Identification of Genes and Pathways Related to Phenol Degradation in Metagenomic Libraries from Petroleum Refinery Wastewater

PubMed Central

Silva, Cynthia C.; Hayden, Helen; Sawbridge, Tim; Mele, Pauline; De Paula, Sérgio O.; Silva, Lívia C. F.; Vidigal, Pedro M. P.; Vicentini, Renato; Sousa, Maíra P.; Torres, Ana Paula R.; Santiago, Vânia M. J.; Oliveira, Valéria M.

2013-01-01

Two fosmid libraries, totaling 13,200 clones, were obtained from bioreactor sludge of petroleum refinery wastewater treatment system. The library screening based on PCR and biological activity assays revealed more than 400 positive clones for phenol degradation. From these, 100 clones were randomly selected for pyrosequencing in order to evaluate the genetic potential of the microorganisms present in wastewater treatment plant for biodegradation, focusing mainly on novel genes and pathways of phenol and aromatic compound degradation. The sequence analysis of selected clones yielded 129,635 reads at an estimated 17-fold coverage. The phylogenetic analysis showed Burkholderiales and Rhodocyclales as the most abundant orders among the selected fosmid clones. The MG-RAST analysis revealed a broad metabolic profile with important functions for wastewater treatment, including metabolism of aromatic compounds, nitrogen, sulphur and phosphorus. The predicted 2,276 proteins included phenol hydroxylases and cathecol 2,3- dioxygenases, involved in the catabolism of aromatic compounds, such as phenol, byphenol, benzoate and phenylpropanoid. The sequencing of one fosmid insert of 33 kb unraveled the gene that permitted the host, Escherichia coli EPI300, to grow in the presence of aromatic compounds. Additionally, the comparison of the whole fosmid sequence against bacterial genomes deposited in GenBank showed that about 90% of sequence showed no identity to known sequences of Proteobacteria deposited in the NCBI database. This study surveyed the functional potential of fosmid clones for aromatic compound degradation and contributed to our knowledge of the biodegradative capacity and pathways of microbial assemblages present in refinery wastewater treatment system. PMID:23637911

Identification and cloning of four riboswitches from Burkholderia pseudomallei strain K96243

NASA Astrophysics Data System (ADS)

Munyati-Othman, Noor; Fatah, Ahmad Luqman Abdul; Piji, Mohd Al Akmarul Fizree Bin Md; Ramlan, Effirul Ikhwan; Raih, Mohd Firdaus

2015-09-01

Structured RNAs referred as riboswitches have been predicted to be present in the genome sequence of Burkholderia pseudomallei strain K96243. Four of the riboswitches were identified and analyzed through BLASTN, Rfam search and multiple sequence alignment. The RNA aptamers belong to the following riboswitch classifications: glycine riboswitch, cobalamin riboswitch, S-adenosyl-(L)-homocysteine (SAH) riboswitch and flavin mononucleotide (FMN) riboswitch. The conserved nucleotides for each aptamer were identified and were marked on the secondary structure generated by RNAfold. These riboswitches were successfully amplified and cloned for further study.

Cloning and expression of a cDNA coding for a human monocyte-derived plasminogen activator inhibitor.

PubMed

Antalis, T M; Clark, M A; Barnes, T; Lehrbach, P R; Devine, P L; Schevzov, G; Goss, N H; Stephens, R W; Tolstoshev, P

1988-02-01

Human monocyte-derived plasminogen activator inhibitor (mPAI-2) was purified to homogeneity from the U937 cell line and partially sequenced. Oligonucleotide probes derived from this sequence were used to screen a cDNA library prepared from U937 cells. One positive clone was sequenced and contained most of the coding sequence as well as a long incomplete 3' untranslated region (1112 base pairs). This cDNA sequence was shown to encode mPAI-2 by hybrid-select translation. A cDNA clone encoding the remainder of the mPAI-2 mRNA was obtained by primer extension of U937 poly(A)+ RNA using a probe complementary to the mPAI-2 coding region. The coding sequence for mPAI-2 was placed under the control of the lambda PL promoter, and the protein expressed in Escherichia coli formed a complex with urokinase that could be detected immunologically. By nucleotide sequence analysis, mPAI-2 cDNA encodes a protein containing 415 amino acids with a predicted unglycosylated Mr of 46,543. The predicted amino acid sequence of mPAI-2 is very similar to placental PAI-2 (3 amino acid differences) and shows extensive homology with members of the serine protease inhibitor (serpin) superfamily. mPAI-2 was found to be more homologous to ovalbumin (37%) than the endothelial plasminogen activator inhibitor, PAI-1 (26%). Like ovalbumin, mPAI-2 appears to have no typical amino-terminal signal sequence. The 3' untranslated region of the mPAI-2 cDNA contains a putative regulatory sequence that has been associated with the inflammatory mediators.

Cloning and expression of a cDNA coding for a human monocyte-derived plasminogen activator inhibitor.

PubMed Central

Antalis, T M; Clark, M A; Barnes, T; Lehrbach, P R; Devine, P L; Schevzov, G; Goss, N H; Stephens, R W; Tolstoshev, P

1988-01-01

Human monocyte-derived plasminogen activator inhibitor (mPAI-2) was purified to homogeneity from the U937 cell line and partially sequenced. Oligonucleotide probes derived from this sequence were used to screen a cDNA library prepared from U937 cells. One positive clone was sequenced and contained most of the coding sequence as well as a long incomplete 3' untranslated region (1112 base pairs). This cDNA sequence was shown to encode mPAI-2 by hybrid-select translation. A cDNA clone encoding the remainder of the mPAI-2 mRNA was obtained by primer extension of U937 poly(A)+ RNA using a probe complementary to the mPAI-2 coding region. The coding sequence for mPAI-2 was placed under the control of the lambda PL promoter, and the protein expressed in Escherichia coli formed a complex with urokinase that could be detected immunologically. By nucleotide sequence analysis, mPAI-2 cDNA encodes a protein containing 415 amino acids with a predicted unglycosylated Mr of 46,543. The predicted amino acid sequence of mPAI-2 is very similar to placental PAI-2 (3 amino acid differences) and shows extensive homology with members of the serine protease inhibitor (serpin) superfamily. mPAI-2 was found to be more homologous to ovalbumin (37%) than the endothelial plasminogen activator inhibitor, PAI-1 (26%). Like ovalbumin, mPAI-2 appears to have no typical amino-terminal signal sequence. The 3' untranslated region of the mPAI-2 cDNA contains a putative regulatory sequence that has been associated with the inflammatory mediators. Images PMID:3257578

In silico cloning and B/T cell epitope prediction of triosephosphate isomerase from Echinococcus granulosus.

PubMed

Wang, Fen; Ye, Bin

2016-10-01

Cystic echinococcosis is a worldwide zoonosis caused by Echinococcus granulosus. Because the methods of diagnosis and treatment for cystic echinococcosis were limited, it is still necessary to screen target proteins for the development of new anti-hydatidosis vaccine. In this study, the triosephosphate isomerase gene of E. granulosus was in silico cloned. The B cell and T cell epitopes were predicted by bioinformatics methods. The cDNA sequence of EgTIM was composition of 1094 base pairs, with an open reading frame of 753 base pairs. The deduced amino acid sequences were composed of 250 amino acids. Five cross-reactive epitopes, locating on 21aa-35aa, 43aa-57aa, 94aa-107aa, 115-129aa, and 164aa-183aa, could be expected to serve as candidate epitopes in the development of vaccine against E. granulosus. These results could provide bases for gene cloning, recombinant expression, and the designation of anti-hydatidosis vaccine.

Nucleotide sequence of a complementary DNA encoding pea cytosolic copper/zinc superoxide dismutase. [Pisum sativum L

DOE Office of Scientific and Technical Information (OSTI.GOV)

White, D.A.; Zilinskas, B.A.

1991-08-01

The authors now report the nucleotide sequence of the cytosolic Cu/Zn SOD cloned from a {lambda}gt11 cDNA library constructed from mRNA extracted from leaves of 7- to 10-d pea seedlings (Pisum sativum L.). The clone was isolated using a 22-base synthetic oligonucleotide complementary to the amino acid sequence CGIIGLQG. This sequence, found at the protein's carboxy terminus, is highly conserved among plant cytosolic Cu/Zn SODs but not chloroplastic Cu/Zn SODs. The 738-base pair sequence contains an open reading frame specifying 152 codons and a predicted M{sub r} of 18,024 D. The deduced amino acid sequence is highly homologous (79-82% identity)more » with the sequences of other known plant cytosolic Cu/Zn SODs but less highly conserved (63-65%) when compared with several chloroplastic Cu/Zn SODs including pea (10).« less

Chromosomal Mapping of Canine-Derived BAC Clones to the Red Fox and American Mink Genomes

PubMed Central

Vorobieva, Nadegda V.; Beklemisheva, Violetta R.; Johnson, Jennifer L.; Temnykh, Svetlana V.; Yudkin, Dmitry V.; Trut, Lyudmila N.; Andre, Catherine; Galibert, Francis; Aguirre, Gustavo D.; Acland, Gregory M.; Graphodatsky, Alexander S.

2009-01-01

High-quality sequencing of the dog (Canis lupus familiaris) genome has enabled enormous progress in genetic mapping of canine phenotypic variation. The red fox (Vulpes vulpes), another canid species, also exhibits a wide range of variation in coat color, morphology, and behavior. Although the fox genome has not yet been sequenced, canine genomic resources have been used to construct a meiotic linkage map of the red fox genome and begin genetic mapping in foxes. However, a more detailed gene-specific comparative map between the dog and fox genomes is required to establish gene order within homologous regions of dog and fox chromosomes and to refine breakpoints between homologous chromosomes of the 2 species. In the current study, we tested whether canine-derived gene–containing bacterial artificial chromosome (BAC) clones can be routinely used to build a gene-specific map of the red fox genome. Forty canine BAC clones were mapped to the red fox genome by fluorescence in situ hybridization (FISH). Each clone was uniquely assigned to a single fox chromosome, and the locations of 38 clones agreed with cytogenetic predictions. These results clearly demonstrate the utility of FISH mapping for construction of a whole-genome gene-specific map of the red fox. The further possibility of using canine BAC clones to map genes in the American mink (Mustela vison) genome was also explored. Much lower success was obtained for this more distantly related farm-bred species, although a few BAC clones were mapped to the predicted chromosomal locations. PMID:19546120

Chromosomal mapping of canine-derived BAC clones to the red fox and American mink genomes.

PubMed

Kukekova, Anna V; Vorobieva, Nadegda V; Beklemisheva, Violetta R; Johnson, Jennifer L; Temnykh, Svetlana V; Yudkin, Dmitry V; Trut, Lyudmila N; Andre, Catherine; Galibert, Francis; Aguirre, Gustavo D; Acland, Gregory M; Graphodatsky, Alexander S

2009-01-01

High-quality sequencing of the dog (Canis lupus familiaris) genome has enabled enormous progress in genetic mapping of canine phenotypic variation. The red fox (Vulpes vulpes), another canid species, also exhibits a wide range of variation in coat color, morphology, and behavior. Although the fox genome has not yet been sequenced, canine genomic resources have been used to construct a meiotic linkage map of the red fox genome and begin genetic mapping in foxes. However, a more detailed gene-specific comparative map between the dog and fox genomes is required to establish gene order within homologous regions of dog and fox chromosomes and to refine breakpoints between homologous chromosomes of the 2 species. In the current study, we tested whether canine-derived gene-containing bacterial artificial chromosome (BAC) clones can be routinely used to build a gene-specific map of the red fox genome. Forty canine BAC clones were mapped to the red fox genome by fluorescence in situ hybridization (FISH). Each clone was uniquely assigned to a single fox chromosome, and the locations of 38 clones agreed with cytogenetic predictions. These results clearly demonstrate the utility of FISH mapping for construction of a whole-genome gene-specific map of the red fox. The further possibility of using canine BAC clones to map genes in the American mink (Mustela vison) genome was also explored. Much lower success was obtained for this more distantly related farm-bred species, although a few BAC clones were mapped to the predicted chromosomal locations.

Hop stunt viroid: molecular cloning and nucleotide sequence of the complete cDNA copy.

PubMed Central

Ohno, T; Takamatsu, N; Meshi, T; Okada, Y

1983-01-01

The complete cDNA of hop stunt viroid (HSV) has been cloned by the method of Okayama and Berg (Mol.Cell.Biol.2,161-170. (1982] and the complete nucleotide sequence has been established. The covalently closed circular single-stranded HSV RNA consists of 297 nucleotides. The secondary structure predicted for HSV contains 67% of its residues base-paired. The native HSV can possess an extended rod-like structure characteristic of viroids previously established. The central region of the native HSV has a similar structure to the conserved region found in all viroids sequenced so far except for avocado sunblotch viroid. The sequence homologous to the 5'-end of U1a RNA is also found in the sequence of HSV but not in the central conserved region. Images PMID:6312412

Cloning and bioinformatic analysis of lovastatin biosynthesis regulatory gene lovE.

PubMed

Huang, Xin; Li, Hao-ming

2009-08-05

Lovastatin is an effective drug for treatment of hyperlipidemia. This study aimed to clone lovastatin biosynthesis regulatory gene lovE and analyze the structure and function of its encoding protein. According to the lovastatin synthase gene sequence from genebank, primers were designed to amplify and clone the lovastatin biosynthesis regulatory gene lovE from Aspergillus terrus genomic DNA. Bioinformatic analysis of lovE and its encoding animo acid sequence was performed through internet resources and software like DNAMAN. Target fragment lovE, almost 1500 bp in length, was amplified from Aspergillus terrus genomic DNA and the secondary and three-dimensional structures of LovE protein were predicted. In the lovastatin biosynthesis process lovE is a regulatory gene and LovE protein is a GAL4-like transcriptional factor.

Characterization of AFLAV, a Tf1/Sushi retrotransposon from Aspergillus flavus.

PubMed

Hua, Sui-Sheng T; Tarun, Alice S; Pandey, Sonal N; Chang, Leo; Chang, Perng-Kuang

2007-02-01

The plasmid, pAF28, a genomic clone from Aspergillus flavus NRRL 6541, has been used as a hybridization probe to fingerprint A. flavus strains isolated in corn and peanut fields. The insert of pAF28 contains a 4.5 kb region which encodes a truncated retrotransposon (AfRTL-1). In search for a full-length and intact copy of retrotransposon, we exploited a novel PCR cloning strategy by amplifying a 3.4 kb region from the genomic DNA of A. flavus NRRL 6541. The fragment was cloned into pCR 4-TOPO. Sequence analysis confirmed that this region encoded putative domains of partial reverse transcriptase, RNase H, and integrase of the predicted retrotransposon. The two flanking long terminal repeats (LTRs) and the sequence between them comprise a putative full-length LTR retrotransposon of 7799 bp in length. This intact retrotransposon sequence is named AFLAV (A. flavus Retrotransposon). The order of the predicted catalytic domains in the polyprotein (Pol) placed AFLAV in the Tf1/sushi subgroup of the Ty3/gypsy retrotransposon family. Primers derived from AFLAV sequence were used to screen this retrotransposon in other strains of A. flavus. More than fifty strains of A. flavus isolated from different geological origins were surveyed and the results show that many strains have extensive deletions in the regions encoding the capsid (Gag) and Pol.

Molecular cloning and analysis of Schizosaccharomyces pombe Reb1p: sequence-specific recognition of two sites in the far upstream rDNA intergenic spacer.

PubMed Central

Zhao, A; Guo, A; Liu, Z; Pape, L

1997-01-01

The coding sequences for a Schizosaccharomyces pombe sequence-specific DNA binding protein, Reb1p, have been cloned. The predicted S. pombe Reb1p is 24-29% identical to mouse TTF-1 (transcription termination factor-1) and Saccharomyces cerevisiae REB1 protein, both of which direct termination of RNA polymerase I catalyzed transcripts. The S.pombe Reb1 cDNA encodes a predicted polypeptide of 504 amino acids with a predicted molecular weight of 58.4 kDa. The S. pombe Reb1p is unusual in that the bipartite DNA binding motif identified originally in S.cerevisiae and Klyveromyces lactis REB1 proteins is uninterrupted and thus S.pombe Reb1p may contain the smallest natural REB1 homologous DNA binding domain. Its genomic coding sequences were shown to be interrupted by two introns. A recombinant histidine-tagged Reb1 protein bearing the rDNA binding domain has two homologous, sequence-specific binding sites in the S. pomber DNA intergenic spacer, located between 289 and 480 nt downstream of the end of the approximately 25S rRNA coding sequences. Each binding site is 13-14 bp downstream of two of the three proposed in vivo termination sites. The core of this 17 bp site, AGGTAAGGGTAATGCAC, is specifically protected by Reb1p in footprinting analysis. PMID:9016645

Large-Scale Concatenation cDNA Sequencing

PubMed Central

Yu, Wei; Andersson, Björn; Worley, Kim C.; Muzny, Donna M.; Ding, Yan; Liu, Wen; Ricafrente, Jennifer Y.; Wentland, Meredith A.; Lennon, Greg; Gibbs, Richard A.

1997-01-01

A total of 100 kb of DNA derived from 69 individual human brain cDNA clones of 0.7–2.0 kb were sequenced by concatenated cDNA sequencing (CCS), whereby multiple individual DNA fragments are sequenced simultaneously in a single shotgun library. The method yielded accurate sequences and a similar efficiency compared with other shotgun libraries constructed from single DNA fragments (>20 kb). Computer analyses were carried out on 65 cDNA clone sequences and their corresponding end sequences to examine both nucleic acid and amino acid sequence similarities in the databases. Thirty-seven clones revealed no DNA database matches, 12 clones generated exact matches (≥98% identity), and 16 clones generated nonexact matches (57%–97% identity) to either known human or other species genes. Of those 28 matched clones, 8 had corresponding end sequences that failed to identify similarities. In a protein similarity search, 27 clone sequences displayed significant matches, whereas only 20 of the end sequences had matches to known protein sequences. Our data indicate that full-length cDNA insert sequences provide significantly more nucleic acid and protein sequence similarity matches than expressed sequence tags (ESTs) for database searching. [All 65 cDNA clone sequences described in this paper have been submitted to the GenBank data library under accession nos. U79240–U79304.] PMID:9110174

Locating Sequence on FPC Maps and Selecting a Minimal Tiling Path

PubMed Central

Engler, Friedrich W.; Hatfield, James; Nelson, William; Soderlund, Carol A.

2003-01-01

This study discusses three software tools, the first two aid in integrating sequence with an FPC physical map and the third automatically selects a minimal tiling path given genomic draft sequence and BAC end sequences. The first tool, FSD (FPC Simulated Digest), takes a sequenced clone and adds it back to the map based on a fingerprint generated by an in silico digest of the clone. This allows verification of sequenced clone positions and the integration of sequenced clones that were not originally part of the FPC map. The second tool, BSS (Blast Some Sequence), takes a query sequence and positions it on the map based on sequence associated with the clones in the map. BSS has multiple uses as follows: (1) When the query is a file of marker sequences, they can be added as electronic markers. (2) When the query is draft sequence, the results of BSS can be used to close gaps in a sequenced clone or the physical map. (3) When the query is a sequenced clone and the target is BAC end sequences, one may select the next clone for sequencing using both sequence comparison results and map location. (4) When the query is whole-genome draft sequence and the target is BAC end sequences, the results can be used to select many clones for a minimal tiling path at once. The third tool, pickMTP, automates the majority of this last usage of BSS. Results are presented using the rice FPC map, BAC end sequences, and whole-genome shotgun from Syngenta. PMID:12915486

An oleate 12-hydroxylase from Ricinus communis L. is a fatty acyl desaturase homolog

DOE Office of Scientific and Technical Information (OSTI.GOV)

Van De Loo, F.J.; Broun, P.; Turner, S.

1995-07-18

Recent spectroscopic evidence implicating a binuclear iron site at the reaction center of fatty acyl desaturases suggested to us that certain fatty acyl hydroxylases may share significant amino acid sequence similarity with desaturases. To test this theory, we prepared a cDNA library from developing endosperm of the castor-oil plant (Ricinus communis L.) and obtained partial nucleotide sequences for 468 anonymous clones that were not expressed at high levels in leaves, a tissue deficient in 12-hydroxyoleic acid. This resulted in the identification of several cDNA clones encoding a polypeptide of 387 amino acids with a predicted molecular weight of 44,407 andmore » with {approx}67% sequence homology to microsomal oleate desaturase from Arabidopsis. Expression of a full-length clone under control of the cauliflower mosaic virus 35S promoter in transgenic tobacco resulted in the accumulation of low levels of 12-hydroxyoleic acid in seeds, indicating that the clone encodes the castor oleate hydroxylase. These results suggest that fatty acyl desaturases and hydroxylases share similar reaction mechanisms and provide an example of enzyme evolution. 26 refs., 6 figs., 1 tab.« less

The Silkworm (Bombyx mori) microRNAs and Their Expressions in Multiple Developmental Stages

PubMed Central

Luo, Qibin; Cai, Yimei; Lin, Wen-chang; Chen, Huan; Yang, Yue; Hu, Songnian; Yu, Jun

2008-01-01

Background MicroRNAs (miRNAs) play crucial roles in various physiological processes through post-transcriptional regulation of gene expressions and are involved in development, metabolism, and many other important molecular mechanisms and cellular processes. The Bombyx mori genome sequence provides opportunities for a thorough survey for miRNAs as well as comparative analyses with other sequenced insect species. Methodology/Principal Findings We identified 114 non-redundant conserved miRNAs and 148 novel putative miRNAs from the B. mori genome with an elaborate computational protocol. We also sequenced 6,720 clones from 14 developmental stage-specific small RNA libraries in which we identified 35 unique miRNAs containing 21 conserved miRNAs (including 17 predicted miRNAs) and 14 novel miRNAs (including 11 predicted novel miRNAs). Among the 114 conserved miRNAs, we found six pairs of clusters evolutionarily conserved cross insect lineages. Our observations on length heterogeneity at 5′ and/or 3′ ends of nine miRNAs between cloned and predicted sequences, and three mature forms deriving from the same arm of putative pre-miRNAs suggest a mechanism by which miRNAs gain new functions. Analyzing development-related miRNAs expression at 14 developmental stages based on clone-sampling and stem-loop RT PCR, we discovered an unusual abundance of 33 sequences representing 12 different miRNAs and sharply fluctuated expression of miRNAs at larva-molting stage. The potential functions of several stage-biased miRNAs were also analyzed in combination with predicted target genes and silkworm's phenotypic traits; our results indicated that miRNAs may play key regulatory roles in specific developmental stages in the silkworm, such as ecdysis. Conclusions/Significance Taking a combined approach, we identified 118 conserved miRNAs and 151 novel miRNA candidates from the B. mori genome sequence. Our expression analyses by sampling miRNAs and real-time PCR over multiple developmental stages allowed us to pinpoint molting stages as hotspots of miRNA expression both in sorts and quantities. Based on the analysis of target genes, we hypothesized that miRNAs regulate development through a particular emphasis on complex stages rather than general regulatory mechanisms. PMID:18714353

Molecular cloning and characterization of Aspergillus nidulans cyclophilin B.

PubMed

Joseph, J D; Heitman, J; Means, A R

1999-06-01

Cyclophilins are an evolutionarily conserved family of proteins which serve as the intracellular receptors for the immunosuppressive drug cyclosporin A. Here we report the characterization of the first cyclophilin cloned from the filamentous fungus Aspergillus nidulans (CYPB). Sequence analysis of the cypB gene predicts an encoded protein with highest homology to the murine cyclophilin B protein. The sequence similarity includes an N-terminal sequence predicted to target the protein to the endoplasmic reticulum (ER) as well as a C-terminal sequence predicted to retain the mature protein in the ER. The bacterially expressed hexa-histidine tagged protein displays peptidyl-prolyl isomerase activity which is inhibited by cyclosporin A. In the presence of cyclosporin A, the expressed protein also inhibits purified calcineurin. When the endogenous cypB gene was disrupted and placed under the control of the regulatable alcohol dehydrogenase promoter, the strain demonstrated no detectable growth phenotype under conditions which induce or repress cypB transcription. Induction or repression of the cypB gene also did not effect sensitivity of A. nidulans to cyclosporin A. cypB mRNA levels were significantly elevated under severe heat shock conditions, indicating a possible role for the A. nidulans cyclophilin B protein during growth in high stress environments. Copyright 1999 Academic Press.

Structure, inheritance, and expression of hybrid poplar (Populus trichocarpa x Populus deltoides) phenylalanine ammonia-lyase genes.

PubMed Central

Subramaniam, R; Reinold, S; Molitor, E K; Douglas, C J

1993-01-01

A heterologous probe encoding phenylalanine ammonia-lyase (PAL) was used to identify PAL clones in cDNA libraries made with RNA from young leaf tissue of two Populus deltoides x P. trichocarpa F1 hybrid clones. Sequence analysis of a 2.4-kb cDNA confirmed its identity as a full-length PAl clone. The predicted amino acid sequence is conserved in comparison with that of PAL genes from several other plants. Southern blot analysis of popular genomic DNA from parental and hybrid individuals, restriction site polymorphism in PAL cDNA clones, and sequence heterogeneity in the 3' ends of several cDNA clones suggested that PAL is encoded by at least two genes that can be distinguished by HindIII restriction site polymorphisms. Clones containing each type of PAL gene were isolated from a poplar genomic library. Analysis of the segregation of PAL-specific HindIII restriction fragment-length polymorphisms demonstrated the existence of two independently segregating PAL loci, one of which was mapped to a linkage group of the poplar genetic map. Developmentally regulated PAL expression in poplar was analyzed using RNA blots. Highest expression was observed in young stems, apical buds, and young leaves. Expression was lower in older stems and undetectable in mature leaves. Cellular localization of PAL expression by in situ hybridization showed very high levels of expression in subepidermal cells of leaves early during leaf development. In stems and petioles, expression was associated with subepidermal cells and vascular tissues. PMID:8108506

Functional metagenomics reveals novel β-galactosidases not predictable from gene sequences.

PubMed

Cheng, Jiujun; Romantsov, Tatyana; Engel, Katja; Doxey, Andrew C; Rose, David R; Neufeld, Josh D; Charles, Trevor C

2017-01-01

The techniques of metagenomics have allowed researchers to access the genomic potential of uncultivated microbes, but there remain significant barriers to determination of gene function based on DNA sequence alone. Functional metagenomics, in which DNA is cloned and expressed in surrogate hosts, can overcome these barriers, and make important contributions to the discovery of novel enzymes. In this study, a soil metagenomic library carried in an IncP cosmid was used for functional complementation for β-galactosidase activity in both Sinorhizobium meliloti (α-Proteobacteria) and Escherichia coli (γ-Proteobacteria) backgrounds. One β-galactosidase, encoded by six overlapping clones that were selected in both hosts, was identified as a member of glycoside hydrolase family 2. We could not identify ORFs obviously encoding possible β-galactosidases in 19 other sequenced clones that were only able to complement S. meliloti. Based on low sequence identity to other known glycoside hydrolases, yet not β-galactosidases, three of these ORFs were examined further. Biochemical analysis confirmed that all three encoded β-galactosidase activity. Lac36W_ORF11 and Lac161_ORF7 had conserved domains, but lacked similarities to known glycoside hydrolases. Lac161_ORF10 had neither conserved domains nor similarity to known glycoside hydrolases. Bioinformatic and structural modeling implied that Lac161_ORF10 protein represented a novel enzyme family with a five-bladed propeller glycoside hydrolase domain. By discovering founding members of three novel β-galactosidase families, we have reinforced the value of functional metagenomics for isolating novel genes that could not have been predicted from DNA sequence analysis alone.

PredPPCrys: accurate prediction of sequence cloning, protein production, purification and crystallization propensity from protein sequences using multi-step heterogeneous feature fusion and selection.

PubMed

Wang, Huilin; Wang, Mingjun; Tan, Hao; Li, Yuan; Zhang, Ziding; Song, Jiangning

2014-01-01

X-ray crystallography is the primary approach to solve the three-dimensional structure of a protein. However, a major bottleneck of this method is the failure of multi-step experimental procedures to yield diffraction-quality crystals, including sequence cloning, protein material production, purification, crystallization and ultimately, structural determination. Accordingly, prediction of the propensity of a protein to successfully undergo these experimental procedures based on the protein sequence may help narrow down laborious experimental efforts and facilitate target selection. A number of bioinformatics methods based on protein sequence information have been developed for this purpose. However, our knowledge on the important determinants of propensity for a protein sequence to produce high diffraction-quality crystals remains largely incomplete. In practice, most of the existing methods display poorer performance when evaluated on larger and updated datasets. To address this problem, we constructed an up-to-date dataset as the benchmark, and subsequently developed a new approach termed 'PredPPCrys' using the support vector machine (SVM). Using a comprehensive set of multifaceted sequence-derived features in combination with a novel multi-step feature selection strategy, we identified and characterized the relative importance and contribution of each feature type to the prediction performance of five individual experimental steps required for successful crystallization. The resulting optimal candidate features were used as inputs to build the first-level SVM predictor (PredPPCrys I). Next, prediction outputs of PredPPCrys I were used as the input to build second-level SVM classifiers (PredPPCrys II), which led to significantly enhanced prediction performance. Benchmarking experiments indicated that our PredPPCrys method outperforms most existing procedures on both up-to-date and previous datasets. In addition, the predicted crystallization targets of currently non-crystallizable proteins were provided as compendium data, which are anticipated to facilitate target selection and design for the worldwide structural genomics consortium. PredPPCrys is freely available at http://www.structbioinfor.org/PredPPCrys.

Preparation and properties of pure, full-length IclR protein of Escherichia coli. Use of time-of-flight mass spectrometry to investigate the problems encountered.

PubMed Central

Donald, L. J.; Chernushevich, I. V.; Zhou, J.; Verentchikov, A.; Poppe-Schriemer, N.; Hosfield, D. J.; Westmore, J. B.; Ens, W.; Duckworth, H. W.; Standing, K. G.

1996-01-01

IclR protein, the repressor of the aceBAK operon of Escherichia coli, has been examined by time-of-flight mass spectrometry, with ionization by matrix assisted laser desorption or by electrospray. The purified protein was found to have a smaller mass than that predicted from the base sequence of the cloned iclR gene. Additional measurements were made on mixtures of peptides derived from IclR by treatment with trypsin and cyanogen bromide. They showed that the amino acid sequence is that predicted from the gene sequence, except that the protein has suffered truncation by removal of the N-terminal eight or, in some cases, nine amino acid residues. The peptide bond whose hydrolysis would remove eight residues is a typical target for the E. coli protease OmpT. We find that, by taking precautions to minimize Omp T proteolysis, or by eliminating it through mutation of the host strain, we can isolate full-length IclR protein (lacking only the N-terminal methionine residue). Full-length IclR is a much better DNA-binding protein than the truncated versions: it binds the aceBAK operator sequence 44-fold more tightly, presumably because of additional contacts that the N-terminal residues make with the DNA. Our experience thus demonstrates the advantages of using mass spectrometry to characterize newly purified proteins produced from cloned genes, especially where proteolysis or other covalent modification is a concern. This technique gives mass spectra from complex peptide mixtures that can be analyzed completely, without any fractionation of the mixtures, by reference to the amino acid sequence inferred from the base sequence of the cloned gene. PMID:8844850

Cloning and characterization of a mouse gene with homology to the human von Hippel-Lindau disease tumor suppressor gene: implications for the potential organization of the human von Hippel-Lindau disease gene.

PubMed

Gao, J; Naglich, J G; Laidlaw, J; Whaley, J M; Seizinger, B R; Kley, N

1995-02-15

The human von Hippel-Lindau disease (VHL) gene has recently been identified and, based on the nucleotide sequence of a partial cDNA clone, has been predicted to encode a novel protein with as yet unknown functions [F. Latif et al., Science (Washington DC), 260: 1317-1320, 1993]. The length of the encoded protein and the characteristics of the cellular expressed protein are as yet unclear. Here we report the cloning and characterization of a mouse gene (mVHLh1) that is widely expressed in different mouse tissues and shares high homology with the human VHL gene. It predicts a protein 181 residues long (and/or 162 amino acids, considering a potential alternative start codon), which across a core region of approximately 140 residues displays a high degree of sequence identity (98%) to the predicted human VHL protein. High stringency DNA and RNA hybridization experiments and protein expression analyses indicate that this gene is the most highly VHL-related mouse gene, suggesting that it represents the mouse VHL gene homologue rather than a related gene sharing a conserved functional domain. These findings provide new insights into the potential organization of the VHL gene and nature of its encoded protein.

Hybrid sequencing approach applied to human fecal metagenomic clone libraries revealed clones with potential biotechnological applications.

PubMed

Džunková, Mária; D'Auria, Giuseppe; Pérez-Villarroya, David; Moya, Andrés

2012-01-01

Natural environments represent an incredible source of microbial genetic diversity. Discovery of novel biomolecules involves biotechnological methods that often require the design and implementation of biochemical assays to screen clone libraries. However, when an assay is applied to thousands of clones, one may eventually end up with very few positive clones which, in most of the cases, have to be "domesticated" for downstream characterization and application, and this makes screening both laborious and expensive. The negative clones, which are not considered by the selected assay, may also have biotechnological potential; however, unfortunately they would remain unexplored. Knowledge of the clone sequences provides important clues about potential biotechnological application of the clones in the library; however, the sequencing of clones one-by-one would be very time-consuming and expensive. In this study, we characterized the first metagenomic clone library from the feces of a healthy human volunteer, using a method based on 454 pyrosequencing coupled with a clone-by-clone Sanger end-sequencing. Instead of whole individual clone sequencing, we sequenced 358 clones in a pool. The medium-large insert (7-15 kb) cloning strategy allowed us to assemble these clones correctly, and to assign the clone ends to maintain the link between the position of a living clone in the library and the annotated contig from the 454 assembly. Finally, we found several open reading frames (ORFs) with previously described potential medical application. The proposed approach allows planning ad-hoc biochemical assays for the clones of interest, and the appropriate sub-cloning strategy for gene expression in suitable vectors/hosts.

Analyses of chicken immunoglobulin light chain cDNA clones indicate a few germline V lambda genes and allotypes of the C lambda locus.

PubMed

Parvari, R; Ziv, E; Lentner, F; Tel-Or, S; Burstein, Y; Schechter, I

1987-01-01

cDNA libraries of chicken spleen and Harder gland (a gland enriched with immunocytes) constructed in pBR322 were screened by differential hybridization and by mRNA hybrid-selected translation. Eleven L-chain cDNA clones were identified from which VL probes were prepared and each was annealed with kidney DNA restriction digests. All VL probes revealed the same set of bands, corresponding to about 15 germline VL genes of one subgroup. The nucleotide sequences of six VL clones showed greater than or equal to 85% homology, and the predicted amino acid sequences were identical or nearly identical to the major N-terminal sequence of L-chains in chicken serum. These findings, and the fact that the VL clones were randomly selected from normal lymphoid tissues, strongly indicate that the bulk of chicken L-chains is encoded by a few germline VL genes, probably much less than 15 since many of the VL genes are known to be pseudogenes. Therefore, it is likely that somatic mechanisms operating prior to specific triggering by antigen play a major role in the generation of antibody diversity in chicken. Analysis of the constant region locus (sequencing of CL gene and cDNAs) demonstrate a single CL isotype and suggest the presence of CL allotypes.

Cost-effective sequencing of full-length cDNA clones powered by a de novo-reference hybrid assembly.

PubMed

Kuroshu, Reginaldo M; Watanabe, Junichi; Sugano, Sumio; Morishita, Shinichi; Suzuki, Yutaka; Kasahara, Masahiro

2010-05-07

Sequencing full-length cDNA clones is important to determine gene structures including alternative splice forms, and provides valuable resources for experimental analyses to reveal the biological functions of coded proteins. However, previous approaches for sequencing cDNA clones were expensive or time-consuming, and therefore, a fast and efficient sequencing approach was demanded. We developed a program, MuSICA 2, that assembles millions of short (36-nucleotide) reads collected from a single flow cell lane of Illumina Genome Analyzer to shotgun-sequence approximately 800 human full-length cDNA clones. MuSICA 2 performs a hybrid assembly in which an external de novo assembler is run first and the result is then improved by reference alignment of shotgun reads. We compared the MuSICA 2 assembly with 200 pooled full-length cDNA clones finished independently by the conventional primer-walking using Sanger sequencers. The exon-intron structure of the coding sequence was correct for more than 95% of the clones with coding sequence annotation when we excluded cDNA clones insufficiently represented in the shotgun library due to PCR failure (42 out of 200 clones excluded), and the nucleotide-level accuracy of coding sequences of those correct clones was over 99.99%. We also applied MuSICA 2 to full-length cDNA clones from Toxoplasma gondii, to confirm that its ability was competent even for non-human species. The entire sequencing and shotgun assembly takes less than 1 week and the consumables cost only approximately US$3 per clone, demonstrating a significant advantage over previous approaches.

Molecular cloning, overexpression, purification, and sequence analysis of the giant panda (Ailuropoda melanoleuca) ferritin light polypeptide.

PubMed

Fu, L; Hou, Y L; Ding, X; Du, Y J; Zhu, H Q; Zhang, N; Hou, W R

2016-08-30

The complementary DNA (cDNA) of the giant panda (Ailuropoda melanoleuca) ferritin light polypeptide (FTL) gene was successfully cloned using reverse transcription-polymerase chain reaction technology. We constructed a recombinant expression vector containing FTL cDNA and overexpressed it in Escherichia coli using pET28a plasmids. The expressed protein was then purified by nickel chelate affinity chromatography. The cloned cDNA fragment was 580 bp long and contained an open reading frame of 525 bp. The deduced protein sequence was composed of 175 amino acids and had an estimated molecular weight of 19.90 kDa, with an isoelectric point of 5.53. Topology prediction revealed one N-glycosylation site, two casein kinase II phosphorylation sites, one N-myristoylation site, two protein kinase C phosphorylation sites, and one cell attachment sequence. Alignment indicated that the nucleotide and deduced amino acid sequences are highly conserved across several mammals, including Homo sapiens, Cavia porcellus, Equus caballus, and Felis catus, among others. The FTL gene was readily expressed in E. coli, which gave rise to the accumulation of a polypeptide of the expected size (25.50 kDa, including an N-terminal polyhistidine tag).

Cost-Effective Sequencing of Full-Length cDNA Clones Powered by a De Novo-Reference Hybrid Assembly

PubMed Central

Sugano, Sumio; Morishita, Shinichi; Suzuki, Yutaka

2010-01-01

Background Sequencing full-length cDNA clones is important to determine gene structures including alternative splice forms, and provides valuable resources for experimental analyses to reveal the biological functions of coded proteins. However, previous approaches for sequencing cDNA clones were expensive or time-consuming, and therefore, a fast and efficient sequencing approach was demanded. Methodology We developed a program, MuSICA 2, that assembles millions of short (36-nucleotide) reads collected from a single flow cell lane of Illumina Genome Analyzer to shotgun-sequence ∼800 human full-length cDNA clones. MuSICA 2 performs a hybrid assembly in which an external de novo assembler is run first and the result is then improved by reference alignment of shotgun reads. We compared the MuSICA 2 assembly with 200 pooled full-length cDNA clones finished independently by the conventional primer-walking using Sanger sequencers. The exon-intron structure of the coding sequence was correct for more than 95% of the clones with coding sequence annotation when we excluded cDNA clones insufficiently represented in the shotgun library due to PCR failure (42 out of 200 clones excluded), and the nucleotide-level accuracy of coding sequences of those correct clones was over 99.99%. We also applied MuSICA 2 to full-length cDNA clones from Toxoplasma gondii, to confirm that its ability was competent even for non-human species. Conclusions The entire sequencing and shotgun assembly takes less than 1 week and the consumables cost only ∼US$3 per clone, demonstrating a significant advantage over previous approaches. PMID:20479877

A comprehensive list of cloned human DNA sequences

PubMed Central

Schmidtke, Jörg; Cooper, David N.

1987-01-01

A list of DNA sequences cloned from the human genome is presented. Intended as a guide to clone availability, this list includes published reports of cDNA, genomic and synthetic clones comprising gene and pseudogene sequences, uncharacterised DNA segments and repetitive DNA elements. PMID:3575113

A comprehensive list of cloned human DNA sequences

PubMed Central

Schmidtke, Jörg; Cooper, David N.

1990-01-01

A list of DNA sequences cloned from the human genome is presented. Intended as a guide to clone availability, this list includes published reports of cDNA, genomic and synthetic clones comprising gene and pseudogene sequences, uncharacterised DNA segments and repetitive DNA elements. PMID:2333227

A comprehensive list of cloned human DNA sequences

PubMed Central

Schmidtke, Jörg; Cooper, David N.

1988-01-01

A list of DNA sequences cloned from the human genome is presented. Intended as a guide to clone availability, this list includes published reports of cDNA, genomic and synthetic clones comprising gene and pseudogene sequences, uncharacterised DNA segments and repetitive DNA elements. PMID:3368330

A comprehensive list of cloned human DNA sequences

PubMed Central

Schmidtke, Jörg; Cooper, David N.

1989-01-01

A list of DNA sequences cloned from the human genome is presented. Intended as a guide to clone availability, this list includes published reports of cDNA, genomic and synthetic clones comprising gene and pseudogene sequences, uncharacterised DNA segments and repetitive DNA elements. PMID:2654889

To Clone or Not To Clone: Method Analysis for Retrieving Consensus Sequences In Ancient DNA Samples

PubMed Central

Winters, Misa; Barta, Jodi Lynn; Monroe, Cara; Kemp, Brian M.

2011-01-01

The challenges associated with the retrieval and authentication of ancient DNA (aDNA) evidence are principally due to post-mortem damage which makes ancient samples particularly prone to contamination from “modern” DNA sources. The necessity for authentication of results has led many aDNA researchers to adopt methods considered to be “gold standards” in the field, including cloning aDNA amplicons as opposed to directly sequencing them. However, no standardized protocol has emerged regarding the necessary number of clones to sequence, how a consensus sequence is most appropriately derived, or how results should be reported in the literature. In addition, there has been no systematic demonstration of the degree to which direct sequences are affected by damage or whether direct sequencing would provide disparate results from a consensus of clones. To address this issue, a comparative study was designed to examine both cloned and direct sequences amplified from ∼3,500 year-old ancient northern fur seal DNA extracts. Majority rules and the Consensus Confidence Program were used to generate consensus sequences for each individual from the cloned sequences, which exhibited damage at 31 of 139 base pairs across all clones. In no instance did the consensus of clones differ from the direct sequence. This study demonstrates that, when appropriate, cloning need not be the default method, but instead, should be used as a measure of authentication on a case-by-case basis, especially when this practice adds time and cost to studies where it may be superfluous. PMID:21738625

An in silico DNA cloning experiment for the biochemistry laboratory.

PubMed

Elkins, Kelly M

2011-01-01

This laboratory exercise introduces students to concepts in recombinant DNA technology while accommodating a major semester project in protein purification, structure, and function in a biochemistry laboratory for junior- and senior-level undergraduate students. It is also suitable for forensic science courses focused in DNA biology and advanced high school biology classes. Students begin by examining a plasmid map with the goal of identifying which restriction enzymes may be used to clone a piece of foreign DNA containing a gene of interest into the vector. From the National Center for Biotechnology Initiative website, students are instructed to retrieve a protein sequence and use Expasy's Reverse Translate program to reverse translate the protein to cDNA. Students then use Integrated DNA Technologies' OligoAnalyzer to predict the complementary DNA strand and obtain DNA recognition sequences for the desired restriction enzymes from New England Biolabs' website. Students add the appropriate DNA restriction sequences to the double-stranded foreign DNA for cloning into the plasmid and infecting Escherichia coli cells. Students are introduced to computational biology tools, molecular biology terminology and the process of DNA cloning in this valuable single session, in silico experiment. This project develops students' understanding of the cloning process as a whole and contrasts with other laboratory and internship experiences in which the students may be involved in only a piece of the cloning process/techniques. Students interested in pursuing postgraduate study and research or employment in an academic biochemistry or molecular biology laboratory or industry will benefit most from this experience. Copyright © 2010 Wiley Periodicals, Inc.

Quick and clean cloning.

PubMed

Thieme, Frank; Marillonnet, Sylvestre

2014-01-01

Identification of unknown sequences that flank known sequences of interest requires PCR amplification of DNA fragments that contain the junction between the known and unknown flanking sequences. Since amplified products often contain a mixture of specific and nonspecific products, the quick and clean (QC) cloning procedure was developed to clone specific products only. QC cloning is a ligation-independent cloning procedure that relies on the exonuclease activity of T4 DNA polymerase to generate single-stranded extensions at the ends of the vector and insert. A specific feature of QC cloning is the use of vectors that contain a sequence called catching sequence that allows cloning specific products only. QC cloning is performed by a one-pot incubation of insert and vector in the presence of T4 DNA polymerase at room temperature for 10 min followed by direct transformation of the incubation mix in chemo-competent Escherichia coli cells.

Effects of cloning and root-tip size on observations of fungal ITS sequences from Picea glauca roots

Treesearch

Daniel L. Lindner; Mark T. Banik

2009-01-01

To better understand the effects of cloning on observations of fungal ITS sequences from Picea glauca (white spruce) roots two techniques were compared: (i) direct sequencing of fungal ITS regions from individual root tips without cloning and (ii) cloning and sequencing of fungal ITS regions from individual root tips. Effect of root tip size was...

Cloning and expression of a nuclear encoded plastid specific 33 kDa ribonucleoprotein gene (33RNP) from pea that is light stimulated.

PubMed

Reddy, M K; Nair, S; Singh, B N; Mudgil, Y; Tewari, K K; Sopory, S K

2001-01-24

We report the cloning and sequencing of both cDNA and genomic DNA of a 33 kDa chloroplast ribonucleoprotein (33RNP) from pea. The analysis of the predicted amino acid sequence of the cDNA clone revealed that the encoded protein contains two RNA binding domains, including the conserved consensus ribonucleoprotein sequences CS-RNP1 and CS-RNP2, on the C-terminus half and the presence of a putative transit peptide sequence in the N-terminus region. The phylogenetic and multiple sequence alignment analysis of pea chloroplast RNP along with RNPs reported from the other plant sources revealed that the pea 33RNP is very closely related to Nicotiana sylvestris 31RNP and 28RNP and also to 31RNP and 28RNP of Arabidopsis and spinach, respectively. The pea 33RNP was expressed in Escherichia coli and purified to homogeneity. The in vitro import of precursor protein into chloroplasts confirmed that the N-terminus putative transit peptide is a bona fide transit peptide and 33RNP is localized in the chloroplast. The nucleic acid-binding properties of the recombinant protein, as revealed by South-Western analysis, showed that 33RNP has higher binding affinity for poly (U) and oligo dT than for ssDNA and dsDNA. The steady state transcript level was higher in leaves than in roots and the expression of this gene is light stimulated. Sequence analysis of the genomic clone revealed that the gene contains four exons and three introns. We have also isolated and analyzed the 5' flanking region of the pea 33RNP gene.

Acetylcholinesterase of Rhipicephalus (Boophilus) microplus and Phlebotomus papatasi: Gene Identification, Expression, and Biochemical Properties of Recombinant Proteins

DTIC Science & Technology

2013-01-01

predicted amino acid sequences of the three encoded BmAChEs were no more closely related to one another than AChEs from different organisms and their...solely on nucleotide and amino acid sequence similarity; however, the cholinesterase gene family contains a number of related enzymes and structural...acetylcholinesterase of P. papatasi was cloned, sequenced , and expressed in the baculo- virus system to generate a recombinant enzyme for biochemical

Characterisation and cloning of a Na(+)-dependent broad-specificity neutral amino acid transporter from NBL-1 cells: a novel member of the ASC/B(0) transporter family.

PubMed

Pollard, Matthew; Meredith, David; McGivan, John D

2002-04-12

Na(+)-dependent neutral amino acid transport into the bovine renal epithelial cell line NBL-1 is catalysed by a broad-specificity transporter originally termed System B(0). This transporter is shown to differ in specificity from the B(0) transporter cloned from JAR cells [J. Biol. Chem. 271 (1996) 18657] in that it interacts much more strongly with phenylalanine. Using probes designed to conserved transmembrane regions of the ASC/B(0) transporter family we have isolated a cDNA encoding the NBL-1 cell System B(0) transporter. When expressed in Xenopus oocytes the clone catalysed Na(+)-dependent alanine uptake which was inhibited by glutamine, leucine and phenylalanine. However, the clone did not catalyse Na(+)-dependent phenylalanine transport, again as in NBL-1 cells. The clone encoded a protein of 539 amino acids; the predicted transmembrane domains were almost identical in sequence to those of the other members of the B(0)/ASC transporter family. Comparison of the sequences of NBL-1 and JAR cell transporters showed some differences near the N-terminus, C-terminus and in the loop between helices 3 and 4. The NBL-1 B(0) transporter is not the same as the renal brush border membrane transporter since it does not transport phenylalanine. Differences in specificity in this protein family arise from relatively small differences in amino acid sequence.

DNA hypomethylation of individual sequences in aborted cloned bovine fetuses.

PubMed

Chen, Tao; Jiang, Yan; Zhang, Yan-Ling; Liu, Jing-He; Hou, Yi; Schatten, Heide; Chen, Da-Yuan; Sun, Qing-Yuan

2005-09-01

Cloned bovines have a much higher abortion rate than those derived in vivo. Available evidence indicates that inappropriate epigenetic reprogramming of donor nuclei is the primary cause of cloning failure. To gain a better understanding of the DNA methylation changes associated with the high abortion rate of cloned bovines, we examined the DNA methylation status of a repeated sequence (satellite I) and the promoter regions of two single-copy genes (interleukin 3/cytokeratin) in aborted cloned fetuses, aborted fetuses derived from artificial insemination (AI), cloned adults and AI adults by bisulfite sequencing and restriction enzyme analysis. Two of four aborted cloned fetuses show very low methylation levels in the two single-copy gene promoter regions. One of the two fetuses also showed undermethylated status in the satellite I sequence. The other two aborted cloned fetuses have similar methylation levels to those of aborted AI fetuses. However, no difference in methylation was observed between cloned adults and AI adults. Our results demonstrate for the first time the undermethylated status of individual sequences in aborted cloned fetuses. These findings suggest that aberrant DNA methylation may contribute to the developmental failure of cloned bovine fetuses.

Clone DB: an integrated NCBI resource for clone-associated data

PubMed Central

Schneider, Valerie A.; Chen, Hsiu-Chuan; Clausen, Cliff; Meric, Peter A.; Zhou, Zhigang; Bouk, Nathan; Husain, Nora; Maglott, Donna R.; Church, Deanna M.

2013-01-01

The National Center for Biotechnology Information (NCBI) Clone DB (http://www.ncbi.nlm.nih.gov/clone/) is an integrated resource providing information about and facilitating access to clones, which serve as valuable research reagents in many fields, including genome sequencing and variation analysis. Clone DB represents an expansion and replacement of the former NCBI Clone Registry and has records for genomic and cell-based libraries and clones representing more than 100 different eukaryotic taxa. Records provide details of library construction, associated sequences, map positions and information about resource distribution. Clone DB is indexed in the NCBI Entrez system and can be queried by fields that include organism, clone name, gene name and sequence identifier. Whenever possible, genomic clones are mapped to reference assemblies and their map positions provided in clone records. Clones mapping to specific genomic regions can also be searched for using the NCBI Clone Finder tool, which accepts queries based on sequence coordinates or features such as gene or transcript names. Clone DB makes reports of library, clone and placement data on its FTP site available for download. With Clone DB, users now have available to them a centralized resource that provides them with the tools they will need to make use of these important research reagents. PMID:23193260

Cancer systems biology in the genome sequencing era: part 1, dissecting and modeling of tumor clones and their networks.

PubMed

Wang, Edwin; Zou, Jinfeng; Zaman, Naif; Beitel, Lenore K; Trifiro, Mark; Paliouras, Miltiadis

2013-08-01

Recent tumor genome sequencing confirmed that one tumor often consists of multiple cell subpopulations (clones) which bear different, but related, genetic profiles such as mutation and copy number variation profiles. Thus far, one tumor has been viewed as a whole entity in cancer functional studies. With the advances of genome sequencing and computational analysis, we are able to quantify and computationally dissect clones from tumors, and then conduct clone-based analysis. Emerging technologies such as single-cell genome sequencing and RNA-Seq could profile tumor clones. Thus, we should reconsider how to conduct cancer systems biology studies in the genome sequencing era. We will outline new directions for conducting cancer systems biology by considering that genome sequencing technology can be used for dissecting, quantifying and genetically characterizing clones from tumors. Topics discussed in Part 1 of this review include computationally quantifying of tumor subpopulations; clone-based network modeling, cancer hallmark-based networks and their high-order rewiring principles and the principles of cell survival networks of fast-growing clones. Crown Copyright © 2013. Published by Elsevier Ltd. All rights reserved.

Construction of random sheared fosmid library from Chinese cabbage and its use for Brassica rapa genome sequencing project.

PubMed

Park, Tae-Ho; Park, Beom-Seok; Kim, Jin-A; Hong, Joon Ki; Jin, Mina; Seol, Young-Joo; Mun, Jeong-Hwan

2011-01-01

As a part of the Multinational Genome Sequencing Project of Brassica rapa, linkage group R9 and R3 were sequenced using a bacterial artificial chromosome (BAC) by BAC strategy. The current physical contigs are expected to cover approximately 90% euchromatins of both chromosomes. As the project progresses, BAC selection for sequence extension becomes more limited because BAC libraries are restriction enzyme-specific. To support the project, a random sheared fosmid library was constructed. The library consists of 97536 clones with average insert size of approximately 40 kb corresponding to seven genome equivalents, assuming a Chinese cabbage genome size of 550 Mb. The library was screened with primers designed at the end of sequences of nine points of scaffold gaps where BAC clones cannot be selected to extend the physical contigs. The selected positive clones were end-sequenced to check the overlap between the fosmid clones and the adjacent BAC clones. Nine fosmid clones were selected and fully sequenced. The sequences revealed two completed gap filling and seven sequence extensions, which can be used for further selection of BAC clones confirming that the fosmid library will facilitate the sequence completion of B. rapa. Copyright © 2011. Published by Elsevier Ltd.

PredPPCrys: Accurate Prediction of Sequence Cloning, Protein Production, Purification and Crystallization Propensity from Protein Sequences Using Multi-Step Heterogeneous Feature Fusion and Selection

PubMed Central

Wang, Huilin; Wang, Mingjun; Tan, Hao; Li, Yuan; Zhang, Ziding; Song, Jiangning

2014-01-01

X-ray crystallography is the primary approach to solve the three-dimensional structure of a protein. However, a major bottleneck of this method is the failure of multi-step experimental procedures to yield diffraction-quality crystals, including sequence cloning, protein material production, purification, crystallization and ultimately, structural determination. Accordingly, prediction of the propensity of a protein to successfully undergo these experimental procedures based on the protein sequence may help narrow down laborious experimental efforts and facilitate target selection. A number of bioinformatics methods based on protein sequence information have been developed for this purpose. However, our knowledge on the important determinants of propensity for a protein sequence to produce high diffraction-quality crystals remains largely incomplete. In practice, most of the existing methods display poorer performance when evaluated on larger and updated datasets. To address this problem, we constructed an up-to-date dataset as the benchmark, and subsequently developed a new approach termed ‘PredPPCrys’ using the support vector machine (SVM). Using a comprehensive set of multifaceted sequence-derived features in combination with a novel multi-step feature selection strategy, we identified and characterized the relative importance and contribution of each feature type to the prediction performance of five individual experimental steps required for successful crystallization. The resulting optimal candidate features were used as inputs to build the first-level SVM predictor (PredPPCrys I). Next, prediction outputs of PredPPCrys I were used as the input to build second-level SVM classifiers (PredPPCrys II), which led to significantly enhanced prediction performance. Benchmarking experiments indicated that our PredPPCrys method outperforms most existing procedures on both up-to-date and previous datasets. In addition, the predicted crystallization targets of currently non-crystallizable proteins were provided as compendium data, which are anticipated to facilitate target selection and design for the worldwide structural genomics consortium. PredPPCrys is freely available at http://www.structbioinfor.org/PredPPCrys. PMID:25148528

Oligonucleotide fingerprinting of rRNA genes for analysis of fungal community composition.

PubMed

Valinsky, Lea; Della Vedova, Gianluca; Jiang, Tao; Borneman, James

2002-12-01

Thorough assessments of fungal diversity are currently hindered by technological limitations. Here we describe a new method for identifying fungi, oligonucleotide fingerprinting of rRNA genes (OFRG). ORFG sorts arrayed rRNA gene (ribosomal DNA [rDNA]) clones into taxonomic clusters through a series of hybridization experiments, each using a single oligonucleotide probe. A simulated annealing algorithm was used to design an OFRG probe set for fungal rDNA. Analysis of 1,536 fungal rDNA clones derived from soil generated 455 clusters. A pairwise sequence analysis showed that clones with average sequence identities of 99.2% were grouped into the same cluster. To examine the accuracy of the taxonomic identities produced by this OFRG experiment, we determined the nucleotide sequences for 117 clones distributed throughout the tree. For all but two of these clones, the taxonomic identities generated by this OFRG experiment were consistent with those generated by a nucleotide sequence analysis. Eighty-eight percent of the clones were affiliated with Ascomycota, while 12% belonged to BASIDIOMYCOTA: A large fraction of the clones were affiliated with the genera Fusarium (404 clones) and Raciborskiomyces (176 clones). Smaller assemblages of clones had high sequence identities to the Alternaria, Ascobolus, Chaetomium, Cryptococcus, and Rhizoctonia clades.

Dasytricha dominance in Surti buffalo rumen revealed by 18S rRNA sequences and real-time PCR assay.

PubMed

Singh, K M; Tripathi, A K; Pandya, P R; Rank, D N; Kothari, R K; Joshi, C G

2011-09-01

The genetic diversity of protozoa in Surti buffalo rumen was studied by amplified ribosomal DNA restriction analysis, 18S rDNA sequence homology and phylogenetic and Real-time PCR analysis methods. Three animals were fed diet comprised green fodder Napier bajra 21 (Pennisetum purpureum), mature pasture grass (Dicanthium annulatum) and concentrate mixture (20% crude protein, 65% total digestible nutrients). A protozoa-specific primer (P-SSU-342f) and a eukarya-specific primer (Medlin B) were used to amplify a 1,360 bp fragment of DNA encoding protozoal small subunit (SSU) ribosomal RNA from rumen fluid. A total of 91 clones were examined and identified 14 different 18S RNA sequences based on PCR-RFLP pattern. These 14 phylotypes were distributed into four genera-based 18S rDNA database sequences and identified as Dasytricha (57 clones), Isotricha (14 clones), Ostracodinium (11 clones) and Polyplastron (9 clones). Phylogenetic analyses were also used to infer the makeup of protozoa communities in the rumen of Surti buffalo. Out of 14 sequences, 8 sequences (69 clones) clustered with the Dasytricha ruminantium-like clone and 4 sequences (13 clones) were also phylogenetically placed with the Isotricha prostoma-like clone. Moreover, 2 phylotypes (9 clones) were related to Polyplastron multivesiculatum-like clone. In addition, the number of 18S rDNA gene copies of Dasytricha ruminantium (0.05% to ciliate protozoa) was higher than Entodinium sp. (2.0 × 10(5) vs. 1.3 × 10(4)) in per ml ruminal fluid.

Dynamical System Modeling to Simulate Donor T Cell Response to Whole Exome Sequencing-Derived Recipient Peptides Demonstrates Different Alloreactivity Potential in HLA-Matched and -Mismatched Donor-Recipient Pairs.

PubMed

Abdul Razzaq, Badar; Scalora, Allison; Koparde, Vishal N; Meier, Jeremy; Mahmood, Musa; Salman, Salman; Jameson-Lee, Max; Serrano, Myrna G; Sheth, Nihar; Voelkner, Mark; Kobulnicky, David J; Roberts, Catherine H; Ferreira-Gonzalez, Andrea; Manjili, Masoud H; Buck, Gregory A; Neale, Michael C; Toor, Amir A

2016-05-01

Immune reconstitution kinetics and subsequent clinical outcomes in HLA-matched recipients of allogeneic stem cell transplantation (SCT) are variable and difficult to predict. Considering SCT as a dynamical system may allow sequence differences across the exomes of the transplant donors and recipients to be used to simulate an alloreactive T cell response, which may allow better clinical outcome prediction. To accomplish this, whole exome sequencing was performed on 34 HLA-matched SCT donor-recipient pairs (DRPs) and the nucleotide sequence differences translated to peptides. The binding affinity of the peptides to the relevant HLA in each DRP was determined. The resulting array of peptide-HLA binding affinity values in each patient was considered as an operator modifying a hypothetical T cell repertoire vector, in which each T cell clone proliferates in accordance with the logistic equation of growth. Using an iterating system of matrices, each simulated T cell clone's growth was calculated with the steady-state population being proportional to the magnitude of the binding affinity of the driving HLA-peptide complex. Incorporating competition between T cell clones responding to different HLA-peptide complexes reproduces a number of features of clinically observed T cell clonal repertoire in the simulated repertoire, including sigmoidal growth kinetics of individual T cell clones and overall repertoire, Power Law clonal frequency distribution, increase in repertoire complexity over time with increasing clonal diversity, and alteration of clonal dominance when a different antigen array is encountered, such as in SCT. The simulated, alloreactive T cell repertoire was markedly different in HLA-matched DRPs. The patterns were differentiated by rate of growth and steady-state magnitude of the simulated T cell repertoire and demonstrate a possible correlation with survival. In conclusion, exome wide sequence differences in DRPs may allow simulation of donor alloreactive T cell response to recipient antigens and may provide a quantitative basis for refining donor selection and titration of immunosuppression after SCT. Copyright © 2016 American Society for Blood and Marrow Transplantation. Published by Elsevier Inc. All rights reserved.

Bacterial diversity in permanently cold and alkaline ikaite columns from Greenland.

PubMed

Schmidt, Mariane; Priemé, Anders; Stougaard, Peter

2006-12-01

Bacterial diversity in alkaline (pH 10.4) and permanently cold (4 degrees C) ikaite tufa columns from the Ikka Fjord, SW Greenland, was investigated using growth characterization of cultured bacterial isolates with Terminal-restriction fragment length polymorphism (T-RFLP) and sequence analysis of bacterial 16S rRNA gene fragments. More than 200 bacterial isolates were characterized with respect to pH and temperature tolerance, and it was shown that the majority were cold-active alkaliphiles. T-RFLP analysis revealed distinct bacterial communities in different fractions of three ikaite columns, and, along with sequence analysis, it showed the presence of rich and diverse bacterial communities. Rarefaction analysis showed that the 109 sequenced clones in the 16S rRNA gene library represented between 25 and 65% of the predicted species richness in the three ikaite columns investigated. Phylogenetic analysis of the 16S rRNA gene sequences revealed many sequences with similarity to alkaliphilic or psychrophilic bacteria, and showed that 33% of the cloned sequences and 33% of the cultured bacteria showed less than 97% sequence identity to known sequences in databases, and may therefore represent yet unknown species.

Final progress report, Construction of a genome-wide highly characterized clone resource for genome sequencing

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nierman, William C.

At TIGR, the human Bacterial Artificial Chromosome (BAC) end sequencing and trimming were with an overall sequencing success rate of 65%. CalTech human BAC libraries A, B, C and D as well as Roswell Park Cancer Institute's library RPCI-11 were used. To date, we have generated >300,000 end sequences from >186,000 human BAC clones with an average read length {approx}460 bp for a total of 141 Mb covering {approx}4.7% of the genome. Over sixty percent of the clones have BAC end sequences (BESs) from both ends representing over five-fold coverage of the genome by the paired-end clones. The average phredmore » Q20 length is {approx}400 bp. This high accuracy makes our BESs match the human finished sequences with an average identity of 99% and a match length of 450 bp, and a frequency of one match per 12.8 kb contig sequence. Our sample tracking has ensured a clone tracking accuracy of >90%, which gives researchers a high confidence in (1) retrieving the right clone from the BA C libraries based on the sequence matches; and (2) building a minimum tiling path of sequence-ready clones across the genome and genome assembly scaffolds.« less

Molecular characterization of a gene POLR2H encoded an essential subunit for RNA polymerase II from the Giant Panda (Ailuropoda Melanoleuca).

PubMed

Du, Yu-Jie; Hou, Yi-Ling; Hou, Wan-Ru

2013-02-01

The Giant Panda is an endangered and valuable gene pool in genetic, its important functional gene POLR2H encodes an essential shared peptide H of RNA polymerases. The genomic DNA and cDNA sequences were cloned successfully for the first time from the Giant Panda (Ailuropoda melanoleuca) adopting touchdown-PCR and reverse transcription polymerase chain reaction (RT-PCR), respectively. The length of the genomic sequence of the Giant Panda is 3,285 bp, including five exons and four introns. The cDNA fragment cloned is 509 bp in length, containing an open reading frame of 453 bp encoding 150 amino acids. Alignment analysis indicated that both the cDNA and its deduced amino acid sequence were highly conserved. Protein structure prediction showed that there was one protein kinase C phosphorylation site, four casein kinase II phosphorylation sites and one amidation site in the POLR2H protein, further shaping advanced protein structure. The cDNA cloned was expressed in Escherichia coli, which indicated that POLR2H fusion with the N-terminally His-tagged form brought about the accumulation of an expected 20.5 kDa polypeptide in line with the predicted protein. On the basis of what has already been achieved in this study, further deep-in research will be conducted, which has great value in theory and practical significance.

Cloning, expression and phylogenetic analysis of Hemolin, from the Chinese oak silkmoth, Antheraea pernyi.

PubMed

Li, Wenli; Terenius, Olle; Hirai, Makoto; Nilsson, Anders S; Faye, Ingrid

2005-01-01

The Chinese oak silk moth Antheraea pernyi is an important silk producer. To understand microbial resistance of this moth, we cloned Hemolin, encoding a multifunctional immune protein belonging to the immunoglobulin superfamily, and examined the expression in gonads and fat body. The ApHemolin amino acid sequence was compared to other Hemolin sequences in order to predict functional sites. Several sites were conserved; among them a phosphate binding site, which according to 3D structure modelling does not appear in neuroglian, the phylogenetically closest related protein. In addition, two conserved KDG sequences in the C-C' loop of immunoglobulin domains 1 and 3, give rise to gamma-turns, which is a common motif in the C'-C'' loop of the hypervariable region L2 in vertebrate immunoglobulins. The comparisons also show variable regions of specific interest for future studies of hemolin and its interaction with microbial entities.

1,4-Benzoquinone reductase from Phanerochaete chrysosporium: cDNA cloning and regulation of expression

DOE Office of Scientific and Technical Information (OSTI.GOV)

Akileswaran, L.; Brock, B.J.; Cereghino, J.L.

1999-02-01

A cDNA clone encoding a quinone reductase (QR) from the white rot basidiomycete Phanerochaete chrysosporium was isolated and sequenced. The cDNA consisted of 1,007 nucleotides and a poly(A) tail and encoded a deduced protein containing 271 amino acids. The experimentally determined eight-amino-acid N-germinal sequence of the purified QR protein from P. chrysosporium matched amino acids 72 to 79 of the predicted translation product of the cDNA. The M{sub r} of the predicted translation product, beginning with Pro-72, was essentially identical to the experimentally determined M{sub r} of one monomer of the QR dimer, and this finding suggested that QR ismore » synthesized as a proenzyme. The results of in vitro transcription-translation experiments suggested that QR is synthesized as a proenzyme with a 71-amino-acid leader sequence. This leader sequence contains two potential KEX2 cleavage sites and numerous potential cleavage sites for dipeptidyl aminopeptidase. The QR activity in cultures of P. chrysosporium increased following the addition of 2-dimethoxybenzoquinone, vanillic acid, or several other aromatic compounds. An immunoblot analysis indicated that induction resulted in an increase in the amount of QR protein, and a Northern blot analysis indicated that this regulation occurs at the level of the qr mRNA.« less

Molecular cloning and expression of the gene encoding the kinetoplast-associated type II DNA topoisomerase of Crithidia fasciculata.

PubMed

Pasion, S G; Hines, J C; Aebersold, R; Ray, D S

1992-01-01

A type II DNA topoisomerase, topoIImt, was shown previously to be associated with the kinetoplast DNA of the trypanosomatid Crithidia fasciculata. The gene encoding this kinetoplast-associated topoisomerase has been cloned by immunological screening of a Crithidia genomic expression library with monoclonal antibodies raised against the purified enzyme. The gene CfaTOP2 is a single copy gene and is expressed as a 4.8-kb polyadenylated transcript. The nucleotide sequence of CfaTOP2 has been determined and encodes a predicted polypeptide of 1239 amino acids with a molecular mass of 138,445. The identification of the cloned gene is supported by immunoblot analysis of the beta-galactosidase-CfaTOP2 fusion protein expressed in Escherichia coli and by analysis of tryptic peptide sequences derived from purified topoIImt. CfaTOP2 shares significant homology with nuclear type II DNA topoisomerases of other eukaryotes suggesting that in Crithidia both nuclear and mitochondrial forms of topoisomerase II are encoded by the same gene.

Lineage-specific Virulence Determinants of Haemophilus influenzae Biogroup aegyptius

PubMed Central

Strouts, Fiona R.; Power, Peter; Croucher, Nicholas J.; Corton, Nicola; van Tonder, Andries; Quail, Michael A.; Langford, Paul R.; Hudson, Michael J.; Parkhill, Julian; Bentley, Stephen D.

2012-01-01

An emergent clone of Haemophilus influenzae biogroup aegyptius (Hae) is responsible for outbreaks of Brazilian purpuric fever (BPF). First recorded in Brazil in 1984, the so-called BPF clone of Hae caused a fulminant disease that started with conjunctivitis but developed into septicemic shock; mortality rates were as high as 70%. To identify virulence determinants, we conducted a pan-genomic analysis. Sequencing of the genomes of the BPF clone strain F3031 and a noninvasive conjunctivitis strain, F3047, and comparison of these sequences with 5 other complete H. influenzae genomes showed that >77% of the F3031 genome is shared among all H. influenzae strains. Delineation of the Hae accessory genome enabled characterization of 163 predicted protein-coding genes; identified differences in established autotransporter adhesins; and revealed a suite of novel adhesins unique to Hae, including novel trimeric autotransporter adhesins and 4 new fimbrial operons. These novel adhesins might play a critical role in host–pathogen interactions. PMID:22377449

Inferring Higher Functional Information for RIKEN Mouse Full-Length cDNA Clones With FACTS

PubMed Central

Nagashima, Takeshi; Silva, Diego G.; Petrovsky, Nikolai; Socha, Luis A.; Suzuki, Harukazu; Saito, Rintaro; Kasukawa, Takeya; Kurochkin, Igor V.; Konagaya, Akihiko; Schönbach, Christian

2003-01-01

FACTS (Functional Association/Annotation of cDNA Clones from Text/Sequence Sources) is a semiautomated knowledge discovery and annotation system that integrates molecular function information derived from sequence analysis results (sequence inferred) with functional information extracted from text. Text-inferred information was extracted from keyword-based retrievals of MEDLINE abstracts and by matching of gene or protein names to OMIM, BIND, and DIP database entries. Using FACTS, we found that 47.5% of the 60,770 RIKEN mouse cDNA FANTOM2 clone annotations were informative for text searches. MEDLINE queries yielded molecular interaction-containing sentences for 23.1% of the clones. When disease MeSH and GO terms were matched with retrieved abstracts, 22.7% of clones were associated with potential diseases, and 32.5% with GO identifiers. A significant number (23.5%) of disease MeSH-associated clones were also found to have a hereditary disease association (OMIM Morbidmap). Inferred neoplastic and nervous system disease represented 49.6% and 36.0% of disease MeSH-associated clones, respectively. A comparison of sequence-based GO assignments with informative text-based GO assignments revealed that for 78.2% of clones, identical GO assignments were provided for that clone by either method, whereas for 21.8% of clones, the assignments differed. In contrast, for OMIM assignments, only 28.5% of clones had identical sequence-based and text-based OMIM assignments. Sequence, sentence, and term-based functional associations are included in the FACTS database (http://facts.gsc.riken.go.jp/), which permits results to be annotated and explored through web-accessible keyword and sequence search interfaces. The FACTS database will be a critical tool for investigating the functional complexity of the mouse transcriptome, cDNA-inferred interactome (molecular interactions), and pathome (pathologies). PMID:12819151

Rapid CRISPR/Cas9-Mediated Cloning of Full-Length Epstein-Barr Virus Genomes from Latently Infected Cells.

PubMed

Yajima, Misako; Ikuta, Kazufumi; Kanda, Teru

2018-04-03

Herpesviruses have relatively large DNA genomes of more than 150 kb that are difficult to clone and sequence. Bacterial artificial chromosome (BAC) cloning of herpesvirus genomes is a powerful technique that greatly facilitates whole viral genome sequencing as well as functional characterization of reconstituted viruses. We describe recently invented technologies for rapid BAC cloning of herpesvirus genomes using CRISPR/Cas9-mediated homology-directed repair. We focus on recent BAC cloning techniques of Epstein-Barr virus (EBV) genomes and discuss the possible advantages of a CRISPR/Cas9-mediated strategy comparatively with precedent EBV-BAC cloning strategies. We also describe the design decisions of this technology as well as possible pitfalls and points to be improved in the future. The obtained EBV-BAC clones are subjected to long-read sequencing analysis to determine complete EBV genome sequence including repetitive regions. Rapid cloning and sequence determination of various EBV strains will greatly contribute to the understanding of their global geographical distribution. This technology can also be used to clone disease-associated EBV strains and test the hypothesis that they have special features that distinguish them from strains that infect asymptomatically.

Rapid CRISPR/Cas9-Mediated Cloning of Full-Length Epstein-Barr Virus Genomes from Latently Infected Cells

PubMed Central

Ikuta, Kazufumi; Kanda, Teru

2018-01-01

Herpesviruses have relatively large DNA genomes of more than 150 kb that are difficult to clone and sequence. Bacterial artificial chromosome (BAC) cloning of herpesvirus genomes is a powerful technique that greatly facilitates whole viral genome sequencing as well as functional characterization of reconstituted viruses. We describe recently invented technologies for rapid BAC cloning of herpesvirus genomes using CRISPR/Cas9-mediated homology-directed repair. We focus on recent BAC cloning techniques of Epstein-Barr virus (EBV) genomes and discuss the possible advantages of a CRISPR/Cas9-mediated strategy comparatively with precedent EBV-BAC cloning strategies. We also describe the design decisions of this technology as well as possible pitfalls and points to be improved in the future. The obtained EBV-BAC clones are subjected to long-read sequencing analysis to determine complete EBV genome sequence including repetitive regions. Rapid cloning and sequence determination of various EBV strains will greatly contribute to the understanding of their global geographical distribution. This technology can also be used to clone disease-associated EBV strains and test the hypothesis that they have special features that distinguish them from strains that infect asymptomatically. PMID:29614006

Sequence verification as quality-control step for production of cDNA microarrays.

PubMed

Taylor, E; Cogdell, D; Coombes, K; Hu, L; Ramdas, L; Tabor, A; Hamilton, S; Zhang, W

2001-07-01

To generate cDNA arrays in our core laboratory, we amplified about 2300 PCR products from a human, sequence-verified cDNA clone library. As a quality-control step, we sequenced the PCR products immediately before printing. The sequence information was used to search the GenBank database to confirm the identities. Although these clones were previously sequence verified by the company, we found that only 79% of the clones matched the original database after handling. Our experience strongly indicates the necessity to sequence verify the clones at the final stage before printing on microarray slides and to modify the gene list accordingly.

Molecular cloning, molecular evolution and gene expression of cDNAs encoding thyrotropin-releasing hormone receptor subtypes in a teleost, the sockeye salmon (Oncorhynchus nerka).

PubMed

Saito, Yuichi; Mekuchi, Miyuki; Kobayashi, Noriaki; Kimura, Makoto; Aoki, Yasuhiro; Masuda, Tomohiro; Azuma, Teruo; Fukami, Motohiro; Iigo, Masayuki; Yanagisawa, Tadashi

2011-11-01

Molecular cloning of thyrotropin-releasing hormone receptors (TRHR) was performed in a teleost, the sockeye salmon (Oncorhynchus nerka). Four different TRHR cDNAs were cloned and named TRHR1, TRHR2a, TRHR2b and TRHR3 based on their similarity to known TRHR subtypes in vertebrates. Important residues for TRH binding were conserved in deduced amino acid sequences of the three TRHR subtypes except for the TRHR2b. Seven transmembrane domains were predicted for TRHR1, TRHR2a and TRHR3 proteins but only five for TRHR2b which appears to be truncated. In silico database analysis identified putative TRHR sequences including invertebrate TRHR and reptilian, avian and mammalian TRHR3. Phylogenetic analyses predicted the molecular evolution of TRHR in vertebrates: from the common ancestral TRHR (i.e. invertebrate TRHR), the TRHR2 subtype diverged first and then TRHR1 and TRHR3 diverged. Reverse transcription-polymerase chain reaction analyses revealed TRHR1 transcripts in the brain (hypothalamus), retina, pituitary gland and large intestine; TRHR2a in the brain (telencephalon and hypothalamus); and TRHR3 in the brain (olfactory bulbs) and retina. Copyright © 2011 Elsevier Inc. All rights reserved.

Rose spring dwarf-associated virus has RNA structural and gene-expression features like those of Barley yellow dwarf virus

PubMed Central

Salem, Nida’ M.; Miller, W. Allen; Rowhani, Adib; Golino, Deborah A.; Moyne, Anne-Laure; Falk, Bryce W.

2015-01-01

We determined the complete nucleotide sequence of the Rose spring dwarf-associated virus (RSDaV) genomic RNA (GenBank accession no. EU024678) and compared its predicted RNA structural characteristics affecting gene expression. A cDNA library was derived from RSDaV double-stranded RNAs (dsRNAs) purified from infected tissue. Nucleotide sequence analysis of the cloned cDNAs, plus for clones generated by 5′- and 3′-RACE showed the RSDaV genomic RNA to be 5,808 nucleotides. The genomic RNA contains five major open reading frames (ORFs), and three small ORFs in the 3′-terminal 800 nucleotides, typical for viruses of genus Luteovirus in the family Luteoviridae. Northern blot hybridization analysis revealed the genomic RNA and two prominent subgenomic RNAs of approximately 3 kb and 1 kb. Putative 5′ ends of the sgRNAs were predicted by identification of conserved sequences and secondary structures which resembled the Barley yellow dwarf virus (BYDV) genomic RNA 5′ end and subgenomic RNA promoter sequences. Secondary structures of the BYDV-like ribosomal frameshift elements and cap-independent translation elements, including long-distance base pairing spanning four kb were identified. These contain similarities but also informative differences with the BYDV structures, including a strikingly different structure predicted for the 3′ cap-independent translation element. These analyses of the RSDaV genomic RNA show more complexity for the RNA structural elements for members of the Luteoviridae. PMID:18329064

Rose spring dwarf-associated virus has RNA structural and gene-expression features like those of Barley yellow dwarf virus.

PubMed

Salem, Nida' M; Miller, W Allen; Rowhani, Adib; Golino, Deborah A; Moyne, Anne-Laure; Falk, Bryce W

2008-06-05

We determined the complete nucleotide sequence of the Rose spring dwarf-associated virus (RSDaV) genomic RNA (GenBank accession no. EU024678) and compared its predicted RNA structural characteristics affecting gene expression. A cDNA library was derived from RSDaV double-stranded RNAs (dsRNAs) purified from infected tissue. Nucleotide sequence analysis of the cloned cDNAs, plus for clones generated by 5'- and 3'-RACE showed the RSDaV genomic RNA to be 5808 nucleotides. The genomic RNA contains five major open reading frames (ORFs), and three small ORFs in the 3'-terminal 800 nucleotides, typical for viruses of genus Luteovirus in the family Luteoviridae. Northern blot hybridization analysis revealed the genomic RNA and two prominent subgenomic RNAs of approximately 3 kb and 1 kb. Putative 5' ends of the sgRNAs were predicted by identification of conserved sequences and secondary structures which resembled the Barley yellow dwarf virus (BYDV) genomic RNA 5' end and subgenomic RNA promoter sequences. Secondary structures of the BYDV-like ribosomal frameshift elements and cap-independent translation elements, including long-distance base pairing spanning four kb were identified. These contain similarities but also informative differences with the BYDV structures, including a strikingly different structure predicted for the 3' cap-independent translation element. These analyses of the RSDaV genomic RNA show more complexity for the RNA structural elements for members of the Luteoviridae.

Cloning and expression in Escherichia coli of isopenicillin N synthetase genes from Streptomyces lipmanii and Aspergillus nidulans.

PubMed Central

Weigel, B J; Burgett, S G; Chen, V J; Skatrud, P L; Frolik, C A; Queener, S W; Ingolia, T D

1988-01-01

beta-Lactam antibiotics such as penicillins and cephalosporins are synthesized by a wide variety of microbes, including procaryotes and eucaryotes. Isopenicillin N synthetase catalyzes a key reaction in the biosynthetic pathway of penicillins and cephalosporins. The genes encoding this protein have previously been cloned from the filamentous fungi Cephalosporium acremonium and Penicillium chrysogenum and characterized. We have extended our analysis to the isopenicillin N synthetase genes from the fungus Aspergillus nidulans and the gram-positive procaryote Streptomyces lipmanii. The isopenicillin N synthetase genes from these organisms have been cloned and sequenced, and the proteins encoded by the open reading frames were expressed in Escherichia coli. Active isopenicillin N synthetase enzyme was recovered from extracts of E. coli cells prepared from cells containing each of the genes in expression vectors. The four isopenicillin N synthetase genes studied are closely related. Pairwise comparison of the DNA sequences showed between 62.5 and 75.7% identity; comparison of the predicted amino acid sequences showed between 53.9 and 80.6% identity. The close homology of the procaryotic and eucaryotic isopenicillin N synthetase genes suggests horizontal transfer of the genes during evolution. Images PMID:3045077

Isolation and characterisation of a pod dehiscence zone-specific polygalacturonase from Brassica napus.

PubMed

Petersen, M; Sander, L; Child, R; van Onckelen, H; Ulvskov, P; Borkhardt, B

1996-06-01

Seven distinct partial cDNAs, similar in sequence to previously described polygalacturonases (PGs), were amplified from cDNA derived from rape pod wall, dehiscence zone and leaves by the polymerase chain reaction. Northern analysis showed that one clone, PG35-8, was expressed at low levels in the dehiscence zone during the first five weeks after anthesis but was very abundantly expressed at week 6. In contrast, no PG35-8-related RNA was detected in the pod wall. Our data suggest that there are temporal and spatial correlations between the breakdown of the middle lamella, of the dehiscence zone cells and the pattern of synthesis of PG35-8 transcripts which may indicate a role for this particular PG in rape pod dehiscence. PG35-8 was used to isolate five cDNA clones from a rape dehiscence zone cDNA library. Restriction enzyme analysis and partial sequencing revealed that they were derived from four highly homologous transcripts which are probably allelic forms of a single gene. One full-length clone, RDPG1, was completely sequenced. The predicted protein of RDPG1 showed its highest identity with PG from apple fruit with an identity of 52%.

A rapid and cost-effective method for sequencing pooled cDNA clones by using a combination of transposon insertion and Gateway technology.

PubMed

Morozumi, Takeya; Toki, Daisuke; Eguchi-Ogawa, Tomoko; Uenishi, Hirohide

2011-09-01

Large-scale cDNA-sequencing projects require an efficient strategy for mass sequencing. Here we describe a method for sequencing pooled cDNA clones using a combination of transposon insertion and Gateway technology. Our method reduces the number of shotgun clones that are unsuitable for reconstruction of cDNA sequences, and has the advantage of reducing the total costs of the sequencing project.

Complexity and dynamics of HIV-1 chemokine receptor usage in a multidrug-resistant adolescent.

PubMed

Cavarelli, Mariangela; Mainetti, Lara; Pignataro, Angela Rosa; Bigoloni, Alba; Tolazzi, Monica; Galli, Andrea; Nozza, Silvia; Castagna, Antonella; Sampaolo, Michela; Boeri, Enzo; Scarlatti, Gabriella

2014-12-01

Maraviroc (MVC) is licensed in clinical practice for patients with R5 virus and virological failure; however, in anecdotal reports, dual/mixed viruses were also inhibited. We retrospectively evaluated the evolution of HIV-1 coreceptor tropism in plasma and peripheral blood mononuclear cells (PBMCs) of an infected adolescent with a CCR5/CXCR4 Trofile profile who experienced an important but temporary immunological and virological response during a 16-month period of MVC-based therapy. Coreceptor usage of biological viral clones isolated from PBMCs was investigated in U87.CD4 cells expressing wild-type or chimeric CCR5 and CXCR4. Plasma and PBMC-derived viral clones were sequenced to predict coreceptor tropism using the geno2pheno algorithm from the V3 envelope sequence and pol gene-resistant mutations. From start to 8.5 months of MVC treatment only R5X4 viral clones were observed, whereas at 16 months the phenotype enlarged to also include R5 and X4 clones. Chimeric receptor usage suggested the preferential usage of the CXCR4 coreceptor by the R5X4 biological clones. According to phenotypic data, R5 viruses were susceptible, whereas R5X4 and X4 viruses were resistant to RANTES and MVC in vitro. Clones at 16 months, but not at baseline, showed an amino acidic resistance pattern in protease and reverse transcription genes, which, however, did not drive their tropisms. The geno2pheno algorithm predicted at baseline R5 viruses in plasma, and from 5.5 months throughout follow-up only CXCR4-using viruses. An extended methodological approach is needed to unravel the complexity of the phenotype and variation of viruses resident in the different compartments of an infected individual. The accurate evaluation of the proportion of residual R5 viruses may guide therapeutic intervention in highly experienced patients with limited therapeutic options.

Complexity and Dynamics of HIV-1 Chemokine Receptor Usage in a Multidrug-Resistant Adolescent

PubMed Central

Mainetti, Lara; Pignataro, Angela Rosa; Bigoloni, Alba; Tolazzi, Monica; Galli, Andrea; Nozza, Silvia; Castagna, Antonella; Sampaolo, Michela; Boeri, Enzo; Scarlatti, Gabriella

2014-01-01

Abstract Maraviroc (MVC) is licensed in clinical practice for patients with R5 virus and virological failure; however, in anecdotal reports, dual/mixed viruses were also inhibited. We retrospectively evaluated the evolution of HIV-1 coreceptor tropism in plasma and peripheral blood mononuclear cells (PBMCs) of an infected adolescent with a CCR5/CXCR4 Trofile profile who experienced an important but temporary immunological and virological response during a 16-month period of MVC-based therapy. Coreceptor usage of biological viral clones isolated from PBMCs was investigated in U87.CD4 cells expressing wild-type or chimeric CCR5 and CXCR4. Plasma and PBMC-derived viral clones were sequenced to predict coreceptor tropism using the geno2pheno algorithm from the V3 envelope sequence and pol gene-resistant mutations. From start to 8.5 months of MVC treatment only R5X4 viral clones were observed, whereas at 16 months the phenotype enlarged to also include R5 and X4 clones. Chimeric receptor usage suggested the preferential usage of the CXCR4 coreceptor by the R5X4 biological clones. According to phenotypic data, R5 viruses were susceptible, whereas R5X4 and X4 viruses were resistant to RANTES and MVC in vitro. Clones at 16 months, but not at baseline, showed an amino acidic resistance pattern in protease and reverse transcription genes, which, however, did not drive their tropisms. The geno2pheno algorithm predicted at baseline R5 viruses in plasma, and from 5.5 months throughout follow-up only CXCR4-using viruses. An extended methodological approach is needed to unravel the complexity of the phenotype and variation of viruses resident in the different compartments of an infected individual. The accurate evaluation of the proportion of residual R5 viruses may guide therapeutic intervention in highly experienced patients with limited therapeutic options. PMID:25275490

Comparison of predicted binders in Rhipicephalus (Boophilus) microplus intestine protein variants Bm86 Campo Grande strain, Bm86 and Bm95.

PubMed

Andreotti, Renato; Pedroso, Marisela S; Caetano, Alexandre R; Martins, Natália F

2008-01-01

This paper reports the sequence analysis of Bm86 Campo Grande strain comparing it with Bm86 and Bm95 antigens from the preparations TickGardPLUS and Gavac, respectively. The PCR product was cloned into pMOSBlue and sequenced. The secondary structure prediction tool PSIPRED was used to calculate alpha helices and beta strand contents of the predicted polypeptide. The hydrophobicity profile was calculated using the algorithms from the Hopp and Woods method, in addition to identification of potential MHC class-I binding regions in the antigens. Pair-wise alignment revealed that the similarity between Bm86 Campo Grande strain and Bm86 is 0.2% higher than that between Bm86 Campo Grande strain and Bm95 antigens. The identities were 96.5% and 96.3% respectively. Major suggestive differences in hydrophobicity were predicted among the sequences in two specific regions.

Whole-Genome Sequencing and Assembly with High-Throughput, Short-Read Technologies

PubMed Central

Sundquist, Andreas; Ronaghi, Mostafa; Tang, Haixu; Pevzner, Pavel; Batzoglou, Serafim

2007-01-01

While recently developed short-read sequencing technologies may dramatically reduce the sequencing cost and eventually achieve the $1000 goal for re-sequencing, their limitations prevent the de novo sequencing of eukaryotic genomes with the standard shotgun sequencing protocol. We present SHRAP (SHort Read Assembly Protocol), a sequencing protocol and assembly methodology that utilizes high-throughput short-read technologies. We describe a variation on hierarchical sequencing with two crucial differences: (1) we select a clone library from the genome randomly rather than as a tiling path and (2) we sample clones from the genome at high coverage and reads from the clones at low coverage. We assume that 200 bp read lengths with a 1% error rate and inexpensive random fragment cloning on whole mammalian genomes is feasible. Our assembly methodology is based on first ordering the clones and subsequently performing read assembly in three stages: (1) local assemblies of regions significantly smaller than a clone size, (2) clone-sized assemblies of the results of stage 1, and (3) chromosome-sized assemblies. By aggressively localizing the assembly problem during the first stage, our method succeeds in assembling short, unpaired reads sampled from repetitive genomes. We tested our assembler using simulated reads from D. melanogaster and human chromosomes 1, 11, and 21, and produced assemblies with large sets of contiguous sequence and a misassembly rate comparable to other draft assemblies. Tested on D. melanogaster and the entire human genome, our clone-ordering method produces accurate maps, thereby localizing fragment assembly and enabling the parallelization of the subsequent steps of our pipeline. Thus, we have demonstrated that truly inexpensive de novo sequencing of mammalian genomes will soon be possible with high-throughput, short-read technologies using our methodology. PMID:17534434

cDNA sequence and expression of a cold-responsive gene in Citrus unshiu.

PubMed

Hara, M; Wakasugi, Y; Ikoma, Y; Yano, M; Ogawa, K; Kuboi, T

1999-02-01

A cDNA clone encoding a protein (CuCOR19), the sequence of which is similar to Poncirus COR19, of the dehydrin family was isolated from the epicarp of Citrus unshiu. The molecular mass of the predicted protein was 18,980 daltons. CuCOR19 was highly hydrophilic and contained three repeating elements including Lys-rich motifs. The gene expression in leaves increased by cold stress.

Ubiquitous and gene-specific regulatory 5' sequences in a sea urchin histone DNA clone coding for histone protein variants.

PubMed Central

Busslinger, M; Portmann, R; Irminger, J C; Birnstiel, M L

1980-01-01

The DNA sequences of the entire structural H4, H3, H2A and H2B genes and of their 5' flanking regions have been determined in the histone DNA clone h19 of the sea urchin Psammechinus miliaris. In clone h19 the polarity of transcription and the relative arrangement of the histone genes is identical to that in clone h22 of the same species. The histone proteins encoded by h19 DNA differ in their primary structure from those encoded by clone h22 and have been compared to histone protein sequences of other sea urchin species as well as other eukaryotes. A comparative analysis of the 5' flanking DNA sequences of the structural histone genes in both clones revealed four ubiquitous sequence motifs; a pentameric element GATCC, followed at short distance by the Hogness box GTATAAATAG, a conserved sequence PyCATTCPu, in or near which the 5' ends of the mRNAs map in h22 DNA and lastly a sequence A, containing the initiation codon. These sequences are also found, sometimes in modified version, in front of other eukaryotic genes transcribed by polymerase II. When prelude sequences of isocoding histone genes in clone h19 and h22 are compared areas of homology are seen to extend beyond the ubiquitous sequence motifs towards the divergent AT-rich spacer and terminate between approximately 140 and 240 nucleotides away from the structural gene. These prelude regions contain quite large conservative sequence blocks which are specific for each type of histone genes. Images PMID:7443547

Isolation, molecular cloning and expression of cellobiohydrolase B (CbhB) from Aspergillus niger in Escherichia coli

NASA Astrophysics Data System (ADS)

Woon, J. S. K.; Murad, A. M. A.; Abu Bakar, F. D.

2015-09-01

A cellobiohydrolase B (CbhB) from Aspergillus niger ATCC 10574 was cloned and expressed in E. coli. CbhB has an open reading frame of 1611 bp encoding a putative polypeptide of 536 amino acids. Analysis of the encoded polypeptide predicted a molecular mass of 56.2 kDa, a cellulose binding module (CBM) and a catalytic module. In order to obtain the mRNA of cbhB, total RNA was extracted from A. niger cells induced by 1% Avicel. First strand cDNA was synthesized from total RNA via reverse transcription. The full length cDNA of cbhB was amplified by PCR and cloned into the cloning vector, pGEM-T Easy. A comparison between genomic DNA and cDNA sequences of cbhB revealed that the gene is intronless. Upon the removal of the signal peptide, the cDNA of cbhB was cloned into the expression vector pET-32b. However, the recombinant CbhB was expressed in Escherichia coli Origami DE3 as an insoluble protein. A homology model of CbhB predicted the presence of nine disulfide bonds in the protein structure which may have contributed to the improper folding of the protein and thus, resulting in inclusion bodies in E. coli.

A digestive prolyl carboxypeptidase in Tenebrio molitor larvae

USDA-ARS?s Scientific Manuscript database

Prolyl carboxypeptidase (PRCP) was purified from the anterior midgut of larvae of a stored product pest, Tenebrio molitor. The cDNA of PRCP was cloned, and the predicted protein was identical to the proteomic sequences of the purified enzyme. The substrate specificity of the enzyme was studied, and ...

Process of labeling specific chromosomes using recombinant repetitive DNA

DOEpatents

Moyzis, R.K.; Meyne, J.

1988-02-12

Chromosome preferential nucleotide sequences are first determined from a library of recombinant DNA clones having families of repetitive sequences. Library clones are identified with a low homology with a sequence of repetitive DNA families to which the first clones respectively belong and variant sequences are then identified by selecting clones having a pattern of hybridization with genomic DNA dissimilar to the hybridization pattern shown by the respective families. In another embodiment, variant sequences are selected from a sequence of a known repetitive DNA family. The selected variant sequence is classified as chromosome specific, chromosome preferential, or chromosome nonspecific. Sequences which are classified as chromosome preferential are further sequenced and regions are identified having a low homology with other regions of the chromosome preferential sequence or with known sequences of other family members and consensus sequences of the repetitive DNA families for the chromosome preferential sequences. The selected low homology regions are then hybridized with chromosomes to determine those low homology regions hybridized with a specific chromosome under normal stringency conditions.

Megabase sequencing of human genome by ordered-shotgun-sequencing (OSS) strategy

NASA Astrophysics Data System (ADS)

Chen, Ellson Y.

1997-05-01

So far we have used OSS strategy to sequence over 2 megabases DNA in large-insert clones from regions of human X chromosomes with different characteristic levels of GC content. The method starts by randomly fragmenting a BAC, YAC or PAC to 8-12 kb pieces and subcloning those into lambda phage. Insert-ends of these clones are sequenced and overlapped to create a partial map. Complete sequencing is then done on a minimal tiling path of selected subclones, recursively focusing on those at the edges of contigs to facilitate mergers of clones across the entire target. To reduce manual labor, PCR processes have been adapted to prepare sequencing templates throughout the entire operation. The streamlined process can thus lend itself to further automation. The OSS approach is suitable for large- scale genomic sequencing, providing considerable flexibility in the choice of subclones or regions for more or less intensive sequencing. For example, subclones containing contaminating host cell DNA or cloning vector can be recognized and ignored with minimal sequencing effort; regions overlapping a neighboring clone already sequenced need not be redone; and segments containing tandem repeats or long repetitive sequences can be spotted early on and targeted for additional attention.

Evaluation of microbial community in hydrothermal field by direct DNA sequencing

NASA Astrophysics Data System (ADS)

Kawarabayasi, Y.; Maruyama, A.

2002-12-01

Many extremophiles have been discovered from terrestrial and marine hydrothermal fields. Some thermophiles can grow beyond 90°C in culture, while direct microscopic analysis occasionally indicates that microbes may survive in much hotter hydrothermal fluids. However, it is very difficult to isolate and cultivate such microbes from the environments, i.e., over 99% of total microbes remains undiscovered. Based on experiences of entire microbial genome analysis (Y.K.) and microbial community analysis (A.M.), we started to find out unique microbes/genes in hydrothermal fields through direct sequencing of environmental DNA fragments. At first, shotgun plasmid libraries were directly constructed with the DNA molecules prepared from mixed microbes collected by an in situ filtration system from low-temperature fluids at RM24 in the Southern East Pacific Rise (S-EPR). A gene amplification (PCR) technique was not used for preventing mutation in the process. The nucleotide sequences of 285 clones indicated that no sequence had identical data in public databases. Among 27 clones determined entire sequences, no ORF was identified on 14 clones like intron in Eukaryote. On four clones, tetra-nucleotide-long multiple tandem repetitive sequences were identified. This type of sequence was identified in some familiar disease in human. The result indicates that living/dead materials with eukaryotic features may exist in this low temperature field. Secondly, shotgun plasmid libraries were constructed from the environmental DNA prepared from Beppu hot springs. In randomly-selected 143 clones used for sequencing, no known sequence was identified. Unlike the clones in S-EPR library, clear ORFs were identified on all nine clones determined the entire sequence. It was found that one clone, H4052, contained the complete Aspartyl-tRNA synthetase. Phylogenetic analysis using amino acid sequences of this gene indicated that this gene was separated from other Euryarchaea before the differentiation of species. Thus, some novel archaeal species are expected to be in this field. The present direct cloning and sequencing technique is now opening a window to the new world in hydrothermal microbial community analysis.

Demonstration of GTG as an endogenous initiation codon for a human mRNA transcript revealed by molecular cloning of the serpin endopin 2B.

PubMed

Hwang, Shin-Rong; Garza, Christina Z; Wegrzyn, Jill; Hook, Vivian Y H

2004-08-16

This study demonstrates utilization of the novel GTG initiation codon for translation of a human mRNA transcript that encodes the serpin endopin 2B, a protease inhibitor. Molecular cloning revealed the nucleotide sequence of the human endopin 2B cDNA. Its deduced primary sequence shows high homology to bovine endopin 2A that possesses cross-class protease inhibition of elastase and papain. Notably, the human endopin 2B cDNA sequence revealed GTG as the predicted translation initiation codon; the predicted translation product of 46 kDa endopin 2B was produced by in vitro translation of 35S-endopin 2B with mammalian (rabbit) protein translation components. Importantly, bioinformatic studies demonstrated the presence of the entire human endopin 2B cDNA sequence with GTG as initiation codon within the human genome on chromosome 14. Further evidence for GTG as a functional initiation codon was illustrated by GTG-mediated in vitro translation of the heterologous protein EGFP, and by GTG-mediated expression of EGFP in mammalian PC12 cells. Mutagenesis of GTG to GTC resulted in the absence of EGFP expression in PC12 cells, indicating the function of GTG as an initiation codon. In addition, it was apparent that the GTG initiation codon produces lower levels of translated protein compared to ATG as initiation codon. Significantly, GTG-mediated translation of endopin 2B demonstrates a functional human gene product not previously predicted from initial analyses of the human genome. Further analyses based on GTG as an alternative initiation codon may predict new candidate genes of the human genome.

Cloning and sequencing of a cellobiohydrolase gene from Trichoderma harzianum FP108

Treesearch

Patrick Guilfoile; Ron Burns; Zu-Yi Gu; Matt Amundson; Fu-Hsian Chang

1999-01-01

A cbbl cellobiohydrolase gene was cloned and sequenced from the fungus Trichoderrna harzianum FP108. The cloning was performed by PCR amplification of T. harzianum genomic DNA, using PCR primers whose sequence was based on the cbbl gene from Tricboderma reesei. The 3' end of the gene was isolated by inverse...

The bark of Robinia pseudoacacia contains a complex mixture of lectins.Characterization of the proteins and the cDNA clones.

PubMed Central

Van Damme, E J; Barre, A; Smeets, K; Torrekens, S; Van Leuven, F; Rougé, P; Peumans, W J

1995-01-01

Two lectins were isolated from the inner bark of Robinia pseudoacacia (black locust). The first (and major) lectin (called RPbAI) is composed of five isolectins that originate from the association of 31.5- and 29-kD polypeptides into tetramers. In contrast, the second (minor) lectin (called RPbAII) is a hometetramer composed of 26-kD subunits. The cDNA clones encoding the polypeptides of RPbAI and RPbAII were isolated and their sequences determined. Apparently all three polypeptides are translated from mRNAs of approximately 1.2 kb. Alignment of the deduced amino acid sequences of the different clones indicates that the 31.5- and 29-kD RPbAI polypeptides show approximately 80% sequence identity and are homologous to the previously reported legume seed lectins, whereas the 26-kD RPbAII polypeptide shows only 33% sequence identity to the previously described legume lectins. Modeling the 31.5-kD subunit of RPbAI predicts that its three-dimensional structure is strongly related to the three-dimensional models that have been determined thus far for a few legume lectins. Southern blot analysis of genomic DNA isolated from Robinia has revealed that the Robinia bark lectins are the result of the expression of a small family of lectin genes. PMID:7716244

Exponential megapriming PCR (EMP) cloning--seamless DNA insertion into any target plasmid without sequence constraints.

PubMed

Ulrich, Alexander; Andersen, Kasper R; Schwartz, Thomas U

2012-01-01

We present a fast, reliable and inexpensive restriction-free cloning method for seamless DNA insertion into any plasmid without sequence limitation. Exponential megapriming PCR (EMP) cloning requires two consecutive PCR steps and can be carried out in one day. We show that EMP cloning has a higher efficiency than restriction-free (RF) cloning, especially for long inserts above 2.5 kb. EMP further enables simultaneous cloning of multiple inserts.

Pan-cancer analysis of the extent and consequences of intra-tumor heterogeneity

PubMed Central

Andor, Noemi; Graham, Trevor A.; Jansen, Marnix; Xia, Li C.; Aktipis, C. Athena; Petritsch, Claudia; Ji, Hanlee P.; Maley, Carlo C.

2016-01-01

Intra-tumor heterogeneity (ITH) drives neoplastic progression and therapeutic resistance. We used EXPANDS and PyClone to detect clones >10% frequency within 1,165 exome sequences from TCGA tumors. 86% of tumors across 12 cancer types had at least two clones. ITH in nuclei morphology was associated with genetic ITH (Spearman ρ: 0.24–0.41, P<0.001). Mutation of a driver gene that typically appears in smaller clones was a survival risk factor (HR=2.15, 95% CI: 1.71–2.69). The risk of mortality also increased when >2 clones coexisted (HR=1.49, 95% CI: 1.20–1.87). In two independent datasets, copy number alterations affecting either <25% or >75% of a tumor’s genome predicted reduced risk (HR=0.15, 95% CI: 0.08–0.29). Mortality risk also declined when more than four clones coexisted in the sample, suggesting a tradeoff between costs and benefits of genomic instability. ITH and genomic instability have the potential to be useful measures universally applicable across cancers. PMID:26618723

Microvariation Artifacts Introduced by PCR and Cloning of Closely Related 16S rRNA Gene Sequences†

PubMed Central

Speksnijder, Arjen G. C. L.; Kowalchuk, George A.; De Jong, Sander; Kline, Elizabeth; Stephen, John R.; Laanbroek, Hendrikus J.

2001-01-01

A defined template mixture of seven closely related 16S-rDNA clones was used in a PCR-cloning experiment to assess and track sources of artifactual sequence variation in 16S rDNA clone libraries. At least 14% of the recovered clones contained aberrations. Artifact sources were polymerase errors, a mutational hot spot, and cloning of heteroduplexes and chimeras. These data may partially explain the high degree of microheterogeneity typical of sequence clusters detected in environmental clone libraries. PMID:11133483

Cloning, sequencing, and expression of cDNA for human. beta. -glucuronidase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Oshima, A.; Kyle, J.W.; Miller, R.D.

1987-02-01

The authors report here the cDNA sequence for human placental ..beta..-glucuronidase (..beta..-D-glucuronoside glucuronosohydrolase, EC 3.2.1.31) and demonstrate expression of the human enzyme in transfected COS cells. They also sequenced a partial cDNA clone from human fibroblasts that contained a 153-base-pair deletion within the coding sequence and found a second type of cDNA clone from placenta that contained the same deletion. Nuclease S1 mapping studies demonstrated two types of mRNAs in human placenta that corresponded to the two types of cDNA clones isolated. The NH/sub 2/-terminal amino acid sequence determined for human spleen ..beta..-glucuronidase agreed with that inferred from the DNAmore » sequence of the two placental clones, beginning at amino acid 23, suggesting a cleaved signal sequence of 22 amino acids. When transfected into COS cells, plasmids containing either placental clone expressed an immunoprecipitable protein that contained N-linked oligosaccharides as evidenced by sensitivity to endoglycosidase F. However, only transfection with the clone containing the 153-base-pair segment led to expression of human ..beta..-glucuronidase activity. These studies provide the sequence for the full-length cDNA for human ..beta..-glucuronidase, demonstrate the existence of two populations of mRNA for ..beta..-glucuronidase in human placenta, only one of which specifies a catalytically active enzyme, and illustrate the importance of expression studies in verifying that a cDNA is functionally full-length.« less

Mapping neurofibromatosis 1 homologous loci by fluorescence in situ hybridization

DOE Office of Scientific and Technical Information (OSTI.GOV)

Viskochil, D.; Breidenbach, H.H.; Cawthon, R.

Neurofibromatosis 1 maps to chromosome band 17q11.2 and the NF1 gene is comprised of 59 exons that span approximately 335 kb of genomic DNA. In order to further analyze the structure of NF1 from exons 2 through 27b, we isolated a number of cosmid and bacteriophage P-1 genomic clones using NF1-exon probes under high-stringency hybridization conditions. Using tagged, intron-based primers and DNA from various clones as a template, we PCR-amplified and sequenced individual NF1 exons. The exon sequences in PCR products from several genomic clones differed from the exon sequence derived from cloned NF1 cDNAs. Clones with variant sequences weremore » mapped by fluorescence in situ hybridization under high-stringency conditions. Three clones mapped to chromosome band 15q11.2, one mapped to 14q11.2, one mapped to both 2q14.1-14.3 and 14q11.2, one mapped to 2q33-34, and one mapped to both 18q11.2 and 21q21. Even though some PCR-product sequences retained proper splice junctions and open reading frames, we have yet to identify cDNAs that correspond to the variant exon sequences. We are now sequencing clones that map to NF1-homologous loci in order to develop discriminating primer pairs for the exclusive amplification of NF1-specific sequences in our efforts to develop a comprehensive NF1 mutation screen using genomic DNA as template. The role of NF1-homologous sequences may play in neurofibromatosis 1 is not clear.« less

Taxonomic and functional assignment of cloned sequences from high Andean forest soil metagenome.

PubMed

Montaña, José Salvador; Jiménez, Diego Javier; Hernández, Mónica; Angel, Tatiana; Baena, Sandra

2012-02-01

Total metagenomic DNA was isolated from high Andean forest soil and subjected to taxonomical and functional composition analyses by means of clone library generation and sequencing. The obtained yield of 1.7 μg of DNA/g of soil was used to construct a metagenomic library of approximately 20,000 clones (in the plasmid p-Bluescript II SK+) with an average insert size of 4 Kb, covering 80 Mb of the total metagenomic DNA. Metagenomic sequences near the plasmid cloning site were sequenced and them trimmed and assembled, obtaining 299 reads and 31 contigs (0.3 Mb). Taxonomic assignment of total sequences was performed by BLASTX, resulting in 68.8, 44.8 and 24.5% classification into taxonomic groups using the metagenomic RAST server v2.0, WebCARMA v1.0 online system and MetaGenome Analyzer v3.8 software, respectively. Most clone sequences were classified as Bacteria belonging to phlya Actinobacteria, Proteobacteria and Acidobacteria. Among the most represented orders were Actinomycetales (34% average), Rhizobiales, Burkholderiales and Myxococcales and with a greater number of sequences in the genus Mycobacterium (7% average), Frankia, Streptomyces and Bradyrhizobium. The vast majority of sequences were associated with the metabolism of carbohydrates, proteins, lipids and catalytic functions, such as phosphatases, glycosyltransferases, dehydrogenases, methyltransferases, dehydratases and epoxide hydrolases. In this study we compared different methods of taxonomic and functional assignment of metagenomic clone sequences to evaluate microbial diversity in an unexplored soil ecosystem, searching for putative enzymes of biotechnological interest and generating important information for further functional screening of clone libraries.

A genome-wide BAC-end sequence survey provides first insights into sweetpotato (Ipomoea batatas (L.) Lam.) genome composition.

PubMed

Si, Zengzhi; Du, Bing; Huo, Jinxi; He, Shaozhen; Liu, Qingchang; Zhai, Hong

2016-11-21

Sweetpotato, Ipomoea batatas (L.) Lam., is an important food crop widely grown in the world. However, little is known about the genome of this species because it is a highly heterozygous hexaploid. Gaining a more in-depth knowledge of sweetpotato genome is therefore necessary and imperative. In this study, the first bacterial artificial chromosome (BAC) library of sweetpotato was constructed. Clones from the BAC library were end-sequenced and analyzed to provide genome-wide information about this species. The BAC library contained 240,384 clones with an average insert size of 101 kb and had a 7.93-10.82 × coverage of the genome, and the probability of isolating any single-copy DNA sequence from the library was more than 99%. Both ends of 8310 BAC clones randomly selected from the library were sequenced to generate 11,542 high-quality BAC-end sequences (BESs), with an accumulative length of 7,595,261 bp and an average length of 658 bp. Analysis of the BESs revealed that 12.17% of the sweetpotato genome were known repetitive DNA, including 7.37% long terminal repeat (LTR) retrotransposons, 1.15% Non-LTR retrotransposons and 1.42% Class II DNA transposons etc., 18.31% of the genome were identified as sweetpotato-unique repetitive DNA and 10.00% of the genome were predicted to be coding regions. In total, 3,846 simple sequences repeats (SSRs) were identified, with a density of one SSR per 1.93 kb, from which 288 SSRs primers were designed and tested for length polymorphism using 20 sweetpotato accessions, 173 (60.07%) of them produced polymorphic bands. Sweetpotato BESs had significant hits to the genome sequences of I. trifida and more matches to the whole-genome sequences of Solanum lycopersicum than those of Vitis vinifera, Theobroma cacao and Arabidopsis thaliana. The first BAC library for sweetpotato has been successfully constructed. The high quality BESs provide first insights into sweetpotato genome composition, and have significant hits to the genome sequences of I. trifida and more matches to the whole-genome sequences of Solanum lycopersicum. These resources as a robust platform will be used in high-resolution mapping, gene cloning, assembly of genome sequences, comparative genomics and evolution for sweetpotato.

Molecular cloning of a cDNA coding for GTP cyclohydrolase I from Dictyostelium discoideum.

PubMed Central

Witter, K; Cahill, D J; Werner, T; Ziegler, I; Rödl, W; Bacher, A; Gütlich, M

1996-01-01

The GTP cyclohydrolase I (GTP-CH) gene of the cellular slime mould Dictyostelium discoideum has been cloned and sequenced. The 855 bp cDNA of this gene contains the open reading frame (ORF) encoding 232 amino acids with a predicted molecular mass of approx. 26 kDa. Southern blot analysis indicated the presence of a single gene for GTP-CH in Dictyostelium. PCR amplification of the ORF from chromosomal DNA and sequencing showed the existence of a 101 bp intron in the GTP-CH gene of Dictyostelium discoideum. The amino acid sequence has 47% and 49% positional identity to those of the human and yeast enzymes respectively. Most of the sequence variation between species is located in the N-terminal part of the protein. The overall identity with the E. coli protein is markedly lower. The enzyme was expressed in E. coli and purified as a 68 kDa fusion protein with the maltose-binding protein of E. coli. GTP-CH of Dictyostelium is heat-stable and showed maximal activity at 60 degrees C. The Km value for GTP is 50 microM. PMID:8870645

Molecular cloning and characterization of alpha - galactosidase gene from Glaciozyma antarctica

NASA Astrophysics Data System (ADS)

Moheer, Reyad Qaed Al; Bakar, Farah Diba Abu; Murad, Abdul Munir Abdul

2015-09-01

Psychrophilic enzymes are proteins produced by psychrophilic organisms which recently are the limelight for industrial applications. A gene encoding α-galactosidase from a psychrophilic yeast, Glaciozyma antarctica PI12 which belongs to glycoside hydrolase family 27, was isolated and analyzed using several bioinformatic tools. The cDNA of the gene with the size of 1,404-bp encodes a protein with 467 amino acid residues. Predicted molecular weight of protein was 48.59 kDa and hence we name the gene encoding α-galactosidase as GAL48. We found that the predicted protein sequences possessed signal peptide sequence and are highly conserved among other fungal α-galactosidase.

Instability of plasmid DNA sequences: macro and micro evolution of the antibiotic resistance plasmid R6-5.

PubMed

Timmis, K N; Cabello, F; Andrés, I; Nordheim, A; Burkhardt, H J; Cohen, S N

1978-11-16

Detailed examination of the structure of cloned DNA fragments of the R6-5 antibiotic resistance plasmid has revealed a substantial degree of polynucleotide sequence heterogeneity and indicates that sequence rearrangements in plasmids and possible other replicons occur more frequently than has hitherto been appreciated. The sequences changes in cloned R6-5 fragments were shown in some instances to have occurred prior to cloning, i.e. existing in the original population of R6-5 molecules that was obtained from a single bacterial clone and by several different criteria judged to be homogeneous, and in others to have occurred either during the cloning procedure or during subsequent propagation of hybrid molecules. The molecular changes that are described involved insertion/deletion of the previously characterized IS2 insertion element, formation of a new inverted repeat structure probably by duplication of a preexisting R6-5 DNA sequence, sequence inversion, and loss and gain of restriction endonuclease cleavage sites.

Interferon-gamma of the giant panda (Ailuropoda melanoleuca): complementary DNA cloning, expression, and phylogenetic analysis.

PubMed

Tao, Yaqiong; Zeng, Bo; Xu, Liu; Yue, Bisong; Yang, Dong; Zou, Fangdong

2010-01-01

Interferon-gamma (IFN-gamma) is the only member of type II IFN and is vital in the regulation of immune and inflammatory responses. Herein we report the cloning, expression, and sequence analysis of IFN-gamma from the giant panda (Ailuropoda melanoleuca). The open reading frame of this gene is 501 base pair in length and encodes a polypeptide consisting of 166 amino acids. All conserved N-linked glycosylation sites and cysteine residues among carnivores were found in the predicted amino acid sequence of the giant panda. Recombinant giant panda IFN-gamma with a V5 epitope and polyhistidine tag was expressed in HEK293 host cells and confirmed by Western blotting. Phylogenetic analysis of mammalian IFN-gamma-coding sequences indicated that the giant panda IFN-gamma was closest to that of carnivores, then to ungulates and dolphin, and shared a distant relationship with mouse and human. These results represent a first step into the study of IFN-gamma in giant panda.

Chromosome specific repetitive DNA sequences

DOEpatents

Moyzis, Robert K.; Meyne, Julianne

1991-01-01

A method is provided for determining specific nucleotide sequences useful in forming a probe which can identify specific chromosomes, preferably through in situ hybridization within the cell itself. In one embodiment, chromosome preferential nucleotide sequences are first determined from a library of recombinant DNA clones having families of repetitive sequences. Library clones are identified with a low homology with a sequence of repetitive DNA families to which the first clones respectively belong and variant sequences are then identified by selecting clones having a pattern of hybridization with genomic DNA dissimilar to the hybridization pattern shown by the respective families. In another embodiment, variant sequences are selected from a sequence of a known repetitive DNA family. The selected variant sequence is classified as chromosome specific, chromosome preferential, or chromosome nonspecific. Sequences which are classified as chromosome preferential are further sequenced and regions are identified having a low homology with other regions of the chromosome preferential sequence or with known sequences of other family me This invention is the result of a contract with the Department of Energy (Contract No. W-7405-ENG-36).

Analysis of heterogeneity of Copia-like retrotransposons in the genome of cassava (Manihot esculenta Crantz).

PubMed

Gbadegesin, Micheal A; Beeching, John R

2011-12-20

Retrotransposons are ubiquitous in eukaryotic genomes and now proving to be useful genetic tools for genetic diversity and phylogenetic analyses, especially in plants. In order to assess the diversity of Ty1/Copia-like retrotransposons of cassava, we used PCR primers anchored on the conserved domains of reverse transcriptases (RTs) to amplify cassava Ty1/Copia-like RT. The PCR product was cloned and sequenced. Sequences analysis of the clones revealed the presence of 69 families of Ty1/Copia-like retrotransposon in the genome of cassava. Comparative analyses of the predicted amino acid sequences of these clones with those of other plants showed that retroelements of this class are very heterogeneous in cassava. Cassava is widely grown for its edible roots in the tropical and subtropical regions of the world. Cassava roots, though poor in protein, are rich in starch (makes up about 80% of the dry matter), vitamin C, carotenes, calcium and potassium. It has a great commercial importance as a source of starch and starch based products. Realizing the importance of cassava, it stands out as a crop to benefit from biotechnology development. Heterogeneity of Mecops (Manihot esculenta copia-like Retrotransposons) showed that they may be useful for genetic diversity and phylogenetic analyses of cassava germplasm.

Molecular cloning, sequencing, and expression of Eimeria tenella HSP70 partial gene.

PubMed

Bogado, A L G; Martins, G F; Sasse, J P; Guimarães, J da S; Garcia, J L

2017-03-15

Members of the Eimeria genus are protozoan parasites of the subphylum Apicomplexa (Eimeriidae family), and belong to the coccidia group. Eimeria tenella is one of the most pathogenic species owing to its ability to penetrate the mucosa, and cause inflammation and damage. It is an obligate intracellular parasite that causes disease by destroying the host cells during multiplication. Heat shock protein 70 (HSP70) is a molecular chaperone that prevents cellular stress. The objective of this study was to clone, sequence, and express E. tenella HSP70 protein. After selecting the region of highest hydrophilicity in the hsp70 gene, we cloned complementary DNA (cDNA) into a pTrcHis2-TOPO vector and transformed it into TOP10 Escherichia coli cells; after induction, the bacteria expressed a 23-kDa protein with insoluble expression levels of approximately 5 mg/L. In summary, the partial hsp70 gene was successfully expressed in E. coli, producing a 23-kDa protein under insoluble conditions, and the antigen characteristics predicted by hydrophilicity analysis suggest the development of a vaccine for use in avian coccidiosis.

Two members of the mouse mdr gene family confer multidrug resistance with overlapping but distinct drug specificities.

PubMed Central

Devault, A; Gros, P

1990-01-01

We report the cloning and functional analysis of a complete clone for the third member of the mouse mdr gene family, mdr3. Nucleotide and predicted amino acid sequence analyses showed that the three mouse mdr genes encode highly homologous membrane glycoproteins, which share the same length (1,276 residues), the same predicted functional domains, and overall structural arrangement. Regions of divergence among the three proteins are concentrated in discrete segments of the predicted polypeptides. Sequence comparison indicated that the three mouse mdr genes were created from a common ancestor by two independent gene duplication events, the most recent one producing mdr1 and mdr3. When transfected and overexpressed in otherwise drug-sensitive cells, the mdr3 gene, like mdr1 and unlike mdr2, conferred multidrug resistance to these cells. In independently derived transfected cell clones expressing similar amounts of either MDR1 or MDR3 protein, the drug resistance profile conferred by mdr3 was distinct from that conferred by mdr1. Cells transfected with and expressing MDR1 showed a marked 7- to 10-fold preferential resistance to colchicine and Adriamycin compared with cells expressing equivalent amounts of MDR3. Conversely, cells transfected with and expressing MDR3 showed a two- to threefold preferential resistance to actinomycin D over their cellular counterpart expressing MDR1. These results suggest that MDR1 and MDR3 are membrane-associated efflux pumps which, in multidrug-resistant cells and perhaps normal tissues, have overlapping but distinct substrate specificities. Images PMID:1969610

Library analysis of SCHEMA-guided protein recombination.

PubMed

Meyer, Michelle M; Silberg, Jonathan J; Voigt, Christopher A; Endelman, Jeffrey B; Mayo, Stephen L; Wang, Zhen-Gang; Arnold, Frances H

2003-08-01

The computational algorithm SCHEMA was developed to estimate the disruption caused when amino acid residues that interact in the three-dimensional structure of a protein are inherited from different parents upon recombination. To evaluate how well SCHEMA predicts disruption, we have shuffled the distantly-related beta-lactamases PSE-4 and TEM-1 at 13 sites to create a library of 2(14) (16,384) chimeras and examined which ones retain lactamase function. Sequencing the genes from ampicillin-selected clones revealed that the percentage of functional clones decreased exponentially with increasing calculated disruption (E = the number of residue-residue contacts that are broken upon recombination). We also found that chimeras with low E have a higher probability of maintaining lactamase function than chimeras with the same effective level of mutation but chosen at random from the library. Thus, the simple distance metric used by SCHEMA to identify interactions and compute E allows one to predict which chimera sequences are most likely to retain their function. This approach can be used to evaluate crossover sites for recombination and to create highly mosaic, folded chimeras.

Library analysis of SCHEMA-guided protein recombination

PubMed Central

Meyer, Michelle M.; Silberg, Jonathan J.; Voigt, Christopher A.; Endelman, Jeffrey B.; Mayo, Stephen L.; Wang, Zhen-Gang; Arnold, Frances H.

2003-01-01

The computational algorithm SCHEMA was developed to estimate the disruption caused when amino acid residues that interact in the three-dimensional structure of a protein are inherited from different parents upon recombination. To evaluate how well SCHEMA predicts disruption, we have shuffled the distantly-related β-lactamases PSE-4 and TEM-1 at 13 sites to create a library of 214 (16,384) chimeras and examined which ones retain lactamase function. Sequencing the genes from ampicillin-selected clones revealed that the percentage of functional clones decreased exponentially with increasing calculated disruption (E = the number of residue–residue contacts that are broken upon recombination). We also found that chimeras with low E have a higher probability of maintaining lactamase function than chimeras with the same effective level of mutation but chosen at random from the library. Thus, the simple distance metric used by SCHEMA to identify interactions and compute E allows one to predict which chimera sequences are most likely to retain their function. This approach can be used to evaluate crossover sites for recombination and to create highly mosaic, folded chimeras. PMID:12876318

Characterization of the alkaline/neutral invertase gene in Dendrobium officinale and its relationship with polysaccharide accumulation.

PubMed

Gao, F; Cao, X F; Si, J P; Chen, Z Y; Duan, C L

2016-05-06

Dendrobium officinale is one of the most well-known traditional Chinese medicines, and polysaccharide is its main active ingredient. Many studies have investigated the synthesis and accumulation mechanisms of polysaccharide, but until recently, little was known about the molecular mechanism of how polysaccharide is synthesized because no related genes have been cloned. In this study, we cloned an alkaline/neutral invertase gene from D. officinale (DoNI) by the rapid amplification of cDNA ends (RACE) method. DoNI was 2231 bp long and contained an open reading frame that predicted a 62.8-kDa polypeptide with 554-amino acid residues. An alkaline/neutral invertase conserved domain was predicted from this deduced amino acid sequence, and DoNI had a similar deduced amino acid sequence to Setaria italica and Oryza brachyantha. We also found that DoNI expression in different tissues was closely related to DoNI activity, and more importantly, polysaccharide level. Our results indicate that DoNI is associated with polysaccharide accumulation in D. officinale.

A novel species-specific tandem repeat DNA family from Sinapis arvensis: detection of telomere-like sequences.

PubMed

Kapila, R; Das, S; Srivastava, P S; Lakshmikumaran, M

1996-08-01

DNA sequences representing a tandemly repeated DNA family of the Sinapis arvensis genome were cloned and characterized. The 700-bp tandem repeat family is represented by two clones, pSA35 and pSA52, which are 697 and 709 bp in length, respectively. Dot matrix analysis of the sequences indicates the presence of repeated elements within each monomeric unit. Sequence analysis of the repetitive region of clones pSA35 and pSA52 shows that there are several copies of a 7-bp repeat element organized in tandem. The consensus sequence of this repeat element is 5'-TTTAGGG-3'. These elements are highly mutated and the difference in length between the two clones is due to different copy numbers of these elements. The repetitive region of clone pSA35 has 26 copies of the element TTTAGGG, whereas clone pSA52 has 28 copies. The repetitive region in both clones is flanked on either side by inverted repeats that may be footprints of a transposition event. Sequence comparison indicates that the element TTTAGGG is identical to telomeric repeats present in Arabidopsis, maize, tomato, and other plants. However, Bal31 digestion kinetics indicates non-telomeric localization of the 700-bp tandem repeats. The clones represent a novel repeat family as (i) they contain telomere-like motifs as subrepeats within each unit; and (ii) they do not hybridize to related crucifers and are species-specific in nature.

Molecular cloning, sequence analysis, prokaryotic expression, and function prediction of foot-specific peroxidase in Hydra magnipapillata Chinese strain.

PubMed

Pan, H C; Yang, H Q; Zhao, F X; Qian, X C

2014-08-28

The cDNA sequence of foot-specific peroxidase PPOD1 from the Chinese strain of Hydra magnipapillata was cloned by reverse transcription-polymerase chain reaction. The cDNA sequence contained a coding region with an 873-bp open reading frame, a 31-bp 5'-untranslated region, and a 36-bp 3'-untranslated region. The structure prediction results showed that PPOD1 contains 10.34% of α-helix, 38.62% of extended strand, 12.41% of β-turn, and 38.62% of random coil. The structural core was α-helix at the N terminus. The GenBank protein blast server showed that PPOD1 contains 2 fascin-like domains. In addition, high-level PPOD1 activity was only present in the ectodermal epithelial cells located on the edge of the adhesive face of the basal disc, and that these cells extended lamellipodia and filopodia when the basal disc was tightly attached to a glass slide. The fascin-like domains of Hydra PPOD1 might contribute to the bundling of the actin filament of these cells, and hence, the formation of filopodia. In conclusion, these cells might play an important role in strengthening the adsorbability of the basal disc to substrates.

Ebbie: automated analysis and storage of small RNA cloning data using a dynamic web server

PubMed Central

Ebhardt, H Alexander; Wiese, Kay C; Unrau, Peter J

2006-01-01

Background DNA sequencing is used ubiquitously: from deciphering genomes[1] to determining the primary sequence of small RNAs (smRNAs) [2-5]. The cloning of smRNAs is currently the most conventional method to determine the actual sequence of these important regulators of gene expression. Typical smRNA cloning projects involve the sequencing of hundreds to thousands of smRNA clones that are delimited at their 5' and 3' ends by fixed sequence regions. These primers result from the biochemical protocol used to isolate and convert the smRNA into clonable PCR products. Recently we completed a smRNA cloning project involving tobacco plants, where analysis was required for ~700 smRNA sequences[6]. Finding no easily accessible research tool to enter and analyze smRNA sequences we developed Ebbie to assist us with our study. Results Ebbie is a semi-automated smRNA cloning data processing algorithm, which initially searches for any substring within a DNA sequencing text file, which is flanked by two constant strings. The substring, also termed smRNA or insert, is stored in a MySQL and BlastN database. These inserts are then compared using BlastN to locally installed databases allowing the rapid comparison of the insert to both the growing smRNA database and to other static sequence databases. Our laboratory used Ebbie to analyze scores of DNA sequencing data originating from an smRNA cloning project[6]. Through its built-in instant analysis of all inserts using BlastN, we were able to quickly identify 33 groups of smRNAs from ~700 database entries. This clustering allowed the easy identification of novel and highly expressed clusters of smRNAs. Ebbie is available under GNU GPL and currently implemented on Conclusion Ebbie was designed for medium sized smRNA cloning projects with about 1,000 database entries [6-8].Ebbie can be used for any type of sequence analysis where two constant primer regions flank a sequence of interest. The reliable storage of inserts, and their annotation in a MySQL database, BlastN[9] comparison of new inserts to dynamic and static databases make it a powerful new tool in any laboratory using DNA sequencing. Ebbie also prevents manual mistakes during the excision process and speeds up annotation and data-entry. Once the server is installed locally, its access can be restricted to protect sensitive new DNA sequencing data. Ebbie was primarily designed for smRNA cloning projects, but can be applied to a variety of RNA and DNA cloning projects[2,3,10,11]. PMID:16584563

Recovery of infectious virus from full-length cowpox virus (CPXV) DNA cloned as a bacterial artificial chromosome (BAC)

PubMed Central

2011-01-01

Transmission from pet rats and cats to humans as well as severe infection in felids and other animal species have recently drawn increasing attention to cowpox virus (CPXV). We report the cloning of the entire genome of cowpox virus strain Brighton Red (BR) as a bacterial artificial chromosome (BAC) in Escherichia coli and the recovery of infectious virus from cloned DNA. Generation of a full-length CPXV DNA clone was achieved by first introducing a mini-F vector, which allows maintenance of large circular DNA in E. coli, into the thymidine kinase locus of CPXV by homologous recombination. Circular replication intermediates were then electroporated into E. coli DH10B cells. Upon successful establishment of the infectious BR clone, we modified the full-length clone such that recombination-mediated excision of bacterial sequences can occur upon transfection in eukaryotic cells. This self-excision of the bacterial replicon is made possible by a sequence duplication within mini-F sequences and allows recovery of recombinant virus progeny without remaining marker or vector sequences. The in vitro growth properties of viruses derived from both BAC clones were determined and found to be virtually indistinguishable from those of parental, wild-type BR. Finally, the complete genomic sequence of the infectious clone was determined and the cloned viral genome was shown to be identical to that of the parental virus. In summary, the generated infectious clone will greatly facilitate studies on individual genes and pathogenesis of CPXV. Moreover, the vector potential of CPXV can now be more systematically explored using this newly generated tool. PMID:21314965

Exponential Megapriming PCR (EMP) Cloning—Seamless DNA Insertion into Any Target Plasmid without Sequence Constraints

PubMed Central

Ulrich, Alexander; Andersen, Kasper R.; Schwartz, Thomas U.

2012-01-01

We present a fast, reliable and inexpensive restriction-free cloning method for seamless DNA insertion into any plasmid without sequence limitation. Exponential megapriming PCR (EMP) cloning requires two consecutive PCR steps and can be carried out in one day. We show that EMP cloning has a higher efficiency than restriction-free (RF) cloning, especially for long inserts above 2.5 kb. EMP further enables simultaneous cloning of multiple inserts. PMID:23300917

Molecular modelling of the Norrie disease protein predicts a cystine knot growth factor tertiary structure.

PubMed

Meitinger, T; Meindl, A; Bork, P; Rost, B; Sander, C; Haasemann, M; Murken, J

1993-12-01

The X-lined gene for Norrie disease, which is characterized by blindness, deafness and mental retardation has been cloned recently. This gene has been thought to code for a putative extracellular factor; its predicted amino acid sequence is homologous to the C-terminal domain of diverse extracellular proteins. Sequence pattern searches and three-dimensional modelling now suggest that the Norrie disease protein (NDP) has a tertiary structure similar to that of transforming growth factor beta (TGF beta). Our model identifies NDP as a member of an emerging family of growth factors containing a cystine knot motif, with direct implications for the physiological role of NDP. The model also sheds light on sequence related domains such as the C-terminal domain of mucins and of von Willebrand factor.

Isolation, molecular cloning and expression of cellobiohydrolase B (CbhB) from Aspergillus niger in Escherichia coli

DOE Office of Scientific and Technical Information (OSTI.GOV)

Woon, J. S. K., E-mail: jameswoon@siswa.ukm.edu.my; Murad, A. M. A., E-mail: munir@ukm.edu.my; Abu Bakar, F. D., E-mail: fabyff@ukm.edu.my

A cellobiohydrolase B (CbhB) from Aspergillus niger ATCC 10574 was cloned and expressed in E. coli. CbhB has an open reading frame of 1611 bp encoding a putative polypeptide of 536 amino acids. Analysis of the encoded polypeptide predicted a molecular mass of 56.2 kDa, a cellulose binding module (CBM) and a catalytic module. In order to obtain the mRNA of cbhB, total RNA was extracted from A. niger cells induced by 1% Avicel. First strand cDNA was synthesized from total RNA via reverse transcription. The full length cDNA of cbhB was amplified by PCR and cloned into the cloning vector, pGEM-Tmore » Easy. A comparison between genomic DNA and cDNA sequences of cbhB revealed that the gene is intronless. Upon the removal of the signal peptide, the cDNA of cbhB was cloned into the expression vector pET-32b. However, the recombinant CbhB was expressed in Escherichia coli Origami DE3 as an insoluble protein. A homology model of CbhB predicted the presence of nine disulfide bonds in the protein structure which may have contributed to the improper folding of the protein and thus, resulting in inclusion bodies in E. coli.« less

Accurate and predictive antibody repertoire profiling by molecular amplification fingerprinting.

PubMed

Khan, Tarik A; Friedensohn, Simon; Gorter de Vries, Arthur R; Straszewski, Jakub; Ruscheweyh, Hans-Joachim; Reddy, Sai T

2016-03-01

High-throughput antibody repertoire sequencing (Ig-seq) provides quantitative molecular information on humoral immunity. However, Ig-seq is compromised by biases and errors introduced during library preparation and sequencing. By using synthetic antibody spike-in genes, we determined that primer bias from multiplex polymerase chain reaction (PCR) library preparation resulted in antibody frequencies with only 42 to 62% accuracy. Additionally, Ig-seq errors resulted in antibody diversity measurements being overestimated by up to 5000-fold. To rectify this, we developed molecular amplification fingerprinting (MAF), which uses unique molecular identifier (UID) tagging before and during multiplex PCR amplification, which enabled tagging of transcripts while accounting for PCR efficiency. Combined with a bioinformatic pipeline, MAF bias correction led to measurements of antibody frequencies with up to 99% accuracy. We also used MAF to correct PCR and sequencing errors, resulting in enhanced accuracy of full-length antibody diversity measurements, achieving 98 to 100% error correction. Using murine MAF-corrected data, we established a quantitative metric of recent clonal expansion-the intraclonal diversity index-which measures the number of unique transcripts associated with an antibody clone. We used this intraclonal diversity index along with antibody frequencies and somatic hypermutation to build a logistic regression model for prediction of the immunological status of clones. The model was able to predict clonal status with high confidence but only when using MAF error and bias corrected Ig-seq data. Improved accuracy by MAF provides the potential to greatly advance Ig-seq and its utility in immunology and biotechnology.

Accurate and predictive antibody repertoire profiling by molecular amplification fingerprinting

PubMed Central

Khan, Tarik A.; Friedensohn, Simon; de Vries, Arthur R. Gorter; Straszewski, Jakub; Ruscheweyh, Hans-Joachim; Reddy, Sai T.

2016-01-01

High-throughput antibody repertoire sequencing (Ig-seq) provides quantitative molecular information on humoral immunity. However, Ig-seq is compromised by biases and errors introduced during library preparation and sequencing. By using synthetic antibody spike-in genes, we determined that primer bias from multiplex polymerase chain reaction (PCR) library preparation resulted in antibody frequencies with only 42 to 62% accuracy. Additionally, Ig-seq errors resulted in antibody diversity measurements being overestimated by up to 5000-fold. To rectify this, we developed molecular amplification fingerprinting (MAF), which uses unique molecular identifier (UID) tagging before and during multiplex PCR amplification, which enabled tagging of transcripts while accounting for PCR efficiency. Combined with a bioinformatic pipeline, MAF bias correction led to measurements of antibody frequencies with up to 99% accuracy. We also used MAF to correct PCR and sequencing errors, resulting in enhanced accuracy of full-length antibody diversity measurements, achieving 98 to 100% error correction. Using murine MAF-corrected data, we established a quantitative metric of recent clonal expansion—the intraclonal diversity index—which measures the number of unique transcripts associated with an antibody clone. We used this intraclonal diversity index along with antibody frequencies and somatic hypermutation to build a logistic regression model for prediction of the immunological status of clones. The model was able to predict clonal status with high confidence but only when using MAF error and bias corrected Ig-seq data. Improved accuracy by MAF provides the potential to greatly advance Ig-seq and its utility in immunology and biotechnology. PMID:26998518

Using Partial Genomic Fosmid Libraries for Sequencing CompleteOrganellar Genomes

DOE Office of Scientific and Technical Information (OSTI.GOV)

McNeal, Joel R.; Leebens-Mack, James H.; Arumuganathan, K.

2005-08-26

Organellar genome sequences provide numerous phylogenetic markers and yield insight into organellar function and molecular evolution. These genomes are much smaller in size than their nuclear counterparts; thus, their complete sequencing is much less expensive than total nuclear genome sequencing, making broader phylogenetic sampling feasible. However, for some organisms it is challenging to isolate plastid DNA for sequencing using standard methods. To overcome these difficulties, we constructed partial genomic libraries from total DNA preparations of two heterotrophic and two autotrophic angiosperm species using fosmid vectors. We then used macroarray screening to isolate clones containing large fragments of plastid DNA. Amore » minimum tiling path of clones comprising the entire genome sequence of each plastid was selected, and these clones were shotgun-sequenced and assembled into complete genomes. Although this method worked well for both heterotrophic and autotrophic plants, nuclear genome size had a dramatic effect on the proportion of screened clones containing plastid DNA and, consequently, the overall number of clones that must be screened to ensure full plastid genome coverage. This technique makes it possible to determine complete plastid genome sequences for organisms that defy other available organellar genome sequencing methods, especially those for which limited amounts of tissue are available.« less

Mutations Affecting Expression of the rosy Locus in Drosophila melanogaster

PubMed Central

Lee, Chong Sung; Curtis, Daniel; McCarron, Margaret; Love, Carol; Gray, Mark; Bender, Welcome; Chovnick, Arthur

1987-01-01

The rosy locus in Drosophila melanogaster codes for the enzyme xanthine dehydrogenase (XDH). Previous studies defined a "control element" near the 5' end of the gene, where variant sites affected the amount of rosy mRNA and protein produced. We have determined the DNA sequence of this region from both genomic and cDNA clones, and from the ry+10 underproducer strain. This variant strain had many sequence differences, so that the site of the regulatory change could not be fixed. A mutagenesis was also undertaken to isolate new regulatory mutations. We induced 376 new mutations with 1-ethyl-1-nitrosourea (ENU) and screened them to isolate those that reduced the amount of XDH protein produced, but did not change the properties of the enzyme. Genetic mapping was used to find mutations located near the 5' end of the gene. DNA from each of seven mutants was cloned and sequenced through the 5' region. Mutant base changes were identified in all seven; they appear to affect splicing and translation of the rosy mRNA. In a related study (T. P. Keith et al. 1987), the genomic and cDNA sequences are extended through the 3' end of the gene; the combined sequences define the processing pattern of the rosy transcript and predict the amino acid sequence of XDH. PMID:3036645

Identification of Genes Encoding Conjugated Bile Salt Hydrolase and Transport in Lactobacillus johnsonii 100-100

PubMed Central

Elkins, Christopher A.; Savage, Dwayne C.

1998-01-01

Cytosolic extracts of Lactobacillus johnsonii 100-100 (previously reported as Lactobacillus sp. strain 100-100) contain four heterotrimeric isozymes composed of two peptides, α and β, with conjugated bile salt hydrolase (BSH) activity. We now report cloning, from the genome of strain 100-100, a 2,977-bp DNA segment that expresses BSH activity in Escherichia coli. The sequencing of this segment showed that it contained one complete and two partial open reading frames (ORFs). The 3′ partial ORF (927 nucleotides) was predicted by BLAST and confirmed with 5′ and 3′ deletions to be a BSH gene. Thermal asymmetric interlaced PCR was used to extend and complete the 948-nucleotide sequence of the BSH gene 3′ of the cloned segment. The predicted amino acid sequence of the 5′ partial ORF (651 nucleotides) was about 80% similar to the C-terminal half of the largest, complete ORF (1,353 nucleotides), and these two putative proteins were similar to several amine, multidrug resistance, and sugar transport proteins of the major facilitator superfamily. E. coli DH5α cells transformed with a construct containing these ORFs, in concert with an extracellular factor produced by strain 100-100, demonstrated levels of uptake of [14C]taurocholic acid that were increased as much as threefold over control levels. [14C]Cholic acid was taken up in similar amounts by strain DH5α pSportI (control) and DH5α p2000 (transport clones). These findings support a hypothesis that the ORFs are conjugated bile salt transport genes which may be arranged in an operon with BSH genes. PMID:9721268

Method for introducing unidirectional nested deletions

DOEpatents

Dunn, John J.; Quesada, Mark A.; Randesi, Matthew

2001-01-01

Disclosed is a method for the introduction of unidirectional deletions in a cloned DNA segment in the context of a cloning vector which contains an f1 endonuclease recognition sequence adjacent to the insertion site of the DNA segment. Also disclosed is a method for producing single-stranded DNA probes utilizing the same cloning vector. An optimal vector, PZIP is described. Methods for introducing unidirectional deletions into a terminal location of a cloned DNA sequence which is inserted into the vector of the present invention are also disclosed. These methods are useful for introducing deletions into either or both ends of a cloned DNA insert, for high throughput sequencing of any DNA of interest.

Public health surveillance of multidrug-resistant clones of Neisseria gonorrhoeae in Europe: a genomic survey.

PubMed

Harris, Simon R; Cole, Michelle J; Spiteri, Gianfranco; Sánchez-Busó, Leonor; Golparian, Daniel; Jacobsson, Susanne; Goater, Richard; Abudahab, Khalil; Yeats, Corin A; Bercot, Beatrice; Borrego, Maria José; Crowley, Brendan; Stefanelli, Paola; Tripodo, Francesco; Abad, Raquel; Aanensen, David M; Unemo, Magnus

2018-05-15

Traditional methods for molecular epidemiology of Neisseria gonorrhoeae are suboptimal. Whole-genome sequencing (WGS) offers ideal resolution to describe population dynamics and to predict and infer transmission of antimicrobial resistance, and can enhance infection control through linkage with epidemiological data. We used WGS, in conjunction with linked epidemiological and phenotypic data, to describe the gonococcal population in 20 European countries. We aimed to detail changes in phenotypic antimicrobial resistance levels (and the reasons for these changes) and strain distribution (with a focus on antimicrobial resistance strains in risk groups), and to predict antimicrobial resistance from WGS data. We carried out an observational study, in which we sequenced isolates taken from patients with gonorrhoea from the European Gonococcal Antimicrobial Surveillance Programme in 20 countries from September to November, 2013. We also developed a web platform that we used for automated antimicrobial resistance prediction, molecular typing (N gonorrhoeae multi-antigen sequence typing [NG-MAST] and multilocus sequence typing), and phylogenetic clustering in conjunction with epidemiological and phenotypic data. The multidrug-resistant NG-MAST genogroup G1407 was predominant and accounted for the most cephalosporin resistance, but the prevalence of this genogroup decreased from 248 (23%) of 1066 isolates in a previous study from 2009-10 to 174 (17%) of 1054 isolates in this survey in 2013. This genogroup previously showed an association with men who have sex with men, but changed to an association with heterosexual people (odds ratio=4·29). WGS provided substantially improved resolution and accuracy over NG-MAST and multilocus sequence typing, predicted antimicrobial resistance relatively well, and identified discrepant isolates, mixed infections or contaminants, and multidrug-resistant clades linked to risk groups. To our knowledge, we provide the first use of joint analysis of WGS and epidemiological data in an international programme for regional surveillance of sexually transmitted infections. WGS provided enhanced understanding of the distribution of antimicrobial resistance clones, including replacement with clones that were more susceptible to antimicrobials, in several risk groups nationally and regionally. We provide a framework for genomic surveillance of gonococci through standardised sampling, use of WGS, and a shared information architecture for interpretation and dissemination by use of open access software. The European Centre for Disease Prevention and Control, The Centre for Genomic Pathogen Surveillance, Örebro University Hospital, and Wellcome. Copyright © 2018 The Author(s). Published by Elsevier Ltd. This is an Open Access article under the CC BY 4.0 license. Published by Elsevier Ltd.. All rights reserved.

Cloning, sequencing, and expression of interferon-γ from elk in North America

USGS Publications Warehouse

Sweeney, Steven J.; Emerson, Carlene; Eriks, Inge S.

2001-01-01

Eradication of Mycobacterium bovis relies on accurate detection of infected animals, including potential domestic and wildlife reservoirs. Available diagnostic tests lack the sensitivity and specificity necessary for accurate detection, particularly in infected wildlife populations. Recently, an in vitro diagnostic test for cattle which measures plasma interferon-gamma (IFN-γ) levels in blood following in vitro incubation with M. bovis purified protein derivative has been enveloped. This test appears to have increased sensitivity over traditional testing. Unfortunately, it does not detect IFN-γ from Cervidae. To begin to address this problem, the IFN-γ gene from elk (Cervus elaphus) was cloned, sequenced, expressed, and characterized. cDNA was cloned from mitogen stimulated peripheral blood mononuclear cells. The predicted amino acid (aa) sequence was compared to known sequences from cattle, sheep, goats, red deer (Cervus elaphus), humans, and mice. Biological activity of the recombinant elk IFN-γ (rElkIFN-γ) was confirmed in a vesicular stomatitis virus cytopathic effect reduction assay. Production of monoclonal antibodies to IFN-γ epitopes conserved between ruminant species could provide an important tool for the development of reliable, practical diagnostic assays for detection of a delayed type hypersensitivity response to a variety of persistent infectious agents in ruminants, including M. bovis and Brucella abortus. Moreover, development of these reagents will aid investigators in studies to explore immunological responses of elk that are associated with resistance to infectious diseases.

Environmental and genetic modulation of the phenotypic expression of antibiotic resistance

PubMed Central

Andersson, Dan I

2017-01-01

Abstract Antibiotic resistance can be acquired by mutation or horizontal transfer of a resistance gene, and generally an acquired mechanism results in a predictable increase in phenotypic resistance. However, recent findings suggest that the environment and/or the genetic context can modify the phenotypic expression of specific resistance genes/mutations. An important implication from these findings is that a given genotype does not always result in the expected phenotype. This dissociation of genotype and phenotype has important consequences for clinical bacteriology and for our ability to predict resistance phenotypes from genetics and DNA sequences. A related problem concerns the degree to which the genes/mutations currently identified in vitro can fully explain the in vivo resistance phenotype, or whether there is a significant additional amount of presently unknown mutations/genes (genetic ‘dark matter’) that could contribute to resistance in clinical isolates. Finally, a very important question is whether/how we can identify the genetic features that contribute to making a successful pathogen, and predict why some resistant clones are very successful and spread globally? In this review, we describe different environmental and genetic factors that influence phenotypic expression of antibiotic resistance genes/mutations and how this information is needed to understand why particular resistant clones spread worldwide and to what extent we can use DNA sequences to predict evolutionary success. PMID:28333270

Exploiting long read sequencing technologies to establish high quality highly contiguous pig reference genome assemblies

USDA-ARS?s Scientific Manuscript database

The current pig reference genome sequence (Sscrofa10.2) was established using Sanger sequencing and following the clone-by-clone hierarchical shotgun sequencing approach used in the public human genome project. However, as sequence coverage was low (4-6x) the resulting assembly was only of draft qua...

PyClone: statistical inference of clonal population structure in cancer.

PubMed

Roth, Andrew; Khattra, Jaswinder; Yap, Damian; Wan, Adrian; Laks, Emma; Biele, Justina; Ha, Gavin; Aparicio, Samuel; Bouchard-Côté, Alexandre; Shah, Sohrab P

2014-04-01

We introduce PyClone, a statistical model for inference of clonal population structures in cancers. PyClone is a Bayesian clustering method for grouping sets of deeply sequenced somatic mutations into putative clonal clusters while estimating their cellular prevalences and accounting for allelic imbalances introduced by segmental copy-number changes and normal-cell contamination. Single-cell sequencing validation demonstrates PyClone's accuracy.

Cloning and purification of alpha-neurotoxins from king cobra (Ophiophagus hannah).

PubMed

He, Ying-Ying; Lee, Wei-Hui; Zhang, Yun

2004-09-01

Thirteen complete and three partial cDNA sequences were cloned from the constructed king cobra (Ophiophagus hannah) venom gland cDNA library. Phylogenetic analysis of nucleotide sequences of king cobra with those from other snake venoms revealed that obtained cDNAs are highly homologous to snake venom alpha-neurotoxins. Alignment of deduced mature peptide sequences of the obtained clones with those of other reported alpha-neurotoxins from the king cobra venom indicates that our obtained 16 clones belong to long-chain neurotoxins (seven), short-chain neurotoxins (seven), weak toxin (one) and variant (one), respectively. Up to now, two out of 16 newly cloned king cobra alpha-neurotoxins have identical amino acid sequences with CM-11 and Oh-6A/6B, which have been characterized from the same venom. Furthermore, five long-chain alpha-neurotoxins and two short-chain alpha-neurotoxins were purified from crude venom and their N-terminal amino acid sequences were determined. The cDNAs encoding the putative precursors of the purified native peptide were also determined based on the N-terminal amino acid sequencing. The purified alpha-neurotoxins showed different lethal activities on mice.

Identification and characterization of an early gene in the Lymantria dispar multinucleocapsid nuclear polyhedrosis virus

Treesearch

David S. Bischoff; James M. Slavicek

1995-01-01

The Lymantria dispar multinucleocapsid nuclear polyhedrosis virus (LdMNPV) gene encoding G22 was cloned and sequenced. The G22 gene codes for a 191 amino acid protein with a predicted Mr of 22000. Expression of G22 in a rabbit reticulocyte system generated a protein with an M...

(New hosts and vectors for genome cloning)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Not Available

The main goal of our project remains the development of new bacterial hosts and vectors for the stable propagation of human DNA clones in E. coli. During the past six months of our current budget period, we have (1) continued to develop new hosts that permit the stable maintenance of unstable features of human DNA, and (2) developed a series of vectors for (a) cloning large DNA inserts, (b) assessing the frequency of human sequences that are lethal to the growth of E. coli, and (c) assessing the stability of human sequences cloned in M13 for large-scale sequencing projects.

[New hosts and vectors for genome cloning]. Progress report

DOE Office of Scientific and Technical Information (OSTI.GOV)

Not Available

The main goal of our project remains the development of new bacterial hosts and vectors for the stable propagation of human DNA clones in E. coli. During the past six months of our current budget period, we have (1) continued to develop new hosts that permit the stable maintenance of unstable features of human DNA, and (2) developed a series of vectors for (a) cloning large DNA inserts, (b) assessing the frequency of human sequences that are lethal to the growth of E. coli, and (c) assessing the stability of human sequences cloned in M13 for large-scale sequencing projects.

Amalga-like virus infecting Antonospora locustae, a microsporidian pathogen of grasshoppers, plus related viruses associated with other arthropods.

PubMed

Pyle, Jesse D; Keeling, Patrick J; Nibert, Max L

2017-04-02

A previously reported Expressed Sequence Tag (EST) library from spores of microsporidian Antonospora locustae includes a number of clones with sequence similarities to plant amalgaviruses. Reexamining the sequence accessions from that library, we found additional such clones, contributing to a 3247-nt contig that approximates the length of an amalga-like virus genome. Using A. locustae spores stored from that previous study, and new ones obtained from the same source, we newly visualized the putative dsRNA genome of this virus and obtained amplicons yielding a 3387-nt complete genome sequence. Phylogenetic analyses suggested it as prototype strain of a new genus in family Amalgaviridae. The genome contains two partially overlapping long ORFs, with downstream ORF2 in the +1 frame relative to ORF1 and a proposed motif for +1 ribosomal frameshifting in the region of overlap. Subsequent database searches using the predicted fusion protein sequence of this new amalga-like virus identified related sequences in the transcriptome of a basal hexapod, the springtail species Tetrodontophora bielanensis. We speculate that this second new amalga-like virus (contig length, 3475 nt) likely also derived from a microsporidian, or related organism, which was associated with the springtail specimens at the time of sampling for transcriptome analysis. Other findings of interest include evidence that the ORF1 translation products of these two new amalga-like viruses contain a central region of predicted α-helical coiled coil, as recently reported for plant amalgaviruses, and transcriptome-based evidence for another new amalga-like virus in the transcriptome of another basal hexapod, the two-pronged bristletail species Campodea augens. Copyright © 2017 Elsevier B.V. All rights reserved.

Molecular Cloning and Sequencing of Hemoglobin-Beta Gene of Channel Catfish, Ictalurus Punctatus Rafinesque

USDA-ARS?s Scientific Manuscript database

: Hemoglobin-y gene of channel catfish , lctalurus punctatus, was cloned and sequenced . Total RNA from head kidneys was isolated, reverse transcribed and amplified . The sequence of the channel catfish hemoglobin-y gene consists of 600 nucleotides . Analysis of the nucleotide sequence reveals one o...

Sequencing of cDNA Clones from the Genetic Map of Tomato (Lycopersicon esculentum)

PubMed Central

Ganal, Martin W.; Czihal, Rosemarie; Hannappel, Ulrich; Kloos, Dorothee-U.; Polley, Andreas; Ling, Hong-Qing

1998-01-01

The dense RFLP linkage map of tomato (Lycopersicon esculentum) contains >300 anonymous cDNA clones. Of those clones, 272 were partially or completely sequenced. The sequences were compared at the DNA and protein level to known genes in databases. For 57% of the clones, a significant match to previously described genes was found. The information will permit the conversion of those markers to STS markers and allow their use in PCR-based mapping experiments. Furthermore, it will facilitate the comparative mapping of genes across distantly related plant species by direct comparison of DNA sequences and map positions. [cDNA sequence data reported in this paper have been submitted to the EMBL database under accession nos. AA824695–AA825005 and the dbEST_Id database under accession nos. 1546519–1546862.] PMID:9724330

The Metarhizium anisopliae trp1 gene: cloning and regulatory analysis.

PubMed

Staats, Charley Christian; Silva, Marcia Suzana Nunes; Pinto, Paulo Marcos; Vainstein, Marilene Henning; Schrank, Augusto

2004-07-01

The trp1 gene from the entomopathogenic fungus Metarhizium anisopliae, cloned by heterologous hybridization with the plasmid carrying the trpC gene from Aspergillus nidulans, was sequence characterized. The predicted translation product has the conserved catalytic domains of glutamine amidotransferase (G domain), indoleglycerolphosphate synthase (C domain), and phosphoribosyl anthranilate isomerase (F domain) organized as NH2-G-C-F-COOH. The ORF is interrupted by a single intron of 60 nt that is position conserved in relation to trp genes from Ascomycetes and length conserved in relation to Basidiomycetes species. RT-PCR analysis suggests constitutive expression of trp1 gene in M. anisopliae.

Large inserts for big data: artificial chromosomes in the genomic era.

PubMed

Tocchetti, Arianna; Donadio, Stefano; Sosio, Margherita

2018-05-01

The exponential increase in available microbial genome sequences coupled with predictive bioinformatic tools is underscoring the genetic capacity of bacteria to produce an unexpected large number of specialized bioactive compounds. Since most of the biosynthetic gene clusters (BGCs) present in microbial genomes are cryptic, i.e. not expressed under laboratory conditions, a variety of cloning systems and vectors have been devised to harbor DNA fragments large enough to carry entire BGCs and to allow their transfer in suitable heterologous hosts. This minireview provides an overview of the vectors and approaches that have been developed for cloning large BGCs, and successful examples of heterologous expression.

Genomic organization, sequence characterization and expression analysis of Tenebrio molitor apolipophorin-III in response to an intracellular pathogen, Listeria monocytogenes.

PubMed

Noh, Ju Young; Patnaik, Bharat Bhusan; Tindwa, Hamisi; Seo, Gi Won; Kim, Dong Hyun; Patnaik, Hongray Howrelia; Jo, Yong Hun; Lee, Yong Seok; Lee, Bok Luel; Kim, Nam Jung; Han, Yeon Soo

2014-01-25

Apolipophorin III (apoLp-III) is a well-known hemolymph protein having a functional role in lipid transport and immune response of insects. We cloned full-length cDNA encoding putative apoLp-III from larvae of the coleopteran beetle, Tenebrio molitor (TmapoLp-III), by identification of clones corresponding to the partial sequence of TmapoLp-III, subsequently followed with full length sequencing by a clone-by-clone primer walking method. The complete cDNA consists of 890 nucleotides, including an ORF encoding 196 amino acid residues. Excluding a putative signal peptide of the first 20 amino acid residues, the 176-residue mature apoLp-III has a calculated molecular mass of 19,146Da. Genomic sequence analysis with respect to its cDNA showed that TmapoLp-III was organized into four exons interrupted by three introns. Several immune-related transcription factor binding sites were discovered in the putative 5'-flanking region. BLAST and phylogenetic analyses reveal that TmapoLp-III has high sequence identity (88%) with Tribolium castaneum apoLp-III but shares little sequence homologies (<26%) with other apoLp-IIIs. Homology modeling of Tm apoLp-III shows a bundle of five amphipathic alpha helices, including a short helix 3'. The 'helix-short helix-helix' motif was predicted to be implicated in lipid binding interactions, through reversible conformational changes and accommodating the hydrophobic residues to the exterior for stability. Highest level of TmapoLp-III mRNA was detected at late pupal stages, albeit it is expressed in the larval and adult stages at lower levels. The tissue specific expression of the transcripts showed significantly higher numbers in larval fat body and adult integument. In addition, TmapoLp-III mRNA was found to be highly upregulated in late stages of L. monocytogenes or E. coli challenge. These results indicate that TmapoLp-III may play an important role in innate immune responses against bacterial pathogens in T. molitor. Copyright © 2013 Elsevier B.V. All rights reserved.

Cloning and characterization of the gene for an additional extracellular serine protease of Bacillus subtilis.

PubMed

Sloma, A; Rufo, G A; Theriault, K A; Dwyer, M; Wilson, S W; Pero, J

1991-11-01

We have purified a minor extracellular serine protease from a strain of Bacillus subtilis bearing null mutations in five extracellular protease genes: apr, npr, epr, bpr, and mpr (A. Sloma, C. Rudolph, G. Rufo, Jr., B. Sullivan, K. Theriault, D. Ally, and J. Pero, J. Bacteriol. 172:1024-1029, 1990). During purification, this novel protease (Vpr) was found bound in a complex in the void volume after gel filtration chromatography. The amino-terminal sequence of the purified protein was determined, and an oligonucleotide probe was constructed on the basis of the amino acid sequence. This probe was used to clone the structural gene (vpr) for this protease. The gene encodes a primary product of 806 amino acids. The amino acid sequence of the mature protein was preceded by a signal sequence of approximately 28 amino acids and a prosequence of approximately 132 amino acids. The mature protein has a predicted molecular weight of 68,197; however, the isolated protein has an apparent molecular weight of 28,500, suggesting that Vpr undergoes C-terminal processing or proteolysis. The vpr gene maps in the ctrA-sacA-epr region of the chromosome and is not required for growth or sporulation.

The maize stripe virus major noncapsid protein messenger RNA transcripts contain heterogeneous leader sequences at their 5' termini.

PubMed

Huiet, L; Feldstein, P A; Tsai, J H; Falk, B W

1993-12-01

Primer extension analyses and a PCR-based cloning strategy were used to identify and characterize 5' nucleotide sequences on the maize stripe virus (MStV) RNA4 mRNA transcripts encoding the major noncapsid protein (NCP). Direct RNA sequence analysis by primer extension showed that the NCP mRNA transcripts had 10-15 nucleotides beyond the 5' terminus of the MStV RNA4 nucleotide sequence. MStV genomic RNAs isolated from ribonucleoprotein particles (RNPs) lacked the additional 5' nucleotides. cDNA clones representing the 5' region of the mRNA transcripts were constructed, and the nucleotide sequences of the 5' regions were determined for 16 clones. Each was found to have a distinct 10-15 nucleotide sequence immediately 5' of the MStV RNA4 sequence. Eleven of 16 clones had the correct MStV RNA4 5' nucleotide sequence, while five showed minor variations at or near the 5' most MStV RNA4 nucleotide. These characteristics show strong similarities to other viral mRNA transcripts which are synthesized by cap snatching.

Cloning, expression and N-terminal myristoylation of CpCPK1, a calcium-dependent protein kinase from zucchini (Cucurbita pepo L.).

PubMed

Ellard-Ivey, M; Hopkins, R B; White, T J; Lomax, T L

1999-01-01

We have isolated a full-length cDNA clone (CpCDPK1) encoding a calcium-dependent protein kinase (CDPK) gene from zucchini (Cucurbita pepo L.). The predicted amino acid sequence of the cDNA shows a remarkably high degree of similarity to members of the CDPK gene family from Arabidopsis thaliana, especially AtCPK1 and AtCPK2. Northern analysis of steady-state mRNA levels for CpCPK1 in etiolated and light-grown zucchini seedlings shows that the transcript is most abundant in etiolated hypocotyls and overall expression is suppressed by light. As described for other members of the CDPK gene family from different species, the CpCPK1 clone has a putative N-terminal myristoylation sequence. In this study, site-directed mutagenesis and an in vitro coupled transcription/translation system were used to demonstrate that the protein encoded by this cDNA is specifically myristoylated by a plant N-myristoyl transferase. This is the first demonstration of myristoylation of a CDPK protein which may contribute to the mechanism by which this protein is localized to the plasma membrane.

Gene cloning and characterization of arylamine N-acetyltransferase from Bacillus cereus strain 10-L-2.

PubMed

Takenaka, Shinji; Cheng, Minyi; Mulyono; Koshiya, Atsushi; Murakami, Shuichiro; Aoki, Kenji

2009-01-01

Bacillus cereus strain 10-L-2 synthesizes two arylamine N-acetyltransferases (Nat-a and Nat-b) with broad substrate specificities toward aniline and its derivatives. In southern blot analysis using probes encoding the NH2-terminus of Nat-b and a conserved region of N-acetyltransferases, digested total DNA of strain 10-L-2 showed one positive band. We cloned and sequenced the gene encoding Nat-b. The NH2-terminal amino acid sequence predicted from the open reading frame (768 base pairs) corresponded to that of purified Nat-b. The cloned Nat-b gene was expressed in Escherichia coli. The expressed enzyme (BcNAT) from the recombinant strain was partially purified and characterized. Nat-b from strain 10-L-2 and BcNAT from the recombinant strain were slightly different from each others in substrate specificity and thermo-stability. We examined the biotransformations of 2-aminophenols and phenylenediamines by the whole cells of the recombinant strain. The cells converted these compounds into their corresponding acetanilides. Only one amino group of phenylenediamines was acetylated. The cells utilized 4-nitroacetanilide as an acetyl donor instead of acetyl-CoA. 4-Aminoacetanilide was produced and 4-nitroaniline was released almost stoichiometrically.

Sequencing and characterization of asclepain f: the first cysteine peptidase cDNA cloned and expressed from Asclepias fruticosa latex.

PubMed

Trejo, Sebastián A; López, Laura M I; Caffini, Néstor O; Natalucci, Claudia L; Canals, Francesc; Avilés, Francesc X

2009-07-01

Asclepain f is a papain-like protease previously isolated and characterized from latex of Asclepias fruticosa. This enzyme is a member of the C1 family of cysteine proteases that are synthesized as preproenzymes. The enzyme belongs to the alpha + beta class of proteins, with two disulfide bridges (Cys22-Cys63 and Cys56-Cys95) in the alpha domain, and another one (Cys150-Cys201) in the beta domain, as was determined by molecular modeling. A full-length 1,152 bp cDNA was cloned by RT-RACE-PCR from latex mRNA. The sequence was predicted as an open reading frame of 340 amino acid residues, of which 16 residues belong to the signal peptide, 113 to the propeptide and 211 to the mature enzyme. The full-length cDNA was ligated to pPICZalpha vector and expressed in Pichia pastoris. Recombinant asclepain f showed endopeptidase activity on pGlu-Phe-Leu-p-nitroanilide and was identified by PMF-MALDI-TOF MS. Asclepain f is the first peptidase cloned and expressed from mRNA isolated from plant latex, confirming the presence of the preprocysteine peptidase in the latex.

The Status, Quality, and Expansion of the NIH Full-Length cDNA Project: The Mammalian Gene Collection (MGC)

PubMed Central

2004-01-01

The National Institutes of Health's Mammalian Gene Collection (MGC) project was designed to generate and sequence a publicly accessible cDNA resource containing a complete open reading frame (ORF) for every human and mouse gene. The project initially used a random strategy to select clones from a large number of cDNA libraries from diverse tissues. Candidate clones were chosen based on 5′-EST sequences, and then fully sequenced to high accuracy and analyzed by algorithms developed for this project. Currently, more than 11,000 human and 10,000 mouse genes are represented in MGC by at least one clone with a full ORF. The random selection approach is now reaching a saturation point, and a transition to protocols targeted at the missing transcripts is now required to complete the mouse and human collections. Comparison of the sequence of the MGC clones to reference genome sequences reveals that most cDNA clones are of very high sequence quality, although it is likely that some cDNAs may carry missense variants as a consequence of experimental artifact, such as PCR, cloning, or reverse transcriptase errors. Recently, a rat cDNA component was added to the project, and ongoing frog (Xenopus) and zebrafish (Danio) cDNA projects were expanded to take advantage of the high-throughput MGC pipeline. PMID:15489334

[New hosts and vectors for genome cloning]. Progress report, 1990--1991

DOE Office of Scientific and Technical Information (OSTI.GOV)

Not Available

The main goal of our project remains the development of new bacterial hosts and vectors for the stable propagation of human DNA clones in E. coli. During the past six months of our current budget period, we have (1) continued to develop new hosts that permit the stable maintenance of unstable features of human DNA, and (2) developed a series of vectors for (a) cloning large DNA inserts, (b) assessing the frequency of human sequences that are lethal to the growth of E. coli, and (c) assessing the stability of human sequences cloned in M13 for large-scale sequencing projects.

Cloning and characterization of the Cerasus humilis sucrose phosphate synthase gene (ChSPS1)

PubMed Central

Du, Junjie; Mu, Xiaopeng; Wang, Pengfei

2017-01-01

Sucrose is crucial to the growth and development of plants, and sucrose phosphate synthase (SPS) plays a key role in sucrose synthesis. To understand the genetic and molecular mechanisms of sucrose synthesis in Cerasus humilis, ChSPS1, a homologue of SPS, was cloned using RT-PCR. Sequence analysis showed that the open reading frame (ORF) sequence of ChSPS1 is 3174 bp in length, encoding a predicted protein of 1057 amino acids. The predicted protein showed a high degree of sequence identity with SPS homologues from other species. Real-time RT-PCR analysis showed that ChSPS1 mRNA was detected in all tissues and the transcription level was the highest in mature fruit. There is a significant positive correlation between expression of ChSPS1 and sucrose content. Prokaryotic expression of ChSPS1 indicated that ChSPS1 protein was expressed in E. coli and it had the SPS activity. Overexpression of ChSPS1 in tobacco led to upregulation of enzyme activity and increased sucrose contents in transgenic plants. Real-time RT-PCR analysis showed that the expression of ChSPS1 in transgenic tobacco was significantly higher than in wild type plants. These results suggested that ChSPS1 plays an important role in sucrose synthesis in Cerasus humilis. PMID:29036229

Impact of cultivation on characterisation of species composition of soil bacterial communities.

PubMed

McCaig, A E.; Grayston, S J.; Prosser, J I.; Glover, L A.

2001-03-01

The species composition of culturable bacteria in Scottish grassland soils was investigated using a combination of Biolog and 16S rDNA analysis for characterisation of isolates. The inclusion of a molecular approach allowed direct comparison of sequences from culturable bacteria with sequences obtained during analysis of DNA extracted directly from the same soil samples. Bacterial strains were isolated on Pseudomonas isolation agar (PIA), a selective medium, and on tryptone soya agar (TSA), a general laboratory medium. In total, 12 and 21 morphologically different bacterial cultures were isolated on PIA and TSA, respectively. Biolog and sequencing placed PIA isolates in the same taxonomic groups, the majority of cultures belonging to the Pseudomonas (sensu stricto) group. However, analysis of 16S rDNA sequences proved more efficient than Biolog for characterising TSA isolates due to limitations of the Microlog database for identifying environmental bacteria. In general, 16S rDNA sequences from TSA isolates showed high similarities to cultured species represented in sequence databases, although TSA-8 showed only 92.5% similarity to the nearest relative, Bacillus insolitus. In general, there was very little overlap between the culturable and uncultured bacterial communities, although two sequences, PIA-2 and TSA-13, showed >99% similarity to soil clones. A cloning step was included prior to sequence analysis of two isolates, TSA-5 and TSA-14, and analysis of several clones confirmed that these cultures comprised at least four and three sequence types, respectively. All isolate clones were most closely related to uncultured bacteria, with clone TSA-5.1 showing 99.8% similarity to a sequence amplified directly from the same soil sample. Interestingly, one clone, TSA-5.4, clustered within a novel group comprising only uncultured sequences. This group, which is associated with the novel, deep-branching Acidobacterium capsulatum lineage, also included clones isolated during direct analysis of the same soil and from a wide range of other sample types studied elsewhere. The study demonstrates the value of fine-scale molecular analysis for identification of laboratory isolates and indicates the culturability of approximately 1% of the total population but under a restricted range of media and cultivation conditions.

Characterization of (CA)n microsatellite repeats from large-insert clones.

PubMed

Litt, M; Browne, D

2001-05-01

The most laborious part of developing (CA)n microsatellite repeats as genetic markers is constructing DNA clones to permit determination of sequences flanking the microsatellites. When cosmids or large-insert phage clones are used as primary sources of (CA)n repeat markers, they have traditionally been subcloned into plasmid vectors such as pUC18 or M13 mp 18/19 cloning vectors to obtain fragments of suitable size for DNA sequencing. This unit presents an alternative approach whereby a set of degenerate sequencing primers that anneal directly to (CA)n microsatellites can be used to determine sequences that are inaccessible with vector-derived primers. Because the primers anneal to the repeat and not to the vector, they can be used with subclones containing inserts of several kilobases and should, in theory, always give sequence in the regions directly flanking the repeat. Degeneracy at the 3 end of each of these primers prevents elongation of primers that have annealed out-of-register. The most laborious part of developing (CA)n microsatellite repeats as genetic markers is constructing DNA clones to permit.

Isolation of mini- and microsatellite loci from chromosome 19 library

DOE Office of Scientific and Technical Information (OSTI.GOV)

Prosnyak, M.I.; Belajeva, O.V.; Polukarova, L.G.

Mini- and microsatellite sequences are abundant in the human genome and are very useful as genetic markers. We report the isolation of a panel of clones containing marker sequences from chromosome 19. We screened 10,000 clones from the chromosome 19 cosmid library for the presence of di-(CA)n, tri-(TCC)n, (CAC)n microsatellites and M13-like minisatellite sequences. For this we have used synthetic oligonucleotides and polynucleotides, including micro- (CA, TCC, CAC) and minisatellite (M13 core) sequences. Preliminary results indicated that the chromosome 19 cosmid library contained both human and hamster clones. In order to identify human sequences from this library we have developedmore » the technique of colony and blot hybridization with Alu-PCR, L1-PCR and B1-PCR probes. Dozens of clones have been selected, some of which were analyzed by conventional Southern blot analysis and non-radioactive in situ hybridization of chromosomes. Highly informative markers derived from these clones will be used for physical and genetic mapping of chromosome 19.« less

cDNA, genomic sequence cloning, and overexpression of EIF1 from the giant panda (Ailuropoda Melanoleuca) and the black bear (Ursus Thibetanus Mupinensis).

PubMed

Hou, Wan-ru; Tang, Yun; Hou, Yi-ling; Song, Yan; Zhang, Tian; Wu, Guang-fu

2010-07-01

Eukaryotic initiation factor (eIF) EIF1 is a universally conserved translation factor that is involved in translation initiation site selection. The cDNA and the genomic sequences of EIF1 were cloned successfully from the giant panda (Ailuropoda melanoleuca) and the black bear (Ursus thibetanus mupinensis) using reverse transcription polymerase chain reaction (RT-PCR) technology and touchdown-polymerase chain reaction, respectively. The cDNAs of the EIF1 cloned from the giant panda and the black bear are 418 bp in size, containing an open reading frame (ORF) of 342 bp encoding 113 amino acids. The length of the genomic sequence of the giant panda is 1909 bp, which contains four exons and three introns. The length of the genomic sequence of the black bear is 1897 bp, which also contains four exons and three introns. Sequence alignment indicates a high degree of homology to those of Homo sapiens, Mus musculus, Rattus norvegicus, and Bos Taurus at both amino acid and DNA levels. Topology prediction shows there are one N-glycosylation site, two Casein kinase II phosphorylation sites, and a Amidation site in the EIF1 protein of the giant panda and black bear. In addition, there is a protein kinase C phosphorylation site in EIF1 of the giant panda. The giant panda and the black bear EIF1 genes were overexpressed in E. coli BL21. The results indicated that the both EIF1 fusion proteins with the N-terminally His-tagged form gave rise to the accumulation of two expected 19 kDa polypeptide. The expression products obtained could be used to purify the proteins and study their function further.

Human scFv antibody fragments specific for hepatocellular carcinoma selected from a phage display library.

PubMed

Yu, Bing; Ni, Ming; Li, Wen-Han; Lei, Ping; Xing, Wei; Xiao, Dai-Wen; Huang, Yu; Tang, Zhen-Jie; Zhu, Hui-Fen; Shen, Guan-Xin

2005-07-14

To identify the scFv antibody fragments specific for hepatocellular carcinoma by biopanning from a large human naive scFv phage display library. A large human naive scFv phage library was used to search for the specific targets by biopanning with the hepatocellular carcinoma cell line HepG2 for the positive-selecting and the normal liver cell line L02 for the counter-selecting. After three rounds of biopanning, individual scFv phages binding selectively to HepG2 cells were picked out. PCR was carried out for identification of the clones containing scFv gene sequence. The specific scFv phages were selected by ELISA and flow cytometry. DNA sequences of positive clones were analyzed by using Applied Biosystem Automated DNA sequencers 3 730. The expression proteins of the specific scFv antibody fragments in E.coli HB2151 were purified by the affinity chromatography and detected by SDS-PAGE, Western blot and ELISA. The biological effect of the soluble antibody fragments on the HepG2 cells was investigated by observing the cell proliferation. Two different positive clones were obtained and the functional variable sequences were identified. Their DNA sequences of the scFv antibody fragments were submitted to GenBank (accession nos: AY686498 and AY686499). The soluble scFv antibody fragments were successfully expressed in E.coli HB2151. The relative molecular mass of the expression products was about 36 ku, according to its predicted M(r) value. The two soluble scFv antibody fragments also had specific binding activity and obvious growth inhibition properties to HepG2 cells. The phage library biopanning permits identification of specific antibody fragments for hepatocellular carcinoma and affords experiment evidence for its immunotherapy study.

Rich bacterial assemblages from Maritime Antarctica (Potter Cove, South Shetlands) reveal several kinds of endemic and undescribed phylotypes.

PubMed

Landone Vescovo, Ignacio A; Golemba, Marcelo D; Di Lello, Federico A; Culasso, Andrés C A; Levin, Gustavo; Ruberto, Lucas; Mac Cormack, Walter P; López, José L

2014-01-01

Bacterial richness in maritime Antarctica has been poorly described to date. Phylogenetic affiliation of seawater free-living microbial assemblages was studied from three locations near the Argentinean Jubany Station during two Antarctic summers. Sixty 16S RNA cloned sequences were phylogenetically affiliated to Alphaproteobacteria (30/60 clones), Gammaproteobacteria(19/60 clones), Betaproteobacteria and Cytophaga-Flavobacteriia-Bacteroides (CFB), which were (2/60) and (3/60) respectively. Furthermore, six out of 60 clones could not be classified. Both, Alphaproteobacteria and Gammaproteobacteria, showed several endemic and previously undescribed sequences. Moreover, the absence of Cyanobacteria sequences in our samples is remarkable. In conclusion, we are reporting a rich sequence assemblage composed of widely divergent isolates among themselves and distant from the most closely related sequences currently deposited in data banks. Copyright © 2014 Asociación Argentina de Microbiología. Publicado por Elsevier España. All rights reserved.

Phylogenetic characterization of a biogas plant microbial community integrating clone library 16S-rDNA sequences and metagenome sequence data obtained by 454-pyrosequencing.

PubMed

Kröber, Magdalena; Bekel, Thomas; Diaz, Naryttza N; Goesmann, Alexander; Jaenicke, Sebastian; Krause, Lutz; Miller, Dimitri; Runte, Kai J; Viehöver, Prisca; Pühler, Alfred; Schlüter, Andreas

2009-06-01

The phylogenetic structure of the microbial community residing in a fermentation sample from a production-scale biogas plant fed with maize silage, green rye and liquid manure was analysed by an integrated approach using clone library sequences and metagenome sequence data obtained by 454-pyrosequencing. Sequencing of 109 clones from a bacterial and an archaeal 16S-rDNA amplicon library revealed that the obtained nucleotide sequences are similar but not identical to 16S-rDNA database sequences derived from different anaerobic environments including digestors and bioreactors. Most of the bacterial 16S-rDNA sequences could be assigned to the phylum Firmicutes with the most abundant class Clostridia and to the class Bacteroidetes, whereas most archaeal 16S-rDNA sequences cluster close to the methanogen Methanoculleus bourgensis. Further sequences of the archaeal library most probably represent so far non-characterised species within the genus Methanoculleus. A similar result derived from phylogenetic analysis of mcrA clone sequences. The mcrA gene product encodes the alpha-subunit of methyl-coenzyme-M reductase involved in the final step of methanogenesis. BLASTn analysis applying stringent settings resulted in assignment of 16S-rDNA metagenome sequence reads to 62 16S-rDNA amplicon sequences thus enabling frequency of abundance estimations for 16S-rDNA clone library sequences. Ribosomal Database Project (RDP) Classifier processing of metagenome 16S-rDNA reads revealed abundance of the phyla Firmicutes, Bacteroidetes and Euryarchaeota and the orders Clostridiales, Bacteroidales and Methanomicrobiales. Moreover, a large fraction of 16S-rDNA metagenome reads could not be assigned to lower taxonomic ranks, demonstrating that numerous microorganisms in the analysed fermentation sample of the biogas plant are still unclassified or unknown.

Molecular and functional characterization of the first tick CAP2b (periviscerokinin) receptor from Rhipicephalus (Boophilus) microplus

USDA-ARS?s Scientific Manuscript database

The cDNA of the receptor for CAP2b/periviscerokinin (PVK) neuropeptides, designated Rhimi-CAP2b-R, was cloned from synganglia of tick Rhipicephalus (Boophilus) microplus. This receptor is the ortholog of the insect CAP2b/PVK receptor, as concluded from analyses of the predicted protein sequence, ph...

Characterization of the Lymantria dispar nucleopolyhedrovirus 25K FP gene

Treesearch

David S. Bischoff; James M. Slavicek

1996-01-01

The Lymantria dispar nucleopolyhedrovirus (LdMNPV) gene encoding the 25K FP protein has been cloned and sequenced. The 25KFP gene codes for a 217 amino acid protein with a predicted molecular mass of 24870 Da. Expression of the 25K FP protein in a rabbit reticulocyte system generated a 27 kDa protein, in close agreement with the...

Structure and Biochemestry of Laccases from the Lignin-Degrading Basidiomycete, Ganoderma lucidum

DOE Office of Scientific and Technical Information (OSTI.GOV)

C.A.Reddy, PI

2005-06-30

G. lucidum is one of the most important and widely distributed ligninolytic white rot fungi from habitats such as forest soils, agricultural soils, and tropical mangrove ecosystems and produce laccases as an important family of lignin modifying enzymes. Biochemically, laccases are blue multi copper oxidases that couple four electron reduction of molecular oxygen to water. There is a growing interest in the use of laccases for a variety of industrial applications such as bio-pulping and biobleaching as well as in their ability to detoxify a wide variety of toxic environmental pollutants. These key oxidative enzymes are found in all themore » three domains of life: Eukaryota. Prokarya, and Archaea. Ganoderma lucidum (strain no.103561) produces laccase with some of the highest activity (17,000 micro katals per mg of protein) reported for any laccases to date. Our results showed that this organism produces at least 11 different isoforms of laccase based on variation in mol. weight and/or PI. Our Studies showed that the presence of copper in the medium yields 15- to 20-fold greater levels of enzyme by G. lucidum. Dialysation of extra cellular fluid of G. lucidum against 10mM sodium tartrate (pH5.5) gave an additional 15 to 17 fold stimulation of activity with an observed specific activity of 17,000 {micro}katals/mg protein. Dialysis against acetate buffer gave five fold increase in activity while dialysis against glycine showed inhibition of activity. Purification by FPLC and preparative gel electrophoresis gave purified fractions that resolved into eleven isoforms as separated by isoelectric focusing, and the PI,s were 4.7, 4.6, 4.5, 4.3, 4.2, 4.1, 3.8, 3.7, 3.5, 3.4 and 3.3. Genomic clones of laccase were isolated using G. lucidum DNA as a template and using inverse PCR and forward/reverse primers corresponding to the sequences of the conserved copper binding region in the N-terminal domain of one of the laccases of this organism. Inverse PCR amplication of HindIII digested and ligated G.lucidum DNA was done using ABI Geneamp XL PCR kit in Ribocycler. The 5 conserved copper binding region of laccase was used for designing forward primer (5TCGACAATTCTTTCCTGTACG3) and reverse primer (5 TGGAGATGGG ACACT GGCTTATC 3). The PCR profile was 95 C for 3min, 94 C for 1min, 57 C for 30 sec and 68 C for 5min. for 30 cycles, and the final extension was at 72 C for 10min. The resulting {approx}2.7 Kb inverse PCR fragment was cloned into ZERO TOPOII blunt ligation vector (INVITROGEN) and screened on Kanamycin plates. Selected putative clones containing inserts were digested with a battery of restriction enzymes and analyzed on 1% agarose gels. Restriction digestion of these clones with BamHI, PstI, SalI, PvuII, EcoRI, and XhoI revealed 8 distinct patterns suggesting gene diversity. Two clones were sequenced using overlapping primers on ABI system. The sequences were aligned using Bioedit program. The aa sequences of the clones were deduced by Genewise2 program using Aspergillus as the reference organism. Eukaryotic gene regulatory sequences were identified using GeneWise2 Program. Laccase sequence alignments and similarity indexes were calculated using ClustalW and BioEdit programs. Blast analysis of two distinct BamHI clones, lac1 and lac4, showed that the proteins encoded by these clones are fungal laccase sequences. The coding sequence of lac1gene is interrupted by 6 introns ranging in size from 37-55 nt and encodes a mature protein consisting of 456 aa (Mr: 50,160), preceded by a putative 37-aa signal sequence. This predicted Mr is in agreement with the range of Mrs previously reported by us for the laccases of G. lucidum. The deduced aa sequence of LAC1 showed relatively high degree of homology with laccases of other basidiomycetes. It showed 96% homology to full-length LAC4 protein and 47-53% similarity to unpublished partial laccase sequences of other G. lucidum strains. Among the other basidiomycete laccases, LAC1 showed the highest similarity of 53-55% to Trametes versicolorLAC3 and LAC4. The consensus copper-binding domains found in other basidiomycete laccases are conserved in the LAC1 protein of G.lucidum. Eight putative N-glycosylation sites as well as consensus eukaryotic promoter sequence and polyadenylation signal sequences are also found. Coding sequence of lac4 is interrupted by 7 introns, encodes a mature protein of 525aa (Mr: 57,750), and has 98% nt homology to lac1, but was otherwise identical. Molecular masses of GLAC1 and GLAC4 were 49.8 kDa (462aa) and 52.5 kDa (524aa) in comparison to T. versicolr laccase which was 56.3 kDa (524aa). Predicted PI values of GLAC1, GLAC4 and T. versicolor laccase are, respectively 4.5, 4.7, and 4.2. Eight other laccase clones, distinct from lac1 and lac4 have recently been isolated from G. lucidum Our results show the existence of a laccase multi-gene family in G. lucidum in agreement with our earlier results showing multiple isoforms of laccase in this organism.« less

Identification of an additional member of the protein-tyrosine-phosphatase family: evidence for alternative splicing in the tyrosine phosphatase domain.

PubMed Central

Matthews, R J; Cahir, E D; Thomas, M L

1990-01-01

Protein-tyrosine-phosphatases (protein-tyrosine-phosphate phosphohydrolase, EC 3.13.48) have been implicated in the regulation of cell growth; however, to date few tyrosine phosphatases have been characterized. To identify additional family members, the cDNA for the human tyrosine phosphatase leukocyte common antigen (LCA; CD45) was used to screen, under low stringency, a mouse pre-B-cell cDNA library. Two cDNA clones were isolated and sequence analysis predicts a protein sequence of 793 amino acids. We have named the molecule LRP (LCA-related phosphatase). RNA transfer analysis indicates that the cDNAs were derived from a 3.2-kilobase mRNA. The LRP mRNA is transcribed in a wide variety of tissues. The predicted protein structure can be divided into the following structural features: a short 19-amino acid leader sequence, an exterior domain of 123 amino acids that is predicted to be highly glycosylated, a 24-amino acid membrane-spanning region, and a 627-amino acid cytoplasmic region. The cytoplasmic region contains two approximately 260-amino acid domains, each with homology to the tyrosine phosphatase family. One of the cDNA clones differed in that it had a 108-base-pair insertion that, while preserving the reading frame, would disrupt the first protein-tyrosine-phosphatase domain. Analysis of genomic DNA indicates that the insertion is due to an alternatively spliced exon. LRP appears to be evolutionarily conserved as a putative homologue has been identified in the invertebrate Styela plicata. Images PMID:2162042

WebPrInSeS: automated full-length clone sequence identification and verification using high-throughput sequencing data.

PubMed

Massouras, Andreas; Decouttere, Frederik; Hens, Korneel; Deplancke, Bart

2010-07-01

High-throughput sequencing (HTS) is revolutionizing our ability to obtain cheap, fast and reliable sequence information. Many experimental approaches are expected to benefit from the incorporation of such sequencing features in their pipeline. Consequently, software tools that facilitate such an incorporation should be of great interest. In this context, we developed WebPrInSeS, a web server tool allowing automated full-length clone sequence identification and verification using HTS data. WebPrInSeS encompasses two separate software applications. The first is WebPrInSeS-C which performs automated sequence verification of user-defined open-reading frame (ORF) clone libraries. The second is WebPrInSeS-E, which identifies positive hits in cDNA or ORF-based library screening experiments such as yeast one- or two-hybrid assays. Both tools perform de novo assembly using HTS data from any of the three major sequencing platforms. Thus, WebPrInSeS provides a highly integrated, cost-effective and efficient way to sequence-verify or identify clones of interest. WebPrInSeS is available at http://webprinses.epfl.ch/ and is open to all users.

WebPrInSeS: automated full-length clone sequence identification and verification using high-throughput sequencing data

PubMed Central

Massouras, Andreas; Decouttere, Frederik; Hens, Korneel; Deplancke, Bart

2010-01-01

High-throughput sequencing (HTS) is revolutionizing our ability to obtain cheap, fast and reliable sequence information. Many experimental approaches are expected to benefit from the incorporation of such sequencing features in their pipeline. Consequently, software tools that facilitate such an incorporation should be of great interest. In this context, we developed WebPrInSeS, a web server tool allowing automated full-length clone sequence identification and verification using HTS data. WebPrInSeS encompasses two separate software applications. The first is WebPrInSeS-C which performs automated sequence verification of user-defined open-reading frame (ORF) clone libraries. The second is WebPrInSeS-E, which identifies positive hits in cDNA or ORF-based library screening experiments such as yeast one- or two-hybrid assays. Both tools perform de novo assembly using HTS data from any of the three major sequencing platforms. Thus, WebPrInSeS provides a highly integrated, cost-effective and efficient way to sequence-verify or identify clones of interest. WebPrInSeS is available at http://webprinses.epfl.ch/ and is open to all users. PMID:20501601

Isolation and sequence of partial cDNA clones of human L1: homology of human and rodent L1 in the cytoplasmic region.

PubMed

Harper, J R; Prince, J T; Healy, P A; Stuart, J K; Nauman, S J; Stallcup, W B

1991-03-01

We have isolated cDNA clones coding for the human homologue of the neuronal cell adhesion molecule L1. The nucleotide sequence of the cDNA clones and the deduced primary amino acid sequence of the carboxy terminal portion of the human L1 are homologous to the corresponding sequences of mouse L1 and rat NILE glycoprotein, with an especially high sequences identity in the cytoplasmic regions of the proteins. There is also protein sequence homology with the cytoplasmic region of the Drosophila cell adhesion molecule, neuroglian. The conservation of the cytoplasmic domain argues for an important functional role for this portion of the molecule.

Cloning and sequencing of an alkaline protease gene from Bacillus lentus and amplification of the gene on the B. lentus chromosome by an improved technique.

PubMed

Jørgensen, P L; Tangney, M; Pedersen, P E; Hastrup, S; Diderichsen, B; Jørgensen, S T

2000-02-01

A gene encoding an alkaline protease was cloned from an alkalophilic bacillus, and its nucleotide sequence was determined. The cloned gene was used to increase the copy number of the protease gene on the chromosome by an improved gene amplification technique.

SNP discovery by high-throughput sequencing in soybean

PubMed Central

2010-01-01

Background With the advance of new massively parallel genotyping technologies, quantitative trait loci (QTL) fine mapping and map-based cloning become more achievable in identifying genes for important and complex traits. Development of high-density genetic markers in the QTL regions of specific mapping populations is essential for fine-mapping and map-based cloning of economically important genes. Single nucleotide polymorphisms (SNPs) are the most abundant form of genetic variation existing between any diverse genotypes that are usually used for QTL mapping studies. The massively parallel sequencing technologies (Roche GS/454, Illumina GA/Solexa, and ABI/SOLiD), have been widely applied to identify genome-wide sequence variations. However, it is still remains unclear whether sequence data at a low sequencing depth are enough to detect the variations existing in any QTL regions of interest in a crop genome, and how to prepare sequencing samples for a complex genome such as soybean. Therefore, with the aims of identifying SNP markers in a cost effective way for fine-mapping several QTL regions, and testing the validation rate of the putative SNPs predicted with Solexa short sequence reads at a low sequencing depth, we evaluated a pooled DNA fragment reduced representation library and SNP detection methods applied to short read sequences generated by Solexa high-throughput sequencing technology. Results A total of 39,022 putative SNPs were identified by the Illumina/Solexa sequencing system using a reduced representation DNA library of two parental lines of a mapping population. The validation rates of these putative SNPs predicted with low and high stringency were 72% and 85%, respectively. One hundred sixty four SNP markers resulted from the validation of putative SNPs and have been selectively chosen to target a known QTL, thereby increasing the marker density of the targeted region to one marker per 42 K bp. Conclusions We have demonstrated how to quickly identify large numbers of SNPs for fine mapping of QTL regions by applying massively parallel sequencing combined with genome complexity reduction techniques. This SNP discovery approach is more efficient for targeting multiple QTL regions in a same genetic population, which can be applied to other crops. PMID:20701770

Targeting a Complex Transcriptome: The Construction of the Mouse Full-Length cDNA Encyclopedia

PubMed Central

Carninci, Piero; Waki, Kazunori; Shiraki, Toshiyuki; Konno, Hideaki; Shibata, Kazuhiro; Itoh, Masayoshi; Aizawa, Katsunori; Arakawa, Takahiro; Ishii, Yoshiyuki; Sasaki, Daisuke; Bono, Hidemasa; Kondo, Shinji; Sugahara, Yuichi; Saito, Rintaro; Osato, Naoki; Fukuda, Shiro; Sato, Kenjiro; Watahiki, Akira; Hirozane-Kishikawa, Tomoko; Nakamura, Mari; Shibata, Yuko; Yasunishi, Ayako; Kikuchi, Noriko; Yoshiki, Atsushi; Kusakabe, Moriaki; Gustincich, Stefano; Beisel, Kirk; Pavan, William; Aidinis, Vassilis; Nakagawara, Akira; Held, William A.; Iwata, Hiroo; Kono, Tomohiro; Nakauchi, Hiromitsu; Lyons, Paul; Wells, Christine; Hume, David A.; Fagiolini, Michela; Hensch, Takao K.; Brinkmeier, Michelle; Camper, Sally; Hirota, Junji; Mombaerts, Peter; Muramatsu, Masami; Okazaki, Yasushi; Kawai, Jun; Hayashizaki, Yoshihide

2003-01-01

We report the construction of the mouse full-length cDNA encyclopedia,the most extensive view of a complex transcriptome,on the basis of preparing and sequencing 246 libraries. Before cloning,cDNAs were enriched in full-length by Cap-Trapper,and in most cases,aggressively subtracted/normalized. We have produced 1,442,236 successful 3′-end sequences clustered into 171,144 groups, from which 60,770 clones were fully sequenced cDNAs annotated in the FANTOM-2 annotation. We have also produced 547,149 5′ end reads,which clustered into 124,258 groups. Altogether, these cDNAs were further grouped in 70,000 transcriptional units (TU),which represent the best coverage of a transcriptome so far. By monitoring the extent of normalization/subtraction, we define the tentative equivalent coverage (TEC),which was estimated to be equivalent to >12,000,000 ESTs derived from standard libraries. High coverage explains discrepancies between the very large numbers of clusters (and TUs) of this project,which also include non-protein-coding RNAs,and the lower gene number estimation of genome annotations. Altogether,5′-end clusters identify regions that are potential promoters for 8637 known genes and 5′-end clusters suggest the presence of almost 63,000 transcriptional starting points. An estimate of the frequency of polyadenylation signals suggests that at least half of the singletons in the EST set represent real mRNAs. Clones accounting for about half of the predicted TUs await further sequencing. The continued high-discovery rate suggests that the task of transcriptome discovery is not yet complete. PMID:12819125

New Approaches to Attenuated Hepatitis a Vaccine Development: Cloning and Sequencing of Cell-Culture Adapted Viral cDNA.

DTIC Science & Technology

1987-10-13

after multiple passages in vivo and in vitro. J. Gen. Virol. 67, 1741- 1744. Sabin , A.B. (1985). Oral poliovirus vaccine : history of its development...IN (N NEW APPROACHES TO ATTENUATED HEPATITIS A VACCINE DEVELOPMENT: Q) CLONING AND SEQUENCING OF CELL-CULTURE ADAPTED VIRAL cDNA I ANNUAL REPORT...6ll02Bsl0 A 055 11. TITLE (Include Security Classification) New Approaches to Attenuated Hepatitis A Vaccine Development: Cloning and Sequencing of Cell

Molecular cloning, sequence characterization and recombinant expression of Nanog gene in goat fibroblast cells using lentiviral based expression system.

PubMed

Singhal, Dinesh K; Singhal, Raxita; Malik, Hruda N; Kumar, Surender; Kumar, Sudarshan; Mohanty, Ashok K; Kaushik, Jai K; Malakar, Dhruba

2014-01-01

Nanog is a homeodomain containing protein which plays important roles in regulation of signaling pathways for maintenance and induction of pluripotency in stem cells. Because of its unique expression in stem cells it is also regarded as pluripotency marker. In this study goat Nanog (gNanog) gene has been amplified, cloned and characterized at sequence level with successful over-expression in CHO-K1 cell line using a lentiviral based system. gNanog ORF is 903 bp long which codes for Nanog protein of size 300 amino acids (aas). Complete nucleotide sequence shows some evolutionary mutation in goat in comparision to other species. Protein sequence of goat is highly similar to other species. Overall, gNanog nucleotide sequence and predicted protein sequence showed high similarity and minimum divergence with cattle (96 % identity/4 % divergence) and buffalo (94/5 %) while low similarity and high divergence with pig (84/15 %), human (81/23 %) and mouse (69/40 %) indicating evolutionary closeness of gNanog to cattle and buffalo. gNanog lentiviral expression construct was prepared for over-expression of Nanog gene in adult goat fibroblast cells. Lentiviral expression construct of Nanog enabled continuous protein expression for induction and maintenance of pluripotency. Western blotting revealed the expression of Nanog gene at protein level which supported that the lentiviral expression system is highly promising for Nanog protein expression in differentiated goat cell.

Molecular cloning, expression pattern, and 3D structural prediction of the cold inducible RNA-binding protein (CIRP) in Japanese flounder ( Paralichthys olivaceus)

NASA Astrophysics Data System (ADS)

Yang, Xiao; Gao, Jinning; Ma, Liman; Li, Zan; Wang, Wenji; Wang, Zhongkai; Yu, Haiyang; Qi, Jie; Wang, Xubo; Wang, Zhigang; Zhang, Quanqi

2015-02-01

Cold-inducible RNA-binding protein (CIRP) is a kind of RNA binding proteins that plays important roles in many physiological processes. The CIRP has been widely studied in mammals and amphibians since it was first cloned from mammals. On the contrary, there are little reports in teleosts. In this study, the Po CIRP gene of the Japanese flounder was cloned and sequenced. The genomic sequence consists of seven exons and six introns. The putative PoCIRP protein of flounder was 198 amino acid residues long containing the RNA recognition motif (RRM). Phylogenetic analysis showed that the flounder PoCIRP is highly conserved with other teleost CIRPs. The 5' flanking sequence was cloned by genome walking and many transcription factor binding sites were identified. There is a CpGs region located in promoter and exon I region and the methylation state is low. Quantitative real-time PCR analysis uncovered that Po CIRP gene was widely expressed in adult tissues with the highest expression level in the ovary. The mRNA of the Po CIRP was maternally deposited and the expression level of the gene was regulated up during the gastrula and neurula stages. In order to gain the information how the protein interacts with mRNA, we performed the modeling of the 3D structure of the flounder PoCIRP. The results showed a cleft existing the surface of the molecular. Taken together, the results indicate that the CIRP is a multifunctional molecular in teleosts and the findings about the structure provide valuable information for understanding the basis of this protein's function.

Molecular cloning and chromosomal localization of a pseudogene related to the human Acyl-CoA binding protein/diazepam binding inhibitor

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gersuk, V.H.; Rose, T.M.; Todaro, G.J.

The acyl-CoA binding protein (ACBP) and the diazepam binding inhibitor (DBI) or endozepine are independent isolates of a single 86-amino-acid, 10-kDa protein. ACBP/DBI is highly conserved between species and has been identified in several diverse organisms, including human, cow, rat, frog, duck, insects, plants, and yeast. Although the genomic locus has not yet been cloned in humans, complementary DNA clones with different 5{prime} ends have been isolated and characterized. These cDNA clones appear to be encoded by a single gene. However, Southern blot analyses, in situ hybridizations, and somatic cell hybrid chromosomal mapping all suggest that there are multiple ACBP/DBI-relatedmore » sequences in the genome. To identify potential members of this gene family, degenerate oligonucleotides corresponding to highly conserved regions of ACBP/DBI were used to screen a human genomic DNA library using the polymerase chain reaction. A novel gene, DBIP1, that is closely related to ACBP/DBI but is clearly distinct was identified. DBIP1 bears extensive sequence homology to ACBP/DBI but lacks the introns predicted by rat and duck genomic sequence studies. A 1-base deletion in the coding region results in a frameshift and, along with the absence of introns and the lack of a detectable transcript, suggests that DBIP1 is a pseudogene. ACBP/DBI has previously been mapped to chromosome 2, although this was recently disputed, and a chromosome 6 location was suggested. We show that ACBP/DBI is correctly placed on chromosome 2 and that the gene identified on chromosome 6 is DBIP1. 33 refs., 3 figs., 1 tab.« less

Cloning, sequencing and characterization of lipase genes from a polyhydroxyalkanoate- (PHA-) synthesizing Pseudomonas resinovorans

USDA-ARS?s Scientific Manuscript database

Lipase (lip) and lipase-specific foldase (lif) genes of a biodegradable polyhydroxyalkanoate- (PHA-) synthesizing Pseudomonas resinovorans NRRL B-2649 were cloned using primers based on consensus sequences, followed by PCR-based genome walking. Sequence analyses showed a putative Lip gene-product (...

Targeted mutagenesis of dengue virus type 2 replicon RNA by yeast in vivo recombination.

PubMed

Manzano, Mark; Padmanabhan, Radhakrishnan

2014-01-01

The use of cDNA infectious clones or subgenomic replicons is indispensable in studying flavivirus biology. Mutating nucleotides or amino acid residues gives important clues to their function in the viral life cycle. However, a major challenge to the establishment of a reverse genetics system for flaviviruses is the instability of their nucleotide sequences in Escherichia coli. Thus, direct cloning using conventional restriction enzyme-based procedures usually leads to unwanted rearrangements of the construct. In this chapter, we discuss a cloning strategy that bypasses traditional cloning procedures. We take advantage of the observations from previous studies that (1) unstable sequences in bacteria can be cloned in eukaryotic systems and (2) Saccharomyces cerevisiae has a well-studied genetics system to introduce sequences using homologous recombination. We describe a protocol to perform targeted mutagenesis in a subgenomic dengue virus 2 replicon. Our method makes use of homologous recombination in yeast using a linearized replicon and a PCR product containing the desired mutation. Constructs derived from this method can be propagated in E. coli with improved stability. Thus, yeast in vivo recombination provides an excellent strategy to genetically engineer flavivirus infectious clones or replicons because this system is compatible with inherently unstable sequences of flaviviruses and is not restricted by the limitations of traditional cloning procedures.

Expression cloning of a gibberellin 20-oxidase, a multifunctional enzyme involved in gibberellin biosynthesis.

PubMed Central

Lange, T; Hedden, P; Graebe, J E

1994-01-01

In the biosynthetic pathway to the gibberellins (GAs), carbon-20 is removed by oxidation to give the C19-GAs, which include the biologically active plant hormones. We report the isolation of a cDNA clone encoding a GA 20-oxidase [gibberellin, 2-oxoglutarate:oxygen oxidoreductase (20-hydroxylating, oxidizing) EC 1.14.11.-] by screening a cDNA library from developing cotyledons of pumpkin (Cucurbita maxima L.) for expression of this enzyme. When mRNA from either the cotyledons or the endosperm was translated in vitro using rabbit reticulocyte lysates, the products contained GA12 20-oxidase activity. A polyclonal antiserum was raised against the amino acid sequence of a peptide released by tryptic digestion of purified GA 20-oxidase from the endosperm. A cDNA expression library in lambda gt11 was prepared from cotyledon mRNA and screened with the antiserum. The identity of positive clones was confirmed by the demonstration of GA12 20-oxidase activity in single bacteriophage plaques. Recombinant protein from a selected clone catalyzed the three-step conversions of GA12 to GA25 and of GA53 to GA17, as well as the formation of the C19-GAs, GA1, GA9, and GA20, from their respective aldehyde precursors, GA23, GA24, and GA19. The nucleotide sequence of the cDNA insert contains an open reading frame of 1158 nt encoding a protein of 386 amino acid residues. The predicted M(r) (43,321) and pI (5.3) are similar to those determined experimentally for the native GA 20-oxidase. Furthermore, the derived amino acid sequence includes sequences obtained from the N terminus and two tryptic peptides from the native enzyme. It also contains regions that are highly conserved in a group of non-heme Fe-containing dioxygenases. Images PMID:8078921

Nitrous Oxide Reductase (nosZ) Gene Fragments Differ between Native and Cultivated Michigan Soils

PubMed Central

Stres, Blaž; Mahne, Ivan; Avguštin, Gorazd; Tiedje, James M.

2004-01-01

The effect of standard agricultural management on the genetic heterogeneity of nitrous oxide reductase (nosZ) fragments from denitrifying prokaryotes in native and cultivated soil was explored. Thirty-six soil cores were composited from each of the two soil management conditions. nosZ gene fragments were amplified from triplicate samples, and PCR products were cloned and screened by restriction fragment length polymorphism (RFLP). The total nosZ RFLP profiles increased in similarity with soil sample size until triplicate 3-g samples produced visually identical RFLP profiles for each treatment. Large differences in total nosZ profiles were observed between the native and cultivated soils. The fragments representing major groups of clones encountered at least twice and four randomly selected clones with unique RFLP patterns were sequenced to verify nosZ identity. The sequence diversity of nosZ clones from the cultivated field was higher, and only eight patterns were found in clone libraries from both soils among the 182 distinct nosZ RFLP patterns identified from the two soils. A group of clones that comprised 32% of all clones dominated the gene library of native soil, whereas many minor groups were observed in the gene library of cultivated soil. The 95% confidence intervals of the Chao1 nonparametric richness estimator for nosZ RFLP data did not overlap, indicating that the levels of species richness are significantly different in the two soils, the cultivated soil having higher diversity. Phylogenetic analysis of deduced amino acid sequences grouped the majority of nosZ clones into an interleaved Michigan soil cluster whose cultured members are α-Proteobacteria. Only four nosZ sequences from cultivated soil and one from the native soil were related to sequences found in γ-Proteobacteria. Sequences from the native field formed a distinct, closely related cluster (Dmean = 0.16) containing 91.6% of the native clones. Clones from the cultivated field were more distantly related to each other (Dmean = 0.26), and 65% were found outside of the cluster from the native soil, further indicating a difference in the two communities. Overall, there appears to be a relationship between use and richness, diversity, and the phylogenetic position of nosZ sequences, indicating that agricultural use of soil caused a shift to a more diverse denitrifying community. PMID:14711656

Comparative genomics of Lupinus angustifolius gene-rich regions: BAC library exploration, genetic mapping and cytogenetics

PubMed Central

2013-01-01

Background The narrow-leafed lupin, Lupinus angustifolius L., is a grain legume species with a relatively compact genome. The species has 2n = 40 chromosomes and its genome size is 960 Mbp/1C. During the last decade, L. angustifolius genomic studies have achieved several milestones, such as molecular-marker development, linkage maps, and bacterial artificial chromosome (BAC) libraries. Here, these resources were integratively used to identify and sequence two gene-rich regions (GRRs) of the genome. Results The genome was screened with a probe representing the sequence of a microsatellite fragment length polymorphism (MFLP) marker linked to Phomopsis stem blight resistance. BAC clones selected by hybridization were subjected to restriction fingerprinting and contig assembly, and 232 BAC-ends were sequenced and annotated. BAC fluorescence in situ hybridization (BAC-FISH) identified eight single-locus clones. Based on physical mapping, cytogenetic localization, and BAC-end annotation, five clones were chosen for sequencing. Within the sequences of clones that hybridized in FISH to a single-locus, two large GRRs were identified. The GRRs showed strong and conserved synteny to Glycine max duplicated genome regions, illustrated by both identical gene order and parallel orientation. In contrast, in the clones with dispersed FISH signals, more than one-third of sequences were transposable elements. Sequenced, single-locus clones were used to develop 12 genetic markers, increasing the number of L. angustifolius chromosomes linked to appropriate linkage groups by five pairs. Conclusions In general, probes originating from MFLP sequences can assist genome screening and gene discovery. However, such probes are not useful for positional cloning, because they tend to hybridize to numerous loci. GRRs identified in L. angustifolius contained a low number of interspersed repeats and had a high level of synteny to the genome of the model legume G. max. Our results showed that not only was the gene nucleotide sequence conserved between soybean and lupin GRRs, but the order and orientation of particular genes in syntenic blocks was homologous, as well. These findings will be valuable to the forthcoming sequencing of the lupin genome. PMID:23379841

Molecular cloning and characterization of chitinase genes from Candida albicans.

PubMed

McCreath, K J; Specht, C A; Robbins, P W

1995-03-28

Chitinase (EC 3.2.1.14) is an important enzyme for the remodeling of chitin in the cell wall of fungi. We have cloned three chitinase genes (CHT1, CHT2, and CHT3) from the dimorphic human pathogen Candida albicans. CHT2 and CHT3 have been sequenced in full and their primary structures have been analyzed: CHT2 encodes a protein of 583 aa with a predicted size of 60.8 kDa; CHT3 encodes a protein of 567 aa with a predicted size of 60 kDa. All three genes show striking similarity to other chitinase genes in the literature, especially in the proposed catalytic domain. Transcription of CHT2 and CHT3 was greater when C. albicans was grown in a yeast phase as compared to a mycelial phase. A transcript of CHT1 could not be detected in either growth condition.

Genotypic tropism testing by massively parallel sequencing: qualitative and quantitative analysis.

PubMed

Däumer, Martin; Kaiser, Rolf; Klein, Rolf; Lengauer, Thomas; Thiele, Bernhard; Thielen, Alexander

2011-05-13

Inferring viral tropism from genotype is a fast and inexpensive alternative to phenotypic testing. While being highly predictive when performed on clonal samples, sensitivity of predicting CXCR4-using (X4) variants drops substantially in clinical isolates. This is mainly attributed to minor variants not detected by standard bulk-sequencing. Massively parallel sequencing (MPS) detects single clones thereby being much more sensitive. Using this technology we wanted to improve genotypic prediction of coreceptor usage. Plasma samples from 55 antiretroviral-treated patients tested for coreceptor usage with the Monogram Trofile Assay were sequenced with standard population-based approaches. Fourteen of these samples were selected for further analysis with MPS. Tropism was predicted from each sequence with geno2pheno[coreceptor]. Prediction based on bulk-sequencing yielded 59.1% sensitivity and 90.9% specificity compared to the trofile assay. With MPS, 7600 reads were generated on average per isolate. Minorities of sequences with high confidence in CXCR4-usage were found in all samples, irrespective of phenotype. When using the default false-positive-rate of geno2pheno[coreceptor] (10%), and defining a minority cutoff of 5%, the results were concordant in all but one isolate. The combination of MPS and coreceptor usage prediction results in a fast and accurate alternative to phenotypic assays. The detection of X4-viruses in all isolates suggests that coreceptor usage as well as fitness of minorities is important for therapy outcome. The high sensitivity of this technology in combination with a quantitative description of the viral population may allow implementing meaningful cutoffs for predicting response to CCR5-antagonists in the presence of X4-minorities.

DsaV methyltransferase and its isoschizomers contain a conserved segment that is similar to the segment in Hhai methyltransferase that is in contact with DNA bases.

PubMed Central

Gopal, J; Yebra, M J; Bhagwat, A S

1994-01-01

The methyltransferase (MTase) in the DsaV restriction--modification system methylates within 5'-CCNGG sequences. We have cloned the gene for this MTase and determined its sequence. The predicted sequence of the MTase protein contains sequence motifs conserved among all cytosine-5 MTases and is most similar to other MTases that methylate CCNGG sequences, namely M.ScrFI and M.SsoII. All three MTases methylate the internal cytosine within their recognition sequence. The 'variable' region within the three enzymes that methylate CCNGG can be aligned with the sequences of two enzymes that methylate CCWGG sequences. Remarkably, two segments within this region contain significant similarity with the region of M.HhaI that is known to contact DNA bases. These alignments suggest that many cytosine-5 MTases are likely to interact with DNA using a similar structural framework. Images PMID:7971279

Cloning and characterization of a Candida albicans gene homologous to fructose-1,6-bisphosphatase genes.

PubMed

De la Rosa, J M; Ruíz, T; Rodríguez, L

2000-12-01

By sequencing of the DNA adjacent to the Candida albicans SEC61 gene, an open reading frame encoding a polypeptide of 331 amino acids was found. The predicted protein showed a strong homology with the fructose-1,6-bisphosphatase [FbPase] from other organisms, and conserved regions included the catalytic motif found in all known FbPases. Although the cloned gene did not complement the growth failure of a Saccharomyces cerevisiae fbp1 mutant in media with gluconeogenic carbon sources, it was transcribed in the transformants in a fashion that indicates a partial repression by glucose. A similar control on the transcription of this gene and on FbPase activity was found in wild-type C. albicans, where the cloned gene (CaFBP1) was shown to be localized in a single chromosomal locus in the genome.

Identification of antigen-specific human monoclonal antibodies using high-throughput sequencing of the antibody repertoire.

PubMed

Liu, Ju; Li, Ruihua; Liu, Kun; Li, Liangliang; Zai, Xiaodong; Chi, Xiangyang; Fu, Ling; Xu, Junjie; Chen, Wei

2016-04-22

High-throughput sequencing of the antibody repertoire provides a large number of antibody variable region sequences that can be used to generate human monoclonal antibodies. However, current screening methods for identifying antigen-specific antibodies are inefficient. In the present study, we developed an antibody clone screening strategy based on clone dynamics and relative frequency, and used it to identify antigen-specific human monoclonal antibodies. Enzyme-linked immunosorbent assay showed that at least 52% of putative positive immunoglobulin heavy chains composed antigen-specific antibodies. Combining information on dynamics and relative frequency improved identification of positive clones and elimination of negative clones. and increase the credibility of putative positive clones. Therefore the screening strategy could simplify the subsequent experimental screening and may facilitate the generation of antigen-specific antibodies. Copyright © 2016 Elsevier Inc. All rights reserved.

Reverse transcription polymerase chain reaction protocols for cloning small circular RNAs.

PubMed

Navarro, B; Daròs, J A; Flores, R

1998-07-01

A protocol is described for general application for cloning small circular RNAs which requires only minimal amounts of template (approximately 50 ng) of unknown sequence. Both cDNA strands are synthesized with a 26-mer primer whose six 3'-terminal positions are totally degenerate in two consecutive reactions catalyzed by reverse transcriptase and DNA polymerase, respectively. The cDNAs are then PCR-amplified, using a 20-mer primer with the non-degenerate sequence of the previous primer, cloned and sequenced. This information permits the synthesis of one or more pairs of specific and adjacent primers for obtaining full-length cDNA clones by a protocol which is also described.

Cloning and sequencing of the allophycocyanin genes from Spirulina maxima (Cyanophyta)

NASA Astrophysics Data System (ADS)

Qin, Song; Hiroyuki, Kojima; Yoshikazu, Kawata; Shin-Ichi, Yano; Zeng, Cheng-Kui

1998-03-01

The genes coding for the α-and β-subunit of allophycocyanin ( apcA and apcB) from the cyanophyte Spirulina maxima were cloned and sequenced. The results revealed 44.4% of nucleotide sequence similarity and 30.4% of similarity of deduced amino acid sequence between them. The amino acid sequence identities between S. maxima and S. platensis are 99.4% for α subunit and 100% for β subunit.

Observing Clonal Dynamics across Spatiotemporal Axes: A Prelude to Quantitative Fitness Models for Cancer.

PubMed

McPherson, Andrew W; Chan, Fong Chun; Shah, Sohrab P

2018-02-01

The ability to accurately model evolutionary dynamics in cancer would allow for prediction of progression and response to therapy. As a prelude to quantitative understanding of evolutionary dynamics, researchers must gather observations of in vivo tumor evolution. High-throughput genome sequencing now provides the means to profile the mutational content of evolving tumor clones from patient biopsies. Together with the development of models of tumor evolution, reconstructing evolutionary histories of individual tumors generates hypotheses about the dynamics of evolution that produced the observed clones. In this review, we provide a brief overview of the concepts involved in predicting evolutionary histories, and provide a workflow based on bulk and targeted-genome sequencing. We then describe the application of this workflow to time series data obtained for transformed and progressed follicular lymphomas (FL), and contrast the observed evolutionary dynamics between these two subtypes. We next describe results from a spatial sampling study of high-grade serous (HGS) ovarian cancer, propose mechanisms of disease spread based on the observed clonal mixtures, and provide examples of diversification through subclonal acquisition of driver mutations and convergent evolution. Finally, we state implications of the techniques discussed in this review as a necessary but insufficient step on the path to predictive modelling of disease dynamics. Copyright © 2018 Cold Spring Harbor Laboratory Press; all rights reserved.

Diverse Dengue Type 2 Virus Populations Contain Recombinant and Both Parental Viruses in a Single Mosquito Host

PubMed Central

Craig, Scott; Thu, Hlaing Myat; Lowry, Kym; Wang, Xiao-fang; Holmes, Edward C.; Aaskov, John

2003-01-01

Envelope (E) protein genes sampled from populations of dengue 2 (DEN-2) virus in individual Aedes aegypti mosquitoes and in serum from dengue patients were copied to cDNA, cloned, and sequenced. The nucleotide sequences of the E genes in more than 70% of the clones differed from the consensus sequence for the corresponding virus population at up to 11 sites, and 24 of the 94 clones contained at least one stop codon. Virus populations recovered up to 2 years apart yielded clones with similar polymorphisms in the E gene. For one mosquito, the clones obtained fell into two genotypes. One group of sequences was closely related to those of viruses recovered from dengue patients in the same locality (Yangon, Myanmar) since 1995 and were classified as Asian 1 genotype. The second group were Cosmopolitan genotype viruses which were also circulating in Yangon in 2000 and which were related to DEN-2 viruses sampled from southern China in 1999. Finally, one clone was identified as a recombinant genome composed of portions of these two “parental” genotypes. This is the first report of recombinant and parental dengue viruses in a single host. PMID:12634407

Spectrum of benzo[a]pyrene-induced mutations in the Pig-a gene of L5178YTk+/- cells identified with next generation sequencing.

PubMed

Revollo, Javier; Wang, Yiying; McKinzie, Page; Dad, Azra; Pearce, Mason; Heflich, Robert H; Dobrovolsky, Vasily N

2017-12-01

We used Sanger sequencing and next generation sequencing (NGS) for analysis of mutations in the endogenous X-linked Pig-a gene of clonally expanded L5178YTk +/- cells. The clones developed from single cells that were sorted on a flow cytometer based upon the expression pattern of the GPI-anchored marker, CD90, on their surface. CD90-deficient and CD90-proficient cells were sorted from untreated cultures and CD90-deficient cells were sorted from cultures treated with benzo[a]pyrene (B[a]P). Pig-a mutations were identified in all clones developed from CD90-deficient cells; no Pig-a mutations were found in clones of CD90-proficient cells. The spectrum of B[a]P-induced Pig-a mutations was dominated by basepair substitutions, small insertions and deletions at G:C, or at sequences rich in G:C content. We observed high concordance between Pig-a mutations determined by Sanger sequencing and by NGS, but NGS was able to identify mutations in samples that were difficult to analyze by Sanger sequencing (e.g., mixtures of two mutant clones). Overall, the NGS method is a cost and labor efficient high throughput approach for analysis of a large number of mutant clones. Published by Elsevier B.V.

Russell body inducing threshold depends on the variable domain sequences of individual human IgG clones and the cellular protein homeostasis.

PubMed

Stoops, Janelle; Byrd, Samantha; Hasegawa, Haruki

2012-10-01

Russell bodies are intracellular aggregates of immunoglobulins. Although the mechanism of Russell body biogenesis has been extensively studied by using truncated mutant heavy chains, the importance of the variable domain sequences in this process and in immunoglobulin biosynthesis remains largely unknown. Using a panel of structurally and functionally normal human immunoglobulin Gs, we show that individual immunoglobulin G clones possess distinctive Russell body inducing propensities that can surface differently under normal and abnormal cellular conditions. Russell body inducing predisposition unique to each immunoglobulin G clone was corroborated by the intrinsic physicochemical properties encoded in the heavy chain variable domain/light chain variable domain sequence combinations that define each immunoglobulin G clone. While the sequence based intrinsic factors predispose certain immunoglobulin G clones to be more prone to induce Russell bodies, extrinsic factors such as stressful cell culture conditions also play roles in unmasking Russell body propensity from immunoglobulin G clones that are normally refractory to developing Russell bodies. By taking advantage of heterologous expression systems, we dissected the roles of individual subunit chains in Russell body formation and examined the effect of non-cognate subunit chain pair co-expression on Russell body forming propensity. The results suggest that the properties embedded in the variable domain of individual light chain clones and their compatibility with the partnering heavy chain variable domain sequences underscore the efficiency of immunoglobulin G biosynthesis, the threshold for Russell body induction, and the level of immunoglobulin G secretion. We propose that an interplay between the unique properties encoded in variable domain sequences and the state of protein homeostasis determines whether an immunoglobulin G expressing cell will develop the Russell body phenotype in a dynamic cellular setting. Copyright © 2012 Elsevier B.V. All rights reserved.

Phylogenetic position of parabasalid symbionts from the termite Calotermes flavicollis based on small subunit rRNA sequences.

PubMed

Gerbod, D; Edgcomb, V P; Noël, C; Delgado-Viscogliosi, P; Viscogliosi, E

2000-09-01

Small subunit rDNA genes were amplified by polymerase chain reaction using specific primers from mixed-population DNA obtained from the whole hindgut of the termite Calotermes flavicollis. Comparative sequence analysis of the clones revealed two kinds of sequences that were both from parabasalid symbionts. In a molecular tree inferred by distance, parsimony and likelihood methods, and including 27 parabasalid sequences retrieved from the data bases, the sequences of the group II (clones Cf5 and Cf6) were closely related to the Devescovinidae/Calonymphidae species and thus were assigned to the Devescovinidae Foaina. The sequence of the group I (clone Cf1) emerged within the Trichomonadinae and strongly clustered with Tetratrichomonas gallinarum. On the basis of morphological data, the Monocercomonadidae Hexamastix termitis might be the most likely origin of this sequence.

The Degradome database: mammalian proteases and diseases of proteolysis.

PubMed

Quesada, Víctor; Ordóñez, Gonzalo R; Sánchez, Luis M; Puente, Xose S; López-Otín, Carlos

2009-01-01

The degradome is defined as the complete set of proteases present in an organism. The recent availability of whole genomic sequences from multiple organisms has led us to predict the contents of the degradomes of several mammalian species. To ensure the fidelity of these predictions, our methods have included manual curation of individual sequences and, when necessary, direct cloning and sequencing experiments. The results of these studies in human, chimpanzee, mouse and rat have been incorporated into the Degradome database, which can be accessed through a web interface at http://degradome.uniovi.es. The annotations about each individual protease can be retrieved by browsing catalytic classes and families or by searching specific terms. This web site also provides detailed information about genetic diseases of proteolysis, a growing field of great importance for multiple users. Finally, the user can find additional information about protease structures, protease inhibitors, ancillary domains of proteases and differences between mammalian degradomes.

The Degradome database: mammalian proteases and diseases of proteolysis

PubMed Central

Quesada, Víctor; Ordóñez, Gonzalo R.; Sánchez, Luis M.; Puente, Xose S.; López-Otín, Carlos

2009-01-01

The degradome is defined as the complete set of proteases present in an organism. The recent availability of whole genomic sequences from multiple organisms has led us to predict the contents of the degradomes of several mammalian species. To ensure the fidelity of these predictions, our methods have included manual curation of individual sequences and, when necessary, direct cloning and sequencing experiments. The results of these studies in human, chimpanzee, mouse and rat have been incorporated into the Degradome database, which can be accessed through a web interface at http://degradome.uniovi.es. The annotations about each individual protease can be retrieved by browsing catalytic classes and families or by searching specific terms. This web site also provides detailed information about genetic diseases of proteolysis, a growing field of great importance for multiple users. Finally, the user can find additional information about protease structures, protease inhibitors, ancillary domains of proteases and differences between mammalian degradomes. PMID:18776217

SSHscreen and SSHdb, generic software for microarray based gene discovery: application to the stress response in cowpea

PubMed Central

2010-01-01

Background Suppression subtractive hybridization is a popular technique for gene discovery from non-model organisms without an annotated genome sequence, such as cowpea (Vigna unguiculata (L.) Walp). We aimed to use this method to enrich for genes expressed during drought stress in a drought tolerant cowpea line. However, current methods were inefficient in screening libraries and management of the sequence data, and thus there was a need to develop software tools to facilitate the process. Results Forward and reverse cDNA libraries enriched for cowpea drought response genes were screened on microarrays, and the R software package SSHscreen 2.0.1 was developed (i) to normalize the data effectively using spike-in control spot normalization, and (ii) to select clones for sequencing based on the calculation of enrichment ratios with associated statistics. Enrichment ratio 3 values for each clone showed that 62% of the forward library and 34% of the reverse library clones were significantly differentially expressed by drought stress (adjusted p value < 0.05). Enrichment ratio 2 calculations showed that > 88% of the clones in both libraries were derived from rare transcripts in the original tester samples, thus supporting the notion that suppression subtractive hybridization enriches for rare transcripts. A set of 118 clones were chosen for sequencing, and drought-induced cowpea genes were identified, the most interesting encoding a late embryogenesis abundant Lea5 protein, a glutathione S-transferase, a thaumatin, a universal stress protein, and a wound induced protein. A lipid transfer protein and several components of photosynthesis were down-regulated by the drought stress. Reverse transcriptase quantitative PCR confirmed the enrichment ratio values for the selected cowpea genes. SSHdb, a web-accessible database, was developed to manage the clone sequences and combine the SSHscreen data with sequence annotations derived from BLAST and Blast2GO. The self-BLAST function within SSHdb grouped redundant clones together and illustrated that the SSHscreen plots are a useful tool for choosing anonymous clones for sequencing, since redundant clones cluster together on the enrichment ratio plots. Conclusions We developed the SSHscreen-SSHdb software pipeline, which greatly facilitates gene discovery using suppression subtractive hybridization by improving the selection of clones for sequencing after screening the library on a small number of microarrays. Annotation of the sequence information and collaboration was further enhanced through a web-based SSHdb database, and we illustrated this through identification of drought responsive genes from cowpea, which can now be investigated in gene function studies. SSH is a popular and powerful gene discovery tool, and therefore this pipeline will have application for gene discovery in any biological system, particularly non-model organisms. SSHscreen 2.0.1 and a link to SSHdb are available from http://microarray.up.ac.za/SSHscreen. PMID:20359330

Investigation of bacterial and archaeal communities: novel protocols using modern sequencing by Illumina MiSeq and traditional DGGE-cloning.

PubMed

Kraková, Lucia; Šoltys, Katarína; Budiš, Jaroslav; Grivalský, Tomáš; Ďuriš, František; Pangallo, Domenico; Szemes, Tomáš

2016-09-01

Different protocols based on Illumina high-throughput DNA sequencing and denaturing gradient gel electrophoresis (DGGE)-cloning were developed and applied for investigating hot spring related samples. The study was focused on three target genes: archaeal and bacterial 16S rRNA and mcrA of methanogenic microflora. Shorter read lengths of the currently most popular technology of sequencing by Illumina do not allow analysis of the complete 16S rRNA region, or of longer gene fragments, as was the case of Sanger sequencing. Here, we demonstrate that there is no need for special indexed or tailed primer sets dedicated to short variable regions of 16S rRNA since the presented approach allows the analysis of complete bacterial 16S rRNA amplicons (V1-V9) and longer archaeal 16S rRNA and mcrA sequences. Sample augmented with transposon is represented by a set of approximately 300 bp long fragments that can be easily sequenced by Illumina MiSeq. Furthermore, a low proportion of chimeric sequences was observed. DGGE-cloning based strategies were performed combining semi-nested PCR, DGGE and clone library construction. Comparing both investigation methods, a certain degree of complementarity was observed confirming that the DGGE-cloning approach is not obsolete. Novel protocols were created for several types of laboratories, utilizing the traditional DGGE technique or using the most modern Illumina sequencing.

The LINE-1 DNA sequences in four mammalian orders predict proteins that conserve homologies to retrovirus proteins.

PubMed Central

Fanning, T; Singer, M

1987-01-01

Recent work suggests that one or more members of the highly repeated LINE-1 (L1) DNA family found in all mammals may encode one or more proteins. Here we report the sequence of a portion of an L1 cloned from the domestic cat (Felis catus). These data permit comparison of the L1 sequences in four mammalian orders (Carnivore, Lagomorph, Rodent and Primate) and the comparison supports the suggested coding potential. In two separate, noncontiguous regions in the carboxy terminal half of the proteins predicted from the DNA sequences, there are several strongly conserved segments. In one region, these share homology with known or suspected reverse transcriptases, as described by others in rodents and primates. In the second region, closer to the carboxy terminus, the strongly conserved segments are over 90% homologous among the four orders. One of the latter segments is cysteine rich and resembles the putative metal binding domains of nucleic acid binding proteins, including those of TFIIIA and retroviruses. PMID:3562227

Cloning and characterization of the major histone H2A genes completes the cloning and sequencing of known histone genes of Tetrahymena thermophila.

PubMed Central

Liu, X; Gorovsky, M A

1996-01-01

A truncated cDNA clone encoding Tetrahymena thermophila histone H2A2 was isolated using synthetic degenerate oligonucleotide probes derived from H2A protein sequences of Tetrahymena pyriformis. The cDNA clone was used as a homologous probe to isolate a truncated genomic clone encoding H2A1. The remaining regions of the genes for H2A1 (HTA1) and H2A2 (HTA2) were then isolated using inverse PCR on circularized genomic DNA fragments. These partial clones were assembled into intact HTA1 and HTA2 clones. Nucleotide sequences of the two genes were highly homologous within the coding region but not in the noncoding regions. Comparison of the deduced amino acid sequences with protein sequences of T. pyriformis H2As showed only two and three differences respectively, in a total of 137 amino acids for H2A1, and 132 amino acids for H2A2, indicating the two genes arose before the divergence of these two species. The HTA2 gene contains a TAA triplet within the coding region, encoding a glutamine residue. In contrast with the T. thermophila HHO and HTA3 genes, no introns were identified within the two genes. The 5'- and 3'-ends of the histone H2A mRNAs; were determined by RNase protection and by PCR mapping using RACE and RLM-RACE methods. Both genes encode polyadenylated mRNAs and are highly expressed in vegetatively growing cells but only weakly expressed in starved cultures. With the inclusion of these two genes, T. thermophila is the first organism whose entire complement of known core and linker histones, including replication-dependent and basal variants, has been cloned and sequenced. PMID:8760889

Construction of the BAC Library of Small Abalone (Haliotis diversicolor) for Gene Screening and Genome Characterization.

PubMed

Jiang, Likun; You, Weiwei; Zhang, Xiaojun; Xu, Jian; Jiang, Yanliang; Wang, Kai; Zhao, Zixia; Chen, Baohua; Zhao, Yunfeng; Mahboob, Shahid; Al-Ghanim, Khalid A; Ke, Caihuan; Xu, Peng

2016-02-01

The small abalone (Haliotis diversicolor) is one of the most important aquaculture species in East Asia. To facilitate gene cloning and characterization, genome analysis, and genetic breeding of it, we constructed a large-insert bacterial artificial chromosome (BAC) library, which is an important genetic tool for advanced genetics and genomics research. The small abalone BAC library includes 92,610 clones with an average insert size of 120 Kb, equivalent to approximately 7.6× of the small abalone genome. We set up three-dimensional pools and super pools of 18,432 BAC clones for target gene screening using PCR method. To assess the approach, we screened 12 target genes in these 18,432 BAC clones and identified 16 positive BAC clones. Eight positive BAC clones were then sequenced and assembled with the next generation sequencing platform. The assembled contigs representing these 8 BAC clones spanned 928 Kb of the small abalone genome, providing the first batch of genome sequences for genome evaluation and characterization. The average GC content of small abalone genome was estimated as 40.33%. A total of 21 protein-coding genes, including 7 target genes, were annotated into the 8 BACs, which proved the feasibility of PCR screening approach with three-dimensional pools in small abalone BAC library. One hundred fifty microsatellite loci were also identified from the sequences for marker development in the future. The BAC library and clone pools provided valuable resources and tools for genetic breeding and conservation of H. diversicolor.

Strong spurious transcription likely contributes to DNA insert bias in typical metagenomic clone libraries.

PubMed

Lam, Kathy N; Charles, Trevor C

2015-01-01

Clone libraries provide researchers with a powerful resource to study nucleic acid from diverse sources. Metagenomic clone libraries in particular have aided in studies of microbial biodiversity and function, and allowed the mining of novel enzymes. Libraries are often constructed by cloning large inserts into cosmid or fosmid vectors. Recently, there have been reports of GC bias in fosmid metagenomic libraries, and it was speculated to be a result of fragmentation and loss of AT-rich sequences during cloning. However, evidence in the literature suggests that transcriptional activity or gene product toxicity may play a role. To explore possible mechanisms responsible for sequence bias in clone libraries, we constructed a cosmid library from a human microbiome sample and sequenced DNA from different steps during library construction: crude extract DNA, size-selected DNA, and cosmid library DNA. We confirmed a GC bias in the final cosmid library, and we provide evidence that the bias is not due to fragmentation and loss of AT-rich sequences but is likely occurring after DNA is introduced into Escherichia coli. To investigate the influence of strong constitutive transcription, we searched the sequence data for promoters and found that rpoD/σ(70) promoter sequences were underrepresented in the cosmid library. Furthermore, when we examined the genomes of taxa that were differentially abundant in the cosmid library relative to the original sample, we found the bias to be more correlated with the number of rpoD/σ(70) consensus sequences in the genome than with simple GC content. The GC bias of metagenomic libraries does not appear to be due to DNA fragmentation. Rather, analysis of promoter sequences provides support for the hypothesis that strong constitutive transcription from sequences recognized as rpoD/σ(70) consensus-like in E. coli may lead to instability, causing loss of the plasmid or loss of the insert DNA that gives rise to the transcription. Despite widespread use of E. coli to propagate foreign DNA in metagenomic libraries, the effects of in vivo transcriptional activity on clone stability are not well understood. Further work is required to tease apart the effects of transcription from those of gene product toxicity.

Development of positive control materials for DNA-based detection of cystic fibrosis: Cloning and sequencing of 31 mutations

DOE Office of Scientific and Technical Information (OSTI.GOV)

Iovannisci, D.; Brown, C.; Winn-Deen, E.

1994-09-01

The cloning and sequencing of the gene associated with cystic fibrosis (CF) now provides the opportunity for earlier detection and carrier screening through DNA-based detection schemes. To date, over 300 mutations have been reported to the CF Consortium; however, only 30 mutations have been observed frequently enough world-wide to warrant routine screening. Many of these mutations are not available as cloned material or as established tissue culture cell lines to aid in the development of DNA-based detection assays. We have therefore cloned the 30 most frequently reported mutations, plus the mutation R347H due to its association with male infertility (31more » mutations, total). Two approaches were employed: direct PCR amplification, where mutations were available from patient sources, and site-directed PCR mutagenesis of normal genomic DNA to generate the remaining mutations. After amplification, products were cloned into a sequencing vector, bacterial transformants were screened by a novel method (PCR/oligonucleotide litigation assay/sequence-coded separation), and plamid DNA sequences determined by automated fluorescent methods on the Applied Biosystems 373A. Mixing of the clones allows the construction of artificial genotypes useful as positive control material for assay validation. A second round of mutagenesis, resulting in the construction of plasmids bearing multiple mutations, will be evaluated for their utility as reagent control materials in kit development.« less

Cloning and sequencing of a gene encoding a 21-kilodalton outer membrane protein from Bordetella avium and expression of the gene in Salmonella typhimurium.

PubMed Central

Gentry-Weeks, C R; Hultsch, A L; Kelly, S M; Keith, J M; Curtiss, R

1992-01-01

Three gene libraries of Bordetella avium 197 DNA were prepared in Escherichia coli LE392 by using the cosmid vectors pCP13 and pYA2329, a derivative of pCP13 specifying spectinomycin resistance. The cosmid libraries were screened with convalescent-phase anti-B. avium turkey sera and polyclonal rabbit antisera against B. avium 197 outer membrane proteins. One E. coli recombinant clone produced a 56-kDa protein which reacted with convalescent-phase serum from a turkey infected with B. avium 197. In addition, five E. coli recombinant clones were identified which produced B. avium outer membrane proteins with molecular masses of 21, 38, 40, 43, and 48 kDa. At least one of these E. coli clones, which encoded the 21-kDa protein, reacted with both convalescent-phase turkey sera and antibody against B. avium 197 outer membrane proteins. The gene for the 21-kDa outer membrane protein was localized by Tn5seq1 mutagenesis, and the nucleotide sequence was determined by dideoxy sequencing. DNA sequence analysis of the 21-kDa protein revealed an open reading frame of 582 bases that resulted in a predicted protein of 194 amino acids. Comparison of the predicted amino acid sequence of the gene encoding the 21-kDa outer membrane protein with protein sequences in the National Biomedical Research Foundation protein sequence data base indicated significant homology to the OmpA proteins of Shigella dysenteriae, Enterobacter aerogenes, E. coli, and Salmonella typhimurium and to Neisseria gonorrhoeae outer membrane protein III, Haemophilus influenzae protein P6, and Pseudomonas aeruginosa porin protein F. The gene (ompA) encoding the B. avium 21-kDa protein hybridized with 4.1-kb DNA fragments from EcoRI-digested, chromosomal DNA of Bordetella pertussis and Bordetella bronchiseptica and with 6.0- and 3.2-kb DNA fragments from EcoRI-digested, chromosomal DNA of B. avium and B. avium-like DNA, respectively. A 6.75-kb DNA fragment encoding the B. avium 21-kDa protein was subcloned into the Asd+ vector pYA292, and the construct was introduced into the avirulent delta cya delta crp delta asd S. typhimurium chi 3987 for oral immunization of birds. The gene encoding the 21-kDa protein was expressed equivalently in B. avium 197, delta asd E. coli chi 6097, and S. typhimurium chi 3987 and was localized primarily in the cytoplasmic membrane and outer membrane. In preliminary studies on oral inoculation of turkey poults with S. typhimurium chi 3987 expressing the gene encoding the B. avium 21-kDa protein, it was determined that a single dose of the recombinant Salmonella vaccine failed to elicit serum antibodies against the 21-kDa protein and challenge with wild-type B. avium 197 resulted in colonization of the trachea and thymus with B. avium 197. Images PMID:1447140

Molecular cloning and nucleotide sequence of a transforming gene detected by transfection of chicken B-cell lymphoma DNA

NASA Astrophysics Data System (ADS)

Goubin, Gerard; Goldman, Debra S.; Luce, Judith; Neiman, Paul E.; Cooper, Geoffrey M.

1983-03-01

A transforming gene detected by transfection of chicken B-cell lymphoma DNA has been isolated by molecular cloning. It is homologous to a conserved family of sequences present in normal chicken and human DNAs but is not related to transforming genes of acutely transforming retroviruses. The nucleotide sequence of the cloned transforming gene suggests that it encodes a protein that is partially homologous to the amino terminus of transferrin and related proteins although only about one tenth the size of transferrin.

Construction, Characterization, and Preliminary BAC-End Sequence Analysis of a Bacterial Artificial Chromosome Library of the Tea Plant (Camellia sinensis)

PubMed Central

Lin, Jinke; Kudrna, Dave; Wing, Rod A.

2011-01-01

We describe the construction and characterization of a publicly available BAC library for the tea plant, Camellia sinensis. Using modified methods, the library was constructed with the aim of developing public molecular resources to advance tea plant genomics research. The library consists of a total of 401,280 clones with an average insert size of 135 kb, providing an approximate coverage of 13.5 haploid genome equivalents. No empty vector clones were observed in a random sampling of 576 BAC clones. Further analysis of 182 BAC-end sequences from randomly selected clones revealed a GC content of 40.35% and low chloroplast and mitochondrial contamination. Repetitive sequence analyses indicated that LTR retrotransposons were the most predominant sequence class (86.93%–87.24%), followed by DNA retrotransposons (11.16%–11.69%). Additionally, we found 25 simple sequence repeats (SSRs) that could potentially be used as genetic markers. PMID:21234344

Cloning and sequence analysis of the invertase gene INV 1 from the yeast Pichia anomala.

PubMed

Pérez, J A; Rodríguez, J; Rodríguez, L; Ruiz, T

1996-02-01

A genomic library from the yeast Pichia anomala has been constructed and employed to clone the gene encoding the sucrose-hydrolysing enzyme invertase by complementation of a sucrose non-fermenting mutant of Saccharomyces cerevisiae. The cloned gene, INV1, was sequenced and found to encode a polypeptide of 550 amino acids which contained a 22 amino-acid signal sequence and ten potential glycosylation sites. The amino-acid sequence shows significant identity with other yeast invertases and also with Kluyveromyces marxianus inulinase, a yeast beta-fructofuranosidase which has a different substrate specificity. The nucleotide sequences of the 5' and 3' non-coding regions were found to contain several consensus motifs probably involved in the initiation and termination of gene transcription.

Targeted isolation, sequence assembly and characterization of two white spruce (Picea glauca) BAC clones for terpenoid synthase and cytochrome P450 genes involved in conifer defence reveal insights into a conifer genome

PubMed Central

2009-01-01

Background Conifers are a large group of gymnosperm trees which are separated from the angiosperms by more than 300 million years of independent evolution. Conifer genomes are extremely large and contain considerable amounts of repetitive DNA. Currently, conifer sequence resources exist predominantly as expressed sequence tags (ESTs) and full-length (FL)cDNAs. There is no genome sequence available for a conifer or any other gymnosperm. Conifer defence-related genes often group into large families with closely related members. The goals of this study are to assess the feasibility of targeted isolation and sequence assembly of conifer BAC clones containing specific genes from two large gene families, and to characterize large segments of genomic DNA sequence for the first time from a conifer. Results We used a PCR-based approach to identify BAC clones for two target genes, a terpene synthase (3-carene synthase; 3CAR) and a cytochrome P450 (CYP720B4) from a non-arrayed genomic BAC library of white spruce (Picea glauca). Shotgun genomic fragments isolated from the BAC clones were sequenced to a depth of 15.6- and 16.0-fold coverage, respectively. Assembly and manual curation yielded sequence scaffolds of 172 kbp (3CAR) and 94 kbp (CYP720B4) long. Inspection of the genomic sequences revealed the intron-exon structures, the putative promoter regions and putative cis-regulatory elements of these genes. Sequences related to transposable elements (TEs), high complexity repeats and simple repeats were prevalent and comprised approximately 40% of the sequenced genomic DNA. An in silico simulation of the effect of sequencing depth on the quality of the sequence assembly provides direction for future efforts of conifer genome sequencing. Conclusion We report the first targeted cloning, sequencing, assembly, and annotation of large segments of genomic DNA from a conifer. We demonstrate that genomic BAC clones for individual members of multi-member gene families can be isolated in a gene-specific fashion. The results of the present work provide important new information about the structure and content of conifer genomic DNA that will guide future efforts to sequence and assemble conifer genomes. PMID:19656416

Targeted isolation, sequence assembly and characterization of two white spruce (Picea glauca) BAC clones for terpenoid synthase and cytochrome P450 genes involved in conifer defence reveal insights into a conifer genome.

PubMed

Hamberger, Björn; Hall, Dawn; Yuen, Mack; Oddy, Claire; Hamberger, Britta; Keeling, Christopher I; Ritland, Carol; Ritland, Kermit; Bohlmann, Jörg

2009-08-06

Conifers are a large group of gymnosperm trees which are separated from the angiosperms by more than 300 million years of independent evolution. Conifer genomes are extremely large and contain considerable amounts of repetitive DNA. Currently, conifer sequence resources exist predominantly as expressed sequence tags (ESTs) and full-length (FL)cDNAs. There is no genome sequence available for a conifer or any other gymnosperm. Conifer defence-related genes often group into large families with closely related members. The goals of this study are to assess the feasibility of targeted isolation and sequence assembly of conifer BAC clones containing specific genes from two large gene families, and to characterize large segments of genomic DNA sequence for the first time from a conifer. We used a PCR-based approach to identify BAC clones for two target genes, a terpene synthase (3-carene synthase; 3CAR) and a cytochrome P450 (CYP720B4) from a non-arrayed genomic BAC library of white spruce (Picea glauca). Shotgun genomic fragments isolated from the BAC clones were sequenced to a depth of 15.6- and 16.0-fold coverage, respectively. Assembly and manual curation yielded sequence scaffolds of 172 kbp (3CAR) and 94 kbp (CYP720B4) long. Inspection of the genomic sequences revealed the intron-exon structures, the putative promoter regions and putative cis-regulatory elements of these genes. Sequences related to transposable elements (TEs), high complexity repeats and simple repeats were prevalent and comprised approximately 40% of the sequenced genomic DNA. An in silico simulation of the effect of sequencing depth on the quality of the sequence assembly provides direction for future efforts of conifer genome sequencing. We report the first targeted cloning, sequencing, assembly, and annotation of large segments of genomic DNA from a conifer. We demonstrate that genomic BAC clones for individual members of multi-member gene families can be isolated in a gene-specific fashion. The results of the present work provide important new information about the structure and content of conifer genomic DNA that will guide future efforts to sequence and assemble conifer genomes.

Nucleotide sequence determination of guinea-pig casein B mRNA reveals homology with bovine and rat alpha s1 caseins and conservation of the non-coding regions of the mRNA.

PubMed Central

Hall, L; Laird, J E; Craig, R K

1984-01-01

Nucleotide sequence analysis of cloned guinea-pig casein B cDNA sequences has identified two casein B variants related to the bovine and rat alpha s1 caseins. Amino acid homology was largely confined to the known bovine or predicted rat phosphorylation sites and within the 'signal' precursor sequence. Comparison of the deduced nucleotide sequence of the guinea-pig and rat alpha s1 casein mRNA species showed greater sequence conservation in the non-coding than in the coding regions, suggesting a functional and possibly regulatory role for the non-coding regions of casein mRNA. The results provide insight into the evolution of the casein genes, and raise questions as to the role of conserved nucleotide sequences within the non-coding regions of mRNA species. Images Fig. 1. PMID:6548375

Differential display RT PCR of total RNA from human foreskin fibroblasts for investigation of androgen-dependent gene expression

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nitsche, E.M.; Moquin, A.; Adams, P.S.

1996-05-03

Male sexual differentiation is a process that involves androgen action via the androgen receptor. Defects in the androgen receptor, many resulting from point mutations in the androgen receptor gene, lead to varying degrees of impaired masculinization in chromosomally male individuals. To date no specific androgen regulated morphogens involved in this process have been identified and no marker genes are known that would help to predict further virilization in infants with partial androgen insensitivity. In the present study we first show data on androgen regulated gene expression investigated by differential display reverse transcription PCR (dd RT PCR) on total RNA frommore » human neonatal genital skin fibroblasts cultured in the presence or absence of 100 nM testosterone. Using three different primer combinations, 54 cDNAs appeared to be regulated by androgens. Most of these sequences show the characteristics of expressed mRNAs but showed no homology to sequences in the database. However 15 clones with significant homology to previously cloned sequences were identified. Seven cDNAs appear to be induced by androgen withdrawal. Of these, five are similar to ETS (expression tagged sequences) from unknown genes; the other two show significant homology to the cDNAs of ubiquitin and human guanylate binding protein 2 (GBP-2). In addition, we have identified 8 cDNA clones which show homologies to other sequences in the database and appear to be upregulated in the presence of testosterone. Three differential expressed sequences show significant homology to the cDNAs of L-plastin and one to the cDNA of testican. This latter gene codes for a proteoglycan involved in cell social behavior and therefore of special interest in this context. The results of this study are of interest in further investigation of normal and disturbed androgen-dependent gene expression. 49 refs., 2 figs., 5 tabs.« less

Bystander effects in radiation-induced genomic instability

NASA Technical Reports Server (NTRS)

Morgan, William F.; Hartmann, Andreas; Limoli, Charles L.; Nagar, Shruti; Ponnaiya, Brian

2002-01-01

Exposure of GM10115 hamster-human hybrid cells to X-rays can result in the induction of chromosomal instability in the progeny of surviving cells. This instability manifests as the dynamic production of novel sub-populations of cells with unique cytogenetic rearrangements involving the "marker" human chromosome. We have used the comet assay to investigate whether there was an elevated level of endogenous DNA breaks in chromosomally unstable clones that could provide a source for the chromosomal rearrangements and thus account for the persistent instability observed. Our results indicate no significant difference in comet tail measurement between non-irradiated and radiation-induced chromosomally unstable clones. Using two-color fluorescence in situ hybridization we also investigated whether recombinational events involving the interstitial telomere repeat-like sequences in GM10115 cells were involved at frequencies higher than random processes would otherwise predict. Nine of 11 clones demonstrated a significantly higher than expected involvement of these interstitial telomere repeat-like sequences at the recombination junction between the human and hamster chromosomes. Since elevated levels of endogenous breaks were not detected in unstable clones we propose that epigenetic or bystander effects (BSEs) lead to the activation of recombinational pathways that perpetuate the unstable phenotype. Specifically, we expand upon the hypothesis that radiation induces conditions and/or factors that stimulate the production of reactive oxygen species (ROS). These reactive intermediates then contribute to a chronic pro-oxidant environment that cycles over multiple generations, promoting chromosomal recombination and other phenotypes associated with genomic instability.

Cloning and sequencing of the alcohol dehydrogenase II gene from Zymomonas mobilis

DOEpatents

Ingram, Lonnie O.; Conway, Tyrrell

1992-01-01

The alcohol dehydrogenase II gene from Zymomonas mobilis has been cloned and sequenced. This gene can be expressed at high levels in other organisms to produce acetaldehyde or to convert acetaldehyde to ethanol.

[Cloning and sequence analysis of recombinant fusion gene of Escherichia coli heat-liable enterotoxin B subunit and Actinobacillus actinomycetemcomitans fimbria associative protein].

PubMed

Li, Yi; Sun, Hong-chen; Guo, Xue-jun; Feng, Shu-zhang

2005-02-01

To clone the recombinant fusion gene of Escherichia coli heat-liable enterotoxin B subunit (Ltb) and Actinobacillus actinomycetemcomitans fimbria associative protein (Fap). Two couples of primers were designed for PCR according to the known sequence of ltb and fap. The ltb and fap gene were obtained by amplification PCR technique from plasmid EWD299 of Escherichia coli and Actinobacillus actinomycetemcomitans 310 DNA respectively, and fused them by PCR. The fusion gene ltb-fap were cloning into plasmid pET28a(+). The recombined plasmid pET28a ltb-fap was transformed into Escherichia coli DH5alpha. The recombinant was screened and identified by restriction enzyme and PCR. The cloned gene was sequenced. The ltb-fap about 531bp in size was obtained successfully, and identified by PCR, restrictive enzyme and sequence analysis. The vector of pET28a ltb-fap was obtained.

Characterization of bacterial diversity in pulque, a traditional Mexican alcoholic fermented beverage, as determined by 16S rDNA analysis.

PubMed

Escalante, Adelfo; Rodríguez, María Elena; Martínez, Alfredo; López-Munguía, Agustín; Bolívar, Francisco; Gosset, Guillermo

2004-06-15

The bacterial diversity in pulque, a traditional Mexican alcoholic fermented beverage, was studied in 16S rDNA clone libraries from three pulque samples. Sequenced clones identified as Lactobacillus acidophilus, Lactobacillus strain ASF360, L. kefir, L. acetotolerans, L. hilgardii, L. plantarum, Leuconostoc pseudomesenteroides, Microbacterium arborescens, Flavobacterium johnsoniae, Acetobacter pomorium, Gluconobacter oxydans, and Hafnia alvei, were detected for the first time in pulque. Identity of 16S rDNA sequenced clones showed that bacterial diversity present among pulque samples is dominated by Lactobacillus species (80.97%). Seventy-eight clones exhibited less than 95% of relatedness to NCBI database sequences, which may indicate the presence of new species in pulque samples.

Microbial Communities in the Surface Mucopolysaccharide Layer and the Black Band Microbial Mat of Black Band-Diseased Siderastrea siderea

PubMed Central

Sekar, Raju; Mills, DeEtta K.; Remily, Elizabeth R.; Voss, Joshua D.; Richardson, Laurie L.

2006-01-01

Microbial community profiles and species composition associated with two black band-diseased colonies of the coral Siderastrea siderea were studied by 16S rRNA-targeted gene cloning, sequencing, and amplicon-length heterogeneity PCR (LH-PCR). Bacterial communities associated with the surface mucopolysaccharide layer (SML) of apparently healthy tissues of the infected colonies, together with samples of the black band disease (BBD) infections, were analyzed using the same techniques for comparison. Gene sequences, ranging from 424 to 1,537 bp, were retrieved from all positive clones (n = 43 to 48) in each of the four clone libraries generated and used for comparative sequence analysis. In addition to LH-PCR community profiling, all of the clone sequences were aligned with LH-PCR primer sequences, and the theoretical lengths of the amplicons were determined. Results revealed that the community profiles were significantly different between BBD and SML samples. The SML samples were dominated by γ-proteobacteria (53 to 64%), followed by β-proteobacteria (18 to 21%) and α-proteobacteria (5 to 11%). In contrast, both BBD clone libraries were dominated by α-proteobacteria (58 to 87%), followed by verrucomicrobia (2 to 10%) and 0 to 6% each of δ-proteobacteria, bacteroidetes, firmicutes, and cyanobacteria. Alphaproteobacterial sequence types related to the bacteria associated with toxin-producing dinoflagellates were observed in BBD clone libraries but were not found in the SML libraries. Similarly, sequences affiliated with the family Desulfobacteraceae and toxin-producing cyanobacteria, both believed to be involved in BBD pathogenesis, were found only in BBD libraries. These data provide evidence for an association of numerous toxin-producing heterotrophic microorganisms with BBD of corals. PMID:16957217

Molecular cloning and expression of a gene for a factor which stabilizes formation of inhibitor-mitochondrial ATPase complex from Saccharomyces cerevisiae.

PubMed

Akashi, A; Yoshida, Y; Nakagoshi, H; Kuroki, K; Hashimoto, T; Tagawa, K; Imamoto, F

1988-10-01

Stabilizing factor, a 9 kDa protein, stabilizes and facilitates formation of the complex between mitochondrial ATP synthase and its intrinsic inhibitor protein. A clone containing the gene encoding the 9 kDa protein was selected from a yeast genomic library to determine the structure of its precursor protein. As deduced from the nucleotide sequence, the precursor of the yeast 9 kDa stabilizing factor contains 86 amino acid residues and has a molecular weight of 10,062. From the predicted sequence we infer that the stabilizing factor precursor contains a presequence of 23 amino acid residues at its amino terminus. We also used S1 mapping to determine the initiation site of transcription under glucose-repressed or derepressed conditions. These experiments suggest that transcription of this gene starts at three different sites and that only one of them is not affected by the presence of glucose.

Characterization of transformation related genes in oral cancer cells.

PubMed

Chang, D D; Park, N H; Denny, C T; Nelson, S F; Pe, M

1998-04-16

A cDNA representational difference analysis (cDNA-RDA) and an arrayed filter technique were used to characterize transformation-related genes in oral cancer. From an initial comparison of normal oral epithelial cells and a human papilloma virus (HPV)-immortalized oral epithelial cell line, we obtained 384 differentially expressed gene fragments and arrayed them on a filter. Two hundred and twelve redundant clones were identified by three rounds of back hybridization. Sequence analysis of the remaining clones revealed 99 unique clones corresponding to 69 genes. The expression of these transformation related gene fragments in three nontumorigenic HPV-immortalized oral epithelial cell lines and three oral cancer cell lines were simultaneously monitored using a cDNA array hybridization. Although there was a considerable cell line-to-cell line variability in the expression of these clones, a reliable prediction of their expression could be made from the cDNA array hybridization. Our study demonstrates the utility of combining cDNA-RDA and arrayed filters in high-throughput gene expression difference analysis. The differentially expressed genes identified in this study should be informative in studying oral epithelial cell carcinogenesis.

Cloning and characterization of the gene for an additional extracellular serine protease of Bacillus subtilis.

PubMed Central

Sloma, A; Rufo, G A; Theriault, K A; Dwyer, M; Wilson, S W; Pero, J

1991-01-01

We have purified a minor extracellular serine protease from a strain of Bacillus subtilis bearing null mutations in five extracellular protease genes: apr, npr, epr, bpr, and mpr (A. Sloma, C. Rudolph, G. Rufo, Jr., B. Sullivan, K. Theriault, D. Ally, and J. Pero, J. Bacteriol. 172:1024-1029, 1990). During purification, this novel protease (Vpr) was found bound in a complex in the void volume after gel filtration chromatography. The amino-terminal sequence of the purified protein was determined, and an oligonucleotide probe was constructed on the basis of the amino acid sequence. This probe was used to clone the structural gene (vpr) for this protease. The gene encodes a primary product of 806 amino acids. The amino acid sequence of the mature protein was preceded by a signal sequence of approximately 28 amino acids and a prosequence of approximately 132 amino acids. The mature protein has a predicted molecular weight of 68,197; however, the isolated protein has an apparent molecular weight of 28,500, suggesting that Vpr undergoes C-terminal processing or proteolysis. The vpr gene maps in the ctrA-sacA-epr region of the chromosome and is not required for growth or sporulation. Images FIG. 1 PMID:1938892

Molecular approach to annelid regeneration: cDNA subtraction cloning reveals various novel genes that are upregulated during the large-scale regeneration of the oligochaete, Enchytraeus japonensis.

PubMed

Myohara, Maroko; Niva, Cintia Carla; Lee, Jae Min

2006-08-01

To identify genes specifically activated during annelid regeneration, suppression subtractive hybridization was performed with cDNAs from regenerating and intact Enchytraeus japonensis, a terrestrial oligochaete that can regenerate a complete organism from small body fragments within 4-5 days. Filter array screening subsequently revealed that about 38% of the forward-subtracted cDNA clones contained genes that were upregulated during regeneration. Two hundred seventy-nine of these clones were sequenced and found to contain 165 different sequences (79 known and 86 unknown). Nine clones were fully sequenced and four of these sequences were matched to known genes for glutamine synthetase, glucosidase 1, retinal protein 4, and phosphoribosylaminoimidazole carboxylase, respectively. The remaining five clones encoded an unknown open-reading frame. The expression levels of these genes were highest during blastema formation. Our present results, therefore, demonstrate the great potential of annelids as a new experimental subject for the exploration of unknown genes that play critical roles in animal regeneration.

Comparative Sequence Analysis of Plasmids from Lactobacillus delbrueckii and Construction of a Shuttle Cloning Vector▿

PubMed Central

Lee, Ju-Hoon; Halgerson, Jamie S.; Kim, Jeong-Hwan; O'Sullivan, Daniel J.

2007-01-01

While plasmids are very commonly associated with the majority of the lactic acid bacteria, they are only very rarely associated with Lactobacillus delbrueckii, with only four characterized to date. In this study, the complete sequence of a native plasmid, pDOJ1, from a strain of Lactobacillus delbrueckii subsp. bulgaricus was determined. It consisted of a circular DNA molecule of 6,220 bp with a G+C content of 44.6% and a characteristic ori and encoded six open reading frames (ORFs), of which functions could be predicted for three—a mobilization (Mob) protein, a transposase, and a fused primase-helicase replication protein. Comparative analysis of pDOJ1 and the other available L. delbrueckii plasmids (pLBB1, pJBL2, pN42, and pLL1212) revealed a very similar organization and amino acid identities between 85 and 98% for the putative proteins of all six predicted ORFs from pDOJ1, reflecting a common origin for L. delbrueckii plasmids. Analysis of the fused primase-helicase replication gene found a similar fused organization only in the theta replicating group B plasmids from Streptococcus thermophilus. This observation and the ability of the replicon to function in S. thermophilus support the idea that the origin of plasmids in L. delbrueckii was likely from S. thermophilus. This may reflect the close association of these two species in dairy fermentations, particularly yogurt production. As no vector based on plasmid replicons from L. delbrueckii has previously been constructed, an Escherichia coli-L. delbrueckii shuttle cloning vector, pDOJ4, was constructed from pDOJ1, the p15A ori, the chloramphenicol resistance gene of pCI372, and the lacZ polylinker from pUC18. This cloning vector was successfully introduced into E. coli, L. delbrueckii subsp. bulgaricus, S. thermophilus, and Lactococcus lactis. This shuttle cloning vector provides a new tool for molecular analysis of Lactobacillus delbrueckii and other lactic acid bacteria. PMID:17526779

Exploring the loblolly pine (Pinus taeda L.) genome by BAC sequencing and Cot analysis.

PubMed

Perera, Dinum; Magbanua, Zenaida V; Thummasuwan, Supaphan; Mukherjee, Dipaloke; Arick, Mark; Chouvarine, Philippe; Nairn, Campbell J; Schmutz, Jeremy; Grimwood, Jane; Dean, Jeffrey F D; Peterson, Daniel G

2018-07-15

Loblolly pine (LP; Pinus taeda L.) is an economically and ecologically important tree in the southeastern U.S. To advance understanding of the loblolly pine (LP; Pinus taeda L.) genome, we sequenced and analyzed 100 BAC clones and performed a Cot analysis. The Cot analysis indicates that the genome is composed of 57, 24, and 10% highly-repetitive, moderately-repetitive, and single/low-copy sequences, respectively (the remaining 9% of the genome is a combination of fold back and damaged DNA). Although single/low-copy DNA only accounts for 10% of the LP genome, the amount of single/low-copy DNA in LP is still 14 times the size of the Arabidopsis genome. Since gene numbers in LP are similar to those in Arabidopsis, much of the single/low-copy DNA of LP would appear to be composed of DNA that is both gene- and repeat-poor. Macroarrays prepared from a LP bacterial artificial chromosome (BAC) library were hybridized with probes designed from cell wall synthesis/wood development cDNAs, and 50 of the "targeted" clones were selected for further analysis. An additional 25 clones were selected because they contained few repeats, while 25 more clones were selected at random. The 100 BAC clones were Sanger sequenced and assembled. Of the targeted BACs, 80% contained all or part of the cDNA used to target them. One targeted BAC was found to contain fungal DNA and was eliminated from further analysis. Combinations of similarity-based and ab initio gene prediction approaches were utilized to identify and characterize potential coding regions in the 99 BACs containing LP DNA. From this analysis, we identified 154 gene models (GMs) representing both putative protein-coding genes and likely pseudogenes. Ten of the GMs (all of which were specifically targeted) had enough support to be classified as intact genes. Interestingly, the 154 GMs had statistically indistinguishable (α = 0.05) distributions in the targeted and random BAC clones (15.18 and 12.61 GM/Mb, respectively), whereas the low-repeat BACs contained significantly fewer GMs (7.08 GM/Mb). However, when GM length was considered, the targeted BACs had a significantly greater percentage of their length in GMs (3.26%) when compared to random (1.63%) and low-repeat (0.62%) BACs. The results of our study provide insight into LP evolution and inform ongoing efforts to produce a reference genome sequence for LP, while characterization of genes involved in cell wall production highlights carbon metabolism pathways that can be leveraged for increasing wood production. Copyright © 2018 The Authors. Published by Elsevier B.V. All rights reserved.

Molecular analysis of RAPD DNA based markers: their potential use for the detection of genetic variability in jojoba (Simmondsia chinensis L Schneider).

PubMed

Amarger, V; Mercier, L

1995-01-01

We have applied the recently developed technique of random amplified polymorphic DNA (RAPD) for the discrimination between two jojoba clones at the genomic level. Among a set of 30 primers tested, a simple reproducible pattern with three distinct fragments for clone D and two distinct fragments for clone E was obtained with primer OPB08. Since RAPD products are the results of arbitrarily priming events and because a given primer can amplify a number of non-homologous sequences, we wondered whether or not RAPD bands, even those of similar size, were derived from different loci in the two clones. To answer this question, two complementary approaches were used: i) cloning and sequencing of the amplification products from clone E; and ii) complementary Southern analysis of RAPD gels using cloned or amplified fragments (directly recovered from agarose gels) as RFLP probes. The data reported here show that the RAPD reaction generates multiple amplified fragments. Some fragments, although resolved as a single band on agarose gels, contain different DNA species of the same size. Furthermore, it appears that the cloned RAPD products of known sequence that do not target repetitive DNA can be used as hybridization probes in RFLP to detect a polymorphism among individuals.

Genomic cloning and promoter functional analysis of myostatin-2 in shi drum, Umbrina cirrosa: conservation of muscle-specific promoter activity.

PubMed

Nadjar-Boger, Elisabeth; Maccatrozzo, Lisa; Radaelli, Giuseppe; Funkenstein, Bruria

2013-02-01

Myostatin (MSTN) is a member of the transforming growth factor-ß superfamily, known as a negative regulator of skeletal muscle development and growth in mammals. In contrast to mammals, fish possess at least two paralogs of MSTN: MSTN-1 and MSTN-2. Here we describe the cloning and sequence analysis of spliced and precursor (unspliced) transcripts as well as the 5' flanking region of MSTN-2 from the marine fish Umbrina cirrosa (ucMSTN-2). In silico analysis revealed numerous putative cis regulatory elements including several E-boxes known as binding sites to myogenic transcription factors. Transient transfection experiments using non-muscle and muscle cell lines showed high transcriptional activity in muscle cells and in differentiated neural cells, in accordance with our previous findings in MSTN-2 promoter from Sparus aurata. Comparative informatics analysis of MSTN-2 from several fish species revealed high conservation of the predicted amino acid sequence as well as the gene structure (exon length) although intron length varied between species. The proximal promoter of MSTN-2 gene was found to be conserved among Perciforms. In conclusion, this study reinforces our conclusion that MSTN-2 promoter is a very strong promoter, especially in muscle cells. In addition, we show that the MSTN-2 gene structure is highly conserved among fishes as is the predicted amino acid sequence of the peptide. Copyright © 2012 Elsevier Inc. All rights reserved.

Dynamics of the cytotoxic T cell response to a model of acute viral infection.

PubMed

DeWitt, William S; Emerson, Ryan O; Lindau, Paul; Vignali, Marissa; Snyder, Thomas M; Desmarais, Cindy; Sanders, Catherine; Utsugi, Heidi; Warren, Edus H; McElrath, Juliana; Makar, Karen W; Wald, Anna; Robins, Harlan S

2015-04-01

A detailed characterization of the dynamics and breadth of the immune response to an acute viral infection, as well as the determinants of recruitment to immunological memory, can greatly contribute to our basic understanding of the mechanics of the human immune system and can ultimately guide the design of effective vaccines. In addition to neutralizing antibodies, T cells have been shown to be critical for the effective resolution of acute viral infections. We report the first in-depth analysis of the dynamics of the CD8(+) T cell repertoire at the level of individual T cell clonal lineages upon vaccination of human volunteers with a single dose of YF-17D. This live attenuated yellow fever virus vaccine yields sterile, long-term immunity and has been previously used as a model to understand the immune response to a controlled acute viral infection. We identified and enumerated unique CD8(+) T cell clones specifically induced by this vaccine through a combined experimental and statistical approach that included high-throughput sequencing of the CDR3 variable region of the T cell receptor β-chain and an algorithm that detected significantly expanded T cell clones. This allowed us to establish that (i) on average, ∼ 2,000 CD8(+) T cell clones were induced by YF-17D, (ii) 5 to 6% of the responding clones were recruited to long-term memory 3 months postvaccination, (iii) the most highly expanded effector clones were preferentially recruited to the memory compartment, and (iv) a fraction of the YF-17D-induced clones could be identified from peripheral blood lymphocytes solely by measuring clonal expansion. The exhaustive investigation of pathogen-induced effector T cells is essential to accurately quantify the dynamics of the human immune response. The yellow fever vaccine (YFV) has been broadly used as a model to understand how a controlled, self-resolving acute viral infection induces an effective and long-term protective immune response. Here, we extend this previous work by reporting the identity of activated effector T cell clones that expand in response to the YFV 2 weeks postvaccination (as defined by their unique T cell receptor gene sequence) and by tracking clones that enter the memory compartment 3 months postvaccination. This is the first study to use high-throughput sequencing of immune cells to characterize the breadth of the antiviral effector cell response and to determine the contribution of unique virus-induced clones to the long-lived memory T cell repertoire. Thus, this study establishes a benchmark against which future vaccines can be compared to predict their efficacy. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

Dynamics of the Cytotoxic T Cell Response to a Model of Acute Viral Infection

PubMed Central

DeWitt, William S.; Emerson, Ryan O.; Lindau, Paul; Vignali, Marissa; Snyder, Thomas M.; Desmarais, Cindy; Sanders, Catherine; Utsugi, Heidi; Warren, Edus H.; McElrath, Juliana; Makar, Karen W.; Wald, Anna

2015-01-01

ABSTRACT A detailed characterization of the dynamics and breadth of the immune response to an acute viral infection, as well as the determinants of recruitment to immunological memory, can greatly contribute to our basic understanding of the mechanics of the human immune system and can ultimately guide the design of effective vaccines. In addition to neutralizing antibodies, T cells have been shown to be critical for the effective resolution of acute viral infections. We report the first in-depth analysis of the dynamics of the CD8+ T cell repertoire at the level of individual T cell clonal lineages upon vaccination of human volunteers with a single dose of YF-17D. This live attenuated yellow fever virus vaccine yields sterile, long-term immunity and has been previously used as a model to understand the immune response to a controlled acute viral infection. We identified and enumerated unique CD8+ T cell clones specifically induced by this vaccine through a combined experimental and statistical approach that included high-throughput sequencing of the CDR3 variable region of the T cell receptor β-chain and an algorithm that detected significantly expanded T cell clones. This allowed us to establish that (i) on average, ∼2,000 CD8+ T cell clones were induced by YF-17D, (ii) 5 to 6% of the responding clones were recruited to long-term memory 3 months postvaccination, (iii) the most highly expanded effector clones were preferentially recruited to the memory compartment, and (iv) a fraction of the YF-17D-induced clones could be identified from peripheral blood lymphocytes solely by measuring clonal expansion. IMPORTANCE The exhaustive investigation of pathogen-induced effector T cells is essential to accurately quantify the dynamics of the human immune response. The yellow fever vaccine (YFV) has been broadly used as a model to understand how a controlled, self-resolving acute viral infection induces an effective and long-term protective immune response. Here, we extend this previous work by reporting the identity of activated effector T cell clones that expand in response to the YFV 2 weeks postvaccination (as defined by their unique T cell receptor gene sequence) and by tracking clones that enter the memory compartment 3 months postvaccination. This is the first study to use high-throughput sequencing of immune cells to characterize the breadth of the antiviral effector cell response and to determine the contribution of unique virus-induced clones to the long-lived memory T cell repertoire. Thus, this study establishes a benchmark against which future vaccines can be compared to predict their efficacy. PMID:25653453

Function-based classification of carbohydrate-active enzymes by recognition of short, conserved peptide motifs.

PubMed

Busk, Peter Kamp; Lange, Lene

2013-06-01

Functional prediction of carbohydrate-active enzymes is difficult due to low sequence identity. However, similar enzymes often share a few short motifs, e.g., around the active site, even when the overall sequences are very different. To exploit this notion for functional prediction of carbohydrate-active enzymes, we developed a simple algorithm, peptide pattern recognition (PPR), that can divide proteins into groups of sequences that share a set of short conserved sequences. When this method was used on 118 glycoside hydrolase 5 proteins with 9% average pairwise identity and representing four characterized enzymatic functions, 97% of the proteins were sorted into groups correlating with their enzymatic activity. Furthermore, we analyzed 8,138 glycoside hydrolase 13 proteins including 204 experimentally characterized enzymes with 28 different functions. There was a 91% correlation between group and enzyme activity. These results indicate that the function of carbohydrate-active enzymes can be predicted with high precision by finding short, conserved motifs in their sequences. The glycoside hydrolase 61 family is important for fungal biomass conversion, but only a few proteins of this family have been functionally characterized. Interestingly, PPR divided 743 glycoside hydrolase 61 proteins into 16 subfamilies useful for targeted investigation of the function of these proteins and pinpointed three conserved motifs with putative importance for enzyme activity. Furthermore, the conserved sequences were useful for cloning of new, subfamily-specific glycoside hydrolase 61 proteins from 14 fungi. In conclusion, identification of conserved sequence motifs is a new approach to sequence analysis that can predict carbohydrate-active enzyme functions with high precision.

Molecular cloning of chitinase 33 (chit33) gene from Trichoderma atroviride

PubMed Central

Matroudi, S.; Zamani, M.R.; Motallebi, M.

2008-01-01

In this study Trichoderma atroviride was selected as over producer of chitinase enzyme among 30 different isolates of Trichoderma sp. on the basis of chitinase specific activity. From this isolate the genomic and cDNA clones encoding chit33 have been isolated and sequenced. Comparison of genomic and cDNA sequences for defining gene structure indicates that this gene contains three short introns and also an open reading frame coding for a protein of 321 amino acids. The deduced amino acid sequence includes a 19 aa putative signal peptide. Homology between this sequence and other reported Trichoderma Chit33 proteins are discussed. The coding sequence of chit33 gene was cloned in pEt26b(+) expression vector and expressed in E. coli. PMID:24031242

Predicted cycloartenol synthase protein from Kandelia obovata and Rhizophora stylosa using online software of Phyre2 and Swiss-model

NASA Astrophysics Data System (ADS)

Basyuni, M.; Sulistiyono, N.; Wati, R.; Sumardi; Oku, H.; Baba, S.; Sagami, H.

2018-03-01

Cloning of Kandelia obovata KcCAS gene (previously known as Kandelia candel) and Rhizophora stylosa RsCAS have already have been reported and encoded cycloartenol synthases. In this study, the predicted KcCAS and RsCAS protein were analyzed using online software of Phyre2 and Swiss-model. The protein modelling for KcCAS and RsCAS cycloartenol synthases was determined using Pyre2 had similar results with slightly different in sequence identity. By contrast, the Swiss-model for KcCAS slightly had higher sequence identity (47.31%) and Qmean (0.70) compared to RsCAS. No difference of ligands binding site which is considered as modulators for both cycloartenol synthases. The range of predicted protein derived from 91-757 amino acid residues with coverage sequence similarities 0.86, respectively from template model of lanosterol synthase from the human. Homology modelling revealed that 706 residues (93% of the amino acid sequence) had been modelled with 100.0% confidence by the single highest scoring template for both KcCAS and RsCAS using Phyre2. This coverage was more elevated than swiss-model predicted (86%). The present study suggested that both genes are responsible for the genesis of cycloartenol in these mangrove plants.

Microbial community analysis of a coastal hot spring in Kagoshima, Japan, using molecular- and culture-based approaches.

PubMed

Nishiyama, Minako; Yamamoto, Shuichi; Kurosawa, Norio

2013-08-01

Ibusuki hot spring is located on the coastline of Kagoshima Bay, Japan. The hot spring water is characterized by high salinity, high temperature, and neutral pH. The hot spring is covered by the sea during high tide, which leads to severe fluctuations in several environmental variables. A combination of molecular- and culture-based techniques was used to determine the bacterial and archaeal diversity of the hot spring. A total of 48 thermophilic bacterial strains were isolated from two sites (Site 1: 55.6°C; Site 2: 83.1°C) and they were categorized into six groups based on their 16S rRNA gene sequence similarity. Two groups (including 32 isolates) demonstrated low sequence similarity with published species, suggesting that they might represent novel taxa. The 148 clones from the Site 1 bacterial library included 76 operational taxonomy units (OTUs; 97% threshold), while 132 clones from the Site 2 bacterial library included 31 OTUs. Proteobacteria, Bacteroidetes, and Firmicutes were frequently detected in both clone libraries. The clones were related to thermophilic, mesophilic and psychrophilic bacteria. Approximately half of the sequences in bacterial clone libraries shared <92% sequence similarity with their closest sequences in a public database, suggesting that the Ibusuki hot spring may harbor a unique and novel bacterial community. By contrast, 77 clones from the Site 2 archaeal library contained only three OTUs, most of which were affiliated with Thaumarchaeota.

Sequence Typing Confirms that a Predominant Listeria monocytogenes Clone Caused Human Listeriosis Cases and Outbreaks in Canada from 1988 to 2010

PubMed Central

Reimer, Aleisha; Verghese, Bindhu; Lok, Mei; Ziegler, Jennifer; Farber, Jeffrey; Pagotto, Franco; Graham, Morag; Nadon, Celine A.

2012-01-01

Human listeriosis outbreaks in Canada have been predominantly caused by serotype 1/2a isolates with highly similar pulsed-field gel electrophoresis (PFGE) patterns. Multilocus sequence typing (MLST) and multi-virulence-locus sequence typing (MVLST) each identified a diverse population of Listeria monocytogenes isolates, and within that, both methods had congruent subtypes that substantiated a predominant clone (clonal complex 8; virulence type 59; proposed epidemic clone 5 [ECV]) that has been causing human illness across Canada for more than 2 decades. PMID:22337989

Combined Use of 16S Ribosomal DNA and 16S rRNA To Study the Bacterial Community of Polychlorinated Biphenyl-Polluted Soil

PubMed Central

Nogales, Balbina; Moore, Edward R. B.; Llobet-Brossa, Enrique; Rossello-Mora, Ramon; Amann, Rudolf; Timmis, Kenneth N.

2001-01-01

The bacterial diversity assessed from clone libraries prepared from rRNA (two libraries) and ribosomal DNA (rDNA) (one library) from polychlorinated biphenyl (PCB)-polluted soil has been analyzed. A good correspondence of the community composition found in the two types of library was observed. Nearly 29% of the cloned sequences in the rDNA library were identical to sequences in the rRNA libraries. More than 60% of the total cloned sequence types analyzed were grouped in phylogenetic groups (a clone group with sequence similarity higher than 97% [98% for Burkholderia and Pseudomonas-type clones]) represented in both types of libraries. Some of those phylogenetic groups, mostly represented by a single (or pair) of cloned sequence type(s), were observed in only one of the types of library. An important difference between the libraries was the lack of clones representative of the Actinobacteria in the rDNA library. The PCB-polluted soil exhibited a high bacterial diversity which included representatives of two novel lineages. The apparent abundance of bacteria affiliated to the beta-subclass of the Proteobacteria, and to the genus Burkholderia in particular, was confirmed by fluorescence in situ hybridization analysis. The possible influence on apparent diversity of low template concentrations was assessed by dilution of the RNA template prior to amplification by reverse transcription-PCR. Although differences in the composition of the two rRNA libraries obtained from high and low RNA concentrations were observed, the main components of the bacterial community were represented in both libraries, and therefore their detection was not compromised by the lower concentrations of template used in this study. PMID:11282645

Sequence verification of synthetic DNA by assembly of sequencing reads

PubMed Central

Wilson, Mandy L.; Cai, Yizhi; Hanlon, Regina; Taylor, Samantha; Chevreux, Bastien; Setubal, João C.; Tyler, Brett M.; Peccoud, Jean

2013-01-01

Gene synthesis attempts to assemble user-defined DNA sequences with base-level precision. Verifying the sequences of construction intermediates and the final product of a gene synthesis project is a critical part of the workflow, yet one that has received the least attention. Sequence validation is equally important for other kinds of curated clone collections. Ensuring that the physical sequence of a clone matches its published sequence is a common quality control step performed at least once over the course of a research project. GenoREAD is a web-based application that breaks the sequence verification process into two steps: the assembly of sequencing reads and the alignment of the resulting contig with a reference sequence. GenoREAD can determine if a clone matches its reference sequence. Its sophisticated reporting features help identify and troubleshoot problems that arise during the sequence verification process. GenoREAD has been experimentally validated on thousands of gene-sized constructs from an ORFeome project, and on longer sequences including whole plasmids and synthetic chromosomes. Comparing GenoREAD results with those from manual analysis of the sequencing data demonstrates that GenoREAD tends to be conservative in its diagnostic. GenoREAD is available at www.genoread.org. PMID:23042248

Ultra-low background DNA cloning system.

PubMed

Goto, Kenta; Nagano, Yukio

2013-01-01

Yeast-based in vivo cloning is useful for cloning DNA fragments into plasmid vectors and is based on the ability of yeast to recombine the DNA fragments by homologous recombination. Although this method is efficient, it produces some by-products. We have developed an "ultra-low background DNA cloning system" on the basis of yeast-based in vivo cloning, by almost completely eliminating the generation of by-products and applying the method to commonly used Escherichia coli vectors, particularly those lacking yeast replication origins and carrying an ampicillin resistance gene (Amp(r)). First, we constructed a conversion cassette containing the DNA sequences in the following order: an Amp(r) 5' UTR (untranslated region) and coding region, an autonomous replication sequence and a centromere sequence from yeast, a TRP1 yeast selectable marker, and an Amp(r) 3' UTR. This cassette allowed conversion of the Amp(r)-containing vector into the yeast/E. coli shuttle vector through use of the Amp(r) sequence by homologous recombination. Furthermore, simultaneous transformation of the desired DNA fragment into yeast allowed cloning of this DNA fragment into the same vector. We rescued the plasmid vectors from all yeast transformants, and by-products containing the E. coli replication origin disappeared. Next, the rescued vectors were transformed into E. coli and the by-products containing the yeast replication origin disappeared. Thus, our method used yeast- and E. coli-specific "origins of replication" to eliminate the generation of by-products. Finally, we successfully cloned the DNA fragment into the vector with almost 100% efficiency.

Molecular cloning of actin genes in Trichomonas vaginalis and phylogeny inferred from actin sequences.

PubMed

Bricheux, G; Brugerolle, G

1997-08-01

The parasitic protozoan Trichomonas vaginalis is known to contain the ubiquitous and highly conserved protein actin. A genomic library and a cDNA library have been screened to identify and clone the actin gene(s) of T. vaginalis. The nucleotide sequence of one gene and its flanking regions have been determined. The open reading frame encodes a protein of 376 amino acids. The sequence is not interrupted by any introns and the promoter could be represented by a 10 bp motif close to a consensus motif also found upstream of most sequenced T. vaginalis genes. The five different clones isolated from the cDNA library have similar sequences and encode three actin proteins differing only by one or two amino acids. A phylogenetic analysis of 31 actin sequences by distance matrix and parsimony methods, using centractin as outgroup, gives congruent trees with Parabasala branching above Diplomonadida.

Cloning and sequencing of a laccase gene from the lignin-degrading basidiomycete Pleurotus ostreatus.

PubMed Central

Giardina, P; Cannio, R; Martirani, L; Marzullo, L; Palmieri, G; Sannia, G

1995-01-01

The gene (pox1) encoding a phenol oxidase from Pleurotus ostreatus, a lignin-degrading basidiomycete, was cloned and sequenced, and the corresponding pox1 cDNA was also synthesized and sequenced. The isolated gene consists of 2,592 bp, with the coding sequence being interrupted by 19 introns and flanked by an upstream region in which putative CAAT and TATA consensus sequences could be identified at positions -174 and -84, respectively. The isolation of a second cDNA (pox2 cDNA), showing 84% similarity, and of the corresponding truncated genomic clones demonstrated the existence of a multigene family coding for isoforms of laccase in P. ostreatus. PCR amplifications of specific regions on the DNA of isolated monokaryons proved that the two genes are not allelic forms. The POX1 amino acid sequence deduced was compared with those of other known laccases from different fungi. PMID:7793961

Variations on a theme of Lander and Waterman

DOE Office of Scientific and Technical Information (OSTI.GOV)

Speed, T.

1997-12-01

The original Lander and Waterman mathematical analysis was for fingerprinting random clones. Since that time, a number of variants of their theory have appeared, including ones which apply to mapping by anchoring random clones, and to non-random or directed clone mapping. The same theory is now widely used to devise random sequencing strategies. In this talk I will review these developments, and go on the discuss the theory required for directed sequencing strategies.

The Release 6 reference sequence of the Drosophila melanogaster genome

DOE PAGES

Hoskins, Roger A.; Carlson, Joseph W.; Wan, Kenneth H.; ...

2015-01-14

Drosophila melanogaster plays an important role in molecular, genetic, and genomic studies of heredity, development, metabolism, behavior, and human disease. The initial reference genome sequence reported more than a decade ago had a profound impact on progress in Drosophila research, and improving the accuracy and completeness of this sequence continues to be important to further progress. We previously described improvement of the 117-Mb sequence in the euchromatic portion of the genome and 21 Mb in the heterochromatic portion, using a whole-genome shotgun assembly, BAC physical mapping, and clone-based finishing. Here, we report an improved reference sequence of the single-copy andmore » middle-repetitive regions of the genome, produced using cytogenetic mapping to mitotic and polytene chromosomes, clone-based finishing and BAC fingerprint verification, ordering of scaffolds by alignment to cDNA sequences, incorporation of other map and sequence data, and validation by whole-genome optical restriction mapping. These data substantially improve the accuracy and completeness of the reference sequence and the order and orientation of sequence scaffolds into chromosome arm assemblies. Representation of the Y chromosome and other heterochromatic regions is particularly improved. The new 143.9-Mb reference sequence, designated Release 6, effectively exhausts clone-based technologies for mapping and sequencing. Highly repeat-rich regions, including large satellite blocks and functional elements such as the ribosomal RNA genes and the centromeres, are largely inaccessible to current sequencing and assembly methods and remain poorly represented. In conclusion, further significant improvements will require sequencing technologies that do not depend on molecular cloning and that produce very long reads.« less

The Release 6 reference sequence of the Drosophila melanogaster genome

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hoskins, Roger A.; Carlson, Joseph W.; Wan, Kenneth H.

Drosophila melanogaster plays an important role in molecular, genetic, and genomic studies of heredity, development, metabolism, behavior, and human disease. The initial reference genome sequence reported more than a decade ago had a profound impact on progress in Drosophila research, and improving the accuracy and completeness of this sequence continues to be important to further progress. We previously described improvement of the 117-Mb sequence in the euchromatic portion of the genome and 21 Mb in the heterochromatic portion, using a whole-genome shotgun assembly, BAC physical mapping, and clone-based finishing. Here, we report an improved reference sequence of the single-copy andmore » middle-repetitive regions of the genome, produced using cytogenetic mapping to mitotic and polytene chromosomes, clone-based finishing and BAC fingerprint verification, ordering of scaffolds by alignment to cDNA sequences, incorporation of other map and sequence data, and validation by whole-genome optical restriction mapping. These data substantially improve the accuracy and completeness of the reference sequence and the order and orientation of sequence scaffolds into chromosome arm assemblies. Representation of the Y chromosome and other heterochromatic regions is particularly improved. The new 143.9-Mb reference sequence, designated Release 6, effectively exhausts clone-based technologies for mapping and sequencing. Highly repeat-rich regions, including large satellite blocks and functional elements such as the ribosomal RNA genes and the centromeres, are largely inaccessible to current sequencing and assembly methods and remain poorly represented. In conclusion, further significant improvements will require sequencing technologies that do not depend on molecular cloning and that produce very long reads.« less

Generating an Open Reading Frame (ORF) Entry Clone and Destination Clone.

PubMed

Reece-Hoyes, John S; Walhout, Albertha J M

2018-01-02

This protocol describes using the Gateway recombinatorial cloning system to create an Entry clone carrying an open reading frame (ORF) and then to transfer the ORF into a Destination vector. In this example, BP recombination is used to clone an ORF from a cDNA source into the Donor vector pDONR 221. The ORF from the resulting Entry clone is then transferred into the Destination vector pDEST-15; the product (the Destination clone) will express the ORF as an amino-terminal GST-fusion. The technique can be used as a guide for cloning any other DNA fragment of interest-a promoter sequence or 3' untranslated region (UTR), for example-with substitutions of different genetic material such as genomic DNA, att sites, and vectors as required. The series of constructions and transformations requires 9-15 d, not including time that may be required for sequence confirmation, if desired/necessary. © 2018 Cold Spring Harbor Laboratory Press.

DNA sequences and composition from 12 BAC clones-derived MUSB SSR markers mapped to cotton (Gossypium Hirsutum L. x G. Barbadense L.)chromosomes 11 and 21

USDA-ARS?s Scientific Manuscript database

To discover resistance (R) and/or pathogen-induced (PR) genes involved in disease response, 12 bacterial artificial chromosome (BAC) clones from cv. Acala Maxxa (G. hirsutum) were sequenced at the Clemson University, Genomics Institute, Clemson, SC. These BACs derived MUSB single sequence repeat (SS...

Characterization of the in vitro expressed autoimmune rippling muscle disease immunogenic domain of human titin encoded by TTN exons 248-249

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zelinka, L.; McCann, S.; Budde, J.

2011-08-05

Highlights: {yields} Affinity purification of the autoimmune rippling muscle disease immunogenic domain of titin. {yields} Partial sequence analysis confirms that the peptides is in the I band region of titin. {yields} This region of the human titin shows high degree of homology to mouse titin N2-A. -- Abstract: Autoimmune rippling muscle disease (ARMD) is an autoimmune neuromuscular disease associated with myasthenia gravis (MG). Past studies in our laboratory recognized a very high molecular weight skeletal muscle protein antigen identified by ARMD patient antisera as the titin isoform. These past studies used antisera from ARMD and MG patients as probes tomore » screen a human skeletal muscle cDNA library and several pBluescript clones revealed supporting expression of immunoreactive peptides. This study characterizes the products of subcloning the titin immunoreactive domain into pGEX-3X and the subsequent fusion protein. Sequence analysis of the fusion gene indicates the cloned titin domain (GenBank ID: (EU428784)) is in frame and is derived from a sequence of N2-A spanning the exons 248-250 an area that encodes the fibronectin III domain. PCR and EcoR1 restriction mapping studies have demonstrated that the inserted cDNA is of a size that is predicted by bioinformatics analysis of the subclone. Expression of the fusion protein result in the isolation of a polypeptide of 52 kDa consistent with the predicted inferred amino acid sequence. Immunoblot experiments of the fusion protein, using rippling muscle/myasthenia gravis antisera, demonstrate that only the titin domain is immunoreactive.« less

Bacterial Artificial Chromosome Libraries for Mouse Sequencing and Functional Analysis

PubMed Central

Osoegawa, Kazutoyo; Tateno, Minako; Woon, Peng Yeong; Frengen, Eirik; Mammoser, Aaron G.; Catanese, Joseph J.; Hayashizaki, Yoshihide; de Jong, Pieter J.

2000-01-01

Bacterial artificial chromosome (BAC) and P1-derived artificial chromosome (PAC) libraries providing a combined 33-fold representation of the murine genome have been constructed using two different restriction enzymes for genomic digestion. A large-insert PAC library was prepared from the 129S6/SvEvTac strain in a bacterial/mammalian shuttle vector to facilitate functional gene studies. For genome mapping and sequencing, we prepared BAC libraries from the 129S6/SvEvTac and the C57BL/6J strains. The average insert sizes for the three libraries range between 130 kb and 200 kb. Based on the numbers of clones and the observed average insert sizes, we estimate each library to have slightly in excess of 10-fold genome representation. The average number of clones found after hybridization screening with 28 probes was in the range of 9–14 clones per marker. To explore the fidelity of the genomic representation in the three libraries, we analyzed three contigs, each established after screening with a single unique marker. New markers were established from the end sequences and screened against all the contig members to determine if any of the BACs and PACs are chimeric or rearranged. Only one chimeric clone and six potential deletions have been observed after extensive analysis of 113 PAC and BAC clones. Seventy-one of the 113 clones were conclusively nonchimeric because both end markers or sequences were mapped to the other confirmed contig members. We could not exclude chimerism for the remaining 41 clones because one or both of the insert termini did not contain unique sequence to design markers. The low rate of chimerism, ∼1%, and the low level of detected rearrangements support the anticipated usefulness of the BAC libraries for genome research. [The sequence data described in this paper have been submitted to the GenBank data library under accession numbers AQ797173–AQ797398.] PMID:10645956

Analysis of Two Cosmid Clones from Chromosome 4 of Drosophila melanogaster Reveals Two New Genes Amid an Unusual Arrangement of Repeated Sequences

PubMed Central

Locke, John; Podemski, Lynn; Roy, Ken; Pilgrim, David; Hodgetts, Ross

1999-01-01

Chromosome 4 from Drosophila melanogaster has several unusual features that distinguish it from the other chromosomes. These include a diffuse appearance in salivary gland polytene chromosomes, an absence of recombination, and the variegated expression of P-element transgenes. As part of a larger project to understand these properties, we are assembling a physical map of this chromosome. Here we report the sequence of two cosmids representing ∼5% of the polytenized region. Both cosmid clones contain numerous repeated DNA sequences, as identified by cross hybridization with labeled genomic DNA, BLAST searches, and dot matrix analysis, which are positioned between and within the transcribed sequences. The repetitive sequences include three copies of the mobile element Hoppel, one copy of the mobile element HB, and 18 DINE repeats. DINE is a novel, short repeated sequence dispersed throughout both cosmid sequences. One cosmid includes the previously described cubitus interruptus (ci) gene and two new genes: that a gene with a predicted amino acid sequence similar to ribosomal protein S3a which is consistent with the Minute(4)101 locus thought to be in the region, and a novel member of the protein family that includes plexin and met–hepatocyte growth factor receptor. The other cosmid contains only the two short 5′-most exons from the zinc-finger-homolog-2 (zfh-2) gene. This is the first extensive sequence analysis of noncoding DNA from chromosome 4. The distribution of the various repeats suggests its organization is similar to the β-heterochromatic regions near the base of the major chromosome arms. Such a pattern may account for the diffuse banding of the polytene chromosome 4 and the variegation of many P-element transgenes on the chromosome. PMID:10022978

Depletion of Unwanted Nucleic Acid Templates by Selective Cleavage: LNAzymes, Catalytically Active Oligonucleotides Containing Locked Nucleic Acids, Open a New Window for Detecting Rare Microbial Community Members

PubMed Central

Dolinšek, Jan; Dorninger, Christiane; Lagkouvardos, Ilias; Wagner, Michael

2013-01-01

Many studies of molecular microbial ecology rely on the characterization of microbial communities by PCR amplification, cloning, sequencing, and phylogenetic analysis of genes encoding rRNAs or functional marker enzymes. However, if the established clone libraries are dominated by one or a few sequence types, the cloned diversity is difficult to analyze by random clone sequencing. Here we present a novel approach to deplete unwanted sequence types from complex nucleic acid mixtures prior to cloning and downstream analyses. It employs catalytically active oligonucleotides containing locked nucleic acids (LNAzymes) for the specific cleavage of selected RNA targets. When combined with in vitro transcription and reverse transcriptase PCR, this LNAzyme-based technique can be used with DNA or RNA extracts from microbial communities. The simultaneous application of more than one specific LNAzyme allows the concurrent depletion of different sequence types from the same nucleic acid preparation. This new method was evaluated with defined mixtures of cloned 16S rRNA genes and then used to identify accompanying bacteria in an enrichment culture dominated by the nitrite oxidizer “Candidatus Nitrospira defluvii.” In silico analysis revealed that the majority of publicly deposited rRNA-targeted oligonucleotide probes may be used as specific LNAzymes with no or only minor sequence modifications. This efficient and cost-effective approach will greatly facilitate tasks such as the identification of microbial symbionts in nucleic acid preparations dominated by plastid or mitochondrial rRNA genes from eukaryotic hosts, the detection of contaminants in microbial cultures, and the analysis of rare organisms in microbial communities of highly uneven composition. PMID:23263968

Comparison of methanogen diversity of yak (Bos grunniens) and cattle (Bos taurus) from the Qinghai-Tibetan plateau, China.

PubMed

Huang, Xiao Dan; Tan, Hui Yin; Long, Ruijun; Liang, Juan Boo; Wright, André-Denis G

2012-10-19

Methane emissions by methanogen from livestock ruminants have significantly contributed to the agricultural greenhouse gas effect. It is worthwhile to compare methanogen from "energy-saving" animal (yak) and normal animal (cattle) in order to investigate the link between methanogen structure and low methane production. Diversity of methanogens from the yak and cattle rumen was investigated by analysis of 16S rRNA gene sequences from rumen digesta samples from four yaks (209 clones) and four cattle (205 clones) from the Qinghai-Tibetan Plateau area (QTP). Overall, a total of 414 clones (i.e. sequences) were examined and assigned to 95 operational taxonomic units (OTUs) using MOTHUR, based upon a 98% species-level identity criterion. Forty-six OTUs were unique to the yak clone library and 34 OTUs were unique to the cattle clone library, while 15 OTUs were found in both libraries. Of the 95 OTUs, 93 putative new species were identified. Sequences belonging to the Thermoplasmatales-affiliated Linage C (TALC) were found to dominate in both libraries, accounting for 80.9% and 62.9% of the sequences from the yak and cattle clone libraries, respectively. Sequences belonging to the Methanobacteriales represented the second largest clade in both libraries. However, Methanobrevibacter wolinii (QTPC 110) was only found in the cattle library. The number of clones from the order Methanomicrobiales was greater in cattle than in the yak clone library. Although the Shannon index value indicated similar diversity between the two libraries, the Libshuff analysis indicated that the methanogen community structure of the yak was significantly different than those from cattle. This study revealed for the first time the molecular diversity of methanogen community in yaks and cattle in Qinghai-Tibetan Plateau area in China. From the analysis, we conclude that yaks have a unique rumen microbial ecosystem that is significantly different from that of cattle, this may also help to explain why yak produce less methane than cattle.

Comparison of methanogen diversity of yak (Bos grunniens) and cattle (Bos taurus) from the Qinghai-Tibetan plateau, China

PubMed Central

2012-01-01

Background Methane emissions by methanogen from livestock ruminants have significantly contributed to the agricultural greenhouse gas effect. It is worthwhile to compare methanogen from “energy-saving” animal (yak) and normal animal (cattle) in order to investigate the link between methanogen structure and low methane production. Results Diversity of methanogens from the yak and cattle rumen was investigated by analysis of 16S rRNA gene sequences from rumen digesta samples from four yaks (209 clones) and four cattle (205 clones) from the Qinghai-Tibetan Plateau area (QTP). Overall, a total of 414 clones (i.e. sequences) were examined and assigned to 95 operational taxonomic units (OTUs) using MOTHUR, based upon a 98% species-level identity criterion. Forty-six OTUs were unique to the yak clone library and 34 OTUs were unique to the cattle clone library, while 15 OTUs were found in both libraries. Of the 95 OTUs, 93 putative new species were identified. Sequences belonging to the Thermoplasmatales-affiliated Linage C (TALC) were found to dominate in both libraries, accounting for 80.9% and 62.9% of the sequences from the yak and cattle clone libraries, respectively. Sequences belonging to the Methanobacteriales represented the second largest clade in both libraries. However, Methanobrevibacter wolinii (QTPC 110) was only found in the cattle library. The number of clones from the order Methanomicrobiales was greater in cattle than in the yak clone library. Although the Shannon index value indicated similar diversity between the two libraries, the Libshuff analysis indicated that the methanogen community structure of the yak was significantly different than those from cattle. Conclusion This study revealed for the first time the molecular diversity of methanogen community in yaks and cattle in Qinghai-Tibetan Plateau area in China. From the analysis, we conclude that yaks have a unique rumen microbial ecosystem that is significantly different from that of cattle, this may also help to explain why yak produce less methane than cattle. PMID:23078429

Shedding genomic light on Aristotle's lantern.

PubMed

Sodergren, Erica; Shen, Yufeng; Song, Xingzhi; Zhang, Lan; Gibbs, Richard A; Weinstock, George M

2006-12-01

Sea urchins have proved fascinating to biologists since the time of Aristotle who compared the appearance of their bony mouth structure to a lantern in The History of Animals. Throughout modern times it has been a model system for research in developmental biology. Now, the genome of the sea urchin Strongylocentrotus purpuratus is the first echinoderm genome to be sequenced. A high quality draft sequence assembly was produced using the Atlas assembler to combine whole genome shotgun sequences with sequences from a collection of BACs selected to form a minimal tiling path along the genome. A formidable challenge was presented by the high degree of heterozygosity between the two haplotypes of the selected male representative of this marine organism. This was overcome by use of the BAC tiling path backbone, in which each BAC represents a single haplotype, as well as by improvements in the Atlas software. Another innovation introduced in this project was the sequencing of pools of tiling path BACs rather than individual BAC sequencing. The Clone-Array Pooled Shotgun Strategy greatly reduced the cost and time devoted to preparing shotgun libraries from BAC clones. The genome sequence was analyzed with several gene prediction methods to produce a comprehensive gene list that was then manually refined and annotated by a volunteer team of sea urchin experts. This latter annotation community edited over 9000 gene models and uncovered many unexpected aspects of the sea urchin genetic content impacting transcriptional regulation, immunology, sensory perception, and an organism's development. Analysis of the basic deuterostome genetic complement supports the sea urchin's role as a model system for deuterostome and, by extension, chordate development.

A novel pair of immunoglobulin-like receptors expressed by B cells and myeloid cells

PubMed Central

Kubagawa, Hiromi; Burrows, Peter D.; Cooper, Max D.

1997-01-01

An Fcα receptor probe of human origin was used to identify novel members of the Ig gene superfamily in mice. Paired Ig-like receptors, named PIR-A and PIR-B, are predicted from sequence analysis of the cDNAs isolated from a mouse splenic library. Both type I transmembrane proteins possess similar ectodomains with six Ig-like loops, but have different transmembrane and cytoplasmic regions. The predicted PIR-A protein has a short cytoplasmic tail and a charged Arg residue in the transmembrane region that, by analogy with the FcαR relative, suggests the potential for association with an additional transmembrane protein to form a signal transducing unit. In contrast, the PIR-B protein has an uncharged transmembrane region and a long cytoplasmic tail containing four potential immunoreceptor tyrosine-based inhibitory motifs. These features are shared by the related killer inhibitory receptors. PIR-A proteins appear to be highly variable, in that predicted peptide sequences differ for seven randomly selected PIR-A clones, whereas PIR-B cDNA clones are invariant. Southern blot analysis with PIR-B and PIR-A-specific probes suggests only one PIR-B gene and multiple PIR-A genes. The PIR-A and PIR-B genes are expressed in B lymphocytes and myeloid lineage cells, wherein both are expressed simultaneously. The characteristics of the highly-conserved PIR-A and PIR-B genes and their coordinate cellular expression suggest a potential regulatory role in humoral, inflammatory, and allergic responses. PMID:9144225

Combinatorial Pooling Enables Selective Sequencing of the Barley Gene Space

PubMed Central

Lonardi, Stefano; Duma, Denisa; Alpert, Matthew; Cordero, Francesca; Beccuti, Marco; Bhat, Prasanna R.; Wu, Yonghui; Ciardo, Gianfranco; Alsaihati, Burair; Ma, Yaqin; Wanamaker, Steve; Resnik, Josh; Bozdag, Serdar; Luo, Ming-Cheng; Close, Timothy J.

2013-01-01

For the vast majority of species – including many economically or ecologically important organisms, progress in biological research is hampered due to the lack of a reference genome sequence. Despite recent advances in sequencing technologies, several factors still limit the availability of such a critical resource. At the same time, many research groups and international consortia have already produced BAC libraries and physical maps and now are in a position to proceed with the development of whole-genome sequences organized around a physical map anchored to a genetic map. We propose a BAC-by-BAC sequencing protocol that combines combinatorial pooling design and second-generation sequencing technology to efficiently approach denovo selective genome sequencing. We show that combinatorial pooling is a cost-effective and practical alternative to exhaustive DNA barcoding when preparing sequencing libraries for hundreds or thousands of DNA samples, such as in this case gene-bearing minimum-tiling-path BAC clones. The novelty of the protocol hinges on the computational ability to efficiently compare hundred millions of short reads and assign them to the correct BAC clones (deconvolution) so that the assembly can be carried out clone-by-clone. Experimental results on simulated data for the rice genome show that the deconvolution is very accurate, and the resulting BAC assemblies have high quality. Results on real data for a gene-rich subset of the barley genome confirm that the deconvolution is accurate and the BAC assemblies have good quality. While our method cannot provide the level of completeness that one would achieve with a comprehensive whole-genome sequencing project, we show that it is quite successful in reconstructing the gene sequences within BACs. In the case of plants such as barley, this level of sequence knowledge is sufficient to support critical end-point objectives such as map-based cloning and marker-assisted breeding. PMID:23592960

Combinatorial pooling enables selective sequencing of the barley gene space.

PubMed

Lonardi, Stefano; Duma, Denisa; Alpert, Matthew; Cordero, Francesca; Beccuti, Marco; Bhat, Prasanna R; Wu, Yonghui; Ciardo, Gianfranco; Alsaihati, Burair; Ma, Yaqin; Wanamaker, Steve; Resnik, Josh; Bozdag, Serdar; Luo, Ming-Cheng; Close, Timothy J

2013-04-01

For the vast majority of species - including many economically or ecologically important organisms, progress in biological research is hampered due to the lack of a reference genome sequence. Despite recent advances in sequencing technologies, several factors still limit the availability of such a critical resource. At the same time, many research groups and international consortia have already produced BAC libraries and physical maps and now are in a position to proceed with the development of whole-genome sequences organized around a physical map anchored to a genetic map. We propose a BAC-by-BAC sequencing protocol that combines combinatorial pooling design and second-generation sequencing technology to efficiently approach denovo selective genome sequencing. We show that combinatorial pooling is a cost-effective and practical alternative to exhaustive DNA barcoding when preparing sequencing libraries for hundreds or thousands of DNA samples, such as in this case gene-bearing minimum-tiling-path BAC clones. The novelty of the protocol hinges on the computational ability to efficiently compare hundred millions of short reads and assign them to the correct BAC clones (deconvolution) so that the assembly can be carried out clone-by-clone. Experimental results on simulated data for the rice genome show that the deconvolution is very accurate, and the resulting BAC assemblies have high quality. Results on real data for a gene-rich subset of the barley genome confirm that the deconvolution is accurate and the BAC assemblies have good quality. While our method cannot provide the level of completeness that one would achieve with a comprehensive whole-genome sequencing project, we show that it is quite successful in reconstructing the gene sequences within BACs. In the case of plants such as barley, this level of sequence knowledge is sufficient to support critical end-point objectives such as map-based cloning and marker-assisted breeding.

Rapid amplification of 5' complementary DNA ends (5' RACE).

PubMed

2005-08-01

This method is used to extend partial cDNA clones by amplifying the 5' sequences of the corresponding mRNAs 1-3. The technique requires knowledge of only a small region of sequence within the partial cDNA clone. During PCR, the thermostable DNA polymerase is directed to the appropriate target RNA by a single primer derived from the region of known sequence; the second primer required for PCR is complementary to a general feature of the target-in the case of 5' RACE, to a homopolymeric tail added (via terminal transferase) to the 3' termini of cDNAs transcribed from a preparation of mRNA. This synthetic tail provides a primer-binding site upstream of the unknown 5' sequence of the target mRNA. The products of the amplification reaction are cloned into a plasmid vector for sequencing and subsequent manipulation.

CRISPR-Cas9-Edited Site Sequencing (CRES-Seq): An Efficient and High-Throughput Method for the Selection of CRISPR-Cas9-Edited Clones.

PubMed

Veeranagouda, Yaligara; Debono-Lagneaux, Delphine; Fournet, Hamida; Thill, Gilbert; Didier, Michel

2018-01-16

The emergence of clustered regularly interspaced short palindromic repeats-Cas9 (CRISPR-Cas9) gene editing systems has enabled the creation of specific mutants at low cost, in a short time and with high efficiency, in eukaryotic cells. Since a CRISPR-Cas9 system typically creates an array of mutations in targeted sites, a successful gene editing project requires careful selection of edited clones. This process can be very challenging, especially when working with multiallelic genes and/or polyploid cells (such as cancer and plants cells). Here we described a next-generation sequencing method called CRISPR-Cas9 Edited Site Sequencing (CRES-Seq) for the efficient and high-throughput screening of CRISPR-Cas9-edited clones. CRES-Seq facilitates the precise genotyping up to 96 CRISPR-Cas9-edited sites (CRES) in a single MiniSeq (Illumina) run with an approximate sequencing cost of $6/clone. CRES-Seq is particularly useful when multiple genes are simultaneously targeted by CRISPR-Cas9, and also for screening of clones generated from multiallelic genes/polyploid cells. © 2018 by John Wiley & Sons, Inc. Copyright © 2018 John Wiley & Sons, Inc.

Analysis of Facultative Lithotroph Distribution and Diversity on Volcanic Deposits by Use of the Large Subunit of Ribulose 1,5-Bisphosphate Carboxylase/Oxygenase†

PubMed Central

Nanba, K.; King, G. M.; Dunfield, K.

2004-01-01

A 492- to 495-bp fragment of the gene coding for the large subunit of the form I ribulose 1,5-bisphosphate carboxylase/oxygenase (RubisCO) (rbcL) was amplified by PCR from facultatively lithotrophic aerobic CO-oxidizing bacteria, colorless and purple sulfide-oxidizing microbial mats, and genomic DNA extracts from tephra and ash deposits from Kilauea volcano, for which atmospheric CO and hydrogen have been previously documented as important substrates. PCR products from the mats and volcanic sites were used to construct rbcL clone libraries. Phylogenetic analyses showed that the rbcL sequences from all isolates clustered with form IC rbcL sequences derived from facultative lithotrophs. In contrast, the microbial mat clone sequences clustered with sequences from obligate lithotrophs representative of form IA rbcL. Clone sequences from volcanic sites fell within the form IC clade, suggesting that these sites were dominated by facultative lithotrophs, an observation consistent with biogeochemical patterns at the sites. Based on phylogenetic and statistical analyses, clone libraries differed significantly among volcanic sites, indicating that they support distinct lithotrophic assemblages. Although some of the clone sequences were similar to known rbcL sequences, most were novel. Based on nucleotide diversity and average pairwise difference, a forested site and an 1894 lava flow were found to support the most diverse and least diverse lithotrophic populations, respectively. These indices of diversity were not correlated with rates of atmospheric CO and hydrogen uptake but were correlated with estimates of respiration and microbial biomass. PMID:15066819

Analysis of facultative lithotroph distribution and diversity on volcanic deposits by use of the large subunit of ribulose 1,5-bisphosphate carboxylase/oxygenase.

PubMed

Nanba, K; King, G M; Dunfield, K

2004-04-01

A 492- to 495-bp fragment of the gene coding for the large subunit of the form I ribulose 1,5-bisphosphate carboxylase/oxygenase (RubisCO) (rbcL) was amplified by PCR from facultatively lithotrophic aerobic CO-oxidizing bacteria, colorless and purple sulfide-oxidizing microbial mats, and genomic DNA extracts from tephra and ash deposits from Kilauea volcano, for which atmospheric CO and hydrogen have been previously documented as important substrates. PCR products from the mats and volcanic sites were used to construct rbcL clone libraries. Phylogenetic analyses showed that the rbcL sequences from all isolates clustered with form IC rbcL sequences derived from facultative lithotrophs. In contrast, the microbial mat clone sequences clustered with sequences from obligate lithotrophs representative of form IA rbcL. Clone sequences from volcanic sites fell within the form IC clade, suggesting that these sites were dominated by facultative lithotrophs, an observation consistent with biogeochemical patterns at the sites. Based on phylogenetic and statistical analyses, clone libraries differed significantly among volcanic sites, indicating that they support distinct lithotrophic assemblages. Although some of the clone sequences were similar to known rbcL sequences, most were novel. Based on nucleotide diversity and average pairwise difference, a forested site and an 1894 lava flow were found to support the most diverse and least diverse lithotrophic populations, respectively. These indices of diversity were not correlated with rates of atmospheric CO and hydrogen uptake but were correlated with estimates of respiration and microbial biomass.

Cloning and characterization of new bioluminescent proteins

NASA Astrophysics Data System (ADS)

Szent-Gyorgyi, Christopher; Ballou, Byron T.; Dagnal, Erich; Bryan, Bruce

1999-07-01

Over the past two years Prolume has undertaken a comprehensive program to clone luciferases and associated 'green fluorescent proteins' (GFPs) from marine animals that use coelenterazine as the luciferin. To data we have cloned several bioluminescent proteins, including two novel copepod luciferases and two anthozoan GFPs. These four proteins have sequences that differ greatly form previously cloned analogous proteins; the sequence diversity apparently is due to independent evolutionary origins and unusual evolutionary constraints. Thus coelenterazine-based bioluminescent systems may also manifest a variety of useful properties. We discuss form this taxonomic perspective the initial biochemical and spectral characterization of our cloned proteins. Emphasis is placed on the anthozoan luciferase-GFP systems, whose efficient resonance energy transfer has elicited much current interest.

Bioproduction and characterization of extracellular melanin-like pigment from industrially polluted metagenomic library equipped Escherichia coli.

PubMed

Amin, Shivani; Rastogi, Rajesh P; Sonani, Ravi R; Ray, Arabinda; Sharma, Rakesh; Madamwar, Datta

2018-04-15

To explore the potential genes from the industrially polluted Amlakhadi canal, located in Ankleshwar, Gujarat, India, its community genome was extracted and cloned into E. coli EPI300™-T1 R using a fosmid vector (pCC2 FOS™) generating a library of 3,92,000 clones with average size of 40kb of DNA-insert. From this library, the clone DM1 producing brown colored melanin-like pigment was isolated and characterized. For over expression of the pigment, further sub-cloning of the clone DM1 was done. Sub-clone containing 10kb of the insert was sequenced for gene identification. The amino acids sequence of a protein 4-Hydroxyphenylpyruvate dioxygenase (HPPD), which is know to be involved in melanin biosynthesis was obtained from the gene sequence. The sequence-homology based 3D structure model of HPPD was constructed and analyzed. The physico-chemical nature of pigment was further analysed using 1 H and 13 C NMR, LC-MS, FTIR and UV-visible spectroscopy. The pigment was readily soluble in DMSO with an absorption maximum around 290nm. Based on the genetic and chemical characterization, the compound was confirmed as melanin-like pigment. The present results indicate that the metagenomic library from industrially polluted environment generated a microbial tool for the production of melanin-like pigment. Copyright © 2018 Elsevier B.V. All rights reserved.

Cloning of precursors for two MIH/VIH-related peptides in the prawn, Macrobrachium rosenbergii.

PubMed

Yang, W J; Rao, K R

2001-11-30

Two cDNA clones (634 and 1366 bp) encoding MIH/VIH (molt-inhibiting hormone/vitellogenesis-inhibiting hormone)-related peptides were isolated and sequenced from a Macrobrachium rosenbergii eyestalk ganglia cDNA library. The clones contain a 360 and 339 bp open-reading frame, and their conceptually translated peptides consist of a 41 and 34 amino acid signal peptide, respectively, and a 78 amino acid residue mature peptide hormone. The amino acid sequences of the peptides exhibit higher identities with other known MIHs and VIH (44-69%) than with CHHs (28-33%). This is the first report describing the cloning and sequencing of two MIH/VIH-related peptides in a single crustacean species. Transcription of these mRNAs was detected in the eyestalk ganglia, but not in the thoracic ganglia, hepatopancreas, gut, gill, heart, or muscle.

ddClone: joint statistical inference of clonal populations from single cell and bulk tumour sequencing data.

PubMed

Salehi, Sohrab; Steif, Adi; Roth, Andrew; Aparicio, Samuel; Bouchard-Côté, Alexandre; Shah, Sohrab P

2017-03-01

Next-generation sequencing (NGS) of bulk tumour tissue can identify constituent cell populations in cancers and measure their abundance. This requires computational deconvolution of allelic counts from somatic mutations, which may be incapable of fully resolving the underlying population structure. Single cell sequencing (SCS) is a more direct method, although its replacement of NGS is impeded by technical noise and sampling limitations. We propose ddClone, which analytically integrates NGS and SCS data, leveraging their complementary attributes through joint statistical inference. We show on real and simulated datasets that ddClone produces more accurate results than can be achieved by either method alone.

Production and characterization of monoclonal antibodies to IgM of Pacific herring (Clupea pallasii)

USGS Publications Warehouse

Purcell, Maureen K.; Bromage, Erin S.; Silva, Jessica; Hansen, John D.; Badil, Samantha M.; Woodson, James C.; Hershberger, Paul K.

2012-01-01

Pacific herring (Clupea pallasii) have a central role in the North Pacific ecosystem as a forage fish species and are natural reservoirs of several important finfish pathogens, including Viral hemorrhagic septicemia virus (VHSV). Here, we report the identification of the gene encoding the immunoglobulin mu (IgM) heavy chain, as well as the development and characterization of monoclonal antibodies (MAbs) that specifically react with Pacific herring IgM. Pacific herring immunoglobulin was purified and consisted of heavy and light chains of approximately 80 and 25 kDa. Three hybridoma clones were initially identified by ELISA as reactive with purified immunoglobulin but only one clone was able to detect an 80 kDa protein in Pacific and Atlantic herring (Clupea harengus) whole plasma by denaturing western blot. However, all three MAbs were able to precipitate an 80 kDa protein from Pacific herring and LCMS sequencing of peptide fragments derived from this protein matched the predicted amino acid sequence of the cloned, heavy chain gene. In addition, two of the MAbs stained cells within the putative lymphocyte gates for the spleen, anterior kidney and posterior kidney but were not reactive for myeloid/granulocyte gates, which is consistent with these MAbs reacting with surface IgM+ B-cells. To our knowledge, this is the first report of IgM-related gene sequences and anti-IgM monoclonal antibodies from any member of the family Clupeidae. The antibodies produced in this study are critical for achieving our long-term goal of conducting serological surveillance to assess pathogen exposure in natural populations of Pacific herring.

Developing a Bacteroides System for Function-Based Screening of DNA from the Human Gut Microbiome.

PubMed

Lam, Kathy N; Martens, Eric C; Charles, Trevor C

2018-01-01

Functional metagenomics is a powerful method that allows the isolation of genes whose role may not have been predicted from DNA sequence. In this approach, first, environmental DNA is cloned to generate metagenomic libraries that are maintained in Escherichia coli, and second, the cloned DNA is screened for activities of interest. Typically, functional screens are carried out using E. coli as a surrogate host, although there likely exist barriers to gene expression, such as lack of recognition of native promoters. Here, we describe efforts to develop Bacteroides thetaiotaomicron as a surrogate host for screening metagenomic DNA from the human gut. We construct a B. thetaiotaomicron-compatible fosmid cloning vector, generate a fosmid clone library using DNA from the human gut, and show successful functional complementation of a B. thetaiotaomicron glycan utilization mutant. Though we were unable to retrieve the physical fosmid after complementation, we used genome sequencing to identify the complementing genes derived from the human gut microbiome. Our results demonstrate that the use of B. thetaiotaomicron to express metagenomic DNA is promising, but they also exemplify the challenges that can be encountered in the development of new surrogate hosts for functional screening. IMPORTANCE Human gut microbiome research has been supported by advances in DNA sequencing that make it possible to obtain gigabases of sequence data from metagenomes but is limited by a lack of knowledge of gene function that leads to incomplete annotation of these data sets. There is a need for the development of methods that can provide experimental data regarding microbial gene function. Functional metagenomics is one such method, but functional screens are often carried out using hosts that may not be able to express the bulk of the environmental DNA being screened. We expand the range of current screening hosts and demonstrate that human gut-derived metagenomic libraries can be introduced into the gut microbe Bacteroides thetaiotaomicron to identify genes based on activity screening. Our results support the continuing development of genetically tractable systems to obtain information about gene function.

Degradation of triglycerides by a pseudomonad isolated from milk: molecular analysis of a lipase-encoding gene and its expression in Escherichia coli.

PubMed Central

Johnson, L A; Beacham, I R; MacRae, I C; Free, M L

1992-01-01

Psychrotrophic lipolytic bacteria represent a significant problem in the storage of refrigerated dairy products. A lipase-encoding gene has been cloned and characterized from a highly lipolytic strain of Pseudomonas. The nucleotide sequence of the gene predicts a polypeptide of M(r) 49,905, which was identified when the gene was expressed in Escherichia coli. Images PMID:1622251

Structure of the gene encoding VGF, a nervous system-specific mRNA that is rapidly and selectively induced by nerve growth factor in PC12 cells.

PubMed

Salton, S R; Fischberg, D J; Dong, K W

1991-05-01

Nerve growth factor (NGF) plays a critical role in the development and survival of neurons in the peripheral nervous system. Following treatment with NGF but not epidermal growth factor, rat pheochromocytoma (PC12) cells undergo neural differentiation. We have cloned a nervous system-specific mRNA, NGF33.1, that is rapidly and relatively selectively induced by treatment of PC12 cells with NGF and basic fibroblast growth factor in comparison with epidermal growth factor. Analysis of the nucleic acid and predicted amino acid sequences of the NGF33.1 cDNA clone suggested that this clone corresponded to the NGF-inducible mRNA called VGF (A. Levi, J. D. Eldridge, and B. M. Paterson, Science 229:393-395, 1985; R. Possenti, J. D. Eldridge, B. M. Paterson, A. Grasso, and A. Levi, EMBO J. 8:2217-2223, 1989). We have used the NGF33.1 cDNA clone to isolate and characterize the VGF gene, and in this paper we report the complete sequence of the VGF gene, including 853 bases of 5' flank revealed TATAA and CCAAT elements, several GC boxes, and a consensus cyclic AMP response element-binding protein binding site. The VGF promoter contains sequences homologous to other NGF-inducible, neuronal promoters. We further show that VGF mRNA is induced in PC12 cells to a greater extent by depolarization and by phorbol-12-myristate-13-acetate treatment than by 8-bromo-cyclic AMP treatment. By Northern (RNA) and RNase protection analysis, VGF mRNA is detectable in embryonic and postnatal central and peripheral nervous tissues but not in a number of nonneural tissues. In the cascade of events which ultimately leads to the neural differentiation of NGF-treated PC12 cells, the VGF gene encodes the most rapidly and selectively regulated, nervous-system specific mRNA yet identified.

Bacterial community composition in different sediments from the Eastern Mediterranean Sea: a comparison of four 16S ribosomal DNA clone libraries.

PubMed

Polymenakou, Paraskevi N; Bertilsson, Stefan; Tselepides, Anastasios; Stephanou, Euripides G

2005-10-01

The regional variability of sediment bacterial community composition and diversity was studied by comparative analysis of four large 16S ribosomal DNA (rDNA) clone libraries from sediments in different regions of the Eastern Mediterranean Sea (Thermaikos Gulf, Cretan Sea, and South lonian Sea). Amplified rDNA restriction analysis of 664 clones from the libraries indicate that the rDNA richness and evenness was high: for example, a near-1:1 relationship among screened clones and number of unique restriction patterns when up to 190 clones were screened for each library. Phylogenetic analysis of 207 bacterial 16S rDNA sequences from the sediment libraries demonstrated that Gamma-, Delta-, and Alphaproteobacteria, Holophaga/Acidobacteria, Planctomycetales, Actinobacteria, Bacteroidetes, and Verrucomicrobia were represented in all four libraries. A few clones also grouped with the Betaproteobacteria, Nitrospirae, Spirochaetales, Chlamydiae, Firmicutes, and candidate division OPl 1. The abundance of sequences affiliated with Gammaproteobacteria was higher in libraries from shallow sediments in the Thermaikos Gulf (30 m) and the Cretan Sea (100 m) compared to the deeper South Ionian station (2790 m). Most sequences in the four sediment libraries clustered with uncultured 16S rDNA phylotypes from marine habitats, and many of the closest matches were clones from hydrocarbon seeps, benzene-mineralizing consortia, sulfate reducers, sulk oxidizers, and ammonia oxidizers. LIBSHUFF statistics of 16S rDNA gene sequences from the four libraries revealed major differences, indicating either a very high richness in the sediment bacterial communities or considerable variability in bacterial community composition among regions, or both.

Deciphering KRAS and NRAS mutated clone dynamics in MLL-AF4 paediatric leukaemia by ultra deep sequencing analysis.

PubMed

Trentin, Luca; Bresolin, Silvia; Giarin, Emanuela; Bardini, Michela; Serafin, Valentina; Accordi, Benedetta; Fais, Franco; Tenca, Claudya; De Lorenzo, Paola; Valsecchi, Maria Grazia; Cazzaniga, Giovanni; Kronnie, Geertruy Te; Basso, Giuseppe

2016-10-04

To induce and sustain the leukaemogenic process, MLL-AF4+ leukaemia seems to require very few genetic alterations in addition to the fusion gene itself. Studies of infant and paediatric patients with MLL-AF4+ B cell precursor acute lymphoblastic leukaemia (BCP-ALL) have reported mutations in KRAS and NRAS with incidences ranging from 25 to 50%. Whereas previous studies employed Sanger sequencing, here we used next generation amplicon deep sequencing for in depth evaluation of RAS mutations in 36 paediatric patients at diagnosis of MLL-AF4+ leukaemia. RAS mutations including those in small sub-clones were detected in 63.9% of patients. Furthermore, the mutational analysis of 17 paired samples at diagnosis and relapse revealed complex RAS clone dynamics and showed that the mutated clones present at relapse were almost all originated from clones that were already detectable at diagnosis and survived to the initial therapy. Finally, we showed that mutated patients were indeed characterized by a RAS related signature at both transcriptional and protein levels and that the targeting of the RAS pathway could be of beneficial for treatment of MLL-AF4+ BCP-ALL clones carrying somatic RAS mutations.

COOLAIR Antisense RNAs Form Evolutionarily Conserved Elaborate Secondary Structures

DOE PAGES

Hawkes, Emily J.; Hennelly, Scott P.; Novikova, Irina V.; ...

2016-09-20

There is considerable debate about the functionality of long non-coding RNAs (lncRNAs). Lack of sequence conservation has been used to argue against functional relevance. Here, we investigated antisense lncRNAs, called COOLAIR, at the A. thaliana FLC locus and experimentally determined their secondary structure. The major COOLAIR variants are highly structured, organized by exon. The distally polyadenylated transcript has a complex multi-domain structure, altered by a single non-coding SNP defining a functionally distinct A. thaliana FLC haplotype. The A. thaliana COOLAIR secondary structure was used to predict COOLAIR exons in evolutionarily divergent Brassicaceae species. These predictions were validated through chemical probingmore » and cloning. Despite the relatively low nucleotide sequence identity, the structures, including multi-helix junctions, show remarkable evolutionary conservation. In a number of places, the structure is conserved through covariation of a non-contiguous DNA sequence. This structural conservation supports a functional role for COOLAIR transcripts rather than, or in addition to, antisense transcription.« less

COOLAIR Antisense RNAs Form Evolutionarily Conserved Elaborate Secondary Structures

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hawkes, Emily J.; Hennelly, Scott P.; Novikova, Irina V.

There is considerable debate about the functionality of long non-coding RNAs (lncRNAs). Lack of sequence conservation has been used to argue against functional relevance. Here, we investigated antisense lncRNAs, called COOLAIR, at the A. thaliana FLC locus and experimentally determined their secondary structure. The major COOLAIR variants are highly structured, organized by exon. The distally polyadenylated transcript has a complex multi-domain structure, altered by a single non-coding SNP defining a functionally distinct A. thaliana FLC haplotype. The A. thaliana COOLAIR secondary structure was used to predict COOLAIR exons in evolutionarily divergent Brassicaceae species. These predictions were validated through chemical probingmore » and cloning. Despite the relatively low nucleotide sequence identity, the structures, including multi-helix junctions, show remarkable evolutionary conservation. In a number of places, the structure is conserved through covariation of a non-contiguous DNA sequence. This structural conservation supports a functional role for COOLAIR transcripts rather than, or in addition to, antisense transcription.« less

Expression of the Pasteurella haemolytica leukotoxin is inhibited by a locus that encodes an ATP-binding cassette homolog.

PubMed Central

Highlander, S K; Wickersham, E A; Garza, O; Weinstock, G M

1993-01-01

Multicopy and single-copy chromosomal fusions between the Pasteurella haemolytica leukotoxin regulatory region and the Escherichia coli beta-galactosidase gene have been constructed. These fusions were used as reporters to identify and isolate regulators of leukotoxin expression from a P. haemolytica cosmid library. A cosmid clone, which inhibited leukotoxin expression from multicopy and single-copy protein fusions, was isolated and found to contain the complete leukotoxin gene cluster plus additional upstream sequences. The locus responsible for inhibition of expression from leukotoxin-beta-galactosidase fusions was mapped within these upstream sequences, by transposon mutagenesis with Tn5, and its DNA sequence was determined. The inhibitory activity was found to be associated with a predicted 440-amino-acid reading frame (lapA) that lies within a four-gene arginine transport locus. LapA is predicted to be the nucleotide-binding component of this transport system and shares homology with the Clp family of proteases. Images PMID:8359916

Analysis of full-length sequences of two Citrus yellow mosaic badnavirus isolates infecting Citrus jambhiri (Rough Lemon) and Citrus sinensis L. Osbeck (Sweet Orange) from a nursery in India.

PubMed

Anthony Johnson, A M; Borah, B K; Sai Gopal, D V R; Dasgupta, I

2012-12-01

Citrus yellow mosaic badna virus (CMBV), a member of the Family Caulimoviridae, Genus Badnavirus is the causative agent of mosaic disease among Citrus species in southern India. Despite its reported prevalence in several citrus species, complete information on clear functional genomics or functional information of full-length genomes from all the CMBV isolates infecting citrus species are not available in publicly accessible databases. CMBV isolates from Rough Lemon and Sweet Orange collected from a nursery were cloned and sequenced. The analysis revealed high sequence homology of the two CMBV isolates with previously reported CMBV sequences implying that they represent new variants. Based on computational analysis of the predicted secondary structures, the possible functions of some CMBV proteins have been analyzed.

A molecular model for illegitimate recombination in Bacillus subtilis.

PubMed

Temeyer, K B; Hopkins, K M; Chapman, L F

1991-01-01

The recombinant DNA junctions at which pUB110 and Bacillus subtilis chromosomal DNA were joined to form the plasmid pKBT1 were cloned and sequenced. From the sequencing data we conclude that the pUB110 sequence is intact in the pair of cloned pKBT1 fragments and pTL12 sequences are not present. A molecular model for the formation of pKBT1 based on structural motifs characteristic of the joint sites is presented.

Novel Immune Modulating Cellular Vaccine for Prostate Cancer

DTIC Science & Technology

2014-10-01

restriction sites. Murine PSMA : The cDNA encoding mPSMA was purchased from Sino Biologicals and was cloned into the HindIII and BamHI sites of pSP73-Sph/A64...sequence) and reverse primer 5’-TATATAGAGCTCTCAGATGTTCCGATACACATCTC-3’ Murine PSMA no signal sequence (mPSMA-SS): Murine PSMA minus the signal sequence...contains a HindIII site for cloning and utilizes an ATG that lies downstream of the signal sequence as the start codon in PSMA -SS ( PSMA without signal

Molecular cloning of a gene encoding translation initiation factor (TIF) from Candida albicans.

PubMed

Mirbod, F; Nakashima, S; Kitajima, Y; Ghannoum, M A; Cannon, R D; Nozawa, Y

1996-01-01

The differential display technique was applied to compare mRNAs from two clinical isolates of Candida albicans with different virulence; high (potent strain, 16240) and low (weak strain, 18084) extracellular phospholipase activities. Complementary DNA fragments corresponding to several apparently differentially expressed mRNAs were recovered and sequenced. A complementary DNA fragment seen distinctly in the potent phospholipase producing strain was highly homologous to the yeast translation initiation factor (TIF). The selected DNA fragment was then used as a probe to isolate its corresponding complementary DNA clone from a library of C. albicans genomic DNA. The sequence of isolated gene revealed an open reading frame of 1194 nucleotides with the potential to encode a protein of 397 amino acids with a predicted molecular weight of 43 kDa. Over its entire length, the amino acid sequence showed strong homology (78-89%) to Saccharomyces cerevisiae TIF and (63-80%) to mouse eIF-4A proteins. Therefore, our C. albicans gene was identified to be TIF (Ca TIF). Northern blot analysis in the two strains of C. albicans revealed that Ca TIF expression is 1.5-fold higher in the potent phospholipase producing strain. The restriction endonuclease digestion of genomic DNA from this potent strain revealed at least two hybridized bands in Southern blot analysis, suggesting two or more closely related sequences in the C. albicans genome.

Cloning, sequencing and characterization of lipase from a polyhydroxyalkanoate- (PHA-) synthesizing Pseudomonas resinovorans

USDA-ARS?s Scientific Manuscript database

Lipase gene (lip) of a biodegradable polyhydroxyalkanoate- (PHA-) synthesizing bacterium P. resinovorans NRRL B-2649 was cloned, sequenced and characterized by using consensus primers and PCR-based genome walking method. The ORF of the putative Lip (314 amino acids) and its active site (Ser111, Asp...

Quantitative DNA fiber mapping

DOEpatents

Gray, Joe W.; Weier, Heinz-Ulrich G.

1998-01-01

The present invention relates generally to the DNA mapping and sequencing technologies. In particular, the present invention provides enhanced methods and compositions for the physical mapping and positional cloning of genomic DNA. The present invention also provides a useful analytical technique to directly map cloned DNA sequences onto individual stretched DNA molecules.

The Genome Sequence of a Type ST239 Methicillin-Resistant Staphylococcus aureus Isolate from a Malaysian Hospital

PubMed Central

Lee, LS; Teh, LK; Zainuddin, ZF; Salleh, MZ

2014-01-01

We report the genome sequence of a healthcare-associated MRSA type ST239 clone isolated from a patient with septicemia in Malaysia. This clone typifies the characteristics of ST239 lineage, including resistance to multiple antibiotics and antiseptics. PMID:25197474

Microeukaryotic diversity in marine environments, an analysis of surface layer sediments from the East Sea.

PubMed

Park, Soo-Je; Park, Byoung-Joon; Pham, Vinh Hoa; Yoon, Dae-No; Kim, Si-Kwan; Rhee, Sung-Keun

2008-06-01

Molecular techniques, based on clone library of 18S rRNA gene, were employed to ascertain the diversity of microeukaryotic organisms in sediments from the East Sea. A total of 261 clones were recovered from surface sediments. Most of the clone sequences (90%) were affiliated with protists, dominated by Ciliates (18%) and Dinoflagellates (19%) of Alveolates, phototrophic Stramenopiles (11%), and Cercozoa (20%). Many of the clones were related to uncultivated eukaryotes clones retrieved from anoxic environments with several highly divergent 18S rRNA gene sequences. However, no clones were related to cultivated obligate anaerobic protists. Protistan communities between subsurface layers of 1 and 9 cm shared 23% of total phylotypes which comprised 64% of total clones retrieved. Analysis of diversity indices and rarefaction curve showed that the protistan community within the 1 cm layer exhibited higher diversity than the 9 cm layer. Our results imply that diverse protists remain to be uncovered within marine benthic environments.

Brain cDNA clone for human cholinesterase

DOE Office of Scientific and Technical Information (OSTI.GOV)

McTiernan, C.; Adkins, S.; Chatonnet, A.

1987-10-01

A cDNA library from human basal ganglia was screened with oligonucleotide probes corresponding to portions of the amino acid sequence of human serum cholinesterase. Five overlapping clones, representing 2.4 kilobases, were isolated. The sequenced cDNA contained 207 base pairs of coding sequence 5' to the amino terminus of the mature protein in which there were four ATG translation start sites in the same reading frame as the protein. Only the ATG coding for Met-(-28) lay within a favorable consensus sequence for functional initiators. There were 1722 base pairs of coding sequence corresponding to the protein found circulating in human serum.more » The amino acid sequence deduced from the cDNA exactly matched the 574 amino acid sequence of human serum cholinesterase, as previously determined by Edman degradation. Therefore, our clones represented cholinesterase rather than acetylcholinesterase. It was concluded that the amino acid sequences of cholinesterase from two different tissues, human brain and human serum, were identical. Hybridization of genomic DNA blots suggested that a single gene, or very few genes coded for cholinesterase.« less

The Dynein Gene Family in Chlamydomonas Reinhardtii

PubMed Central

Porter, M. E.; Knott, J. A.; Myster, S. H.; Farlow, S. J.

1996-01-01

To correlate dynein heavy chain (Dhc) genes with flagellar mutations and gain insight into the function of specific dynein isoforms, we placed eight members of the Dhc gene family on the genetic map of Chlamydomonas. Using a PCR-based strategy, we cloned 11 Dhc genes from Chlamydomonas. Comparisons with other Dhc genes indicate that two clones correspond to genes encoding the alpha and beta heavy chains of the outer dynein arm. Alignment of the predicted amino acid sequences spanning the nucleotide binding site indicates that the remaining nine clones can be subdivided into three groups that are likely to include representatives of the inner-arm Dhc isoforms. Gene-specific probes reveal that each clone represents a single-copy gene that is expressed as a transcript of the appropriate size (>13 kb) sufficient to encode a high molecular weight Dhc polypeptide. The expression of all nine genes is upregulated in response to deflagellation, suggesting a role in axoneme assembly or motility. Restriction fragment length polymorphisms between divergent C. reinhardtii strains have been used to place each Dhc gene on the genetic map of Chlamydomonas. These studies lay the groundwork for correlating defects in different Dhc genes with specific flagellar mutations. PMID:8889521

Cloning and sequence determination of the gene coding for the pyruvate phosphate dikinase of Entamoeba histolytica.

PubMed

Saavedra-Lira, E; Pérez-Montfort, R

1994-05-16

We isolated three overlapping clones from a DNA genomic library of Entamoeba histolytica strain HM1:IMSS, whose translated nucleotide (nt) sequence shows similarities of 51, 48 and 47% with the amino acid (aa) sequences reported for the pyruvate phosphate dikinases from Bacteroides symbiosus, maize and Flaveria trinervia, respectively. The reading frame determined codes for a protein of 886 aa.

Isolation and characterization of a cDNA clone for the complete protein coding region of the delta subunit of the mouse acetylcholine receptor.

PubMed Central

LaPolla, R J; Mayne, K M; Davidson, N

1984-01-01

A mouse cDNA clone has been isolated that contains the complete coding region of a protein highly homologous to the delta subunit of the Torpedo acetylcholine receptor (AcChoR). The cDNA library was constructed in the vector lambda 10 from membrane-associated poly(A)+ RNA from BC3H-1 mouse cells. Surprisingly, the delta clone was selected by hybridization with cDNA encoding the gamma subunit of the Torpedo AcChoR. The nucleotide sequence of the mouse cDNA clone contains an open reading frame of 520 amino acids. This amino acid sequence exhibits 59% and 50% sequence homology to the Torpedo AcChoR delta and gamma subunits, respectively. However, the mouse nucleotide sequence has several stretches of high homology with the Torpedo gamma subunit cDNA, but not with delta. The mouse protein has the same general structural features as do the Torpedo subunits. It is encoded by a 3.3-kilobase mRNA. There is probably only one, but at most two, chromosomal genes coding for this or closely related sequences. Images PMID:6096870

Molecular cloning of two human liver 3 alpha-hydroxysteroid/dihydrodiol dehydrogenase isoenzymes that are identical with chlordecone reductase and bile-acid binder.

PubMed Central

Deyashiki, Y; Ogasawara, A; Nakayama, T; Nakanishi, M; Miyabe, Y; Sato, K; Hara, A

1994-01-01

Human liver contains two dihydrodiol dehydrogenases, DD2 and DD4, associated with 3 alpha-hydroxysteroid dehydrogenase activity. We have raised polyclonal antibodies that cross-reacted with the two enzymes and isolated two 1.2 kb cDNA clones (C9 and C11) for the two enzymes from a human liver cDNA library using the antibodies. The clones of C9 and C11 contained coding sequences corresponding to 306 and 321 amino acid residues respectively, but lacked 5'-coding regions around the initiation codon. Sequence analyses of several peptides obtained by enzymic and chemical cleavages of the two purified enzymes verified that the C9 and C11 clones encoded DD2 and DD4 respectively, and further indicated that the sequence of DD2 had at least additional 16 residues upward from the N-terminal sequence deduced from the cDNA. There was 82% amino acid sequence identity between the two enzymes, indicating that the enzymes are genetic isoenzymes. A computer-based comparison of the cDNAs of the isoenzymes with the DNA sequence database revealed that the nucleotide and amino acid sequences of DD2 and DD4 are virtually identical with those of human bile-acid binder and human chlordecone reductase cDNAs respectively. Images Figure 1 PMID:8172617

Massively parallel polymerase cloning and genome sequencing of single cells using nanoliter microwells

PubMed Central

Gole, Jeff; Gore, Athurva; Richards, Andrew; Chiu, Yu-Jui; Fung, Ho-Lim; Bushman, Diane; Chiang, Hsin-I; Chun, Jerold; Lo, Yu-Hwa; Zhang, Kun

2013-01-01

Genome sequencing of single cells has a variety of applications, including characterizing difficult-to-culture microorganisms and identifying somatic mutations in single cells from mammalian tissues. A major hurdle in this process is the bias in amplifying the genetic material from a single cell, a procedure known as polymerase cloning. Here we describe the microwell displacement amplification system (MIDAS), a massively parallel polymerase cloning method in which single cells are randomly distributed into hundreds to thousands of nanoliter wells and simultaneously amplified for shotgun sequencing. MIDAS reduces amplification bias because polymerase cloning occurs in physically separated nanoliter-scale reactors, facilitating the de novo assembly of near-complete microbial genomes from single E. coli cells. In addition, MIDAS allowed us to detect single-copy number changes in primary human adult neurons at 1–2 Mb resolution. MIDAS will further the characterization of genomic diversity in many heterogeneous cell populations. PMID:24213699

Characterization of the Prokaryotic Diversity in Cold Saline Perennial Springs of the Canadian High Arctic▿

PubMed Central

Perreault, Nancy N.; Andersen, Dale T.; Pollard, Wayne H.; Greer, Charles W.; Whyte, Lyle G.

2007-01-01

The springs at Gypsum Hill and Colour Peak on Axel Heiberg Island in the Canadian Arctic originate from deep salt aquifers and are among the few known examples of cold springs in thick permafrost on Earth. The springs discharge cold anoxic brines (7.5 to 15.8% salts), with a mean oxidoreduction potential of −325 mV, and contain high concentrations of sulfate and sulfide. We surveyed the microbial diversity in the sediments of seven springs by denaturing gradient gel electrophoresis (DGGE) and analyzing clone libraries of 16S rRNA genes amplified with Bacteria and Archaea-specific primers. Dendrogram analysis of the DGGE banding patterns divided the springs into two clusters based on their geographic origin. Bacterial 16S rRNA clone sequences from the Gypsum Hill library (spring GH-4) were classified into seven phyla (Actinobacteria, Bacteroidetes, Firmicutes, Gemmatimonadetes, Proteobacteria, Spirochaetes, and Verrucomicrobia); Deltaproteobacteria and Gammaproteobacteria sequences represented half of the clone library. Sequences related to Proteobacteria (82%), Firmicutes (9%), and Bacteroidetes (6%) constituted 97% of the bacterial clone library from Colour Peak (spring CP-1). Most GH-4 archaeal clone sequences (79%) were related to the Crenarchaeota while half of the CP-1 sequences were related to orders Halobacteriales and Methanosarcinales of the Euryarchaeota. Sequences related to the sulfur-oxidizing bacterium Thiomicrospira psychrophila dominated both the GH-4 (19%) and CP-1 (45%) bacterial libraries, and 56 to 76% of the bacterial sequences were from potential sulfur-metabolizing bacteria. These results suggest that the utilization and cycling of sulfur compounds may play a major role in the energy production and maintenance of microbial communities in these unique, cold environments. PMID:17220254

Cloning and characterization of mouse ACF7, a novel member of the dystonin subfamily of actin binding proteins.

PubMed

Bernier, G; Mathieu, M; De Repentigny, Y; Vidal, S M; Kothary, R

1996-11-15

We have recently cloned the gene responsible for the mouse neurological disorder dystonia musculorum. The predicted product of this gene, dystonin (Dst), is a neural isoform of bullous pemphigoid antigen 1 (Bpag1) with an N-terminal actin binding domain. Here we report on the cloning and characterization of mouse ACF7. Sequence analysis revealed extended homology of mACF7 with both the actin binding domain (ABD) and the Bpag1 portions of dystonin. Moreover, mACF7 and Dst display similar isoform diversity and encode similar sized transcripts in the nervous system. Phylogenetic analysis of mACF7 and dystonin ABD sequences suggests a recent evolutionary origin and that these proteins form a separate novel subfamily within the beta-spectrin superfamily of actin binding proteins. Given the implication of several actin binding proteins in genetic disorders, it is important to know the pattern of mACF7 expression. mACF7 transcripts are detected principally in lung, brain, spinal cord, skeletal and cardiac muscle, and skin. Intriguingly, mACF7 expression in lung is strongly induced just before birth and is restricted to type II alveolar cells. To determine whether spontaneous mutants that may be defective in mACF7 exist, we have mapped the mACF7 gene to mouse chromosome 4.

Cloning and characterization of a type 3 iodothyronine deiodinase (D3) in the liver of the chondrichtyan Chiloscyllium punctatum.

PubMed

Martínez, Lidia Mayorga; Orozco, Aurea; Villalobos, Patricia; Valverde-R, Carlos

2008-05-01

Thyroid hormone bioactivity is finely regulated at the cellular level by the peripheral iodothyronine deiodinases (D). The study of thyroid function in fish has been restricted mainly to teleosts, whereas the study and characterization of Ds have been overlooked in chondrichthyes. Here we report the cloning and operational characterization of both the native and the recombinant hepatic type 3 iodothyronine deiodinase in the tropical shark Chiloscyllium punctatum. Native and recombinant sD3 show identical catalytic activities: a strong preference for T3-inner-ring deiodination, a requirement for a high concentration of DTT, a sequential reaction mechanism, and resistance to PTU inhibition. The cloned cDNA contains 1298 nucleotides [excluding the poly(A) tail] and encodes a predicted protein of 259 amino acids. The triplet TGA coding for selenocysteine (Sec) is at position 123. The consensus selenocysteine insertion sequence (SECIS) was identified 228 bp upstream of the poly(A) tail and corresponds to form 2. The deduced amino acid sequence was 77% and 72% identical to other D3 cDNAs in fishes and other vertebrates, respectively. As in the case of other piscivore teleost species, shark expresses hepatic D3 through adulthood. This characteristic may be associated with the alimentary strategy in which the protection from an exogenous overload of thyroid hormones could be of physiological importance for thyroidal homeostasis.

A general strategy for cloning viroids and other small circular RNAs that uses minimal amounts of template and does not require prior knowledge of its sequence.

PubMed

Navarro, B; Daròs, J A; Flores, R

1996-01-01

Two PCR-based methods are described for obtaining clones of small circular RNAs of unknown sequence and for which only minute amounts are available. To avoid introducing any assumption about the RNA sequence, synthesis of the cDNAs is initiated with random primers. The cDNA population is then PCR-amplified using a primer whose sequence is present at both sides of the cDNAs, since they have been obtained with random hexamers and then a linker with the sequence of the PCR primer has been ligated to their termini, or because the cDNAs have been synthesized with an oligonucleotide that contains the sequence of the PCR primer at its 5' end and six randomized positions at its 3' end. The procedures need only approximately 50 ng of purified RNA template. The reasons for the emergence of cloning artifacts and precautions to avoid them are discussed.

Isolation and characterization of two overlapping cosmid clones from the 4q35 region, near the facioscapulohumeral muscular dystrophy locus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Deidda, G.; Grisanti, P.; Vigneti, E.

1994-09-01

The gene for facioscapulohumeral muscular dystrophy (FSHD) has been localized by linkage analysis to the 4q35 region. The most telomeric p13E-11 prove has been shown to detect 4q35 DNA rearrangements in both sporadic and familial cases of the disease. With the aim of constructing a detailed physical map of the 4q35 region and searching for the mutant gene, we used p13E-11 probe to isolate cosmid clones from a human genomic library in a pCos-EMBL 2 vector. Two positive clones were isolated, clones 3 and 5, which partially overlap and carry human genomic inserts of 42 and 45 kb, respectively. Themore » cosmids share a common region containing the p13E-11 region and a stretch of KpnI units consisting of 3.2 kb tandemly repeated sequences (about 10). The restriction maps were constructed using the following enzymes: Bam HI, BgIII, Eco RI, EcoRV, KpnI and Sfi I. Clone 3 extends 4 kb upstream of C5 and stops within the Kpn repeats. Clone 5 extends 4 kb downstream from the Kpn repeats and it presents an additional EcoRI site. Clone 5 contains a stretch of Kpn sequences of nearly 32 kb, corresponding to 10 Kpn repeats; clone 3 contains a stretch of 29 kb corresponding to 9 Kpn repeats, as determined by PFGE analysis of partial digestion of the clones. Clone 5 seems to contain the entire Eco RI region prone to rearrangements in FSHD patients. From clone 5 several subclones were obtained, from the Kpn region and from the region spanning from the last Kpn repeat to the cloning site. No single copy sequences were detected. Subclones from the 3{prime} end region contain beta-satellite or Sau3A-like sequences. In situ hybridization with the whole C5 cosmid shows hybridization signals at the tip of chromosome 4 (4q35) and chromosome 10 (10q26), in the pericentromeric region of chromosome 1 (1q12) and in the p12 region of the acrocentric chromosomes (chr. 21, 22, 13, 14, 15).« less

Molecular cloning in Arabidopsis thaliana of a new protein phosphatase 2C (PP2C) with homology to ABI1 and ABI2.

PubMed

Rodriguez, P L; Leube, M P; Grill, E

1998-11-01

We report the cloning of both the cDNA and the corresponding genomic sequence of a new PP2C from Arabidopsis thaliana, named AtP2C-HA (for homology to ABI1/ABI2). The AtP2C-HA cDNA contains an open reading frame of 1536 bp and encodes a putative protein of 511 amino acids with a predicted molecular mass of 55.7 kDa. The AtP2C-HA protein is composed of two domains, a C-terminal PP2C catalytic domain and a N-terminal extension of ca. 180 amino acid residues. The deduced amino acid sequence is 55% and 54% identical to ABI1 and ABI2, respectively. Comparison of the genomic structure of the ABI1, ABI2 and AtP2C-HA genes suggests that they belong to a multigene family. The expression of the AtP2C-HA gene is up-regulated by abscisic acid (ABA) treatment.

Molecular cloning of trypsin cDNAs and trypsin gene expression in the salmon louse Lepeophtheirus salmonis (Copepoda: Caligidae).

PubMed

Johnson, S C; Ewart, K V; Osborne, J A; Delage, D; Ross, N W; Murray, H M

2002-09-01

The salmon louse, Lepeophtheirus salmonis, is a marine ectoparasitic copepod that infects salmonid fishes. We are studying the interactions between this parasite and its salmonid hosts, as it is a common cause of disease in both wild and farmed stocks of salmon. In this paper, we report on the cloning and sequencing of seven trypsin-like enzymes from a cDNA library prepared from whole body preadult female and male L. salmonis. The predicted trypsin activation peptides are 23 or 24 residues in length, considerably longer than previously reported activation peptides of other animals. Differences in the putative signal and activation peptide sequences of the trypsin isoforms suggest that these forms differ in their regulation and function. The calculated molecular weights of the trypsins range from 23.6 to 23.7 kDa. There are eight cysteine residues, which suggest the presence of four disulfide bridges. These trypsins are very similar (>or=46% aa identity) to other crustacean trypsins and insect hypodermins. Using in situ hybridization techniques trypsinogen expression could be identified in all three cell types of the midgut.

Persistence and evolution of allergen-specific IgE repertoires during subcutaneous specific immunotherapy

PubMed Central

Levin, Mattias; King, Jasmine J.; Glanville, Jacob; Jackson, Katherine J. L.; Looney, Timothy J.; Hoh, Ramona A.; Mari, Adriano; Andersson, Morgan; Greiff, Lennart; Fire, Andrew Z.; Boyd, Scott D.; Ohlin, Mats

2016-01-01

Background Specific immunotherapy (SIT) is the only treatment with proven long-term curative potential in allergic disease. Allergen-specific IgE is the causative agent of allergic disease, and antibodies contribute to SIT, but the effects of SIT on aeroallergen-specific B cell repertoires are not well understood. Objective To characterize the IgE sequences expressed by allergen-specific B cells, and track the fate of these B cell clones during SIT. Methods We have used high-throughput antibody gene sequencing and identification of allergen-specific IgE using combinatorial antibody fragment library technology to analyze immunoglobulin repertoires of blood and nasal mucosa of aeroallergen-sensitized individuals before and during the first year of subcutaneous SIT. Results Of 52 distinct allergen-specific IgE heavy chains from eight allergic donors, 37 were also detected by high-throughput antibody gene sequencing of blood, nasal mucosa, or both sample types. The allergen-specific clones had increased persistence, higher likelihood of belonging to clones expressing other switched isotypes, and possibly larger clone size than the rest of the IgE repertoire. Clone members in nasal tissue showed close mutational relationships. Conclusion Combining functional binding studies, deep antibody repertoire sequencing, and information on clinical outcomes in larger studies may in the future aid assessment of SIT mechanisms and efficacy. PMID:26559321

Rapid and efficient cDNA library screening by self-ligation of inverse PCR products (SLIP).

PubMed

Hoskins, Roger A; Stapleton, Mark; George, Reed A; Yu, Charles; Wan, Kenneth H; Carlson, Joseph W; Celniker, Susan E

2005-12-02

cDNA cloning is a central technology in molecular biology. cDNA sequences are used to determine mRNA transcript structures, including splice junctions, open reading frames (ORFs) and 5'- and 3'-untranslated regions (UTRs). cDNA clones are valuable reagents for functional studies of genes and proteins. Expressed Sequence Tag (EST) sequencing is the method of choice for recovering cDNAs representing many of the transcripts encoded in a eukaryotic genome. However, EST sequencing samples a cDNA library at random, and it recovers transcripts with low expression levels inefficiently. We describe a PCR-based method for directed screening of plasmid cDNA libraries. We demonstrate its utility in a screen of libraries used in our Drosophila EST projects for 153 transcription factor genes that were not represented by full-length cDNA clones in our Drosophila Gene Collection. We recovered high-quality, full-length cDNAs for 72 genes and variously compromised clones for an additional 32 genes. The method can be used at any scale, from the isolation of cDNA clones for a particular gene of interest, to the improvement of large gene collections in model organisms and the human. Finally, we discuss the relative merits of directed cDNA library screening and RT-PCR approaches.

Small RNA analysis in Petunia hybrida identifies unusual tissue-specific expression patterns of conserved miRNAs and of a 24mer RNA

PubMed Central

Tedder, Philip; Zubko, Elena; Westhead, David R.; Meyer, Peter

2009-01-01

Two pools of small RNAs were cloned from inflorescences of Petunia hybrida using a 5′-ligation dependent and a 5′-ligation independent approach. The two libraries were integrated into a public website that allows the screening of individual sequences against 359,769 unique clones. The library contains 15 clones with 100% identity and 53 clones with one mismatch to miRNAs described for other plant species. For two conserved miRNAs, miR159 and miR390, we find clear differences in tissue-specific distribution, compared with other species. This shows that evolutionary conservation of miRNA sequences does not necessarily include a conservation of the miRNA expression profile. Almost 60% of all clones in the database are 24-nucleotide clones. In accordance with the role of 24mers in marking repetitive regions, we find them distributed across retroviral and transposable element sequences but other 24mers map to promoter regions and to different transcript regions. For one target region we observe tissue-specific variation of matching 24mers, which demonstrates that, as for 21mers, 24mer concentrations are not necessarily identical in different tissues. Asymmetric distribution of a putative novel miRNA in the two libraries suggests that the cloning method can be selective for the representation of certain small RNAs in a collection. PMID:19369427

Lineage-tracking of stem cell differentiation: a neutral model of hematopoiesis in rhesus macaque

NASA Astrophysics Data System (ADS)

Chou, Tom

How a potentially diverse population of hematopoietic stem cells (HSCs) differentiates and proliferates to supply more than 1011 mature blood cells every day in humans remains a key biological question. We investigated this process by quantitatively analyzing the clonal structure of peripheral blood that is generated by a population of transplanted lentivirus-marked HSCs in myeloablated rhesus macaques. Each transplanted HSC generates a clonal lineage of cells in the peripheral blood that is then detected and quantified through deep sequencing of the viral vector integration sites (VIS) common within each lineage. This approach allowed us to observe, over a period of 4-12 years, hundreds of distinct clonal lineages. Surprisingly, while the distinct clone sizes varied by three orders of magnitude, we found that collectively, they form a steady-state clone size-distribution with a distinctive shape. Our concise model shows that slow HSC differentiation followed by fast progenitor growth is responsible for the observed broad clone size-distribution. Although all cells are assumed to be statistically identical, analogous to a neutral theory for the different clone lineages, our mathematical approach captures the intrinsic variability in the times to HSC differentiation after transplantation. Steady-state solutions of our model show that the predicted clone size-distribution is sensitive to only two combinations of parameters. By fitting the measured clone size-distributions to our mechanistic model, we estimate both the effective HSC differentiation rate and the number of active HSCs. NSF and NIH.

Isolation and characterization of microsatellite markers in Fraser fir (Abies fraseri)

Treesearch

S.A. Josserand; K.M. Potter; G. Johnson; J.A. Bowen; J. Frampton; C.D. Nelson

2006-01-01

We describe the isolation and characterization of 14 microsatellite loci from Fraser fir (Abies fraseri). These markers originated from cloned inserts enriched for DNA sequences containing tandem di- and tri-nucleotide repeats. In total, 36 clones were selected, sequenced and evaluated. Polymerase chain reaction (PCR) primers for 14 of these...

Molecular cloning, overexpression, and enzymatic characterization of glycosyl hydrolase family 16 β-Agarase from marine bacterium Saccharophagus sp. AG21 in Escherichia coli.

PubMed

Lee, Youngdeuk; Oh, Chulhong; De Zoysa, Mahanama; Kim, Hyowon; Wickramaarachchi, Wickramaarachchige Don Niroshana; Whang, Ilson; Kang, Do-Hyung; Lee, Jehee

2013-01-01

An agar-degrading bacterium was isolated from red seaweed (Gelidium amansii) on a natural seawater agar plate, and identified as Saccharophagus sp. AG21. The β-agarase gene from Saccharophagus sp. AG21 (agy1) was screened by long and accurate (LA)-PCR. The predicted sequence has a 1,908 bp open reading frame encoding 636 amino acids (aa), and includes a glycosyl hydrolase family 16 (GH16) β-agarase module and two carbohydrate binding modules of family 6 (CBM6). The deduced aa sequence showed 93.7% and 84.9% similarity to β-agarase of Saccharophagus degradans and Microbulbifer agarilyticus, respectively. The mature agy1 was cloned and overexpressed as a His-tagged recombinant β-agarase (rAgy1) in Escherichia coli, and had a predicted molecular mass of 69 kDa and an isoelectric point of 4.5. rAgy1 showed optimum activity at 55oC and pH 7.6, and had a specific activity of 85 U/mg. The rAgy1 activity was enhanced by FeSO4 (40%), KCl (34%), and NaCl (34%), compared with the control. The newly identified rAgy1 is a β-agarase, which acts to degrade agarose to neoagarotetraose (NA4) and neoagarohexaose (NA6) and may be useful for applications in the cosmetics, food, bioethanol, and reagent industries.

A retinoic acid-inducible mRNA from F9 teratocarcinoma cells encodes a novel protease inhibitor homologue.

PubMed

Wang, S Y; Gudas, L J

1990-09-15

We have previously isolated several cDNA clones specific for mRNA species that increase in abundance during the retinoic acid-associated differentiation of F9 teratocarcinoma stem cells. One of these mRNAs, J6, encodes a approximately 40 kDa protein as assayed by hybrid selection and in vitro translation (Wang, S.-Y., LaRosa, G., and Gudas, L. J. (1985) Dev. Biol. 107, 75-86). The time course of J6 mRNA expression is similar to those of both laminin B1 and collagen IV (alpha 1) messages following retinoic acid addition. To address the functional role of this protein, we have isolated a full-length cDNA clone complementary to this approximately 40-kDa protein mRNA. Sequence analysis reveals an open reading frame of 406 amino acids (Mr 45,652). The carboxyl-terminal portion of this predicted protein contains a region that is homologous to the reactive sites found among members of the serpin (serine protease inhibitor) family. The predicted reactive site (P1-P1') of this J6 protein is Arg-Ser, which is the same as that of antithrombin III. Like ovalbumin and human monocyte-derived plasminogen activator inhibitor (mPAI-2), which are members of the serpin gene family, the J6 protein appears to have no typical amino-terminal signal sequence.

Characterization of the genomic organization of the region bordering the centromere of chromosome V of Podospora anserina by direct sequencing.

PubMed

Silar, Philippe; Barreau, Christian; Debuchy, Robert; Kicka, Sébastien; Turcq, Béatrice; Sainsard-Chanet, Annie; Sellem, Carole H; Billault, Alain; Cattolico, Laurence; Duprat, Simone; Weissenbach, Jean

2003-08-01

A Podospora anserina BAC library of 4800 clones has been constructed in the vector pBHYG allowing direct selection in fungi. Screening of the BAC collection for centromeric sequences of chromosome V allowed the recovery of clones localized on either sides of the centromere, but no BAC clone was found to contain the centromere. Seven BAC clones containing 322,195 and 156,244bp from either sides of the centromeric region were sequenced and annotated. One 5S rRNA gene, 5 tRNA genes, and 163 putative coding sequences (CDS) were identified. Among these, only six CDS seem specific to P. anserina. The gene density in the centromeric region is approximately one gene every 2.8kb. Extrapolation of this gene density to the whole genome of P. anserina suggests that the genome contains about 11,000 genes. Synteny analyses between P. anserina and Neurospora crassa show that co-linearity extends at the most to a few genes, suggesting rapid genome rearrangements between these two species.

Cloning of a MADS box gene (GhMADS3) from cotton and analysis of its homeotic role in transgenic tobacco.

PubMed

Guo, Yulong; Zhu, Qinlong; Zheng, Shangyong; Li, Mingyang

2007-06-01

A MADS box gene (GhMADS3) was cloned from cotton (Gossypium hirsutum L.) based on EST sequences. The predicted protein sequence of GhMADS3 showed 85%, 73%, and 62% identity with Theobroma cacao TcAG, Antirrhinum majus FAR, and Arabidopsis thaliana AG, respectively, and was grouped with AG homologues when the full length sequences excluding N-extensions were compared. GhMADS3 expressed in the wild type cotton flower primarily in stamens and carpels, which was comparable to AG in Arabidopsis. However, it was not expressed in floral buds of a homeotic cotton variant chv1. Ectopic expression of GhMADS3 in tobacco (Nicotiana tabacum L.) resulted in flowers with sepal-to-carpel and petal-to-stamen transformation. The carpelloid first whorl organs, with stigmatic tissue on their upper edges, had a white appearance when compared with the dark green color of the wild type sepals. At times, long filaments were observed at the fusion site of the first carpelloid oranges. The second whorl organs in staminoid were usually smaller than the wild type and the color was changed from pink to white. These results suggest that GhMADS3 has a homeotic role in flower development.

Molecular cloning of the heat shock protein 20 gene from Paphia textile and its expression in response to heat shock

NASA Astrophysics Data System (ADS)

Li, Jiakai; Wu, Xiangwei; Tan, Jing; Zhao, Ruixiang; Deng, Lingwei; Liu, Xiande

2015-07-01

P. textile is an important aquaculture species in China and is mainly distributed in Fujian, Guangdong, and Guangxi Provinces. In this study, an HSP20 cDNA designated PtHSP20 was cloned from P. textile. The full-length cDNA of PtHSP20 is 1 090 bp long and contains a 5' untranslated region (UTR) of 93 bp, a 3' UTR of 475 bp, and an open reading frame (ORF) of 522 bp. The PtHSP20 cDNA encodes 173 amino acid residues and has a molecular mass of 20.22 kDa and an isoelectric point of 6.2. Its predicted amino acid sequence shows that PtHSP20 contains a typical α-crystallin domain (residues 77-171) and three polyadenylation signal-sequences at the C-terminus. According to an amino acid sequence alignment, PtHSP20 shows moderate homology to other mollusk sHSPs. PtHSP20 mRNA was present in all of the test tissues including the heart, digestive gland, adductor muscle, gonad, gill, and mantle, with the highest concentration found in the gonad. Under the stress of high temperature, the expression of PtHSP20 mRNA was down-regulated in all of the tissues except the adductor muscle and gonad.

Acidophiles of saline water at thermal vents of Vulcano, Italy.

PubMed

Simmons, Susan; Norris, R

2002-06-01

DNA was extracted from samples taken from close to acidic hydrothermal vents on shore of the Aeolian Island of Vulcano (Italy). RNA gene sequences were amplified by PCR, cloned, and sequenced. A sequence with an origin in samples at 35 degrees and 45 degrees C corresponded to that of a novel Acidithiobacillus species that was isolated from water close to the vents. Novel, iron-oxidizing mesophilic acidophiles were isolated through enrichment cultures with ferrous iron but were not represented in the clone banks of environmental rDNA. These acidophiles were related to Thiobacillus prosperus, which was isolated previously from Vulcano. The archaeal sequences that comprised a clone bank representing a high-temperature sample (75 degrees C) corresponded to those of Acidianus brierleyi and of thermophiles previously isolated from Vulcano, Thermoplasma volcanium and Acidianus infernus.

Identification by Subtractive Hybridization of a Novel Insertion Sequence Specific for Virulent Strains of Porphyromonas gingivalis

PubMed Central

Sawada, Koichi; Kokeguchi, Susumu; Hongyo, Hiroshi; Sawada, Satoko; Miyamoto, Manabu; Maeda, Hiroshi; Nishimura, Fusanori; Takashiba, Shogo; Murayama, Yoji

1999-01-01

Subtractive hybridization was employed to isolate specific genes from virulent Porphyromonas gingivalis strains that are possibly related to abscess formation. The genomic DNA from the virulent strain P. gingivalis W83 was subtracted with DNA from the avirulent strain ATCC 33277. Three clones unique to strain W83 were isolated and sequenced. The cloned DNA fragments were 885, 369, and 132 bp and had slight homology with only Bacillus stearothermophilus IS5377, which is a putative transposase. The regions flanking the cloned DNA fragments were isolated and sequenced, and the gene structure around the clones was revealed. These three clones were located side-by-side in a gene reported as an outer membrane protein. The three clones interrupt the open reading frame of the outer membrane protein gene. This inserted DNA, consisting of three isolated clones, was designated IS1598, which was 1,396 bp (i.e., a 1,158-bp open reading frame) in length and was flanked by 16-bp terminal inverted repeats and a 9-bp duplicated target sequence. IS1598 was detected in P. gingivalis W83, W50, and FDC 381 by Southern hybridization. All three P. gingivalis strains have been shown to possess abscess-forming ability in animal models. However, IS1598 was not detected in avirulent strains of P. gingivalis, including ATCC 33277. The IS1598 may interrupt the synthesis of the outer membrane protein, resulting in changes in the structure of the bacterial outer membrane. The IS1598 isolated in this study is a novel insertion element which might be a specific marker for virulent P. gingivalis strains. PMID:10531208

Mutational analysis of the Wolfram syndrome gene in two families with chromosome 4p-linked bipolar affective disorder.

PubMed

Evans, K L; Lawson, D; Meitinger, T; Blackwood, D H; Porteous, D J

2000-04-03

Bipolar affective disorder (BPAD) is a complex disease with a significant genetic component. Heterozygous carriers of Wolfram syndrome (WFS) are at increased risk of psychiatric illness. A gene for WFS (WFS1) has recently been cloned and mapped to chromosome 4p, in the general region we previously reported as showing linkage to BPAD. Here we present sequence analysis of the WFS1 coding sequence in five affected individuals from two chromosome 4p-linked families. This resulted in the identification of six polymorphisms, two of which are predicted to change the amino acid sequence of the WFS1 protein, however none of the changes segregated with disease status. Am. J. Med. Genet. (Neuropsychiatr. Genet.) 96:158-160, 2000. Copyright 2000 Wiley-Liss, Inc.

shRNA target prediction informed by comprehensive enquiry (SPICE): a supporting system for high-throughput screening of shRNA library.

PubMed

Kamatuka, Kenta; Hattori, Masahiro; Sugiyama, Tomoyasu

2016-12-01

RNA interference (RNAi) screening is extensively used in the field of reverse genetics. RNAi libraries constructed using random oligonucleotides have made this technology affordable. However, the new methodology requires exploration of the RNAi target gene information after screening because the RNAi library includes non-natural sequences that are not found in genes. Here, we developed a web-based tool to support RNAi screening. The system performs short hairpin RNA (shRNA) target prediction that is informed by comprehensive enquiry (SPICE). SPICE automates several tasks that are laborious but indispensable to evaluate the shRNAs obtained by RNAi screening. SPICE has four main functions: (i) sequence identification of shRNA in the input sequence (the sequence might be obtained by sequencing clones in the RNAi library), (ii) searching the target genes in the database, (iii) demonstrating biological information obtained from the database, and (iv) preparation of search result files that can be utilized in a local personal computer (PC). Using this system, we demonstrated that genes targeted by random oligonucleotide-derived shRNAs were not different from those targeted by organism-specific shRNA. The system facilitates RNAi screening, which requires sequence analysis after screening. The SPICE web application is available at http://www.spice.sugysun.org/.

Cloning and sequence analysis of Hemonchus contortus HC58cDNA.

PubMed

Muleke, Charles I; Ruofeng, Yan; Lixin, Xu; Xinwen, Bo; Xiangrui, Li

2007-06-01

The complete coding sequence of Hemonchus contortus HC58cDNA was generated by rapid amplification of cDNA ends and polymerase chain reaction using primers based on the 5' and 3' ends of the parasite mRNA, accession no. AF305964. The HC58cDNA gene was 851 bp long, with open reading frame of 717 bp, precursors to 239 amino acids coding for approximately 27 kDa protein. Analysis of amino acid sequence revealed conserved residues of cysteine, histidine, asparagine, occluding loop pattern, hemoglobinase motif and glutamine of the oxyanion hole characteristic of cathepsin B like proteases (CBL). Comparison of the predicted amino acid sequences showed the protein shared 33.5-58.7% identity to cathepsin B homologues in the papain clan CA family (family C1). Phylogenetic analysis revealed close evolutionary proximity of the protein sequence to counterpart sequences in the CBL, suggesting that HC58cDNA was a member of the papain family.

Clonal architecture of secondary acute myeloid leukemia defined by single-cell sequencing.

PubMed

Hughes, Andrew E O; Magrini, Vincent; Demeter, Ryan; Miller, Christopher A; Fulton, Robert; Fulton, Lucinda L; Eades, William C; Elliott, Kevin; Heath, Sharon; Westervelt, Peter; Ding, Li; Conrad, Donald F; White, Brian S; Shao, Jin; Link, Daniel C; DiPersio, John F; Mardis, Elaine R; Wilson, Richard K; Ley, Timothy J; Walter, Matthew J; Graubert, Timothy A

2014-07-01

Next-generation sequencing has been used to infer the clonality of heterogeneous tumor samples. These analyses yield specific predictions-the population frequency of individual clones, their genetic composition, and their evolutionary relationships-which we set out to test by sequencing individual cells from three subjects diagnosed with secondary acute myeloid leukemia, each of whom had been previously characterized by whole genome sequencing of unfractionated tumor samples. Single-cell mutation profiling strongly supported the clonal architecture implied by the analysis of bulk material. In addition, it resolved the clonal assignment of single nucleotide variants that had been initially ambiguous and identified areas of previously unappreciated complexity. Accordingly, we find that many of the key assumptions underlying the analysis of tumor clonality by deep sequencing of unfractionated material are valid. Furthermore, we illustrate a single-cell sequencing strategy for interrogating the clonal relationships among known variants that is cost-effective, scalable, and adaptable to the analysis of both hematopoietic and solid tumors, or any heterogeneous population of cells.

Construction and Cloning of Reporter-Tagged Replicon cDNA for an In Vitro Replication Study of Murine Norovirus-1 (MNV-1).

PubMed

Ahmad, Muhammad Khairi; Tabana, Yasser M; Ahmed, Mowaffaq Adam; Sandai, Doblin Anak; Mohamed, Rafeezul; Ismail, Ida Shazrina; Zulkiflie, Nurulisa; Yunus, Muhammad Amir

2017-12-01

A norovirus maintains its viability, infectivity and virulence by its ability to replicate. However, the biological mechanisms of the process remain to be explored. In this work, the NanoLuc™ Luciferase gene was used to develop a reporter-tagged replicon system to study norovirus replication. The NanoLuc™ Luciferase reporter protein was engineered to be expressed as a fusion protein for MNV-1 minor capsid protein, VP2. The foot-and-mouth disease virus 2A (FMDV2A) sequence was inserted between the 3'end of the reporter gene and the VP2 start sequence to allow co-translational 'cleavage' of fusion proteins during intracellular transcript expression. Amplification of the fusion gene was performed using a series of standard and overlapping polymerase chain reactions. The resulting amplicon was then cloned into three readily available backbones of MNV-1 cDNA clones. Restriction enzyme analysis indicated that the NanoLucTM Luciferase gene was successfully inserted into the parental MNV-1 cDNA clone. The insertion was further confirmed by using DNA sequencing. NanoLuc™ Luciferase-tagged MNV-1 cDNA clones were successfully engineered. Such clones can be exploited to develop robust experimental assays for in vitro assessments of viral RNA replication.

Diversity of nifH gene pools in the rhizosphere of two cultivars of sorghum (Sorghum bicolor) treated with contrasting levels of nitrogen fertilizer.

PubMed

Coelho, Marcia Reed Rodrigues; de Vos, Marjon; Carneiro, Newton Portilho; Marriel, Ivanildo Evódio; Paiva, Edilson; Seldin, Lucy

2008-02-01

The diversity of nitrogen-fixing bacteria was assessed in the rhizospheres of two cultivars of sorghum (IS 5322-C and IPA 1011) sown in Cerrado soil amended with two levels of nitrogen fertilizer (12 and 120 kg ha(-1)). The nifH gene was amplified directly from DNA extracted from the rhizospheres, and the PCR products cloned and sequenced. Four clone libraries were generated from the nifH fragments and 245 sequences were obtained. Most of the clones (57%) were closely related to nifH genes of uncultured bacteria. NifH clones affiliated with Azohydromonas spp., Ideonella sp., Rhizobium etli and Bradyrhizobium sp. were found in all libraries. Sequences affiliated with Delftia tsuruhatensis were found in the rhizosphere of both cultivars sown with high levels of nitrogen, while clones affiliated with Methylocystis sp. were detected only in plants sown under low levels of nitrogen. Moreover, clones affiliated with Paenibacillus durus could be found in libraries from the cultivar IS 5322-C sown either in high or low amounts of fertilizer. This study showed that the amount of nitrogen used for fertilization is the overriding determinative factor that influenced the nitrogen-fixing community structures in sorghum rhizospheres cultivated in Cerrado soil.

A physical map of a BAC clone contig covering the entire autosome insertion between ovine MHC Class IIa and IIb

PubMed Central

2012-01-01

Background The ovine Major Histocompatibility Complex (MHC) harbors genes involved in overall resistance/susceptibility of the host to infectious diseases. Compared to human and mouse, the ovine MHC is interrupted by a large piece of autosome insertion via a hypothetical chromosome inversion that constitutes ~25% of ovine chromosome 20. The evolutionary consequence of such an inversion and an insertion (inversion/insertion) in relation to MHC function remains unknown. We previously constructed a BAC clone physical map for the ovine MHC exclusive of the insertion region. Here we report the construction of a high-density physical map covering the autosome insertion in order to address the question of what the inversion/insertion had to do with ruminants during the MHC evolution. Results A total of 119 pairs of comparative bovine oligo primers were utilized to screen an ovine BAC library for positive clones and the orders and overlapping relationships of the identified clones were determined by DNA fingerprinting, BAC-end sequencing, and sequence-specific PCR. A total of 368 positive BAC clones were identified and 108 of the effective clones were ordered into an overlapping BAC contig to cover the consensus region between ovine MHC class IIa and IIb. Therefore, a continuous physical map covering the entire ovine autosome inversion/insertion region was successfully constructed. The map confirmed the bovine sequence assembly for the same homologous region. The DNA sequences of 185 BAC-ends have been deposited into NCBI database with the access numbers HR309252 through HR309068, corresponding to dbGSS ID 30164010 through 30163826. Conclusions We have constructed a high-density BAC clone physical map for the ovine autosome inversion/insertion between the MHC class IIa and IIb. The entire ovine MHC region is now fully covered by a continuous BAC clone contig. The physical map we generated will facilitate MHC functional studies in the ovine, as well as the comparative MHC evolution in ruminants. PMID:22897909

Apple beta-galactosidase. Activity against cell wall polysaccharides and characterization of a related cDNA clone.

PubMed Central

Ross, G S; Wegrzyn, T; MacRae, E A; Redgwell, R J

1994-01-01

A beta-galactosidase was purified from cortical tissue of ripe apples (Malus domestica Borkh. cv Granny Smith) using a procedure involving affinity chromatography on lactosyl-Sepharose. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis indicated that two polypeptides of 44 and 32 kD were present in the fraction that showed activity against the synthetic substrate p-nitrophenol-beta-D-galactopyranoside. The enzyme preparation was incubated with polysaccharide extracts from apple cell walls containing beta-(1-->4)-linked galactans, and products of digestion were analyzed by gas chromatography. Small amounts of monomeric galactose were released during incubation, showing that the enzyme was active against native substrates. Amino acid sequence information was obtained from the purified protein, and this showed high homology with the anticipated polypeptide coded by the ethylene-regulated SR12 gene in carnation (K.G. Raghothama, K.A. Lawton, P.B. Goldborough, W.R. Woodson [1991] Plant Mol Biol 17: 61-71) and a harvest-related pTIP31 cDNA from asparagus (G. King, personal communication). Using the asparagus cDNA clone as a probe, an apple homolog (pABG1) was isolated. This clone contains a 2637-bp insert, including an open reading frame that codes for a polypeptide of 731 amino acids. Cleavage of an N-terminal signal sequence would leave a predicted polypeptide of 78.5 kD. Genomic DNA analysis and the isolation of other homologous apple clones suggest that pABG1 represents one member of an apple beta-galactosidase gene family. Northern analysis during fruit development and ripening showed accumulation of pABG1-homologous RNA during fruit ripening. Enzyme activity as measured in crude extracts increased during fruit development to a level that was maintained during ripening. PMID:7991682

Characterization of X-OCRL, a Xenopus laevis homologue of OCRL-1, the Lowe oculocerebrorenal syndrome candidate gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Reilly, D.S.; Nussbaum, R.L.

1994-09-01

The Lowe oculocerebrorenal syndrome (OCRL) is an X-linked disease characterized by congenital cataract, mental retardation, and renal tubular dysfunction. A candidate cDNA, OCRL-1, was identified by positional cloning and mutations in OCRL-1 have been detected in patients with Lowe syndrome. The OCRL-1 nucleotide sequence encodes a predicted protein of 968 amino acids and shares 51% amino acid identity with a human inositol polyphosphate-5-phosphatase. This suggests that the underlying defect in OCRL may be due to a defect in inositol phosphate metabolism. The isolation of OCRL-1 provides the opportunity to investigate its function through the use of animal model systems. Wemore » have isolated a partial cDNA clone encoding an OCRL-1 homologue, X-OCRL, from the South African clawed frog, Xenopus laevis. We used a portion of the human cDNA to screen a Xenopus laevis embryo cDNA library and isolated four positive clones. One clone, 42-5A, is a 650 bp insert with over 75% amino acid identity to the corresponding region of the human OCRL-1 sequence. 42-5A detects messenger RNA in adult Xenopus brain, stomach, small intestine, skin, muscle, lung, blood, and oviduct. X-OCRL messenger RNA is first detected during late gastrula and continues to be expressed throughout Xenopus development. In situ hybridization studies are underway to identify the cellular localization of X-OCRL expression in Xenopus embryos and adult tissues. We are especially interested in characterizing X-OCRL expression during formation of the amphibian lens since congenital cataracts are a constant feature of the human disease.« less

Molecular cloning and functional expression of bovine spleen ecto-NAD+ glycohydrolase: structural identity with human CD38.

PubMed Central

Augustin, A; Muller-Steffner, H; Schuber, F

2000-01-01

Bovine spleen ecto-NAD(+) glycohydrolase, an archetypal member of the mammalian membrane-associated NAD(P)(+) glycohydrolase enzyme family (EC 3.2.2.6), displays catalytic features similar to those of CD38, i.e. a protein originally described as a lymphocyte differentiation marker involved in the metabolism of cyclic ADP-ribose and signal transduction. Using amino acid sequence information obtained from NAD(+) glycohydrolase and from a truncated and hydrosoluble form of the enzyme (hNADase) purified to homogeneity, a full-length cDNA clone was obtained. The deduced sequence indicates a protein of 278 residues with a molecular mass of 31.5 kDa. It predicts that bovine ecto-NAD(+) glycohydrolase is a type II transmembrane protein, with a very short intracellular tail. The bulk of the enzyme, which is extracellular and contains two potential N-glycosylation sites, yields the fully catalytically active hNADase which is truncated by 71 residues. Transfection of HeLa cells with the full-length cDNA resulted in the expression of the expected NAD(+) glycohydrolase, ADP-ribosyl cyclase and GDP-ribosyl cyclase activities at the surface of the cells. The bovine enzyme, which is the first 'classical' NAD(P)(+) glycohydrolase whose structure has been established, presents a particularly high sequence identity with CD38, including the presence of 10 strictly conserved cysteine residues in the ectodomain and putative catalytic residues. However, it lacks two otherwise conserved cysteine residues near its C-terminus. Thus hNADase, the truncated protein of 207 amino acids, represents the smallest functional domain endowed with all the catalytic activities of CD38/NAD(+) glycohydrolases so far identified. Altogether, our data strongly suggest that the cloned bovine spleen ecto-NAD(+) glycohydrolase is the bovine equivalent of CD38. PMID:10600637

Biology of Symbioses between Marine Invertebrates and Intracellular Bacteria

DTIC Science & Technology

1991-01-21

bisphosphate carboxylase ( RubisCO ) from symbiotic bacteria of various origins, b) To continue methods development for 16S rRNA sequencing from symbionts in...frozen and badly preserved specimens, and c) To use these new techniques to sequence 16s DNA from a variety of symbionts a) RubisCO We have cloned the...gene coding for RubisCO from the sulfur oxidixing symbiont of the gastropod Alvinochoncha hessleri. Nucleotide sequence analysis of the cloned fragment

Crotoxin: Structural Studies, Mechanism of Action and Cloning of Its Gene

DTIC Science & Technology

1987-03-01

other venoms and examine their toxin neutral- izing ability. The amino acid sequences of both crotoxin subunits were determined Is a prelude to cloning...be examined for their potential as anti-idiotype vaccines The complete amino acid sequence of the basic subunit and two of the three dic subunit chains...of crotoxin from the venom of C.d. terrificus has been de rmined. Sequence comparison data suggest that the non-toxic, acidic subunit was derived

A maize map standard with sequenced core markers, grass genome reference points and 932 expressed sequence tagged sites (ESTs) in a 1736-locus map.

PubMed Central

Davis, G L; McMullen, M D; Baysdorfer, C; Musket, T; Grant, D; Staebell, M; Xu, G; Polacco, M; Koster, L; Melia-Hancock, S; Houchins, K; Chao, S; Coe, E H

1999-01-01

We have constructed a 1736-locus maize genome map containing1156 loci probed by cDNAs, 545 probed by random genomic clones, 16 by simple sequence repeats (SSRs), 14 by isozymes, and 5 by anonymous clones. Sequence information is available for 56% of the loci with 66% of the sequenced loci assigned functions. A total of 596 new ESTs were mapped from a B73 library of 5-wk-old shoots. The map contains 237 loci probed by barley, oat, wheat, rice, or tripsacum clones, which serve as grass genome reference points in comparisons between maize and other grass maps. Ninety core markers selected for low copy number, high polymorphism, and even spacing along the chromosome delineate the 100 bins on the map. The average bin size is 17 cM. Use of bin assignments enables comparison among different maize mapping populations and experiments including those involving cytogenetic stocks, mutants, or quantitative trait loci. Integration of nonmaize markers in the map extends the resources available for gene discovery beyond the boundaries of maize mapping information into the expanse of map, sequence, and phenotype information from other grass species. This map provides a foundation for numerous basic and applied investigations including studies of gene organization, gene and genome evolution, targeted cloning, and dissection of complex traits. PMID:10388831

High Bacterial Diversity in Permanently Cold Marine Sediments

PubMed Central

Ravenschlag, Katrin; Sahm, Kerstin; Pernthaler, Jakob; Amann, Rudolf

1999-01-01

A 16S ribosomal DNA (rDNA) clone library from permanently cold marine sediments was established. Screening 353 clones by dot blot hybridization with group-specific oligonucleotide probes suggested a predominance of sequences related to bacteria of the sulfur cycle (43.4% potential sulfate reducers). Within this fraction, the major cluster (19.0%) was affiliated with Desulfotalea sp. and other closely related psychrophilic sulfate reducers isolated from the same habitat. The cloned sequences showed between 93 and 100% similarity to these bacteria. Two additional groups were frequently encountered: 13% of the clones were related to Desulfuromonas palmitatis, and a second group was affiliated with Myxobacteria spp. and Bdellovibrio spp. Many clones (18.1%) belonged to the γ subclass of the class Proteobacteria and were closest to symbiotic or free-living sulfur oxidizers. Probe target groups were further characterized by amplified rDNA restriction analysis to determine diversity within the groups and within the clone library. Rarefaction analysis suggested that the total diversity assessed by 16S rDNA analysis was very high in these permanently cold sediments and was only partially revealed by screening of 353 clones. PMID:10473405

Trypanosoma cruzi Clone Dm28c Draft Genome Sequence

PubMed Central

Grisard, Edmundo Carlos; Teixeira, Santuza Maria Ribeiro; de Almeida, Luiz Gonzaga Paula; Stoco, Patricia Hermes; Gerber, Alexandra Lehmkuhl; Talavera-López, Carlos; Lima, Oberdan Cunha; Andersson, Björn

2014-01-01

Trypanosoma cruzi affects millions of people worldwide. Clinical variability of Chagas disease can be due to the genetic variability of this parasite, requiring further genome studies. Here we report the genome sequence of the T. cruzi Dm28c clone (TcI), a strain related to the sylvatic cycle of the parasite. PMID:24482508

Asymmetric single-strand polymorphism: an accurate and cost-effective method to amplify and sequence allelic variants

USDA-ARS?s Scientific Manuscript database

We needed to obtain an alternative to conventional cloning to generate high-quality DNA sequences from a variety of nuclear orthologs for phylogenetic studies in potato, to save time and money and to avoid problems typically encountered in cloning. We tested a variety of SSCP protocols to include pu...

Changes in the Composition of Drinking Water Bacterial Clone Libraries Introduced by Using Two Different 16S rRna Gene PCR Primers

EPA Science Inventory

Sequence analysis of 16S rRNA gene clone libraries is a popular tool used to describe the composition of natural microbial communities. Commonly, clone libraries are developed by direct cloning of 16S rRNA gene PCR products. Different primers are often employed in the initial amp...

Changes in the Composition of Drinking Water Bacterial Clone Libraries Introduced by Using Two Different 16S rRNA Gene PCR Primers

EPA Science Inventory

Sequence analysis of 16S rRNA gene clone libraries is a popular tool used to describe the composition of natural microbial communities. Commonly, clone libraries are developed by direct cloning of 16S rRNA gene PCR products. Different primers are often employed in the initial amp...

Isolation and characterization of two cDNA clones encoding for glutamate dehydrogenase in Nicotiana plumbaginifolia.

PubMed

Ficarelli, A; Tassi, F; Restivo, F M

1999-03-01

We have isolated two full length cDNA clones encoding Nicotiana plumbaginifolia NADH-glutamate dehydrogenase. Both clones share amino acid boxes of homology corresponding to conserved GDH catalytic domains and putative mitochondrial targeting sequence. One clone shows a putative EF-hand loop. The level of the two transcripts is affected differently by carbon source.

Cloning

MedlinePlus

... Sheets A Brief Guide to Genomics About NHGRI Research About the International HapMap Project Biological Pathways Chromosome Abnormalities Chromosomes Cloning Comparative Genomics DNA Microarray Technology DNA Sequencing Deoxyribonucleic Acid ( ...

Bacteria Community in the Terrestrial Deep Subsurface Microbiology Research of the Chinese Continent Scientific Drilling

NASA Astrophysics Data System (ADS)

Wang, Y.; Xia, Y.; Dong, H.; Dong, X.; Yang, K.; Dong, Z.; Huang, L.

2005-12-01

Microbial communities in the deep drill cores from the Chinese Continent Scientific Drilling were analyzed with culture-independent and dependent techniques. Genomic DNA was extracted from two metamorphic rocks: S1 from 430 and S13 from 1033 meters below the ground surface. The 16S rRNA gene was amplified by polymerase chain reaction (PCR) followed by cloning and sequencing. The total cell number was counted using the 4',6-diamidino-2-phenylindole (DAPI) staining and biomass of two specific bacteria were quantified using real-time PCR. Enrichment was set up for a rock from 3911 meters below the surface in medium for authotrophic methanogens (i.e., CO2 + H2). The total cell number in S13 was 1.0 × 104 cells per gram of rock. 16S rRNA gene analysis indicated that low G + C Gram positive sequences were dominant (50 percent of all 54 clone sequenced) followed by the alpha-, beta, and gamma-Proteobacteria. Within the low G + C Gram positive bacteria, most clone sequences were similar to species of Bacillus from various natural environments (deserts, rivers etc.). Within the Proteobacteria, our clone sequences were similar to species of Acinetobacter, Acidovorax, and Aeromonas. The RT-RCP results showed that biomass of two particular clone sequences (CCSD1305, similar to Aeromonas caviae and CCSD1307, similar to Acidovorax facilis) was 95 and 1258 cells/g, respectively. A bacterial isolate was obtained from the 3911-m rock in methanogenic medium. It was Gram negative with no flagella, immobile, and facultative anaerobic, and grows optimally at 65oC. Phylogenetic analysis indicated that it was closely related to the genus of Bacillus. Physiological tests further revealed that it was a strain of Bacillus caldotenax.

Generation of a total of 6483 expressed sequence tags from 60 day-old bovine whole fetus and fetal placenta.

PubMed

Oishi, M; Gohma, H; Lejukole, H Y; Taniguchi, Y; Yamada, T; Suzuki, K; Shinkai, H; Uenishi, H; Yasue, H; Sasaki, Y

2004-05-01

Expressed sequence tags (ESTs) generated based on characterization of clones isolated randomly from cDNA libraries are used to study gene expression profiles in specific tissues and to provide useful information for characterizing tissue physiology. In this study, two directionally cloned cDNA libraries were constructed from 60 day-old bovine whole fetus and fetal placenta. We have characterized 5357 and 1126 clones, and then identified 3464 and 795 unique sequences for the fetus and placenta cDNA libraries: 1851 and 504 showed homology to already identified genes, and 1613 and 291 showed no significant matches to any of the sequences in DNA databases, respectively. Further, we found 94 unique sequences overlapping in both the fetus and the placenta, leading to a catalog of 4165 genes expressed in 60 day-old fetus and placenta. The catalog is used to examine expression profile of genes in 60 day-old bovine fetus and placenta.

Plasmid-encoded hygromycin B resistance: the sequence of hygromycin B phosphotransferase gene and its expression in Escherichia coli and Saccharomyces cerevisiae.

PubMed

Gritz, L; Davies, J

1983-11-01

The plasmid-borne gene hph coding for hygromycin B phosphotransferase (HPH) in Escherichia coli has been identified and its nucleotide sequence determined. The hph gene is 1026 nucleotides long, coding for a protein with a predicted Mr of 39 000. The hph gene was placed in a shuttle plasmid vector, downstream from the promoter region of the cyc 1 gene of Saccharomyces cerevisiae, and an hph construction containing a single AUG in the 5' noncoding region allowed direct selection following transformation in yeast and in E. coli. Thus the hph gene can be used in cloning vectors for both pro- and eukaryotes.

Isolation of a new dual-functional caffeine synthase gene encoding an enzyme for the conversion of 7-methylxanthine to caffeine from coffee (Coffea arabica L.).

PubMed

Mizuno, Kouichi; Okuda, Akira; Kato, Misako; Yoneyama, Naho; Tanaka, Hiromi; Ashihara, Hiroshi; Fujimura, Tatsuhito

2003-01-16

In coffee and tea plants, caffeine is synthesized from xanthosine via a pathway that includes three methylation steps. We report the isolation of a bifunctional coffee caffeine synthase (CCS1) clone from coffee endosperm by reverse transcription-polymerase chain reaction (RT-PCR) and rapid amplification of cDNA ends (RACE) technique using previously reported sequence information for theobromine synthases (CTSs). The predicted amino acid sequences of CCS1 are more than 80% identical to CTSs and are about 40% similar to those of tea caffeine synthase (TCS1). Interestingly, CCS1 has dual methylation activity like tea TCS1.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Leong, JoAnn Ching

The nucleotide sequence of the IHNV glycoprotein gene has been determined from a cDNA clone containing the entire coding region. The glycoprotein cDNA clone contained a leader sequence of 48 bases, a coding region of 1524 nucleotides, and 39 bases at the 3 foot end. The entire cDNA clone contains 1609 nucleodites and encodes a protein of 508 amino acids. The deduced amino acid sequence gave a translated molecular weight of 56,795 daltons. A hydropathicity profile of the deduced amino acid sequence indicated that there were two major hydrophobic domains: one,at the N-terminus,delineating a signal peptide of 18 amino acidsmore » and the other, at the C-terminus,delineating the region of the transmembrane. Five possible sites of N-linked glyscoylation were identified. Although no nucleic acid homology existed between the IHNV glycoprotein gene and the glycoprotein genes of rabies and VSV, there was significant homology at the amino acid level between all three rhabdovirus glycoproteins.« less

Isolation and characterization of full-length cDNA clones coding for cholinesterase from fetal human tissues

DOE Office of Scientific and Technical Information (OSTI.GOV)

Prody, C.A.; Zevin-Sonkin, D.; Gnatt, A.

1987-06-01

To study the primary structure and regulation of human cholinesterases, oligodeoxynucleotide probes were prepared according to a consensus peptide sequence present in the active site of both human serum pseudocholinesterase and Torpedo electric organ true acetylcholinesterase. Using these probes, the authors isolated several cDNA clones from lambdagt10 libraries of fetal brain and liver origins. These include 2.4-kilobase cDNA clones that code for a polypeptide containing a putative signal peptide and the N-terminal, active site, and C-terminal peptides of human BtChoEase, suggesting that they code either for BtChoEase itself or for a very similar but distinct fetal form of cholinesterase. Inmore » RNA blots of poly(A)/sup +/ RNA from the cholinesterase-producing fetal brain and liver, these cDNAs hybridized with a single 2.5-kilobase band. Blot hybridization to human genomic DNA revealed that these fetal BtChoEase cDNA clones hybridize with DNA fragments of the total length of 17.5 kilobases, and signal intensities indicated that these sequences are not present in many copies. Both the cDNA-encoded protein and its nucleotide sequence display striking homology to parallel sequences published for Torpedo AcChoEase. These finding demonstrate extensive homologies between the fetal BtChoEase encoded by these clones and other cholinesterases of various forms and species.« less

Imperfect duplicate insertions type of mutations in plasmepsin V modulates binding properties of PEXEL motifs of export proteins in Indian Plasmodium vivax.

PubMed

Rawat, Manmeet; Vijay, Sonam; Gupta, Yash; Tiwari, Pramod Kumar; Sharma, Arun

2013-01-01

Plasmepsin V (PM-V) have functionally conserved orthologues across the Plasmodium genus who's binding and antigenic processing at the PEXEL motifs for export about 200-300 essential proteins is important for the virulence and viability of the causative Plasmodium species. This study was undertaken to determine P. vivax plasmepsin V Ind (PvPM-V-Ind) PEXEL motif export pathway for pathogenicity-related proteins/antigens export thereby altering plasmodium exportome during erythrocytic stages. We identify and characterize Plasmodium vivax plasmepsin-V-Ind (mutant) gene by cloning, sequence analysis, in silico bioinformatic protocols and structural modeling predictions based on docking studies on binding capacity with PEXEL motifs processing in terms of binding and accessibility of export proteins. Cloning and sequence analysis for genetic diversity demonstrates PvPM-V-Ind (mutant) gene is highly conserved among all isolates from different geographical regions of India. Imperfect duplicate insertion types of mutations (SVSE from 246-249 AA and SLSE from 266-269 AA) were identified among all Indian isolates in comparison to P.vivax Sal-1 (PvPM-V-Sal 1) isolate. In silico bioinformatics interaction studies of PEXEL peptide and active enzyme reveal that PvPM-V-Ind (mutant) is only active in endoplasmic reticulum lumen and membrane embedding is essential for activation of plasmepsin V. Structural modeling predictions based on docking studies with PEXEL motif show significant variation in substrate protein binding of these imperfect mutations with data mined PEXEL sequences. The predicted variation in the docking score and interacting amino acids of PvPM-V-Ind (mutant) proteins with PEXEL and lopinavir suggests a modulation in the activity of PvPM-V in terms of binding and accessibility at these sites. Our functional modeled validation of PvPM-V-Ind (mutant) imperfect duplicate insertions with data mined PEXEL sequences leading to altered binding and substrate accessibility of the enzyme makes it a plausible target to investigate export mechanisms for in silico virtual screening and novel pharmacophore designing.

Imperfect Duplicate Insertions Type of Mutations in Plasmepsin V Modulates Binding Properties of PEXEL Motifs of Export Proteins in Indian Plasmodium vivax

PubMed Central

Rawat, Manmeet; Vijay, Sonam; Gupta, Yash; Tiwari, Pramod Kumar; Sharma, Arun

2013-01-01

Introduction Plasmepsin V (PM-V) have functionally conserved orthologues across the Plasmodium genus who's binding and antigenic processing at the PEXEL motifs for export about 200–300 essential proteins is important for the virulence and viability of the causative Plasmodium species. This study was undertaken to determine P. vivax plasmepsin V Ind (PvPM-V-Ind) PEXEL motif export pathway for pathogenicity-related proteins/antigens export thereby altering plasmodium exportome during erythrocytic stages. Method We identify and characterize Plasmodium vivax plasmepsin-V-Ind (mutant) gene by cloning, sequence analysis, in silico bioinformatic protocols and structural modeling predictions based on docking studies on binding capacity with PEXEL motifs processing in terms of binding and accessibility of export proteins. Results Cloning and sequence analysis for genetic diversity demonstrates PvPM-V-Ind (mutant) gene is highly conserved among all isolates from different geographical regions of India. Imperfect duplicate insertion types of mutations (SVSE from 246–249 AA and SLSE from 266–269 AA) were identified among all Indian isolates in comparison to P.vivax Sal-1 (PvPM-V-Sal 1) isolate. In silico bioinformatics interaction studies of PEXEL peptide and active enzyme reveal that PvPM-V-Ind (mutant) is only active in endoplasmic reticulum lumen and membrane embedding is essential for activation of plasmepsin V. Structural modeling predictions based on docking studies with PEXEL motif show significant variation in substrate protein binding of these imperfect mutations with data mined PEXEL sequences. The predicted variation in the docking score and interacting amino acids of PvPM-V-Ind (mutant) proteins with PEXEL and lopinavir suggests a modulation in the activity of PvPM-V in terms of binding and accessibility at these sites. Conclusion/Significance Our functional modeled validation of PvPM-V-Ind (mutant) imperfect duplicate insertions with data mined PEXEL sequences leading to altered binding and substrate accessibility of the enzyme makes it a plausible target to investigate export mechanisms for in silico virtual screening and novel pharmacophore designing. PMID:23555891

A comprehensive survey of soil acidobacterial diversity using pyrosequencing and clone library analyses

PubMed Central

Jones, Ryan T; Robeson, Michael S; Lauber, Christian L; Hamady, Micah; Knight, Rob; Fierer, Noah

2010-01-01

Acidobacteria are ubiquitous and abundant members of soil bacterial communities. However, an ecological understanding of this important phylum has remained elusive because its members have been difficult to culture and few molecular investigations have focused exclusively on this group. We generated an unprecedented number of acidobacterial DNA sequence data using pyrosequencing and clone libraries (39 707 and 1787 sequences, respectively) to characterize the relative abundance, diversity and composition of acidobacterial communities across a range of soil types. To gain insight into the ecological characteristics of acidobacterial taxa, we investigated the large-scale biogeographic patterns exhibited by acidobacterial communities, and related soil and site characteristics to acidobacterial community assemblage patterns. The 87 soils analyzed by pyrosequencing contained more than 8600 unique acidobacterial phylotypes (at the 97% sequence similarity level). One phylotype belonging to Acidobacteria subgroup 1, but not closely related to any cultured representatives, was particularly abundant, accounting for 7.4% of bacterial sequences and 17.6% of acidobacterial sequences, on average, across the soils. The abundance of Acidobacteria relative to other bacterial taxa was highly variable across the soils examined, but correlated strongly with soil pH (R = −0.80, P<0.001). Soil pH was also the best predictor of acidobacterial community composition, regardless of how the communities were characterized, and the relative abundances of the dominant Acidobacteria subgroups were readily predictable. Acidobacterial communities were more phylogenetically clustered as soil pH departed from neutrality, suggesting that pH is an effective habitat filter, restricting community membership to progressively more narrowly defined lineages as pH deviates from neutrality. PMID:19129864

Sequence Analysis of Different Domains of Plasmodium vivax Apical Membrane Antigen (PvAMA-1 gene) Locus in Iran.

PubMed

Motevalli Haghi, A; Nateghpour, M; Edrissian, Ghh; Sepehrizadeh, Z; Mohebali, M; Khoramizade, Mr; Shahrbabak, S Sabouri; Moghimi, H

2012-01-01

Plasmodium vivax is responsible for approximately 80 million malaria cases in the world. Apical membrane antigen1 (AMA-1) is a type I integral membrane protein present in all Plasmodium species. AMA-1 interferes in critical steps of invasion of human hepatocytes by sporozoites and red blood cells by merozoites and is one of the most immunodominant antigens for eliciting a protective immune response in human. It is considered as a promising antigen for inclusion in a vaccine against P. vivax. Since more knowledge is needed to lighten the scope of such antigen we compared genetic variation in P. vivax AMA-1from an Iranian isolate with those reported from some of the other malarious countries so far. P. vivax genomic DNA was extracted from the whole blood of an Iranian patient with patent P. vivax infection. The nucleotide sequence for 446 amino acid (AA) residues (42-488 of PvAMA-1) was amplified by PCR and cloned in pUC19 vector for sequencing. Sequence analysis of the antigen showed a high degree of identity (99%) with strong homology to the PvAMA-1 gene of P. vivax S3 and SKO814 isolates from India and Korea (Asian isolates) respectively, and 96% similarity with P. vivax Sal-1 AMA-1 gene from El Salvador. We cloned and characterized three domains of PvAMA-1 gene from an Iranian patient. Predicted protein sequence of this gene showed some discrepancies in corresponding protein in comparing with similar genes reported from other malarious countries.

Prunus necrotic ringspot ilarvirus: nucleotide sequence of RNA3 and the relationship to other ilarviruses based on coat protein comparison.

PubMed

Guo, D; Maiss, E; Adam, G; Casper, R

1995-05-01

The RNA3 of prunus necrotic ringspot ilarvirus (PNRSV) has been cloned and its entire sequence determined. The RNA3 consists of 1943 nucleotides (nt) and possesses two large open reading frames (ORFs) separated by an intergenic region of 74 nt. The 5' proximal ORF is 855 nt in length and codes for a protein of molecular mass 31.4 kDa which has homologies with the putative movement protein of other members of the Bromoviridae. The 3' proximal ORF of 675 nt is the cistron for the coat protein (CP) and has a predicted molecular mass of 24.9 kDa. The sequence of the 3' non-coding region (NCR) of PNRSV RNA3 showed a high degree of similarity with those of tobacco streak virus (TSV), prune dwarf virus (PDV), apple mosaic virus (ApMV) and also alfalfa mosaic virus (AIMV). In addition it contained potential stem-loop structures with interspersed AUGC motifs characteristic for ilar- and alfamoviruses. This conserved primary and secondary structure in all 3' NCRs may be responsible for the interaction with homologous and heterologous CPs and subsequent activation of genome replication. The CP gene of an ApMV isolate (ApMV-G) of 657 nt has also been cloned and sequenced. Although ApMV and PNRSV have a distant serological relationship, the deduced amino acid sequences of their CPs have an identity of only 51.8%. The N termini of PNRSV and ApMV CPs have in common a zinc-finger motif and the potential to form an amphipathic helix.

Cloning, sequencing, disruption and phenotypic analysis of uvsC, an Aspergillus nidulans homologue of yeast RAD51.

PubMed

van Heemst, D; Swart, K; Holub, E F; van Dijk, R; Offenberg, H H; Goosen, T; van den Broek, H W; Heyting, C

1997-05-01

We have cloned the uvsC gene of Aspergillus nidulans by complementation of the A. nidulans uvsC114 mutant. The predicted protein UVSC shows 67.4% sequence identity to the Saccharomyces cerevisiae Rad51 protein and 27.4% sequence identity to the Escherichia coli RecA protein. Transcription of uvsC is induced by methyl-methane sulphonate (MMS), as is transcription of RAD51 of yeast. Similar levels of uvsC transcription were observed after MMS induction in a uvsC+ strain and the uvsC114 mutant. The coding sequence of the uvsC114 allele has a deletion of 6 bp, which results in deletion of two amino acids and replacement of one amino acid in the translation product. In order to gain more insight into the biological function of the uvsC gene, a uvsC null mutant was constructed, in which the entire uvsC coding sequence was replaced by a selectable marker gene. Meiotic and mitotic phenotypes of a uvsC+ strain, the uvsC114 mutant and the uvsC null mutant were compared. The uvsC null mutant was more sensitive to both UV and MMS than the uvsC114 mutant. The uvsC114 mutant arrested in meiotic prophase-I. The uvsC null mutant arrested at an earlier stage, before the onset of meiosis. One possible interpretation of these meiotic phenotypes is that the A. nidulans homologue of Rad51 of yeast has a role both in the specialized processes preceding meiosis and in meiotic prophase I.

(Mechanisms of inhibition of viral replication in plants): Progress report

DOE Office of Scientific and Technical Information (OSTI.GOV)

Palukaitis, P.

1988-01-01

The genome of cucumber virus (CMV) was cloned and about 300 clones were obtained that contained CMV sequences. These were further subdivided into clones that were derived from RNAs 3 and 4, and those that were not, and thus represented RNAs 1 and 2.

[Investigation of bacterial diversity in the biological desulfurization reactor for treating high salinity wastewater by the 16S rDNA cloning method].

PubMed

Liu, Wei-Guo; Liang, Cun-Zhen; Yang, Jin-Sheng; Wang, Gui-Ping; Liu, Miao-Miao

2013-02-01

The bacterial diversity in the biological desulfurization reactor operated continuously for 1 year was studied by the 16S rDNA cloning and sequencing method. Forty clones were randomly selected and their partial 16S rDNA genes (ca. 1,400 bp) were sequenced and blasted. The results indicated that there were dominant bacterias in the biological desulfurization reactor, where 33 clones belonged to 3 different published phyla, while 1 clone belonged to unknown phylum. The dominant bacterial community in the system was Proteobacteria, which accounted for 85.3%. The bacterial community succession was as follows: the gamma-Proteobacteria(55.9%), beta-Proteobacteria(17.6%), Actinobacteridae (8.8%), delta-Proteobacteria (5.9%) , alpha-Proteobacteria(5.9%), and Sphingobacteria (2.9%). Halothiobacillus sp. ST15 and Thiobacillus sp. UAM-I were the major desulfurization strains.

[Cloning and characterization of genes differentially expressed in human dental pulp cells and gingival fibroblasts].

PubMed

Wang, Zhong-dong; Wu, Ji-nan; Zhou, Lin; Ling, Jun-qi; Guo, Xi-min; Xiao, Ming-zhen; Zhu, Feng; Pu, Qin; Chai, Yu-bo; Zhao, Zhong-liang

2007-02-01

To study the biological properties of human dental pulp cells (HDPC) by cloning and analysis of genes differentially expressed in HDPC in comparison with human gingival fibroblasts (HGF). HDPC and HGF were cultured and identified by immunocytochemistry. HPDC and HGF subtractive cDNA library was established by PCR-based modified subtractive hybridization, genes differentially expressed by HPDC were cloned, sequenced and compared to find homogeneous sequence in GenBank by BLAST. Cloning and sequencing analysis indicate 12 genes differentially expressed were obtained, in which two were unknown genes. Among the 10 known genes, 4 were related to signal transduction, 2 were related to trans-membrane transportation (both cell membrane and nuclear membrane), and 2 were related to RNA splicing mechanisms. The biological properties of HPDC are determined by the differential expression of some genes and the growth and differentiation of HPDC are associated to the dynamic protein synthesis and secretion activities of the cell.

Recombinational Cloning Using Gateway and In-Fusion Cloning Schemes

PubMed Central

Throop, Andrea L.; LaBaer, Joshua

2015-01-01

The comprehensive study of protein structure and function, or proteomics, depends on the obtainability of full-length cDNAs in species-specific expression vectors and subsequent functional analysis of the expressed protein. Recombinational cloning is a universal cloning technique based on site-specific recombination that is independent of the insert DNA sequence of interest, which differentiates this method from the classical restriction enzyme-based cloning methods. Recombinational cloning enables rapid and efficient parallel transfer of DNA inserts into multiple expression systems. This unit summarizes strategies for generating expression-ready clones using the most popular recombinational cloning technologies, including the commercially available Gateway® (Life Technologies) and In-Fusion® (Clontech) cloning technologies. PMID:25827088

PanDaTox: A tool for accelerated metabolic engineering

DOE Office of Scientific and Technical Information (OSTI.GOV)

Amitai, Gil; Sorek, Rotem

2012-07-18

Metabolic engineering is often facilitated by cloning of genes encoding enzymes from various heterologous organisms into E. coli. Such engineering efforts are frequently hampered by foreign genes that are toxic to the E. coli host. We have developed PanDaTox (www.weizmann.ac.il/pandatox), a web-based resource that provides experimental toxicity information for more than 1.5 million genes from hundreds of different microbial genomes. The toxicity predictions, which were extensively experimentally verified, are based on serial cloning of genes into E. coli as part of the Sanger whole genome shotgun sequencing process. PanDaTox can accelerate metabolic engineering projects by allowing researchers to exclude toxicmore » genes from the engineering plan and verify the clonability of selected genes before the actual metabolic engineering experiments are conducted.« less

Cloning the Gravity and Shear Stress Related Genes from MG-63 Cells by Subtracting Hybridization

NASA Astrophysics Data System (ADS)

Zhang, Shu; Dai, Zhong-quan; Wang, Bing; Cao, Xin-sheng; Li, Ying-hui; Sun, Xi-qing

2008-06-01

Background The purpose of the present study was to clone the gravity and shear stress related genes from osteoblast-like human osteosarcoma MG-63 cells by subtractive hybridization. Method MG-63 cells were divided into two groups (1G group and simulated microgravity group). After cultured for 60 h in two different gravitational environments, two groups of MG-63 cells were treated with 1.5Pa fluid shear stress (FSS) for 60 min, respectively. The total RNA in cells was isolated. The gravity and shear stress related genes were cloned by subtractive hybridization. Result 200 clones were gained. 30 positive clones were selected using PCR method based on the primers of vector and sequenced. The obtained sequences were analyzed by blast. changes of 17 sequences were confirmed by RT-PCR and these genes are related to cell proliferation, cell differentiation, protein synthesis, signal transduction and apoptosis. 5 unknown genes related to gravity and shear stress were found. Conclusion In this part of our study, our result indicates that simulated microgravity may change the activities of MG-63 cells by inducing the functional alterations of specific genes.

Dissemination of VIM-2 producing Pseudomonas aeruginosa ST233 at tertiary care hospitals in Egypt.

PubMed

Zafer, Mai Mahmoud; Al-Agamy, Mohamed Hamed; El-Mahallawy, Hadir Ahmed; Amin, Magdy Aly; El Din Ashour, Seif

2015-03-12

Pseudomonas aeruginosa is an important nosocomial pathogen, commonly causing infections in immunocompromised patients. The aim of this study was to examine the genetic relatedness of metallo-beta-lactamase (MBL) producing carbapenem resistant Pseudomonas aeruginosa clinical isolates collected from 2 tertiary hospitals in Cairo, Egypt using Multi Locus sequence typing (MLST). Phenotypic and genotypic detection of metallo-beta-lactamase for forty eight non-duplicate carbapenem resistant P. aeruginosa isolates were carried out. DNA sequencing and MLST were done. The bla VIM-2 gene was highly prevalent (28/33 strains, 85%) among 33 MBL-positive P.aeruginosa isolates. MLST revealed eleven distinct Sequence Types (STs). A unique ST233 clone producing VIM-2 was documented by MLST in P.aeruginosa strains isolated from Cairo university hospitals. The high prevalence of VIM-2 producers was not due to the spread of a single clone. The findings of the present study clearly demonstrate that clones of VIM-2 positive in our hospitals are different from those reported from European studies. Prevalence of VIM-2 producers of the same clone was detected from surgical specimens whereas oncology related specimens were showing diverse clones.

Cloning and sequencing of the pheP gene, which encodes the phenylalanine-specific transport system of Escherichia coli.

PubMed Central

Pi, J; Wookey, P J; Pittard, A J

1991-01-01

The phenylalanine-specific permease gene (pheP) of Escherichia coli has been cloned and sequenced. The gene was isolated on a 6-kb Sau3AI fragment from a chromosomal library, and its presence was verified by complementation of a mutant lacking the functional phenylalanine-specific permease. Subcloning from this fragment localized the pheP gene on a 2.7-kb HindIII-HindII fragment. The nucleotide sequence of this 2.7-kb region was determined. An open reading frame was identified which extends from a putative start point of translation (GTG at position 636) to a termination signal (TAA at position 2010). The assignment of the GTG as the initiation codon was verified by site-directed mutagenesis of the initiation codon and by introducing a chain termination mutation into the pheP-lacZ fusion construct. A single initiation site of transcription 30 bp upstream of the start point of translation was identified by the primer extension analysis. The pheP structural gene consists of 1,374 nucleotides specifying a protein of 458 amino acid residues. The PheP protein is very hydrophobic (71% nonpolar residues). A topological model predicted from the sequence analysis defines 12 transmembrane segments. This protein is highly homologous with the AroP (general aromatic transport) system of E. coli (59.6% identity) and to a lesser extent with the yeast permeases CAN1 (arginine), PUT4 (proline), and HIP1 (histidine) of Saccharomyces cerevisiae. Images PMID:1711024

Molecular cloning and expression of the CRISP family of proteins in the boar.

PubMed

Vadnais, Melissa L; Foster, Douglas N; Roberts, Kenneth P

2008-12-01

The family of mammalian cysteine-rich secretory proteins (CRISP) have been well characterized in the rat, mouse, and human. Here we report the molecular cloning and expression analysis of CRISP1, CRISP2, and CRISP3 in the boar. A partial sequence published in the National Center for Biotechnology Information (NCBI) database was used to derive the full-length sequences for CRISP1 and CRISP2 using rapid amplification of cDNA ends. RT-PCR confirmed the expression of these mRNAs in the boar reproductive tract, and real time RT-PCR showed CRISP1 to be highly expressed throughout the epididymis, with CRISP2 highly expressed in the testis. A search of the porcine genomic sequence in the NCBI database identified a BAC (CH242-199E6) encoding the CRISP1 gene. This BAC is derived from porcine Chromosome 7 and is syntenic with the regions of the mouse, rat, and human genomes encoding the CRISP gene family. This BAC was found to encode a third CRISP protein with a predicted amino acid sequence of high similarity to human CRISP3. Using RT-PCR we show that CRISP3 expression in the boar reproductive tract is confined to the prostate. Recombinant porcine (rp) CRISP2 protein was produced and purified. When incubated with capacitated boar sperm, rpCRISP2 induced an acrosome reaction, consistent with its demonstrated ability to alter the activity of calcium channels.

Molecular Identification of Ectomycorrhizal Mycelium in Soil Horizons

PubMed Central

Landeweert, Renske; Leeflang, Paula; Kuyper, Thom W.; Hoffland, Ellis; Rosling, Anna; Wernars, Karel; Smit, Eric

2003-01-01

Molecular identification techniques based on total DNA extraction provide a unique tool for identification of mycelium in soil. Using molecular identification techniques, the ectomycorrhizal (EM) fungal community under coniferous vegetation was analyzed. Soil samples were taken at different depths from four horizons of a podzol profile. A basidiomycete-specific primer pair (ITS1F-ITS4B) was used to amplify fungal internal transcribed spacer (ITS) sequences from total DNA extracts of the soil horizons. Amplified basidiomycete DNA was cloned and sequenced, and a selection of the obtained clones was analyzed phylogenetically. Based on sequence similarity, the fungal clone sequences were sorted into 25 different fungal groups, or operational taxonomic units (OTUs). Out of 25 basidiomycete OTUs, 7 OTUs showed high nucleotide homology (≥99%) with known EM fungal sequences and 16 were found exclusively in the mineral soil. The taxonomic positions of six OTUs remained unclear. OTU sequences were compared to sequences from morphotyped EM root tips collected from the same sites. Of the 25 OTUs, 10 OTUs had ≥98% sequence similarity with these EM root tip sequences. The present study demonstrates the use of molecular techniques to identify EM hyphae in various soil types. This approach differs from the conventional method of EM root tip identification and provides a novel approach to examine EM fungal communities in soil. PMID:12514012

Molecular analysis of the microbial diversity present in the colonic wall, colonic lumen, and cecal lumen of a pig.

PubMed

Pryde, S E; Richardson, A J; Stewart, C S; Flint, H J

1999-12-01

Random clones of 16S ribosomal DNA gene sequences were isolated after PCR amplification with eubacterial primers from total genomic DNA recovered from samples of the colonic lumen, colonic wall, and cecal lumen from a pig. Sequences were also obtained for cultures isolated anaerobically from the same colonic-wall sample. Phylogenetic analysis showed that many sequences were related to those of Lactobacillus or Streptococcus spp. or fell into clusters IX, XIVa, and XI of gram-positive bacteria. In addition, 59% of randomly cloned sequences showed less than 95% similarity to database entries or sequences from cultivated organisms. Cultivation bias is also suggested by the fact that the majority of isolates (54%) recovered from the colon wall by culturing were related to Lactobacillus and Streptococcus, whereas this group accounted for only one-third of the sequence variation for the same sample from random cloning. The remaining cultured isolates were mainly Selenomonas related. A higher proportion of Lactobacillus reuteri-related sequences than of Lactobacillus acidophilus- and Lactobacillus amylovorus-related sequences were present in the colonic-wall sample. Since the majority of bacterial ribosomal sequences recovered from the colon wall are less than 95% related to known organisms, the roles of many of the predominant wall-associated bacteria remain to be defined.

Molecular Analysis of the Microbial Diversity Present in the Colonic Wall, Colonic Lumen, and Cecal Lumen of a Pig

PubMed Central

Pryde, Susan E.; Richardson, Anthony J.; Stewart, Colin S.; Flint, Harry J.

1999-01-01

Random clones of 16S ribosomal DNA gene sequences were isolated after PCR amplification with eubacterial primers from total genomic DNA recovered from samples of the colonic lumen, colonic wall, and cecal lumen from a pig. Sequences were also obtained for cultures isolated anaerobically from the same colonic-wall sample. Phylogenetic analysis showed that many sequences were related to those of Lactobacillus or Streptococcus spp. or fell into clusters IX, XIVa, and XI of gram-positive bacteria. In addition, 59% of randomly cloned sequences showed less than 95% similarity to database entries or sequences from cultivated organisms. Cultivation bias is also suggested by the fact that the majority of isolates (54%) recovered from the colon wall by culturing were related to Lactobacillus and Streptococcus, whereas this group accounted for only one-third of the sequence variation for the same sample from random cloning. The remaining cultured isolates were mainly Selenomonas related. A higher proportion of Lactobacillus reuteri-related sequences than of Lactobacillus acidophilus- and Lactobacillus amylovorus-related sequences were present in the colonic-wall sample. Since the majority of bacterial ribosomal sequences recovered from the colon wall are less than 95% related to known organisms, the roles of many of the predominant wall-associated bacteria remain to be defined. PMID:10583991

Differences in expression of retinal pigment epithelium mRNA between normal canines

PubMed Central

2004-01-01

Abstract A reference database of differences in mRNA expression in normal healthy canine retinal pigment epithelium (RPE) has been established. This database identifies non-informative differences in mRNA expression that can be used in screening canine RPE for mutations associated with clinical effects on vision. Complementary DNA (cDNA) pools were prepared from mRNA harvested from RPE, amplified by PCR, and used in a subtractive hybridization protocol (representational differential analysis) to identify differences in RPE mRNA expression between canines. The effect of relatedness of the test canines on the frequency of occurrence of differences was evaluated by using 2 unrelated canines for comparison with 2 female sibling canines of blue heeler/bull terrier lineage. Differentially expressed cDNA species were cloned, sequenced, and identified by comparison to public database entries. The most frequently observed differentially expressed sequence from the unrelated canine comparison was cDNA with 21 base pairs (bp) identical to the human epithelial membrane protein 1 gene (present in 8 of 20 clones). Different clones from the same-sex sibling RPE contained repetitions of several short sequence motifs including the human epithelial membrane protein 1 (4 of 25 clones). Other prevalent differences between sibling RPE included sequences similar to a chicken genetic marker sequence motif (5 of 25), and 6 clones with homology to porcine major histocompatibility loci. In addition to identifying several repetitively occurring, noninformative, differentially expressed RPE mRNA species, the findings confirm that fewer differences occurred between siblings, highlighting the importance of using closely related subjects in representational difference analysis studies. PMID:15352545

Cloning and Characterization of the Pyrrolomycin Biosynthetic Gene Clusters from Actinosporangium vitaminophilum ATCC 31673 and Streptomyces sp. Strain UC 11065▿

PubMed Central

Zhang, Xiujun; Parry, Ronald J.

2007-01-01

The pyrrolomycins are a family of polyketide antibiotics, some of which contain a nitro group. To gain insight into the nitration mechanism associated with the formation of these antibiotics, the pyrrolomycin biosynthetic gene cluster from Actinosporangium vitaminophilum was cloned. Sequencing of ca. 56 kb of A. vitaminophilum DNA revealed 35 open reading frames (ORFs). Sequence analysis revealed a clear relationship between some of these ORFs and the biosynthetic gene cluster for pyoluteorin, a structurally related antibiotic. Since a gene transfer system could not be devised for A. vitaminophilum, additional proof for the identity of the cloned gene cluster was sought by cloning the pyrrolomycin gene cluster from Streptomyces sp. strain UC 11065, a transformable pyrrolomycin producer. Sequencing of ca. 26 kb of UC 11065 DNA revealed the presence of 17 ORFs, 15 of which exhibit strong similarity to ORFs in the A. vitaminophilum cluster as well as a nearly identical organization. Single-crossover disruption of two genes in the UC 11065 cluster abolished pyrrolomycin production in both cases. These results confirm that the genetic locus cloned from UC 11065 is essential for pyrrolomycin production, and they also confirm that the highly similar locus in A. vitaminophilum encodes pyrrolomycin biosynthetic genes. Sequence analysis revealed that both clusters contain genes encoding the two components of an assimilatory nitrate reductase. This finding suggests that nitrite is required for the formation of the nitrated pyrrolomycins. However, sequence analysis did not provide additional insights into the nitration process, suggesting the operation of a novel nitration mechanism. PMID:17158935

Molecular cloning of the plasma membrane H(+)-ATPase from Kluyveromyces lactis: a single nucleotide substitution in the gene confers ethidium bromide resistance and deficiency in K+ uptake.

PubMed Central

Miranda, M; Ramírez, J; Peña, A; Coria, R

1995-01-01

A Kluyveromyces lactis strain resistant to ethidium bromide and deficient in potassium uptake was isolated. Studies on the proton-pumping activity of the mutant strain showed that a decreased H(+)-ATPase specific activity was responsible for the observed phenotypes. The putative K. lactis PMA1 gene encoding the plasma membrane H(+)-ATPase was cloned by its ability to relieve the potassium transport defect of this mutant and by reversing its resistance to ethidium bromide. Its deduced amino acid sequence predicts a protein 899 residues long that is structurally colinear in its full length to H(+)-ATPases cloned from different yeasts, except for the presence of a variable N-terminal domain. By PCR-mediated amplification, we identified a transition from G to A that rendered the substitution of the fully conserved methionine at position 699 by isoleucine. We attribute to this amino acid change the low capacity of the mutant H(+)-ATPase to pump out protons. PMID:7730265

Organization of the hao gene cluster of Nitrosomonas europaea: genes for two tetraheme c cytochromes.

PubMed

Bergmann, D J; Arciero, D M; Hooper, A B

1994-06-01

The organization of genes for three proteins involved in ammonia oxidation in Nitrosomonas europaea has been investigated. The amino acid sequence of the N-terminal region and four heme-containing peptides produced by proteolysis of the tetraheme cytochrome c554 of N. europaea were determined by Edman degradation. The gene (cycA) encoding this cytochrome is present in three copies per genome (H. McTavish, F. LaQuier, D. Arciero, M. Logan, G. Mundfrom, J.A. Fuchs, and A. B. Hooper, J. Bacteriol. 175:2445-2447, 1993). Three clones, representing at least two copies of cycA, were isolated and sequenced by the dideoxy-chain termination procedure. In both copies, the sequences of 211 amino acids derived from the gene sequence are identical and include all amino acids predicted by the proteolytic peptides. In two copies, the cycA open reading frame (ORF) is followed closely (three bases in one copy) by a second ORF predicted to encode a 28-kDa tetraheme c cytochrome not previously characterized but similar to the nirT gene product of Pseudomonas stutzeri. In one copy of the cycA gene cluster, the second ORF is absent.

Whole-Genome Sequence of Coxiella burnetii Nine Mile RSA439 (Phase II, Clone 4), a Laboratory Workhorse Strain

PubMed Central

Beare, Paul A.; Moses, Abraham S.; Martens, Craig A.; Heinzen, Robert A.

2017-01-01

ABSTRACT Here, we report the whole-genome sequence of Coxiella burnetii Nine Mile RSA439 (phase II, clone 4), a laboratory strain used extensively to investigate the biology of this intracellular bacterial pathogen. The genome consists of a 1.97-Mb chromosome and a 37.32-kb plasmid. PMID:28596399

Whole-Genome Sequence of Coxiella burnetii Nine Mile RSA439 (Phase II, Clone 4), a Laboratory Workhorse Strain.

PubMed

Millar, Jess A; Beare, Paul A; Moses, Abraham S; Martens, Craig A; Heinzen, Robert A; Raghavan, Rahul

2017-06-08

Here, we report the whole-genome sequence of Coxiella burnetii Nine Mile RSA439 (phase II, clone 4), a laboratory strain used extensively to investigate the biology of this intracellular bacterial pathogen. The genome consists of a 1.97-Mb chromosome and a 37.32-kb plasmid. Copyright © 2017 Millar et al.

Hypervirulent Clone of Group B Streptococcus Serotype III Sequence Type 283, Hong Kong, 1993–2012

PubMed Central

Ang, Irene; Fung, Kitty; Liyanapathirana, Veranja; Luo, Ming Jing; Lai, Raymond

2016-01-01

We describe a hypervirulent clone of group B Streptococcus serotype III, subtype 4, sequence type 283, that caused invasive disease with a predilection for meningitis in Hong Kong during 1993–2012. The organism is associated with high mortality and increased summer prevalence and is linked to diseased fish from freshwater fish farms. PMID:27648702

Complementary DNA cloning, sequence analysis, and tissue transcription profile of a novel U2AF2 gene from the Chinese Banna mini-pig inbred line.

PubMed

Wang, S Y; Huo, J L; Miao, Y W; Cheng, W M; Zeng, Y Z

2013-04-02

U2 small nuclear RNA auxiliary factor 2 (U2AF2) is an important gene for pre-messenger RNA splicing in higher eukaryotes. In this study, the Banna mini-pig inbred line (BMI) U2AF2 coding sequence (CDS) was cloned, sequenced, and characterized. The U2AF2 complete CDS was amplified using the reverse transcription-polymerase chain reaction (RT-PCR) technique based on the conserved sequence information of cattle and known highly homologous swine expressed sequence tags. This novel gene was deposited into the National Center for Biotechnology Information database (Accession No. JQ839267). Sequence analysis revealed that the BMI U2AF2 coding sequence consisted of 1416 bp and encoded 471 amino acids with a molecular weight of 53.12 kDa. The protein sequence has high sequence homology with U2AF65 of 6 species - Homo sapiens (100%), Equus caballus (100%), Canis lupus (100%), Macaca mulatta (99.8%), Bos taurus (74.4%), and Mus musculus (74.4%). The phylogenetic tree analysis revealed that BMI U2AF65 has a closer genetic relationship with B. taurus U2AF65 than with U2AF65 of E. caballus, C. lupus, M. mulatta, H. sapiens, and M. musculus. RT-PCR analysis showed that BMI U2AF2 was most highly expressed in the brain; moderately expressed in the spleen, lung, muscle, and skin; and weakly expressed in the liver, kidney, and ovary. Its expression was nearly silent in the spinal cord, nerve fiber, heart, stomach, pancreas, and intestine. Three microRNA target sites were predicted in the CDS of BMI U2AF2 messenger RNA. Our results establish a foundation for further insight into this swine gene.

Purification, characterization, and cDNA cloning of a novel acidic endoglycoceramidase from the jellyfish, Cyanea nozakii.

PubMed

Horibata, Y; Okino, N; Ichinose, S; Omori, A; Ito, M

2000-10-06

Endoglycoceramidase (EC ) is an enzyme capable of cleaving the glycosidic linkage between oligosaccharides and ceramides in various glycosphingolipids. We report here the purification, characterization, and cDNA cloning of a novel endoglycoceramidase from the jellyfish, Cyanea nozakii. The purified enzyme showed a single protein band estimated to be 51 kDa on SDS-polyacrylamide gel electrophoresis. The enzyme showed a pH optimum of 3.0 and was activated by Triton X-100 and Lubrol PX but not by sodium taurodeoxycholate. This enzyme preferentially hydrolyzed gangliosides, especially GT1b and GQ1b, whereas neutral glycosphingolipids were somewhat resistant to hydrolysis by the enzyme. A full-length cDNA encoding the enzyme was cloned by 5'- and 3'-rapid amplification of cDNA ends using a partial amino acid sequence of the purified enzyme. The open reading frame of 1509 nucleotides encoded a polypeptide of 503 amino acids including a signal sequence of 25 residues and six potential N-glycosylation sites. Interestingly, the Asn-Glu-Pro sequence, which is the putative active site of Rhodococcus endoglycoceramidase, was conserved in the deduced amino acid sequences. This is the first report of the cloning of an endoglycoceramidase from a eukaryote.

Genetics of bacteria that utilize one carbon compounds: Final report, March 1, 1982-February 29, 1988

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hanson, R.S.

Broad host range plasmid vectors useful for cloning genes from bacteria that grow on methane and methanol were constructed. We have cloned and mapped nineteen genes required for the growth of Methylobacterium organophilum strain XX on methanol. Nineteen genes were found in seven linkage groups on the M. organophilum genome and were separated by 40 kb or more. Eleven genes were required for the synthesis of methanol dehydrogenase (MDH) and were located in three unlinked gene clusters. The MDH structural gene was localized on a 2.5 kb DNA fragment. The gene was sequenced and contains a 175 bp untranslated leadermore » sequence, a signal sequence and the structural gene. MDH messenger RNA (mRNA) has a half life of approximately 20 min. and is present at approximately 2% of the cellular mRNA. The structural gene for the ..gamma.. subunit of methane monoxygenases has been cloned from Methylosporovibrio. Methane monooxygenase subunits have been purified by Prof. J. Lipscomb's laboratory and are being sequenced to construct DNA probes to identify cloned subunit genes. New facultative methylotrophic bacteria were isolated and characterized. Several amino acid auxotrophs have been isolated. 11 refs.« less

Reduced randomness in quantum cryptography with sequences of qubits encoded in the same basis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lamoureux, L.-P.; Cerf, N. J.; Bechmann-Pasquinucci, H.

2006-03-15

We consider the cloning of sequences of qubits prepared in the states used in the BB84 or six-state quantum cryptography protocol, and show that the single-qubit fidelity is unaffected even if entire sequences of qubits are prepared in the same basis. This result is only valid provided that the sequences are much shorter than the total key. It is of great importance for practical quantum cryptosystems because it reduces the need for high-speed random number generation without impairing on the security against finite-size cloning attacks.

A Survey of Validation Strategies for CRISPR-Cas9 Editing.

PubMed

Sentmanat, Monica F; Peters, Samuel T; Florian, Colin P; Connelly, Jon P; Pruett-Miller, Shondra M

2018-01-17

The T7 endonuclease 1 (T7E1) mismatch detection assay is a widely used method for evaluating the activity of site-specific nucleases, such as the clustered regularly interspaced short palindromic repeats (CRISPR)-Cas9 system. To determine the accuracy and sensitivity of this assay, we compared the editing estimates derived by the T7E1 assay with that of targeted next-generation sequencing (NGS) in pools of edited mammalian cells. Here, we report that estimates of nuclease activity determined by T7E1 most often do not accurately reflect the activity observed in edited cells. Editing efficiencies of CRISPR-Cas9 complexes with similar activity by T7E1 can prove dramatically different by NGS. Additionally, we compared editing efficiencies predicted by the Tracking of Indels by Decomposition (TIDE) assay and the Indel Detection by Amplicon Analysis (IDAA) assay to that observed by targeted NGS for both cellular pools and single-cell derived clones. We show that targeted NGS, TIDE, and IDAA assays predict similar editing efficiencies for pools of cells but that TIDE and IDAA can miscall alleles in edited clones.

Analysis of a diverse assemblage of diazotrophic bacteria from Spartina alterniflora using DGGE and clone library screening.

PubMed

Lovell, Charles R; Decker, Peter V; Bagwell, Christopher E; Thompson, Shelly; Matsui, George Y

2008-05-01

Methods to assess the diversity of the diazotroph assemblage in the rhizosphere of the salt marsh cordgrass, Spartina alterniflora were examined. The effectiveness of nifH PCR-denaturing gradient gel electrophoresis (DGGE) was compared to that of nifH clone library analysis. Seventeen DGGE gel bands were sequenced and yielded 58 nonidentical nifH sequences from a total of 67 sequences determined. A clone library constructed using the GC-clamp nifH primers that were employed in the PCR-DGGE (designated the GC-Library) yielded 83 nonidentical sequences from a total of 257 nifH sequences. A second library constructed using an alternate set of nifH primers (N-Library) yielded 83 nonidentical sequences from a total of 138 nifH sequences. Rarefaction curves for the libraries did not reach saturation, although the GC-Library curve was substantially dampened and appeared to be closer to saturation than the N-Library curve. Phylogenetic analyses showed that DGGE gel band sequencing recovered nifH sequences that were frequently sampled in the GC-Library, as well as sequences that were infrequently sampled, and provided a species composition assessment that was robust, efficient, and relatively inexpensive to obtain. Further, the DGGE method permits a large number of samples to be examined for differences in banding patterns, after which bands of interest can be sampled for sequence determination.

Identification, sequencing and expression of an integral membrane protein of the trans-Golgi network (TGN38).

PubMed Central

Luzio, J P; Brake, B; Banting, G; Howell, K E; Braghetta, P; Stanley, K K

1990-01-01

Organelle-specific integral membrane proteins were identified by a novel strategy which gives rise to monospecific antibodies to these proteins as well as to the cDNA clones encoding them. A cDNA expression library was screened with a polyclonal antiserum raised against Triton X-114-extracted organelle proteins and clones were then grouped using antibodies affinity-purified on individual fusion proteins. The identification, molecular cloning and sequencing are described of a type 1 membrane protein (TGN38) which is located specifically in the trans-Golgi network. Images Fig. 1. Fig. 3. PMID:2204342

Feasibility of physical map construction from fingerprinted bacterial artificial chromosome libraries of polyploid plant species

PubMed Central

2010-01-01

Background The presence of closely related genomes in polyploid species makes the assembly of total genomic sequence from shotgun sequence reads produced by the current sequencing platforms exceedingly difficult, if not impossible. Genomes of polyploid species could be sequenced following the ordered-clone sequencing approach employing contigs of bacterial artificial chromosome (BAC) clones and BAC-based physical maps. Although BAC contigs can currently be constructed for virtually any diploid organism with the SNaPshot high-information-content-fingerprinting (HICF) technology, it is currently unknown if this is also true for polyploid species. It is possible that BAC clones from orthologous regions of homoeologous chromosomes would share numerous restriction fragments and be therefore included into common contigs. Because of this and other concerns, physical mapping utilizing the SNaPshot HICF of BAC libraries of polyploid species has not been pursued and the possibility of doing so has not been assessed. The sole exception has been in common wheat, an allohexaploid in which it is possible to construct single-chromosome or single-chromosome-arm BAC libraries from DNA of flow-sorted chromosomes and bypass the obstacles created by polyploidy. Results The potential of the SNaPshot HICF technology for physical mapping of polyploid plants utilizing global BAC libraries was evaluated by assembling contigs of fingerprinted clones in an in silico merged BAC library composed of single-chromosome libraries of two wheat homoeologous chromosome arms, 3AS and 3DS, and complete chromosome 3B. Because the chromosome arm origin of each clone was known, it was possible to estimate the fidelity of contig assembly. On average 97.78% or more clones, depending on the library, were from a single chromosome arm. A large portion of the remaining clones was shown to be library contamination from other chromosomes, a feature that is unavoidable during the construction of single-chromosome BAC libraries. Conclusions The negligibly low level of incorporation of clones from homoeologous chromosome arms into a contig during contig assembly suggested that it is feasible to construct contigs and physical maps using global BAC libraries of wheat and almost certainly also of other plant polyploid species with genome sizes comparable to that of wheat. Because of the high purity of the resulting assembled contigs, they can be directly used for genome sequencing. It is currently unknown but possible that equally good BAC contigs can be also constructed for polyploid species containing smaller, more gene-rich genomes. PMID:20170511

The population structure of Vibrio cholerae from the Chandigarh Region of Northern India.

PubMed

Abd El Ghany, Moataz; Chander, Jagadish; Mutreja, Ankur; Rashid, Mamoon; Hill-Cawthorne, Grant A; Ali, Shahjahan; Naeem, Raeece; Thomson, Nicholas R; Dougan, Gordon; Pain, Arnab

2014-07-01

Cholera infection continues to be a threat to global public health. The current cholera pandemic associated with Vibrio cholerae El Tor has now been ongoing for over half a century. Thirty-eight V. cholerae El Tor isolates associated with a cholera outbreak in 2009 from the Chandigarh region of India were characterised by a combination of microbiology, molecular typing and whole-genome sequencing. The genomic analysis indicated that two clones of V. cholera circulated in the region and caused disease during this time. These clones fell into two distinct sub-clades that map independently onto wave 3 of the phylogenetic tree of seventh pandemic V. cholerae El Tor. Sequence analyses of the cholera toxin gene, the Vibrio seventh Pandemic Island II (VSPII) and SXT element correlated with this phylogenetic position of the two clades on the El Tor tree. The clade 2 isolates, characterized by a drug-resistant profile and the expression of a distinct cholera toxin, are closely related to the recent V. cholerae isolated elsewhere, including Haiti, but fell on a distinct branch of the tree, showing they were independent outbreaks. Multi-Locus Sequence Typing (MLST) distinguishes two sequence types among the 38 isolates, that did not correspond to the clades defined by whole-genome sequencing. Multi-Locus Variable-length tandem-nucleotide repeat Analysis (MLVA) identified 16 distinct clusters. The use of whole-genome sequencing enabled the identification of two clones of V. cholerae that circulated during the 2009 Chandigarh outbreak. These clones harboured a similar structure of ICEVchHai1 but differed mainly in the structure of CTX phage and VSPII. The limited capacity of MLST and MLVA to discriminate between the clones that circulated in the 2009 Chandigarh outbreak highlights the value of whole-genome sequencing as a route to the identification of further genetic markers to subtype V. cholerae isolates.

Citrus and Prunuscopia-like retrotransposons.

PubMed

Asíns, M J; Monforte, A J; Mestre, P F; Carbonell, E A

1999-08-01

Many of the world's most important citrus cultivars ("Washington Navel", satsumas, clementines) have arisen through somatic mutation. This phenomenon occurs fairly often in the various species and varieties of the genus.The presence of copia-like retrotransposons has been investigated in fruit trees, especially citrus, by using a PCR assay designed to detect copia-like reverse transcriptase (RT) sequences. Amplification products from a genotype of each the following species Citrus sinensis, Citrus grandis, Citrus clementina, Prunus armeniaca and Prunus amygdalus, were cloned and some of them sequenced. Southern-blot hybridization using RT clones as probes showed that multiple copies are integrated throughout the citrus genome, while only 1-3 copies are detected in the P. armeniaca genome, which is in accordance with the Citrus and Prunus genome sizes. Sequence analysis of RT clones allowed a search for homologous sequences within three gene banks. The most similar ones correspond to RT domains of copia-like retrotransposons from unrelated plant species. Cluster analysis of these sequences has shown a great heterogeneity among RT domains cloned from the same genotype. This finding supports the hypothesis that horizontal transmission of retrotransposons has occurred in the past. The species presenting a RT sequence most similar to citrus RT clones is Gnetum montanum, a gymnosperm whose distribution area coincides with two of the main centers of origin of Citrus spp. A new C-methylated restriction DNA fragment containing a RT sequence is present in navel sweet oranges, but not in Valencia oranges from which the former originated suggesting, that retrotransposon activity might be, at least in part, involved in the genetic variability among sweet orange cultivars. Given that retrotransposons are quite abundant throughout the citrus genome, their activity should be investigated thoroughly before commercializing any transgenic citrus plant where the transgene(s) is part of a viral genome in order to avoid its possible recombination with an active retroelement. Focusing on other strategies to control virus diseases is recommended in citrus.

Clones from a shooty tobacco crown gall tumor I: deletions, rearrangements and amplifications resulting in irregular T-DNA structures and organizations.

PubMed

Peerbolte, R; Leenhouts, K; Hooykaas-van Slogteren, G M; Hoge, J H; Wullems, G J; Schilperoort, R A

1986-07-01

Transformed clones from a shooty tobacco crown gall tumor, induced byAgrobacterium tumefaciens strain LBA1501, having a Tn1831 insertion in the auxin locus, were investigated for their T-DNA structure and expression. In addition to clones with the expected phenotype, i.e. phytohormone autonomy, regeneration of non-rooting shoots and octopine synthesis (Aut(+)Reg(+)Ocs(+) 'type I' clones), clones were obtained with an aberrant phenotype. Among these were the Aut(-)Reg(-)Ocs(+) 'type II' clones. Two shooty type I clones and three type II callus clones (all randomly chosen) as well as a rooting shoot regenerated from a type II clone via a high kinetin treatment, all had a T-DNA structure which differed significantly from 'regular' T-DNA structures. No Tn1831 DNA sequences were detected in these clones. The two type I clones were identical: they both contained the same highly truncated T-DNA segments. One TL-DNA segment of approximately 0.7 kb, originating form the left part of the TL-region, was present at one copy per diploid tobacco genome. Another segment with a maximum size of about 7 kb was derived from the right hand part of the TL-region and was present at minimally two copies. Three copies of a truncated TR-DNA segment were detected, probably starting at the right TR-DNA border repeat and ending halfway the regular TR-region. Indications have been obtained that at least some of the T-DNA segments are closely linked, sometimes via intervening plant DNA sequences. The type I clones harbored TL-DNA transcripts 4, 6a/b and 3 as well as TR-DNA transcript 0'. The type II clones harbored three to six highly truncated T-DNA segments, originating from the right part of the TL-region. In addition they had TR-DNA segments, similar to those of the type I clones. On Northern blots TR-DNA transcripts 0' and 1' were detected as well as the TL-DNA transcripts 3 and 6a/b and an 1800 bp hybrid transcript (tr.Y) containing gene 6b sequences. Possible origins of the observed irregularities in T-DNA structures are discussed in relation to fidelity of transformation of plant cells viaAgrobacterium.

Cytoreductive conditioning intensity predicts clonal diversity in ADA-SCID retroviral gene therapy patients

PubMed Central

Lill, Georgia R.; Shaw, Kit; Carbonaro-Sarracino, Denise A.; Davila, Alejandra; Sokolic, Robert; Candotti, Fabio; Pellegrini, Matteo

2017-01-01

Retroviral gene therapy has proved efficacious for multiple genetic diseases of the hematopoietic system, but roughly half of clinical gene therapy trial protocols using gammaretroviral vectors have reported leukemias in some of the patients treated. In dramatic contrast, 39 adenosine deaminase–deficient severe combined immunodeficiency (ADA-SCID) patients have been treated with 4 distinct gammaretroviral vectors without oncogenic consequence. We investigated clonal dynamics and diversity in a cohort of 15 ADA-SCID children treated with gammaretroviral vectors and found clear evidence of genotoxicity, indicated by numerous common integration sites near proto-oncogenes and by increased abundance of clones with integrations near MECOM and LMO2. These clones showed stable behavior over multiple years and never expanded to the point of dominance or dysplasia. One patient developed a benign clonal dominance that could not be attributed to insertional mutagenesis and instead likely resulted from expansion of a transduced natural killer clone in response to chronic Epstein-Barr virus viremia. Clonal diversity and T-cell repertoire, measured by vector integration site sequencing and T-cell receptor β-chain rearrangement sequencing, correlated significantly with the amount of busulfan preconditioning delivered to patients and to CD34+ cell dose. These data, in combination with results of other ADA-SCID gene therapy trials, suggest that disease background may be a crucial factor in leukemogenic potential of retroviral gene therapy and underscore the importance of cytoreductive conditioning in this type of gene therapy approach. PMID:28351939

cDNA cloning of the murine PEX gene implicated in X-linked hypophosphatemia and evidence for expression in bone

DOE Office of Scientific and Technical Information (OSTI.GOV)

Du, L.; Desbarats, M.; Viel, J.

1996-08-15

The recently identified human PEX g ene apparently encodes for a neutral endopeptidase that is mutated in patients with X-linked hypophosphatemia. The 3{prime} and 5{prime} ends of the coding region of PEX have not been cloned, nor has the tissue expression of the gene been identified. Here we report the isolation and characterization of the complete open reading frame of the mouse Pex gene and the demonstration of its expression in bone. Mouse Pex cDNA is predicted to encode a protein of 749 amino acids with 95% identity to the available human PEX sequence and significant homology to members ofmore » the membrane-bound metalloendopeptidase family. Northern blot analysis revealed a 6.6-kb transcript in bone and in cultured osteoblasts from normal mice that was not detectable in samples from the Hyp mouse, the murine homolog of human X-linked hypophosphatemia. Pex transcripts were, however, detectable in Hyp bone by RT-PCR amplification. Of particular interest, a cDNA clone from rat incisor shows 93% sequence identity to the 5{prime} end of Pex cDNA, suggesting that Pex may be expressed in another calcified tissue, the tooth. The association of impaired mineralization of bone and teeth and disturbed renal phosphate reabsorption with altered expression of Pex suggests that the Pex gene product may play a critical role in these processes. 47 refs., 2 figs., 1 tab.« less

Cytoreductive conditioning intensity predicts clonal diversity in ADA-SCID retroviral gene therapy patients.

PubMed

Cooper, Aaron R; Lill, Georgia R; Shaw, Kit; Carbonaro-Sarracino, Denise A; Davila, Alejandra; Sokolic, Robert; Candotti, Fabio; Pellegrini, Matteo; Kohn, Donald B

2017-05-11

Retroviral gene therapy has proved efficacious for multiple genetic diseases of the hematopoietic system, but roughly half of clinical gene therapy trial protocols using gammaretroviral vectors have reported leukemias in some of the patients treated. In dramatic contrast, 39 adenosine deaminase-deficient severe combined immunodeficiency (ADA-SCID) patients have been treated with 4 distinct gammaretroviral vectors without oncogenic consequence. We investigated clonal dynamics and diversity in a cohort of 15 ADA-SCID children treated with gammaretroviral vectors and found clear evidence of genotoxicity, indicated by numerous common integration sites near proto-oncogenes and by increased abundance of clones with integrations near MECOM and LMO2 These clones showed stable behavior over multiple years and never expanded to the point of dominance or dysplasia. One patient developed a benign clonal dominance that could not be attributed to insertional mutagenesis and instead likely resulted from expansion of a transduced natural killer clone in response to chronic Epstein-Barr virus viremia. Clonal diversity and T-cell repertoire, measured by vector integration site sequencing and T-cell receptor β-chain rearrangement sequencing, correlated significantly with the amount of busulfan preconditioning delivered to patients and to CD34 + cell dose. These data, in combination with results of other ADA-SCID gene therapy trials, suggest that disease background may be a crucial factor in leukemogenic potential of retroviral gene therapy and underscore the importance of cytoreductive conditioning in this type of gene therapy approach.

Protein modelling of triterpene synthase genes from mangrove plants using Phyre2 and Swiss-model

NASA Astrophysics Data System (ADS)

Basyuni, M.; Wati, R.; Sulistiyono, N.; Hayati, R.; Sumardi; Oku, H.; Baba, S.; Sagami, H.

2018-03-01

Molecular cloning of five oxidosqualene cyclases (OSC) genes from Bruguiera gymnorrhiza, Kandelia candel, and Rhizophora stylosa had previously been cloned, characterized, and encoded mono and -multi triterpene synthases. The present study analyzed protein modelling of triterpene synthase genes from mangrove using Phyre2 and Swiss-model. The diversity was noted within protein modelling of triterpene synthases using Phyre2 from sequence identity (38-43%) and residue (696-703). RsM2 was distinguishable from others for template structure; it used lanosterol synthase as a template (PDB ID: w6j.1.A). By contrast, other genes used human lanosterol synthase (1w6k.1.A). The predicted bind sites were correlated with the product of triterpene synthase, the product of BgbAS was β-amyrin, while RsM1 contained a significant amount of β-amyrin. Similarly BgLUS and KcMS, both main products was lupeol, on the other hand, RsM2 with the outcome of taraxerol. Homology modelling revealed that 696 residues of BgbAS, BgLUS, RsM1, and RsM2 (91-92% of the amino acid sequence) had been modelled with 100% confidence by the single highest scoring template using Phyre2. This coverage was higher than Swiss-model (85-90%). The present study suggested that molecular cloning of triterpene genes provides useful tools for studying the protein modelling related regulation of isoprenoids biosynthesis in mangrove forests.

Identification and characterization of novel reptile cathelicidins from elapid snakes.

PubMed

Zhao, Hui; Gan, Tong-Xiang; Liu, Xiao-Dong; Jin, Yang; Lee, Wen-Hui; Shen, Ji-Hong; Zhang, Yun

2008-10-01

Three cDNA sequences coding for elapid cathelicidins were cloned from constructed venom gland cDNA libraries of Naja atra, Bungarus fasciatus and Ophiophagus hannah. The open reading frames of the cloned elapid cathelicidins were all composed of 576bp and coded for 191 amino acid residue protein precursors. Each of the deduced elapid cathelicidin has a 22 amino acid residue signal peptide, a conserved cathelin domain of 135 amino acid residues and a mature antimicrobial peptide of 34 amino acid residues. Unlike the highly divergent cathelicidins in mammals, the nucleotide and deduced protein sequences of the three cloned elapid cathelicidins were remarkably conserved. All the elapid mature cathelicidins were predicted to be cleaved at Valine157 by elastase. OH-CATH, the deduced mature cathelicidin from king cobra, was chemically synthesized and it showed strong antibacterial activity against various bacteria with minimal inhibitory concentration of 1-20microg/ml in the presence of 1% NaCl. Meanwhile, the synthetic peptide showed no haemolytic activity toward human red blood cells even at a high dose of 200microg/ml. Phylogenetic analysis of cathelicidins from vertebrate suggested that elapid and viperid cathelicidins were grouped together in the tree. Snake cathelicidins were evolutionary closely related to the neutrophilic granule proteins (NGPs) from mouse, rat and rabbit. Snake cathelicidins also showed a close relationship with avian fowlicidins (1-3) and chicken myeloid antimicrobial peptide 27. Elapid cathelicidins might be used as models for the development of novel therapeutic drugs.

Generation and characterization of anti-MUC4 monoclonal antibodies reactive with normal and cancer cells in humans.

PubMed

Moniaux, Nicolas; Varshney, Grish Chandra; Chauhan, Subhash Chand; Copin, Marie Christine; Jain, Maneesh; Wittel, Uwe A; Andrianifahanana, Mahefatiana; Aubert, Jean-Pierre; Batra, Surinder Kumar

2004-02-01

We have previously cloned the full-length cDNA (approximately 28 Kb) and established the complete genomic organization (25 exons/introns over 100 kb) of the human MUC4 mucin. This large molecule is predicted to protrude over 2 microm above the cell surface, in which MUC4alpha is an extracellular mucin-type glycoprotein subunit and MUC4beta is the transmembrane subunit. Over two thirds of the encoded protein sequence consists of 16-amino-acid tandem repeats (TR), which are flanked by unique sequences. In this study we generated and characterized monoclonal antibodies (MAbs) directed against the TR region of MUC4. Mice were immunized with a KLH-conjugated MUC4 TR peptide, STGDTTPLPVTDTSSV. Several clones were purified by three rounds of limited dilutions and stable clones presenting a sustained antibody production were selected for subsequent characterization. Antibodies were tested for their reactivity and specificity to recognize the MUC4 peptide and further screened by enzyme-linked immunosorbent assay (ELISA) and Western blotting analyses. One of the MAbs (8G7) was strongly reactive against the MUC4 peptide and with native MUC4 from human tissues or pancreatic cancer cells in Western blotting, immunohistochemistry, and confocal analysis. Anti-MUC4 MAb may represent a powerful tool for the study of MUC4 function under normal and pathological conditions and for diagnosis of solid tumors including those in the breast, pancreas, lungs, and ovaries.

Successful application of FTA Classic Card technology and use of bacteriophage phi29 DNA polymerase for large-scale field sampling and cloning of complete maize streak virus genomes.

PubMed

Owor, Betty E; Shepherd, Dionne N; Taylor, Nigel J; Edema, Richard; Monjane, Adérito L; Thomson, Jennifer A; Martin, Darren P; Varsani, Arvind

2007-03-01

Leaf samples from 155 maize streak virus (MSV)-infected maize plants were collected from 155 farmers' fields in 23 districts in Uganda in May/June 2005 by leaf-pressing infected samples onto FTA Classic Cards. Viral DNA was successfully extracted from cards stored at room temperature for 9 months. The diversity of 127 MSV isolates was analysed by PCR-generated RFLPs. Six representative isolates having different RFLP patterns and causing either severe, moderate or mild disease symptoms, were chosen for amplification from FTA cards by bacteriophage phi29 DNA polymerase using the TempliPhi system. Full-length genomes were inserted into a cloning vector using a unique restriction enzyme site, and sequenced. The 1.3-kb PCR product amplified directly from FTA-eluted DNA and used for RFLP analysis was also cloned and sequenced. Comparison of cloned whole genome sequences with those of the original PCR products indicated that the correct virus genome had been cloned and that no errors were introduced by the phi29 polymerase. This is the first successful large-scale application of FTA card technology to the field, and illustrates the ease with which large numbers of infected samples can be collected and stored for downstream molecular applications such as diversity analysis and cloning of potentially new virus genomes.

Construction and Cloning of Reporter-Tagged Replicon cDNA for an In Vitro Replication Study of Murine Norovirus-1 (MNV-1)

PubMed Central

Ahmad, Muhammad Khairi; Tabana, Yasser M; Ahmed, Mowaffaq Adam; Sandai, Doblin Anak; Mohamed, Rafeezul; Ismail, Ida Shazrina; Zulkiflie, Nurulisa; Yunus, Muhammad Amir

2017-01-01

Background A norovirus maintains its viability, infectivity and virulence by its ability to replicate. However, the biological mechanisms of the process remain to be explored. In this work, the NanoLuc™ Luciferase gene was used to develop a reporter-tagged replicon system to study norovirus replication. Methods The NanoLuc™ Luciferase reporter protein was engineered to be expressed as a fusion protein for MNV-1 minor capsid protein, VP2. The foot-and-mouth disease virus 2A (FMDV2A) sequence was inserted between the 3′end of the reporter gene and the VP2 start sequence to allow co-translational ‘cleavage’ of fusion proteins during intracellular transcript expression. Amplification of the fusion gene was performed using a series of standard and overlapping polymerase chain reactions. The resulting amplicon was then cloned into three readily available backbones of MNV-1 cDNA clones. Results Restriction enzyme analysis indicated that the NanoLucTM Luciferase gene was successfully inserted into the parental MNV-1 cDNA clone. The insertion was further confirmed by using DNA sequencing. Conclusion NanoLuc™ Luciferase-tagged MNV-1 cDNA clones were successfully engineered. Such clones can be exploited to develop robust experimental assays for in vitro assessments of viral RNA replication. PMID:29379384

Deep nirS amplicon sequencing of San Francisco Bay sediments enables prediction of geography and environmental conditions from denitrifying community composition.

PubMed

Lee, Jessica A; Francis, Christopher A

2017-12-01

Denitrification is a dominant nitrogen loss process in the sediments of San Francisco Bay. In this study, we sought to understand the ecology of denitrifying bacteria by using next-generation sequencing (NGS) to survey the diversity of a denitrification functional gene, nirS (encoding cytchrome-cd 1 nitrite reductase), along the salinity gradient of San Francisco Bay over the course of a year. We compared our dataset to a library of nirS sequences obtained previously from the same samples by standard PCR cloning and Sanger sequencing, and showed that both methods similarly demonstrated geography, salinity and, to a lesser extent, nitrogen, to be strong determinants of community composition. Furthermore, the depth afforded by NGS enabled novel techniques for measuring the association between environment and community composition. We used Random Forests modelling to demonstrate that the site and salinity of a sample could be predicted from its nirS sequences, and to identify indicator taxa associated with those environmental characteristics. This work contributes significantly to our understanding of the distribution and dynamics of denitrifying communities in San Francisco Bay, and provides valuable tools for the further study of this key N-cycling guild in all estuarine systems. © 2017 Society for Applied Microbiology and John Wiley & Sons Ltd.

PRP5: a helicase-like protein required for mRNA splicing in yeast.

PubMed Central

Dalbadie-McFarland, G; Abelson, J

1990-01-01

A 96-kDa protein predicted by the DNA sequence of the Saccharomyces cerevisiae PRP5 gene contains a domain that bears a striking resemblance to a family of RNA helicases characterized by the conserved amino acid sequence Asp-Glu-Ala-Asp (D-E-A-D). Previous work indicated that the product of the PRP5 gene is required for splicing and that spliceosome assembly does not occur in its absence. However, its precise role in splicing and the nature of its biochemical activity remained unknown. To examine the role of PRP5 in splicing, we cloned the gene by complementation of a temperature-sensitive mutation and determined its DNA sequence. We discuss here the possible roles for an RNA helicase in splicing and for the activity of the PRP5 protein. Images PMID:2349233

Draft genome sequence of the rubber tree Hevea brasiliensis.

PubMed

Rahman, Ahmad Yamin Abdul; Usharraj, Abhilash O; Misra, Biswapriya B; Thottathil, Gincy P; Jayasekaran, Kandakumar; Feng, Yun; Hou, Shaobin; Ong, Su Yean; Ng, Fui Ling; Lee, Ling Sze; Tan, Hock Siew; Sakaff, Muhd Khairul Luqman Muhd; Teh, Beng Soon; Khoo, Bee Feong; Badai, Siti Suriawati; Aziz, Nurohaida Ab; Yuryev, Anton; Knudsen, Bjarne; Dionne-Laporte, Alexandre; Mchunu, Nokuthula P; Yu, Qingyi; Langston, Brennick J; Freitas, Tracey Allen K; Young, Aaron G; Chen, Rui; Wang, Lei; Najimudin, Nazalan; Saito, Jennifer A; Alam, Maqsudul

2013-02-02

Hevea brasiliensis, a member of the Euphorbiaceae family, is the major commercial source of natural rubber (NR). NR is a latex polymer with high elasticity, flexibility, and resilience that has played a critical role in the world economy since 1876. Here, we report the draft genome sequence of H. brasiliensis. The assembly spans ~1.1 Gb of the estimated 2.15 Gb haploid genome. Overall, ~78% of the genome was identified as repetitive DNA. Gene prediction shows 68,955 gene models, of which 12.7% are unique to Hevea. Most of the key genes associated with rubber biosynthesis, rubberwood formation, disease resistance, and allergenicity have been identified. The knowledge gained from this genome sequence will aid in the future development of high-yielding clones to keep up with the ever increasing need for natural rubber.

Draft genome sequence of the rubber tree Hevea brasiliensis

PubMed Central

2013-01-01

Background Hevea brasiliensis, a member of the Euphorbiaceae family, is the major commercial source of natural rubber (NR). NR is a latex polymer with high elasticity, flexibility, and resilience that has played a critical role in the world economy since 1876. Results Here, we report the draft genome sequence of H. brasiliensis. The assembly spans ~1.1 Gb of the estimated 2.15 Gb haploid genome. Overall, ~78% of the genome was identified as repetitive DNA. Gene prediction shows 68,955 gene models, of which 12.7% are unique to Hevea. Most of the key genes associated with rubber biosynthesis, rubberwood formation, disease resistance, and allergenicity have been identified. Conclusions The knowledge gained from this genome sequence will aid in the future development of high-yielding clones to keep up with the ever increasing need for natural rubber. PMID:23375136

Small gene family encoding an eggshell (chorion) protein of the human parasite Schistosoma mansoni

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bobek, L.A.; Rekosh, D.M.; Lo Verde, P.T.

1988-08-01

The authors isolated six independent genomic clones encoding schistosome chorion or eggshell proteins from a Schistosoma mansoni genomic library. A linkage map of five of the clones spanning 35 kilobase pairs (kbp) of the S. mansoni genome was constructed. The region contained two eggshell protein genes closely linked, separated by 7.5 kbp of intergenic DNA. The two genes of the cluster were arranged in the same orientation, that is, they were transcribed from the same strand. The sixth clone probably represents a third copy of the eggshell gene that is not contained within the 35-kbp region. The 5- end ofmore » the mRNA transcribed from these genes was defined by primer extension directly off the RNA. The ATCAT cap site sequence was homologous to a silkmoth chorion PuTCATT cap site sequence, where Pu indicates any purine. DNA sequence analysis showed that there were no introns in these genes. The DNA sequences of the three genes were very homologous to each other and to a cDNA clone, pSMf61-46, differing only in three or four nucleotices. A multiple TATA box was located at positions -23 to -31, and a CAAAT sequence was located at -52 upstream of the eggshell transcription unit. Comparison of sequences in regions further upstream with silkmoth and Drosophila sequences revealed very short elements that were shared. One such element, TCACGT, recently shown to be an essential cis-regulatory element for silkmoth chorion gene promoter function, was found at a similar position in all three organisms.« less

Comparative performance of high-density oligonucleotide sequencing and dideoxynucleotide sequencing of HIV type 1 pol from clinical samples.

PubMed

Günthard, H F; Wong, J K; Ignacio, C C; Havlir, D V; Richman, D D

1998-07-01

The performance of the high-density oligonucleotide array methodology (GeneChip) in detecting drug resistance mutations in HIV-1 pol was compared with that of automated dideoxynucleotide sequencing (ABI) of clinical samples, viral stocks, and plasmid-derived NL4-3 clones. Sequences from 29 clinical samples (plasma RNA, n = 17; lymph node RNA, n = 5; lymph node DNA, n = 7) from 12 patients, from 6 viral stock RNA samples, and from 13 NL4-3 clones were generated by both methods. Editing was done independently by a different investigator for each method before comparing the sequences. In addition, NL4-3 wild type (WT) and mutants were mixed in varying concentrations and sequenced by both methods. Overall, a concordance of 99.1% was found for a total of 30,865 bases compared. The comparison of clinical samples (plasma RNA and lymph node RNA and DNA) showed a slightly lower match of base calls, 98.8% for 19,831 nucleotides compared (protease region, 99.5%, n = 8272; RT region, 98.3%, n = 11,316), than for viral stocks and NL4-3 clones (protease region, 99.8%; RT region, 99.5%). Artificial mixing experiments showed a bias toward calling wild-type bases by GeneChip. Discordant base calls are most likely due to differential detection of mixtures. The concordance between GeneChip and ABI was high and appeared dependent on the nature of the templates (directly amplified versus cloned) and the complexity of mixes.

Highly Efficient CRISPR/Cas9-Mediated Cloning and Functional Characterization of Gastric Cancer-Derived Epstein-Barr Virus Strains.

PubMed

Kanda, Teru; Furuse, Yuki; Oshitani, Hitoshi; Kiyono, Tohru

2016-05-01

The Epstein-Barr virus (EBV) is etiologically linked to approximately 10% of gastric cancers, in which viral genomes are maintained as multicopy episomes. EBV-positive gastric cancer cells are incompetent for progeny virus production, making viral DNA cloning extremely difficult. Here we describe a highly efficient strategy for obtaining bacterial artificial chromosome (BAC) clones of EBV episomes by utilizing a CRISPR/Cas9-mediated strand break of the viral genome and subsequent homology-directed repair. EBV strains maintained in two gastric cancer cell lines (SNU719 and YCCEL1) were cloned, and their complete viral genome sequences were determined. Infectious viruses of gastric cancer cell-derived EBVs were reconstituted, and the viruses established stable latent infections in immortalized keratinocytes. While Ras oncoprotein overexpression caused massive vacuolar degeneration and cell death in control keratinocytes, EBV-infected keratinocytes survived in the presence of Ras expression. These results implicate EBV infection in predisposing epithelial cells to malignant transformation by inducing resistance to oncogene-induced cell death. Recent progress in DNA-sequencing technology has accelerated EBV whole-genome sequencing, and the repertoire of sequenced EBV genomes is increasing progressively. Accordingly, the presence of EBV variant strains that may be relevant to EBV-associated diseases has begun to attract interest. Clearly, the determination of additional disease-associated viral genome sequences will facilitate the identification of any disease-specific EBV variants. We found that CRISPR/Cas9-mediated cleavage of EBV episomal DNA enabled the cloning of disease-associated viral strains with unprecedented efficiency. As a proof of concept, two gastric cancer cell-derived EBV strains were cloned, and the infection of epithelial cells with reconstituted viruses provided important clues about the mechanism of EBV-mediated epithelial carcinogenesis. This experimental system should contribute to establishing the relationship between viral genome variation and EBV-associated diseases. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

Tenebrio molitor antifreeze protein gene identification and regulation.

PubMed

Qin, Wensheng; Walker, Virginia K

2006-02-15

The yellow mealworm, Tenebrio molitor, is a freeze susceptible, stored product pest. Its winter survival is facilitated by the accumulation of antifreeze proteins (AFPs), encoded by a small gene family. We have now isolated 11 different AFP genomic clones from 3 genomic libraries. All the clones had a single coding sequence, with no evidence of intervening sequences. Three genomic clones were further characterized. All have putative TATA box sequences upstream of the coding regions and multiple potential poly(A) signal sequences downstream of the coding regions. A TmAFP regulatory region, B1037, conferred transcriptional activity when ligated to a luciferase reporter sequence and after transfection into an insect cell line. A 143 bp core promoter including a TATA box sequence was identified. Its promoter activity was increased 4.4 times by inserting an exotic 245 bp intron into the construct, similar to the enhancement of transgenic expression seen in several other systems. The addition of a duplication of the first 120 bp sequence from the 143 bp core promoter decreased promoter activity by half. Although putative hormonal response sequences were identified, none of the five hormones tested enhanced reporter activity. These studies on the mechanisms of AFP transcriptional control are important for the consideration of any transfer of freeze-resistance phenotypes to beneficial hosts.

Studying long 16S rDNA sequences with ultrafast-metagenomic sequence classification using exact alignments (Kraken).

PubMed

Valenzuela-González, Fabiola; Martínez-Porchas, Marcel; Villalpando-Canchola, Enrique; Vargas-Albores, Francisco

2016-03-01

Ultrafast-metagenomic sequence classification using exact alignments (Kraken) is a novel approach to classify 16S rDNA sequences. The classifier is based on mapping short sequences to the lowest ancestor and performing alignments to form subtrees with specific weights in each taxon node. This study aimed to evaluate the classification performance of Kraken with long 16S rDNA random environmental sequences produced by cloning and then Sanger sequenced. A total of 480 clones were isolated and expanded, and 264 of these clones formed contigs (1352 ± 153 bp). The same sequences were analyzed using the Ribosomal Database Project (RDP) classifier. Deeper classification performance was achieved by Kraken than by the RDP: 73% of the contigs were classified up to the species or variety levels, whereas 67% of these contigs were classified no further than the genus level by the RDP. The results also demonstrated that unassembled sequences analyzed by Kraken provide similar or inclusively deeper information. Moreover, sequences that did not form contigs, which are usually discarded by other programs, provided meaningful information when analyzed by Kraken. Finally, it appears that the assembly step for Sanger sequences can be eliminated when using Kraken. Kraken cumulates the information of both sequence senses, providing additional elements for the classification. In conclusion, the results demonstrate that Kraken is an excellent choice for use in the taxonomic assignment of sequences obtained by Sanger sequencing or based on third generation sequencing, of which the main goal is to generate larger sequences. Copyright © 2016 Elsevier B.V. All rights reserved.

Transposon-containing DNA cloning vector and uses thereof

DOEpatents

Berg, C.M.; Berg, D.E.; Wang, G.

1997-07-08

The present invention discloses a rapid method of restriction mapping, sequencing or localizing genetic features in a segment of deoxyribonucleic acid (DNA) that is up to 42 kb in size. The method in part comprises cloning of the DNA segment in a specialized cloning vector and then isolating nested deletions in either direction in vivo by intramolecular transposition into the cloned DNA. A plasmid has been prepared and disclosed. 4 figs.

Transposon-containing DNA cloning vector and uses thereof

DOEpatents

Berg, Claire M.; Berg, Douglas E.; Wang, Gan

1997-01-01

The present invention discloses a rapid method of restriction mapping, sequencing or localizing genetic features in a segment of deoxyribonucleic acid (DNA) that is up to 42 kb in size. The method in part comprises cloning of the DNA segment in a specialized cloning vector and then isolating nested deletions in either direction in vivo by intramolecular transposition into the cloned DNA. A plasmid has been prepared and disclosed.

Whole genome comparison of donor and cloned dogs

PubMed Central

Kim, Hak-Min; Cho, Yun Sung; Kim, Hyunmin; Jho, Sungwoong; Son, Bongjun; Choi, Joung Yoon; Kim, Sangsoo; Lee, Byeong Chun; Bhak, Jong; Jang, Goo

2013-01-01

Cloning is a process that produces genetically identical organisms. However, the genomic degree of genetic resemblance in clones needs to be determined. In this report, the genomes of a cloned dog and its donor were compared. Compared with a human monozygotic twin, the genome of the cloned dog showed little difference from the genome of the nuclear donor dog in terms of single nucleotide variations, chromosomal instability, and telomere lengths. These findings suggest that cloning by somatic cell nuclear transfer produced an almost identical genome. The whole genome sequence data of donor and cloned dogs can provide a resource for further investigations on epigenetic contributions in phenotypic differences. PMID:24141358

The ura5 gene of the ascomycete Sordaria macrospora: molecular cloning, characterization and expression in Escherichia coli.

PubMed

Le Chevanton, L; Leblon, G

1989-04-15

We cloned the ura5 gene coding for the orotate phosphoribosyl transferase from the ascomycete Sordaria macrospora by heterologous probing of a Sordaria genomic DNA library with the corresponding Podospora anserina sequence. The Sordaria gene was expressed in an Escherichia coli pyrE mutant strain defective for the same enzyme, and expression was shown to be promoted by plasmid sequences. The nucleotide sequence of the 1246-bp DNA fragment encompassing the region of homology with the Podospora gene has been determined. This sequence contains an open reading frame of 699 nucleotides. The deduced amino acid sequence shows 72% similarity with the corresponding Podospora protein.

Capturing diversity of marine heterotrophic protists: one cell at a time

PubMed Central

Heywood, Jane L; Sieracki, Michael E; Bellows, Wendy; Poulton, Nicole J; Stepanauskas, Ramunas

2011-01-01

Recent applications of culture-independent, molecular methods have revealed unexpectedly high diversity in a variety of functional and phylogenetic groups of microorganisms in the ocean. However, none of the existing research tools are free from significant limitations, such as PCR and cloning biases, low phylogenetic resolution and others. Here, we employed novel, single-cell sequencing techniques to assess the composition of small (<10 μm diameter), heterotrophic protists from the Gulf of Maine. Single cells were isolated by flow cytometry, their genomes amplified, and 18S rRNA marker genes were amplified and sequenced. We compared the results to traditional environmental PCR cloning of sorted cells. The diversity of heterotrophic protists was significantly higher in the library of single amplified genomes (SAGs) than in environmental PCR clone libraries of the 18S rRNA gene, obtained from the same coastal sample. Libraries of SAGs, but not clones contained several recently discovered, uncultured groups, including picobiliphytes and novel marine stramenopiles. Clone, but not SAG, libraries contained several large clusters of identical and nearly identical sequences of Dinophyceae, Cercozoa and Stramenopiles. Similar results were obtained using two alternative primer sets, suggesting that PCR biases may not be the only explanation for the observed patterns. Instead, differences in the number of 18S rRNA gene copies among the various protist taxa probably had a significant role in determining the PCR clone composition. These results show that single-cell sequencing has the potential to more accurately assess protistan community composition than previously established methods. In addition, the creation of SAG libraries opens opportunities for the analysis of multiple genes or entire genomes of the uncultured protist groups. PMID:20962875

Frame-Insensitive Expression Cloning of Fluorescent Protein from Scolionema suvaense.

PubMed

Horiuchi, Yuki; Laskaratou, Danai; Sliwa, Michel; Ruckebusch, Cyril; Hatori, Kuniyuki; Mizuno, Hideaki; Hotta, Jun-Ichi

2018-01-26

Expression cloning from cDNA is an important technique for acquiring genes encoding novel fluorescent proteins. However, the probability of in-frame cDNA insertion following the first start codon of the vector is normally only 1/3, which is a cause of low cloning efficiency. To overcome this issue, we developed a new expression plasmid vector, pRSET-TriEX, in which transcriptional slippage was induced by introducing a DNA sequence of (dT) 14 next to the first start codon of pRSET. The effectiveness of frame-insensitive cloning was validated by inserting the gene encoding eGFP with all three possible frames to the vector. After transformation with one of these plasmids, E. coli cells expressed eGFP with no significant difference in the expression level. The pRSET-TriEX vector was then used for expression cloning of a novel fluorescent protein from Scolionema suvaense . We screened 3658 E. coli colonies transformed with pRSET-TriEX containing Scolionema suvaense cDNA, and found one colony expressing a novel green fluorescent protein, ScSuFP. The highest score in protein sequence similarity was 42% with the chain c of multi-domain green fluorescent protein like protein "ember" from Anthoathecata sp. Variations in the N- and/or C-terminal sequence of ScSuFP compared to other fluorescent proteins indicate that the expression cloning, rather than the sequence similarity-based methods, was crucial for acquiring the gene encoding ScSuFP. The absorption maximum was at 498 nm, with an extinction efficiency of 1.17 × 10⁵ M -1 ·cm -1 . The emission maximum was at 511 nm and the fluorescence quantum yield was determined to be 0.6. Pseudo-native gel electrophoresis showed that the protein forms obligatory homodimers.

[Expression of human-mouse chimeric antibody directed against Chikungunya virus with site-specific integration system].

PubMed

Li, Jian-min; Chen, Wei; Jia, Xiu-jie; An, Xiao-ping; Li, Bing; Fan, Ying-ru; Tong, Yi-gang

2005-05-01

To obtain CHO/dhfr(-) cells line with integrated FRT sequence in the chromosome transcription active site and to express human-mouse chimeric antibody directed against Chikungunya Virus by using the cell line. The fusion gene of FRT and HBsAg was constructed by PCR and cloned into the MCS of pCI-neo to construct pCI-FRT-HBsAg. The pCI-FRT-HBsAg was transfected into CHO/dhfr(-) cells and cell clones with high expression of HBsAg were screened by detecting the amount of HBsAg with ELISA. A CHO cell clone with the highest expression was chosen and named as CHO/dhfr(-) FRT(+). pAFRT HFLF, a expression plasmid of chimeric antibody with RFT sequence was transfected into CHO/dhfr(-) FRT(+) cells and cell clones with high expression of the chimeric antibody were screened by increasing concentration of MTX. A CHO cell clone with high expression of the chimeric antibody was cultured in large scale and supernatant was collected from which the chimeric antibody was purified. The purified chimeric antibody was analyzed by SDS-PAGE, Western blot and IFA. A CHO/dhfr(-) cells line with integrated FRT sequence in the chromosome transcription active site was obtained successfully. A cell clone with yield of 5 mg/L of chimeric antibody was obtained, as compared with routine CHO cell expression system with a yield of 2 mg/L. A cell line with integrated FRT sequence in the chromosome transcription active site was obtained and with it human-mouse chimeric antibody directed against Chikungunya virus was expressed. This system lays a solid foundation which can be used for expressing antibodies and other proteins.

Genetic variability in G2 and F2 region between biological clones of human respiratory syncytial virus with or without host immune selection pressure

PubMed Central

Moraes, Claudia Trigo Pedroso; Oliveira, Danielle Bruna Leal; Campos, Angelica Cristine Almeida; Bosso, Patricia Alves; Lima, Hildener Nogueira; Stewien, Klaus Eberhard; Gilio, Alfredo Elias; Vieira, Sandra Elisabete; Botosso, Viviane Fongaro; Durigon, Edison Luiz

2015-01-01

Human respiratory syncytial virus (HRSV) is an important respiratory pathogens among children between zero-five years old. Host immunity and viral genetic variability are important factors that can make vaccine production difficult. In this work, differences between biological clones of HRSV were detected in clinical samples in the absence and presence of serum collected from children in the convalescent phase of the illness and from their biological mothers. Viral clones were selected by plaque assay in the absence and presence of serum and nucleotide sequences of the G2 and F2 genes of HRSV biological clones were compared. One non-synonymous mutation was found in the F gene (Ile5Asn) in one clone of an HRSV-B sample and one non-synonymous mutation was found in the G gene (Ser291Pro) in four clones of the same HRSV-B sample. Only one of these clones was obtained after treatment with the child's serum. In addition, some synonymous mutations were determined in two clones of the HRSV-A samples. In conclusion, it is possible that minor sequences could be selected by host antibodies contributing to the HRSV evolutionary process, hampering the development of an effective vaccine, since we verify the same codon alteration in absence and presence of human sera in individual clones of BR-85 sample. PMID:25742274

Genetic variability in G2 and F2 region between biological clones of human respiratory syncytial virus with or without host immune selection pressure.

PubMed

Moraes, Claudia Trigo Pedroso; Oliveira, Danielle Bruna Leal; Campos, Angelica Cristine Almeida; Bosso, Patricia Alves; Lima, Hildener Nogueira; Stewien, Klaus Eberhard; Gilio, Alfredo Elias; Vieira, Sandra Elisabete; Botosso, Viviane Fongaro; Durigon, Edison Luiz

2015-02-01

Human respiratory syncytial virus (HRSV) is an important respiratory pathogens among children between zero-five years old. Host immunity and viral genetic variability are important factors that can make vaccine production difficult. In this work, differences between biological clones of HRSV were detected in clinical samples in the absence and presence of serum collected from children in the convalescent phase of the illness and from their biological mothers. Viral clones were selected by plaque assay in the absence and presence of serum and nucleotide sequences of the G2 and F2 genes of HRSV biological clones were compared. One non-synonymous mutation was found in the F gene (Ile5Asn) in one clone of an HRSV-B sample and one non-synonymous mutation was found in the G gene (Ser291Pro) in four clones of the same HRSV-B sample. Only one of these clones was obtained after treatment with the child's serum. In addition, some synonymous mutations were determined in two clones of the HRSV-A samples. In conclusion, it is possible that minor sequences could be selected by host antibodies contributing to the HRSV evolutionary process, hampering the development of an effective vaccine, since we verify the same codon alteration in absence and presence of human sera in individual clones of BR-85 sample.

New FeFe-hydrogenase genes identified in a metagenomic fosmid library from a municipal wastewater treatment plant as revealed by high-throughput sequencing.

PubMed

Tomazetto, Geizecler; Wibberg, Daniel; Schlüter, Andreas; Oliveira, Valéria M

2015-01-01

A fosmid metagenomic library was constructed with total community DNA obtained from a municipal wastewater treatment plant (MWWTP), with the aim of identifying new FeFe-hydrogenase genes encoding the enzymes most important for hydrogen metabolism. The dataset generated by pyrosequencing of a fosmid library was mined to identify environmental gene tags (EGTs) assigned to FeFe-hydrogenase. The majority of EGTs representing FeFe-hydrogenase genes were affiliated with the class Clostridia, suggesting that this group is the main hydrogen producer in the MWWTP analyzed. Based on assembled sequences, three FeFe-hydrogenase genes were predicted based on detection of the L2 motif (MPCxxKxxE) in the encoded gene product, confirming true FeFe-hydrogenase sequences. These sequences were used to design specific primers to detect fosmids encoding FeFe-hydrogenase genes predicted from the dataset. Three identified fosmids were completely sequenced. The cloned genomic fragments within these fosmids are closely related to members of the Spirochaetaceae, Bacteroidales and Firmicutes, and their FeFe-hydrogenase sequences are characterized by the structure type M3, which is common to clostridial enzymes. FeFe-hydrogenase sequences found in this study represent hitherto undetected sequences, indicating the high genetic diversity regarding these enzymes in MWWTP. Results suggest that MWWTP have to be considered as reservoirs for new FeFe-hydrogenase genes. Copyright © 2014 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.

Rhipicephalus (Boophilus) microplus strain Deutsch, 5 BAC clone sequencing, including two encoding Cytochrome P450s and one encoding CzEst9 carboxylesterase

USDA-ARS?s Scientific Manuscript database

The cattle tick, Rhipicephalus (Boophilus) microplus, has a genome over 2.4 times the size of the human genome, and with over 70% of repetitive DNA, this genome would prove very costly to sequence at today's prices and difficult to assemble and analyze. BAC clones give insight into the genome struct...

Isolation, cloning, and characterization of the 2S albumin: a new allergen from hazelnut.

PubMed

Garino, Cristiano; Zuidmeer, Laurian; Marsh, Justin; Lovegrove, Alison; Morati, Maria; Versteeg, Serge; Schilte, Piet; Shewry, Peter; Arlorio, Marco; van Ree, Ronald

2010-09-01

2S albumins are the major allergens involved in severe food allergy to nuts, seeds, and legumes. We aimed to isolate, clone, and express 2S albumin from hazelnut and determine its allergenicity. 2S albumin from hazelnut extract was purified using size exclusion chromatography and RP-HPLC. After N-terminal sequencing, degenerated and poly-d(T) primers were used to clone the 2S albumin sequence from hazelnut cDNA. After expression in Escherichia coli and affinity purification, IgE reactivity was evaluated by Immunoblot/ImmunoCAP (inhibition) analyses using sera of nut-allergic patients. N-terminal sequencing of a approximately 10 kDa peak from size exclusion chromatography/RP-HPLC gave two sequences highly homologous to pecan 2S albumin, an 11 amino acid (aa) N-terminal and a 10 aa internal peptide. The obtained clone (441 bp) encoded a 147 aa hazelnut 2S albumin consisting of a putative signal peptide (22 aa), a linker peptide (20 aa), and the mature protein sequence (105 aa). The latter was successfully expressed in E. coli. Both recombinant and natural 2S albumin demonstrated similar IgE reactivity in Immunoblot/ImmunoCAP (inhibition) analyses. We confirmed the postulated role of hazelnut 2S albumin as an allergen. The availability of recombinant molecules will allow establishing the importance of hazelnut 2S albumin for hazelnut allergy.

Assignment of the human caltractin gene (CALT) to Xq28 by fluorescence in situ hybridization

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tanaka, Tanaka; Okui, Keiko; Nakamura, Yusuke

1994-12-01

The centrosome is the major microtubule-organizing center of interphase eukaryotic cells, an its duplication is essential to eukaryotic cell division. Caltractin, a structural component of centrosomes, is highly homologous in amino acid sequence to the product of the CDC31 gene of Saccharomyces cerevisiae. In S. cerevisiae, an important role for CDC31 in duplication of the spindle pole body (SPB), a kind of microtubule-organizing center, has been demonstrated by an experiment in which mutant CDC31 prevented SPB duplication and led to formation of a monopolar spindle. In view of the localization of human caltractin in centrosomes and the sequence homology itmore » bears to yeast CDC31, it is reasonable to assume that caltractin functions in humans as CDC31 does in yeast. As a part of the Human Genome Project, we have been determining nucleotide sequences of DNA clones randomly selected from a directionally cloned cDNA library constructed from fetal brain mRNA obtained from Clontech (La Jolla, CA). By comparing 5{prime} partial DNA sequences of these cDNA clones with known DNA sequences in the database, we found one clone that was highly homologous to the caltractin gene of Chlamydomonas, which turned out to be the same as a human gene identified recently. 4 refs., 1 fig.« less

The HPr(Ser) Kinase of Streptococcus salivarius: Purification, Properties, and Cloning of the hprK Gene

PubMed Central

Brochu, Denis; Vadeboncoeur, Christian

1999-01-01

In gram-positive bacteria, HPr, a protein of the phosphoenolpyruvate:sugar phosphotransferase system, is phosphorylated on a serine residue at position 46 by an ATP-dependent protein kinase. The HPr(Ser) kinase of Streptococcus salivarius ATCC 25975 was purified, and the encoding gene (hprK) was cloned by using a nucleotide probe designed from the N-terminal amino acid sequence. The predicted amino acid sequence of the S. salivarius enzyme showed 45% identity with the Bacillus subtilis enzyme, the conserved residues being located mainly in the C-terminal half of the protein. The predicted hprK gene product has a molecular mass of 34,440 Da and a pI of 5.6. These values agree well with those found experimentally by polyacrylamide gel electrophoresis in the presence of sodium dodecyl sulfate, molecular sieve chromatography in the presence of guanidine hydrochloride, and chromatofocusing using the purified protein. The native protein migrates on a Superdex 200 HR column as a 330,000-Da protein, suggesting that the HPr(Ser) kinase is a decamer. The enzyme requires Mg2+ for activity and functions optimally at pH 7.5. Unlike the enzyme from other gram-positive bacteria, the HPr(Ser) kinase from S. salivarius is not stimulated by FDP or other glycolytic intermediates. The enzyme is inhibited by inorganic phosphate, and its Kms for HPr and ATP are 31 μM and 1 mM, respectively. PMID:9922231

Molecular Cloning, Expression Analysis, and Functional Characterization of the H(+)-Pyrophosphatase from Jatropha curcas.

PubMed

Yang, Yumei; Luo, Zhu; Zhang, Mengru; Liu, Chang; Gong, Ming; Zou, Zhurong

2016-04-01

H(+)-pyrophosphatase (H(+)-PPase) is a primary pyrophosphate (PPi)-energized proton pump to generate electrochemical H(+) gradient for ATP production and substance translocations across membranes. It plays an important role in stress adaptation that was intensively substantiated by numerous transgenic plants overexpressing H(+)-PPases yet devoid of any correlated studies pointing to the elite energy plant, Jatropha curcas. Herein, we cloned the full length of J. curcas H(+)-PPase (JcVP1) complementary DNA (cDNA) by reverse transcription PCR, based on the assembled sequence of its ESTs highly matched to Hevea brasiliensis H(+)-PPase. This gene encodes a polypeptide of 765 amino acids that was predicted as a K(+)-dependent H(+)-PPase evolutionarily closest to those of other Euphorbiaceae plants. Many cis-regulatory elements relevant to environmental stresses, molecular signals, or tissue-specificity were identified by promoter prediction within the 1.5-kb region upstream of JcVP1 coding sequence. Meanwhile, the responses of JcVP1 expression to several common abiotic stresses (salt, drought, heat, cold) were characterized with a considerable accordance with the inherent stress tolerance of J. curcas. Moreover, we found that the heterologous expression of JcVP1 could significantly improve the salt tolerance in both recombinant Escherichia coli and Saccharomyces cerevisiae, and this effect could be further fortified in yeast by N-terminal addition of a vacuole-targeting signal peptide from the H(+)-PPase of Trypanosoma cruzi.

Characterization of Dihydrofolate Reductase Genes from Trimethoprim-Susceptible and Trimethoprim-Resistant Strains of Enterococcus faecalis

PubMed Central

Coque, Teresa M.; Singh, Kavindra V.; Weinstock, George M.; Murray, Barbara E.

1999-01-01

Enterococci are usually susceptible in vitro to trimethoprim; however, high-level resistance (HLR) (MICs, >1,024 μg/ml) has been reported. We studied Enterococcus faecalis DEL, for which the trimethoprim MIC was >1,024 μg/ml. No transfer of resistance was achieved by broth or filter matings. Two different genes that conferred trimethoprim resistance when they were cloned in Escherichia coli (MICs, 128 and >1,024 μg/ml) were studied. One gene that coded for a polypeptide of 165 amino acids (MIC, 128 μg/ml for E. coli) was identical to dfr homologs that we cloned from a trimethoprim-susceptible E. faecalis strain, and it is presumed to be the intrinsic E. faecalis dfr gene (which causes resistance in E. coli when cloned in multiple copies); this gene was designated dfrE. The nucleotide sequence 5′ to this dfr gene showed similarity to thymidylate synthetase genes, suggesting that the dfr and thy genes from E. faecalis are located in tandem. The E. faecalis gene that conferred HLR to trimethoprim in E. coli, designated dfrF, codes for a predicted polypeptide of 165 amino acids with 38 to 64% similarity with other dihydrofolate reductases from gram-positive and gram-negative organisms. The nucleotide sequence 5′ to dfrF did not show similarity to the thy sequences. A DNA probe for dfrF hybridized under high-stringency conditions only to colony lysates of enterococci for which the trimethoprim MIC was >1,024 μg/ml; there was no hybridization to plasmid DNA from the strain of origin. To confirm that this gene causes trimethoprim resistance in enterococci, we cloned it into the integrative vector pAT113 and electroporated it into RH110 (E. faecalis OG1RF::Tn916ΔEm) (trimethoprim MIC, 0.5 μg/ml), which resulted in RH110 derivatives for which the trimethoprim MIC was >1,024 μg/ml. These results indicate that dfrF is an acquired but probably chromosomally located gene which is responsible for in vitro HLR to trimethoprim in E. faecalis. PMID:9869579

Molecular Cloning and Ethylene Induction of mRNA Encoding a Phytoalexin Elicitor-Releasing Factor, beta-1,3-Endoglucanase, in Soybean.

PubMed

Takeuchi, Y; Yoshikawa, M; Takeba, G; Tanaka, K; Shibata, D; Horino, O

1990-06-01

Soybean (Glycine max) beta-1,3-endoglucanase (EC 3.2. 1.39) is involved in one of the earliest plant-pathogen interactions that may lead to active disease resistance by releasing elicitor-active carbohydrates from the cell walls of fungal pathogens. Ethylene induced beta-1,3-endoglucanase activity to 2- to 3-fold higher levels in cotyledons of soybean seedlings. A specific polyclonal antiserum raised against purified soybean beta-1,3-endoglucanase was used to immunoprecipitate in vitro translation products, demonstrating that ethylene induction increased translatable beta-1,3-endoglucanase mRNA. Several cDNA clones for the endoglucanase gene were obtained by antibody screening of a lambda-gt11 expression library prepared from soybean cotyledons. Hybrid-select translation experiments indicated that the cloned cDNA encoded a 36-kilodalton precursor protein product that was specifically immunoprecipitated with beta-1,3-endoglucanase antiserum. Escherichia coli cells expressing the cloned cDNA also synthesized an immunologically positive protein. Nucleotide sequence of three independent clones revealed a single uninterrupted open reading frame of 1041 nucleotides, corresponding to a polypeptide of 347 residue long. The primary amino acid sequence of beta-1,3-endoglucanase as deduced from the nucleotide sequence was confirmed by direct amino acid sequencing of trypsin digests of the glucanase. The soybean beta-1,3-endoglucanase exhibited 53% amino acid homology to a beta-1,3-glucanase cloned from cultured tobacco cells and 48% homology to a beta-(1,3-1,4)-glucanase from barley. Utilizing the largest cloned cDNA (pEG488) as a hybridization probe, it was found that the increase in translatable beta-1,3-endoglucanase mRNA seen upon ethylene treatment of soybean seedlings was due to 50- to 100-fold increase in steady state mRNA levels, indicating that ethylene regulates gene expression of this enzyme important in disease resistance at the level of gene transcription.

Molecular cloning, sequence analysis and homology modeling of the first caudata amphibian antifreeze-like protein in axolotl (Ambystoma mexicanum).

PubMed

Zhang, Songyan; Gao, Jiuxiang; Lu, Yiling; Cai, Shasha; Qiao, Xue; Wang, Yipeng; Yu, Haining

2013-08-01

Antifreeze proteins (AFPs) refer to a class of polypeptides that are produced by certain vertebrates, plants, fungi, and bacteria and which permit their survival in subzero environments. In this study, we report the molecular cloning, sequence analysis and three-dimensional structure of the axolotl antifreeze-like protein (AFLP) by homology modeling of the first caudate amphibian AFLP. We constructed a full-length spleen cDNA library of axolotl (Ambystoma mexicanum). An EST having highest similarity (∼42%) with freeze-responsive liver protein Li16 from Rana sylvatica was identified, and the full-length cDNA was subsequently obtained by RACE-PCR. The axolotl antifreeze-like protein sequence represents an open reading frame for a putative signal peptide and the mature protein composed of 93 amino acids. The calculated molecular mass and the theoretical isoelectric point (pl) of this mature protein were 10128.6 Da and 8.97, respectively. The molecular characterization of this gene and its deduced protein were further performed by detailed bioinformatics analysis. The three-dimensional structure of current AFLP was predicted by homology modeling, and the conserved residues required for functionality were identified. The homology model constructed could be of use for effective drug design. This is the first report of an antifreeze-like protein identified from a caudate amphibian.

Defense Response in Slash Pine: Chitosan Treatment Alters the Abundance of Specific mRNAs

Treesearch

Mary E. Mason; John M. Davis

1997-01-01

We used differential display to identify chitosan responsive cDNAs in slashpine cell cultures. Two clones that showed increased mRNA abundance had sequence similarity to genes with roles in major plant defense responses, clone 18 to cinnamic acid 4-hydroxylase, and clone 30 to chitinase.

Isolation and characterization of full-length cDNA clones coding for cholinesterase from fetal human tissues.

PubMed Central

Prody, C A; Zevin-Sonkin, D; Gnatt, A; Goldberg, O; Soreq, H

1987-01-01

To study the primary structure and regulation of human cholinesterases, oligodeoxynucleotide probes were prepared according to a consensus peptide sequence present in the active site of both human serum pseudocholinesterase (BtChoEase; EC 3.1.1.8) and Torpedo electric organ "true" acetylcholinesterase (AcChoEase; EC 3.1.1.7). Using these probes, we isolated several cDNA clones from lambda gt10 libraries of fetal brain and liver origins. These include 2.4-kilobase cDNA clones that code for a polypeptide containing a putative signal peptide and the N-terminal, active site, and C-terminal peptides of human BtChoEase, suggesting that they code either for BtChoEase itself or for a very similar but distinct fetal form of cholinesterase. In RNA blots of poly(A)+ RNA from the cholinesterase-producing fetal brain and liver, these cDNAs hybridized with a single 2.5-kilobase band. Blot hybridization to human genomic DNA revealed that these fetal BtChoEase cDNA clones hybridize with DNA fragments of the total length of 17.5 kilobases, and signal intensities indicated that these sequences are not present in many copies. Both the cDNA-encoded protein and its nucleotide sequence display striking homology to parallel sequences published for Torpedo AcChoEase. These findings demonstrate extensive homologies between the fetal BtChoEase encoded by these clones and other cholinesterases of various forms and species. Images PMID:3035536

Rapid cloning of genes in hexaploid wheat using cultivar-specific long-range chromosome assembly.

PubMed

Thind, Anupriya Kaur; Wicker, Thomas; Šimková, Hana; Fossati, Dario; Moullet, Odile; Brabant, Cécile; Vrána, Jan; Doležel, Jaroslav; Krattinger, Simon G

2017-08-01

Cereal crops such as wheat and maize have large repeat-rich genomes that make cloning of individual genes challenging. Moreover, gene order and gene sequences often differ substantially between cultivars of the same crop species. A major bottleneck for gene cloning in cereals is the generation of high-quality sequence information from a cultivar of interest. In order to accelerate gene cloning from any cropping line, we report 'targeted chromosome-based cloning via long-range assembly' (TACCA). TACCA combines lossless genome-complexity reduction via chromosome flow sorting with Chicago long-range linkage to assemble complex genomes. We applied TACCA to produce a high-quality (N50 of 9.76 Mb) de novo chromosome assembly of the wheat line CH Campala Lr22a in only 4 months. Using this assembly we cloned the broad-spectrum Lr22a leaf-rust resistance gene, using molecular marker information and ethyl methanesulfonate (EMS) mutants, and found that Lr22a encodes an intracellular immune receptor homologous to the Arabidopsis thaliana RPM1 protein.

Cloning, characterization, expression and comparative analysis of pig Golgi membrane sphingomyelin synthase 1.

PubMed

Guillén, Natalia; Navarro, María A; Surra, Joaquín C; Arnal, Carmen; Fernández-Juan, Marta; Cebrián-Pérez, Jose Alvaro; Osada, Jesús

2007-02-15

Pig sphingomyelin synthase 1 (SMS1) cDNA was cloned, characterized and compared to the human ortholog. Porcine protein consists of 413 amino acids and displays a 97% sequence identity with human protein. A phylogenic tree of proteins reveals that porcine SMS1 is more closely related to bovine and rodent proteins than to human. Analysis of protein mass was higher than the theoretical prediction based on amino acid sequence suggesting a kind of posttranslational modification. Quantitative representation of tissue distribution obtained by real-time RT-PCR showed that it was widely expressed although important variations in levels were obtained among organs. Thus, the cardiovascular system, especially the heart, showed the highest value of all the tissues studied. Regional differences of expression were observed in the central nervous system and intestinal tract. Analysis of the hepatic mRNA and protein expressions of SMS1 following turpentine treatment revealed a progressive decrease in the former paralleled by a decrease in the protein concentration. These findings indicate the variation in expression in the different tissues might suggest a different requirement of Golgi sphingomyelin for the specific function in each organ and a regulation of the enzyme in response to turpentine-induced hepatic injury.

Genomic cloning and chromosomal localization of HRY, the human homolog to the Drosophila segmentation gene, hairy

DOE Office of Scientific and Technical Information (OSTI.GOV)

Feder, J.N.; Jan, L.Y.; Jan, Y.N.

The Drosophila hairy gene encodes a basic helix- loop-helix protein that functions in at least two steps during Drosophila development: (1) during embryogenesis, when it partakes in the establishment of segments, and (2) during the larval stage, when it functions negatively in determining the pattern of sensory bristles on the adult fly. In the rat, a structurally homologous gene (RHL) behaves as an immediate-early gene in its response to growth factors and can, like that in Drosophila, suppress neuronal differentiation events. Here, the authors report the genomic cloning of the human hairy gene homolog (HRY). The coding region of themore » gene is contained within four exons. The predicted amino acid sequence reveals only four amino acid differences between the human and rat genes. Analysis of the DNA sequence 5[prime] to the coding region reveals a putatitve untranslated exon. To increase the value of the HRY gene as a genetic marker and to assess its potential involvement in genetic disorders, they sublocalized the locus to chromosome 3q28-q29 by fluorescence in situ hybridization. 34 refs., 4 figs., 1 tab.« less

cDNA isolated from a human T-cell library encodes a member of the protein-tyrosine-phosphatase family

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cool, D.E.; Tonks, N.K.; Charbonneau, H.

1989-07-01

A human peripheral T-cell cDNA library was screened with two labeled synthetic oligonucleotides encoding regions of a human placenta protein-tyrosine-phosphatase. One positive clone was isolated and the nucleotide sequence was determined. It contained 1,305 base pairs of open reading frame followed by a TAA stop codon and 978 base pairs of 3{prime} untranslated end, although a poly(A){sup +} tail was not found. An initiator methionine residue was predicted at position 61, which would result in a protein of 415 amino acid residues. This was supported by the synthesis of a M{sub r} 48,000 protein in an in vitro reticulocyte lysatemore » translation system using RNA transcribed from the cloned cDNA and T7 RNA polymerase. The deduced amino acid sequence was compared to other known proteins revealing 65% identity to the low M{sub r} PTPase 1B isolated from placenta. In view of the high degree of similarity, the T-cell cDNA likely encodes a newly discovered protein-tyrosine-phosphatase, thus expanding this family of genes.« less

Purification and cDNA cloning of ferritin from the hepatopancreas of the freshwater crayfish Pacifastacus leniusculus.

PubMed

Huang, T S; Law, J H; Söderhäll, K

1996-03-01

Ferritin was purified from the hepatopancreas of the freshwater crayfish Pacifastacus leniusculus after injection of iron. It has the same size as horse spleen ferritin (440 kDa) and migrates as two bands, 19 kDa and 20 kDa, respectively, in SDS/PAGE under reducing conditions. Crayfish ferritin (20 kDa) was cloned from a hepatopancreas cDNA library. The deduced amino acid sequence of the crayfish ferritin shows a closer relationship to vertebrate ferritin heavy chains than to insect ferritin and contains the conserved H-specific residues for the ferroxidase centre found in vertebrate ferritin heavy chain. An IRE(iron-responsive element)-like sequence with a predicted stem-loop structure was present in the 5' untranslated region of the crayfish ferritin mRNA. Crayfish ferritin does not share the atypical properties of insect ferritins, such as high molecular mass of intact protein, abundance in hemolymph, and export into vacuoles. We suggest that there are two different types of ferritins distributed in different species: insect-type or secretory ferritins which are predominant in the snail oocyte and insects, and vertebrate (crustacean)-type or cytosolic ferritins which are predominant in vertebrates and crustacea.

Molecular cloning and characterization of an α-amylase cDNA highly expressed in major feeding stages of the coffee berry borer, Hypothenemus hampei.

PubMed

Bezerra, C A; Macedo, L L P; Amorim, T M L; Santos, V O; Fragoso, R R; Lucena, W A; Meneguim, A M; Valencia-Jimenez, A; Engler, G; Silva, M C M; Albuquerque, E V S; Grossi-de-Sa, M F

2014-12-10

α-Amylases are common enzymes responsible for hydrolyzing starch. Insect-pests, whose larvae develop in seeds, rely obligatorily on α-amylase activity to digest starch, as their major food source. Considering the relevance of insect α-amylases and the natural α-amylase inhibitors present in seeds to protect from insect damage, we report here the molecular cloning and nucleotide sequence of the full-length AmyHha cDNA of the coffee berry borer, Hypothenemus hampei, a major insect-pest of coffee crops. The AmyHha sequence has 1879 bp, containing a 1458 bp open reading frame, which encodes a predicted protein with 485 amino acid residues, with a predicted molecular mass of 51.2 kDa. The deduced protein showed 55-79% identity to other insect α-amylases, including Anthonomus grandis, Ips typographus and Sitophilus oryzae α-amylases. In depth analysis revealed that the highly conserved three amino acid residues (Asp184, Glu220, and Asp285), which compose the catalytic site are also presented in AmyHha amylase. The AmyHha gene seems to be a single copy in the haploid genome and AmyHha transcription levels were found higher in L2 larvae and adult insects, both corresponding to major feeding phases. Modeling of the AmyHha predicted protein uncovered striking structural similarities to the Tenebrio molitor α-amylase also displaying the same amino acid residues involved in enzyme catalysis (Asp184, Glu220 and Asp285). Since AmyHha gene was mostly transcribed in the intestinal tract of H. hampei larvae, the cognate α-amylase could be considered a high valuable target to coffee bean insect control by biotechnological strategies. Copyright © 2014. Published by Elsevier B.V.

Local circulating clones of Staphylococcus aureus in Ecuador.

PubMed

Zurita, Jeannete; Barba, Pedro; Ortega-Paredes, David; Mora, Marcelo; Rivadeneira, Sebastián

The spread of pandemic Staphylococcus aureus clones, mainly methicillin-resistant S. aureus (MRSA), must be kept under surveillance to assemble an accurate, local epidemiological analysis. In Ecuador, the prevalence of the USA300 Latin American variant clone (USA300-LV) is well known; however, there is little information about other circulating clones. The aim of this work was to identify the sequence types (ST) using a Multiple-Locus Variable number tandem repeat Analysis 14-locus genotyping approach. We analyzed 132 S. aureus strains that were recovered from 2005 to 2013 and isolated in several clinical settings in Quito, Ecuador. MRSA isolates composed 46.97% (62/132) of the study population. Within MRSA, 37 isolates were related to the USA300-LV clone (ST8-MRSA-IV, Panton-Valentine Leukocidin [PVL] +) and 10 were related to the Brazilian clone (ST239-MRSA-III, PVL-). Additionally, two isolates (ST5-MRSA-II, PVL-) were related to the New York/Japan clone. One isolate was related to the Pediatric clone (ST5-MRSA-IV, PVL-), one isolate (ST45-MRSA-II, PVL-) was related to the USA600 clone, and one (ST22-MRSA-IV, PVL-) was related to the epidemic UK-EMRSA-15 clone. Moreover, the most prevalent MSSA sequence types were ST8 (11 isolates), ST45 (8 isolates), ST30 (8 isolates), ST5 (7 isolates) and ST22 (6 isolates). Additionally, we found one isolate that was related to the livestock associated S. aureus clone ST398. We conclude that in addition to the high prevalence of clone LV-ST8-MRSA-IV, other epidemic clones are circulating in Quito, such as the Brazilian, Pediatric and New York/Japan clones. The USA600 and UK-EMRSA-15 clones, which were not previously described in Ecuador, were also found. Moreover, we found evidence of the presence of the livestock associated clone ST398 in a hospital environment. Copyright © 2016 Sociedade Brasileira de Infectologia. Published by Elsevier Editora Ltda. All rights reserved.

[Detection and diversity analysis of rumen methanogens in the co-cultures with anaerobic fungi].

PubMed

Cheng, Yan-fen; Mao, Sheng-yong; Pei, Cai-xia; Liu, Jian-xin; Zhu, Wei-yun

2006-12-01

Rumen methanogen diversity in the co-cultures with anaerobic fungi from goat rumen was analyzed. Mix-cultures of anaerobic fungi and methanogens were obtained from goat rumen using anaerobic fungal medium and the addition of penicillin and streptomycin and then subcultured 62 times by transferring cultures every 3 - 4d. Total DNA from the original rumen fluid and subcultured fungal cultures was used for PCR/DGGE and RFLP analysis. 16S rDNA of clones corresponding to representative OTUs were sequenced. Results showed that the diversity index (Shannon index) of the methanogens generated from DGGE profiles reduced from 1.32 to 0.99 from rumen fluid to fungal culture after 45 subculturing, with the lowest similarity of DGGE profiles at 34.7%. The Shannon index increased from 0.99 to 1.15 from the fungal culture after 45 subculturing to that after 62 subculturing, with the lowest similarity at 89.2% . A total of 5 OTUs were obtained from 69. clones using RFLP analysis and six clones representing the 5 OTUs respectively were sequenced. Of the 5 OTUs, three had their cloned 16S rDNA sequences most closely related to uncultured archaeal symbiont PA202 with the same similarity of 95 %, but had not closely related to any identified culturable methanogen. The rest two OTUs had their cloned 16S rDNA sequences sharing the same closest relative, uncultured rumen methanogen 956, with the same similarity of 97% .Their 16S rDNA sequences of these two OTUs also showed 97% similar to the closest identified culturable methanogen Methanobrevibacter sp. NT7. In conclusion, diverse yet unidentified rumen methanogen species exist in the co-cultures with anaerobic fungi isolated from the goat rumen.

Complex structural behavior of oligopurine-oligopyrimidine sequence cloned within the supercoiled plasmid.

PubMed Central

Parniewski, P; Galazka, G; Wilk, A; Klysik, J

1989-01-01

Synthetic sequence GATCC(AG)7ATCG(AT)4CG(AG)7 was cloned into plasmid and its structural behavior under the influence of supercoiling was analysed by chemical modification at variety of experimental conditions. It was found that this sequence adopts at least two different non-B conformations depending on -delta and pH values. Moreover, 12 nucleotide long non-pur.pyr spacer region separating two identical (AG)7 blocks does not provide a significant energy barrier protecting against unusual structures formation. Images PMID:2644622

Cloning and sequence analysis of a cDNA clone coding for the mouse GM2 activator protein.

PubMed Central

Bellachioma, G; Stirling, J L; Orlacchio, A; Beccari, T

1993-01-01

A cDNA (1.1 kb) containing the complete coding sequence for the mouse GM2 activator protein was isolated from a mouse macrophage library using a cDNA for the human protein as a probe. There was a single ATG located 12 bp from the 5' end of the cDNA clone followed by an open reading frame of 579 bp. Northern blot analysis of mouse macrophage RNA showed that there was a single band with a mobility corresponding to a size of 2.3 kb. We deduce from this that the mouse mRNA, in common with the mRNA for the human GM2 activator protein, has a long 3' untranslated sequence of approx. 1.7 kb. Alignment of the mouse and human deduced amino acid sequences showed 68% identity overall and 75% identity for the sequence on the C-terminal side of the first 31 residues, which in the human GM2 activator protein contains the signal peptide. Hydropathicity plots showed great similarity between the mouse and human sequences even in regions of low sequence similarity. There is a single N-glycosylation site in the mouse GM2 activator protein sequence (Asn151-Phe-Thr) which differs in its location from the single site reported in the human GM2 activator protein sequence (Asn63-Val-Thr). Images Figure 1 PMID:7689829

Characterization and mapping of cDNA encoding aspartate aminotransferase in rice, Oryza sativa L.

PubMed

Song, J; Yamamoto, K; Shomura, A; Yano, M; Minobe, Y; Sasaki, T

1996-10-31

Fifteen cDNA clones, putatively identified as encoding aspartate aminotransferase (AST, EC 2.6.1.1.), were isolated and partially sequenced. Together with six previously isolated clones putatively identified to encode ASTs (Sasaki, et al. 1994, Plant Journal 6, 615-624), their sequences were characterized and classified into 4 cDNA species. Two of the isolated clones, C60213 and C2079, were full-length cDNAs, and their complete nucleotide sequences were determined. C60213 was 1612 bp long and its deduced amino acid sequence showed 88% homology with that of Panicum miliaceum L. mitochondrial AST. The C60213-encoded protein had an N-terminal amino acid sequence that was characteristic of a mitochondrial transit peptide. On the other hand, C2079 was 1546 bp long and had 91% amino acid sequence homology with P. miliaceum L. cytosolic AST but lacked in the transit peptide sequence. The homologies of nucleotide sequences and deduced amino acid sequences of C2079 and C60213 were 54% and 52%, respectively. C2079 and C60213 were mapped on chromosomes 1 and 6, respectively, by restriction fragment length polymorphism linkage analysis. Northern blot analysis using C2079 as a probe revealed much higher transcript levels in callus and root than in green and etiolated shoots, suggesting tissue-specific variations of AST gene expression.

Cloning and sequencing of Staphylococcus aureus murC, a gene essential for cell wall biosynthesis.

PubMed

Lowe, A M; Deresiewicz, R L

1999-01-01

Staphylococcus aureus is a major human pathogen that is increasingly resistant to clinically useful antimicrobial agents. While screening for S. aureus genes expressed during mammalian infection, we isolated murC. This gene encodes UDP-N-acetylmuramoyl-L-alanine synthetase, an enzyme essential for cell wall biosynthesis in a number of bacteria. S. aureus MurC has a predicted mass 49,182 Da and complements the temperature-sensitive murC mutation of E. coli ST222. Sequence data on the DNA flanking staphylococcal murC suggests that the local gene organization there parallels that found in B. subtilis, but differs from that found in gram-negative bacterial pathogens. MurC proteins represent promising targets for broad spectrum antimicrobial drug development.

Outbreak of OXA-48-Producing Klebsiella pneumoniae Involving a Sequence Type 101 Clone in Batna University Hospital, Algeria

PubMed Central

Loucif, Lotfi; Kassah-Laouar, Ahmed; Saidi, Mahdia; Messala, Amina; Chelaghma, Widad

2016-01-01

Seven nonredundant ertapenem-resistant Klebsiella pneumoniae isolates were collected between May 2014 and 19 January 2015 in the nephrology and hematology units of Batna University Hospital in Algeria. All strains coproduced the blaOXA-48, blaCTX-M-15, blaSHV-1, and blaTEM-1D genes. Six of these isolates belonged to the pandemic clone sequence type 101 (ST101). The blaOXA-48 gene was located on a conjugative IncL/M-type plasmid. This is the first known outbreak of OXA-48-producing K. pneumoniae isolates involving an ST101 clone in Batna University Hospital. PMID:27645236

Horse cDNA clones encoding two MHC class I genes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Barbis, D.P.; Maher, J.K.; Stanek, J.

1994-12-31

Two full-length clones encoding MHC class I genes were isolated by screening a horse cDNA library, using a probe encoding in human HLA-A2.2Y allele. The library was made in the pcDNA1 vector (Invitrogen, San Diego, CA), using mRNA from peripheral blood lymphocytes obtained from a Thoroughbred stallion (No. 0834) homozygous for a common horse MHC haplotype (ELA-A2, -B2, -D2; Antczak et al. 1984; Donaldson et al. 1988). The clones were sequenced, using SP6 and T7 universal primers and horse-specific oligonucleotides designed to extend previously determined sequences.

A Blumeria graminisf.sp. hordei BAC library--contig building and microsynteny studies.

PubMed

Pedersen, Carsten; Wu, Boqian; Giese, Henriette

2002-11-01

A bacterial artificial chromosome (BAC) library of Blumeria graminis f.sp. hordei, containing 12,000 clones with an average insert size of 41 kb, was constructed. The library represents about three genome equivalents and BAC-end sequencing showed a high content of repetitive sequences, making contig-building difficult. To identify overlapping clones, several strategies were used: colony hybridisation, PCR screening, fingerprinting techniques and the use of single-copy expressed sequence tags. The latter proved to be the most efficient method for identification of overlapping clones. Two contigs, at or close to avirulence loci, were constructed. Single nucleotide polymorphism (SNP) markers were developed from BAC-end sequences to link the contigs to the genetic maps. Two other BAC contigs were used to study microsynteny between B. graminis and two other ascomycetes, Neurospora crassa and Aspergillus fumigatus. The library provides an invaluable tool for the isolation of avirulence genes from B. graminis and for the study of gene synteny between this fungus and other fungi.

Isolation and cloning of a metalloproteinase from king cobra snake venom.

PubMed

Guo, Xiao-Xi; Zeng, Lin; Lee, Wen-Hui; Zhang, Yun; Jin, Yang

2007-06-01

A 50 kDa fibrinogenolytic protease, ohagin, from the venom of Ophiophagus hannah was isolated by a combination of gel filtration, ion-exchange and heparin affinity chromatography. Ohagin specifically degraded the alpha-chain of human fibrinogen and the proteolytic activity was completely abolished by EDTA, but not by PMSF, suggesting it is a metalloproteinase. It dose-dependently inhibited platelet aggregation induced by ADP, TMVA and stejnulxin. The full sequence of ohagin was deduced by cDNA cloning and confirmed by protein sequencing and peptide mass fingerprinting. The full-length cDNA sequence of ohagin encodes an open reading frame of 611 amino acids that includes signal peptide, proprotein and mature protein comprising metalloproteinase, disintegrin-like and cysteine-rich domains, suggesting it belongs to P-III class metalloproteinase. In addition, P-III class metalloproteinases from the venom glands of Naja atra, Bungarus multicinctus and Bungarus fasciatus were also cloned in this study. Sequence analysis and phylogenetic analysis indicated that metalloproteinases from elapid snake venoms form a new subgroup of P-III SVMPs.

Production of a full-length infectious GFP-tagged cDNA clone of Beet mild yellowing virus for the study of plant-polerovirus interactions.

PubMed

Stevens, Mark; Viganó, Felicita

2007-04-01

The full-length cDNA of Beet mild yellowing virus (Broom's Barn isolate) was sequenced and cloned into the vector pLitmus 29 (pBMYV-BBfl). The sequence of BMYV-BBfl (5721 bases) shared 96% and 98% nucleotide identity with the other complete sequences of BMYV (BMYV-2ITB, France and BMYV-IPP, Germany respectively). Full-length capped RNA transcripts of pBMYV-BBfl were synthesised and found to be biologically active in Arabidopsis thaliana protoplasts following electroporation or PEG inoculation when the protoplasts were subsequently analysed using serological and molecular methods. The BMYV sequence was modified by inserting DNA that encoded the jellyfish green fluorescent protein (GFP) into the P5 gene close to its 3' end. A. thaliana protoplasts electroporated with these RNA transcripts were biologically active and up to 2% of transfected protoplasts showed GFP-specific fluorescence. The exploitation of these cDNA clones for the study of the biology of beet poleroviruses is discussed.

Cloning and expression of 130-kd mosquito-larvicidal delta-endotoxin gene of Bacillus thuringiensis var. Israelensis in Escherichia coli.

PubMed

Angsuthanasombat, C; Chungjatupornchai, W; Kertbundit, S; Luxananil, P; Settasatian, C; Wilairat, P; Panyim, S

1987-07-01

Five recombinant E. coli clones exhibiting toxicity to Aedes aegypti larvae were obtained from a library of 800 clones containing XbaI DNA fragments of 110 kb plasmid from B. thuringiensis var. israelensis. All the five clones (pMU 14/258/303/388/679) had the same 3.8-kb insert and encoded a major protein of 130 kDa which was highly toxic to A. aegypti larvae. Three clones (pMU 258/303/388) transcribed the 130 kD a gene in the same direction as that of lac Z promoter of pUC12 vector whereas the transcription of the other two (pMU 14/679) was in the opposite direction. A 1.9-kb fragment of the 3.8 kb insert coded for a protein of 65 kDa. Partial DNA sequence of the 3.8 kb insert, corresponding to the 5'-terminal of the 130 kDa gene, revealed a continuous reading frame, a Shine-Dalgarno sequence and a tentative 5'-regulatory region. These results demonstrated that the 3.8 kb insert is a minimal DNA fragment containing a regulatory region plus the coding sequence of the 130 kDa protein that is highly toxic to mosquito larvae.

A putative siderophore-interacting protein from the marine bacterium Shewanella frigidimarina NCIMB 400: cloning, expression, purification, crystallization and X-ray diffraction analysis

PubMed Central

Trindade, Inês B.; Fonseca, Bruno M.; Matias, Pedro M.; Louro, Ricardo O.; Moe, Elin

2016-01-01

Siderophore-binding proteins (SIPs) perform a key role in iron acquisition in multiple organisms. In the genome of the marine bacterium Shewanella frigidimarina NCIMB 400, the gene tagged as SFRI_RS12295 encodes a protein from this family. Here, the cloning, expression, purification and crystallization of this protein are reported, together with its preliminary X-ray crystallographic analysis to 1.35 Å resolution. The SIP crystals belonged to the monoclinic space group P21, with unit-cell parameters a = 48.04, b = 78.31, c = 67.71 Å, α = 90, β = 99.94, γ = 90°, and are predicted to contain two molecules per asymmetric unit. Structure determination by molecular replacement and the use of previously determined ∼2 Å resolution SIP structures with ∼30% sequence identity as templates are ongoing. PMID:27599855

DNA sequence of the lymphotropic variant of minute virus of mice, MVM(i), and comparison with the DNA sequence of the fibrotropic prototype strain.

PubMed

Astell, C R; Gardiner, E M; Tattersall, P

1986-02-01

The sequence of molecular clones of the genome of MVM(i), a lymphotropic variant of minute virus of mice, was determined and compared with that of MVM(p), the fibrotropic prototype strain. At the nucleotide level there are 163 base changes: 129 transitions and 34 transversions. Most nucleotide changes are silent, with only 27 amino acids changes predicted, of which 22 are conservative. Notable differences between the MVM(i) and MVM(p) genomes which may account for the cell specificities of these viruses occur within the 3' nontranslated regions. The differences discussed include the absence of a 65-base-pair direct in MVM(i), the presence of only two polyadenylation sites in MVM(i) compared with four in MVM(p), and sequences that bear a resemblance to enhancer sequences. Also included in this paper is an important correction to the MVM(p) sequence (C.R. Astell, M. Thomson, M. Merchlinsky, and D. C. Ward, Nucleic Acids Res. 11:999-1018, 1983).

[Microbial community in the Anammox process of thermal denitration tail liquid].

PubMed

Li, Jin; Yu, Deshuang; Zhao, Dan; Wang, Xiaochen

2014-12-01

An anaerobic sequencing batch reactor (ASBR) was used to treat thermal denitration tail liquid and microbial community was studied. Activated sludge was taken from the reactor for scanning electron microscope analysis. The images showed that the dominant cells in the flora were oval cocci. Its diameter was about 0.7 μm. Through a series of molecular biology methods such as extracting total DNA from the sludge, PCR amplification, positive clone authentication and sequencing, we obtained the 16S rDNA sequences of the flora. Phylogenetic tree and clone library were established. The universal bacteria primers of 27F-1492R PCR amplification system obtained 85 clones and could be divided into 21 OTUS. The proportions were as follows: Proteobacteria 61.18%; Acidobacteria 17.65%; Chlorobi 8.24%; Chlorofexi 5.88%; Gemmatimonadetes 3.53%; Nitrospirae 2.35% and Planctomycetes 1.18%. The specific anammox bacterial primers of pla46rc-630r and AMX368-AMX820 PCR amplification system obtained 45 clones. They were divided into 3 OTUS. Candidatus brocadia sp. occupied 95.6% and unknown strains occupied 4.4%.

Cloning and expression of Bartonella henselae sucB gene encoding an immunogenic dihydrolipoamide succinyltransferase homologous protein.

PubMed

Kabeya, Hidenori; Maruyama, Soichi; Hirano, Kouji; Mikami, Takeshi

2003-01-01

Immunoscreening of a ZAP genomic library of Bartonella henselae strain Houston-1 expressed in Escherichia coli resulted in the isolation of a clone containing 3.5 kb BamHI genomic DNA fragment. This 3.5 kb DNA fragment was found to contain a sequence of a gene encoding a protein with significant homology to the dihydrolipoamide succinyltransferase of Brucella melitensis (sucB). Subsequent cloning and DNA sequence analysis revealed that the deduced amino acid sequence from the cloned gene showed 66.5% identity to SucB protein of B. melitensis, and 43.4 and 47.2% identities to those of Coxiella burnetii and E. coli, respectively. The gene was expressed as a His-Nus A-tagged fusion protein. The recombinant SucB protein (rSucB) was shown to be an immunoreactive protein of about 115 kDa by Western blot analysis with sera from B. henselae-immunized mice. Therefore the rSucB may be a candidate antigen for a specific serological diagnosis of B. henselae infection.

Cloning and construction of recombinant palI gene from Klebsiella oxytoca on pET-32b into E. coli BL21 (DE3) pLysS for production of isomaltulose, a new generation of sugar

DOE Office of Scientific and Technical Information (OSTI.GOV)

Moeis, Maelita R., E-mail: sony@sith.itb.ac.id; Berlian, Liska, E-mail: sony@sith.itb.ac.id; Suhandono, Sony, E-mail: sony@sith.itb.ac.id

Klebsiella oxytoca produces sucrose isomerase which catalyses the conversion of sucrose to isomaltulose, a new generation of sugar. From the previous study, palI gene from Klebsiella oxytoca was succesfully isolated from sapodilla fruit (Manilkara zapota). The full-length palI gene sequence of Klebsiella oxytoca was cloned in E. coli DH5α. The deduced amino acid sequence shows 498 residues which includes conserved motif for sucrose isomerisation {sup 325}RLDRD{sup 329} and 97% identical to palI gene from Klebsiella sp. LX3 (GenBank:AAK82938.1). This fragment was succesfullly ligated into the expression vector pET-32b using overlap-extension PCR and cloned in Escherichia coli BL21 (DE3) pLysS. DNAmore » sequencing result shows that palI gene of Klebsiella oxytoca was inserted in-frame in pET-32b. This is the first report on cloning of palI gene from Klebsiella oxytoca.« less

Identification of Prostate Cancer-Specific microDNAs

DTIC Science & Technology

2014-12-01

displacement amplification (MDA). 2 adopted multiple displacement amplification (MDA) with random primers for enriched circular DNA by rolling circle ... amplification (RCA) (Fig. 1) and then amplified DNA fragments were subject to deep sequencing. Sequence NO of Reads seq 1 184 seq 2 133 seq 3 2407 seq...prostate cancer cells through multiple displacement amplification .  Clone #7 is the top candidate which has been cloned in an expression vector and it

Identification and characterization of mutant clones with enhanced propagation rates from phage-displayed peptide libraries.

PubMed

Nguyen, Kieu T H; Adamkiewicz, Marta A; Hebert, Lauren E; Zygiel, Emily M; Boyle, Holly R; Martone, Christina M; Meléndez-Ríos, Carola B; Noren, Karen A; Noren, Christopher J; Hall, Marilena Fitzsimons

2014-10-01

A target-unrelated peptide (TUP) can arise in phage display selection experiments as a result of a propagation advantage exhibited by the phage clone displaying the peptide. We previously characterized HAIYPRH, from the M13-based Ph.D.-7 phage display library, as a propagation-related TUP resulting from a G→A mutation in the Shine-Dalgarno sequence of gene II. This mutant was shown to propagate in Escherichia coli at a dramatically faster rate than phage bearing the wild-type Shine-Dalgarno sequence. We now report 27 additional fast-propagating clones displaying 24 different peptides and carrying 14 unique mutations. Most of these mutations are found either in or upstream of the gene II Shine-Dalgarno sequence, but still within the mRNA transcript of gene II. All 27 clones propagate at significantly higher rates than normal library phage, most within experimental error of wild-type M13 propagation, suggesting that mutations arise to compensate for the reduced virulence caused by the insertion of a lacZα cassette proximal to the replication origin of the phage used to construct the library. We also describe an efficient and convenient assay to diagnose propagation-related TUPS among peptide sequences selected by phage display. Copyright © 2014 The Authors. Published by Elsevier Inc. All rights reserved.

Diversity of the small subunit ribosomal RNA gene of the arbuscular mycorrhizal fungi colonizing Clintonia borealis from a mixed-wood boreal forest.

PubMed

DeBellis, Tonia; Widden, Paul

2006-11-01

Arbuscular mycorrhizal fungi (AMF) communities in Clintonia borealis roots from a boreal mixed forests in northwestern Québec were investigated. Roots were sampled from 100 m2 plots whose overstory was dominated by either trembling aspen (Populus tremuloides Michx.), white birch (Betula papyrifera Marsh.), or mixed white spruce (Picea glauca (Moench) Voss) and balsam fir (Abies balsamea (L.) Mill.). Part of the 18S ribosomal gene of the AMF was amplified and the resulting PCR products were cloned. Restriction analysis of the 576 resulting clones yielded 92 different restriction patterns which were then sequenced. Fifty-two sequences closely matched other Glomus sequences from Genbank. Phylogenetic analysis revealed 10 different AMF sequence types, most of which clustered with other uncultured AM sequences from plant roots from various field sites. Compared with other AMF communities from comparable studies, richness and diversity were higher than observed in an arable field, but lower than seen in a tropical forest and a temperate wetland. The AMF communities from Clintonia roots under the different canopy types did not differ significantly and the dominant sequence type, which clustered with AM sequences from a variety of environments and hosts at distant geographical locations, represented 66.9% of all the clones analyzed.

In silico Analysis of 2085 Clones from a Normalized Rat Vestibular Periphery 3′ cDNA Library

PubMed Central

Roche, Joseph P.; Cioffi, Joseph A.; Kwitek, Anne E.; Erbe, Christy B.; Popper, Paul

2005-01-01

The inserts from 2400 cDNA clones isolated from a normalized Rattus norvegicus vestibular periphery cDNA library were sequenced and characterized. The Wackym-Soares vestibular 3′ cDNA library was constructed from the saccular and utricular maculae, the ampullae of all three semicircular canals and Scarpa's ganglia containing the somata of the primary afferent neurons, microdissected from 104 male and female rats. The inserts from 2400 randomly selected clones were sequenced from the 5′ end. Each sequence was analyzed using the BLAST algorithm compared to the Genbank nonredundant, rat genome, mouse genome and human genome databases to search for high homology alignments. Of the initial 2400 clones, 315 (13%) were found to be of poor quality and did not yield useful information, and therefore were eliminated from the analysis. Of the remaining 2085 sequences, 918 (44%) were found to represent 758 unique genes having useful annotations that were identified in databases within the public domain or in the published literature; these sequences were designated as known characterized sequences. 1141 sequences (55%) aligned with 1011 unique sequences had no useful annotations and were designated as known but uncharacterized sequences. Of the remaining 26 sequences (1%), 24 aligned with rat genomic sequences, but none matched previously described rat expressed sequence tags or mRNAs. No significant alignment to the rat or human genomic sequences could be found for the remaining 2 sequences. Of the 2085 sequences analyzed, 86% were singletons. The known, characterized sequences were analyzed with the FatiGO online data-mining tool (http://fatigo.bioinfo.cnio.es/) to identify level 5 biological process gene ontology (GO) terms for each alignment and to group alignments with similar or identical GO terms. Numerous genes were identified that have not been previously shown to be expressed in the vestibular system. Further characterization of the novel cDNA sequences may lead to the identification of genes with vestibular-specific functions. Continued analysis of the rat vestibular periphery transcriptome should provide new insights into vestibular function and generate new hypotheses. Physiological studies are necessary to further elucidate the roles of the identified genes and novel sequences in vestibular function. PMID:16103642

Cloning and sequence analysis of the human brain beta-adrenergic receptor. Evolutionary relationship to rodent and avian beta-receptors and porcine muscarinic receptors.

PubMed

Chung, F Z; Lentes, K U; Gocayne, J; Fitzgerald, M; Robinson, D; Kerlavage, A R; Fraser, C M; Venter, J C

1987-01-26

Two cDNA clones, lambda-CLFV-108 and lambda-CLFV-119, encoding for the beta-adrenergic receptor, have been isolated from a human brain stem cDNA library. One human genomic clone, LCV-517 (20 kb), was characterized by restriction mapping and partial sequencing. The human brain beta-receptor consists of 413 amino acids with a calculated Mr of 46480. The gene contains three potential glucocorticoid receptor-binding sites. The beta-receptor expressed in human brain was homology with rodent (88%) and avian (52%) beta-receptors and with porcine muscarinic cholinergic receptors (31%), supporting our proposal [(1984) Proc. Natl. Acad. Sci. USA 81, 272 276] that adrenergic and muscarinic cholinergic receptors are structurally related. This represents the first cloning of a neurotransmitter receptor gene from human brain.

High-resolution mapping and sequence analysis of 597 cDNA clones transcribed from the 1 Mb region in human chromosome 4q16.3 containing Huntington disease gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hadano, S.; Ishida, Y.; Tomiyasu, H.

1994-09-01

To complete a transcription map of the 1 Mb region in human chromosome 4p16.3 containing the Huntington disease (HD) gene, the isolation of cDNA clones are being performed throughout. Our method relies on a direct screening of the cDNA libraries probed with single copy microclones from 3 YAC clones spanning 1 Mbp of the HD gene region. AC-DNAs were isolated by a preparative pulsed-field gel electrophoresis, amplified by both a single unique primer (SUP)-PCR and a linker ligation PCR, and 6 microclone-DNA libraries were generated. Then, 8,640 microclones from these libraries were independently amplified by PCR, and arrayed onto themore » membranes. 800-900 microclones that were not cross-hybridized with total human and yeast genomic DNA, TAC vector DNA, and ribosomal cDNA on a dot hybridization (putatively carrying single copy sequences) were pooled to make 9 probe pools. A total of {approximately}1.8x10{sup 7} plaques from the human brain cDNA libraries was screened with 9 pool-probes, and then 672 positive cDNA clones were obtained. So far, 597 cDNA clones were defined and arrayed onto a map of the 1 Mbp of the HD gene region by hybridization with HD region-specific cosmid contigs and YAC clones. Further characterization including a DNA sequencing and Northern blot analysis is currently underway.« less

Genomics approach to the environmental community of microorganisms

NASA Astrophysics Data System (ADS)

Kawarabayasi, Y.; Maruyama, A.

2004-12-01

It was indicated by microscopic observation or comparison of 16S rDNA sequence that many extremophiles were surviving in many hydrothermal environments. But it is generally said that over 99% of total microbes are now uncultivable. Thus, we planned to identify uncultivable microbes through direct sequencing of environmental DNA. At first, shotgun plasmid libraries were directly constructed with the DNA molecules prepared from mixed microbes collected from low-temperature hydrothermal water at RM24 in the Southern East Pacific Rise (S-EPR). It was shown that the sequences of some number of clones indicated the similar feature to the intron in eukaryote or tandem repetitive sequence identified in some human familiar diseases. The results indicated that many microorganisms with eukaryotic feature were dominant in low temperature water of S-EPR. Secondly, shotgun plasmid libraries were constructed from the environmental DNA prepared from Beppu hot springs. The ORFs were easily identified all clones determined entire sequence. Thus it can be said that hot springs is good resources for searching novel genes. At last, the mixed microbes isolated from Suiyo seamount were used for construction of shotgun library. The clones in this library contained the ORFs. From some clones in hot spring and Suiyo sample, aminoacyl-tRNA synthatase, which is generally present in all organisms, was isolated by similarity. The phylogenetic analysis of aminoacyl-tRNA synthetase identified indicated that novel and unidentified microorganisms should be present in hot spring or Suiyo seamount. The novel genes identified from Suiyo seamount were also utilized for expression in E. coli. Some gene products were successfully obtained from the E. coli cells as soluble proteins. Some protein indicated the thermostability up to 70_E#8249;C, meaning that the original host cell of this gene should be stable up to the same temperature. Our work indicates that environmental genomics, including the direct cloning, sequencing of environmental DNA and expression of gene identified, is powerful approach to collect novel uncultivable microbes or novel active genes.

Comparative analysis and molecular characterization of genomic sequences and proteins of FABP4 and FABP5 from the giant panda (Ailuropoda melanoleuca).

PubMed

Song, B; Hou, Y L; Ding, X; Wang, T; Wang, F; Zhong, J C; Xu, T; Zhong, J; Hou, W R; Shuai, S R

2014-02-20

Fatty acid binding proteins (FABPs) are a family of small, highly conserved cytoplasmic proteins that bind long-chain fatty acids and other hydrophobic ligands. In this study, cDNA and genomic sequences of FABP4 and FABP5 were cloned successfully from the giant panda (Ailuropoda melanoleuca) using reverse transcription polymerase chain reaction (RT-PCR) technology and touchdown-PCR. The cDNAs of FABP4 and FABP5 cloned from the giant panda were 400 and 413 bp in length, containing an open reading frame of 399 and 408 bp, encoding 132 and 135 amino acids, respectively. The genomic sequences of FABP4 and FABP5 were 3976 and 3962 bp, respectively, which each contained four exons and three introns. Sequence alignment indicated a high degree of homology with reported FABP sequences of other mammals at both the amino acid and DNA levels. Topology prediction revealed seven protein kinase C phosphorylation sites, two casein kinase II phosphorylation sites, two N-myristoylation sites, and one cytosolic fatty acid-binding protein signature in the FABP4 protein, and three N-glycosylation sites, three protein kinase C phosphorylation sites, one casein kinase II phosphorylation site, one N-myristoylation site, one amidation site, and one cytosolic fatty acid-binding protein signature in the FABP5 protein. The FABP4 and FABP5 genes were overexpressed in Escherichia coli BL21 and they produced the expected 16.8- and 17.0-kDa polypeptides. The results obtained in this study provide information for further in-depth research of this system, which has great value of both theoretical and practical significance.

Genome-wide identification and characterization of NB-ARC resistant genes in wheat (Triticum aestivum L.) and their expression during leaf rust infection.

PubMed

Chandra, Saket; Kazmi, Andaleeb Z; Ahmed, Zainab; Roychowdhury, Gargi; Kumari, Veena; Kumar, Manish; Mukhopadhyay, Kunal

2017-07-01

NB-ARC domain-containing resistance genes from the wheat genome were identified, characterized and localized on chromosome arms that displayed differential yet positive response during incompatible and compatible leaf rust interactions. Wheat (Triticum aestivum L.) is an important cereal crop; however, its production is affected severely by numerous diseases including rusts. An efficient, cost-effective and ecologically viable approach to control pathogens is through host resistance. In wheat, high numbers of resistance loci are present but only few have been identified and cloned. A comprehensive analysis of the NB-ARC-containing genes in complete wheat genome was accomplished in this study. Complete NB-ARC encoding genes were mined from the Ensembl Plants database to predict 604 NB-ARC containing sequences using the HMM approach. Genome-wide analysis of orthologous clusters in the NB-ARC-containing sequences of wheat and other members of the Poaceae family revealed maximum homology with Oryza sativa indica and Brachypodium distachyon. The identification of overlap between orthologous clusters enabled the elucidation of the function and evolution of resistance proteins. The distributions of the NB-ARC domain-containing sequences were found to be balanced among the three wheat sub-genomes. Wheat chromosome arms 4AL and 7BL had the most NB-ARC domain-containing contigs. The spatio-temporal expression profiling studies exemplified the positive role of these genes in resistant and susceptible wheat plants during incompatible and compatible interaction in response to the leaf rust pathogen Puccinia triticina. Two NB-ARC domain-containing sequences were modelled in silico, cloned and sequenced to analyze their fine structures. The data obtained in this study will augment isolation, characterization and application NB-ARC resistance genes in marker-assisted selection based breeding programs for improving rust resistance in wheat.

16S rRNA Gene Sequence Analysis of Drinking Water Using RNA and DNA Extracts as Targets for Clone Library Development

EPA Science Inventory

The bacterial composition of chlorinated drinking water was analyzed using 16S rRNA gene clone libraries derived from DNA extracts of 12 samples and compared to clone libraries previously generated using RNA extracts from the same samples. Phylogenetic analysis of 761 DNA-based ...

[Cloning and sequencing of KIR2DL1 framework gene cDNA and identification of a novel allele].

PubMed

Sun, Ge; Wang, Chang; Zhen, Jianxin; Zhang, Guobin; Xu, Yunping; Deng, Zhihui

2016-10-01

To develop an assay for cDNA cloning and haplotype sequencing of KIR2DL1 framework gene and determine the genotype of an ethnic Han from southern China. Total RNA was isolated from peripheral blood sample, and complementary DNA (cDNA) transcript was synthesized by RT-PCR. The entire coding sequence of the KIR2DL1 framework gene was amplified with a pair of KIR2DL1-specific PCR primers. The PCR products with a length of approximately 1.2 kb were then subjected to cloning and haplotype sequencing. A specific target fragment of the KIR2DL1 framework gene was obtained. Following allele separation, a wild-type KIR2DL1*00302 allele and a novel variant allele, KIR2DL1*031, were identified. Sequence alignment with KIR2DL1 alleles from the IPD-KIR Database showed that the novel allele KIR2DL1*031 has differed from the closest allele KIR2DL1*00302 by a non-synonymous mutation at CDS nt 188A>G (codon 42 GAG>GGG) in exon 4, which has caused an amino acid change Glu42Gly. The sequence of the novel allele KIR2DL1*031 was submitted to GenBank under the accession number KP025960 and to the IPD-KIR Database under the submission number IWS40001982. A name KIR2DL1*031 has been officially assigned by the World Health Organization (WHO) Nomenclature Committee. An assay for cDNA cloning and haplotype sequencing of KIR2DL1 has been established, which has a broad applications in KIR studies at allelic level.

Isolation and mapping of telomeric pentanucleotide (TAACC)n repeats of the Pacific whiteleg shrimp, Penaeus vannamei, using fluorescence in situ hybridization.

PubMed

Alcivar-Warren, Acacia; Meehan-Meola, Dawn; Wang, Yongping; Guo, Ximing; Zhou, Linghua; Xiang, Jianhai; Moss, Shaun; Arce, Steve; Warren, William; Xu, Zhenkang; Bell, Kireina

2006-01-01

To develop genetic and physical maps for shrimp, accurate information on the actual number of chromosomes and a large number of genetic markers is needed. Previous reports have shown two different chromosome numbers for the Pacific whiteleg shrimp, Penaeus vannamei, the most important penaeid shrimp species cultured in the Western hemisphere. Preliminary results obtained by direct sequencing of clones from a Sau3A-digested genomic library of P. vannamei ovary identified a large number of (TAACC/GGTTA)-containing SSRs. The objectives of this study were to (1) examine the frequency of (TAACC)n repeats in 662 P. vannamei genomic clones that were directly sequenced, and perform homology searches of these clones, (2) confirm the number of chromosomes in testis of P. vannamei, and (3) localize the TAACC repeats in P. vannamei chromosome spreads using fluorescence in situ hybridization (FISH). Results for objective 1 showed that 395 out of the 662 clones sequenced contained single or multiple SSRs with three or more repeat motifs, 199 of which contained variable tandem repeats of the pentanucleotide (TAACC/GGTTA)n, with 3 to 14 copies per sequence. The frequency of (TAACC)n repeats in P. vannamei is 4.68 kb for SSRs with five or more repeat motifs. Sequence comparisons using the BLASTN nonredundant and expressed sequence tag (EST) databases indicated that most of the TAACC-containing clones were similar to either the core pentanucleotide repeat in PVPENTREP locus (GenBank accession no. X82619) or portions of 28S rRNA. Transposable elements (transposase for Tn1000 and reverse transcriptase family members), hypothetical or unnamed protein products, and genes of known function such as 18S and 28S rRNAs, heat shock protein 70, and thrombospondin were identified in non-TAACC-containing clones. For objective 2, the meiotic chromosome number of P. vannamei was confirmed as N = 44. For objective 3, four FISH probes (P1 to P4) containing different numbers of TAACC repeats produced positive signals on telomeres of P. vannamei chromosomes. A few chromosomes had positive signals interstitially. Probe signal strength and chromosome coverage differed in the general order of P1>P2>P3>P4, which correlated with the length of TAACC repeats within the probes: 83, 66, 35, and 30 bp, respectively, suggesting that the TAACC repeats, and not the flanking sequences, produced the TAACC signals at chromosome ends and TAACC is likely the telomere sequence for P. vannamei.

Identification of Abundantly Expressed Novel and Conserved Genes from the Infective Larval Stage of Toxocara canis by an Expressed Sequence Tag Strategy

PubMed Central

Tetteh, Kevin K. A.; Loukas, Alex; Tripp, Cindy; Maizels, Rick M.

1999-01-01

Larvae of Toxocara canis, a nematode parasite of dogs, infect humans, causing visceral and ocular larva migrans. In noncanid hosts, larvae neither grow nor differentiate but endure in a state of arrested development. Reasoning that parasite protein production is orientated to immune evasion, we undertook a random sequencing project from a larval cDNA library to characterize the most highly expressed transcripts. In all, 266 clones were sequenced, most from both 3′ and 5′ ends, and similarity searches against GenBank protein and dbEST nucleotide databases were conducted. Cluster analyses showed that 128 distinct gene products had been found, all but 3 of which represented newly identified genes. Ninety-five genes were represented by a single clone, but seven transcripts were present at high frequencies, each composing >2% of all clones sequenced. These high-abundance transcripts include a mucin and a C-type lectin, which are both major excretory-secretory antigens released by parasites. Four highly expressed novel gene transcripts, termed ant (abundant novel transcript) genes, were found. Together, these four genes comprised 18% of all cDNA clones isolated, but no similar sequences occur in the Caenorhabditis elegans genome. While the coding regions of the four genes are dissimilar, their 3′ untranslated tracts have significant homology in nucleotide sequence. The discovery of these abundant, parasite-specific genes of newly identified lectins and mucins, as well as a range of conserved and novel proteins, provides defined candidates for future analysis of the molecular basis of immune evasion by T. canis. PMID:10456930

A Personal Journey of Discovery: Developing Technology and Changing Biology

NASA Astrophysics Data System (ADS)

Hood, Lee

2008-07-01

This autobiographical article describes my experiences in developing chemically based, biological technologies for deciphering biological information: DNA, RNA, proteins, interactions, and networks. The instruments developed include protein and DNA sequencers and synthesizers, as well as ink-jet technology for synthesizing DNA chips. Diverse new strategies for doing biology also arose from novel applications of these instruments. The functioning of these instruments can be integrated to generate powerful new approaches to cloning and characterizing genes from a small amount of protein sequence or to using gene sequences to synthesize peptide fragments so as to characterize various properties of the proteins. I also discuss the five paradigm changes in which I have participated: the development and integration of biological instrumentation; the human genome project; cross-disciplinary biology; systems biology; and predictive, personalized, preventive, and participatory (P4) medicine. Finally, I discuss the origins, the philosophy, some accomplishments, and the future trajectories of the Institute for Systems Biology.

Genomic investigations of evolutionary dynamics and epistasis in microbial evolution experiments.

PubMed

Jerison, Elizabeth R; Desai, Michael M

2015-12-01

Microbial evolution experiments enable us to watch adaptation in real time, and to quantify the repeatability and predictability of evolution by comparing identical replicate populations. Further, we can resurrect ancestral types to examine changes over evolutionary time. Until recently, experimental evolution has been limited to measuring phenotypic changes, or to tracking a few genetic markers over time. However, recent advances in sequencing technology now make it possible to extensively sequence clones or whole-population samples from microbial evolution experiments. Here, we review recent work exploiting these techniques to understand the genomic basis of evolutionary change in experimental systems. We first focus on studies that analyze the dynamics of genome evolution in microbial systems. We then survey work that uses observations of sequence evolution to infer aspects of the underlying fitness landscape, concentrating on the epistatic interactions between mutations and the constraints these interactions impose on adaptation. Copyright © 2015 Elsevier Ltd. All rights reserved.

Identification of a Linked Set of Genes in Serpulina hyodysenteriae (B204) Predicted To Encode Closely Related 39-Kilodalton Extracytoplasmic Proteins

PubMed Central

Gabe, Jeffrey D.; Dragon, Elizabeth; Chang, Ray-Jen; McCaman, Michael T.

1998-01-01

A tandem pair of nearly identical genes from Serpulina hyodysenteriae (B204) were cloned and sequenced. The full open reading frame of one gene and the partial open reading frame of the neighboring gene appear to encode secreted proteins which are homologous to, yet distinct from, the 39-kDa extracytoplasmic protein purified from the membrane fraction of S. hyodysenteriae. We have designated these newly identified genes vspA and vspB (for variable surface protein). PMID:9440540

Mammalian cDNA Library from the NIH Mammalian Gene Collection (MGC) | Office of Cancer Genomics

Cancer.gov

The MGC provides the research community full-length clones for most of the defined (as of 2006) human and mouse genes, along with selected clones of cow and rat genes. Clones were designed to allow easy transfer of the ORF sequences into nearly any type of expression vector. MGC provides protein ‘expression-ready’ clones for each of the included human genes. MGC is part of the ORFeome Collaboration (OC).

Restriction enzyme body doubles and PCR cloning: on the general use of type IIs restriction enzymes for cloning.

PubMed

Tóth, Eszter; Huszár, Krisztina; Bencsura, Petra; Kulcsár, Péter István; Vodicska, Barbara; Nyeste, Antal; Welker, Zsombor; Tóth, Szilvia; Welker, Ervin

2014-01-01

The procedure described here allows the cloning of PCR fragments containing a recognition site of the restriction endonuclease (Type IIP) used for cloning in the sequence of the insert. A Type IIS endonuclease--a Body Double of the Type IIP enzyme--is used to generate the same protruding palindrome. Thus, the insert can be cloned to the Type IIP site of the vector without digesting the PCR product with the same Type IIP enzyme. We achieve this by incorporating the recognition site of a Type IIS restriction enzyme that cleaves the DNA outside of its recognition site in the PCR primer in such a way that the cutting positions straddle the desired overhang sequence. Digestion of the PCR product by the Body Double generates the required overhang. Hitherto the use of Type IIS restriction enzymes in cloning reactions has only been used for special applications, the approach presented here makes Type IIS enzymes as useful as Type IIP enzymes for general cloning purposes. To assist in finding Body Double enzymes, we summarised the available Type IIS enzymes which are potentially useful for Body Double cloning and created an online program (http://group.szbk.u-szeged.hu/welkergr/body_double/index.html) for the selection of suitable Body Double enzymes and the design of the appropriate primers.

Anti-digoxin Fab variants generated by phage display.

PubMed

Murata, Viviane Midori; Schmidt, Mariana Costa Braga; Kalil, Jorge; Tsuruta, Lilian Rumi; Moro, Ana Maria

2013-06-01

Digoxin is a pharmaceutical used in the control of cardiac dysfunction. Its therapeutic window is narrow, with effect dosage very close to the toxic dosage. To counteract the toxic effect, polyclonal Fab fragments are commercially available. Our study is based on a monoclonal anti-digoxin antibody, which would provide a product with a specific potency and more precise dosage for the detoxification of patients under digoxin treatment. Phage display technology was used to select variants with high affinity. From an anti-digoxin hybridoma, RNA was extracted for subsequent cDNA synthesis. Specific primers were used for the LC and Fd amplifications, then cloned sequentially in a phagemid vector (pComb3X) for the combinatorial Fab library construction. Clones were selected for their ability to bind to digoxin-BSA. The presence of light and heavy chains was checked, randomly selected clones then sequenced and induced to produce soluble Fabs, and subsequently analyzed for anti-digoxin expression. Out of ten clones randomly chosen, six resulted positive expression of the product. The sequencing of these revealed two identical clones and one presenting a pseudogene in the LC. Four clones presenting variations in the framework1 showed binding to digoxin-BSA by ELISA and western blotting. The specific binding was further confirmed by Biacore(®), which allowed ranking of the clones. The development of these clones allowed the selection of variants with higher affinity than the original version.

Evidence for two transferrin loci in the Salmo trutta genome.

PubMed

Rozman, T; Dovc, P; Marić, S; Kokalj-Vokac, N; Erjavec-Skerget, A; Rab, P; Snoj, A

2008-12-01

To determine the organization of transferrin (TF) locus in the Salmo trutta genome, partial DNA and cDNA sequencing, fluorescent in situ hybridization (FISH) and Salmo salar BAC analysis were performed. TF expression levels and copy number prediction were assessed using real-time PCR. In addition to two previously reported DNA TF variant sequences of S. trutta and Salmo marmoratus (TF1), two novel variant sequences (TF2) were revealed in both species. Variant-specific sequence tags, characterizing two variants for each TF type (TF1 and TF2), were identified in genomic clones from each of the F1 hybrids between S. trutta and S. marmoratus. These clearly documented double heterozygote status at the TF loci. The real-time PCR data showed that each of the two TF types (TF1 and TF2) existed in one copy only and that the transcription of TF2 was considerably lower compared with TF1. Using FISH, hybridization signals were observed on two medium-sized acrocentric chromosomes of S. trutta karyotype. A TF type-specific PCR followed by a restriction analysis revealed the presence of two TF loci in the majority of analysed BAC clones. It was concluded that the TF gene is duplicated in the genome of S. trutta, and that the two TF loci are located adjacent to one another on the same chromosome. The differing transcription levels of TF1 and TF2 appear to depend on the corresponding promoter activity, which at least for TF2 seems to vary between different Salmo congeners.

The Three Major Spanish Clones of Penicillin-Resistant Streptococcus pneumoniae Are the Most Common Clones Recovered in Recent Cases of Meningitis in Spain

PubMed Central

Enright, Mark C.; Fenoll, Asunción; Griffiths, David; Spratt, Brian G.

1999-01-01

One hundred six isolates of Streptococcus pneumoniae recovered in Spain from patients with meningitis in 1997 and 1998 were characterized by multilocus sequence typing. A heterogeneous collection of genotypes was associated with meningitis in Spain: 65 different sequence types were resolved and, even at a genetic distance of 0.43, there were 37 distinct lineages. Thirty-eight percent of the isolates, including all isolates of serotypes 6B, 9V, 14, and 23F, were resistant to penicillin, and 24% of the isolates were members of the three major Spanish penicillin-resistant or multidrug-resistant clones of serotypes 6B, 9V, and 23F or serotype variants of these clones. These three clones (MICs, 1 to 2 μg of penicillin/ml) were the most common clones associated with pneumococcal meningitis in Spain during 1997 and 1998. Only two of the other clones associated with meningitis were penicillin resistant (MICs, 0.12 to 0.5 μg/ml). One of the two most prevalent penicillin-susceptible clones causing meningitis (serotype 3) has not been detected outside of Spain, whereas the other (serotype 18C) has been recovered from patients with meningitis in the United Kingdom, The Netherlands, and Denmark. The prevalence of meningitis caused by isolates of the three major Spanish penicillin-resistant or multiply antibiotic-resistant clones, which are now globally distributed, is disturbing and clearly establishes their ability to cause life-threatening disease. PMID:10488179

Cloning of a cDNA encoding 1-aminocyclopropane-1-carboxylate synthase and expression of its mRNA in ripening apple fruit.

PubMed

Dong, J G; Kim, W T; Yip, W K; Thompson, G A; Li, L; Bennett, A B; Yang, S F

1991-08-01

1-Aminocyclopropane-1-carboxylate (ACC) synthase (EC 4.4.1.14) purified from apple (Malus sylvestris Mill.) fruit was subjected to trypsin digestion. Following separation by reversed-phase high-pressure liquid chromatography, ten tryptic peptides were sequenced. Based on the sequences of three tryptic peptides, three sets of mixed oligonucleotide probes were synthesized and used to screen a plasmid cDNA library prepared from poly(A)(+) RNA of ripe apple fruit. A 1.5-kb (kilobase) cDNA clone which hybridized to all three probes were isolated. The clone contained an open reading frame of 1214 base pairs (bp) encoding a sequence of 404 amino acids. While the polyadenine tail at the 3'-end was intact, it lacked a portion of sequence at the 5'-end. Using the RNA-based polymerase chain reaction, an additional sequence of 148 bp was obtained at the 5'-end. Thus, 1362 bp were sequenced and they encode 454 amino acids. The deduced amino-acid sequence contained peptide sequences corresponding to all ten tryptic fragments, confirming the identity of the cDNA clone. Comparison of the deduced amino-acid sequence between ACC synthase from apple fruit and those from tomato (Lycopersicon esculentum Mill.) and winter squash (Cucurbita maxima Duch.) fruits demonstrated the presence of seven highly conserved regions, including the previously identified region for the active site. The size of the translation product of ACC-synthase mRNA was similar to that of the mature protein on sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), indicating that apple ACC-synthase undergoes only minor, if any, post-translational proteolytic processing. Analysis of ACC-synthase mRNA by in-vitro translation-immunoprecipitation, and by Northern blotting indicates that the ACC-synthase mRNA was undetectable in unripe fruit, but was accumulated massively during the ripening proccess. These data demonstrate that the expression of the ACC-synthase gene is developmentally regulated.

Cloning and sequence analysis demonstrate the chromate reduction ability of a novel chromate reductase gene from Serratia sp.

PubMed

Deng, Peng; Tan, Xiaoqing; Wu, Ying; Bai, Qunhua; Jia, Yan; Xiao, Hong

2015-03-01

The ChrT gene encodes a chromate reductase enzyme which catalyzes the reduction of Cr(VI). The chromate reductase is also known as flavin mononucleotide (FMN) reductase (FMN_red). The aim of the present study was to clone the full-length ChrT DNA from Serratia sp. CQMUS2 and analyze the deduced amino acid sequence and three-dimensional structure. The putative ChrT gene fragment of Serratia sp. CQMUS2 was isolated by polymerase chain reaction (PCR), according to the known FMN_red gene sequence from Serratia sp. AS13. The flanking sequences of the ChrT gene were obtained by high efficiency TAIL-PCR, while the full-length gene of ChrT was cloned in Escherichia coli for subsequent sequencing. The nucleotide sequence of ChrT was submitted onto GenBank under the accession number, KF211434. Sequence analysis of the gene and amino acids was conducted using the Basic Local Alignment Search Tool, and open reading frame (ORF) analysis was performed using ORF Finder software. The ChrT gene was found to be an ORF of 567 bp that encodes a 188-amino acid enzyme with a calculated molecular weight of 20.4 kDa. In addition, the ChrT protein was hypothesized to be an NADPH-dependent FMN_red and a member of the flavodoxin-2 superfamily. The amino acid sequence of ChrT showed high sequence similarity to the FMN reductase genes of Klebsiella pneumonia and Raoultella ornithinolytica , which belong to the flavodoxin-2 superfamily. Furthermore, ChrT was shown to have a 85.6% similarity to the three-dimensional structure of Escherichia coli ChrR, sharing four common enzyme active sites for chromate reduction. Therefore, ChrT gene cloning and protein structure determination demonstrated the ability of the gene for chromate reduction. The results of the present study provide a basis for further studies on ChrT gene expression and protein function.

Cloning and sequence analysis demonstrate the chromate reduction ability of a novel chromate reductase gene from Serratia sp

PubMed Central

DENG, PENG; TAN, XIAOQING; WU, YING; BAI, QUNHUA; JIA, YAN; XIAO, HONG

2015-01-01

The ChrT gene encodes a chromate reductase enzyme which catalyzes the reduction of Cr(VI). The chromate reductase is also known as flavin mononucleotide (FMN) reductase (FMN_red). The aim of the present study was to clone the full-length ChrT DNA from Serratia sp. CQMUS2 and analyze the deduced amino acid sequence and three-dimensional structure. The putative ChrT gene fragment of Serratia sp. CQMUS2 was isolated by polymerase chain reaction (PCR), according to the known FMN_red gene sequence from Serratia sp. AS13. The flanking sequences of the ChrT gene were obtained by high efficiency TAIL-PCR, while the full-length gene of ChrT was cloned in Escherichia coli for subsequent sequencing. The nucleotide sequence of ChrT was submitted onto GenBank under the accession number, KF211434. Sequence analysis of the gene and amino acids was conducted using the Basic Local Alignment Search Tool, and open reading frame (ORF) analysis was performed using ORF Finder software. The ChrT gene was found to be an ORF of 567 bp that encodes a 188-amino acid enzyme with a calculated molecular weight of 20.4 kDa. In addition, the ChrT protein was hypothesized to be an NADPH-dependent FMN_red and a member of the flavodoxin-2 superfamily. The amino acid sequence of ChrT showed high sequence similarity to the FMN reductase genes of Klebsiella pneumonia and Raoultella ornithinolytica, which belong to the flavodoxin-2 superfamily. Furthermore, ChrT was shown to have a 85.6% similarity to the three-dimensional structure of Escherichia coli ChrR, sharing four common enzyme active sites for chromate reduction. Therefore, ChrT gene cloning and protein structure determination demonstrated the ability of the gene for chromate reduction. The results of the present study provide a basis for further studies on ChrT gene expression and protein function. PMID:25667630

Complementary DNA sequencing and identification of mRNAs from the venomous gland of Agkistrodon piscivorus leucostoma.

PubMed

Jia, Ying; Cantu, Bruno A; Sánchez, Elda E; Pérez, John C

2008-06-15

To advance our knowledge on the snake venom composition and transcripts expressed in venom gland at the molecular level, we constructed a cDNA library from the venom gland of Agkistrodon piscivorus leucostoma for the generation of expressed sequence tags (ESTs) database. From the randomly sequenced 2112 independent clones, we have obtained ESTs for 1309 (62%) cDNAs, which showed significant deduced amino acid sequence similarity (scores >80) to previously characterized proteins in National Center for Biotechnology Information (NCBI) database. Ribosomal proteins make up 47 clones (2%) and the remaining 756 (36%) cDNAs represent either unknown identity or show BLASTX sequence identity scores of <80 with known GenBank accessions. The most highly expressed gene encoding phospholipase A(2) (PLA(2)) accounting for 35% of A. p. leucostoma venom gland cDNAs was identified and further confirmed by crude venom applied to sodium dodecyl sulfate/polyacrylamide gel electrophoresis (SDS-PAGE) electrophoresis and protein sequencing. A total of 180 representative genes were obtained from the sequence assemblies and deposited to EST database. Clones showing sequence identity to disintegrins, thrombin-like enzymes, hemorrhagic toxins, fibrinogen clotting inhibitors and plasminogen activators were also identified in our EST database. These data can be used to develop a research program that will help us identify genes encoding proteins that are of medical importance or proteins involved in the mechanisms of the toxin venom.

Sequence Ready Characterization of the Pericentromeric Region of 19p12

DOE Office of Scientific and Technical Information (OSTI.GOV)

Evan E. Eichler

2006-08-31

Current mapping and sequencing strategies have been inadequate within the proximal portion of 19p12 due, in part, to the presence of a recently expanded ZNF (zinc-finger) gene family and the presence of large (25-50 kb) inverted beta-satellite repeat structures which bracket this tandemly duplicated gene family. The virtual of absence of classically defined “unique” sequence within the region has hampered efforts to identify and characterize a suitable minimal tiling path of clones which can be used as templates required for finished sequencing of the region. The goal of this proposal is to develop and implement a novel sequence-anchor strategy tomore » generate a contiguous BAC map of the most proximal portion of chromosome 19p12 for the purpose of complete sequence characterization. The target region will be an estimated 4.5 Mb of DNA extending from STS marker D19S450 (the beginning of the ZNF gene cluster) to the centromeric (alpha-satellite) junction of 19p11. The approach will entail 1) pre-selection of 19p12 BAC and cosmid clones (NIH approved library) utilizing both 19p12 -unique and 19p12-SPECIFIC repeat probes (Eichler et al., 1998); 2) the generation of a BAC/cosmid end-sequence map across the region with a density of one marker every 8kb; 3) the development of a second-generation of STS (sequence tagged sites) which will be used to identify and verify clonal overlap at the level of the sequence; 4) incorporation of these sequence-anchored overlapping clones into existing cosmid/BAC restriction maps developed at Livermore National Laboratory; and 5) validation of the organization of this region utilizing high-resolution FISH techniques (extended chromatin analysis) on monochromosomal 19 somatic cell hybrids and parental cell lines of source material. The data generated will be used in the selection of the most parsimonious tiling path of BAC clones to be sequenced as part of the JGI effort on chromosome 19 and should serve as a model for the sequence characterization of other difficult regions of the human genome« less

Nucleotide sequence analysis establishes the role of endogenous murine leukemia virus DNA segments in formation of recombinant mink cell focus-forming murine leukemia viruses.

PubMed Central

Khan, A S

1984-01-01

The sequence of 363 nucleotides near the 3' end of the pol gene and 564 nucleotides from the 5' terminus of the env gene in an endogenous murine leukemia viral (MuLV) DNA segment, cloned from AKR/J mouse DNA and designated as A-12, was obtained. For comparison, the nucleotide sequence in an analogous portion of AKR mink cell focus-forming (MCF) 247 MuLV provirus was also determined. Sequence features unique to MCF247 MuLV DNA in the 3' pol and 5' env regions were identified by comparison with nucleotide sequences in analogous regions of NFS -Th-1 xenotropic and AKR ecotropic MuLV proviruses. These included (i) an insertion of 12 base pairs encoding four amino acids located 60 base pairs from the 3' terminus of the pol gene and immediately preceding the env gene, (ii) the deletion of 12 base pairs (encoding four amino acids) and the insertion of 3 base pairs (encoding one amino acid) in the 5' portion of the env gene, and (iii) single base substitutions resulting in 2 MCF247 -specific amino acids in the 3' pol and 23 in the 5' env regions. Nucleotide sequence comparison involving the 3' pol and 5' env regions of AKR MCF247 , NFS xenotropic, and AKR ecotropic MuLV proviruses with the cloned endogenous MuLV DNA indicated that MCF247 proviral DNA sequences were conserved in the cloned endogenous MuLV proviral segment. In fact, total nucleotide sequence identity existed between the endogenous MuLV DNA and the MCF247 MuLV provirus in the 3' portion of the pol gene. In the 5' env region, only 4 of 564 nucleotides were different, resulting in three amino acid changes between AKR MCF247 MuLV DNA and the endogenous MuLV DNA present in clone A-12. In addition, nucleotide sequence comparison indicated that Moloney-and Friend-MCF MuLVs were also highly related in the 3' pol and 5' env regions to the cloned endogenous MuLV DNA. These results establish the role of endogenous MuLV DNA segments in generation of recombinant MCF viruses. PMID:6328017

Stable MSAP markers for the distinction of Vitis vinifera cv Pinot noir clones.

PubMed

Ocaña, Juan; Walter, Bernard; Schellenbaum, Paul

2013-11-01

Grapevine is one of the most economically important fruit crops. Molecular markers have been used to study grapevine diversity. For instance, simple sequence repeats are a powerful tool for identification of grapevine cultivars, while amplified fragment length polymorphisms have shown their usefulness in intra-varietal diversity studies. Other techniques such as sequence-specific amplified polymorphism are based on the presence of mobile elements in the genome, but their detection lies upon their activity. Relevant attention has been drawn toward epigenetic sources of variation. In this study, a set of Vitis vinifera cv Pinot noir clones were analyzed using the methylation-sensitive amplified polymorphism technique with isoschizomers MspI and HpaII. Nine out of fourteen selective primer combinations were informative and generated two types of polymorphic fragments which were categorized as "stable" and "unstable." In total, 23 stable fragments were detected and they discriminated 92.5 % of the studied clones. Detected stable polymorphisms were either common to several clones, restricted to a few clones or unique to a single clone. The identification of these stable epigenetic markers will be useful in clonal diversity studies. We highlight the relevance of stable epigenetic variation in V. vinifera clones and analyze at which level these markers could be applicable for the development of forthright techniques for clonal distinction.

Characterization and Expression Analysis of a Retinoblastoma-Related Gene from Chinese Wild Vitis pseudoreticulata.

PubMed

Wen, Zhifeng; Gao, Min; Jiao, Chen; Wang, Qian; Xu, Hui; Walter, Monika; Xu, Weirong; Bassett, Carole; Wang, Xiping

2012-01-01

Retinoblastoma-related (RBR) genes, a conserved gene family in higher eukaryotes, play important roles in cell differentiation, development, and mammalian cell death; however, little is known of their function in plants. In this study, a RBR gene was isolated from the Chinese wild grape, Vitis pseudoreticulata W. T. Wang clone "Baihe-35-1", and designated as VpRBR . The cDNA sequence of VpRBR was 3,030 bp and contained an open reading frame of 3,024 bp. Conceptual translation of this gene indicated a composition of 1,007 amino acids with a predicted molecular mass of 117.3 kDa. The predicted protein showed a retinoblastoma-associated protein domain A from amino acid residues 416 to 579, and domain B from residues 726 to 855. The result of expression analysis indicated that VpRBR was expressed in tissues, leaves, stem, tendrils, flower, and grape skin at different expression levels. Further quantitative reverse transcription-PCR (qRT-PCR) data indicated that VpRBR levels were higher in Erysiphe necator-treated "Baihe-35-1" and "Baihe-13-1", two resistant clones of Chinese wild V. pseudoreticulata , than in E. necator-treated "Hunan-1", a susceptible clone of V. pseudoreticulata . Furthermore, the expression of VpRBR in response to salicylic acid (SA), methyl jasmonate (MeJA), and ethylene (Eth) in grape leaves was also investigated. Taken together, these data indicate that VpRBR may contribute to some aspect of powdery mildew resistance in grape.

A new set of ESTs and cDNA clones from full-length and normalized libraries for gene discovery and functional characterization in citrus

PubMed Central

Marques, M Carmen; Alonso-Cantabrana, Hugo; Forment, Javier; Arribas, Raquel; Alamar, Santiago; Conejero, Vicente; Perez-Amador, Miguel A

2009-01-01

Background Interpretation of ever-increasing raw sequence information generated by modern genome sequencing technologies faces multiple challenges, such as gene function analysis and genome annotation. Indeed, nearly 40% of genes in plants encode proteins of unknown function. Functional characterization of these genes is one of the main challenges in modern biology. In this regard, the availability of full-length cDNA clones may fill in the gap created between sequence information and biological knowledge. Full-length cDNA clones facilitate functional analysis of the corresponding genes enabling manipulation of their expression in heterologous systems and the generation of a variety of tagged versions of the native protein. In addition, the development of full-length cDNA sequences has the power to improve the quality of genome annotation. Results We developed an integrated method to generate a new normalized EST collection enriched in full-length and rare transcripts of different citrus species from multiple tissues and developmental stages. We constructed a total of 15 cDNA libraries, from which we isolated 10,898 high-quality ESTs representing 6142 different genes. Percentages of redundancy and proportion of full-length clones range from 8 to 33, and 67 to 85, respectively, indicating good efficiency of the approach employed. The new EST collection adds 2113 new citrus ESTs, representing 1831 unigenes, to the collection of citrus genes available in the public databases. To facilitate functional analysis, cDNAs were introduced in a Gateway-based cloning vector for high-throughput functional analysis of genes in planta. Herein, we describe the technical methods used in the library construction, sequence analysis of clones and the overexpression of CitrSEP, a citrus homolog to the Arabidopsis SEP3 gene, in Arabidopsis as an example of a practical application of the engineered Gateway vector for functional analysis. Conclusion The new EST collection denotes an important step towards the identification of all genes in the citrus genome. Furthermore, public availability of the cDNA clones generated in this study, and not only their sequence, enables testing of the biological function of the genes represented in the collection. Expression of the citrus SEP3 homologue, CitrSEP, in Arabidopsis results in early flowering, along with other phenotypes resembling the over-expression of the Arabidopsis SEPALLATA genes. Our findings suggest that the members of the SEP gene family play similar roles in these quite distant plant species. PMID:19747386

Cloning and characterization of the gene encoding the endopolygalacturonase-inhibiting protein (PGIP) of Phaseolus vulgaris L.

PubMed

Toubart, P; Desiderio, A; Salvi, G; Cervone, F; Daroda, L; De Lorenzo, G

1992-05-01

Polygalacturonase-inhibiting protein (PGIP) is a cell wall protein purified from hypocotyls of true bean (Phaseolus vulgaris L.). PGIP inhibits fungal endopolygalacturonases and is considered to be an important factor for plant resistance to phytopathogenic fungi (Albersheim and Anderson, 1971; Cervone et al., 1987). The amino acid sequences of the N-terminus and one internal tryptic peptide of the PGIP purified from P. vulgaris cv. Pinto were used to design redundant oligonucleotides that were successfully utilized as primers in a polymerase chain reaction (PCR) with total DNA of P. vulgaris as a template. A DNA band of 758 bp (a specific PCR amplification product of part of the gene coding for PGIP) was isolated and cloned. By using the 758-bp DNA as a hybridization probe, a lambda clone containing the PGIP gene was isolated from a genomic library of P. vulgaris cv. Saxa. The coding and immediate flanking regions of the PGIP gene, contained on a subcloned 3.3 kb SalI-SalI DNA fragment, were sequenced. A single, continuous ORF of 1026 nt (342 amino acids) was present in the genomic clone. The nucleotide and deduced amino acid sequences of the PGIP gene showed no significant similarity with any known databank sequence. Northern blotting analysis of poly(A)+ RNAs, isolated from various tissues of bean seedlings or from suspension-cultured bean cells, were also performed using the cloned PCR-generated DNA as a probe. A 1.2 kb transcript was detected in suspension-cultured cells and, to a lesser extent, in leaves, hypocotyls, and flowers.(ABSTRACT TRUNCATED AT 250 WORDS)

A fosmid cloning strategy for detecting the widest possible spectrum of microbes from the international space station drinking water system.

PubMed

Choi, Sangdun; Chang, Mi Sook; Stuecker, Tara; Chung, Christine; Newcombe, David A; Venkateswaran, Kasthuri

2012-12-01

In this study, fosmid cloning strategies were used to assess the microbial populations in water from the International Space Station (ISS) drinking water system (henceforth referred to as Prebiocide and Tank A water samples). The goals of this study were: to compare the sensitivity of the fosmid cloning strategy with that of traditional culture-based and 16S rRNA-based approaches and to detect the widest possible spectrum of microbial populations during the water purification process. Initially, microbes could not be cultivated, and conventional PCR failed to amplify 16S rDNA fragments from these low biomass samples. Therefore, randomly primed rolling-circle amplification was used to amplify any DNA that might be present in the samples, followed by size selection by using pulsed-field gel electrophoresis. The amplified high-molecular-weight DNA from both samples was cloned into fosmid vectors. Several hundred clones were randomly selected for sequencing, followed by Blastn/Blastx searches. Sequences encoding specific genes from Burkholderia, a species abundant in the soil and groundwater, were found in both samples. Bradyrhizobium and Mesorhizobium, which belong to rhizobia, a large community of nitrogen fixers often found in association with plant roots, were present in the Prebiocide samples. Ralstonia, which is prevalent in soils with a high heavy metal content, was detected in the Tank A samples. The detection of many unidentified sequences suggests the presence of potentially novel microbial fingerprints. The bacterial diversity detected in this pilot study using a fosmid vector approach was higher than that detected by conventional 16S rRNA gene sequencing.

Characterization of species-specific repeated DNA sequences from B. nigra.

PubMed

Gupta, V; Lakshmisita, G; Shaila, M S; Jagannathan, V; Lakshmikumaran, M S

1992-07-01

The construction and characterization of two genome-specific recombinant DNA clones from B. nigra are described. Southern analysis showed that the two clones belong to a dispersed repeat family. They differ from each other in their length, distribution and sequence, though the average GC content is nearly the same (45%). These B genome-specific repeats have been used to analyse the phylogenetic relationships between cultivated and wild species of the family Brassicaceae.

Complete sequence of the first chimera genome constructed by cloning the whole genome of Synechocystis strain PCC6803 into the Bacillus subtilis 168 genome.

PubMed

Watanabe, Satoru; Shiwa, Yuh; Itaya, Mitsuhiro; Yoshikawa, Hirofumi

2012-12-01

Genome synthesis of existing or designed genomes is made feasible by the first successful cloning of a cyanobacterium, Synechocystis PCC6803, in Gram-positive, endospore-forming Bacillus subtilis. Whole-genome sequence analysis of the isolate and parental B. subtilis strains provides clues for identifying single nucleotide polymorphisms (SNPs) in the 2 complete bacterial genomes in one cell.

Molecular evidence for zoonotic transmission of an emergent, highly pathogenic Campylobacter jejuni clone in the United States.

PubMed

Sahin, Orhan; Fitzgerald, Collette; Stroika, Steven; Zhao, Shaohua; Sippy, Rachel J; Kwan, Patrick; Plummer, Paul J; Han, Jing; Yaeger, Michael J; Zhang, Qijing

2012-03-01

Campylobacter jejuni is a major zoonotic pathogen. A highly virulent, tetracycline-resistant C. jejuni clone (clone SA) has recently emerged in ruminant reservoirs and has become the predominant cause of sheep abortion in the United States. To determine whether clone SA is associated with human disease, we compared the clinical isolates of clone SA from sheep abortions with the human isolates of the PulseNet National Campylobacter databases at the CDC and the FDA using pulsed-field gel electrophoresis (PFGE), multilocus sequence typing (MLST), and serotyping. The combined SmaI and KpnI PFGE pattern designations of clone SA from sheep were indistinguishable from those of 123 (9.03%) human C. jejuni isolates (total, 1,361) in the CDC database, among which 56 were associated with sporadic infections and 67 were associated with outbreaks that occurred in multiple states from 2003 to 2010. Most of the outbreaks were attributed to raw milk, while the sources for most of the sporadic cases were unknown. All clone SA isolates examined, including PFGE-matched human isolates, belong to sequence type 8 (ST-8) by MLST and serotype HS:1,8, further indicating the clonality of the related isolates from different host species. Additionally, C. jejuni clone SA was identified in raw milk, cattle feces, the feces and bile of healthy sheep, and abortion cases of cattle and goats, indicating the broad distribution of this pathogenic clone in ruminants. These results provide strong molecular and epidemiological evidence for zoonotic transmission of this emergent clone from ruminants to humans and indicate that C. jejuni clone SA is an important threat to public health.

Molecular Evidence for Zoonotic Transmission of an Emergent, Highly Pathogenic Campylobacter jejuni Clone in the United States

PubMed Central

Sahin, Orhan; Fitzgerald, Collette; Stroika, Steven; Zhao, Shaohua; Sippy, Rachel J.; Kwan, Patrick; Plummer, Paul J.; Han, Jing; Yaeger, Michael J.

2012-01-01

Campylobacter jejuni is a major zoonotic pathogen. A highly virulent, tetracycline-resistant C. jejuni clone (clone SA) has recently emerged in ruminant reservoirs and has become the predominant cause of sheep abortion in the United States. To determine whether clone SA is associated with human disease, we compared the clinical isolates of clone SA from sheep abortions with the human isolates of the PulseNet National Campylobacter databases at the CDC and the FDA using pulsed-field gel electrophoresis (PFGE), multilocus sequence typing (MLST), and serotyping. The combined SmaI and KpnI PFGE pattern designations of clone SA from sheep were indistinguishable from those of 123 (9.03%) human C. jejuni isolates (total, 1,361) in the CDC database, among which 56 were associated with sporadic infections and 67 were associated with outbreaks that occurred in multiple states from 2003 to 2010. Most of the outbreaks were attributed to raw milk, while the sources for most of the sporadic cases were unknown. All clone SA isolates examined, including PFGE-matched human isolates, belong to sequence type 8 (ST-8) by MLST and serotype HS:1,8, further indicating the clonality of the related isolates from different host species. Additionally, C. jejuni clone SA was identified in raw milk, cattle feces, the feces and bile of healthy sheep, and abortion cases of cattle and goats, indicating the broad distribution of this pathogenic clone in ruminants. These results provide strong molecular and epidemiological evidence for zoonotic transmission of this emergent clone from ruminants to humans and indicate that C. jejuni clone SA is an important threat to public health. PMID:22189122

Massive dominance of Epsilonproteobacteria in formation waters from a Canadian oil sands reservoir containing severely biodegraded oil

PubMed Central

Hubert, Casey R J; Oldenburg, Thomas B P; Fustic, Milovan; Gray, Neil D; Larter, Stephen R; Penn, Kevin; Rowan, Arlene K; Seshadri, Rekha; Sherry, Angela; Swainsbury, Richard; Voordouw, Gerrit; Voordouw, Johanna K; Head, Ian M

2012-01-01

Summary The subsurface microbiology of an Athabasca oil sands reservoir in western Canada containing severely biodegraded oil was investigated by combining 16S rRNA gene- and polar lipid-based analyses of reservoir formation water with geochemical analyses of the crude oil and formation water. Biomass was filtered from formation water, DNA was extracted using two different methods, and 16S rRNA gene fragments were amplified with several different primer pairs prior to cloning and sequencing or community fingerprinting by denaturing gradient gel electrophoresis (DGGE). Similar results were obtained irrespective of the DNA extraction method or primers used. Archaeal libraries were dominated by Methanomicrobiales (410 of 414 total sequences formed a dominant phylotype affiliated with a Methanoregula sp.), consistent with the proposed dominant role of CO2-reducing methanogens in crude oil biodegradation. In two bacterial 16S rRNA clone libraries generated with different primer pairs, > 99% and 100% of the sequences were affiliated with Epsilonproteobacteria (n = 382 and 72 total clones respectively). This massive dominance of Epsilonproteobacteria sequences was again obtained in a third library (99% of sequences; n = 96 clones) using a third universal bacterial primer pair (inosine-341f and 1492r). Sequencing of bands from DGGE profiles and intact polar lipid analyses were in accordance with the bacterial clone library results. Epsilonproteobacterial OTUs were affiliated with Sulfuricurvum, Arcobacter and Sulfurospirillum spp. detected in other oil field habitats. The dominant organism revealed by the bacterial libraries (87% of all sequences) is a close relative of Sulfuricurvum kujiense – an organism capable of oxidizing reduced sulfur compounds in crude oil. Geochemical analysis of organic extracts from bitumen at different reservoir depths down to the oil water transition zone of these oil sands indicated active biodegradation of dibenzothiophenes, and stable sulfur isotope ratios for elemental sulfur and sulfate in formation waters were indicative of anaerobic oxidation of sulfur compounds. Microbial desulfurization of crude oil may be an important metabolism for Epsilonproteobacteria indigenous to oil reservoirs with elevated sulfur content and may explain their prevalence in formation waters from highly biodegraded petroleum systems. PMID:21824242

A hybrid BAC physical map of potato: a framework for sequencing a heterozygous genome

PubMed Central

2011-01-01

Background Potato is the world's third most important food crop, yet cultivar improvement and genomic research in general remain difficult because of the heterozygous and tetraploid nature of its genome. The development of physical map resources that can facilitate genomic analyses in potato has so far been very limited. Here we present the methods of construction and the general statistics of the first two genome-wide BAC physical maps of potato, which were made from the heterozygous diploid clone RH89-039-16 (RH). Results First, a gel electrophoresis-based physical map was made by AFLP fingerprinting of 64478 BAC clones, which were aligned into 4150 contigs with an estimated total length of 1361 Mb. Screening of BAC pools, followed by the KeyMaps in silico anchoring procedure, identified 1725 AFLP markers in the physical map, and 1252 BAC contigs were anchored the ultradense potato genetic map. A second, sequence-tag-based physical map was constructed from 65919 whole genome profiling (WGP) BAC fingerprints and these were aligned into 3601 BAC contigs spanning 1396 Mb. The 39733 BAC clones that overlap between both physical maps provided anchors to 1127 contigs in the WGP physical map, and reduced the number of contigs to around 2800 in each map separately. Both physical maps were 1.64 times longer than the 850 Mb potato genome. Genome heterozygosity and incomplete merging of BAC contigs are two factors that can explain this map inflation. The contig information of both physical maps was united in a single table that describes hybrid potato physical map. Conclusions The AFLP physical map has already been used by the Potato Genome Sequencing Consortium for sequencing 10% of the heterozygous genome of clone RH on a BAC-by-BAC basis. By layering a new WGP physical map on top of the AFLP physical map, a genetically anchored genome-wide framework of 322434 sequence tags has been created. This reference framework can be used for anchoring and ordering of genomic sequences of clone RH (and other potato genotypes), and opens the possibility to finish sequencing of the RH genome in a more efficient way via high throughput next generation approaches. PMID:22142254

Automated sample-preparation technologies in genome sequencing projects.

PubMed

Hilbert, H; Lauber, J; Lubenow, H; Düsterhöft, A

2000-01-01

A robotic workstation system (BioRobot 96OO, QIAGEN) and a 96-well UV spectrophotometer (Spectramax 250, Molecular Devices) were integrated in to the process of high-throughput automated sequencing of double-stranded plasmid DNA templates. An automated 96-well miniprep kit protocol (QIAprep Turbo, QIAGEN) provided high-quality plasmid DNA from shotgun clones. The DNA prepared by this procedure was used to generate more than two mega bases of final sequence data for two genomic projects (Arabidopsis thaliana and Schizosaccharomyces pombe), three thousand expressed sequence tags (ESTs) plus half a mega base of human full-length cDNA clones, and approximately 53,000 single reads for a whole genome shotgun project (Pseudomonas putida).

Environmental Control Of A Genetic Process

NASA Technical Reports Server (NTRS)

Khosla, Chaitan; Bailey, James E.

1991-01-01

E. coli bacteria altered to contain DNA sequence encoding production of hemoglobin made to produce hemoglobin at rates decreasing with increases in concentration of oxygen in culture media. Represents amplification of part of method described in "Cloned Hemoglobin Genes Enhance Growth Of Cells" (NPO-17517). Manipulation of promoter/regulator DNA sequences opens promising new subfield of recombinant-DNA technology for environmental control of expression of selected DNA sequences. New recombinant-DNA fusion gene products, expression vectors, and nucleotide-base sequences will emerge. Likely applications include such aerobic processes as manufacture of cloned proteins and synthesis of metabolites, production of chemicals by fermentation, enzymatic degradation, treatment of wastes, brewing, and variety of oxidative chemical reactions.

T cell receptor (TCR) structure of autologous melanoma-reactive cytotoxic T lymphocyte (CTL) clones: tumor-infiltrating lymphocytes overexpress in vivo the TCR beta chain sequence used by an HLA-A2- restricted and melanocyte-lineage-specific CTL clone

PubMed Central

1993-01-01

HLA-A2+ melanomas express common melanoma-associated antigens (Ags) recognized in vitro by autologous cytotoxic T lymphocytes (CTL). However, it is not known whether tumor Ags can drive in vivo a selective accumulation/expansion of Ag-specific, tumor-infiltrating T lymphocytes (TIL). Therefore, to evaluate this possibility, 39 CTL clones isolated from several independent mixed lymphocyte tumor cultures (MLTC) of TIL and peripheral blood lymphocytes (PBL) of an HLA- A2+ melanoma patient and selected for T cell receptor (TCR)-dependent, HLA-restricted tumor lysis, were used for analysis of TCR alpha and beta chain structure by the cDNA polymerase chain reaction (PCR) technique with variable gene-specific primers followed by sequencing. Despite absence of oligoclonality in fresh TIL and PBL, as well as in T cells of day 28 MLTC (day of cloning), sequence analysis of TCR alpha and beta chains of TIL clones revealed a dominance of a major category of melanoma-specific, HLA-A2-restricted T cells expressing a V alpha 8.2/J alpha AP511/C alpha and V beta 2.1/D beta 1/J beta 1.1/C beta 1 TCR. The same TCR was also found in 2 out of 14 PBL clones. The other PBL clones employed a V alpha 2.1 gene segment associated with either V beta 13.2, 14, or w22. Clones A81 (V alpha 2.1/J alpha IGRJ alpha 04/C alpha and V beta 14/D beta 1/J beta 1.2/C beta 1) and A21 (V alpha 8.2/J alpha AP511/C alpha and V beta 2.1/D beta 1/J beta 1.1/C beta 1), representative of the two most frequent TCR of PBL and TIL, respectively, expressed different lytic patterns, but both were HLA-A2 restricted and lysed only HLA-A2+ melanomas and normal melanocytes, thus indicating recognition of two distinct HLA-A2-associated and tissue-related Ags. Finally, by the inverse PCR technique, the specific TCR beta chain (V beta 2.1/D beta 1/J beta 1.1/C beta 1) expressed by the dominant TIL clone was found to represent 19 and 18.4% of all V beta 2 sequences expressed in the fresh tumor sample and in the purified TIL, respectively, but < 0.19% of V beta 2+ sequences expressed in PBL. These results are consistent with the hypothesis that a clonal expansion/accumulation of a melanocyte-lineage-specific and HLA-A2-restricted T cell clone occurred in vivo at the site of tumor growth. PMID:8376931

The Influence of Polyploidy on the Evolution of Yeast Grown in a Sub-Optimal Carbon Source

PubMed Central

Scott, Amber L.; Richmond, Phillip A.; Dowell, Robin D.; Selmecki, Anna M.

2017-01-01

Abstract Polyploidization events have occurred during the evolution of many fungi, plant, and animal species and are thought to contribute to speciation and tumorigenesis, however little is known about how ploidy level contributes to adaptation at the molecular level. Here we integrate whole genome sequencing, RNA expression analysis, and relative fitness of ∼100 evolved clones at three ploidy levels. Independent haploid, diploid, and tetraploid populations were grown in a low carbon environment for 250 generations. We demonstrate that the key adaptive mutation in the evolved clones is predicted by a gene expression signature of just five genes. All of the adaptive mutations identified encompass a narrow set of genes, however the tetraploid clones gain a broader spectrum of adaptive mutations than haploid or diploid clones. While many of the adaptive mutations occur in genes that encode proteins with known roles in glucose sensing and transport, we discover mutations in genes with no canonical role in carbon utilization (IPT1 and MOT3), as well as identify novel dominant mutations in glucose signal transducers thought to only accumulate recessive mutations in carbon limited environments (MTH1 and RGT1). We conclude that polyploid cells explore more genotypic and phenotypic space than lower ploidy cells. Our study provides strong evidence for the beneficial role of polyploidization events that occur during the evolution of many species and during tumorigenesis. PMID:28957510

Cloning and localization of MCdef, a defensin from Manila clams (Ruditapes philippinarum).

PubMed

Adhya, Mausumi; Jeung, Hee-Do; Kang, Hyun-Sil; Choi, Kwang-Sik; Lee, Dong Sun; Cho, Moonjae

2012-01-01

A defensin-like peptide was previously detected in hemocytes of Manila clams (Ruditapes philippinarum). In the current study, we cloned and characterized this defensin, designated MCdef. Cloning produced a full-length gene sequence of 201 bp predicted to encode a 66-amino-acid precursor protein maturing to a 44-amino-acid residue. Amino acid sequence analysis showed that MCdef is similar to defensins from marine mollusks and ticks. Phylogenetic analysis suggested that MCdef is closely related to defensins from Mytilus galloprovincialis (Mediterranean mussel) and Crassostrea gigas (Pacific cupped oyster). The three-dimensional structure of MCdef was modeled using the solution structure of C. gigas defensin as a template. With the exception of three variable loop areas, the modeled structure of MCdef was identical to that of C. gigas defensin. MCdef antiserum was raised against a synthetic MCdef peptide and verified by Western blotting using recombinant MCdef. RT-PCR analysis demonstrated high levels of MCdef mRNA in hemocytes and adductor, foot, gill, mantle, palp, and siphon tissues of Vibrio tapetis-infected Manila clams, whereas in V. tapetis-uninfected Manila clams, the level of MCdef mRNA was low in adductor, palp, and siphon tissues and even lower in the other tested tissues. Immunohistochemical analysis revealed high MCdef expression was detected in the gill, the mantle, and the digestive tubules of the diverticulum of V. tapetis-infected Manila clams. Minimum inhibitory concentration (MIC) of the purified rMCdef was determined. MCdef showed highest activity against Streptococcus iniae and Staphylococcus aureus. Copyright © 2011 Elsevier Inc. All rights reserved.

Isolation of a cDNA Encoding a Granule-Bound 152-Kilodalton Starch-Branching Enzyme in Wheat1

PubMed Central

Båga, Monica; Nair, Ramesh B.; Repellin, Anne; Scoles, Graham J.; Chibbar, Ravindra N.

2000-01-01

Screening of a wheat (Triticum aestivum) cDNA library for starch-branching enzyme I (SBEI) genes combined with 5′-rapid amplification of cDNA ends resulted in isolation of a 4,563-bp composite cDNA, Sbe1c. Based on sequence alignment to characterized SBEI cDNA clones isolated from plants, the SBEIc predicted from the cDNA sequence was produced with a transit peptide directing the polypeptide into plastids. Furthermore, the predicted mature form of SBEIc was much larger (152 kD) than previously characterized plant SBEI (80–100 kD) and contained a partial duplication of SBEI sequences. The first SBEI domain showed high amino acid similarity to a 74-kD wheat SBEI-like protein that is inactive as a branching enzyme when expressed in Escherichia coli. The second SBEI domain on SBEIc was identical in sequence to a functional 87-kD SBEI produced in the wheat endosperm. Immunoblot analysis of proteins produced in developing wheat kernels demonstrated that the 152-kD SBEIc was, in contrast to the 87- to 88-kD SBEI, preferentially associated with the starch granules. Proteins similar in size and recognized by wheat SBEI antibodies were also present in Triticum monococcum, Triticum tauschii, and Triticum turgidum subsp. durum. PMID:10982440

Precerebellin is a cerebellum-specific protein with similarity to the globular domain of complement C1q B chain.

PubMed Central

Urade, Y; Oberdick, J; Molinar-Rode, R; Morgan, J I

1991-01-01

The cerebellum contains a hexadecapeptide, termed cerebellin, that is conserved in sequence from human to chicken. Three independent, overlapping cDNA clones have been isolated from a human cerebellum cDNA library that encode the cerebellin sequence. The longest clone codes for a protein of 193 amino acids that we term precerebellin. This protein has a significant similarity (31.3% identity, 52.2% similarity) to the globular (non-collagen-like) region of the B chain of human complement component C1q. The region of relatedness extends over approximately 145 amino acids located in the carboxyl terminus of both proteins. Unlike C1q B chain, no collagen-like motifs are present in the amino-terminal regions of precerebellin. The amino terminus of precerebellin contains three possible N-linked glycosylation sites. Although hydrophobic amino acids are clustered at the amino terminus, they do not conform to the classical signal-peptide motif, and no other obvious membrane-spanning domains are predicted from the cDNA sequence. The cDNA predicts that the cerebellin peptide is flanked by Val-Arg and Glu-Pro residues. Therefore, cerebellin is not liberated from precerebellin by the classical dibasic amino acid proteolytic-cleavage mechanism seen in many neuropeptide precursors. In Northern (RNA) blots, precerebellin transcripts, with four distinct sizes (1.8, 2.3, 2.7, and 3.0 kilobases), are abundant in cerebellum. These transcripts are present at either very low or undetectable levels in other brain areas and extraneural structures. A similar pattern of cerebellin precursor transcripts are seen in rat, mouse, and human cerebellum. Furthermore, a partial genomic fragment from mouse shows the same bands in Northern blots as the human cDNA clone. During rat development, precerebellin transcripts mirror the level of cerebellin peptide. Low levels of precerebellin mRNA are seen at birth. Levels increase modestly from postpartum day 1 to 8, then increase more dramatically between day 5 and 15, and eventually reach peak values between day 21 and 56. Because cerebellin-like immunoreactivity is associated with Purkinje cell postsynaptic structures, these data raise interesting possibilities concerning the function of the cerebellin precursor in synaptic physiology. Images PMID:1704129

HTP-OligoDesigner: An Online Primer Design Tool for High-Throughput Gene Cloning and Site-Directed Mutagenesis.

PubMed

Camilo, Cesar M; Lima, Gustavo M A; Maluf, Fernando V; Guido, Rafael V C; Polikarpov, Igor

2016-01-01

Following burgeoning genomic and transcriptomic sequencing data, biochemical and molecular biology groups worldwide are implementing high-throughput cloning and mutagenesis facilities in order to obtain a large number of soluble proteins for structural and functional characterization. Since manual primer design can be a time-consuming and error-generating step, particularly when working with hundreds of targets, the automation of primer design process becomes highly desirable. HTP-OligoDesigner was created to provide the scientific community with a simple and intuitive online primer design tool for both laboratory-scale and high-throughput projects of sequence-independent gene cloning and site-directed mutagenesis and a Tm calculator for quick queries.

Gene Transfer and Molecular Cloning of the Human NGF Receptor

NASA Astrophysics Data System (ADS)

Chao, Moses V.; Bothwell, Mark A.; Ross, Alonzo H.; Koprowski, Hilary; Lanahan, Anthony A.; Buck, C. Randall; Sehgal, Amita

1986-04-01

Nerve growth factor (NGF) and its receptor are important in the development of cells derived from the neural crest. Mouse L cell transformants have been generated that stably express the human NGF receptor gene transfer with total human DNA. Affinity cross-linking, metabolic labeling and immunoprecipitation, and equilibrium binding with 125I-labeled NGF revealed that this NGF receptor had the same size and binding characteristics as the receptor from human melanoma cells and rat PC12 cells. The sequences encoding the NGF receptor were molecularly cloned using the human Alu repetitive sequence as a probe. A cosmid clone that contained the human NGF receptor gene allowed efficient transfection and expression of the receptor.

pYEMF, a pUC18-derived XcmI T-vector for efficient cloning of PCR products.

PubMed

Gu, Jingsong; Ye, Chunjiang

2011-03-01

A 1330-bp DNA sequence with two XcmI cassettes was inserted into pUC18 to construct an efficient XcmI T-vector parent plasmid, pYEMF. The large size of the inserted DNA fragment improved T-vector cleavage efficiency, and guaranteed good separation of the molecular components after restriction digestion. The pYEMF-T-vector generated from parent plasmid pYEMF permits blue/white colony screening; cloning efficiency analysis showed that most white colonies (>75%) were putative transformants which carried the cloning product. The sequence analysis and design approach presented here will facilitate applications in the fields of molecular biology and genetic engineering.

Cloning and Sequencing of Defective Particles Derived from the Autonomous Parvovirus Minute Virus of Mice for the Construction of Vectors with Minimal cis-Acting Sequences

PubMed Central

Clément, Nathalie; Avalosse, Bernard; El Bakkouri, Karim; Velu, Thierry; Brandenburger, Annick

2001-01-01

The production of wild-type-free stocks of recombinant parvovirus minute virus of mice [MVM(p)] is difficult due to the presence of homologous sequences in vector and helper genomes that cannot easily be eliminated from the overlapping coding sequences. We have therefore cloned and sequenced spontaneously occurring defective particles of MVM(p) with very small genomes to identify the minimal cis-acting sequences required for DNA amplification and virus production. One of them has lost all capsid-coding sequences but is still able to replicate in permissive cells when nonstructural proteins are provided in trans by a helper plasmid. Vectors derived from this particle produce stocks with no detectable wild-type MVM after cotransfection with new, matched, helper plasmids that present no homology downstream from the transgene. PMID:11152501

Cloning and sequence analysis of complementary DNA encoding an aberrantly rearranged human T-cell gamma chain.

PubMed Central

Dialynas, D P; Murre, C; Quertermous, T; Boss, J M; Leiden, J M; Seidman, J G; Strominger, J L

1986-01-01

Complementary DNA (cDNA) encoding a human T-cell gamma chain has been cloned and sequenced. At the junction of the variable and joining regions, there is an apparent deletion of two nucleotides in the human cDNA sequence relative to the murine gamma-chain cDNA sequence, resulting simultaneously in the generation of an in-frame stop codon and in a translational frameshift. For this reason, the sequence presented here encodes an aberrantly rearranged human T-cell gamma chain. There are several surprising differences between the deduced human and murine gamma-chain amino acid sequences. These include poor homology in the variable region, poor homology in a discrete segment of the constant region precisely bounded by the expected junctions of exon CII, and the presence in the human sequence of five potential sites for N-linked glycosylation. Images PMID:3458221

Cloning and sequence analysis of a cDNA encoding the alpha-subunit of mouse beta-N-acetylhexosaminidase and comparison with the human enzyme.

PubMed Central

Beccari, T; Hoade, J; Orlacchio, A; Stirling, J L

1992-01-01

cDNAs encoding the mouse beta-N-acetylhexosaminidase alpha-subunit were isolated from a mouse testis library. The longest of these (1.7 kb) was sequenced and showed 83% similarity with the human alpha-subunit cDNA sequence. The 5' end of the coding sequence was obtained from a genomic DNA clone. Alignment of the human and mouse sequences showed that all three putative N-glycosylation sites are conserved, but that the mouse alpha-subunit has an additional site towards the C-terminus. All eight cysteines in the human sequence are conserved in the mouse. There are an additional two cysteines in the mouse alpha-subunit signal peptide. All amino acids affected in Tay-Sachs-disease mutations are conserved in the mouse. Images Fig. 1. PMID:1379046

Intervening sequences in a plant gene-comparison of the partial sequence of cDNA and genomic DNA of French bean phaseolin

NASA Astrophysics Data System (ADS)

Sun, S. M.; Slightom, J. L.; Hall, T. C.

1981-01-01

A plant gene coding for the major storage protein (phaseolin, G1-globulin) of the French bean was isolated from a genomic library constructed in the phage vector Charon 24A. Comparison of the nucleotide sequence of part of the gene with that of the cloned messenger RNA (cDNA) revealed the presence of three intervening sequences, all beginning with GTand ending with AG. The 5' and 3' boundaries of intervening sequences TVS-A (88 base pairs) and IVS-B (124 base pairs) are similar to those described for animal and viral genes, but the 3' boundary of IVS-C (129 base pairs) shows some differences. A sequence of 185 amino acids deduced from the cloned DMAs represents about 40% of a phaseolin polypeptide.

Analysis of membrane protein genes in a Brazilian isolate of Anaplasma marginale.

PubMed

G Junior, Daniel S; Araújo, Flábio R; Almeida Junior, Nalvo F; Adi, Said S; Cheung, Luciana M; Fragoso, Stenio P; Ramos, Carlos A N; Oliveira, Renato Henrique M de; Santos, Caroline S; Bacanelli, Gisele; Soares, Cleber O; Rosinha, Grácia M S; Fonseca, Adivaldo H

2010-11-01

The sequencing of the complete genome of Anaplasma marginale has enabled the identification of several genes that encode membrane proteins, thereby increasing the chances of identifying candidate immunogens. Little is known regarding the genetic variability of genes that encode membrane proteins in A. marginale isolates. The aim of the present study was to determine the degree of conservation of the predicted amino acid sequences of OMP1, OMP4, OMP5, OMP7, OMP8, OMP10, OMP14, OMP15, SODb, OPAG1, OPAG3, VirB3, VirB9-1, PepA, EF-Tu and AM854 proteins in a Brazilian isolate of A. marginale compared to other isolates. Hence, primers were used to amplify these genes: omp1, omp4, omp5, omp7, omp8, omp10, omp14, omp15, sodb, opag1, opag3, virb3, VirB9-1, pepA, ef-tu and am854. After polimerase chain reaction amplification, the products were cloned and sequenced using the Sanger method and the predicted amino acid sequence were multi-aligned using the CLUSTALW and MEGA 4 programs, comparing the predicted sequences between the Brazilian, Saint Maries, Florida and A. marginale centrale isolates. With the exception of outer membrane protein (OMP) 7, all proteins exhibited 92-100% homology to the other A. marginale isolates. However, only OMP1, OMP5, EF-Tu, VirB3, SODb and VirB9-1 were selected as potential immunogens capable of promoting cross-protection between isolates due to the high degree of homology (over 72%) also found with A. (centrale) marginale.

Characterization of genomic sequence showing strong association with polyembryony among diverse Citrus species and cultivars, and its synteny with Vitis and Populus.

PubMed

Nakano, Michiharu; Shimada, Takehiko; Endo, Tomoko; Fujii, Hiroshi; Nesumi, Hirohisa; Kita, Masayuki; Ebina, Masumi; Shimizu, Tokurou; Omura, Mitsuo

2012-02-01

Polyembryony, in which multiple somatic nucellar cell-derived embryos develop in addition to the zygotic embryo in a seed, is common in the genus Citrus. Previous genetic studies indicated polyembryony is mainly determined by a single locus, but the underlying molecular mechanism is still unclear. As a step towards identification and characterization of the gene or genes responsible for nucellar embryogenesis in Citrus, haplotype-specific physical maps around the polyembryony locus were constructed. By sequencing three BAC clones aligned on the polyembryony haplotype, a single contiguous draft sequence consisting of 380 kb containing 70 predicted open reading frames (ORFs) was reconstructed. Single nucleotide polymorphism genotypes detected in the sequenced genomic region showed strong association with embryo type in Citrus, indicating a common polyembryony locus is shared among widely diverse Citrus cultivars and species. The arrangement of the predicted ORFs in the characterized genomic region showed high collinearity to the genomic sequence of chromosome 4 of Vitis vinifera and linkage group VI of Populus trichocarpa, suggesting that the syntenic relationship among these species is conserved even though V. vinifera and P. trichocarpa are non-apomictic species. This is the first study to characterize in detail the genomic structure of an apomixis locus determining adventitious embryony. Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.

Spatial constraints govern competition of mutant clones in human epidermis.

PubMed

Lynch, M D; Lynch, C N S; Craythorne, E; Liakath-Ali, K; Mallipeddi, R; Barker, J N; Watt, F M

2017-10-24

Deep sequencing can detect somatic DNA mutations in tissues permitting inference of clonal relationships. This has been applied to human epidermis, where sun exposure leads to the accumulation of mutations and an increased risk of skin cancer. However, previous studies have yielded conflicting conclusions about the relative importance of positive selection and neutral drift in clonal evolution. Here, we sequenced larger areas of skin than previously, focusing on cancer-prone skin spanning five decades of life. The mutant clones identified were too large to be accounted for solely by neutral drift. Rather, using mathematical modelling and computational lattice-based simulations, we show that observed clone size distributions can be explained by a combination of neutral drift and stochastic nucleation of mutations at the boundary of expanding mutant clones that have a competitive advantage. These findings demonstrate that spatial context and cell competition cooperate to determine the fate of a mutant stem cell.

Molecular analysis of microflora associated with dentoalveolar abscesses.

PubMed Central

Dymock, D; Weightman, A J; Scully, C; Wade, W G

1996-01-01

The microflora associated with three dentoalveolar abscesses was determined by cultural and molecular methods. 16S rRNA genes were randomly amplified by means of conserved eubacterial primers and cloned. Restriction fragment length polymorphism analysis of the clones and amplified genes encoding 16S rRNA from the cultured bacteria was used to detect putative unculturable bacteria. Clones representative of five predominant groups of uncultured organisms were sequenced. Two were identified as Porphyromonas gingivalis and Prevotella oris, and one was found to be closely related to Peptostreptococcus micros. The remaining two clones did not correspond to known, previously sequenced organisms. One was related to Zoogloea ramigera, a species of aerobic waterborne organisms, while the other was distantly related to the genus Prevotella. This study has demonstrated the possibility of the characterization of microflora associated with human infection by molecular methods without the inherent biases of culture. PMID:8904410

Cloning, functional expression, and characterization of a PKA-activated gastric Cl- channel.

PubMed

Malinowska, D H; Kupert, E Y; Bahinski, A; Sherry, A M; Cuppoletti, J

1995-01-01

cDNA encoding a Cl- channel was isolated from a rabbit gastric library, sequenced, and expressed in Xenopus oocytes. The predicted protein (898 amino acids, relative molecular mass 98,433 Da) was overall 93% similar to the rat brain ClC-2 Cl- channel. However, a 151-amino acid stretch toward the COOH-terminus was 74% similar to ClC-2 with six amino acids deleted. Two new potential protein kinase A (PKA) phosphorylation sites (also protein kinase C phosphorylation sites) were introduced. cRNA-injected Xenopus oocytes expressed a Cl- channel that was active at pHtrans 3 and had a linear current-voltage (I-V) curve and a slope conductance of 29 +/- 1 pS at 800 mM CsCl. A fivefold Cl- gradient caused a rightward shift in the I-V curve with a reversal potential of +30 +/- 3 mV, indicating anion selectivity. The selectivity was I- > Cl- > NO3-. The native and recombinant Cl- channel were both activated in vitro by PKA catalytic subunit and ATP. The electrophysiological and regulatory properties of the cloned and the native channel were similar. The cloned protein may be the Cl- channel involved in gastric HCl secretion.

In vitro resistance to 5-nitroimidazoles and benzimidazoles in Giardia duodenalis: variability and variation in gene expression.

PubMed

Argüello-García, Raúl; Cruz-Soto, Maricela; Romero-Montoya, Lydia; Ortega-Pierres, Guadalupe

2009-12-01

The susceptibility of Giardia duodenalis trophozoites exposed in vitro to sublethal concentrations of metronidazole (MTZ) and albendazole (ABZ) may exhibit inter-culture (variability) and intra-culture (variation) differences in drug susceptibility. It was previously reported that MTZ-resistant trophozoites may display changes in pyruvate:ferredoxin oxidoreductase (PFOR) expression while changes at the beta-tubulin molecule are apparently absent in ABZ-resistant cultures. To assess the levels of gene expression of these molecules, we obtained cloned cultures growing at concentrations up to 23 microM MTZ (WBRM23) and up to 8muM ABZ (WBRA8) and gene sequence and expression of pfor and beta-tubulin loci were compared with these of drug-susceptible clone WB1. Neither the pfor nor the beta-tubulin genes showed changes at sequence level but the MTZ-resistant clones WBRM21 and WBRM23 showed up-regulation of the pfor RNA using the gdh gene as reference. By using WB1 and WBRA8 clones in representational difference analyses of gene expression (RDA) an insert referred to as ARR-VSP was selected and sequenced. It showed the highest homology to one VSP molecule in the Giardia Genome Database (orf GL50803_101765). This isogene was up-regulated in five ABZ-resistant clones and the clone WBRA8 exhibited the highest RNA expression level. When successive progenies of clones WB1, WBRM23 and WBRA8 were analyzed in Northern blot assays to detect pfor and ARR-VSP RNAs respectively, the expression patterns showed variation for both genes but it was much lower in the clone WBRA8. These results suggest that G. duodenalis cultures either susceptible or resistant to MTZ and ABZ may display variability and variation at RNA expression levels albeit these were more marked in the MTZ-resistant parasites. These data might have further implications defining major mechanisms involved in drug resistance of Giardia.

Regulation of pathogenicity in hop stunt viroid-related group II citrus viroids.

PubMed

Reanwarakorn, K; Semancik, J S

1998-12-01

Nucleotide sequences were determined for two hop stunt viroid-related Group II citrus viroids characterized as either a cachexia disease non-pathogenic variant (CVd-IIa) or a pathogenic variant (CVd-IIb). Sequence identity between the two variants of 95.6% indicated a conserved genome with the principal region of nucleotide difference clustered in the variable (V) domain. Full-length viroid RT-PCR cDNA products were cloned into plasmid SP72. Viroid cDNA clones as well as derived RNA transcripts were transmissible to citron (Citrus medica L.) and Luffa aegyptiaca Mill. To determine the locus of cachexia pathogenicity as well as symptom expression in Luffa, chimeric viroid cDNA clones were constructed from segments of either the left terminal, pathogenic and conserved (T1-P-C) domains or the conserved, variable and right terminal (C-V-T2) domains of CVd-IIa or CVd-IIb in reciprocal exchanges. Symptoms induced by the various chimeric constructs on the two bioassay hosts reflected the differential response observed with CVd-IIa and -IIb. Constructs with the C-V-T2 domains region from clone-IIa induced severe symptoms on Luffa typical of CVd-IIa, but were non-symptomatic on mandarin as a bioassay host for the cachexia disease. Constructs with the same region (C-V-T2) from the clone-IIb genome induced only mild symptoms on Luffa, but produced a severe reaction on mandarin, as observed for CVd-IIb. Specific site-directed mutations were introduced into the V domain of the CVd-IIa clone to construct viroid cDNA clones with either partial or complete conversions to the CVd-IIb sequence. With the introduction of six site-specific changes into the V domain of the clone-IIa genome, cachexia pathogenicity was acquired as well as a moderation of severe symptoms on Luffa.

MagnaportheDB: a federated solution for integrating physical and genetic map data with BAC end derived sequences for the rice blast fungus Magnaporthe grisea.

PubMed

Martin, Stanton L; Blackmon, Barbara P; Rajagopalan, Ravi; Houfek, Thomas D; Sceeles, Robert G; Denn, Sheila O; Mitchell, Thomas K; Brown, Douglas E; Wing, Rod A; Dean, Ralph A

2002-01-01

We have created a federated database for genome studies of Magnaporthe grisea, the causal agent of rice blast disease, by integrating end sequence data from BAC clones, genetic marker data and BAC contig assembly data. A library of 9216 BAC clones providing >25-fold coverage of the entire genome was end sequenced and fingerprinted by HindIII digestion. The Image/FPC software package was then used to generate an assembly of 188 contigs covering >95% of the genome. The database contains the results of this assembly integrated with hybridization data of genetic markers to the BAC library. AceDB was used for the core database engine and a MySQL relational database, populated with numerical representations of BAC clones within FPC contigs, was used to create appropriately scaled images. The database is being used to facilitate sequencing efforts. The database also allows researchers mapping known genes or other sequences of interest, rapid and easy access to the fundamental organization of the M.grisea genome. This database, MagnaportheDB, can be accessed on the web at http://www.cals.ncsu.edu/fungal_genomics/mgdatabase/int.htm.

cDNA cloning of Brassica napus malonyl-CoA:ACP transacylase (MCAT) (fab D) and complementation of an E. coli MCAT mutant.

PubMed

Simon, J W; Slabas, A R

1998-09-18

The GenBank database was searched using the E. coli malonyl CoA:ACP transacylase (MCAT) sequence, for plant protein/cDNA sequences corresponding to MCAT, a component of plant fatty acid synthetase (FAS), for which the plant cDNA has not been isolated. A 272-bp Zea mays EST sequence (GenBank accession number: AA030706) was identified which has strong homology to the E. coli MCAT. A PCR derived cDNA probe from Zea mays was used to screen a Brassica napus (rape) cDNA library. This resulted in the isolation of a 1200-bp cDNA clone which encodes an open reading frame corresponding to a protein of 351 amino acids. The protein shows 47% homology to the E. coli MCAT amino acid sequence in the coding region for the mature protein. Expression of a plasmid (pMCATrap2) containing the plant cDNA sequence in Fab D89, an E. coli mutant, in MCAT activity restores growth demonstrating functional complementation and direct function of the cloned cDNA. This is the first functional evidence supporting the identification of a plant cDNA for MCAT.

Characterization and cloning of tripeptidyl peptidase II from the fruit fly, Drosophila melanogaster.

PubMed

Renn, S C; Tomkinson, B; Taghert, P H

1998-07-24

We describe the characterization, cloning, and genetic analysis of tripeptidyl peptidase II (TPP II) from Drosophila melanogaster. Mammalian TPP II removes N-terminal tripeptides, has wide distribution, and has been identified as the cholecystokinin-degrading peptidase in rat brain. Size exclusion and ion exchange chromatography produced a 70-fold purification of dTPP II activity from Drosophila tissue extracts. The substrate specificity and the inhibitor sensitivity of dTPP II is comparable to that of the human enzyme. In particular, dTPP II is sensitive to butabindide, a specific inhibitor of the rat cholecystokinin-inactivating activity. We isolated a 4309-base pair dTPP II cDNA which predicts a 1354-amino acid protein. The deduced human and Drosophila TPP II proteins display 38% overall identity. The catalytic triad, its spacing, and the sequences that surround it are highly conserved; the C-terminal end of dTPP II contains a 100-amino acid insert not found in the mammalian proteins. Recombinant dTPP II displays the predicted activity following expression in HEK cells. TPP II maps to cytological position 49F4-7; animals deficient for this interval show reduced TPP II activity.

A second gene for acyl-(acyl-carrier-protein): glycerol-3-phosphate acyltransferase in squash, Cucurbita moschata cv. Shirogikuza(*), codes for an oleate-selective isozyme: molecular cloning and protein purification studies.

PubMed

Nishida, I; Sugiura, M; Enju, A; Nakamura, M

2000-12-01

A new isogene for acyl-(acyl-carrier-protein):glycerol-3-phosphate acyltransferase (GPAT; EC 2.3.1.15) in squash has been cloned and the gene product was identified as oleate-selective GPAT. Using PCR primers that could hybridise with exons for a previously cloned squash GPAT, we obtained two PCR products of different size: one coded for a previously cloned squash GPAT corresponding to non-selective isoforms AT2 and AT3, and the other for a new isozyme, probably the oleate-selective isoform AT1. Full-length amino acid sequences of respective isozymes were deduced from the nucleotide sequences of genomic genes and cDNAs, which were cloned by a series of PCR-based methods. Thus, we designated the new gene CmATS1;1 and the other one CmATS1;2. Genome blot analysis revealed that the squash genome contained the two isogenes at non-allelic loci. AT1-active fractions were partially purified, and three polypeptide bands were identified as being AT1 polypeptides, which exhibited relative molecular masses of 39.5-40.5 kDa, pI values of 6.75-7.15, and oleate selectivity over palmitate. Partial amino-terminal sequences obtained from two of these bands verified that the new isogene codes for AT1 polypeptides.

The rapidly emerging ESBL-producing Escherichia coli O25-ST131 clone carries LPS core synthesis genes of the K-12 type.

PubMed

Szijártó, Valéria; Pal, Tibor; Nagy, Gabor; Nagy, Eszter; Ghazawi, Akela; al-Haj, Mohammed; El Kurdi, Sylvia; Sonnevend, Agnes

2012-07-01

The clone Escherichia coli O25 ST131, typically producing extended-spectrum beta-lactamases (ESBLs), has spread globally and became the dominant type among extraintestinal isolates at many parts of the world. However, the reasons behind the emergence and success of this clone are only partially understood. We compared the core type genes by PCR of ESBL-producing and ESBL-nonproducing strains isolated from urinary tract infections in the United Arab Emirates and found a surprisingly high frequency of the K-12 core type (44.6%) among members of the former group, while in the latter one, it was as low (3.7%), as reported earlier. The high figure was almost entirely attributable to the presence of members of the clone O25 ST131 among ESBL producers. Strains from the same clone isolated in Europe also carried the K-12 core type genes. Sequencing the entire core operon of an O25 ST131 isolate revealed a high level of similarity to known K-12 core gene sequences and an almost complete identity with a recently sequenced non-O25 ST131 fecal isolate. The exact chemical structure and whether and how this unusual core type contributed to the sudden emergence of ST131 require further investigations. © 2012 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

Bacterial examination of endodontic infections by clonal analysis in concert with denaturing high-performance liquid chromatography.

PubMed

Jacinto, R C; Gomes, B P F A; Desai, M; Rajendram, D; Shah, H N

2007-12-01

The aim of this study was to examine the diversity of bacterial species in the infected root canals of teeth associated with endodontic abscesses by cloning and sequencing techniques in concert with denaturing high-performance liquid chromatography. Samples collected from five infected root canals were subjected to polymerase chain reaction (PCR) with universal 16S ribosomal DNA primers. Products of these PCRs were cloned and sequenced. Denaturing high-performance liquid chromatography (DHPLC) was used as a screening method to reduce the number of clones necessary for DNA sequencing. All samples were positive for the presence of bacteria and a range of 7-13 different bacteria were found per root canal sample. In total, 48 different oral clones were detected among the five root canal samples. Olsenella profusa was the only species present in all samples. Porphyromonas gingivalis, Dialister pneumosintes, Dialister invisus, Lachnospiraceae oral clone, Staphylococcus aureus, Pseudoramibacter alactolyticus, Peptostreptococcus micros and Enterococcus faecalis were found in two of the five samples. The majority of the taxa were present in only one sample, for example Tannerella forsythia, Shuttleworthia satelles and Filifactor alocis. Some facultative anaerobes that are frequently isolated from endodontic infections such as E. faecalis, Streptococcus anginosus and Lactobacillus spp. were also found in this study. Clonal analysis of the microflora associated with endodontic infections revealed a wide diversity of oral species.

Cloning, expression, and sequence analysis of the Bacillus methanolicus C1 methanol dehydrogenase gene.

PubMed Central

de Vries, G E; Arfman, N; Terpstra, P; Dijkhuizen, L

1992-01-01

The gene (mdh) coding for methanol dehydrogenase (MDH) of thermotolerant, methylotroph Bacillus methanolicus C1 has been cloned and sequenced. The deduced amino acid sequence of the mdh gene exhibited similarity to those of five other alcohol dehydrogenase (type III) enzymes, which are distinct from the long-chain zinc-containing (type I) or short-chain zinc-lacking (type II) enzymes. Highly efficient expression of the mdh gene in Escherichia coli was probably driven from its own promoter sequence. After purification of MDH from E. coli, the kinetic and biochemical properties of the enzyme were investigated. The physiological effect of MDH synthesis in E. coli and the role of conserved sequence patterns in type III alcohol dehydrogenases have been analyzed and are discussed. Images PMID:1644761

Preparation of anti-mouse caspase-12 mRNA hammerhead ribozyme and identification of its activity in vitro

PubMed Central

Jiang, Shan; Xie, Qing; Zhang, Wei; Zhou, Xia-Qiu; Jin, You-Xin

2005-01-01

AIM: To prepare and identify specific anti-mouse caspase-12 hammerhead ribozymes in vitro, in order to select a more effective ribozyme against mouse caspase-12 as a potential tool to rescue cells from endoplasmic reticulum stress induced apoptosis. METHODS: Two hammerhead ribozymes directed separately against 138 and 218 site of nucleotide of mouse caspase-12 mRNA were designed by computer software, and their DNA sequences were synthesized. The synthesized ribozymes were cloned into an eukaryotic expression vector-neorpBSKU6 and embedded in U6 SnRNA context for further study. Mouse caspase-12 gene segment was cloned into PGEM-T vector under the control of T7 RNA polymerase promoter (containing gene sequence from positions nt 41 to nt 894) as target. In vitro transcription both the ribozymes and target utilize T7 promoter. The target was labeled with [α-32P]UTP, while ribozymes were not labeled. After gel purification the RNAs were dissolved in RNase free water. Ribozyme and target were incubated for 90 min at 37°C in reaction buffer (40 mmol/L Tris-HCL, pH 7.5, 10 mmol/L Mg2+). Molar ratio of ribozyme vs target was 30:1. Samples were analyzed on 6% PAGE (containing 8 mol/L urea). RESULTS: Both caspase-12 and ribozyme gene sequences were successfully cloned into expression vector confirmed by sequencing. Ribozymes and caspase-12 mRNA were obtained by in vitro transcription. Cleavage experiment showed that in a physiological similar condition (37°C, pH 7.5), Rz138 and Rz218 both cleaved targets at predicted sites, for Rz138 the cleavage efficiency was about 100%, for Rz218 the value was 36.66%. CONCLUSION: Rz138 prepared in vitro can site specific cleave mouse caspase-12 mRNA with an excellent efficiency. It shows a potential to suppress the expression of caspase-12 in vivo, thus provided a new way to protect cells from ER stress induced apoptosis. PMID:15996037

Molecular cloning and characterization of the full-length cDNA encoding the tree shrew (tupaia belangeri) CD28

NASA Astrophysics Data System (ADS)

Huang, Xiaoyan; Yan, Yan; Wang, Sha; Wang, Qinying; Shi, Jian; Shao, Zhanshe; Dai, Jiejie

2017-11-01

CD28 is one of the most important co-stimulatory molecules expressed by naive and primed T cells. The tree shrews (Tupaia belangeri), as an ideal animal model for analyzing mechanism of human diseases receiving extensive attentions, demands essential research tools, in particular in the study of cellular markers and monoclonal antibodies for immunological studies. However, little is known about tree shrew CD28 (tsCD28) until now. In this study, a 663 bp of the full-length CD28 cDNA, encoding a polypeptide of 220 amino acids was cloned from tree shrew spleen lymphocytes. The nucleotide sequence of the tsCD28 showed 85%, 76%, and 75% similarities with human, rat, and mouse, respectively, which showed the affinity relationship between tree shrew and human is much closer than between human and rodents. The open reading frame (ORF) sequence of tsCD28 gene was predicted to be in correspondence with the signal sequence, immunoglobulin variable-like (IgV) domain, transmembrane domain and cytoplasmic tail, respectively.We also analyzed its molecular characteristics with other mammals by using biology software such as Clustal W 2.0 and so forth. Our results showed that tsCD28 contained many features conserved in CD28 genes from other mammals, including conserved signal peptide and glycosylation sites, and several residues responsible for binding to the CD28R, and the tsCD28 amino acid sequence were found a close genetic relationship with human and monkey. The crystal structure and surface charge revealed most regions of tree shrew CD28 molecule surface charges are similar as human. However, compared with human CD28 (hCD28) regions, in some areas, the surface positive charge of tsCD28 was less than hCD28, which may affect antibody binding. The present study is the first report of cloning and characterization of CD28 in tree shrew. This study provides a theoretical basis for the further study the structure and function of tree shrew CD28 and utilize tree shrew as an effective animal model of human disease.

RNA-Seq in the discovery of a sparsely expressed scent-determining monoterpene synthase in lavender (Lavandula).

PubMed

Adal, Ayelign M; Sarker, Lukman S; Malli, Radesh P N; Liang, Ping; Mahmoud, Soheil S

2018-06-09

Using RNA-Seq, we cloned and characterized a unique monoterpene synthase responsible for the formation of a scent-determining S-linalool constituent of lavender oils from Lavandula × intermedia. Several species of Lavandula produce essential oils (EOs) consisting mainly of monoterpenes including linalool, one of the most abundant and scent-determining oil constituents. Although R-linalool dominates the EOs of lavenders, varying amounts (depending on the species) of the S-linalool enantiomer can also be found in these plants. Despite its relatively low abundance, S-linalool contributes a sweet, pleasant scent and is an important constituent of lavender EOs. While several terpene synthase genes including R-linalool synthase have been cloned from lavenders many important terpene synthases including S-linalool synthase have not been described from these plants. In this study, we employed RNA-Seq and other complementary sequencing data to clone and functionally characterize the sparsely expressed S-linalool synthase cDNA (LiS-LINS) from Lavandula × intermedia. Recombinant LiS-LINS catalyzed the conversion of the universal monoterpene precursor geranyl diphosphate to S-linalool as the sole product. Intriguingly, LiS-LINS exhibited very low (~ 30%) sequence similarity to other Lavandula terpene synthases, including R-linalool synthase. However, the predicted 3D structure of this protein, including the composition and arrangement of amino acids at the active site, is highly homologous to known terpene synthase proteins. LiS-LINS transcripts were detected in flowers, but were much less abundant than those corresponding to LiR-LINS, paralleling enantiomeric composition of linalool in L. × intermedia oils. These data indicate that production of S-linalool is at least partially controlled at the level of transcription from LiS-LINS. The cloned LiS-LINS cDNA may be used to enhance oil composition in lavenders and other plants through metabolic engineering.

Molecular cloning and developmental expression of the catalytic and 65-kDa regulatory subunits of protein phosphatase 2A in Drosophila.

PubMed Central

Mayer-Jaekel, R E; Baumgartner, S; Bilbe, G; Ohkura, H; Glover, D M; Hemmings, B A

1992-01-01

cDNA clones encoding the catalytic subunit and the 65-kDa regulatory subunit of protein phosphatase 2A (PR65) from Drosophila melanogaster have been isolated by homology screening with the corresponding human cDNAs. The Drosophila clones were used to analyze the spatial and temporal expression of the transcripts encoding these two proteins. The Drosophila PR65 cDNA clones contained an open reading frame of 1773 nucleotides encoding a protein of 65.5 kDa. The predicted amino acid sequence showed 75 and 71% identity to the human PR65 alpha and beta isoforms, respectively. As previously reported for the mammalian PR65 isoforms, Drosophila PR65 is composed of 15 imperfect repeating units of approximately 39 amino acids. The residues contributing to this repeat structure show also the highest sequence conservation between species, indicating a functional importance for these repeats. The gene encoding Drosophila PR65 was located at 29B1,2 on the second chromosome. A major transcript of 2.8 kilobase (kb) encoding the PR65 subunit and two transcripts of 1.6 and 2.5 kb encoding the catalytic subunit could be detected throughout Drosophila development. All of these mRNAs were most abundant during early embryogenesis and were expressed at lower levels in larvae and adult flies. In situ hybridization of different developmental stages showed a colocalization of the PR65 and catalytic subunit transcripts. The mRNA expression is high in the nurse cells and oocytes, consistent with a high equally distributed expression in early embryos. In later embryonal development, the expression remains high in the nervous system and the gonads but the overall transcript levels decrease. In third instar larvae, high levels of mRNA could be observed in brain, imaginal discs, and in salivary glands. These results indicate that protein phosphatase 2A transcript levels change during development in a tissue and in a time-specific manner. Images PMID:1320961

Characterization of complete genome sequence of the spring viremia of carp virus isolated from common carp (Cyprinus carpio) in China.

PubMed

Teng, Y; Liu, H; Lv, J Q; Fan, W H; Zhang, Q Y; Qin, Q W

2007-01-01

The complete genome of spring viraemia of carp virus (SVCV) strain A-1 isolated from cultured common carp (Cyprinus carpio) in China was sequenced and characterized. Reverse transcription-polymerase chain reaction (RT-PCR) derived clones were constructed and the DNA was sequenced. It showed that the entire genome of SVCV A-1 consists of 11,100 nucleotide base pairs, the predicted size of the viral RNA of rhabdoviruses. However, the additional insertions in bp 4633-4676 and bp 4684-4724 of SVCV A-1 were different from the other two published SVCV complete genomes. Five open reading frames (ORFs) of SVCV A-1 were identified and further confirmed by RT-PCR and DNA sequencing of their respective RT-PCR products. The 5 structural proteins encoded by the viral RNA were ordered 3'-N-P-M-G-L-5'. This is the first report of a complete genome sequence of SVCV isolated from cultured carp in China. Phylogenetic analysis indicates that SVCV A-1 is closely related to the members of the genus Vesiculovirus, family Rhabdoviridae.

Fusion primer and nested integrated PCR (FPNI-PCR): a new high-efficiency strategy for rapid chromosome walking or flanking sequence cloning

PubMed Central

2011-01-01

Background The advent of genomics-based technologies has revolutionized many fields of biological enquiry. However, chromosome walking or flanking sequence cloning is still a necessary and important procedure to determining gene structure. Such methods are used to identify T-DNA insertion sites and so are especially relevant for organisms where large T-DNA insertion libraries have been created, such as rice and Arabidopsis. The currently available methods for flanking sequence cloning, including the popular TAIL-PCR technique, are relatively laborious and slow. Results Here, we report a simple and effective fusion primer and nested integrated PCR method (FPNI-PCR) for the identification and cloning of unknown genomic regions flanked known sequences. In brief, a set of universal primers was designed that consisted of various 15-16 base arbitrary degenerate oligonucleotides. These arbitrary degenerate primers were fused to the 3' end of an adaptor oligonucleotide which provided a known sequence without degenerate nucleotides, thereby forming the fusion primers (FPs). These fusion primers are employed in the first step of an integrated nested PCR strategy which defines the overall FPNI-PCR protocol. In order to demonstrate the efficacy of this novel strategy, we have successfully used it to isolate multiple genomic sequences namely, 21 orthologs of genes in various species of Rosaceace, 4 MYB genes of Rosa rugosa, 3 promoters of transcription factors of Petunia hybrida, and 4 flanking sequences of T-DNA insertion sites in transgenic tobacco lines and 6 specific genes from sequenced genome of rice and Arabidopsis. Conclusions The successful amplification of target products through FPNI-PCR verified that this novel strategy is an effective, low cost and simple procedure. Furthermore, FPNI-PCR represents a more sensitive, rapid and accurate technique than the established TAIL-PCR and hiTAIL-PCR procedures. PMID:22093809

cDNA cloning, characterization and expression analysis of a novel antimicrobial peptide gene penaeidin-3 (Fi-Pen3) from the haemocytes of Indian white shrimp Fenneropenaeus indicus.

PubMed

Shanthi, S; Vaseeharan, B

2012-03-20

A new member of antimicrobial peptide genes of the penaeidin family, penaeidin 3, was cloned from the haemocytes of Indian white shrimp Fenneropeneaus indicus (F. indicus), by reverse transcription PCR (RT-PCR) and rapid amplification of cDNA end (RACE-PCR) methods. The complete nucleotide sequence of cDNA clone of Indian white shrimp F. indicus Penaeidin 3 (Fi-Pen3) was 243bp long and has an open reading frame which encodes 80 amino acid peptide. The homology analysis of Fi-Pen3 sequence with other Penaeidins 3 shows higher similarity with Penaeus monodon (92%). The theoretical 3D structure generated through ab initio modelling indicated the presence of two-disulphide bridges in the alpha-helix. The signal peptide sequence of Fi-Pen3 is almost entirely homologous to that of other Penaeidin 3 of crustaceans, while differing relatively in the N-terminal domain of the mature peptide. The mature peptide has a predicted molecular weight of 84.9kDa, and a theoretical pI of 9.38. Phylogenetic analysis of Fi-Pen3 shows high resemblance with other Pen-3 from P. monodon, Litopenaeus stylirostris, Litopenaeus vannamei and Litopenaeus setiferus. Fi-Pen3 found to be expressed in haemocytes, heart, hepatopancreas, muscles, gills, intestine, and eyestalk with higher expression in haemocytes. Microbial challenge resulted in mRNA up-regulation, up to 6h post injection of Vibrio parahemolyticus. The Fi-Pen3 mRNA expression of F. indicus in the premolt stage (D(01) and D(02)) was significantly up-regulated than the postmolt (A and B) and intermolt stages (C). The findings of the present paper underline the involvement of Fi-Pen3 in innate immune system of F. indicus. Copyright © 2011 Elsevier GmbH. All rights reserved.

The Dermatophagoides farinae group 22 allergen: cloning and expression in Escherichia coli.

PubMed

Cui, Yu-bao; Cai, Hong-xing; Zhou, Ying; Wang, Nan; Yu, Li-li; Yang, Li; Zhang, Cheng-bo

2015-09-01

Dermatophagoides farinae (Hughes) (Acari: Pyroglyphidae) and other domestic mites produce allergens that affect people worldwide. Here, the complementary DNA (cDNA) coding for group 22 allergen of D. farinae (Der f 22) from China was cloned, sequenced, and expressed successfully. The cDNA encoding Der f 22 was synthesized by reverse transcription polymerase chain reaction (RT-PCR), then ligated to the pCold-TF for expression in Escherichia coli BL21 cells. The purified recombinant fusion protein was identified by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), Western-blotting, and tandem matrix-assisted laser desorption ionization time-of-flight (MALDI-TOF/TOF). The full-length cDNA comprised 468 nucleotides and was 99.57% (466/468) identical with the reference sequence (GenBank: DQ643992). After the plasmid pCold-TF-Der f 22 was transformed into E. coli BL21 and expressed with the induction of IPTG, SDS-PAGE showed a specific band for the recombinant fusion protein. The recombinant fusion protein, which was purified by chromatography, bound with a His-tagged antibody by Western blotting. MALDI-TOF/TOF mass spectrometry revealed that the structure of the recombinant protein was identical to the predicted Der f 22 structure. The hydrophilic protein contains a signal peptide of 20 amino acids, and the mature Der f 22 consists of 135 amino acid residues with a molecular weight of 14.7 kDa and theoretical isoelectric points (pI) of 6.38. Its secondary structure comprises an alpha helix (38.5%), beta-sheet (45.9%), random coils (11.85%), and beta-turns (11.1%). This work represents the first reported full-length sequence and successful cloning of Der f 22 from D. farinae in China; bioinformatics analysis can be used to further study the allergenicity and clinical utility of the recombinant Der f 22. © 2015 ARS-AAOA, LLC.

Screening of Pro-Asp Sequences Exposed on Bacteriophage M13 as an Ideal Anchor for Gold Nanocubes.

PubMed

Lee, Hwa Kyoung; Lee, Yujean; Kim, Hyori; Lee, Hye-Eun; Chang, Hyejin; Nam, Ki Tae; Jeong, Dae Hong; Chung, Junho

2017-09-15

Bacteriophages are thought to be ideal vehicles for linking antibodies to nanoparticles. Here, we define the sequence of peptides exposed as a fusion protein on M13 bacteriophages to yield optimal binding of gold nanocubes and efficient bacteriophage amplification. We generated five helper bacteriophage libraries using AE(X) 2 DP, AE(X) 3 DP, AE(X) 4 DP, AE(X) 5 DP, and AE(X) 6 DP as the exposed portion of pVIII, in which X was a randomized amino acid residue encoded by the nucleotide sequence NNK. Efficient phage amplification was achievable only in the AE(X) 2 DP, AE(X) 3 DP, and AE(X) 4 DP libraries. Through biopanning with gold nanocubes, we enriched the phage clones and selected the clone with the highest fold change after enrichment. This clone displayed Pro-Asp on the surface of the bacteriophage and had amplification yields similar to those of the wild-type helper bacteriophage (VCSM13). The clone displayed even binding of gold nanocubes along its length and minimal aggregation after binding. We conclude that, for efficient amplification, the exposed pVIII amino acid length should be limited to six residues and Ala-Glu-Pro-Asp-Asp-Pro (AEPDDP) is the ideal fusion protein sequence for guaranteeing the optimal formation of a complex with gold nanocubes.

A manually annotated Actinidia chinensis var. chinensis (kiwifruit) genome highlights the challenges associated with draft genomes and gene prediction in plants.

PubMed

Pilkington, Sarah M; Crowhurst, Ross; Hilario, Elena; Nardozza, Simona; Fraser, Lena; Peng, Yongyan; Gunaseelan, Kularajathevan; Simpson, Robert; Tahir, Jibran; Deroles, Simon C; Templeton, Kerry; Luo, Zhiwei; Davy, Marcus; Cheng, Canhong; McNeilage, Mark; Scaglione, Davide; Liu, Yifei; Zhang, Qiong; Datson, Paul; De Silva, Nihal; Gardiner, Susan E; Bassett, Heather; Chagné, David; McCallum, John; Dzierzon, Helge; Deng, Cecilia; Wang, Yen-Yi; Barron, Lorna; Manako, Kelvina; Bowen, Judith; Foster, Toshi M; Erridge, Zoe A; Tiffin, Heather; Waite, Chethi N; Davies, Kevin M; Grierson, Ella P; Laing, William A; Kirk, Rebecca; Chen, Xiuyin; Wood, Marion; Montefiori, Mirco; Brummell, David A; Schwinn, Kathy E; Catanach, Andrew; Fullerton, Christina; Li, Dawei; Meiyalaghan, Sathiyamoorthy; Nieuwenhuizen, Niels; Read, Nicola; Prakash, Roneel; Hunter, Don; Zhang, Huaibi; McKenzie, Marian; Knäbel, Mareike; Harris, Alastair; Allan, Andrew C; Gleave, Andrew; Chen, Angela; Janssen, Bart J; Plunkett, Blue; Ampomah-Dwamena, Charles; Voogd, Charlotte; Leif, Davin; Lafferty, Declan; Souleyre, Edwige J F; Varkonyi-Gasic, Erika; Gambi, Francesco; Hanley, Jenny; Yao, Jia-Long; Cheung, Joey; David, Karine M; Warren, Ben; Marsh, Ken; Snowden, Kimberley C; Lin-Wang, Kui; Brian, Lara; Martinez-Sanchez, Marcela; Wang, Mindy; Ileperuma, Nadeesha; Macnee, Nikolai; Campin, Robert; McAtee, Peter; Drummond, Revel S M; Espley, Richard V; Ireland, Hilary S; Wu, Rongmei; Atkinson, Ross G; Karunairetnam, Sakuntala; Bulley, Sean; Chunkath, Shayhan; Hanley, Zac; Storey, Roy; Thrimawithana, Amali H; Thomson, Susan; David, Charles; Testolin, Raffaele; Huang, Hongwen; Hellens, Roger P; Schaffer, Robert J

2018-04-16

Most published genome sequences are drafts, and most are dominated by computational gene prediction. Draft genomes typically incorporate considerable sequence data that are not assigned to chromosomes, and predicted genes without quality confidence measures. The current Actinidia chinensis (kiwifruit) 'Hongyang' draft genome has 164 Mb of sequences unassigned to pseudo-chromosomes, and omissions have been identified in the gene models. A second genome of an A. chinensis (genotype Red5) was fully sequenced. This new sequence resulted in a 554.0 Mb assembly with all but 6 Mb assigned to pseudo-chromosomes. Pseudo-chromosomal comparisons showed a considerable number of translocation events have occurred following a whole genome duplication (WGD) event some consistent with centromeric Robertsonian-like translocations. RNA sequencing data from 12 tissues and ab initio analysis informed a genome-wide manual annotation, using the WebApollo tool. In total, 33,044 gene loci represented by 33,123 isoforms were identified, named and tagged for quality of evidential support. Of these 3114 (9.4%) were identical to a protein within 'Hongyang' The Kiwifruit Information Resource (KIR v2). Some proportion of the differences will be varietal polymorphisms. However, as most computationally predicted Red5 models required manual re-annotation this proportion is expected to be small. The quality of the new gene models was tested by fully sequencing 550 cloned 'Hort16A' cDNAs and comparing with the predicted protein models for Red5 and both the original 'Hongyang' assembly and the revised annotation from KIR v2. Only 48.9% and 63.5% of the cDNAs had a match with 90% identity or better to the original and revised 'Hongyang' annotation, respectively, compared with 90.9% to the Red5 models. Our study highlights the need to take a cautious approach to draft genomes and computationally predicted genes. Our use of the manual annotation tool WebApollo facilitated manual checking and correction of gene models enabling improvement of computational prediction. This utility was especially relevant for certain types of gene families such as the EXPANSIN like genes. Finally, this high quality gene set will supply the kiwifruit and general plant community with a new tool for genomics and other comparative analysis.

Characterization of proviruses cloned from mink cell focus-forming virus-infected cellular DNA.

PubMed Central

Khan, A S; Repaske, R; Garon, C F; Chan, H W; Rowe, W P; Martin, M A

1982-01-01

Two proviruses were cloned from EcoRI-digested DNA extracted from mink cells chronically infected with AKR mink cell focus-forming (MCF) 247 murine leukemia virus (MuLV), using a lambda phage host vector system. One cloned MuLV DNA fragment (designated MCF 1) contained sequences extending 6.8 kilobases from an EcoRI restriction site in the 5' long terminal repeat (LTR) to an EcoRI site located in the envelope (env) region and was indistinguishable by restriction endonuclease mapping for 5.1 kilobases (except for the EcoRI site in the LTR) from the 5' end of AKR ecotropic proviral DNA. The DNA segment extending from 5.1 to 6.8 kilobases contained several restriction sites that were not present in the AKR ecotropic provirus. A 0.5-kilobase DNA segment located at the 3' end of MCF 1 DNA contained sequences which hybridized to a xenotropic env-specific DNA probe but not to labeled ecotropic env-specific DNA. This dual character of MCF 1 proviral DNA was also confirmed by analyzing heteroduplex molecules by electron microscopy. The second cloned proviral DNA (designated MCF 2) was a 6.9-kilobase EcoRI DNA fragment which contained LTR sequences at each end and a 2.0-kilobase deletion encompassing most of the env region. The MCF 2 proviral DNA proved to be a useful reagent for detecting LTRs electron microscopically due to the presence of nonoverlapping, terminally located LTR sequences which effected its circularization with DNAs containing homologous LTR sequences. Nucleotide sequence analysis demonstrated the presence of a 104-base-pair direct repeat in the LTR of MCF 2 DNA. In contrast, only a single copy of the reiterated component of the direct repeat was present in MCF 1 DNA. Images PMID:6281459

Communities of archaea and bacteria in a subsurface radioactive thermal spring in the Austrian Central Alps, and evidence of ammonia-oxidizing Crenarchaeota.

PubMed

Weidler, Gerhard W; Dornmayr-Pfaffenhuemer, Marion; Gerbl, Friedrich W; Heinen, Wolfgang; Stan-Lotter, Helga

2007-01-01

Scanning electron microscopy revealed great morphological diversity in biofilms from several largely unexplored subterranean thermal Alpine springs, which contain radium 226 and radon 222. A culture-independent molecular analysis of microbial communities on rocks and in the water of one spring, the "Franz-Josef-Quelle" in Bad Gastein, Austria, was performed. Four hundred fifteen clones were analyzed. One hundred thirty-two sequences were affiliated with 14 bacterial operational taxonomic units (OTUs) and 283 with four archaeal OTUs. Rarefaction analysis indicated a high diversity of bacterial sequences, while archaeal sequences were less diverse. The majority of the cloned archaeal 16S rRNA gene sequences belonged to the soil-freshwater-subsurface (1.1b) crenarchaeotic group; other representatives belonged to the freshwater-wastewater-soil (1.3b) group, except one clone, which was related to a group of uncultivated Euryarchaeota. These findings support recent reports that Crenarchaeota are not restricted to high-temperature environments. Most of the bacterial sequences were related to the Proteobacteria (alpha, beta, gamma, and delta), Bacteroidetes, and Planctomycetes. One OTU was allied with Nitrospina sp. (delta-Proteobacteria) and three others grouped with Nitrospira. Statistical analyses suggested high diversity based on 16S rRNA gene analyses; the rarefaction plot of archaeal clones showed a plateau. Since Crenarchaeota have been implicated recently in the nitrogen cycle, the spring environment was probed for the presence of the ammonia monooxygenase subunit A (amoA) gene. Sequences were obtained which were related to crenarchaeotic amoA genes from marine and soil habitats. The data suggested that nitrification processes are occurring in the subterranean environment and that ammonia may possibly be an energy source for the resident communities.

SCREENING OF PROTEASE INHIBITORS RESISTANCE MUTATIONS IN HEPATITIS C VIRUS ISOLATES INFECTING ROMANIAN PATIENTS UNEXPOSED TO TRIPLE THERAPY.

PubMed

Dinu, Sorin; Calistru, Petre-Iacob; Ceauşu, Emanoil; Târdeil, Graţiela; Oprişan, Gabriela

2015-01-01

Although the European recommendations include the use of new antiviral drugs for the treatment of hepatitis C, in Romania the current treatment remains interferon plus ribavirin. First generation viral protease inhibitors (i.e. boceprevir, telaprevir), which have raised the chances of obtaining viral clearance in up to 70% of infection cases produced by genotype 1 isolates, have not been introduced yet as standard treatment in our country. The success of these new antivirals is limited by the occurrence and selection of resistance mutations during therapy. We set-up a molecular study aiming to detect any resistance mutations to boceprevir and telaprevir harbored by hepatitis C isolates infecting Romanian patients naïve to viral protease inhibitors. Since these new antivirals are efficient and approved for genotype 1 infection, viral samples were genotyped following a protocol previously developed by our research group. We analyzed by both population sequencing and molecular cloning and sequencing the NS3 protease region of hepatitis C virus isolates infecting patients which were not previously exposed to boceprevir and telaprevir. All the analyzed samples were subtype 1b and resembled the samples collected in recent years from Romanian patients. Molecular cloning followed by sequencing showed great intra-host diversity, which is known to represent the source of isolates with different resistance phenotypes. Both population sequencing and molecular cloning followed by clone sequencing revealed two boceprevir resistance mutations (T54S and V55A), respectively, a telaprevir resistance mutation (T54S) in the sequences obtained from a patient with chronic hepatitis C. To our knowledge, this is the first study indicating the existence of pre-treatment resistance mutations to boceprevir and telaprevir in hepatitis C virus isolates infecting Romanian patients.

The Chapel Hill hemophilia A dog colony exhibits a factor VIII gene inversion

PubMed Central

Lozier, Jay N.; Dutra, Amalia; Pak, Evgenia; Zhou, Nan; Zheng, Zhili; Nichols, Timothy C.; Bellinger, Dwight A.; Read, Marjorie; Morgan, Richard A.

2002-01-01

In the Chapel Hill colony of factor VIII-deficient dogs, abnormal sequence (ch8, for canine hemophilia 8, GenBank no. AF361485) follows exons 1–22 in the factor VIII transcript in place of exons 23–26. The canine hemophilia 8 locus (ch8) sequence was found in a 140-kb normal dog genomic DNA bacterial artificial chromosome (BAC) clone that was completely outside the factor VIII gene, but not in BAC clones containing the factor VIII gene. The BAC clone that contained ch8 also contained a homologue of F8A (factor 8 associated) sequence, which participates in a common inversion that causes severe hemophilia A in humans. Fluorescence in situ hybridization analysis indicated that exons 1–26 normally proceed sequentially from telomere to centromere at Xq28, and ch8 is telomeric to the factor VIII gene. The appearance of an “upstream” genomic sequence element (ch8) at the end of the aberrant factor VIII transcript suggested that an inversion of genomic DNA replaced factor VIII exons 22–26 with ch8. The F8A sequence appeared also in overlapping normal BAC clones containing factor VIII sequence. We hypothesized that homologous recombination between copies of canine F8A inside and outside the factor VIII gene had occurred, as in human hemophilia A. High-resolution fluorescent in situ hybridization on hemophilia A dog DNA revealed a pattern consistent with this inversion mechanism. We also identified a HindIII restriction fragment length polymorphism of F8A fragments that distinguished hemophilia A, carrier, and normal dogs' DNA. The Chapel Hill hemophilia A dog colony therefore replicates the factor VIII gene inversion commonly seen in humans with severe hemophilia A. PMID:12242334

Ageratum enation virus-a begomovirus of weeds with the potential to infect crops.

PubMed

Tahir, Muhammad; Amin, Imran; Haider, Muhammad Saleem; Mansoor, Shahid; Briddon, Rob W

2015-02-10

Samples of two Ageratum conyzoides, one Sonchus oleraceus and one turnip (Brassica rapa var. rapa) exhibiting virus-like symptoms were collected from Pakistan and Nepal. Full-length begomovirus clones were obtained from the four plant samples and betasatellite clones from three of these. The begomovirus sequences were shown to be isolates of Ageratum enation virus (AEV) with greater than 89.1% nucleotide sequence identity to the 26 AEV sequences available in the databases. The three betasatellite sequences were shown to be isolates of Ageratum yellow leaf curl betasatellite (AYLCB) with greater than 90% identity to the 18 AYLCB sequences available in the databases. The AEV sequences were shown to fall into two distinct strains, for which the names Nepal (consisting of isolates from Nepal, India, and Pakistan-including the isolates identified here) and India (isolates occurring only in India) strains are proposed. For the clones obtained from two AEV isolates, with their AYLCB, infectivity was shown by Agrobacterium-mediated inoculation to Nicotiana benthamiana, N. tabacum, Solanum lycopersicon and A. conyzoides. N. benthamiana plants infected with AEV alone or betasatellite alone showed no symptoms. N. benthamiana plants infected with AEV with its associated betasatellite showed leaf curl symptoms. The findings show that AEV is predominantly a virus of weeds that has the capacity to infect crops. AYLCB appears to be the common partner betasatellite of AEV and is associated with diseases with a range of very different symptoms in the same plant species. The inability to satisfy Koch's postulates with the cloned components of isolate SOL in A. conyzoides suggests that the etiology may be more complex than a single virus with a single betasatellite.

Ageratum enation virus—A Begomovirus of Weeds with the Potential to Infect Crops

PubMed Central

Tahir, Muhammad; Amin, Imran; Haider, Muhammad Saleem; Mansoor, Shahid; Briddon, Rob W.

2015-01-01

Samples of two Ageratum conyzoides, one Sonchus oleraceus and one turnip (Brassica rapa var. rapa) exhibiting virus-like symptoms were collected from Pakistan and Nepal. Full-length begomovirus clones were obtained from the four plant samples and betasatellite clones from three of these. The begomovirus sequences were shown to be isolates of Ageratum enation virus (AEV) with greater than 89.1% nucleotide sequence identity to the 26 AEV sequences available in the databases. The three betasatellite sequences were shown to be isolates of Ageratum yellow leaf curl betasatellite (AYLCB) with greater than 90% identity to the 18 AYLCB sequences available in the databases. The AEV sequences were shown to fall into two distinct strains, for which the names Nepal (consisting of isolates from Nepal, India, and Pakistan—including the isolates identified here) and India (isolates occurring only in India) strains are proposed. For the clones obtained from two AEV isolates, with their AYLCB, infectivity was shown by Agrobacterium-mediated inoculation to Nicotiana benthamiana, N. tabacum, Solanum lycopersicon and A. conyzoides. N. benthamiana plants infected with AEV alone or betasatellite alone showed no symptoms. N. benthamiana plants infected with AEV with its associated betasatellite showed leaf curl symptoms. The findings show that AEV is predominantly a virus of weeds that has the capacity to infect crops. AYLCB appears to be the common partner betasatellite of AEV and is associated with diseases with a range of very different symptoms in the same plant species. The inability to satisfy Koch’s postulates with the cloned components of isolate SOL in A. conyzoides suggests that the etiology may be more complex than a single virus with a single betasatellite. PMID:25674770