Sample records for close sequence similarity

  1. Marker genes that are less conserved in their sequences are useful for predicting genome-wide similarity levels between closely related prokaryotic strains

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lan, Yemin; Rosen, Gail; Hershberg, Ruth

    The 16s rRNA gene is so far the most widely used marker for taxonomical classification and separation of prokaryotes. Since it is universally conserved among prokaryotes, it is possible to use this gene to classify a broad range of prokaryotic organisms. At the same time, it has often been noted that the 16s rRNA gene is too conserved to separate between prokaryotes at finer taxonomic levels. In this paper, we examine how well levels of similarity of 16s rRNA and 73 additional universal or nearly universal marker genes correlate with genome-wide levels of gene sequence similarity. We demonstrate that themore » percent identity of 16s rRNA predicts genome-wide levels of similarity very well for distantly related prokaryotes, but not for closely related ones. In closely related prokaryotes, we find that there are many other marker genes for which levels of similarity are much more predictive of genome-wide levels of gene sequence similarity. Finally, we show that the identities of the markers that are most useful for predicting genome-wide levels of similarity within closely related prokaryotic lineages vary greatly between lineages. However, the most useful markers are always those that are least conserved in their sequences within each lineage. In conclusion, our results show that by choosing markers that are less conserved in their sequences within a lineage of interest, it is possible to better predict genome-wide gene sequence similarity between closely related prokaryotes than is possible using the 16s rRNA gene. We point readers towards a database we have created (POGO-DB) that can be used to easily establish which markers show lowest levels of sequence conservation within different prokaryotic lineages.« less

  2. Marker genes that are less conserved in their sequences are useful for predicting genome-wide similarity levels between closely related prokaryotic strains

    DOE PAGES

    Lan, Yemin; Rosen, Gail; Hershberg, Ruth

    2016-05-03

    The 16s rRNA gene is so far the most widely used marker for taxonomical classification and separation of prokaryotes. Since it is universally conserved among prokaryotes, it is possible to use this gene to classify a broad range of prokaryotic organisms. At the same time, it has often been noted that the 16s rRNA gene is too conserved to separate between prokaryotes at finer taxonomic levels. In this paper, we examine how well levels of similarity of 16s rRNA and 73 additional universal or nearly universal marker genes correlate with genome-wide levels of gene sequence similarity. We demonstrate that themore » percent identity of 16s rRNA predicts genome-wide levels of similarity very well for distantly related prokaryotes, but not for closely related ones. In closely related prokaryotes, we find that there are many other marker genes for which levels of similarity are much more predictive of genome-wide levels of gene sequence similarity. Finally, we show that the identities of the markers that are most useful for predicting genome-wide levels of similarity within closely related prokaryotic lineages vary greatly between lineages. However, the most useful markers are always those that are least conserved in their sequences within each lineage. In conclusion, our results show that by choosing markers that are less conserved in their sequences within a lineage of interest, it is possible to better predict genome-wide gene sequence similarity between closely related prokaryotes than is possible using the 16s rRNA gene. We point readers towards a database we have created (POGO-DB) that can be used to easily establish which markers show lowest levels of sequence conservation within different prokaryotic lineages.« less

  3. Lactobacillus cypricasei Lawson et al. 2001 is a later heterotypic synonym of Lactobacillus acidipiscis Tanasupawat et al. 2000.

    PubMed

    Naser, Sabri M; Vancanneyt, Marc; Hoste, Bart; Snauwaert, Cindy; Swings, Jean

    2006-07-01

    The applicability of a multilocus sequence analysis (MLSA)-based identification system for lactobacilli was evaluated. Two housekeeping genes that code for the phenylalanyl-tRNA synthase alpha-subunit (pheS) and RNA polymerase alpha-subunit (rpoA) were sequenced and analysed for members of the Lactobacillus salivarius species group. The type strains of Lactobacillus acidipiscis and Lactobacillus cypricasei were investigated further using a third gene that encodes the alpha-subunit of ATP synthase (atpA). The MLSA data revealed close relatedness between L. acidipiscis and L. cypricasei, with 99.8-100 % pheS, rpoA and atpA gene sequence similarities. Comparison of the 16S rRNA gene sequences of the type strains of the two species confirmed the close relatedness (99.8 % gene sequence similarity) between the two taxa. Similar phenotypes and high DNA-DNA binding values in the range of 84 to 97.5 % confirmed that L. acidipiscis and L. cypricasei are synonymous species. On the basis of the present study, it is proposed that Lactobacillus cypricasei is a later heterotypic synonym of Lactobacillus acidipiscis.

  4. A plasma membrane sucrose-binding protein that mediates sucrose uptake shares structural and sequence similarity with seed storage proteins but remains functionally distinct.

    PubMed

    Overvoorde, P J; Chao, W S; Grimes, H D

    1997-06-20

    Photoaffinity labeling of a soybean cotyledon membrane fraction identified a sucrose-binding protein (SBP). Subsequent studies have shown that the SBP is a unique plasma membrane protein that mediates the linear uptake of sucrose in the presence of up to 30 mM external sucrose when ectopically expressed in yeast. Analysis of the SBP-deduced amino acid sequence indicates it lacks sequence similarity with other known transport proteins. Data presented here, however, indicate that the SBP shares significant sequence and structural homology with the vicilin-like seed storage proteins that organize into homotrimers. These similarities include a repeated sequence that forms the basis of the reiterated domain structure characteristic of the vicilin-like protein family. In addition, analytical ultracentrifugation and nonreducing SDS-polyacrylamide gel electrophoresis demonstrate that the SBP appears to be organized into oligomeric complexes with a Mr indicative of the existence of SBP homotrimers and homodimers. The structural similarity shared by the SBP and vicilin-like proteins provides a novel framework to explore the mechanistic basis of SBP-mediated sucrose uptake. Expression of the maize Glb protein (a vicilin-like protein closely related to the SBP) in yeast demonstrates that a closely related vicilin-like protein is unable to mediate sucrose uptake. Thus, despite sequence and structural similarities shared by the SBP and the vicilin-like protein family, the SBP is functionally divergent from other members of this group.

  5. [Phylogenetic relationships among the genera of Taxodiaceae and Cupressaceae from 28S rDNA sequences].

    PubMed

    Li, Chun-Xiang; Yang, Qun

    2003-03-01

    DNA sequences from 28S rDNA were used to assess relationships between and within traditional Taxodiaceae and Cupressaceae s.s. The MP tree and NJ tree generally are similar to one another. The results show that Taxodiaceae and Cupressaceae s.s. form a monophyletic conifer lineage excluding Sciadopitys. In the Taxodiaceae-Cupressaceae s.s. monophyletic group, the Taxodiaceae is paraphyletic. Taxodium, Glyptostrobus and Cryptomeria forming a clade(Taxodioideae), in which Glyptostrobus and Taxodium are closely related and sister to Cryptomeria; Sequoia, Sequoiadendron and Metasequoia are closely related to each other, forming another clade (Sequoioideae), in which Sequoia and Sequoiadendron are closely related and sister to Metasequoia; the seven genera of Cupressaceae s.s. are found to be closely related to form a monophyletic lineage (Cupressoideae). These results are basically similar to analyses from chloroplast gene data. But the relationships among Taiwania, Sequoioideae, Taxodioideae, and Cupressoideae remain unclear because of the slow evolution rate of 28S rDNA, which might best be answered by sequencing more rapidly evolving nuclear genes.

  6. How close is close: 16S rRNA sequence identity may not be sufficient to guarantee species identity

    NASA Technical Reports Server (NTRS)

    Fox, G. E.; Wisotzkey, J. D.; Jurtshuk, P. Jr

    1992-01-01

    16S rRNA (genes coding for rRNA) sequence comparisons were conducted with the following three psychrophilic strains: Bacillus globisporus W25T (T = type strain) and Bacillus psychrophilus W16AT, and W5. These strains exhibited more than 99.5% sequence identity and within experimental uncertainty could be regarded as identical. Their close taxonomic relationship was further documented by phenotypic similarities. In contrast, previously published DNA-DNA hybridization results have convincingly established that these strains do not belong to the same species if current standards are used. These results emphasize the important point that effective identity of 16S rRNA sequences is not necessarily a sufficient criterion to guarantee species identity. Thus, although 16S rRNA sequences can be used routinely to distinguish and establish relationships between genera and well-resolved species, very recently diverged species may not be recognizable.

  7. Bacillus Strains Most Closely Related to Bacillus nealsonii Are Not Effectively Circumscribed within the Taxonomic Species Definition

    PubMed Central

    Peak, K. Kealy; Duncan, Kathleen E.; Luna, Vicki A.; King, Debra S.; McCarthy, Peter J.; Cannons, Andrew C.

    2011-01-01

    Bacillus strains with >99.7% 16S rRNA gene sequence similarity were characterized with DNA:DNA hybridization, cellular fatty acid (CFA) analysis, and testing of 100 phenotypic traits. When paired with the most closely related type strain, percent DNA:DNA similarities (% S) for six Bacillus strains were all far below the recommended 70% threshold value for species circumscription with Bacillus nealsonii. An apparent genomic group of four Bacillus strain pairings with 94%–70% S was contradicted by the failure of the strains to cluster in CFA- and phenotype-based dendrograms as well as by their differentiation with 9–13 species level discriminators such as nitrate reduction, temperature range, and acid production from carbohydrates. The novel Bacillus strains were monophyletic and very closely related based on 16S rRNA gene sequence. Coherent genomic groups were not however supported by similarly organized phenotypic clusters. Therefore, the strains were not effectively circumscribed within the taxonomic species definition. PMID:22046187

  8. CREB expression in the brains of two closely related parasitic wasp species that differ in long-term memory formation.

    PubMed

    van den Berg, M; Verbaarschot, P; Hontelez, S; Vet, L E M; Dicke, M; Smid, H M

    2010-06-01

    The cAMP/PKA signalling pathway and transcription factor cAMP response element-binding protein (CREB) play key roles in long-term memory (LTM) formation. We used two closely related parasitic wasp species, Cotesia glomerata and Cotesia rubecula, which were previously shown to be different in LTM formation, and sequenced at least nine different CREB transcripts in both wasp species. The splicing patterns, functional domains and amino acid sequences were similar to those found in the CREB genes of other organisms. The predicted amino acid sequences of the CREB isoforms were identical in both wasp species. Using real-time quantitative PCR we found that two low abundant CREB transcripts are differentially expressed in the two wasps, whereas the expression levels of high abundant transcripts are similar.

  9. Dynamics of actin evolution in dinoflagellates.

    PubMed

    Kim, Sunju; Bachvaroff, Tsvetan R; Handy, Sara M; Delwiche, Charles F

    2011-04-01

    Dinoflagellates have unique nuclei and intriguing genome characteristics with very high DNA content making complete genome sequencing difficult. In dinoflagellates, many genes are found in multicopy gene families, but the processes involved in the establishment and maintenance of these gene families are poorly understood. Understanding the dynamics of gene family evolution in dinoflagellates requires comparisons at different evolutionary scales. Studies of closely related species provide fine-scale information relative to species divergence, whereas comparisons of more distantly related species provides broad context. We selected the actin gene family as a highly expressed conserved gene previously studied in dinoflagellates. Of the 142 sequences determined in this study, 103 were from the two closely related species, Dinophysis acuminata and D. caudata, including full length and partial cDNA sequences as well as partial genomic amplicons. For these two Dinophysis species, at least three types of sequences could be identified. Most copies (79%) were relatively similar and in nucleotide trees, the sequences formed two bushy clades corresponding to the two species. In comparisons within species, only eight to ten nucleotide differences were found between these copies. The two remaining types formed clades containing sequences from both species. One type included the most similar sequences in between-species comparisons with as few as 12 nucleotide differences between species. The second type included the most divergent sequences in comparisons between and within species with up to 93 nucleotide differences between sequences. In all the sequences, most variation occurred in synonymous sites or the 5' UnTranslated Region (UTR), although there was still limited amino acid variation between most sequences. Several potential pseudogenes were found (approximately 10% of all sequences depending on species) with incomplete open reading frames due to frameshifts or early stop codons. Overall, variation in the actin gene family fits best with the "birth and death" model of evolution based on recent duplications, pseudogenes, and incomplete lineage sorting. Divergence between species was similar to variation within species, so that actin may be too conserved to be useful for phylogenetic estimation of closely related species.

  10. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cang, Zixuan; Mu, Lin; Wu, Kedi

    Here, protein function and dynamics are closely related to its sequence and structure. However, prediction of protein function and dynamics from its sequence and structure is still a fundamental challenge in molecular biology. Protein classification, which is typically done through measuring the similarity between proteins based on protein sequence or physical information, serves as a crucial step toward the understanding of protein function and dynamics.

  11. The complete mitochondrial genome of the Anabas testudineus (Perciformes, Anabantidae) and its comparison with other related fish species.

    PubMed

    Behera, Bijay Kumar; Baisvar, Vishwamitra Singh; Kumari, Kavita; Rout, Ajaya Kumar; Pakrashi, Sudip; Paria, Prasenjet; Rao, A R; Rai, Anil

    2017-03-01

    In the present study, the complete mitochondrial genome sequence of Anabas testudineusis reported using PGM sequencer (Ion Torrent, Life Technologies, La Jolla, CA). The complete mitogenome of climbing perch, A. testudineusis obtained by the de novo sequences assembly of genomic reads using the Torrent Mapping Alignment Program (TMAP), which is 16 603 bp in length. The mitogenome of A. testudineus composed of 13 protein- coding genes, two rRNA, and 22 tRNAs. Here, 20 tRNAs genes showed typical clover leaf model, and D-Loop as the control region along with gene order and organization, being closely similar to Osphronemidae and most of other Perciformes fish mitogenomes of NCBI databases. The mitogenome in the present study has 99% similarity to the complete mitogenome sequence of earlier reported A. testudineus. The phylogenetic analysis of Anabantidae depicted that their mitogenomes are closely related to each other. The complete mitogenome sequence of A. testudineus would be helpful in understanding the population genetics, phylogenetics, and evolution of Anabantidae.

  12. A topological approach for protein classification

    DOE PAGES

    Cang, Zixuan; Mu, Lin; Wu, Kedi; ...

    2015-11-04

    Here, protein function and dynamics are closely related to its sequence and structure. However, prediction of protein function and dynamics from its sequence and structure is still a fundamental challenge in molecular biology. Protein classification, which is typically done through measuring the similarity between proteins based on protein sequence or physical information, serves as a crucial step toward the understanding of protein function and dynamics.

  13. BLAST and FASTA similarity searching for multiple sequence alignment.

    PubMed

    Pearson, William R

    2014-01-01

    BLAST, FASTA, and other similarity searching programs seek to identify homologous proteins and DNA sequences based on excess sequence similarity. If two sequences share much more similarity than expected by chance, the simplest explanation for the excess similarity is common ancestry-homology. The most effective similarity searches compare protein sequences, rather than DNA sequences, for sequences that encode proteins, and use expectation values, rather than percent identity, to infer homology. The BLAST and FASTA packages of sequence comparison programs provide programs for comparing protein and DNA sequences to protein databases (the most sensitive searches). Protein and translated-DNA comparisons to protein databases routinely allow evolutionary look back times from 1 to 2 billion years; DNA:DNA searches are 5-10-fold less sensitive. BLAST and FASTA can be run on popular web sites, but can also be downloaded and installed on local computers. With local installation, target databases can be customized for the sequence data being characterized. With today's very large protein databases, search sensitivity can also be improved by searching smaller comprehensive databases, for example, a complete protein set from an evolutionarily neighboring model organism. By default, BLAST and FASTA use scoring strategies target for distant evolutionary relationships; for comparisons involving short domains or queries, or searches that seek relatively close homologs (e.g. mouse-human), shallower scoring matrices will be more effective. Both BLAST and FASTA provide very accurate statistical estimates, which can be used to reliably identify protein sequences that diverged more than 2 billion years ago.

  14. eShadow: A tool for comparing closely related sequences

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ovcharenko, Ivan; Boffelli, Dario; Loots, Gabriela G.

    2004-01-15

    Primate sequence comparisons are difficult to interpret due to the high degree of sequence similarity shared between such closely related species. Recently, a novel method, phylogenetic shadowing, has been pioneered for predicting functional elements in the human genome through the analysis of multiple primate sequence alignments. We have expanded this theoretical approach to create a computational tool, eShadow, for the identification of elements under selective pressure in multiple sequence alignments of closely related genomes, such as in comparisons of human to primate or mouse to rat DNA. This tool integrates two different statistical methods and allows for the dynamic visualizationmore » of the resulting conservation profile. eShadow also includes a versatile optimization module capable of training the underlying Hidden Markov Model to differentially predict functional sequences. This module grants the tool high flexibility in the analysis of multiple sequence alignments and in comparing sequences with different divergence rates. Here, we describe the eShadow comparative tool and its potential uses for analyzing both multiple nucleotide and protein alignments to predict putative functional elements. The eShadow tool is publicly available at http://eshadow.dcode.org/« less

  15. Whole genome sequences of the raspberry and strawberry pathogens Phytophthora rubi and P. fragariae

    USDA-ARS?s Scientific Manuscript database

    Phytophthora rubi and P. fragariae are two closely related oomycete plant pathogens that exhibit strong morphological and physiological similarities, but are specialized to infect different hosts of economic importance, namely raspberry and strawberry. Here, we report the draft genome sequences of t...

  16. Tachyon search speeds up retrieval of similar sequences by several orders of magnitude.

    PubMed

    Tan, Joshua; Kuchibhatla, Durga; Sirota, Fernanda L; Sherman, Westley A; Gattermayer, Tobias; Kwoh, Chia Yee; Eisenhaber, Frank; Schneider, Georg; Maurer-Stroh, Sebastian

    2012-06-15

    The usage of current sequence search tools becomes increasingly slower as databases of protein sequences continue to grow exponentially. Tachyon, a new algorithm that identifies closely related protein sequences ~200 times faster than standard BLAST, circumvents this limitation with a reduced database and oligopeptide matching heuristic. The tool is publicly accessible as a webserver at http://tachyon.bii.a-star.edu.sg and can also be accessed programmatically through SOAP.

  17. Mouse Vk gene classification by nucleic acid sequence similarity.

    PubMed

    Strohal, R; Helmberg, A; Kroemer, G; Kofler, R

    1989-01-01

    Analyses of immunoglobulin (Ig) variable (V) region gene usage in the immune response, estimates of V gene germline complexity, and other nucleic acid hybridization-based studies depend on the extent to which such genes are related (i.e., sequence similarity) and their organization in gene families. While mouse Igh heavy chain V region (VH) gene families are relatively well-established, a corresponding systematic classification of Igk light chain V region (Vk) genes has not been reported. The present analysis, in the course of which we reviewed the known extent of the Vk germline gene repertoire and Vk gene usage in a variety of responses to foreign and self antigens, provides a classification of mouse Vk genes in gene families composed of members with greater than 80% overall nucleic acid sequence similarity. This classification differed in several aspects from that of VH genes: only some Vk gene families were as clearly separated (by greater than 25% sequence dissimilarity) as typical VH gene families; most Vk gene families were closely related and, in several instances, members from different families were very similar (greater than 80%) over large sequence portions; frequently, classification by nucleic acid sequence similarity diverged from existing classifications based on amino-terminal protein sequence similarity. Our data have implications for Vk gene analyses by nucleic acid hybridization and describe potentially important differences in sequence organization between VH and Vk genes.

  18. Phylogenetic characterization of Canine Parvovirus VP2 partial sequences from symptomatic dogs samples.

    PubMed

    Zienius, D; Lelešius, R; Kavaliauskis, H; Stankevičius, A; Šalomskas, A

    2016-01-01

    The aim of the present study was to detect canine parvovirus (CPV) from faecal samples of clinically ill domestic dogs by polymerase chain reaction (PCR) followed by VP2 gene partial sequencing and molecular characterization of circulating strains in Lithuania. Eleven clinically and antigen-tested positive dog faecal samples, collected during the period of 2014-2015, were investigated by using PCR. The phylogenetic investigations indicated that the Lithuanian CPV VP2 partial sequences (3025-3706 cds) were closely related and showed 99.0-99.9% identity. All Lithuanian sequences were associated with one phylogroup, but grouped in different clusters. Ten of investigated Lithuanian CPV VP2 sequences were closely associated with CPV 2a antigenic variant (99.4% nt identity). Five CPV VP2 sequences from Lithuania were related to CPV-2a, but were rather divergent (6.8 nt differences). Only one CPV VP2 sequence from Lithuania was associated (99.3% nt identity) with CPV-2b VP2 sequences from France, Italy, USA and Korea. The four of eleven investigated Lithuanian dogs with CPV infection symptoms were vaccinated with CPV-2 vaccine, but their VP2 sequences were phylogenetically distantly associated with CPV vaccine strains VP2 sequences (11.5-15.8 nt differences). Ten Lithuanian CPV VP2 sequences had monophyletic relations among the close geographically associated samples, but five of them were rather divergent (1.0% less sequence similarity). The one Lithuanian CPV VP2 sequence was closely related with CPV-2b antigenic variant. All the Lithuanian CPV VP2 partial sequences were conservative and phylogenetically low associated with most commonly used CPV vaccine strains.

  19. Sequencing of the needle transcriptome from Norway spruce (Picea abies Karst L.) reveals lower substitution rates, but similar selective constraints in gymnosperms and angiosperms

    PubMed Central

    2012-01-01

    Background A detailed knowledge about spatial and temporal gene expression is important for understanding both the function of genes and their evolution. For the vast majority of species, transcriptomes are still largely uncharacterized and even in those where substantial information is available it is often in the form of partially sequenced transcriptomes. With the development of next generation sequencing, a single experiment can now simultaneously identify the transcribed part of a species genome and estimate levels of gene expression. Results mRNA from actively growing needles of Norway spruce (Picea abies) was sequenced using next generation sequencing technology. In total, close to 70 million fragments with a length of 76 bp were sequenced resulting in 5 Gbp of raw data. A de novo assembly of these reads, together with publicly available expressed sequence tag (EST) data from Norway spruce, was used to create a reference transcriptome. Of the 38,419 PUTs (putative unique transcripts) longer than 150 bp in this reference assembly, 83.5% show similarity to ESTs from other spruce species and of the remaining PUTs, 3,704 show similarity to protein sequences from other plant species, leaving 4,167 PUTs with limited similarity to currently available plant proteins. By predicting coding frames and comparing not only the Norway spruce PUTs, but also PUTs from the close relatives Picea glauca and Picea sitchensis to both Pinus taeda and Taxus mairei, we obtained estimates of synonymous and non-synonymous divergence among conifer species. In addition, we detected close to 15,000 SNPs of high quality and estimated gene expression differences between samples collected under dark and light conditions. Conclusions Our study yielded a large number of single nucleotide polymorphisms as well as estimates of gene expression on transcriptome scale. In agreement with a recent study we find that the synonymous substitution rate per year (0.6 × 10−09 and 1.1 × 10−09) is an order of magnitude smaller than values reported for angiosperm herbs. However, if one takes generation time into account, most of this difference disappears. The estimates of the dN/dS ratio (non-synonymous over synonymous divergence) reported here are in general much lower than 1 and only a few genes showed a ratio larger than 1. PMID:23122049

  20. [Detection and diversity analysis of rumen methanogens in the co-cultures with anaerobic fungi].

    PubMed

    Cheng, Yan-fen; Mao, Sheng-yong; Pei, Cai-xia; Liu, Jian-xin; Zhu, Wei-yun

    2006-12-01

    Rumen methanogen diversity in the co-cultures with anaerobic fungi from goat rumen was analyzed. Mix-cultures of anaerobic fungi and methanogens were obtained from goat rumen using anaerobic fungal medium and the addition of penicillin and streptomycin and then subcultured 62 times by transferring cultures every 3 - 4d. Total DNA from the original rumen fluid and subcultured fungal cultures was used for PCR/DGGE and RFLP analysis. 16S rDNA of clones corresponding to representative OTUs were sequenced. Results showed that the diversity index (Shannon index) of the methanogens generated from DGGE profiles reduced from 1.32 to 0.99 from rumen fluid to fungal culture after 45 subculturing, with the lowest similarity of DGGE profiles at 34.7%. The Shannon index increased from 0.99 to 1.15 from the fungal culture after 45 subculturing to that after 62 subculturing, with the lowest similarity at 89.2% . A total of 5 OTUs were obtained from 69. clones using RFLP analysis and six clones representing the 5 OTUs respectively were sequenced. Of the 5 OTUs, three had their cloned 16S rDNA sequences most closely related to uncultured archaeal symbiont PA202 with the same similarity of 95 %, but had not closely related to any identified culturable methanogen. The rest two OTUs had their cloned 16S rDNA sequences sharing the same closest relative, uncultured rumen methanogen 956, with the same similarity of 97% .Their 16S rDNA sequences of these two OTUs also showed 97% similar to the closest identified culturable methanogen Methanobrevibacter sp. NT7. In conclusion, diverse yet unidentified rumen methanogen species exist in the co-cultures with anaerobic fungi isolated from the goat rumen.

  1. Isolation and sequence analysis of a novel rhesus macaque foamy virus isolate with a serotype-1-like env.

    PubMed

    Ensser, Armin; Großkopf, Anna K; Mätz-Rensing, Kerstin; Roos, Christian; Hahn, Alexander S

    2018-06-02

    SFVmmu-DPZ9524 represents the third completely sequenced rhesus macaque simian foamy virus (SFV) isolate, alongside SFVmmu_K3T with a similar SFV-1-type env, and R289HybAGM with a SFV-2-like env. Sequence analysis demonstrates that, in gag and pol, SFVmmu-DPZ9524 is more closely related to R289HybAGM than to SFVmmu_K3T, which, outside of env, is more similar to a Japanese macaque isolate than to the other two rhesus macaque isolates SFVmmu-DPZ9524 and R289HybAGM. Further, we identify bel as another recombinant locus in R289HybAGM, confirming that recombination contributes to sequence diversity in SFV.

  2. Comparative analysis of chloroplast genomes of the genus Citrus and its close relatives.

    PubMed

    Liu, Xiaogang; Wu, Hongkun; Luo, Yan; Xi, Wanpeng; Zhou, Zhiqin

    2017-01-01

    The genus Citrus and its close relatives are economically and nutritionally important fruit trees. However, the huge controversy over the phylogeny of key wild species, as well as the genetic relationship between the cultivated species and their putative wild progenitors, remains unresolved. Comparative analyses of chloroplast (cp) genomes have been useful in resolving various phylogenetic issues. Thus far, the cp genomes of only two Citrus species have been sequenced. In this study, we sequenced six complete cp genomes, four belonging to the genus Citrus, and two belonging to the genera Fortunella and Poncirus, respectively. These newly sequenced genomes together with the two publicly available were used for comparative analyses of the genus Citrus and its close relatives. All eight cp genomes share similar basic structure, gene order and gene content. Phylogenetic analyses supported the monophyly of the three genera in the order Sapindales within the major clade Malvidae.

  3. The complete nucleotide sequence of RNA 3 of a peach isolate of Prunus necrotic ringspot virus.

    PubMed

    Hammond, R W; Crosslin, J M

    1995-04-01

    The complete nucleotide sequence of RNA 3 of the PE-5 peach isolate of Prunus necrotic ringspot ilarvirus (PNRSV) was obtained from cloned cDNA. The RNA sequence is 1941 nucleotides and contains two open reading frames (ORFs). ORF 1 consisted of 284 amino acids with a calculated molecular weight of 31,729 Da and ORF 2 contained 224 amino acids with a calculated molecular weight of 25,018 Da. ORF 2 corresponds to the coat protein gene. Expression of ORF 2 engineered into a pTrcHis vector in Escherichia coli results in a fusion polypeptide of approximately 28 kDa which cross-reacts with PNRSV polyclonal antiserum. Analysis of the coat protein amino acid sequence reveals a putative "zinc-finger" domain at the amino-terminal portion of the protein. Two tetranucleotide AUGC motifs occur in the 3'-UTR of the RNA and may function in coat protein binding and genome activation. ORF 1 homologies to other ilarviruses and alfalfa mosaic virus are confined to limited regions of conserved amino acids. The translated amino acid sequence of the coat protein gene shows 92% similarity to one isolate of apple mosaic virus, a closely related member of the ilarvirus group of plant viruses, but only 66% similarity to the amino acid sequence of the coat protein gene of a second isolate. These relationships are also reflected at the nucleotide sequence level. These results in one instance confirm the close similarities observed at the biophysical and serological levels between these two viruses, but on the other hand call into question the nomenclature used to describe these viruses.

  4. Complete mitochondrial genome sequence of Indian medium carp, Labeo gonius (Hamilton, 1822) and its comparison with other related carp species.

    PubMed

    Behera, Bijay Kumar; Kumari, Kavita; Baisvar, Vishwamitra Singh; Rout, Ajaya Kumar; Pakrashi, Sudip; Paria, Prasenjet; Jena, J K

    2017-01-01

    In the present study, the complete mitochondrial genome sequence of Labeo gonius is reported using PGM sequencer (Ion Torrent). The complete mitogenome of L. gonius is obtained by the de novo sequences assembly of genomic reads using the Torrent Mapping Alignment Program (TMAP) which is 16 614 bp in length. The mitogenome of L. gonius comprised of 13 protein-coding genes, 22 tRNAs, 2 rRNA genes, and D-loop as control region along with gene order and organization, being similar to most of other fish mitogenomes of NCBI databases. The mitogenome in the present study has 99% similarity to the complete mitogenome sequence of Labeo fimbriatus, as reported earlier. The phylogenetic analysis of Cypriniformes depicted that their mitogenomes are closely related to each other. The complete mitogenome sequence of L. gonius would be helpful in understanding the population genetics, phylogenetics, and evolution of Indian Carps.

  5. Functional organization of a single nif cluster in the mesophilic archaeon Methanosarcina mazei strain Gö1

    PubMed Central

    Ehlers, Claudia; Veit, Katharina; Gottschalk, Gerhard; Schmitz, Ruth A.

    2002-01-01

    The mesophilic methanogenic archaeon Methanosarcina mazei strain Gö1 is able to utilize molecular nitrogen (N2) as its sole nitrogen source. We have identified and characterized a single nitrogen fixation (nif) gene cluster in M. mazei Gö1 with an approximate length of 9 kbp. Sequence analysis revealed seven genes with sequence similarities to nifH, nifI1, nifI2, nifD, nifK, nifE and nifN, similar to other diazotrophic methanogens and certain bacteria such as Clostridium acetobutylicum, with the two glnB-like genes (nifI1 and nifI2) located between nifH and nifD. Phylogenetic analysis of deduced amino acid sequences for the nitrogenase structural genes of M. mazei Gö1 showed that they are most closely related to Methanosarcina barkeri nif2 genes, and also closely resemble those for the corresponding nif products of the gram-positive bacterium C. acetobutylicum. Northern blot analysis and reverse transcription PCR analysis demonstrated that the M. mazei nif genes constitute an operon transcribed only under nitrogen starvation as a single 8 kb transcript. Sequence analysis revealed a palindromic sequence at the transcriptional start site in front of the M. mazei nifH gene, which may have a function in transcriptional regulation of the nif operon. PMID:15803652

  6. Phylogeny of the ammonia-producing ruminal bacteria Peptostreptococcus anaerobius, Clostridium sticklandii, and Clostridium aminophilum sp. nov

    NASA Technical Reports Server (NTRS)

    Paster, B. J.; Russell, J. B.; Yang, C. M.; Chow, J. M.; Woese, C. R.; Tanner, R.

    1993-01-01

    In previous studies, gram-positive bacteria which grew rapidly with peptides or an amino acid as the sole energy source were isolated from bovine rumina. Three isolates, strains C, FT (T = type strain), and SR, were considered to be ecologically important since they produced up to 20-fold more ammonia than other ammonia-producing ruminal bacteria. On the basis of phenotypic criteria, the taxonomic position of these new isolates was uncertain. In this study, the 16S rRNA sequences of these isolates and related bacteria were determined to establish the phylogenetic positions of the organisms. The sequences of strains C, FT, and SR and reference strains of Peptostreptococcus anaerobius, Clostridium sticklandii, Clostridium coccoides, Clostridium aminovalericum, Acetomaculum ruminis, Clostridium leptum, Clostridium lituseburense, Clostridium acidiurici, and Clostridium barkeri were determined by using a modified Sanger dideoxy chain termination method. Strain C, a large coccus purported to belong to the genus Peptostreptococcus, was closely related to P. anaerobius, with a level of sequence similarity of 99.6%. Strain SR, a heat-resistant, short, rod-shaped organism, was closely related to C. sticklandii, with a level of sequence similarity of 99.9%. However, strain FT, a heat-resistant, pleomorphic, rod-shaped organism, was only distantly related to some clostridial species and P. anaerobius. On the basis of the sequence data, it was clear that strain FT warranted designation as a separate species. The closest known relative of strain FT was C. coccoides (level of similarity, only 90.6%). Additional strains that are phenotypically similar to strain FT were isolated in this study.(ABSTRACT TRUNCATED AT 250 WORDS).

  7. Acetylcholinesterase of Rhipicephalus (Boophilus) microplus and Phlebotomus papatasi: Gene Identification, Expression, and Biochemical Properties of Recombinant Proteins

    DTIC Science & Technology

    2013-01-01

    predicted amino acid sequences of the three encoded BmAChEs were no more closely related to one another than AChEs from different organisms and their...solely on nucleotide and amino acid sequence similarity; however, the cholinesterase gene family contains a number of related enzymes and structural...acetylcholinesterase of P. papatasi was cloned, sequenced , and expressed in the baculo- virus system to generate a recombinant enzyme for biochemical

  8. Biodiversity and phylogenetic analysis of culturable bacteria indigenous to Khewra salt mine of pakistan and their industrial importance

    PubMed Central

    Akhtar, Nasrin; Ghauri, Muhammad A.; Iqbal, Aamira; Anwar, Munir A.; Akhtar, Kalsoom

    2008-01-01

    Culturable bacterial biodiversity and industrial importance of the isolates indigenous to Khewra salt mine, Pakistan was assessed. PCR Amplification of 16S rDNA of isolates was carried out by using universal primers FD1 and rP1and products were sequenced commercially. These gene sequences were compared with other gene sequences in the GenBank databases to find the closely related sequences. The alignment of these sequences with sequences available from GenBank database was carried out to construct a phylogenetic tree for these bacteria. These genes were deposited to GenBank and accession numbers were obtained. Most of the isolates belonged to different species of genus Bacillus, sharing 92-99% 16S rDNA identity with the respective type strain. Other isolates had close similarities with Escherichia coli, Staphylococcus arlettae and Staphylococcus gallinarum with 97%, 98% and 99% 16S rDNA similarity respectively. The abilities of isolates to produce industrial enzymes (amylase, carboxymethylcellulase, xylanase, cellulase and protease) were checked. All isolates were tested against starch, carboxymethylcellulose (CMC), xylane, cellulose, and casein degradation in plate assays. BPT-5, 11,18,19 and 25 indicated the production of copious amounts of carbohydrates and protein degrading enzymes. Based on this study it can be concluded that Khewra salt mine is populated with diverse bacterial groups, which are potential source of industrial enzymes for commercial applications. PMID:24031194

  9. Characterization of a Novel Simian Immunodeficiency Virus (SIVmonNG1) Genome Sequence from a Mona Monkey (Cercopithecus mona)

    PubMed Central

    Barlow, Katrina L.; Ajao, Adebowale Oluwafemi; Clewley, Jonathan P.

    2003-01-01

    A novel simian immunodeficiency virus (SIV) sequence has been recovered from RNA extracted from the serum of a mona monkey (Cercopithecus mona) wild born in Nigeria. The sequence was obtained by using novel generic (degenerate) PCR primers and spans from two-thirds into the gag gene to the 3′ poly(A) tail of the SIVmonNG1 RNA genome. Analysis of the open reading frames revealed that the SIVmonNG1 genome codes for a Vpu protein, in addition to Gag, Pol, Vif, Vpr, Tat, Rev, Env, and Nef proteins. Previously, only lentiviruses infecting humans (human immunodeficiency virus type 1 [HIV-1]) and chimpanzees (SIVcpz) were known to have a vpu gene; more recently, this has also been found in SIVgsn from Cercopithecus nictitans. Overall, SIVmonNG1 most closely resembles SIVgsn: the env gene sequence groups with HIV-1/SIVcpz env sequences, whereas the pol gene sequence clusters closely with the pol sequence of SIVsyk from Cercopithecus albogaris. By bootscanning and similarity plotting, the first half of pol resembles SIVsyk, whereas the latter part is closer to SIVcol from Colobus guereza. The similarities between the complex mosaic genomes of SIVmonNG1 and SIVgsn are consistent with a shared or common lineage. These data further highlight the intricate nature of the relationships between the SIVs from different primate species and will be helpful for unraveling these associations. PMID:12768007

  10. Azospirillum zeae sp. nov., a diazotrophic bacterium isolated from rhizosphere soil of Zea mays.

    PubMed

    Mehnaz, Samina; Weselowski, Brian; Lazarovits, George

    2007-12-01

    Two free-living nitrogen-fixing bacterial strains, N6 and N7(T), were isolated from corn rhizosphere. A polyphasic taxonomic approach, including morphological characterization, Biolog analysis, DNA-DNA hybridization, and 16S rRNA, cpn60 and nifH gene sequence analysis, was taken to analyse the two strains. 16S rRNA gene sequence analysis indicated that strains N6 and N7(T) both belonged to the genus Azospirillum and were closely related to Azospirillum oryzae (98.7 and 98.8 % similarity, respectively) and Azospirillum lipoferum (97.5 and 97.6 % similarity, respectively). DNA-DNA hybridization of strains N6 and N7(T) showed reassociation values of 48 and 37 %, respectively, with A. oryzae and 43 % with A. lipoferum. Sequences of the nifH and cpn60 genes of both strains showed 99 and approximately 95 % similarity, respectively, with those of A. oryzae. Chemotaxonomic characteristics (Q-10 as quinone system, 18 : 1omega7c as major fatty acid) and G+C content of the DNA (67.6 mol%) were also similar to those of members of the genus Azospirillum. Gene sequences and Biolog and fatty acid analysis showed that strains N6 and N7(T) differed from the closely related species A. lipoferum and A. oryzae. On the basis of these results, it is proposed that these nitrogen-fixing strains represent a novel species. The name Azospirillum zeae sp. nov. is suggested, with N7(T) (=NCCB 100147(T)=LMG 23989(T)) as the type strain.

  11. An improved model for whole genome phylogenetic analysis by Fourier transform.

    PubMed

    Yin, Changchuan; Yau, Stephen S-T

    2015-10-07

    DNA sequence similarity comparison is one of the major steps in computational phylogenetic studies. The sequence comparison of closely related DNA sequences and genomes is usually performed by multiple sequence alignments (MSA). While the MSA method is accurate for some types of sequences, it may produce incorrect results when DNA sequences undergone rearrangements as in many bacterial and viral genomes. It is also limited by its computational complexity for comparing large volumes of data. Previously, we proposed an alignment-free method that exploits the full information contents of DNA sequences by Discrete Fourier Transform (DFT), but still with some limitations. Here, we present a significantly improved method for the similarity comparison of DNA sequences by DFT. In this method, we map DNA sequences into 2-dimensional (2D) numerical sequences and then apply DFT to transform the 2D numerical sequences into frequency domain. In the 2D mapping, the nucleotide composition of a DNA sequence is a determinant factor and the 2D mapping reduces the nucleotide composition bias in distance measure, and thus improving the similarity measure of DNA sequences. To compare the DFT power spectra of DNA sequences with different lengths, we propose an improved even scaling algorithm to extend shorter DFT power spectra to the longest length of the underlying sequences. After the DFT power spectra are evenly scaled, the spectra are in the same dimensionality of the Fourier frequency space, then the Euclidean distances of full Fourier power spectra of the DNA sequences are used as the dissimilarity metrics. The improved DFT method, with increased computational performance by 2D numerical representation, can be applicable to any DNA sequences of different length ranges. We assess the accuracy of the improved DFT similarity measure in hierarchical clustering of different DNA sequences including simulated and real datasets. The method yields accurate and reliable phylogenetic trees and demonstrates that the improved DFT dissimilarity measure is an efficient and effective similarity measure of DNA sequences. Due to its high efficiency and accuracy, the proposed DFT similarity measure is successfully applied on phylogenetic analysis for individual genes and large whole bacterial genomes. Copyright © 2015 Elsevier Ltd. All rights reserved.

  12. Cytogenetic evidence for asexual evolution of bdelloid rotifers.

    PubMed

    Mark Welch, Jessica L; Mark Welch, David B; Meselson, Matthew

    2004-02-10

    DNA sequencing has shown individual bdelloid rotifer genomes to contain two or more diverged copies of every gene examined and has revealed no closely similar copies. These and other findings are consistent with long-term asexual evolution of bdelloids. It is not entirely ruled out, however, that bdelloid genomes consist of previously undetected pairs of sequences so similar as to be identical over the regions sequenced, as might result if bdelloids were highly inbred sexual diploids or polyploids. Here, we employ fluorescent in situ hybridization with cosmid probes to determine the copy number and chromosomal distribution of the heat shock gene hsp82 and adjacent sequences in the bdelloid Philodina roseola. We conclude that the four copies identified by sequencing are the only ones present and that each is on a separate chromosome. Bdelloids therefore are not highly homozygous sexually reproducing diploids or polyploids.

  13. Insights Into the Etiology of Polerovirus-Induced Pepper Yellows Disease.

    PubMed

    Lotos, Leonidas; Olmos, Antonio; Orfanidou, Chrysoula; Efthimiou, Konstantinos; Avgelis, Apostolos; Katis, Nikolaos I; Maliogka, Varvara I

    2017-12-01

    The study of an emerging yellows disease of pepper crops (pepper yellows disease [PYD]) in Greece led to the identification of a polerovirus closely related to Pepper vein yellows virus (PeVYV). Recovery of its full genome sequence by next-generation sequencing of small interfering RNAs allowed its characterization as a new poleroviruses, which was provisionally named Pepper yellows virus (PeYV). Transmission experiments revealed its association with the disease. Sequence similarity and phylogenetic analysis highlighted the common ancestry of the three poleroviruses (PeVYV, PeYV, and Pepper yellow leaf curl virus [PYLCV]) currently reported to be associated with PYD, even though significant genetic differences were identified among them, especially in the C-terminal region of P5 and the 3' noncoding region. Most of the differences observed can be attributed to a modular type of evolution, which produces mosaic-like variants giving rise to these different poleroviruses Overall, similar to other polerovirus-related diseases, PYD is caused by at least three species (PeVYV, PeYV, and PYLCV) belonging to this group of closely related pepper-infecting viruses.

  14. Fingerprinting of Cyanobacteria Based on PCR with Primers Derived from Short and Long Tandemly Repeated Repetitive Sequences

    PubMed Central

    Rasmussen, Ulla; Svenning, Mette M.

    1998-01-01

    The presence of repeated DNA (short tandemly repeated repetitive [STRR] and long tandemly repeated repetitive [LTRR]) sequences in the genome of cyanobacteria was used to generate a fingerprint method for symbiotic and free-living isolates. Primers corresponding to the STRR and LTRR sequences were used in the PCR, resulting in a method which generate specific fingerprints for individual isolates. The method was useful both with purified DNA and with intact cyanobacterial filaments or cells as templates for the PCR. Twenty-three Nostoc isolates from a total of 35 were symbiotic isolates from the angiosperm Gunnera species, including isolates from the same Gunnera species as well as from different species. The results show a genetic similarity among isolates from different Gunnera species as well as a genetic heterogeneity among isolates from the same Gunnera species. Isolates which have been postulated to be closely related or identical revealed similar results by the PCR method, indicating that the technique is useful for clustering of even closely related strains. The method was applied to nonheterocystus cyanobacteria from which a fingerprint pattern was obtained. PMID:16349487

  15. Streptomyces castaneus sp. nov., a novel actinomycete isolated from the rhizosphere of Peucedanum praeruptorum Dunn.

    PubMed

    Zhou, Shuyu; Li, Zhilei; Bai, Lu; Yan, Kai; Zhao, Junwei; Lu, Chang; Liu, Chongxi; Wang, Xiangjing; Xiang, Wensheng

    2017-01-01

    During an investigation of microbial diversity in medicinal herbs, a novel actinomycete, strain NEAU-QHHV11 T was isolated from the rhizosphere of Peucedanum praeruptorum Dunn collected from Xianglu Mountain in Heilongjiang Province, northeast China and characterized using a polyphasic approach. The organism was found to have typical characteristics of the genus Streptomyces. Phylogenetic analysis based on 16S rRNA gene sequence also indicated that strain NEAU-QHHV11 T belongs to the genus Streptomyces and was most closely related to Streptomyces graminilatus NBRC 108882 T (98.7 % sequence similarity) and Streptomyces turgidiscabies NBRC 16080 T (98.7 % sequence similarity). The results of DNA-DNA hybridization and some phenotypic characteristics indicated that strain NEAU-QHHV11 T could be distinguished from its close phylogenetic relatives. Thus, strain NEAU-QHHV11 T represents a novel species of the genus Streptomyces, for which the name Streptomyces castaneus sp. nov. is proposed. The type strain is NEAU-QHHV11 T (=CGMCC 4.7235 T  = DSM 100520 T ).

  16. First insights into a type II toxin-antitoxin system from the clinical isolate Mycobacterium sp. MHSD3, similar to epsilon/zeta systems.

    PubMed

    Jaén-Luchoro, Daniel; Aliaga-Lozano, Francisco; Gomila, Rosa Maria; Gomila, Margarita; Salvà-Serra, Francisco; Lalucat, Jorge; Bennasar-Figueras, Antoni

    2017-01-01

    A putative type II toxin-antitoxin (TA) system was found in the clinical isolate Mycobacterium sp. MHSD3, a strain closely related to Mycobacterium chelonae. Further analyses of the protein sequences of the two genes revealed the presence of domains related to a TA system. BLAST analyses indicated the presence of closely related proteins in the genomes of other recently published M. chelonae strains. The functionality of both elements of the TA system was demonstrated when expressed in Escherichia coli cells, and the predicted structure of the toxin is very similar to those of well-known zeta-toxins, leading to the definition of a type II TA system similar to epsilon/zeta TA systems in strains that are closely related to M. chelonae.

  17. Phylogenetic relationships among the major lineages of the birds-of-paradise (Paradisaeidae) using mitochondrial DNA gene sequences.

    PubMed

    Nunn, G B; Cracraft, J

    1996-06-01

    Complete mitochondrial cytochrome b gene sequences were determined from 12 species of the Australo-Papuan birds-of-paradise (Paradisaeidae) representing 9 genera. Phylogenetic analysis of these and 5 previously published sequences reveals a radiation of the main paradisaeinine lineages that took place over a relatively short evolutionary time scale. The core paradisaeinines are resolved as the monophyletic sister-group to the crow-like manucodines. The genus Parotia is basal to other paradisaeinines and is not closely related to the morphologically similar genera Ptiloris and Lophorina. Three major clades within the paradisaeinine ingroup include: (1) Cicinnurus and Diphyllodes, (2) Ptiloris and Lophorina, and (3) the genus Paradisaea. The monotypic genus Seleucidis is apparently closely related to clades (1) and (2). Cytochrome b sequences did not provide evidence for the monophyly of the sicklebill genera Epimachus and Drepanornis. The paradisaeid tree is characterized by short internodal distances. Thus, some clades cannot be strongly resolved by cytochrome b sequences alone.

  18. Molecular evidence for piroplasms in wild Reeves' muntjac (Muntiacus reevesi) in China.

    PubMed

    Yang, Ji-fei; Li, You-quan; Liu, Zhi-jie; Liu, Jun-long; Guan, Gui-quan; Chen, Ze; Luo, Jian-xun; Wang, Xiao-long; Yin, Hong

    2014-10-01

    DNA from liver samples of 17 free-ranging wild Reeves' muntjac (Muntiacus reevesi) was used for PCR amplification of piropalsm 18S rRNA gene. Of 17 samples, 14 (82.4%) showed a specific PCR product which were cloned and sequenced. BLAST analysis of the sequences obtained showed similarities to Babesia sp., Theileria capreoli, Theileria uilenbergi and Theileria sp. BO302-SE. Phylogenetic analysis showed that the Babesia sp. detected in the present study was distantly separated from known Babesia species of wild and domestic animals. Six sequences showed 100% similarity to T. capreoli while five sequences were separated from all known Theileria species and constituted an independent clade with Theileria sp. BO302-SE derived from roe deer in Italy; two sequences were close to T. uilenbergi with 97% similarity. This is the first description of hemoparasite infection in free-ranging wild Reeves' muntjac in China. Our results indicate that wild Reeves' muntjac may play an important reservoir role for hemoparasites. Crown Copyright © 2014. Published by Elsevier Ireland Ltd. All rights reserved.

  19. Close evolutionary relatedness among functionally distantly related members of the (alpha/beta)8-barrel glycosyl hydrolases suggested by the similarity of their fifth conserved sequence region.

    PubMed

    Janecek, S

    1995-12-11

    A short conserved sequence equivalent to the fifth conserved sequence region of alpha-amylases (173_LPDLD, Aspergillus oryzae alpha-amylase) comprising the calcium-ligand aspartate, Asp-175, was identified in the amino acid sequences of several members of the family of (alpha/beta)8-barrel glycosyl hydrolases. Despite the fact that the aspartate is not invariantly conserved, the stretch can be easily recognised in all sequences to be positioned 26-28 amino acid residues in front of the well-known catalytic aspartate (Asp-206, A. oryzae alpha-amylase) located in the beta 4-strand of the barrel. The identification of this region revealed remarkable similarities between some alpha-amylases (those from Bacillus megaterium, Bacillus subtilis and Dictyoglomus thermophilum) on the one hand and several different enzyme specificities (such as oligo-1,6-glucosidase, amylomaltase and neopullulanase, respectively) on the other hand. The most interesting example was offered by B. subtilis alpha-amylase and potato amylomaltase with the regions LYDWN and LYDWK, respectively. These observations support the idea that all members of the family of glycosyl hydrolases adopting the structure of the alpha-amylase-type (alpha/beta)8-barrel are mutually closely related and the strict evolutionary borders separating the individual enzyme specificities can be hardly defined.

  20. DNA Barcode for Identifying Folium Artemisiae Argyi from Counterfeits.

    PubMed

    Mei, Quanxi; Chen, Xiaolu; Xiang, Li; Liu, Yue; Su, Yanyan; Gao, Yuqiao; Dai, Weibo; Dong, Pengpeng; Chen, Shilin

    2016-01-01

    Folium Artemisiae Argyi is an important herb in traditional Chinese medicine. It is commonly used in moxibustion, medicine, etc. However, identifying Artemisia argyi is difficult because this herb exhibits similar morphological characteristics to closely related species and counterfeits. To verify the applicability of DNA barcoding, ITS2 and psbA-trnH were used to identify A. argyi from 15 closely related species and counterfeits. Results indicated that total DNA was easily extracted from all the samples and that both ITS2 and psbA-trnH fragments can be easily amplified. ITS2 was a more ideal barcode than psbA-trnH and ITS2+psbA-trnH to identify A. argyi from closely related species and counterfeits on the basis of sequence character, genetic distance, and tree methods. The sequence length was 225 bp for the 56 ITS2 sequences of A. argyi, and no variable site was detected. For the ITS2 sequences, A. capillaris, A. anomala, A. annua, A. igniaria, A. maximowicziana, A. princeps, Dendranthema vestitum, and D. indicum had single nucleotide polymorphisms (SNPs). The intraspecific Kimura 2-Parameter distance was zero, which is lower than the minimum interspecific distance (0.005). A. argyi, the closely related species, and counterfeits, except for Artemisia maximowicziana and Artemisia sieversiana, were separated into pairs of divergent clusters by using the neighbor joining, maximum parsimony, and maximum likelihood tree methods. Thus, the ITS2 sequence was an ideal barcode to identify A. argyi from closely related species and counterfeits to ensure the safe use of this plant.

  1. Tachyon search speeds up retrieval of similar sequences by several orders of magnitude

    PubMed Central

    Tan, Joshua; Kuchibhatla, Durga; Sirota, Fernanda L.; Sherman, Westley A.; Gattermayer, Tobias; Kwoh, Chia Yee; Eisenhaber, Frank; Schneider, Georg; Maurer-Stroh, Sebastian

    2012-01-01

    Summary: The usage of current sequence search tools becomes increasingly slower as databases of protein sequences continue to grow exponentially. Tachyon, a new algorithm that identifies closely related protein sequences ~200 times faster than standard BLAST, circumvents this limitation with a reduced database and oligopeptide matching heuristic. Availability and implementation: The tool is publicly accessible as a webserver at http://tachyon.bii.a-star.edu.sg and can also be accessed programmatically through SOAP. Contact: sebastianms@bii.a-star.edu.sg Supplementary information: Supplementary data are available at the Bioinformatics online. PMID:22531216

  2. EUGENE'HOM: A generic similarity-based gene finder using multiple homologous sequences.

    PubMed

    Foissac, Sylvain; Bardou, Philippe; Moisan, Annick; Cros, Marie-Josée; Schiex, Thomas

    2003-07-01

    EUGENE'HOM is a gene prediction software for eukaryotic organisms based on comparative analysis. EUGENE'HOM is able to take into account multiple homologous sequences from more or less closely related organisms. It integrates the results of TBLASTX analysis, splice site and start codon prediction and a robust coding/non-coding probabilistic model which allows EUGENE'HOM to handle sequences from a variety of organisms. The current target of EUGENE'HOM is plant sequences. The EUGENE'HOM web site is available at http://genopole.toulouse.inra.fr/bioinfo/eugene/EuGeneHom/cgi-bin/EuGeneHom.pl.

  3. Microbial diversity in an Armenian geothermal spring assessed by molecular and culture-based methods.

    PubMed

    Panosyan, Hovik; Birkeland, Nils-Kåre

    2014-11-01

    The phylogenetic diversity of the prokaryotic community thriving in the Arzakan hot spring in Armenia was studied using molecular and culture-based methods. A sequence analysis of 16S rRNA gene clone libraries demonstrated the presence of a diversity of microorganisms belonging to the Alphaproteobacteria, Betaproteobacteria, Gammaproteobacteria, Epsilonproteobacteria, Firmicutes, Bacteroidetes phyla, and Cyanobacteria. Proteobacteria was the dominant group, representing 52% of the bacterial clones. Denaturing gradient gel electrophoresis profiles of the bacterial 16S rRNA gene fragments also indicated the abundance of Proteobacteria, Bacteroidetes, and Cyanobacteria populations. Most of the sequences were most closely related to uncultivated microorganisms and shared less than 96% similarity with their closest matches in GenBank, indicating that this spring harbors a unique community of novel microbial species or genera. The majority of the sequences of an archaeal 16S rRNA gene library, generated from a methanogenic enrichment, were close relatives of members of the genus Methanoculleus. Aerobic endospore-forming bacteria mainly belonging to Bacillus and Geobacillus were detected only by culture-dependent methods. Three isolates were successfully obtained having 99, 96, and 96% 16S rRNA gene sequence similarities to Arcobacter sp., Methylocaldum sp., and Methanoculleus sp., respectively. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  4. High frequency of hepatitis E virus infection in swine from South Brazil and close similarity to human HEV isolates.

    PubMed

    Passos-Castilho, Ana Maria; Granato, Celso Francisco Hernandes

    Hepatitis E virus is responsible for acute and chronic liver infections worldwide. Swine hepatitis E virus has been isolated in Brazil, and a probable zoonotic transmission has been described, although data are still scarce. The aim of this study was to investigate the frequency of hepatitis E virus infection in pigs from a small-scale farm in the rural area of Paraná State, South Brazil. Fecal samples were collected from 170 pigs and screened for hepatitis E virus RNA using a duplex real-time RT-PCR targeting a highly conserved 70nt long sequence within overlapping parts of ORF2 and ORF3 as well as a 113nt sequence of ORF2. Positive samples with high viral loads were subjected to direct sequencing and phylogenetic analysis. hepatitis E virus RNA was detected in 34 (20.0%) of the 170 pigs following positive results in at least one set of screening real-time RT-PCR primers and probes. The swine hepatitis E virus strains clustered with the genotype hepatitis E virus-3b reference sequences in the phylogenetic analysis and showed close similarity to human hepatitis E virus isolates previously reported in Brazil. Copyright © 2017 Sociedade Brasileira de Microbiologia. Published by Elsevier Editora Ltda. All rights reserved.

  5. Movie denoising by average of warped lines.

    PubMed

    Bertalmío, Marcelo; Caselles, Vicent; Pardo, Alvaro

    2007-09-01

    Here, we present an efficient method for movie denoising that does not require any motion estimation. The method is based on the well-known fact that averaging several realizations of a random variable reduces the variance. For each pixel to be denoised, we look for close similar samples along the level surface passing through it. With these similar samples, we estimate the denoised pixel. The method to find close similar samples is done via warping lines in spatiotemporal neighborhoods. For that end, we present an algorithm based on a method for epipolar line matching in stereo pairs which has per-line complexity O (N), where N is the number of columns in the image. In this way, when applied to the image sequence, our algorithm is computationally efficient, having a complexity of the order of the total number of pixels. Furthermore, we show that the presented method is unsupervised and is adapted to denoise image sequences with an additive white noise while respecting the visual details on the movie frames. We have also experimented with other types of noise with satisfactory results.

  6. Lunatimonas lonarensis gen. nov., sp. nov., a haloalkaline bacterium of the family Cyclobacteriaceae with nitrate reducing activity.

    PubMed

    Srinivas, T N R; Aditya, S; Bhumika, V; Kumar, P Anil

    2014-02-01

    Novel pinkish-orange pigmented, Gram-negative staining, half-moon shaped, non-motile, strictly aerobic strains designated AK24(T) and AK26 were isolated from water and sediment samples of Lonar Lake, Buldhana district, Maharahstra, India. Both strains were positive for oxidase, catalase and β-galactosidase activities. The predominant fatty acids were iso-C15:0 (41.5%), anteiso-C15:0 (9.7%), iso-C17:0 3OH (9.6%), iso-C17:1 ω9c (10.2%) and C16:1 ω7c/C16:1 ω6c/iso-C15:0 2OH (summed feature 3) (14.4%). The strains contained MK-7 as the major respiratory quinone, and phosphatidylethanolamine and five unidentified lipids as the polar lipids. Blast analysis of the 16S rRNA gene sequence of strain AK24(T) showed that it was closely related to Aquiflexum balticum, with a pair-wise sequence similarity of 91.6%, as well as to Fontibacter ferrireducens, Belliella baltica and Indibacter alkaliphilus (91.3, 91.2 and 91.2% pair-wise sequence similarity, respectively), but it only had between 88.6 and 91.0% pair-wise sequence similarity to the rest of the family members. The MALDI-TOF assay reported no significant similarities for AK24(T) and AK26, since they potentially represented a new species. A MALDI MSP dendrogram showed close similarity between the two strains, but they maintained a distance from their phylogenetic neighbors. The genome of AK24(T) showed the presence of heavy metal tolerance genes, including the genes providing resistance to arsenic, cadmium, cobalt and zinc. A cluster of heat shock resistance genes was also found in the genome. Two lantibiotic producing genes, LanR and LasB, were also found in the genome of AK24(T). Strains AK24(T) and AK26 were very closely related to each other with 99.5% pair-wise sequence similarity. Phylogenetic analysis indicated that the strains were members of the family Cyclobacteriaceae and they clustered with the genus Mariniradius, as well as with the genera Aquiflexum, Cecembia, Fontibacter, Indibacter, and Shivajiella. DNA-DNA hybridization between strains AK24(T) and AK26 showed a relatedness of 82% and their rep-PCR banding patterns were very similar. Based on data from the current polyphasic study, it is proposed that the isolates be placed in a new genus and species with the name Lunatimonas lonarensis gen. nov., sp. nov. The type strain of Lunatimonas lonarensis is AK24(T) (=JCM 18822(T)=MTCC 11627(T)). Copyright © 2013 Elsevier GmbH. All rights reserved.

  7. On the persistence and detectability of ancient Beothuk mitochondrial DNA genomes in living First Nations peoples.

    PubMed

    Collier, Ashley; Carr, Steven M

    2018-03-29

    Claims have long been made as to the survival to the present day of descendants of the Newfoundland Beothuk, a group generally accepted to have become extinct with the death of the last known member, Shanawdithit, in 1829. Interest has recently been revived by the availability of commercial genetic testing, which some claim can assign living individuals to specific Native American groups. We compare complete mitogenome sequences (16569 bp) from aDNA of eight distinct Beothuk lineages, including Shanawdithit's uncle Nonosabasut and his wife Demasduit, with three Newfoundland Mi'kmaq lineages and 21 other living Native Americans drawn from GenBank. A Newfoundland Mi'kmaq lineage in Haplogroup A is more similar to three Native Americans (1-3 SNPs) than to the most closely related Beothuk (24 SNPs). Nonosabasut in Haplogroup X is identical to a non-Beothuk Native American. Demasduit in Haplogroup C differs from three other Native Americans by 1-4 substitutions. Within a 2168 bp region of the HVS sequences available from living Mi'kmaq of the Miawpukek First Nation in Newfoundland, lineages in Haplogroups C, X, and A differ by 1, 4, and 8 substitutions, from the most similar Beothuk, and are more similar to other Native Americans. MtDNA genome sequences in living persons identical or similar to those of Beothuk do not necessarily indicate Beothuk ancestry. Mi'kmaq lineages cannot at this time be associated with any Beothuk lineages more closely than those of other Native Americans.

  8. Microbial diversity and methanogenic activity of Antrim Shale formation waters from recently fractured wells

    PubMed Central

    Wuchter, Cornelia; Banning, Erin; Mincer, Tracy J.; Drenzek, Nicholas J.; Coolen, Marco J. L.

    2013-01-01

    The Antrim Shale in the Michigan Basin is one of the most productive shale gas formations in the U.S., but optimal resource recovery strategies must rely on a thorough understanding of the complex biogeochemical, microbial, and physical interdependencies in this and similar systems. We used Illumina MiSeq 16S rDNA sequencing to analyze the diversity and relative abundance of prokaryotic communities present in Antrim shale formation water of three closely spaced recently fractured gas-producing wells. In addition, the well waters were incubated with a suite of fermentative and methanogenic substrates in an effort to stimulate microbial methane generation. The three wells exhibited substantial differences in their community structure that may arise from their different drilling and fracturing histories. Bacterial sequences greatly outnumbered those of archaea and shared highest similarity to previously described cultures of mesophiles and moderate halophiles within the Firmicutes, Bacteroidetes, and δ- and ε-Proteobacteria. The majority of archaeal sequences shared highest sequence similarity to uncultured euryarchaeotal environmental clones. Some sequences closely related to cultured methylotrophic and hydrogenotrophic methanogens were also present in the initial well water. Incubation with methanol and trimethylamine stimulated methylotrophic methanogens and resulted in the largest increase in methane production in the formation waters, while fermentation triggered by the addition of yeast extract and formate indirectly stimulated hydrogenotrophic methanogens. The addition of sterile powdered shale as a complex natural substrate stimulated the rate of methane production without affecting total methane yields. Depletion of methane indicative of anaerobic methane oxidation (AMO) was observed over the course of incubation with some substrates. This process could constitute a substantial loss of methane in the shale formation. PMID:24367357

  9. [Genetic diversity and phylogeny of rhizobia isolated from peanut (Arachis hypogaea)].

    PubMed

    Yang, Jiang-Ke; Xie, Fu-Li; Zhou, Jun-Chu

    2002-12-01

    Forty three rhizobium strains isolated from peanut (Arachis hypogaea) and 15 reference strains from other genus and species were analyzed by the method of 16S rRNA RFLP, 16S rRNA sequencing and 16S-23S IGS PCR RFLP. The results of the 16S rRNA RFLP shown that 43 strains tested were all ascribed to the genus of Bradyrhizobium phylogenetically. Strains tested were adjacent to the B. japonicum and far from B. elkanii 16S rRNA genotype. The genotypes generated by the 4 restriction endonucleases, Mbo I, Dde I, Hae III and Msp I, were same as the representatives of B. japonicum. The dendrogram generated by 16S rRNA sequence and Neighbor-joining method shown that peanut rhizobia clustered into the subcluster represented by B. japonicum and B. liaoningense, were more close to B. liaoningense genetically, and the sequence difference between them was less than 1%. High sequence similarity was also determined between B. liaoningense and B. japonicum. JZ1, representative strain of peanut rhizobia were systematically far from the B. elkanii, and the sequence divergence about 2%. The results from IGS RFLP analysis indicated that although they were phylogenetically close to B. japonicum and B. elkanii, peanut rhizobia forming an independent group at the similarity of 71% could be further divided into four subgroups, A, B, C and D. Subgroup A consisted of strains from different region, subgroup B was composed of strains from Wuchang, Qianjiang and Jingzhou, subgroup C was mainly composed of strains from Jingzhou and starins of subgroup D mainly from Neijiang. Reference strains from B. japonicum and B. elkanii were independently clustered into the subgroup E at the similarity of 71%. The geographical factor effect on genetic diversity of rhizobia was found.

  10. Burkholderia cordobensis sp. nov., from agricultural soils.

    PubMed

    Draghi, Walter O; Peeters, Charlotte; Cnockaert, Margo; Snauwaert, Cindy; Wall, Luis G; Zorreguieta, Angeles; Vandamme, Peter

    2014-06-01

    Two Gram-negative, rod-shaped bacteria were isolated from agricultural soils in Córdoba province in central Argentina. Their 16S rRNA gene sequences demonstrated that they belong to the genus Burkholderia, with Burkholderia zhejiangensis as most closely related formally named species; this relationship was confirmed through comparative gyrB sequence analysis. Whole-cell fatty acid analysis supported their assignment to the genus Burkholderia. Burkholderia sp. strain YI23, for which a whole-genome sequence is available, represents the same taxon, as demonstrated by its highly similar 16S rRNA (100% similarity) and gyrB (99.1-99.7%) gene sequences. The results of DNA-DNA hybridization experiments and physiological and biochemical characterization further substantiated the genotypic and phenotypic distinctiveness of the Argentinian soil isolates, for which the name Burkholderia cordobensis sp. nov. is proposed, with strain MMP81(T) ( = LMG 27620(T) = CCUG 64368(T)) as the type strain. © 2014 IUMS.

  11. A ruby-colored Pseudobaeospora species is described as new from material collected on the island of Hawaii.

    PubMed

    Desjardin, Dennis E; Hemmes, Don E; Perry, Brian A

    2014-01-01

    Pseudobaeospora wipapatiae is described as new based on material collected in alien wet habitats on the island of Hawaii. Unique features of this beautiful species include deep ruby-colored basidiomes with two-spored basidia, amyloid cheilocystidia and a hymeniderm pileipellis with abundant pileocystidia that is initially deep ruby in KOH then changes to lilac gray. Phylogenetic analysis of nuclear large ribosomal subunit sequence data suggest a close relationship between Pseudobaeospora and Tricholoma. BLAST comparisons of internal transcribed spacer and 5.8S nuclear ribosomal subunit regions sequence data reveal greatest similarity with existing sequences of Pseudobaeospora species. A comprehensive description, color photograph, illustrations of salient micromorphological features and comparisons with phenetically similar taxa are provided. © 2014 by The Mycological Society of America.

  12. Adhesive Proteins of Stalked and Acorn Barnacles Display Homology with Low Sequence Similarities

    PubMed Central

    Jonker, Jaimie-Leigh; Abram, Florence; Pires, Elisabete; Varela Coelho, Ana; Grunwald, Ingo; Power, Anne Marie

    2014-01-01

    Barnacle adhesion underwater is an important phenomenon to understand for the prevention of biofouling and potential biotechnological innovations, yet so far, identifying what makes barnacle glue proteins ‘sticky’ has proved elusive. Examination of a broad range of species within the barnacles may be instructive to identify conserved adhesive domains. We add to extensive information from the acorn barnacles (order Sessilia) by providing the first protein analysis of a stalked barnacle adhesive, Lepas anatifera (order Lepadiformes). It was possible to separate the L. anatifera adhesive into at least 10 protein bands using SDS-PAGE. Intense bands were present at approximately 30, 70, 90 and 110 kilodaltons (kDa). Mass spectrometry for protein identification was followed by de novo sequencing which detected 52 peptides of 7–16 amino acids in length. None of the peptides matched published or unpublished transcriptome sequences, but some amino acid sequence similarity was apparent between L. anatifera and closely-related Dosima fascicularis. Antibodies against two acorn barnacle proteins (ab-cp-52k and ab-cp-68k) showed cross-reactivity in the adhesive glands of L. anatifera. We also analysed the similarity of adhesive proteins across several barnacle taxa, including Pollicipes pollicipes (a stalked barnacle in the order Scalpelliformes). Sequence alignment of published expressed sequence tags clearly indicated that P. pollicipes possesses homologues for the 19 kDa and 100 kDa proteins in acorn barnacles. Homology aside, sequence similarity in amino acid and gene sequences tended to decline as taxonomic distance increased, with minimum similarities of 18–26%, depending on the gene. The results indicate that some adhesive proteins (e.g. 100 kDa) are more conserved within barnacles than others (20 kDa). PMID:25295513

  13. Adhesive proteins of stalked and acorn barnacles display homology with low sequence similarities.

    PubMed

    Jonker, Jaimie-Leigh; Abram, Florence; Pires, Elisabete; Varela Coelho, Ana; Grunwald, Ingo; Power, Anne Marie

    2014-01-01

    Barnacle adhesion underwater is an important phenomenon to understand for the prevention of biofouling and potential biotechnological innovations, yet so far, identifying what makes barnacle glue proteins 'sticky' has proved elusive. Examination of a broad range of species within the barnacles may be instructive to identify conserved adhesive domains. We add to extensive information from the acorn barnacles (order Sessilia) by providing the first protein analysis of a stalked barnacle adhesive, Lepas anatifera (order Lepadiformes). It was possible to separate the L. anatifera adhesive into at least 10 protein bands using SDS-PAGE. Intense bands were present at approximately 30, 70, 90 and 110 kilodaltons (kDa). Mass spectrometry for protein identification was followed by de novo sequencing which detected 52 peptides of 7-16 amino acids in length. None of the peptides matched published or unpublished transcriptome sequences, but some amino acid sequence similarity was apparent between L. anatifera and closely-related Dosima fascicularis. Antibodies against two acorn barnacle proteins (ab-cp-52k and ab-cp-68k) showed cross-reactivity in the adhesive glands of L. anatifera. We also analysed the similarity of adhesive proteins across several barnacle taxa, including Pollicipes pollicipes (a stalked barnacle in the order Scalpelliformes). Sequence alignment of published expressed sequence tags clearly indicated that P. pollicipes possesses homologues for the 19 kDa and 100 kDa proteins in acorn barnacles. Homology aside, sequence similarity in amino acid and gene sequences tended to decline as taxonomic distance increased, with minimum similarities of 18-26%, depending on the gene. The results indicate that some adhesive proteins (e.g. 100 kDa) are more conserved within barnacles than others (20 kDa).

  14. Wind data mining by Kohonen Neural Networks.

    PubMed

    Fayos, José; Fayos, Carolina

    2007-02-14

    Time series of Circulation Weather Type (CWT), including daily averaged wind direction and vorticity, are self-classified by similarity using Kohonen Neural Networks (KNN). It is shown that KNN is able to map by similarity all 7300 five-day CWT sequences during the period of 1975-94, in London, United Kingdom. It gives, as a first result, the most probable wind sequences preceding each one of the 27 CWT Lamb classes in that period. Inversely, as a second result, the observed diffuse correlation between both five-day CWT sequences and the CWT of the 6(th) day, in the long 20-year period, can be generalized to predict the last from the previous CWT sequence in a different test period, like 1995, as both time series are similar. Although the average prediction error is comparable to that obtained by forecasting standard methods, the KNN approach gives complementary results, as they depend only on an objective classification of observed CWT data, without any model assumption. The 27 CWT of the Lamb Catalogue were coded with binary three-dimensional vectors, pointing to faces, edges and vertex of a "wind-cube," so that similar CWT vectors were close.

  15. A novel alignment-free method to classify protein folding types by combining spectral graph clustering with Chou's pseudo amino acid composition.

    PubMed

    Tripathi, Pooja; Pandey, Paras N

    2017-07-07

    The present work employs pseudo amino acid composition (PseAAC) for encoding the protein sequences in their numeric form. Later this will be arranged in the similarity matrix, which serves as input for spectral graph clustering method. Spectral methods are used previously also for clustering of protein sequences, but they uses pair wise alignment scores of protein sequences, in similarity matrix. The alignment score depends on the length of sequences, so clustering short and long sequences together may not good idea. Therefore the idea of introducing PseAAC with spectral clustering algorithm came into scene. We extensively tested our method and compared its performance with other existing machine learning methods. It is consistently observed that, the number of clusters that we obtained for a given set of proteins is close to the number of superfamilies in that set and PseAAC combined with spectral graph clustering shows the best classification results. Copyright © 2017 Elsevier Ltd. All rights reserved.

  16. Two distinct DNA sequences recognized by transcription factors represent enthalpy and entropy optima

    PubMed Central

    Yin, Yimeng; Das, Pratyush K; Jolma, Arttu; Zhu, Fangjie; Popov, Alexander; Xu, You; Nilsson, Lennart

    2018-01-01

    Most transcription factors (TFs) can bind to a population of sequences closely related to a single optimal site. However, some TFs can bind to two distinct sequences that represent two local optima in the Gibbs free energy of binding (ΔG). To determine the molecular mechanism behind this effect, we solved the structures of human HOXB13 and CDX2 bound to their two optimal DNA sequences, CAATAAA and TCGTAAA. Thermodynamic analyses by isothermal titration calorimetry revealed that both sites were bound with similar ΔG. However, the interaction with the CAA sequence was driven by change in enthalpy (ΔH), whereas the TCG site was bound with similar affinity due to smaller loss of entropy (ΔS). This thermodynamic mechanism that leads to at least two local optima likely affects many macromolecular interactions, as ΔG depends on two partially independent variables ΔH and ΔS according to the central equation of thermodynamics, ΔG = ΔH - TΔS. PMID:29638214

  17. Bacillus infantis sp. nov. and Bacillus idriensis sp. nov., isolated from a patient with neonatal sepsis.

    PubMed

    Ko, Kwan Soo; Oh, Won Sup; Lee, Mi Young; Lee, Jang Ho; Lee, Hyuck; Peck, Kyong Ran; Lee, Nam Yong; Song, Jae-Hoon

    2006-11-01

    Two Gram-positive bacilli, designated as strains SMC 4352-1T and SMC 4352-2T, were isolated sequentially from the blood of a newborn child with sepsis. They could not be identified by using conventional clinical microbiological methods. 16S rRNA gene sequencing and phylogenetic analysis revealed that both strains belonged to the genus Bacillus but clearly diverged from known Bacillus species. Strain SMC 4352-1T and strain SMC 4352-2T were found to be closely related to Bacillus firmus NCIMB 9366T (98.2% sequence similarity) and Bacillus cibi JG-30T (97.1% sequence similarity), respectively. They also displayed low DNA-DNA reassociation values (less than 40%) with respect to the most closely related Bacillus species. On the basis of their polyphasic characteristics, strain SMC 4352-1T and strain SMC 4352-2T represent two novel species of the genus Bacillus, for which the names Bacillus infantis sp. nov. (type strain SMC 4352-1T=KCCM 90025T=JCM 13438T) and Bacillus idriensis sp. nov. (type strain SMC 4352-2T=KCCM 90024T=JCM 13437T) are proposed.

  18. Candida halmiae sp. nov., Geotrichum ghanense sp. nov. and Candida awuaii sp. nov., isolated from Ghanaian cocoa fermentations.

    PubMed

    Nielsen, Dennis S; Jakobsen, Mogens; Jespersen, Lene

    2010-06-01

    During an investigation of the microbiology of Ghanaian cocoa fermentations, a number of yeast isolates with unusual pheno- and genotypic properties representing three possible novel species were isolated. Members of Group A divided by multilateral budding and ascospores were not produced. Group B strains produced true hyphae and ascospores were not produced. Group C representatives divided by budding and formed chains and star-like aggregates. Ascospores were not produced. Sequence analysis of the 26S rRNA gene (D1/D2 region) revealed that the Group A isolates were phylogenetically most closely related to Saturnispora mendoncae (gene sequence similarity 92.4 %), Saturnispora besseyi (88.8 %), Saturnispora saitoi (88.8 %) and Saturnispora ahearnii (88.3 %). Members of Group B were most closely related to representatives of the genera Dipodascus and Galactomyces and the asporogenous genus Geotrichum, but in all cases with 26S rRNA gene (D1/D2 region) similarities below 87 %. For Group C, the most closely related species were Candida rugopelliculosa (92.4 %), Pichia occidentalis (91.6 %) and Pichia exigua (91.9 %). The very low gene sequence similarities obtained for the three groups of isolates clearly indicated that they represented novel species. Repetitive Palindromic PCR (Rep-PCR) of the isolates and their closest phylogenetic relatives confirmed that the new isolates belonged to previously undescribed species. In conclusion, based on the genetic and phenotypic results, the new isolates were considered to represent three novel species, for which the names Candida halmiae (group A, type strain G3(T)=CBS 11009(T)=CCUG 56721(T)); Geotrichum ghanense (group B, type strain G6(T)=CBS 11010(T)=CCUG 56722(T)) and Candida awuaii (group C, type strain G15(T)=CBS 11011(T)=CCUG 56723(T)) are proposed.

  19. Intermingled Klebsiella pneumoniae Populations Between Retail Meats and Human Urinary Tract Infections.

    PubMed

    Davis, Gregg S; Waits, Kara; Nordstrom, Lora; Weaver, Brett; Aziz, Maliha; Gauld, Lori; Grande, Heidi; Bigler, Rick; Horwinski, Joseph; Porter, Stephen; Stegger, Marc; Johnson, James R; Liu, Cindy M; Price, Lance B

    2015-09-15

    Klebsiella pneumoniae is a common colonizer of the gastrointestinal tract of humans, companion animals, and livestock. To better understand potential contributions of foodborne K. pneumoniae to human clinical infections, we compared K. pneumoniae isolates from retail meat products and human clinical specimens to assess their similarity based on antibiotic resistance, genetic relatedness, and virulence. Klebsiella pneumoniae was isolated from retail meats from Flagstaff grocery stores in 2012 and from urine and blood specimens from Flagstaff Medical Center in 2011-2012. Isolates underwent antibiotic susceptibility testing and whole-genome sequencing. Genetic relatedness of the isolates was assessed using multilocus sequence typing and phylogenetic analyses. Extraintestinal virulence of several closely related meat-source and urine isolates was assessed using a murine sepsis model. Meat-source isolates were significantly more likely to be multidrug resistant and resistant to tetracycline and gentamicin than clinical isolates. Four sequence types occurred among both meat-source and clinical isolates. Phylogenetic analyses confirmed close relationships among meat-source and clinical isolates. Isolates from both sources showed similar virulence in the mouse sepsis model. Meat-source K. pneumoniae isolates were more likely than clinical isolates to be antibiotic resistant, which could reflect selective pressures from antibiotic use in food-animal production. The close genetic relatedness of meat-source and clinical isolates, coupled with similarities in virulence, suggest that the barriers to transmission between these 2 sources are low. Taken together, our results suggest that retail meat is a potential vehicle for transmitting virulent, antibiotic-resistant K. pneumoniae from food animals to humans. © The Author 2015. Published by Oxford University Press on behalf of the Infectious Diseases Society of America.

  20. EUGÈNE'HOM: a generic similarity-based gene finder using multiple homologous sequences

    PubMed Central

    Foissac, Sylvain; Bardou, Philippe; Moisan, Annick; Cros, Marie-Josée; Schiex, Thomas

    2003-01-01

    EUGÈNE'HOM is a gene prediction software for eukaryotic organisms based on comparative analysis. EUGÈNE'HOM is able to take into account multiple homologous sequences from more or less closely related organisms. It integrates the results of TBLASTX analysis, splice site and start codon prediction and a robust coding/non-coding probabilistic model which allows EUGÈNE'HOM to handle sequences from a variety of organisms. The current target of EUGÈNE'HOM is plant sequences. The EUGÈNE'HOM web site is available at http://genopole.toulouse.inra.fr/bioinfo/eugene/EuGeneHom/cgi-bin/EuGeneHom.pl. PMID:12824408

  1. DNA sequence analysis of the photosynthesis region of Rhodobacter sphaeroides 2.4.1.

    PubMed

    Choudhary, M; Kaplan, S

    2000-02-15

    This paper describes the DNA sequence of the photosynthesis region of Rhodobacter sphaeroides 2.4.1 (T). The photosynthesis gene cluster is located within a approximately 73 kb Ase I genomic DNA fragment containing the puf, puhA, cycA and puc operons. A total of 65 open reading frames (ORFs) have been identified, of which 61 showed significant similarity to genes/proteins of other organisms while only four did not reveal any significant sequence similarity to any gene/protein sequences in the database. The data were compared with the corresponding genes/ORFs from a different strain of R.sphaeroides and Rhodobacter capsulatus, a close relative of R. sphaeroides. A detailed analysis of the gene organization in the photosynthesis region revealed a similar gene order in both species with some notable differences located to the pucBAC = cycA region. In addition, photosynthesis gene regulatory protein (PpsR, FNR, IHF) binding motifs in upstream sequences of a number of photosynthesis genes have been identified and shown to differ between these two species. The difference in gene organization relative to pucBAC and cycA suggests that this region originated independently of the photosynthesis gene cluster of R.sphaeroides.

  2. Phenotypic, Genotypic, and Antimicrobial Characteristics of Streptococcus halichoeri Isolates from Humans, Proposal To Rename Streptococcus halichoeri as Streptococcus halichoeri subsp. halichoeri, and Description of Streptococcus halichoeri subsp. hominis subsp. nov., a Bacterium Associated with Human Clinical Infections.

    PubMed

    Shewmaker, P L; Whitney, A M; Humrighouse, B W

    2016-03-01

    Phenotypic, genotypic, and antimicrobial characteristics of six phenotypically distinct human clinical isolates that most closely resembled the type strain of Streptococcus halichoeri isolated from a seal are presented. Sequencing of the 16S rRNA, rpoB, sodA, and recN genes; comparative whole-genome analysis; conventional biochemical and Rapid ID 32 Strep identification methods; and antimicrobial susceptibility testing were performed on the human isolates, the type strain of S. halichoeri, and type strains of closely related species. The six human clinical isolates were biochemically indistinguishable from each other and showed 100% 16S rRNA, rpoB, sodA, and recN gene sequence similarity. Comparative 16S rRNA gene sequencing analysis revealed 98.6% similarity to S. halichoeri CCUG 48324(T), 97.9% similarity to S. canis ATCC 43496(T), and 97.8% similarity to S. ictaluri ATCC BAA-1300(T). A 3,530-bp fragment of the rpoB gene was 98.8% similar to the S. halichoeri type strain, 84.6% to the S. canis type strain, and 83.8% to the S. ictaluri type strain. The S. halichoeri type strain and the human clinical isolates were susceptible to the antimicrobials tested based on CLSI guidelines for Streptococcus species viridans group with the exception of tetracycline and erythromycin. The human isolates were phenotypically distinct from the type strain isolated from a seal; comparative whole-genome sequence analysis confirmed that the human isolates were S. halichoeri. On the basis of these results, a novel subspecies, Streptococcus halichoeri subsp. hominis, is proposed for the human isolates and Streptococcus halichoeri subsp. halichoeri is proposed for the gray seal isolates. The type strain of the novel subspecies is SS1844(T) = CCUG 67100(T) = LMG 28801(T). Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  3. Extensive characterization of Tupaia belangeri neuropeptidome using an integrated mass spectrometric approach.

    PubMed

    Petruzziello, Filomena; Fouillen, Laetitia; Wadensten, Henrik; Kretz, Robert; Andren, Per E; Rainer, Gregor; Zhang, Xiaozhe

    2012-02-03

    Neuropeptidomics is used to characterize endogenous peptides in the brain of tree shrews (Tupaia belangeri). Tree shrews are small animals similar to rodents in size but close relatives of primates, and are excellent models for brain research. Currently, tree shrews have no complete proteome information available on which direct database search can be allowed for neuropeptide identification. To increase the capability in the identification of neuropeptides in tree shrews, we developed an integrated mass spectrometry (MS)-based approach that combines methods including data-dependent, directed, and targeted liquid chromatography (LC)-Fourier transform (FT)-tandem MS (MS/MS) analysis, database construction, de novo sequencing, precursor protein search, and homology analysis. Using this integrated approach, we identified 107 endogenous peptides that have sequences identical or similar to those from other mammalian species. High accuracy MS and tandem MS information, with BLAST analysis and chromatographic characteristics were used to confirm the sequences of all the identified peptides. Interestingly, further sequence homology analysis demonstrated that tree shrew peptides have a significantly higher degree of homology to equivalent sequences in humans than those in mice or rats, consistent with the close phylogenetic relationship between tree shrews and primates. Our results provide the first extensive characterization of the peptidome in tree shrews, which now permits characterization of their function in nervous and endocrine system. As the approach developed fully used the conservative properties of neuropeptides in evolution and the advantage of high accuracy MS, it can be portable for identification of neuropeptides in other species for which the fully sequenced genomes or proteomes are not available.

  4. PaPrBaG: A machine learning approach for the detection of novel pathogens from NGS data

    NASA Astrophysics Data System (ADS)

    Deneke, Carlus; Rentzsch, Robert; Renard, Bernhard Y.

    2017-01-01

    The reliable detection of novel bacterial pathogens from next-generation sequencing data is a key challenge for microbial diagnostics. Current computational tools usually rely on sequence similarity and often fail to detect novel species when closely related genomes are unavailable or missing from the reference database. Here we present the machine learning based approach PaPrBaG (Pathogenicity Prediction for Bacterial Genomes). PaPrBaG overcomes genetic divergence by training on a wide range of species with known pathogenicity phenotype. To that end we compiled a comprehensive list of pathogenic and non-pathogenic bacteria with human host, using various genome metadata in conjunction with a rule-based protocol. A detailed comparative study reveals that PaPrBaG has several advantages over sequence similarity approaches. Most importantly, it always provides a prediction whereas other approaches discard a large number of sequencing reads with low similarity to currently known reference genomes. Furthermore, PaPrBaG remains reliable even at very low genomic coverages. CombiningPaPrBaG with existing approaches further improves prediction results.

  5. Conserved regulatory elements of the promoter sequence of the gene rpoH of enteric bacteria

    PubMed Central

    Ramírez-Santos, Jesús; Collado-Vides, Julio; García-Varela, Martin; Gómez-Eichelmann, M. Carmen

    2001-01-01

    The rpoH regulatory region of different members of the enteric bacteria family was sequenced or downloaded from GenBank and compared. In addition, the transcriptional start sites of rpoH of Yersinia frederiksenii and Proteus mirabilis, two distant members of this family, were determined. Sequences similar to the σ70 promoters P1, P4 and P5, to the σE promoter P3 and to boxes DnaA1, DnaA2, cAMP receptor protein (CRP) boxes CRP1, CRP2 and box CytR present in Escherichia coli K12, were identified in sequences of closely related bacteria such as: E.coli, Shigella flexneri, Salmonella enterica serovar Typhimurium, Citrobacter freundii, Enterobacter cloacae and Klebsiella pneumoniae. In more distant bacteria, Y.frederiksenii and P.mirabilis, the rpoH regulatory region has a distal P1-like σ70 promoter and two proximal promoters: a heat-induced σE-like promoter and a σ70 promoter. Sequences similar to the regulatory boxes were not identified in these bacteria. This study suggests that the general pattern of transcription of the rpoH gene in enteric bacteria includes a distal σ70 promoter, >200 nt upstream of the initiation codon, and two proximal promoters: a heat-induced σE-like promoter and a σ70 promoter. A second proximal σ70 promoter under catabolite-regulation is probably present only in bacteria closely related to E.coli. PMID:11139607

  6. Diversity of 16S rRNA genes of new Ehrlichia strains isolated from horses with clinical signs of Potomac horse fever.

    PubMed

    Wen, B; Rikihisa, Y; Fuerst, P A; Chaichanasiriwithaya, W

    1995-04-01

    Ehrlichia risticii is the causative agent of Potomac horse fever. Variations among the major antigens of different local E. risticii strains have been detected previously. To further assess genetic variability in this species or species complex, the sequences of the 16S rRNA genes of several isolates obtained from sick horses diagnosed as having Potomac horse fever were determined. The sequences of six isolates obtained from Ohio and three isolates obtained from Kentucky were amplified by PCR. Three groups of sequences were identified. The sequences of five of the Ohio isolates were identical to the sequence of the type strain of E. risticii, the Illinois strain. The sequence of one Ohio isolate, isolate 081, was unique; this sequence differed in 10 nucleotides from the sequence of the type strain (level of similarity, 99.3%). The sequences of the three Kentucky isolates were identical to each other, but differed by five bases from the sequence of the type strain (level of similarity, 99.6%). The levels of sequence similarity of isolate 081, the Kentucky isolates, and the type strain to the next most closely related Ehrlichia sp., Ehrlichia sennetsu, were 99.3, 99.2, and 99.2%, respectively. On the basis of the distinct antigenic profiles and the levels of 16S rRNA sequence divergence, isolate 081 is as divergent from the type strain of E. risticii as E. sennetsu is. Therefore, we suggest that strain 081 and the Kentucky isolates may represent two new distinct Ehrlichia species.

  7. Azospirillum canadense sp. nov., a nitrogen-fixing bacterium isolated from corn rhizosphere.

    PubMed

    Mehnaz, Samina; Weselowski, Brian; Lazarovits, George

    2007-03-01

    A free-living diazotrophic strain, DS2(T), was isolated from corn rhizosphere. Polyphasic taxonomy was performed including morphological characterization, Biolog analysis, and 16S rRNA, cpn60 and nifH gene sequence analyses. 16S rRNA gene sequence analysis indicated that strain DS2(T) was closely related to the genus Azospirillum (96 % similarity). Chemotaxonomic characteristics (DNA G+C content 67.9 mol%; Q-10 quinone system; major fatty acid 18 : 1omega7c) were also similar to those of the genus Azospirillum. In all the analyses, including phenotypic characterization using Biolog analysis and comparison of cellular fatty acids, this isolate was found to be different from the closely related species Azospirillum lipoferum, Azospirillum oryzae and Azospirillum brasilense. On the basis of these results, a novel species is proposed for this nitrogen-fixing strain. The name Azospirillum canadense sp. nov. is suggested with the type strain DS2(T) (=NCCB 100108(T)=LMG 23617(T)).

  8. Genome sequencing identifies Listeria fleischmannii subsp. coloradonensis subsp. nov., isolated from a ranch.

    PubMed

    den Bakker, Henk C; Manuel, Clyde S; Fortes, Esther D; Wiedmann, Martin; Nightingale, Kendra K

    2013-09-01

    Twenty Listeria-like isolates were obtained from environmental samples collected on a cattle ranch in northern Colorado; all of these isolates were found to share an identical partial sigB sequence, suggesting close relatedness. The isolates were similar to members of the genus Listeria in that they were Gram-stain-positive, short rods, oxidase-negative and catalase-positive; the isolates were similar to Listeria fleischmannii because they were non-motile at 25 °C. 16S rRNA gene sequencing for representative isolates and whole genome sequencing for one isolate was performed. The genome of the type strain of Listeria fleischmannii (strain LU2006-1(T)) was also sequenced. The draft genomes were very similar in size and the average MUMmer nucleotide identity across 91% of the genomes was 95.16%. Genome sequence data were used to design primers for a six-gene multi-locus sequence analysis (MLSA) scheme. Phylogenies based on (i) the near-complete 16S rRNA gene, (ii) 31 core genes and (iii) six housekeeping genes illustrated the close relationship of these Listeria-like isolates to Listeria fleischmannii LU2006-1(T). Sufficient genetic divergence of the Listeria-like isolates from the type strain of Listeria fleischmannii and differing phenotypic characteristics warrant these isolates to be classified as members of a distinct infraspecific taxon, for which the name Listeria fleischmannii subsp. coloradonensis subsp. nov. is proposed. The type strain is TTU M1-001(T) ( =BAA-2414(T) =DSM 25391(T)). The isolates of Listeria fleischmannii subsp. coloradonensis subsp. nov. differ from the nominate subspecies by the inability to utilize melezitose, turanose and sucrose, and the ability to utilize inositol. The results also demonstrate the utility of whole genome sequencing to facilitate identification of novel taxa within a well-described genus. The genomes of both subspecies of Listeria fleischmannii contained putative enhancin genes; the Listeria fleischmannii subsp. coloradonensis subsp. nov. genome also encoded a putative mosquitocidal toxin. The presence of these genes suggests possible adaptation to an insect host, and further studies are needed to probe niche adaptation of Listeria fleischmannii.

  9. Genomic insight into the common carp (Cyprinus carpio) genome by sequencing analysis of BAC-end sequences

    PubMed Central

    2011-01-01

    Background Common carp is one of the most important aquaculture teleost fish in the world. Common carp and other closely related Cyprinidae species provide over 30% aquaculture production in the world. However, common carp genomic resources are still relatively underdeveloped. BAC end sequences (BES) are important resources for genome research on BAC-anchored genetic marker development, linkage map and physical map integration, and whole genome sequence assembling and scaffolding. Result To develop such valuable resources in common carp (Cyprinus carpio), a total of 40,224 BAC clones were sequenced on both ends, generating 65,720 clean BES with an average read length of 647 bp after sequence processing, representing 42,522,168 bp or 2.5% of common carp genome. The first survey of common carp genome was conducted with various bioinformatics tools. The common carp genome contains over 17.3% of repetitive elements with GC content of 36.8% and 518 transposon ORFs. To identify and develop BAC-anchored microsatellite markers, a total of 13,581 microsatellites were detected from 10,355 BES. The coding region of 7,127 genes were recognized from 9,443 BES on 7,453 BACs, with 1,990 BACs have genes on both ends. To evaluate the similarity to the genome of closely related zebrafish, BES of common carp were aligned against zebrafish genome. A total of 39,335 BES of common carp have conserved homologs on zebrafish genome which demonstrated the high similarity between zebrafish and common carp genomes, indicating the feasibility of comparative mapping between zebrafish and common carp once we have physical map of common carp. Conclusion BAC end sequences are great resources for the first genome wide survey of common carp. The repetitive DNA was estimated to be approximate 28% of common carp genome, indicating the higher complexity of the genome. Comparative analysis had mapped around 40,000 BES to zebrafish genome and established over 3,100 microsyntenies, covering over 50% of the zebrafish genome. BES of common carp are tremendous tools for comparative mapping between the two closely related species, zebrafish and common carp, which should facilitate both structural and functional genome analysis in common carp. PMID:21492448

  10. Structure, sequence and expression of the hepatitis delta (δ) viral genome

    NASA Astrophysics Data System (ADS)

    Wang, Kang-Sheng; Choo, Qui-Lim; Weiner, Amy J.; Ou, Jing-Hsiung; Najarian, Richard C.; Thayer, Richard M.; Mullenbach, Guy T.; Denniston, Katherine J.; Gerin, John L.; Houghton, Michael

    1986-10-01

    Biochemical and electron microscopic data indicate that the human hepatitis δ viral agent contains a covalently closed circular and single-stranded RNA genome that has certain similarities with viroid-like agents from plants. The sequence of the viral genome (1,678 nucleotides) has been determined and an open reading frame within the complementary strand has been shown to encode an antigen that binds specifically to antisera from patients with chronic hepatitis δ viral infections.

  11. Molecular Phylogenetic Analysis of Archaeal Intron-Containing Genes Coding for rRNA Obtained from a Deep-Subsurface Geothermal Water Pool

    PubMed Central

    Takai, Ken; Horikoshi, Koki

    1999-01-01

    Molecular phylogenetic analysis of a naturally occurring microbial community in a deep-subsurface geothermal environment indicated that the phylogenetic diversity of the microbial population in the environment was extremely limited and that only hyperthermophilic archaeal members closely related to Pyrobaculum were present. All archaeal ribosomal DNA sequences contained intron-like sequences, some of which had open reading frames with repeated homing-endonuclease motifs. The sequence similarity analysis and the phylogenetic analysis of these homing endonucleases suggested the possible phylogenetic relationship among archaeal rRNA-encoded homing endonucleases. PMID:10584021

  12. Lactococcus lactis subsp. tructae subsp. nov. isolated from the intestinal mucus of brown trout (Salmo trutta) and rainbow trout (Oncorhynchus mykiss).

    PubMed

    Pérez, Tania; Balcázar, José Luis; Peix, Alvaro; Valverde, Angel; Velázquez, Encarna; de Blas, Ignacio; Ruiz-Zarzuela, Imanol

    2011-08-01

    The species Lactococcus lactis currently includes three subspecies; L. lactis subsp. lactis and L. lactis subsp. cremoris, isolated from milk sources, and L. lactis subsp. hordniae, isolated from the leafhopper Hordnia circellata. In this study, three strains, designated L105(T), I3 and L101, were isolated from the intestinal mucus of brown trout (Salmo trutta) and rainbow trout (Oncorhynchus mykiss). These strains were closely related to members of the species Lactococcus lactis. Strain L105(T) showed 99.4 % 16S rRNA gene sequence similarity to that of the type strains L. lactis subsp. lactis NCDO 604(T) and L. lactis subsp. hordniae NCDO 2181(T) and showed 99.9 % similarity to the type strain Lactococcus lactis subsp. cremoris NCDO 607(T). Analysis of two housekeeping genes, rpoB and recA, confirmed the close relationship between the novel strains and L. lactis subsp. cremoris with similarities of 99.3 and 99.7 %, respectively. The three strains could, however, be differentiated from their closest relatives on the basis of several phenotypic characteristics, as was the case for L. lactis subsp. lactis and L. lactis subsp. hordniae, which were also closely related on the basis of 16S rRNA, rpoB and recA gene sequence similarities. The strains isolated in this study represent a new subspecies, for which the name Lactococcus lactis subsp. tructae subsp. nov. is proposed. The type strain is L105(T) ( = LMG 24662(T)  = DSM 21502(T)).

  13. Sphingomonas azotifigens sp. nov., a nitrogen-fixing bacterium isolated from the roots of Oryza sativa.

    PubMed

    Xie, Cheng-Hui; Yokota, Akira

    2006-04-01

    Three yellow-pigmented strains associated with rice plants were characterized by using a polyphasic approach. The nitrogen-fixing abilities of these strains were confirmed by acetylene reduction assay and nifH gene detection. The three strains were found to be very closely related, with 99.9 % 16S rRNA gene sequence similarity and greater than 70 % DNA-DNA hybridization values, suggesting that the three strains represent a single species. 16S rRNA gene sequence analysis indicated that the strains were closely related to Sphingomonas trueperi, with 99.5 % similarity. The chemotaxonomic characteristics (G+C content of the DNA of 68.0 mol%, ubiquinone Q-10 system, 2-OH as the only hydroxy fatty acid and homospermidine as the sole polyamine) were similar to those of members of the genus Sphingomonas. Based on DNA-DNA hybridization values and physiological characteristics, the three novel strains could be differentiated from other recognized species of the genus Sphingomonas. The name Sphingomonas azotifigens sp. nov. is proposed to accommodate these bacterial strains; the type strain is Y39T (=NBRC 15497T = IAM 15283T = CCTCC AB205007T).

  14. Comparative sequence analysis of Sordaria macrospora and Neurospora crassa as a means to improve genome annotation.

    PubMed

    Nowrousian, Minou; Würtz, Christian; Pöggeler, Stefanie; Kück, Ulrich

    2004-03-01

    One of the most challenging parts of large scale sequencing projects is the identification of functional elements encoded in a genome. Recently, studies of genomes of up to six different Saccharomyces species have demonstrated that a comparative analysis of genome sequences from closely related species is a powerful approach to identify open reading frames and other functional regions within genomes [Science 301 (2003) 71, Nature 423 (2003) 241]. Here, we present a comparison of selected sequences from Sordaria macrospora to their corresponding Neurospora crassa orthologous regions. Our analysis indicates that due to the high degree of sequence similarity and conservation of overall genomic organization, S. macrospora sequence information can be used to simplify the annotation of the N. crassa genome.

  15. Sequence similarities and evolutionary relationships of microbial, plant and animal alpha-amylases.

    PubMed

    Janecek, S

    1994-09-01

    Amino acid sequence comparison of 37 alpha-amylases from microbial, plant and animal sources was performed to identify their mutual sequence similarities in addition to the five already described conserved regions. These sequence regions were examined from structure/function and evolutionary perspectives. An unrooted evolutionary tree of alpha-amylases was constructed on a subset of 55 residues from the alignment of sequence similarities along with conserved regions. The most important new information extracted from the tree was as follows: (a) the close evolutionary relationship of Alteromonas haloplanctis alpha-amylase (thermolabile enzyme from an antarctic psychrotroph) with the already known group of homologous alpha-amylases from streptomycetes, Thermomonospora curvata, insects and mammals, and (b) the remarkable 40.1% identity between starch-saccharifying Bacillus subtilis alpha-amylase and the enzyme from the ruminal bacterium Butyrivibrio fibrisolvens, an alpha-amylase with an unusually large polypeptide chain (943 residues in the mature enzyme). Due to a very high degree of similarity, the whole amino acid sequences of three groups of alpha-amylases, namely (a) fungi and yeasts, (b) plants, and (c) A. haloplanctis, streptomycetes, T. curvata, insects and mammals, were aligned independently and their unrooted distance trees were calculated using these alignments. Possible rooting of the trees was also discussed. Based on the knowledge of the location of the five disulfide bonds in the structure of pig pancreatic alpha-amylase, the possible disulfide bridges were established for each of these groups of homologous alpha-amylases.

  16. Complete nucleotide sequence of the freshwater unicellular cyanobacterium Synechococcus elongatus PCC 6301 chromosome: gene content and organization.

    PubMed

    Sugita, Chieko; Ogata, Koretsugu; Shikata, Masamitsu; Jikuya, Hiroyuki; Takano, Jun; Furumichi, Miho; Kanehisa, Minoru; Omata, Tatsuo; Sugiura, Masahiro; Sugita, Mamoru

    2007-01-01

    The entire genome of the unicellular cyanobacterium Synechococcus elongatus PCC 6301 (formerly Anacystis nidulans Berkeley strain 6301) was sequenced. The genome consisted of a circular chromosome 2,696,255 bp long. A total of 2,525 potential protein-coding genes, two sets of rRNA genes, 45 tRNA genes representing 42 tRNA species, and several genes for small stable RNAs were assigned to the chromosome by similarity searches and computer predictions. The translated products of 56% of the potential protein-coding genes showed sequence similarities to experimentally identified and predicted proteins of known function, and the products of 35% of the genes showed sequence similarities to the translated products of hypothetical genes. The remaining 9% of genes lacked significant similarities to genes for predicted proteins in the public DNA databases. Some 139 genes coding for photosynthesis-related components were identified. Thirty-seven genes for two-component signal transduction systems were also identified. This is the smallest number of such genes identified in cyanobacteria, except for marine cyanobacteria, suggesting that only simple signal transduction systems are found in this strain. The gene arrangement and nucleotide sequence of Synechococcus elongatus PCC 6301 were nearly identical to those of a closely related strain Synechococcus elongatus PCC 7942, except for the presence of a 188.6 kb inversion. The sequences as well as the gene information shown in this paper are available in the Web database, CYORF (http://www.cyano.genome.jp/).

  17. The assessment of epiphytic yeast diversity in sugarcane phyllosphere in Thailand by culture-independent method.

    PubMed

    Nasanit, Rujikan; Tangwong-O-Thai, Apirat; Tantirungkij, Manee; Limtong, Savitree

    2015-12-01

    The diversity of epiphytic yeasts from sugarcane (Saccharum officinarum Linn.) phyllospheres in Thailand was investigated by culture-independent method based on the analysis of the D1/D2 domains of the large subunit rRNA gene sequences. Forty-five samples of sugarcane leaf were collected randomly from ten provinces in Thailand. A total of 1342 clones were obtained from 45 clone libraries. 426 clones (31.7 %) were closely related to yeast strains in the GenBank database, and they were clustered into 31 operational taxonomic units (OTUs) with a similarity threshold of 99 %. All OTU sequences were classified in phylum Basidiomycota which were closely related to 11 yeast species in seven genera including Cryptococcus flavus, Hannaella coprosmaensis, Rhodotorula taiwanensis, Jaminaea angkoreiensis, Malassezia restricta, Pseudozyma antarctica, Pseudozyma aphidis, Pseudozyma hubeiensis, Pseudozyma prolifica, Pseudozyma shanxiensis, and Sporobolomyces vermiculatus. The most predominant yeasts detected belonged to Ustilaginales with 89.4 % relative frequency and the prevalent yeast genus was Pseudozyma. However, the majority were unable to be identified as known yeast species and these sequences may represent the sequences of new yeast taxa. In addition, The OTU that closely related to P. prolifica was commonly detected in sugarcane phyllosphere. Copyright © 2015 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.

  18. Molecular characterization of nucleopolyhedrovirus of three lepidopteran pests using late expression factor-8 gene.

    PubMed

    Jose, Jency; Jalali, S K; Shivalingaswamy, T M; Kumar, N K Krishna; Bhatnagar, R; Bandyopadhyay, A

    2013-06-01

    A PCR based method for detection of viral DNA in nucleopolyhedrovirus of three lepidopterans, Spodoptera litura, Amsacta albistriga and Helicoverpa armigera, was developed by employing the late expression factor-8 (lef-8) gene of three NPV using specific primers. The amplicons of 689, 699 and 665 bp were amplified, respectively, and the nucleotide sequences were submitted to GenBank and the accession numbers were obtained. The sequences of lef-8 gene of S. litura NPV and H. armigera NPV matched with those of their respective references in the GenBank database, thereby confirming their identity, however, the sequence of A. albistriga NPV was the first sequence submitted to the GenBank database. The sequence similarity analysis between the three lef-8 gene of NPV sequenced in the present study revealed that there was no significant similarity between them, however A. albistriga NPV and S. litura NPV were found to be closely related. CLUSTAL alignment of the sequences generated revealed general relatedness among NPVs lef-8 gene. The study confirmed that lef-8 gene can be used for quick and correct discriminatory identification of insect viruses.

  19. New Hepatitis B Virus of Cranes That Has an Unexpected Broad Host Range

    PubMed Central

    Prassolov, Alexej; Hohenberg, Heinz; Kalinina, Tatyana; Schneider, Carola; Cova, Lucyna; Krone, Oliver; Frölich, Kai; Will, Hans; Sirma, Hüseyin

    2003-01-01

    All hepadnaviruses known so far have a very limited host range, restricted to their natural hosts and a few closely related species. This is thought to be due mainly to sequence divergence in the large envelope protein and species-specific differences in host components essential for virus propagation. Here we report an infection of cranes with a novel hepadnavirus, designated CHBV, that has an unexpectedly broad host range and is only distantly evolutionarily related to avihepadnaviruses of related hosts. Direct DNA sequencing of amplified CHBV DNA as well a sequencing of cloned viral genomes revealed that CHBV is most closely related to, although distinct from, Ross' goose hepatitis B virus (RGHBV) and slightly less closely related to duck hepatitis B virus (DHBV). Phylogenetically, cranes are very distant from geese and ducks and are most closely related to herons and storks. Naturally occurring hepadnaviruses in the last two species are highly divergent in sequence from RGHBV and DHBV and do not infect ducks or do so only marginally. In contrast, CHBV from crane sera and recombinant CHBV produced from LMH cells infected primary duck hepatocytes almost as efficiently as DHBV did. This is the first report of a rather broad host range of an avihepadnavirus. Our data imply either usage of similar or identical entry pathways and receptors by DHBV and CHBV, unusual host and virus adaptation mechanisms, or divergent evolution of the host genomes and cellular components required for virus propagation. PMID:12525630

  20. New hepatitis B virus of cranes that has an unexpected broad host range.

    PubMed

    Prassolov, Alexej; Hohenberg, Heinz; Kalinina, Tatyana; Schneider, Carola; Cova, Lucyna; Krone, Oliver; Frölich, Kai; Will, Hans; Sirma, Hüseyin

    2003-02-01

    All hepadnaviruses known so far have a very limited host range, restricted to their natural hosts and a few closely related species. This is thought to be due mainly to sequence divergence in the large envelope protein and species-specific differences in host components essential for virus propagation. Here we report an infection of cranes with a novel hepadnavirus, designated CHBV, that has an unexpectedly broad host range and is only distantly evolutionarily related to avihepadnaviruses of related hosts. Direct DNA sequencing of amplified CHBV DNA as well a sequencing of cloned viral genomes revealed that CHBV is most closely related to, although distinct from, Ross' goose hepatitis B virus (RGHBV) and slightly less closely related to duck hepatitis B virus (DHBV). Phylogenetically, cranes are very distant from geese and ducks and are most closely related to herons and storks. Naturally occurring hepadnaviruses in the last two species are highly divergent in sequence from RGHBV and DHBV and do not infect ducks or do so only marginally. In contrast, CHBV from crane sera and recombinant CHBV produced from LMH cells infected primary duck hepatocytes almost as efficiently as DHBV did. This is the first report of a rather broad host range of an avihepadnavirus. Our data imply either usage of similar or identical entry pathways and receptors by DHBV and CHBV, unusual host and virus adaptation mechanisms, or divergent evolution of the host genomes and cellular components required for virus propagation.

  1. First report of the complete sequence of Sida golden yellow vein virus from Jamaica.

    PubMed

    Stewart, Cheryl S; Kon, Tatsuya; Gilbertson, Robert L; Roye, Marcia E

    2011-08-01

    Begomoviruses are phytopathogens that threaten food security [18]. Sida spp. are ubiquitous weed species found in Jamaica. Sida samples were collected island-wide, DNA was extracted via a modified Dellaporta method, and the viral genome was amplified using degenerate and sequence-specific primers [2, 11]. The amplicons were cloned and sequenced. Sequence analysis revealed that a DNA-A molecule isolated from a plant in Liguanea, St. Andrew, was 90.9% similar to Sida golden yellow vein virus-[United States of America:Homestead:A11], making it a strain of SiGYVV. It was named Sida golden yellow vein virus-[Jamaica:Liguanea 2:2008] (SiGYVV-[JM:Lig2:08]). The cognate DNA-B, previously unreported, was successfully cloned and was most similar to that of Malvastrum yellow mosaic Jamaica virus (MaYMJV). Phylogenetic analysis suggested that this virus was most closely related to begomoviruses that infect malvaceous hosts in Jamaica, Cuba and Florida in the United States.

  2. Entropic fluctuations in DNA sequences

    NASA Astrophysics Data System (ADS)

    Thanos, Dimitrios; Li, Wentian; Provata, Astero

    2018-03-01

    The Local Shannon Entropy (LSE) in blocks is used as a complexity measure to study the information fluctuations along DNA sequences. The LSE of a DNA block maps the local base arrangement information to a single numerical value. It is shown that despite this reduction of information, LSE allows to extract meaningful information related to the detection of repetitive sequences in whole chromosomes and is useful in finding evolutionary differences between organisms. More specifically, large regions of tandem repeats, such as centromeres, can be detected based on their low LSE fluctuations along the chromosome. Furthermore, an empirical investigation of the appropriate block sizes is provided and the relationship of LSE properties with the structure of the underlying repetitive units is revealed by using both computational and mathematical methods. Sequence similarity between the genomic DNA of closely related species also leads to similar LSE values at the orthologous regions. As an application, the LSE covariance function is used to measure the evolutionary distance between several primate genomes.

  3. The tick plasma lectin, Dorin M, is a fibrinogen-related molecule.

    PubMed

    Rego, Ryan O M; Kovár, Vojtĕch; Kopácek, Petr; Weise, Christoph; Man, Petr; Sauman, Ivo; Grubhoffer, Libor

    2006-04-01

    A lectin, named Dorin M, previously isolated and characterized from the hemolymph plasma of the soft tick, Ornithodoros moubata, was cloned and sequenced. The immunofluorescence using confocal microscopy revealed that Dorin M is produced in the tick hemocytes. A tryptic cleavage of Dorin M was performed and the resulting peptide fragments were sequenced by Edman degradation and/or mass spectrometry. Two of three internal peptide sequences displayed a significant similarity to the family of fibrinogen-related molecules. Degenerate primers were designed and used for PCR with hemocyte cDNA as a template. The sequence of the whole Dorin M cDNA was completed by the method of RACE. The tissue-specific expression investigated by RT-PCR revealed that Dorin M, in addition to hemocytes, is significantly expressed in salivary glands. The derived amino-acid sequence clearly shows that Dorin M has a fibrinogen-like domain, and exhibited the most significant similarity with tachylectins 5A and 5B from a horseshoe crab, Tachypleus tridentatus. In addition, other protein and binding characteristics suggest that Dorin M is closely related to tachylectins-5. Since these lectins have been reported to function as non-self recognizing molecules, we believe that Dorin M may play a similar role in an innate immunity of the tick and, possibly, also in pathogen transmission by this vector.

  4. Molecular analysis of the split cox1 gene from the Basidiomycota Agrocybe aegerita: relationship of its introns with homologous Ascomycota introns and divergence levels from common ancestral copies.

    PubMed

    Gonzalez, P; Barroso, G; Labarère, J

    1998-10-05

    The Basidiomycota Agrocybe aegerita (Aa) mitochondrial cox1 gene (6790 nucleotides), encoding a protein of 527aa (58377Da), is split by four large subgroup IB introns possessing site-specific endonucleases assumed to be involved in intron mobility. When compared to other fungal COX1 proteins, the Aa protein is closely related to the COX1 one of the Basidiomycota Schizophyllum commune (Sc). This clade reveals a relationship with the studied Ascomycota ones, with the exception of Schizosaccharomyces pombe (Sp) which ranges in an out-group position compared with both higher fungi divisions. When comparison is extended to other kingdoms, fungal COX1 sequences are found to be more related to algae and plant ones (more than 57.5% aa similarity) than to animal sequences (53.6% aa similarity), contrasting with the previously established close relationship between fungi and animals, based on comparisons of nuclear genes. The four Aa cox1 introns are homologous to Ascomycota or algae cox1 introns sharing the same location within the exonic sequences. The percentages of identity of the intronic nucleotide sequences suggest a possible acquisition by lateral transfers of ancestral copies or of their derived sequences. These identities extend over the whole intronic sequences, arguing in favor of a transfer of the complete intron rather than a transfer limited to the encoded ORF. The intron i4 shares 74% of identity, at the nucleotidic level, with the Podospora anserina (Pa) intron i14, and up to 90.5% of aa similarity between the encoded proteins, i.e. the highest values reported to date between introns of two phylogenetically distant species. This low divergence argues for a recent lateral transfer between the two species. On the contrary, the low sequence identities (below 36%) observed between Aa i1 and the homologous Sp i1 or Prototheca wickeramii (Pw) i1 suggest a long evolution time after the separation of these sequences. The introns i2 and i3 possessed intermediate percentages of identity with their homologous Ascomycota introns. This is the first report of the complete nucleotide sequence and molecular organization of a mitochondrial cox1 gene of any member of the Basidiomycota division.

  5. Comparative Analyses of DNA Methylation and Sequence Evolution Using Nasonia Genomes

    PubMed Central

    Park, Jungsun; Peng, Zuogang; Zeng, Jia; Elango, Navin; Park, Taesung; Wheeler, Dave; Werren, John H.; Yi, Soojin V.

    2011-01-01

    The functional and evolutionary significance of DNA methylation in insect genomes remains to be resolved. Nasonia is well situated for comparative analyses of DNA methylation and genome evolution, since the genomes of a moderately distant outgroup species as well as closely related sibling species are available. Using direct sequencing of bisulfite-converted DNA, we uncovered a substantial level of DNA methylation in 17 of 18 Nasonia vitripennis genes and a strong correlation between methylation level and CpG depletion. Notably, in the sex-determining locus transformer, the exon that is alternatively spliced between the sexes is heavily methylated in both males and females, whereas other exons are only sparsely methylated. Orthologous genes of the honeybee and Nasonia show highly similar relative levels of CpG depletion, despite ∼190 My divergence. Densely and sparsely methylated genes in these species also exhibit similar functional enrichments. We found that the degree of CpG depletion is negatively correlated with substitution rates between closely related Nasonia species for synonymous, nonsynonymous, and intron sites. This suggests that mutation rates increase with decreasing levels of germ line methylation. Thus, DNA methylation is prevalent in the Nasonia genome, may participate in regulatory processes such as sex determination and alternative splicing, and is correlated with several aspects of genome and sequence evolution. PMID:21693438

  6. Community phylogenetic analysis of moderately thermophilic cyanobacterial mats from China, the Philippines and Thailand.

    PubMed

    Hongmei, Jing; Aitchison, Jonathan C; Lacap, Donnabella C; Peerapornpisal, Yuwadee; Sompong, Udomluk; Pointing, Stephen B

    2005-08-01

    Most community molecular studies of thermophilic cyanobacterial mats to date have focused on Synechococcus occurring at temperatures of approximately 50-65 degrees C. These reveal that molecular diversity exceeds that indicated by morphology, and that phylogeographic lineages exist. The moderately thermophilic and generally filamentous cyanobacterial mat communities occurring at lower temperatures have not previously been investigated at the community molecular level. Here we report community diversity in mats of 42-53 degrees C recovered from previously unstudied geothermal locations. Separation of 16S rRNA gene-defined genotypes from community DNA was achieved by DGGE. Genotypic diversity was greater than morphotype diversity in all mats sampled, although genotypes generally corresponded to observed morphotypes. Thirty-six sequences were recovered from DGGE bands. Phylogenetic analyses revealed these to form novel thermophilic lineages distinct from their mesophilic counterparts, within Calothrix, Cyanothece, Fischerella, Phormidium, Pleurocapsa, Oscillatoria and Synechococcus. Where filamentous cyanobacterial sequences belonging to the same genus were recovered from the same site, these were generally closely affiliated. Location-specific sequences were observed for some genotypes recovered from geochemically similar yet spatially separated sites, thus providing evidence for phylogeographic lineages that evolve in isolation. Other genotypes were more closely affiliated to geographically remote counterparts from similar habitats suggesting that adaptation to certain niches is also important.

  7. Identification of Opportunistic Pathogenic Bacteria in Drinking Water Samples of Different Rural Health Centers and Their Clinical Impacts on Humans

    PubMed Central

    Pindi, Pavan Kumar; Raghuveer Yadav, P.; Shiva Shanker, A.

    2013-01-01

    International drinking water quality monitoring programs have been established in order to prevent or to reduce the risk of contracting water-related infections. A survey was performed on groundwater-derived drinking water from 13 different hospitals in the Mahabubnagar District. A total of 55 bacterial strains were isolated which belonged to both gram-positive and gram-negative bacteria. All the taxa were identified based on the 16S rRNA gene sequence analysis based on which they are phylogenetically close to 27 different taxa. Many of the strains are closely related to their phylogenetic neighbors and exhibit from 98.4 to 100% sequence similarity at the 16S rRNA gene sequence level. The most common group was similar to Acinetobacter junii (21.8%) and Acinetobacter calcoaceticus (10.9%) which were shared by 7 and 5 water samples, respectively. Out of 55 isolates, only 3 isolates belonged to coliform group which are Citrobacter freundii and Pantoea anthophila. More than half (52.7%, 29 strains) of the phylogenetic neighbors which belonged to 12 groups were reported to be pathogenic and isolated from clinical specimens. Out of 27 representative taxa are affiliated have eight representative genera in drinking water except for those affiliated with the genera Exiguobacterium, Delftia, Kocuria, and Lysinibacillus. PMID:23862144

  8. GeneBee-net: Internet-based server for analyzing biopolymers

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Brodsky, L.I.; Ivanov, V.V.; Nikolaev, V.K.

    This work describes a network server for searching databanks of biopolymer structures and performing other biocomputing procedures; it is available via direct Internet connection. Basic server procedures are dedicated to homology (similarity) search of sequence and 3D structure of proteins. The homologies found could be used to build multiple alignments, predict protein and RNA secondary structure, and construct phylogenetic trees. In addition to traditional methods of sequence similarity search, the authors propose {open_quotes}non-matrix{close_quotes} (correlational) search. An analogous approach is used to identify regions of similar tertiary structure of proteins. Algorithm concepts and usage examples are presented for new methods. Servicemore » logic is based upon interaction of a client program and server procedures. The client program allows the compilation of queries and the processing of results of an analysis.« less

  9. Molecular cloning, sequence characterization and recombinant expression of Nanog gene in goat fibroblast cells using lentiviral based expression system.

    PubMed

    Singhal, Dinesh K; Singhal, Raxita; Malik, Hruda N; Kumar, Surender; Kumar, Sudarshan; Mohanty, Ashok K; Kaushik, Jai K; Malakar, Dhruba

    2014-01-01

    Nanog is a homeodomain containing protein which plays important roles in regulation of signaling pathways for maintenance and induction of pluripotency in stem cells. Because of its unique expression in stem cells it is also regarded as pluripotency marker. In this study goat Nanog (gNanog) gene has been amplified, cloned and characterized at sequence level with successful over-expression in CHO-K1 cell line using a lentiviral based system. gNanog ORF is 903 bp long which codes for Nanog protein of size 300 amino acids (aas). Complete nucleotide sequence shows some evolutionary mutation in goat in comparision to other species. Protein sequence of goat is highly similar to other species. Overall, gNanog nucleotide sequence and predicted protein sequence showed high similarity and minimum divergence with cattle (96 % identity/4 % divergence) and buffalo (94/5 %) while low similarity and high divergence with pig (84/15 %), human (81/23 %) and mouse (69/40 %) indicating evolutionary closeness of gNanog to cattle and buffalo. gNanog lentiviral expression construct was prepared for over-expression of Nanog gene in adult goat fibroblast cells. Lentiviral expression construct of Nanog enabled continuous protein expression for induction and maintenance of pluripotency. Western blotting revealed the expression of Nanog gene at protein level which supported that the lentiviral expression system is highly promising for Nanog protein expression in differentiated goat cell.

  10. Characterization and assessment of an avian repetitive DNA sequence as an icterid phylogenetic marker.

    PubMed

    Quinn, J S; Guglich, E; Seutin, G; Lau, R; Marsolais, J; Parna, L; Boag, P T; White, B N

    1992-02-01

    The first tandemly repeated sequence examined in a passerine bird, a 431-bp PstI fragment named pMAT1, has been cloned from the genome of the brown-headed cowbird (Molothrus ater). The sequence represents about 5-10% of the genome (about 4 x 10(5) copies) and yields prominent ethidium bromide stained bands when genomic DNA cut with a variety of restriction enzymes is electrophoresed in agarose gels. A particularly striking ladder of fragments is apparent when the DNA is cut with HinfI, indicative of a tandem arrangement of the monomer. The cloned PstI monomer has been sequenced, revealing no internal repeated structure. There are sequences that hybridize with pMAT1 found in related nine-primaried oscines but not in more distantly related oscines, suboscines, or nonpasserine species. Little sequence similarity to tandemly repeated PstI cut sequences from the merlin (Falco columbarius), saurus crane (Grus antigone), or Puerto Rican parrot (Amazona vittata) or to HinfI digested sequence from the Toulouse goose (Anser anser) was detected. The isolated sequence was used as a probe to examine DNA samples of eight members of the tribe Icterini. This examination revealed phylogenetically informative characters. The repeat contains cutting sites from a number of restriction enzymes, which, if sufficiently polymorphic, would provide new phylogenetic characters. Sequences like these, conserved within a species, but variable between closely related species, may be very useful for phylogenetic studies of closely related taxa.

  11. Conifer R2R3-MYB transcription factors: sequence analyses and gene expression in wood-forming tissues of white spruce (Picea glauca)

    PubMed Central

    Bedon, Frank; Grima-Pettenati, Jacqueline; Mackay, John

    2007-01-01

    Background Several members of the R2R3-MYB family of transcription factors act as regulators of lignin and phenylpropanoid metabolism during wood formation in angiosperm and gymnosperm plants. The angiosperm Arabidopsis has over one hundred R2R3-MYBs genes; however, only a few members of this family have been discovered in gymnosperms. Results We isolated and characterised full-length cDNAs encoding R2R3-MYB genes from the gymnosperms white spruce, Picea glauca (13 sequences), and loblolly pine, Pinus taeda L. (five sequences). Sequence similarities and phylogenetic analyses placed the spruce and pine sequences in diverse subgroups of the large R2R3-MYB family, although several of the sequences clustered closely together. We searched the highly variable C-terminal region of diverse plant MYBs for conserved amino acid sequences and identified 20 motifs in the spruce MYBs, nine of which have not previously been reported and three of which are specific to conifers. The number and length of the introns in spruce MYB genes varied significantly, but their positions were well conserved relative to angiosperm MYB genes. Quantitative RTPCR of MYB genes transcript abundance in root and stem tissues revealed diverse expression patterns; three MYB genes were preferentially expressed in secondary xylem, whereas others were preferentially expressed in phloem or were ubiquitous. The MYB genes expressed in xylem, and three others, were up-regulated in the compression wood of leaning trees within 76 hours of induction. Conclusion Our survey of 18 conifer R2R3-MYB genes clearly showed a gene family structure similar to that of Arabidopsis. Three of the sequences are likely to play a role in lignin metabolism and/or wood formation in gymnosperm trees, including a close homolog of the loblolly pine PtMYB4, shown to regulate lignin biosynthesis in transgenic tobacco. PMID:17397551

  12. Evolution of long centromeres in fire ants.

    PubMed

    Huang, Yu-Ching; Lee, Chih-Chi; Kao, Chia-Yi; Chang, Ni-Chen; Lin, Chung-Chi; Shoemaker, DeWayne; Wang, John

    2016-09-15

    Centromeres are essential for accurate chromosome segregation, yet sequence conservation is low even among closely related species. Centromere drive predicts rapid turnover because some centromeric sequences may compete better than others during female meiosis. In addition to sequence composition, longer centromeres may have a transmission advantage. We report the first observations of extremely long centromeres, covering on average 34 % of the chromosomes, in the red imported fire ant Solenopsis invicta. By comparison, cytological examination of Solenopsis geminata revealed typical small centromeric constrictions. Bioinformatics and molecular analyses identified CenSol, the major centromeric satellite DNA repeat. We found that CenSol sequences are very similar between the two species but the CenSol copy number in S. invicta is much greater than that in S. geminata. In addition, centromere expansion in S. invicta is not correlated with the duplication of CenH3. Comparative analyses revealed that several closely related fire ant species also possess long centromeres. Our results are consistent with a model of simple runaway centromere expansion due to centromere drive. We suggest expanded centromeres may be more prevalent in hymenopteran insects, which use haplodiploid sex determination, than previously considered.

  13. Understanding the enormous diversity of bacteriophages: the tailed phages that infect the bacterial family Enterobacteriaceae.

    PubMed

    Grose, Julianne H; Casjens, Sherwood R

    2014-11-01

    Bacteriophages are the predominant biological entity on the planet. The recent explosion of sequence information has made estimates of their diversity possible. We describe the genomic comparison of 337 fully sequenced tailed phages isolated on 18 genera and 31 species of bacteria in the Enterobacteriaceae. These phages were largely unambiguously grouped into 56 diverse clusters (32 lytic and 24 temperate) that have syntenic similarity over >50% of the genomes within each cluster, but substantially less sequence similarity between clusters. Most clusters naturally break into sets of more closely related subclusters, 78% of which are correlated with their host genera. The largest groups of related phages are superclusters united by genome synteny to lambda (81 phages) and T7 (51 phages). This study forms a robust framework for understanding diversity and evolutionary relationships of existing tailed phages, for relating newly discovered phages and for determining host/phage relationships.

  14. Understanding the enormous diversity of bacteriophages: the tailed phages that infect the bacterial family Enterobacteriaceae

    PubMed Central

    Grose, Julianne H.; Casjens, Sherwood R.

    2014-01-01

    Bacteriophages are the predominant biological entity on the planet. The recent explosion of sequence information has made estimates of their diversity possible. We describe the genomic comparison of 337 fully sequenced tailed phages isolated on 18 genera and 31 species of bacteria in the Enterobacteriaceae. These phages were largely unambiguously grouped into 56 diverse clusters (32 lytic and 24 temperate) that have syntenic similarity over >50% of the genomes within each cluster, but substantially less sequence similarity between clusters. Most clusters naturally break into sets of more closely related subclusters, 78% of which are correlated with their host genera. The largest groups of related phages are superclusters united by genome synteny to lambda (81 phages) and T7 (51 phages). This study forms a robust framework for understanding diversity and evolutionary relationships of existing tailed phages, for relating newly discovered phages and for determining host/phage relationships. PMID:25240328

  15. Comparisons of Highly Virulent H5N1 Influenza A Viruses Isolated from Humans and Chickens from Hong Kong

    PubMed Central

    Suarez, David L.; Perdue, Michael L.; Cox, Nancy; Rowe, Thomas; Bender, Catherine; Huang, Jing; Swayne, David E.

    1998-01-01

    Genes of an influenza A (H5N1) virus from a human in Hong Kong isolated in May 1997 were sequenced and found to be all avian-like (K. Subbarao et al., Science 279:393–395, 1998). Gene sequences of this human isolate were compared to those of a highly pathogenic chicken H5N1 influenza virus isolated from Hong Kong in April 1997. Sequence comparisons of all eight RNA segments from the two viruses show greater than 99% sequence identity between them. However, neither isolate’s gene sequence was closely (>95% sequence identity) related to any other gene sequences found in the GenBank database. Phylogenetic analysis demonstrated that the nucleotide sequences of at least four of the eight RNA segments clustered with Eurasian origin avian influenza viruses. The hemagglutinin gene phylogenetic analysis also included the sequences from an additional three human and two chicken H5N1 virus isolates from Hong Kong, and the isolates separated into two closely related groups. However, no single amino acid change separated the chicken origin and human origin isolates, but they all contained multiple basic amino acids at the hemagglutinin cleavage site, which is associated with a highly pathogenic phenotype in poultry. In experimental intravenous inoculation studies with chickens, all seven viruses were highly pathogenic, killing most birds within 24 h. All infected chickens had virtually identical pathologic lesions, including moderate to severe diffuse edema and interstitial pneumonitis. Viral nucleoprotein was most frequently demonstrated in vascular endothelium, macrophages, heterophils, and cardiac myocytes. Asphyxiation from pulmonary edema and generalized cardiovascular collapse were the most likely pathogenic mechanisms responsible for illness and death. In summary, a small number of changes in hemagglutinin gene sequences defined two closely related subgroups, with both subgroups having human and chicken members, among the seven viruses examined from Hong Kong, and all seven viruses were highly pathogenic in chickens and caused similar lesions in experimental inoculations. PMID:9658115

  16. Detection and characterisation of coronaviruses in migratory and non-migratory Australian wild birds.

    PubMed

    Chamings, Anthony; Nelson, Tiffanie M; Vibin, Jessy; Wille, Michelle; Klaassen, Marcel; Alexandersen, Soren

    2018-04-13

    We evaluated the presence of coronaviruses by PCR in 918 Australian wild bird samples collected during 2016-17. Coronaviruses were detected in 141 samples (15.3%) from species of ducks, shorebirds and herons and from multiple sampling locations. Sequencing of selected positive samples found mainly gammacoronaviruses, but also some deltacoronaviruses. The detection rate of coronaviruses was improved by using multiple PCR assays, as no single assay could detect all coronavirus positive samples. Sequencing of the relatively conserved Orf1 PCR amplicons found that Australian duck gammacoronaviruses were similar to duck gammacoronaviruses around the world. Some sequenced shorebird gammacoronaviruses belonged to Charadriiformes lineages, but others were more closely related to duck gammacoronaviruses. Australian duck and heron deltacoronaviruses belonged to lineages with other duck and heron deltacoronaviruses, but were almost 20% different in nucleotide sequence to other deltacoronavirus sequences available. Deltacoronavirus sequences from shorebirds formed a lineage with a deltacoronavirus from a ruddy turnstone detected in the United States. Given that Australian duck gammacoronaviruses are highly similar to those found in other regions, and Australian ducks rarely come into contact with migratory Palearctic duck species, we hypothesise that migratory shorebirds are the important vector for moving wild bird coronaviruses into and out of Australia.

  17. Tropical Archaea: Diversity associated with the surface microlayer of corals

    USGS Publications Warehouse

    Kellogg, C.A.

    2004-01-01

    Recent 16S rDNA studies have focused on detecting uncultivated bacteria associated with Caribbean reef corals in an effort to address the ecological roles of coral-associated microbes. Reports of Archaea associated with fishes and marine invertebrates raised the question of whether Archaea might also be part of the coral-associated microbial community. DNA analysis of mucus from 3 reef-building species of Caribbean corals, Montastraea annularis complex, Diploria strigosa and D. labyrinthiformis in the US Virgin Islands yielded 34 groups of archaeal 16S ribotypes (defined at the level of 97% similarity). The majority (75%) was most closely matched by BLAST searches to sequences derived from marine water column samples, whereas the remaining ribotypes were most similar to sequences isolated from anoxic environments (15%) and hydrothermal vents (9%). Unlike previous 16S studies of coral-associated Bacteria, the results do not suggest specific associations between particular archaeal sequences and individual coral species. Marine Archaea (Groups I, II and III) in addition to Thermoplasma-like, methanogen, and marine benthic crenarchaeote phylotypes, were detected in the mucus of tropical corals. The finding of sequences from coral-associated Archaea that are closely related to strict and facultative anaerobes, as well as to uncultivated Archaea from other types of anoxic environments, suggests that anaerobic micro-niches may exist in coral mucus layers. Archaea, with their unique biogeochemical capabilities, broaden the scope of possible interactions between corals and their associated microbial communities.

  18. Development of a systematic feedback isolation approach for targeted strains from mixed culture systems.

    PubMed

    Poudel, Pramod; Tashiro, Yukihiro; Miyamoto, Hirokuni; Miyamoto, Hisashi; Okugawa, Yuki; Sakai, Kenji

    2017-01-01

    Elucidation of functions of bacteria in a mixed culture system (MCS) such as composting, activated sludge system is difficult, since the system is complicating with many unisolated bacteria. Here, we developed a systematic feedback isolation strategy for the isolation and rapid screening of multiple targeted strains from MCS. Six major strains (Corynebacterium sphenisci, Bacillus thermocloacae, Bacillus thermoamylovorans, Bacillus smithii, Bacillus humi, and Bacillus coagulans), which are detected by denaturing gradient gel electrophoresis (DGGE) analysis in our previous study on MCS for l-lactic acid production, were targeted for isolation. Based on information of suitable cultivation conditions (e.g., media, pH, temperature) from the literature, feedback isolation was performed to form 136 colonies. The following direct colony matrix assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF MS) was optimised as the second screening to narrow down 20 candidate colonies from similar spectra patterns with six closest type strains. This step could distinguish bacteria at the species level with distance similarity scores ≥0.55 corresponding to 16S rRNA gene sequence similarity ≥98.2%, suggesting that this is an effective technique to minimize isolates close to targeted type strains. Analysis of 16S rRNA gene sequences indicated that two targeted strains and one strain related to the target had successfully been isolated, showing high similarities (99.5-100%) with the sequences from the DGGE bands, and that the other candidates were affiliated with three strains that were closely related to the target species. This study proposes a new method for systematic feedback isolation that may be useful for isolating targeted strains from MCS for further investigation. Copyright © 2016 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  19. Reappraisal of the taxonomy of Streptococcus suis serotypes 20, 22 and 26: Streptococcus parasuis sp. nov.

    PubMed

    Nomoto, R; Maruyama, F; Ishida, S; Tohya, M; Sekizaki, T; Osawa, Ro

    2015-02-01

    In order to clarify the taxonomic position of serotypes 20, 22 and 26 of Streptococcus suis, biochemical and molecular genetic studies were performed on isolates (SUT-7, SUT-286(T), SUT-319, SUT-328 and SUT-380) reacted with specific antisera of serotypes 20, 22 or 26 from the saliva of healthy pigs as well as reference strains of serotypes 20, 22 and 26. Comparative recN gene sequencing showed high genetic relatedness among our isolates, but marked differences from the type strain S. suis NCTC 10234(T), i.e. 74.8-75.7 % sequence similarity. The genomic relatedness between the isolates and other strains of species of the genus Streptococcus, including S. suis, was calculated using the average nucleotide identity values of whole genome sequences, which indicated that serotypes 20, 22 and 26 should be removed taxonomically from S. suis and treated as a novel genomic species. Comparative sequence analysis revealed 99.0-100 % sequence similarities for the 16S rRNA genes between the reference strains of serotypes 20, 22 and 26, and our isolates. Isolate STU-286(T) had relatively high 16S rRNA gene sequence similarity with S. suis NCTC 10234(T) (98.8 %). SUT-286(T) could be distinguished from S. suis and other closely related species of the genus Streptococcus using biochemical tests. Due to its phylogenetic and phenotypic similarities to S. suis we propose naming the novel species Streptococcus parasuis sp. nov., with SUT-286(T) ( = JCM 30273(T) = DSM 29126(T)) as the type strain. © 2015 IUMS.

  20. Comparison of the Folding Mechanism of Highly Homologous Proteins in the Lipid-binding Protein Family

    EPA Science Inventory

    The folding mechanism of two closely related proteins in the intracellular lipid binding protein family, human bile acid binding protein (hBABP) and rat bile acid binding protein (rBABP) were examined. These proteins are 77% identical (93% similar) in sequence Both of these singl...

  1. Partial gene sequences for the A subunit of methyl-coenzyme M reductase (mcrI) as a phylogenetic tool for the family Methanosarcinaceae

    NASA Technical Reports Server (NTRS)

    Springer, E.; Sachs, M. S.; Woese, C. R.; Boone, D. R.

    1995-01-01

    Representatives of the family Methanosarcinaceae were analyzed phylogenetically by comparing partial sequences of their methyl-coenzyme M reductase (mcrI) genes. A 490-bp fragment from the A subunit of the gene was selected, amplified by the PCR, cloned, and sequenced for each of 25 strains belonging to the Methanosarcinaceae. The sequences obtained were aligned with the corresponding portions of five previously published sequences, and all of the sequences were compared to determine phylogenetic distances by Fitch distance matrix methods. We prepared analogous trees based on 16S rRNA sequences; these trees corresponded closely to the mcrI trees, although the mcrI sequences of pairs of organisms had 3.01 +/- 0.541 times more changes than the respective pairs of 16S rRNA sequences, suggesting that the mcrI fragment evolved about three times more rapidly than the 16S rRNA gene. The qualitative similarity of the mcrI and 16S rRNA trees suggests that transfer of genetic information between dissimilar organisms has not significantly affected these sequences, although we found inconsistencies between some mcrI distances that we measured and and previously published DNA reassociation data. It is unlikely that multiple mcrI isogenes were present in the organisms that we examined, because we found no major discrepancies in multiple determinations of mcrI sequences from the same organism. Our primers for the PCR also match analogous sites in the previously published mcrII sequences, but all of the sequences that we obtained from members of the Methanosarcinaceae were more closely related to mcrI sequences than to mcrII sequences, suggesting that members of the Methanosarcinaceae do not have distinct mcrII genes.

  2. Poinsettia latent virus is not a cryptic virus, but a natural polerovirus-sobemovirus hybrid

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Siepen, Marc aus dem; Pohl, Jens O.; Koo, Bong-Jin

    2005-06-05

    The biochemical and genetic features of Poinsettia latent virus (PnLV, formerly named Poinsettia cryptic virus), which is spread worldwide in commercial cultivars of Euphorbia pulcherrima without inducing symptoms, have been determined using virus-purification, immunological techniques, electron microscopy, cloning, and sequencing. PnLV was found to be a chimeric virus with one 4652 bases, plus strand RNA showing a close relationship to poleroviruses within the first three quarters of its genome but to sobemoviruses in the last quarter. Thus, we propose to classify this virus as 'polemovirus'. Similarities of protein and nucleic acid sequences at the 5' and extreme 3' end ofmore » its RNA suggest a replication mode like that of poleroviruses, whereas the coat protein sequence is closely related to that of sobemoviruses. Consistent with these results, PnLV forms stable icosahedra of 34 nm in diameter. The consequences for the taxonomy of PnLV and for gardeners' practice are discussed.« less

  3. Development of PCR primers specific for the amplification and direct sequencing of gyrB genes from microbacteria, order Actinomycetales.

    PubMed

    Richert, Kathrin; Brambilla, Evelyne; Stackebrandt, Erko

    2005-01-01

    PCR primer sets were developed for the specific amplification and sequence analyses encoding the gyrase subunit B (gyrB) of members of the family Microbacteriaceae, class Actinobacteria. The family contains species highly related by 16S rRNA gene sequence analyses. In order to test if the gene sequence analysis of gyrB is appropriate to discriminate between closely related species, we evaluate the 16S rRNA gene phylogeny of its members. As the published universal primer set for gyrB failed to amplify the responding gene of the majority of the 80 type strains of the family, three new primer sets were identified that generated fragments with a composite sequence length of about 900 nt. However, the amplification of all three fragments was successful only in 25% of the 80 type strains. In this study, the substitution frequencies in genes encoding gyrase and 16S rDNA were compared for 10 strains of nine genera. The frequency of gyrB nucleotide substitution is significantly higher than that of the 16S rDNA, and no linear correlation exists between the similarities of both molecules among members of the Microbacteriaceae. The phylogenetic analyses using the gyrB sequences provide higher resolution than using 16S rDNA sequences and seem able to discriminate between closely related species.

  4. A cDNA from a mouse pancreatic beta cell encoding a putative transcription factor of the insulin gene.

    PubMed Central

    Walker, M D; Park, C W; Rosen, A; Aronheim, A

    1990-01-01

    Cell specific expression of the insulin gene is achieved through transcriptional mechanisms operating on multiple DNA sequence elements located in the 5' flanking region of the gene. Of particular importance in the rat insulin I gene are two closely similar 9 bp sequences (IEB1 and IEB2): mutation of either of these leads to 5-10 fold reduction in transcriptional activity. We have screened an expression cDNA library derived from mouse pancreatic endocrine beta cells with a radioactive DNA probe containing multiple copies of the IEB1 sequence. A cDNA clone (A1) isolated by this procedure encodes a protein which shows efficient binding to the IEB1 probe, but much weaker binding to either an unrelated DNA probe or to a probe bearing a single base pair insertion within the recognition sequence. DNA sequence analysis indicates a protein belonging to the helix-loop-helix family of DNA-binding proteins. The ability of the protein encoded by clone A1 to recognize a number of wild type and mutant DNA sequences correlates closely with the ability of each sequence element to support transcription in vivo in the context of the insulin 5' flanking DNA. We conclude that the isolated cDNA may encode a transcription factor that participates in control of insulin gene expression. Images PMID:2181401

  5. A Murine Herpesvirus Closely Related to Ubiquitous Human Herpesviruses Causes T-Cell Depletion

    PubMed Central

    Zhao, Guoyan; Penna, Vinay R.; Park, Eugene; Lauron, Elvin J.; Harvey, Ian B.; Beatty, Wandy L.; Plougastel-Douglas, Beatrice; Poursine-Laurent, Jennifer; Fremont, Daved H.; Wang, David

    2017-01-01

    ABSTRACT The human roseoloviruses human herpesvirus 6A (HHV-6A), HHV-6B, and HHV-7 comprise the Roseolovirus genus of the human Betaherpesvirinae subfamily. Infections with these viruses have been implicated in many diseases; however, it has been challenging to establish infections with roseoloviruses as direct drivers of pathology, because they are nearly ubiquitous and display species-specific tropism. Furthermore, controlled study of infection has been hampered by the lack of experimental models, and until now, a mouse roseolovirus has not been identified. Herein we describe a virus that causes severe thymic necrosis in neonatal mice, characterized by a loss of CD4+ T cells. These phenotypes resemble those caused by the previously described mouse thymic virus (MTV), a putative herpesvirus that has not been molecularly characterized. By next-generation sequencing of infected tissue homogenates, we assembled a contiguous 174-kb genome sequence containing 128 unique predicted open reading frames (ORFs), many of which were most closely related to herpesvirus genes. Moreover, the structure of the virus genome and phylogenetic analysis of multiple genes strongly suggested that this virus is a betaherpesvirus more closely related to the roseoloviruses, HHV-6A, HHV-6B, and HHV-7, than to another murine betaherpesvirus, mouse cytomegalovirus (MCMV). As such, we have named this virus murine roseolovirus (MRV) because these data strongly suggest that MRV is a mouse homolog of HHV-6A, HHV-6B, and HHV-7. IMPORTANCE Herein we describe the complete genome sequence of a novel murine herpesvirus. By sequence and phylogenetic analyses, we show that it is a betaherpesvirus most closely related to the roseoloviruses, human herpesviruses 6A, 6B, and 7. These data combined with physiological similarities with human roseoloviruses collectively suggest that this virus is a murine roseolovirus (MRV), the first definitively described rodent roseolovirus, to our knowledge. Many biological and clinical ramifications of roseolovirus infection in humans have been hypothesized, but studies showing definitive causative relationships between infection and disease susceptibility are lacking. Here we show that MRV infects the thymus and causes T-cell depletion, suggesting that other roseoloviruses may have similar properties. PMID:28179532

  6. A Murine Herpesvirus Closely Related to Ubiquitous Human Herpesviruses Causes T-Cell Depletion.

    PubMed

    Patel, Swapneel J; Zhao, Guoyan; Penna, Vinay R; Park, Eugene; Lauron, Elvin J; Harvey, Ian B; Beatty, Wandy L; Plougastel-Douglas, Beatrice; Poursine-Laurent, Jennifer; Fremont, Daved H; Wang, David; Yokoyama, Wayne M

    2017-05-01

    The human roseoloviruses human herpesvirus 6A (HHV-6A), HHV-6B, and HHV-7 comprise the Roseolovirus genus of the human Betaherpesvirinae subfamily. Infections with these viruses have been implicated in many diseases; however, it has been challenging to establish infections with roseoloviruses as direct drivers of pathology, because they are nearly ubiquitous and display species-specific tropism. Furthermore, controlled study of infection has been hampered by the lack of experimental models, and until now, a mouse roseolovirus has not been identified. Herein we describe a virus that causes severe thymic necrosis in neonatal mice, characterized by a loss of CD4 + T cells. These phenotypes resemble those caused by the previously described mouse thymic virus (MTV), a putative herpesvirus that has not been molecularly characterized. By next-generation sequencing of infected tissue homogenates, we assembled a contiguous 174-kb genome sequence containing 128 unique predicted open reading frames (ORFs), many of which were most closely related to herpesvirus genes. Moreover, the structure of the virus genome and phylogenetic analysis of multiple genes strongly suggested that this virus is a betaherpesvirus more closely related to the roseoloviruses, HHV-6A, HHV-6B, and HHV-7, than to another murine betaherpesvirus, mouse cytomegalovirus (MCMV). As such, we have named this virus murine roseolovirus (MRV) because these data strongly suggest that MRV is a mouse homolog of HHV-6A, HHV-6B, and HHV-7. IMPORTANCE Herein we describe the complete genome sequence of a novel murine herpesvirus. By sequence and phylogenetic analyses, we show that it is a betaherpesvirus most closely related to the roseoloviruses, human herpesviruses 6A, 6B, and 7. These data combined with physiological similarities with human roseoloviruses collectively suggest that this virus is a murine roseolovirus (MRV), the first definitively described rodent roseolovirus, to our knowledge. Many biological and clinical ramifications of roseolovirus infection in humans have been hypothesized, but studies showing definitive causative relationships between infection and disease susceptibility are lacking. Here we show that MRV infects the thymus and causes T-cell depletion, suggesting that other roseoloviruses may have similar properties. Copyright © 2017 American Society for Microbiology.

  7. Evolutionary distances in the twilight zone--a rational kernel approach.

    PubMed

    Schwarz, Roland F; Fletcher, William; Förster, Frank; Merget, Benjamin; Wolf, Matthias; Schultz, Jörg; Markowetz, Florian

    2010-12-31

    Phylogenetic tree reconstruction is traditionally based on multiple sequence alignments (MSAs) and heavily depends on the validity of this information bottleneck. With increasing sequence divergence, the quality of MSAs decays quickly. Alignment-free methods, on the other hand, are based on abstract string comparisons and avoid potential alignment problems. However, in general they are not biologically motivated and ignore our knowledge about the evolution of sequences. Thus, it is still a major open question how to define an evolutionary distance metric between divergent sequences that makes use of indel information and known substitution models without the need for a multiple alignment. Here we propose a new evolutionary distance metric to close this gap. It uses finite-state transducers to create a biologically motivated similarity score which models substitutions and indels, and does not depend on a multiple sequence alignment. The sequence similarity score is defined in analogy to pairwise alignments and additionally has the positive semi-definite property. We describe its derivation and show in simulation studies and real-world examples that it is more accurate in reconstructing phylogenies than competing methods. The result is a new and accurate way of determining evolutionary distances in and beyond the twilight zone of sequence alignments that is suitable for large datasets.

  8. Profiling mRNAs of Two Cuscuta Species Reveals Possible Candidate Transcripts Shared by Parasitic Plants

    PubMed Central

    Wijeratne, Saranga; Fraga, Martina; Meulia, Tea; Doohan, Doug; Li, Zhaohu; Qu, Feng

    2013-01-01

    Dodders are among the most important parasitic plants that cause serious yield losses in crop plants. In this report, we sought to unveil the genetic basis of dodder parasitism by profiling the trancriptomes of Cuscuta pentagona and C. suaveolens, two of the most common dodder species using a next-generation RNA sequencing platform. De novo assembly of the sequence reads resulted in more than 46,000 isotigs and contigs (collectively referred to as expressed sequence tags or ESTs) for each species, with more than half of them predicted to encode proteins that share significant sequence similarities with known proteins of non-parasitic plants. Comparing our datasets with transcriptomes of 12 other fully sequenced plant species confirmed a close evolutionary relationship between dodder and tomato. Using a rigorous set of filtering parameters, we were able to identify seven pairs of ESTs that appear to be shared exclusively by parasitic plants, thus providing targets for tailored management approaches. In addition, we also discovered ESTs with sequences similarities to known plant viruses, including cryptic viruses, in the dodder sequence assemblies. Together this study represents the first comprehensive transcriptome profiling of parasitic plants in the Cuscuta genus, and is expected to contribute to our understanding of the molecular mechanisms of parasitic plant-host plant interactions. PMID:24312295

  9. Profiling mRNAs of two Cuscuta species reveals possible candidate transcripts shared by parasitic plants.

    PubMed

    Jiang, Linjian; Wijeratne, Asela J; Wijeratne, Saranga; Fraga, Martina; Meulia, Tea; Doohan, Doug; Li, Zhaohu; Qu, Feng

    2013-01-01

    Dodders are among the most important parasitic plants that cause serious yield losses in crop plants. In this report, we sought to unveil the genetic basis of dodder parasitism by profiling the trancriptomes of Cuscuta pentagona and C. suaveolens, two of the most common dodder species using a next-generation RNA sequencing platform. De novo assembly of the sequence reads resulted in more than 46,000 isotigs and contigs (collectively referred to as expressed sequence tags or ESTs) for each species, with more than half of them predicted to encode proteins that share significant sequence similarities with known proteins of non-parasitic plants. Comparing our datasets with transcriptomes of 12 other fully sequenced plant species confirmed a close evolutionary relationship between dodder and tomato. Using a rigorous set of filtering parameters, we were able to identify seven pairs of ESTs that appear to be shared exclusively by parasitic plants, thus providing targets for tailored management approaches. In addition, we also discovered ESTs with sequences similarities to known plant viruses, including cryptic viruses, in the dodder sequence assemblies. Together this study represents the first comprehensive transcriptome profiling of parasitic plants in the Cuscuta genus, and is expected to contribute to our understanding of the molecular mechanisms of parasitic plant-host plant interactions.

  10. Two Different Rickettsial Bacteria Invading Volvox carteri

    PubMed Central

    Kawafune, Kaoru; Hongoh, Yuichi; Hamaji, Takashi; Sakamoto, Tomoaki; Kurata, Tetsuya; Hirooka, Shunsuke; Miyagishima, Shin-ya; Nozaki, Hisayoshi

    2015-01-01

    Background Bacteria of the family Rickettsiaceae are principally associated with arthropods. Recently, endosymbionts of the Rickettsiaceae have been found in non-phagotrophic cells of the volvocalean green algae Carteria cerasiformis, Pleodorina japonica, and Volvox carteri. Such endosymbionts were present in only C. cerasiformis strain NIES-425 and V. carteri strain UTEX 2180, of various strains of Carteria and V. carteri examined, suggesting that rickettsial endosymbionts may have been transmitted to only a few algal strains very recently. However, in preliminary work, we detected a sequence similar to that of a rickettsial gene in the nuclear genome of V. carteri strain EVE. Methodology/Principal Findings Here we explored the origin of the rickettsial gene-like sequences in the endosymbiont-lacking V. carteri strain EVE, by performing comparative analyses on 13 strains of V. carteri. By reference to our ongoing genomic sequence of rickettsial endosymbionts in C. cerasiformis strain NIES-425 cells, we confirmed that an approximately 9-kbp DNA sequence encompassing a region similar to that of four rickettsial genes was present in the nuclear genome of V. carteri strain EVE. Phylogenetic analyses, and comparisons of the synteny of rickettsial gene-like sequences from various strains of V. carteri, indicated that the rickettsial gene-like sequences in the nuclear genome of V. carteri strain EVE were closely related to rickettsial gene sequences of P. japonica, rather than those of V. carteri strain UTEX 2180. Conclusion/Significance At least two different rickettsial organisms may have invaded the V. carteri lineage, one of which may be the direct ancestor of the endosymbiont of V. carteri strain UTEX 2180, whereas the other may be closely related to the endosymbiont of P. japonica. Endosymbiotic gene transfer from the latter rickettsial organism may have occurred in an ancestor of V. carteri. Thus, the rickettsiae may be widely associated with V. carteri, and likely have often been lost during host evolution. PMID:25671568

  11. Complete genome sequence of a coxsackievirus B3 recombinant isolated from an aseptic meningitis outbreak in eastern China.

    PubMed

    Zhang, Wenqiang; Lin, Xiaojuan; Jiang, Ping; Tao, Zexin; Liu, Xiaolin; Ji, Feng; Wang, Tongzhan; Wang, Suting; Lv, Hui; Xu, Aiqiang; Wang, Haiyan

    2016-08-01

    Coxsackievirus B3 (CV-B3) has frequently been associated with aseptic meningitis outbreaks in China. To identify sequence motifs related to aseptic meningitis and to construct an infectious clone, the genome sequence of 08TC170, a representative strain isolated from cerebrospinal fluid (CSF) samples from an outbreak in Shandong in 2008, was determined, and the coding regions for P1-P3 and VP1 were aligned. The first 21 and last 20 residues were "TTAAAACAGCCTGTGGGTTGT" and "ATTCTCCGCATTCGGTGCGG", respectively. The whole genome consisted of 7401 nucleotides, sharing 80.8 % identity with the prototype strain Nancy and low sequence similarity with members of clusters A-C. In contrast, 08TC170 showed high sequence similarity to members of cluster D. An especially high level of sequence identity (≥97.7 %) was found within a branch constituted by 08TC170 and four Chinese strains that clustered together in all of the P1-P3 phylogenic trees. In addition, 08TC170 also possessed a close relationship to the Hong Kong strain 26362/08 in VP1. Similarity plot analysis showed that 08TC170 was most similar to the Chinese CV-B3 strain SSM in P1 and the partial P2 coding region but to the CV-B5 or E-6 strain in 2C and following regions. A T277A mutation was found in 08TC170 and other strains isolated in 2008-2010, but not in strains isolated before 2008, which had high sequence similarity and formed the cluster A277. The results suggested that 08TC170 was the product of both intertypic recombination and point mutation, whose effects on viral neurovirulence will be investigated in a further study. The high homology between 08TC170 and other strains revealed their co-circulation in mainland China and Hong Kong and indicates that further surveillance is needed.

  12. Molecular cloning of actin genes in Trichomonas vaginalis and phylogeny inferred from actin sequences.

    PubMed

    Bricheux, G; Brugerolle, G

    1997-08-01

    The parasitic protozoan Trichomonas vaginalis is known to contain the ubiquitous and highly conserved protein actin. A genomic library and a cDNA library have been screened to identify and clone the actin gene(s) of T. vaginalis. The nucleotide sequence of one gene and its flanking regions have been determined. The open reading frame encodes a protein of 376 amino acids. The sequence is not interrupted by any introns and the promoter could be represented by a 10 bp motif close to a consensus motif also found upstream of most sequenced T. vaginalis genes. The five different clones isolated from the cDNA library have similar sequences and encode three actin proteins differing only by one or two amino acids. A phylogenetic analysis of 31 actin sequences by distance matrix and parsimony methods, using centractin as outgroup, gives congruent trees with Parabasala branching above Diplomonadida.

  13. Genetic relationships among Hylocereus and Selenicereus vine cacti (Cactaceae): evidence from hybridization and cytological studies.

    PubMed

    Tel-Zur, Noemi; Abbo, Shahal; Bar-Zvi, Dudy; Mizrahi, Yosef

    2004-10-01

    Hylocereus and Selenicereus are native to tropical and sub-tropical America. Based on its taxonomic status and crossability relations it was postulated that H. megalanthus (syn. S. megalanthus) is an allotetraploid (2n = 4x = 44) derived from natural hybridization between two closely related diploid taxa. The present work aimed at elucidating the genetic relationships between species of the two genera. Crosses were performed and the putative hybrids were analysed by chromosome counts and morphological traits. The ploidy level of hybrids was confirmed by fluorescent in situ hybridization (FISH) of rDNA sites. Genomic in situ hybridization (GISH) was used in an attempt to identify the putative diploid genome donors of H. megalanthus and an artificial interploid hybrid. Reciprocal crosses among four diploid Hylocereus species (H. costaricensis, H. monacanthus (syn. H. polyrhizus), H. undatus and Hylocereus sp.) yielded viable diploid hybrids, with regular chromosome pairing. Reciprocal crosses between these Hylocereus spp. and H. megalanthus yielded viable triploid, pentaploid, hexaploid and aneuploid hybrids. Morphological and phenological traits confirm the hybrid origin. In situ detection of rDNA sites was in accord with the ploidy status of the species and hybrid studied. GISH results indicated that overall sequence composition of H. megalanthus is similar to that of H. ocamponis and S. grandiflorus. High sequence similarity was also found between the parental genomes of H. monacanthus and H. megalanthus in one triploid hybrid. The ease of obtaining partially fertile F1 hybrids and the relative sequence similarity (in GISH study) suggest close genetic relationships among the taxa analysed.

  14. Hop stunt viroid: molecular cloning and nucleotide sequence of the complete cDNA copy.

    PubMed Central

    Ohno, T; Takamatsu, N; Meshi, T; Okada, Y

    1983-01-01

    The complete cDNA of hop stunt viroid (HSV) has been cloned by the method of Okayama and Berg (Mol.Cell.Biol.2,161-170. (1982] and the complete nucleotide sequence has been established. The covalently closed circular single-stranded HSV RNA consists of 297 nucleotides. The secondary structure predicted for HSV contains 67% of its residues base-paired. The native HSV can possess an extended rod-like structure characteristic of viroids previously established. The central region of the native HSV has a similar structure to the conserved region found in all viroids sequenced so far except for avocado sunblotch viroid. The sequence homologous to the 5'-end of U1a RNA is also found in the sequence of HSV but not in the central conserved region. Images PMID:6312412

  15. Are humans getting 'mad-cow disease' from eating beef, or something else?

    PubMed

    Concepcion, G P; Padlan, E A

    2003-05-01

    Bovine spongiform encephalopathy (BSE) or 'mad-cow disease' is believed to have been caused by the consumption of scrapie-infected sheep matter that had been added to cattle feed. BSE is then believed to have been transmitted to humans by the consumption of infected beef. We have compared the sequences of human and various animal prion proteins with regards to the fragments that could result from gastric digestion. We noted the close similarity of the sequences of human and rodent prion proteins in a peptic fragment that corresponds very closely to one that had been shown by others to be protease resistant and infective. Since rats and mice are known to be susceptible to prion disease, we propose that ingestion of infected rodent parts, possibly droppings, may be a possible mode of transmission of scrapie or BSE to humans.

  16. Seismic evidence for non-synchronization in two close sdb+dM binaries from Kepler photometry

    NASA Astrophysics Data System (ADS)

    Pablo, Herbert; Kawaler, Steven D.; Reed, M. D.; Bloemen, S.; Charpinet, S.; Hu, H.; Telting, J.; Østensen, R. H.; Baran, A. S.; Green, E. M.; Hermes, J. J.; Barclay, T.; O'Toole, S. J.; Mullally, Fergal; Kurtz, D. W.; Christensen-Dalsgaard, J.; Caldwell, Douglas A.; Christiansen, Jessie L.; Kinemuchi, K.

    2012-05-01

    We report on extended photometry of two pulsating subdwarf B (sdB) stars in close binaries. For both cases, we use rotational splitting of the pulsation frequencies to show that the sdB component rotates much too slowly to be in synchronous rotation. We use a theory of tidal interaction in binary stars to place limits on the mass ratios that are independent of estimates based on the radial velocity curves. The companions have masses below 0.26 M⊙. The pulsation spectra show the signature of high-overtone g-mode pulsation. One star, KIC 11179657, has a clear sequence of g modes with equal period spacings as well as several periodicities that depart from that trend. KIC 02991403 shows a similar sequence, but has many more modes that do not fit the simple pattern.

  17. Using Spreadsheets to Help Students Think Recursively

    ERIC Educational Resources Information Center

    Webber, Robert P.

    2012-01-01

    Spreadsheets lend themselves naturally to recursive computations, since a formula can be defined as a function of one of more preceding cells. A hypothesized closed form for the "n"th term of a recursive sequence can be tested easily by using a spreadsheet to compute a large number of the terms. Similarly, a conjecture about the limit of a series…

  18. Pre-processing SAR image stream to facilitate compression for transport on bandwidth-limited-link

    DOEpatents

    Rush, Bobby G.; Riley, Robert

    2015-09-29

    Pre-processing is applied to a raw VideoSAR (or similar near-video rate) product to transform the image frame sequence into a product that resembles more closely the type of product for which conventional video codecs are designed, while sufficiently maintaining utility and visual quality of the product delivered by the codec.

  19. Reliable differentiation of Meyerozyma guilliermondii from Meyerozyma caribbica by internal transcribed spacer restriction fingerprinting.

    PubMed

    Romi, Wahengbam; Keisam, Santosh; Ahmed, Giasuddin; Jeyaram, Kumaraswamy

    2014-02-28

    Meyerozyma guilliermondii (anamorph Candida guilliermondii) and Meyerozyma caribbica (anamorph Candida fermentati) are closely related species of the genetically heterogenous M. guilliermondii complex. Conventional phenotypic methods frequently misidentify the species within this complex and also with other species of the Saccharomycotina CTG clade. Even the long-established sequencing of large subunit (LSU) rRNA gene remains ambiguous. We also faced similar problem during identification of yeast isolates of M. guilliermondii complex from indigenous bamboo shoot fermentation in North East India. There is a need for development of reliable and accurate identification methods for these closely related species because of their increasing importance as emerging infectious yeasts and associated biotechnological attributes. We targeted the highly variable internal transcribed spacer (ITS) region (ITS1-5.8S-ITS2) and identified seven restriction enzymes through in silico analysis for differentiating M. guilliermondii from M. caribbica. Fifty five isolates of M. guilliermondii complex which could not be delineated into species-specific taxonomic ranks by API 20 C AUX and LSU rRNA gene D1/D2 sequencing were subjected to ITS-restriction fragment length polymorphism (ITS-RFLP) analysis. TaqI ITS-RFLP distinctly differentiated the isolates into M. guilliermondii (47 isolates) and M. caribbica (08 isolates) with reproducible species-specific patterns similar to the in silico prediction. The reliability of this method was validated by ITS1-5.8S-ITS2 sequencing, mitochondrial DNA RFLP and electrophoretic karyotyping. We herein described a reliable ITS-RFLP method for distinct differentiation of frequently misidentified M. guilliermondii from M. caribbica. Even though in silico analysis differentiated other closely related species of M. guilliermondii complex from the above two species, it is yet to be confirmed by in vitro analysis using reference strains. This method can be used as a reliable tool for rapid and accurate identification of closely related species of M. guilliermondii complex and for differentiating emerging infectious yeasts of the Saccharomycotina CTG clade.

  20. Comparative modeling without implicit sequence alignments.

    PubMed

    Kolinski, Andrzej; Gront, Dominik

    2007-10-01

    The number of known protein sequences is about thousand times larger than the number of experimentally solved 3D structures. For more than half of the protein sequences a close or distant structural analog could be identified. The key starting point in a classical comparative modeling is to generate the best possible sequence alignment with a template or templates. With decreasing sequence similarity, the number of errors in the alignments increases and these errors are the main causes of the decreasing accuracy of the molecular models generated. Here we propose a new approach to comparative modeling, which does not require the implicit alignment - the model building phase explores geometric, evolutionary and physical properties of a template (or templates). The proposed method requires prior identification of a template, although the initial sequence alignment is ignored. The model is built using a very efficient reduced representation search engine CABS to find the best possible superposition of the query protein onto the template represented as a 3D multi-featured scaffold. The criteria used include: sequence similarity, predicted secondary structure consistency, local geometric features and hydrophobicity profile. For more difficult cases, the new method qualitatively outperforms existing schemes of comparative modeling. The algorithm unifies de novo modeling, 3D threading and sequence-based methods. The main idea is general and could be easily combined with other efficient modeling tools as Rosetta, UNRES and others.

  1. Characterization of 47 MHC class I sequences in Filipino cynomolgus macaques

    PubMed Central

    Campbell, Kevin J.; Detmer, Ann M.; Karl, Julie A.; Wiseman, Roger W.; Blasky, Alex J.; Hughes, Austin L.; Bimber, Benjamin N.; O’Connor, Shelby L.; O’Connor, David H.

    2009-01-01

    Cynomolgus macaques (Macaca fascicularis) provide increasingly common models for infectious disease research. Several geographically distinct populations of these macaques from Southeast Asia and the Indian Ocean island of Mauritius are available for pathogenesis studies. Though host genetics may profoundly impact results of such studies, similarities and differences between populations are often overlooked. In this study we identified 47 full-length MHC class I nucleotide sequences in 16 cynomolgus macaques of Filipino origin. The majority of MHC class I sequences characterized (39 of 47) were unique to this regional population. However, we discovered eight sequences with perfect identity and six sequences with close similarity to previously defined MHC class I sequences from other macaque populations. We identified two ancestral MHC haplotypes that appear to be shared between Filipino and Mauritian cynomolgus macaques, notably a Mafa-B haplotype that has previously been shown to protect Mauritian cynomolgus macaques against challenge with a simian/human immunodeficiency virus, SHIV89.6P. We also identified a Filipino cynomolgus macaque MHC class I sequence for which the predicted protein sequence differs from Mamu-B*17 by a single amino acid. This is important because Mamu-B*17 is strongly associated with protection against simian immunodeficiency virus (SIV) challenge in Indian rhesus macaques. These findings have implications for the evolutionary history of Filipino cynomolgus macaques as well as for the use of this model in SIV/SHIV research protocols. PMID:19107381

  2. PAQ: Partition Analysis of Quasispecies.

    PubMed

    Baccam, P; Thompson, R J; Fedrigo, O; Carpenter, S; Cornette, J L

    2001-01-01

    The complexities of genetic data may not be accurately described by any single analytical tool. Phylogenetic analysis is often used to study the genetic relationship among different sequences. Evolutionary models and assumptions are invoked to reconstruct trees that describe the phylogenetic relationship among sequences. Genetic databases are rapidly accumulating large amounts of sequences. Newly acquired sequences, which have not yet been characterized, may require preliminary genetic exploration in order to build models describing the evolutionary relationship among sequences. There are clustering techniques that rely less on models of evolution, and thus may provide nice exploratory tools for identifying genetic similarities. Some of the more commonly used clustering methods perform better when data can be grouped into mutually exclusive groups. Genetic data from viral quasispecies, which consist of closely related variants that differ by small changes, however, may best be partitioned by overlapping groups. We have developed an intuitive exploratory program, Partition Analysis of Quasispecies (PAQ), which utilizes a non-hierarchical technique to partition sequences that are genetically similar. PAQ was used to analyze a data set of human immunodeficiency virus type 1 (HIV-1) envelope sequences isolated from different regions of the brain and another data set consisting of the equine infectious anemia virus (EIAV) regulatory gene rev. Analysis of the HIV-1 data set by PAQ was consistent with phylogenetic analysis of the same data, and the EIAV rev variants were partitioned into two overlapping groups. PAQ provides an additional tool which can be used to glean information from genetic data and can be used in conjunction with other tools to study genetic similarities and genetic evolution of viral quasispecies.

  3. Candida mesorugosa sp. nov., a novel yeast species similar to Candida rugosa, isolated from a tertiary hospital in Brazil.

    PubMed

    Chaves, Guilherme M; Terçarioli, Gisela R; Padovan, Ana Carolina B; Rosas, Robert C; Ferreira, Renata C; Melo, Analy S A; Colombo, Arnaldo L

    2013-04-01

    Candida rugosa is a yeast species that is emerging as a causative agent of invasive infection, particularly in Latin America. Recently, C. pseudorugosa was proposed as a new species closely related to C. rugosa. We evaluated in this investigation the genetic heterogeneity within the C. rugosa species complex. All clinical isolates used in this study were identified phenotypically as C. rugosa but were genotypically different from the C. rugosa type, ATCC 10571. RAPD marker analysis revealed less than 83% similarity between our clinical isolates and the C. rugosa type strain. The D1/D2 region sequences of our clinical isolates showed 98% identity with C. rugosa but only 94-95% identity with C. pseudorugosa. The ITS rDNA sequences of the Brazilian isolates showed 91% identity with the C. rugosa ATCC 10571 ITS sequence. Network and Bayesian analyses of ITS and housekeeping gene sequences separated our clinical isolates into different branches from C. rugosa type strain. These differences are sufficient to reassign our isolates to a distinct species, named C. mesorugosa.

  4. Interspecific and intraspecific gene variability in a 1-Mb region containing the highest density of NBS-LRR genes found in the melon genome.

    PubMed

    González, Víctor M; Aventín, Núria; Centeno, Emilio; Puigdomènech, Pere

    2014-12-17

    Plant NBS-LRR -resistance genes tend to be found in clusters, which have been shown to be hot spots of genome variability. In melon, half of the 81 predicted NBS-LRR genes group in nine clusters, and a 1 Mb region on linkage group V contains the highest density of R-genes and presence/absence gene polymorphisms found in the melon genome. This region is known to contain the locus of Vat, an agronomically important gene that confers resistance to aphids. However, the presence of duplications makes the sequencing and annotation of R-gene clusters difficult, usually resulting in multi-gapped sequences with higher than average errors. A 1-Mb sequence that contains the largest NBS-LRR gene cluster found in melon was improved using a strategy that combines Illumina paired-end mapping and PCR-based gap closing. Unknown sequence was decreased by 70% while about 3,000 SNPs and small indels were corrected. As a result, the annotations of 18 of a total of 23 NBS-LRR genes found in this region were modified, including additional coding sequences, amino acid changes, correction of splicing boundaries, or fussion of ORFs in common transcription units. A phylogeny analysis of the R-genes and their comparison with syntenic sequences in other cucurbits point to a pattern of local gene amplifications since the diversification of cucurbits from other families, and through speciation within the family. A candidate Vat gene is proposed based on the sequence similarity between a reported Vat gene from a Korean melon cultivar and a sequence fragment previously absent in the unrefined sequence. A sequence refinement strategy allowed substantial improvement of a 1 Mb fragment of the melon genome and the re-annotation of the largest cluster of NBS-LRR gene homologues found in melon. Analysis of the cluster revealed that resistance genes have been produced by sequence duplication in adjacent genome locations since the divergence of cucurbits from other close families, and through the process of speciation within the family a candidate Vat gene was also identified using sequence previously unavailable, which demonstrates the advantages of genome assembly refinements when analyzing complex regions such as those containing clusters of highly similar genes.

  5. Bacteria Community in the Terrestrial Deep Subsurface Microbiology Research of the Chinese Continent Scientific Drilling

    NASA Astrophysics Data System (ADS)

    Wang, Y.; Xia, Y.; Dong, H.; Dong, X.; Yang, K.; Dong, Z.; Huang, L.

    2005-12-01

    Microbial communities in the deep drill cores from the Chinese Continent Scientific Drilling were analyzed with culture-independent and dependent techniques. Genomic DNA was extracted from two metamorphic rocks: S1 from 430 and S13 from 1033 meters below the ground surface. The 16S rRNA gene was amplified by polymerase chain reaction (PCR) followed by cloning and sequencing. The total cell number was counted using the 4',6-diamidino-2-phenylindole (DAPI) staining and biomass of two specific bacteria were quantified using real-time PCR. Enrichment was set up for a rock from 3911 meters below the surface in medium for authotrophic methanogens (i.e., CO2 + H2). The total cell number in S13 was 1.0 × 104 cells per gram of rock. 16S rRNA gene analysis indicated that low G + C Gram positive sequences were dominant (50 percent of all 54 clone sequenced) followed by the alpha-, beta, and gamma-Proteobacteria. Within the low G + C Gram positive bacteria, most clone sequences were similar to species of Bacillus from various natural environments (deserts, rivers etc.). Within the Proteobacteria, our clone sequences were similar to species of Acinetobacter, Acidovorax, and Aeromonas. The RT-RCP results showed that biomass of two particular clone sequences (CCSD1305, similar to Aeromonas caviae and CCSD1307, similar to Acidovorax facilis) was 95 and 1258 cells/g, respectively. A bacterial isolate was obtained from the 3911-m rock in methanogenic medium. It was Gram negative with no flagella, immobile, and facultative anaerobic, and grows optimally at 65oC. Phylogenetic analysis indicated that it was closely related to the genus of Bacillus. Physiological tests further revealed that it was a strain of Bacillus caldotenax.

  6. The crystal structure of Erwinia amylovora AmyR, a member of the YbjN protein family, shows similarity to type III secretion chaperones but suggests different cellular functions

    PubMed Central

    Bartho, Joseph D.; Bellini, Dom; Wuerges, Jochen; Demitri, Nicola; Toccafondi, Mirco; Schmitt, Armin O.; Zhao, Youfu; Walsh, Martin A.

    2017-01-01

    AmyR is a stress and virulence associated protein from the plant pathogenic Enterobacteriaceae species Erwinia amylovora, and is a functionally conserved ortholog of YbjN from Escherichia coli. The crystal structure of E. amylovora AmyR reveals a class I type III secretion chaperone-like fold, despite the lack of sequence similarity between these two classes of protein and lacking any evidence of a secretion-associated role. The results indicate that AmyR, and YbjN proteins in general, function through protein-protein interactions without any enzymatic action. The YbjN proteins of Enterobacteriaceae show remarkably low sequence similarity with other members of the YbjN protein family in Eubacteria, yet a high level of structural conservation is observed. Across the YbjN protein family sequence conservation is limited to residues stabilising the protein core and dimerization interface, while interacting regions are only conserved between closely related species. This study presents the first structure of a YbjN protein from Enterobacteriaceae, the most highly divergent and well-studied subgroup of YbjN proteins, and an in-depth sequence and structural analysis of this important but poorly understood protein family. PMID:28426806

  7. The crystal structure of Erwinia amylovora AmyR, a member of the YbjN protein family, shows similarity to type III secretion chaperones but suggests different cellular functions.

    PubMed

    Bartho, Joseph D; Bellini, Dom; Wuerges, Jochen; Demitri, Nicola; Toccafondi, Mirco; Schmitt, Armin O; Zhao, Youfu; Walsh, Martin A; Benini, Stefano

    2017-01-01

    AmyR is a stress and virulence associated protein from the plant pathogenic Enterobacteriaceae species Erwinia amylovora, and is a functionally conserved ortholog of YbjN from Escherichia coli. The crystal structure of E. amylovora AmyR reveals a class I type III secretion chaperone-like fold, despite the lack of sequence similarity between these two classes of protein and lacking any evidence of a secretion-associated role. The results indicate that AmyR, and YbjN proteins in general, function through protein-protein interactions without any enzymatic action. The YbjN proteins of Enterobacteriaceae show remarkably low sequence similarity with other members of the YbjN protein family in Eubacteria, yet a high level of structural conservation is observed. Across the YbjN protein family sequence conservation is limited to residues stabilising the protein core and dimerization interface, while interacting regions are only conserved between closely related species. This study presents the first structure of a YbjN protein from Enterobacteriaceae, the most highly divergent and well-studied subgroup of YbjN proteins, and an in-depth sequence and structural analysis of this important but poorly understood protein family.

  8. Bacterial-like PPP protein phosphatases: novel sequence alterations in pathogenic eukaryotes and peculiar features of bacterial sequence similarity.

    PubMed

    Kerk, David; Uhrig, R Glen; Moorhead, Greg B

    2013-01-01

    Reversible phosphorylation is a widespread modification affecting the great majority of eukaryotic cellular proteins, and whose effects influence nearly every cellular function. Protein phosphatases are increasingly recognized as exquisitely regulated contributors to these changes. The PPP (phosphoprotein phosphatase) family comprises enzymes, which catalyze dephosphorylation at serine and threonine residues. Nearly a decade ago, "bacterial-like" enzymes were recognized with similarity to proteins from various bacterial sources: SLPs (Shewanella-like phosphatases), RLPHs (Rhizobiales-like phosphatases), and ALPHs (ApaH-like phosphatases). A recent article from our laboratory appearing in Plant Physiology characterizes their extensive organismal distribution, abundance in plant species, predicted subcellular localization, motif organization, and sequence evolution. One salient observation is the distinct evolutionary trajectory followed by SLP genes and proteins in photosynthetic eukaryotes vs. animal and plant pathogens derived from photosynthetic ancestors. We present here a closer look at sequence data that emphasizes the distinctiveness of pathogen SLP proteins and that suggests that they might represent novel drug targets. A second observation in our original report was the high degree of similarity between the bacterial-like PPPs of eukaryotes and closely related proteins of the "eukaryotic-like" phyla Myxococcales and Planctomycetes. We here reflect on the possible implications of these observations and their importance for future research.

  9. Mass spectrometry-based protein identification by integrating de novo sequencing with database searching.

    PubMed

    Wang, Penghao; Wilson, Susan R

    2013-01-01

    Mass spectrometry-based protein identification is a very challenging task. The main identification approaches include de novo sequencing and database searching. Both approaches have shortcomings, so an integrative approach has been developed. The integrative approach firstly infers partial peptide sequences, known as tags, directly from tandem spectra through de novo sequencing, and then puts these sequences into a database search to see if a close peptide match can be found. However the current implementation of this integrative approach has several limitations. Firstly, simplistic de novo sequencing is applied and only very short sequence tags are used. Secondly, most integrative methods apply an algorithm similar to BLAST to search for exact sequence matches and do not accommodate sequence errors well. Thirdly, by applying these methods the integrated de novo sequencing makes a limited contribution to the scoring model which is still largely based on database searching. We have developed a new integrative protein identification method which can integrate de novo sequencing more efficiently into database searching. Evaluated on large real datasets, our method outperforms popular identification methods.

  10. Discovery of a novel retrovirus sequence in an Australian native rodent (Melomys burtoni): a putative link between gibbon ape leukemia virus and koala retrovirus.

    PubMed

    Simmons, Greg; Clarke, Daniel; McKee, Jeff; Young, Paul; Meers, Joanne

    2014-01-01

    Gibbon ape leukaemia virus (GALV) and koala retrovirus (KoRV) share a remarkably close sequence identity despite the fact that they occur in distantly related mammals on different continents. It has previously been suggested that infection of their respective hosts may have occurred as a result of a species jump from another, as yet unidentified vertebrate host. To investigate possible sources of these retroviruses in the Australian context, DNA samples were obtained from 42 vertebrate species and screened using PCR in order to detect proviral sequences closely related to KoRV and GALV. Four proviral partial sequences totalling 2880 bases which share a strong similarity with KoRV and GALV were detected in DNA from a native Australian rodent, the grassland melomys, Melomys burtoni. We have designated this novel gammaretrovirus Melomys burtoni retrovirus (MbRV). The concatenated nucleotide sequence of MbRV shares 93% identity with the corresponding sequence from GALV-SEATO and 83% identity with KoRV. The geographic ranges of the grassland melomys and of the koala partially overlap. Thus a species jump by MbRV from melomys to koalas is conceivable. However the genus Melomys does not occur in mainland South East Asia and so it appears most likely that another as yet unidentified host was the source of GALV.

  11. The primary structure of fatty-acid-binding protein from nurse shark liver. Structural and evolutionary relationship to the mammalian fatty-acid-binding protein family.

    PubMed

    Medzihradszky, K F; Gibson, B W; Kaur, S; Yu, Z H; Medzihradszky, D; Burlingame, A L; Bass, N M

    1992-02-01

    The primary structure of a fatty-acid-binding protein (FABP) isolated from the liver of the nurse shark (Ginglymostoma cirratum) was determined by high-performance tandem mass spectrometry (employing multichannel array detection) and Edman degradation. Shark liver FABP consists of 132 amino acids with an acetylated N-terminal valine. The chemical molecular mass of the intact protein determined by electrospray ionization mass spectrometry (Mr = 15124 +/- 2.5) was in good agreement with that calculated from the amino acid sequence (Mr = 15121.3). The amino acid sequence of shark liver FABP displays significantly greater similarity to the FABP expressed in mammalian heart, peripheral nerve myelin and adipose tissue (61-53% sequence similarity) than to the FABP expressed in mammalian liver (22% similarity). Phylogenetic trees derived from the comparison of the shark liver FABP amino acid sequence with the members of the mammalian fatty-acid/retinoid-binding protein gene family indicate the initial divergence of an ancestral gene into two major subfamilies: one comprising the genes for mammalian liver FABP and gastrotropin, the other comprising the genes for mammalian cellular retinol-binding proteins I and II, cellular retinoic-acid-binding protein myelin P2 protein, adipocyte FABP, heart FABP and shark liver FABP, the latter having diverged from the ancestral gene that ultimately gave rise to the present day mammalian heart-FABP, adipocyte FABP and myelin P2 protein sequences. The sequence for intestinal FABP from the rat could be assigned to either subfamily, depending on the approach used for phylogenetic tree construction, but clearly diverged at a relatively early evolutionary time point. Indeed, sequences proximately ancestral or closely related to mammalian intestinal FABP, liver FABP, gastrotropin and the retinoid-binding group of proteins appear to have arisen prior to the divergence of shark liver FABP and should therefore also be present in elasmobranchs. The presence in shark liver of an FABP which differs substantially in primary structure from mammalian liver FABP, while being closely related to the FABP expressed in mammalian heart muscle, peripheral nerve myelin and adipocytes, opens a further dimension regarding the question of the existence of structure-dependent and tissue-specific specialization of FABP function in lipid metabolism.

  12. Impact of cultivation on characterisation of species composition of soil bacterial communities.

    PubMed

    McCaig, A E.; Grayston, S J.; Prosser, J I.; Glover, L A.

    2001-03-01

    The species composition of culturable bacteria in Scottish grassland soils was investigated using a combination of Biolog and 16S rDNA analysis for characterisation of isolates. The inclusion of a molecular approach allowed direct comparison of sequences from culturable bacteria with sequences obtained during analysis of DNA extracted directly from the same soil samples. Bacterial strains were isolated on Pseudomonas isolation agar (PIA), a selective medium, and on tryptone soya agar (TSA), a general laboratory medium. In total, 12 and 21 morphologically different bacterial cultures were isolated on PIA and TSA, respectively. Biolog and sequencing placed PIA isolates in the same taxonomic groups, the majority of cultures belonging to the Pseudomonas (sensu stricto) group. However, analysis of 16S rDNA sequences proved more efficient than Biolog for characterising TSA isolates due to limitations of the Microlog database for identifying environmental bacteria. In general, 16S rDNA sequences from TSA isolates showed high similarities to cultured species represented in sequence databases, although TSA-8 showed only 92.5% similarity to the nearest relative, Bacillus insolitus. In general, there was very little overlap between the culturable and uncultured bacterial communities, although two sequences, PIA-2 and TSA-13, showed >99% similarity to soil clones. A cloning step was included prior to sequence analysis of two isolates, TSA-5 and TSA-14, and analysis of several clones confirmed that these cultures comprised at least four and three sequence types, respectively. All isolate clones were most closely related to uncultured bacteria, with clone TSA-5.1 showing 99.8% similarity to a sequence amplified directly from the same soil sample. Interestingly, one clone, TSA-5.4, clustered within a novel group comprising only uncultured sequences. This group, which is associated with the novel, deep-branching Acidobacterium capsulatum lineage, also included clones isolated during direct analysis of the same soil and from a wide range of other sample types studied elsewhere. The study demonstrates the value of fine-scale molecular analysis for identification of laboratory isolates and indicates the culturability of approximately 1% of the total population but under a restricted range of media and cultivation conditions.

  13. StralSV: assessment of sequence variability within similar 3D structures and application to polio RNA-dependent RNA polymerase.

    PubMed

    Zemla, Adam T; Lang, Dorothy M; Kostova, Tanya; Andino, Raul; Ecale Zhou, Carol L

    2011-06-02

    Most of the currently used methods for protein function prediction rely on sequence-based comparisons between a query protein and those for which a functional annotation is provided. A serious limitation of sequence similarity-based approaches for identifying residue conservation among proteins is the low confidence in assigning residue-residue correspondences among proteins when the level of sequence identity between the compared proteins is poor. Multiple sequence alignment methods are more satisfactory--still, they cannot provide reliable results at low levels of sequence identity. Our goal in the current work was to develop an algorithm that could help overcome these difficulties by facilitating the identification of structurally (and possibly functionally) relevant residue-residue correspondences between compared protein structures. Here we present StralSV (structure-alignment sequence variability), a new algorithm for detecting closely related structure fragments and quantifying residue frequency from tight local structure alignments. We apply StralSV in a study of the RNA-dependent RNA polymerase of poliovirus, and we demonstrate that the algorithm can be used to determine regions of the protein that are relatively unique, or that share structural similarity with proteins that would be considered distantly related. By quantifying residue frequencies among many residue-residue pairs extracted from local structural alignments, one can infer potential structural or functional importance of specific residues that are determined to be highly conserved or that deviate from a consensus. We further demonstrate that considerable detailed structural and phylogenetic information can be derived from StralSV analyses. StralSV is a new structure-based algorithm for identifying and aligning structure fragments that have similarity to a reference protein. StralSV analysis can be used to quantify residue-residue correspondences and identify residues that may be of particular structural or functional importance, as well as unusual or unexpected residues at a given sequence position. StralSV is provided as a web service at http://proteinmodel.org/AS2TS/STRALSV/.

  14. The siRNA Non-seed Region and Its Target Sequences Are Auxiliary Determinants of Off-Target Effects.

    PubMed

    Kamola, Piotr J; Nakano, Yuko; Takahashi, Tomoko; Wilson, Paul A; Ui-Tei, Kumiko

    2015-12-01

    RNA interference (RNAi) is a powerful tool for post-transcriptional gene silencing. However, the siRNA guide strand may bind unintended off-target transcripts via partial sequence complementarity by a mechanism closely mirroring micro RNA (miRNA) silencing. To better understand these off-target effects, we investigated the correlation between sequence features within various subsections of siRNA guide strands, and its corresponding target sequences, with off-target activities. Our results confirm previous reports that strength of base-pairing in the siRNA seed region is the primary factor determining the efficiency of off-target silencing. However, the degree of downregulation of off-target transcripts with shared seed sequence is not necessarily similar, suggesting that there are additional auxiliary factors that influence the silencing potential. Here, we demonstrate that both the melting temperature (Tm) in a subsection of siRNA non-seed region, and the GC contents of its corresponding target sequences, are negatively correlated with the efficiency of off-target effect. Analysis of experimentally validated miRNA targets demonstrated a similar trend, indicating a putative conserved mechanistic feature of seed region-dependent targeting mechanism. These observations may prove useful as parameters for off-target prediction algorithms and improve siRNA 'specificity' design rules.

  15. Streptococcus oricebi sp. nov., isolated from the oral cavity of tufted capuchin.

    PubMed

    Saito, M; Shinozaki-Kuwahara, N; Hirasawa, M; Takada, K

    2016-02-01

    A Gram-stain-positive, catalase-negative, coccus-shaped organism was isolated from the oral cavity of tufted capuchin (Cebus apella). Comparative 16S rRNA gene sequence analysis suggested classification of the organism within the genus Streptococcus. Strain M8T was related most closely to Streptococcus oralis ATCC 35037T (96.17 % similarity) followed by Streptococcus massiliensis CCUG 49690T (95.90 %) based on the 16S rRNA gene. Strain M8T was related most closely to S. massiliensis CCUG 49690T (86.58 %) based on the RNA polymerase β subunit-encoding gene (rpoB), and to Streptococcus tigurinus AZ_3aT (81.26 %) followed by S. massiliensis CCUG 49690T (80.45 %) based on the 60 kDa heat-shock protein gene (groEL). The phylogenetic trees of 16S rRNA, rpoB and groEL gene sequences showed that strain M8T was most closely related to S. massiliensis. Based on phenotypic characterization as well as 16S rRNA gene and housekeeping gene (rpoB and groEL) sequence data, a novel taxon, Streptococcus oricebi sp. nov. (type strain M8T = JCM 30719T = DSM 100101T), is proposed.

  16. Methylobacterium variabile sp. nov., a methylotrophic bacterium isolated from an aquatic environment.

    PubMed

    Gallego, Virginia; García, Maria Teresa; Ventosa, Antonio

    2005-07-01

    Strain GR3(T) was isolated from drinking water during a screening programme to monitor the bacterial population present in the distribution system of Seville (Spain), and it was studied phenotypically, genotypically and phylogenetically. This pink-pigmented bacterium was identified as a Methylobacterium sp. Members of this genus are distributed in a wide variety of natural habitats, including soil, dust, air, freshwater and aquatic sediments. Phylogenetic analysis of the 16S rRNA gene sequence showed that strain GR3(T) was closely related to Methylobacterium aquaticum (97.4% sequence similarity), whereas sequence similarity values with respect to the rest of the species belonging to this genus were lower than 96%. Furthermore, the DNA-DNA hybridization data and its phenotypic characteristics clearly indicate that the isolate represents a novel Methylobacterium species, for which the name Methylobacterium variabile sp. nov. is proposed. GR3(T) (=DSM 16961(T)=CCM 7281(T)=CECT 7045(T)) is the type strain; the DNA G+C content of this strain is 69.2 mol%.

  17. Bacteria of an anaerobic 1,2-dichloropropane-dechlorinating mixed culture are phylogenetically related to those of other anaerobic dechlorinating consortia.

    PubMed

    Schlötelburg, C; von Wintzingerode, F; Hauck, R; Hegemann, W; Göbel, U B

    2000-07-01

    A 16S-rDNA-based molecular study was performed to determine the bacterial diversity of an anaerobic, 1,2-dichloropropane-dechlorinating bioreactor consortium derived from sediment of the River Saale, Germany. Total community DNA was extracted and bacterial 16S rRNA genes were subsequently amplified using conserved primers. A clone library was constructed and analysed by sequencing the 16S rDNA inserts of randomly chosen clones followed by dot blot hybridization with labelled polynucleotide probes. The phylogenetic analysis revealed significant sequence similarities of several as yet uncultured bacterial species in the bioreactor to those found in other reductively dechlorinating freshwater consortia. In contrast, no close relationship was obtained with as yet uncultured bacteria found in reductively dechlorinating consortia derived from marine habitats. One rDNA clone showed >97% sequence similarity to Dehalobacter species, known for reductive dechlorination of tri- and tetrachloroethene. These results suggest that reductive dechlorination in microbial freshwater habitats depends upon a specific bacterial community structure.

  18. Cryptic diversity in European bats.

    PubMed Central

    Mayer, F.; von Helversen, O.

    2001-01-01

    Different species of bat can be morphologically very similar. In order to estimate the amount of cryptic diversity among European bats we screened the intra- and interspecific genetic variation in 26 European vespertilionid bat species. We sequenced the DNA of subunit 1 of the mitochondrial protein NADH dehydrogenase (ND1) from several individuals of a species, which were sampled in a variety of geographical regions. A phylogeny based on the mitochondrial (mt) DNA data is in good agreement with the current classification in the family. Highly divergent mitochondrial lineages were found in two taxa, which differed in at least 11% of their ND1 sequence. The two mtDNA lineages in Plecotus austriacus correlated with the two subspecies Plecotus austriacus austriacus and Plecotus austriacus kolombatovici. The two mtDNA lineages in Myotis mystacinus were partitioned among two morphotypes. The evidence for two new bat species within Europe is discussed. Convergent adaptive evolution might have contributed to the morphological similarity among distantly related species if they occupy similar ecological niches. Closely related species may differ in their ecology but not necessarily in their morphology. On the other hand, two morphologically clearly different species (Eptesicus serotinus and Eptesicus nilssonii) were found to be genetically very similar. Neither morphological nor mitochondrial DNA sequence analysis alone can be guaranteed to identify species. PMID:11522202

  19. The complete nucleotide sequence and genome organization of a novel betaflexivirus infecting Citrullus lanatus.

    PubMed

    Xin, Min; Zhang, Peipei; Liu, Wenwen; Ren, Yingdang; Cao, Mengji; Wang, Xifeng

    2017-10-01

    The complete nucleotide sequence of a novel positive single-stranded (+ss) RNA virus, tentatively named watermelon virus A (WVA), was determined using a combination of three methods: RNA sequencing, small RNA sequencing, and Sanger sequencing. The full genome of WVA is comprised of 8,372 nucleotides (nt), excluding the poly (A) tail, and contains four open reading frames (ORFs). The largest ORF, ORF1 encodes a putative replication-associated polyprotein (RP) with three conserved domains. ORF2 and ORF4 encode a movement protein (MP) and coat protein (CP), respectively. The putative product encoded by ORF3, of an estimated molecular mass of 25 kDa, has no significant similarity with other proteins. Identity and phylogenetic analysis indicate that WVA is a new virus, closely related to members of the family Betaflexiviridae. However, the final taxonomic allocation of WVA within the family is yet to be determined.

  20. Comparative sequence analysis of B5R gene of zoonotic buffalo pox virus isolates with other orthopoxviruses.

    PubMed

    Chandranaik, B M; Singh, Raj Kumar; Hosamani, Mahusudan; Krishnappa, Giriappa; Harish, Balur R; Chethana, C S; Renukaprasad, C

    2011-02-01

    The present paper describes the isolation of buffalo pox virus from scab lesions and its molecular characterization through B5R gene sequencing. During our study, pustular pox lesions were observed on the teats and mammary parenchyma of cattle and buffaloes, and the disease was of significant zoonotic importance since similar lesions were produced on the hands, legs, and face of people in close contact with the affected animals. The collected scab materials were subjected for virus isolation in 9-11-day-old chicken embryos by the chorioallontoic membrane route and in the Vero cell line. The virus was confirmed by a sensitive and rapid diagnostic polymerase chain reaction using the primers that amplify "A type inclusion" gene, and further, B5R gene of the virus was sequenced and compared with the corresponding sequences of other orthopoxviruses. The results showed high sequence homology of our isolates with other orthopoxviruses.

  1. Phylogenetic characterization of a biogas plant microbial community integrating clone library 16S-rDNA sequences and metagenome sequence data obtained by 454-pyrosequencing.

    PubMed

    Kröber, Magdalena; Bekel, Thomas; Diaz, Naryttza N; Goesmann, Alexander; Jaenicke, Sebastian; Krause, Lutz; Miller, Dimitri; Runte, Kai J; Viehöver, Prisca; Pühler, Alfred; Schlüter, Andreas

    2009-06-01

    The phylogenetic structure of the microbial community residing in a fermentation sample from a production-scale biogas plant fed with maize silage, green rye and liquid manure was analysed by an integrated approach using clone library sequences and metagenome sequence data obtained by 454-pyrosequencing. Sequencing of 109 clones from a bacterial and an archaeal 16S-rDNA amplicon library revealed that the obtained nucleotide sequences are similar but not identical to 16S-rDNA database sequences derived from different anaerobic environments including digestors and bioreactors. Most of the bacterial 16S-rDNA sequences could be assigned to the phylum Firmicutes with the most abundant class Clostridia and to the class Bacteroidetes, whereas most archaeal 16S-rDNA sequences cluster close to the methanogen Methanoculleus bourgensis. Further sequences of the archaeal library most probably represent so far non-characterised species within the genus Methanoculleus. A similar result derived from phylogenetic analysis of mcrA clone sequences. The mcrA gene product encodes the alpha-subunit of methyl-coenzyme-M reductase involved in the final step of methanogenesis. BLASTn analysis applying stringent settings resulted in assignment of 16S-rDNA metagenome sequence reads to 62 16S-rDNA amplicon sequences thus enabling frequency of abundance estimations for 16S-rDNA clone library sequences. Ribosomal Database Project (RDP) Classifier processing of metagenome 16S-rDNA reads revealed abundance of the phyla Firmicutes, Bacteroidetes and Euryarchaeota and the orders Clostridiales, Bacteroidales and Methanomicrobiales. Moreover, a large fraction of 16S-rDNA metagenome reads could not be assigned to lower taxonomic ranks, demonstrating that numerous microorganisms in the analysed fermentation sample of the biogas plant are still unclassified or unknown.

  2. Whole genome evaluation of tandem repeat polymorphisms between two pathogenically similar strains of Xylella fastidiosa isolated from almond and grape in California

    USDA-ARS?s Scientific Manuscript database

    Whole genome tandem repeat polymorphisms were evaluated between two closely related Xylella fastidiosa strains, M23 and Temecula1, both cause almond leaf scorch disease (ALSD) and grape Pierce’s disease (PD) in California. Strain M23 was isolated from almond and the genome was sequenced in this stu...

  3. A brief period of eyes-closed rest enhances motor skill consolidation.

    PubMed

    Humiston, Graelyn B; Wamsley, Erin J

    2018-06-05

    Post-training sleep benefits both declarative and procedural memory consolidation. However, recent research suggests that eyes-closed waking rest may provide a similar benefit. Brokaw et al. (2016), for example, recently demonstrated that verbal declarative memory improved more following a 15 min period of waking rest, in comparison to 15 min of active wake. Here, we used the same procedures to test whether procedural memory similarly benefits from waking rest. Participants were trained on the Motor Sequence Task (MST), followed by a 15 min retention interval during which they either rested with their eyes closed or completed a distractor task. Rest significantly enhanced MST performance, mirroring the effect observed in Brokaw et al. (2016) and demonstrating that waking rest benefits the early stages of procedural memory. An additional group of participants tested 4 h later displayed no effect of rest. Overall, these results suggest that the early MST performance "boost" described in prior studies may depend on post-learning state. Copyright © 2018 Elsevier Inc. All rights reserved.

  4. Purification and characterization of moschins, arginine-glutamate-rich proteins with translation-inhibiting activity from brown pumpkin (Cucurbita moschata) seeds.

    PubMed

    Ng, T B; Parkash, A; Tso, W W

    2002-10-01

    From fresh brown pumpkin seeds, two proteins with a molecular mass of 12kDa and an N-terminal sequence rich in arginine and glutamate residues were obtained. The protein designated alpha-moschin closely resembled the fruitfly programmed-cell death gene product and the protein designated beta-moschin demonstrated striking similarity to prepro 2S albumin in N-terminal sequence. alpha- and beta-moschins inhibited translation in the rabbit reticulocyte lysate system with an IC(50) of 17 microM and 300nM, respectively.

  5. The tiger genome and comparative analysis with lion and snow leopard genomes.

    PubMed

    Cho, Yun Sung; Hu, Li; Hou, Haolong; Lee, Hang; Xu, Jiaohui; Kwon, Soowhan; Oh, Sukhun; Kim, Hak-Min; Jho, Sungwoong; Kim, Sangsoo; Shin, Young-Ah; Kim, Byung Chul; Kim, Hyunmin; Kim, Chang-Uk; Luo, Shu-Jin; Johnson, Warren E; Koepfli, Klaus-Peter; Schmidt-Küntzel, Anne; Turner, Jason A; Marker, Laurie; Harper, Cindy; Miller, Susan M; Jacobs, Wilhelm; Bertola, Laura D; Kim, Tae Hyung; Lee, Sunghoon; Zhou, Qian; Jung, Hyun-Ju; Xu, Xiao; Gadhvi, Priyvrat; Xu, Pengwei; Xiong, Yingqi; Luo, Yadan; Pan, Shengkai; Gou, Caiyun; Chu, Xiuhui; Zhang, Jilin; Liu, Sanyang; He, Jing; Chen, Ying; Yang, Linfeng; Yang, Yulan; He, Jiaju; Liu, Sha; Wang, Junyi; Kim, Chul Hong; Kwak, Hwanjong; Kim, Jong-Soo; Hwang, Seungwoo; Ko, Junsu; Kim, Chang-Bae; Kim, Sangtae; Bayarlkhagva, Damdin; Paek, Woon Kee; Kim, Seong-Jin; O'Brien, Stephen J; Wang, Jun; Bhak, Jong

    2013-01-01

    Tigers and their close relatives (Panthera) are some of the world's most endangered species. Here we report the de novo assembly of an Amur tiger whole-genome sequence as well as the genomic sequences of a white Bengal tiger, African lion, white African lion and snow leopard. Through comparative genetic analyses of these genomes, we find genetic signatures that may reflect molecular adaptations consistent with the big cats' hypercarnivorous diet and muscle strength. We report a snow leopard-specific genetic determinant in EGLN1 (Met39>Lys39), which is likely to be associated with adaptation to high altitude. We also detect a TYR260G>A mutation likely responsible for the white lion coat colour. Tiger and cat genomes show similar repeat composition and an appreciably conserved synteny. Genomic data from the five big cats provide an invaluable resource for resolving easily identifiable phenotypes evident in very close, but distinct, species.

  6. A new Notomastus (Annelida, Capitellidae) species from Korean waters, with genetic comparison based on three gene markers.

    PubMed

    Jeong, Man-Ki; Soh, Ho Young; Wi, Jin Hee; Suh, Hae-Lip

    2018-01-01

    Notomastus koreanus sp. n. , collected from the sublittoral muddy bottom of Korean waters, is described as a new species. The Korean new species closely resembles N. torquatus Hutchings & Rainer, 1979 in the chaetal arrangement and the details of abdominal segments, but differs in the position of genital pores and the absence of eyes. DNA sequences (mtCOI, 16S rRNA, and histone H3) of the new species were compared with all the available sequences of Notomastus species in the GenBank database. Three genes showed significant genetic differences between the new species and its congeners (COI: 51.2%, 16S: 38.1-47.3%, H3: 3.7-9.3%). This study also includes a comprehensive comparison of the new Korean Notomastus species with its most closely similar species, based on the morphological and genetic results.

  7. Maguari Virus Associated with Human Disease

    PubMed Central

    Groseth, Allison; Vine, Veronica; Weisend, Carla; Guevara, Carolina; Watts, Douglas; Russell, Brandy; Tesh, Robert B.

    2017-01-01

    Despite the lack of evidence for symptomatic human infection with Maguari virus (MAGV), its close relation to Cache Valley virus (CVV), which does infect humans, remains a concern. We sequenced the complete genome of a MAGV-like isolate (OBS6657) obtained from a febrile patient in Pucallpa, Ucayali, Peru, in 1998. To facilitate its classification, we generated additional full-length sequences for the MAGV prototype strain, 3 additional MAGV-like isolates, and the closely related CVV (7 strains), Tlacotalpan (1 strain), Playas (3 strains), and Fort Sherman (1 strain) viruses. The OBS6657 isolate is similar to the MAGV prototype, whereas 2 of the other MAGV-like isolates are located on a distinct branch and most likely warrant classification as a separate virus species and 1 is, in fact, a misclassified CVV strain. Our findings provide clear evidence that MAGV can cause human disease. PMID:28726602

  8. The tiger genome and comparative analysis with lion and snow leopard genomes

    PubMed Central

    Cho, Yun Sung; Hu, Li; Hou, Haolong; Lee, Hang; Xu, Jiaohui; Kwon, Soowhan; Oh, Sukhun; Kim, Hak-Min; Jho, Sungwoong; Kim, Sangsoo; Shin, Young-Ah; Kim, Byung Chul; Kim, Hyunmin; Kim, Chang-uk; Luo, Shu-Jin; Johnson, Warren E.; Koepfli, Klaus-Peter; Schmidt-Küntzel, Anne; Turner, Jason A.; Marker, Laurie; Harper, Cindy; Miller, Susan M.; Jacobs, Wilhelm; Bertola, Laura D.; Kim, Tae Hyung; Lee, Sunghoon; Zhou, Qian; Jung, Hyun-Ju; Xu, Xiao; Gadhvi, Priyvrat; Xu, Pengwei; Xiong, Yingqi; Luo, Yadan; Pan, Shengkai; Gou, Caiyun; Chu, Xiuhui; Zhang, Jilin; Liu, Sanyang; He, Jing; Chen, Ying; Yang, Linfeng; Yang, Yulan; He, Jiaju; Liu, Sha; Wang, Junyi; Kim, Chul Hong; Kwak, Hwanjong; Kim, Jong-Soo; Hwang, Seungwoo; Ko, Junsu; Kim, Chang-Bae; Kim, Sangtae; Bayarlkhagva, Damdin; Paek, Woon Kee; Kim, Seong-Jin; O’Brien, Stephen J.; Wang, Jun; Bhak, Jong

    2013-01-01

    Tigers and their close relatives (Panthera) are some of the world’s most endangered species. Here we report the de novo assembly of an Amur tiger whole-genome sequence as well as the genomic sequences of a white Bengal tiger, African lion, white African lion and snow leopard. Through comparative genetic analyses of these genomes, we find genetic signatures that may reflect molecular adaptations consistent with the big cats’ hypercarnivorous diet and muscle strength. We report a snow leopard-specific genetic determinant in EGLN1 (Met39>Lys39), which is likely to be associated with adaptation to high altitude. We also detect a TYR260G>A mutation likely responsible for the white lion coat colour. Tiger and cat genomes show similar repeat composition and an appreciably conserved synteny. Genomic data from the five big cats provide an invaluable resource for resolving easily identifiable phenotypes evident in very close, but distinct, species. PMID:24045858

  9. Genetic Relationships among Hylocereus and Selenicereus Vine Cacti (Cactaceae): Evidence from Hybridization and Cytological Studies

    PubMed Central

    TEL-ZUR, NOEMI; ABBO, SHAHAL; BAR-ZVI, DUDY; MIZRAHI, YOSEF

    2004-01-01

    • Background and Aims Hylocereus and Selenicereus are native to tropical and sub-tropical America. Based on its taxonomic status and crossability relations it was postulated that H. megalanthus (syn. S. megalanthus) is an allotetraploid (2n = 4x = 44) derived from natural hybridization between two closely related diploid taxa. The present work aimed at elucidating the genetic relationships between species of the two genera. • Methods Crosses were performed and the putative hybrids were analysed by chromosome counts and morphological traits. The ploidy level of hybrids was confirmed by fluorescent in situ hybridization (FISH) of rDNA sites. Genomic in situ hybridization (GISH) was used in an attempt to identify the putative diploid genome donors of H. megalanthus and an artificial interploid hybrid. • Key Results Reciprocal crosses among four diploid Hylocereus species (H. costaricensis, H. monacanthus (syn. H. polyrhizus), H. undatus and Hylocereus sp.) yielded viable diploid hybrids, with regular chromosome pairing. Reciprocal crosses between these Hylocereus spp. and H. megalanthus yielded viable triploid, pentaploid, hexaploid and aneuploid hybrids. Morphological and phenological traits confirm the hybrid origin. In situ detection of rDNA sites was in accord with the ploidy status of the species and hybrid studied. GISH results indicated that overall sequence composition of H. megalanthus is similar to that of H. ocamponis and S. grandiflorus. High sequence similarity was also found between the parental genomes of H. monacanthus and H. megalanthus in one triploid hybrid. • Conclusions The ease of obtaining partially fertile F1 hybrids and the relative sequence similarity (in GISH study) suggest close genetic relationships among the taxa analysed. PMID:15329334

  10. Complete mitochondrial genome sequence of the hedgehog seahorse Hippocampus spinosissimus Weber, 1933 (Gasterosteiformes:Syngnathidae).

    PubMed

    Liu, Shuaishuai; Zhang, Yanhong; Wang, Changming; Lin, Qiang

    2016-07-01

    The complete mitochondrial genome sequence of the hedgehog seahorse Hippocampus spinosissimus was first determined in this article. The total length of H. spinosissimus mitogenome is 16 527 bp and consists of 13 protein-coding genes, 2 rRNA genes, 22 tRNA genes and 1 control region. The gene order and composition of H. spinosissimus were similar to those of most other vertebrates. The overall base composition of H. spinosissimus is 32.1% A, 30.3% T, 14.9% G and 22.7% C, with a slight A + T-rich feature (62.4%). Phylogenetic analyses based on complete mitochondrial genome sequence showed that H. spinosissimus has a close genetic relationship to H. ingens and H. kuda.

  11. Reclassification of Pseudomonas mephitica Claydon and Hammer 1939 as a later heterotypic synonym of Janthinobacterium lividum (Eisenberg 1891) De Ley et al. 1978.

    PubMed

    Kämpfer, Peter; Falsen, Enevold; Busse, Hans-Jürgen

    2008-01-01

    Pseudomonas mephitica CCUG 2513(T) has been reinvestigated to clarify its taxonomic position. 16S rRNA gene sequence comparisons demonstrated that this strain clusters phylogenetically closely with Janthinobacterium lividum (99.8% sequence similarity to the type strain). Investigation of fatty acid patterns, polar lipid profiles, polyamine patterns and quinone systems supported this delineation. Substrate utilization profiles and biochemical characteristics displayed no differences from the type strain of J. lividum, CCUG 2344(T). Therefore, the reclassification of Pseudomonas mephitica as a later heterotypic synonym of Janthinobacterium lividum is proposed, based upon the estimated phylogenetic position derived from 16S rRNA gene sequence data and chemotaxonomic and biochemical data.

  12. StralSV: assessment of sequence variability within similar 3D structures and application to polio RNA-dependent RNA polymerase

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zemla, A; Lang, D; Kostova, T

    2010-11-29

    Most of the currently used methods for protein function prediction rely on sequence-based comparisons between a query protein and those for which a functional annotation is provided. A serious limitation of sequence similarity-based approaches for identifying residue conservation among proteins is the low confidence in assigning residue-residue correspondences among proteins when the level of sequence identity between the compared proteins is poor. Multiple sequence alignment methods are more satisfactory - still, they cannot provide reliable results at low levels of sequence identity. Our goal in the current work was to develop an algorithm that could overcome these difficulties and facilitatemore » the identification of structurally (and possibly functionally) relevant residue-residue correspondences between compared protein structures. Here we present StralSV, a new algorithm for detecting closely related structure fragments and quantifying residue frequency from tight local structure alignments. We apply StralSV in a study of the RNA-dependent RNA polymerase of poliovirus and demonstrate that the algorithm can be used to determine regions of the protein that are relatively unique or that shared structural similarity with structures that are distantly related. By quantifying residue frequencies among many residue-residue pairs extracted from local alignments, one can infer potential structural or functional importance of specific residues that are determined to be highly conserved or that deviate from a consensus. We further demonstrate that considerable detailed structural and phylogenetic information can be derived from StralSV analyses. StralSV is a new structure-based algorithm for identifying and aligning structure fragments that have similarity to a reference protein. StralSV analysis can be used to quantify residue-residue correspondences and identify residues that may be of particular structural or functional importance, as well as unusual or unexpected residues at a given sequence position.« less

  13. Identification of Bacillus Probiotics Isolated from Soil Rhizosphere Using 16S rRNA, recA, rpoB Gene Sequencing and RAPD-PCR.

    PubMed

    Mohkam, Milad; Nezafat, Navid; Berenjian, Aydin; Mobasher, Mohammad Ali; Ghasemi, Younes

    2016-03-01

    Some Bacillus species, especially Bacillus subtilis and Bacillus pumilus groups, have highly similar 16S rRNA gene sequences, which are hard to identify based on 16S rDNA sequence analysis. To conquer this drawback, rpoB, recA sequence analysis along with randomly amplified polymorphic (RAPD) fingerprinting was examined as an alternative method for differentiating Bacillus species. The 16S rRNA, rpoB and recA genes were amplified via a polymerase chain reaction using their specific primers. The resulted PCR amplicons were sequenced, and phylogenetic analysis was employed by MEGA 6 software. Identification based on 16S rRNA gene sequencing was underpinned by rpoB and recA gene sequencing as well as RAPD-PCR technique. Subsequently, concatenation and phylogenetic analysis showed that extent of diversity and similarity were better obtained by rpoB and recA primers, which are also reinforced by RAPD-PCR methods. However, in one case, these approaches failed to identify one isolate, which in combination with the phenotypical method offsets this issue. Overall, RAPD fingerprinting, rpoB and recA along with concatenated genes sequence analysis discriminated closely related Bacillus species, which highlights the significance of the multigenic method in more precisely distinguishing Bacillus strains. This research emphasizes the benefit of RAPD fingerprinting, rpoB and recA sequence analysis superior to 16S rRNA gene sequence analysis for suitable and effective identification of Bacillus species as recommended for probiotic products.

  14. Microbacterium agarici sp. nov., Microbacterium humi sp. nov. and Microbacterium pseudoresistens sp. nov., isolated from the base of the mushroom Agaricus blazei.

    PubMed

    Young, C-C; Busse, H-J; Langer, S; Chu, Jiunn-Nan; Schumann, P; Arun, A B; Shen, Fo-Ting; Rekha, P D; Kämpfer, P

    2010-04-01

    Three Gram-positive, rod-shaped bacteria (strains CC-SBCK-209( T), CC-12309(T) and CC-5209(T)) were isolated from the stalk of the edible mushroom Agaricus blazei grown in the laboratory. 16S rRNA gene sequence analysis indicated that all three isolates clearly belonged to the genus Microbacterium. Strains CC-SBCK-209( T) and CC-12309(T) were most related closely to the type strain of Microbacterium halotolerans (95.9 and 96.1 % 16S rRNA gene sequence similarity, respectively). These two novel strains shared 97.9 % 16S rRNA gene sequence similarity. Levels of similarity to the type strains of all other recognized Microbacterium species were lower than 95.5 %. The third strain (CC-5209( T)) showed the highest 16S rRNA gene sequence similarity to the type strain of Microbacterium resistens (97.6 %); levels of similarity to the type strains of all other recognized Microbacterium species were lower than 96 %. The quinone systems of strains CC-SBCK-209(T), CC-12309(T) and CC-5209(T) consisted of MK-11/MK-12, MK-11/MK-10 and MK-13 as major compounds, respectively. All three strains contained ornithine in their peptidoglycan. The major polar lipids were diphosphatidylglycerol, phosphatidylglycerol and an unknown glycolipid. The polyamine pattern consisted of spermidine and spermine as predominant components. Fatty acid profiles (anteiso-C(15 : 0), iso-C(16 : 0) and anteiso-C(17 : 0 ) as major components) supported the affiliation of all three strains to the genus Microbacterium. The results of physiological and biochemical tests and DNA-DNA hybridization experiments allowed the clear phenotypic and genotypic differentiation of strains CC-SBCK-209(T) and CC-12309( T) from M. halotolerans and other closely related Microbacterium species. Strain CC-5209(T) could be differentiated clearly from M. resistens both genotypically and phenotypically. Based on these data, the novel strains are considered to represent three novel species of the genus Microbacterium. The names proposed for these organisms are Microbacterium agarici sp. nov. [type strain CC-SBCK-209( T) (=DSM 21798(T)=CCM 7686(T))], Microbacterium humi sp. nov. [type strain CC-12309(T) (=DSM 21799(T)=CCM 7687(T))] and Microbacterium pseudoresistens sp. nov. [type strain CC-5209(T) (=DSM 22185(T)=CCM 7688(T))].

  15. Innate Immune Complexity in the Purple Sea Urchin: Diversity of the Sp185/333 System

    PubMed Central

    Smith, L. Courtney

    2012-01-01

    The California purple sea urchin, Strongylocentrotus purpuratus, is a long-lived echinoderm with a complex and sophisticated innate immune system. There are several large gene families that function in immunity in this species including the Sp185/333 gene family that has ∼50 (±10) members. The family shows intriguing sequence diversity and encodes a broad array of diverse yet similar proteins. The genes have two exons of which the second encodes the mature protein and has repeats and blocks of sequence called elements. Mosaics of element patterns plus single nucleotide polymorphisms-based variants of the elements result in significant sequence diversity among the genes yet maintains similar structure among the members of the family. Sequence of a bacterial artificial chromosome insert shows a cluster of six, tightly linked Sp185/333 genes that are flanked by GA microsatellites. The sequences between the GA microsatellites in which the Sp185/333 genes and flanking regions are located, are much more similar to each other than are the sequences outside the microsatellites suggesting processes such as gene conversion, recombination, or duplication. However, close linkage does not correspond with greater sequence similarity compared to randomly cloned and sequenced genes that are unlikely to be linked. There are three segmental duplications that are bounded by GAT microsatellites and include three almost identical genes plus flanking regions. RNA editing is detectible throughout the mRNAs based on comparisons to the genes, which, in combination with putative post-translational modifications to the proteins, results in broad arrays of Sp185/333 proteins that differ among individuals. The mature proteins have an N-terminal glycine-rich region, a central RGD motif, and a C-terminal histidine-rich region. The Sp185/333 proteins are localized to the cell surface and are found within vesicles in subsets of polygonal and small phagocytes. The coelomocyte proteome shows full-length and truncated proteins, including some with missense sequence. Current results suggest that both native Sp185/333 proteins and a recombinant protein bind bacteria and are likely important in sea urchin innate immunity. PMID:22566951

  16. The Mycetophila ruficollis Meigen (Diptera, Mycetophilidae) group in Europe: elucidating species delimitation with COI and ITS2 sequence data

    PubMed Central

    Jürgenstein, Siiri; Kurina, Olavi; Põldmaa, Kadri

    2015-01-01

    Abstract European species of the Mycetophila ruficollis group are compared on the basis of morphology and sequences of mitochondrial cytochrome oxidase subunit one (COI) and the ITS2 region of nuclear ribosomal DNA. The study represents the first evaluation of morphology-based species delimitation of closely related fungus gnat species by applying molecular information. Detailed descriptions and illustrations of the male terminalia are presented along with a key for the identification of all nine European species of the group. Phylogenetic analyses of molecular data generally supported the morphological species discrimination. The barcoding region of COI superseded ITS2 rDNA in resolving species. In the COI barcoding region interspecific differences ranged from 2.9 to 10.6% and the intraspecific distance from 0.08 to 0.8%. Only COI data distinguished between the similar and closely related Mycetophila ichneumonea and Mycetophila uninotata of which the latter was observed to include cryptic species. The host range of some species is suggested to be narrower than previously considered and to depend on the forest type. Presented evidence indicates the importance of analysing sequence data of morphologically very similar mycetophages reared from identified host fungi for elucidating species delimitation as well as their geographic and host ranges. New country records, viz. Estonia for Mycetophila evanida, Georgia for Mycetophila ichneumonea, Mycetophila idonea and Mycetophila ruficollis, and Norway for Mycetophila strobli, widen the known distribution ranges of these species. PMID:26167119

  17. Molecular Characterization of Epiphytic Bacterial Communities on Charophycean Green Algae

    PubMed Central

    Fisher, Madeline M.; Wilcox, Lee W.; Graham, Linda E.

    1998-01-01

    Epiphytic bacterial communities within the sheath material of three filamentous green algae, Desmidium grevillii, Hyalotheca dissiliens, and Spondylosium pulchrum (class Charophyceae, order Zygnematales), collected from a Sphagnum bog were characterized by PCR amplification, cloning, and sequencing of 16S ribosomal DNA. A total of 20 partial sequences and nine different sequence types were obtained, and one sequence type was recovered from the bacterial communities on all three algae. By phylogenetic analysis, the cloned sequences were placed into several major lineages of the Bacteria domain: the Flexibacter/Cytophaga/Bacteroides phylum and the α, β, and γ subdivisions of the phylum Proteobacteria. Analysis at the subphylum level revealed that the majority of our sequences were not closely affiliated with those of known, cultured taxa, although the estimated evolutionary distances between our sequences and their nearest neighbors were always less than 0.1 (i.e., greater than 90% similar). This result suggests that the majority of sequences obtained in this study represent as yet phenotypically undescribed bacterial species and that the range of bacterial-algal interactions that occur in nature has not yet been fully described. PMID:9797295

  18. Pathogenic bacteria in sewage treatment plants as revealed by 454 pyrosequencing.

    PubMed

    Ye, Lin; Zhang, Tong

    2011-09-01

    This study applied 454 high-throughput pyrosequencing to analyze potentially pathogenic bacteria in activated sludge from 14 municipal wastewater treatment plants (WWTPs) across four countries (China, U.S., Canada, and Singapore), plus the influent and effluent of one of the 14 WWTPs. A total of 370,870 16S rRNA gene sequences with average length of 207 bps were obtained and all of them were assigned to corresponding taxonomic ranks by using RDP classifier and MEGAN. It was found that the most abundant potentially pathogenic bacteria in the WWTPs were affiliated with the genera of Aeromonas and Clostridium. Aeromonas veronii, Aeromonas hydrophila, and Clostridium perfringens were species most similar to the potentially pathogenic bacteria found in this study. Some sequences highly similar (>99%) to Corynebacterium diphtheriae were found in the influent and activated sludge samples from a saline WWTP. Overall, the percentage of the sequences closely related (>99%) to known pathogenic bacteria sequences was about 0.16% of the total sequences. Additionally, a platform-independent Java application (BAND) was developed for graphical visualization of the data of microbial abundance generated by high-throughput pyrosequencing. The approach demonstrated in this study could examine most of the potentially pathogenic bacteria simultaneously instead of one-by-one detection by other methods.

  19. De novo assembly and characterization of the garlic (Allium sativum) bud transcriptome by Illumina sequencing.

    PubMed

    Sun, Xiudong; Zhou, Shumei; Meng, Fanlu; Liu, Shiqi

    2012-10-01

    Garlic is widely used as a spice throughout the world for the culinary value of its flavor and aroma, which are created by the chemical transformation of a series of organic sulfur compounds. To analyze the transcriptome of Allium sativum and discover the genes involved in sulfur metabolism, cDNAs derived from the total RNA of Allium sativum buds were analyzed by Illumina sequencing. Approximately 26.67 million 90 bp paired-end clean reads were achieved in two libraries. A total of 127,933 unigenes were generated by de novo assembly and were compared with the sequences in public databases. Of these, 45,286 unigenes had significant hits to the sequences in the Nr database, 29,514 showed significant similarity to known proteins in the Swiss-Prot database and, 20,706 and 21,952 unigenes had significant similarity to existing sequences in the KEGG and COG databases, respectively. Moreover, genes involved in organic sulfur biosynthesis were identified. These unigenes data will provide the foundation for research on gene expression, genomics and functional genomics in Allium sativum. Key message The obtained unigenes will provide the foundation for research on functional genomics in Allium sativum and its closely related species, and fill the gap of the existing plant EST database.

  20. Satellite DNA Sequences in Canidae and Their Chromosome Distribution in Dog and Red Fox.

    PubMed

    Vozdova, Miluse; Kubickova, Svatava; Cernohorska, Halina; Fröhlich, Jan; Rubes, Jiri

    2016-01-01

    Satellite DNA is a characteristic component of mammalian centromeric heterochromatin, and a comparative analysis of its evolutionary dynamics can be used for phylogenetic studies. We analysed satellite and satellite-like DNA sequences available in NCBI for 4 species of the family Canidae (red fox, Vulpes vulpes, VVU; domestic dog, Canis familiaris, CFA; arctic fox, Vulpes lagopus, VLA; raccoon dog, Nyctereutes procyonoides procyonoides, NPR) by comparative sequence analysis, which revealed 86-90% intraspecies and 76-79% interspecies similarity. Comparative fluorescence in situ hybridisation in the red fox and dog showed signals of the red fox satellite probe in canine and vulpine autosomal centromeres, on VVUY, B chromosomes, and in the distal parts of VVU9q and VVU10p which were shown to contain nucleolus organiser regions. The CFA satellite probe stained autosomal centromeres only in the dog. The CFA satellite-like DNA did not show any significant sequence similarity with the satellite DNA of any species analysed and was localised to the centromeres of 9 canine chromosome pairs. No significant heterochromatin block was detected on the B chromosomes of the red fox. Our results show extensive heterogeneity of satellite sequences among Canidae and prove close evolutionary relationships between the red and arctic fox. © 2017 S. Karger AG, Basel.

  1. Microsporidia, amitochondrial protists, possess a 70-kDa heat shock protein gene of mitochondrial evolutionary origin.

    PubMed

    Peyretaillade, E; Broussolle, V; Peyret, P; Méténier, G; Gouy, M; Vivarès, C P

    1998-06-01

    An intronless gene encoding a protein of 592 amino acid residues with similarity to 70-kDa heat shock proteins (HSP70s) has been cloned and sequenced from the amitochondrial protist Encephalitozoon cuniculi (phylum Microsporidia). Southern blot analyses show the presence of a single gene copy located on chromosome XI. The encoded protein exhibits an N-terminal hydrophobic leader sequence and two motifs shared by proteobacterial and mitochondrially expressed HSP70 homologs. Phylogenetic analysis using maximum likelihood and evolutionary distances place the E. cuniculi sequence in the cluster of mitochondrially expressed HSP70s, with a higher evolutionary rate than those of homologous sequences. Similar results were obtained after cloning a fragment of the homologous gene in the closely related species E. hellem. The presence of a nuclear targeting signal-like sequence supports a role of the Encephalitozoon HSP70 as a molecular chaperone of nuclear proteins. No evidence for cytosolic or endoplasmic reticulum forms of HSP70 was obtained through PCR amplification. These data suggest that Encephalitozoon species have evolved from an ancestor bearing mitochondria, which is in disagreement with the postulated presymbiotic origin of Microsporidia. The specific role and intracellular localization of the mitochondrial HSP70-like protein remain to be elucidated.

  2. Streptomonospora tuzyakensis sp. nov., a halophilic actinomycete isolated from saline soil.

    PubMed

    Tatar, Demet; Guven, Kiymet; Inan, Kadriye; Cetin, Demet; Belduz, Ali Osman; Sahin, Nevzat

    2016-01-01

    A novel actinobacterium, designated strain BN506(T), was isolated from soil collected from Tuz (Salt) Lake, Konya, Turkey, and was characterised to determine its taxonomic position. The isolate was found to have morphological and chemotaxonomic properties associated with members of the genus Streptomonospora. The isolate was found to grow optimally at 37 °C and in the presence of 10 % (w/v) NaCl but not in the absence of NaCl. Phylogenetic analyses based on an almost-complete 16S rRNA gene sequences indicated that isolate is closely related to members of the genus Streptomonospora and forms a distinct phyletic line in the Streptomonospora phylogenetic tree. Strain BN506(T) is closely related to Streptomonospora halophila YIM 91355(T) (98.1 % sequence similarity). Sequence similarities with other type strains of the genus Streptomyces were lower than 98.0 %. The cell wall of the novel strain was found to contain meso-diaminopimelic acid. Whole cell hydrolysates were found to contain galactose, glucose and ribose. The predominant menaquinone was identified as MK-10(H8) (57.0 %). The polar lipids detected were identified as diphosphatidylglycerol, phosphatidylglycerol and phosphatidylcholine. The major fatty acids were found to be anteiso-C17:0, iso-C16:0 and 10 methyl C18:0. Based on 16S rRNA gene sequence analysis, DNA-DNA relatedness, phenotypic characteristics and chemotaxonomic data, strain BN506(T) was identified as a member of a novel species of the genus Streptomonospora, for which the name Streptomonospora tuzyakensis sp. nov. (type strain BN506(T) = DSM 45930(T) = KCTC 29210(T)) is proposed.

  3. Verrucosispora sonchi sp. nov., a novel endophytic actinobacterium isolated from the leaves of common sowthistle (Sonchus oleraceus L.).

    PubMed

    Ma, Zhaoxu; Zhao, Shanshan; Cao, Tingting; Liu, Chongxi; Huang, Ying; Gao, Yuhang; Yan, Kai; Xiang, Wensheng; Wang, Xiangjing

    2016-12-01

    A novel actinobacterium, designated strain NEAU-QY3T, was isolated from the leaves of Sonchus oleraceus L. and examined using a polyphasic taxonomic approach. The organism formed single spores with smooth surface on substrate mycelia. Phylogenetic analysis based on the 16S rRNA gene sequence indicated that the strain had a close association with the genus Verrucosispora and shared the highest sequence similarity with Verrucosispora qiuiae RtIII47T (99.17 %), an association that was supported by a bootstrap value of 94 % in the neighbour-joining tree and also recovered with the maximum-likelihood algorithm. The strain also showed high 16S rRNA gene sequence similarities to Xiangella phaseoli NEAU-J5T (98.78 %), Jishengella endophytica 202201T (98.51 %), Micromonospora eburnea LK2-10T (98.28 %), Verrucosispora lutea YIM 013T (98.23 %) and Salinispora pacifica CNR-114T (98.23 %). Furthermore, phylogenetic analysis based on the gyrB gene sequences supported the conclusion that strain NEAU-QY3T should be assigned to the genus Verrucosispora. However, the DNA-DNA hybridization relatedness values between strain NEAU-QY3T and V. qiuiae RtIII47T and V. lutea YIM 013T were below 70 %. With reference to phenotypic characteristics, phylogenetic data and DNA-DNA hybridization results, strain NEAU-QY3T was readily distinguished from its most closely related strains and classified as a new species, for which the name Verrucosispora sonchi sp. nov. is proposed. The type strain is NEAU-QY3T (=CGMCC 4.7312T=DSM 101530T).

  4. The role of corchorus in spreading of tomato yellow leaf curl virus on tomato in Jeddah, Saudi Arabia.

    PubMed

    Sohrab, Sayed Sartaj

    2016-03-01

    Corchorus (Corchorus capsularis L. and Corchorus olitorius L.) is one of the most important fiber crops grown in tropical and subtropical regions throughout the world. Field survey was conducted and naturally infected leaf samples were collected from corchorus and tomato plants in Jeddah, Saudi Arabia. The causal virus was transmitted by whiteflies to tomato plants and begomovirus infection was confirmed by Polymerase chain reaction. The complete viral genome and associated betasatellites were amplified, cloned and sequenced from both corchorus and tomato samples. The genetic variability and phylogenetic relationships were determined for both isolates (corchorus and tomato). The complete genome sequences showed highest (99.5 % nt) similarity with tomato yellow leaf curl virus (TYLCV) and formed closest cluster with TYLCV-Tomato reported from Jizan and Al-Qasim, Saudi Arabia and betasatellites sequences showed highest similarity (99.8 % nt) with Tomato yellow leaf curl betasatellites-Jeddah followed by Tomato yellow leaf curl Oman betasatellites and formed closed cluster with TYLCV-Tomato. On the basis of results obtained from whiteflies transmission, sequence similarity and phylogenetic relationships; it is concluded that the identified virus could be a variant of TYLCV circulating in the Kingdom. The significance of this study demonstrated that the corchorus is serving as reservoir and alternative host and playing an important role in spreading the begomovirus associated disease in the Kingdom of Saudi Arabia.

  5. Optically Mapping Multiple Bacterial Genomes Simultaneously in a Single Run

    DTIC Science & Technology

    2011-11-21

    sequence orientation. We have demonstrated mapping of Shigella dysenteriae and Escherichia coli simultaneously, despite their very close phylogenetic...relationship ( Shigella and Escherichia coli are generally considered to be within a single species, but are segregated at the genus level for historical...reasons [4]); two clones of Shigella would likely not map together successfully using the mixed DNA method. Similarly, based on reference maps being

  6. DNA barcodes for Nearctic Auchenorrhyncha (Insecta: Hemiptera).

    PubMed

    Foottit, Robert G; Maw, Eric; Hebert, P D N

    2014-01-01

    Many studies have shown the suitability of sequence variation in the 5' region of the mitochondrial cytochrome c oxidase I (COI) gene as a DNA barcode for the identification of species in a wide range of animal groups. We examined 471 species in 147 genera of Hemiptera: Auchenorrhyncha drawn from specimens in the Canadian National Collection of Insects to assess the effectiveness of DNA barcoding in this group. Analysis of the COI gene revealed less than 2% intra-specific divergence in 93% of the taxa examined, while minimum interspecific distances exceeded 2% in 70% of congeneric species pairs. Although most species are characterized by a distinct sequence cluster, sequences for members of many groups of closely related species either shared sequences or showed close similarity, with 25% of species separated from their nearest neighbor by less than 1%. This study, although preliminary, provides DNA barcodes for about 8% of the species of this hemipteran suborder found in North America north of Mexico. Barcodes can enable the identification of many species of Auchenorrhyncha, but members of some species groups cannot be discriminated. Future use of DNA barcodes in regulatory, pest management, and environmental applications will be possible as the barcode library for Auchenorrhyncha expands to include more species and broader geographic coverage.

  7. DNA Barcodes for Nearctic Auchenorrhyncha (Insecta: Hemiptera)

    PubMed Central

    Foottit, Robert G.; Maw, Eric; Hebert, P. D. N.

    2014-01-01

    Background Many studies have shown the suitability of sequence variation in the 5′ region of the mitochondrial cytochrome c oxidase I (COI) gene as a DNA barcode for the identification of species in a wide range of animal groups. We examined 471 species in 147 genera of Hemiptera: Auchenorrhyncha drawn from specimens in the Canadian National Collection of Insects to assess the effectiveness of DNA barcoding in this group. Methodology/Principal Findings Analysis of the COI gene revealed less than 2% intra-specific divergence in 93% of the taxa examined, while minimum interspecific distances exceeded 2% in 70% of congeneric species pairs. Although most species are characterized by a distinct sequence cluster, sequences for members of many groups of closely related species either shared sequences or showed close similarity, with 25% of species separated from their nearest neighbor by less than 1%. Conclusions/Significance This study, although preliminary, provides DNA barcodes for about 8% of the species of this hemipteran suborder found in North America north of Mexico. Barcodes can enable the identification of many species of Auchenorrhyncha, but members of some species groups cannot be discriminated. Future use of DNA barcodes in regulatory, pest management, and environmental applications will be possible as the barcode library for Auchenorrhyncha expands to include more species and broader geographic coverage. PMID:25004106

  8. CombAlign: a code for generating a one-to-many sequence alignment from a set of pairwise structure-based sequence alignments.

    PubMed

    Zhou, Carol L Ecale

    2015-01-01

    In order to better define regions of similarity among related protein structures, it is useful to identify the residue-residue correspondences among proteins. Few codes exist for constructing a one-to-many multiple sequence alignment derived from a set of structure or sequence alignments, and a need was evident for creating such a tool for combining pairwise structure alignments that would allow for insertion of gaps in the reference structure. This report describes a new Python code, CombAlign, which takes as input a set of pairwise sequence alignments (which may be structure based) and generates a one-to-many, gapped, multiple structure- or sequence-based sequence alignment (MSSA). The use and utility of CombAlign was demonstrated by generating gapped MSSAs using sets of pairwise structure-based sequence alignments between structure models of the matrix protein (VP40) and pre-small/secreted glycoprotein (sGP) of Reston Ebolavirus and the corresponding proteins of several other filoviruses. The gapped MSSAs revealed structure-based residue-residue correspondences, which enabled identification of structurally similar versus differing regions in the Reston proteins compared to each of the other corresponding proteins. CombAlign is a new Python code that generates a one-to-many, gapped, multiple structure- or sequence-based sequence alignment (MSSA) given a set of pairwise sequence alignments (which may be structure based). CombAlign has utility in assisting the user in distinguishing structurally conserved versus divergent regions on a reference protein structure relative to other closely related proteins. CombAlign was developed in Python 2.6, and the source code is available for download from the GitHub code repository.

  9. Duck egg-drop syndrome caused by BYD virus, a new Tembusu-related flavivirus.

    PubMed

    Su, Jingliang; Li, Shuang; Hu, Xudong; Yu, Xiuling; Wang, Yongyue; Liu, Peipei; Lu, Xishan; Zhang, Guozhong; Hu, Xueying; Liu, Di; Li, Xiaoxia; Su, Wenliang; Lu, Hao; Mok, Ngai Shing; Wang, Peiyi; Wang, Ming; Tian, Kegong; Gao, George F

    2011-03-24

    Since April 2010, a severe outbreak of duck viral infection, with egg drop, feed uptake decline and ovary-oviduct disease, has spread around the major duck-producing regions in China. A new virus, named BYD virus, was isolated in different areas, and a similar disease was reproduced in healthy egg-producing ducks, infecting with the isolated virus. The virus was re-isolated from the affected ducks and replicated well in primary duck embryo fibroblasts and Vero cells, causing the cytopathic effect. The virus was identified as an enveloped positive-stranded RNA virus with a size of approximately 55 nm in diameter. Genomic sequencing of the isolated virus revealed that it is closely related to Tembusu virus (a mosquito-borne Ntaya group flavivirus), with 87-91% nucleotide identity of the partial E (envelope) proteins to that of Tembusu virus and 72% of the entire genome coding sequence with Bagaza virus, the most closely related flavivirus with an entirely sequenced genome. Collectively our systematic studies fulfill Koch's postulates, and therefore, the causative agent of the duck egg drop syndrome occurring in China is a new flavivirus. Flavivirus is an emerging and re-emerging zoonotic pathogen and BYD virus that causes severe egg-drop, could be disastrous for the duck industry. More importantly its public health concerns should also be evaluated, and its epidemiology should be closely watched due to the zoonotic nature of flaviviruses.

  10. Genetic Analysis of Vibrio parahaemolyticus O3:K6 Strains That Have Been Isolated in Mexico Since 1998

    PubMed Central

    Licea-Navarro, Alexei Fedorovish; Revilla-Castellanos, Valeria Jeanette; Wong-Chang, Irma; González-Sánchez, Ricardo

    2017-01-01

    Vibrio parahaemolyticus is an important human pathogen that has been isolated worldwide from clinical cases, most of which have been associated with seafood consumption. Environmental and clinical toxigenic strains of V. parahaemolyticus that were isolated in Mexico from 1998 to 2012, including those from the only outbreak that has been reported in this country, were characterized genetically to assess the presence of the O3:K6 pandemic clone, and their genetic relationship to strains that are related to the pandemic clonal complex (CC3). Pathogenic tdh+ and tdh+/trh+ strains were analyzed by pulsed-field gel electrophoresis (PFGE) and multilocus sequence typing (MLST). Also, the entire genome of a Mexican O3:K6 strain was sequenced. Most of the strains were tdh/ORF8-positive and corresponded to the O3:K6 serotype. By PFGE and MLST, there was very close genetic relationship between ORF8/O3:K6 strains, and very high genetic diversities from non-pandemic strains. The genetic relationship is very close among O3:K6 strains that were isolated in Mexico and sequences that were available for strains in the CC3, based on the PubMLST database. The whole-genome sequence of CICESE-170 strain had high similarity with that of the reference RIMD 2210633 strain, and harbored 7 pathogenicity islands, including the 4 that denote O3:K6 pandemic strains. These results indicate that pandemic strains that have been isolated in Mexico show very close genetic relationship among them and with those isolated worldwide. PMID:28099500

  11. Gene structure and evolution of transthyretin in the order Chiroptera.

    PubMed

    Khwanmunee, Jiraporn; Leelawatwattana, Ladda; Prapunpoj, Porntip

    2016-02-01

    Bats are mammals in the order Chiroptera. Although many extensive morphologic and molecular genetics analyses have been attempted, phylogenetic relationships of bats has not been completely resolved. The paraphyly of microbats is of particular controversy that needs to be confirmed. In this study, we attempted to use the nucleotide sequence of transthyretin (TTR) intron 1 to resolve the relationship among bats. To explore its utility, the complete sequences of TTR gene and intron 1 region of bats in Vespertilionidae: genus Eptesicus (Eptesicus fuscus) and genus Myotis (Myotis brandtii, Myotis davidii, and Myotis lucifugus), and Pteropodidae (Pteropus alecto and Pteropus vampyrus) were extracted from the retrieved sequences, whereas those of Rhinoluphus affinis and Scotophilus kuhlii were amplified and sequenced. The derived overall amino sequences of bat TTRs were found to be very similar to those in other eutherians but differed from those in other classes of vertebrates. However, missing of amino acids from N-terminal or C-terminal region was observed. The phylogenetic analysis of amino acid sequences suggested bat and other eutherian TTRs lineal descent from a single most recent common ancestor which differed from those of non-placental mammals and the other classes of vertebrates. The splicing of bat TTR precursor mRNAs was similar to those of other eutherian but different from those of marsupial, bird, reptile and amphibian. Based on TTR intron 1 sequence, the inferred evolutionary relationship within Chiroptera revealed more closely relatedness of R. affinis to megabats than to microbats. Accordingly, the paraphyly of microbats was suggested.

  12. Piroplasms in brown hyaenas (Parahyaena brunnea) and spotted hyaenas (Crocuta crocuta) in Namibia and South Africa are closely related to Babesia lengau.

    PubMed

    Burroughs, Richard E J; Penzhorn, Barend L; Wiesel, Ingrid; Barker, Nancy; Vorster, Ilse; Oosthuizen, Marinda C

    2017-02-01

    The objective of our study was identification and molecular characterization of piroplasms and rickettsias occurring in brown (Parahyaena brunnea) and spotted hyaenas (Crocuta crocuta) from various localities in Namibia and South Africa. Whole blood (n = 59) and skin (n = 3) specimens from brown (n = 15) and spotted hyaenas (n = 47) were screened for the presence of Babesia, Theileria, Ehrlichia and Anaplasma species using the reverse line blot (RLB) hybridization technique. PCR products of 52/62 (83.9%) of the specimens hybridized only with the Theileria/Babesia genus-specific probes and not with any of the species-specific probes, suggesting the presence of a novel species or variant of a species. No Ehrlichia and/or Anaplasma species DNA could be detected. A parasite 18S ribosomal RNA gene of brown (n = 3) and spotted hyaena (n = 6) specimens was subsequently amplified and cloned, and the recombinants were sequenced. Homologous sequence searches of databases indicated that the obtained sequences were most closely related to Babesia lengau, originally described from cheetahs (Acinonyx jubatus). Observed sequence similarities were subsequently confirmed by phylogenetic analyses which showed that the obtained hyaena sequences formed a monophyletic group with B. lengau, B abesia conradae and sequences previously isolated from humans and wildlife in the western USA. Within the B. lengau clade, the obtained sequences and the published B. lengau sequences were grouped into six distinct groups, of which groups I to V represented novel B. lengau genotypes and/or gene variants. We suggest that these genotypes cannot be classified as new Babesia species, but rather as variants of B. lengau. This is the first report of occurrence of piroplasms in brown hyaenas.

  13. Morphology and Phylogeny of a New Species of Anaerobic Ciliate, Trimyema finlayi n. sp., with Endosymbiotic Methanogens.

    PubMed

    Lewis, William H; Sendra, Kacper M; Embley, T Martin; Esteban, Genoveva F

    2018-01-01

    Many anaerobic ciliated protozoa contain organelles of mitochondrial ancestry called hydrogenosomes. These organelles generate molecular hydrogen that is consumed by methanogenic Archaea, living in endosymbiosis within many of these ciliates. Here we describe a new species of anaerobic ciliate, Trimyema finlayi n. sp., by using silver impregnation and microscopy to conduct a detailed morphometric analysis. Comparisons with previously published morphological data for this species, as well as the closely related species, Trimyema compressum , demonstrated that despite them being similar, both the mean cell size and the mean number of somatic kineties are lower for T. finlayi than for T. compressum , which suggests that they are distinct species. This was also supported by analysis of the 18S rRNA genes from these ciliates, the sequences of which are 97.5% identical (6 substitutions, 1479 compared bases), and in phylogenetic analyses these sequences grouped with other 18S rRNA genes sequenced from previous isolates of the same respective species. Together these data provide strong evidence that T. finlayi is a novel species of Trimyema , within the class Plagiopylea. Various microscopic techniques demonstrated that T. finlayi n. sp. contains polymorphic endosymbiotic methanogens, and analysis of the endosymbionts' 16S rRNA gene showed that they belong to the genus Methanocorpusculum , which was confirmed using fluorescence in situ hybridization with specific probes. Despite the degree of similarity and close relationship between these ciliates, T. compressum contains endosymbiotic methanogens from a different genus, Methanobrevibacter . In phylogenetic analyses of 16S rRNA genes, the Methanocorpusculum endosymbiont of T. finlayi n. sp. grouped with sequences from Methanomicrobia, including the endosymbiont of an earlier isolate of the same species, ' Trimyema sp.,' which was sampled approximately 22 years earlier, at a distant (∼400 km) geographical location. Identification of the same endosymbiont species in the two separate isolates of T. finlayi n. sp. provides evidence for spatial and temporal stability of the Methanocorpusculum-T. finlayi n. sp. endosymbiosis. T. finlayi n. sp. and T. compressum provide an example of two closely related anaerobic ciliates that have endosymbionts from different methanogen genera, suggesting that the endosymbionts have not co-speciated with their hosts.

  14. Mammoth and Elephant Phylogenetic Relationships: Mammut Americanum, the Missing Outgroup

    PubMed Central

    Orlando, Ludovic; Hänni, Catherine; Douady, Christophe J.

    2007-01-01

    At the morphological level, the woolly mammoth has most often been considered as the sister-species of Asian elephants, but at the DNA level, different studies have found support for proximity with African elephants. Recent reports have increased the available sequence data and apparently solved the discrepancy, finding mammoths to be most closely related to Asian elephants. However, we demonstrate here that the three competing topologies have similar likelihood, bayesian and parsimony supports. The analysis further suggests the inadequacy of using Sirenia or Hyracoidea as outgroups. We therefore argue that orthologous sequences from the extinct American mastodon will be required to definitively solve this long-standing question. PMID:19430604

  15. Prevotella timonensis sp. nov., isolated from a human breast abscess.

    PubMed

    Glazunova, Olga O; Launay, Thierry; Raoult, Didier; Roux, Véronique

    2007-04-01

    Gram-negative anaerobic rods were isolated from a human breast abscess. Based on genotypic and phenotypic characteristics, the novel strain belonged to the genus Prevotella. Phylogenetic analysis based on 16S rRNA gene sequence comparisons showed that it was closely related to Prevotella buccalis (94 % 16S rRNA gene sequence similarity), Prevotella salivae (90 %) and Prevotella oris (89.1 %). The major cellular fatty acid was C(14 : 0) (19.5 %). The new isolate represents a novel species in the genus Prevotella, for which the name Prevotella timonensis sp. nov. is proposed. The type strain is strain 4401737(T) (=CIP 108522(T)=CCUG 50105(T)).

  16. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Boore, Jeffrey L.; Staton, Joseph

    We have determined the sequence of about half (7470 nts) of the mitochondrial genome of the sipunculid Phascolopsis gouldii, the first representative of this phylum to be so studied. All of the 19 identified genes are transcribed from the same DNA strand. The arrangement of these genes is remarkably similar to that of the oligochaete annelid Lumbricus terrestris. Comparison of both the inferred amino acid sequences and the gene arrangements of a variety of diverse metazoan taxa reveals that the phylum Sipuncula is more closely related to Annelida than to Mollusca. This requires reinterpretation of the homology of several embryologicalmore » features and of patterns of animal body plan evolution.« less

  17. Genomic Variation, Host Range, and Infection Kinetics of Closely Related Cyanopodoviruses from New England Coastal Waters

    NASA Astrophysics Data System (ADS)

    Veglia, A. J.; Milford, C. R.; Marston, M.

    2016-02-01

    Viruses infecting marine Synechococcus are abundant in coastal marine environments and influence the community composition and abundance of their cyanobacterial hosts. In this study, we focused on the cyanopodoviruses which have smaller genomes and narrower host ranges relative to cyanomyoviruses. While previous studies have compared the genomes of diverse podoviruses, here we analyzed the genomic variation, host ranges, and infection kinetics of podoviruses within the same OTU. The genomes of fifty-five podoviral isolates from the coastal waters of New England were fully sequenced. Based on DNA polymerase gene sequences, these isolates fall into five discrete OTUs (termed RIP - Rhode Island Podovirus). Although all the isolates belonging to the same RIP have very similar DNA polymerase gene sequences (>98% sequence identity), differences in genome content, particularly in regions associated with tail fiber genes, were observed among isolates in the same RIP. Host range tests reveal variation both across and within RIPs. Notably within RIP1, isolates that had similar tail fiber regions also had similar host ranges. Isolates belonging to RIP4 do not contain the host-derived psbA photosynthesis gene, while isolates in the other four RIPs do possess a psbA gene. Nevertheless, infection kinetic experiments suggest that the latent period and burst size for RIP4 isolates are similar to RIP1 isolates. We are continuing to investigate the correlations among genome content, host range, and infection kinetics of isolates belonging to the same OTU. Our results to date suggest that there is substantial genomic variation within an OTU and that this variation likely influences cyanopodoviral - host interactions.

  18. Substrate-Driven Mapping of the Degradome by Comparison of Sequence Logos

    PubMed Central

    Fuchs, Julian E.; von Grafenstein, Susanne; Huber, Roland G.; Kramer, Christian; Liedl, Klaus R.

    2013-01-01

    Sequence logos are frequently used to illustrate substrate preferences and specificity of proteases. Here, we employed the compiled substrates of the MEROPS database to introduce a novel metric for comparison of protease substrate preferences. The constructed similarity matrix of 62 proteases can be used to intuitively visualize similarities in protease substrate readout via principal component analysis and construction of protease specificity trees. Since our new metric is solely based on substrate data, we can engraft the protease tree including proteolytic enzymes of different evolutionary origin. Thereby, our analyses confirm pronounced overlaps in substrate recognition not only between proteases closely related on sequence basis but also between proteolytic enzymes of different evolutionary origin and catalytic type. To illustrate the applicability of our approach we analyze the distribution of targets of small molecules from the ChEMBL database in our substrate-based protease specificity trees. We observe a striking clustering of annotated targets in tree branches even though these grouped targets do not necessarily share similarity on protein sequence level. This highlights the value and applicability of knowledge acquired from peptide substrates in drug design of small molecules, e.g., for the prediction of off-target effects or drug repurposing. Consequently, our similarity metric allows to map the degradome and its associated drug target network via comparison of known substrate peptides. The substrate-driven view of protein-protein interfaces is not limited to the field of proteases but can be applied to any target class where a sufficient amount of known substrate data is available. PMID:24244149

  19. Applying Agrep to r-NSA to solve multiple sequences approximate matching.

    PubMed

    Ni, Bing; Wong, Man-Hon; Lam, Chi-Fai David; Leung, Kwong-Sak

    2014-01-01

    This paper addresses the approximate matching problem in a database consisting of multiple DNA sequences, where the proposed approach applies Agrep to a new truncated suffix array, r-NSA. The construction time of the structure is linear to the database size, and the computations of indexing a substring in the structure are constant. The number of characters processed in applying Agrep is analysed theoretically, and the theoretical upper-bound can approximate closely the empirical number of characters, which is obtained through enumerating the characters in the actual structure built. Experiments are carried out using (synthetic) random DNA sequences, as well as (real) genome sequences including Hepatitis-B Virus and X-chromosome. Experimental results show that, compared to the straight-forward approach that applies Agrep to multiple sequences individually, the proposed approach solves the matching problem in much shorter time. The speed-up of our approach depends on the sequence patterns, and for highly similar homologous genome sequences, which are the common cases in real-life genomes, it can be up to several orders of magnitude.

  20. Characterizing novel endogenous retroviruses from genetic variation inferred from short sequence reads

    PubMed Central

    Mourier, Tobias; Mollerup, Sarah; Vinner, Lasse; Hansen, Thomas Arn; Kjartansdóttir, Kristín Rós; Guldberg Frøslev, Tobias; Snogdal Boutrup, Torsten; Nielsen, Lars Peter; Willerslev, Eske; Hansen, Anders J.

    2015-01-01

    From Illumina sequencing of DNA from brain and liver tissue from the lion, Panthera leo, and tumor samples from the pike-perch, Sander lucioperca, we obtained two assembled sequence contigs with similarity to known retroviruses. Phylogenetic analyses suggest that the pike-perch retrovirus belongs to the epsilonretroviruses, and the lion retrovirus to the gammaretroviruses. To determine if these novel retroviral sequences originate from an endogenous retrovirus or from a recently integrated exogenous retrovirus, we assessed the genetic diversity of the parental sequences from which the short Illumina reads are derived. First, we showed by simulations that we can robustly infer the level of genetic diversity from short sequence reads. Second, we find that the measures of nucleotide diversity inferred from our retroviral sequences significantly exceed the level observed from Human Immunodeficiency Virus infections, prompting us to conclude that the novel retroviruses are both of endogenous origin. Through further simulations, we rule out the possibility that the observed elevated levels of nucleotide diversity are the result of co-infection with two closely related exogenous retroviruses. PMID:26493184

  1. Streptobacillus notomytis sp. nov., isolated from a spinifex hopping mouse (Notomys alexis Thomas, 1922), and emended description of Streptobacillus Levaditi et al. 1925, Eisenberg et al. 2015 emend.

    PubMed

    Eisenberg, Tobias; Glaeser, Stefanie P; Ewers, Christa; Semmler, Torsten; Nicklas, Werner; Rau, Jörg; Mauder, Norman; Hofmann, Nicola; Imaoka, Koichi; Kimura, Masanobu; Kämpfer, Peter

    2015-12-01

    A pleomorphic, Gram-negative, rod-shaped, indole-, oxidase- and catalase-negative, non-spore-forming, non-motile bacterium was isolated in 1979 from the heart of a spinifex hopping mouse (Notomys alexis Thomas, 1922) with septicaemia and stored as Streptobacillus moniliformis in the strain collection of the Animal Health Laboratory, South Perth, Western Australia (AHL 370-1), as well as under CCUG 12425. On the basis of 16SrRNA gene sequence analyses, the strain was assigned to the genus Streptobacillus, with 99.4 % sequence similarity to the type strain of Streptobacillus moniliformis, 95.6 %sequence similarity to the type strain of Streptobacillus hongkongensis and 99.0 %sequence similarity to the type strain of Streptobacillus felis. The clear differentiation of strain AHL 370-1T from Streptobacillus moniliformis, Streptobacillus hongkongensis and Streptobacillus felis was also supported by rpoB, groEL and recA nucleotide and amino acid sequence analysis. Average nucleotide identity was 87.16 % between strain AHL 370-1T and Streptobacillus moniliformis DSM 12112T. Physiological data confirmed the allocation of strain AHL 370-1T to the family Leptotrichiaceae, considering the very similar profiles of enzyme activities and fatty acids compared to closely related species. Within the genus Streptobacillus,isolate AHL 370-1T could also be separated unambiguously from the type strains of Streptobacillus moniliformis, Streptobacillus hongkongensis and Streptobacillus felis by MALDI-TOF mass spectrometry. Two further strains (KWG2 and KWG24) isolated from asymptomatic black rats in Japan were highly similar to AHL 370-1T. On the basis of these data, we propose the novel species Streptobacillus notomytis sp. nov., with the type strain AHL370-1T (=CCUG 12425T=DSM 100026T=CCM 8593T=EF 12425T).

  2. Isolation of nucleotide binding site-leucine rich repeat and kinase resistance gene analogues from sugarcane (Saccharum spp.).

    PubMed

    Glynn, Neil C; Comstock, Jack C; Sood, Sushma G; Dang, Phat M; Chaparro, Jose X

    2008-01-01

    Resistance gene analogues (RGAs) have been isolated from many crops and offer potential in breeding for disease resistance through marker-assisted selection, either as closely linked or as perfect markers. Many R-gene sequences contain kinase domains, and indeed kinase genes have been reported as being proximal to R-genes, making kinase analogues an additionally promising target. The first step towards utilizing RGAs as markers for disease resistance is isolation and characterization of the sequences. Sugarcane clone US01-1158 was identified as resistant to yellow leaf caused by the sugarcane yellow leaf virus (SCYLV) and moderately resistant to rust caused by Puccinia melanocephala Sydow & Sydow. Degenerate primers that had previously proved useful for isolating RGAs and kinase analogues in wheat and soybean were used to amplify DNA from sugarcane (Saccharum spp.) clone US-01-1158. Sequences generated from 1512 positive clones were assembled into 134 contigs of between two and 105 sequences. Comparison of the contig consensuses with the NCBI sequence database using BLASTx showed that 20 had sequence homology to nuclear binding site and leucine rich repeat (NBS-LRR) RGAs, and eight to kinase genes. Alignment of the deduced amino acid sequences with similar sequences from the NCBI database allowed the identification of several conserved domains. The alignment and resulting phenetic tree showed that many of the sequences had greater similarity to sequences from other species than to one another. The use of degenerate primers is a useful method for isolating novel sugarcane RGA and kinase gene analogues. Further studies are needed to evaluate the role of these genes in disease resistance.

  3. Corynebacterium pilbarense sp. nov., a non-lipophilic corynebacterium isolated from a human ankle aspirate.

    PubMed

    Aravena-Roman, M; Spröer, C; Sträubler, B; Inglis, T; Yassin, A F

    2010-07-01

    A non-lipophilic coryneform bacterium isolated from an anaerobic Bactec bottle inoculated with an ankle aspirate from a male patient was characterized by phenotypic and molecular taxonomic methods. Chemotaxonomic investigations revealed the presence of short-chain mycolic acids in the cell wall of the bacterium, a feature consistent with members of the genus Corynebacterium. Comparative 16S rRNA gene sequence analysis demonstrated that the isolate displayed 92.0-99.0 % gene sequence similarity with members of the genus Corynebacterium, with Corynebacterium ureicelerivorans as the most closely related phylogenetic species (99.0 % gene sequence similarity). However, the isolate could be genomically separated from C. ureicelerivorans on the basis of DNA-DNA hybridization studies (39.5 % relatedness). Furthermore, the isolate could also be differentiated from C. ureicelerivorans and other species of the genus Corynebacterium on the basis of biochemical properties. Based on both phenotypic and phylogenetic evidence, it is proposed that this isolate be classified as representing a novel species, Corynebacterium pilbarense sp. nov. (type strain IMMIB WACC 658(T)=DSM 45350(T)=CCUG 57942(T)).

  4. Methylobacterium pseudosasae sp. nov., a pink-pigmented, facultatively methylotrophic bacterium isolated from the bamboo phyllosphere.

    PubMed

    Madhaiyan, Munusamy; Poonguzhali, Selvaraj

    2014-02-01

    A pink-pigmented, Gram negative, aerobic, facultatively methylotrophic bacterium, strain BL44(T), was isolated from bamboo leaves and identified as a member of the genus Methylobacterium. Phylogenetic analysis based on 16S rRNA gene sequences showed similarity values of 98.7-97.0 % with closely related type strains and showed highest similarity to Methylobacterium zatmanii DSM 5688(T) (98.7 %) and Methylobacterium thiocyanatum DSM 11490(T) (98.7 %). Methylotrophic metabolism in this strain was confirmed by PCR amplification and sequencing of the mxaF gene coding for the α-subunit of methanol dehydrogenase. Strain BL44(T) produced three known quorum sensing signal molecules with similar retention time to C8, C10 and C12-HSLs when characterized by GC-MS. The fatty acid profiles contained major amounts of C18:1 ω7c, iso-3OH C17:0 and summed feature 3 (C16:1 ω7c and/or iso-C15:0 2-OH), which supported the grouping of the isolate in the genus Methylobacterium. The DNA G+C content was 66.9 mol%. DNA relatedness of the strain BL44(T) to its most closely related strains ranged from 12-43.3 %. On the basis of the phenotypic, phylogenetic and DNA-DNA hybridization data, strain BL44(T) is assigned to a novel species of the genus Methylobacterium for which the name Methylobacterium pseudosasae sp. nov. is proposed (type strain BL44(T) = NBRC 105205(T) = ICMP 17622(T)).

  5. Activation of Adhesion G Protein-coupled Receptors: AGONIST SPECIFICITY OF STACHEL SEQUENCE-DERIVED PEPTIDES.

    PubMed

    Demberg, Lilian M; Winkler, Jana; Wilde, Caroline; Simon, Kay-Uwe; Schön, Julia; Rothemund, Sven; Schöneberg, Torsten; Prömel, Simone; Liebscher, Ines

    2017-03-17

    Members of the adhesion G protein-coupled receptor (aGPCR) family carry an agonistic sequence within their large ectodomains. Peptides derived from this region, called the Stachel sequence, can activate the respective receptor. As the conserved core region of the Stachel sequence is highly similar between aGPCRs, the agonist specificity of Stachel sequence-derived peptides was tested between family members using cell culture-based second messenger assays. Stachel peptides derived from aGPCRs of subfamily VI (GPR110/ADGRF1, GPR116/ADGRF5) and subfamily VIII (GPR64/ADGRG2, GPR126/ADGRG6) are able to activate more than one member of the respective subfamily supporting their evolutionary relationship and defining them as pharmacological receptor subtypes. Extended functional analyses of the Stachel sequences and derived peptides revealed agonist promiscuity, not only within, but also between aGPCR subfamilies. For example, the Stachel -derived peptide of GPR110 (subfamily VI) can activate GPR64 and GPR126 (both subfamily VIII). Our results indicate that key residues in the Stachel sequence are very similar between aGPCRs allowing for agonist promiscuity of several Stachel -derived peptides. Therefore, aGPCRs appear to be pharmacologically more closely related than previously thought. Our findings have direct implications for many aGPCR studies, as potential functional overlap has to be considered for in vitro and in vivo studies. However, it also offers the possibility of a broader use of more potent peptides when the original Stachel sequence is less effective. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  6. Genetic and phylogenetic analysis of a novel parvovirus isolated from chickens in Guangxi, China.

    PubMed

    Feng, Bin; Xie, Zhixun; Deng, Xianwen; Xie, Liji; Xie, Zhiqin; Huang, Li; Fan, Qin; Luo, Sisi; Huang, Jiaoling; Zhang, Yanfang; Zeng, Tingting; Wang, Sheng; Wang, Leyi

    2016-11-01

    A previously unidentified chicken parvovirus (ChPV) strain, associated with runting-stunting syndrome (RSS), is now endemic among chickens in China. To explore the genetic diversity of ChPV strains, we determined the first complete genome sequence of a novel ChPV isolate (GX-CH-PV-7) identified in chickens in Guang Xi, China, and showed moderate genome sequence similarity to reference strains. Analysis showed that the viral genome sequence is 86.4 %-93.9 % identical to those of other ChPVs. Genetic and phylogenetic analyses showed that this newly emergent GX-CH-PV-7 is closely related to Gallus gallus enteric parvovirus isolate ChPV 798 from the USA, indicating that they may share a common ancestor. The complete DNA sequence is 4612 bp long with an A+T content of 56.66 %. We determined the first complete genome sequence of a previously unidentified ChPV strain to elucidate its origin and evolutionary status.

  7. A species pair of Bivesicula Yamaguti, 1934 (Trematoda: Bivesiculidae) in unrelated Great Barrier Reef fishes: implications for the basis of speciation in coral reef fish trematodes.

    PubMed

    Trieu, Nancy; Cutmore, Scott C; Miller, Terrence L; Cribb, Thomas H

    2015-07-01

    Combined morphological and molecular analysis shows that a species of Bivesicula Yamaguti, 1934 from four species of Apogonidae Günther [Nectamia fusca (Quoy & Gaimard), Ostorhinchus angustatus (Smith & Radcliffe), O. cookii (Macleay) and Taeniamia fucata (Cantor)] on the Great Barrier Reef is morphologically similar to, but clearly distinct from B. unexpecta Cribb, Bray & Barker, 1994 which infects a sympatric pomacentrid, Acanthochromis polyacanthus (Bleeker). Bivesicula neglecta n. sp. is proposed for the form from apogonids. Novel ITS2 rDNA sequences generated for the two species differ at just one consistent base position, implying that the two species are closely related. The combination of their close relationship, high but distinct specificity and co-occurrence suggests that speciation was driven by a recent host switching event enabled by similar dietary ecomorphology.

  8. Closely related dermatophyte species produce different patterns of secreted proteins.

    PubMed

    Giddey, Karin; Favre, Bertrand; Quadroni, Manfredo; Monod, Michel

    2007-02-01

    Dermatophytes are the most common infectious agents responsible for superficial mycosis in humans and animals. Various species in this group of fungi show overlapping characteristics. We investigated the possibility that closely related dermatophyte species with different behaviours secrete distinct proteins when grown in the same culture medium. Protein patterns from culture filtrates of several strains of the same species were very similar. In contrast, secreted protein profiles from various species were different, and so a specific signature could be associated with each of the six analysed species. In particular, protein patterns were useful to distinguish Trichophyton tonsurans from Trichophyton equinum, which cannot be differentiated by ribosomal DNA sequencing. The secreted proteases Sub2, Sub6 and Sub7 of the subtilisin family, as well as Mep3 and Mep4 of the fungalisin family were identified. SUB6, SUB7, MEP3 and MEP4 genes were cloned and sequenced. Although the protein sequence of each protease was highly conserved across species, their level of secretion by the various species was not equivalent. These results suggest that a switch of habitat could be related to a differential expression of genes encoding homologous secreted proteins.

  9. Phylogeny of marine Bacillus isolates from the Gulf of Mexico

    NASA Technical Reports Server (NTRS)

    Siefert, J. L.; Larios-Sanz, M.; Nakamura, L. K.; Slepecky, R. A.; Paul, J. H.; Moore, E. R.; Fox, G. E.; Jurtshuk, P. Jr

    2000-01-01

    The phylogeny of 11 pigmented, aerobic, spore-forming isolates from marine sources was studied. Forty-two biochemical characteristics were examined, and a 16S rDNA sequence was obtained for each isolate. In a phylogenetic tree based on 16S sequencing, four isolates (NRRL B-14850, NRRL B-14904, NRRL B-14907, and NRRL B-14908) clustered with B. subtilis and related organisms; NRRL B-14907 was closely related to B. amyloliquefaciens. NRRL B-14907 and NRRL B-14908 were phenotypically similar to B. amyloliquefaciens and B. pumilus, respectively. Three strains (NRRL B-14906, NRRL B-14910, and NRRL B-14911) clustered in a clade that included B. firmus, B. lentus, and B. megaterium. NRRL B-14910 was closely related phenotypically and phylogenetically to B. megaterium. NRRL B-14905 clustered with the mesophilic round spore-producing species, B. fusiformis and B. sphaericus; the isolate was more closely related to B. fusiformis. NRRL B-14905 displayed characteristics typical of the B. sphaericus-like organisms. NRRL B-14909 and NRRL B-14912 clustered with the Paenibacillus species and displayed characteristics typical of the genus. Only NRRL B-14851, an unusually thin rod that forms very small spores, may represent a new Bacillus species.

  10. De novo mutations in genes of mediator complex causing syndromic intellectual disability: mediatorpathy or transcriptomopathy?

    PubMed

    Caro-Llopis, Alfonso; Rosello, Monica; Orellana, Carmen; Oltra, Silvestre; Monfort, Sandra; Mayo, Sonia; Martinez, Francisco

    2016-12-01

    Mutations in the X-linked gene MED12 cause at least three different, but closely related, entities of syndromic intellectual disability. Recently, a new syndrome caused by MED13L deleterious variants has been described, which shows similar clinical manifestations including intellectual disability, hypotonia, and other congenital anomalies. Genotyping of 1,256 genes related with neurodevelopment was performed by next-generation sequencing in three unrelated patients and their healthy parents. Clinically relevant findings were confirmed by conventional sequencing. Each patient showed one de novo variant not previously reported in the literature or databases. Two different missense variants were found in the MED12 or MED13L genes and one nonsense mutation was found in the MED13L gene. The phenotypic consequences of these mutations are closely related and/or have been previously reported in one or other gene. Additionally, MED12 and MED13L code for two closely related partners of the mediator kinase module. Consequently, we propose the concept of a common MED12/MED13L clinical spectrum, encompassing Opitz-Kaveggia syndrome, Lujan-Fryns syndrome, Ohdo syndrome, MED13L haploinsufficiency syndrome, and others.

  11. Molecular phylogenetic lineage of Plagiopogon and Askenasia (Protozoa, Ciliophora) revealed by their gene sequences

    NASA Astrophysics Data System (ADS)

    Liu, An; Yi, Zhenzhen; Lin, Xiaofeng; Hu, Xiaozhong; Al-Farraj, Saleh A.; Al-Rasheid, Khaled A. S.

    2015-08-01

    Prostomates and haptorians are two basal groups of ciliates with limited morphological characteristics available for taxonomy. Morphologically, the structures used to identify prostomates and haptorians are similar or even identical, which generate heavy taxonomic and phylogenetic confusion. In present work, phylogenetic positions lineage of two rare genera, Plagiopogon and Askenasia, were investigated. Three genes including small subunit ribosomal RNA gene (hereafter SSU rDNA), internal transcribed spacer region (ITS region), and large subunit ribosomal RNA gene (LSU rDNA) were analyzed, 10 new sequences five species each. Our findings included 1) class Prostomatea and order Haptorida are multiphyletic; 2) it may not be appropriate to place order Cyclotrichiida in subclass Haptoria, and the systematic lineage of order Cyclotrichiida needs to be verified further; 3) genus Plagiopogon branches consistently within a clade covering most prostomes and is basal of clade Colepidae, implying its close lineage to Prostomatea; and 4) Askenasia is phylogenetically distant from the subclass Haptoria but close to classes Prostomatea, Plagiopylea and Oligohymenophorea. We supposed that the toxicyst of Askenasia may be close to taxa of prostomes instead of haptorians, and the dorsal brush is a more typical morphological characteristics of haptorians than toxicysts.

  12. Molecular evidence that the asexual industrial fungus Trichoderma reesei is a clonal derivative of the ascomycete Hypocrea jecorina.

    PubMed Central

    Kuhls, K; Lieckfeldt, E; Samuels, G J; Kovacs, W; Meyer, W; Petrini, O; Gams, W; Börner, T; Kubicek, C P

    1996-01-01

    The relationship of the important cellulase producing asexual fungus Trichoderma reesei to its putative teleomorphic (sexual) ancestor Hypocrea jecorina and other species of the Trichoderma sect. Longibrachiatum was studied by PCR-fingerprinting and sequence analyses of the nuclear ribosomal DNA region containing the internal transcribed spacers (ITS-1 and ITS-2) and the 5.8S rRNA gene. The differences in the corresponding ITS sequences allowed a grouping of anamorphic (asexual) species of Trichoderma sect. Longibrachiatum into Trichoderma longibrachiatum, Trichoderma pseudokoningii, and Trichoderma reesei. The sexual species Hypocrea schweinitzii and H. jecorina were also clearly separated from each other. H. jecorina and T. reesei exhibited identical sequences, suggesting close relatedness or even species identity. Intraspecific and interspecific variation in the PCR-fingerprinting patterns supported the differentiation of species based on ITS sequences, the grouping of the strains, and the assignment of these strains to individual species. The variations between T. reesei and H. jecorina were at the same order of magnitude as found between all strains of H. jecorina, but much lower than the observed interspecific variations. Identical ITS sequences and the high similarity of PCR-fingerprinting patterns indicate a very close relationship between T. reesei and H. jecorina, whereas differences of the ITS sequences and the PCR-fingerprinting patterns show a clear phylogenetic distance between T. reesei/H. jecorina and T. longibrachiatum. T. reesei is considered to be an asexual, clonal line derived from a population of the tropical ascomycete H. jecorina. Images Fig. 2 PMID:8755548

  13. GyrB sequence analysis and MALDI-TOF MS as identification tools for plant pathogenic Clavibacter.

    PubMed

    Zaluga, Joanna; Heylen, Kim; Van Hoorde, Koenraad; Hoste, Bart; Van Vaerenbergh, Johan; Maes, Martine; De Vos, Paul

    2011-09-01

    The bacterial genus Clavibacter has only one species, Clavibacter michiganensis, containing five subspecies. All five are plant pathogens, among which three are recognized as quarantine pests (mentioned on the EPPO A2 list). Prevention of their introduction and epidemic outbreaks requires a reliable and accurate identification. Currently, identification of these bacteria is time consuming and often problematic, mainly because of cross-reactions with other plant-associated bacteria in immunological tests and false-negative results in PCR detection methods. Furthermore, distinguishing closely related subspecies is not straightforward. This study aimed at evaluating the use of matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF MS) and a fragment of the gyrB sequence for the reliable and fast identification of the Clavibacter subspecies. Amplification and sequencing of gyrB using a single primer set had sufficient resolution and specificity to identify each subspecies based on both sequence similarities in cluster analyses and specific signatures within the sequences. All five subspecies also generated distinct and reproducible MALDI-TOF MS profiles, with unique and specific ion peaks for each subspecies, which could be used as biomarkers for identification. Results from both methods were in agreement and were able to distinguish the five Clavibacter subspecies from each other and from representatives of closely related Rathayibacter, Leifsonia or Curtobacterium species. Our study suggests that proteomic analysis using MALDI-TOF MS and gyrB sequence are powerful diagnostic tools for the accurate identification of Clavibacter plant pathogens. Copyright © 2011 Elsevier GmbH. All rights reserved.

  14. Sequence Analysis of the Cryptic Plasmid pMG101 from Rhodopseudomonas palustris and Construction of Stable Cloning Vectors

    PubMed Central

    Inui, Masayuki; Roh, Jung Hyeob; Zahn, Kenneth; Yukawa, Hideaki

    2000-01-01

    A 15-kb cryptic plasmid was obtained from a natural isolate of Rhodopseudomonas palustris. The plasmid, designated pMG101, was able to replicate in R. palustris and in closely related strains of Bradyrhizobium japonicum and phototrophic Bradyrhizobium species. However, it was unable to replicate in the purple nonsulfur bacterium Rhodobacter sphaeroides and in Rhizobium species. The replication region of pMG101 was localized to a 3.0-kb SalI-XhoI fragment, and this fragment was stably maintained in R. palustris for over 100 generations in the absence of selection. The complete nucleotide sequence of this fragment revealed two open reading frames (ORFs), ORF1 and ORF2. The deduced amino acid sequence of ORF1 is similar to sequences of Par proteins, which mediate plasmid stability from certain plasmids, while ORF2 was identified as a putative rep gene, coding for an initiator of plasmid replication, based on homology with the Rep proteins of several other plasmids. The function of these sequences was studied by deletion mapping and gene disruptions of ORF1 and ORF2. pMG101-based Escherichia coli-R. palustris shuttle cloning vectors pMG103 and pMG105 were constructed and were stably maintained in R. palustris growing under nonselective conditions. The ability of plasmid pMG101 to replicate in R. palustris and its close phylogenetic relatives should enable broad application of these vectors within this group of α-proteobacteria. PMID:10618203

  15. Role of molecular mimicry to HIV-1 peptides in HIV-1–related immunologic thrombocytopenia

    PubMed Central

    Li, Zongdong; Nardi, Michael A.; Karpatkin, Simon

    2005-01-01

    Patients with early HIV-1 infection develop an autoimmune thrombocytopenia in which antibody is directed against an immunodominant epitope of the β3 (glycoprotein IIIa [GPIIIa]) integrin, GPIIIa49-66. This antibody induces thrombocytopenia by a novel complement-independent mechanism in which platelets are fragmented by antibody-induced generation of H2O2 derived from the interaction of platelet nicotinamide adenine dinucleotide phosphate (NADPH) oxidase and 12-lipoxygenase. To examine whether sharing of epitope between host and parasite may be responsible for this immunodominant epitope, we screened for antibody-reactive peptides capable of inhibiting platelet lysis and oxidation in vitro, using a filamentous phage display 7-mer peptide library. Fourteen of these phage-peptide clones were identified. Five shared close sequence similarity with GPIIIa49-66, as expected. Ten were molecular mimics with close sequence similarity to HIV-1 proteins nef, gag, env, and pol. Seven were synthesized as 10-mers from their known HIV-1 sequence and found to inhibit anti–GPIIIa49-66–induced platelet oxidation/fragmentation in vitro. Three rabbit antibodies raised against these peptides induced platelet oxidation/fragmentation in vitro and thrombocytopenia in vivo when passively transferred into mice. One of the peptides shared a known epitope region with HIV-1 protein nef and was derived from a variant region of the protein. These data provide strong support for molecular mimicry in HIV-1-immunologic thrombocytopenia within polymorphic regions of HIV-1 proteins. A known epitope of nef is particularly incriminated. PMID:15774614

  16. Marinobacterium rhizophilum sp. nov., isolated from the rhizosphere of the coastal tidal-flat plant Suaeda japonica.

    PubMed

    Kim, Yoon-Gon; Jin, Yeon-A; Hwang, Chung Yeon; Cho, Byung Cheol

    2008-01-01

    A Gram-negative, strictly aerobic, marine bacterium, designated strain CL-YJ9(T), was isolated from sediment closely associated with the roots of a plant (Suaeda japonica) inhabiting a coastal tidal flat. Cells of the novel strain were straight and rod-shaped and were motile by means of monopolar flagella. A phylogenetic analysis based on 16S rRNA gene sequences revealed that strain CL-YJ9(T) belongs to the genus Marinobacterium and was most closely related to Marinobacterium halophilum mano11(T) (94.1% sequence similarity) and to other members of the genus Marinobacterium (92.5-93.7% sequence similarity). The strain grew with 1-5% NaCl (optimum, 3%) and at 5-30 degrees C (optimum, approx. 25 degrees C) and pH 6.0-9.0 (optimum, pH 7.0). The predominant cellular fatty acids were summed feature 3 (C(16:1)omega7c and/or iso-C(15:0) 2-OH, 40.3%), C(18:1)omega7c (26.6%), C(16:0) (16.6%) and C(10:0) 3-OH (7.1%). The major isoprenoid quinone was Q-8. The G+C content of the genomic DNA was 61 mol%. On the basis of the data from this polyphasic study, strain CL-YJ9(T) belongs to the genus Marinobacterium but is distinguishable from the recognized species. Strain CL-YJ9(T) therefore represents a novel species, for which the name Marinobacterium rhizophilum sp. nov. is proposed. The type strain is CL-YJ9(T) (=KCCM 42386(T) =DSM 18822(T)).

  17. Automated method for tracing leading and trailing processes of migrating neurons in confocal image sequences

    NASA Astrophysics Data System (ADS)

    Kerekes, Ryan A.; Gleason, Shaun S.; Trivedi, Niraj; Solecki, David J.

    2010-03-01

    Segmentation, tracking, and tracing of neurons in video imagery are important steps in many neuronal migration studies and can be inaccurate and time-consuming when performed manually. In this paper, we present an automated method for tracing the leading and trailing processes of migrating neurons in time-lapse image stacks acquired with a confocal fluorescence microscope. In our approach, we first locate and track the soma of the cell of interest by smoothing each frame and tracking the local maxima through the sequence. We then trace the leading process in each frame by starting at the center of the soma and stepping repeatedly in the most likely direction of the leading process. This direction is found at each step by examining second derivatives of fluorescent intensity along curves of constant radius around the current point. Tracing terminates after a fixed number of steps or when fluorescent intensity drops below a fixed threshold. We evolve the resulting trace to form an improved trace that more closely follows the approximate centerline of the leading process. We apply a similar algorithm to the trailing process of the cell by starting the trace in the opposite direction. We demonstrate our algorithm on two time-lapse confocal video sequences of migrating cerebellar granule neurons (CGNs). We show that the automated traces closely approximate ground truth traces to within 1 or 2 pixels on average. Additionally, we compute line intensity profiles of fluorescence along the automated traces and quantitatively demonstrate their similarity to manually generated profiles in terms of fluorescence peak locations.

  18. Characterization of a new strain of Taura syndrome virus (TSV) from Colombian shrimp farms and the implication in the selection of TSV resistant lines.

    PubMed

    Aranguren, Luis Fernando; Salazar, Marcela; Tang, Kathy; Caraballo, Xenia; Lightner, Donald

    2013-01-01

    Prior to 2004, Colombian shrimp farming benefited from a selection program in which Penaeus vannamei stocks were developed with resistance to Taura syndrome disease (TS). However since 2004, TS reappeared as a significant disease. In 2010, an apparently new strain of TSV (designated as CO 10) was collected in Colombia. Its genome was sequenced and compared with six other fully sequenced isolates. This analysis revealed that the TSV CO 10 is closely related to the isolates from Hawaii and Venezuela. Phylogenetic analysis based on capsid protein 2 (CP2) region from 59 TSV isolates shows that the recent Colombian isolates (2006-2010) form a new cluster and differ from the previous Colombia isolates (1994-1998) by 4% in nucleotide sequence. The virulence of this CO 10 isolate was similar to a Belize TSV determined through experimental infection in P. vannamei showing 100% mortalities and similar survival curves. By RT-qPCR for TSV, the viral loads were also close in the infected shrimp from both CO 10 and Belize at the order of 1×10(10) copies per μl RNA. To develop TSV-resistant lines, the candidate shrimp should be challenged with virus strains that have been isolated most recently from the regions where they will be cultured. This study suggests that the TSV present in Colombian shrimp farms during the last 5 years is a new TSV strain with high virulence. Copyright © 2012 Elsevier Inc. All rights reserved.

  19. Thermal control of low-pressure fractionation processes. [in basaltic magma solidification

    NASA Technical Reports Server (NTRS)

    Usselman, T. M.; Hodge, D. S.

    1978-01-01

    Thermal models detailing the solidification paths for shallow basaltic magma chambers (both open and closed systems) were calculated using finite-difference techniques. The total solidification time for closed chambers are comparable to previously published calculations; however, the temperature-time paths are not. These paths are dependent on the phase relations and the crystallinity of the system, because both affect the manner in which the latent heat of crystallization is distributed. In open systems, where a chamber would be periodically replenished with additional parental liquid, calculations indicate that the possibility is strong that a steady-state temperature interval is achieved near a major phase boundary. In these cases it is straightforward to analyze fractionation models of the basaltic liquid evolution and their corresponding cumulate sequences. This steady thermal fractionating state can be invoked to explain large amounts of erupted basalts of similar composition over long time periods from the same volcanic center and some rhythmically layered basic cumulate sequences.

  20. Phylogenetic analysis of the spirochete Borrelia microti, a potential agent of relapsing fever in Iran.

    PubMed

    Naddaf, Saied Reza; Ghazinezhad, Behnaz; Bahramali, Golnaz; Cutler, Sally Jane

    2012-09-01

    We report a role for Borrelia microti as a cause of relapsing fever in Iran supported by robust epidemiological evidence. The molecular identity of this spirochete and its relation with other relapsing fever borreliae have, until now, been poorly delineated. We analyzed an isolate of B. microti, obtained from Ornithodoros erraticus ticks, by sequencing four loci (16S rRNA, flaB, glpQ, intragenic spacer [IGS]) and comparing these sequences with those of other relapsing fever borreliae. Phylogenetic analysis using concatenated sequences of 16S rRNA, flaB, and glpQ grouped B. microti alongside three members of the African group, B. duttonii, B. recurrentis, and B. crocidurae, which are distinct from B. persica, the most prevalent established cause of tick-borne relapsing fever in Iran. The similarity values for 10 concatenated sequences totaling 2,437 nucleotides ranged from 92.11% to 99.84%, with the highest homologies being between B. duttonii and B. microti and between B. duttonii and B. recurrentis. Furthermore, the more discriminatory IGS sequence analysis corroborated the close similarity (97.76% to 99.56%) between B. microti and B. duttonii. These findings raise the possibility that both species may indeed be the same and further dispel the one-species, one-vector theory that has been the basis for classification of relapsing fever Borrelia for the last 100 years.

  1. Nicotine pharmacokinetic profiles of the Tobacco Heating System 2.2, cigarettes and nicotine gum in Japanese smokers.

    PubMed

    Brossard, Patrick; Weitkunat, Rolf; Poux, Valerie; Lama, Nicola; Haziza, Christelle; Picavet, Patrick; Baker, Gizelle; Lüdicke, Frank

    2017-10-01

    Two open-label randomized cross-over studies in Japanese smokers investigated the single-use nicotine pharmacokinetic profile of the Tobacco Heating System (THS) 2.2, cigarettes (CC) and nicotine replacement therapy (Gum). In each study, one on the regular and one on the menthol variants of the THS and CC, both using Gum as reference, 62 subjects were randomized to four sequences: Sequence 1: THS - CC (n = 22); Sequence 2: CC - THS (n = 22); Sequence 3: THS - Gum (n = 9); Sequence 4: Gum - THS (n = 9). Plasma nicotine concentrations were measured in 16 blood samples collected over 24 h after single use. Maximal nicotine concentration (C max ) and area under the curve from start of product use to time of last quantifiable concentration (AUC 0-last ) were similar between THS and CC in both studies, with ratios varying from 88 to 104% for C max and from 96 to 98% for AUC 0-last . Urge-to-smoke total scores were comparable between THS and CC. The THS nicotine pharmacokinetic profile was close to CC, with similar levels of urge-to-smoke. This suggests that THS can satisfy smokers and be a viable alternative to cigarettes for adult smokers who want to continue using tobacco. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

  2. A comparison of complete mitochondrial genomes of silver carp hypophthalmichthys molitrix and bighead carp hypophthalmichthys nobilis: Implications for their taxonomic relationship and phylogeny

    USGS Publications Warehouse

    Li, S.-F.; Xu, J.-W.; Yang, Q.-L.; Wang, C.H.; Chen, Q.; Chapman, D.C.; Lu, G.

    2009-01-01

    Based upon morphological characters, Silver carp Hypophthalmichthys molitrix and bighead carp Hypophthalmichthys nobilis (or Aristichthys nobilis) have been classified into either the same genus or two distinct genera. Consequently, the taxonomic relationship of the two species at the generic level remains equivocal. This issue is addressed by sequencing complete mitochondrial genomes of H. molitrix and H. nobilis, comparing their mitogenome organization, structure and sequence similarity, and conducting a comprehensive phylogenetic analysis of cyprinid species. As with other cyprinid fishes, the mitogenomes of the two species were structurally conserved, containing 37 genes including 13 protein-coding genes, two ribosomal RNA genes, 22 transfer RNA (tRNAs) genes and a putative control region (D-loop). Sequence similarity between the two mitogenomes varied in different genes or regions, being highest in the tRNA genes (98??8%), lowest in the control region (89??4%) and intermediate in the protein-coding genes (94??2%). Analyses of the sequence comparison and phylogeny using concatenated protein sequences support the view that the two species belong to the genus Hypophthalmichthys. Further studies using nuclear markers and involving more closely related species, and the systematic combination of traditional biology and molecular biology are needed in order to confirm this conclusion. ?? 2009 The Fisheries Society of the British Isles.

  3. Mating-type genes from the homothallic fungus Sordaria macrospora are functionally expressed in a heterothallic ascomycete.

    PubMed

    Pöggeler, S; Risch, S; Kück, U; Osiewacz, H D

    1997-10-01

    Homokaryons from the homothallic ascomycte Sordaria macrospora are able to enter the sexual pathway and to form fertile fruiting bodies. To analyze the molecular basis of homothallism and to elucidate the role of mating-products during fruiting body development, we cloned and sequenced the entire S. macrospora mating-type locus. Comparison of the Sordaria mating-type locus with mating-type idiomorphs from the heterothallic ascomycetes Neurospora crassa and Podospora anserina revealed that sequences from both idiomorphs (A/a and mat-/mat+, respectively) are contiguous in S. macrospora. DNA sequencing of the S. macrospora mating-type region allowed the identification of four open reading frames (ORFs), which were termed Smt-a1, SmtA-1, SmtA-2 and SmtA-3. While Smt-a1, SmtA-1, and SmtA-2 show strong sequence similarities with the corresponding N. crassa mating-type ORFs, SmtA-3 has a chimeric character. It comprises sequences that are similar to the A and a mating-type idiomorph from N. crassa. To determine functionality of the S. macrospora mating-type genes, we show that all ORFs are transcriptionally expressed. Furthermore, we transformed the S. macrospora mating-type genes into mat- and mat+ strains of the closely related heterothallic fungus P. anserina. The transformation experiments show that mating-type genes from S. macrospora induce fruiting body formation in P. anserina.

  4. Prevotella paludivivens sp. nov., a novel strictly anaerobic, Gram-negative, hemicellulose-decomposing bacterium isolated from plant residue and rice roots in irrigated rice-field soil.

    PubMed

    Ueki, Atsuko; Akasaka, Hiroshi; Satoh, Atsuya; Suzuki, Daisuke; Ueki, Katsuji

    2007-08-01

    Two strictly anaerobic bacterial strains, KB7(T) and A42, were isolated from rice plant residue and living rice roots, respectively, from irrigated rice-field soil in Japan. These two strains were closely related to each other with 16S rRNA gene sequence similarity of 99.8 %. Both strains showed almost the same physiological properties. Cells were Gram-negative, non-motile, non-spore-forming rods. Growth was remarkably stimulated by the addition of haemin to the medium. The strains utilized various saccharides including xylan, xylose, pectin and carboxymethylcellulose and produced acetate and succinate with small amounts of formate and malate. The strains grew at 10-40 degrees C; optimum growth was observed at 30 degrees C and pH 5.7-6.7. Oxidase, catalase and nitrate-reducing activities were not detected. Aesculin was hydrolysed. The major cellular fatty acids were anteiso-C(15 : 0), iso-C(15 : 0), C(15 : 0) and iso-C(17 : 0) 3-OH. Menaquinones MK-11 and MK-11(H(2)) were the major respiratory quinones and the genomic DNA G+C content was 39.2 mol%. Phylogenetic analysis based on 16S rRNA gene sequences placed both strains in the phylum Bacteroidetes. 16S rRNA gene sequence analysis showed that the most related species to both strains was Prevotella oulorum (92.8-92.9 % similarity). Prevotella veroralis and Prevotella melaninogenica were the next most closely related known species with sequence similarities of 91.9-92.4 %. Based on differences in the phylogenetic, ecological, physiological and chemotaxonomic characteristics between the two isolates and related species, it is proposed that strains KB7(T) and A42 represent a novel species, Prevotella paludivivens sp. nov. This is the first described Prevotella species derived from a natural habitat; all other Prevotella species are from mammalian sources. The type strain of Prevotella paludivivens is KB7(T) (=JCM 13650(T)=DSM 17968(T)).

  5. Lactobacillus silagincola sp. nov. and Lactobacillus pentosiphilus sp. nov., isolated from silage.

    PubMed

    Tohno, Masanori; Tanizawa, Yasuhiro; Irisawa, Tomohiro; Masuda, Takaharu; Sakamoto, Mitsuo; Arita, Masanori; Ohkuma, Moriya; Kobayashi, Hisami

    2017-09-01

    Three Gram-stain positive, non-motile, non-spore-forming, catalase-negative and rod-shaped bacterial strains (IWT5T, IWT25T and IWT140), isolated from silage, were investigated by using a polyphasic taxonomic approach. Strains IWT5T and IWT25T grew at 10-37 °C and 30-37 °C, and at pH 4.0-7.5 and 4.0-7.0, respectively. The G+C contents of genomic DNA of strains IWT5T and IWT25T were 43.2 and 44.4 mol%, respectively. Strains IWT5T and IWT25T contained C16 : 0, C18 : 1 ω9c and summed feature 7 (unknown 18.846/C19 : 1 ω6c/C19 : 0cyclo ω10c) as the major fatty acids. Strain IWT5T was most closely related to the type strains of Lactobacillus mixtipabuli (99.9 % 16S rRNA gene sequence similarity) and Lactobacillus silagei (99.5 %). For IWT25T, the 16S rRNA gene sequence similarities with the closely related neighbour type strains L. mixtipabuli and L. silagei were 99.5 and 99.5 %, respectively. The 16S rRNA gene sequence similarities among the three novel isolates were 99.5-99.9 %. The average nucleotide identities of strains IWT5T and IWT25T to other neighbours of the genus Lactobacillus were less than 82 % and the genomes of IWT25T and IWT140 shared 97.3 % average nucleotide identity, demonstrating that the three strains were allocated to two different novel species of the genus Lactobacillus. Together with multilocus sequence analysis, phenotypic and chemotaxonomic characteristics, strains IWT5T (=JCM 31144T=DSM 102973T) and IWT25T (=JCM 31145T=DSM 102974T) are proposed as the type strains of novel species of the genus Lactobacillus, with the names Lactobacillus silagincola sp. nov. and Lactobacillus pentosiphilus sp. nov., respectively.

  6. Pyrosequencing the Canine Faecal Microbiota: Breadth and Depth of Biodiversity

    PubMed Central

    Hand, Daniel; Wallis, Corrin; Colyer, Alison; Penn, Charles W.

    2013-01-01

    Mammalian intestinal microbiota remain poorly understood despite decades of interest and investigation by culture-based and other long-established methodologies. Using high-throughput sequencing technology we now report a detailed analysis of canine faecal microbiota. The study group of animals comprised eleven healthy adult miniature Schnauzer dogs of mixed sex and age, some closely related and all housed in kennel and pen accommodation on the same premises with similar feeding and exercise regimes. DNA was extracted from faecal specimens and subjected to PCR amplification of 16S rDNA, followed by sequencing of the 5′ region that included variable regions V1 and V2. Barcoded amplicons were sequenced by Roche-454 FLX high-throughput pyrosequencing. Sequences were assigned to taxa using the Ribosomal Database Project Bayesian classifier and revealed dominance of Fusobacterium and Bacteroidetes phyla. Differences between animals in the proportions of different taxa, among 10,000 reads per animal, were clear and not supportive of the concept of a “core microbiota”. Despite this variability in prominent genera, littermates were shown to have a more similar faecal microbial composition than unrelated dogs. Diversity of the microbiota was also assessed by assignment of sequence reads into operational taxonomic units (OTUs) at the level of 97% sequence identity. The OTU data were then subjected to rarefaction analysis and determination of Chao1 richness estimates. The data indicated that faecal microbiota comprised possibly as many as 500 to 1500 OTUs. PMID:23382835

  7. Constraints on the depositional age and tectonometamorphic evolution of marbles from the Biharia Nappe System (Apuseni Mountains, Romania)

    NASA Astrophysics Data System (ADS)

    Reiser, Martin Kaspar; Schuster, Ralf; Tropper, Peter; Fügenschuh, Bernhard

    2017-04-01

    Basement rocks from the Biharia Nappe System in the Apuseni Mountains comprise several dolomite and calcite marble sequences or lenses which experienced deformation and metamorphic overprint during the Alpine orogeny. New Sr, O and C-isotope data in combination with considerations from the lithological sequences indicate Middle to Late Triassic deposition of calcite marbles from the Vulturese-Belioara Series (Biharia Nappe s.str.). Ductile deformation and large-scale folding of the siliciclastic and carbonatic lithologies is attributed to NW-directed nappe stacking during late Early Cretaceous times (D2). The studied marble sequences experienced a metamorphic overprint under lower greenschist- facies conditions (316-370 °C based on calcite - dolomite geothermometry) during this tectonic event. Other marble sequences from the Biharia Nappe System (i.e. Vidolm and Baia de Arieș nappes) show similarities in the stratigraphic sequence and their isotope signature, together with a comparable structural position close to nappe contact. However, the dataset is not concise enough to allow for a definitive attribution of a Mesozoic origin to other marble sequences than the Vulturese-Belioara Series.

  8. High resolution identity testing of inactivated poliovirus vaccines

    PubMed Central

    Mee, Edward T.; Minor, Philip D.; Martin, Javier

    2015-01-01

    Background Definitive identification of poliovirus strains in vaccines is essential for quality control, particularly where multiple wild-type and Sabin strains are produced in the same facility. Sequence-based identification provides the ultimate in identity testing and would offer several advantages over serological methods. Methods We employed random RT-PCR and high throughput sequencing to recover full-length genome sequences from monovalent and trivalent poliovirus vaccine products at various stages of the manufacturing process. Results All expected strains were detected in previously characterised products and the method permitted identification of strains comprising as little as 0.1% of sequence reads. Highly similar Mahoney and Sabin 1 strains were readily discriminated on the basis of specific variant positions. Analysis of a product known to contain incorrect strains demonstrated that the method correctly identified the contaminants. Conclusion Random RT-PCR and shotgun sequencing provided high resolution identification of vaccine components. In addition to the recovery of full-length genome sequences, the method could also be easily adapted to the characterisation of minor variant frequencies and distinction of closely related products on the basis of distinguishing consensus and low frequency polymorphisms. PMID:26049003

  9. Design and implementation of a database for Brucella melitensis genome annotation.

    PubMed

    De Hertogh, Benoît; Lahlimi, Leïla; Lambert, Christophe; Letesson, Jean-Jacques; Depiereux, Eric

    2008-03-18

    The genome sequences of three Brucella biovars and of some species close to Brucella sp. have become available, leading to new relationship analysis. Moreover, the automatic genome annotation of the pathogenic bacteria Brucella melitensis has been manually corrected by a consortium of experts, leading to 899 modifications of start sites predictions among the 3198 open reading frames (ORFs) examined. This new annotation, coupled with the results of automatic annotation tools of the complete genome sequences of the B. melitensis genome (including BLASTs to 9 genomes close to Brucella), provides numerous data sets related to predicted functions, biochemical properties and phylogenic comparisons. To made these results available, alphaPAGe, a functional auto-updatable database of the corrected sequence genome of B. melitensis, has been built, using the entity-relationship (ER) approach and a multi-purpose database structure. A friendly graphical user interface has been designed, and users can carry out different kinds of information by three levels of queries: (1) the basic search use the classical keywords or sequence identifiers; (2) the original advanced search engine allows to combine (by using logical operators) numerous criteria: (a) keywords (textual comparison) related to the pCDS's function, family domains and cellular localization; (b) physico-chemical characteristics (numerical comparison) such as isoelectric point or molecular weight and structural criteria such as the nucleic length or the number of transmembrane helix (TMH); (c) similarity scores with Escherichia coli and 10 species phylogenetically close to B. melitensis; (3) complex queries can be performed by using a SQL field, which allows all queries respecting the database's structure. The database is publicly available through a Web server at the following url: http://www.fundp.ac.be/urbm/bioinfo/aPAGe.

  10. Legionella saoudiensis sp. nov., isolated from a sewage water sample.

    PubMed

    Bajrai, Leena Hussein; Azhar, Esam Ibraheem; Yasir, Muhammad; Jardot, Priscilla; Barrassi, Lina; Raoult, Didier; La Scola, Bernard; Pagnier, Isabelle

    2016-11-01

    A Gram-stain-negative, bacilli-shaped bacterial strain, LS-1T, was isolated from a sewage water sample collected in Jeddah, Saudi Arabia. The taxonomic position of strain LS-1T was investigated using a polyphasic taxonomic approach. Phylogenetic analysis based on 16S rRNA gene sequences and those of four other genes indicated that strain LS-1T belongs to the genus Legionella in the family Legionellaceae. Regarding the 16S rRNA gene, the most closely related species are Legionella rowbothamii LLAP-6T (98.6 %) and Legionella lytica L2T (98.5 %). The mip gene sequence of strain LS-1T showed 94 % sequence similarity with that of L. lytica L2T and 93 % similarity with that of L. rowbothamii LLAP-6T. Strain LS-1T grew optimally at a temperature of 32 °C on a buffered charcoal yeast extract (BCYE) agar plate in a 5 % CO2 atmosphere and had a flagellum. The combined phylogenetic, phenotypic and genomic sequence data suggest that strain LS-1T represents a novel species of the genus Legionella, for which the name Legionella saoudiensis sp. nov. is proposed. The type strain is LS-1T (=DSM 101682T=CSUR P2101T).

  11. Incorporating information on predicted solvent accessibility to the co-evolution-based study of protein interactions.

    PubMed

    Ochoa, David; García-Gutiérrez, Ponciano; Juan, David; Valencia, Alfonso; Pazos, Florencio

    2013-01-27

    A widespread family of methods for studying and predicting protein interactions using sequence information is based on co-evolution, quantified as similarity of phylogenetic trees. Part of the co-evolution observed between interacting proteins could be due to co-adaptation caused by inter-protein contacts. In this case, the co-evolution is expected to be more evident when evaluated on the surface of the proteins or the internal layers close to it. In this work we study the effect of incorporating information on predicted solvent accessibility to three methods for predicting protein interactions based on similarity of phylogenetic trees. We evaluate the performance of these methods in predicting different types of protein associations when trees based on positions with different characteristics of predicted accessibility are used as input. We found that predicted accessibility improves the results of two recent versions of the mirrortree methodology in predicting direct binary physical interactions, while it neither improves these methods, nor the original mirrortree method, in predicting other types of interactions. That improvement comes at no cost in terms of applicability since accessibility can be predicted for any sequence. We also found that predictions of protein-protein interactions are improved when multiple sequence alignments with a richer representation of sequences (including paralogs) are incorporated in the accessibility prediction.

  12. Microvirga vignae sp. nov., a root nodule symbiotic bacterium isolated from cowpea grown in semi-arid Brazil.

    PubMed

    Radl, Viviane; Simões-Araújo, Jean Luiz; Leite, Jakson; Passos, Samuel Ribeiro; Martins, Lindete Míria Vieira; Xavier, Gustavo Ribeiro; Rumjanek, Norma Gouvêa; Baldani, José Ivo; Zilli, Jerri Edson

    2014-03-01

    16S rRNA gene sequence analysis of eight strains (BR 3299(T), BR 3296, BR 10192, BR 10193, BR 10194, BR 10195, BR 10196 and BR 10197) isolated from nodules of cowpea collected from a semi-arid region of Brazil showed 97 % similarity to sequences of recently described rhizobial species of the genus Microvirga. Phylogenetic analyses of four housekeeping genes (gyrB, recA, dnaK and rpoB), DNA-DNA relatedness and AFLP further indicated that these strains belong to a novel species within the genus Microvirga. Our data support the hypothesis that genes related to nitrogen fixation were obtained via horizontal gene transfer, as sequences of nifH genes were very similar to those found in members of the genera Rhizobium and Mesorhizobium, which are not immediate relatives of the genus Microvirga, as shown by 16S rRNA gene sequence analysis. Phenotypic traits, such as host range and carbon utilization, differentiate the novel strains from the most closely related species, Microvirga lotononidis, Microvirga zambiensis and Microvirga lupini. Therefore, these symbiotic nitrogen-fixing bacteria are proposed to be representatives of a novel species, for which the name Microvirga vignae sp. nov. is suggested. The type strain is BR3299(T) ( = HAMBI 3457(T)).

  13. Molecular Characterization of the Kamese Virus, an Unassigned Rhabdovirus, Isolated from Culex pruina in the Central African Republic.

    PubMed

    Simo Tchetgna, Huguette Dorine; Nakoune, Emmanuel; Selekon, Benjamin; Gessain, Antoine; Manuguerra, Jean-Claude; Kazanji, Mirdad; Berthet, Nicolas

    2017-06-01

    Rhabdoviridae is one of the most diversified families of RNA viruses whose members infect a wide range of plants, animals, and arthropods. The members of this family are classified into 13 genera and >150 unassigned viruses. Here, we sequenced the complete genome of a rhabdovirus belonging to the Hart Park serogroup, the Kamese virus (KAMV), isolated in 1977 from Culex pruina in the Central African Republic. The genomic sequence showed an organization typical of rhabdoviruses with additional genes in the P-M and G-L intergenic regions, as already reported for the Hart Park serogroup. Our Kamese strain (ArB9074) had 98% and 78.8% nucleotide sequence similarity with the prototypes of the KAMV and Mossuril virus isolated in Uganda and Mozambique in two different Culex species, respectively. Moreover, the protein sequences had 98-100% amino acid similarity with the prototype of the KAMV, except for an additional gene (U3) that showed a divergence of 6%. These molecular data show that our strain of the KAMV is genetically close to the Culex annuliorus strain that was circulating in Uganda in 1967. However, this study suggests the need to improve our knowledge of the KAMV to better understand its behavior, its life cycle, and its potential reservoirs.

  14. Streptococcus ovuberis sp. nov., isolated from a subcutaneous abscess in the udder of a sheep.

    PubMed

    Zamora, Leydis; Pérez-Sancho, Marta; Fernández-Garayzábal, Jose Francisco; Orden, Jose Antonio; Domínguez-Bernal, Gustavo; de la Fuente, Ricardo; Domínguez, Lucas; Vela, Ana Isabel

    2017-11-01

    One unidentified, Gram-stain-positive, catalase-negative coccus-shaped organism was recovered from a subcutaneous abscess of the udder of a sheep and subjected to a polyphasic taxonomic analysis. Based on cellular morphology and biochemical criteria, the isolate was tentatively assigned to the genus Streptococcus, although the organism did not appear to match any recognized species. 16S rRNA gene sequence comparison studies confirmed its identification as a member of the genus Streptococcus and showed that the nearest phylogenetic relatives of the unknown coccus corresponded to Streptococcus moroccensis and Streptococcus cameli (95.9 % 16S rRNA gene sequence similarity). The sodA sequence analysis showed less than 89.3 % sequence similarity with the currently recognized species of the genus Streptococcus. The novel bacterial isolate was distinguished from close relatives of the genus Streptococcusby using biochemical tests. A mass spectrometry profile was also obtained for the novel isolate using matrix-assisted laser desorption/ionization time-of-flight mass spectrometry (MALDI-TOF MS). Based on both phenotypic and phylogenetic findings, it is proposed that the unknown bacterium be classified as a representative of a novel species of the genus Streptococcus, Streptococcus ovuberis sp. nov. The type strain of Streptococcus ovuberissp. nov. is VB15-00779 T (=CECT 9179 T =CCUG 69612 T ).

  15. Comparison of internal transcribed spacers and intergenic spacer regions of five common Iranian sheep bursate nematodes.

    PubMed

    Nabavi, Reza; Conneely, Brendan; McCarthy, Elaine; Good, Barbara; Shayan, Parviz; DE Waal, Theo

    2014-09-01

    Accurate identification of sheep nematodes is a critical point in epidemiological studies and monitoring of drug resistance in flocks. However, due to a close morphological similarity between the eggs and larval stages of many of these nematodes, such identification is not a trivial task. There are a number of studies showing that molecular targets in ribosomal DNA (Internal transcribed spacer 1, 2 and Intergenic spacer) are suitable for accurate identification of sheep bursate nematodes. The objective of present study was to compare the ITS1, ITS2 and IGS regions of Iranian common bursate nematodes in order to choose best target for specific identification methods. The first and second internal transcribed spacers (ITS1and ITS2) and intergenic spacer (IGS) of the ribosomal DNA (rDNA) of 5 common Iranian bursate nematodes of sheep were sequenced. The sequences of some non-Iranian isolates were used for comparison in order to evaluate the variation in sequence homology between geographically different nematode populations. Comparison of the ITS1 and ITS2 sequences of Iranian nematodes showed greatest similarity among Teladorsagia circumcincta and Marshallagia marshalli of 94% and 88%, respectively. While Trichostrongylus colubriformis and M. marshalli showed the highest homology (99%) in the IGS sequences. Comparison of the spacer sequences of Iranian with non-Iranian isolates showed significantly higher variation in Haemonchus contortus compared to the other species. Both the ITS1 and ITS2 sequences are convenient targets to have species-specific identification of Iranian bursate nematodes. On the other hand the IGS region may be a less suitable molecular target.

  16. The complete nucleotide sequence of the genome of Barley yellow dwarf virus-RMV reveals it to be a new Polerovirus distantly related to other yellow dwarf viruses

    PubMed Central

    Krueger, Elizabeth N.; Beckett, Randy J.; Gray, Stewart M.; Miller, W. Allen

    2013-01-01

    The yellow dwarf viruses (YDVs) of the Luteoviridae family represent the most widespread group of cereal viruses worldwide. They include the Barley yellow dwarf viruses (BYDVs) of genus Luteovirus, the Cereal yellow dwarf viruses (CYDVs) and Wheat yellow dwarf virus (WYDV) of genus Polerovirus. All of these viruses are obligately aphid transmitted and phloem-limited. The first described YDVs (initially all called BYDV) were classified by their most efficient vector. One of these viruses, BYDV-RMV, is transmitted most efficiently by the corn leaf aphid, Rhopalosiphum maidis. Here we report the complete 5612 nucleotide sequence of the genomic RNA of a Montana isolate of BYDV-RMV (isolate RMV MTFE87, Genbank accession no. KC921392). The sequence revealed that BYDV-RMV is a polerovirus, but it is quite distantly related to the CYDVs or WYDV, which are very closely related to each other. Nor is BYDV-RMV closely related to any other particular polerovirus. Depending on the gene that is compared, different poleroviruses (none of them a YDV) share the most sequence similarity to BYDV-RMV. Because of its distant relationship to other YDVs, and because it commonly infects maize via its vector, R. maidis, we propose that BYDV-RMV be renamed Maize yellow dwarf virus-RMV (MYDV-RMV). PMID:23888156

  17. The complete nucleotide sequence of the genome of Barley yellow dwarf virus-RMV reveals it to be a new Polerovirus distantly related to other yellow dwarf viruses.

    PubMed

    Krueger, Elizabeth N; Beckett, Randy J; Gray, Stewart M; Miller, W Allen

    2013-01-01

    The yellow dwarf viruses (YDVs) of the Luteoviridae family represent the most widespread group of cereal viruses worldwide. They include the Barley yellow dwarf viruses (BYDVs) of genus Luteovirus, the Cereal yellow dwarf viruses (CYDVs) and Wheat yellow dwarf virus (WYDV) of genus Polerovirus. All of these viruses are obligately aphid transmitted and phloem-limited. The first described YDVs (initially all called BYDV) were classified by their most efficient vector. One of these viruses, BYDV-RMV, is transmitted most efficiently by the corn leaf aphid, Rhopalosiphum maidis. Here we report the complete 5612 nucleotide sequence of the genomic RNA of a Montana isolate of BYDV-RMV (isolate RMV MTFE87, Genbank accession no. KC921392). The sequence revealed that BYDV-RMV is a polerovirus, but it is quite distantly related to the CYDVs or WYDV, which are very closely related to each other. Nor is BYDV-RMV closely related to any other particular polerovirus. Depending on the gene that is compared, different poleroviruses (none of them a YDV) share the most sequence similarity to BYDV-RMV. Because of its distant relationship to other YDVs, and because it commonly infects maize via its vector, R. maidis, we propose that BYDV-RMV be renamed Maize yellow dwarf virus-RMV (MYDV-RMV).

  18. Evolutionary distance from human homologs reflects allergenicity of animal food proteins.

    PubMed

    Jenkins, John A; Breiteneder, Heimo; Mills, E N Clare

    2007-12-01

    In silico analysis of allergens can identify putative relationships among protein sequence, structure, and allergenic properties. Such systematic analysis reveals that most plant food allergens belong to a restricted number of protein superfamilies, with pollen allergens behaving similarly. We have investigated the structural relationships of animal food allergens and their evolutionary relatedness to human homologs to define how closely a protein must resemble a human counterpart to lose its allergenic potential. Profile-based sequence homology methods were used to classify animal food allergens into Pfam families, and in silico analyses of their evolutionary and structural relationships were performed. Animal food allergens could be classified into 3 main families--tropomyosins, EF-hand proteins, and caseins--along with 14 minor families each composed of 1 to 3 allergens. The evolutionary relationships of each of these allergen superfamilies showed that in general, proteins with a sequence identity to a human homolog above approximately 62% were rarely allergenic. Single substitutions in otherwise highly conserved regions containing IgE epitopes in EF-hand parvalbumins may modulate allergenicity. These data support the premise that certain protein structures are more allergenic than others. Contrasting with plant food allergens, animal allergens, such as the highly conserved tropomyosins, challenge the capability of the human immune system to discriminate between foreign and self-proteins. Such immune responses run close to becoming autoimmune responses. Exploiting the closeness between animal allergens and their human homologs in the development of recombinant allergens for immunotherapy will need to consider the potential for developing unanticipated autoimmune responses.

  19. Amino Acid Properties Conserved in Molecular Evolution

    PubMed Central

    Rudnicki, Witold R.; Mroczek, Teresa; Cudek, Paweł

    2014-01-01

    That amino acid properties are responsible for the way protein molecules evolve is natural and is also reasonably well supported both by the structure of the genetic code and, to a large extent, by the experimental measures of the amino acid similarity. Nevertheless, there remains a significant gap between observed similarity matrices and their reconstructions from amino acid properties. Therefore, we introduce a simple theoretical model of amino acid similarity matrices, which allows splitting the matrix into two parts – one that depends only on mutabilities of amino acids and another that depends on pairwise similarities between them. Then the new synthetic amino acid properties are derived from the pairwise similarities and used to reconstruct similarity matrices covering a wide range of information entropies. Our model allows us to explain up to 94% of the variability in the BLOSUM family of the amino acids similarity matrices in terms of amino acid properties. The new properties derived from amino acid similarity matrices correlate highly with properties known to be important for molecular evolution such as hydrophobicity, size, shape and charge of amino acids. This result closes the gap in our understanding of the influence of amino acids on evolution at the molecular level. The methods were applied to the single family of similarity matrices used often in general sequence homology searches, but it is general and can be used also for more specific matrices. The new synthetic properties can be used in analyzes of protein sequences in various biological applications. PMID:24967708

  20. A Gene Encoding a Hevein-Like Protein from Elderberry Fruits Is Homologous to PR-4 and Class V Chitinase Genes1

    PubMed Central

    Van Damme, Els J.M.; Charels, Diana; Roy, Soma; Tierens, Koenraad; Barre, Annick; Martins, José C.; Rougé, Pierre; Van Leuven, Fred; Does, Mirjam; Peumans, Willy J.

    1999-01-01

    We isolated SN-HLPf (Sambucus nigra hevein-like fruit protein), a hevein-like chitin-binding protein, from mature elderberry fruits. Cloning of the corresponding gene demonstrated that SN-HLPf is synthesized as a chimeric precursor consisting of an N-terminal chitin-binding domain corresponding to the mature elderberry protein and an unrelated C-terminal domain. Sequence comparisons indicated that the N-terminal domain of this precursor has high sequence similarity with the N-terminal domain of class I PR-4 (pathogenesis-related) proteins, whereas the C terminus is most closely related to that of class V chitinases. On the basis of these sequence homologies the gene encoding SN-HLPf can be considered a hybrid between a PR-4 and a class V chitinase gene. PMID:10198114

  1. Skin Microbiome Surveys Are Strongly Influenced by Experimental Design.

    PubMed

    Meisel, Jacquelyn S; Hannigan, Geoffrey D; Tyldsley, Amanda S; SanMiguel, Adam J; Hodkinson, Brendan P; Zheng, Qi; Grice, Elizabeth A

    2016-05-01

    Culture-independent studies to characterize skin microbiota are increasingly common, due in part to affordable and accessible sequencing and analysis platforms. Compared to culture-based techniques, DNA sequencing of the bacterial 16S ribosomal RNA (rRNA) gene or whole metagenome shotgun (WMS) sequencing provides more precise microbial community characterizations. Most widely used protocols were developed to characterize microbiota of other habitats (i.e., gastrointestinal) and have not been systematically compared for their utility in skin microbiome surveys. Here we establish a resource for the cutaneous research community to guide experimental design in characterizing skin microbiota. We compare two widely sequenced regions of the 16S rRNA gene to WMS sequencing for recapitulating skin microbiome community composition, diversity, and genetic functional enrichment. We show that WMS sequencing most accurately recapitulates microbial communities, but sequencing of hypervariable regions 1-3 of the 16S rRNA gene provides highly similar results. Sequencing of hypervariable region 4 poorly captures skin commensal microbiota, especially Propionibacterium. WMS sequencing, which is resource and cost intensive, provides evidence of a community's functional potential; however, metagenome predictions based on 16S rRNA sequence tags closely approximate WMS genetic functional profiles. This study highlights the importance of experimental design for downstream results in skin microbiome surveys. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

  2. Skin microbiome surveys are strongly influenced by experimental design

    PubMed Central

    Meisel, Jacquelyn S.; Hannigan, Geoffrey D.; Tyldsley, Amanda S.; SanMiguel, Adam J.; Hodkinson, Brendan P.; Zheng, Qi; Grice, Elizabeth A.

    2016-01-01

    Culture-independent studies to characterize skin microbiota are increasingly common, due in part to affordable and accessible sequencing and analysis platforms. Compared to culture-based techniques, DNA sequencing of the bacterial 16S ribosomal RNA (rRNA) gene or whole metagenome shotgun (WMS) sequencing provide more precise microbial community characterizations. Most widely used protocols were developed to characterize microbiota of other habitats (i.e. gastrointestinal), and have not been systematically compared for their utility in skin microbiome surveys. Here we establish a resource for the cutaneous research community to guide experimental design in characterizing skin microbiota. We compare two widely sequenced regions of the 16S rRNA gene to WMS sequencing for recapitulating skin microbiome community composition, diversity, and genetic functional enrichment. We show that WMS sequencing most accurately recapitulates microbial communities, but sequencing of hypervariable regions 1-3 of the 16S rRNA gene provides highly similar results. Sequencing of hypervariable region 4 poorly captures skin commensal microbiota, especially Propionibacterium. WMS sequencing, which is resource- and cost-intensive, provides evidence of a community’s functional potential; however, metagenome predictions based on 16S rRNA sequence tags closely approximate WMS genetic functional profiles. This work highlights the importance of experimental design for downstream results in skin microbiome surveys. PMID:26829039

  3. Microbial diversity in ultra-high-pressure rocks and fluids from the Chinese Continental Scientific Drilling Project in China.

    PubMed

    Zhang, Gengxin; Dong, Hailiang; Xu, Zhiqin; Zhao, Donggao; Zhang, Chuanlun

    2005-06-01

    Microbial communities in ultra-high-pressure (UHP) rocks and drilling fluids from the Chinese Continental Scientific Drilling Project were characterized. The rocks had a porosity of 1 to 3.5% and a permeability of approximately 0.5 mDarcy. Abundant fluid and gas inclusions were present in the minerals. The rocks contained significant amounts of Fe2O3, FeO, P2O5, and nitrate (3 to 16 ppm). Acridine orange direct counting and phospholipid fatty acid analysis indicated that the total counts in the rocks and the fluids were 5.2 x 10(3) to 2.4 x 10(4) cells/g and 3.5 x 10(8) to 4.2 x 10(9) cells/g, respectively. Enrichment assays resulted in successful growth of thermophilic and alkaliphilic bacteria from the fluids, and some of these bacteria reduced Fe(III) to magnetite. 16S rRNA gene analyses indicated that the rocks were dominated by sequences similar to sequences of Proteobacteria and that most organisms were related to nitrate reducers from a saline, alkaline, cold habitat; however, some phylotypes were either members of a novel lineage or closely related to uncultured clones. The bacterial communities in the fluids were more diverse and included Proteobacteria, Bacteroidetes, gram-positive bacteria, Planctomycetes, and Candidatus taxa. The archaeal diversity was lower, and most sequences were not related to any known cultivated species. Some archaeal sequences were 90 to 95% similar to sequences recovered from ocean sediments or other subsurface environments. Some archaeal sequences from the drilling fluids were >93% similar to sequences of Sulfolobus solfataricus, and the thermophilic nature was consistent with the in situ temperature. We inferred that the microbes in the UHP rocks reside in fluid and gas inclusions, whereas those in the drilling fluids may be derived from subsurface fluids.

  4. Microbial Diversity in Ultra-High-Pressure Rocks and Fluids from the Chinese Continental Scientific Drilling Project in China

    PubMed Central

    Zhang, Gengxin; Dong, Hailiang; Xu, Zhiqin; Zhao, Donggao; Zhang, Chuanlun

    2005-01-01

    Microbial communities in ultra-high-pressure (UHP) rocks and drilling fluids from the Chinese Continental Scientific Drilling Project were characterized. The rocks had a porosity of 1 to 3.5% and a permeability of ∼0.5 mDarcy. Abundant fluid and gas inclusions were present in the minerals. The rocks contained significant amounts of Fe2O3, FeO, P2O5, and nitrate (3 to 16 ppm). Acridine orange direct counting and phospholipid fatty acid analysis indicated that the total counts in the rocks and the fluids were 5.2 × 103 to 2.4 × 104 cells/g and 3.5 × 108 to 4.2 × 109 cells/g, respectively. Enrichment assays resulted in successful growth of thermophilic and alkaliphilic bacteria from the fluids, and some of these bacteria reduced Fe(III) to magnetite. 16S rRNA gene analyses indicated that the rocks were dominated by sequences similar to sequences of Proteobacteria and that most organisms were related to nitrate reducers from a saline, alkaline, cold habitat; however, some phylotypes were either members of a novel lineage or closely related to uncultured clones. The bacterial communities in the fluids were more diverse and included Proteobacteria, Bacteroidetes, gram-positive bacteria, Planctomycetes, and Candidatus taxa. The archaeal diversity was lower, and most sequences were not related to any known cultivated species. Some archaeal sequences were 90 to 95% similar to sequences recovered from ocean sediments or other subsurface environments. Some archaeal sequences from the drilling fluids were >93% similar to sequences of Sulfolobus solfataricus, and the thermophilic nature was consistent with the in situ temperature. We inferred that the microbes in the UHP rocks reside in fluid and gas inclusions, whereas those in the drilling fluids may be derived from subsurface fluids. PMID:15933024

  5. Characterizing protein domain associations by Small-molecule ligand binding

    PubMed Central

    Li, Qingliang; Cheng, Tiejun; Wang, Yanli; Bryant, Stephen H.

    2012-01-01

    Background Protein domains are evolutionarily conserved building blocks for protein structure and function, which are conventionally identified based on protein sequence or structure similarity. Small molecule binding domains are of great importance for the recognition of small molecules in biological systems and drug development. Many small molecules, including drugs, have been increasingly identified to bind to multiple targets, leading to promiscuous interactions with protein domains. Thus, a large scale characterization of the protein domains and their associations with respect to small-molecule binding is of particular interest to system biology research, drug target identification, as well as drug repurposing. Methods We compiled a collection of 13,822 physical interactions of small molecules and protein domains derived from the Protein Data Bank (PDB) structures. Based on the chemical similarity of these small molecules, we characterized pairwise associations of the protein domains and further investigated their global associations from a network point of view. Results We found that protein domains, despite lack of similarity in sequence and structure, were comprehensively associated through binding the same or similar small-molecule ligands. Moreover, we identified modules in the domain network that consisted of closely related protein domains by sharing similar biochemical mechanisms, being involved in relevant biological pathways, or being regulated by the same cognate cofactors. Conclusions A novel protein domain relationship was identified in the context of small-molecule binding, which is complementary to those identified by traditional sequence-based or structure-based approaches. The protein domain network constructed in the present study provides a novel perspective for chemogenomic study and network pharmacology, as well as target identification for drug repurposing. PMID:23745168

  6. Renorming c0 and closed, bounded, convex sets with fixed point property for affine nonexpansive mappings

    NASA Astrophysics Data System (ADS)

    Nezir, Veysel; Mustafa, Nizami

    2017-04-01

    In 2008, P.K. Lin provided the first example of a nonreflexive space that can be renormed to have fixed point property for nonexpansive mappings. This space was the Banach space of absolutely summable sequences l1 and researchers aim to generalize this to c0, Banach space of null sequences. Before P.K. Lin's intriguing result, in 1979, Goebel and Kuczumow showed that there is a large class of non-weak* compact closed, bounded, convex subsets of l1 with fixed point property for nonexpansive mappings. Then, P.K. Lin inspired by Goebel and Kuczumow's ideas to give his result. Similarly to P.K. Lin's study, Hernández-Linares worked on L1 and in his Ph.D. thesis, supervisored under Maria Japón, showed that L1 can be renormed to have fixed point property for affine nonexpansive mappings. Then, related questions for c0 have been considered by researchers. Recently, Nezir constructed several equivalent norms on c0 and showed that there are non-weakly compact closed, bounded, convex subsets of c0 with fixed point property for affine nonexpansive mappings. In this study, we construct a family of equivalent norms containing those developed by Nezir as well and show that there exists a large class of non-weakly compact closed, bounded, convex subsets of c0 with fixed point property for affine nonexpansive mappings.

  7. Mapping the Space of Genomic Signatures

    PubMed Central

    Kari, Lila; Hill, Kathleen A.; Sayem, Abu S.; Karamichalis, Rallis; Bryans, Nathaniel; Davis, Katelyn; Dattani, Nikesh S.

    2015-01-01

    We propose a computational method to measure and visualize interrelationships among any number of DNA sequences allowing, for example, the examination of hundreds or thousands of complete mitochondrial genomes. An "image distance" is computed for each pair of graphical representations of DNA sequences, and the distances are visualized as a Molecular Distance Map: Each point on the map represents a DNA sequence, and the spatial proximity between any two points reflects the degree of structural similarity between the corresponding sequences. The graphical representation of DNA sequences utilized, Chaos Game Representation (CGR), is genome- and species-specific and can thus act as a genomic signature. Consequently, Molecular Distance Maps could inform species identification, taxonomic classifications and, to a certain extent, evolutionary history. The image distance employed, Structural Dissimilarity Index (DSSIM), implicitly compares the occurrences of oligomers of length up to k (herein k = 9) in DNA sequences. We computed DSSIM distances for more than 5 million pairs of complete mitochondrial genomes, and used Multi-Dimensional Scaling (MDS) to obtain Molecular Distance Maps that visually display the sequence relatedness in various subsets, at different taxonomic levels. This general-purpose method does not require DNA sequence alignment and can thus be used to compare similar or vastly different DNA sequences, genomic or computer-generated, of the same or different lengths. We illustrate potential uses of this approach by applying it to several taxonomic subsets: phylum Vertebrata, (super)kingdom Protista, classes Amphibia-Insecta-Mammalia, class Amphibia, and order Primates. This analysis of an extensive dataset confirms that the oligomer composition of full mtDNA sequences can be a source of taxonomic information. This method also correctly finds the mtDNA sequences most closely related to that of the anatomically modern human (the Neanderthal, the Denisovan, and the chimp), and that the sequence most different from it in this dataset belongs to a cucumber. PMID:26000734

  8. Molecular characterization of 'Candidatus Borrelia tachyglossi' (family Spirochaetaceae) in echidna ticks, Bothriocroton concolor.

    PubMed

    Loh, Siew-May; Gillett, Amber; Ryan, Una; Irwin, Peter; Oskam, Charlotte

    2017-04-01

    Recently, a novel species of the genus Borreliawas identified in Bothriocroton concolor and Ixodes holocyclus ticks from echidnas. Analyses of 16S rRNA and flaB genes identified three closely related genotypes of this bacterium (Borrelia sp. Aus A-C) that were unique and distinct from previously described borreliae. Phylogenetic analyses of flaB (763 bp), groEL (1537 bp), gyrB (1702 bp) and glpQ (874 bp) gene sequences and concatenated sequences (3585 bp) of three gene loci (16S rRNA, flaB and gyrB) were consistent with previous findings and confirm that this novel species of the genus Borrelia is more closely related to, yet distinct from, the Reptile-associated (REP) and Relapsing Fever (RF) groups. At the flaB locus, genotypes A, B and C shared the highest percentage sequence similarities (87.9, 88 and 87.9 %, respectively) with B.orrelia turcica (REP), whereas at the groEL and gyrB loci, these genotypes were most similar (88.2-89.4 %) to B.orrelia hermsii (RF). At the glpQ locus, genotypes A and B were most similar (85.7 and 85.4 % respectively) to Borrelia sp. Tortoise14H1 (REP). The presence of the glpQ gene, which is absent in the Lyme Borreliosis group spirochaetes, further emphasises that the novel species of the genus Borrelia characterized in the present study does not belong to this group. Phylogenetic analyses at multiple loci produced consistent topographies revealing the monophyletic grouping of this bacterium, therefore providing strong support for its species status. We propose the name 'CandidatusBorrelia tachyglossi', and hypothesize that this species of the genus Borrelia may be endemic to Australia. The pathogenic potential of this bacterium is not yet known.

  9. Molecular characterization of ‘Candidatus Borrelia tachyglossi’ (family Spirochaetaceae) in echidna ticks, Bothriocroton concolor

    PubMed Central

    Loh, Siew-May; Gillett, Amber; Ryan, Una; Irwin, Peter

    2017-01-01

    Recently, a novel species of the genus Borreliawas identified in Bothriocroton concolor and Ixodes holocyclus ticks from echidnas. Analyses of 16S rRNA and flaB genes identified three closely related genotypes of this bacterium (Borrelia sp. Aus A-C) that were unique and distinct from previously described borreliae. Phylogenetic analyses of flaB (763 bp), groEL (1537 bp), gyrB (1702 bp) and glpQ (874 bp) gene sequences and concatenated sequences (3585 bp) of three gene loci (16S rRNA, flaB and gyrB) were consistent with previous findings and confirm that this novel species of the genus Borrelia is more closely related to, yet distinct from, the Reptile-associated (REP) and Relapsing Fever (RF) groups. At the flaB locus, genotypes A, B and C shared the highest percentage sequence similarities (87.9, 88 and 87.9 %, respectively) with B.orrelia turcica (REP), whereas at the groEL and gyrB loci, these genotypes were most similar (88.2–89.4 %) to B.orrelia hermsii (RF). At the glpQ locus, genotypes A and B were most similar (85.7 and 85.4 % respectively) to Borrelia sp. Tortoise14H1 (REP). The presence of the glpQ gene, which is absent in the Lyme Borreliosis group spirochaetes, further emphasises that the novel species of the genus Borrelia characterized in the present study does not belong to this group. Phylogenetic analyses at multiple loci produced consistent topographies revealing the monophyletic grouping of this bacterium, therefore providing strong support for its species status. We propose the name ‘Candidatus Borrelia tachyglossi’, and hypothesize that this species of the genus Borrelia may be endemic to Australia. The pathogenic potential of this bacterium is not yet known. PMID:28475032

  10. Paenibacillus nebraskensis sp. nov., isolated from the root surface of field-grown maize.

    PubMed

    Kämpfer, Peter; Busse, Hans-Jürgen; McInroy, John A; Hu, Chia-Hui; Kloepper, Joseph W; Glaeser, Stefanie P

    2017-12-01

    A Gram-positive-staining, aerobic, non-endospore-forming bacterial strain (JJ-59 T ), isolated from a field-grown maize plant in Dunbar, Nebraska in 2014 was studied by a polyphasic approach. Based on 16S rRNA gene sequence similarity comparisons, strain JJ-59 T was shown to be a member of the genus Paenibacillus, most closely related to the type strains of Paenibacillus aceris (98.6 % 16S rRNA gene sequence similarity) and Paenibacillus chondroitinus (97.8 %). For all other type strains of species of the genus Paenibacillus lower 16S rRNA gene sequence similarities were obtained. DNA-DNA hybridization values of strain JJ-59 T to the type strains of P. aceris and P. chondroitinus were 26 % (reciprocal, 59 %) and 52 % (reciprocal, 59 %), respectively. Chemotaxonomic characteristics such as the presence of meso-diaminopimelic acid in the peptidoglycan, the major quinone MK-7 and spermidine as the major polyamine were in agreement with the characteristics of the genus Paenibacillus. Strain JJ-59 T shared with its next related species P. aceris the major lipids diphosphatidylglycerol, phosphatidylglycerol, phosphatidylethanolamine and an unidentified aminophospholipid, but the presence/absence of certain lipids was clearly distinguishable. Major fatty acids of strain JJ-59 T were anteiso-C15 : 0, iso-C15 : 0 and iso-C16 : 0, and the genomic G+C content is 47.2 mol%. Physiological and biochemical characteristics of strain JJ-59 T were clearly different from the most closely related species of the genus Paenibacillus. Thus, strain JJ-59 T represents a novel species of the genus Paenibacillus, for which the name Paenibacillus nebraskensis sp. nov. is proposed, with JJ-59 T (=DSM 103623 T =CIP 111179 T =LMG 29764 T ) as the type strain.

  11. Phylogenetic structure of Leishmania tropica in the new endemic focus Birjand in East Iran in comparison to other Iranian endemic regions.

    PubMed

    Karamian, Mehdi; Kuhls, Katrin; Hemmati, Mina; Ghatee, Mohammad Amin

    2016-06-01

    Iran has been identified being among the countries with the highest number of cutaneous leishmaniasis (CL) cases. South Khorasan province in East Iran is an emerging focus of CL. Species identification of sixty clinical samples by ITS1 PCR-RFLP presented evidence for the dominance of Leishmania tropica (90%) in this region. Analysis of the ITS1 sequence of 19 L. tropica isolates revealed seven closely related sequence types. In addition, ITS1 sequences available in GenBank from other Iranian regions were compiled for comparison with the studied isolates. Iranian L. tropica was distributed in two main clusters. All East Iranian sequence types were grouped with strains from foci from Southeast and Central regions in cluster A, showing highly similar sequences. The highest similarity was observed between most L. tropica from East and all isolates from Southeast regions and from Savojbolagh county in Central Iran. Southwest L. tropica was shown to be paraphyletic as the isolates were distributed in both clusters A and B. All Northeastern L. tropica were part of cluster B, however they showed significant heterogeneity and were distributed in different subclusters. Distribution of L. tropica populations was to some extent congruent with genetic lineages of Phlebotomus sergenti in Iran and may be an evidence for parasite-vector co-evolution. Southeast-East L. tropica was also similar to strains from Herat province in Afghanistan at the East border of Iran. This is the first comprehensive study on population structure of L. tropica in Iran that provides a guideline for appropriate sampling for further molecular based epidemiological studies. Copyright © 2016 Elsevier B.V. All rights reserved.

  12. Molecular characterization and phylogenetic relationships among microsporidian isolates infecting silkworm, Bombyx mori using small subunit rRNA (SSU-rRNA) gene sequence analysis.

    PubMed

    Nath, B Surendra; Gupta, S K; Bajpai, A K

    2012-12-01

    The life cycle, spore morphology, pathogenicity, tissue specificity, mode of transmission and small subunit rRNA (SSU-rRNA) gene sequence analysis of the five new microsporidian isolates viz., NIWB-11bp, NIWB-12n, NIWB-13md, NIWB-14b and NIWB-15mb identified from the silkworm, Bombyx mori have been studied along with type species, NIK-1s_mys. The life cycle of the microsporidians identified exhibited the sequential developmental cycles that are similar to the general developmental cycle of the genus, Nosema. The spores showed considerable variations in their shape, length and width. The pathogenicity observed was dose-dependent and differed from each of the microsporidian isolates; the NIWB-15mb was found to be more virulent than other isolates. All of the microsporidians were found to infect most of the tissues examined and showed gonadal infection and transovarial transmission in the infected silkworms. SSU-rRNA sequence based phylogenetic tree placed NIWB-14b, NIWB-12n and NIWB-11bp in a separate branch along with other Nosema species and Nosema bombycis; while NIWB-15mb and NIWB-13md together formed another cluster along with other Nosema species. NIK-1s_mys revealed a signature sequence similar to standard type species, N. bombycis, indicating that NIK-1s_mys is similar to N. bombycis. Based on phylogenetic relationships, branch length information based on genetic distance and nucleotide differences, we conclude that the microsporidian isolates identified are distinctly different from the other known species and belonging to the genus, Nosema. This SSU-rRNA gene sequence analysis method is found to be more useful approach in detecting different and closely related microsporidians of this economically important domestic insect.

  13. Bat Caliciviruses and Human Noroviruses Are Antigenically Similar and Have Overlapping Histo-Blood Group Antigen Binding Profiles.

    PubMed

    Kocher, Jacob F; Lindesmith, Lisa C; Debbink, Kari; Beall, Anne; Mallory, Michael L; Yount, Boyd L; Graham, Rachel L; Huynh, Jeremy; Gates, J Edward; Donaldson, Eric F; Baric, Ralph S

    2018-05-22

    Emerging zoonotic viral diseases remain a challenge to global public health. Recent surveillance studies have implicated bats as potential reservoirs for a number of viral pathogens, including coronaviruses and Ebola viruses. Caliciviridae represent a major viral family contributing to emerging diseases in both human and animal populations and have been recently identified in bats. In this study, we blended metagenomics, phylogenetics, homology modeling, and in vitro assays to characterize two novel bat calicivirus (BtCalV) capsid sequences, corresponding to strain BtCalV/A10/USA/2009, identified in Perimyotis subflavus near Little Orleans, MD, and bat norovirus. We observed that bat norovirus formed virus-like particles and had epitopes and receptor-binding patterns similar to those of human noroviruses. To determine whether these observations stretch across multiple bat caliciviruses, we characterized a novel bat calicivirus, BtCalV/A10/USA/2009. Phylogenetic analysis revealed that BtCalV/A10/USA/2009 likely represents a novel Caliciviridae genus and is most closely related to "recoviruses." Homology modeling revealed that the capsid sequences of BtCalV/A10/USA/2009 and bat norovirus resembled human norovirus capsid sequences and retained host ligand binding within the receptor-binding domains similar to that seen with human noroviruses. Both caliciviruses bound histo-blood group antigens in patterns that overlapped those seen with human and animal noroviruses. Taken together, our results indicate the potential for bat caliciviruses to bind histo-blood group antigens and overcome a significant barrier to cross-species transmission. Additionally, we have shown that bat norovirus maintains antigenic epitopes similar to those seen with human noroviruses, providing further evidence of evolutionary descent. Our results reiterate the importance of surveillance of wild-animal populations, especially of bats, for novel viral pathogens. IMPORTANCE Caliciviruses are rapidly evolving viruses that cause pandemic outbreaks associated with significant morbidity and mortality globally. The animal reservoirs for human caliciviruses are unknown; bats represent critical reservoir species for several emerging and zoonotic diseases. Recent reports have identified several bat caliciviruses but have not characterized biological functions associated with disease risk, including their potential emergence in other mammalian populations. In this report, we identified a novel bat calicivirus that is most closely related to nonhuman primate caliciviruses. Using this new bat calicivirus and a second norovirus-like bat calicivirus capsid gene sequence, we generated virus-like particles that have host carbohydrate ligand binding patterns similar to those of human and animal noroviruses and that share antigens with human noroviruses. The similarities to human noroviruses with respect to binding patterns and antigenic epitopes illustrate the potential for bat caliciviruses to emerge in other species and the importance of pathogen surveillance in wild-animal populations. Copyright © 2018 Kocher et al.

  14. Lithostratigraphic and biostratigraphic evidence for brief and synchronous Early Mesozoic basalt eruption over the Maghreb (Northwest Africa)

    NASA Astrophysics Data System (ADS)

    Et-Touhami, M.; Et-Touhami, M.; Olsen, P. E.; Puffer, J.

    2001-05-01

    Previously very sparse biostratigraphic data suggested that the Early Mesozoic tholeiitic effusive and intrusive magmatism in the various basins of the Maghreb occurred over a long time (Ladinian-Hettangian). However, a detailed comparison of the stratigraphy underlying, interbedded with, and overlying the basalts in these basins shows not only remarkable similarities with each other, but also with sequences in the latest Triassic and earliest Jurassic of eastern North America. There, the sequences have been shown to be cyclical, controlled by Milankovitch-type climate cycles; the same seems to be true in at least part of the Maghreb. Thus, the Moroccan basins have cyclical sequences surrounding and interbedded with one or two basaltic units. In the Argana and Khemisset basins the Tr-J boundary is identified by palynology to be below the lowest basalt, and the remarkably close lithological similarity between the pre-basalt sequence in the other Moroccan basins and to the North American basins - especially the Fundy basin - suggests a tight correlation in time. Likewise, the strata above the lowest basalt in Morocco show a similar pattern to what is seen above the lowest basalt formation in eastern North America, as do the overlying sequences. Furthermore, geochemistry on basalts in the Argana, Bou Fekrane, Khemisset, and Iouawen basins indicate they are high-Ti quartz-normative tholeiites as are the Orange Mountain Basalt (Fundy basin) and the North Mountain Basalt (Newark basin). The remarkable lithostratigraphic similarity across the Maghreb of these strata suggest contemporaneous and synchronous eruption over a time span of less than 200 ky, based on Milankovitch calibration, and within a ~20 ky interval after the Triassic-Jurassic boundary. Differences with previous interpretations of the biostratigraphy can be rationalized as a result of: 1, an over-reliance on comparisons with northern European palynology; 2, over-interpretation of poorly preserved fossils; and 3, rarity of early Jurassic non-marine ostracode assemblages.

  15. The PL6-Family Plasmids of Haloquadratum Are Virus-Related.

    PubMed

    Dyall-Smith, Mike; Pfeiffer, Friedhelm

    2018-01-01

    Plasmids PL6A and PL6B are both carried by the C23 T strain of the square archaeon Haloquadratum walsbyi , and are closely related (76% nucleotide identity), circular, about 6 kb in size, and display the same gene synteny. They are unrelated to other known plasmids and all of the predicted proteins are cryptic in function. Here we describe two additional PL6-related plasmids, pBAJ9-6 and pLT53-7, each carried by distinct isolates of Haloquadratum walsbyi that were recovered from hypersaline waters in Australia. A third PL6-like plasmid, pLTMV-6, was assembled from metavirome data from Lake Tyrell, a salt-lake in Victoria, Australia. Comparison of all five plasmids revealed a distinct plasmid family with strong conservation of gene content and synteny, an average size of 6.2 kb (range 5.8-7.0 kb) and pairwise similarities between 61-79%. One protein (F3) was closely similar to a protein carried by betapleolipoviruses while another (R6) was similar to a predicted AAA-ATPase of His 1 halovirus (His1V_gp16). Plasmid pLT53-7 carried a gene for a FkbM family methyltransferase that was not present in any of the other plasmids. Comparative analysis of all PL6-like plasmids provided better resolution of conserved sequences and coding regions, confirmed the strong link to haloviruses, and showed that their sequences are highly conserved among examples from Haloquadratum isolates and metagenomic data that collectively cover geographically distant locations, indicating that these genetic elements are widespread.

  16. A novel endogenous betaretrovirus group characterized from polar bears (Ursus maritimus) and giant pandas (Ailuropoda melanoleuca).

    PubMed

    Mayer, Jens; Tsangaras, Kyriakos; Heeger, Felix; Avila-Arcos, María; Stenglein, Mark D; Chen, Wei; Sun, Wei; Mazzoni, Camila J; Osterrieder, Nikolaus; Greenwood, Alex D

    2013-08-15

    Transcriptome analysis of polar bears (Ursus maritimus) yielded sequences with highest similarity to the human endogenous retrovirus group HERV-K(HML-2). Further analysis of the polar bear draft genome identified an endogenous betaretrovirus group comprising 26 proviral copies and 231 solo LTRs. Molecular dating indicates the group originated before the divergence of bears from a common ancestor but is not present in all carnivores. Closely related sequences were identified in the giant panda (Ailuropoda melanoleuca) and characterized from its genome. We have designated the polar bear and giant panda sequences U. maritimus endogenous retrovirus (UmaERV) and A. melanoleuca endogenous retrovirus (AmeERV), respectively. Phylogenetic analysis demonstrated that the bear virus group is nested within the HERV-K supergroup among bovine and bat endogenous retroviruses suggesting a complex evolutionary history within the HERV-K group. All individual remnants of proviral sequences contain numerous frameshifts and stop codons and thus, the virus is likely non-infectious. Copyright © 2013 Elsevier Inc. All rights reserved.

  17. Cloning, characterization and sequence comparison of the gene coding for IMP dehydrogenase from Pyrococcus furiosus.

    PubMed

    Collart, F R; Osipiuk, J; Trent, J; Olsen, G J; Huberman, E

    1996-10-03

    We have cloned and characterized the gene encoding inosine monophosphate dehydrogenase (IMPDH) from Pyrococcus furiosus (Pf), a hyperthermophillic archeon. Sequence analysis of the Pf gene indicated an open reading frame specifying a protein of 485 amino acids (aa) with a calculated M(r) of 52900. Canonical Archaea promoter elements, Box A and Box B, are located -49 and -17 nucleotides (nt), respectively, upstream of the putative start codon. The sequence of the putative active-site region conforms to the IMPDH signature motif and contains a putative active-site cysteine. Phylogenetic relationships derived by using all available IMPDH sequences are consistent with trees developed for other molecules; they do not precisely resolve the history of Pf IMPDH but indicate a close similarity to bacterial IMPDH proteins. The phylogenetic analysis indicates that a gene duplication occurred prior to the division between rodents and humans, accounting for the Type I and II isoforms identified in mice and humans.

  18. The conserved mitochondrial gene distribution in relatives of Turritopsis nutricula, an immortal jellyfish.

    PubMed

    Devarapalli, Pratap; Kumavath, Ranjith N; Barh, Debmalya; Azevedo, Vasco

    2014-01-01

    Turritopsis nutricula (T. nutricula) is the one of the known reported organisms that can revert its life cycle to the polyp stage even after becoming sexually mature, defining itself as the only immortal organism in the animal kingdom. Therefore, the animal is having prime importance in basic biological, aging, and biomedical researches. However, till date, the genome of this organism has not been sequenced and even there is no molecular phylogenetic study to reveal its close relatives. Here, using phylogenetic analysis based on available 16s rRNA gene and protein sequences of Cytochrome oxidase subunit-I (COI or COX1) of T. nutricula, we have predicted the closest relatives of the organism. While we found Nemopsis bachei could be closest organism based on COX1 gene sequence; T. dohrnii may be designated as the closest taxon to T. nutricula based on rRNA. Moreover, we have figured out four species that showed similar root distance based on COX1 protein sequence.

  19. A novel endogenous betaretrovirus group characterized from polar bears (Ursus maritimus) and giant pandas (Ailuropoda melanoleuca)

    PubMed Central

    Mayer, Jens; Tsangaras, Kyriakos; Heeger, Felix; Ávila-Arcos, Maria; Stenglein, Mark D.; Chen, Wei; Sun, Wei; Mazzoni, Camila; Osterrieder, Nikolaus; Greenwood, Alex D.

    2013-01-01

    Transcriptome analysis of polar bears (Ursus maritimus) yielded sequences with highest similarity to the human endogenous retrovirus group HERV-K(HML-2). Further analysis of the polar bear draft genome identified an endogenous betaretrovirus group comprising 26 proviral copies and 231 solo LTRs. Molecular dating indicates the group originated before the divergence of bears from a common ancestor but is not present in all carnivores. Closely related sequences were identified in the giant panda (Ailuropoda melanoleuca) and characterized from its genome. We have designated the polar bear and giant panda sequences Ursus maritimus endogenous retrovirus (UmaERV) and Ailuropoda melanoleuca endogenous retrovirus (AmeERV), respectively. Phylogenetic analysis demonstrated that the bear virus group is nested within the HERV-K supergroup among bovine and bat endogenous retroviruses suggesting a complex evolutionary history within the HERV-K group. All individual remnants of proviral sequences contain numerous frameshifts and stop codons and thus, the virus is likely non-infectious. PMID:23725819

  20. Enrichment of specific protozoan populations during in situ bioremediation of uranium-contaminated groundwater.

    PubMed

    Holmes, Dawn E; Giloteaux, Ludovic; Williams, Kenneth H; Wrighton, Kelly C; Wilkins, Michael J; Thompson, Courtney A; Roper, Thomas J; Long, Philip E; Lovley, Derek R

    2013-07-01

    The importance of bacteria in the anaerobic bioremediation of groundwater polluted with organic and/or metal contaminants is well recognized and in some instances so well understood that modeling of the in situ metabolic activity of the relevant subsurface microorganisms in response to changes in subsurface geochemistry is feasible. However, a potentially significant factor influencing bacterial growth and activity in the subsurface that has not been adequately addressed is protozoan predation of the microorganisms responsible for bioremediation. In field experiments at a uranium-contaminated aquifer located in Rifle, CO, USA, acetate amendments initially promoted the growth of metal-reducing Geobacter species, followed by the growth of sulfate reducers, as observed previously. Analysis of 18S rRNA gene sequences revealed a broad diversity of sequences closely related to known bacteriovorous protozoa in the groundwater before the addition of acetate. The bloom of Geobacter species was accompanied by a specific enrichment of sequences most closely related to the ameboid flagellate, Breviata anathema, which at their peak accounted for over 80% of the sequences recovered. The abundance of Geobacter species declined following the rapid emergence of B. anathema. The subsequent growth of sulfate-reducing Peptococcaceae was accompanied by another specific enrichment of protozoa, but with sequences most similar to diplomonadid flagellates from the family Hexamitidae, which accounted for up to 100% of the sequences recovered during this phase of the bioremediation. These results suggest a prey-predator response with specific protozoa responding to increased availability of preferred prey bacteria. Thus, quantifying the influence of protozoan predation on the growth, activity and composition of the subsurface bacterial community is essential for predictive modeling of in situ uranium bioremediation strategies.

  1. Whole-genome characterization of a Peruvian alpaca rotavirus isolate expressing a novel VP4 genotype.

    PubMed

    Rojas, Miguel; Gonçalves, Jorge Luiz S; Dias, Helver G; Manchego, Alberto; Pezo, Danilo; Santos, Norma

    2016-11-30

    The SA44 isolate of Rotavirus A (RVA) was identified from a neonatal Peruvian alpaca presenting with diarrhea, and the full-length genome sequence of the isolate (designated RVA/Alpaca-tc/PER/SA44/2014/G3P[40]) was determined. Phylogenetic analyses showed that the isolate possessed the genotype constellation G3-P[40]-I8-R3-C3-M3-A9-N3-T3-E3-H6, which differs considerably from those of RVA strains isolated from other species of the order Artiodactyla. Overall, the genetic constellation of the SA44 strain was quite similar to those of RVA strains isolated from a bat in Asia (MSLH14 and MYAS33). Nonetheless, phylogenetic analyses of each genome segment identified a distinct combination of genes. Several sequences were closely related to corresponding gene sequences in RVA strains from other species, including human (VP1, VP2, NSP1, and NSP2), simian (VP3 and NSP5), bat (VP6 and NSP4), and equine (NSP3). The VP7 gene sequence was closely related to RVA strains from a Peruvian alpaca (K'ayra/3368-10; 99.0% nucleotide and 99.7% amino acid identity) and from humans (RCH272; 95% nucleotide and 99.0% amino acid identity). The nucleotide sequence of the VP4 gene was distantly related to other VP4 sequences and was designated as the reference strain for the new P[40] genotype. This unique genetic makeup suggests that the SA44 strain emerged from multiple reassortment events between bat-, equine-, and human-like RVA strains. Copyright © 2016 Elsevier B.V. All rights reserved.

  2. Enrichment of specific protozoan populations during in situ bioremediation of uranium-contaminated groundwater

    PubMed Central

    Holmes, Dawn E; Giloteaux, Ludovic; Williams, Kenneth H; Wrighton, Kelly C; Wilkins, Michael J; Thompson, Courtney A; Roper, Thomas J; Long, Philip E; Lovley, Derek R

    2013-01-01

    The importance of bacteria in the anaerobic bioremediation of groundwater polluted with organic and/or metal contaminants is well recognized and in some instances so well understood that modeling of the in situ metabolic activity of the relevant subsurface microorganisms in response to changes in subsurface geochemistry is feasible. However, a potentially significant factor influencing bacterial growth and activity in the subsurface that has not been adequately addressed is protozoan predation of the microorganisms responsible for bioremediation. In field experiments at a uranium-contaminated aquifer located in Rifle, CO, USA, acetate amendments initially promoted the growth of metal-reducing Geobacter species, followed by the growth of sulfate reducers, as observed previously. Analysis of 18S rRNA gene sequences revealed a broad diversity of sequences closely related to known bacteriovorous protozoa in the groundwater before the addition of acetate. The bloom of Geobacter species was accompanied by a specific enrichment of sequences most closely related to the ameboid flagellate, Breviata anathema, which at their peak accounted for over 80% of the sequences recovered. The abundance of Geobacter species declined following the rapid emergence of B. anathema. The subsequent growth of sulfate-reducing Peptococcaceae was accompanied by another specific enrichment of protozoa, but with sequences most similar to diplomonadid flagellates from the family Hexamitidae, which accounted for up to 100% of the sequences recovered during this phase of the bioremediation. These results suggest a prey–predator response with specific protozoa responding to increased availability of preferred prey bacteria. Thus, quantifying the influence of protozoan predation on the growth, activity and composition of the subsurface bacterial community is essential for predictive modeling of in situ uranium bioremediation strategies. PMID:23446832

  3. Enrichment of specific protozoan populations during in situ bioremediation of uranium-contaminated groundwater

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Holmes, Dawn; Giloteaux, L.; Williams, Kenneth H.

    2013-07-28

    The importance of bacteria in the anaerobic bioremediation of groundwater polluted with organic and/or metal contaminants is well-recognized and in some instances so well understood that modeling of the in situ metabolic activity of the relevant subsurface microorganisms in response to changes in subsurface geochemistry is feasible. However, a potentially significant factor influencing bacterial growth and activity in the subsurface that has not been adequately addressed is protozoan predation of the microorganisms responsible for bioremediation. In field experiments at a uranium-contaminated aquifer located in Rifle, CO, acetate amendments initially promoted the growth of metal-reducing Geobacter species followed by the growthmore » of sulfate-reducers, as previously observed. Analysis of 18S rRNA gene sequences revealed a broad diversity of sequences closely related to known bacteriovorous protozoa in the groundwater prior to the addition of acetate. The bloom of Geobacter species was accompanied by a specific enrichment of sequences most closely related to the amoeboid flagellate, Breviata anathema, which at their peak accounted for over 80% of the sequences recovered. The abundance of Geobacter species declined following the rapid emergence of B. anathema. The subsequent growth of sulfate-reducing Peptococcaceae was accompanied by another specific enrichment of protozoa, but with sequences most similar to diplomonadid flagellates from the family Hexamitidae, which accounted for up to 100% of the sequences recovered during this phase of the bioremediation. These results suggest a prey-predator response with specific protozoa responding to increased availability of preferred prey bacteria. Thus, quantifying the influence of protozoan predation on the growth, activity, and composition of the subsurface bacterial community is essential for predictive modeling of in situ uranium bioremediation strategies.« less

  4. Muricauda antarctica sp. nov., a marine member of the Flavobacteriaceae isolated from Antarctic seawater.

    PubMed

    Wu, Yue-Hong; Yu, Pei-Song; Zhou, Ya-Dong; Xu, Lin; Wang, Chun-Sheng; Wu, Min; Oren, Aharon; Xu, Xue-Wei

    2013-09-01

    A Gram-stain-negative, rod-shaped bacterium with appendages, designated Ar-22(T), was isolated from a seawater sample collected from the western part of Prydz Bay, near Cape Darnley, Antarctica. Strain Ar-22(T) grew optimally at 35 °C, at pH 7.5 and in the presence of 1-3% (w/v) NaCl. The isolate was positive for casein, gelatin and Tween 20 decomposition and negative for H2S production and indole formation. Chemotaxonomic analysis showed that MK-6 was the major isoprenoid quinone and phosphatidylethanolamine was the major polar lipid. The major fatty acids were iso-C(17:0) 3-OH, iso-C(15:1) G, iso-C(15:0) and C(16:1)ω7c/iso-C(15:0) 2OH. The genomic DNA G+C content was 44.8 mol%. Comparative 16S rRNA gene sequence analysis revealed that strain Ar-22(T) is closely related to members of the genus Muricauda, sharing 94.2-97.3% sequence similarity with the type strains of species of the genus Muricauda and being most closely related to the Muricauda aquimarina. Phylogenetic analysis based on the 16S rRNA gene sequence comparison confirmed that strain Ar-22(T) formed a deep lineage with Muricauda flavescens. Sequence similarity between strain Ar-22(T) and Muricauda ruestringensis DSM 13258(T), the type species of the genus Muricauda, was 96.9%. Strain Ar-22(T) exhibited mean DNA-DNA relatedness values of 40.1%, 49.4% and 25.7% to M. aquimarina JCM 11811(T), M. flavescens JCM 11812(T) and Muricauda lutimaris KCTC 22173(T), respectively. On the basis of phenotypic and genotypic data, strain Ar-22(T) represents a novel species of the genus Muricauda, for which the name Muricauda antarctica sp. nov. (type strain Ar-22(T) =CGMCC 1.12174(T) = JCM 18450(T)) is proposed.

  5. Paenibacillus phoenicis sp. nov., isolated from the Phoenix Lander assembly facility and a subsurface molybdenum mine.

    PubMed

    Benardini, James N; Vaishampayan, Parag A; Schwendner, Petra; Swanner, Elizabeth; Fukui, Youhei; Osman, Sharif; Satomi, Masakata; Venkateswaran, Kasthuri

    2011-06-01

    A novel Gram-positive, motile, endospore-forming, aerobic bacterium was isolated from the NASA Phoenix Lander assembly clean room that exhibits 100 % 16S rRNA gene sequence similarity to two strains isolated from a deep subsurface environment. All strains are rod-shaped, endospore-forming bacteria, whose endospores are resistant to UV radiation up to 500 J m(-2). A polyphasic taxonomic study including traditional phenotypic tests, fatty acid analysis, 16S rRNA gene sequencing and DNA-DNA hybridization analysis was performed to characterize these novel strains. The 16S rRNA gene sequencing convincingly grouped these novel strains within the genus Paenibacillus as a separate cluster from previously described species. The similarity of 16S rRNA gene sequences among the novel strains was identical but only 98.1 to 98.5 % with their nearest neighbours Paenibacillus barengoltzii ATCC BAA-1209(T) and Paenibacillus timonensis CIP 108005(T). The menaquinone MK-7 was dominant in these novel strains as shown in other species of the genus Paenibacillus. The DNA-DNA hybridization dissociation value was <45 % with the closest related species. The novel strains had DNA G+C contents of 51.9 to 52.8 mol%. Phenotypically, the novel strains can be readily differentiated from closely related species by the absence of urease and gelatinase and the production of acids from a variety of sugars including l-arabinose. The major fatty acid was anteiso-C(15 : 0) as seen in P. barengoltzii and P. timonensis whereas the proportion of C(16 : 0) was significantly different from the closely related species. Based on phylogenetic and phenotypic results, it was concluded that these strains represent a novel species of the genus Paenibacillus, for which the name Paenibacillus phoenicis sp. nov. is proposed. The type strain is 3PO2SA(T) ( = NRRL B-59348(T)  = NBRC 106274(T)).

  6. [Sequencing and analysis of the complete mitochondrial genome of the King Cobra, Ophiophagus hannah (Serpents: Elapidae)].

    PubMed

    Chen, Nian; Lai, Xiao-Ping

    2010-07-01

    We obtained the complete mitochondrial genome of King Cobra(GenBank accession number: EU_921899) by Ex Taq-PCR, TA-cloning and primer-walking methods. This genome is very similar to other vertebrate, which is 17 267 bp in length and encodes 38 genes (including 13 protein-coding, 2 ribosomal RNA and 23 transfer RNA genes) and two long non-coding regions. The duplication of tRNA-Ile gene forms a new mitochondrial gene rearrangement model. Eight tRNA genes and one protein genes were transcribed from L strand, and the other genes were transcribed genes from H strand. Genes on the H strand show a fairly similar content of Adenosine and Thymine respectively, whereas those on the L strand have higher proportion of A than T. Combined rDNA sequence data (12S+16S rRNA) were used to reconstruct the phylogeny of 21 snake species for which complete mitochondrial genome sequences were available in the public databases. This large data set and an appropriate range of outgroup taxa demonstrated that Elapidae is more closely related to colubridae than viperidae, which supports the traditional viewpoints.

  7. Barcodes for genomes and applications

    PubMed Central

    Zhou, Fengfeng; Olman, Victor; Xu, Ying

    2008-01-01

    Background Each genome has a stable distribution of the combined frequency for each k-mer and its reverse complement measured in sequence fragments as short as 1000 bps across the whole genome, for 1

  8. Mucilaginibacter carri sp. nov., isolated from a car air conditioning system.

    PubMed

    Kim, Dong-Uk; Lee, Hyosun; Kim, Hyun; Kim, Song-Gun; Park, So Yoon; Ka, Jong-Ok

    2016-04-01

    A Gram-stain-negative, pink bacterial strain, designated PR0008KT, was isolated from an automobile evaporator core in Korea. The cells were obligately aerobic and rod-shaped. The strain grew at 10-40 °C (optimum, 20 °C), at pH 5-8 (optimum, 7), and in the presence of 0-1.5% (w/v) NaCl. Phylogenetically, the strain was closely related to members of the genus Mucilaginibacter (93.4-97.0% 16S rRNA sequence similarities) and showed a high sequence similarity with Mucilaginibacter litoreus BR-18T, Mucilaginibacter lutimaris BR-3T and Mucilaginibacter soli R9-65T (97.0%, 96.9% and 96.9% 16S rRNA sequence similarity, respectively). It contained summed feature 3 (C16:1ω7c and/or C16:1ω6c), C16 : 0, iso-C17:0 3-OH and C16:0 as the predominant fatty acids and MK-7 as the major menaquinone. The polar lipids were phosphatidylethanolamine, one unknown aminophospholipid, two unknown aminolipids and two unknown polar lipids. The DNA G+C content of this strain was 47.4 mol%. Based on the phenotypic, genotypic and chemotaxonomic data, strain PR0008KT represents a novel species in the genus Mucilaginibacter, for which the name Mucilaginibacter carri sp. nov. (=KACC 17938T=NBRC 111539T) is proposed.

  9. Characterisation of culture-independent and -dependent microbial communities in a high-temperature offshore chalk petroleum reservoir.

    PubMed

    Kaster, Krista M; Bonaunet, Kristin; Berland, Harald; Kjeilen-Eilertsen, Grethe; Brakstad, Odd Gunnar

    2009-11-01

    Recent studies have indicated that oil reservoirs harbour diverse microbial communities. Culture-dependent and culture-independent methods were used to evaluate the microbial diversity in produced water samples of the Ekofisk oil field, a high temperature, and fractured chalk reservoir in the North Sea. DGGE analyses of 16S rRNA gene fragments were used to assess the microbial diversity of both archaeal and bacterial communities in produced water samples and enrichment cultures from 4 different wells (B-08, X-08, X-18 and X-25). Low diversity communities were found when 16S rDNA libraries of bacterial and archaeal assemblages were generated from total community DNA obtained from produced water samples and enrichment cultures. Sequence analysis of the clones indicated close matches to microbes associated with high-temperature oil reservoirs or other similar environments. Sequences were found to be similar to members of the genera Thermotoga, Caminicella, Thermoanaerobacter, Archaeoglobus, Thermococcus, and Methanobulbus. Enrichment cultures obtained from the produced water samples were dominated by sheathed rods. Sequence analyses of the cultures indicated predominance of the genera Petrotoga, Arcobacter, Archaeoglobus and Thermococcus. The communities of both produced water and enrichment cultures appeared to be dominated by thermophilic fermenters capable of reducing sulphur compounds. These results suggest that the biochemical processes in the Ekofisk chalk reservoir are similar to those observed in high-temperature sandstone reservoirs.

  10. Cyanobacterial Diversity in Microbial Mats from the Hypersaline Lagoon System of Araruama, Brazil: An In-depth Polyphasic Study.

    PubMed

    Ramos, Vitor M C; Castelo-Branco, Raquel; Leão, Pedro N; Martins, Joana; Carvalhal-Gomes, Sinda; Sobrinho da Silva, Frederico; Mendonça Filho, João G; Vasconcelos, Vitor M

    2017-01-01

    Microbial mats are complex, micro-scale ecosystems that can be found in a wide range of environments. In the top layer of photosynthetic mats from hypersaline environments, a large diversity of cyanobacteria typically predominates. With the aim of strengthening the knowledge on the cyanobacterial diversity present in the coastal lagoon system of Araruama (state of Rio de Janeiro, Brazil), we have characterized three mat samples by means of a polyphasic approach. We have used morphological and molecular data obtained by culture-dependent and -independent methods. Moreover, we have compared different classification methodologies and discussed the outcomes, challenges, and pitfalls of these methods. Overall, we show that Araruama's lagoons harbor a high cyanobacterial diversity. Thirty-six unique morphospecies could be differentiated, which increases by more than 15% the number of morphospecies and genera already reported for the entire Araruama system. Morphology-based data were compared with the 16S rRNA gene phylogeny derived from isolate sequences and environmental sequences obtained by PCR-DGGE and pyrosequencing. Most of the 48 phylotypes could be associated with the observed morphospecies at the order level. More than one third of the sequences demonstrated to be closely affiliated (best BLAST hit results of ≥99%) with cyanobacteria from ecologically similar habitats. Some sequences had no close relatives in the public databases, including one from an isolate, being placed as "loner" sequences within different orders. This hints at hidden cyanobacterial diversity in the mats of the Araruama system, while reinforcing the relevance of using complementary approaches to study cyanobacterial diversity.

  11. Cyanobacterial Diversity in Microbial Mats from the Hypersaline Lagoon System of Araruama, Brazil: An In-depth Polyphasic Study

    PubMed Central

    Ramos, Vitor M. C.; Castelo-Branco, Raquel; Leão, Pedro N.; Martins, Joana; Carvalhal-Gomes, Sinda; Sobrinho da Silva, Frederico; Mendonça Filho, João G.; Vasconcelos, Vitor M.

    2017-01-01

    Microbial mats are complex, micro-scale ecosystems that can be found in a wide range of environments. In the top layer of photosynthetic mats from hypersaline environments, a large diversity of cyanobacteria typically predominates. With the aim of strengthening the knowledge on the cyanobacterial diversity present in the coastal lagoon system of Araruama (state of Rio de Janeiro, Brazil), we have characterized three mat samples by means of a polyphasic approach. We have used morphological and molecular data obtained by culture-dependent and -independent methods. Moreover, we have compared different classification methodologies and discussed the outcomes, challenges, and pitfalls of these methods. Overall, we show that Araruama's lagoons harbor a high cyanobacterial diversity. Thirty-six unique morphospecies could be differentiated, which increases by more than 15% the number of morphospecies and genera already reported for the entire Araruama system. Morphology-based data were compared with the 16S rRNA gene phylogeny derived from isolate sequences and environmental sequences obtained by PCR-DGGE and pyrosequencing. Most of the 48 phylotypes could be associated with the observed morphospecies at the order level. More than one third of the sequences demonstrated to be closely affiliated (best BLAST hit results of ≥99%) with cyanobacteria from ecologically similar habitats. Some sequences had no close relatives in the public databases, including one from an isolate, being placed as “loner” sequences within different orders. This hints at hidden cyanobacterial diversity in the mats of the Araruama system, while reinforcing the relevance of using complementary approaches to study cyanobacterial diversity. PMID:28713360

  12. Evolutionary interpretations of mycobacteriophage biodiversity and host-range through the analysis of codon usage bias.

    PubMed

    Esposito, Lauren A; Gupta, Swati; Streiter, Fraida; Prasad, Ashley; Dennehy, John J

    2016-10-01

    In an genomics course sponsored by the Howard Hughes Medical Institute (HHMI), undergraduate students have isolated and sequenced the genomes of more than 1,150 mycobacteriophages, creating the largest database of sequenced bacteriophages able to infect a single host, Mycobacterium smegmatis , a soil bacterium. Genomic analysis indicates that these mycobacteriophages can be grouped into 26 clusters based on genetic similarity. These clusters span a continuum of genetic diversity, with extensive genomic mosaicism among phages in different clusters. However, little is known regarding the primary hosts of these mycobacteriophages in their natural habitats, nor of their broader host ranges. As such, it is possible that the primary host of many newly isolated mycobacteriophages is not M. smegmatis , but instead a range of closely related bacterial species. However, determining mycobacteriophage host range presents difficulties associated with mycobacterial cultivability, pathogenicity and growth. Another way to gain insight into mycobacteriophage host range and ecology is through bioinformatic analysis of their genomic sequences. To this end, we examined the correlations between the codon usage biases of 199 different mycobacteriophages and those of several fully sequenced mycobacterial species in order to gain insight into the natural host range of these mycobacteriophages. We find that UPGMA clustering tends to match, but not consistently, clustering by shared nucleotide sequence identify. In addition, analysis of GC content, tRNA usage and correlations between mycobacteriophage and mycobacterial codon usage bias suggests that the preferred host of many clustered mycobacteriophages is not M. smegmatis but other, as yet unknown, members of the mycobacteria complex or closely allied bacterial species.

  13. Evolutionary interpretations of mycobacteriophage biodiversity and host-range through the analysis of codon usage bias

    PubMed Central

    Esposito, Lauren A.; Gupta, Swati; Streiter, Fraida; Prasad, Ashley

    2016-01-01

    In an genomics course sponsored by the Howard Hughes Medical Institute (HHMI), undergraduate students have isolated and sequenced the genomes of more than 1,150 mycobacteriophages, creating the largest database of sequenced bacteriophages able to infect a single host, Mycobacterium smegmatis, a soil bacterium. Genomic analysis indicates that these mycobacteriophages can be grouped into 26 clusters based on genetic similarity. These clusters span a continuum of genetic diversity, with extensive genomic mosaicism among phages in different clusters. However, little is known regarding the primary hosts of these mycobacteriophages in their natural habitats, nor of their broader host ranges. As such, it is possible that the primary host of many newly isolated mycobacteriophages is not M. smegmatis, but instead a range of closely related bacterial species. However, determining mycobacteriophage host range presents difficulties associated with mycobacterial cultivability, pathogenicity and growth. Another way to gain insight into mycobacteriophage host range and ecology is through bioinformatic analysis of their genomic sequences. To this end, we examined the correlations between the codon usage biases of 199 different mycobacteriophages and those of several fully sequenced mycobacterial species in order to gain insight into the natural host range of these mycobacteriophages. We find that UPGMA clustering tends to match, but not consistently, clustering by shared nucleotide sequence identify. In addition, analysis of GC content, tRNA usage and correlations between mycobacteriophage and mycobacterial codon usage bias suggests that the preferred host of many clustered mycobacteriophages is not M. smegmatis but other, as yet unknown, members of the mycobacteria complex or closely allied bacterial species. PMID:28348827

  14. Complementary DNA cloning and molecular evolution of opine dehydrogenases in some marine invertebrates.

    PubMed

    Kimura, Tomohiro; Nakano, Toshiki; Yamaguchi, Toshiyasu; Sato, Minoru; Ogawa, Tomohisa; Muramoto, Koji; Yokoyama, Takehiko; Kan-No, Nobuhiro; Nagahisa, Eizou; Janssen, Frank; Grieshaber, Manfred K

    2004-01-01

    The complete complementary DNA sequences of genes presumably coding for opine dehydrogenases from Arabella iricolor (sandworm), Haliotis discus hannai (abalone), and Patinopecten yessoensis (scallop) were determined, and partial cDNA sequences were derived for Meretrix lusoria (Japanese hard clam) and Spisula sachalinensis (Sakhalin surf clam). The primers ODH-9F and ODH-11R proved useful for amplifying the sequences for opine dehydrogenases from the 4 mollusk species investigated in this study. The sequence of the sandworm was obtained using primers constructed from the amino acid sequence of tauropine dehydrogenase, the main opine dehydrogenase in A. iricolor. The complete cDNA sequence of A. iricolor, H. discus hannai, and P. yessoensis encode 397, 400, and 405 amino acids, respectively. All sequences were aligned and compared with published databank sequences of Loligo opalescens, Loligo vulgaris (squid), Sepia officinalis (cuttlefish), and Pecten maximus (scallop). As expected, a high level of homology was observed for the cDNA from closely related species, such as for cephalopods or scallops, whereas cDNA from the other species showed lower-level homologies. A similar trend was observed when the deduced amino acid sequences were compared. Furthermore, alignment of these sequences revealed some structural motifs that are possibly related to the binding sites of the substrates. The phylogenetic trees derived from the nucleotide and amino acid sequences were consistent with the classification of species resulting from classical taxonomic analyses.

  15. Mitochondrial DNA variation and phylogenetic relationships among five tuna species based on sequencing of D-loop region.

    PubMed

    Kumar, Girish; Kocour, Martin; Kunal, Swaraj Priyaranjan

    2016-05-01

    In order to assess the DNA sequence variation and phylogenetic relationship among five tuna species (Auxis thazard, Euthynnus affinis, Katsuwonus pelamis, Thunnus tonggol, and T. albacares) out of all four tuna genera, partial sequences of the mitochondrial DNA (mtDNA) D-loop region were analyzed. The estimate of intra-specific sequence variation in studied species was low, ranging from 0.027 to 0.080 [Kimura's two parameter distance (K2P)], whereas values of inter-specific variation ranged from 0.049 to 0.491. The longtail tuna (T. tonggol) and yellowfin tuna (T. albacares) were found to share a close relationship (K2P = 0.049) while skipjack tuna (K. pelamis) was most divergent studied species. Phylogenetic analysis using Maximum-Likelihood (ML) and Neighbor-Joining (NJ) methods supported the monophyletic origin of Thunnus species. Similarly, phylogeny of Auxis and Euthynnus species substantiate the monophyly. However, results showed a distinct origin of K. pelamis from genus Thunnus as well as Auxis and Euthynnus. Thus, the mtDNA D-loop region sequence data supports the polyphyletic origin of tuna species.

  16. A Sabin 2-related poliovirus recombinant contains a homologous sequence of human enterovirus species C in the viral polymerase coding region.

    PubMed

    Zhang, Yong; Zhang, Fan; Zhu, Shuangli; Chen, Li; Yan, Dongmei; Wang, Dongyan; Tang, Ruiyan; Zhu, Hui; Hou, Xiaohui; An, Hongqiu; Zhang, Hong; Xu, Wenbo

    2010-02-01

    A type 2 vaccine-related poliovirus (strain CHN3024), differing from the Sabin 2 strain by 0.44% in the VP1 coding region was isolated from a patient with vaccine-associated paralytic poliomyelitis. Sequences downstream of nucleotide position 6735 (3D(pol) coding region) were derived from an unidentified sequence; no close match for a potential parent was found, but it could be classified into a non-polio human enteroviruses species C (HEV-C) phylogeny. The virus differed antigenically from the parental Sabin strain, having an amino acid substitution in the neutralizing antigenic site 1. The similarity between CHN3024 and Sabin 2 sequences suggests that the recombination was recent; this is supported by the estimation that the initiating OPV dose was given only 36-75 days before sampling. The patient's clinical manifestations, intratypic differentiation examination, and whole-genome sequencing showed that this recombinant exhibited characteristics of neurovirulent vaccine-derived polioviruses (VDPV), which may, thus, pose a potential threat to a polio-free world.

  17. The draft genome of the pest tephritid fruit fly Bactrocera tryoni: resources for the genomic analysis of hybridising species.

    PubMed

    Gilchrist, Anthony Stuart; Shearman, Deborah C A; Frommer, Marianne; Raphael, Kathryn A; Deshpande, Nandan P; Wilkins, Marc R; Sherwin, William B; Sved, John A

    2014-12-20

    The tephritid fruit flies include a number of economically important pests of horticulture, with a large accumulated body of research on their biology and control. Amongst the Tephritidae, the genus Bactrocera, containing over 400 species, presents various species groups of potential utility for genetic studies of speciation, behaviour or pest control. In Australia, there exists a triad of closely-related, sympatric Bactrocera species which do not mate in the wild but which, despite distinct morphologies and behaviours, can be force-mated in the laboratory to produce fertile hybrid offspring. To exploit the opportunities offered by genomics, such as the efficient identification of genetic loci central to pest behaviour and to the earliest stages of speciation, investigators require genomic resources for future investigations. We produced a draft de novo genome assembly of Australia's major tephritid pest species, Bactrocera tryoni. The male genome (650-700 Mbp) includes approximately 150 Mb of interspersed repetitive DNA sequences and 60 Mb of satellite DNA. Assessment using conserved core eukaryotic sequences indicated 98% completeness. Over 16,000 MAKER-derived gene models showed a large degree of overlap with other Dipteran reference genomes. The sequence of the ribosomal RNA transcribed unit was also determined. Unscaffolded assemblies of B. neohumeralis and B. jarvisi were then produced; comparison with B. tryoni showed that the species are more closely related than any Drosophila species pair. The similarity of the genomes was exploited to identify 4924 potentially diagnostic indels between the species, all of which occur in non-coding regions. This first draft B. tryoni genome resembles other dipteran genomes in terms of size and putative coding sequences. For all three species included in this study, we have identified a comprehensive set of non-redundant repetitive sequences, including the ribosomal RNA unit, and have quantified the major satellite DNA families. These genetic resources will facilitate the further investigations of genetic mechanisms responsible for the behavioural and morphological differences between these three species and other tephritids. We have also shown how whole genome sequence data can be used to generate simple diagnostic tests between very closely-related species where only one of the species is scaffolded.

  18. Patterns of microbial diversity along a salinity gradient in the Guerrero Negro solar saltern, Baja CA Sur, Mexico

    PubMed Central

    Dillon, Jesse G.; Carlin, Mark; Gutierrez, Abraham; Nguyen, Vivian; McLain, Nathan

    2013-01-01

    The goal of this study was to use environmental sequencing of 16S rRNA and bop genes to compare the diversity of planktonic bacteria and archaea across ponds with increasing salinity in the Exportadora de Sal (ESSA) evaporative saltern in Guerrero Negro, Baja CA S., Mexico. We hypothesized that diverse communities of heterotrophic bacteria and archaea would be found in the ESSA ponds, but that bacterial diversity would decrease relative to archaea at the highest salinities. Archaeal 16S rRNA diversity was higher in Ponds 11 and 12 (370 and 380 g l−1 total salts, respectively) compared to Pond 9 (180 g l−1 total salts). Both Pond 11 and 12 communities had high representation (47 and 45% of clones, respectively) by Haloquadratum walsbyi-like (99% similarity) lineages. The archaeal community in Pond 9 was dominated (79%) by a single uncultured phylotype with 99% similarity to sequences recovered from the Sfax saltern in Tunisia. This pattern was mirrored in bop gene diversity with greater numbers of highly supported phylotypes including many Haloquadratum-like sequences from the two highest salinity ponds. In Pond 9, most bop sequences, were not closely related to sequences in databases. Bacterial 16S rRNA diversity was higher than archaeal in both Pond 9 and Pond 12 samples, but not Pond 11, where a non-Salinibacter lineage within the Bacteroidetes >98% similar to environmental clones recovered from Lake Tuz in Turkey and a saltern in Chula Vista, CA was most abundant (69% of community). This OTU was also the most abundant in Pond 12, but only represented 14% of clones in the more diverse pond. The most abundant OTU in Pond 9 (33% of community) was 99% similar to an uncultured gammaproteobacterial clone from the Salton Sea. Results suggest that the communities of saltern bacteria and archaea vary even in ponds with similar salinity and further investigation into the ecology of diverse, uncultured halophile communities is warranted. PMID:24391633

  19. Microbial eukaryotic diversity and distribution in a river plume and cyclonic eddy-influenced ecosystem in the South China Sea

    PubMed Central

    Wu, Wenxue; Wang, Lei; Liao, Yu; Huang, Bangqin

    2015-01-01

    To evaluate microbial eukaryotic diversity and distribution in mesoscale processes, we investigated 18S rDNA diversity in a river plume and cyclonic eddy-influenced ecosystem in the southwestern South China Sea (SCS). Restriction fragment length polymorphism analysis was carried out using multiple primer sets. Relative to a wide range of previous similar studies, we observed a significantly higher proportion of sequences of pigmented taxa. Among the photosynthetic groups, Haptophyta accounted for 27.7% of the sequenced clones, which belonged primarily to Prymnesiophyceae. Unexpectedly, five operational taxonomic units of Cryptophyta were closely related to freshwater species. The Chlorophyta mostly fell within the Prasinophyceae, which was comprised of six clades, including Clade III, which is detected in the SCS for the first time in this study. Among the photosynthetic stramenopiles, Chrysophyceae was the most diverse taxon, which included seven clades. The majority of 18S rDNA sequences affiliated with the Dictyochophyceae, Eustigmatophyceae, and Pelagophyceae were closely related to those of pure cultures. The results of redundancy analysis and the permutation Mantel test based on unweighted UniFrac distances, conducted for spatial analyses of the Haptophyta subclades suggested that the Mekong River plume and cyclonic eddy play important roles in regulating microbial eukaryotic diversity and distribution in the southwestern SCS. PMID:26268071

  20. Binding Site Turnover Produces Pervasive Quantitative Changes in Transcription Factor Binding between Closely Related Drosophila Species

    PubMed Central

    Trapnell, Cole; Davidson, Stuart; Pachter, Lior; Chu, Hou Cheng; Tonkin, Leath A.; Biggin, Mark D.; Eisen, Michael B.

    2010-01-01

    Changes in gene expression play an important role in evolution, yet the molecular mechanisms underlying regulatory evolution are poorly understood. Here we compare genome-wide binding of the six transcription factors that initiate segmentation along the anterior-posterior axis in embryos of two closely related species: Drosophila melanogaster and Drosophila yakuba. Where we observe binding by a factor in one species, we almost always observe binding by that factor to the orthologous sequence in the other species. Levels of binding, however, vary considerably. The magnitude and direction of the interspecies differences in binding levels of all six factors are strongly correlated, suggesting a role for chromatin or other factor-independent forces in mediating the divergence of transcription factor binding. Nonetheless, factor-specific quantitative variation in binding is common, and we show that it is driven to a large extent by the gain and loss of cognate recognition sequences for the given factor. We find only a weak correlation between binding variation and regulatory function. These data provide the first genome-wide picture of how modest levels of sequence divergence between highly morphologically similar species affect a system of coordinately acting transcription factors during animal development, and highlight the dominant role of quantitative variation in transcription factor binding over short evolutionary distances. PMID:20351773

  1. The Gap Procedure: for the identification of phylogenetic clusters in HIV-1 sequence data.

    PubMed

    Vrbik, Irene; Stephens, David A; Roger, Michel; Brenner, Bluma G

    2015-11-04

    In the context of infectious disease, sequence clustering can be used to provide important insights into the dynamics of transmission. Cluster analysis is usually performed using a phylogenetic approach whereby clusters are assigned on the basis of sufficiently small genetic distances and high bootstrap support (or posterior probabilities). The computational burden involved in this phylogenetic threshold approach is a major drawback, especially when a large number of sequences are being considered. In addition, this method requires a skilled user to specify the appropriate threshold values which may vary widely depending on the application. This paper presents the Gap Procedure, a distance-based clustering algorithm for the classification of DNA sequences sampled from individuals infected with the human immunodeficiency virus type 1 (HIV-1). Our heuristic algorithm bypasses the need for phylogenetic reconstruction, thereby supporting the quick analysis of large genetic data sets. Moreover, this fully automated procedure relies on data-driven gaps in sorted pairwise distances to infer clusters, thus no user-specified threshold values are required. The clustering results obtained by the Gap Procedure on both real and simulated data, closely agree with those found using the threshold approach, while only requiring a fraction of the time to complete the analysis. Apart from the dramatic gains in computational time, the Gap Procedure is highly effective in finding distinct groups of genetically similar sequences and obviates the need for subjective user-specified values. The clusters of genetically similar sequences returned by this procedure can be used to detect patterns in HIV-1 transmission and thereby aid in the prevention, treatment and containment of the disease.

  2. Lactobacillus strain diversity based on partial hsp60 gene sequences and design of PCR-restriction fragment length polymorphism assays for species identification and differentiation.

    PubMed

    Blaiotta, Giuseppe; Fusco, Vincenzina; Ercolini, Danilo; Aponte, Maria; Pepe, Olimpia; Villani, Francesco

    2008-01-01

    A phylogenetic tree showing diversities among 116 partial (499-bp) Lactobacillus hsp60 (groEL, encoding a 60-kDa heat shock protein) nucleotide sequences was obtained and compared to those previously described for 16S rRNA and tuf gene sequences. The topology of the tree produced in this study showed a Lactobacillus species distribution similar, but not identical, to those previously reported. However, according to the most recent systematic studies, a clear differentiation of 43 single-species clusters was detected/identified among the sequences analyzed. The slightly higher variability of the hsp60 nucleotide sequences than of the 16S rRNA sequences offers better opportunities to design or develop molecular assays allowing identification and differentiation of either distant or very closely related Lactobacillus species. Therefore, our results suggest that hsp60 can be considered an excellent molecular marker for inferring the taxonomy and phylogeny of members of the genus Lactobacillus and that the chosen primers can be used in a simple PCR procedure allowing the direct sequencing of the hsp60 fragments. Moreover, in this study we performed a computer-aided restriction endonuclease analysis of all 499-bp hsp60 partial sequences and we showed that the PCR-restriction fragment length polymorphism (RFLP) patterns obtainable by using both endonucleases AluI and TacI (in separate reactions) can allow identification and differentiation of all 43 Lactobacillus species considered, with the exception of the pair L. plantarum/L. pentosus. However, the latter species can be differentiated by further analysis with Sau3AI or MseI. The hsp60 PCR-RFLP approach was efficiently applied to identify and to differentiate a total of 110 wild Lactobacillus strains (including closely related species, such as L. casei and L. rhamnosus or L. plantarum and L. pentosus) isolated from cheese and dry-fermented sausages.

  3. Lactobacillus Strain Diversity Based on Partial hsp60 Gene Sequences and Design of PCR-Restriction Fragment Length Polymorphism Assays for Species Identification and Differentiation▿ †

    PubMed Central

    Blaiotta, Giuseppe; Fusco, Vincenzina; Ercolini, Danilo; Aponte, Maria; Pepe, Olimpia; Villani, Francesco

    2008-01-01

    A phylogenetic tree showing diversities among 116 partial (499-bp) Lactobacillus hsp60 (groEL, encoding a 60-kDa heat shock protein) nucleotide sequences was obtained and compared to those previously described for 16S rRNA and tuf gene sequences. The topology of the tree produced in this study showed a Lactobacillus species distribution similar, but not identical, to those previously reported. However, according to the most recent systematic studies, a clear differentiation of 43 single-species clusters was detected/identified among the sequences analyzed. The slightly higher variability of the hsp60 nucleotide sequences than of the 16S rRNA sequences offers better opportunities to design or develop molecular assays allowing identification and differentiation of either distant or very closely related Lactobacillus species. Therefore, our results suggest that hsp60 can be considered an excellent molecular marker for inferring the taxonomy and phylogeny of members of the genus Lactobacillus and that the chosen primers can be used in a simple PCR procedure allowing the direct sequencing of the hsp60 fragments. Moreover, in this study we performed a computer-aided restriction endonuclease analysis of all 499-bp hsp60 partial sequences and we showed that the PCR-restriction fragment length polymorphism (RFLP) patterns obtainable by using both endonucleases AluI and TacI (in separate reactions) can allow identification and differentiation of all 43 Lactobacillus species considered, with the exception of the pair L. plantarum/L. pentosus. However, the latter species can be differentiated by further analysis with Sau3AI or MseI. The hsp60 PCR-RFLP approach was efficiently applied to identify and to differentiate a total of 110 wild Lactobacillus strains (including closely related species, such as L. casei and L. rhamnosus or L. plantarum and L. pentosus) isolated from cheese and dry-fermented sausages. PMID:17993558

  4. Isolation and distribution of a novel iron-oxidizing crenarchaeon from acidic geothermal springs in Yellowstone National Park.

    PubMed

    Kozubal, M; Macur, R E; Korf, S; Taylor, W P; Ackerman, G G; Nagy, A; Inskeep, W P

    2008-02-01

    Novel thermophilic crenarchaea have been observed in Fe(III) oxide microbial mats of Yellowstone National Park (YNP); however, no definitive work has identified specific microorganisms responsible for the oxidation of Fe(II). The objectives of the current study were to isolate and characterize an Fe(II)-oxidizing member of the Sulfolobales observed in previous 16S rRNA gene surveys and to determine the abundance and distribution of close relatives of this organism in acidic geothermal springs containing high concentrations of dissolved Fe(II). Here we report the isolation and characterization of the novel, Fe(II)-oxidizing, thermophilic, acidophilic organism Metallosphaera sp. strain MK1 obtained from a well-characterized acid-sulfate-chloride geothermal spring in Norris Geyser Basin, YNP. Full-length 16S rRNA gene sequence analysis revealed that strain MK1 exhibits only 94.9 to 96.1% sequence similarity to other known Metallosphaera spp. and less than 89.1% similarity to known Sulfolobus spp. Strain MK1 is a facultative chemolithoautotroph with an optimum pH range of 2.0 to 3.0 and an optimum temperature range of 65 to 75 degrees C. Strain MK1 grows optimally on pyrite or Fe(II) sorbed onto ferrihydrite, exhibiting doubling times between 10 and 11 h under aerobic conditions (65 degrees C). The distribution and relative abundance of MK1-like 16S rRNA gene sequences in 14 acidic geothermal springs containing Fe(III) oxide microbial mats were evaluated. Highly related MK1-like 16S rRNA gene sequences (>99% sequence similarity) were consistently observed in Fe(III) oxide mats at temperatures ranging from 55 to 80 degrees C. Quantitative PCR using Metallosphaera-specific primers confirmed that organisms highly similar to strain MK1 comprised up to 40% of the total archaeal community at selected sites. The broad distribution of highly related MK1-like 16S rRNA gene sequences in acidic Fe(III) oxide microbial mats is consistent with the observed characteristics and growth optima of Metallosphaera-like strain MK1 and emphasizes the importance of this newly described taxon in Fe(II) chemolithotrophy in acidic high-temperature environments of YNP.

  5. Molecular and phylogenetic characterization of bovine coronavirus virus isolated from dairy cattle in Central Region, Thailand.

    PubMed

    Singasa, Kanokwan; Songserm, Taweesak; Lertwatcharasarakul, Preeda; Arunvipas, Pipat

    2017-10-01

    Bovine coronavirus (BCoV) is involved mainly in enteric infections in cattle. This study reports the first molecular detection of BCoV in a diarrhea outbreak in dairy cows in the Central Region, Thailand. BCoV was molecularly detected from bloody diarrheic cattle feces by using nested PCR. Agarose gel electrophoresis of three diarrheic fecal samples yielded from the 25 samples desired amplicons that were 488 base pairs and sequencing substantiated that have BCoV. The sequence alignment indicated that nucleotide and amino acid sequences, the three TWD isolated in Thailand, were more quite homologous to each other (amino acid at position 39 of TWD1, TWD3 was proline, but TWD2 was serine) and closely related to OK-0514-3strain (virulent respiratory strain; RBCoV).The amino acid sequencing identities among TWD1, TWD2,TWD3, and OK-0514-3 strain were 96.0 to 96.6%, those at which T3I, H65N, D87G, H127Y, andQ136R were changed. In addition, the phylogenetic tree of the hypervariable region S1subunit spike glycoprotein BCoV gene was composed of three major clades by using the 54 sequences generated and showed that the evolutionally distance, TWD1, TWD2, and TWD3 were the isolated group together and most similar to OK-0514-3 strain (98.2 to 98.5% similarity). Further study will develop ELISA assay for serologic detection of winter dysentery disease.

  6. The Mitochondrial Genome Sequence and Molecular Phylogeny of the Turkey, Meleagris gallopavo

    PubMed Central

    Guan, Xiaojing; Silva, Pradeepa; Gyenai, Kwaku B.; Xu, Jun; Geng, Tuoyu; Tu, Zhijian; Samuels, David C.; Smith, Edward J.

    2009-01-01

    Summary The mitochondrial genome (mtGenome) has been very little studied in the turkey (Meleagris gallopavo), for which there is no publicly available whole genome mitochondrial sequence. Here, we used PCR-based methods with 19 pairs of primers designed from the chicken and other species to develop a complete turkey mtGenome sequence. A total length of 16, 717 bp of the whole turkey mtGenome was obtained, with 85% similarity to chicken mtGenome. There were 13 genes and 24 RNA (22 tRNA and 2 rRNA) annotated. The mtGenome-based phylogenetic analysis suggests that the turkey is most closely related to the chicken, Gallus gallus, and quail, Corturnix japonica. Given the importance of the mitochondria genome, the present work adds to the growing genomic resources needed to define the genetic mechanisms that underlie some economic traits in the turkey. PMID:19067672

  7. A novel chlorophyll a/b binding (Cab) protein gene from petunia which encodes the lower molecular weight Cab precursor protein.

    PubMed

    Stayton, M M; Black, M; Bedbrook, J; Dunsmuir, P

    1986-12-22

    The 16 petunia Cab genes which have been characterized are all closely related at the nucleotide sequence level and they encode Cab precursor polypeptides which are similar in sequence and length. Here we describe a novel petunia Cab gene which encodes a unique Cab precursor protein. This protein is a member of the smallest class of Cab precursor proteins for which no gene has previously been assigned in petunia or any other species. The features of this Cab precursor protein are that it is shorter by 2-3 amino acids than the formerly characterized Cab precursors, its transit peptide sequence is unrelated, and the mature polypeptide is significantly diverged at the functionally important N terminus from other petunia Cab proteins. Gene structure also discriminates this gene which is the only intron containing Cab gene in petunia genomic DNA.

  8. Lactobacillus micheneri sp. nov., Lactobacillus timberlakei sp. nov. and Lactobacillus quenuiae sp. nov., lactic acid bacteria isolated from wild bees and flowers.

    PubMed

    McFrederick, Quinn S; Vuong, Hoang Q; Rothman, Jason A

    2018-06-01

    Gram-stain-positive, rod-shaped, non-spore forming bacteria have been isolated from flowers and the guts of adult wild bees in the families Megachilidae and Halictidae. Phylogenetic analysis of the 16S rRNA gene indicated that these bacteria belong to the genus Lactobacillus, and are most closely related to the honey-bee associated bacteria Lactobacillus kunkeei (97.0 % sequence similarity) and Lactobacillus apinorum (97.0 % sequence similarity). Phylogenetic analyses of 16S rRNA genes and six single-copy protein coding genes, in situ and in silico DNA-DNA hybridization, and fatty-acid profiling differentiates the newly isolated bacteria as three novel Lactobacillus species: Lactobacillus micheneri sp. nov. with the type strain Hlig3 T (=DSM 104126 T ,=NRRL B-65473 T ), Lactobacillus timberlakei with the type strain HV_12 T (=DSM 104128 T ,=NRRL B-65472 T ), and Lactobacillus quenuiae sp. nov. with the type strain HV_6 T (=DSM 104127 T ,=NRRL B-65474 T ).

  9. ORGANIZATION OF THE nif GENES OF THE NONHETEROCYSTOUS CYANOBACTERIUM TRICHODESMIUM SP. IMS101.

    PubMed

    Dominic, Benny; Zani, Sabino; Chen, Yi-Bu; Mellon, Mark T; Zehr, Jonathan P

    2000-08-26

    An approximately 16-kb fragment of the Trichodesmium sp. IMS101 (a nonheterocystous filamentous cyanobacterium) "conventional"nif gene cluster was cloned and sequenced. The gene organization of the Trichodesmium and Anabaena variabilis vegetative (nif 2) nitrogenase gene clusters spanning the region from nif B to nif W are similar except for the absence of two open reading frames (ORF3 and ORF1) in Trichodesmium. The Trichodesmium nif EN genes encode a fused Nif EN polypeptide that does not appear to be processed into individual Nif E and Nif N polypeptides. Fused nif EN genes were previously found in the A. variabilis nif 2 genes, but we have found that fused nif EN genes are widespread in the nonheterocystous cyanobacteria. Although the gene organization of the nonheterocystous filamentous Trichodesmium nif gene cluster is very similar to that of the A. variabilis vegetative nif 2 gene cluster, phylogenetic analysis of nif sequences do not support close relatedness of Trichodesmium and A. variabilis vegetative (nif 2) nitrogenase genes.

  10. Acanthamoeba castellanii contains a ribosomal RNA enhancer binding protein which stimulates TIF-IB binding and transcription under stringent conditions.

    PubMed

    Yang, Q; Radebaugh, C A; Kubaska, W; Geiss, G K; Paule, M R

    1995-11-11

    The intergenic spacer (IGS) of Acanthamoeba castellanii rRNA genes contains repeated elements which are weak enhancers for transcription by RNA polymerase I. A protein, EBF, was identified and partially purified which binds to the enhancers and to several other sequences within the IGS, but not to other DNA fragments, including the rRNA core promoter. No consensus binding sequence could be discerned in these fragments and bound factor is in rapid equilibrium with unbound. EBF has functional characteristics similar to vertebrate upstream binding factors (UBF). Not only does it bind to the enhancer and other IGS elements, but it also stimulates binding of TIF-IB, the fundamental transcription initiation factor, to the core promoter and stimulates transcription from the promoter. Attempts to identify polypeptides with epitopes similar to rat or Xenopus laevis UBF suggest that structurally the protein from A.castellanii is not closely related to vertebrate UBF.

  11. Acanthamoeba castellanii contains a ribosomal RNA enhancer binding protein which stimulates TIF-IB binding and transcription under stringent conditions.

    PubMed Central

    Yang, Q; Radebaugh, C A; Kubaska, W; Geiss, G K; Paule, M R

    1995-01-01

    The intergenic spacer (IGS) of Acanthamoeba castellanii rRNA genes contains repeated elements which are weak enhancers for transcription by RNA polymerase I. A protein, EBF, was identified and partially purified which binds to the enhancers and to several other sequences within the IGS, but not to other DNA fragments, including the rRNA core promoter. No consensus binding sequence could be discerned in these fragments and bound factor is in rapid equilibrium with unbound. EBF has functional characteristics similar to vertebrate upstream binding factors (UBF). Not only does it bind to the enhancer and other IGS elements, but it also stimulates binding of TIF-IB, the fundamental transcription initiation factor, to the core promoter and stimulates transcription from the promoter. Attempts to identify polypeptides with epitopes similar to rat or Xenopus laevis UBF suggest that structurally the protein from A.castellanii is not closely related to vertebrate UBF. Images PMID:7501455

  12. Characterization of myosin heavy chain and its gene in Amoeba proteus.

    PubMed

    Oh, S W; Jeon, K W

    1998-01-01

    Monoclonal antibodies against the myosin heavy chain of Amoeba proteus were obtained and used to localize myosin inside amoebae and to clone cDNAs encoding myosin. Myosin was found throughout the amoeba cytoplasm but was more concentrated in the ectoplasmic regions as determined by indirect immunofluorescence microscopy. In symbiont-bearing xD amoebae, myosin was also found on the symbiosome membranes, as checked by indirect immunofluorescence microscopy and by immunoelectron microscopy. The open reading frame of a cloned myosin cDNA contained 6,414 nucleotides, coding for a polypeptide of 2,138 amino acids. While the amino-acid sequence of the globular head region of amoeba's myosin had a high degree of similarity with that of myosins from various organisms, the tail region building a coiled-coil structure did not show a significant sequence similarity. There appeared to be at least three different isoforms of myosins in amoebae, with closely related amino acids in the globular head region.

  13. Chryseomicrobium imtechense gen. nov., sp. nov., a new member of the family Planococcaceae.

    PubMed

    Arora, Pankaj Kumar; Chauhan, Archana; Pant, Bhawana; Korpole, Suresh; Mayilraj, Shanmugam; Jain, Rakesh Kumar

    2011-08-01

    A Gram-stain-positive, rod-shaped, yellow, non-motile, non-spore-forming, strictly aerobic bacterial strain, designated MW 10(T), was isolated from seawater of the Bay of Bengal, India, and was subjected to a polyphasic taxonomic study. Analysis of the 16S rRNA gene sequence revealed that strain MW 10(T) showed highest similarity to the type strains of Psychrobacillus psychrodurans (96.15 %) and Psychrobacillus psychrotolerans (96.01 %) and showed less than 96 % similarity to members of the genera Paenisporosarcina, Planococcus, Sporosarcina and Planomicrobium. Phylogenetic analysis based on the 16S rRNA gene sequence showed that strain MW 10(T) formed a clade separate from members of closely related genera. The morphological, physiological and chemotaxonomic characteristics of strain MW 10(T) differed from those of members of closely related genera. The major fatty acid in strain MW 10(T) was iso-C(15 : 0) and the menaquinones were MK-7 (48.4 %), MK-8 (32.3 %), MK-7(H(2)) (13.7 %) and MK-6 (5.6 %). The polar lipids were diphosphatidylglycerol, phosphatidylglycerol, phosphatidylethanolamine, phosphatidylcholine, an unknown phospholipid, an unknown lipid and an unknown glycolipid. The cell-wall peptidoglycan type was l-Lys-d-Asp. The genomic DNA G+C content (53.4 mol%) of strain MW 10(T) was significantly different from those of members of closely related genera. On the basis of its morphological, physiological and chemotaxonomic characteristics as well as our phylogenetic analysis, we conclude that strain MW 10(T) is a member of a novel genus and species, for which the name Chryseomicrobium imtechense gen. nov., sp. nov., is proposed. The type strain of Chryseomicrobium imtechense is MW 10(T) ( = MTCC 10098(T)  = JCM 16573(T)).

  14. Massively parallel pyrosequencing of the mitochondrial genome with the 454 methodology in forensic genetics.

    PubMed

    Mikkelsen, Martin; Frank-Hansen, Rune; Hansen, Anders J; Morling, Niels

    2014-09-01

    of sequencing of whole mitochondrial genome, HV1 and HV2 DNA with the second generation system (SGS) Roche 454 GS Junior were compared with results of Sanger sequencing and SNP typing with SNaPshot single base extension detected with MALDI-TOF and capillary electrophoresis. We investigated the performance of the software analysis of the data, reproducibility, ability to sequence homopolymeric regions, detection of mixtures and heteroplasmy as well as the implications of the depth of coverage. We found full reproducibility between samples sequenced twice with SGS. We found close to full concordance between the mtDNA sequences of 26 samples obtained with (1) the 454 SGS method using a depth of coverage above 100 and (2) Sanger sequencing and SNP typing. The discrepancies were primarily observed in homopolymeric regions. The 454 SGS method was able to sequence 95% of the reads correctly in homopolymers up to 4 bases, and up to 6 bases could be sequenced with similar success if the results were carefully, visually inspected. The 454 technology was able to detect mixtures or heteroplasmy of approximately 10%. We detected previously unreported heteroplasmy in the GM9947A component of the NIST human mitochondrial DNA SRM-2392 standard reference material. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  15. Characterization of human MMTV-like (HML) elements similar to a sequence that was highly expressed in a human breast cancer: further definition of the HML-6 group.

    PubMed

    Yin, H; Medstrand, P; Kristofferson, A; Dietrich, U; Aman, P; Blomberg, J

    1999-03-30

    Previously, we found a retroviral sequence, HML-6.2BC1, to be expressed at high levels in a multifocal ductal breast cancer from a 41-year-old woman who also developed ovarian carcinoma. The sequence of a human genomic clone (HML-6.28) selected by high-stringency hybridization with HML-6.2BC1 is reported here. It was 99% identical to HML-6.2BC1 and gave the same restriction fragments as total DNA. HML-6.28 is a 4.7-kb provirus with a 5'LTR, truncated in RT. Data from two similar genomic clones and sequences found in GenBank are also reported. Overlaps between them gave a rather complete picture of the HML-6.2BC1-like human endogenous retroviral elements. Work with somatic cell hybrids and FISH localized HML-6.28 to chromosome 6, band p21, close to the MHC region. The causal role of HML-6.28 in breast cancer remains unclear. Nevertheless, the ca. 20 Myr old HML-6 sequences enabled the definition of common and unique features of type A, B, and D (ABD) retroviruses. In Gag, HML-6 has no intervening sequences between matrix and capsid proteins, unlike extant exogenous ABD viruses, possibly an ancestral feature. Alignment of the dUTPase showed it to be present in all ABD viruses, but gave a phylogenetic tree different from trees made from other ABD genes, indicating a distinct phylogeny of dUTPase. A conserved 24-mer sequence in the amino terminus of some ABD envelope genes suggested a conserved function. Copyright 1999 Academic Press.

  16. Enterobacter muelleri sp. nov., isolated from the rhizosphere of Zea mays.

    PubMed

    Kämpfer, Peter; McInroy, John A; Glaeser, Stefanie P

    2015-11-01

    A beige-pigmented, oxidase-negative bacterial strain (JM-458T), isolated from a rhizosphere sample, was studied using a polyphasic taxonomic approach. Cells of the isolate were rod-shaped and stained Gram-negative. A comparison of the 16S rRNA gene sequence of strain JM-458T with sequences of the type strains of closely related species of the genus Enterobacter showed that it shared highest sequence similarity with Enterobacter mori (98.7 %), Enterobacter hormaechei (98.3 %), Enterobacter cloacae subsp. dissolvens, Enterobacter ludwigii and Enterobacter asburiae (all 98.2 %). 16S rRNA gene sequence similarities to all other Enterobacter species were below 98 %. Multilocus sequence analysis based on concatenated partial rpoB, gyrB, infB and atpD gene sequences showed a clear distinction of strain JM-458T from its closest related type strains. The fatty acid profile of the strain consisted of C16 : 0, C17 : 0 cyclo, iso-C15 : 0 2-OH/C16 : 1ω7c and C18 : 1ω7c as major components. DNA-DNA hybridizations between strain JM-458T and the type strains of E. mori, E. hormaechei and E. ludwigii resulted in relatedness values of 29 % (reciprocal 25 %), 24 % (reciprocal 43 %) and 16 % (reciprocal 17 %), respectively. DNA-DNA hybridization results together with multilocus sequence analysis results and differential biochemical and chemotaxonomic properties showed that strain JM-458T represents a novel species of the genus Enterobacter, for which the name Enterobacter muelleri sp. nov. is proposed. The type strain is JM-458T ( = DSM 29346T = CIP 110826T = LMG 28480T = CCM 8546T).

  17. Diverse Thermus species inhabit a single hot spring microbial mat

    NASA Technical Reports Server (NTRS)

    Nold, S. C.; Ward, D. M.

    1995-01-01

    Through an effort to characterize aerobic chemoorganotrophic bacteria in the Octopus Spring cyano-bacterial mat community, we cultivated four Thermus isolates with unique 16S rRNA sequences. Isolates clustered within existing Thermus clades, including those containing Thermus ruber, Thermus aquaticus, and a subgroup closely related to T. aquaticus. One Octopus Spring isolate is nearly identical (99.9% similar) to isolates from Iceland, and two others are closely related to a T. ruber isolated from Russia. Octopus Spring isolates similar to T. aquaticus and T. ruber exhibited optimal growth rates at high (65-70 degrees C) and low (50 degrees C) temperatures, respectively, with the most abundant species best adapted to the temperature of the habitat (50-55 degrees C). Our results display a diversity of Thermus genotypes defined by 16S rRNA within one hot spring microbial community. We suggest that specialization to temperature and perhaps other local environmental features controls the abundance of Thermus populations.

  18. ...And Kronos Ate His Sons

    NASA Astrophysics Data System (ADS)

    Vitiello, Giuseppe

    In closed systems, energy is conserved. The origin of the time axis is completely arbitrary due to the invariance under continuous time-translations. The flowing of time swallows those fictitious origins one might assign on its axis, as Kronos ate his sons. Dissipation breaks such a scenario. It implies a non-forgettable origin of time. Open systems need their complement (their "double") in order to become, together, a closed system. Time emerges as an observable measured by the evolution of the open system complement, which acts as a clock. The conservation of the energy-momentum tensor in electrodynamics is considered and its relation with dissipative systems and self-similar fractal structures is discussed. The isomorphism with coherent states in quantum field theory (QFT) is established and the generator of transitions among unitarily inequivalent representations of the canonical commutation relations (CCR) is shown to provide sequences in time of phases, which defines the arrow of time. Merging properties of electrodynamics, fractal self-similarity, dissipation and coherent states point to an integrated vision of Nature.

  19. High resolution identity testing of inactivated poliovirus vaccines.

    PubMed

    Mee, Edward T; Minor, Philip D; Martin, Javier

    2015-07-09

    Definitive identification of poliovirus strains in vaccines is essential for quality control, particularly where multiple wild-type and Sabin strains are produced in the same facility. Sequence-based identification provides the ultimate in identity testing and would offer several advantages over serological methods. We employed random RT-PCR and high throughput sequencing to recover full-length genome sequences from monovalent and trivalent poliovirus vaccine products at various stages of the manufacturing process. All expected strains were detected in previously characterised products and the method permitted identification of strains comprising as little as 0.1% of sequence reads. Highly similar Mahoney and Sabin 1 strains were readily discriminated on the basis of specific variant positions. Analysis of a product known to contain incorrect strains demonstrated that the method correctly identified the contaminants. Random RT-PCR and shotgun sequencing provided high resolution identification of vaccine components. In addition to the recovery of full-length genome sequences, the method could also be easily adapted to the characterisation of minor variant frequencies and distinction of closely related products on the basis of distinguishing consensus and low frequency polymorphisms. Copyright © 2015 The Authors. Published by Elsevier Ltd.. All rights reserved.

  20. Cymbidium chlorotic mosaic virus, a new sobemovirus isolated from a spring orchid (Cymbidium goeringii) in Japan.

    PubMed

    Kondo, Hideki; Takemoto, Shogo; Maruyama, Kazuyuki; Chiba, Sotaro; Andika, Ida Bagus; Suzuki, Nobuhiro

    2015-08-01

    Cymbidium chlorotic mosaic virus (CyCMV), isolated from a spring orchid (Cymbidium goeringii), was characterized molecularly. CyCMV isometric virions comprise a single, positive-strand RNA genome of 4,083 nucleotides and 30-kDa coat protein. The virus genome contains five overlapping open reading frames with a genomic organization similar to that of sobemoviruses. BLAST searches and phylogenetic analysis revealed that CyCMV is most closely related to papaya lethal yellowing virus, a proposed dicot-infecting sobemovirus (58.8 % nucleotide sequence identity), but has a relatively distant relationship to monocot-infecting sobemoviruses, with only modest sequence identities. This suggests that CyCMV is a new monocot-infecting member of the floating genus Sobemovirus.

  1. Phylogeny of Symbiotic Genes and the Symbiotic Properties of Rhizobia Specific to Astragalus glycyphyllos L.

    PubMed

    Gnat, Sebastian; Małek, Wanda; Oleńska, Ewa; Wdowiak-Wróbel, Sylwia; Kalita, Michał; Łotocka, Barbara; Wójcik, Magdalena

    2015-01-01

    The phylogeny of symbiotic genes of Astragalus glycyphyllos L. (liquorice milkvetch) nodule isolates was studied by comparative sequence analysis of nodA, nodC, nodH and nifH loci. In all these genes phylograms, liquorice milkvetch rhizobia (closely related to bacteria of three species, i.e. Mesorhizobium amorphae, Mesorhizobium septentrionale and Mesorhizobium ciceri) formed one clearly separate cluster suggesting the horizontal transfer of symbiotic genes from a single ancestor to the bacteria being studied. The high sequence similarity of the symbiotic genes of A. glycyphyllos rhizobia (99-100% in the case of nodAC and nifH genes, and 98-99% in the case of nodH one) points to the relatively recent (in evolutionary scale) lateral transfer of these genes. In the nodACH and nifH phylograms, A. glycyphyllos nodule isolates were grouped together with the genus Mesorhizobium species in one monophyletic clade, close to M. ciceri, Mesorhizobium opportunistum and Mesorhizobium australicum symbiovar biserrulae bacteria, which correlates with the close relationship of these rhizobia host plants. Plant tests revealed the narrow host range of A. glycyphyllos rhizobia. They formed effective symbiotic interactions with their native host (A. glycyphyllos) and Amorpha fruticosa but not with 11 other fabacean species. The nodules induced on A. glycyphyllos roots were indeterminate with apical, persistent meristem, an age gradient of nodule tissues and cortical vascular bundles. To reflect the symbiosis-adaptive phenotype of rhizobia, specific for A. glycyphyllos, we propose for these bacteria the new symbiovar "glycyphyllae", based on nodA and nodC genes sequences.

  2. Phylogeny of Symbiotic Genes and the Symbiotic Properties of Rhizobia Specific to Astragalus glycyphyllos L.

    PubMed Central

    Gnat, Sebastian; Małek, Wanda; Oleńska, Ewa; Wdowiak-Wróbel, Sylwia; Kalita, Michał; Łotocka, Barbara; Wójcik, Magdalena

    2015-01-01

    The phylogeny of symbiotic genes of Astragalus glycyphyllos L. (liquorice milkvetch) nodule isolates was studied by comparative sequence analysis of nodA, nodC, nodH and nifH loci. In all these genes phylograms, liquorice milkvetch rhizobia (closely related to bacteria of three species, i.e. Mesorhizobium amorphae, Mesorhizobium septentrionale and Mesorhizobium ciceri) formed one clearly separate cluster suggesting the horizontal transfer of symbiotic genes from a single ancestor to the bacteria being studied. The high sequence similarity of the symbiotic genes of A. glycyphyllos rhizobia (99–100% in the case of nodAC and nifH genes, and 98–99% in the case of nodH one) points to the relatively recent (in evolutionary scale) lateral transfer of these genes. In the nodACH and nifH phylograms, A. glycyphyllos nodule isolates were grouped together with the genus Mesorhizobium species in one monophyletic clade, close to M. ciceri, Mesorhizobium opportunistum and Mesorhizobium australicum symbiovar biserrulae bacteria, which correlates with the close relationship of these rhizobia host plants. Plant tests revealed the narrow host range of A. glycyphyllos rhizobia. They formed effective symbiotic interactions with their native host (A. glycyphyllos) and Amorpha fruticosa but not with 11 other fabacean species. The nodules induced on A. glycyphyllos roots were indeterminate with apical, persistent meristem, an age gradient of nodule tissues and cortical vascular bundles. To reflect the symbiosis-adaptive phenotype of rhizobia, specific for A. glycyphyllos, we propose for these bacteria the new symbiovar “glycyphyllae”, based on nodA and nodC genes sequences. PMID:26496493

  3. Reclassification of Bacillus marismortui as Salibacillus marismortui comb. nov.

    PubMed

    Arahal, D R; Márquez, M C; Volcani, B E; Schleifer, K H; Ventosa, A

    2000-07-01

    Recently, the features of a group of strains isolated from Dead Sea enrichments obtained in 1936 by one of us (B. E. Volcani) were described. They were gram-positive, moderately halophilic, spore-forming rods, and were placed in a new species, Bacillus marismortui. At the same time, the new genus Salibacillus was proposed for the halophilic species Bacillus salexigens. B. marismortui and Salibacillus salexigens have similar phenotypic characteristics and the same peptidoglycan type. Phylogenetic analysis based on 16S rRNA sequence comparisons showed that they are sufficiently closely related (96.6% similarity) as to warrant placement in the same genus. However, DNA-DNA hybridization experiments showed that they constitute two separate species (41% DNA similarity). Therefore the reclassification of Bacillus marismortui as Salibacillus marismortui comb. nov. is proposed.

  4. Evolution of heliobacteria: implications for photosynthetic reaction center complexes

    NASA Technical Reports Server (NTRS)

    Vermaas, W. F.; Blankenship, R. E. (Principal Investigator)

    1994-01-01

    The evolutionary position of the heliobacteria, a group of green photosynthetic bacteria with a photosynthetic apparatus functionally resembling Photosystem I of plants and cyanobacteria, has been investigated with respect to the evolutionary relationship to Gram-positive bacteria and cyanobacteria. On the basis of 16S rRNA sequence analysis, the heliobacteria appear to be most closely related to Gram-positive bacteria, but also an evolutionary link to cyanobacteria is evident. Interestingly, a 46-residue domain including the putative sixth membrane-spanning region of the heliobacterial reaction center protein show rather strong similarity (33% identity and 72% similarity) to a region including the sixth membrane-spanning region of the CP47 protein, a chlorophyll-binding core antenna polypeptide of Photosystem II. The N-terminal half of the heliobacterial reaction center polypeptide shows a moderate sequence similarity (22% identity over 232 residues) with the CP47 protein, which is significantly more than the similarity with the Photosystem I core polypeptides in this region. An evolutionary model for photosynthetic reaction center complexes is discussed, in which an ancestral homodimeric reaction center protein (possibly resembling the heliobacterial reaction center protein) with 11 membrane-spanning regions per polypeptide has diverged to give rise to the core of Photosystem I, Photosystem II, and of the photosynthetic apparatus in green, purple, and heliobacteria.

  5. Does similarity in call structure or foraging ecology explain interspecific information transfer in wild Myotis bats?

    PubMed

    Hügel, Theresa; van Meir, Vincent; Muñoz-Meneses, Amanda; Clarin, B-Markus; Siemers, Björn M; Goerlitz, Holger R

    2017-01-01

    Animals can gain important information by attending to the signals and cues of other animals in their environment, with acoustic information playing a major role in many taxa. Echolocation call sequences of bats contain information about the identity and behaviour of the sender which is perceptible to close-by receivers. Increasing evidence supports the communicative function of echolocation within species, yet data about its role for interspecific information transfer is scarce. Here, we asked which information bats extract from heterospecific echolocation calls during foraging. In three linked playback experiments, we tested in the flight room and field if foraging Myotis bats approached the foraging call sequences of conspecifics and four heterospecifics that were similar in acoustic call structure only (acoustic similarity hypothesis), in foraging ecology only (foraging similarity hypothesis), both, or none. Compared to the natural prey capture rate of 1.3 buzzes per minute of bat activity, our playbacks of foraging sequences with 23-40 buzzes/min simulated foraging patches with significantly higher profitability. In the flight room, M. capaccinii only approached call sequences of conspecifics and of the heterospecific M. daubentonii with similar acoustics and foraging ecology. In the field, M. capaccinii and M. daubentonii only showed a weak positive response to those two species. Our results confirm information transfer across species boundaries and highlight the importance of context on the studied behaviour, but cannot resolve whether information transfer in trawling Myotis is based on acoustic similarity only or on a combination of similarity in acoustics and foraging ecology. Animals transfer information, both voluntarily and inadvertently, and within and across species boundaries. In echolocating bats, acoustic call structure and foraging ecology are linked, making echolocation calls a rich source of information about species identity, ecology and activity of the sender, which receivers might exploit to find profitable foraging grounds. We tested in three lab and field experiments if information transfer occurs between bat species and if bats obtain information about ecology from echolocation calls. Myotis capaccinii/daubentonii bats approached call playbacks, but only those from con- and heterospecifics with similar call structure and foraging ecology, confirming interspecific information transfer. Reactions differed between lab and field, emphasising situation-dependent differences in animal behaviour, the importance of field research, and the need for further studies on the underlying mechanism of information transfer and the relative contributions of acoustic and ecological similarity.

  6. [Analysis of the molecular characteristics and cloning of full-length coding sequence of interleukin-2 in tree shrews].

    PubMed

    Huang, Xiao-Yan; Li, Ming-Li; Xu, Juan; Gao, Yue-Dong; Wang, Wen-Guang; Yin, An-Guo; Li, Xiao-Fei; Sun, Xiao-Mei; Xia, Xue-Shan; Dai, Jie-Jie

    2013-04-01

    While the tree shrew (Tupaia belangeri chinensis) is an excellent animal model for studying the mechanisms of human diseases, but few studies examine interleukin-2 (IL-2), an important immune factor in disease model evaluation. In this study, a 465 bp of the full-length IL-2 cDNA encoding sequence was cloned from the RNA of tree shrew spleen lymphocytes, which were then cultivated and stimulated with ConA (concanavalin). Clustal W 2.0 was used to compare and analyze the sequence and molecular characteristics, and establish the similarity of the overall structure of IL-2 between tree shrews and other mammals. The homology of the IL-2 nucleotide sequence between tree shrews and humans was 93%, and the amino acid homology was 80%. The phylogenetic tree results, derived through the Neighbour-Joining method using MEGA5.0, indicated a close genetic relationship between tree shrews, Homo sapiens, and Macaca mulatta. The three-dimensional structure analysis showed that the surface charges in most regions of tree shrew IL-2 were similar to between tree shrews and humans; however, the N-glycosylation sites and local structures were different, which may affect antibody binding. These results provide a fundamental basis for the future study of IL-2 monoclonal antibody in tree shrews, thereby improving their utility as a model.

  7. Biochemical characterization and molecular evidence of a laccase from the bird's nest fungus Cyathus bulleri.

    PubMed

    Vasdev, Kavita; Dhawan, Shikha; Kapoor, Rajeev Kumar; Kuhad, Ramesh Chander

    2005-08-01

    Cyathus bulleri, a bird's nest fungus, known to decolorize polymeric dye Poly R-478, was found to produce 8 U ml(-1) of laccase in malt extract broth. Laccase activity appeared as a single band on non-denaturing gel. Laccase was purified to homogeneity by anion exchange chromatography and gel filtration. The enzyme was a monomer with an apparent molecular mass of 60 kD, pI of 3.7 and was stable in the pH range of 2-6 with an optimum pH of 5.2. The optimal reaction temperature was 45 degrees C and the enzyme lost its activity above 70 degrees C. Enzyme could oxidize a broad range of various phenolic substrates. K(m) values for ABTS, 2,6-dimethoxyphenol, guaiacol, and ferulic acid were found to be 48.6, 56, 22, and 14 mM while K(cat) values were 204, 180, 95.6, and 5.2, respectively. It was completely inhibited by KCN, NaN(3), beta-mercaptoethanol, HgCl(2), and SDS, while EDTA had no effect on enzyme activity. The N-terminal amino acid sequence of C. bulleri laccase showed close homology to N-terminal sequences of laccase from other white-rot fungi. A 150 bp gene sequence encoding copper-binding domains I and II was most similar to the sequence encoding a laccase from Pycnoporus cinnabarinus with 74.8% level of similarity.

  8. Isolation and sequencing of the gene encoding Sp23, a structural protein of spermatophore of the mealworm beetle, Tenebrio molitor.

    PubMed

    Feng, X; Happ, G M

    1996-11-14

    The cDNA for Sp23, a structural protein of the spermatophore of Tenebrio molitor, had been previously cloned and characterized (Paesen, G.C., Schwartz, M.B., Peferoen, M., Weyda, F. and Happ, G.M. (1992a) Amino acid sequence of Sp23, a structure protein of the spermatophore of the mealworm beetle, Tenebrio molitor. J. Biol. Chem. 257, 18852-18857). Using the labeled cDNA for Sp23 as a probe to screen a library of genomic DNA from Tenebrio molitor, we isolated a genomic clone for Sp23. A 5373-base pair (bp) restriction fragment containing the Sp23 gene was sequenced. The coding region is separated by a 55-bp intron which is located close to the translation start site. Three putative ecdysone response elements (EcRE) are identified in the 5' flanking region of the Sp23 gene. Comparison of the flanking regions of the Sp23 gene with those of the D-protein gene expressed in the accessory glands of Tenebrio reveals similar sequences present in the flanking regions of the two genes. The genomic organization of the coding region of the Sp23 gene shares similarities with that of the D-protein gene, three Drosophila accessory gland genes and two Drosophila 20-OH ecdysone-responsive genes.

  9. Electrospray ionization mass analysis of normal and genetic variants of human serum albumin.

    PubMed

    Brennan, S O

    1998-11-01

    Both normal albumin (Al A) and genetically modified forms were isolated from six heterozygous subjects. Albumins from each individual were analyzed by electrospray ionization mass spectrometry (ESI MS), and the mass was compared with that predicted from the protein sequence. In all cases, the Al A was heterogeneous, with components of mass (+/- SE) 66463+/-4, 66586+/-3, and 66718+/-5 Da. Each genetic variant showed similar heterogeneity. The mass increase in Al Casebrook (2214 Da) was very close to that predicted (2205 Da) from protein and carbohydrate sequence analysis, whereas the increase in Al Redhill (2378 Da) was close to that expected (2392 Da) for an Arg-albumin with a disialylated N-linked biantennary oligosaccharide and an Ala-->Thr mutation. The circulating proalbumins, Christchurch and Blenheim, had mass increases of 748 and 756 Da, respectively, over Al A; in excellent agreement with theoretical values of 744 and 756. Clear shifts in mass were also detected for the point substitutions 177Cys-->Phe (44 Da), 1Asp-->Val (20 Da), and Arg-albumin (160 Da).

  10. The Genome Sequence of Bacillus cereus ATCC 10987 Reveals Metabolic Adaptations and a Large Plasmid Related to Bacillus anthracis pXO1

    DTIC Science & Technology

    2004-01-01

    Flagellar genes Presentb Presentc Presentc Tagatose utilization genes Absent Present Partiald Functional PlcR Absente Presente Presente Mobile genetic...closely related and one that is divergent (Supplementary ®g. S3). dThere are similar tagatose utilization genes in B.cereus ATCC 14579; however, they...replacement responsible for the transport and utilization of the carbohydrate tagatose (BCE1896±BCE1912). The corres- ponding 5.0 kb region in

  11. Cloning of a cDNA encoding bovine mitochondrial NADP(+)-specific isocitrate dehydrogenase and structural comparison with its isoenzymes from different species.

    PubMed Central

    Huh, T L; Ryu, J H; Huh, J W; Sung, H C; Oh, I U; Song, B J; Veech, R L

    1993-01-01

    Mitochondrial NADP(+)-specific isocitrate dehydrogenase (IDP) was co-purified with the pyruvate dehydrogenase complex from bovine kidney mitochondria. The determination of its N-terminal 16-amino-acid sequence revealed that it is highly similar to the IDP from yeast. A cDNA clone (1.8 kb long) encoding this protein was isolated from a bovine kidney lambda gt11 cDNA library using a synthetic oligodeoxynucleotide. The deduced protein sequence of this cDNA clone rendered a precursor protein of 452 amino-acid residues (50,830 Da) and a mature protein of 413 amino-acid residues (46,519 Da). It is 100% identical to the internal tryptic peptide sequences of the autologous form from pig heart and 62% similar to that from yeast. However, it shares little similarity with the mitochondrial NAD(+)-specific isoenzyme from yeast. Structural analyses of the deduced proteins of IDP isoenzymes from different species indicated that similarity exists in certain regions, which may represent the common domains for the active sites or coenzyme-binding sites. In Northern-blot analysis, one species of mRNA (about 2.2 kb for both bovine and human) was hybridized with a 32P-labelled cDNA probe. Southern-blot analysis of genomic DNAs verified simple patterns of hybridization with this cDNA. These results strongly indicate that the mitochondrial IDP may be derived from a single gene family which does not appear to be closely related to that of the NAD(+)-specific isoenzyme. Images Figure 1 Figure 3 Figure 4 Figure 5 PMID:8318002

  12. Microbial Diversity of Groundwater from Deep Subsurface Environment

    NASA Astrophysics Data System (ADS)

    Lin, L.; Onstott, T. C.; Hall, J.

    2002-12-01

    The subsurface environment harbors one of the most abundant reservoirs of biomass on Earth. The distribution of microbial ecosystems and the diversity of microbial metabolisms there remained poorly understood due to lack of detailed sampling over three-dimensional space with extremely heterogeneous characteristics. South African Au mines, however, provide the best access in the world to various types of groundwater and rocks at depths up to 4 km below surface. In this study, we present our recent analyses of microbial community structure of groundwater (with residence time of several million years) collected from depths between 850 to 1500 mbsl of Beatrix Au mine, South Africa. Five groundwater samples were collected anaerobically from freshly drilling boreholes with flow rates of 1 to 38 L/min. Cells were concentrated through filtration and total DNA were extracted from filters and PCR-amplified with primers targeting 16S rDNA gene. The amplicons were cloned and digested with restriction enzymes to identify the unique clone type. Sequences were obtained through direct sequencing of representative clones and compared with the closest matching sequences deposited in the gene bank for the construction of phylogenetic tree. The archaeal signatures were only found in one sample and close to the lineage of methanosarcina. The most predominant ribotype was similar to the environmental clone found in the same mine under the species level while the rest of ribotypes were either close to those capable of methanogenesis from long-chain alkanes or found in rice field or were distant from other environmental clones reported in previous study (Takai et al., 2001). The bacterial community exhibited a wide range of diversity among samples. Most samples were dominated by sequences close to alpha proteobacteria with various proportions of beta, gamma proteobacteria and environmental clones. A significant proportion of sequences close to thermophilic delta proteobacteria and clostridia were observed from one of the deepest samples. Since the in-situ water or rock temperature at sampling location is below the temperature range for thermophilic bacteria, this might indicate that the microorganisms once colonizing in the deeper and hotter portion of crust were transported upward with hydrothermal fluid and preserved in the sealed water pocket for a time scale of millions of years.

  13. Thalassospira lucentensis gen. nov., sp. nov., a new marine member of the alpha-Proteobacteria.

    PubMed

    López-López, Arantxa; Pujalte, María J; Benlloch, Susana; Mata-Roig, Manuel; Rosselló-Mora, Ramón; Garay, Esperanza; Rodríguez-Valera, Francisco

    2002-07-01

    A novel bacterium from the Mediterranean Sea was isolated under oligotrophic conditions at in situ temperature after prolonged continuous culture. The isolates were initially characterized by partial 16S rRNA gene sequencing. Similarity searches of one of the isolates, QMT2T, indicated high sequence identity to the well-characterized Rhodospirillum rubrum, [Aquaspirillum] itersonii and [Oceanospirillum] pusillum micro-organisms, which are representatives of the alpha-subclass of the Proteobacteria. The highest level of similarity of the complete 165 rRNA gene with respect to these microorganisms was 89%. Features such as the low similarities of 165 rRNA of QMT2T with its phylogenetically close neighbours, the distinct G+C content, and the differences in phenotypic features, including pigmentation, fatty acid composition, salt tolerance, the lack of bacteriochlorophyll a, and the capacity to use carbohydrates as carbon sources, are indicative of the novel nature of the isolate QMT2T among the alpha-Proteobacteria. This report describes the classification of strain QMT2T (= DSM 14000T = CECT 5390T) as a new genus and species, Thalassospira lucentensis gen. nov, sp. nov., in the family Rhodospirillaceae.

  14. Prokaryotic phylogenetic diversity of Hungarian deep subsurface geothermal well waters.

    PubMed

    Németh, Andrea; Szirányi, Barbara; Krett, Gergely; Janurik, Endre; Kosáros, Tünde; Pekár, Ferenc; Márialigeti, Károly; Borsodi, Andrea K

    2014-09-01

    Geothermal wells characterized by thermal waters warmer than 30°C can be found in more than 65% of the area of Hungary. The examined thermal wells located nearby Szarvas are used for heating industrial and agricultural facilities because of their relatively high hydrocarbon content. The aim of this study was to reveal the prokaryotic community structure of the water of SZR18, K87 and SZR21 geothermal wells using molecular cloning methods and Denaturing Gradient Gel Electrophoresis (DGGE). Water samples from the outflow pipes were collected in 2012 and 2013. The phylogenetic distribution of archaeal molecular clones was very similar in each sample, the most abundant groups belonged to the genera Methanosaeta, Methanothermobacter and Thermofilum. In contrast, the distribution of bacterial molecular clones was very diverse. Many of them showed the closest sequence similarities to uncultured clone sequences from similar thermal environments. From the water of the SZR18 well, phylotypes closely related to genera Fictibacillus and Alicyclobacillus (Firmicutes) were only revealed, while the bacterial diversity of the K87 well water was much higher. Here, the members of the phyla Thermodesulfobacteria, Proteobacteria, Nitrospira, Chlorobi, OP1 and OPB7 were also detected besides Firmicutes.

  15. Genomic analysis of a new mammalian distal-less gene: Dlx7.

    PubMed

    Nakamura, S; Stock, D W; Wydner, K L; Bollekens, J A; Takeshita, K; Nagai, B M; Chiba, S; Kitamura, T; Freeland, T M; Zhao, Z; Minowada, J; Lawrence, J B; Weiss, K M; Ruddle, F H

    1996-12-15

    We have cloned a new Dlx gene (Dlx7) from human and mouse that may represent the mammalian orthologue of the newt gene NvHBox-5. The homeodomains of these genes are highly similar to all other vertebrate Dlx genes, and regions of similarity also exist between mammalian Dlx7 and a subset of vertebrate Dlx genes downstream of the homeodomain. The sequence divergence between human and mouse Dlx7 in these regions is greater than that predicted from comparisons of other vertebrate Dlx genes, however, and there is little sequence similarity upstream of the homeodomain both between these two genes and with other Dlx genes. We present evidence for alternative splicing of mouse Dlx7 upstream of the homeodomain that may account for some of this divergence. We have mapped human DLX7 distal to the 5' end of the HOXB cluster at an estimated distance of between 1 and 2 Mb by FISH. Both the human and the mouse Dlx7 are shown to be closely linked to Dlx3 in a convergently transcribed orientation. These mapping results support the possibility that vertebrate distal-less genes have been duplicated in concert with the Hox clusters.

  16. Closely related NDM-1-encoding plasmids from Escherichia coli and Klebsiella pneumoniae in Taiwan.

    PubMed

    Chen, Chao-Ju; Wu, Tsu-Lan; Lu, Po-Liang; Chen, Ying-Tsong; Fung, Chang-Phone; Chuang, Yin-Ching; Lin, Jung-Chung; Siu, L Kristopher

    2014-01-01

    Two plasmids carrying blaNDM-1 isolated from carbapenem-resistant Klebsiella pneumoniae (CR-KP) and carbapenem-resistant Escherichia coli (CR-EC) were sequenced. CR-KP and CR-EC were isolated from two Taiwanese patients without travel histories. Complete sequencing of the plasmids (pLK75 and pLK78) was conducted using a shotgun approach. Annotation of the contigs was performed using the RAST Server, followed by manual inspection and correction. These similar plasmids were obtained from two patients with overlapping stays at the same hospital. The pLK75 and pLK78 plasmids were 56,489-bp and 56,072-bp in length, respectively. Plasmid annotation revealed a common backbone similar to the IncN plasmid pR46. The regions flanking the blaNDM-1 genes in these plasmids were very similar to plasmid pNDM-HU01 in Japan, which contains a complex class 1 integron located next to an ISCR1 element. The ISCR1 element has been suggested to provide a powerful mechanism for mobilising antibiotic resistance genes. Two indigenous NDM-1-producing Enterobacteriaceae cases were identified for the first time in Taiwan, highlighting the alarming introduction of NDM-1-producing Enterobacteriaceae in this region.

  17. Streptomyces atlanticus sp. nov., a novel actinomycete isolated from marine sponge Aplysina fulva (Pallas, 1766).

    PubMed

    Silva, Fábio Sérgio Paulino; Souza, Danilo Tosta; Zucchi, Tiago Domingues; Pansa, Camila Cristiane; de Figueiredo Vasconcellos, Rafael Leandro; Crevelin, Eduardo José; de Moraes, Luiz Alberto Beraldo; Melo, Itamar Soares

    2016-11-01

    The taxonomic position of a novel marine actinomycete isolated from a marine sponge, Aplysina fulva, which had been collected in the Archipelago of Saint Peter and Saint Paul (Equatorial Atlantic Ocean), was determined by using a polyphasic approach. The organism showed a combination of morphological and chemotaxonomic characteristics consistent with its classification in the genus Streptomyces and forms a distinct branch within the Streptomyces somaliensis 16S rRNA gene tree subclade. It is closely related to Streptomyces violascens ISP 5183 T (97.27 % 16S rRNA gene sequence similarity) and Streptomyces hydrogenans NBRC 13475 T (97.15 % 16S rRNA gene sequence similarity). The 16S rRNA gene similarities between the isolate and the remaining members of the subclade are lower than 96.77 %. The organism can be distinguished readily from other members of the S. violacens subclade using a combination of phenotypic properties. On the basis of these results, it is proposed that isolate 103 T (=NRRL B-65309 T  = CMAA 1378 T ) merits recognition as the type strain of a new Streptomyces species, namely Streptomyces atlanticus sp. nov.

  18. West Nile virus, Anopheles flavivirus, a novel flavivirus as well as Merida-like rhabdovirus Turkey in field-collected mosquitoes from Thrace and Anatolia.

    PubMed

    Öncü, Ceren; Brinkmann, Annika; Günay, Filiz; Kar, Sırrı; Öter, Kerem; Sarıkaya, Yasemen; Nitsche, Andreas; Linton, Yvonne-Marie; Alten, Bülent; Ergünay, Koray

    2018-01-01

    Mosquitoes are involved in the transmission and maintenance of several viral diseases with significant health impact. Biosurveillance efforts have also revealed insect-specific viruses, observed to cocirculate with pathogenic strains. This report describes the findings of flavivirus and rhabdovirus screening, performed in eastern Thrace and Aegean region of Anatolia during 2016, including and expanding on locations with previously-documented virus activity. A mosquito cohort of 1545 individuals comprising 14 species were collected and screened in 108 pools via generic and specific amplification and direct metagenomics by next generation sequencing. Seven mosquito pools (6.4%) were positive in the flavivirus screening. West Nile virus lineage 1 clade 1a sequences were characterized in a pool Culex pipiens sensu lato specimens, providing the initial virus detection in Aegean region following 2010 outbreak. In an Anopheles maculipennis sensu lato pool, sequences closely-related to Anopheles flaviviruses were obtained, with similarities to several African and Australian strains of this new insect-specific flavivirus clade. In pools comprising Uranotaenia unguiculata (n=3), Cx. pipiens s.l. (n=1) and Aedes caspius (n=1) mosquitoes, sequences of a novel flavivirus, distantly-related to Flavivirus AV2011, identified previously in Spain and Turkey, were characterized. Moreover, DNA forms of the novel flavivirus were detected in two Ur. unguiculata pools. These sequences were highly-similar to the sequences amplified from viral RNA, with undisrupted reading frames, suggest the occurrence of viral DNA forms in natural conditions within mosquito hosts. Rhabdovirus screening revealed sequences of a recently-described novel virus, named the Merida-like virus Turkey (MERDLVT) in 5 Cx. pipiens s.l. pools (4.6%). Partial L and N gene sequences of MERDLVT were well-conserved among strains, with evidence for geographical clustering in phylogenetic analyses. Metagenomics provided the near-full genomic sequence in a specimen, revealing an identical genome organization and limited divergence from the prototype MERDLVT isolate. Copyright © 2017 Elsevier B.V. All rights reserved.

  19. Analysis of intra-host genetic diversity of Prunus necrotic ringspot virus (PNRSV) using amplicon next generation sequencing.

    PubMed

    Kinoti, Wycliff M; Constable, Fiona E; Nancarrow, Narelle; Plummer, Kim M; Rodoni, Brendan

    2017-01-01

    PCR amplicon next generation sequencing (NGS) analysis offers a broadly applicable and targeted approach to detect populations of both high- or low-frequency virus variants in one or more plant samples. In this study, amplicon NGS was used to explore the diversity of the tripartite genome virus, Prunus necrotic ringspot virus (PNRSV) from 53 PNRSV-infected trees using amplicons from conserved gene regions of each of PNRSV RNA1, RNA2 and RNA3. Sequencing of the amplicons from 53 PNRSV-infected trees revealed differing levels of polymorphism across the three different components of the PNRSV genome with a total number of 5040, 2083 and 5486 sequence variants observed for RNA1, RNA2 and RNA3 respectively. The RNA2 had the lowest diversity of sequences compared to RNA1 and RNA3, reflecting the lack of flexibility tolerated by the replicase gene that is encoded by this RNA component. Distinct PNRSV phylo-groups, consisting of closely related clusters of sequence variants, were observed in each of PNRSV RNA1, RNA2 and RNA3. Most plant samples had a single phylo-group for each RNA component. Haplotype network analysis showed that smaller clusters of PNRSV sequence variants were genetically connected to the largest sequence variant cluster within a phylo-group of each RNA component. Some plant samples had sequence variants occurring in multiple PNRSV phylo-groups in at least one of each RNA and these phylo-groups formed distinct clades that represent PNRSV genetic strains. Variants within the same phylo-group of each Prunus plant sample had ≥97% similarity and phylo-groups within a Prunus plant sample and between samples had less ≤97% similarity. Based on the analysis of diversity, a definition of a PNRSV genetic strain was proposed. The proposed definition was applied to determine the number of PNRSV genetic strains in each of the plant samples and the complexity in defining genetic strains in multipartite genome viruses was explored.

  20. Alt a 1 allergen homologs from Alternaria and related taxa: analysis of phylogenetic content and secondary structure.

    PubMed

    Hong, Soon Gyu; Cramer, Robert A; Lawrence, Christopher B; Pryor, Barry M

    2005-02-01

    A gene for the Alternaria major allergen, Alt a 1, was amplified from 52 species of Alternaria and related genera, and sequence information was used for phylogenetic study. Alt a 1 gene sequences evolved 3.8 times faster and contained 3.5 times more parsimony-informative sites than glyceraldehyde-3-phosphate dehydrogenase (gpd) sequences. Analyses of Alt a 1 gene and gpd exon sequences strongly supported grouping of Alternaria spp. and related taxa into several species-groups described in previous studies, especially the infectoria, alternata, porri, brassicicola, and radicina species-groups and the Embellisia group. The sonchi species-group was newly suggested in this study. Monophyly of the Nimbya group was moderately supported, and monophyly of the Ulocladium group was weakly supported. Relationships among species-groups and among closely related species of the same species-group were not fully resolved. However, higher resolution could be obtained using Alt a 1 sequences or a combined dataset than using gpd sequences alone. Despite high levels of variation in amino acid sequences, results of in silico prediction of protein secondary structure for Alt a 1 demonstrated a high degree of structural similarity for most of the species suggesting a conservation of function.

  1. The Alveolate Perkinsus marinus: Biological Insights from EST Gene Discovery

    PubMed Central

    2010-01-01

    Background Perkinsus marinus, a protozoan parasite of the eastern oyster Crassostrea virginica, has devastated natural and farmed oyster populations along the Atlantic and Gulf coasts of the United States. It is classified as a member of the Perkinsozoa, a recently established phylum considered close to the ancestor of ciliates, dinoflagellates, and apicomplexans, and a key taxon for understanding unique adaptations (e.g. parasitism) within the Alveolata. Despite intense parasite pressure, no disease-resistant oysters have been identified and no effective therapies have been developed to date. Results To gain insight into the biological basis of the parasite's virulence and pathogenesis mechanisms, and to identify genes encoding potential targets for intervention, we generated >31,000 5' expressed sequence tags (ESTs) derived from four trophozoite libraries generated from two P. marinus strains. Trimming and clustering of the sequence tags yielded 7,863 unique sequences, some of which carry a spliced leader. Similarity searches revealed that 55% of these had hits in protein sequence databases, of which 1,729 had their best hit with proteins from the chromalveolates (E-value ≤ 1e-5). Some sequences are similar to those proven to be targets for effective intervention in other protozoan parasites, and include not only proteases, antioxidant enzymes, and heat shock proteins, but also those associated with relict plastids, such as acetyl-CoA carboxylase and methyl erythrithol phosphate pathway components, and those involved in glycan assembly, protein folding/secretion, and parasite-host interactions. Conclusions Our transcriptome analysis of P. marinus, the first for any member of the Perkinsozoa, contributes new insight into its biology and taxonomic position. It provides a very informative, albeit preliminary, glimpse into the expression of genes encoding functionally relevant proteins as potential targets for chemotherapy, and evidence for the presence of a relict plastid. Further, although P. marinus sequences display significant similarity to those from both apicomplexans and dinoflagellates, the presence of trans-spliced transcripts confirms the previously established affinities with the latter. The EST analysis reported herein, together with the recently completed sequence of the P. marinus genome and the development of transfection methodology, should result in improved intervention strategies against dermo disease. PMID:20374649

  2. Variability and genetic structure of the population of watermelon mosaic virus infecting melon in Spain.

    PubMed

    Moreno, I M; Malpica, J M; Díaz-Pendón, J A; Moriones, E; Fraile, A; García-Arenal, F

    2004-01-05

    The genetic structure of the population of Watermelon mosaic virus (WMV) in Spain was analysed by the biological and molecular characterisation of isolates sampled from its main host plant, melon. The population was a highly homogeneous one, built of a single pathotype, and comprising isolates closely related genetically. There was indication of temporal replacement of genotypes, but not of spatial structure of the population. Analyses of nucleotide sequences in three genomic regions, that is, in the cistrons for the P1, cylindrical inclusion (CI) and capsid (CP) proteins, showed lower similar values of nucleotide diversity for the P1 than for the CI or CP cistrons. The CI protein and the CP were under tighter evolutionary constraints than the P1 protein. Also, for the CI and CP cistrons, but not for the P1 cistron, two groups of sequences, defining two genetic strains, were apparent. Thus, different genomic regions of WMV show different evolutionary dynamics. Interestingly, for the CI and CP cistrons, sequences were clustered into two regions of the sequence space, defining the two strains above, and no intermediary sequences were identified. Recombinant isolates were found, accounting for at least 7% of the population. These recombinants presented two interesting features: (i) crossover points were detected between the analysed regions in the CI and CP cistrons, but not between those in the P1 and CI cistrons, (ii) crossover points were not observed within the analysed coding regions for the P1, CI or CP proteins. This indicates strong selection against isolates with recombinant proteins, even when originated from closely related strains. Hence, data indicate that genotypes of WMV, generated by mutation or recombination, outside of acceptable, discrete, regions in the evolutionary space, are eliminated from the virus population by negative selection.

  3. Combinatorial events of insertion sequences and ICE in Gram-negative bacteria.

    PubMed

    Toleman, Mark A; Walsh, Timothy R

    2011-09-01

    The emergence of antibiotic and antimicrobial resistance in Gram-negative bacteria is incremental and linked to genetic elements that function in a so-called 'one-ended transposition' manner, including ISEcp1, ISCR elements and Tn3-like transposons. The power of these elements lies in their inability to consistently recognize one of their own terminal sequences, while recognizing more genetically distant surrogate sequences. This has the effect of mobilizing the DNA sequence found adjacent to their initial location. In general, resistance in Gram-negatives is closely linked to a few one-off events. These include the capture of the class 1 integron by a Tn5090-like transposon; the formation of the 3' conserved segment (3'-CS); and the fusion of the ISCR1 element to the 3'-CS. The structures formed by these rare events have been massively amplified and disseminated in Gram-negative bacteria, but hitherto, are rarely found in Gram-positives. Such events dominate current resistance gene acquisition and are instrumental in the construction of large resistance gene islands on chromosomes and plasmids. Similar combinatorial events appear to have occurred between conjugative plasmids and phages constructing hybrid elements called integrative and conjugative elements or conjugative transposons. These elements are beginning to be closely linked to some of the more powerful resistance mechanisms such as the extended spectrum β-lactamases, metallo- and AmpC type β-lactamases. Antibiotic resistance in Gram-negative bacteria is dominated by unusual combinatorial mistakes of Insertion sequences and gene fusions which have been selected and amplified by antibiotic pressure enabling the formation of extended resistance islands. © 2011 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

  4. Drosophila Nora virus capsid proteins differ from those of other picorna-like viruses.

    PubMed

    Ekström, Jens-Ola; Habayeb, Mazen S; Srivastava, Vaibhav; Kieselbach, Thomas; Wingsle, Gunnar; Hultmark, Dan

    2011-09-01

    The recently discovered Nora virus from Drosophila melanogaster is a single-stranded RNA virus. Its published genomic sequence encodes a typical picorna-like cassette of replicative enzymes, but no capsid proteins similar to those in other picorna-like viruses. We have now done additional sequencing at the termini of the viral genome, extending it by 455 nucleotides at the 5' end, but no more coding sequence was found. The completeness of the final 12,333-nucleotide sequence was verified by the production of infectious virus from the cloned genome. To identify the capsid proteins, we purified Nora virus particles and analyzed their proteins by mass spectrometry. Our results show that the capsid is built from three major proteins, VP4A, B and C, encoded in the fourth open reading frame of the viral genome. The viral particles also contain traces of a protein from the third open reading frame, VP3. VP4A and B are not closely related to other picorna-like virus capsid proteins in sequence, but may form similar jelly roll folds. VP4C differs from the others and is predicted to have an essentially α-helical conformation. In a related virus, identified from EST database sequences from Nasonia parasitoid wasps, VP4C is encoded in a separate open reading frame, separated from VP4A and B by a frame-shift. This opens a possibility that VP4C is produced in non-equimolar quantities. Altogether, our results suggest that the Nora virus capsid has a different protein organization compared to the order Picornavirales. Copyright © 2011 Elsevier B.V. All rights reserved.

  5. Genomic, proteomic and bioinformatic analysis of two temperate phages in Roseobacter clade bacteria isolated from the deep-sea water.

    PubMed

    Tang, Kai; Lin, Dan; Zheng, Qiang; Liu, Keshao; Yang, Yujie; Han, Yu; Jiao, Nianzhi

    2017-06-27

    Marine phages are spectacularly diverse in nature. Dozens of roseophages infecting members of Roseobacter clade bacteria were isolated and characterized, exhibiting a very high degree of genetic diversity. In the present study, the induction of two temperate bacteriophages, namely, vB_ThpS-P1 and vB_PeaS-P1, was performed in Roseobacter clade bacteria isolated from the deep-sea water, Thiobacimonas profunda JLT2016 and Pelagibaca abyssi JLT2014, respectively. Two novel phages in morphological, genomic and proteomic features were presented, and their phylogeny and evolutionary relationships were explored by bioinformatic analysis. Electron microscopy showed that the morphology of the two phages were similar to that of siphoviruses. Genome sequencing indicated that the two phages were similar in size, organization, and content, thereby suggesting that these shared a common ancestor. Despite the presence of Mu-like phage head genes, the phages are more closely related to Rhodobacter phage RC1 than Mu phages in terms of gene content and sequence similarity. Based on comparative genomic and phylogenetic analysis, we propose a Mu-like head phage group to allow for the inclusion of Mu-like phages and two newly phages. The sequences of the Mu-like head phage group were widespread, occurring in each investigated metagenomes. Furthermore, the horizontal exchange of genetic material within the Mu-like head phage group might have involved a gene that was associated with phage phenotypic characteristics. This study is the first report on the complete genome sequences of temperate phages that infect deep-sea roseobacters, belonging to the Mu-like head phage group. The Mu-like head phage group might represent a small but ubiquitous fraction of marine viral diversity.

  6. High-Throughput Identification and Screening of Novel Methylobacterium Species Using Whole-Cell MALDI-TOF/MS Analysis

    PubMed Central

    Tani, Akio; Sahin, Nurettin; Matsuyama, Yumiko; Enomoto, Takashi; Nishimura, Naoki; Yokota, Akira; Kimbara, Kazuhide

    2012-01-01

    Methylobacterium species are ubiquitous α-proteobacteria that reside in the phyllosphere and are fed by methanol that is emitted from plants. In this study, we applied whole-cell matrix-assisted laser desorption/ionization time-of-flight mass spectrometry analysis (WC-MS) to evaluate the diversity of Methylobacterium species collected from a variety of plants. The WC-MS spectrum was reproducible through two weeks of cultivation on different media. WC-MS spectrum peaks of M. extorquens strain AM1 cells were attributed to ribosomal proteins, but those were not were also found. We developed a simple method for rapid identification based on spectra similarity. Using all available type strains of Methylobacterium species, the method provided a certain threshold similarity value for species-level discrimination, although the genus contains some type strains that could not be easily discriminated solely by 16S rRNA gene sequence similarity. Next, we evaluated the WC-MS data of approximately 200 methylotrophs isolated from various plants with MALDI Biotyper software (Bruker Daltonics). Isolates representing each cluster were further identified by 16S rRNA gene sequencing. In most cases, the identification by WC-MS matched that by sequencing, and isolates with unique spectra represented possible novel species. The strains belonging to M. extorquens, M. adhaesivum, M. marchantiae, M. komagatae, M. brachiatum, M. radiotolerans, and novel lineages close to M. adhaesivum, many of which were isolated from bryophytes, were found to be the most frequent phyllospheric colonizers. The WC-MS technique provides emerging high-throughputness in the identification of known/novel species of bacteria, enabling the selection of novel species in a library and identification without 16S rRNA gene sequencing. PMID:22808262

  7. Patterns of genetic diversity in Hepatozoon spp. infecting snakes from North Africa and the Mediterranean Basin.

    PubMed

    Tomé, Beatriz; Maia, João P; Salvi, Daniele; Brito, José C; Carretero, Miguel A; Perera, Ana; Meimberg, Harald; Harris, David James

    2014-03-01

    Species of Hepatozoon Miller, 1908 are blood parasites most commonly found in snakes but some have been described from all tetrapod groups and a wide variety of hematophagous invertebrates. Previous studies have suggested possible associations between Hepatozoon spp. found in predators and prey. Particularly, some saurophagous snakes from North Africa and the Mediterranean region have been found to be infected with Hepatozoon spp. similar to those of various sympatric lizard hosts. In this study, we have screened tissue samples of 111 North African and Mediterranean snakes, using specific primers for the 18S rRNA gene. In the phylogenetic analysis, the newly-generated Hepatozoon spp. sequences grouped separately into five main clusters. Three of these clusters were composed by Hepatozoon spp. also found in snakes and other reptiles from the Mediterranean Basin and North Africa. In the other two clusters, the new sequences were not closely related to geographically proximate known sequences. The phylogeny of Hepatozoon spp. inferred here was not associated with intermediate host taxonomy or geographical distribution. From the other factors that could explain these evolutionary patterns, the most likely seems series of intermediate hosts providing similar ribotypes of Hepatozoon and a high prevalence of host shifts for Hepatozoon spp. This is indicated by ribotypes of high similarity found in different reptile families, as well as by divergent ribotypes found in the same host species. This potentially low host specificity has profound implications for the systematics of Hepatozoon spp.

  8. Ursidibacter maritimus gen. nov., sp. nov. and Ursidibacter arcticus sp. nov., two new members of the family Pasteurellaceae isolated from the oral cavity of bears.

    PubMed

    Johanne Hansen, Mie; Strøm Braaten, Mira; Miki Bojesen, Anders; Christensen, Henrik; Sonne, Christian; Dietz, Rune; Frost Bertelsen, Mads

    2015-10-01

    Thirty-three suspected strains of the family Pasteurellaceae isolated from the oral cavity of polar and brown bears were characterized by genotypic and phenotypic tests. Phylogenetic analysis of partial 16S rRNA gene and rpoB sequences showed that the investigated isolates formed two closely related monophyletic groups, representing two novel species of a new genus. Based on 16S rRNA gene sequence comparison Bibersteinia trehalosi was the closest related species with a validly published name, with 95.4 % similarity to the polar bear group and 94.4 % similarity to the brown bear group. Otariodibacter oris was the closest related species based on rpoB sequence comparison with a similarity of 89.8 % with the polar bear group and 90 % with the brown bear group. The new genus could be separated from existing genera of the family Pasteurellaceae by three to ten phenotypic characters, and the two novel species could be separated from each other by two phenotypic characters. It is proposed that the strains should be classified as representatives of a new genus, Ursidibacter gen. nov., with two novel species: the type species Ursidibacter maritimus sp. nov., isolated from polar bears (type strain Pb43106T = CCUG 65144T = DSM 28137T, DNA G+C content 39.3 mol%), and Ursidibacter arcticus sp. nov., isolated from brown bears (type strain Bamse61T = CCUG 65145T = DSM 28138T).

  9. Streptomyces lasiicapitis sp. nov., an actinomycete that produces kanchanamycin, isolated from the head of an ant (Lasius fuliginosus L.).

    PubMed

    Ye, Lan; Zhao, Shanshan; Li, Yao; Jiang, Shanwen; Zhao, Yue; Li, Jinmeng; Yan, Kai; Wang, Xiangjing; Xiang, Wensheng; Liu, Chongxi

    2017-05-01

    During a screening for novel and biotechnologically useful actinobacteria in insects, a kanchanamycin-producing actinomycete with antifungal activity, designated strain 3H-HV17(2)T, was isolated from the head of an ant (Lasius fuliginosus L.) and characterized using a polyphasic approach. 16S rRNA gene sequence similarity studies showed that strain 3H-HV17(2)T belongs to the genus Streptomyces with the highest sequence similarities to Streptomyces spectabilis NBRC 13424T (98.90 %, with which it phylogenetically clustered, Streptomyces alboflavus NRRL B-2373T (98.65 %) and Streptomyces flavofungini NBRC 13371T (98.36 %). Phylogenetic analysis based on the gyrB gene also supported the close relationship of these strains. The morphological and chemotaxonomic properties of the strain are also consistent with those members of the genus Streptomyces. A combination of DNA-DNA hybridization experiments and phenotypic tests were carried out between strain 3H-HV17(2)T and its phylogenetically closely related strains, which further clarified their relatedness and demonstrated that strain 3H-HV17(2)T could be distinguished from these strains. Therefore, strain 3H-HV17(2)T is concluded to represent a novel species of the genus Streptomyces, for which the name Streptomyces lasiicapitis sp. nov. is proposed. The type strain is 3H-HV17(2)T (=CGMCC 4.7349T=DSM 103124T).

  10. Intricate interactions between the bloom-forming cyanobacterium Microcystis aeruginosa and foreign genetic elements, revealed by diversified clustered regularly interspaced short palindromic repeat (CRISPR) signatures.

    PubMed

    Kuno, Sotaro; Yoshida, Takashi; Kaneko, Takakazu; Sako, Yoshihiko

    2012-08-01

    Clustered regularly interspaced short palindromic repeats (CRISPR) confer sequence-dependent, adaptive resistance in prokaryotes against viruses and plasmids via incorporation of short sequences, called spacers, derived from foreign genetic elements. CRISPR loci are thus considered to provide records of past infections. To describe the host-parasite (i.e., cyanophages and plasmids) interactions involving the bloom-forming freshwater cyanobacterium Microcystis aeruginosa, we investigated CRISPR in four M. aeruginosa strains and in two previously sequenced genomes. The number of spacers in each locus was larger than the average among prokaryotes. All spacers were strain specific, except for a string of 11 spacers shared in two closely related strains, suggesting diversification of the loci. Using CRISPR repeat-based PCR, 24 CRISPR genotypes were identified in a natural cyanobacterial community. Among 995 unique spacers obtained, only 10 sequences showed similarity to M. aeruginosa phage Ma-LMM01. Of these, six spacers showed only silent or conservative nucleotide mutations compared to Ma-LMM01 sequences, suggesting a strategy by the cyanophage to avert CRISPR immunity dependent on nucleotide identity. These results imply that host-phage interactions can be divided into M. aeruginosa-cyanophage combinations rather than pandemics of population-wide infectious cyanophages. Spacer similarity also showed frequent exposure of M. aeruginosa to small cryptic plasmids that were observed only in a few strains. Thus, the diversification of CRISPR implies that M. aeruginosa has been challenged by diverse communities (almost entirely uncharacterized) of cyanophages and plasmids.

  11. Intricate Interactions between the Bloom-Forming Cyanobacterium Microcystis aeruginosa and Foreign Genetic Elements, Revealed by Diversified Clustered Regularly Interspaced Short Palindromic Repeat (CRISPR) Signatures

    PubMed Central

    Kuno, Sotaro; Kaneko, Takakazu; Sako, Yoshihiko

    2012-01-01

    Clustered regularly interspaced short palindromic repeats (CRISPR) confer sequence-dependent, adaptive resistance in prokaryotes against viruses and plasmids via incorporation of short sequences, called spacers, derived from foreign genetic elements. CRISPR loci are thus considered to provide records of past infections. To describe the host-parasite (i.e., cyanophages and plasmids) interactions involving the bloom-forming freshwater cyanobacterium Microcystis aeruginosa, we investigated CRISPR in four M. aeruginosa strains and in two previously sequenced genomes. The number of spacers in each locus was larger than the average among prokaryotes. All spacers were strain specific, except for a string of 11 spacers shared in two closely related strains, suggesting diversification of the loci. Using CRISPR repeat-based PCR, 24 CRISPR genotypes were identified in a natural cyanobacterial community. Among 995 unique spacers obtained, only 10 sequences showed similarity to M. aeruginosa phage Ma-LMM01. Of these, six spacers showed only silent or conservative nucleotide mutations compared to Ma-LMM01 sequences, suggesting a strategy by the cyanophage to avert CRISPR immunity dependent on nucleotide identity. These results imply that host-phage interactions can be divided into M. aeruginosa-cyanophage combinations rather than pandemics of population-wide infectious cyanophages. Spacer similarity also showed frequent exposure of M. aeruginosa to small cryptic plasmids that were observed only in a few strains. Thus, the diversification of CRISPR implies that M. aeruginosa has been challenged by diverse communities (almost entirely uncharacterized) of cyanophages and plasmids. PMID:22636003

  12. Multiple ice-binding proteins of probable prokaryotic origin in an Antarctic lake alga, Chlamydomonas sp. ICE-MDV (Chlorophyceae).

    PubMed

    Raymond, James A; Morgan-Kiss, Rachael

    2017-08-01

    Ice-associated algae produce ice-binding proteins (IBPs) to prevent freezing damage. The IBPs of the three chlorophytes that have been examined so far share little similarity across species, making it likely that they were acquired by horizontal gene transfer (HGT). To clarify the importance and source of IBPs in chlorophytes, we sequenced the IBP genes of another Antarctic chlorophyte, Chlamydomonas sp. ICE-MDV (Chlamy-ICE). Genomic DNA and total RNA were sequenced and screened for known ice-associated genes. Chlamy-ICE has as many as 50 IBP isoforms, indicating that they have an important role in survival. The IBPs are of the DUF3494 type and have similar exon structures. The DUF3494 sequences are much more closely related to prokaryotic sequences than they are to sequences in other chlorophytes, and the chlorophyte IBP and ribosomal 18S phylogenies are dissimilar. The multiple IBP isoforms found in Chlamy-ICE and other algae may allow the algae to adapt to a greater variety of ice conditions than prokaryotes, which typically have a single IBP gene. The predicted structure of the DUF3494 domain has an ice-binding face with an orderly array of hydrophilic side chains. The results indicate that Chlamy-ICE acquired its IBP genes by HGT in a single event. The acquisitions of IBP genes by this and other species of Antarctic algae by HGT appear to be key evolutionary events that allowed algae to extend their ranges into polar environments. © 2017 Phycological Society of America.

  13. Characterization of Chemosynthetic Microbial Mats Associated with Intertidal Hydrothermal Sulfur Vents in White Point, San Pedro, CA, USA

    PubMed Central

    Miranda, Priscilla J.; McLain, Nathan K.; Hatzenpichler, Roland; Orphan, Victoria J.; Dillon, Jesse G.

    2016-01-01

    The shallow-sea hydrothermal vents at White Point (WP) in Palos Verdes on the southern California coast support microbial mats and provide easily accessed settings in which to study chemolithoautotrophic sulfur cycling. Previous studies have cultured sulfur-oxidizing bacteria from the WP mats; however, almost nothing is known about the in situ diversity and activity of the microorganisms in these habitats. We studied the diversity, micron-scale spatial associations and metabolic activity of the mat community via sequence analysis of 16S rRNA and aprA genes, fluorescence in situ hybridization (FISH) microscopy and sulfate reduction rate (SRR) measurements. Sequence analysis revealed a diverse group of bacteria, dominated by sulfur cycling gamma-, epsilon-, and deltaproteobacterial lineages such as Marithrix, Sulfurovum, and Desulfuromusa. FISH microscopy suggests a close physical association between sulfur-oxidizing and sulfur-reducing genotypes, while radiotracer studies showed low, but detectable, SRR. Comparative 16S rRNA gene sequence analyses indicate the WP sulfur vent microbial mat community is similar, but distinct from other hydrothermal vent communities representing a range of biotopes and lithologic settings. These findings suggest a complete biological sulfur cycle is operating in the WP mat ecosystem mediated by diverse bacterial lineages, with some similarity with deep-sea hydrothermal vent communities. PMID:27512390

  14. Antimicrobial activities of novel cultivable bacteria isolated from marine sponge Tedania anhelans

    NASA Astrophysics Data System (ADS)

    Zeng, Zhen; Zhao, Jing; Ke, Caihuan; Wang, Dexiang

    2013-05-01

    Marine sponge Tedania anhelans distributes throughout the intertidal zone of Fujian, southeastern China, and is a potential source of natural bioactive products. The sponge harbors a large number of bacterial groups that have been identified using various techniques, including fluorescent in situ hybridization (FISH). Fractionation of dissociated sponge allowed isolation of 25 bacterial species. Based on 16S rRNA gene sequencing, phylogenetic analysis attributed most of these eubacteria to α- Proteobacteria, γ- Proteobacteria, Cytophaga / Flavobacterium / Bacteroidetes (CFB group), and the family Bacillaceae of Gram-positive bacteria. In sequence similarity, five putatively novel species were identified with less than 98% similarity to other strains in the NCBI database. Tests for antimicrobial activities were performed against Gram-positive bacteria, Gram-negative bacteria, fungi, antitumor indicators Escherichia coli 343/591 (with DNA repair deficiency), regular E. coli 343/636 (with different DNA repair capacity), and 10 bacterial isolates exhibited inhibitory bioactivities. Among these strains, three isolates were detected involving function gene NRPS-A domains, which were most closely related to the amino acid sequences of linear gramicidin synthetase and pyoverdine synthetase. These results contribute to our knowledge of the microbes associated with marine sponges and further reveal novel bacterial resources for the screening of bioactive marine natural products.

  15. Transfer of Bacillus halodenitrificans Denariaz et al. 1989 to the genus Virgibacillus as Virgibacillus halodenitrificans comb. nov.

    PubMed

    Yoon, Jung-Hoon; Oh, Tae-Kwang; Park, Yong-Ha

    2004-11-01

    A Gram-variable, endospore-forming moderately halophilic rod, strain SF-121, was isolated from a marine solar saltern of the Yellow Sea in Korea. The result of 16S rRNA gene sequence analysis showed that strain SF-121 has highest sequence similarity (99.7 %) with the type strain of Bacillus halodenitrificans. Phylogenetic analyses based on 16S rRNA gene sequences revealed that B. halodenitrificans DSM 10037(T) and strain SF-121 are more closely related to the genus Virgibacillus than to the genus Bacillus. Strain SF-121 and B. halodenitrificans DSM 10037(T) exhibited 16S rRNA gene similarity levels of 95.3-97.5 % with the type strains of Virgibacillus species and 94.0 % with the type strain of Bacillus subtilis. DNA-DNA relatedness and phenotypic data indicated that B. halodenitrificans DSM 10037(T) and strain SF-121 are members of the same species. B. halodenitrificans DSM 10037(T) and strain SF-121 exhibited DNA-DNA relatedness values of 9-11 % with the type strains of Virgibacillus carmonensis and Virgibacillus marismortui. On the basis of the phenotypic, chemotaxonomic, phylogenetic and genetic data, B. halodenitrificans should be reclassified in the genus Virgibacillus as Virgibacillus halodenitrificans comb. nov.

  16. Multi locus sequence analysis and symbiotic characterization of novel Ensifer strains nodulating Tephrosia spp. in the Indian Thar Desert.

    PubMed

    Tak, Nisha; Awasthi, Esha; Bissa, Garima; Meghwal, Raju Ram; James, Euan K; Sprent, Janet S; Gehlot, Hukam S

    2016-12-01

    Phylogenetically diverse Ensifer strains associated with five species of Tephrosia growing in alkaline soils of semi-arid regions of the Thar Desert were characterized using multi locus sequence analysis. Based on 16S rRNA and four protein-coding housekeeping gene (recA, atpD, glnII and dnaK) sequences, the Tephrosia-Ensifer strains were genetically different from the type strains of Ensifer saheli, Ensifer kostiensis, Ensifer terangae (African origin) and Ensifer psoraleae (Asiatic origin). One strain, Ensifer sp. TL4, showed maximum similarity (99%) to Ensifer adhaerens LMG 20216 T and formed a separate lineage close to it. Phylogenetic incongruence between sym and housekeeping genes was observed. The monophyletic origin of symbiotic genes from Asia in the Tephrosia-Ensifer strains from the Thar Desert suggests that they might have been acquired from a common ancestor and horizontally transferred. These novel strains are promiscuous, cross-nodulating some papilionoid crop species, mimosoid trees and the caesalpinioid Chamaecrista pumila. This study improves understanding of the distribution of Ensifer in unexplored and threatened alkaline arid regions of the Thar Desert and how this relates to other similar regions in the world. Copyright © 2016 Elsevier GmbH. All rights reserved.

  17. A family of long intergenic non-coding RNA genes in human chromosomal region 22q11.2 carry a DNA translocation breakpoint/AT-rich sequence

    PubMed Central

    2018-01-01

    FAM230C, a long intergenic non-coding RNA (lincRNA) gene in human chromosome 13 (chr13) is a member of lincRNA genes termed family with sequence similarity 230. An analysis using bioinformatics search tools and alignment programs was undertaken to determine properties of FAM230C and its related genes. Results reveal that the DNA translocation element, the Translocation Breakpoint Type A (TBTA) sequence, which consists of satellite DNA, Alu elements, and AT-rich sequences is embedded in the FAM230C gene. Eight lincRNA genes related to FAM230C also carry the TBTA sequences. These genes were formed from a large segment of the 3’ half of the FAM230C sequence duplicated in chr22, and are specifically in regions of low copy repeats (LCR22)s, in or close to the 22q.11.2 region. 22q11.2 is a chromosomal segment that undergoes a high rate of DNA translocation and is prone to genetic deletions. FAM230C-related genes present in other chromosomes do not carry the TBTA motif and were formed from the 5’ half region of the FAM230C sequence. These findings identify a high specificity in lincRNA gene formation by gene sequence duplication in different chromosomes. PMID:29668722

  18. The Complete Genomic Sequence of Pepper Yellow Leaf Curl Virus (PYLCV) and Its Implications for Our Understanding of Evolution Dynamics in the Genus Polerovirus

    PubMed Central

    Dombrovsky, Aviv; Glanz, Eyal; Lachman, Oded; Sela, Noa; Doron-Faigenboim, Adi; Antignus, Yehezkel

    2013-01-01

    We determined the complete sequence and organization of the genome of a putative member of the genus Polerovirus tentatively named Pepper yellow leaf curl virus (PYLCV). PYLCV has a wider host range than Tobacco vein-distorting virus (TVDV) and has a close serological relationship with Cucurbit aphid-borne yellows virus (CABYV) (both poleroviruses). The extracted viral RNA was subjected to SOLiD next-generation sequence analysis and used as a template for reverse transcription synthesis, which was followed by PCR amplification. The ssRNA genome of PYLCV includes 6,028 nucleotides encoding six open reading frames (ORFs), which is typical of the genus Polerovirus. Comparisons of the deduced amino acid sequences of the PYLCV ORFs 2-4 and ORF5, indicate that there are high levels of similarity between these sequences to ORFs 2-4 of TVDV (84-93%) and to ORF5 of CABYV (87%). Both PYLCV and Pepper vein yellowing virus (PeVYV) contain sequences that point to a common ancestral polerovirus. The recombination breakpoint which is located at CABYV ORF3, which encodes the viral coat protein (CP), may explain the CABYV-like sequences found in the genomes of the pepper infecting viruses PYLCV and PeVYV. Two additional regions unique to PYLCV (PY1 and PY2) were identified between nucleotides 4,962 and 5,061 (ORF 5) and between positions 5,866 and 6,028 in the 3' NCR. Sequence analysis of the pepper-infecting PeVYV revealed three unique regions (Pe1-Pe3) with no similarity to other members of the genus Polerovirus. Genomic analyses of PYLCV and PeVYV suggest that the speciation of these viruses occurred through putative recombination event(s) between poleroviruses co-infecting a common host(s), resulting in the emergence of PYLCV, a novel pathogen with a wider host range. PMID:23936244

  19. The complete genomic sequence of pepper yellow leaf curl virus (PYLCV) and its implications for our understanding of evolution dynamics in the genus polerovirus.

    PubMed

    Dombrovsky, Aviv; Glanz, Eyal; Lachman, Oded; Sela, Noa; Doron-Faigenboim, Adi; Antignus, Yehezkel

    2013-01-01

    We determined the complete sequence and organization of the genome of a putative member of the genus Polerovirus tentatively named Pepper yellow leaf curl virus (PYLCV). PYLCV has a wider host range than Tobacco vein-distorting virus (TVDV) and has a close serological relationship with Cucurbit aphid-borne yellows virus (CABYV) (both poleroviruses). The extracted viral RNA was subjected to SOLiD next-generation sequence analysis and used as a template for reverse transcription synthesis, which was followed by PCR amplification. The ssRNA genome of PYLCV includes 6,028 nucleotides encoding six open reading frames (ORFs), which is typical of the genus Polerovirus. Comparisons of the deduced amino acid sequences of the PYLCV ORFs 2-4 and ORF5, indicate that there are high levels of similarity between these sequences to ORFs 2-4 of TVDV (84-93%) and to ORF5 of CABYV (87%). Both PYLCV and Pepper vein yellowing virus (PeVYV) contain sequences that point to a common ancestral polerovirus. The recombination breakpoint which is located at CABYV ORF3, which encodes the viral coat protein (CP), may explain the CABYV-like sequences found in the genomes of the pepper infecting viruses PYLCV and PeVYV. Two additional regions unique to PYLCV (PY1 and PY2) were identified between nucleotides 4,962 and 5,061 (ORF 5) and between positions 5,866 and 6,028 in the 3' NCR. Sequence analysis of the pepper-infecting PeVYV revealed three unique regions (Pe1-Pe3) with no similarity to other members of the genus Polerovirus. Genomic analyses of PYLCV and PeVYV suggest that the speciation of these viruses occurred through putative recombination event(s) between poleroviruses co-infecting a common host(s), resulting in the emergence of PYLCV, a novel pathogen with a wider host range.

  20. An exploration of the sequence of a 2.9-Mb region of the genome of Drosophila melanogaster: the Adh region.

    PubMed Central

    Ashburner, M; Misra, S; Roote, J; Lewis, S E; Blazej, R; Davis, T; Doyle, C; Galle, R; George, R; Harris, N; Hartzell, G; Harvey, D; Hong, L; Houston, K; Hoskins, R; Johnson, G; Martin, C; Moshrefi, A; Palazzolo, M; Reese, M G; Spradling, A; Tsang, G; Wan, K; Whitelaw, K; Celniker, S

    1999-01-01

    A contiguous sequence of nearly 3 Mb from the genome of Drosophila melanogaster has been sequenced from a series of overlapping P1 and BAC clones. This region covers 69 chromosome polytene bands on chromosome arm 2L, including the genetically well-characterized "Adh region." A computational analysis of the sequence predicts 218 protein-coding genes, 11 tRNAs, and 17 transposable element sequences. At least 38 of the protein-coding genes are arranged in clusters of from 2 to 6 closely related genes, suggesting extensive tandem duplication. The gene density is one protein-coding gene every 13 kb; the transposable element density is one element every 171 kb. Of 73 genes in this region identified by genetic analysis, 49 have been located on the sequence; P-element insertions have been mapped to 43 genes. Ninety-five (44%) of the known and predicted genes match a Drosophila EST, and 144 (66%) have clear similarities to proteins in other organisms. Genes known to have mutant phenotypes are more likely to be represented in cDNA libraries, and far more likely to have products similar to proteins of other organisms, than are genes with no known mutant phenotype. Over 650 chromosome aberration breakpoints map to this chromosome region, and their nonrandom distribution on the genetic map reflects variation in gene spacing on the DNA. This is the first large-scale analysis of the genome of D. melanogaster at the sequence level. In addition to the direct results obtained, this analysis has allowed us to develop and test methods that will be needed to interpret the complete sequence of the genome of this species.Before beginning a Hunt, it is wise to ask someone what you are looking for before you begin looking for it. Milne 1926 PMID:10471707

  1. Phylogenetic analysis of Haemaphysalis erinacei Pavesi, 1884 (Acari: Ixodidae) from China, Turkey, Italy and Romania.

    PubMed

    Hornok, Sándor; Wang, Yuanzhi; Otranto, Domenico; Keskin, Adem; Lia, Riccardo Paolo; Kontschán, Jenő; Takács, Nóra; Farkas, Róbert; Sándor, Attila D

    2016-12-15

    Haemaphysalis erinacei is one of the few ixodid tick species for which valid names of subspecies exist. Despite their disputed taxonomic status in the literature, these subspecies have not yet been compared with molecular methods. The aim of the present study was to investigate the phylogenetic relationships of H. erinacei subspecies, in the context of the first finding of this tick species in Romania. After morphological identification, DNA was extracted from five adults of H. e. taurica (from Romania and Turkey), four adults of H. e. erinacei (from Italy) and 17 adults of H. e. turanica (from China). From these samples fragments of the cytochrome c oxidase subunit 1 (cox1) and 16S rRNA genes were amplified via PCR and sequenced. Results showed that cox1 and 16S rRNA gene sequence divergences between H. e. taurica from Romania and H. e. erinacei from Italy were below 2%. However, the sequence divergences between H. e. taurica from Romania and H. e. turanica from China were high (up to 7.3% difference for the 16S rRNA gene), exceeding the reported level of sequence divergence between closely related tick species. At the same time, two adults of H. e. taurica from Turkey had higher 16S rRNA gene similarity to H. e. turanica from China (up to 97.5%) than to H. e. taurica from Romania (96.3%), but phylogenetically clustered more closely to H. e. taurica than to H. e. turanica. This is the first finding of H. erinacei in Romania, and the first (although preliminary) phylogenetic comparison of H. erinacei subspecies. Phylogenetic analyses did not support that the three H. erinacei subspecies evaluated here are of equal taxonomic rank, because the genetic divergence between H. e. turanica from China and H. e. taurica from Romania exceeded the usual level of sequence divergence between closely related tick species, suggesting that they might represent different species. Therefore, the taxonomic status of the subspecies of H. erinacei needs to be revised based on a larger number of specimens collected throughout its geographical range.

  2. Perturbations in DNA structure upon interaction with porphyrins revealed by chemical probes, DNA footprinting and molecular modelling.

    PubMed

    Ford, K G; Neidle, S

    1995-06-01

    The interactions of several porphyrins with a 74 base-pair DNA sequence have been examined by footprinting and chemical protection methods. Tetra-(4-N-methyl-(pyridyl)) porphyrin (TMPy), two of its metal complexes and tetra-(4-trimethylanilinium) porphyrin (TMAP) bind to closely similar AT-rich sequences. The three TMPy ligands produce modest changes in DNA structure and base accessibility on binding, in contrast to the large-scale conformational changes observed with TMAP. Molecular modelling studies have been performed on TMPy and TMAP bound in the AT-rich minor groove of an oligonucleotide. These have shown that significant structural change is needed to accommodate the bulky trimethyl substituent groups of TMAP, in contrast to the facile minor groove fit of TMPy.

  3. Highly pathogenic avian influenza virus subtype H5N1 in mute swans (Cygnus olor) in Central Bosnia.

    PubMed

    Goletić, Teufik; Gagić, Abdulah; Residbegović, Emina; Kustura, Aida; Kavazović, Aida; Savić, Vladimir; Harder, Timm; Starick, Elke; Prasović, Senad

    2010-03-01

    In order to determine the actual prevalence of avian influenza viruses (AIVs) in wild birds in Bosnia and Herzegovina, extensive surveillance was carried out between October 2005 and April 2006. A total of 394 samples representing 41 bird species were examined for the presence of influenza A virus using virus isolation in embryonated chicken eggs, PCR, and nucleotide sequencing. AIV subtype H5N1 was detected in two mute swans (Cygnus olor). The isolates were determined to be highly pathogenic avian influenza (HPAI) virus and the hemagglutinin sequence was closely similar to A/Cygnus olor/Astrakhan/ Ast05-2-10/2005 (H5N1). This is the first report of HPAI subtype H5N1 in Bosnia and Herzegovina.

  4. Complete genome sequences of Geobacillus sp. WCH70, a thermophilic strain isolated from wood compost

    DOE PAGES

    Brumm, Phillip; Land, Miriam L.; Mead, David

    2016-04-27

    Geobacillus sp. WCH70 was one of several thermophilic organisms isolated from hot composts in the Middleton, WI area. Comparison of 16 S rRNA sequences showed the strain may be a new species, and is most closely related to G. galactosidasius and G. toebii. The genome was sequenced, assembled, and annotated by the DOE Joint Genome Institute and deposited at the NCBI in December 2009 (CP001638). The genome of Geobacillus species WCH70 consists of one circular chromosome of 3,893,306 bp with an average G + C content of 43 %, and two circular plasmids of 33,899 and 10,287 bp with anmore » average G + C content of 40 %. Among sequenced organisms, Geobacillus sp. WCH70 shares highest Average Nucleotide Identity (86 %) with G. thermoglucosidasius strains, as well as similar genome organization. Geobacillus sp. WCH70 appears to be a highly adaptable organism, with an exceptionally high 125 annotated transposons in the genome. The organism also possesses four predicted restriction-modification systems not found in other Geobacillus species.« less

  5. The nucleotide sequence of Watermelon mosaic virus (WMV, Potyvirus) reveals interspecific recombination between two related potyviruses in the 5' part of the genome.

    PubMed

    Desbiez, C; Lecoq, H

    2004-08-01

    Watermelon mosaic virus (WMV, Potyvirus) is a potyvirus with a worldwide distribution, mostly in temperate and mediterranean regions. According to the partial sequences that were available, WMV appeared to share high sequence similarity with Soybean mosaic virus (SMV), and it was almost considered as a strain of SMV in spite of its different and much broader host range. Like SMV, it was also related to legume-infecting potyviruses belonging to the " Bean common mosaic virus (BCMV) subgroup". In this paper we obtained the full-length sequence of WMV, and we confirmed that this virus is very closely related to SMV in most of its genome; however, there is evidence for an interspecific recombination in the P1 protein, as the P1 of WMV was 135 amino-acids longer than that of SMV, and the N-terminal half of the P1 showed no relation to SMV but was 85% identical to BCMV. This suggests that WMV has emerged through an ancestral recombination event, and supports the distinction of WMV and SMV as separate taxonomic units.

  6. Molecular cloning of a putative gene encoding isopentenyltransferase from pingyitiancha (Malus hupehensis) and characterization of its response to nitrate.

    PubMed

    Peng, Jing; Peng, Futian; Zhu, Chunfu; Wei, Shaochong

    2008-06-01

    A putative isopentenyltransferase (IPT) encoding gene was identified from a pingyitiancha (Malus hupehensis Rehd.) expressed sequence tag database, and the full-length gene was cloned by RACE. Based on expression profile and sequence alignment, the nucleotide sequence of the clone, named MhIPT3, was most similar to AtIPT3, an IPT gene in Arabidopsis. The full-length cDNA contained a 963-bp open reading frame encoding a protein of 321 amino acids with a molecular mass of 37.3 kDa. Sequence analysis of genomic DNA revealed the absence of introns in the frame. Quantitative real-time PCR analysis demonstrated that the gene was expressed in roots, stems and leaves. Application of nitrate to roots of nitrogen-deprived seedlings strongly induced expression of MhIPT3 and was accompanied by the accumulation of cytokinins, whereas MhIPT3 expression was little affected by ammonium application to roots of nitrogen-deprived seedlings. Application of nitrate to leaves also up-regulated the expression of MhIPT3 and corresponded closely with the accumulation of isopentyladenine and isopentyladenosine in leaves.

  7. RNA polymerase beta-subunit gene (rpoB) sequence analysis for the identification of Bacteroides spp.

    PubMed

    Ko, K S; Kuwahara, T; Haehwa, L; Yoon, Y-J; Kim, B-J; Lee, K-H; Ohnishi, Y; Kook, Y-H

    2007-01-01

    Partial rpoB sequences (317 bp) of 11 species of Bacteroides, two Porphyromonas spp. and two Prevotella spp. were compared to delineate the genetic relationships among Bacteroides and closely related anaerobic species. The high level of inter-species sequence dissimilarities (7.6-20.8%) allowed the various Bacteroides spp. to be distinguished. The position of the Bacteroides distasonis and Bacteriodes merdae cluster in the rpoB tree was different from the position in the 16S rRNA gene tree. Based on rpoB sequence similarity and clustering in the rpoB tree, it was possible to correctly re-identify 80 clinical isolates of Bacteroides. In addition to two subgroups, cfiA-negative (division I) and cfiA-positive (division II), of Bacteroides fragilis isolates, two distinct subgroups were also found among Bacteroides ovatus and Bacteroides thetaiotaomicron isolates. Bacteroides genus-specific rpoB PCR and B. fragilis species-specific rpoB PCR allowed Bacteroides spp. to be differentiated from Porphyromonas and Prevotella spp., and also allowed B. fragilis to be differentiated from other non-fragilisBacteroides spp. included in the present study.

  8. Complete genome sequences of Geobacillus sp. WCH70, a thermophilic strain isolated from wood compost

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Brumm, Phillip; Land, Miriam L.; Mead, David

    Geobacillus sp. WCH70 was one of several thermophilic organisms isolated from hot composts in the Middleton, WI area. Comparison of 16 S rRNA sequences showed the strain may be a new species, and is most closely related to G. galactosidasius and G. toebii. The genome was sequenced, assembled, and annotated by the DOE Joint Genome Institute and deposited at the NCBI in December 2009 (CP001638). The genome of Geobacillus species WCH70 consists of one circular chromosome of 3,893,306 bp with an average G + C content of 43 %, and two circular plasmids of 33,899 and 10,287 bp with anmore » average G + C content of 40 %. Among sequenced organisms, Geobacillus sp. WCH70 shares highest Average Nucleotide Identity (86 %) with G. thermoglucosidasius strains, as well as similar genome organization. Geobacillus sp. WCH70 appears to be a highly adaptable organism, with an exceptionally high 125 annotated transposons in the genome. The organism also possesses four predicted restriction-modification systems not found in other Geobacillus species.« less

  9. Molecular Cloning and Sequence Analysis of a Phenylalanine Ammonia-Lyase Gene from Dendrobium

    PubMed Central

    Cai, Yongping; Lin, Yi

    2013-01-01

    In this study, a phenylalanine ammonia-lyase (PAL) gene was cloned from Dendrobium candidum using homology cloning and RACE. The full-length sequence and catalytic active sites that appear in PAL proteins of Arabidopsis thaliana and Nicotiana tabacum are also found: PAL cDNA of D. candidum (designated Dc-PAL1, GenBank No. JQ765748) has 2,458 bps and contains a complete open reading frame (ORF) of 2,142 bps, which encodes 713 amino acid residues. The amino acid sequence of DcPAL1 has more than 80% sequence identity with the PAL genes of other plants, as indicated by multiple alignments. The dominant sites and catalytic active sites, which are similar to that showing in PAL proteins of Arabidopsis thaliana and Nicotiana tabacum, are also found in DcPAL1. Phylogenetic tree analysis revealed that DcPAL is more closely related to PALs from orchidaceae plants than to those of other plants. The differential expression patterns of PAL in protocorm-like body, leaf, stem, and root, suggest that the PAL gene performs multiple physiological functions in Dendrobium candidum. PMID:23638048

  10. Closed Genome Sequence of Chryseobacterium piperi Strain CTMT/ATCC BAA-1782, a Gram-Negative Bacterium with Clostridial Neurotoxin-Like Coding Sequences

    PubMed Central

    Wentz, Travis G.; Muruvanda, Tim; Thirunavukkarasu, Nagarajan; Hoffmann, Maria; Allard, Marc W.; Hodge, David R.; Pillai, Segaran P.; Hammack, Thomas S.; Brown, Eric W.

    2017-01-01

    ABSTRACT Clostridial neurotoxins, including botulinum and tetanus neurotoxins, are among the deadliest known bacterial toxins. Until recently, the horizontal mobility of this toxin gene family appeared to be limited to the genus Clostridium. We report here the closed genome sequence of Chryseobacterium piperi, a Gram-negative bacterium containing coding sequences with homology to clostridial neurotoxin family proteins. PMID:29192076

  11. Microbial eukaryotic diversity and distribution in a river plume and cyclonic eddy-influenced ecosystem in the South China Sea.

    PubMed

    Wu, Wenxue; Wang, Lei; Liao, Yu; Huang, Bangqin

    2015-10-01

    To evaluate microbial eukaryotic diversity and distribution in mesoscale processes, we investigated 18S rDNA diversity in a river plume and cyclonic eddy-influenced ecosystem in the southwestern South China Sea (SCS). Restriction fragment length polymorphism analysis was carried out using multiple primer sets. Relative to a wide range of previous similar studies, we observed a significantly higher proportion of sequences of pigmented taxa. Among the photosynthetic groups, Haptophyta accounted for 27.7% of the sequenced clones, which belonged primarily to Prymnesiophyceae. Unexpectedly, five operational taxonomic units of Cryptophyta were closely related to freshwater species. The Chlorophyta mostly fell within the Prasinophyceae, which was comprised of six clades, including Clade III, which is detected in the SCS for the first time in this study. Among the photosynthetic stramenopiles, Chrysophyceae was the most diverse taxon, which included seven clades. The majority of 18S rDNA sequences affiliated with the Dictyochophyceae, Eustigmatophyceae, and Pelagophyceae were closely related to those of pure cultures. The results of redundancy analysis and the permutation Mantel test based on unweighted UniFrac distances, conducted for spatial analyses of the Haptophyta subclades suggested that the Mekong River plume and cyclonic eddy play important roles in regulating microbial eukaryotic diversity and distribution in the southwestern SCS. © 2015 The Authors. MicrobiologyOpen published by John Wiley & Sons Ltd.

  12. The mitochondrial genome of Hydra oligactis (Cnidaria, Hydrozoa) sheds new light on animal mtDNA evolution and cnidarian phylogeny.

    PubMed

    Kayal, Ehsan; Lavrov, Dennis V

    2008-02-29

    The 16,314-nuceotide sequence of the linear mitochondrial DNA (mtDNA) molecule of Hydra oligactis (Cnidaria, Hydrozoa)--the first from the class Hydrozoa--has been determined. This sequence contains genes for 13 energy pathway proteins, small and large subunit rRNAs, and methionine and tryptophan tRNAs, as is typical for cnidarians. All genes have the same transcriptional orientation and their arrangement in the genome is similar to that of the jellyfish Aurelia aurita. In addition, a partial copy of cox1 is present at one end of the molecule in a transcriptional orientation opposite to the rest of the genes, forming a part of inverted terminal repeat characteristic of linear mtDNA and linear mitochondrial plasmids. The sequence close to at least one end of the molecule contains several homonucleotide runs as well as small inverted repeats that are able to form strong secondary structures and may be involved in mtDNA maintenance and expression. Phylogenetic analysis of mitochondrial genes of H. oligactis and other cnidarians supports the Medusozoa hypothesis but also suggests that Anthozoa may be paraphyletic, with octocorallians more closely related to the Medusozoa than to the Hexacorallia. The latter inference implies that Anthozoa is paraphyletic and that the polyp (rather than a medusa) is the ancestral body type in Cnidaria.

  13. Differences in community composition of bacteria in four glaciers in western China

    NASA Astrophysics Data System (ADS)

    An, L. Z.; Chen, Y.; Xiang, S.-R.; Shang, T.-C.; Tian, L.-D.

    2010-06-01

    Microbial community patterns vary in glaciers worldwide, presenting unique responses to global climatic and environmental changes. Four bacterial clone libraries were established by 16S rRNA gene amplification from four ice layers along the 42-m-long ice core MuztB drilled from the Muztag Ata Glacier. A total of 151 bacterial sequences obtained from the ice core MuztB were phylogenetically compared with the 71 previously reported sequences from three ice cores extracted from ice caps Malan, Dunde, and Puruogangri. Six phylogenetic clusters Flavisolibacter, Flexibacter (Bacteroidetes), Acinetobacter, Enterobacter (Gammaproteobacteria), Planococcus/Anoxybacillus (Firmicutes), and Propionibacter/Luteococcus (Actinobacteria) frequently occurred along the Muztag Ata Glacier profile, and their proportion varied by seasons. Sequence analysis showed that most of the sequences from the ice core clustered with those from cold environments, and the sequence clusters from the same glacier more closely grouped together than those from the geographically isolated glaciers. Moreover, bacterial communities from the same location or similarly aged ice formed a cluster, and were clearly separate from those from other geographically isolated glaciers. In summary, the findings provide preliminary evidence of zonal distribution of microbial community, and suggest biogeography of microorganisms in glacier ice.

  14. Chromobacterium sphagni sp. nov., an insecticidal bacterium isolated from Sphagnum bogs.

    PubMed

    Blackburn, Michael B; Farrar, Robert R; Sparks, Michael E; Kuhar, Daniel; Mitchell, Ashaki; Gundersen-Rindal, Dawn E

    2017-09-01

    Sixteen isolates of Gram-reaction-negative, motile, violet-pigmented bacteria were isolated from Sphagnum bogs in West Virginia and Maine, USA. 16S rRNA gene sequences and fatty acid analysis revealed a high degree of relatedness among the isolates, and genome sequencing of two isolates, IIBBL 14B-1T and IIBBL 37-2 (from West Virginia and Maine, respectively), revealed highly similar genomic sequences. The average nucleotide identity (gANI) calculated for these two isolates was found to be in excess of 99 %, but did not exceed 88 % when comparing either isolate with genomic sequences of Chromobacterium violaceum ATCC 12472T, C. haemolyticum DSM 19808T, C. piscinae ND17, C. subtsugae PRAA4-1T, C. vaccinii MWU205T or C. amazonense CBMAI 310T. Collectively, gANI and 16S rRNA gene sequence comparisons suggested that isolates IIBBL 14B-1T and IIBBL 37-2 were most closely related to C. subtsugae, but represented a distinct species. We propose the name Chromobacterium sphagni sp. nov. for this taxon; the type strain is IIBBL 14B-1T (=NRRL B-67130T=JCM 31882T).

  15. Discovering frequently recurring movement sequences in team-sport athlete spatiotemporal data.

    PubMed

    Sweeting, Alice J; Aughey, Robert J; Cormack, Stuart J; Morgan, Stuart

    2017-12-01

    Athlete external load is typically analysed from predetermined movement thresholds. The combination of movement sequences and differences in these movements between playing positions is also currently unknown. This study developed a method to discover the frequently recurring movement sequences across playing position during matches. The external load of 12 international female netball athletes was collected by a local positioning system during four national-level matches. Velocity, acceleration and angular velocity were calculated from positional (X, Y) data, clustered via one-dimensional k-means and assigned a unique alphabetic label. Combinations of velocity, acceleration and angular velocity movement were compared using the Levenshtein distance and similarities computed by the longest common substring problem. The contribution of each movement sequence, according to playing position and relative to the wider data set, was then calculated via the Minkowski distance. A total of 10 frequently recurring combinations of movement were discovered, regardless of playing position. Only the wing attack, goal attack and goal defence playing positions are closely related. We developed a technique to discover the movement sequences, according to playing position, performed by elite netballers. This methodology can be extended to discover the frequently recurring movements within other team sports and across levels of competition.

  16. Assessing Diversity of DNA Structure-Related Sequence Features in Prokaryotic Genomes

    PubMed Central

    Huang, Yongjie; Mrázek, Jan

    2014-01-01

    Prokaryotic genomes are diverse in terms of their nucleotide and oligonucleotide composition as well as presence of various sequence features that can affect physical properties of the DNA molecule. We present a survey of local sequence patterns which have a potential to promote non-canonical DNA conformations (i.e. different from standard B-DNA double helix) and interpret the results in terms of relationships with organisms' habitats, phylogenetic classifications, and other characteristics. Our present work differs from earlier similar surveys not only by investigating a wider range of sequence patterns in a large number of genomes but also by using a more realistic null model to assess significant deviations. Our results show that simple sequence repeats and Z-DNA-promoting patterns are generally suppressed in prokaryotic genomes, whereas palindromes and inverted repeats are over-represented. Representation of patterns that promote Z-DNA and intrinsic DNA curvature increases with increasing optimal growth temperature (OGT), and decreases with increasing oxygen requirement. Additionally, representations of close direct repeats, palindromes and inverted repeats exhibit clear negative trends with increasing OGT. The observed relationships with environmental characteristics, particularly OGT, suggest possible evolutionary scenarios of structural adaptation of DNA to particular environmental niches. PMID:24408877

  17. Phylogenetic Analysis of Theileria annulata Infected Cell Line S15 Iran Vaccine Strain.

    PubMed

    Habibi, Gh

    2012-01-01

    Bovine theileriosis results from infection with obligate intracellular protozoa of the genus Theileria. The phylogenetic relationships between two isolates of Theileria annulata, and 36 Theileria spp., as well as 6 outgroup including Babesia spp. and coccidian protozoa were analyzed using the 18S rRNA gene sequence. The target DNA segment was amplified by PCR. The PCR product was used for direct sequencing. The length of the 18S rRNA gene of all Theileria spp. involved in this study was around 1,400 bp. A phylogenetic tree was inferred based on the 18S rRNA gene sequence of the Iran and Iraq isolates, and other species of Theileria available in GenBank. In the constructed tree, Theileria annulata (Iran vaccine strain) was closely related to other T. annulata from Europe, Asia, as well as T. lestoquardi, T. parva and T. taurotragi all in one clade. Phylogenetic analyses based on small subunit ribosomal RNA gene suggested that the percent identity of the sequence of Iran vaccine strain was completely the same as Iraq sequence (100% identical), but the similarity of Iran vaccine strain with other T. annulata reported from China, Spain and Italy determined the 97.9 to 99.9% identity.

  18. A range-wide synthesis and timeline for phylogeographic events in the red fox (Vulpes vulpes).

    PubMed

    Kutschera, Verena E; Lecomte, Nicolas; Janke, Axel; Selva, Nuria; Sokolov, Alexander A; Haun, Timm; Steyer, Katharina; Nowak, Carsten; Hailer, Frank

    2013-06-05

    Many boreo-temperate mammals have a Pleistocene fossil record throughout Eurasia and North America, but only few have a contemporary distribution that spans this large area. Examples of Holarctic-distributed carnivores are the brown bear, grey wolf, and red fox, all three ecological generalists with large dispersal capacity and a high adaptive flexibility. While the two former have been examined extensively across their ranges, no phylogeographic study of the red fox has been conducted across its entire Holarctic range. Moreover, no study included samples from central Asia, leaving a large sampling gap in the middle of the Eurasian landmass. Here we provide the first mitochondrial DNA sequence data of red foxes from central Asia (Siberia), and new sequences from several European populations. In a range-wide synthesis of 729 red fox mitochondrial control region sequences, including 677 previously published and 52 newly obtained sequences, this manuscript describes the pattern and timing of major phylogeographic events in red foxes, using a Bayesian coalescence approach with multiple fossil tip and root calibration points. In a 335 bp alignment we found in total 175 unique haplotypes. All newly sequenced individuals belonged to the previously described Holarctic lineage. Our analyses confirmed the presence of three Nearctic- and two Japan-restricted lineages that were formed since the Mid/Late Pleistocene. The phylogeographic history of red foxes is highly similar to that previously described for grey wolves and brown bears, indicating that climatic fluctuations and habitat changes since the Pleistocene had similar effects on these highly mobile generalist species. All three species originally diversified in Eurasia and later colonized North America and Japan. North American lineages persisted through the last glacial maximum south of the ice sheets, meeting more recent colonizers from Beringia during postglacial expansion into the northern Nearctic. Both brown bears and red foxes colonized Japan's northern island Hokkaido at least three times, all lineages being most closely related to different mainland lineages. Red foxes, grey wolves, and brown bears thus represent an interesting case where species that occupy similar ecological niches also exhibit similar phylogeographic histories.

  19. A range-wide synthesis and timeline for phylogeographic events in the red fox (Vulpes vulpes)

    PubMed Central

    2013-01-01

    Background Many boreo-temperate mammals have a Pleistocene fossil record throughout Eurasia and North America, but only few have a contemporary distribution that spans this large area. Examples of Holarctic-distributed carnivores are the brown bear, grey wolf, and red fox, all three ecological generalists with large dispersal capacity and a high adaptive flexibility. While the two former have been examined extensively across their ranges, no phylogeographic study of the red fox has been conducted across its entire Holarctic range. Moreover, no study included samples from central Asia, leaving a large sampling gap in the middle of the Eurasian landmass. Results Here we provide the first mitochondrial DNA sequence data of red foxes from central Asia (Siberia), and new sequences from several European populations. In a range-wide synthesis of 729 red fox mitochondrial control region sequences, including 677 previously published and 52 newly obtained sequences, this manuscript describes the pattern and timing of major phylogeographic events in red foxes, using a Bayesian coalescence approach with multiple fossil tip and root calibration points. In a 335 bp alignment we found in total 175 unique haplotypes. All newly sequenced individuals belonged to the previously described Holarctic lineage. Our analyses confirmed the presence of three Nearctic- and two Japan-restricted lineages that were formed since the Mid/Late Pleistocene. Conclusions The phylogeographic history of red foxes is highly similar to that previously described for grey wolves and brown bears, indicating that climatic fluctuations and habitat changes since the Pleistocene had similar effects on these highly mobile generalist species. All three species originally diversified in Eurasia and later colonized North America and Japan. North American lineages persisted through the last glacial maximum south of the ice sheets, meeting more recent colonizers from Beringia during postglacial expansion into the northern Nearctic. Both brown bears and red foxes colonized Japan’s northern island Hokkaido at least three times, all lineages being most closely related to different mainland lineages. Red foxes, grey wolves, and brown bears thus represent an interesting case where species that occupy similar ecological niches also exhibit similar phylogeographic histories. PMID:23738594

  20. Volcanic Soils as Sources of Novel CO-Oxidizing Paraburkholderia and Burkholderia: Paraburkholderia hiiakae sp. nov., Paraburkholderia metrosideri sp. nov., Paraburkholderia paradisi sp. nov., Paraburkholderia peleae sp. nov., and Burkholderia alpina sp. nov. a Member of the Burkholderia cepacia Complex

    PubMed Central

    Weber, Carolyn F.; King, Gary M.

    2017-01-01

    Previous studies showed that members of the Burkholderiales were important in the succession of aerobic, molybdenum-dependent CO oxidizing-bacteria on volcanic soils. During these studies, four isolates were obtained from Kilauea Volcano (Hawai‘i, USA); one strain was isolated from Pico de Orizaba (Mexico) during a separate study. Based on 16S rRNA gene sequence similarities, the Pico de Orizaba isolate and the isolates from Kilauea Volcano were provisionally assigned to the genera Burkholderia and Paraburkholderia, respectively. Each of the isolates possessed a form I coxL gene that encoded the catalytic subunit of carbon monoxide dehydrogenase (CODH); none of the most closely related type strains possessed coxL or oxidized CO. Genome sequences for Paraburkholderia type strains facilitated an analysis of 16S rRNA gene sequence similarities and average nucleotide identities (ANI). ANI did not exceed 95% (the recommended cutoff for species differentiation) for any of the pairwise comparisons among 27 reference strains related to the new isolates. However, since the highest 16S rRNA gene sequence similarity among this set of reference strains was 98.93%, DNA-DNA hybridizations (DDH) were performed for two isolates whose 16S rRNA gene sequence similarities with their nearest phylogenetic neighbors were 98.96 and 99.11%. In both cases DDH values were <16%. Based on multiple variables, four of the isolates represent novel species within the Paraburkholderia: Paraburkholderia hiiakae sp. nov. (type strain I2T = DSM 28029T = LMG 27952T); Paraburkholderia paradisi sp. nov. (type strain WAT = DSM 28027T = LMG 27949T); Paraburkholderia peleae sp. nov. (type strain PP52-1T = DSM 28028T = LMG 27950T); and Paraburkholderia metrosideri sp. nov. (type strain DNBP6-1T = DSM 28030T = LMG 28140T). The remaining isolate represents the first CO-oxidizing member of the Burkholderia cepacia complex: Burkholderia alpina sp. nov. (type strain PO-04-17-38T = DSM 28031T = LMG 28138T). PMID:28270796

  1. Volcanic Soils as Sources of Novel CO-Oxidizing Paraburkholderia and Burkholderia: Paraburkholderia hiiakae sp. nov., Paraburkholderia metrosideri sp. nov., Paraburkholderia paradisi sp. nov., Paraburkholderia peleae sp. nov., and Burkholderia alpina sp. nov. a Member of the Burkholderia cepacia Complex.

    PubMed

    Weber, Carolyn F; King, Gary M

    2017-01-01

    Previous studies showed that members of the Burkholderiales were important in the succession of aerobic, molybdenum-dependent CO oxidizing-bacteria on volcanic soils. During these studies, four isolates were obtained from Kilauea Volcano (Hawai'i, USA); one strain was isolated from Pico de Orizaba (Mexico) during a separate study. Based on 16S rRNA gene sequence similarities, the Pico de Orizaba isolate and the isolates from Kilauea Volcano were provisionally assigned to the genera Burkholderia and Paraburkholderia , respectively. Each of the isolates possessed a form I coxL gene that encoded the catalytic subunit of carbon monoxide dehydrogenase (CODH); none of the most closely related type strains possessed coxL or oxidized CO. Genome sequences for Paraburkholderia type strains facilitated an analysis of 16S rRNA gene sequence similarities and average nucleotide identities (ANI). ANI did not exceed 95% (the recommended cutoff for species differentiation) for any of the pairwise comparisons among 27 reference strains related to the new isolates. However, since the highest 16S rRNA gene sequence similarity among this set of reference strains was 98.93%, DNA-DNA hybridizations (DDH) were performed for two isolates whose 16S rRNA gene sequence similarities with their nearest phylogenetic neighbors were 98.96 and 99.11%. In both cases DDH values were <16%. Based on multiple variables, four of the isolates represent novel species within the Paraburkholderia : Paraburkholderia hiiakae sp. nov. (type strain I2 T = DSM 28029 T = LMG 27952 T ); Paraburkholderia paradisi sp. nov. (type strain WA T = DSM 28027 T = LMG 27949 T ); Paraburkholderia peleae sp. nov. (type strain PP52-1 T = DSM 28028 T = LMG 27950 T ); and Paraburkholderia metrosideri sp. nov. (type strain DNBP6-1 T = DSM 28030 T = LMG 28140 T ). The remaining isolate represents the first CO-oxidizing member of the Burkholderia cepacia complex: Burkholderia alpina sp. nov. (type strain PO-04-17-38 T = DSM 28031 T = LMG 28138 T ).

  2. Gluconacetobacter kakiaceti sp. nov., an acetic acid bacterium isolated from a traditional Japanese fruit vinegar.

    PubMed

    Iino, Takao; Suzuki, Rei; Tanaka, Naoto; Kosako, Yoshimasa; Ohkuma, Moriya; Komagata, Kazuo; Uchimura, Tai

    2012-07-01

    Two novel acetic acid bacteria, strains G5-1(T) and I5-1, were isolated from traditional kaki vinegar (produced from fruits of kaki, Diospyros kaki Thunb.), collected in Kumamoto Prefecture, Japan. Phylogenetic analysis based on 16S rRNA gene sequences revealed that strains G5-1(T) and I5-1 formed a distinct subline in the genus Gluconacetobacter and were closely related to Gluconacetobacter swingsii DST GL01(T) (99.3% 16S rRNA gene sequence similarity). The isolates showed 96-100% DNA-DNA relatedness with each other, but <53% DNA-DNA relatedness with closely related members of the genus Gluconacetobacter. The isolates could be distinguished from closely related members of the genus Gluconacetobacter by not producing 2- and 5-ketogluconic acids from glucose, producing cellulose, growing without acetic acid and with 30% (w/v) d-glucose, and producing acid from sugars and alcohols. Furthermore, the genomic DNA G+C contents of strains G5-1(T) and I5-1 were a little higher than those of their closest phylogenetic neighbours. On the basis of the phenotypic characteristics and phylogenetic position, strains G5-1(T) and I5-1 are assigned to a novel species, for which the name Gluconacetobacter kakiaceti sp. nov. is proposed; the type strain is G5-1(T) (=JCM 25156(T)=NRIC 0798(T)=LMG 26206(T)).

  3. Closed Circular Chains

    ERIC Educational Resources Information Center

    Caglayan, Günhan

    2016-01-01

    A Steiner chain is defined as the sequence of n circles that are all tangent to two given non-intersecting circles. A closed chain, in particular, is one in which every circle in the sequence is tangent to the previous and next circles of the chain. In a closed Steiner chain the first and the "n"th circles of the chain are also tangent…

  4. Viral Outbreak in Corals Associated with an In Situ Bleaching Event: Atypical Herpes-Like Viruses and a New Megavirus Infecting Symbiodinium

    PubMed Central

    Correa, Adrienne M. S.; Ainsworth, Tracy D.; Rosales, Stephanie M.; Thurber, Andrew R.; Butler, Christopher R.; Vega Thurber, Rebecca L.

    2016-01-01

    Previous studies of coral viruses have employed either microscopy or metagenomics, but few have attempted to comprehensively link the presence of a virus-like particle (VLP) to a genomic sequence. We conducted transmission electron microscopy imaging and virome analysis in tandem to characterize the most conspicuous viral types found within the dominant Pacific reef-building coral genus Acropora. Collections for this study inadvertently captured what we interpret as a natural outbreak of viral infection driven by aerial exposure of the reef flat coincident with heavy rainfall and concomitant mass bleaching. All experimental corals in this study had high titers of viral particles. Three of the dominant VLPs identified were observed in all tissue layers and budding out from the epidermis, including viruses that were ∼70, ∼120, and ∼150 nm in diameter; these VLPs all contained electron dense cores. These morphological traits are reminiscent of retroviruses, herpesviruses, and nucleocytoplasmic large DNA viruses (NCLDVs), respectively. Some 300–500 nm megavirus-like VLPs also were observed within and associated with dinoflagellate algal endosymbiont (Symbiodinium) cells. Abundant sequence similarities to a gammaretrovirus, herpesviruses, and members of the NCLDVs, based on a virome generated from five Acropora aspera colonies, corroborated these morphology-based identifications. Additionally sequence similarities to two diagnostic genes, a MutS and (based on re-annotation of sequences from another study) a DNA polymerase B gene, most closely resembled Pyramimonas orientalis virus, demonstrating the association of a cosmopolitan megavirus with Symbiodinium. We also identified several other virus-like particles in host tissues, along with sequences phylogenetically similar to circoviruses, phages, and filamentous viruses. This study suggests that viral outbreaks may be a common but previously undocumented component of natural bleaching events, particularly following repeated episodes of multiple environmental stressors. PMID:26941712

  5. Occam’s Quantum Strop: Synchronizing and Compressing Classical Cryptic Processes via a Quantum Channel

    NASA Astrophysics Data System (ADS)

    Mahoney, John R.; Aghamohammadi, Cina; Crutchfield, James P.

    2016-02-01

    A stochastic process’ statistical complexity stands out as a fundamental property: the minimum information required to synchronize one process generator to another. How much information is required, though, when synchronizing over a quantum channel? Recent work demonstrated that representing causal similarity as quantum state-indistinguishability provides a quantum advantage. We generalize this to synchronization and offer a sequence of constructions that exploit extended causal structures, finding substantial increase of the quantum advantage. We demonstrate that maximum compression is determined by the process’ cryptic order-a classical, topological property closely allied to Markov order, itself a measure of historical dependence. We introduce an efficient algorithm that computes the quantum advantage and close noting that the advantage comes at a cost-one trades off prediction for generation complexity.

  6. Occam's Quantum Strop: Synchronizing and Compressing Classical Cryptic Processes via a Quantum Channel.

    PubMed

    Mahoney, John R; Aghamohammadi, Cina; Crutchfield, James P

    2016-02-15

    A stochastic process' statistical complexity stands out as a fundamental property: the minimum information required to synchronize one process generator to another. How much information is required, though, when synchronizing over a quantum channel? Recent work demonstrated that representing causal similarity as quantum state-indistinguishability provides a quantum advantage. We generalize this to synchronization and offer a sequence of constructions that exploit extended causal structures, finding substantial increase of the quantum advantage. We demonstrate that maximum compression is determined by the process' cryptic order--a classical, topological property closely allied to Markov order, itself a measure of historical dependence. We introduce an efficient algorithm that computes the quantum advantage and close noting that the advantage comes at a cost-one trades off prediction for generation complexity.

  7. Application of representational difference analysis to identify genomic differences between Bradyrhizobium elkanii and B. Japonicum species.

    PubMed

    Soares, René Arderius; Passaglia, Luciane Maria Pereira

    2010-10-01

    Bradyrhizobium elkanii is successfully used in the formulation of commercial inoculants and, together with B. japonicum, it fully supplies the plant nitrogen demands. Despite the similarity between B. japonicum and B. elkanii species, several works demonstrated genetic and physiological differences between them. In this work Representational Difference Analysis (RDA) was used for genomic comparison between B. elkanii SEMIA 587, a crop inoculant strain, and B. japonicum USDA 110, a reference strain. Two hundred sequences were obtained. From these, 46 sequences belonged exclusively to the genome of B. elkanii strain, and 154 showed similarity to sequences from B. japonicum genome. From the 46 sequences with no similarity to sequences from B. japonicum, 39 showed no similarity to sequences in public databases and seven showed similarity to sequences of genes coding for known proteins. These seven sequences were divided in three groups: similar to sequences from other Bradyrhizobium strains, similar to sequences from other nitrogen-fixing bacteria, and similar to sequences from non nitrogen-fixing bacteria. These new sequences could be used as DNA markers in order to investigate the rates of genetic material gain and loss in natural Bradyrhizobium strains.

  8. From biomedicine to natural history research: EST resources for ambystomatid salamanders

    PubMed Central

    Putta, Srikrishna; Smith, Jeramiah J; Walker, John A; Rondet, Mathieu; Weisrock, David W; Monaghan, James; Samuels, Amy K; Kump, Kevin; King, David C; Maness, Nicholas J; Habermann, Bianca; Tanaka, Elly; Bryant, Susan V; Gardiner, David M; Parichy, David M; Voss, S Randal

    2004-01-01

    Background Establishing genomic resources for closely related species will provide comparative insights that are crucial for understanding diversity and variability at multiple levels of biological organization. We developed ESTs for Mexican axolotl (Ambystoma mexicanum) and Eastern tiger salamander (A. tigrinum tigrinum), species with deep and diverse research histories. Results Approximately 40,000 quality cDNA sequences were isolated for these species from various tissues, including regenerating limb and tail. These sequences and an existing set of 16,030 cDNA sequences for A. mexicanum were processed to yield 35,413 and 20,599 high quality ESTs for A. mexicanum and A. t. tigrinum, respectively. Because the A. t. tigrinum ESTs were obtained primarily from a normalized library, an approximately equal number of contigs were obtained for each species, with 21,091 unique contigs identified overall. The 10,592 contigs that showed significant similarity to sequences from the human RefSeq database reflected a diverse array of molecular functions and biological processes, with many corresponding to genes expressed during spinal cord injury in rat and fin regeneration in zebrafish. To demonstrate the utility of these EST resources, we searched databases to identify probes for regeneration research, characterized intra- and interspecific nucleotide polymorphism, saturated a human – Ambystoma synteny group with marker loci, and extended PCR primer sets designed for A. mexicanum / A. t. tigrinum orthologues to a related tiger salamander species. Conclusions Our study highlights the value of developing resources in traditional model systems where the likelihood of information transfer to multiple, closely related taxa is high, thus simultaneously enabling both laboratory and natural history research. PMID:15310388

  9. The Fecal Viral Flora of Wild Rodents

    PubMed Central

    Phan, Tung G.; Kapusinszky, Beatrix; Wang, Chunlin; Rose, Robert K.; Lipton, Howard L.; Delwart, Eric L.

    2011-01-01

    The frequent interactions of rodents with humans make them a common source of zoonotic infections. To obtain an initial unbiased measure of the viral diversity in the enteric tract of wild rodents we sequenced partially purified, randomly amplified viral RNA and DNA in the feces of 105 wild rodents (mouse, vole, and rat) collected in California and Virginia. We identified in decreasing frequency sequences related to the mammalian viruses families Circoviridae, Picobirnaviridae, Picornaviridae, Astroviridae, Parvoviridae, Papillomaviridae, Adenoviridae, and Coronaviridae. Seventeen small circular DNA genomes containing one or two replicase genes distantly related to the Circoviridae representing several potentially new viral families were characterized. In the Picornaviridae family two new candidate genera as well as a close genetic relative of the human pathogen Aichi virus were characterized. Fragments of the first mouse sapelovirus and picobirnaviruses were identified and the first murine astrovirus genome was characterized. A mouse papillomavirus genome and fragments of a novel adenovirus and adenovirus-associated virus were also sequenced. The next largest fraction of the rodent fecal virome was related to insect viruses of the Densoviridae, Iridoviridae, Polydnaviridae, Dicistroviriade, Bromoviridae, and Virgaviridae families followed by plant virus-related sequences in the Nanoviridae, Geminiviridae, Phycodnaviridae, Secoviridae, Partitiviridae, Tymoviridae, Alphaflexiviridae, and Tombusviridae families reflecting the largely insect and plant rodent diet. Phylogenetic analyses of full and partial viral genomes therefore revealed many previously unreported viral species, genera, and families. The close genetic similarities noted between some rodent and human viruses might reflect past zoonoses. This study increases our understanding of the viral diversity in wild rodents and highlights the large number of still uncharacterized viruses in mammals. PMID:21909269

  10. CRISPR Diversity and Microevolution in Clostridium difficile

    PubMed Central

    Andersen, Joakim M.; Shoup, Madelyn; Robinson, Cathy; Britton, Robert; Olsen, Katharina E.P.; Barrangou, Rodolphe

    2016-01-01

    Abstract Virulent strains of Clostridium difficile have become a global health problem associated with morbidity and mortality. Traditional typing methods do not provide ideal resolution to track outbreak strains, ascertain genetic diversity between isolates, or monitor the phylogeny of this species on a global basis. Here, we investigate the occurrence and diversity of clustered regularly interspaced short palindromic repeats (CRISPR) and CRISPR-associated genes (cas) in C. difficile to assess the potential of CRISPR-based phylogeny and high-resolution genotyping. A single Type-IB CRISPR-Cas system was identified in 217 analyzed genomes with cas gene clusters present at conserved chromosomal locations, suggesting vertical evolution of the system, assessing a total of 1,865 CRISPR arrays. The CRISPR arrays, markedly enriched (8.5 arrays/genome) compared with other species, occur both at conserved and variable locations across strains, and thus provide a basis for typing based on locus occurrence and spacer polymorphism. Clustering of strains by array composition correlated with sequence type (ST) analysis. Spacer content and polymorphism within conserved CRISPR arrays revealed phylogenetic relationship across clades and within ST. Spacer polymorphisms of conserved arrays were instrumental for differentiating closely related strains, e.g., ST1/RT027/B1 strains and pathogenicity locus encoding ST3/RT001 strains. CRISPR spacers showed sequence similarity to phage sequences, which is consistent with the native role of CRISPR-Cas as adaptive immune systems in bacteria. Overall, CRISPR-Cas sequences constitute a valuable basis for genotyping of C. difficile isolates, provide insights into the micro-evolutionary events that occur between closely related strains, and reflect the evolutionary trajectory of these genomes. PMID:27576538

  11. An Evolutionarily Young Polar Bear (Ursus maritimus) Endogenous Retrovirus Identified from Next Generation Sequence Data.

    PubMed

    Tsangaras, Kyriakos; Mayer, Jens; Alquezar-Planas, David E; Greenwood, Alex D

    2015-11-24

    Transcriptome analysis of polar bear (Ursus maritimus) tissues identified sequences with similarity to Porcine Endogenous Retroviruses (PERV). Based on these sequences, four proviral copies and 15 solo long terminal repeats (LTRs) of a newly described endogenous retrovirus were characterized from the polar bear draft genome sequence. Closely related sequences were identified by PCR analysis of brown bear (Ursus arctos) and black bear (Ursus americanus) but were absent in non-Ursinae bear species. The virus was therefore designated UrsusERV. Two distinct groups of LTRs were observed including a recombinant ERV that contained one LTR belonging to each group indicating that genomic invasions by at least two UrsusERV variants have recently occurred. Age estimates based on proviral LTR divergence and conservation of integration sites among ursids suggest the viral group is only a few million years old. The youngest provirus was polar bear specific, had intact open reading frames (ORFs) and could potentially encode functional proteins. Phylogenetic analyses of UrsusERV consensus protein sequences suggest that it is part of a pig, gibbon and koala retrovirus clade. The young age estimates and lineage specificity of the virus suggests UrsusERV is a recent cross species transmission from an unknown reservoir and places the viral group among the youngest of ERVs identified in mammals.

  12. Project 1: Microbial Genomes: A Genomic Approach to Understanding the Evolution of Virulence. Project 2: From Genomes to Life: Drosophilia Development in Space and Time

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Robert DeSalle

    2004-09-10

    This project seeks to use the genomes of two close relatives, A. actinomycetemcomitans and H. aphrophilus, to understand the evolutionary changes that take place in a genome to make it more or less virulent. Our primary specific aim of this project was to sequence, annotate, and analyze the genomes of Actinobacillus actinomycetemcomitans (CU1000, serotype f) and Haemophilus aphrophilus. With these genome sequences we have then compared the whole genome sequences to each other and to the current Aa (HK1651 www.genome.ou.edu) genome project sequence along with other fully sequenced Pasteurellaceae to determine inter and intra species differences that may account formore » the differences and similarities in disease. We also propose to create and curate a comprehensive database where sequence information and analysis for the Pasteurellaceae (family that includes the genera Actinobacillus and Haemophilus) are readily accessible. And finally we have proposed to develop phylogenetic techniques that can be used to efficiently and accurately examine the evolution of genomes. Below we report on progress we have made on these major specific aims. Progress on the specific aims is reported below under two major headings--experimental approaches and bioinformatics and systematic biology approaches.« less

  13. Molecular characterisation of Atlantic salmon paramyxovirus (ASPV): A novel paramyxovirus associated with proliferative gill inflammation

    USGS Publications Warehouse

    Falk, K.; Batts, W.N.; Kvellestad, A.; Kurath, G.; Wiik-Nielsen, J.; Winton, J.R.

    2008-01-01

    Atlantic salmon paramyxovirus (ASPV) was isolated in 1995 from gills of farmed Atlantic salmon suffering from proliferative gill inflammation. The complete genome sequence of ASPV was determined, revealing a genome 16,968 nucleotides in length consisting of six non-overlapping genes coding for the nucleo- (N), phospho- (P), matrix- (M), fusion- (F), haemagglutinin-neuraminidase- (HN) and large polymerase (L) proteins in the order 3???-N-P-M-F-HN-L-5???. The various conserved features related to virus replication found in most paramyxoviruses were also found in ASPV. These include: conserved and complementary leader and trailer sequences, tri-nucleotide intergenic regions and highly conserved transcription start and stop signal sequences. The P gene expression strategy of ASPV was like that of the respiro-, morbilli- and henipaviruses, which express the P and C proteins from the primary transcript and edit a portion of the mRNA to encode V and W proteins. Sequence similarities among various features related to virus replication, pairwise comparisons of all deduced ASPV protein sequences with homologous regions from other members of the family Paramyxoviridae, and phylogenetic analyses of these amino acid sequences suggested that ASPV was a novel member of the sub-family Paramyxovirinae, most closely related to the respiroviruses. ?? 2008 Elsevier B.V. All rights reserved.

  14. Progress in Understanding and Sequencing the Genome of Brassica rapa

    PubMed Central

    Hong, Chang Pyo; Kwon, Soo-Jin; Kim, Jung Sun; Yang, Tae-Jin; Park, Beom-Seok; Lim, Yong Pyo

    2008-01-01

    Brassica rapa, which is closely related to Arabidopsis thaliana, is an important crop and a model plant for studying genome evolution via polyploidization. We report the current understanding of the genome structure of B. rapa and efforts for the whole-genome sequencing of the species. The tribe Brassicaceae, which comprises ca. 240 species, descended from a common hexaploid ancestor with a basic genome similar to that of Arabidopsis. Chromosome rearrangements, including fusions and/or fissions, resulted in the present-day “diploid” Brassica species with variation in chromosome number and phenotype. Triplicated genomic segments of B. rapa are collinear to those of A. thaliana with InDels. The genome triplication has led to an approximately 1.7-fold increase in the B. rapa gene number compared to that of A. thaliana. Repetitive DNA of B. rapa has also been extensively amplified and has diverged from that of A. thaliana. For its whole-genome sequencing, the Brassica rapa Genome Sequencing Project (BrGSP) consortium has developed suitable genomic resources and constructed genetic and physical maps. Ten chromosomes of B. rapa are being allocated to BrGSP consortium participants, and each chromosome will be sequenced by a BAC-by-BAC approach. Genome sequencing of B. rapa will offer a new perspective for plant biology and evolution in the context of polyploidization. PMID:18288250

  15. An Evolutionarily Young Polar Bear (Ursus maritimus) Endogenous Retrovirus Identified from Next Generation Sequence Data

    PubMed Central

    Tsangaras, Kyriakos; Mayer, Jens; Alquezar-Planas, David E.; Greenwood, Alex D.

    2015-01-01

    Transcriptome analysis of polar bear (Ursus maritimus) tissues identified sequences with similarity to Porcine Endogenous Retroviruses (PERV). Based on these sequences, four proviral copies and 15 solo long terminal repeats (LTRs) of a newly described endogenous retrovirus were characterized from the polar bear draft genome sequence. Closely related sequences were identified by PCR analysis of brown bear (Ursus arctos) and black bear (Ursus americanus) but were absent in non-Ursinae bear species. The virus was therefore designated UrsusERV. Two distinct groups of LTRs were observed including a recombinant ERV that contained one LTR belonging to each group indicating that genomic invasions by at least two UrsusERV variants have recently occurred. Age estimates based on proviral LTR divergence and conservation of integration sites among ursids suggest the viral group is only a few million years old. The youngest provirus was polar bear specific, had intact open reading frames (ORFs) and could potentially encode functional proteins. Phylogenetic analyses of UrsusERV consensus protein sequences suggest that it is part of a pig, gibbon and koala retrovirus clade. The young age estimates and lineage specificity of the virus suggests UrsusERV is a recent cross species transmission from an unknown reservoir and places the viral group among the youngest of ERVs identified in mammals. PMID:26610552

  16. Characterization and distribution of a maize cDNA encoding a peptide similar to the catalytic region of second messenger dependent protein kinases

    NASA Technical Reports Server (NTRS)

    Biermann, B.; Johnson, E. M.; Feldman, L. J.

    1990-01-01

    Maize (Zea mays) roots respond to a variety of environmental stimuli which are perceived by a specialized group of cells, the root cap. We are studying the transduction of extracellular signals by roots, particularly the role of protein kinases. Protein phosphorylation by kinases is an important step in many eukaryotic signal transduction pathways. As a first phase of this research we have isolated a cDNA encoding a maize protein similar to fungal and animal protein kinases known to be involved in the transduction of extracellular signals. The deduced sequence of this cDNA encodes a polypeptide containing amino acids corresponding to 33 out of 34 invariant or nearly invariant sequence features characteristic of protein kinase catalytic domains. The maize cDNA gene product is more closely related to the branch of serine/threonine protein kinase catalytic domains composed of the cyclic-nucleotide- and calcium-phospholipid-dependent subfamilies than to other protein kinases. Sequence identity is 35% or more between the deduced maize polypeptide and all members of this branch. The high structural similarity strongly suggests that catalytic activity of the encoded maize protein kinase may be regulated by second messengers, like that of all members of this branch whose regulation has been characterized. Northern hybridization with the maize cDNA clone shows a single 2400 base transcript at roughly similar levels in maize coleoptiles, root meristems, and the zone of root elongation, but the transcript is less abundant in mature leaves. In situ hybridization confirms the presence of the transcript in all regions of primary maize root tissue.

  17. Genomic sequence of mandarin fish rhabdovirus with an unusual small non-transcriptional ORF.

    PubMed

    Tao, Jian-Jun; Zhou, Guang-Zhou; Gui, Jian-Fang; Zhang, Qi-Ya

    2008-03-01

    The complete genome of mandarin fish Siniperca chuatsi rhabdovirus (SCRV) was cloned and sequenced. It comprises 11,545 nucleotides and contains five genes encoding the nucleoprotein N, the phosphoprotein P, the matrix protein M, the glycoprotein G, and the RNA-dependent RNA polymerase protein L. At the 3' and 5' termini of SCRV genome, leader and trailer sequences show inverse complementarity. The N, P, M and G proteins share the highest sequence identities (ranging from 14.8 to 41.5%) with the respective proteins of rhabdovirus 903/87, the L protein has the highest identity with those of vesiculoviruses, especially with Chandipura virus (44.7%). Phylogenetic analysis of L proteins showed that SCRV clustered with spring vireamia of carp virus (SVCV) and was most closely related to viruses in the genus Vesiculovirus. In addition, an overlapping open reading frame (ORF) predicted to encode a protein similar to vesicular stomatitis virus C protein is present within the P gene of SCRV. Furthermore, an unoverlapping small ORF downstream of M ORF within M gene is predicted (tentatively called orf4). Therefore, the genomic organization of SCRV can be proposed as 3' leader-N-P/C-M-(orf4)-G-L-trailer 5'. Orf4 transcription or translation products could not be detected by northern or Western blot, respectively, though one similar mRNA band to M mRNA was found. This is the first report on one small unoverlapping ORF in M gene of a fish rhabdovirus.

  18. Production of recombinant streptokinase from Streptococcus pyogenes isolate and its potential for thrombolytic therapy.

    PubMed

    Assiri, Abdullah S; El-Gamal, Basiouny A; Hafez, Elsayed E; Haidara, Mohamed A

    2014-12-01

    To produce an effective recombinant streptokinase (rSK) from pathogenic Streptococcus pyogenes isolate in yeast, and evaluate its potential for thrombolytic therapy. This study was conducted from November 2012 to December 2013 at King Khalid University, Abha, Kingdom of Saudi Arabia (KSA). Throat swabs collected from 45 pharyngitis patients in Asser Central Hospital, Abha, KSA were used to isolate Streptococcus pyogenes. The bacterial DNA was used for amplification of the streptokinase gene (1200 bp). The gene was cloned and in vitro transcribed in an eukaryotic expression vector that was transformed into yeast Pichia pastoris SMD1168, and the rSK protein was purified and tested for its thrombolytic activity. The Streptococcus pyogenes strain was isolated and its DNA nucleotide sequence revealed similarity to other Streptococcus pyogenes in the Gene bank. Sequencing of the amplified gene based on DNA nucleotide sequence revealed a SK gene closely related to other SK genes in the Gene bank. However, based on deduced amino acids sequence, the gene formed a separate cluster different from clusters formed by other examined genes, suggesting a new bacterial isolate and accordingly a new gene. The purified protein showed 82% clot lysis compared to a commercial SK (81%) at an enzyme concentration of 2000 U/ml. The present yeast rSK showed similar thrombolytic activity in vitro as that of a commercial SK, suggesting its potential for thrombolytic therapy and large scale production. 

  19. Life style and biochemical adaptation in Antarctic fishes

    NASA Astrophysics Data System (ADS)

    di Prisco, Guido

    2000-12-01

    Respiration and metabolism are under investigation in Antarctic fish, in an effort to understand the interplay between ecology and biochemical and physiological processes. Fish of the dominant suborder Notothenioidei are red-blooded, except Channichthyidae (the most phyletically derived family), whose genomes retain transcriptionally inactive DNA sequences closely related to the α-globin gene of red-blooded notothenioids and have lost the β-globin locus. Our structure/function studies on 38 of the 80 red-blooded species are aimed at correlating sequence, multiplicity and oxygen binding with ecological constraints and at obtaining phylogenetic information on evolution. For comparative purposes, this work has been extended to non-Antarctic notothenioids. All sluggish bottom dwellers have a single major hemoglobin (Hb) and often a minor, functionally similar one. Three species of the family Nototheniidae have different life styles. They have uniquely specialised oxygen-transport systems, adjusted to the mode of life of each species. Artedidraconidae have a single Hb, lacking oxygen-binding cooperativity, similar to the ancestral hemoproteins of primitive organisms. The amino acid sequences are currently used in the molecular modelling approach. The study of several enzymes with key roles in metabolism (e.g. glucose-6-phosphate dehydrogenase, L-glutamate dehydrogenase, phosphorylase b, carbonic anhydrase) indicate that some aspects of the molecular structure (e.g. molecular mass, number of subunits, amino acid sequence, temperature of irreversible heat inactivation) have been conserved during development of cold adaptation. However, high catalytic efficiency, possibly due to subtle molecular changes, is observed at low temperature.

  20. Don't Panic! Closed String Tachyons in ALE Spacetimes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Silverstein, Eva M

    2001-08-20

    We consider closed string tachyons localized at the fixed points of noncompact nonsupersymmetric orbifolds. We argue that tachyon condensation drives these orbifolds to flat space or supersymmetric ALE spaces. The decay proceeds via an expanding shell of dilaton gradients and curvature which interpolates between two regions of distinct angular geometry. The string coupling remains weak throughout. For small tachyon VEVs, evidence comes from quiver theories on D-branes probes, in which deformations by twisted couplings smoothly connect non-supersymmetric orbifolds to supersymmetric orbifolds of reduced order. For large tachyon VEVs, evidence comes from worldsheet RG flow and spacetime gravity. For C{sup 2}/Z{submore » n}, we exhibit infinite sequences of transitions producing SUSY ALE spaces via twisted closed string condensation from non-supersymmetric ALE spaces. In a T-dual description this provides a mechanism for creating NS5-branes via closed string tachyon condensation similar to the creation of D-branes via open string tachyon condensation. We also apply our results to recent duality conjectures involving fluxbranes and the type 0 string.« less

  1. Olsenella umbonata sp. nov., a microaerotolerant anaerobic lactic acid bacterium from the sheep rumen and pig jejunum, and emended descriptions of Olsenella, Olsenella uli and Olsenella profusa.

    PubMed

    Kraatz, Mareike; Wallace, R John; Svensson, Liselott

    2011-04-01

    Strain A2 is an anaerobic, variably Gram-stain-positive, non-spore-forming, small and irregularly rod-shaped bacterium from the ruminal fluid of a sheep that has been described informally as a representative of 'Olsenella (basonym Atopobium) oviles'. Three phenotypically similar bacterial strains (lac15, lac16 and lac31(T)) were isolated in concert with Veillonella magna lac18(T) from the mucosal jejunum of a pig. A phylogenetic analysis based on 16S rRNA gene sequences revealed that strains A2, lac15, lac16 and lac31(T) formed a genetically coherent group (100 % interstrain sequence similarity) within the bigeneric Olsenella-Atopobium branch of the family Coriobacteriaceae, class Actinobacteria. This group was most closely related to the type strains of the two recognized Olsenella species, namely Olsenella uli (sequence similarity of 96.85 %) and Olsenella profusa (sequence similarity of 97.20 %). The sequence similarity to the type strain of Atopobium minutum, the type species of the genus Atopobium, was 92.33 %. Unlike those of O. uli and O. profusa, outgrown colonies of strains A2, lac15, lac16 and lac31(T) were opaque and greyish-white with an umbonate elevation on solid culture media. The four novel strains were characterized as being well-adapted and presumably indigenous to the gastrointestinal tract of homoeothermic vertebrates: they were mesophilic, microaerotolerant, neutrophilic and acidotolerant, bile-resistant, mucin-utilizing and markedly peptidolytic lactic acid bacteria. The results of DNA-DNA hybridizations, cellular fatty acid analysis and other differential phenotypic (physiological and biochemical) tests confirmed that strains A2, lac15, lac16 and lac31(T) represent a novel species of the genus Olsenella. On the basis of the genotypic and phenotypic results, we therefore describe Olsenella umbonata sp. nov., with lac31(T) ( = CCUG 58604(T)  = DSM 22620(T)  = JCM 16156(T)) as the type strain and A2 ( = CCUG 58212  = DSM 22619  = JCM 16157) as an additionally available reference strain. Also, based on our data, we propose emended descriptions of the genus Olsenella and the species Olsenella uli and Olsenella profusa.

  2. Manifold learning for automatically predicting articular cartilage morphology in the knee with data from the osteoarthritis initiative (OAI)

    NASA Astrophysics Data System (ADS)

    Donoghue, C.; Rao, A.; Bull, A. M. J.; Rueckert, D.

    2011-03-01

    Osteoarthritis (OA) is a degenerative, debilitating disease with a large socio-economic impact. This study looks to manifold learning as an automatic approach to harness the plethora of data provided by the Osteoarthritis Initiative (OAI). We construct several Laplacian Eigenmap embeddings of articular cartilage appearance from MR images of the knee using multiple MR sequences. A region of interest (ROI) defined as the weight bearing medial femur is automatically located in all images through non-rigid registration. A pairwise intensity based similarity measure is computed between all images, resulting in a fully connected graph, where each vertex represents an image and the weight of edges is the similarity measure. Spectral analysis is then applied to these pairwise similarities, which acts to reduce the dimensionality non-linearly and embeds these images in a manifold representation. In the manifold space, images that are close to each other are considered to be more "similar" than those far away. In the experiment presented here we use manifold learning to automatically predict the morphological changes in the articular cartilage by using the co-ordinates of the images in the manifold as independent variables for multiple linear regression. In the study presented here five manifolds are generated from five sequences of 390 distinct knees. We find statistically significant correlations (up to R2 = 0.75), between our predictors and the results presented in the literature.

  3. Isolation and Distribution of a Novel Iron-Oxidizing Crenarchaeon from Acidic Geothermal Springs in Yellowstone National Park▿ †

    PubMed Central

    Kozubal, M.; Macur, R. E.; Korf, S.; Taylor, W. P.; Ackerman, G. G.; Nagy, A.; Inskeep, W. P.

    2008-01-01

    Novel thermophilic crenarchaea have been observed in Fe(III) oxide microbial mats of Yellowstone National Park (YNP); however, no definitive work has identified specific microorganisms responsible for the oxidation of Fe(II). The objectives of the current study were to isolate and characterize an Fe(II)-oxidizing member of the Sulfolobales observed in previous 16S rRNA gene surveys and to determine the abundance and distribution of close relatives of this organism in acidic geothermal springs containing high concentrations of dissolved Fe(II). Here we report the isolation and characterization of the novel, Fe(II)-oxidizing, thermophilic, acidophilic organism Metallosphaera sp. strain MK1 obtained from a well-characterized acid-sulfate-chloride geothermal spring in Norris Geyser Basin, YNP. Full-length 16S rRNA gene sequence analysis revealed that strain MK1 exhibits only 94.9 to 96.1% sequence similarity to other known Metallosphaera spp. and less than 89.1% similarity to known Sulfolobus spp. Strain MK1 is a facultative chemolithoautotroph with an optimum pH range of 2.0 to 3.0 and an optimum temperature range of 65 to 75°C. Strain MK1 grows optimally on pyrite or Fe(II) sorbed onto ferrihydrite, exhibiting doubling times between 10 and 11 h under aerobic conditions (65°C). The distribution and relative abundance of MK1-like 16S rRNA gene sequences in 14 acidic geothermal springs containing Fe(III) oxide microbial mats were evaluated. Highly related MK1-like 16S rRNA gene sequences (>99% sequence similarity) were consistently observed in Fe(III) oxide mats at temperatures ranging from 55 to 80°C. Quantitative PCR using Metallosphaera-specific primers confirmed that organisms highly similar to strain MK1 comprised up to 40% of the total archaeal community at selected sites. The broad distribution of highly related MK1-like 16S rRNA gene sequences in acidic Fe(III) oxide microbial mats is consistent with the observed characteristics and growth optima of Metallosphaera-like strain MK1 and emphasizes the importance of this newly described taxon in Fe(II) chemolithotrophy in acidic high-temperature environments of YNP. PMID:18083851

  4. Waveform Classification of the 2016 Gyeongju Earthquake Sequence Using Hierarchical Clustering

    NASA Astrophysics Data System (ADS)

    Shin, J. S.; Son, M.; Cho, C.

    2017-12-01

    The 2016 Gyeongju earthquakes, including the ML 5.8 earthquake of September 12, 2016 ccurred around the Yangsan Fault System, which is the most prominent set of lineaments on the Korean Peninsula. The main event is the largest earthquake recorded since instrumental recording began in South Korea We analysed the waveforms of earthquake sequence to better understand the seismicity around this fault system. We defined groups of relocated hypocenters using hierarchical clustering based on waveform similarity. The 2016 Gyeongju events are classified into three major groups: Group A with 185 events, Group B with 134 events, and Group C with 45 events. The waveform similarity of each group was confirmed by the matrix of correlation coefficients. The three groups of waveforms wereare identified in space: the events of Group A occurred at shallower depths than those of Group B, while those of Group C occurred at intermediate depths at the north side. The eight major events occurred in the area including Group A and Group B, whereas the area of Group C produceds no major events. Therefore, the area of Group C couldcan be excluded in considering a major asperity for the Gyeongju earthquakes. Earthquakes that are close together spatially with similar rupture mechanisms produce similar waveforms at the same common station. Thus, the hypocenters classified from the three groups of waveforms, based on waveform similarity imply that the inferred fault plane contains three zones locked under slightly different conditions.

  5. Identification and Characterization of a Novel Alpaca Respiratory Coronavirus Most Closely Related to the Human Coronavirus 229E

    PubMed Central

    Crossley, Beate M.; Mock, Richard E.; Callison, Scott A.; Hietala, Sharon K.

    2012-01-01

    In 2007, a novel coronavirus associated with an acute respiratory disease in alpacas (Alpaca Coronavirus, ACoV) was isolated. Full-length genomic sequencing of the ACoV demonstrated the genome to be consistent with other Alphacoronaviruses. A putative additional open-reading frame was identified between the nucleocapsid gene and 3'UTR. The ACoV was genetically most similar to the common human coronavirus (HCoV) 229E with 92.2% nucleotide identity over the entire genome. A comparison of spike gene sequences from ACoV and from HCoV-229E isolates recovered over a span of five decades showed the ACoV to be most similar to viruses isolated in the 1960’s to early 1980’s. The true origin of the ACoV is unknown, however a common ancestor between the ACoV and HCoV-229E appears to have existed prior to the 1960’s, suggesting virus transmission, either as a zoonosis or anthroponosis, has occurred between alpacas and humans. PMID:23235471

  6. Pulmonary parenchyma segmentation in thin CT image sequences with spectral clustering and geodesic active contour model based on similarity

    NASA Astrophysics Data System (ADS)

    He, Nana; Zhang, Xiaolong; Zhao, Juanjuan; Zhao, Huilan; Qiang, Yan

    2017-07-01

    While the popular thin layer scanning technology of spiral CT has helped to improve diagnoses of lung diseases, the large volumes of scanning images produced by the technology also dramatically increase the load of physicians in lesion detection. Computer-aided diagnosis techniques like lesions segmentation in thin CT sequences have been developed to address this issue, but it remains a challenge to achieve high segmentation efficiency and accuracy without much involvement of human manual intervention. In this paper, we present our research on automated segmentation of lung parenchyma with an improved geodesic active contour model that is geodesic active contour model based on similarity (GACBS). Combining spectral clustering algorithm based on Nystrom (SCN) with GACBS, this algorithm first extracts key image slices, then uses these slices to generate an initial contour of pulmonary parenchyma of un-segmented slices with an interpolation algorithm, and finally segments lung parenchyma of un-segmented slices. Experimental results show that the segmentation results generated by our method are close to what manual segmentation can produce, with an average volume overlap ratio of 91.48%.

  7. Characterization of CG6178 gene product with high sequence similarity to firefly luciferase in Drosophila melanogaster.

    PubMed

    Oba, Yuichi; Ojika, Makoto; Inouye, Satoshi

    2004-03-31

    This is the first identification of a long-chain fatty acyl-CoA synthetase in Drosophila by enzymatic characterization. The gene product of CG6178 (CG6178) in Drosophila melanogaster genome, which has a high sequence similarity to firefly luciferase, has been expressed and characterized. CG6178 showed long-chain fatty acyl-CoA synthetic activity in the presence of ATP, CoA and Mg(2+), suggesting a fatty acyl adenylate is an intermediate. Recently, it was revealed that firefly luciferase has two catalytic functions, monooxygenase (luciferase) and AMP-mediated CoA ligase (fatty acyl-CoA synthetase). However, unlike firefly luciferase, CG6178 did not show luminescence activity in the presence of firefly luciferin, ATP, CoA and Mg(2+). The enzymatic properties of CG6178 including substrate specificity, pH dependency and optimal temperature were close to those of firefly luciferase and rat fatty acyl-CoA synthetase. Further, phylogenic analyses strongly suggest that the firefly luciferase gene may have evolved from a fatty acyl-CoA synthetase gene as a common ancestral gene.

  8. Complete Genome Sequence of a Street Rabies Virus Isolated from a Dog in Nigeria

    PubMed Central

    Zhou, Ming; Zhou, Zutao; Kia, Grace S. N.; Gnanadurai, Clement W.; Leyson, Christina M.; Umoh, Jarlath U.; Kwaga, Jacob P.; Kazeem, Haruna M.

    2013-01-01

    A canine rabies virus (RABV) was isolated from a trade dog in Nigeria. Its entire genome was sequenced and found to be closely related to canine RABVs circulating in Africa. Sequence comparison indicates that the virus is closely related to the Africa 2 RABV lineage. The virus is now termed DRV-NG11. PMID:23469344

  9. Genetic diversity of Rhizobia isolates from Amazon soils using cowpea (Vigna unguiculata) as trap plant

    PubMed Central

    Silva, F.V.; Simões-Araújo, J.L.; Silva Júnior, J.P.; Xavier, G.R.; Rumjanek, N.G.

    2012-01-01

    The aim of this work was to characterize rhizobia isolated from the root nodules of cowpea (Vigna unguiculata) plants cultivated in Amazon soils samples by means of ARDRA (Amplified rDNA Restriction Analysis) and sequencing analysis, to know their phylogenetic relationships. The 16S rRNA gene of rhizobia was amplified by PCR (polymerase chain reaction) using universal primers Y1 and Y3. The amplification products were analyzed by the restriction enzymes HinfI, MspI and DdeI and also sequenced with Y1, Y3 and six intermediate primers. The clustering analysis based on ARDRA profiles separated the Amazon isolates in three subgroups, which formed a group apart from the reference isolates of Bradyrhizobium japonicum and Bradyrhizobium elkanii. The clustering analysis of 16S rRNA gene sequences showed that the fast-growing isolates had similarity with Enterobacter, Rhizobium, Klebsiella and Bradyrhizobium and all the slow-growing clustered close to Bradyrhizobium. PMID:24031880

  10. Isolation and characterization of lymphocyte-like cells from a lamprey

    PubMed Central

    Mayer, Werner E.; Uinuk-ool, Tatiana; Tichy, Herbert; Gartland, Lanier A.; Klein, Jan; Cooper, Max D.

    2002-01-01

    Lymphocyte-like cells in the intestine of the sea lamprey, Petromyzon marinus, were isolated by flow cytometry under light-scatter conditions used for the purification of mouse intestinal lymphocytes. The purified lamprey cells were morphologically indistinguishable from mammalian lymphocytes. A cDNA library was prepared from the lamprey lymphocyte-like cells, and more than 8,000 randomly selected clones were sequenced. Homology searches comparing these ESTs with sequences deposited in the databases led to the identification of numerous genes homologous to those predominantly or characteristically expressed in mammalian lymphocytes, which included genes controlling lymphopoiesis, intracellular signaling, proliferation, migration, and involvement of lymphocytes in innate immune responses. Genes closely related to those that in gnathostomes control antigen processing and transport of antigenic peptides could be ascertained, although no sequences with significant similarity to MHC, T cell receptor, or Ig genes were found. The data suggest that the evolution of lymphocytes in the lamprey has reached a stage poised for the emergence of adaptive immunity. PMID:12388781

  11. Molecular prevalence and genetic diversity of bovine Theileria orientalis in Myanmar.

    PubMed

    Bawm, Saw; Shimizu, Kohei; Hirota, Jun-Ichi; Tosa, Yusuke; Htun, Lat Lat; Maw, Ni Ni; Thein, Myint; Kato, Hirotomo; Sakurai, Tatsuya; Katakura, Ken

    2014-08-01

    Theileria orientalis is a causative agent of benign theileriosis in cattle and distributed in mainly Asian countries. In the present study, we examined the prevalence of T. orientalis infection by PCR based on the major piroplasm surface protein gene (MPSP) sequences in cattle in Myanmar, followed by phylogenetic analysis of the MPSP genes. The MPSP gene was amplified in 258 of 713 (36.2%) cattle blood DNA samples collected from five cities in different geographical regions of Myanmar. Phylogenetic analysis of MPSP sequences from 54 T. orientalis-positive DNA samples revealed the presence of six allelic genotypes, including Types 1, 3, 4, 5, 7, and N-3. Types 5 and 7 were the predominant types detected. Sequences of the MPSP genes detected in Myanmar were closely related to those from Thailand, Vietnam or Mongolia. These findings suggest that movement of animals carrying T. orientalis parasites between Southeast Asian countries could be a reason for the similar genotype distribution of the parasites in Myanmar. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

  12. The genome of the Lactobacillus sanfranciscensis temperate phage EV3

    PubMed Central

    2013-01-01

    Background Bacteriophages infection modulates microbial consortia and transduction is one of the most important mechanism involved in the bacterial evolution. However, phage contamination brings food fermentations to a halt causing economic setbacks. The number of phage genome sequences of lactic acid bacteria especially of lactobacilli is still limited. We analysed the genome of a temperate phage active on Lactobacillus sanfranciscensis, the predominant strain in type I sourdough fermentations. Results Sequencing of the DNA of EV3 phage revealed a genome of 34,834 bp and a G + C content of 36.45%. Of the 43 open reading frames (ORFs) identified, all but eight shared homology with other phages of lactobacilli. A similar genomic organization and mosaic pattern of identities align EV3 with the closely related Lactobacillus vaginalis ATCC 49540 prophage. Four unknown ORFs that had no homologies in the databases or predicted functions were identified. Notably, EV3 encodes a putative dextranase. Conclusions EV3 is the first L. sanfranciscensis phage that has been completely sequenced so far. PMID:24308641

  13. Weissella ghanensis sp. nov., isolated from a Ghanaian cocoa fermentation.

    PubMed

    De Bruyne, Katrien; Camu, Nicholas; Lefebvre, Karen; De Vuyst, Luc; Vandamme, Peter

    2008-12-01

    During a study on lactic acid bacteria (and their species diversity) in spontaneous heap fermentations of Ghanaian cocoa beans, two strains, designated 215(T) and 194B, were isolated. A phylogenetic analysis based on 16S rRNA gene sequences demonstrated that these strains represented a distinct lineage close to the genus Weissella and showing only 92.1 % 16S rRNA gene sequence similarity with respect to their closest neighbour, Weissella soli LMG 20113(T). Whole-cell protein electrophoresis, fluorescent amplified fragment length polymorphism fingerprinting of whole genomes and physiological and biochemical tests confirmed the unique taxonomic position of the two novel isolates. On the basis of the results of the morphological and biochemical tests and 16S rRNA gene sequence analysis, strains 215(T) and 194B represent the most peripheral lineage of the genus Weissella, for which we propose the name Weissella ghanensis sp. nov. The type strain is 215(T) (=LMG 24286(T)=DSM 19935(T)).

  14. Development of a polymerase chain reaction assay for the specific identification of Burkholderia mallei and differentiation from Burkholderia pseudomallei and other closely related Burkholderiaceae.

    PubMed

    Ulrich, Ricky L; Ulrich, Melanie P; Schell, Mark A; Kim, H Stanley; DeShazer, David

    2006-05-01

    Burkholderia mallei and Burkholderia pseudomallei, the etiologic agents responsible for glanders and melioidosis, respectively, are genetically and phenotypically similar and are category B biothreat agents. We used an in silico approach to compare the B. mallei ATCC 23344 and B. pseudomallei K96243 genomes to identify nucleotide sequences unique to B. mallei. Five distinct B. mallei DNA sequences and/or genes were identified and evaluated for polymerase chain reaction (PCR) assay development. Genomic DNAs from a collection of 31 B. mallei and 34 B. pseudomallei isolates, obtained from various geographic, clinical, and environmental sources over a 70-year period, were tested with PCR primers targeted for each of the B. mallei ATCC 23344-specific nucleotide sequences. Of the 5 chromosomal targets analyzed, only PCR primers designed to bimA(Bm) were specific for B. mallei. These primers were used to develop a rapid PCR assay for the definitive identification of B. mallei and differentiation from all other bacteria.

  15. Evaluation and Selection of Best Priority Sequencing Rule in Job Shop Scheduling using Hybrid MCDM Technique

    NASA Astrophysics Data System (ADS)

    Kiran Kumar, Kalla; Nagaraju, Dega; Gayathri, S.; Narayanan, S.

    2017-05-01

    Priority Sequencing Rules provide the guidance for the order in which the jobs are to be processed at a workstation. The application of different priority rules in job shop scheduling gives different order of scheduling. More experimentation needs to be conducted before a final choice is made to know the best priority sequencing rule. Hence, a comprehensive method of selecting the right choice is essential in managerial decision making perspective. This paper considers seven different priority sequencing rules in job shop scheduling. For evaluation and selection of the best priority sequencing rule, a set of eight criteria are considered. The aim of this work is to demonstrate the methodology of evaluating and selecting the best priority sequencing rule by using hybrid multi criteria decision making technique (MCDM), i.e., analytical hierarchy process (AHP) with technique for order preference by similarity to ideal solution (TOPSIS). The criteria weights are calculated by using AHP whereas the relative closeness values of all priority sequencing rules are computed based on TOPSIS with the help of data acquired from the shop floor of a manufacturing firm. Finally, from the findings of this work, the priority sequencing rules are ranked from most important to least important. The comprehensive methodology presented in this paper is very much essential for the management of a workstation to choose the best priority sequencing rule among the available alternatives for processing the jobs with maximum benefit.

  16. On the relationship between residue structural environment and sequence conservation in proteins.

    PubMed

    Liu, Jen-Wei; Lin, Jau-Ji; Cheng, Chih-Wen; Lin, Yu-Feng; Hwang, Jenn-Kang; Huang, Tsun-Tsao

    2017-09-01

    Residues that are crucial to protein function or structure are usually evolutionarily conserved. To identify the important residues in protein, sequence conservation is estimated, and current methods rely upon the unbiased collection of homologous sequences. Surprisingly, our previous studies have shown that the sequence conservation is closely correlated with the weighted contact number (WCN), a measure of packing density for residue's structural environment, calculated only based on the C α positions of a protein structure. Moreover, studies have shown that sequence conservation is correlated with environment-related structural properties calculated based on different protein substructures, such as a protein's all atoms, backbone atoms, side-chain atoms, or side-chain centroid. To know whether the C α atomic positions are adequate to show the relationship between residue environment and sequence conservation or not, here we compared C α atoms with other substructures in their contributions to the sequence conservation. Our results show that C α positions are substantially equivalent to the other substructures in calculations of various measures of residue environment. As a result, the overlapping contributions between C α atoms and the other substructures are high, yielding similar structure-conservation relationship. Take the WCN as an example, the average overlapping contribution to sequence conservation is 87% between C α and all-atom substructures. These results indicate that only C α atoms of a protein structure could reflect sequence conservation at the residue level. © 2017 Wiley Periodicals, Inc.

  17. Sequence requirement of the ade6-4095 meiotic recombination hotspot in Schizosaccharomyces pombe.

    PubMed

    Foulis, Steven J; Fowler, Kyle R; Steiner, Walter W

    2018-02-01

    Homologous recombination occurs at a greatly elevated frequency in meiosis compared to mitosis and is initiated by programmed double-strand DNA breaks (DSBs). DSBs do not occur at uniform frequency throughout the genome in most organisms, but occur preferentially at a limited number of sites referred to as hotspots. The location of hotspots have been determined at nucleotide-level resolution in both the budding and fission yeasts, and while several patterns have emerged regarding preferred locations for DSB hotspots, it remains unclear why particular sites experience DSBs at much higher frequency than other sites with seemingly similar properties. Short sequence motifs, which are often sites for binding of transcription factors, are known to be responsible for a number of hotspots. In this study we identified the minimum sequence required for activity of one of such motif identified in a screen of random sequences capable of producing recombination hotspots. The experimentally determined sequence, GGTCTRGACC, closely matches the previously inferred sequence. Full hotspot activity requires an effective sequence length of 9.5 bp, whereas moderate activity requires an effective sequence length of approximately 8.2 bp and shows significant association with DSB hotspots. In combination with our previous work, this result is consistent with a large number of different sequence motifs capable of producing recombination hotspots, and supports a model in which hotspots can be rapidly regenerated by mutation as they are lost through recombination.

  18. Streptococcus loxodontisalivarius sp. nov. and Streptococcus saliviloxodontae sp. nov., isolated from oral cavities of elephants.

    PubMed

    Saito, Masanori; Shinozaki-Kuwahara, Noriko; Hirasawa, Masatomo; Takada, Kazuko

    2014-09-01

    Four Gram-stain-positive, catalase-negative, coccoid-shaped organisms were isolated from elephant oral cavities. The isolates were tentatively identified as streptococcal species based on the results of biochemical tests. Comparative 16S rRNA gene sequencing studies confirmed the organisms to be members of the genus Streptococcus. Two isolates (NUM 6304(T) and NUM 6312) were related most closely to Streptococcus salivarius with 96.8 % and 93.1 % similarity based on the 16S rRNA gene and the RNA polymerase β subunit encoding gene (rpoB), respectively, and to Streptococcus vestibularis with 83.7 % similarity based on the 60 kDa heat-shock protein gene (groEL). The other two isolates (NUM 6306(T) and NUM 6318) were related most closely to S. vestibularis with 97.0 % and 82.9 % similarity based on the 16S rRNA and groEL genes, respectively, and to S. salivarius with 93.5 % similarity based on the rpoB gene. Based on phylogenetic and phenotypic evidence, these isolates are suggested to represent novel species of the genus Streptococcus, for which the names Streptococcus loxodontisalivarius sp. nov. (type strain NUM 6304(T) = JCM 19287(T) = DSM 27382(T)) and Streptococcus saliviloxodontae sp. nov. (type strain NUM 6306(T) = JCM 19288(T) = DSM 27513(T)) are proposed. © 2014 IUMS.

  19. Antisense transcription is pervasive but rarely conserved in enteric bacteria.

    PubMed

    Raghavan, Rahul; Sloan, Daniel B; Ochman, Howard

    2012-01-01

    Noncoding RNAs, including antisense RNAs (asRNAs) that originate from the complementary strand of protein-coding genes, are involved in the regulation of gene expression in all domains of life. Recent application of deep-sequencing technologies has revealed that the transcription of asRNAs occurs genome-wide in bacteria. Although the role of the vast majority of asRNAs remains unknown, it is often assumed that their presence implies important regulatory functions, similar to those of other noncoding RNAs. Alternatively, many antisense transcripts may be produced by chance transcription events from promoter-like sequences that result from the degenerate nature of bacterial transcription factor binding sites. To investigate the biological relevance of antisense transcripts, we compared genome-wide patterns of asRNA expression in closely related enteric bacteria, Escherichia coli and Salmonella enterica serovar Typhimurium, by performing strand-specific transcriptome sequencing. Although antisense transcripts are abundant in both species, less than 3% of asRNAs are expressed at high levels in both species, and only about 14% appear to be conserved among species. And unlike the promoters of protein-coding genes, asRNA promoters show no evidence of sequence conservation between, or even within, species. Our findings suggest that many or even most bacterial asRNAs are nonadaptive by-products of the cell's transcription machinery. IMPORTANCE Application of high-throughput methods has revealed the expression throughout bacterial genomes of transcripts encoded on the strand complementary to protein-coding genes. Because transcription is costly, it is usually assumed that these transcripts, termed antisense RNAs (asRNAs), serve some function; however, the role of most asRNAs is unclear, raising questions about their relevance in cellular processes. Because natural selection conserves functional elements, comparisons between related species provide a method for assessing functionality genome-wide. Applying such an approach, we assayed all transcripts in two closely related bacteria, Escherichia coli and Salmonella enterica serovar Typhimurium, and demonstrate that, although the levels of genome-wide antisense transcription are similarly high in both bacteria, only a small fraction of asRNAs are shared across species. Moreover, the promoters associated with asRNAs show no evidence of sequence conservation between, or even within, species. These findings indicate that despite the genome-wide transcription of asRNAs, many of these transcripts are likely nonfunctional.

  20. A community of unknown, endophytic fungi in western white pine.

    PubMed

    Ganley, Rebecca J; Brunsfeld, Steven J; Newcombe, George

    2004-07-06

    The endophytic fungi of woody plants may be diverse as often claimed, and likewise, they may be functionally novel as demonstrated in a few studies. However, the endophyte taxa that are most frequently reported tend to belong to fungal groups composed of morphologically similar endophytes and parasites. Thus, it is plausible that endophytes are known (i.e., described) parasites in a latent phase within the host. If this null hypothesis were true, endophytes would represent neither additional fungal diversity distinct from parasite diversity nor a symbiont community likely to be novel ecologically. To be synonymous with parasites of the host, endophytes should at least be most closely related to those same parasites. Here we report that seven distinct parasites of Pinus monticola do not occur as endophytes. The majority of endophytes of P. monticola (90% of 2,019 cultures) belonged to one fungal family, the Rhytismataceae. However, not a single rhytismataceous endophyte was found to be most closely related by sequence homology to the three known rhytismataceous parasites of P. monticola. Similarly, neither endophytic Mycosphaerella nor endophytic Rhizosphaera isolates were most closely related to known parasites of P. monticola. Morphologically, the endophytes of P. monticola can be confounded with the parasites of the same host. However, they are actually most closely related to, but distinct from, parasites of other species of Pinus. If endophytes are generally unknown species, then estimates of 1 million endophytes (i.e., approximately 1 in 14 of all species of life) seem reasonable.

  1. Diversification and microscopic structure of tissues in endemic and endangered species of Dawkinsia tambraparniei from the river Tamiraparani, Tamil Nadu, India.

    PubMed

    Mohan, Divya Sapphire; Arumugam, Sabaridasan; Ramaiah, Soranam

    2018-03-01

    We investigated the study on the endemic and endangered species of Dawkinsia tambraparniei were confined only the areas of the river Tamiraparani. These species are under threats due to the menace of anthropogenic stress. To recognize the crisis behind the particular species, it was analyzed histologically and molecularly from the five pollutant levels of river Tamiraparani. Histologically, the microscopic examinations were also carried out from the crucial organs such as the brain, gill, heart, kidney, and liver, which confirm the spiky survivability of the endemic fish. Assessment of fish organ damages was observed highly in Kokkirakulam and Vannarapettai. Probably with conserved molecular sequences, the species can be identified out from the encountered surveillance of the particular taxa leading to the evolutionary circumstances. The phylogenetic analysis of Dawkinsia tambraparniei populations showed that Cheranmadevi and Vallandau sites populations were closely distributed. Even though the species have similarity sequences of each population were shown that the closely related with same genus but other sub-species. The observed results emphasize the conventional measures to conserve the endemic species and more effectual planning to the proximity of endurances in inhabited zone.

  2. Genome sequences of two closely related strains of Escherichia coli K-12 GM4792.

    PubMed

    Zhang, Yan-Cong; Zhang, Yan; Zhu, Bi-Ru; Zhang, Bo-Wen; Ni, Chuan; Zhang, Da-Yong; Huang, Ying; Pang, Erli; Lin, Kui

    2015-01-01

    Escherichia coli lab strains K-12 GM4792 Lac(+) and GM4792 Lac(-) carry opposite lactose markers, which are useful for distinguishing evolved lines as they produce different colored colonies. The two closely related strains are chosen as ancestors for our ongoing studies of experimental evolution. Here, we describe the genome sequences, annotation, and features of GM4792 Lac(+) and GM4792 Lac(-). GM4792 Lac(+) has a 4,622,342-bp long chromosome with 4,061 protein-coding genes and 83 RNA genes. Similarly, the genome of GM4792 Lac(-) consists of a 4,621,656-bp chromosome containing 4,043 protein-coding genes and 74 RNA genes. Genome comparison analysis reveals that the differences between GM4792 Lac(+) and GM4792 Lac(-) are minimal and limited to only the targeted lac region. Moreover, a previous study on competitive experimentation indicates the two strains are identical or nearly identical in survivability except for lactose utilization in a nitrogen-limited environment. Therefore, at both a genetic and a phenotypic level, GM4792 Lac(+) and GM4792 Lac(-), with opposite neutral markers, are ideal systems for future experimental evolution studies.

  3. Delineating closely related dinoflagellate lineages using phylotranscriptomics.

    PubMed

    Annenkova, Nataliia V; Ahrén, Dag; Logares, Ramiro; Kremp, Anke; Rengefors, Karin

    2018-04-20

    Recently radiated dinoflagellates Apocalathium aciculiferum (collected in Lake Erken, Sweden), A. malmogiense (Baltic Sea) and Apocalathium aff. malmogiense (Highway Lake, Antarctica) represent a lineage with an unresolved phylogeny. We determined their phylogenetic relationships using phylotranscriptomics based on 792 amino acid sequences. Our results showed that A. aciculiferum diverged from the other two closely related lineages, consistent with their different morphologies in cell size, relative cell length and presence of spines. We hypothesized that A. aff. malmogiense and A. malmogiense, which inhabit different hemispheres, are evolutionarily more closely related because they diverged from a marine common ancestor, adapting to a wide salinity range, while A. aciculiferum colonized a freshwater habitat, by acquiring adaptations to this environment, in particular, salinity intolerance. We show that phylotranscriptomics can resolve the phylogeny of recently diverged protists. This has broad relevance, given that many phytoplankton species are morphologically very similar, and single genes sometimes lack the information to determine species' relationships. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

  4. [Genome similarity of Baikal omul and sig].

    PubMed

    Bychenko, O S; Sukhanova, L V; Ukolova, S S; Skvortsov, T A; Potapov, V K; Azhikina, T L; Sverdlov, E D

    2009-01-01

    Two members of the Baikal sig family, a lake sig (Coregonus lavaretus baicalensis Dybovsky) and omul (C. autumnalis migratorius Georgi), are close relatives that diverged from the same ancestor 10-20 thousand years ago. In this work, we studied genomic polymorphism of these two fish species. The method of subtraction hybridization (SH) did not reveal the presence of extended sequences in the sig genome and their absence in the omul genome. All the fragments found by SH corresponded to polymorphous noncoding genome regions varying in mononucleotide substitutions and short deletions. Many of them are mapped close to genes of the immune system and have regions identical to the Tc-1-like transposons abundant among fish, whose transcription activity may affect the expression of adjacent genes. Thus, we showed for the first time that genetic differences between Baikal sig family members are extremely small and cannot be revealed by the SH method. This is another endorsement of the hypothesis on the close relationship between Baikal sig and omul and their evolutionarily recent divergence from a common ancestor.

  5. Actinomyces haliotis sp. nov., a bacterium isolated from the gut of an abalone, Haliotis discus hannai.

    PubMed

    Hyun, Dong-Wook; Shin, Na-Ri; Kim, Min-Soo; Kim, Pil Soo; Kim, Joon Yong; Whon, Tae Woong; Bae, Jin-Woo

    2014-02-01

    A novel, Gram-staining-positive, facultatively anaerobic, non-motile and coccus-shaped bacterium, strain WL80(T), was isolated from the gut of an abalone, Haliotis discus hannai, collected from the northern coast of Jeju in Korea. Optimal growth occurred at 30 °C, pH 7-8 and with 1% (w/v) NaCl. Phylogenetic analyses based on the 16S rRNA gene sequence revealed that strain WL80(T) fell within the cluster of the genus Actinomyces, with highest sequence similarity to the type strains of Actinomyces radicidentis (98.8% similarity) and Actinomyces urogenitalis (97.0% similarity). The major cellular fatty acids were C18 : 1ω9c and C16 : 0. Menaquinone-10 (H4) was the major respiratory quinone. The genomic DNA G+C content of the isolate was 70.4 mol%. DNA-DNA hybridization values with closely related strains indicated less than 7.6% genomic relatedness. The results of physiological, biochemical, chemotaxonomic and genotypic analyses indicated that strain WL80(T) represents a novel species of the genus Actinomyces, for which the name Actinomyces haliotis sp. nov. is proposed. The type strain is WL80(T) ( = KACC 17211(T) = JCM 18848(T)).

  6. A local duplication of the Melanocortin receptor 1 locus in Astyanax

    PubMed Central

    Gross, Joshua B.; Weagley, James; Stahl, Bethany A.; Ma, Li; Espinasa, Luis; McGaugh, Suzanne E.

    2017-01-01

    In this study, we report evidence of a novel duplication of Melanocortin receptor 1 (Mc1r) in the cavefish genome. This locus was discovered following the observation of excessive allelic diversity in a ~820 bp fragment of Mc1r amplified via degenerate PCR from a natural population of Astyanax aeneus fish from Guerrero, Mexico. The cavefish genome reveals the presence of two closely related Mc1r open reading frames separated by a 1.46 kb intergenic region. One open reading frame corresponds to the previously reported Mc1r receptor, and the other open reading frame (duplicate copy) is 975 bp in length, encoding a receptor of 325 amino acids. Sequence similarity analyses position both copies in the syntenic region of the single Mc1r locus in 16 representative craniate genomes spanning bony fish (including Astyanax) to mammals, suggesting we discovered tandem duplicates of this important gene. The two Mc1r copies share ~89% sequence similarity, and, within Astyanax, are more similar to one another compared to other melanocortin family members. Future studies will inform the precise functional significance of the duplicated Mc1r locus, and if this novel copy number variant may have adaptive significance for the Astyanax lineage. PMID:28738163

  7. Integrating alignment-based and alignment-free sequence similarity measures for biological sequence classification.

    PubMed

    Borozan, Ivan; Watt, Stuart; Ferretti, Vincent

    2015-05-01

    Alignment-based sequence similarity searches, while accurate for some type of sequences, can produce incorrect results when used on more divergent but functionally related sequences that have undergone the sequence rearrangements observed in many bacterial and viral genomes. Here, we propose a classification model that exploits the complementary nature of alignment-based and alignment-free similarity measures with the aim to improve the accuracy with which DNA and protein sequences are characterized. Our model classifies sequences using a combined sequence similarity score calculated by adaptively weighting the contribution of different sequence similarity measures. Weights are determined independently for each sequence in the test set and reflect the discriminatory ability of individual similarity measures in the training set. Because the similarity between some sequences is determined more accurately with one type of measure rather than another, our classifier allows different sets of weights to be associated with different sequences. Using five different similarity measures, we show that our model significantly improves the classification accuracy over the current composition- and alignment-based models, when predicting the taxonomic lineage for both short viral sequence fragments and complete viral sequences. We also show that our model can be used effectively for the classification of reads from a real metagenome dataset as well as protein sequences. All the datasets and the code used in this study are freely available at https://collaborators.oicr.on.ca/vferretti/borozan_csss/csss.html. ivan.borozan@gmail.com Supplementary data are available at Bioinformatics online. © The Author 2015. Published by Oxford University Press.

  8. Integrating alignment-based and alignment-free sequence similarity measures for biological sequence classification

    PubMed Central

    Borozan, Ivan; Watt, Stuart; Ferretti, Vincent

    2015-01-01

    Motivation: Alignment-based sequence similarity searches, while accurate for some type of sequences, can produce incorrect results when used on more divergent but functionally related sequences that have undergone the sequence rearrangements observed in many bacterial and viral genomes. Here, we propose a classification model that exploits the complementary nature of alignment-based and alignment-free similarity measures with the aim to improve the accuracy with which DNA and protein sequences are characterized. Results: Our model classifies sequences using a combined sequence similarity score calculated by adaptively weighting the contribution of different sequence similarity measures. Weights are determined independently for each sequence in the test set and reflect the discriminatory ability of individual similarity measures in the training set. Because the similarity between some sequences is determined more accurately with one type of measure rather than another, our classifier allows different sets of weights to be associated with different sequences. Using five different similarity measures, we show that our model significantly improves the classification accuracy over the current composition- and alignment-based models, when predicting the taxonomic lineage for both short viral sequence fragments and complete viral sequences. We also show that our model can be used effectively for the classification of reads from a real metagenome dataset as well as protein sequences. Availability and implementation: All the datasets and the code used in this study are freely available at https://collaborators.oicr.on.ca/vferretti/borozan_csss/csss.html. Contact: ivan.borozan@gmail.com Supplementary information: Supplementary data are available at Bioinformatics online. PMID:25573913

  9. High quality de novo sequencing and assembly of the Saccharomyces arboricolus genome

    PubMed Central

    2013-01-01

    Background Comparative genomics is a formidable tool to identify functional elements throughout a genome. In the past ten years, studies in the budding yeast Saccharomyces cerevisiae and a set of closely related species have been instrumental in showing the benefit of analyzing patterns of sequence conservation. Increasing the number of closely related genome sequences makes the comparative genomics approach more powerful and accurate. Results Here, we report the genome sequence and analysis of Saccharomyces arboricolus, a yeast species recently isolated in China, that is closely related to S. cerevisiae. We obtained high quality de novo sequence and assemblies using a combination of next generation sequencing technologies, established the phylogenetic position of this species and considered its phenotypic profile under multiple environmental conditions in the light of its gene content and phylogeny. Conclusions We suggest that the genome of S. arboricolus will be useful in future comparative genomics analysis of the Saccharomyces sensu stricto yeasts. PMID:23368932

  10. Detection and full genome characterization of two beta CoV viruses related to Middle East respiratory syndrome from bats in Italy.

    PubMed

    Moreno, Ana; Lelli, Davide; de Sabato, Luca; Zaccaria, Guendalina; Boni, Arianna; Sozzi, Enrica; Prosperi, Alice; Lavazza, Antonio; Cella, Eleonora; Castrucci, Maria Rita; Ciccozzi, Massimo; Vaccari, Gabriele

    2017-12-19

    Middle East respiratory syndrome coronavirus (MERS-CoV), which belongs to beta group of coronavirus, can infect multiple host species and causes severe diseases in humans. Multiple surveillance and phylogenetic studies suggest a bat origin. In this study, we describe the detection and full genome characterization of two CoVs closely related to MERS-CoV from two Italian bats, Pipistrellus kuhlii and Hypsugo savii. Pool of viscera were tested by a pan-coronavirus RT-PCR. Virus isolation was attempted by inoculation in different cell lines. Full genome sequencing was performed using the Ion Torrent platform and phylogenetic trees were performed using IQtree software. Similarity plots of CoV clade c genomes were generated by using SSE v1.2. The three dimensional macromolecular structure (3DMMS) of the receptor binding domain (RBD) in the S protein was predicted by sequence-homology method using the protein data bank (PDB). Both samples resulted positive to the pan-coronavirus RT-PCR (IT-batCoVs) and their genome organization showed identical pattern of MERS CoV. Phylogenetic analysis showed a monophyletic group placed in the Beta2c clade formed by MERS-CoV sequences originating from humans and camels and bat-related sequences from Africa, Italy and China. The comparison of the secondary and 3DMMS of the RBD of IT-batCoVs with MERS, HKU4 and HKU5 bat sequences showed two aa deletions located in a region corresponding to the external subdomain of MERS-RBD in IT-batCoV and HKU5 RBDs. This study reported two beta CoVs closely related to MERS that were obtained from two bats belonging to two commonly recorded species in Italy (P. kuhlii and H. savii). The analysis of the RBD showed similar structure in IT-batCoVs and HKU5 respect to HKU4 sequences. Since the RBD domain of HKU4 but not HKU5 can bind to the human DPP4 receptor for MERS-CoV, it is possible to suggest also for IT-batCoVs the absence of DPP4-binding potential. More surveillance studies are needed to better investigate the potential intermediate hosts that may play a role in the interspecies transmission of known and currently unknown coronaviruses with particular attention to the S protein and the receptor specificity and binding affinity.

  11. First molecular evidence of Hepatozoon canis infection in red foxes and golden jackals from Hungary.

    PubMed

    Farkas, Róbert; Solymosi, Norbert; Takács, Nóra; Hornyák, Ákos; Hornok, Sándor; Nachum-Biala, Yaarit; Baneth, Gad

    2014-07-02

    Recently, Hepatozoon canis infection has been detected among shepherd, hunting and stray dogs in the southern part of Hungary, which is considered to be free of Rhipicephalus sanguineus sensu lato and close to the border with Croatia. The aim of this study was to acquire information on the possibility that red foxes and/or golden jackals could play a role in the appearance and spread of H. canis in Hungary. A conventional PCR was used to amplify a 666 bp long fragment of the Hepatozoon 18S rRNA gene from blood samples collected from 334 foxes shot in 231 locations in 16 counties and 15 golden jackals shot in 9 locations in two southwestern counties close to Croatia. A second PCR assay was performed in some of the samples positive by the first PCR to amplify a larger segment (approximately 1500 bp) of the 18S rRNA gene of Hepatozoon spp. for further phylogenetic analysis. Hepatozoon infection was detected in canids shot in 30 locations and 9 counties. Altogether 26 foxes (8.0%, 95% CI: 5-11%) and 9 jackals (60%, 95% CI: 33-81%) were PCR positive. Hepatozoon canis sequences were obtained from 12 foxes and 7 jackals. DNA sequences from 16 animals were 99-100% similar to H. canis from Croatian foxes or dogs while two of the sequences were 99% similar to an Italian fox. Half (13/26) of the infected red foxes and all golden jackals were shot in the two southwestern counties. This is the first report on molecular evidence of H. canis in red foxes (Vulpes vulpes) and golden jackals (Canis aureus) from Hungary, which is considered free from the tick vector of H. canis, R. sanguineus. Although no R. sanguineus sensu lato had been found on infected or non-infected wild canids, the detection of authochnous canine hepatozoonosis in Hungary might imply that the range of R. sanguineus sensu lato has reached this country.

  12. Paenibacillus oenotherae sp. nov. and Paenibacillus hemerocallicola sp. nov., isolated from the roots of herbaceous plants.

    PubMed

    Kim, Tae-Su; Han, Ji-Hye; Joung, Yochan; Kim, Seung Bum

    2015-08-01

    Two Gram-staining-positive, aerobic, endospore-forming, motile bacteria, strains DT7-4T and DLE-12T, were isolated from roots of evening primrose (Oenothera biennis) and day lily (Hemerocallis fulva), respectively, and subjected to taxonomic characterization. Analysis of 16S rRNA gene sequences indicated that the two strains fell into two distinct phylogenetic clusters belonging to the genus Paenibacillus. Strain DT7-4T was most closely related to Paenibacillus phyllosphaerae PALXIL04T and Paenibacillus taihuensis THMBG22T, with 96.3% 16S rRNA gene sequence similarity to each, and strain DLE-12T was most closely related to Paenibacillus ginsengarvi Gsoil 139T and Paenibacillus hodogayensis SGT, with 96.6 and 93.3% sequence similarity, respectively. Both isolates contained anteiso-C15 : 0 as the dominant fatty acid, meso-diaminopimelic acid as the diagnostic diamino acid in the cell-wall peptidoglycan and MK-7 as the respiratory menaquinone. The cellular polar lipids were composed of diphosphatidylglycerol, phosphatidylethanolamine, phosphatidylglycerol and unidentified polar lipids. The DNA G+C contents of strains DT7-4T and DLE-12T were 50.1 ± 0.7 and 55.2 ± 0.5 mol%, respectively. The chemotaxonomic properties of both isolates were typical of members of the genus Paenibacillus. However, our biochemical and phylogenetic analyses distinguished each isolate from related species. Based on our polyphasic taxonomic analysis, strains DT7-4T and DLE-12T should be recognized as representatives of novel species of Paenibacillus, for which the names Paenibacillus oenotherae sp. nov. (type strain DT7-4T = KCTC 33186T = JCM 19573T) and Paenibacillus hemerocallicola sp. nov. (type strain DLE-12T = KCTC 33185T = JCM 19572T) are proposed.

  13. Photobacterium damselae ssp. piscicida: detection by direct amplification of 16S rRNA gene sequences and genotypic variation as determined by amplified fragment length polymorphism (AFLP).

    PubMed

    Kvitt, H; Ucko, M; Colorni, A; Batargias, C; Zlotkin, A; Knibb, W

    2002-04-05

    A PCR protocol for the rapid diagnosis of fish 'pasteurellosis' based on 16S rRNA gene sequences was developed. The procedure combines low annealing temperature that detects low titers of Photobacterium damselae but also related species, and high annealing temperature for the specific identification of P. damselae directly from infected fish. The PCR protocol was validated on 19 piscine isolates of P. damselae ssp. piscicida from different geographic regions (Japan, Italy, Spain, Greece and Israel), on spontaneously infected sea bream Sparus aurata and sea bass Dicentrarchus labrax, and on closely related American Type Culture Collection (ATCC) reference strains. PCR using high annealing temperature (64 degrees C) discriminated between P. damselae and closely related reference strains, including P. histaminum. Sixteen isolates of P. damselae ssp. piscicida, 2 P. damselae ssp. piscicida reference strains and 1 P. damselae ssp. damselae reference strain were subjected to Amplified Fragment Length Polymorphism (AFLP) analysis, and a similarity matrix was produced. Accordingly, the Japanese isolates of P. damselae ssp. piscicida were distinguished from the Mediterranean/European isolates at a cut-off value of 83% similarity. A further subclustering at a cut-off value of 97% allowed discrimination between the Israeli P. damselae ssp. piscicida isolates and the other Mediterranean/European isolates. The combination of PCR direct amplification and AFLP provides a 2-step procedure, where P. damselae is rapidly identified at genus level on the basis of its 16S rRNA gene sequence and then grouped into distinct clusters on the basis of AFLP polymorphisms. The first step of direct amplification is highly sensitive and has immediate practical consequences, offering fish farmers a rapid diagnosis, while the AFLP is more specific and detects intraspecific variation which, in our study, also reflected geographic correspondence. Because of its superior discriminative properties, AFLP can be an important tool for epidemiological and taxonomic studies of this highly homogeneous genus.

  14. Solution NMR analyses of the anticodon arms of proteinogenic and non-proteinogenic tRNAGly

    PubMed Central

    Chang, Andrew T.; Nikonowicz, Edward P.

    2012-01-01

    Although the fate of most tRNA molecules in the cell is aminoacylation and delivery to the ribosome, some tRNAs are destined to fulfill other functional roles. In addition to their central role in translation, tRNA molecules participate in processes such as regulation of gene expression, bacterial cell wall biosynthesis, viral replication, antibiotic biosynthesis, and suppression of alternative splicing. In bacteria, glycyl-tRNA molecules with anticodon sequences GCC and UCC exhibit multiple extra-translational functions including transcriptional regulation and cell wall biosynthesis. We have determined the high-resolution structures of three glycyl-tRNA anticodon arms with anticodon sequences GCC and UCC. Two of the tRNA molecules are proteinogenic (tRNAGly,GCC and tRNAGly,UCC) and the third is non-proteinogenic (np-tRNAGly,UCC) and participates in cell wall biosynthesis. The UV-monitored thermal melting curves show that the anticodon arm of tRNAGly,UCC with a loop-closing C-A+ base pair melts at a 10 °C lower temperature than those of tRNAGly,GCC or np-tRNAGly,UCC. U-A and C-G pairs close the loops of the later two molecules and enhance stem stability. Mg2+ stabilizes the tRNAGly,UCC anticodon arm and lessens the Tm differential. The structures of the three tRNAGly anticodon arms exhibit small differences between one another, but none of them form the classical U-turn motif. The anticodon loop of tRNAGly,GCC becomes more dynamic and disordered in the presence of multivalent cations, whereas metal ion coordination in the anticodon loops of tRNAGly,UCC and np-tRNAGly,UCC establishes conformational homogeneity. The conformational similarity of the molecules is greater than their functional differences might suggest. Because aminoacylation of the full-length tRNA molecules is accomplished by one tRNA synthetase, the similar structural context of the loop may facilitate efficient recognition of each of the anticodon sequences. PMID:22468768

  15. Filling Gaps in Biodiversity Knowledge for Macrofungi: Contributions and Assessment of an Herbarium Collection DNA Barcode Sequencing Project

    PubMed Central

    Osmundson, Todd W.; Robert, Vincent A.; Schoch, Conrad L.; Baker, Lydia J.; Smith, Amy; Robich, Giovanni; Mizzan, Luca; Garbelotto, Matteo M.

    2013-01-01

    Despite recent advances spearheaded by molecular approaches and novel technologies, species description and DNA sequence information are significantly lagging for fungi compared to many other groups of organisms. Large scale sequencing of vouchered herbarium material can aid in closing this gap. Here, we describe an effort to obtain broad ITS sequence coverage of the approximately 6000 macrofungal-species-rich herbarium of the Museum of Natural History in Venice, Italy. Our goals were to investigate issues related to large sequencing projects, develop heuristic methods for assessing the overall performance of such a project, and evaluate the prospects of such efforts to reduce the current gap in fungal biodiversity knowledge. The effort generated 1107 sequences submitted to GenBank, including 416 previously unrepresented taxa and 398 sequences exhibiting a best BLAST match to an unidentified environmental sequence. Specimen age and taxon affected sequencing success, and subsequent work on failed specimens showed that an ITS1 mini-barcode greatly increased sequencing success without greatly reducing the discriminating power of the barcode. Similarity comparisons and nonmetric multidimensional scaling ordinations based on pairwise distance matrices proved to be useful heuristic tools for validating the overall accuracy of specimen identifications, flagging potential misidentifications, and identifying taxa in need of additional species-level revision. Comparison of within- and among-species nucleotide variation showed a strong increase in species discriminating power at 1–2% dissimilarity, and identified potential barcoding issues (same sequence for different species and vice-versa). All sequences are linked to a vouchered specimen, and results from this study have already prompted revisions of species-sequence assignments in several taxa. PMID:23638077

  16. Filling gaps in biodiversity knowledge for macrofungi: contributions and assessment of an herbarium collection DNA barcode sequencing project.

    PubMed

    Osmundson, Todd W; Robert, Vincent A; Schoch, Conrad L; Baker, Lydia J; Smith, Amy; Robich, Giovanni; Mizzan, Luca; Garbelotto, Matteo M

    2013-01-01

    Despite recent advances spearheaded by molecular approaches and novel technologies, species description and DNA sequence information are significantly lagging for fungi compared to many other groups of organisms. Large scale sequencing of vouchered herbarium material can aid in closing this gap. Here, we describe an effort to obtain broad ITS sequence coverage of the approximately 6000 macrofungal-species-rich herbarium of the Museum of Natural History in Venice, Italy. Our goals were to investigate issues related to large sequencing projects, develop heuristic methods for assessing the overall performance of such a project, and evaluate the prospects of such efforts to reduce the current gap in fungal biodiversity knowledge. The effort generated 1107 sequences submitted to GenBank, including 416 previously unrepresented taxa and 398 sequences exhibiting a best BLAST match to an unidentified environmental sequence. Specimen age and taxon affected sequencing success, and subsequent work on failed specimens showed that an ITS1 mini-barcode greatly increased sequencing success without greatly reducing the discriminating power of the barcode. Similarity comparisons and nonmetric multidimensional scaling ordinations based on pairwise distance matrices proved to be useful heuristic tools for validating the overall accuracy of specimen identifications, flagging potential misidentifications, and identifying taxa in need of additional species-level revision. Comparison of within- and among-species nucleotide variation showed a strong increase in species discriminating power at 1-2% dissimilarity, and identified potential barcoding issues (same sequence for different species and vice-versa). All sequences are linked to a vouchered specimen, and results from this study have already prompted revisions of species-sequence assignments in several taxa.

  17. Characterization of full genome sequences of chicken anemia viruses circulating in Egypt reveals distinct genetic diversity and evidence of recombination.

    PubMed

    Erfan, Ahmed M; Selim, Abdullah A; Naguib, Mahmoud M

    2018-06-02

    Chicken anemia virus (CAV) is one of the commercially important diseases of poultry worldwide. In Egypt, CAV has been reported to be a potential threat to the commercial poultry sectors. Hence, this study was aimed at isolation and full genomic analysis of CAVs circulating in chicken populations in different geographical location in Egypt. A total of 42 samples were collected from broiler chicken flocks in 9 governorates in Egypt from 12 to 42 days of age. The mortality rate observed among chickens was ranging from 3% to 22%. Nineteen out of 42 farms were found positive for the CAV genome by polymerase chain reaction (PCR). Full genome sequencing was conducted for 18 positive samples. Genetic analysis revealed a high similarity of >99% in 11 viruses with the vaccine strain Del-Ros; while the other seven samples shared close similarity to CAV field strains isolated from China, Taiwan, and Brazil. The data also indicated Q139 and Q144 amino acids substitutions among the VP1 of Egyptian field strains, which are known to be important in virus replication and spread. Phylogenetic analysis of the sequenced viruses (n = 18) based on either the full gene nucleotide sequence or VP1 coding sequence, suggested the circulation of four distinct genotypes in Egypt designated as group A, B, C and D. Moreover, evidence of recombination was detected among four Egyptian CAVs located within group A. The findings of this study succeeded to elucidate the epidemiological and genetic features of CAVs circulating in Egypt, and underscores the important of CAVs surveillance. Copyright © 2018 Elsevier B.V. All rights reserved.

  18. Serratia aquatilis sp. nov., isolated from drinking water systems.

    PubMed

    Kämpfer, Peter; Glaeser, Stefanie P

    2016-01-01

    A cream-white-pigmented, oxidase-negative bacterium (strain 2015-2462-01T), isolated from a drinking water system, was investigated in detail to determine its taxonomic position. Cells of the isolate were rod-shaped and stained Gram-negative. A comparison of the 16S rRNA gene sequence of strain 2015-2462-01T with sequences of the type strains of closely related species of the genus Serratia revealed highest similarity to Serratia fonticola (98.4 %), Serratia proteamaculans (97.8 %), Serratia liquefaciens and Serratia grimesii (both 97.7 %). 16S rRNA gene sequence similarities to all other Serratia species were below 97.4 %. Multilocus sequence analysis (MLSA) on the basis of concatenated partial gyrB, rpoB, infB and atpD gene sequences showed a clear distinction of strain 2015-2462-01T from the type strains of the closest related Serratia species. The fatty acid profile of the strain consisted of C16 : 1 ω7c, C16 : 0; C14 : 0 and C14 : 0 3-OH/iso-C16 : 1 I as major components. DNA-DNA hybridizations between 2015-2462-01T and S. fonticola ATCC 29844T resulted in a relatedness value of 27 % (reciprocal 20 %). This DNA-DNA hybridization result in combination with the MLSA results and the differential biochemical properties indicated that strain 2015-2462-01T represents a novel species of the genus Serratia, for which the name Serratia aquatilis sp. nov. is proposed. The type strain is 2015-2462-01T ( = LMG 29119T = CCM 8626T).

  19. Differentiation of Xylella fastidiosa Strains via Multilocus Sequence Analysis of Environmentally Mediated Genes (MLSA-E)

    PubMed Central

    Parker, Jennifer K.; Havird, Justin C.

    2012-01-01

    Isolates of the plant pathogen Xylella fastidiosa are genetically very similar, but studies on their biological traits have indicated differences in virulence and infection symptomatology. Taxonomic analyses have identified several subspecies, and phylogenetic analyses of housekeeping genes have shown broad host-based genetic differences; however, results are still inconclusive for genetic differentiation of isolates within subspecies. This study employs multilocus sequence analysis of environmentally mediated genes (MLSA-E; genes influenced by environmental factors) to investigate X. fastidiosa relationships and differentiate isolates with low genetic variability. Potential environmentally mediated genes, including host colonization and survival genes related to infection establishment, were identified a priori. The ratio of the rate of nonsynonymous substitutions to the rate of synonymous substitutions (dN/dS) was calculated to select genes that may be under increased positive selection compared to previously studied housekeeping genes. Nine genes were sequenced from 54 X. fastidiosa isolates infecting different host plants across the United States. Results of maximum likelihood (ML) and Bayesian phylogenetic (BP) analyses are in agreement with known X. fastidiosa subspecies clades but show novel within-subspecies differentiation, including geographic differentiation, and provide additional information regarding host-based isolate variation and specificity. dN/dS ratios of environmentally mediated genes, though <1 due to high sequence similarity, are significantly greater than housekeeping gene dN/dS ratios and correlate with increased sequence variability. MLSA-E can more precisely resolve relationships between closely related bacterial strains with low genetic variability, such as X. fastidiosa isolates. Discovering the genetic relationships between X. fastidiosa isolates will provide new insights into the epidemiology of populations of X. fastidiosa, allowing improved disease management in economically important crops. PMID:22194287

  20. Differentiation of Xylella fastidiosa strains via multilocus sequence analysis of environmentally mediated genes (MLSA-E).

    PubMed

    Parker, Jennifer K; Havird, Justin C; De La Fuente, Leonardo

    2012-03-01

    Isolates of the plant pathogen Xylella fastidiosa are genetically very similar, but studies on their biological traits have indicated differences in virulence and infection symptomatology. Taxonomic analyses have identified several subspecies, and phylogenetic analyses of housekeeping genes have shown broad host-based genetic differences; however, results are still inconclusive for genetic differentiation of isolates within subspecies. This study employs multilocus sequence analysis of environmentally mediated genes (MLSA-E; genes influenced by environmental factors) to investigate X. fastidiosa relationships and differentiate isolates with low genetic variability. Potential environmentally mediated genes, including host colonization and survival genes related to infection establishment, were identified a priori. The ratio of the rate of nonsynonymous substitutions to the rate of synonymous substitutions (dN/dS) was calculated to select genes that may be under increased positive selection compared to previously studied housekeeping genes. Nine genes were sequenced from 54 X. fastidiosa isolates infecting different host plants across the United States. Results of maximum likelihood (ML) and Bayesian phylogenetic (BP) analyses are in agreement with known X. fastidiosa subspecies clades but show novel within-subspecies differentiation, including geographic differentiation, and provide additional information regarding host-based isolate variation and specificity. dN/dS ratios of environmentally mediated genes, though <1 due to high sequence similarity, are significantly greater than housekeeping gene dN/dS ratios and correlate with increased sequence variability. MLSA-E can more precisely resolve relationships between closely related bacterial strains with low genetic variability, such as X. fastidiosa isolates. Discovering the genetic relationships between X. fastidiosa isolates will provide new insights into the epidemiology of populations of X. fastidiosa, allowing improved disease management in economically important crops.

  1. The central domain of bovine submaxillary mucin consists of over 50 tandem repeats of 329 amino acids. Chromosomal localization of the BSM1 gene and relations to ovine and porcine counterparts.

    PubMed

    Jiang, W; Gupta, D; Gallagher, D; Davis, S; Bhavanandan, V P

    2000-04-01

    We previously elucidated five distinct protein domains (I-V) for bovine submaxillary mucin, which is encoded by two genes, BSM1 and BSM2. Using Southern blot analysis, genomic cloning and sequencing of the BSM1 gene, we now show that the central domain (V) consists of approximately 55 tandem repeats of 329 amino acids and that domains III-V are encoded by a 58.4-kb exon, the largest exon known for all genes to date. The BSM1 gene was mapped by fluorescence in situ hybridization to the proximal half of chromosome 5 at bands q2. 2-q2.3. The amino-acid sequence of six tandem repeats (two full and four partial) were found to have only 92-94% identities. We propose that the variability in the amino-acid sequences of the mucin tandem repeat is important for generating the combinatorial library of saccharides that are necessary for the protective function of mucins. The deduced peptide sequences of the central domain match those determined from the purified bovine submaxillary mucin and also show 68-94% identity to published peptide sequences of ovine submaxillary mucin. This indicates that the core protein of ovine submaxillary mucin is closely related to that of bovine submaxillary mucin and contains similar tandem repeats in the central domain. In contrast, the central domain of porcine submaxillary mucin is reported to consist of 81-amino-acid tandem repeats. However, both bovine submaxillary mucin and porcine submaxillary mucin contain similar N-terminal and C-terminal domains and the corresponding genes are in the conserved linkage regions of the respective genomes.

  2. Abundance of Dioxygenase Genes Similar to Ralstonia sp. Strain U2 nagAc Is Correlated with Naphthalene Concentrations in Coal Tar-Contaminated Freshwater Sediments

    PubMed Central

    Dionisi, Hebe M.; Chewning, Christopher S.; Morgan, Katherine H.; Menn, Fu-Min; Easter, James P.; Sayler, Gary S.

    2004-01-01

    We designed a real-time PCR assay able to recognize dioxygenase large-subunit gene sequences with more than 90% similarity to the Ralstonia sp. strain U2 nagAc gene (nagAc-like gene sequences) in order to study the importance of organisms carrying these genes in the biodegradation of naphthalene. Sequencing of PCR products indicated that this real-time PCR assay was specific and able to detect a variety of nagAc-like gene sequences. One to 100 ng of contaminated-sediment total DNA in 25-μl reaction mixtures produced an amplification efficiency of 0.97 without evident PCR inhibition. The assay was applied to surficial freshwater sediment samples obtained in or in close proximity to a coal tar-contaminated Superfund site. Naphthalene concentrations in the analyzed samples varied between 0.18 and 106 mg/kg of dry weight sediment. The assay for nagAc-like sequences indicated the presence of (4.1 ± 0.7) × 103 to (2.9 ± 0.3) × 105 copies of nagAc-like dioxygenase genes per μg of DNA extracted from sediment samples. These values corresponded to (1.2 ± 0.6) × 105 to (5.4 ± 0.4) × 107 copies of this target per g of dry weight sediment when losses of DNA during extraction were taken into account. There was a positive correlation between naphthalene concentrations and nagAc-like gene copies per microgram of DNA (r = 0.89) and per gram of dry weight sediment (r = 0.77). These results provide evidence of the ecological significance of organisms carrying nagAc-like genes in the biodegradation of naphthalene. PMID:15240274

  3. The mitochondrial genome of Malus domestica and the import-driven hypothesis of mitochondrial genome expansion in seed plants.

    PubMed

    Goremykin, Vadim V; Lockhart, Peter J; Viola, Roberto; Velasco, Riccardo

    2012-08-01

    Mitochondrial genomes of spermatophytes are the largest of all organellar genomes. Their large size has been attributed to various factors; however, the relative contribution of these factors to mitochondrial DNA (mtDNA) expansion remains undetermined. We estimated their relative contribution in Malus domestica (apple). The mitochondrial genome of apple has a size of 396 947 bp and a one to nine ratio of coding to non-coding DNA, close to the corresponding average values for angiosperms. We determined that 71.5% of the apple mtDNA sequence was highly similar to sequences of its nuclear DNA. Using nuclear gene exons, nuclear transposable elements and chloroplast DNA as markers of promiscuous DNA content in mtDNA, we estimated that approximately 20% of the apple mtDNA consisted of DNA sequences imported from other cell compartments, mostly from the nucleus. Similar marker-based estimates of promiscuous DNA content in the mitochondrial genomes of other species ranged between 21.2 and 25.3% of the total mtDNA length for grape, between 23.1 and 38.6% for rice, and between 47.1 and 78.4% for maize. All these estimates are conservative, because they underestimate the import of non-functional DNA. We propose that the import of promiscuous DNA is a core mechanism for mtDNA size expansion in seed plants. In apple, maize and grape this mechanism contributed far more to genome expansion than did homologous recombination. In rice the estimated contribution of both mechanisms was found to be similar. © 2012 The Authors. The Plant Journal © 2012 Blackwell Publishing Ltd.

  4. Genome Sequencing of Steroid Producing Bacteria Using Ion Torrent Technology and a Reference Genome.

    PubMed

    Sola-Landa, Alberto; Rodríguez-García, Antonio; Barreiro, Carlos; Pérez-Redondo, Rosario

    2017-01-01

    The Next-Generation Sequencing technology has enormously eased the bacterial genome sequencing and several tens of thousands of genomes have been sequenced during the last 10 years. Most of the genome projects are published as draft version, however, for certain applications the complete genome sequence is required.In this chapter, we describe the strategy that allowed the complete genome sequencing of Mycobacterium neoaurum NRRL B-3805, an industrial strain exploited for steroid production, using Ion Torrent sequencing reads and the genome of a close strain as the reference. This protocol can be applied to analyze the genetic variations between closely related strains; for example, to elucidate the point mutations between a parental strain and a random mutagenesis-derived mutant.

  5. Does the sequence of data collection influence participants' responses to closed and open-ended questions? A methodological study.

    PubMed

    Covell, Christine L; Sidani, Souraya; Ritchie, Judith A

    2012-06-01

    The sequence used for collecting quantitative and qualitative data in concurrent mixed-methods research may influence participants' responses. Empirical evidence is needed to determine if the order of data collection in concurrent mixed methods research biases participants' responses to closed and open-ended questions. To examine the influence of the quantitative-qualitative sequence on responses to closed and open-ended questions when assessing the same variables or aspects of a phenomenon simultaneously within the same study phase. A descriptive cross-sectional, concurrent mixed-methods design was used to collect quantitative (survey) and qualitative (interview) data. The setting was a large multi-site health care centre in Canada. A convenience sample of 50 registered nurses was selected and participated in the study. Participants were randomly assigned to one of two sequences for data collection, quantitative-qualitative or qualitative-quantitative. Independent t-tests were performed to compare the two groups' responses to the survey items. Directed content analysis was used to compare the participants' responses to the interview questions. The sequence of data collection did not greatly affect the participants' responses to the closed-ended questions (survey items) or the open-ended questions (interview questions). The sequencing of data collection, when using both survey and semi-structured interviews, may not bias participants' responses to closed or open-ended questions. Additional research is required to confirm these findings. Copyright © 2011 Elsevier Ltd. All rights reserved.

  6. Mapping Simple Repeated DNA Sequences in Heterochromatin of Drosophila Melanogaster

    PubMed Central

    Lohe, A. R.; Hilliker, A. J.; Roberts, P. A.

    1993-01-01

    Heterochromatin in Drosophila has unusual genetic, cytological and molecular properties. Highly repeated DNA sequences (satellites) are the principal component of heterochromatin. Using probes from cloned satellites, we have constructed a chromosome map of 10 highly repeated, simple DNA sequences in heterochromatin of mitotic chromosomes of Drosophila melanogaster. Despite extensive sequence homology among some satellites, chromosomal locations could be distinguished by stringent in situ hybridizations for each satellite. Only two of the localizations previously determined using gradient-purified bulk satellite probes are correct. Eight new satellite localizations are presented, providing a megabase-level chromosome map of one-quarter of the genome. Five major satellites each exhibit a multichromosome distribution, and five minor satellites hybridize to single sites on the Y chromosome. Satellites closely related in sequence are often located near one another on the same chromosome. About 80% of Y chromosome DNA is composed of nine simple repeated sequences, in particular (AAGAC)(n) (8 Mb), (AAGAG)(n) (7 Mb) and (AATAT)(n) (6 Mb). Similarly, more than 70% of the DNA in chromosome 2 heterochromatin is composed of five simple repeated sequences. We have also generated a high resolution map of satellites in chromosome 2 heterochromatin, using a series of translocation chromosomes whose breakpoints in heterochromatin were ordered by N-banding. Finally, staining and banding patterns of heterochromatic regions are correlated with the locations of specific repeated DNA sequences. The basis for the cytochemical heterogeneity in banding appears to depend exclusively on the different satellite DNAs present in heterochromatin. PMID:8375654

  7. Characterization of cDNAs and genomic DNAs for human threonyl- and cysteinyl-tRNA synthetases

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cruzen, M.E.

    1993-01-01

    Techniques of molecular biology were used to clone, sequence and map two human aminoacyl-tRNA synthetase (aaRS) cDNAs: threonyl-tRNA synthetase (ThrRS) a class II enzyme and cysteinyl-tRNA synthetase (CysRS) a class I enzyme. The predicted protein sequence of human ThrRS is highly homologous to that of lower eukaryotic and prokaryotic ThRSs, particularly in the regions containing the three structural motifs common to all class II synthetases. Signature regions 1 and 2, which characterize the class IIa subgroup (SerRS, ThrRS and HisRS) are highly conserved from bacteria to human. Structural predictions for human ThrRS based on the known structure of the closelymore » related SerRS from E.coli implicate strongly conserved residues in the signature sequences to be important in substrate binding. The amino terminal 100 residues of the deduced amino acid sequence of ThrRS shares structural similarity to SerRS consistent with forming an antiparallel helix implicated in tRNA binding. The 5' untranslated sequence of the human ThrRS gene shares short stretches of common sequence with the gene for hamster HisRS including a binding site for the promoter specific transcription factor sp-1. The deduced amino acid sequence of human CysRS has a high degree of sequence identify to E. coli CysRS. Human CysRS possesses the classic characteristics of a class I synthetase and is most closely related to the MetRS subgroup. The amino terminal half of human CysRS can be modeled as a nucleotide binding fold and shares significant sequence and structural similarity to the other enzymes in this subgroup. The CysRS structural gene (CARS) was mapped to human chromosome 11p15.5 by fluorescent in situ hybridization. CARS is the first aaRS gene to be mapped to chromosome 11. The steady state of both CysRS and ThrRs mRNA were quantitated in several human tissues. Message levels for these enzymes appear to be subjected to differential regulation in different cell types.« less

  8. Analysis of intra-host genetic diversity of Prunus necrotic ringspot virus (PNRSV) using amplicon next generation sequencing

    PubMed Central

    Constable, Fiona E.; Nancarrow, Narelle; Plummer, Kim M.; Rodoni, Brendan

    2017-01-01

    PCR amplicon next generation sequencing (NGS) analysis offers a broadly applicable and targeted approach to detect populations of both high- or low-frequency virus variants in one or more plant samples. In this study, amplicon NGS was used to explore the diversity of the tripartite genome virus, Prunus necrotic ringspot virus (PNRSV) from 53 PNRSV-infected trees using amplicons from conserved gene regions of each of PNRSV RNA1, RNA2 and RNA3. Sequencing of the amplicons from 53 PNRSV-infected trees revealed differing levels of polymorphism across the three different components of the PNRSV genome with a total number of 5040, 2083 and 5486 sequence variants observed for RNA1, RNA2 and RNA3 respectively. The RNA2 had the lowest diversity of sequences compared to RNA1 and RNA3, reflecting the lack of flexibility tolerated by the replicase gene that is encoded by this RNA component. Distinct PNRSV phylo-groups, consisting of closely related clusters of sequence variants, were observed in each of PNRSV RNA1, RNA2 and RNA3. Most plant samples had a single phylo-group for each RNA component. Haplotype network analysis showed that smaller clusters of PNRSV sequence variants were genetically connected to the largest sequence variant cluster within a phylo-group of each RNA component. Some plant samples had sequence variants occurring in multiple PNRSV phylo-groups in at least one of each RNA and these phylo-groups formed distinct clades that represent PNRSV genetic strains. Variants within the same phylo-group of each Prunus plant sample had ≥97% similarity and phylo-groups within a Prunus plant sample and between samples had less ≤97% similarity. Based on the analysis of diversity, a definition of a PNRSV genetic strain was proposed. The proposed definition was applied to determine the number of PNRSV genetic strains in each of the plant samples and the complexity in defining genetic strains in multipartite genome viruses was explored. PMID:28632759

  9. Hybridization and massive mtDNA unidirectional introgression between the closely related Neotropical toads Rhinella marina and R. schneideri inferred from mtDNA and nuclear markers

    PubMed Central

    2011-01-01

    Background The classical perspective that interspecific hybridization in animals is rare has been changing due to a growing list of empirical examples showing the occurrence of gene flow between closely related species. Using sequence data from cyt b mitochondrial gene and three intron nuclear genes (RPL9, c-myc, and RPL3) we investigated patterns of nucleotide polymorphism and divergence between two closely related toad species R. marina and R. schneideri. By comparing levels of differentiation at nuclear and mtDNA levels we were able to describe patterns of introgression and infer the history of hybridization between these species. Results All nuclear loci are essentially concordant in revealing two well differentiated groups of haplotypes, corresponding to the morphologically-defined species R. marina and R. schneideri. Mitochondrial DNA analysis also revealed two well-differentiated groups of haplotypes but, in stark contrast with the nuclear genealogies, all R. schneideri sequences are clustered with sequences of R. marina from the right Amazon bank (RAB), while R. marina sequences from the left Amazon bank (LAB) are monophyletic. An Isolation-with-Migration (IM) analysis using nuclear data showed that R. marina and R. schneideri diverged at ≈ 1.69 Myr (early Pleistocene), while R. marina populations from LAB and RAB diverged at ≈ 0.33 Myr (middle Pleistocene). This time of divergence is not consistent with the split between LAB and RAB populations obtained with mtDNA data (≈ 1.59 Myr), which is notably similar to the estimate obtained with nuclear genes between R. marina and R. schneideri. Coalescent simulations of mtDNA phylogeny under the speciation history inferred from nuclear genes rejected the hypothesis of incomplete lineage sorting to explain the conflicting signal between mtDNA and nuclear-based phylogenies. Conclusions The cytonuclear discordance seems to reflect the occurrence of interspecific hybridization between these two closely related toad species. Overall, our results suggest a phenomenon of extensive mtDNA unidirectional introgression from the previously occurring R. schneideri into the invading R. marina. We hypothesize that climatic-induced range shifts during the Pleistocene/Holocene may have played an important role in the observed patterns of introgression. PMID:21939538

  10. Radiofrequency artefacts in echoplanar imaging induced by two 1.5 T MR scanners in close proximity.

    PubMed

    Li, X; Cui, J; Christopasak, S P; Kumar, A; Peng, Z-G

    2014-06-01

    The purpose of this study was to assess radio frequency (RF) artefacts in echoplanar imaging (EPI) induced by two 1.5 T MR scanners in close proximity and to find an effective method to correct them. Based on the intact shielding of rooms, experiments were performed by two MR scanners with similar centre frequencies. Phantom A (PA) was scanned in one scanner by EPI at different bandwidths (BWs). Simultaneously, phantom B was scanned in a fixed sequence for scanning with the other scanner. RF artefact gaps of PA, scanning time and the image signal-noise ratio (SNR) were measured and recorded. Statistical analysis was performed with the repeated-measures analysis of variance test. Based on findings obtained from PA, three healthy volunteers were studied at a conventional BW and a lower BW to observe the artefact variance. EPI RF artefacts were symmetrically situated in both sides of the image following the phase-encoding direction. The gap size of the artefact became larger and the SNR was significantly improved with a narrower BW. RF artefacts with a lower BW in volunteers presented the same characteristic as PA. For EPI RF artefacts produced by two 1.5 T MR scanners with approximately similar centre frequencies, we can reduce BWs in a suitable range to minimize the effect on MRI. MR scanners with the same field strength installed in the same vicinity might produce RF artefacts in the sequence at larger BWs. Reducing BWs properly is effective to control the position of artefacts and improve the image quality.

  11. [Phylogenetic analysis of closely related Leuconostoc citreum species based on partial housekeeping genes].

    PubMed

    Lv, Qiang; Chen, Ming; Xu, Haiyan; Song, Yuqin; Sun, Zhihong; Dan, Tong; Sun, Tiansong

    2013-07-04

    Using the 16S rRNA, dnaA, murC and pyrG gene sequences, we identified the phylogenetic relationship among closely related Leuconostoc citreum species. Seven Leu. citreum strains originally isolated from sourdough were characterized by PCR methods to amplify the dnaA, murC and pyrG gene sequences, which were determined to assess the suitability as phylogenetic markers. Then, we estimated the genetic distance and constructed the phylogenetic trees including 16S rRNA and above mentioned three housekeeping genes combining with published corresponding sequences. By comparing the phylogenetic trees, the topology of three housekeeping genes trees were consistent with that of 16S rRNA gene. The homology of closely related Leu. citreum species among dnaA, murC, pyrG and 16S rRNA gene sequences were different, ranged from75.5% to 97.2%, 50.2% to 99.7%, 65.0% to 99.8% and 98.5% 100%, respectively. The phylogenetic relationship of three housekeeping genes sequences were highly consistent with the results of 16S rRNA gene sequence, while the genetic distance of these housekeeping genes were extremely high than 16S rRNA gene. Consequently, the dnaA, murC and pyrG gene are suitable for classification and identification closely related Leu. citreum species.

  12. A generalized global alignment algorithm.

    PubMed

    Huang, Xiaoqiu; Chao, Kun-Mao

    2003-01-22

    Homologous sequences are sometimes similar over some regions but different over other regions. Homologous sequences have a much lower global similarity if the different regions are much longer than the similar regions. We present a generalized global alignment algorithm for comparing sequences with intermittent similarities, an ordered list of similar regions separated by different regions. A generalized global alignment model is defined to handle sequences with intermittent similarities. A dynamic programming algorithm is designed to compute an optimal general alignment in time proportional to the product of sequence lengths and in space proportional to the sum of sequence lengths. The algorithm is implemented as a computer program named GAP3 (Global Alignment Program Version 3). The generalized global alignment model is validated by experimental results produced with GAP3 on both DNA and protein sequences. The GAP3 program extends the ability of standard global alignment programs to recognize homologous sequences of lower similarity. The GAP3 program is freely available for academic use at http://bioinformatics.iastate.edu/aat/align/align.html.

  13. USE OF COMPETITIVE DNA HYBRIDIZATION TO IDENTIFY DIFFERENCES IN THE GENOMES OF TWO CLOSELY RELATED FECAL INDICATOR BACTERIA

    EPA Science Inventory

    Although recent technological advances in DNA sequencing and computational biology now allow scientists to compare entire microbial genomes, comparisons of closely related bacterial species and individual isolates by whole-genome sequencing approaches remains prohibitively expens...

  14. Kordia antarctica sp. nov., isolated from Antarctic seawater.

    PubMed

    Baek, Kiwoon; Choi, Ahyoung; Kang, Ilnam; Lee, Kiyoung; Cho, Jang-Cheon

    2013-10-01

    A Gram-staining-negative, chemoheterotrophic, yellow-pigmented, non-motile, flexirubin-negative, facultatively anaerobic bacterium, designated strain IMCC3317(T), was isolated from a coastal seawater sample from the Antarctic Penninsula. Optimal growth of strain IMCC3317(T) was observed at 20 °C, pH 8.0 and in the presence of 2-3 % NaCl. Phylogenetic analysis based on 16S rRNA gene sequences showed that strain IMCC3317(T) belonged to the genus Kordia and was closely related to Kordia algicida OT-1(T) (96.7 % sequence similarity) and Kordia periserrulae IMCC1412(T) (96.1 % sequence similarity). The major fatty acids were 10-methyl C16 : 0 and/or iso-C16 : 1ω9c, iso-C17 : 0 3-OH, iso-C15 : 0 and anteiso-C15 : 0. The G+C content of the genomic DNA was 35.1 mol%. The strain contained menaquinone-6 (MK-6) as the respiratory quinone. The polar lipids detected in the strain were phosphatidylethanolamine and unknown aminophospholipids, aminolipids and polar lipids. On the basis of phylogenetic distinction and differential phenotypic characteristics, it is suggested that strain IMCC3317(T) ( = KCTC 32292(T) = NBRC 109401(T)) be assigned to the genus Kordia as the type strain of a novel species, for which the name Kordia antarctica sp. nov. is proposed.

  15. Characterisation of a large family of polymorphic collagen-like proteins in the endospore-forming bacterium Pasteuria ramosa.

    PubMed

    McElroy, Kerensa; Mouton, Laurence; Du Pasquier, Louis; Qi, Weihong; Ebert, Dieter

    2011-09-01

    Collagen-like proteins containing glycine-X-Y repeats have been identified in several pathogenic bacteria potentially involved in virulence. Recently, a collagen-like surface protein, Pcl1a, was identified in Pasteuria ramosa, a spore-forming parasite of Daphnia. Here we characterise 37 novel putative P. ramosa collagen-like protein genes (PCLs). PCR amplification and sequencing across 10 P. ramosa strains showed they were polymorphic, distinguishing genotypes matching known differences in Daphnia/P. ramosa interaction specificity. Thirty PCLs could be divided into four groups based on sequence similarity, conserved N- and C-terminal regions and G-X-Y repeat structure. Group 1, Group 2 and Group 3 PCLs formed triplets within the genome, with one member from each group represented in each triplet. Maximum-likelihood trees suggested that these groups arose through multiple instances of triplet duplication. For Group 1, 2, 3 and 4 PCLs, X was typically proline and Y typically threonine, consistent with other bacterial collagen-like proteins. The amino acid composition of Pcl2 closely resembled Pcl1a, with X typically being glutamic acid or aspartic acid and Y typically being lysine or glutamine. Pcl2 also showed sequence similarity to Pcl1a and contained a predicted signal peptide, cleavage site and transmembrane domain, suggesting that it is a surface protein. Copyright © 2011 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.

  16. Arthrobacter ruber sp. nov., isolated from glacier ice.

    PubMed

    Liu, Qing; Xin, Yu-Hua; Chen, Xiu-Ling; Liu, Hong-Can; Zhou, Yu-Guang; Chen, Wen-Xin

    2018-05-01

    A Gram-stain-positive strain designated MDB1-42 T was isolated from ice collected from Midui glacier in Tibet, PR China. Strain MDB1-42 T was catalase-positive, oxidase-negative and grew optimally at 25-28 °C and pH 7.0. Phylogenetic analysis based on 16S rRNA gene sequences revealed that MDB1-42 T represented a member of the genus Arthrobacter. The highest level of 16S rRNA gene sequence similarity (99.86 %) was found with Arthrobacter agilis NBRC 15319 T . Multilocus sequence analysis revealed low similarity of 91.93 % between MDB1-42 T and Arthrobacter agilis NBRC 15319 T . Average nucleotide identity and digital DNA-DNA hybridization values between MDB1-42 T and the most closely related strain, Arthrobacter agilis DSM 20550 T , were 81.36 and 24.5 %, respectively. The genomic DNA G+C content was 69.0 mol%. The major cellular fatty acids of MDB1-42 T were anteiso-C15 : 0 and anteiso-C17:0. The polar lipids were phosphatidylglycerol, diphosphatidylglycerol, phosphatidylinositol, one unidentified glycolipid and one unidentified lipid. The predominant menaquinone was MK-9(H2). On the basis of results obtained using a polyphasic approach, a novel species Arthrobacter ruber sp. nov. is proposed, with MDB1-42 T (=CGMCC 1.9772 T =NBRC 113088 T ) as the type strain.

  17. Comparative Analysis of the Gut Microbial Communities in Forest and Alpine Musk Deer Using High-Throughput Sequencing

    PubMed Central

    Hu, Xiaolong; Liu, Gang; Shafer, Aaron B. A.; Wei, Yuting; Zhou, Juntong; Lin, Shaobi; Wu, Haibin; Zhou, Mi; Hu, Defu; Liu, Shuqiang

    2017-01-01

    The gut ecosystem is characterized by dynamic and reciprocal interactions between the host and bacteria. Although characterizing microbiota for herbivores has become recognized as important tool for gauging species health, no study to date has investigated the bacterial communities and evaluated the age-related bacterial dynamics of musk deer. Moreover, gastrointestinal diseases have been hypothesized to be a limiting factor of population growth in captive musk deer. Here, high-throughput sequencing of the bacterial 16S rRNA gene was used to profile the fecal bacterial communities in juvenile and adult alpine and forest musk deer. The two musk deer species harbored similar bacterial communities at the phylum level, whereas the key genera for the two species were distinct. The bacterial communities were dominated by Firmicutes and Bacteroidetes, with the bacterial diversity being higher in forest musk deer. The Firmicutes to Bacteroidetes ratio also increased from juvenile to adult, while the bacterial diversity, within-group and between-group similarity, all increased with age. This work serves as the first sequence-based analysis of variation in bacterial communities within and between musk deer species, and demonstrates how the gut microbial community dynamics vary among closely related species and shift with age. As gastrointestinal diseases have been observed in captive populations, this study provides valuable data that might benefit captive management and future reintroduction programs. PMID:28421061

  18. Organization of the origins of replication of the chromosomes of Mycobacterium smegmatis, Mycobacterium leprae and Mycobacterium tuberculosis and isolation of a functional origin from M. smegmatis.

    PubMed

    Salazar, L; Fsihi, H; de Rossi, E; Riccardi, G; Rios, C; Cole, S T; Takiff, H E

    1996-04-01

    The genus Mycobacterium is composed of species with widely differing growth rates ranging from approximately three hours in Mycobacterium smegmatis to two weeks in Mycobacterium leprae. As DNA replication is coupled to cell duplication, it may be regulated by common mechanisms. The chromosomal regions surrounding the origins of DNA replication from M. smegmatis, M. tuberculosis, and M. leprae have been sequenced, and show very few differences. The gene order, rnpA-rpmH-dnaA-dnaN-recF-orf-gyrB-gyrA, is the same as in other Gram-positive organisms. Although the general organization in M. smegmatis is very similar to that of Streptomyces spp., a closely related genus, M. tuberculosis and M. leprae differ as they lack an open reading frame, between dnaN and recF, which is similar to the gnd gene of Escherichia coli. Within the three mycobacterial species, there is extensive sequence conservation in the intergenic regions flanking dnaA, but more variation from the consensus DnaA box sequence was seen than in other bacteria. By means of subcloning experiments, the putative chromosomal origin of replication of M. smegmatis, containing the dnaA-dnaN region, was shown to promote autonomous replication in M. smegmatis, unlike the corresponding regions from M. tuberculosis or M. leprae.

  19. ECOD: An Evolutionary Classification of Protein Domains

    PubMed Central

    Kinch, Lisa N.; Pei, Jimin; Shi, Shuoyong; Kim, Bong-Hyun; Grishin, Nick V.

    2014-01-01

    Understanding the evolution of a protein, including both close and distant relationships, often reveals insight into its structure and function. Fast and easy access to such up-to-date information facilitates research. We have developed a hierarchical evolutionary classification of all proteins with experimentally determined spatial structures, and presented it as an interactive and updatable online database. ECOD (Evolutionary Classification of protein Domains) is distinct from other structural classifications in that it groups domains primarily by evolutionary relationships (homology), rather than topology (or “fold”). This distinction highlights cases of homology between domains of differing topology to aid in understanding of protein structure evolution. ECOD uniquely emphasizes distantly related homologs that are difficult to detect, and thus catalogs the largest number of evolutionary links among structural domain classifications. Placing distant homologs together underscores the ancestral similarities of these proteins and draws attention to the most important regions of sequence and structure, as well as conserved functional sites. ECOD also recognizes closer sequence-based relationships between protein domains. Currently, approximately 100,000 protein structures are classified in ECOD into 9,000 sequence families clustered into close to 2,000 evolutionary groups. The classification is assisted by an automated pipeline that quickly and consistently classifies weekly releases of PDB structures and allows for continual updates. This synchronization with PDB uniquely distinguishes ECOD among all protein classifications. Finally, we present several case studies of homologous proteins not recorded in other classifications, illustrating the potential of how ECOD can be used to further biological and evolutionary studies. PMID:25474468

  20. ECOD: an evolutionary classification of protein domains.

    PubMed

    Cheng, Hua; Schaeffer, R Dustin; Liao, Yuxing; Kinch, Lisa N; Pei, Jimin; Shi, Shuoyong; Kim, Bong-Hyun; Grishin, Nick V

    2014-12-01

    Understanding the evolution of a protein, including both close and distant relationships, often reveals insight into its structure and function. Fast and easy access to such up-to-date information facilitates research. We have developed a hierarchical evolutionary classification of all proteins with experimentally determined spatial structures, and presented it as an interactive and updatable online database. ECOD (Evolutionary Classification of protein Domains) is distinct from other structural classifications in that it groups domains primarily by evolutionary relationships (homology), rather than topology (or "fold"). This distinction highlights cases of homology between domains of differing topology to aid in understanding of protein structure evolution. ECOD uniquely emphasizes distantly related homologs that are difficult to detect, and thus catalogs the largest number of evolutionary links among structural domain classifications. Placing distant homologs together underscores the ancestral similarities of these proteins and draws attention to the most important regions of sequence and structure, as well as conserved functional sites. ECOD also recognizes closer sequence-based relationships between protein domains. Currently, approximately 100,000 protein structures are classified in ECOD into 9,000 sequence families clustered into close to 2,000 evolutionary groups. The classification is assisted by an automated pipeline that quickly and consistently classifies weekly releases of PDB structures and allows for continual updates. This synchronization with PDB uniquely distinguishes ECOD among all protein classifications. Finally, we present several case studies of homologous proteins not recorded in other classifications, illustrating the potential of how ECOD can be used to further biological and evolutionary studies.

  1. Calculation of the absolute free energy of a smectic-A phase

    NASA Astrophysics Data System (ADS)

    Huang, Chien-Cheng; Ramachandran, Sanoop; Ryckaert, Jean-Paul

    2014-12-01

    In this paper, we provide a scheme to compute the absolute free energy of a smectic-A phase via the "indirect method." The state of interest is connected through a three-step reversible path to a reference state. This state consists of a low-density layer of rods coupled to two external fields maintaining these rods close to the layer's plane and oriented preferably normal to the layer. The low-density free energy of the reference state can be computed on the basis of the relevant second virial coefficients between two rods coupled to the two external fields. We apply this technique to the Gay-Berne potential for calamitics with a parameter set leading to stable isotropic (I), nematic (N), smectic-A (SmA), and crystal (Cr) phases. We locate the I-SmA phase transition at low pressure and the sequence of phase transitions I-N-SmA along higher-pressure isobars and we establish the location of the I-N-SmA triple point. Close to this triple point, we show that the N-SmA transition is clearly first order. Our results are compared to the coexistence lines of the approximate phase diagram elucidated by de Miguel et al. [J. Chem. Phys. 121, 11183 (2004), 10.1063/1.1810472] established through the direct observation of the sequence of phase transitions occurring along isobars under heating or cooling sequences of runs. Finally, we discuss the potential of our technique in studying similar transitions observed on layered phases under confinement.

  2. Further delineation of nonhomologous-based recombination and evidence for subtelomeric segmental duplications in 1p36 rearrangements.

    PubMed

    D'Angelo, Carla S; Gajecka, Marzena; Kim, Chong A; Gentles, Andrew J; Glotzbach, Caron D; Shaffer, Lisa G; Koiffmann, Célia P

    2009-06-01

    The mechanisms involved in the formation of subtelomeric rearrangements are now beginning to be elucidated. Breakpoint sequencing analysis of 1p36 rearrangements has made important contributions to this line of inquiry. Despite the unique architecture of segmental duplications inherent to human subtelomeres, no common mechanism has been identified thus far and different nonexclusive recombination-repair mechanisms seem to predominate. In order to gain further insights into the mechanisms of chromosome breakage, repair, and stabilization mediating subtelomeric rearrangements in humans, we investigated the constitutional rearrangements of 1p36. Cloning of the breakpoint junctions in a complex rearrangement and three non-reciprocal translocations revealed similarities at the junctions, such as microhomology of up to three nucleotides, along with no significant sequence identity in close proximity to the breakpoint regions. All the breakpoints appeared to be unique and their occurrence was limited to non-repetitive, unique DNA sequences. Several recombination- or cleavage-associated motifs that may promote non-homologous recombination were observed in close proximity to the junctions. We conclude that NHEJ is likely the mechanism of DNA repair that generates these rearrangements. Additionally, two apparently pure terminal deletions were also investigated, and the refinement of the breakpoint regions identified two distinct genomic intervals ~25-kb apart, each containing a series of 1p36 specific segmental duplications with 90-98% identity. Segmental duplications can serve as substrates for ectopic homologous recombination or stimulate genomic rearrangements.

  3. Development of SCAR (sequence-characterized amplified region) markers as a complementary tool for identification of ginger (Zingiber officinale Roscoe) from crude drugs and multicomponent formulations.

    PubMed

    Chavan, Preeti; Warude, Dnyaneshwar; Joshi, Kalpana; Patwardhan, Bhushan

    2008-05-01

    Zingiber officinale Roscoe (common or culinary ginger) is an official drug in Ayurvedic, Indian herbal, Chinese, Japanese, African and British Pharmacopoeias. The objective of the present study was to develop DNA-based markers that can be applied for the identification and differentiation of the commercially important plant Z. officinale Roscoe from the closely related species Zingiber zerumbet (pinecone, bitter or 'shampoo' ginger) and Zingiber cassumunar [cassumunar or plai (Thai) ginger]. The rhizomes of the other two Zingiber species used in the present study are morphologically similar to that of Z. officinale Roscoe and can be used as its adulterants or contaminants. Various methods, including macroscopy, microscopy and chemoprofiling, have been reported for the quality control of crude ginger and its products. These methods are reported to have limitations in distinguishing Z. officinale from closely related species. Hence, newer complementary methods for correct identification of ginger are useful. In the present study, RAPD (random amplification of polymorphic DNA) analysis was used to identify putative species-specific amplicons for Z. officinale. These were further cloned and sequenced to develop SCAR (sequence-characterized amplified region) markers. The developed SCAR markers were tested in several non-Zingiber species commonly used in ginger-containing formulations. One of the markers, P3, was found to be specific for Z. officinale and was successfully applied for detection of Z. officinale from Trikatu, a multicomponent formulation.

  4. Unit-length line-1 transcripts in human teratocarcinoma cells.

    PubMed Central

    Skowronski, J; Fanning, T G; Singer, M F

    1988-01-01

    We have characterized the approximately 6.5-kilobase cytoplasmic poly(A)+ Line-1 (L1) RNA present in a human teratocarcinoma cell line, NTera2D1, by primer extension and by analysis of cloned cDNAs. The bulk of the RNA begins (5' end) at the residue previously identified as the 5' terminus of the longest known primate genomic L1 elements, presumed to represent "unit" length. Several of the cDNA clones are close to 6 kilobase pairs, that is, close to full length. The partial sequences of 18 cDNA clones and full sequence of one (5,975 base pairs) indicate that many different genomic L1 elements contribute transcripts to the 6.5-kilobase cytoplasmic poly(A)+ RNA in NTera2D1 cells because no 2 of the 19 cDNAs analyzed had identical sequences. The transcribed elements appear to represent a subset of the total genomic L1s, a subset that has a characteristic consensus sequence in the 3' noncoding region and a high degree of sequence conservation throughout. Two open reading frames (ORFs) of 1,122 (ORF1) and 3,852 (ORF2) bases, flanked by about 800 and 200 bases of sequence at the 5' and 3' ends, respectively, can be identified in the cDNAs. Both ORFs are in the same frame, and they are separated by 33 bases bracketed by two conserved in-frame stop codons. ORF 2 is interrupted by at least one randomly positioned stop codon in the majority of the cDNAs. The data support proposals suggesting that the human L1 family includes one or more functional genes as well as an extraordinarily large number of pseudogenes whose ORFs are broken by stop codons. The cDNA structures suggest that both genes and pseudogenes are transcribed. At least one of the cDNAs (cD11), which was sequenced in its entirety, could, in principle, represent an mRNA for production of the ORF1 polypeptide. The similarity of mammalian L1s to several recently described invertebrate movable elements defines a new widely distributed class of elements which we term class II retrotransposons. Images PMID:2454389

  5. Sequence-similar, structure-dissimilar protein pairs in the PDB.

    PubMed

    Kosloff, Mickey; Kolodny, Rachel

    2008-05-01

    It is often assumed that in the Protein Data Bank (PDB), two proteins with similar sequences will also have similar structures. Accordingly, it has proved useful to develop subsets of the PDB from which "redundant" structures have been removed, based on a sequence-based criterion for similarity. Similarly, when predicting protein structure using homology modeling, if a template structure for modeling a target sequence is selected by sequence alone, this implicitly assumes that all sequence-similar templates are equivalent. Here, we show that this assumption is often not correct and that standard approaches to create subsets of the PDB can lead to the loss of structurally and functionally important information. We have carried out sequence-based structural superpositions and geometry-based structural alignments of a large number of protein pairs to determine the extent to which sequence similarity ensures structural similarity. We find many examples where two proteins that are similar in sequence have structures that differ significantly from one another. The source of the structural differences usually has a functional basis. The number of such proteins pairs that are identified and the magnitude of the dissimilarity depend on the approach that is used to calculate the differences; in particular sequence-based structure superpositioning will identify a larger number of structurally dissimilar pairs than geometry-based structural alignments. When two sequences can be aligned in a statistically meaningful way, sequence-based structural superpositioning provides a meaningful measure of structural differences. This approach and geometry-based structure alignments reveal somewhat different information and one or the other might be preferable in a given application. Our results suggest that in some cases, notably homology modeling, the common use of nonredundant datasets, culled from the PDB based on sequence, may mask important structural and functional information. We have established a data base of sequence-similar, structurally dissimilar protein pairs that will help address this problem (http://luna.bioc.columbia.edu/rachel/seqsimstrdiff.htm).

  6. Isolation of a gammaherpesvirus similar to asinine herpesvirus-2 (AHV-2) from a mule and a survey of mules and donkeys for AHV-2 infection by real-time PCR.

    PubMed

    Bell, Stephanie A; Pusterla, Nicola; Balasuriya, Udeni B R; Mapes, Samantha M; Nyberg, Nicole L; MacLachlan, N James

    2008-07-27

    Equids are commonly infected by herpesviruses, but isolation of herpesviruses from mules has apparently not been previously reported. Furthermore, the genomic relationships among the various equid herpesviruses are poorly characterized. We describe the isolation and preliminary characterization of a mule gammaherpesvirus tentatively identified as asinine herpesvirus-2 (AHV-2; also designated equid herpesvirus-7 (EHV-7)) from the nasal secretions (NS) of a healthy mule in northern California. The virus was initially identified by transmission electron microscopic examination of lysates of cell culture inoculated with NS collected from the mule. A 913 nucleotide sequence of the DNA polymerase gene was amplified using degenerate primers, and comparison of this sequence with those of various other herpesviruses showed that the mule herpesvirus was most closely related to EHV-2 (AHV-2 sequences were not available for comparison). The sequence of a shorter portion (166 nucleotides) of the mule herpesvirus DNA polymerase gene was identical to that of the published sequence of an asinine gammaherpesvirus, previously designated as AHV-4-3 (AY054992). AHV-2 was detected by real-time polymerase chain reaction assay in the NS of approximately 8% of a cohort of 114 healthy mules and 13 donkeys.

  7. The first complete mitochondrial genome of Bactrocera tsuneonis (Miyake) (Diptera: Tephritidae) by next-generation sequencing and its phylogenetic implications.

    PubMed

    Zhang, Yue; Feng, Shiqian; Zeng, Yiying; Ning, Hong; Liu, Lijun; Zhao, Zihua; Jiang, Fan; Li, Zhihong

    2018-06-23

    Bactrocera tsuneonis (Miyake), generally known as the Japanese orange fly, is considered to be a major pest of commercial citrus crops. It has a limited distribution in China, Japan and Vietnam, but it has the potential to invade areas outside of Asia. More genetic information of B. tsuneonis should be obtained in order to develop effective methodologies for rapid and accurate molecular identification due to the difficulty of distinguishing it from Bactrocera minax based on morphological features. We report here the whole mitochondrial genome of B. tsuneonis sequenced by next-generation sequencing. This mitogenome sequence had a total length of 15,865 bp, a typical circular molecule comprising 13 protein-coding genes, 2 rRNA genes, 22 tRNA genes and a non-coding region (A + T-rich control region). The structure and organization of the molecule were typical and similar compared with the published homologous sequences of other fruit flies in Tephritidae. The phylogenetic analyses based on the mitochondrial genome data presented a close genetic relationship between B. tsuneonis and B. minax. This is the first report of the complete mitochondrial genome of B. tsuneonis, and it can be used in further studies of species diagnosis, evolutionary biology, prevention and control. Copyright © 2018. Published by Elsevier B.V.

  8. Birth and death of genes linked to chromosomal inversion

    PubMed Central

    Furuta, Yoshikazu; Kawai, Mikihiko; Yahara, Koji; Takahashi, Noriko; Handa, Naofumi; Tsuru, Takeshi; Oshima, Kenshiro; Yoshida, Masaru; Azuma, Takeshi; Hattori, Masahira; Uchiyama, Ikuo; Kobayashi, Ichizo

    2011-01-01

    The birth and death of genes is central to adaptive evolution, yet the underlying genome dynamics remain elusive. The availability of closely related complete genome sequences helps to follow changes in gene contents and clarify their relationship to overall genome organization. Helicobacter pylori, bacteria in our stomach, are known for their extreme genome plasticity through mutation and recombination and will make a good target for such an analysis. In comparing their complete genome sequences, we found that gain and loss of genes (loci) for outer membrane proteins, which mediate host interaction, occurred at breakpoints of chromosomal inversions. Sequence comparison there revealed a unique mechanism of DNA duplication: DNA duplication associated with inversion. In this process, a DNA segment at one chromosomal locus is copied and inserted, in an inverted orientation, into a distant locus on the same chromosome, while the entire region between these two loci is also inverted. Recognition of this and three more inversion modes, which occur through reciprocal recombination between long or short sequence similarity or adjacent to a mobile element, allowed reconstruction of synteny evolution through inversion events in this species. These results will guide the interpretation of extensive DNA sequencing results for understanding long- and short-term genome evolution in various organisms and in cancer cells. PMID:21212362

  9. New Insights into Asian Prunus Viruses in the Light of NGS-Based Full Genome Sequencing.

    PubMed

    Marais, Armelle; Faure, Chantal; Candresse, Thierry

    2016-01-01

    Double stranded RNAs were purified from five Prunus sources of Asian origin and submitted to 454 pyrosequencing after a random, whole genome amplification. Four complete genomes of Asian prunus virus 1 (APV1), APV2 and APV3 were reconstructed from the sequencing reads, as well as four additional, near-complete genome sequences. Phylogenetic analyses confirmed the close relationships of these three viruses and the taxonomical position previously proposed for APV1, the only APV so far completely sequenced. The genetic distances in the respective polymerase and coat protein genes as well as their gene products suggest that APV2 should be considered as a distinct viral species in the genus Foveavirus, even if the amino acid identity levels in the polymerase are very close to the species demarcation criteria for the family Betaflexiviridae. However, the situation is more complex for APV1 and APV3, for which opposite conclusions are obtained depending on the gene (polymerase or coat protein) analyzed. Phylogenetic and recombination analyses suggest that recombination events may have been involved in the evolution of APV. Moreover, genome comparisons show that the unusually long 3' non-coding region (3' NCR) is highly variable and a hot spot for indel polymorphisms. In particular, two APV3 variants differing only in their 3' NCR were identified in a single Prunus source, with 3' NCRs of 214-312 nt, a size similar to that observed in other foveaviruses, but 567-850 nt smaller than in other APV3 isolates. Overall, this study provides critical genome information of these viruses, frequently associated with Prunus materials, even though their precise role as pathogens remains to be elucidated.

  10. Molecular characterization of the full-length L and M RNAs of Tomato yellow ring virus, a member of the genus Tospovirus.

    PubMed

    Chen, Tsung-Chi; Li, Ju-Ting; Fan, Ya-Shu; Yeh, Yi-Chun; Yeh, Shyi-Dong; Kormelink, Richard

    2013-06-01

    Tomato yellow ring virus (TYRV), first isolated from tomato in Iran, was classified as a non-approved species of the genus Tospovirus based on the characterization of its genomic S RNA. In the current study, the complete sequences of the genomic L and M RNAs of TYRV were determined and analyzed. The L RNA has 8,877 nucleotides (nt) and codes in the viral complementary (vc) strand for the putative RNA-dependent RNA polymerase (RdRp) of 2,873 amino acids (aa) (331 kDa). The RdRp of TYRV shares the highest aa sequence identity (88.7 %) with that of Iris yellow spot virus (IYSV), and contains conserved motifs shared with those of the animal-infecting bunyaviruses. The M RNA contains 4,786 nt and codes in ambisense arrangement for the NSm protein of 308 aa (34.5 kDa) in viral sense, and the Gn/Gc glycoprotein precursor (GP) of 1,310 aa (128 kDa) in vc-sense. Phylogenetic analyses indicated that TYRV is closely clustered with IYSV and Polygonum ringspot virus (PolRSV). The NSm and GP of TYRV share the highest aa sequence identity with those of IYSV and PolRSV (89.9 and 80.2-86.5 %, respectively). Moreover, the GPs of TYRV, IYSV, and PolRSV share highly similar characteristics, among which an identical deduced N-terminal protease cleavage site that is distinct from all tospoviral GPs analyzed thus far. Taken together, the elucidation of the complete genome sequence and biological features of TYRV support a close ancestral relationship with IYSV and PolRSV.

  11. Molecular characterization of KGH, the first human isolate of rabies virus in Korea.

    PubMed

    Park, Jun-Sun; Kim, Chi-Kyeong; Kim, Su Yeon; Ju, Young Ran

    2013-04-01

    The complete genome sequence of the KGH strain of the first human rabies virus, which was isolated from a skin biopsy of a patient with rabies, whose symptoms developed due to bites from a raccoon dog in 2001. The size of the KGH strain genome was determined to be 11,928 nucleotides (nt) with a leader sequence of 58 nt, nucleoprotein gene of 1,353 nt, phosphoprotein gene of 894 nt, matrix protein gene of 609 nt, glycoprotein gene of 1,575 nt, RNA-dependent RNA polymerase gene of 6,384 nt, and trailer region of 69 nt. Sequence similarity was compared with 39 fully sequenced rabies virus genomes currently available, and the result showed 70.6-91.6 % at the nucleotide level, and 82.8-97.9 % at the amino acid level. The deduced amino acids in the viral protein were compared with those of other rabies viruses, and various functional regions were investigated. As a result, we found that the KGH strain only had a unique amino acid substitution that was identified to be associated either with host immune response and pathogenicity in the N protein, or with a related region regulating STAT1 in the P protein, and related to pathogenicity in G protein. Based on phylogenetic analyses using the complete genome of 39 rabies viruses, the KGH strain was determined to be closely related with the NNV-RAB-H strain and transplant rabies virus serotype 1, which are Indian isolates, and was confirmed to belong to the Arctic-like 2 clade. The KGH strain was most closely related to the SKRRD0204HC and SKRRD0205HC strain when compared with Korean animal isolates, which was separated around the same time and place, and belonged to the Gangwon III subgroup.

  12. CRISPR Diversity and Microevolution in Clostridium difficile.

    PubMed

    Andersen, Joakim M; Shoup, Madelyn; Robinson, Cathy; Britton, Robert; Olsen, Katharina E P; Barrangou, Rodolphe

    2016-09-19

    Virulent strains of Clostridium difficile have become a global health problem associated with morbidity and mortality. Traditional typing methods do not provide ideal resolution to track outbreak strains, ascertain genetic diversity between isolates, or monitor the phylogeny of this species on a global basis. Here, we investigate the occurrence and diversity of clustered regularly interspaced short palindromic repeats (CRISPR) and CRISPR-associated genes (cas) in C. difficile to assess the potential of CRISPR-based phylogeny and high-resolution genotyping. A single Type-IB CRISPR-Cas system was identified in 217 analyzed genomes with cas gene clusters present at conserved chromosomal locations, suggesting vertical evolution of the system, assessing a total of 1,865 CRISPR arrays. The CRISPR arrays, markedly enriched (8.5 arrays/genome) compared with other species, occur both at conserved and variable locations across strains, and thus provide a basis for typing based on locus occurrence and spacer polymorphism. Clustering of strains by array composition correlated with sequence type (ST) analysis. Spacer content and polymorphism within conserved CRISPR arrays revealed phylogenetic relationship across clades and within ST. Spacer polymorphisms of conserved arrays were instrumental for differentiating closely related strains, e.g., ST1/RT027/B1 strains and pathogenicity locus encoding ST3/RT001 strains. CRISPR spacers showed sequence similarity to phage sequences, which is consistent with the native role of CRISPR-Cas as adaptive immune systems in bacteria. Overall, CRISPR-Cas sequences constitute a valuable basis for genotyping of C. difficile isolates, provide insights into the micro-evolutionary events that occur between closely related strains, and reflect the evolutionary trajectory of these genomes. © The Author(s) 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  13. New Insights into Asian Prunus Viruses in the Light of NGS-Based Full Genome Sequencing

    PubMed Central

    Marais, Armelle; Faure, Chantal; Candresse, Thierry

    2016-01-01

    Double stranded RNAs were purified from five Prunus sources of Asian origin and submitted to 454 pyrosequencing after a random, whole genome amplification. Four complete genomes of Asian prunus virus 1 (APV1), APV2 and APV3 were reconstructed from the sequencing reads, as well as four additional, near-complete genome sequences. Phylogenetic analyses confirmed the close relationships of these three viruses and the taxonomical position previously proposed for APV1, the only APV so far completely sequenced. The genetic distances in the respective polymerase and coat protein genes as well as their gene products suggest that APV2 should be considered as a distinct viral species in the genus Foveavirus, even if the amino acid identity levels in the polymerase are very close to the species demarcation criteria for the family Betaflexiviridae. However, the situation is more complex for APV1 and APV3, for which opposite conclusions are obtained depending on the gene (polymerase or coat protein) analyzed. Phylogenetic and recombination analyses suggest that recombination events may have been involved in the evolution of APV. Moreover, genome comparisons show that the unusually long 3’ non-coding region (3' NCR) is highly variable and a hot spot for indel polymorphisms. In particular, two APV3 variants differing only in their 3’ NCR were identified in a single Prunus source, with 3' NCRs of 214–312 nt, a size similar to that observed in other foveaviruses, but 567–850 nt smaller than in other APV3 isolates. Overall, this study provides critical genome information of these viruses, frequently associated with Prunus materials, even though their precise role as pathogens remains to be elucidated. PMID:26741704

  14. [The commercially cultivated edible oyster mushrooms Pleurotus sajor-caju and P. pulmonarius are two separate species, similar in morphology but reproductively isolated].

    PubMed

    Shnyreva, A A; Sivolapova, A B; Shnyreva, A V

    2012-11-01

    Two closely related commercially cultivated oyster mushroom species, Pleurotus pulmonarius and P. sajor-caju have been differentiated by traditional mating experiments as well as analysis of the variable ITS and IGS sequences of the ribosomal gene cluster. Molecular analysis of the variable ITS and IGS regions has allowed neither reliable differentiation between the morphologically similar species P. pulmonarius and P. sajor-caju nor confirmation of species identity of the P. sajor-caju strains CS-32, H-1, and H-2. Analysis of the sexual (mating) compatibility between haploid tester strains of these two species in monokaryon-monokaryon mating experiments has demonstrated complete reproductive isolation between P. pulmonarius and P. sajor-caju, thereby confirming that these are separate species.

  15. Comparing COI and ITS as DNA barcode markers for mushrooms and allies (Agaricomycotina).

    PubMed

    Dentinger, Bryn T M; Didukh, Maryna Y; Moncalvo, Jean-Marc

    2011-01-01

    DNA barcoding is an approach to rapidly identify species using short, standard genetic markers. The mitochondrial cytochrome oxidase I gene (COI) has been proposed as the universal barcode locus, but its utility for barcoding in mushrooms (ca. 20,000 species) has not been established. We succeeded in generating 167 partial COI sequences (~450 bp) representing ~100 morphospecies from ~650 collections of Agaricomycotina using several sets of new primers. Large introns (~1500 bp) at variable locations were detected in ~5% of the sequences we obtained. We suspect that widespread presence of large introns is responsible for our low PCR success (~30%) with this locus. We also sequenced the nuclear internal transcribed spacer rDNA regions (ITS) to compare with COI. Among the small proportion of taxa for which COI could be sequenced, COI and ITS perform similarly as a barcode. However, in a densely sampled set of closely related taxa, COI was less divergent than ITS and failed to distinguish all terminal clades. Given our results and the wealth of ITS data already available in public databases, we recommend that COI be abandoned in favor of ITS as the primary DNA barcode locus in mushrooms.

  16. A case of canine borreliosis in Iran caused by Borrelia persica.

    PubMed

    Shirani, Darush; Rakhshanpoor, Alaleh; Cutler, Sally Jane; Ghazinezhad, Behnaz; Naddaf, Saied Reza

    2016-04-01

    Tick-borne relapsing fever is an endemic disease in Iran, with most cases attributed to infection by Borrelia persica, which is transmitted by Ornithodoros tholozani soft ticks. Here, we report spirochetemia in blood of a puppy residing in Tehran, Iran. The causative species was identified by use of highly discriminative IGS sequencing; the 489 bp IGS sequence obtained in our study showed 99% identity (100% coverage) when compared with B. persica sequences derived from clinical cases or from O. tholozani ticks. Our IGS sequence also showed 99% similarity over 414 bp (85% coverage) with a strain from a domestic dog, and 96% over 328 bp (69% coverage) with a strain from a domestic cat. Pet-keeping in cosmopolitan cities like Tehran has become increasingly popular in recent years. Animals are often transported into the city in cages or cardboard boxes that might also harbor minute tick larvae and/or early stages of the nymphs bringing them into the urban environment. This may pose a threat to household members who buy and keep these puppies and as a result may come into close contact with infected ticks. Copyright © 2016 Elsevier GmbH. All rights reserved.

  17. Comparing COI and ITS as DNA Barcode Markers for Mushrooms and Allies (Agaricomycotina)

    PubMed Central

    Dentinger, Bryn T. M.; Didukh, Maryna Y.; Moncalvo, Jean-Marc

    2011-01-01

    DNA barcoding is an approach to rapidly identify species using short, standard genetic markers. The mitochondrial cytochrome oxidase I gene (COI) has been proposed as the universal barcode locus, but its utility for barcoding in mushrooms (ca. 20,000 species) has not been established. We succeeded in generating 167 partial COI sequences (∼450 bp) representing ∼100 morphospecies from ∼650 collections of Agaricomycotina using several sets of new primers. Large introns (∼1500 bp) at variable locations were detected in ∼5% of the sequences we obtained. We suspect that widespread presence of large introns is responsible for our low PCR success (∼30%) with this locus. We also sequenced the nuclear internal transcribed spacer rDNA regions (ITS) to compare with COI. Among the small proportion of taxa for which COI could be sequenced, COI and ITS perform similarly as a barcode. However, in a densely sampled set of closely related taxa, COI was less divergent than ITS and failed to distinguish all terminal clades. Given our results and the wealth of ITS data already available in public databases, we recommend that COI be abandoned in favor of ITS as the primary DNA barcode locus in mushrooms. PMID:21966418

  18. Identification of the full-length β-actin sequence and expression profiles in the tree shrew (Tupaia belangeri).

    PubMed

    Zheng, Yu; Yun, Chenxia; Wang, Qihui; Smith, Wanli W; Leng, Jing

    2015-02-01

    The tree shrew (Tupaia belangeri) diverges from the primate order (Primates) and is classified as a separate taxonomic group of mammals - Scandentia. It has been suggested that the tree shrew can be used as an animal model for studying human diseases; however, the genomic sequence of the tree shrew is largely unidentified. In the present study, we reported the full-length cDNA sequence of the housekeeping gene, β-actin, in the tree shrew. The amino acid sequence of β-actin in the tree shrew was compared to that of humans and other species; a simple phylogenetic relationship was discovered. Quantitative polymerase chain reaction (qPCR) and western blot analysis further demonstrated that the expression profiles of β-actin, as a general conservative housekeeping gene, in the tree shrew were similar to those in humans, although the expression levels varied among different types of tissue in the tree shrew. Our data provide evidence that the tree shrew has a close phylogenetic association with humans. These findings further enhance the potential that the tree shrew, as a species, may be used as an animal model for studying human disorders.

  19. Organization of the hao gene cluster of Nitrosomonas europaea: genes for two tetraheme c cytochromes.

    PubMed

    Bergmann, D J; Arciero, D M; Hooper, A B

    1994-06-01

    The organization of genes for three proteins involved in ammonia oxidation in Nitrosomonas europaea has been investigated. The amino acid sequence of the N-terminal region and four heme-containing peptides produced by proteolysis of the tetraheme cytochrome c554 of N. europaea were determined by Edman degradation. The gene (cycA) encoding this cytochrome is present in three copies per genome (H. McTavish, F. LaQuier, D. Arciero, M. Logan, G. Mundfrom, J.A. Fuchs, and A. B. Hooper, J. Bacteriol. 175:2445-2447, 1993). Three clones, representing at least two copies of cycA, were isolated and sequenced by the dideoxy-chain termination procedure. In both copies, the sequences of 211 amino acids derived from the gene sequence are identical and include all amino acids predicted by the proteolytic peptides. In two copies, the cycA open reading frame (ORF) is followed closely (three bases in one copy) by a second ORF predicted to encode a 28-kDa tetraheme c cytochrome not previously characterized but similar to the nirT gene product of Pseudomonas stutzeri. In one copy of the cycA gene cluster, the second ORF is absent.

  20. Diverse Dengue Type 2 Virus Populations Contain Recombinant and Both Parental Viruses in a Single Mosquito Host

    PubMed Central

    Craig, Scott; Thu, Hlaing Myat; Lowry, Kym; Wang, Xiao-fang; Holmes, Edward C.; Aaskov, John

    2003-01-01

    Envelope (E) protein genes sampled from populations of dengue 2 (DEN-2) virus in individual Aedes aegypti mosquitoes and in serum from dengue patients were copied to cDNA, cloned, and sequenced. The nucleotide sequences of the E genes in more than 70% of the clones differed from the consensus sequence for the corresponding virus population at up to 11 sites, and 24 of the 94 clones contained at least one stop codon. Virus populations recovered up to 2 years apart yielded clones with similar polymorphisms in the E gene. For one mosquito, the clones obtained fell into two genotypes. One group of sequences was closely related to those of viruses recovered from dengue patients in the same locality (Yangon, Myanmar) since 1995 and were classified as Asian 1 genotype. The second group were Cosmopolitan genotype viruses which were also circulating in Yangon in 2000 and which were related to DEN-2 viruses sampled from southern China in 1999. Finally, one clone was identified as a recombinant genome composed of portions of these two “parental” genotypes. This is the first report of recombinant and parental dengue viruses in a single host. PMID:12634407

  1. Zygosaccharomyces favi sp. nov., an obligate osmophilic yeast species from bee bread and honey.

    PubMed

    Čadež, Neža; Fülöp, László; Dlauchy, Dénes; Péter, Gábor

    2015-03-01

    Five yeast strains representing a hitherto undescribed yeast species were isolated from bee bread and honey in Hungary. They are obligate osmophilic, i.e. they are unable to grow in/on high water activity culture media. Following isogamous conjugation, they form 1-4 spheroid or subspheroid ascospores in persistent asci. The analysis of the sequences of their large subunit rRNA gene D1/D2 domain placed the new species in the Zygosaccharomyces clade. In terms of pairwise sequence similarity, Zygosaccharomyces gambellarensis is the most closely related species. Comparisons of D1/D2, internal transcribed spacer and translation elongation factor-1α (EF-1α) gene sequences of the five strains with that of the type strain of Z. gambellarensis revealed that they represent a new yeast species. The name Zygosaccharomyces favi sp. nov. (type strain: NCAIM Y.01994(T) = CBS 13653(T) = NRRL Y-63719(T) = ZIM 2551(T)) is proposed for this new yeast species, which based on phenotype can be distinguished from related Zygosaccharomyces species by its obligate osmophilic nature. Some intragenomic sequence variability, mainly indels, was detected among the ITS copies of the strains of the new species.

  2. The genome sequence of the model ascomycete fungus Podospora anserina.

    PubMed

    Espagne, Eric; Lespinet, Olivier; Malagnac, Fabienne; Da Silva, Corinne; Jaillon, Olivier; Porcel, Betina M; Couloux, Arnaud; Aury, Jean-Marc; Ségurens, Béatrice; Poulain, Julie; Anthouard, Véronique; Grossetete, Sandrine; Khalili, Hamid; Coppin, Evelyne; Déquard-Chablat, Michelle; Picard, Marguerite; Contamine, Véronique; Arnaise, Sylvie; Bourdais, Anne; Berteaux-Lecellier, Véronique; Gautheret, Daniel; de Vries, Ronald P; Battaglia, Evy; Coutinho, Pedro M; Danchin, Etienne Gj; Henrissat, Bernard; Khoury, Riyad El; Sainsard-Chanet, Annie; Boivin, Antoine; Pinan-Lucarré, Bérangère; Sellem, Carole H; Debuchy, Robert; Wincker, Patrick; Weissenbach, Jean; Silar, Philippe

    2008-01-01

    The dung-inhabiting ascomycete fungus Podospora anserina is a model used to study various aspects of eukaryotic and fungal biology, such as ageing, prions and sexual development. We present a 10X draft sequence of P. anserina genome, linked to the sequences of a large expressed sequence tag collection. Similar to higher eukaryotes, the P. anserina transcription/splicing machinery generates numerous non-conventional transcripts. Comparison of the P. anserina genome and orthologous gene set with the one of its close relatives, Neurospora crassa, shows that synteny is poorly conserved, the main result of evolution being gene shuffling in the same chromosome. The P. anserina genome contains fewer repeated sequences and has evolved new genes by duplication since its separation from N. crassa, despite the presence of the repeat induced point mutation mechanism that mutates duplicated sequences. We also provide evidence that frequent gene loss took place in the lineages leading to P. anserina and N. crassa. P. anserina contains a large and highly specialized set of genes involved in utilization of natural carbon sources commonly found in its natural biotope. It includes genes potentially involved in lignin degradation and efficient cellulose breakdown. The features of the P. anserina genome indicate a highly dynamic evolution since the divergence of P. anserina and N. crassa, leading to the ability of the former to use specific complex carbon sources that match its needs in its natural biotope.

  3. Discovery and profiling of novel and conserved microRNAs during flower development in Carya cathayensis via deep sequencing.

    PubMed

    Wang, Zheng Jia; Huang, Jian Qin; Huang, You Jun; Li, Zheng; Zheng, Bing Song

    2012-08-01

    Hickory (Carya cathayensis Sarg.) is an economically important woody plant in China, but its long juvenile phase delays yield. MicroRNAs (miRNAs) are critical regulators of genes and important for normal plant development and physiology, including flower development. We used Solexa technology to sequence two small RNA libraries from two floral differentiation stages in hickory to identify miRNAs related to flower development. We identified 39 conserved miRNA sequences from 114 loci belonging to 23 families as well as two novel and ten potential novel miRNAs belonging to nine families. Moreover, 35 conserved miRNA*s and two novel miRNA*s were detected. Twenty miRNA sequences from 49 loci belonging to 11 families were differentially expressed; all were up-regulated at the later stage of flower development in hickory. Quantitative real-time PCR of 12 conserved miRNA sequences, five novel miRNA families, and two novel miRNA*s validated that all were expressed during hickory flower development, and the expression patterns were similar to those detected with Solexa sequencing. Finally, a total of 146 targets of the novel and conserved miRNAs were predicted. This study identified a diverse set of miRNAs that were closely related to hickory flower development and that could help in plant floral induction.

  4. Characterization of Apricot pseudo-chlorotic leaf spot virus, A Novel Trichovirus Isolated from Stone Fruit Trees.

    PubMed

    Liberti, D; Marais, A; Svanella-Dumas, L; Dulucq, M J; Alioto, D; Ragozzino, A; Rodoni, B; Candresse, T

    2005-04-01

    ABSTRACT A trichovirus closely related to Apple chlorotic leaf spot virus (ACLSV) was detected in symptomatic apricot and Japanese plum from Italy. The Sus2 isolate of this agent cross-reacted with anti-ACLSV polyclonal reagents but was not detected by broad-specificity anti- ACLSV monoclonal antibodies. It had particles with typical trichovirus morphology but, contrary to ACLSV, was unable to infect Chenopodium quinoa and C. amaranticolor. The sequence of its genome (7,494 nucleotides [nt], missing only approximately 30 to 40 nt of the 5' terminal sequence) and the partial sequence of another isolate were determined. The new virus has a genomic organization similar to that of ACLSV, with three open reading frames coding for a replication-associated protein (RNA-dependent RNA polymerase), a movement protein, and a capsid protein, respectively. However, it had only approximately 65 to 67% nucleotide identity with sequenced isolates of ACLSV. The differences in serology, host range, genome sequence, and phylogenetic reconstructions for all viral proteins support the idea that this agent should be considered a new virus, for which the name Apricot pseudo-chlorotic leaf spot virus (APCLSV) is proposed. APCLSV shows substantial sequence variability and has been recovered from various Prunus sources coming from seven countries, an indication that it is likely to have a wide geographical distribution.

  5. A physical map of the bovine genome

    PubMed Central

    Snelling, Warren M; Chiu, Readman; Schein, Jacqueline E; Hobbs, Matthew; Abbey, Colette A; Adelson, David L; Aerts, Jan; Bennett, Gary L; Bosdet, Ian E; Boussaha, Mekki; Brauning, Rudiger; Caetano, Alexandre R; Costa, Marcos M; Crawford, Allan M; Dalrymple, Brian P; Eggen, André; Everts-van der Wind, Annelie; Floriot, Sandrine; Gautier, Mathieu; Gill, Clare A; Green, Ronnie D; Holt, Robert; Jann, Oliver; Jones, Steven JM; Kappes, Steven M; Keele, John W; de Jong, Pieter J; Larkin, Denis M; Lewin, Harris A; McEwan, John C; McKay, Stephanie; Marra, Marco A; Mathewson, Carrie A; Matukumalli, Lakshmi K; Moore, Stephen S; Murdoch, Brenda; Nicholas, Frank W; Osoegawa, Kazutoyo; Roy, Alice; Salih, Hanni; Schibler, Laurent; Schnabel, Robert D; Silveri, Licia; Skow, Loren C; Smith, Timothy PL; Sonstegard, Tad S; Taylor, Jeremy F; Tellam, Ross; Van Tassell, Curtis P; Williams, John L; Womack, James E; Wye, Natasja H; Yang, George; Zhao, Shaying

    2007-01-01

    Background Cattle are important agriculturally and relevant as a model organism. Previously described genetic and radiation hybrid (RH) maps of the bovine genome have been used to identify genomic regions and genes affecting specific traits. Application of these maps to identify influential genetic polymorphisms will be enhanced by integration with each other and with bacterial artificial chromosome (BAC) libraries. The BAC libraries and clone maps are essential for the hybrid clone-by-clone/whole-genome shotgun sequencing approach taken by the bovine genome sequencing project. Results A bovine BAC map was constructed with HindIII restriction digest fragments of 290,797 BAC clones from animals of three different breeds. Comparative mapping of 422,522 BAC end sequences assisted with BAC map ordering and assembly. Genotypes and pedigree from two genetic maps and marker scores from three whole-genome RH panels were consolidated on a 17,254-marker composite map. Sequence similarity allowed integrating the BAC and composite maps with the bovine draft assembly (Btau3.1), establishing a comprehensive resource describing the bovine genome. Agreement between the marker and BAC maps and the draft assembly is high, although discrepancies exist. The composite and BAC maps are more similar than either is to the draft assembly. Conclusion Further refinement of the maps and greater integration into the genome assembly process may contribute to a high quality assembly. The maps provide resources to associate phenotypic variation with underlying genomic variation, and are crucial resources for understanding the biology underpinning this important ruminant species so closely associated with humans. PMID:17697342

  6. Parallel evolution of Batesian mimicry supergene in two Papilio butterflies, P. polytes and P. memnon

    PubMed Central

    Itoh, Takehiko

    2018-01-01

    Batesian mimicry protects animals from predators when mimics resemble distasteful models. The female-limited Batesian mimicry in Papilio butterflies is controlled by a supergene locus switching mimetic and nonmimetic forms. In Papilio polytes, recent studies revealed that a highly diversified region (HDR) containing doublesex (dsx-HDR) constitutes the supergene with dimorphic alleles and is likely maintained by a chromosomal inversion. In the closely related Papilio memnon, which exhibits a similar mimicry polymorphism, we performed whole-genome sequence analyses in 11 butterflies, which revealed a nearly identical dsx-HDR containing three genes (dsx, Nach-like, and UXT) with dimorphic sequences strictly associated with the mimetic/nonmimetic phenotypes. In addition, expression of these genes, except that of Nach-like in female hind wings, showed differences correlated with phenotype. The dimorphic dsx-HDR in P. memnon is maintained without a chromosomal inversion, suggesting that a separate mechanism causes and maintains allelic divergence in these genes. More abundant accumulation of transposable elements and repetitive sequences in the dsx-HDR than in other genomic regions may contribute to the suppression of chromosomal recombination. Gene trees for Dsx, Nach-like, and UXT indicated that mimetic alleles evolved independently in the two Papilio species. These results suggest that the genomic region involving the above three genes has repeatedly diverged so that two allelic sequences of this region function as developmental switches for mimicry polymorphism in the two Papilio species. The supergene structures revealed here suggest that independent evolutionary processes with different genetic mechanisms have led to parallel evolution of similar female-limited polymorphisms underlying Batesian mimicry in Papilio butterflies. PMID:29675466

  7. Comamonas aquatilis sp. nov., isolated from a garden pond.

    PubMed

    Kämpfer, Peter; Busse, Hans-Jürgen; Baars, Sophie; Wilharm, Gottfried; Glaeser, Stefanie P

    2018-04-01

    A beige-pigmented bacterial strain, SB30-Chr27-3 T , isolated from a garden pond, was studied for its taxonomic position. Cells of the isolate were rod-shaped and stained Gram-negative. A comparison of the 16S rRNA gene sequence with the sequences of the type strains of the most closely related species showed that the strain belongs to the genus Comamonas and showed highest sequence similarities to the type strains of Comamonas jiangduensis (97.5 %), Comamonas aquatica (97.4 %) and Comamonas phosphati (97.3 %). The 16S rRNA gene sequence similarities to all other Comamonas species were below 97.0 %. The fatty acid profile of strain SB30-Chr27-3 T consisted of the major fatty acids C16 : 0, C15 : 0iso 2-OH/ C16 : 1ω7c, C18 : 1ω7c/C18 : 1ω9c and, in a minor amount, C10 : 0 3-OH. Major compounds in the polar lipid profile were phosphatidylethanolamine, phosphatidylglycerol, phosphatidylserine and diphosphatidylglycerol. The quinone system was exclusively composed of ubiquinone Q-8. The polyamine pattern contained the major compounds putrescine, cadaverine and 2-hydroxyputrescine. These data and the differentiating biochemical properties indicated that isolate SB30-CHR27-3 T represents a novel species of the genus Comamonas, for which we propose the name >Comamonas aquatilis sp. nov. with the type strain SB30-Chr27-3 T (=CIP 111491 T =CCM 8815 T ).

  8. Diversity and Distribution of Phenol Oxidase Producing Fungi from Soda Lake and Description of Curvularia lonarensis sp. nov.

    PubMed

    Sharma, Rahul; Prakash, Om; Sonawane, Mahesh S; Nimonkar, Yogesh; Golellu, Priyanka B; Sharma, Rohit

    2016-01-01

    Soda lake is hyper alkaline and saline habitat located in closed craters with high evaporation rate. In current study fungal diversity from water and sediment samples of a soda lake (Lonar lake) located in Buldhana district of Maharashtra, India was investigated using extensive culturomics approach and mimicking the natural conditions of Lonar lake in culture media. A total of 104 diverse isolates of extremophilic fungi were recovered from this study and phylogenetically characterized by internal transcribed spacer (ITS) region sequencing. In addition, due to important role of phenol oxidase, and peroxidase in degradation of toxic phenol, lignin, etc., all isolated pure cultures were also screened for extracellular phenol oxidase and peroxidase production potential. Diversity analysis indicated that different groups of extremophilic fungi are present in the water and sediment samples of Lonar lake. A total of 38 species of fungi belonging to 18-different genera were recovered. Out of 104 isolates 32 showed ≤97% sequences similarity, which were morphologically different and could be potential novel isolates of extremophilic fungi. However, out of 104 isolates only 14 showed the extracellular phenol oxidase production potentials at alkaline pH. Curvularia sp. strain MEF018 showed highest phenol oxidase production at alkaline condition and had low sequence similarity with previously characterized species (96% with Curvularia pseudorobusta ). Taxonomic characterization (morphological and physiological) and multi locus sequence analysis (MLSA) using combined alignment of ITS-LSU- gpd of strain MEF018 showed that it is a novel species of the genus Curvularia and hence proposed as Curvularia lonarensis sp. nov.

  9. Biochemical characterization and phylogenetic analysis based on 16S rRNA sequences for V-factor dependent members of Pasteurellaceae derived from laboratory rats.

    PubMed

    Hayashimoto, Nobuhito; Ueno, Masami; Tkakura, Akira; Itoh, Toshio

    2007-06-01

    Phylogenetic analysis based on 16S rRNA sequences with sequence data of some bacterial species of Pasteurellaceae related to rodents deposited in GenBank was performed along with biochemical characterization for the 20 strains of V-factor dependent members of Pasteurellaceae derived from laboratory rats to obtain basic information and to investigate the taxonomic positions. The results of biochemical tests for all strains were identical except for three tests, the ornithine decarboxylase test, and fermentation tests of D(+) mannose and D(+) xylose. The biochemical properties of 8 of 20 strains that showed negative results for the fermentation test of D(+) xylose agreed with those of Haemophilus parainfluenzae complex. By phylogenetic analysis, the strains were divided into two clusters that agreed with the results of the fermentation test of xylose (group I: negative reaction for xylose, group II: positive reaction for xylose). The clusters were independent of other bacterial species of Pasteurellaceae tested. The sequences of the strains in group I showed 99.7-99.8% similarity and the strains in group II showed 99.3-99.7% similarity. None of the strains in group I had a close relation with Haemophilus parainfluenzae by phylogenetic analysis, although they showed the same biochemical properties. In conclusion, the strains had characteristic biochemical properties and formed two independent groups within the "rodent cluster" of Pasteurellaceae that differed in the results of the fermentation test of xylose. Therefore, they seemed to be hitherto undescribed taxa in Pasteurellaceae.

  10. Diversity and Distribution of Phenol Oxidase Producing Fungi from Soda Lake and Description of Curvularia lonarensis sp. nov.

    PubMed Central

    Sharma, Rahul; Prakash, Om; Sonawane, Mahesh S.; Nimonkar, Yogesh; Golellu, Priyanka B.; Sharma, Rohit

    2016-01-01

    Soda lake is hyper alkaline and saline habitat located in closed craters with high evaporation rate. In current study fungal diversity from water and sediment samples of a soda lake (Lonar lake) located in Buldhana district of Maharashtra, India was investigated using extensive culturomics approach and mimicking the natural conditions of Lonar lake in culture media. A total of 104 diverse isolates of extremophilic fungi were recovered from this study and phylogenetically characterized by internal transcribed spacer (ITS) region sequencing. In addition, due to important role of phenol oxidase, and peroxidase in degradation of toxic phenol, lignin, etc., all isolated pure cultures were also screened for extracellular phenol oxidase and peroxidase production potential. Diversity analysis indicated that different groups of extremophilic fungi are present in the water and sediment samples of Lonar lake. A total of 38 species of fungi belonging to 18-different genera were recovered. Out of 104 isolates 32 showed ≤97% sequences similarity, which were morphologically different and could be potential novel isolates of extremophilic fungi. However, out of 104 isolates only 14 showed the extracellular phenol oxidase production potentials at alkaline pH. Curvularia sp. strain MEF018 showed highest phenol oxidase production at alkaline condition and had low sequence similarity with previously characterized species (96% with Curvularia pseudorobusta). Taxonomic characterization (morphological and physiological) and multi locus sequence analysis (MLSA) using combined alignment of ITS-LSU-gpd of strain MEF018 showed that it is a novel species of the genus Curvularia and hence proposed as Curvularia lonarensis sp. nov. PMID:27920761

  11. Alignment-free genome tree inference by learning group-specific distance metrics.

    PubMed

    Patil, Kaustubh R; McHardy, Alice C

    2013-01-01

    Understanding the evolutionary relationships between organisms is vital for their in-depth study. Gene-based methods are often used to infer such relationships, which are not without drawbacks. One can now attempt to use genome-scale information, because of the ever increasing number of genomes available. This opportunity also presents a challenge in terms of computational efficiency. Two fundamentally different methods are often employed for sequence comparisons, namely alignment-based and alignment-free methods. Alignment-free methods rely on the genome signature concept and provide a computationally efficient way that is also applicable to nonhomologous sequences. The genome signature contains evolutionary signal as it is more similar for closely related organisms than for distantly related ones. We used genome-scale sequence information to infer taxonomic distances between organisms without additional information such as gene annotations. We propose a method to improve genome tree inference by learning specific distance metrics over the genome signature for groups of organisms with similar phylogenetic, genomic, or ecological properties. Specifically, our method learns a Mahalanobis metric for a set of genomes and a reference taxonomy to guide the learning process. By applying this method to more than a thousand prokaryotic genomes, we showed that, indeed, better distance metrics could be learned for most of the 18 groups of organisms tested here. Once a group-specific metric is available, it can be used to estimate the taxonomic distances for other sequenced organisms from the group. This study also presents a large scale comparison between 10 methods--9 alignment-free and 1 alignment-based.

  12. Evidence for wild waterfowl origin of H7N3 influenza A virus detected in captive-reared New Jersey pheasants

    USGS Publications Warehouse

    Ramey, Andrew M.; Kim Torchetti, Mia; Poulson, Rebecca L.; Carter, Deborah L.; Reeves, Andrew B.; Link, Paul; Walther, Patrick; Lebarbenchon, Camille; Stallknecht, David E.

    2016-01-01

    In August 2014, a low-pathogenic H7N3 influenza A virus was isolated from pheasants at a New Jersey gamebird farm and hunting preserve. In this study, we use phylogenetic analyses and calculations of genetic similarity to gain inference into the genetic ancestry of this virus and to identify potential routes of transmission. Results of maximum-likelihood (ML) and maximum-clade-credibility (MCC) phylogenetic analyses provide evidence that A/pheasant/New Jersey/26996-2/2014 (H7N3) had closely related H7 hemagglutinin (HA) and N3 neuraminidase (NA) gene segments as compared to influenza A viruses circulating among wild waterfowl in the central and eastern USA. The estimated time of the most recent common ancestry (TMRCA) between the pheasant virus and those most closely related from wild waterfowl was early 2013 for both the H7 HA and N3 NA gene segments. None of the viruses from waterfowl identified as being most closely related to A/pheasant/New Jersey/26996-2/2014 at the HA and NA gene segments in ML and MCC phylogenetic analyses shared ≥99 % nucleotide sequence identity for internal gene segment sequences. This result indicates that specific viral strains identified in this study as being closely related to the HA and NA gene segments of A/pheasant/New Jersey/26996-2/2014 were not the direct predecessors of the etiological agent identified during the New Jersey outbreak. However, the recent common ancestry of the H7 and N3 gene segments of waterfowl-origin viruses and the virus isolated from pheasants suggests that viral diversity maintained in wild waterfowl likely played an important role in the emergence of A/pheasant/New Jersey/26996-2/2014.

  13. Whistle sequences in wild killer whales (Orcinus orca).

    PubMed

    Riesch, Rüdiger; Ford, John K B; Thomsen, Frank

    2008-09-01

    Combining different stereotyped vocal signals into specific sequences increases the range of information that can be transferred between individuals. The temporal emission pattern and the behavioral context of vocal sequences have been described in detail for a variety of birds and mammals. Yet, in cetaceans, the study of vocal sequences is just in its infancy. Here, we provide a detailed analysis of sequences of stereotyped whistles in killer whales off Vancouver Island, British Columbia. A total of 1140 whistle transitions in 192 whistle sequences recorded from resident killer whales were analyzed using common spectrographic analysis techniques. In addition to the stereotyped whistles described by Riesch et al., [(2006). "Stability and group specificity of stereotyped whistles in resident killer whales, Orcinus orca, off British Columbia," Anim. Behav. 71, 79-91.] We found a new and rare stereotyped whistle (W7) as well as two whistle elements, which are closely linked to whistle sequences: (1) stammers and (2) bridge elements. Furthermore, the frequency of occurrence of 12 different stereotyped whistle types within the sequences was not randomly distributed and the transition patterns between whistles were also nonrandom. Finally, whistle sequences were closely tied to close-range behavioral interactions (in particular among males). Hence, we conclude that whistle sequences in wild killer whales are complex signal series and propose that they are most likely emitted by single individuals.

  14. Genetic diversity in Trypanosoma theileri from Sri Lankan cattle and water buffaloes.

    PubMed

    Yokoyama, Naoaki; Sivakumar, Thillaiampalam; Fukushi, Shintaro; Tattiyapong, Muncharee; Tuvshintulga, Bumduuren; Kothalawala, Hemal; Silva, Seekkuge Susil Priyantha; Igarashi, Ikuo; Inoue, Noboru

    2015-01-30

    Trypanosoma theileri is a hemoprotozoan parasite that infects various ruminant species. We investigated the epidemiology of this parasite among cattle and water buffalo populations bred in Sri Lanka, using a diagnostic PCR assay based on the cathepsin L-like protein (CATL) gene. Blood DNA samples sourced from cattle (n=316) and water buffaloes (n=320) bred in different geographical areas of Sri Lanka were PCR screened for T. theileri. Parasite DNA was detected in cattle and water buffaloes alike in all the sampling locations. The overall T. theileri-positive rate was higher in water buffaloes (15.9%) than in cattle (7.6%). Subsequently, PCR amplicons were sequenced and the partial CATL sequences were phylogenetically analyzed. The identity values for the CATL gene were 89.6-99.7% among the cattle-derived sequences, compared with values of 90.7-100% for the buffalo-derived sequences. However, the cattle-derived sequences shared 88.2-100% identity values with those from buffaloes. In the phylogenetic tree, the Sri Lankan CATL gene sequences fell into two major clades (TthI and TthII), both of which contain CATL sequences from several other countries. Although most of the CATL sequences from Sri Lankan cattle and buffaloes clustered independently, two buffalo-derived sequences were observed to be closely related to those of the Sri Lankan cattle. Furthermore, a Sri Lankan buffalo sequence clustered with CATL gene sequences from Brazilian buffalo and Thai cattle. In addition to reporting the first PCR-based survey of T. theileri among Sri Lankan-bred cattle and water buffaloes, the present study found that some of the CATL gene fragments sourced from water buffaloes shared similarity with those determined from cattle in this country. Copyright © 2014 Elsevier B.V. All rights reserved.

  15. High-resolution phylogenetic microbial community profiling

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Singer, Esther; Coleman-Derr, Devin; Bowman, Brett

    2014-03-17

    The representation of bacterial and archaeal genome sequences is strongly biased towards cultivated organisms, which belong to merely four phylogenetic groups. Functional information and inter-phylum level relationships are still largely underexplored for candidate phyla, which are often referred to as microbial dark matter. Furthermore, a large portion of the 16S rRNA gene records in the GenBank database are labeled as environmental samples and unclassified, which is in part due to low read accuracy, potential chimeric sequences produced during PCR amplifications and the low resolution of short amplicons. In order to improve the phylogenetic classification of novel species and advance ourmore » knowledge of the ecosystem function of uncultivated microorganisms, high-throughput full length 16S rRNA gene sequencing methodologies with reduced biases are needed. We evaluated the performance of PacBio single-molecule real-time (SMRT) sequencing in high-resolution phylogenetic microbial community profiling. For this purpose, we compared PacBio and Illumina metagenomic shotgun and 16S rRNA gene sequencing of a mock community as well as of an environmental sample from Sakinaw Lake, British Columbia. Sakinaw Lake is known to contain a large age of microbial species from candidate phyla. Sequencing results show that community structure based on PacBio shotgun and 16S rRNA gene sequences is highly similar in both the mock and the environmental communities. Resolution power and community representation accuracy from SMRT sequencing data appeared to be independent of GC content of microbial genomes and was higher when compared to Illumina-based metagenome shotgun and 16S rRNA gene (iTag) sequences, e.g. full-length sequencing resolved all 23 OTUs in the mock community, while iTags did not resolve closely related species. SMRT sequencing hence offers various potential benefits when characterizing uncharted microbial communities.« less

  16. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Curry, J J; Gallagher, D W; Modarres, M

    Appendices are presented concerning isolation condenser makeup; vapor suppression system; station air system; reactor building closed cooling water system; turbine building secondary closed water system; service water system; emergency service water system; fire protection system; emergency ac power; dc power system; event probability estimation; methodology of accident sequence quantification; and assignment of dominant sequences to release categories.

  17. 33 CFR 117.1035 - Columbia River.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... the remote control stations located at the ends of the bridge. Operation of the bridge shall be as... visually inspect the waterway for marine traffic approaching the bridge. The closing sequence shall not be activated until after marine traffic has cleared the bridge. (3) When the closing sequence is activated, the...

  18. 33 CFR 117.1035 - Columbia River.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... the remote control stations located at the ends of the bridge. Operation of the bridge shall be as... visually inspect the waterway for marine traffic approaching the bridge. The closing sequence shall not be activated until after marine traffic has cleared the bridge. (3) When the closing sequence is activated, the...

  19. Subgrouping Automata: automatic sequence subgrouping using phylogenetic tree-based optimum subgrouping algorithm.

    PubMed

    Seo, Joo-Hyun; Park, Jihyang; Kim, Eun-Mi; Kim, Juhan; Joo, Keehyoung; Lee, Jooyoung; Kim, Byung-Gee

    2014-02-01

    Sequence subgrouping for a given sequence set can enable various informative tasks such as the functional discrimination of sequence subsets and the functional inference of unknown sequences. Because an identity threshold for sequence subgrouping may vary according to the given sequence set, it is highly desirable to construct a robust subgrouping algorithm which automatically identifies an optimal identity threshold and generates subgroups for a given sequence set. To meet this end, an automatic sequence subgrouping method, named 'Subgrouping Automata' was constructed. Firstly, tree analysis module analyzes the structure of tree and calculates the all possible subgroups in each node. Sequence similarity analysis module calculates average sequence similarity for all subgroups in each node. Representative sequence generation module finds a representative sequence using profile analysis and self-scoring for each subgroup. For all nodes, average sequence similarities are calculated and 'Subgrouping Automata' searches a node showing statistically maximum sequence similarity increase using Student's t-value. A node showing the maximum t-value, which gives the most significant differences in average sequence similarity between two adjacent nodes, is determined as an optimum subgrouping node in the phylogenetic tree. Further analysis showed that the optimum subgrouping node from SA prevents under-subgrouping and over-subgrouping. Copyright © 2013. Published by Elsevier Ltd.

  20. Large-Scale Concatenation cDNA Sequencing

    PubMed Central

    Yu, Wei; Andersson, Björn; Worley, Kim C.; Muzny, Donna M.; Ding, Yan; Liu, Wen; Ricafrente, Jennifer Y.; Wentland, Meredith A.; Lennon, Greg; Gibbs, Richard A.

    1997-01-01

    A total of 100 kb of DNA derived from 69 individual human brain cDNA clones of 0.7–2.0 kb were sequenced by concatenated cDNA sequencing (CCS), whereby multiple individual DNA fragments are sequenced simultaneously in a single shotgun library. The method yielded accurate sequences and a similar efficiency compared with other shotgun libraries constructed from single DNA fragments (>20 kb). Computer analyses were carried out on 65 cDNA clone sequences and their corresponding end sequences to examine both nucleic acid and amino acid sequence similarities in the databases. Thirty-seven clones revealed no DNA database matches, 12 clones generated exact matches (≥98% identity), and 16 clones generated nonexact matches (57%–97% identity) to either known human or other species genes. Of those 28 matched clones, 8 had corresponding end sequences that failed to identify similarities. In a protein similarity search, 27 clone sequences displayed significant matches, whereas only 20 of the end sequences had matches to known protein sequences. Our data indicate that full-length cDNA insert sequences provide significantly more nucleic acid and protein sequence similarity matches than expressed sequence tags (ESTs) for database searching. [All 65 cDNA clone sequences described in this paper have been submitted to the GenBank data library under accession nos. U79240–U79304.] PMID:9110174

  1. Setting up a probe based, closed tube real-time PCR assay for focused detection of variable sequence alterations.

    PubMed

    Becságh, Péter; Szakács, Orsolya

    2014-10-01

    During diagnostic workflow when detecting sequence alterations, sometimes it is important to design an algorithm that includes screening and direct tests in combination. Normally the use of direct test, which is mainly sequencing, is limited. There is an increased need for effective screening tests, with "closed tube" during the whole process and therefore decreasing the risk of PCR product contamination. The aim of this study was to design such a closed tube, detection probe based screening assay to detect different kind of sequence alterations in the exon 11 of the human c-kit gene region. Inside this region there are variable possible deletions and single nucleotide changes. During assay setup, more probe chemistry formats were screened and tested. After some optimization steps the taqman probe format was selected.

  2. The complete plastid genome of the middle Asian endemic of Stipa lipskyi (Poaceae).

    PubMed

    Myszczyński, Kamil; Nobis, Marcin; Szczecinska, Monika; Sawicki, Jakub; Nowak, Arkadiusz

    2016-11-01

    The structure of the Stipa lipskyi (GenBank accession no. KT692644) plastid genome is similar to that of closely related Poaceae species: it has a total length of 137 755 bp, the base composition of the plastome is the following: A (30.7%), C (19.3%), G (19.4%) and T (30.5%). The S. lipskyi plastid genome contains 71 genes, excluding second IR region. A complete plastome sequence of S. lipskyi will help the development of primers for examining phylogeny and hybridization events in this taxonomically difficult genus.

  3. Mucilaginibacter pineti sp. nov., isolated from Pinus pinaster wood from a mixed grove of pines trees.

    PubMed

    Paiva, Gabriel; Abreu, Pedro; Proença, Diogo Neves; Santos, Susana; Nobre, Maria Fernanda; Morais, Paula V

    2014-07-01

    Bacterial strain M47C3B(T) was isolated from the endophytic microbial community of a Pinus pinaster tree branch from a mixed grove of pines. Phylogenetic analysis of 16S rRNA gene sequences showed that this organism represented one distinct branch within the family Sphingobacteriaceae, most closely related to the genus Mucilaginibacter. Strain M47C3B(T) formed a distinct lineage, closely related to Mucilaginibacter dorajii KACC 14556(T), with which it shared 97.2% 16S rRNA gene sequence similarity. The other members of the genus Mucilaginibacter included in the same clade were Mucilaginibacter lappiensis ATCC BAA-1855(T) sharing 97.0% similarity and Mucilaginibacter composti TR6-03(T) that had a lower similarity (95.7%). The novel strain was Gram-staining-negative, formed rod-shaped cells, grew optimally at 26 °C and at pH 7, and was able to grow with up to 0.3% (w/v) NaCl. The respiratory quinone was menaquinone 7 (MK-7) and the major fatty acids of the strain were summed feature 3 (C16 : 1ω7c/iso-C15 : 0 2-OH), iso-C15 : 0 and iso-C17 : 0 3-OH, representing 73.5% of the total fatty acids. The major components of the polar lipid profile of strain M47C3B(T) consisted of phosphatidylethanolamine, three unidentified aminophospholipids, one unidentified aminolipid and three unidentified polar lipids. The G+C content of the DNA was 40.6 mol%. On the basis of the phylogenetic analysis and physiological and biochemical characteristics we propose the name Mucilaginibacter pineti sp. nov. for the novel species represented by strain M47C3B(T) ( = CIP 110632(T) = LMG 28160(T)). © 2014 IUMS.

  4. Functional characterisation of the Anopheles leucokinins and their cognate G-protein coupled receptor.

    PubMed

    Radford, Jonathan C; Terhzaz, Selim; Cabrero, Pablo; Davies, Shireen-A; Dow, Julian A T

    2004-12-01

    Identification of the Anopheles gambiae leucokinin gene from the completed A. gambiae genome revealed that this insect species contains three leucokinin peptides, named Anopheles leucokinin I-III. These peptides are similar to those identified in two other mosquito species, Aedes aegypti and Culex salinarius. Additionally, Anopheles leucokinin I displays sequence similarity to Drosophila melanogaster leucokinin. Using a combination of computational and molecular approaches, a full-length cDNA for a candidate leucokinin-like receptor was isolated from A. stephensi, a close relative of A. gambiae. Alignment of the known leucokinin receptors--all G protein-coupled receptors (GPCRs)--with this receptor, identified some key conserved regions within the receptors, notably transmembrane (TM) domains I, II, III, VI and VII. The Anopheles leucokinins and receptor were shown to be a functional receptor-ligand pair. All three Anopheles leucokinins caused a dose-dependent rise in intracellular calcium ([Ca2+]i) when applied to S2 cells co-expressing the receptor and an aequorin transgene, with a potency order of I>II>III. Drosophila leucokinin was also found to activate the Anopheles receptor with a similar EC50 value to Anopheles leucokinin I. However, when the Anopheles peptides were applied to the Drosophila receptor, only Anopheles leucokinin I and II elicited a rise in [Ca2+]i. This suggests that the Anopheles receptor has a broader specificity for leucokinin ligands than the Drosophila receptor. Antisera raised against the Anopheles receptor identified a doublet of approx. 65 and 72 kDa on western blots, consistent with the presence of four N-glycosylation sites within the receptor sequence, and the known glycosylation of the receptor in Drosophila. In Anopheles tubules, as in Drosophila, the receptor was localised to the stellate cells. Thus we provide the first identification of Anopheles mosquito leucokinins (Anopheles leucokinins) and a cognate leucokinin receptor, characterise their interaction and show that Dipteran leucokinin signalling is closely conserved between Drosophila and Anopheles.

  5. Study of mural painting isolates, leading to the transfer of 'Bacillus maroccanus' and 'Bacillus carotarum' to Bacillus simplex, emended description of Bacillus simplex, re-examination of the strains previously attributed to 'Bacillus macroides' and description of Bacillus muralis sp. nov.

    PubMed

    Heyrman, Jeroen; Logan, Niall A; Rodríguez-Díaz, Marina; Scheldeman, Patsy; Lebbe, Liesbeth; Swings, Jean; Heyndrickx, Marc; De Vos, Paul

    2005-01-01

    A group of 24 strains was isolated from deteriorated mural paintings situated in Spain (necropolis of Carmona) and Germany (church of Greene-Kreiensen). (GTG)5-PCR genomic fingerprinting was performed on these strains to assess their genomic variability and the strains were delineated into four groups. Representatives were studied by 16S rRNA gene sequencing and were found to be closely related to Bacillus simplex and the species 'Bacillus macroides' (strain NCIMB 8796) and 'Bacillus maroccanus' (names not validly published) according to a fasta search. The close similarity between B. simplex, 'B. macroides' NCIMB 8796, 'B. maroccanus' and the mural painting isolates was confirmed by additional (GTG)5-PCR, ARDRA, FAME and SDS-PAGE analyses. Furthermore, these techniques revealed that strains of 'Bacillus carotarum', another name that has not been validly published, also showed high similarity to this group of organisms. On the other hand, it was shown that the strains labelled 'B. macroides' in different collections do not all belong to the same species. Strain NCIMB 8796 can be allocated to B. simplex, while strain DSM 54 (=ATCC 12905) shares the highest 16S rRNA gene sequence similarity with Bacillus sphaericus and Bacillus fusiformis (both around 98.6 %). On the basis of further DNA-DNA hybridization data and the study of phenotypic characteristics, one group of five mural painting strains was attributed to a novel species in the genus Bacillus, for which the name Bacillus muralis sp. nov. is proposed. Finally, the remaining mural painting strains, one (LMG 18508=NCIMB 8796) of two strains belonging to 'B. macroides' and strains belonging to 'B. maroccanus' and 'B. carotarum' are allocated to the species B. simplex and an emended description of B. simplex is given.

  6. Anti-infective activity of apolipoprotein domain derived peptides in vitro: identification of novel antimicrobial peptides related to apolipoprotein B with anti-HIV activity

    PubMed Central

    2010-01-01

    Background Previous reports have shown that peptides derived from the apolipoprotein E receptor binding region and the amphipathic α-helical domains of apolipoprotein AI have broad anti-infective activity and antiviral activity respectively. Lipoproteins and viruses share a similar cell biological niche, being of overlapping size and displaying similar interactions with mammalian cells and receptors, which may have led to other antiviral sequences arising within apolipoproteins, in addition to those previously reported. We therefore designed a series of peptides based around either apolipoprotein receptor binding regions, or amphipathic α-helical domains, and tested these for antiviral and antibacterial activity. Results Of the nineteen new peptides tested, seven showed some anti-infective activity, with two of these being derived from two apolipoproteins not previously used to derive anti-infective sequences. Apolipoprotein J (151-170) - based on a predicted amphipathic alpha-helical domain from apolipoprotein J - had measurable anti-HSV1 activity, as did apolipoprotein B (3359-3367) dp (apoBdp), the latter being derived from the LDL receptor binding domain B of apolipoprotein B. The more active peptide - apoBdp - showed similarity to the previously reported apoE derived anti-infective peptide, and further modification of the apoBdp sequence to align the charge distribution more closely to that of apoEdp or to introduce aromatic residues resulted in increased breadth and potency of activity. The most active peptide of this type showed similar potent anti-HIV activity, comparable to that we previously reported for the apoE derived peptide apoEdpL-W. Conclusions These data suggest that further antimicrobial peptides may be obtained using human apolipoprotein sequences, selecting regions with either amphipathic α-helical structure, or those linked to receptor-binding regions. The finding that an amphipathic α-helical region of apolipoprotein J has antiviral activity comparable with that for the previously reported apolipoprotein AI derived peptide 18A, suggests that full-length apolipoprotein J may also have such activity, as has been reported for full-length apolipoprotein AI. Although the strength of the anti-infective activity of the sequences identified was limited, this could be increased substantially by developing related mutant peptides. Indeed the apolipoprotein B-derived peptide mutants uncovered by the present study may have utility as HIV therapeutics or microbicides. PMID:20298574

  7. Novel rod-shaped viruses isolated from garlic, Allium sativum, possessing a unique genome organization.

    PubMed

    Sumi, S; Tsuneyoshi, T; Furutani, H

    1993-09-01

    Rod-shaped flexuous viruses were partially purified from garlic plants (Allium sativum) showing typical mosaic symptoms. The genome was shown to be composed of RNA with a poly(A) tail of an estimated size of 10 kb as shown by denaturing agarose gel electrophoresis. We constructed cDNA libraries and screened four independent clones, which were designated GV-A, GV-B, GV-C and GV-D, using Northern and Southern blot hybridization. Nucleotide sequence determination of the cDNAs, two of which correspond to nearly one-third of the virus genomic RNA, shows that all of these viruses possess an identical genomic structure and that also at least four proteins are encoded in the viral cDNA, their M(r)s being estimated to be 15K, 27K, 40K and 11K. The 15K open reading frame (ORF) encodes the core-like sequence of a zinc finger protein preceded by a cluster of basic amino acid residues. The 27K ORF probably encodes the viral coat protein (CP), based on both the existence of some conserved sequences observed in many other rod-shaped or flexuous virus CPs and an overall amino acid sequence similarity to potexvirus and carlavirus CPs. The 11K ORF shows significant amino acid sequence similarities to the corresponding 12K proteins of the potexviruses and carlaviruses. On the other hand, the 40K ORF product does not resemble any other plant virus gene products reported so far. The genomic organization in the 3' region of the garlic viruses resembles, but clearly differs from, that of carlaviruses. Phylogenetic analysis based upon the amino acid sequence of the viral capsid protein also indicates that the garlic viruses have a unique and distinct domain different from those of the potexvirus and carlavirus groups. The results suggest that the garlic viruses described here belong to an unclassified and new virus group closely related to the carlaviruses.

  8. 'Candidatus Phytoplasma solani', a novel taxon associated with stolbur- and bois noir-related diseases of plants.

    PubMed

    Quaglino, Fabio; Zhao, Yan; Casati, Paola; Bulgari, Daniela; Bianco, Piero Attilio; Wei, Wei; Davis, Robert Edward

    2013-08-01

    Phytoplasmas classified in group 16SrXII infect a wide range of plants and are transmitted by polyphagous planthoppers of the family Cixiidae. Based on 16S rRNA gene sequence identity and biological properties, group 16SrXII encompasses several species, including 'Candidatus Phytoplasma australiense', 'Candidatus Phytoplasma japonicum' and 'Candidatus Phytoplasma fragariae'. Other group 16SrXII phytoplasma strains are associated with stolbur disease in wild and cultivated herbaceous and woody plants and with bois noir disease in grapevines (Vitis vinifera L.). Such latter strains have been informally proposed to represent a separate species, 'Candidatus Phytoplasma solani', but a formal description of this taxon has not previously been published. In the present work, stolbur disease strain STOL11 (STOL) was distinguished from reference strains of previously described species of the 'Candidatus Phytoplasma' genus based on 16S rRNA gene sequence similarity and a unique signature sequence in the 16S rRNA gene. Other stolbur- and bois noir-associated ('Ca. Phytoplasma solani') strains shared >99 % 16S rRNA gene sequence similarity with strain STOL11 and contained the signature sequence. 'Ca. Phytoplasma solani' is the only phytoplasma known to be transmitted by Hyalesthes obsoletus. Insect vectorship and molecular characteristics are consistent with the concept that diverse 'Ca. Phytoplasma solani' strains share common properties and represent an ecologically distinct gene pool. Phylogenetic analyses of 16S rRNA, tuf, secY and rplV-rpsC gene sequences supported this view and yielded congruent trees in which 'Ca. Phytoplasma solani' strains formed, within the group 16SrXII clade, a monophyletic subclade that was most closely related to, but distinct from, that of 'Ca. Phytoplasma australiense'-related strains. Based on distinct molecular and biological properties, stolbur- and bois noir-associated strains are proposed to represent a novel species level taxon, 'Ca. Phytoplasma solani'; STOL11 is designated the reference strain.

  9. Phylogeny and differentiation of reptilian and amphibian ranaviruses detected in Europe.

    PubMed

    Stöhr, Anke C; López-Bueno, Alberto; Blahak, Silvia; Caeiro, Maria F; Rosa, Gonçalo M; Alves de Matos, António Pedro; Martel, An; Alejo, Alí; Marschang, Rachel E

    2015-01-01

    Ranaviruses in amphibians and fish are considered emerging pathogens and several isolates have been extensively characterized in different studies. Ranaviruses have also been detected in reptiles with increasing frequency, but the role of reptilian hosts is still unclear and only limited sequence data has been provided. In this study, we characterized a number of ranaviruses detected in wild and captive animals in Europe based on sequence data from six genomic regions (major capsid protein (MCP), DNA polymerase (DNApol), ribonucleoside diphosphate reductase alpha and beta subunit-like proteins (RNR-α and -β), viral homolog of the alpha subunit of eukaryotic initiation factor 2, eIF-2α (vIF-2α) genes and microsatellite region). A total of ten different isolates from reptiles (tortoises, lizards, and a snake) and four ranaviruses from amphibians (anurans, urodeles) were included in the study. Furthermore, the complete genome sequences of three reptilian isolates were determined and a new PCR for rapid classification of the different variants of the genomic arrangement was developed. All ranaviruses showed slight variations on the partial nucleotide sequences from the different genomic regions (92.6-100%). Some very similar isolates could be distinguished by the size of the band from the microsatellite region. Three of the lizard isolates had a truncated vIF-2α gene; the other ranaviruses had full-length genes. In the phylogenetic analyses of concatenated sequences from different genes (3223 nt/10287 aa), the reptilian ranaviruses were often more closely related to amphibian ranaviruses than to each other, and most clustered together with previously detected ranaviruses from the same geographic region of origin. Comparative analyses show that among the closely related amphibian-like ranaviruses (ALRVs) described to date, three recently split and independently evolving distinct genetic groups can be distinguished. These findings underline the wide host range of ranaviruses and the emergence of pathogen pollution via animal trade of ectothermic vertebrates.

  10. Phylogeny and Differentiation of Reptilian and Amphibian Ranaviruses Detected in Europe

    PubMed Central

    Stöhr, Anke C.; López-Bueno, Alberto; Blahak, Silvia; Caeiro, Maria F.; Rosa, Gonçalo M.; Alves de Matos, António Pedro; Martel, An; Alejo, Alí; Marschang, Rachel E.

    2015-01-01

    Ranaviruses in amphibians and fish are considered emerging pathogens and several isolates have been extensively characterized in different studies. Ranaviruses have also been detected in reptiles with increasing frequency, but the role of reptilian hosts is still unclear and only limited sequence data has been provided. In this study, we characterized a number of ranaviruses detected in wild and captive animals in Europe based on sequence data from six genomic regions (major capsid protein (MCP), DNA polymerase (DNApol), ribonucleoside diphosphate reductase alpha and beta subunit-like proteins (RNR-α and -β), viral homolog of the alpha subunit of eukaryotic initiation factor 2, eIF-2α (vIF-2α) genes and microsatellite region). A total of ten different isolates from reptiles (tortoises, lizards, and a snake) and four ranaviruses from amphibians (anurans, urodeles) were included in the study. Furthermore, the complete genome sequences of three reptilian isolates were determined and a new PCR for rapid classification of the different variants of the genomic arrangement was developed. All ranaviruses showed slight variations on the partial nucleotide sequences from the different genomic regions (92.6–100%). Some very similar isolates could be distinguished by the size of the band from the microsatellite region. Three of the lizard isolates had a truncated vIF-2α gene; the other ranaviruses had full-length genes. In the phylogenetic analyses of concatenated sequences from different genes (3223 nt/10287 aa), the reptilian ranaviruses were often more closely related to amphibian ranaviruses than to each other, and most clustered together with previously detected ranaviruses from the same geographic region of origin. Comparative analyses show that among the closely related amphibian-like ranaviruses (ALRVs) described to date, three recently split and independently evolving distinct genetic groups can be distinguished. These findings underline the wide host range of ranaviruses and the emergence of pathogen pollution via animal trade of ectothermic vertebrates. PMID:25706285

  11. Genome of Horsepox Virus

    PubMed Central

    Tulman, E. R.; Delhon, G.; Afonso, C. L.; Lu, Z.; Zsak, L.; Sandybaev, N. T.; Kerembekova, U. Z.; Zaitsev, V. L.; Kutish, G. F.; Rock, D. L.

    2006-01-01

    Here we present the genomic sequence of horsepox virus (HSPV) isolate MNR-76, an orthopoxvirus (OPV) isolated in 1976 from diseased Mongolian horses. The 212-kbp genome contained 7.5-kbp inverted terminal repeats and lacked extensive terminal tandem repetition. HSPV contained 236 open reading frames (ORFs) with similarity to those in other OPVs, with those in the central 100-kbp region most conserved relative to other OPVs. Phylogenetic analysis of the conserved region indicated that HSPV is closely related to sequenced isolates of vaccinia virus (VACV) and rabbitpox virus, clearly grouping together these VACV-like viruses. Fifty-four HSPV ORFs likely represented fragments of 25 orthologous OPV genes, including in the central region the only known fragmented form of an OPV ribonucleotide reductase large subunit gene. In terminal genomic regions, HSPV lacked full-length homologues of genes variably fragmented in other VACV-like viruses but was unique in fragmentation of the homologue of VACV strain Copenhagen B6R, a gene intact in other known VACV-like viruses. Notably, HSPV contained in terminal genomic regions 17 kbp of OPV-like sequence absent in known VACV-like viruses, including fragments of genes intact in other OPVs and approximately 1.4 kb of sequence present only in cowpox virus (CPXV). HSPV also contained seven full-length genes fragmented or missing in other VACV-like viruses, including intact homologues of the CPXV strain GRI-90 D2L/I4R CrmB and D13L CD30-like tumor necrosis factor receptors, D3L/I3R and C1L ankyrin repeat proteins, B19R kelch-like protein, D7L BTB/POZ domain protein, and B22R variola virus B22R-like protein. These results indicated that HSPV contains unique genomic features likely contributing to a unique virulence/host range phenotype. They also indicated that while closely related to known VACV-like viruses, HSPV contains additional, potentially ancestral sequences absent in other VACV-like viruses. PMID:16940536

  12. Extraordinary Sequence Divergence at Tsga8, an X-linked Gene Involved in Mouse Spermiogenesis

    PubMed Central

    Good, Jeffrey M.; Vanderpool, Dan; Smith, Kimberly L.; Nachman, Michael W.

    2011-01-01

    The X chromosome plays an important role in both adaptive evolution and speciation. We used a molecular evolutionary screen of X-linked genes potentially involved in reproductive isolation in mice to identify putative targets of recurrent positive selection. We then sequenced five very rapidly evolving genes within and between several closely related species of mice in the genus Mus. All five genes were involved in male reproduction and four of the genes showed evidence of recurrent positive selection. The most remarkable evolutionary patterns were found at Testis-specific gene a8 (Tsga8), a spermatogenesis-specific gene expressed during postmeiotic chromatin condensation and nuclear transformation. Tsga8 was characterized by extremely high levels of insertion–deletion variation of an alanine-rich repetitive motif in natural populations of Mus domesticus and M. musculus, differing in length from the reference mouse genome by up to 89 amino acids (27% of the total protein length). This population-level variation was coupled with striking divergence in protein sequence and length between closely related mouse species. Although no clear orthologs had previously been described for Tsga8 in other mammalian species, we have identified a highly divergent hypothetical gene on the rat X chromosome that shares clear orthology with the 5′ and 3′ ends of Tsga8. Further inspection of this ortholog verified that it is expressed in rat testis and shares remarkable similarity with mouse Tsga8 across several general features of the protein sequence despite no conservation of nucleotide sequence across over 60% of the rat-coding domain. Overall, Tsga8 appears to be one of the most rapidly evolving genes to have been described in rodents. We discuss the potential evolutionary causes and functional implications of this extraordinary divergence and the possible contribution of Tsga8 and the other four genes we examined to reproductive isolation in mice. PMID:21186189

  13. Indel PDB: a database of structural insertions and deletions derived from sequence alignments of closely related proteins.

    PubMed

    Hsing, Michael; Cherkasov, Artem

    2008-06-25

    Insertions and deletions (indels) represent a common type of sequence variations, which are less studied and pose many important biological questions. Recent research has shown that the presence of sizable indels in protein sequences may be indicative of protein essentiality and their role in protein interaction networks. Examples of utilization of indels for structure-based drug design have also been recently demonstrated. Nonetheless many structural and functional characteristics of indels remain less researched or unknown. We have created a web-based resource, Indel PDB, representing a structural database of insertions/deletions identified from the sequence alignments of highly similar proteins found in the Protein Data Bank (PDB). Indel PDB utilized large amounts of available structural information to characterize 1-, 2- and 3-dimensional features of indel sites. Indel PDB contains 117,266 non-redundant indel sites extracted from 11,294 indel-containing proteins. Unlike loop databases, Indel PDB features more indel sequences with secondary structures including alpha-helices and beta-sheets in addition to loops. The insertion fragments have been characterized by their sequences, lengths, locations, secondary structure composition, solvent accessibility, protein domain association and three dimensional structures. By utilizing the data available in Indel PDB, we have studied and presented here several sequence and structural features of indels. We anticipate that Indel PDB will not only enable future functional studies of indels, but will also assist protein modeling efforts and identification of indel-directed drug binding sites.

  14. Mitochondrial genes in the colourless alga Prototheca wickerhamii resemble plant genes in their exons but fungal genes in their introns.

    PubMed Central

    Wolff, G; Burger, G; Lang, B F; Kück, U

    1993-01-01

    The mitochondrial DNA from the colourless alga Prototheca wickerhamii contains two mosaic genes as was revealed from complete sequencing of the circular extranuclear genome. The genes for the large subunit of the ribosomal RNA (LSUrRNA) as well as for subunit I of the cytochrome oxidase (coxI) carry two and three intronic sequences respectively. On the basis of their canonical nucleotide sequences they can be classified as group I introns. Phylogenetic comparisons of the coxI protein sequences allow us to conclude that the P.wickerhamii mtDNA is much closer related to higher plant mtDNAs than to those of the chlorophyte alga C.reinhardtii. The comparison of the intron sequences revealed several unusual features: (1) The P.wickerhamii introns are structurally related to mitochondrial introns from various ascomycetous fungi. (2) Phylogenetic analyses indicate a close relationship between fungal and algal intronic sequences. (3) The P. wickerhamii introns are located at positions within the structural genes which can be considered as preferred intron insertion sites in homologous mitochondrial genes from fungi or liverwort. In all cases, the sequences adjacent to the insertion sites are very well conserved over large evolutionary distances. Our finding of highly similar introns in fungi and algae is consistent with the idea that introns have already been present in the bacterial ancestors of present day mitochondria and evolved concomitantly with the organelles. PMID:7680126

  15. Host shifts result in parallel genetic changes when viruses evolve in closely related species

    PubMed Central

    Day, Jonathan P.; Smith, Sophia C. L.; Houslay, Thomas M.; Tagliaferri, Lucia

    2018-01-01

    Host shifts, where a pathogen invades and establishes in a new host species, are a major source of emerging infectious diseases. They frequently occur between related host species and often rely on the pathogen evolving adaptations that increase their fitness in the novel host species. To investigate genetic changes in novel hosts, we experimentally evolved replicate lineages of an RNA virus (Drosophila C Virus) in 19 different species of Drosophilidae and deep sequenced the viral genomes. We found a strong pattern of parallel evolution, where viral lineages from the same host were genetically more similar to each other than to lineages from other host species. When we compared viruses that had evolved in different host species, we found that parallel genetic changes were more likely to occur if the two host species were closely related. This suggests that when a virus adapts to one host it might also become better adapted to closely related host species. This may explain in part why host shifts tend to occur between related species, and may mean that when a new pathogen appears in a given species, closely related species may become vulnerable to the new disease. PMID:29649296

  16. Application of discrete Fourier inter-coefficient difference for assessing genetic sequence similarity.

    PubMed

    King, Brian R; Aburdene, Maurice; Thompson, Alex; Warres, Zach

    2014-01-01

    Digital signal processing (DSP) techniques for biological sequence analysis continue to grow in popularity due to the inherent digital nature of these sequences. DSP methods have demonstrated early success for detection of coding regions in a gene. Recently, these methods are being used to establish DNA gene similarity. We present the inter-coefficient difference (ICD) transformation, a novel extension of the discrete Fourier transformation, which can be applied to any DNA sequence. The ICD method is a mathematical, alignment-free DNA comparison method that generates a genetic signature for any DNA sequence that is used to generate relative measures of similarity among DNA sequences. We demonstrate our method on a set of insulin genes obtained from an evolutionarily wide range of species, and on a set of avian influenza viral sequences, which represents a set of highly similar sequences. We compare phylogenetic trees generated using our technique against trees generated using traditional alignment techniques for similarity and demonstrate that the ICD method produces a highly accurate tree without requiring an alignment prior to establishing sequence similarity.

  17. Actinomycetospora rhizophila sp. nov., an actinomycete isolated from rhizosphere soil of a peace lily (Spathi phyllum Kochii).

    PubMed

    He, Hairong; Zhang, Yuejing; Ma, Zhaoxu; Li, Chuang; Liu, Chongxi; Zhou, Ying; Li, Lianjie; Wang, Xiangjing; Xiang, Wensheng

    2015-05-01

    A novel actinomycete, designated strain NEAU-B-8(T), was isolated from the rhizosphere soil of a peace lily (Spathi phyllum Kochii) collected from Heilongjiang province, north-east China. Key morphological and physiological characteristics as well as chemotaxonomic features of strain NEAU-B-8(T) were congruent with the description of the genus Actinomycetospora , such as the major fatty acids, the whole-cell hydrolysates, the predominant menaquinone and the phospholipid profile. The 16S rRNA gene sequence analysis revealed that strain NEAU-B-8(T) shared the highest sequence similarities with Actinomycetospora lutea JCM 17982(T) (99.3% 16S rRNA gene sequence similarity), Actinomycetospora chlora TT07I-57(T) (98.4 %), Actinomycetospora straminea IY07-55(T) (98.3%) and Actinomycetospora chibensis TT04-21(T) (98.2%); similarities to type strains of other species of this genus were lower than 98%. The phylogenetic tree based on 16S rRNA gene sequences showed that strain NEAU-B-8(T) formed a distinct branch with A. lutea JCM 17982(T) that was supported by a high bootstrap value of 97% in the neighbour-joining tree and was also recovered with the maximum-likelihood algorithm. However, the DNA-DNA relatedness between strain NEAU-B-8(T) and A. lutea JCM 17982(T) was found to be 50.6 ± 1.2%. Meanwhile, strain NEAU-B-8(T) differs from other most closely related strains in phenotypic properties, such as maximum NaCl tolerance, hydrolysis of aesculin and decomposition of urea. On the basis of the morphological, physiological, chemotaxonomic, phylogenetic and DNA-DNA hybridization data, we conclude that strain NEAU-B-8(T) represents a novel species of the genus Actinomycetospora , named Actinomycetospora rhizophila sp. nov. The type strain is NEAU-B-8(T). ( = CGMCC 4.7134(T) =DSM 46673(T)). © 2015 IUMS.

  18. LZW-Kernel: fast kernel utilizing variable length code blocks from LZW compressors for protein sequence classification.

    PubMed

    Filatov, Gleb; Bauwens, Bruno; Kertész-Farkas, Attila

    2018-05-07

    Bioinformatics studies often rely on similarity measures between sequence pairs, which often pose a bottleneck in large-scale sequence analysis. Here, we present a new convolutional kernel function for protein sequences called the LZW-Kernel. It is based on code words identified with the Lempel-Ziv-Welch (LZW) universal text compressor. The LZW-Kernel is an alignment-free method, it is always symmetric, is positive, always provides 1.0 for self-similarity and it can directly be used with Support Vector Machines (SVMs) in classification problems, contrary to normalized compression distance (NCD), which often violates the distance metric properties in practice and requires further techniques to be used with SVMs. The LZW-Kernel is a one-pass algorithm, which makes it particularly plausible for big data applications. Our experimental studies on remote protein homology detection and protein classification tasks reveal that the LZW-Kernel closely approaches the performance of the Local Alignment Kernel (LAK) and the SVM-pairwise method combined with Smith-Waterman (SW) scoring at a fraction of the time. Moreover, the LZW-Kernel outperforms the SVM-pairwise method when combined with BLAST scores, which indicates that the LZW code words might be a better basis for similarity measures than local alignment approximations found with BLAST. In addition, the LZW-Kernel outperforms n-gram based mismatch kernels, hidden Markov model based SAM and Fisher kernel, and protein family based PSI-BLAST, among others. Further advantages include the LZW-Kernel's reliance on a simple idea, its ease of implementation, and its high speed, three times faster than BLAST and several magnitudes faster than SW or LAK in our tests. LZW-Kernel is implemented as a standalone C code and is a free open-source program distributed under GPLv3 license and can be downloaded from https://github.com/kfattila/LZW-Kernel. akerteszfarkas@hse.ru. Supplementary data are available at Bioinformatics Online.

  19. Galliscardovia ingluviei gen. nov., sp. nov., a thermophilic bacterium of the family Bifidobacteriaceae isolated from the crop of a laying hen (Gallus gallus f. domestica).

    PubMed

    Pechar, R; Killer, J; Švejstil, R; Salmonová, H; Geigerová, M; Bunešová, V; Rada, V; Benada, O

    2017-07-01

    Bacteria with potential probiotic applications are not yet sufficiently explored, even for animals with economic importance. Therefore, we decided to isolate and identify representatives of the family Bifidobacteriaceae, which inhabit the crop of laying hens. During the study, a fructose-6-phosphate phosphoketolase-positive strain, RP51T, with a regular/slightly irregular and sometimes an S-shaped slightly curved rod-like shape, was isolated from the crop of a 13 -month-old Hisex Brown hybrid laying hen. The best growth of the Gram-stain-positive bacterium, which was isolated using Bifidobacterium-selective mTPY agar, was found out to be under strictly anaerobic conditions, however an ability to grow under microaerophilic and aerobic conditions was also observed. Sequencing of the almost complete 16S rRNA gene (1444 bp) showed Alloscardovia omnicolens CCUG 31649T and Bombiscardovia coagulans BLAPIII/AGVT to be the most closely related species with similarities of 93.4 and 93.1 %, respectively. Lower sequence similarities were determined with other scardovial genera and other representatives of the genus Bifidobacterium. Taxonomic relationships with A. omnicolens and other members of the family Bifidobacteriaceaewere also demonstrated, based on the sequences of dnaK, fusA, hsp60 and rplB gene fragments. Low sequence similarities of phylogenetic markers to related scardovial genera and bifidobacteria along with unique features of the bacterial strain investigated within the family Bifidobacteriaceae(including the lowest DNA G+C value (44.3 mol%), a unique spectrum of cellular fatty acids and polar lipids, cellular morphology, the wide temperature range for growth (15-49 °C) and habitat) clearly indicate that strain RP51T is a representative of a novel genus within the family Bifidobacteriaceae for which the name Galliscardovia ingluviei gen. nov., sp. nov. (RP51T=DSM 100235T=LMG 28778T=CCM 8606T) is proposed.

  20. A Deletion in the Canine POMC Gene Is Associated with Weight and Appetite in Obesity-Prone Labrador Retriever Dogs.

    PubMed

    Raffan, Eleanor; Dennis, Rowena J; O'Donovan, Conor J; Becker, Julia M; Scott, Robert A; Smith, Stephen P; Withers, David J; Wood, Claire J; Conci, Elena; Clements, Dylan N; Summers, Kim M; German, Alexander J; Mellersh, Cathryn S; Arendt, Maja L; Iyemere, Valentine P; Withers, Elaine; Söder, Josefin; Wernersson, Sara; Andersson, Göran; Lindblad-Toh, Kerstin; Yeo, Giles S H; O'Rahilly, Stephen

    2016-05-10

    Sequencing of candidate genes for obesity in Labrador retriever dogs identified a 14 bp deletion in pro-opiomelanocortin (POMC) with an allele frequency of 12%. The deletion disrupts the β-MSH and β-endorphin coding sequences and is associated with body weight (per allele effect of 0.33 SD), adiposity, and greater food motivation. Among other dog breeds, the deletion was only found in the closely related flat-coat retriever (FCR), where it is similarly associated with body weight and food motivation. The mutation is significantly more common in Labrador retrievers selected to become assistance dogs than pets. In conclusion, the deletion in POMC is a significant modifier of weight and appetite in Labrador retrievers and FCRs and may influence other behavioral traits. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

  1. Genetic analysis of porcine circovirus type 2 from dead minks.

    PubMed

    Wang, Gui-Sheng; Sun, Na; Tian, Fu-Lin; Wen, Yong-Jun; Xu, Cong; Li, Jun; Chen, Qiang; Wang, Jin-Bao

    2016-09-01

    Circovirus infection is a growing problem in the field of veterinary and public health. It is associated with enteric diseases in both mammalian and avian hosts. In this study, we detected and isolated porcine circovirus strains in the tissue samples of minks that died from diarrhoea in Shandong Province, China. We sequenced the whole genome of two porcine strains of Circovirus, designated as MiSD-1 and MiSD-2, which had a 97.34% similarity on nucleotide sequence and were closely related to porcine circovirus type 2 (PCV2), but distantly related to mink circoviral species. Phylogenetically MiSD-1 and MiSD-2 are a part of the PCV2b genotype cluster, which is a highly prevalent genotype worldwide. The closer relationship of MiSD-1 and MiSD-2 to PCV2 from pigs than to other mink circoviral species may be evidence of cross-species transmission and considerable zoonotic potential.

  2. Spectroscopic observations of the optical counterpart of Centaurus X-4

    NASA Technical Reports Server (NTRS)

    Van Paradijs, J.; Verbunt, F.; Van Der Linden, T.; Pedersen, H.; Wamsteker, W.

    1980-01-01

    The optical spectrum of the transient X-ray burst source Centaurus X-4 was observed about 5 weeks after the source reached its maximum. The brightness of the optical counterpart had decreased to V = 18.2, and the star had become appreciably redder (B - V = 0.7) compared to its color at maximum. The spectrum of Centaurus X-4 is similar to that of cataclysmic variables showing strong emission lines of H-1 and weaker lines of He-1 and He-2. The N03 lambda 4640 line is not visible. The continuum energy distribution of Centaurus X-4 shows the presence of a main-sequence star in the system, with spectral type between K3 and K7. This is consistent with the orbital period of 8.2 hr proposed by Kaluzienski et al (1980), if the main-sequence star is close to filling its Roche lobe.

  3. An intron within the 16S ribosomal RNA gene of the archaeon Pyrobaculum aerophilum

    NASA Technical Reports Server (NTRS)

    Burggraf, S.; Larsen, N.; Woese, C. R.; Stetter, K. O.

    1993-01-01

    The 16S rRNA genes of Pyrobaculum aerophilum and Pyrobaculum islandicum were amplified by the polymerase chain reaction, and the resulting products were sequenced directly. The two organisms are closely related by this measure (over 98% similar). However, they differ in that the (lone) 16S rRNA gene of Pyrobaculum aerophilum contains a 713-bp intron not seen in the corresponding gene of Pyrobaculum islandicum. To our knowledge, this is the only intron so far reported in the small subunit rRNA gene of a prokaryote. Upon excision the intron is circularized. A secondary structure model of the intron-containing rRNA suggests a splicing mechanism of the same type as that invoked for the tRNA introns of the Archaea and Eucarya and 23S rRNAs of the Archaea. The intron contains an open reading frame whose protein translation shows no certain homology with any known protein sequence.

  4. Pichia insulana sp. nov., a novel cactophilic yeast from the Caribbean

    PubMed Central

    Ganter, Philip F.; Cardinali, Gianluigi; Boundy-Mills, Kyria

    2010-01-01

    A novel species of ascomycetous yeast, Pichia insulana sp. nov., is described from necrotic tissue of columnar cacti on Caribbean islands. P. insulana is closely related to and phenotypically very similar to Pichia cactophila and Pichia pseudocactophila. There are few distinctions between these taxa besides spore type, host preference and locality. Sporogenous strains of P. insulana that produce asci with four hat-shaped spores have been found only on Curaçao, whereas there was no evidence of sporogenous P. cactophila from that island. In addition, sequences of the D1/D2 fragment of the large-subunit rDNA from 12 Curaçao strains showed consistent differences from the sequences of the type strains of P. cactophila and P. pseudocactophila. The type strain of P. insulana is TSU00-106.5T (=CBS 11169T =UCD-FST 09-160T). PMID:19661524

  5. Detection and partial molecular characterization of atypical plum pox virus isolates from naturally infected sour cherry.

    PubMed

    Chirkov, Sergei; Ivanov, Peter; Sheveleva, Anna

    2013-06-01

    Atypical isolates of plum pox virus (PPV) were discovered in naturally infected sour cherry in urban ornamental plantings in Moscow, Russia. The isolates were detected by polyclonal double antibody sandwich ELISA and RT-PCR using universal primers specific for the 3'-non-coding and coat protein (CP) regions of the genome but failed to be recognized by triple antibody sandwich ELISA with the universal monoclonal antibody 5B and by RT-PCR using primers specific to for PPV strains D, M, C and W. Sequence analysis of the CP genes of nine isolates revealed 99.2-100 % within-group identity and 62-85 % identity to conventional PPV strains. Phylogenetic analysis showed that the atypical isolates represent a group that is distinct from the known PPV strains. Alignment of the N-terminal amino acid sequences of CP demonstrated their close similarity to those of a new tentative PPV strain, CR.

  6. Structural Basis for Sialoglycan Binding by the Streptococcus sanguinis SrpA Adhesin*♦

    PubMed Central

    Bensing, Barbara A.; Loukachevitch, Lioudmila V.; McCulloch, Kathryn M.; Yu, Hai; Vann, Kendra R.; Wawrzak, Zdzislaw; Anderson, Spencer; Chen, Xi; Sullam, Paul M.; Iverson, T. M.

    2016-01-01

    Streptococcus sanguinis is a leading cause of infective endocarditis, a life-threatening infection of the cardiovascular system. An important interaction in the pathogenesis of infective endocarditis is attachment of the organisms to host platelets. S. sanguinis expresses a serine-rich repeat adhesin, SrpA, similar in sequence to platelet-binding adhesins associated with increased virulence in this disease. In this study, we determined the first crystal structure of the putative binding region of SrpA (SrpABR) both unliganded and in complex with a synthetic disaccharide ligand at 1.8 and 2.0 Å resolution, respectively. We identified a conserved Thr-Arg motif that orients the sialic acid moiety and is required for binding to platelet monolayers. Furthermore, we propose that sequence insertions in closely related family members contribute to the modulation of structural and functional properties, including the quaternary structure, the tertiary structure, and the ligand-binding site. PMID:26833566

  7. Posthypnotic state changes and flashbacks: analogous processes?

    PubMed

    Lovern, John

    2012-01-01

    Careful study of the posttraumatic stress disorder and hypnosis literatures reveals some parallels between posttraumatic flashbacks and responses to posthypnotic suggestions. Highly susceptible subjects can slip into hypnosis spontaneously and accept and respond to implied or inadvertent suggestions, some of which may operate in a manner equivalent to posthypnotic suggestions. Later, exposure to appropriate cues may trigger an intrusive revivification of the hypnotic state in which the suggestion occurred. This sequence of events closely resembles the sequence of reactions that some individuals have to trauma that ultimately leads to flashbacks. Thus, flashbacks may be conceived of as intrusive posttraumatic revivifications of trauma-induced hypnosis-like states that are reactivated by trauma-reminiscent cues operating similarly to posthypnotic signals. Implications of viewing flashbacks in this way, especially if this view is supported by future research, could include significant changes in how posttraumatic stress disorder is conceptualized and treated.

  8. On the phylogenetic position of the scrub-birds (Passeriformes: Menurae: Atrichornithidae) of Australia

    USGS Publications Warehouse

    Chesser, R.T.; ten, Have J.

    2007-01-01

    Evolutionary relationships of the scrub-birds Atrichornis were investigated using complete sequences of the recombination-activating gene RAG-1 and the proto-oncogene c-mos for two individuals of the noisy scrub-bird Atrichornis clamosus. Phylogenetic analysis revealed that Atrichornis was sister to the genus Menura (the lyrebirds) and that these two genera (the Menurae) were sister to the rest of the oscine passerines. A sister relationship between Atrichornis and Menura supports the traditional view, based on morphology and DNA hybridization, that these taxa are closely related. Similarly, a sister relationship with the remaining oscine passerines agrees with the morphological distinctiveness of Atrichornis and Menura, although this result contradicts conclusions based on DNA hybridization studies. Although Atrichornis is very well known morphologically, previous conclusions regarding its relationships were hampered by a lack of comparative knowledge of other passerines, making concurrence of the sequence data of particular significance. ?? Dt. Ornithologen-Gesellschaft e.V. 2007.

  9. A septal chromosome segregator protein evolved into a conjugative DNA-translocator protein

    PubMed Central

    Sepulveda, Edgardo; Vogelmann, Jutta

    2011-01-01

    Streptomycetes, Gram-positive soil bacteria well known for the production of antibiotics feature a unique conjugative DNA transfer system. In contrast to classical conjugation which is characterized by the secretion of a pilot protein covalently linked to a single-stranded DNA molecule, in Streptomyces a double-stranded DNA molecule is translocated during conjugative transfer. This transfer involves a single plasmid encoded protein, TraB. A detailed biochemical and biophysical characterization of TraB, revealed a close relationship to FtsK, mediating chromosome segregation during bacterial cell division. TraB translocates plasmid DNA by recognizing 8-bp direct repeats located in a specific plasmid region clt. Similar sequences accidentally also occur on chromosomes and have been shown to be bound by TraB. We suggest that TraB mobilizes chromosomal genes by the interaction with these chromosomal clt-like sequences not relying on the integration of the conjugative plasmid into the chromosome. PMID:22479692

  10. Emergence of rabbit haemorrhagic disease virus 2 in the archipelago of Madeira, Portugal (2016-2017).

    PubMed

    Carvalho, Carina Luísa; Silva, Sara; Gouveia, Paz; Costa, Margarida; Duarte, Elsa Leclerc; Henriques, Ana Margarida; Barros, Sílvia Santos; Luís, Tiago; Ramos, Fernanda; Fagulha, Teresa; Fevereiro, Miguel; Duarte, Margarida Dias

    2017-12-01

    We report the detection of rabbit haemorrhagic disease virus 2 (RHDV2) in the Madeira archipelago, Portugal. Viral circulation was confirmed by RT-qPCR and vp60 sequencing. Epidemiological data revealed the outbreak initiated in October 2016 in Porto Santo affecting wild and domestic rabbits. It was then detected three months later on the island of Madeira. Five haplotypes were identified and a genetic overall similarity of 99.54 to 99.89% was observed between the two viral populations. Unique single nucleotide polymorphisms were recognised in the Madeira archipelago strains, two of which resulting in amino acid substitutions at positions 480 and 570 in the VP60 protein. Phylogenetic investigation by Maximum Likelihood showed all the vp60 sequences from the Madeira archipelago group together with high bootstraps. The analysis also showed that the Madeira archipelago strains are closely related to the strains detected in the south of mainland Portugal in 2016, suggesting a possible introduction from the mainland. The epidemiological data and high genetic similarity indicate a common source for the Porto Santo and Madeira RHDV2 outbreaks. Human activity related to hunting was most probably at the origin of the Madeira outbreak.

  11. Towards a comprehensive barcode library for arctic life - Ephemeroptera, Plecoptera, and Trichoptera of Churchill, Manitoba, Canada

    PubMed Central

    2009-01-01

    Background This study reports progress in assembling a DNA barcode reference library for Ephemeroptera, Plecoptera, and Trichoptera ("EPTs") from a Canadian subarctic site, which is the focus of a comprehensive biodiversity inventory using DNA barcoding. These three groups of aquatic insects exhibit a moderate level of species diversity, making them ideal for testing the feasibility of DNA barcoding for routine biotic surveys. We explore the correlation between the morphological species delineations, DNA barcode-based haplotype clusters delimited by a sequence threshold (2%), and a threshold-free approach to biodiversity quantification--phylogenetic diversity. Results A DNA barcode reference library is built for 112 EPT species for the focal region, consisting of 2277 COI sequences. Close correspondence was found between EPT morphospecies and haplotype clusters as designated using a standard threshold value. Similarly, the shapes of taxon accumulation curves based upon haplotype clusters were very similar to those generated using phylogenetic diversity accumulation curves, but were much more computationally efficient. Conclusion The results of this study will facilitate other lines of research on northern EPTs and also bode well for rapidly conducting initial biodiversity assessments in unknown EPT faunas. PMID:20003245

  12. A novel pathogenic aviadenovirus from red-bellied parrots (Poicephalus rufiventris) unveils deep recombination events among avian host lineages

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Das, Shubhagata, E-mail: sdas@csu.edu.au

    Competing roles of coevolution, selective pressure and recombination are an emerging interest in virus evolution. We report a novel aviadenovirus from captive red-bellied parrots (Poicephalus rufiventris) that uncovers evidence of deep recombination among aviadenoviruses. The sequence identity of the virus was most closely related to Turkey adenovirus D (42% similarity) and other adenoviruses in chickens, turkeys and pigeons. Sequencing and comparative analysis showed that the genome comprised 40,930 nucleotides containing 42 predicted open reading frames (ORFs) 19 of which had strong similarity with genes from other adenovirus species. The new genome unveiled a lineage that likely participated in deep recombinationmore » events across the genus Aviadenovirus accounting for an ancient evolutionary relationship. We hypothesize frequent host switch events and recombination among adenovirus progenitors in Galloanserae hosts caused the radiation of extant aviadenoviruses and the newly assembled Poicephalus adenovirus genome points to a potentially broader host range of these viruses among birds. - Highlights: •Shows how a single new genome can change overall phylogeny. •Reveals host switch events among adenovirus progenitors in Galloanserae hosts. •Points to a potentially broader host range of adenoviruses among birds and wildlife .« less

  13. Nocardioides albertanoniae sp. nov., isolated from Roman catacombs.

    PubMed

    Alias-Villegas, Cynthia; Jurado, Valme; Laiz, Leonila; Miller, Ana Z; Saiz-Jimenez, Cesareo

    2013-04-01

    A Gram-reaction-positive, aerobic, non-spore-forming, rod- or coccoid-shaped, strain, CD40127(T), was isolated from a green biofilm covering the wall of the Domitilla Catacombs in Rome, Italy. Phylogenetic analysis based on 16S rRNA gene sequences revealed that strain CD40127(T) belongs to the genus Nocardioides, closely related to Nocardioides luteus DSM 43366(T) and Nocardioides albus DSM 43109(T) with 98.86 % and 98.01 % similarity values, respectively. Strain CD40127(T) exhibited 16S rRNA gene sequence similarity values below 96.29 % with the rest of the species of the genus Nocardioides. The G+C content of the genomic DNA was 69.7 mol%. The predominant fatty acid was iso-C16 : 0 and the major menaquinone was MK-8(H4) in accordance with the phenotypes of other species of the genus Nocardioides. A polyphasic approach using physiological tests, fatty acid profiles, DNA base ratios and DNA-DNA hybridization showed that isolate CD40127(T) represents a novel species within the genus Nocardioides, for which the name Nocardioides albertanoniae is proposed. The type strain is CD40127(T) ( = DSM 25218(T) = CECT 8014(T)).

  14. Molecular characterization of novel mucosotropic papillomaviruses from a Florida manatee (Trichechus manatus latirostris).

    PubMed

    2015-12-01

    We isolated two new manatee papillomavirus (PV) types, TmPV3 and TmPV4, from a Florida manatee (Trichechus manatus latirostris). Two PV types were previously isolated from this species. TmPV1 is widely dispersed amongst manatees and a close-to-root PV; not much is known about TmPV2. The genomes of TmPV3 and TmPV4 were 7622 and 7771 bp in size, respectively. Both PVs had a genomic organization characteristic of all PVs, with one non-coding region and seven ORFs, including the E7 ORF that is absent in other cetacean PVs. Although these PVs were isolated from separate genital lesions of the same manatee, an enlarged E2/E4 ORF was found only in the TmPV4 genome. The full genome and L1 sequence similarities between TmPV3 and TmPV4 were 63.2 and 70.3 %, respectively. These genomes shared only 49.1 and 50.2 % similarity with TmPV1. The pairwise alignment of L1 nucleotide sequences indicated that the two new PVs nested in a monophyletic group of the genus Rhopapillomavirus, together with the cutaneotropic TmPV1 and TmPV2.

  15. Endogenous Gibbon Ape Leukemia Virus Identified in a Rodent (Melomys burtoni subsp.) from Wallacea (Indonesia)

    PubMed Central

    Alfano, Niccolò; Michaux, Johan; Morand, Serge; Aplin, Ken; Tsangaras, Kyriakos; Löber, Ulrike; Fabre, Pierre-Henri; Fitriana, Yuli; Semiadi, Gono; Ishida, Yasuko; Helgen, Kristofer M.; Roca, Alfred L.; Eiden, Maribeth V.

    2016-01-01

    ABSTRACT Gibbon ape leukemia virus (GALV) and koala retrovirus (KoRV) most likely originated from a cross-species transmission of an ancestral retrovirus into koalas and gibbons via one or more intermediate as-yet-unknown hosts. A virus highly similar to GALV has been identified in an Australian native rodent (Melomys burtoni) after extensive screening of Australian wildlife. GALV-like viruses have also been discovered in several Southeast Asian species, although screening has not been extensive and viruses discovered to date are only distantly related to GALV. We therefore screened 26 Southeast Asian rodent species for KoRV- and GALV-like sequences, using hybridization capture and high-throughput sequencing, in the attempt to identify potential GALV and KoRV hosts. Only the individuals belonging to a newly discovered subspecies of Melomys burtoni from Indonesia were positive, yielding an endogenous provirus very closely related to a strain of GALV. The sequence of the critical receptor domain for GALV infection in the Indonesian M. burtoni subsp. was consistent with the susceptibility of the species to GALV infection. The second record of a GALV in M. burtoni provides further evidence that M. burtoni, and potentially other lineages within the widespread subfamily Murinae, may play a role in the spread of GALV-like viruses. The discovery of a GALV in the most western part of the Australo-Papuan distribution of M. burtoni, specifically in a transitional zone between Asia and Australia (Wallacea), may be relevant to the cross-species transmission to gibbons in Southeast Asia and broadens the known distribution of GALVs in wild rodents. IMPORTANCE Gibbon ape leukemia virus (GALV) and the koala retrovirus (KoRV) are very closely related, yet their hosts neither are closely related nor overlap geographically. Direct cross-species infection between koalas and gibbons is unlikely. Therefore, GALV and KoRV may have arisen via a cross-species transfer from an intermediate host whose range overlaps those of both gibbons and koalas. Using hybridization capture and high-throughput sequencing, we have screened a wide range of rodent candidate hosts from Southeast Asia for KoRV- and GALV-like sequences. Only a Melomys burtoni subspecies from Wallacea (Indonesia) was positive for GALV. We report the genome sequence of this newly identified GALV, the critical domain for infection of its potential cellular receptor, and its phylogenetic relationships with the other previously characterized GALVs. We hypothesize that Melomys burtoni, and potentially related lineages with an Australo-Papuan distribution, may have played a key role in cross-species transmission to other taxa. PMID:27384662

  16. Model-free aftershock forecasts constructed from similar sequences in the past

    NASA Astrophysics Data System (ADS)

    van der Elst, N.; Page, M. T.

    2017-12-01

    The basic premise behind aftershock forecasting is that sequences in the future will be similar to those in the past. Forecast models typically use empirically tuned parametric distributions to approximate past sequences, and project those distributions into the future to make a forecast. While parametric models do a good job of describing average outcomes, they are not explicitly designed to capture the full range of variability between sequences, and can suffer from over-tuning of the parameters. In particular, parametric forecasts may produce a high rate of "surprises" - sequences that land outside the forecast range. Here we present a non-parametric forecast method that cuts out the parametric "middleman" between training data and forecast. The method is based on finding past sequences that are similar to the target sequence, and evaluating their outcomes. We quantify similarity as the Poisson probability that the observed event count in a past sequence reflects the same underlying intensity as the observed event count in the target sequence. Event counts are defined in terms of differential magnitude relative to the mainshock. The forecast is then constructed from the distribution of past sequences outcomes, weighted by their similarity. We compare the similarity forecast with the Reasenberg and Jones (RJ95) method, for a set of 2807 global aftershock sequences of M≥6 mainshocks. We implement a sequence-specific RJ95 forecast using a global average prior and Bayesian updating, but do not propagate epistemic uncertainty. The RJ95 forecast is somewhat more precise than the similarity forecast: 90% of observed sequences fall within a factor of two of the median RJ95 forecast value, whereas the fraction is 85% for the similarity forecast. However, the surprise rate is much higher for the RJ95 forecast; 10% of observed sequences fall in the upper 2.5% of the (Poissonian) forecast range. The surprise rate is less than 3% for the similarity forecast. The similarity forecast may be useful to emergency managers and non-specialists when confidence or expertise in parametric forecasting may be lacking. The method makes over-tuning impossible, and minimizes the rate of surprises. At the least, this forecast constitutes a useful benchmark for more precisely tuned parametric forecasts.

  17. Origin of the Y genome in Elymus and its relationship to other genomes in Triticeae based on evidence from elongation factor G (EF-G) gene sequences.

    PubMed

    Sun, Genlou; Komatsuda, Takao

    2010-08-01

    It is well known that Elymus arose through hybridization between representatives of different genera. Cytogenetic analyses show that all its members include the St genome in combination with one or more of four other genomes, the H, Y, P, and W genomes. The origins of the H, P, and W genomes are known, but not for the Y genome. We analyzed the single copy nuclear gene coding for elongation factor G (EF-G) from 28 accessions of polyploid Elymus species and 45 accessions of diploid Triticeae species in order to investigate origin of the Y genome and its relationship to other genomes in the tribe Triticeae. Sequence comparisons among the St, H, Y, P, W, and E genomes detected genome-specific polymorphisms at 66 nucleotide positions. The St and Y genomes are relatively dissimilar. The phylogeny of the Y genome sequences was investigated for the first time. They were most similar to the W genome sequences. The Y genome sequences were placed in two different groups. These two groups were included in an unresolved clade that included the W and E sequences as well as sequences from many annual species. The H genomes sequences were in a clade with the F, P, and Ns genome sequences as sister groups. These two clades were more closely related to each other and to the L and Xp genomes than they were to the St genome sequences. These data support the hypothesis that the Y genome evolved in a diploid species and has a different origin from the St genome. Copyright 2010 Elsevier Inc. All rights reserved.

  18. The blood DNA virome in 8,000 humans.

    PubMed

    Moustafa, Ahmed; Xie, Chao; Kirkness, Ewen; Biggs, William; Wong, Emily; Turpaz, Yaron; Bloom, Kenneth; Delwart, Eric; Nelson, Karen E; Venter, J Craig; Telenti, Amalio

    2017-03-01

    The characterization of the blood virome is important for the safety of blood-derived transfusion products, and for the identification of emerging pathogens. We explored non-human sequence data from whole-genome sequencing of blood from 8,240 individuals, none of whom were ascertained for any infectious disease. Viral sequences were extracted from the pool of sequence reads that did not map to the human reference genome. Analyses sifted through close to 1 Petabyte of sequence data and performed 0.5 trillion similarity searches. With a lower bound for identification of 2 viral genomes/100,000 cells, we mapped sequences to 94 different viruses, including sequences from 19 human DNA viruses, proviruses and RNA viruses (herpesviruses, anelloviruses, papillomaviruses, three polyomaviruses, adenovirus, HIV, HTLV, hepatitis B, hepatitis C, parvovirus B19, and influenza virus) in 42% of the study participants. Of possible relevance to transfusion medicine, we identified Merkel cell polyomavirus in 49 individuals, papillomavirus in blood of 13 individuals, parvovirus B19 in 6 individuals, and the presence of herpesvirus 8 in 3 individuals. The presence of DNA sequences from two RNA viruses was unexpected: Hepatitis C virus is revealing of an integration event, while the influenza virus sequence resulted from immunization with a DNA vaccine. Age, sex and ancestry contributed significantly to the prevalence of infection. The remaining 75 viruses mostly reflect extensive contamination of commercial reagents and from the environment. These technical problems represent a major challenge for the identification of novel human pathogens. Increasing availability of human whole-genome sequences will contribute substantial amounts of data on the composition of the normal and pathogenic human blood virome. Distinguishing contaminants from real human viruses is challenging.

  19. Endosymbiotic Microbiota of the Bamboo Pseudococcid Antonina crawii (Insecta, Homoptera)

    PubMed Central

    Fukatsu, Takema; Nikoh, Naruo

    2000-01-01

    We characterized the intracellular symbiotic microbiota of the bamboo pseudococcid Antonina crawii by performing a molecular phylogenetic analysis in combination with in situ hybridization. Almost the entire length of the bacterial 16S rRNA gene was amplified and cloned from A. crawii whole DNA. Restriction fragment length polymorphism analysis revealed that the clones obtained included three distinct types of sequences. Nucleotide sequences of the three types were determined and subjected to a molecular phylogenetic analysis. The first sequence was a member of the γ subdivision of the division Proteobacteria (γ-Proteobacteria) to which no sequences in the database were closely related, although the sequences of endosymbionts of other homopterans, such as psyllids and aphids, were distantly related. The second sequence was a β-Proteobacteria sequence and formed a monophyletic group with the sequences of endosymbionts from other pseudococcids. The third sequence exhibited a high level of similarity to sequences of Spiroplasma spp. from ladybird beetles and a tick. Localization of the endosymbionts was determined by using tissue sections of A. crawii and in situ hybridization with specific oligonucleotide probes. The γ- and β-Proteobacteria symbionts were packed in the cytoplasm of the same mycetocytes (or bacteriocytes) and formed a large mycetome (or bacteriome) in the abdomen. The spiroplasma symbionts were also present intracellularly in various tissues at a low density. We observed that the anterior poles of developing eggs in the ovaries were infected by the γ- and β-Proteobacteria symbionts in a systematic way, which ensured vertical transmission. Five representative pseudococcids were examined by performing diagnostic PCR experiments with specific primers; the β-Proteobacteria symbiont was detected in all five pseudococcids, the γ-Proteobacteria symbiont was found in three, and the spiroplasma symbiont was detected only in A. crawii. PMID:10653730

  20. The mitochondrial genome of Ifremeria nautilei and the phylogenetic position of the enigmatic deep-sea Abyssochrysoidea (Mollusca: Gastropoda).

    PubMed

    Osca, David; Templado, José; Zardoya, Rafael

    2014-09-01

    The complete nucleotide sequence of the mitochondrial (mt) genome of the deep-sea vent snail Ifremeria nautilei (Gastropoda: Abyssochrysoidea) was determined. The double stranded circular molecule is 15,664 pb in length and encodes for the typical 37 metazoan mitochondrial genes. The gene arrangement of the Ifremeria mt genome is most similar to genome organization of caenogastropods and differs only on the relative position of the trnW gene. The deduced amino acid sequences of the mt protein coding genes of Ifremeria mt genome were aligned with orthologous sequences from representatives of the main lineages of gastropods and phylogenetic relationships were inferred. The reconstructed phylogeny supports that Ifremeria belongs to Caenogastropoda and that it is closely related to hypsogastropod superfamilies. Results were compared with a reconstructed nuclear-based phylogeny. Moreover, a relaxed molecular-clock timetree calibrated with fossils dated the divergence of Abyssochrysoidea in the Late Jurassic-Early Cretaceous indicating a relatively modern colonization of deep-sea environments by these snails. Copyright © 2014 Elsevier B.V. All rights reserved.

Top