Science.gov

Sample records for co-evolving genomic groups

  1. Evolution of favoritism and group fairness in a co-evolving three-person ultimatum game

    NASA Astrophysics Data System (ADS)

    Takesue, Hirofumi; Ozawa, Akira; Morikawa, So

    2017-05-01

    The evolution of fairness in dyadic relationships has been studied using ultimatum games. However, human fairness is not limited to two-person situations and universal egalitarianism among group members is widely observed. In this study, we investigated the evolution of favoritism and group fairness in a three-person ultimatum game (TUG) under a co-evolutionary framework with both strategy updating and partner switching dynamics. In the TUG, one proposer makes an offer to two responders and the proposal is accepted at the group level if at least one individual responder accepts the offer. Investigating fairness beyond dyadic relationships allows the possibility of favoritism because the proposer can secure acceptance at the group level by discriminating in favor of one responder. Our simulation showed that the proposer favors one responder with a similar type when the frequency of partner switching is low. In contrast, group fairness is observed when the frequency of partner switching is high. The correlation between strategy and neighborhood size suggested that partner switching influences the strategy through the proposer's offer rather than through the responder's acceptance threshold. In addition, the average degree negatively impacts the emergence of fairness unless the frequency of partner switching is high. Furthermore, a higher frequency of partner switching can support the evolution of fairness when the maximum number of games in one time step is restricted to smaller values.

  2. The spread of opinion on co-evolving networks

    NASA Astrophysics Data System (ADS)

    Singh, Pramesh; Sreenivasan, S.; Korniss, G.; Szymanski, B. K.

    2011-03-01

    We discuss a model of opinion formation in co-evolving networks. In realistic scenarios, the network constantly changes structure favoring connections between similar individuals (homophily). Here we allow the opinions to co-evolve with the reorganization of links in the network. This dynamical nature of the network impedes the spreading of opinions. We study how this resistance to the spread can be overcome and consensus can be achieved by randomly distributing a few committed agents (-nodes that are not influenceable in their opinions). In this model adjacent nodes influence each other if they are similar on at least Q attributes, where Q is the influence threshold. Nodes will rewire their existing links if they are not similar enough. We demonstrate through simulations that in the absence of committed agents, time to reach consensus in opinions diverges exponentially with system size N. However, as committed agents are added, beyond a small value of committed fraction, the consensus time becomes a slowly varying function of N. (Ref- F. Vazquez et al. - Phys. Rev. E76, 046120 -2007) Supported in part by ARL and ONR.

  3. Co-evolving prisoner's dilemma: Performance indicators and analytic approaches

    NASA Astrophysics Data System (ADS)

    Zhang, W.; Choi, C. W.; Li, Y. S.; Xu, C.; Hui, P. M.

    2017-02-01

    Understanding the intrinsic relation between the dynamical processes in a co-evolving network and the necessary ingredients in formulating a reliable theory is an important question and a challenging task. Using two slightly different definitions of performance indicator in the context of a co-evolving prisoner's dilemma game, it is shown that very different cooperative levels result and theories of different complexity are required to understand the key features. When the payoff per opponent is used as the indicator (Case A), non-cooperative strategy has an edge and dominates in a large part of the parameter space formed by the cutting-and-rewiring probability and the strategy imitation probability. When the payoff from all opponents is used (Case B), cooperative strategy has an edge and dominates the parameter space. Two distinct phases, one homogeneous and dynamical and another inhomogeneous and static, emerge and the phase boundary in the parameter space is studied in detail. A simple theory assuming an average competing environment for cooperative agents and another for non-cooperative agents is shown to perform well in Case A. The same theory, however, fails badly for Case B. It is necessary to include more spatial correlation into a theory for Case B. We show that the local configuration approximation, which takes into account of the different competing environments for agents with different strategies and degrees, is needed to give reliable results for Case B. The results illustrate that formulating a proper theory requires both a conceptual understanding of the effects of the adaptive processes in the problem and a delicate balance between simplicity and accuracy.

  4. Assembler: Efficient Discovery of Spatial Co-evolving Patterns in Massive Geo-sensory Data

    PubMed Central

    Zhang, Chao; Zheng, Yu; Ma, Xiuli; Han, Jiawei

    2015-01-01

    Recent years have witnessed the wide proliferation of geo-sensory applications wherein a bundle of sensors are deployed at different locations to cooperatively monitor the target condition. Given massive geo-sensory data, we study the problem of mining spatial co-evolving patterns (SCPs), i.e., groups of sensors that are spatially correlated and co-evolve frequently in their readings. SCP mining is of great importance to various real-world applications, yet it is challenging because (1) the truly interesting evolutions are often flooded by numerous trivial fluctuations in the geo-sensory time series; and (2) the pattern search space is extremely large due to the spatiotemporal combinatorial nature of SCP. In this paper, we propose a two-stage method called Assembler. In the first stage, Assembler filters trivial fluctuations using wavelet transform and detects frequent evolutions for individual sensors via a segment-and-group approach. In the second stage, Assembler generates SCPs by assembling the frequent evolutions of individual sensors. Leveraging the spatial constraint, it conceptually organizes all the SCPs into a novel structure called the SCP search tree, which facilitates the effective pruning of the search space to generate SCPs efficiently. Our experiments on both real and synthetic data sets show that Assembler is effective, efficient, and scalable. PMID:26705506

  5. Measurement of organization in complex and co-evolving networks

    NASA Astrophysics Data System (ADS)

    Georgiev, Georgi

    2012-02-01

    We apply a new method for measurement of organization of complex and co-evolving networks using the quantity of physical action. We consider simple arrangements of elements in a network and constraints to their motion along paths and calculate the amount of organization in each system using the following measure: organization is the inverse of the average sum of physical actions of all elements in a system per unit motion multiplied by the Planck's constant. The meaning of quantity of organization here is the number of quanta of action per one unit motion along a path of an element. A unit motion along a path for a network, such as internet, is the transmission of one bit of information. The calculation can be expanded to systems consisting of many elements and constraints and also can be followed as a function of time with improvement of the organization of a system or connected systems and networks. Thus, the principle of least action becomes the driving force, and the least action state of the system, the attractor for all of the paths of its elements and states of its constraints. We consider also the rate of constraint minimization, or decrease of action per element and motion, as a function of the number of elements i.e. quality as a function of quantity. Increase of quantity, within specified limits, leads to increase of level of organization and vice versa.

  6. Genomic Adaptation of the Lactobacillus casei Group

    PubMed Central

    Nakano, Akiyo; Takahata, Muneaki; Murakami, Masaru; Takaki, Takashi; Nishiyama, Hidetoshi; Igimi, Shizunobu; Hattori, Masahira; Morita, Hidetoshi

    2013-01-01

    Lactobacillus casei, L. paracasei, and L. rhamnosus form a closely related taxonomic group (Lactobacillus casei group) within the facultatively heterofermentative lactobacilli. Here, we report the complete genome sequences of L. paracasei JCM 8130 and L. casei ATCC 393, and the draft genome sequence of L. paracasei COM0101, all of which were isolated from daily products. Furthermore, we re-annotated the genome of L. rhamnosus ATCC 53103 (also known as L. rhamnosus GG), which we have previously reported. We confirmed that ATCC 393 is distinct from other strains previously described as L. paracasei. The core genome of 10 completely sequenced strains of the L. casei group comprised 1,682 protein-coding genes. Although extensive genome-wide synteny was found among the L. casei group, the genomes of ATCC 53103, JCM 8130, and ATCC 393 contained genomic islands compared with L. paracasei ATCC 334. Several genomic islands, including carbohydrate utilization gene clusters, were found at the same loci in the chromosomes of the L. casei group. The spaCBA pilus gene cluster, which was first identified in GG, was also found in other strains of the L. casei group, but several L. paracasei strains including COM0101 contained truncated spaC gene. ATCC 53103 encoded a higher number of proteins involved in carbohydrate utilization compared with intestinal lactobacilli, and extracellular adhesion proteins, several of which are absent in other strains of the L. casei group. In addition to previously fully sequenced L. rhamnosus and L. paracasei strains, the complete genome sequences of L. casei will provide valuable insights into the evolution of the L. casei group. PMID:24116025

  7. Comparative Genomics of the Campylobacter lari Group

    PubMed Central

    Miller, William G.; Yee, Emma; Chapman, Mary H.; Smith, Timothy P.L.; Bono, James L.; Huynh, Steven; Parker, Craig T.; Vandamme, Peter; Luong, Khai; Korlach, Jonas

    2014-01-01

    The Campylobacter lari group is a phylogenetic clade within the epsilon subdivision of the Proteobacteria and is part of the thermotolerant Campylobacter spp., a division within the genus that includes the human pathogen Campylobacter jejuni. The C. lari group is currently composed of five species (C. lari, Campylobacter insulaenigrae, Campylobacter volucris, Campylobacter subantarcticus, and Campylobacter peloridis), as well as a group of strains termed the urease-positive thermophilic Campylobacter (UPTC) and other C. lari-like strains. Here we present the complete genome sequences of 11 C. lari group strains, including the five C. lari group species, four UPTC strains, and a lari-like strain isolated in this study. The genome of C. lari subsp. lari strain RM2100 was described previously. Analysis of the C. lari group genomes indicates that this group is highly related at the genome level. Furthermore, these genomes are strongly syntenic with minor rearrangements occurring only in 4 of the 12 genomes studied. The C. lari group can be bifurcated, based on the flagella and flagellar modification genes. Genomic analysis of the UPTC strains indicated that these organisms are variable but highly similar, closely related to but distinct from C. lari. Additionally, the C. lari group contains multiple genes encoding hemagglutination domain proteins, which are either contingency genes or linked to conserved contingency genes. Many of the features identified in strain RM2100, such as major deficiencies in amino acid biosynthesis and energy metabolism, are conserved across all 12 genomes, suggesting that these common features may play a role in the association of the C. lari group with coastal environments and watersheds. PMID:25381664

  8. Co-evolution of genomic islands and their bacterial hosts revealed through phylogenetic analyses of 17 groups of homologous genomic islands.

    PubMed

    Guo, F-B; Wei, W; Wang, X L; Lin, H; Ding, H; Huang, J; Rao, N

    2012-10-15

    Horizontal gene transfer is an important mechanism for the evolution of microbial genomes, and many horizontal gene transfer events are facilitated by genomic islands (GIs). Until now, few reports have provided evidence for the co-evolution of horizontally transferred genes and their hosts. We obtained 17 groups of homologous GIs, all of which appear in 8 or more bacterial strains of the same species or genus. Using phylogenetic analyses, we found that the topological structure of a distance tree based on the proteins of each group of homologous GIs was consistent with that based on the complete proteomes of the hosts. This result clearly indicates that GIs and their bacterial hosts have co-evolved. In addition to presenting and providing evidence for a novel concept, i.e., the co-evolution of GIs and their bacterial hosts, we also describe a new and interesting detail for the phylogenetic analysis of horizontally transferred genes: consistent phylogenetic trees can be obtained by focusing on homologous GIs despite the commonly accepted theory that the phylogenies of horizontally transferred sequences and host organisms should be inconsistent.

  9. A possible packaging signal in the rotavirus genome.

    PubMed

    Suzuki, Yoshiyuki

    2014-01-01

    Group A rotavirus (RVA), an etiological agent of gastroenteritis in young mammals and birds, possesses a genome of 11 double-stranded RNA segments. Although it is believed that the RVA virion contains one copy of each genomic segment and that the positive-strand RNA (+RNA) is incorporated into the core shell, the packaging mechanisms of RVA are not well understood. Here, packaging signals of RVA were searched for by analyzing genomic sequences of mammalian and avian RVA, which are considered to have evolved independently without reassortment. Assuming that packaging is mediated by direct interaction between +RNA segments via base-pairing, co-evolving complementary nucleotide sites were identified within and between genomic segments. There were two pairs of co-evolving complementary sites within the segment encoding VP7 (the VP7 segment) and one pair between the NSP2 and NSP3 segments. In the VP7 segment, the co-evolving complementary sites appeared to form stem structures in both mammalian and avian RVA, supporting their functionality. In contrast, co-evolving complementary sites between the NSP2 and NSP3 segments tended to be free from base-pairings and constituted loop structures, at least in avian RVA, suggesting that they are involved in a specific interaction between these segments as a packaging signal.

  10. Genomes, neurotoxins and biology of Clostridium botulinum Group I and Group II.

    PubMed

    Carter, Andrew T; Peck, Michael W

    2015-05-01

    Recent developments in whole genome sequencing have made a substantial contribution to understanding the genomes, neurotoxins and biology of Clostridium botulinum Group I (proteolytic C. botulinum) and C. botulinum Group II (non-proteolytic C. botulinum). Two different approaches are used to study genomics in these bacteria; comparative whole genome microarrays and direct comparison of complete genome DNA sequences. The properties of the different types of neurotoxin formed, and different neurotoxin gene clusters found in C. botulinum Groups I and II are explored. Specific examples of botulinum neurotoxin genes are chosen for an in-depth discussion of neurotoxin gene evolution. The most recent cases of foodborne botulism are summarised.

  11. Genomes, neurotoxins and biology of Clostridium botulinum Group I and Group II

    PubMed Central

    Carter, Andrew T.; Peck, Michael W.

    2015-01-01

    Recent developments in whole genome sequencing have made a substantial contribution to understanding the genomes, neurotoxins and biology of Clostridium botulinum Group I (proteolytic C. botulinum) and C. botulinum Group II (non-proteolytic C. botulinum). Two different approaches are used to study genomics in these bacteria; comparative whole genome microarrays and direct comparison of complete genome DNA sequences. The properties of the different types of neurotoxin formed, and different neurotoxin gene clusters found in C. botulinum Groups I and II are explored. Specific examples of botulinum neurotoxin genes are chosen for an in-depth discussion of neurotoxin gene evolution. The most recent cases of foodborne botulism are summarised. PMID:25445012

  12. Genomic characterization of Italian Clostridium botulinum group I strains.

    PubMed

    Giordani, Francesco; Fillo, Silvia; Anselmo, Anna; Palozzi, Anna Maria; Fortunato, Antonella; Gentile, Bernardina; Azarnia Tehran, Domenico; Ciammaruconi, Andrea; Spagnolo, Ferdinando; Pittiglio, Valentina; Anniballi, Fabrizio; Auricchio, Bruna; De Medici, Dario; Lista, Florigio

    2015-12-01

    Clostridium botulinum is a gram-positive bacterium capable of producing the botulinum neurotoxin, a powerful poison that causes botulism, a severe neuroparalytic disease. Its genome has been sequenced entirely and its gene content has been analyzed. To date, 19 full genomes and 64 draft genomes are available. The geographical origin of these genomes is predominantly from the US. In the present study, 10 Italian genomes of C. botulinum group I were analyzed and compared with previously sequenced group I genomes, in order to genetically characterize the Italian population of C. botulinum group I and to investigate the phylogenetic relationships among different lineages. Using the suites of software ClonalFrame and ClonalOrigin to perform genomic analysis, we demonstrated that Italian C. botulinum group I population is phylogenetically heterogeneous encompassing different and distant lineages including overseas strains, too. Moreover, a high recombination rate was demonstrated in the evolution of C. botulinum group I species. Finally, genome sequencing of the strain 357 led us to identify a novel botulinum neurotoxin subtype, F8.

  13. Comparative genomics of the Campylobacter lari group

    USDA-ARS?s Scientific Manuscript database

    The Campylobacter lari group is a phylogenetic clade within the epsilon subdivision of the Proteobacteria and is part of the thermotolerant campylobacters, a division within the genus that includes the human pathogen Campylobacter jejuni. The lari group is currently composed of five validly-named sp...

  14. Regularized group regression methods for genomic prediction: Bridge, MCP, SCAD, group bridge, group lasso, sparse group lasso, group MCP and group SCAD

    PubMed Central

    2014-01-01

    Background Genomic prediction is now widely recognized as an efficient, cost-effective and theoretically well-founded method for estimating breeding values using molecular markers spread over the whole genome. The prediction problem entails estimating the effects of all genes or chromosomal segments simultaneously and aggregating them to yield the predicted total genomic breeding value. Many potential methods for genomic prediction exist but have widely different relative computational costs, complexity and ease of implementation, with significant repercussions for predictive accuracy. We empirically evaluate the predictive performance of several contending regularization methods, designed to accommodate grouping of markers, using three synthetic traits of known accuracy. Methods Each of the competitor methods was used to estimate predictive accuracy for each of the three quantitative traits. The traits and an associated genome comprising five chromosomes with 10000 biallelic Single Nucleotide Polymorphic (SNP)-marker loci were simulated for the QTL-MAS 2012 workshop. The models were trained on 3000 phenotyped and genotyped individuals and used to predict genomic breeding values for 1020 unphenotyped individuals. Accuracy was expressed as the Pearson correlation between the simulated true and the estimated breeding values. Results All the methods produced accurate estimates of genomic breeding values. Grouping of markers did not clearly improve accuracy contrary to expectation. Selecting the penalty parameter with replicated 10-fold cross validation often gave better accuracy than using information theoretic criteria. Conclusions All the regularization methods considered produced satisfactory predictive accuracies for most practical purposes and thus deserve serious consideration in genomic prediction research and practice. Grouping markers did not enhance predictive accuracy for the synthetic data set considered. But other more sophisticated grouping schemes could

  15. Cooperative behavior and phase transitions in co-evolving stag hunt game

    NASA Astrophysics Data System (ADS)

    Zhang, W.; Li, Y. S.; Xu, C.; Hui, P. M.

    2016-02-01

    Cooperative behavior and different phases in a co-evolving network dynamics based on the stag hunt game is studied. The dynamical processes are parameterized by a payoff r that tends to promote non-cooperative behavior and a probability q for a rewiring attempt that could isolate the non-cooperators. The interplay between the parameters leads to different phases. Detailed simulations and a mean field theory are employed to reveal the properties of different phases. For small r, the cooperators are the majority and form a connected cluster while the non-cooperators increase with q but remain isolated over the whole range of q, and it is a static phase. For sufficiently large r, cooperators disappear in an intermediate range qL ≤ q ≤qU and a dynamical all-non-cooperators phase results. For q >qU, a static phase results again. A mean field theory based on how the link densities change in time by the co-evolving dynamics is constructed. The theory gives a phase diagram in the q- r parameter space that is qualitatively in agreement with simulation results. The sources of discrepancies between theory and simulations are discussed.

  16. Directed evolution to re-adapt a co-evolved network within an enzyme.

    PubMed

    Strafford, John; Payongsri, Panwajee; Hibbert, Edward G; Morris, Phattaraporn; Batth, Sukhjeet S; Steadman, David; Smith, Mark E B; Ward, John M; Hailes, Helen C; Dalby, Paul A

    2012-01-01

    We have previously used targeted active-site saturation mutagenesis to identify a number of transketolase single mutants that improved activity towards either glycolaldehyde (GA), or the non-natural substrate propionaldehyde (PA). Here, all attempts to recombine the singles into double mutants led to unexpected losses of specific activity towards both substrates. A typical trade-off occurred between soluble expression levels and specific activity for all single mutants, but many double mutants decreased both properties more severely suggesting a critical loss of protein stability or native folding. Statistical coupling analysis (SCA) of a large multiple sequence alignment revealed a network of nine co-evolved residues that affected all but one double mutant. Such networks maintain important functional properties such as activity, specificity, folding, stability, and solubility and may be rapidly disrupted by introducing one or more non-naturally occurring mutations. To identify variants of this network that would accept and improve upon our best D469 mutants for activity towards PA, we created a library of random single, double and triple mutants across seven of the co-evolved residues, combining our D469 variants with only naturally occurring mutations at the remaining sites. A triple mutant cluster at D469, E498 and R520 was found to behave synergistically for the specific activity towards PA. Protein expression was severely reduced by E498D and improved by R520Q, yet variants containing both mutations led to improved specific activity and enzyme expression, but with loss of solubility and the formation of inclusion bodies. D469S and R520Q combined synergistically to improve k(cat) 20-fold for PA, more than for any previous transketolase mutant. R520Q also doubled the specific activity of the previously identified D469T to create our most active transketolase mutant to date. Our results show that recombining active-site mutants obtained by saturation mutagenesis

  17. A SEARCH FOR CO-EVOLVING ION AND NEUTRAL GAS SPECIES IN PRESTELLAR MOLECULAR CLOUD CORES

    SciTech Connect

    Tassis, Konstantinos; Hezareh, Talayeh; Willacy, Karen

    2012-11-20

    A comparison between the widths of ion and neutral molecule spectral lines has been recently used to estimate the strength of the magnetic field in turbulent star-forming regions. However, the ion (HCO{sup +}) and neutral (HCN) species used in such studies may not be necessarily co-evolving at every scale and density, and thus, may not trace the same regions. Here, we use coupled chemical/dynamical models of evolving prestellar molecular cloud cores including non-equilibrium chemistry, with and without magnetic fields, to study the spatial distribution of HCO{sup +} and HCN, which have been used in observations of spectral line width differences to date. In addition, we seek new ion-neutral pairs that are good candidates for such observations, because they have similar evolution and are approximately co-spatial in our models. We identify three such good candidate pairs: HCO{sup +}/NO, HCO{sup +}/CO, and NO{sup +}/NO.

  18. Disconnected-connected network transitions and phase separation driven by co-evolving dynamics

    NASA Astrophysics Data System (ADS)

    Gräser, O.; Xu, C.; Hui, P. M.

    2009-08-01

    A general model that involves agents competing in an evolutionary game and an adaptive networking environment is proposed and studied. Using the snowdrift game as an example, an agent may switch character or rewire the connection when the actual payoff is less than what the agent expected of its character. Depending on the value of a payoff parameter and the initial fraction of cooperators, the system shows two distinct phases: A frozen phase, in which all non-cooperative agents are expelled as isolated agents from clusters of cooperators, and a phase in which agents of different characters form a connected network that continues to evolve. The connectivity of agents of different characters differs significantly in both phases. A theory that treats the two characters separately is constructed. The theory captures the co-evolving dynamics driven disconnected-connected network transition, the phase separation, the phase diagram, and how the system evolves in time.

  19. Genomics of Clostridium botulinum group III strains.

    PubMed

    Sakaguchi, Yoshihiko; Suzuki, Tomonori; Yamamoto, Yumiko; Nishikawa, Atsushi; Oguma, Keiji

    2015-05-01

    In Clostridium botulinum, the characteristics of type C and D strains are quite different from other types, and they are classified as group III. They produce C2 binary toxin and C3 exoenzyme in addition to type C and D neurotoxins. Two different phages and many plasmids are identified in the organisms. The genes of neurotoxin and C3 exoenzyme are converted from toxigenic strains to non-toxigenic strains by the specific bacteriophages (phages), whereas, the C2 toxin gene is carried by large or small plasmids. Classification of type C and D strains has been in confusion because 1) antigenicity of type C and D neurotoxins is complex, 2) the cells produce two types of toxins, neurotoxin and C2 toxin, and 3) some non-toxigenic strains can be converted to produce C or D neurotoxin by the infection with phages. Until now, entire nucleotide sequences of cell chromosomes, phages, and plasmids have been determined. Since both genetic and protein-chemical analyses have been clarifying the above confusions, these data are reviewed historically.

  20. Indel Group in Genomes (IGG) Molecular Genetic Markers1[OPEN

    PubMed Central

    Burkart-Waco, Diana; Kuppu, Sundaram; Britt, Anne; Chetelat, Roger

    2016-01-01

    Genetic markers are essential when developing or working with genetically variable populations. Indel Group in Genomes (IGG) markers are primer pairs that amplify single-locus sequences that differ in size for two or more alleles. They are attractive for their ease of use for rapid genotyping and their codominant nature. Here, we describe a heuristic algorithm that uses a k-mer-based approach to search two or more genome sequences to locate polymorphic regions suitable for designing candidate IGG marker primers. As input to the IGG pipeline software, the user provides genome sequences and the desired amplicon sizes and size differences. Primer sequences flanking polymorphic insertions/deletions are produced as output. IGG marker files for three sets of genomes, Solanum lycopersicum/Solanum pennellii, Arabidopsis (Arabidopsis thaliana) Columbia-0/Landsberg erecta-0 accessions, and S. lycopersicum/S. pennellii/Solanum tuberosum (three-way polymorphic) are included. PMID:27436831

  1. HomologMiner: looking for homologous genomic groups in whole genomes.

    PubMed

    Hou, Minmei; Berman, Piotr; Hsu, Chih-Hao; Harris, Robert S

    2007-04-15

    Complex genomes contain numerous repeated sequences, and genomic duplication is believed to be a main evolutionary mechanism to obtain new functions. Several tools are available for de novo repeat sequence identification, and many approaches exist for clustering homologous protein sequences. We present an efficient new approach to identify and cluster homologous DNA sequences with high accuracy at the level of whole genomes, excluding low-complexity repeats, tandem repeats and annotated interspersed repeats. We also determine the boundaries of each group member so that it closely represents a biological unit, e.g. a complete gene, or a partial gene coding a protein domain. We developed a program called HomologMiner to identify homologous groups applicable to genome sequences that have been properly marked for low-complexity repeats and annotated interspersed repeats. We applied it to the whole genomes of human (hg17), macaque (rheMac2) and mouse (mm8). Groups obtained include gene families (e.g. olfactory receptor gene family, zinc finger families), unannotated interspersed repeats and additional homologous groups that resulted from recent segmental duplications. Our program incorporates several new methods: a new abstract definition of consistent duplicate units, a new criterion to remove moderately frequent tandem repeats, and new algorithmic techniques. We also provide preliminary analysis of the output on the three genomes mentioned above, and show several applications including identifying boundaries of tandem gene clusters and novel interspersed repeat families. All programs and datasets are downloadable from www.bx.psu.edu/miller_lab.

  2. Molecular Epidemiology and Genomics of Group A Streptococcus

    PubMed Central

    Bessen, Debra E.; McShan, W. Michael; Nguyen, Scott V.; Shetty, Amol; Agrawal, Sonia; Tettelin, Hervé

    2014-01-01

    Streptococcus pyogenes (group A streptococcus; GAS) is a strict human pathogen with a very high prevalence worldwide. This review highlights the genetic organization of the species and the important ecological considerations that impact its evolution. Recent advances are presented on the topics of molecular epidemiology, population biology, molecular basis for genetic change, genome structure and genetic flux, phylogenomics and closely related streptococcal species, and the long- and short-term evolution of GAS. The application of whole genome sequence data to addressing key biological questions is discussed. PMID:25460818

  3. Analytic approach to co-evolving dynamics in complex networks: dissatisfied adaptive snowdrift game

    NASA Astrophysics Data System (ADS)

    Gräser, Oliver; Xu, Chen; Hui, P. M.

    2011-08-01

    We investigate the formulation of mean-field (MF) approaches for co-evolving dynamic model systems, focusing on the accuracy and validity of different schemes in closing MF equations. Within the context of a recently introduced co-evolutionary snowdrift game in which rational adaptive actions are driven by dissatisfaction in the payoff, we introduce a method to test the validity of closure schemes and analyse the shortcomings of previous schemes. A previous scheme suitable for adaptive epidemic models is shown to be invalid for the model studied here. A binomial-style closure scheme that significantly improves upon the previous schemes is introduced. Fixed-point analysis of the MF equations not only explains the numerical observed transition between a connected state with suppressed cooperation and a highly cooperative disconnected state, but also reveals a previously undetected connected state that exhibits the unusual behaviour of decreasing cooperation as the temptation for uncooperative action drops. We proposed a procedure for selecting proper initial conditions to realize the unusual state in numerical simulations. The effects of the mean number of connections that an agent carries are also studied.

  4. The Heterogeneity of Mutational Tolerance in a Protein is Dependent on the Strength of Selective Pressure Correlating with Sectors of Co-evolving Residues

    NASA Astrophysics Data System (ADS)

    Stiffler, Michael; Ranganathan, Rama

    2011-03-01

    Proteins are capable of tolerating mutations at many positions while still maintaining fold and function. Previous studies have failed to consider how tolerance to random mutagenesis might depend on the strength of selective pressure. To examine this, we measured the fitness of every single point mutation of TEM-1 beta-lactamase across a range of ampicillin concentrations utilizing a novel application of deep-sequencing. We found that the relative mutational robustness between positions varied considerably with respect to ampicillin concentration: at a low ampicillin concentration only a few positions are intolerant of mutations, while at a higher ampicillin concentration many additional positions are as equally intolerant of mutations. Using an analytic method termed statistical coupling analysis (SCA) to measure the co-variation between all positions in a sequence alignment of beta-lactamases revealed sectors of co-evolving positions associated with groups of residues having increased sensitivity to mutagenesis at either low or high ampicillin concentrations. Our findings suggest that nature has ``designed'' proteins to be robust to random mutagenesis by loading the constraints for fitness on discrete networks of co-evolving positions depending on the strength of selective pressure.

  5. Comparative genome analysis of Bacillus cereus group genomes withBacillus subtilis

    SciTech Connect

    Anderson, Iain; Sorokin, Alexei; Kapatral, Vinayak; Reznik, Gary; Bhattacharya, Anamitra; Mikhailova, Natalia; Burd, Henry; Joukov, Victor; Kaznadzey, Denis; Walunas, Theresa; D'Souza, Mark; Larsen, Niels; Pusch,Gordon; Liolios, Konstantinos; Grechkin, Yuri; Lapidus, Alla; Goltsman,Eugene; Chu, Lien; Fonstein, Michael; Ehrlich, S. Dusko; Overbeek, Ross; Kyrpides, Nikos; Ivanova, Natalia

    2005-09-14

    Genome features of the Bacillus cereus group genomes (representative strains of Bacillus cereus, Bacillus anthracis and Bacillus thuringiensis sub spp israelensis) were analyzed and compared with the Bacillus subtilis genome. A core set of 1,381 protein families among the four Bacillus genomes, with an additional set of 933 families common to the B. cereus group, was identified. Differences in signal transduction pathways, membrane transporters, cell surface structures, cell wall, and S-layer proteins suggesting differences in their phenotype were identified. The B. cereus group has signal transduction systems including a tyrosine kinase related to two-component system histidine kinases from B. subtilis. A model for regulation of the stress responsive sigma factor sigmaB in the B. cereus group different from the well studied regulation in B. subtilis has been proposed. Despite a high degree of chromosomal synteny among these genomes, significant differences in cell wall and spore coat proteins that contribute to the survival and adaptation in specific hosts has been identified.

  6. Mechanisms Used for Genomic Proliferation by Thermophilic Group II Introns

    PubMed Central

    Mohr, Georg; Ghanem, Eman; Lambowitz, Alan M.

    2010-01-01

    Mobile group II introns, which are found in bacterial and organellar genomes, are site-specific retroelments hypothesized to be evolutionary ancestors of spliceosomal introns and retrotransposons in higher organisms. Most bacteria, however, contain no more than one or a few group II introns, making it unclear how introns could have proliferated to higher copy numbers in eukaryotic genomes. An exception is the thermophilic cyanobacterium Thermosynechococcus elongatus, which contains 28 closely related copies of a group II intron, constituting ∼1.3% of the genome. Here, by using a combination of bioinformatics and mobility assays at different temperatures, we identified mechanisms that contribute to the proliferation of T. elongatus group II introns. These mechanisms include divergence of DNA target specificity to avoid target site saturation; adaptation of some intron-encoded reverse transcriptases to splice and mobilize multiple degenerate introns that do not encode reverse transcriptases, leading to a common splicing apparatus; and preferential insertion within other mobile introns or insertion elements, which provide new unoccupied sites in expanding non-essential DNA regions. Additionally, unlike mesophilic group II introns, the thermophilic T. elongatus introns rely on elevated temperatures to help promote DNA strand separation, enabling access to a larger number of DNA target sites by base pairing of the intron RNA, with minimal constraint from the reverse transcriptase. Our results provide insight into group II intron proliferation mechanisms and show that higher temperatures, which are thought to have prevailed on Earth during the emergence of eukaryotes, favor intron proliferation by increasing the accessibility of DNA target sites. We also identify actively mobile thermophilic introns, which may be useful for structural studies, gene targeting in thermophiles, and as a source of thermostable reverse transcriptases. PMID:20543989

  7. Comparative Genomics of the Staphylococcus intermedius Group of Animal Pathogens

    PubMed Central

    Ben Zakour, Nouri L.; Beatson, Scott A.; van den Broek, Adri H. M.; Thoday, Keith L.; Fitzgerald, J. Ross

    2012-01-01

    The Staphylococcus intermedius group consists of three closely related coagulase-positive bacterial species including S. intermedius, Staphylococcus pseudintermedius, and Staphylococcus delphini. S. pseudintermedius is a major skin pathogen of dogs, which occasionally causes severe zoonotic infections of humans. S. delphini has been isolated from an array of different animals including horses, mink, and pigeons, whereas S. intermedius has been isolated only from pigeons to date. Here we provide a detailed analysis of the S. pseudintermedius whole genome sequence in comparison to high quality draft S. intermedius and S. delphini genomes, and to other sequenced staphylococcal species. The core genome of the SIG was highly conserved with average nucleotide identity (ANI) between the three species of 93.61%, which is very close to the threshold of species delineation (95% ANI), highlighting the close-relatedness of the SIG species. However, considerable variation was identified in the content of mobile genetic elements, cell wall-associated proteins, and iron and sugar transporters, reflecting the distinct ecological niches inhabited. Of note, S. pseudintermedius ED99 contained a clustered regularly interspaced short palindromic repeat locus of the Nmeni subtype and S. intermedius contained both Nmeni and Mtube subtypes. In contrast to S. intermedius and S. delphini and most other staphylococci examined to date, S. pseudintermedius contained at least nine predicted reverse transcriptase Group II introns. Furthermore, S. pseudintermedius ED99 encoded several transposons which were largely responsible for its multi-resistant phenotype. Overall, the study highlights extensive differences in accessory genome content between closely related staphylococcal species inhabiting distinct host niches, providing new avenues for research into pathogenesis and bacterial host-adaptation. PMID:22919635

  8. Whole genome phylogeny of Prochlorococcus marinus group of cyanobacteria: genome alignment and overlapping gene approach.

    PubMed

    Prabha, Ratna; Singh, Dhananjaya P; Gupta, Shailendra K; Rai, Anil

    2014-06-01

    Prochlorococcus is the smallest known oxygenic phototrophic marine cyanobacterium dominating the mid-latitude oceans. Physiologically and genetically distinct P. marinus isolates from many oceans in the world were assigned two different groups, a tightly clustered high-light (HL)-adapted and a divergent low-light (LL-) adapted clade. Phylogenetic analysis of this cyanobacterium on the basis of 16S rRNA and other conserved genes did not show consistency with its phenotypic behavior. We analyzed phylogeny of this genus on the basis of complete genome sequences through genome alignment, overlapping-gene content and gene-order approach. Phylogenetic tree of P. marinus obtained by comparing whole genome sequences in contrast to that based on 16S rRNA gene, corresponded well with the HL/LL ecotypic distinction of twelve strains and showed consistency with phenotypic classification of P. marinus. Evidence for the horizontal descent and acquisition of genes within and across the genus was observed. Many genes involved in metabolic functions were found to be conserved across these genomes and many were continuously gained by different strains as per their needs during the course of their evolution. Consistency in the physiological and genetic phylogeny based on whole genome sequence is established. These observations improve our understanding about the adaptation and diversification of these organisms under evolutionary pressure.

  9. Partially satisfied to fully satisfied transitions in co-evolving inverse voter model and possible scaling behavior

    NASA Astrophysics Data System (ADS)

    Choi, C. W.; Xu, C.; Hui, P. M.

    2015-12-01

    Understanding co-evolving networks characterized by the mutual influence of agents' actions and network structure remains a challenge. We study a co-evolving inverse voter model in which agents adapt to achieve a preferred environment with more opposite-opinion neighbors by rewiring their connections and switching opinion. Numerical studies reveal a transition from a dynamic partially satisfied phase to a frozen fully satisfied phase as the rewiring probability is varied. A simple mean field theory is shown to capture the behavior only qualitatively. An improved mean field theory carrying a longer spatial correlation gives better results. Motivated by numerical results in networks of different degrees and mean field results, we propose a scaling variable that combines the rewiring probability and mean degree in a special form. The scaling variable is shown to work well in analyzing data corresponding to different networks and different rewiring probabilities. An application is to predict the results for networks of different degrees based solely on results obtained from networks of one degree. Studying scaling behavior provides an alternative path for understanding co-evolving agent-based dynamical systems, especially in light of the trade-off between complexity of a theory and its accuracy.

  10. Genome evolution in Reptilia, the sister group of mammals.

    PubMed

    Janes, Daniel E; Organ, Christopher L; Fujita, Matthew K; Shedlock, Andrew M; Edwards, Scott V

    2010-01-01

    The genomes of birds and nonavian reptiles (Reptilia) are critical for understanding genome evolution in mammals and amniotes generally. Despite decades of study at the chromosomal and single-gene levels, and the evidence for great diversity in genome size, karyotype, and sex chromosome diversity, reptile genomes are virtually unknown in the comparative genomics era. The recent sequencing of the chicken and zebra finch genomes, in conjunction with genome scans and the online publication of the Anolis lizard genome, has begun to clarify the events leading from an ancestral amniote genome--predicted to be large and to possess a diverse repeat landscape on par with mammals and a birdlike sex chromosome system--to the small and highly streamlined genomes of birds. Reptilia exhibit a wide range of evolutionary rates of different subgenomes and, from isochores to mitochondrial DNA, provide a critical contrast to the genomic paradigms established in mammals.

  11. Analysis of co-evolving genes in campylobacter jejuni and C. coli

    USDA-ARS?s Scientific Manuscript database

    Background: The population structure of Campylobacter has been frequently studied by MLST, for which fragments of housekeeping genes are compared. We wished to determine if the used MLST genes are representative of the complete genome. Methods: A set of 1029 core gene families (CGF) was identifie...

  12. Modeling growth and dissemination of lymphoma in a co-evolving lymph node: a diffuse-domain approach

    NASA Astrophysics Data System (ADS)

    Chuang, Yao-Li; Cristini, Vittorio; Chen, Ying; Li, Xiangrong; Frieboes, Hermann; Lowengrub, John

    2013-03-01

    While partial differential equation models of tumor growth have successfully described various spatiotemporal phenomena observed for in-vitro tumor spheroid experiments, one challenge towards taking these models to further study in-vivo tumors is that instead of relatively static tissue culture with regular boundary conditions, in-vivo tumors are often confined in organ tissues that co-evolve with the tumor growth. Here we adopt a recently developed diffuse-domain method to account for the co-evolving domain boundaries, adapting our previous in-vitro tumor model for the development of lymphoma encapsulated in a lymph node, which may swell or shrink due to proliferation and dissemination of lymphoma cells and treatment by chemotherapy. We use the model to study the induced spatial heterogeneity, which may arise as an emerging phenomenon in experimental observations and model analysis. Spatial heterogeneity is believed to lead to tumor infiltration patterns and reduce the efficacy of chemotherapy, leaving residuals that cause cancer relapse after the treatment. Understanding the spatiotemporal evolution of in-vivo tumors can be an essential step towards more effective strategies of curing cancer. Supported by NIH-PSOC grant 1U54CA143907-01.

  13. MBGD: a platform for microbial comparative genomics based on the automated construction of orthologous groups.

    PubMed

    Uchiyama, Ikuo

    2007-01-01

    The microbial genome database for comparative analysis (MBGD) is a comprehensive platform for microbial comparative genomics. The central function of MBGD is to create orthologous groups among multiple genomes from precomputed all-against-all similarity relationships using the DomClust algorithm. The database now contains >300 published genomes and the number continues to grow. For researchers who are interested in ongoing genome projects, we have now started a new service called 'My MBGD,' which allows users to add their own genome sequences to MBGD for the purpose of identifying orthologs among both the new and the existing genomes. Furthermore, in order to make available the rapidly accumulating information on closely related genome sequences, we enhanced the interface for pairwise genome comparisons using the CGAT interface, which allows users to see nucleotide sequence alignments of non-coding as well as coding regions. MBGD is available at http://mbgd.genome.ad.jp/.

  14. Principles of Genome Evolution in the Drosophila melanogaster Species Group

    PubMed Central

    Ranz, José M; Maurin, Damien; Chan, Yuk S; von Grotthuss, Marcin; Hillier, LaDeana W; Roote, John; Ashburner, Michael; Bergman, Casey M

    2007-01-01

    That closely related species often differ by chromosomal inversions was discovered by Sturtevant and Plunkett in 1926. Our knowledge of how these inversions originate is still very limited, although a prevailing view is that they are facilitated by ectopic recombination events between inverted repetitive sequences. The availability of genome sequences of related species now allows us to study in detail the mechanisms that generate interspecific inversions. We have analyzed the breakpoint regions of the 29 inversions that differentiate the chromosomes of Drosophila melanogaster and two closely related species, D. simulans and D. yakuba, and reconstructed the molecular events that underlie their origin. Experimental and computational analysis revealed that the breakpoint regions of 59% of the inversions (17/29) are associated with inverted duplications of genes or other nonrepetitive sequences. In only two cases do we find evidence for inverted repetitive sequences in inversion breakpoints. We propose that the presence of inverted duplications associated with inversion breakpoint regions is the result of staggered breaks, either isochromatid or chromatid, and that this, rather than ectopic exchange between inverted repetitive sequences, is the prevalent mechanism for the generation of inversions in the melanogaster species group. Outgroup analysis also revealed evidence for widespread breakpoint recycling. Lastly, we have found that expression domains in D. melanogaster may be disrupted in D. yakuba, bringing into question their potential adaptive significance. PMID:17550304

  15. Algebraic double cut and join : A group-theoretic approach to the operator on multichromosomal genomes.

    PubMed

    Bhatia, Sangeeta; Egri-Nagy, Attila; Francis, Andrew R

    2015-11-01

    Establishing a distance between genomes is a significant problem in computational genomics, because its solution can be used to establish evolutionary relationships including phylogeny. The "double cut and join" (DCJ) model of chromosomal rearrangement proposed by Yancopoulos et al. (Bioinformatics 21:3340-3346, 2005) has received attention as it can model inversions, translocations, fusion and fission on a multichromosomal genome that may contain both linear and circular chromosomes. In this paper, we realize the DCJ operator as a group action on the space of multichromosomal genomes. We study this group action, deriving some properties of the group and finding group-theoretic analogues for the key results in the DCJ theory.

  16. Inactivation of human adenovirus genome by different groups of disinfectants.

    PubMed

    Sauerbrei, A; Sehr, K; Eichhorn, U; Reimer, K; Wutzler, P

    2004-05-01

    Human adenoviruses are model viruses for testing the virucidal efficacy of disinfectants. However, a recent study has shown that the chemical sensitivity of adenovirus serotypes varies significantly, possibly due to the composition of the viral capsid and/or the resistance of nucleic acids. We have investigated the effect of molecular changes in the viral genome of the human adenovirus subgenera C and D. A common oligonucleotide fragment within the hexon gene was amplified by polymerase chain reaction (PCR) after exposure to liposomal povidone-iodine (PVP-I), peracetic acid (PAA), and formaldehyde. The findings were compared with infectivity in cell cultures. PVP-I (0.125%) destroyed the infectivity of most serotypes within 60 min. However, PCR revealed no destruction of the adenoviral genome in most serotypes, even after exposure to higher PVP-I concentrations. PAA (0.5%) failed to inactivate the hexon gene of adenovirus types 22 and 44. Furthermore, the hexon gene of adenovirus type 22 was not altered by 0.7% formaldehyde. In conclusion, the genomes of human adenoviruses show considerably more chemical resistance than the complete viral particle. The molecular resistance of individual serotypes also varies. However, there was no clear correlation between the differences in the effect of disinfectants on infectivity of the complete viral particle and destruction of the viral genome.

  17. Genome sequence of a proteolytic (Group I) Clostridium botulinum strain Hall A and comparative analysis of the clostridial genomes.

    PubMed

    Sebaihia, Mohammed; Peck, Michael W; Minton, Nigel P; Thomson, Nicholas R; Holden, Matthew T G; Mitchell, Wilfrid J; Carter, Andrew T; Bentley, Stephen D; Mason, David R; Crossman, Lisa; Paul, Catherine J; Ivens, Alasdair; Wells-Bennik, Marjon H J; Davis, Ian J; Cerdeño-Tárraga, Ana M; Churcher, Carol; Quail, Michael A; Chillingworth, Tracey; Feltwell, Theresa; Fraser, Audrey; Goodhead, Ian; Hance, Zahra; Jagels, Kay; Larke, Natasha; Maddison, Mark; Moule, Sharon; Mungall, Karen; Norbertczak, Halina; Rabbinowitsch, Ester; Sanders, Mandy; Simmonds, Mark; White, Brian; Whithead, Sally; Parkhill, Julian

    2007-07-01

    Clostridium botulinum is a heterogeneous Gram-positive species that comprises four genetically and physiologically distinct groups of bacteria that share the ability to produce botulinum neurotoxin, the most poisonous toxin known to man, and the causative agent of botulism, a severe disease of humans and animals. We report here the complete genome sequence of a representative of Group I (proteolytic) C. botulinum (strain Hall A, ATCC 3502). The genome consists of a chromosome (3,886,916 bp) and a plasmid (16,344 bp), which carry 3650 and 19 predicted genes, respectively. Consistent with the proteolytic phenotype of this strain, the genome harbors a large number of genes encoding secreted proteases and enzymes involved in uptake and metabolism of amino acids. The genome also reveals a hitherto unknown ability of C. botulinum to degrade chitin. There is a significant lack of recently acquired DNA, indicating a stable genomic content, in strong contrast to the fluid genome of Clostridium difficile, which can form longer-term relationships with its host. Overall, the genome indicates that C. botulinum is adapted to a saprophytic lifestyle both in soil and aquatic environments. This pathogen relies on its toxin to rapidly kill a wide range of prey species, and to gain access to nutrient sources, it releases a large number of extracellular enzymes to soften and destroy rotting or decayed tissues.

  18. Genome sequence of a proteolytic (Group I) Clostridium botulinum strain Hall A and comparative analysis of the clostridial genomes

    PubMed Central

    Sebaihia, Mohammed; Peck, Michael W.; Minton, Nigel P.; Thomson, Nicholas R.; Holden, Matthew T.G.; Mitchell, Wilfrid J.; Carter, Andrew T.; Bentley, Stephen D.; Mason, David R.; Crossman, Lisa; Paul, Catherine J.; Ivens, Alasdair; Wells-Bennik, Marjon H.J.; Davis, Ian J.; Cerdeño-Tárraga, Ana M.; Churcher, Carol; Quail, Michael A.; Chillingworth, Tracey; Feltwell, Theresa; Fraser, Audrey; Goodhead, Ian; Hance, Zahra; Jagels, Kay; Larke, Natasha; Maddison, Mark; Moule, Sharon; Mungall, Karen; Norbertczak, Halina; Rabbinowitsch, Ester; Sanders, Mandy; Simmonds, Mark; White, Brian; Whithead, Sally; Parkhill, Julian

    2007-01-01

    Clostridium botulinum is a heterogeneous Gram-positive species that comprises four genetically and physiologically distinct groups of bacteria that share the ability to produce botulinum neurotoxin, the most poisonous toxin known to man, and the causative agent of botulism, a severe disease of humans and animals. We report here the complete genome sequence of a representative of Group I (proteolytic) C. botulinum (strain Hall A, ATCC 3502). The genome consists of a chromosome (3,886,916 bp) and a plasmid (16,344 bp), which carry 3650 and 19 predicted genes, respectively. Consistent with the proteolytic phenotype of this strain, the genome harbors a large number of genes encoding secreted proteases and enzymes involved in uptake and metabolism of amino acids. The genome also reveals a hitherto unknown ability of C. botulinum to degrade chitin. There is a significant lack of recently acquired DNA, indicating a stable genomic content, in strong contrast to the fluid genome of Clostridium difficile, which can form longer-term relationships with its host. Overall, the genome indicates that C. botulinum is adapted to a saprophytic lifestyle both in soil and aquatic environments. This pathogen relies on its toxin to rapidly kill a wide range of prey species, and to gain access to nutrient sources, it releases a large number of extracellular enzymes to soften and destroy rotting or decayed tissues. PMID:17519437

  19. Genomic Sequence or Signature Tags (GSTs) from the Genome Group at Brookhaven National Laboratory (BNL)

    DOE Data Explorer

    Dunn, John J.; McCorkle, Sean R.; Praissman, Laura A.; Hind, Geoffrey; Van der Lelie, Daniel; Bahou, Wadie F.; Gnatenko, Dmitri V.; Krause, Maureen K.

    Genomic Signature Tags (GSTs) are the products of a method we have developed for identifying and quantitatively analyzing genomic DNAs. The DNA is initially fragmented with a type II restriction enzyme. An oligonucleotide adaptor containing a recognition site for MmeI, a type IIS restriction enzyme, is then used to release 21-bp tags from fixed positions in the DNA relative to the sites recognized by the fragmenting enzyme. These tags are PCR-amplified, purified, concatenated and then cloned and sequenced. The tag sequences and abundances are used to create a high resolution GST sequence profile of the genomic DNA. [Quoted from Genomic Signature Tags (GSTs): A System for Profiling Genomic DNA, Dunn, John J.; McCorkle, Sean R.; Praissman, Laura A.; Hind, Geoffrey; Van der Lelie, Daniel; Bahou, Wadie F.; Gnatenko, Dmitri V.; Krause, Maureen K., Revised 9/13/2002

  20. Genomic signatures of evolutionary transitions from solitary to group living

    PubMed Central

    Kapheim, Karen M.; Pan, Hailin; Li, Cai; Salzberg, Steven L.; Puiu, Daniela; Magoc, Tanja; Robertson, Hugh M.; Hudson, Matthew E.; Venkat, Aarti; Fischman, Brielle J.; Hernandez, Alvaro; Yandell, Mark; Ence, Daniel; Holt, Carson; Yocum, George D.; Kemp, William P.; Bosch, Jordi; Waterhouse, Robert M.; Zdobnov, Evgeny M.; Stolle, Eckart; Kraus, F. Bernhard; Helbing, Sophie; Moritz, Robin F. A.; Glastad, Karl M.; Hunt, Brendan G.; Goodisman, Michael A. D.; Hauser, Frank; Grimmelikhuijzen, Cornelis J. P.; Pinheiro, Daniel Guariz; Nunes, Francis Morais Franco; Soares, Michelle Prioli Miranda; Tanaka, Érica Donato; Simões, Zilá Luz Paulino; Hartfelder, Klaus; Evans, Jay D.; Barribeau, Seth M.; Johnson, Reed M.; Massey, Jonathan H.; Southey, Bruce R.; Hasselmann, Martin; Hamacher, Daniel; Biewer, Matthias; Kent, Clement F.; Zayed, Amro; Blatti, Charles; Sinha, Saurabh; Johnston, J. Spencer; Hanrahan, Shawn J.; Kocher, Sarah D.; Wang, Jun; Robinson, Gene E.; Zhang, Guojie

    2017-01-01

    The evolution of eusociality is one of the major transitions in evolution, but the underlying genomic changes are unknown. We compared the genomes of 10 bee species that vary in social complexity, representing multiple independent transitions in social evolution, and report three major findings. First, many important genes show evidence of neutral evolution as a consequence of relaxed selection with increasing social complexity. Second, there is no single road map to eusociality; independent evolutionary transitions in sociality have independent genetic underpinnings. Third, though clearly independent in detail, these transitions do have similar general features, including an increase in constrained protein evolution accompanied by increases in the potential for gene regulation and decreases in diversity and abundance of transposable elements. Eusociality may arise through different mechanisms each time, but would likely always involve an increase in the complexity of gene networks. PMID:25977371

  1. Comparative genomics of the bacterial genus Streptococcus illuminates evolutionary implications of species groups.

    PubMed

    Gao, Xiao-Yang; Zhi, Xiao-Yang; Li, Hong-Wei; Klenk, Hans-Peter; Li, Wen-Jun

    2014-01-01

    Members of the genus Streptococcus within the phylum Firmicutes are among the most diverse and significant zoonotic pathogens. This genus has gone through considerable taxonomic revision due to increasing improvements of chemotaxonomic approaches, DNA hybridization and 16S rRNA gene sequencing. It is proposed to place the majority of streptococci into "species groups". However, the evolutionary implications of species groups are not clear presently. We use comparative genomic approaches to yield a better understanding of the evolution of Streptococcus through genome dynamics, population structure, phylogenies and virulence factor distribution of species groups. Genome dynamics analyses indicate that the pan-genome size increases with the addition of newly sequenced strains, while the core genome size decreases with sequential addition at the genus level and species group level. Population structure analysis reveals two distinct lineages, one including Pyogenic, Bovis, Mutans and Salivarius groups, and the other including Mitis, Anginosus and Unknown groups. Phylogenetic dendrograms show that species within the same species group cluster together, and infer two main clades in accordance with population structure analysis. Distribution of streptococcal virulence factors has no obvious patterns among the species groups; however, the evolution of some common virulence factors is congruous with the evolution of species groups, according to phylogenetic inference. We suggest that the proposed streptococcal species groups are reasonable from the viewpoints of comparative genomics; evolution of the genus is congruent with the individual evolutionary trajectories of different species groups.

  2. Comparative Genomics of the Bacterial Genus Streptococcus Illuminates Evolutionary Implications of Species Groups

    PubMed Central

    Gao, Xiao-Yang; Zhi, Xiao-Yang; Li, Hong-Wei; Klenk, Hans-Peter; Li, Wen-Jun

    2014-01-01

    Members of the genus Streptococcus within the phylum Firmicutes are among the most diverse and significant zoonotic pathogens. This genus has gone through considerable taxonomic revision due to increasing improvements of chemotaxonomic approaches, DNA hybridization and 16S rRNA gene sequencing. It is proposed to place the majority of streptococci into “species groups”. However, the evolutionary implications of species groups are not clear presently. We use comparative genomic approaches to yield a better understanding of the evolution of Streptococcus through genome dynamics, population structure, phylogenies and virulence factor distribution of species groups. Genome dynamics analyses indicate that the pan-genome size increases with the addition of newly sequenced strains, while the core genome size decreases with sequential addition at the genus level and species group level. Population structure analysis reveals two distinct lineages, one including Pyogenic, Bovis, Mutans and Salivarius groups, and the other including Mitis, Anginosus and Unknown groups. Phylogenetic dendrograms show that species within the same species group cluster together, and infer two main clades in accordance with population structure analysis. Distribution of streptococcal virulence factors has no obvious patterns among the species groups; however, the evolution of some common virulence factors is congruous with the evolution of species groups, according to phylogenetic inference. We suggest that the proposed streptococcal species groups are reasonable from the viewpoints of comparative genomics; evolution of the genus is congruent with the individual evolutionary trajectories of different species groups. PMID:24977706

  3. Transmission of facial expressions of emotion co-evolved with their efficient decoding in the brain: behavioral and brain evidence.

    PubMed

    Schyns, Philippe G; Petro, Lucy S; Smith, Marie L

    2009-05-20

    Competent social organisms will read the social signals of their peers. In primates, the face has evolved to transmit the organism's internal emotional state. Adaptive action suggests that the brain of the receiver has co-evolved to efficiently decode expression signals. Here, we review and integrate the evidence for this hypothesis. With a computational approach, we co-examined facial expressions as signals for data transmission and the brain as receiver and decoder of these signals. First, we show in a model observer that facial expressions form a lowly correlated signal set. Second, using time-resolved EEG data, we show how the brain uses spatial frequency information impinging on the retina to decorrelate expression categories. Between 140 to 200 ms following stimulus onset, independently in the left and right hemispheres, an information processing mechanism starts locally with encoding the eye, irrespective of expression, followed by a zooming out to processing the entire face, followed by a zooming back in to diagnostic features (e.g. the opened eyes in "fear", the mouth in "happy"). A model categorizer demonstrates that at 200 ms, the left and right brain have represented enough information to predict behavioral categorization performance.

  4. Co-evolving CENP-A and CAL1 Domains Mediate Centromeric CENP-A Deposition across Drosophila Species.

    PubMed

    Rosin, Leah; Mellone, Barbara G

    2016-04-18

    Centromeres mediate the conserved process of chromosome segregation, yet centromeric DNA and the centromeric histone, CENP-A, are rapidly evolving. The rapid evolution of Drosophila CENP-A loop 1 (L1) is thought to modulate the DNA-binding preferences of CENP-A to counteract centromere drive, the preferential transmission of chromosomes with expanded centromeric satellites. Consistent with this model, CENP-A from Drosophila bipectinata (bip) cannot localize to Drosophila melanogaster (mel) centromeres. We show that this result is due to the inability of the mel CENP-A chaperone, CAL1, to deposit bip CENP-A into chromatin. Co-expression of bip CENP-A and bip CAL1 in mel cells restores centromeric localization, and similar findings apply to other Drosophila species. We identify two co-evolving regions, CENP-A L1 and the CAL1 N terminus, as critical for lineage-specific CENP-A incorporation. Collectively, our data show that the rapid evolution of L1 modulates CAL1-mediated CENP-A assembly, suggesting an alternative mechanism for the suppression of centromere drive.

  5. Population genomics and research ethics with socially identifable groups.

    PubMed

    McGregor, Joan L

    2007-01-01

    In this paper, the author questions whether the research ethics guidelines and procedures are robust enough to protect groups when conducting genetics research with socially identifiable populations, particularly with Native American groups. The author argues for a change in the federal guidelines in substance and procedures of conducting genetic research with socially identifiable groups.

  6. Reclassification of Shewanella putrefaciens Owen's genomic group II as Shewanella baltica sp. nov.

    PubMed

    Ziemke, F; Höfle, M G; Lalucat, J; Rosselló-Mora, R

    1998-01-01

    The taxonomic relationship between several Shewanella putrefaciens isolates from the Baltic Sea and reference strains of this species is presented in this study. Results from DNA-DNA hybridization using a newly developed non-radioactive detection system and from 16S rRNA gene sequencing demonstrated that S. putrefaciens is a heterogeneous species containing more than a single genomic group. The genomic group II was phylogenetically, genotypically and phenotypically distant enough from the species type strain to be classified as a single species within the genus Shewanella. Therefore, we propose to reclassify Owen's genomic group II as Shewanella baltica sp. nov. with the type strain NCTC 10735.

  7. Whole-Genome Sequences of Four Corynebacterium CDC Group F-1 Strains Isolated from Urine

    PubMed Central

    Bernier, Anne-Marie; Peters, Geoffrey A.

    2017-01-01

    ABSTRACT Three draft and one complete genome sequence from strains isolated from urine and consistent with Corynebacterium CDC group F-1 were assembled and studied. Genome sizes ranged between 2.3 and 2.44 Mb, with G+C content between 60.4% and 60.7%. PMID:28153894

  8. A conserved Glu-Arg salt bridge connects co-evolved motifs that define the eukaryote protein kinase fold

    PubMed Central

    Yang, Jie; Wu, Jian; Steichen, Jon M.; Kornev, Alexandr P.; Deal, Michael S.; Li, Sheng; Sankaran, Banumathi; Woods, Virgil L.; Taylor, Susan S.

    2012-01-01

    Eukaryotic protein kinases (EPK)feature two co-evolved structural segments, the Activation segment which starts with the Asp-Phe-Gly (DFG) and ends with the Ala-Pro-Glu (APE) motifs, and the helical GHI-subdomain that comprises αG-αH-αI helices. Eukaryotic-like kinases have a much shorter Activation segment and lack the GHI-subdomain. They thus lack the conserved salt bridge interaction between the APE Glu and an Arg from the GHI-subdomain, a hallmark signature of EPKs. Although the conservation of this salt bridge in EPKs is well known and its implication in diseases has been illustrated by polymorphism analysis, its function has not been carefully studied. In this work, we use murine cAMP dependent protein kinase (PKA) as the model enzyme (Glu208 and Arg280) to examine the role of these two residues. We showed that Ala replacement of either residue caused a 40–120 fold decrease in catalytic efficiency of the enzyme due to an increase in Km(ATP) and a decrease in kcat. Crystal structures, as well as solution studies, also demonstratethat this ion pair contributes to the hydrophobic network and stability of the enzyme. We show that mutation of either Glu or Arg to Ala renders bothmutant proteins less effective substrates for upstream kinase phosphoinositide dependent kinase 1. We propose that the Glu208-Arg280 pair serves as a center hub of connectivity between these two structurally conserved elements in EPKs. Mutations of either residue disrupt communication not only between the two segments but also within the rest of the molecule leading to altered catalytic activity and enzyme regulation. PMID:22138346

  9. Genome Sequence of Acidovorax citrulli Group 1 Strain pslb65 Causing Bacterial Fruit Blotch of Melons

    PubMed Central

    Wang, Tielin; Sun, Baixin; Yang, Yuwen

    2015-01-01

    Acidovorax citrulli is typed into two groups, mainly based on the host. We determined the draft genome of A. citrulli group 1 strain pslb65. The strain was isolated from melon collected from Xinjiang province, China. The A. citrulli pslb65 genome contains 4,903,443 bp and has a G+C content of 68.8 mol%. PMID:25908136

  10. Genome Sequence of Acidovorax citrulli Group 1 Strain pslb65 Causing Bacterial Fruit Blotch of Melons.

    PubMed

    Wang, Tielin; Sun, Baixin; Yang, Yuwen; Zhao, Tingchang

    2015-04-23

    Acidovorax citrulli is typed into two groups, mainly based on the host. We determined the draft genome of A. citrulli group 1 strain pslb65. The strain was isolated from melon collected from Xinjiang province, China. The A. citrulli pslb65 genome contains 4,903,443 bp and has a G+C content of 68.8 mol%. Copyright © 2015 Wang et al.

  11. Nitrogen limitation as a driver of genome size evolution in a group of karst plants

    NASA Astrophysics Data System (ADS)

    Kang, Ming; Wang, Jing; Huang, Hongwen

    2015-06-01

    Genome size is of fundamental biological importance with significance in predicting structural and functional attributes of organisms. Although abundant evidence has shown that the genome size can be largely explained by differential proliferation and removal of non-coding DNA of the genome, the evolutionary and ecological basis of genome size variation remains poorly understood. Nitrogen (N) and phosphorus (P) are essential elements of DNA and protein building blocks, yet often subject to environmental limitation in natural ecosystems. Using phylogenetic comparative methods, we test this hypothesis by determining whether leaf N and P availability affects genome sizes in 99 species of Primulina (Gesneriaceae), a group of soil specialists adapted to limestone karst environment in south China. We find that genome sizes in Primulina are strongly positively correlated with plant N content, but the correlation with plant P content is not significant when phylogeny history was taken into account. This study shows for the first time that N limitation might have been a plausible driver of genome size variation in a group of plants. We propose that competition for nitrogen nutrient between DNA synthesis and cellular functions is a possible mechanism for genome size evolution in Primulina under N-limitation.

  12. Nitrogen limitation as a driver of genome size evolution in a group of karst plants.

    PubMed

    Kang, Ming; Wang, Jing; Huang, Hongwen

    2015-06-25

    Genome size is of fundamental biological importance with significance in predicting structural and functional attributes of organisms. Although abundant evidence has shown that the genome size can be largely explained by differential proliferation and removal of non-coding DNA of the genome, the evolutionary and ecological basis of genome size variation remains poorly understood. Nitrogen (N) and phosphorus (P) are essential elements of DNA and protein building blocks, yet often subject to environmental limitation in natural ecosystems. Using phylogenetic comparative methods, we test this hypothesis by determining whether leaf N and P availability affects genome sizes in 99 species of Primulina (Gesneriaceae), a group of soil specialists adapted to limestone karst environment in south China. We find that genome sizes in Primulina are strongly positively correlated with plant N content, but the correlation with plant P content is not significant when phylogeny history was taken into account. This study shows for the first time that N limitation might have been a plausible driver of genome size variation in a group of plants. We propose that competition for nitrogen nutrient between DNA synthesis and cellular functions is a possible mechanism for genome size evolution in Primulina under N-limitation.

  13. Nitrogen limitation as a driver of genome size evolution in a group of karst plants

    PubMed Central

    Kang, Ming; Wang, Jing; Huang, Hongwen

    2015-01-01

    Genome size is of fundamental biological importance with significance in predicting structural and functional attributes of organisms. Although abundant evidence has shown that the genome size can be largely explained by differential proliferation and removal of non-coding DNA of the genome, the evolutionary and ecological basis of genome size variation remains poorly understood. Nitrogen (N) and phosphorus (P) are essential elements of DNA and protein building blocks, yet often subject to environmental limitation in natural ecosystems. Using phylogenetic comparative methods, we test this hypothesis by determining whether leaf N and P availability affects genome sizes in 99 species of Primulina (Gesneriaceae), a group of soil specialists adapted to limestone karst environment in south China. We find that genome sizes in Primulina are strongly positively correlated with plant N content, but the correlation with plant P content is not significant when phylogeny history was taken into account. This study shows for the first time that N limitation might have been a plausible driver of genome size variation in a group of plants. We propose that competition for nitrogen nutrient between DNA synthesis and cellular functions is a possible mechanism for genome size evolution in Primulina under N-limitation. PMID:26109237

  14. Complete Genome Sequences of Nine Bacillus cereus Group Phages.

    PubMed

    Foltz, Samantha; Johnson, Allison A

    2016-07-14

    We report the sequences of nine novel Bacillus cereus group bacteriophages: DIGNKC, Juglone, Nemo, Nigalana, NotTheCreek, Phrodo, SageFayge, Vinny, and Zuko. These bacteriophages are double-stranded DNA-containing Myoviridae isolated from soil samples using B. thuringiensis subsp. kurstaki as the host bacterium.

  15. Complete Genome Sequences of Nine Bacillus cereus Group Phages

    PubMed Central

    Foltz, Samantha

    2016-01-01

    We report the sequences of nine novel Bacillus cereus group bacteriophages: DIGNKC, Juglone, Nemo, Nigalana, NotTheCreek, Phrodo, SageFayge, Vinny, and Zuko. These bacteriophages are double-stranded DNA-containing Myoviridae isolated from soil samples using B. thuringiensis subsp. kurstaki as the host bacterium. PMID:27417827

  16. HIV type 1 group M subtype G in Cameroon: five genome sequences.

    PubMed

    Yamaguchi, Julie; Ndembi, Nicaise; Ngansop, Charlotte; Mbanya, Dora; Kaptué, Lazare; Gürtler, Lutz G; Devare, Sushil G; Brennan, Catherine A

    2009-04-01

    Near full-length viral genome sequences were obtained for five putative subtype G candidates identified in HIV-infected Cameroonian blood donors, based on partial genome sequences for the gag, pol, and env regions. Phylogenetic analysis of the genome sequences shows that all five strains are pure subtype G with no indication of intersubtype recombination. The Cameroon subtype G sequences did not form a geographically based subcluster and were intermixed within the subtype G branch with isolates from several different countries. HIV-1 group M subtype G accounts for only 4.5% of HIV infections in Cameroon. However, genome segments of subtype G are present in 67% of all infections and 80% of infections due to intersubtype recombinant strains in Cameroon. The addition of five subtype G genome sequences to the HIV database may contribute to a better understanding of the origins and classification of HIV-1 subtypes and CRFs.

  17. Multiple Groups of Novel Retroviral Genomes in Pigs and Related Species

    PubMed Central

    Patience, Clive; Switzer, William M.; Takeuchi, Yasuhiro; Griffiths, David J.; Goward, Melanie E.; Heneine, Walid; Stoye, Jonathan P.; Weiss, Robin A.

    2001-01-01

    In view of the concern over potential infection hazards in the use of porcine tissues and organs for xenotransplantation to humans, we investigated the diversity of porcine endogenous retrovirus (PERV) genomes in the DNA of domestic pigs and related species. In addition to the three known envelope subgroups of infectious gamma retroviruses (PERV-A, -B, and -C), classed together here as PERV group γ1, four novel groups of gamma retrovirus (γ2 to γ5) and four novel groups of beta retrovirus (β1 to β4) genomes were detected in pig DNA using generic and specific PCR primers. PCR quantification indicated that the retroviral genome copy number in the Landrace × Duroc F1 hybrid pig ranged from 2 (β2 and γ5) to approximately 50 (γ1). The γ1, γ2, and β4 genomes were transcribed into RNA in adult kidney tissue. Apart from γ1, the retroviral genomes are not known to be infectious, and sequencing of a small number of amplified genome fragments revealed stop codons in putative open reading frames in several cases. Analysis of DNA from wild boar and other species of Old World pigs (Suidae) and New World peccaries (Tayassuidae) showed that one retrovirus group, β2, was common to all species tested, while the others were present among all Old World species but absent from New World species. The PERV-C subgroup of γ1 genomes segregated among domestic pigs and were absent from two African species (red river hog and warthog). Thus domestic swine and their phylogenetic relatives harbor multiple groups of hitherto undescribed PERV genomes. PMID:11222700

  18. Multiple groups of novel retroviral genomes in pigs and related species.

    PubMed

    Patience, C; Switzer, W M; Takeuchi, Y; Griffiths, D J; Goward, M E; Heneine, W; Stoye, J P; Weiss, R A

    2001-03-01

    In view of the concern over potential infection hazards in the use of porcine tissues and organs for xenotransplantation to humans, we investigated the diversity of porcine endogenous retrovirus (PERV) genomes in the DNA of domestic pigs and related species. In addition to the three known envelope subgroups of infectious gamma retroviruses (PERV-A, -B, and -C), classed together here as PERV group gamma 1, four novel groups of gamma retrovirus (gamma 2 to gamma 5) and four novel groups of beta retrovirus (beta 1 to beta 4) genomes were detected in pig DNA using generic and specific PCR primers. PCR quantification indicated that the retroviral genome copy number in the Landrace x Duroc F(1) hybrid pig ranged from 2 (beta 2 and gamma 5) to approximately 50 (gamma 1). The gamma 1, gamma 2, and beta 4 genomes were transcribed into RNA in adult kidney tissue. Apart from gamma 1, the retroviral genomes are not known to be infectious, and sequencing of a small number of amplified genome fragments revealed stop codons in putative open reading frames in several cases. Analysis of DNA from wild boar and other species of Old World pigs (Suidae) and New World peccaries (Tayassuidae) showed that one retrovirus group, beta 2, was common to all species tested, while the others were present among all Old World species but absent from New World species. The PERV-C subgroup of gamma1 genomes segregated among domestic pigs and were absent from two African species (red river hog and warthog). Thus domestic swine and their phylogenetic relatives harbor multiple groups of hitherto undescribed PERV genomes.

  19. Identification of group B rotaviruses with short genome electropherotypes from adult cows with diarrhea.

    PubMed

    Parwani, A V; Lucchelli, A; Saif, L J

    1996-05-01

    Two field strains (BB-RVLV and KD) of group B rotaviruses from adult dairy cows with diarrhea displayed short genome electropherotypes. Gnotobiotic calves inoculated with fecal filtrates of each group B rotavirus developed diarrhea, and only group B rotaviruses or antigens were detected in the feces by immunoelectron microscopy and in intestinal epithelial cells by immunofluorescent staining, respectively. The feces or intestinal contents of the cows and inoculated calves were negative for group A and C rotaviruses by enzyme-linked immunosorbent assay, immunoelectron microscopy, or cell culture immunofluorescence assays. Comparison of the genome electropherotypes of the calf-passaged BB-RVLV and KD strains with the original samples and reference bovine group A, B, and C rotaviruses revealed conservative of their short-genome electropherotypes and double-stranded RNA migration patterns characteristics of group B rotaviruses. To our knowledge, our previous study (L.J. Saif, K.V. Brock, D.R. Redman, and E.M. Kohler, Vet. Rec. 128:447-449, 1991) and this report are the first description of bovine group B rotaviruses (in a mixed infection with bovine coronavirus or singly in fecal contents) in adult cows with diarrhea and this is the first report of short-genome electropherotypes among group B rotaviruses.

  20. Whole-genome single-nucleotide-polymorphism analysis for discrimination of Clostridium botulinum group I strains.

    PubMed

    Gonzalez-Escalona, Narjol; Timme, Ruth; Raphael, Brian H; Zink, Donald; Sharma, Shashi K

    2014-04-01

    Clostridium botulinum is a genetically diverse Gram-positive bacterium producing extremely potent neurotoxins (botulinum neurotoxins A through G [BoNT/A-G]). The complete genome sequences of three strains harboring only the BoNT/A1 nucleotide sequence are publicly available. Although these strains contain a toxin cluster (HA(+) OrfX(-)) associated with hemagglutinin genes, little is known about the genomes of subtype A1 strains (termed HA(-) OrfX(+)) that lack hemagglutinin genes in the toxin gene cluster. We sequenced the genomes of three BoNT/A1-producing C. botulinum strains: two strains with the HA(+) OrfX(-) cluster (69A and 32A) and one strain with the HA(-) OrfX(+) cluster (CDC297). Whole-genome phylogenic single-nucleotide-polymorphism (SNP) analysis of these strains along with other publicly available C. botulinum group I strains revealed five distinct lineages. Strains 69A and 32A clustered with the C. botulinum type A1 Hall group, and strain CDC297 clustered with the C. botulinum type Ba4 strain 657. This study reports the use of whole-genome SNP sequence analysis for discrimination of C. botulinum group I strains and demonstrates the utility of this analysis in quickly differentiating C. botulinum strains harboring identical toxin gene subtypes. This analysis further supports previous work showing that strains CDC297 and 657 likely evolved from a common ancestor and independently acquired separate BoNT/A1 toxin gene clusters at distinct genomic locations.

  1. Survey of group I and group II introns in 29 sequenced genomes of the Bacillus cereus group: insights into their spread and evolution

    PubMed Central

    Tourasse, Nicolas J.; Kolstø, Anne-Brit

    2008-01-01

    Group I and group II introns are different catalytic self-splicing and mobile RNA elements that contribute to genome dynamics. In this study, we have analyzed their distribution and evolution in 29 sequenced genomes from the Bacillus cereus group of bacteria. Introns were of different structural classes and evolutionary origins, and a large number of nearly identical elements are shared between multiple strains of different sources, suggesting recent lateral transfers and/or that introns are under a strong selection pressure. Altogether, 73 group I introns were identified, inserted in essential genes from the chromosome or newly described prophages, including the first elements found within phages in bacterial plasmids. Notably, bacteriophages are an important source for spreading group I introns between strains. Furthermore, 77 group II introns were found within a diverse set of chromosomal and plasmidic genes. Unusual findings include elements located within conserved DNA metabolism and repair genes and one intron inserted within a novel retroelement. Group II introns are mainly disseminated via plasmids and can subsequently invade the host genome, in particular by coupling mobility with host cell replication. This study reveals a very high diversity and variability of mobile introns in B. cereus group strains. PMID:18587153

  2. Classification of Italian isolates of Borrelia burgdorferi into three genomic groups.

    PubMed

    Cinco, M; De Giovannini, R; Fattorini, P; Florian, F; Graziosi, G

    1993-10-01

    In this study we investigated the genotypic characteristics of some locally isolated strains of B. burgdorferi by three different methodologies: restriction endonuclease analysis (REA), Southern blot hybridization with whole DNAs from Borrelia strains and Southern blot hybridization with rRNA 16 + 23S genes derived from E. coli. REA fingerprintings were evaluated by cluster analysis, according to the principles of numerical taxonomy. The genomas of the locally isolated strains were compared with borreliae originating from different countries of Europe, including Sweden and with the American reference strain B31. Among the European strains, some already described by Baranton (Baranton et al., 1992) as representatives of different genomic groups Borrelia sensu stricto and Borrelia garinii were used. By the different techniques the isolates were included in three genomic groups which could correspond to the three genospecies identified by Baranton, namely B. burgdorferi sensu stricto, B. garinii and B. group VS461: in fact two strains were included in a homogeneous group, probably corresponding to the VS461 genomic group, together with other European borreliae; one isolate was included in a group consisting of B31 and some other European strains already described as belonging to Borrelia burgdorferi in sensu stricto. Finally two isolates were ascribed to a third genomic group probably corresponding to the genospecies indicated as Borrelia garinii. These findings indicate that a small number of Borrelia strains isolated from a very restricted area can be genetically heterogeneous.

  3. StreptoBase: An Oral Streptococcus mitis Group Genomic Resource and Analysis Platform.

    PubMed

    Zheng, Wenning; Tan, Tze King; Paterson, Ian C; Mutha, Naresh V R; Siow, Cheuk Chuen; Tan, Shi Yang; Old, Lesley A; Jakubovics, Nicholas S; Choo, Siew Woh

    2016-01-01

    The oral streptococci are spherical Gram-positive bacteria categorized under the phylum Firmicutes which are among the most common causative agents of bacterial infective endocarditis (IE) and are also important agents in septicaemia in neutropenic patients. The Streptococcus mitis group is comprised of 13 species including some of the most common human oral colonizers such as S. mitis, S. oralis, S. sanguinis and S. gordonii as well as species such as S. tigurinus, S. oligofermentans and S. australis that have only recently been classified and are poorly understood at present. We present StreptoBase, which provides a specialized free resource focusing on the genomic analyses of oral species from the mitis group. It currently hosts 104 S. mitis group genomes including 27 novel mitis group strains that we sequenced using the high throughput Illumina HiSeq technology platform, and provides a comprehensive set of genome sequences for analyses, particularly comparative analyses and visualization of both cross-species and cross-strain characteristics of S. mitis group bacteria. StreptoBase incorporates sophisticated in-house designed bioinformatics web tools such as Pairwise Genome Comparison (PGC) tool and Pathogenomic Profiling Tool (PathoProT), which facilitate comparative pathogenomics analysis of Streptococcus strains. Examples are provided to demonstrate how StreptoBase can be employed to compare genome structure of different S. mitis group bacteria and putative virulence genes profile across multiple streptococcal strains. In conclusion, StreptoBase offers access to a range of streptococci genomic resources as well as analysis tools and will be an invaluable platform to accelerate research in streptococci. Database URL: http://streptococcus.um.edu.my.

  4. StreptoBase: An Oral Streptococcus mitis Group Genomic Resource and Analysis Platform

    PubMed Central

    Zheng, Wenning; Paterson, Ian C.; Mutha, Naresh V. R.; Siow, Cheuk Chuen; Tan, Shi Yang; Old, Lesley A.; Jakubovics, Nicholas S.; Choo, Siew Woh

    2016-01-01

    The oral streptococci are spherical Gram-positive bacteria categorized under the phylum Firmicutes which are among the most common causative agents of bacterial infective endocarditis (IE) and are also important agents in septicaemia in neutropenic patients. The Streptococcus mitis group is comprised of 13 species including some of the most common human oral colonizers such as S. mitis, S. oralis, S. sanguinis and S. gordonii as well as species such as S. tigurinus, S. oligofermentans and S. australis that have only recently been classified and are poorly understood at present. We present StreptoBase, which provides a specialized free resource focusing on the genomic analyses of oral species from the mitis group. It currently hosts 104 S. mitis group genomes including 27 novel mitis group strains that we sequenced using the high throughput Illumina HiSeq technology platform, and provides a comprehensive set of genome sequences for analyses, particularly comparative analyses and visualization of both cross-species and cross-strain characteristics of S. mitis group bacteria. StreptoBase incorporates sophisticated in-house designed bioinformatics web tools such as Pairwise Genome Comparison (PGC) tool and Pathogenomic Profiling Tool (PathoProT), which facilitate comparative pathogenomics analysis of Streptococcus strains. Examples are provided to demonstrate how StreptoBase can be employed to compare genome structure of different S. mitis group bacteria and putative virulence genes profile across multiple streptococcal strains. In conclusion, StreptoBase offers access to a range of streptococci genomic resources as well as analysis tools and will be an invaluable platform to accelerate research in streptococci. Database URL: http://streptococcus.um.edu.my. PMID:27138013

  5. Genome Sequence and Analysis of Buzura suppressaria Nucleopolyhedrovirus: A Group II Alphabaculovirus

    PubMed Central

    Zhu, Zheng; Yin, Feifei; Liu, Xiaoping; Hou, Dianhai; Wang, Jun; Zhang, Lei; Arif, Basil; Wang, Hualin; Deng, Fei; Hu, Zhihong

    2014-01-01

    The genome of Buzura suppressaria nucleopolyhedrovirus (BusuNPV) was sequenced by 454 pyrosequencing technology. The size of the genome is 120,420 bp with 36.8% G+C content. It contains 127 hypothetical open reading frames (ORFs) covering 90.7% of the genome and includes the 37 conserved baculovirus core genes, 84 genes found in other baculoviruses, and 6 unique ORFs. No typical baculoviral homologous repeats (hrs) were present but the genome contained a region of repeated sequences. Gene Parity Plots revealed a 28.8 kb region conserved among the alpha- and beta-baculoviruses. Overall comparisons of BusuNPV to other baculoviruses point to a distinct species in group II Alphabaculovirus. PMID:24475121

  6. Extending the Bacillus cereus group genomics to putative food-borne pathogens of different toxicity

    SciTech Connect

    Lapidus, Alla L.; Goltsman, Eugene; Auger, Sandrine; Galleron, Nathalie; Segurens, Beatrice; Simon, Jorg; Dossat, Carole; Broussolle, Veronique; Brillard, Julien; Guinebretiere, Marie-Helene; Sanchis, Vincent; Nguen-the, Christophe; Lereclus, Didier; Richardson, P M; Wincker, Patrick; Sorokin, Alexei

    2008-01-01

    The Bacillus cereus group represents sporulating soil bacteria containing pathogenic strains which may cause diarrheic or emetic food poisoning outbreaks. Multiple locus sequence typing revealed a presence in natural samples of these bacteria of about 30 clonal complexes. Application of genomic methods to this group was however biased due to the major interest for representatives closely related to Bacillus anthracis. Albeit the most important food-borne pathogens were not yet defined, existing data indicate that they are scattered all over the phylogenetic tree. The preliminary analysis of the sequences of three genomes discussed in this paper narrows down the gaps in our knowledge of the B. cereus group. The strain NVH391-98 is a rare but particularly severe food-borne pathogen. Sequencing revealed that the strain should be a representative of a novel bacterial species, for which the name Bacillus cytotoxis or Bacillus cytotoxicus is proposed. This strain has a reduced genome size compared to other B. cereus group strains. Genome analysis revealed absence of sigma B factor and the presence of genes encoding diarrheic Nhe toxin, not detected earlier. The strain B. cereus F837/76 represents a clonal complex close to that of B. anthracis. Including F837/76, three such B. cereus strains had been sequenced. Alignment of genomes suggests that B. anthracis is their common ancestor. Since such strains often emerge from clinical cases, they merit a special attention. The third strain, KBAB4, is a typical facultative psychrophile generally found in soil. Phylogenic studies show that in nature it is the most active group in terms of gene exchange. Genomic sequence revealed high presence of extra-chromosomal genetic material (about 530 kb) that may account for this phenomenon. Genes coding Nhe-like toxin were found on a big plasmid in this strain. This may indicate a potential mechanism of toxicity spread from the psychrophile strain community. The results of this genomic

  7. Extending the Bacillus cereus group genomics to putative food-borne pathogens of different toxicity.

    PubMed

    Lapidus, Alla; Goltsman, Eugene; Auger, Sandrine; Galleron, Nathalie; Ségurens, Béatrice; Dossat, Carole; Land, Miriam L; Broussolle, Veronique; Brillard, Julien; Guinebretiere, Marie-Helene; Sanchis, Vincent; Nguen-The, Christophe; Lereclus, Didier; Richardson, Paul; Wincker, Patrick; Weissenbach, Jean; Ehrlich, S Dusko; Sorokin, Alexei

    2008-01-30

    The Bacillus cereus group represents sporulating soil bacteria containing pathogenic strains which may cause diarrheic or emetic food poisoning outbreaks. Multiple locus sequence typing revealed a presence in natural samples of these bacteria of about 30 clonal complexes. Application of genomic methods to this group was however biased due to the major interest for representatives closely related to Bacillus anthracis. Albeit the most important food-borne pathogens were not yet defined, existing data indicate that they are scattered all over the phylogenetic tree. The preliminary analysis of the sequences of three genomes discussed in this paper narrows down the gaps in our knowledge of the B. cereus group. The strain NVH391-98 is a rare but particularly severe food-borne pathogen. Sequencing revealed that the strain should be a representative of a novel bacterial species, for which the name Bacillus cytotoxis or Bacillus cytotoxicus is proposed. This strain has a reduced genome size compared to other B. cereus group strains. Genome analysis revealed absence of sigma B factor and the presence of genes encoding diarrheic Nhe toxin, not detected earlier. The strain B. cereus F837/76 represents a clonal complex close to that of B. anthracis. Including F837/76, three such B. cereus strains had been sequenced. Alignment of genomes suggests that B. anthracis is their common ancestor. Since such strains often emerge from clinical cases, they merit a special attention. The third strain, KBAB4, is a typical facultative psychrophile generally found in soil. Phylogenic studies show that in nature it is the most active group in terms of gene exchange. Genomic sequence revealed high presence of extra-chromosomal genetic material (about 530kb) that may account for this phenomenon. Genes coding Nhe-like toxin were found on a big plasmid in this strain. This may indicate a potential mechanism of toxicity spread from the psychrophile strain community. The results of this genomic

  8. Group II Introns Break New Boundaries: Presence in a Bilaterian's Genome

    PubMed Central

    Vallès, Yvonne; Halanych, Kenneth M.; Boore, Jeffrey L.

    2008-01-01

    Group II introns are ribozymes, removing themselves from their primary transcripts, as well as mobile genetic elements, transposing via an RNA intermediate, and are thought to be the ancestors of spliceosomal introns. Although common in bacteria and most eukaryotic organelles, they have never been reported in any bilaterian animal genome, organellar or nuclear. Here we report the first group II intron found in the mitochondrial genome of a bilaterian worm. This location is especially surprising, since animal mitochondrial genomes are generally distinct from those of plants, fungi, and protists by being small and compact, and so are viewed as being highly streamlined, perhaps as a result of strong selective pressures for fast replication while establishing germ plasm during early development. This intron is found in the mtDNA of an annelid worm, (an undescribed species of Nephtys), where the complete sequence revealed a 1819 bp group II intron inside the cox1 gene. We infer that this intron is the result of a recent horizontal gene transfer event from a viral or bacterial vector into the mitochondrial genome of Nephtys sp. Our findings hold implications for understanding mechanisms, constraints, and selective pressures that account for patterns of animal mitochondrial genome evolution PMID:18213396

  9. Towards understanding the first genome sequence of a crenarchaeon by genome annotation using clusters of orthologous groups of proteins (COGs)

    PubMed Central

    Natale, Darren A; Shankavaram, Uma T; Galperin, Michael Y; Wolf, Yuri I; Aravind, L; Koonin, Eugene V

    2000-01-01

    Background: Standard archival sequence databases have not been designed as tools for genome annotation and are far from being optimal for this purpose. We used the database of Clusters of Orthologous Groups of proteins (COGs) to reannotate the genomes of two archaea, Aeropyrum pernix, the first member of the Crenarchaea to be sequenced, and Pyrococcus abyssi. Results: A. pernix and P. abyssi proteins were assigned to COGs using the COGNITOR program; the results were verified on a case-by-case basis and augmented by additional database searches using the PSI-BLAST and TBLASTN programs. Functions were predicted for over 300 proteins from A. pernix, which could not be assigned a function using conventional methods with a conservative sequence similarity threshold, an approximately 50% increase compared to the original annotation. A. pernix shares most of the conserved core of proteins that were previously identified in the Euryarchaeota. Cluster analysis or distance matrix tree construction based on the co-occurrence of genomes in COGs showed that A. pernix forms a distinct group within the archaea, although grouping with the two species of Pyrococci, indicative of similar repertoires of conserved genes, was observed. No indication of a specific relationship between Crenarchaeota and eukaryotes was obtained in these analyses. Several proteins that are conserved in Euryarchaeota and most bacteria are unexpectedly missing in A. pernix, including the entire set of de novo purine biosynthesis enzymes, the GTPase FtsZ (a key component of the bacterial and euryarchaeal cell-division machinery), and the tRNA-specific pseudouridine synthase, previously considered universal. A. pernix is represented in 48 COGs that do not contain any euryarchaeal members. Many of these proteins are TCA cycle and electron transport chain enzymes, reflecting the aerobic lifestyle of A. pernix. Conclusions: Special-purpose databases organized on the basis of phylogenetic analysis and carefully

  10. Complete genome sequence and phylogenetic position of the Bacillus cereus group phage JBP901.

    PubMed

    Asare, Paul Tetteh; Ryu, Sangryeol; Kim, Kwang-Pyo

    2015-09-01

    Bacteriophage JBP901, isolated from fermented food, is specific for Bacillus cereus group species and exhibits a broad host spectrum among a large number of B. cereus isolates. Genome sequence analysis revealed a linear 159,492-bp genome with overall G+C content of 39.7 mol%, and 201 ORFs. The presence of a putative methylase, the large number of tRNAs, and the large number of nucleotide-metabolism- and replication-related genes in JBP901 reflects its broad lytic capacity. Most of the ORFs showed a high degree of similarity to Bcp1, Bc431v3 and BCP78, and various comparative genomics analyses also consistently clustered JBP901 with orphan (unclassified) Bacillus phages in the subfamily Spounavirinae of the family Myoviridae, supporting the presence of a distinguishable group in the subfamily.

  11. Whole-genome phylogeny of Escherichia coli/Shigella group by feature frequency profiles (FFPs)

    PubMed Central

    Sims, Gregory E.; Kim, Sung-Hou

    2011-01-01

    A whole-genome phylogeny of the Escherichia coli/Shigella group was constructed by using the feature frequency profile (FFP) method. This alignment-free approach uses the frequencies of l-mer features of whole genomes to infer phylogenic distances. We present two phylogenies that accentuate different aspects of E. coli/Shigella genomic evolution: (i) one based on the compositions of all possible features of length l = 24 (∼8.4 million features), which are likely to reveal the phenetic grouping and relationship among the organisms and (ii) the other based on the compositions of core features with low frequency and low variability (∼0.56 million features), which account for ∼69% of all commonly shared features among 38 taxa examined and are likely to have genome-wide lineal evolutionary signal. Shigella appears as a single clade when all possible features are used without filtering of noncore features. However, results using core features show that Shigella consists of at least two distantly related subclades, implying that the subclades evolved into a single clade because of a high degree of convergence influenced by mobile genetic elements and niche adaptation. In both FFP trees, the basal group of the E. coli/Shigella phylogeny is the B2 phylogroup, which contains primarily uropathogenic strains, suggesting that the E. coli/Shigella ancestor was likely a facultative or opportunistic pathogen. The extant commensal strains diverged relatively late and appear to be the result of reductive evolution of genomes. We also identify clade distinguishing features and their associated genomic regions within each phylogroup. Such features may provide useful information for understanding evolution of the groups and for quick diagnostic identification of each phylogroup. PMID:21536867

  12. Prokaryotic Virus Orthologous Groups (pVOGs): a resource for comparative genomics and protein family annotation

    PubMed Central

    Grazziotin, Ana Laura; Koonin, Eugene V.; Kristensen, David M.

    2017-01-01

    Viruses are the most abundant and diverse biological entities on earth, and while most of this diversity remains completely unexplored, advances in genome sequencing have provided unprecedented glimpses into the virosphere. The Prokaryotic Virus Orthologous Groups (pVOGs, formerly called Phage Orthologous Groups, POGs) resource has aided in this task over the past decade by using automated methods to keep pace with the rapid increase in genomic data. The uses of pVOGs include functional annotation of viral proteins, identification of genes and viruses in uncharacterized DNA samples, phylogenetic analysis, large-scale comparative genomics projects, and more. The pVOGs database represents a comprehensive set of orthologous gene families shared across multiple complete genomes of viruses that infect bacterial or archaeal hosts (viruses of eukaryotes will be added at a future date). The pVOGs are constructed within the Clusters of Orthologous Groups (COGs) framework that is widely used for orthology identification in prokaryotes. Since the previous release of the POGs, the size has tripled to nearly 3000 genomes and 300 000 proteins, and the number of conserved orthologous groups doubled to 9518. User-friendly webpages are available, including multiple sequence alignments and HMM profiles for each VOG. These changes provide major improvements to the pVOGs database, at a time of rapid advances in virus genomics. The pVOGs database is hosted jointly at the University of Iowa at http://dmk-brain.ecn.uiowa.edu/pVOGs and the NCBI at ftp://ftp.ncbi.nlm.nih.gov/pub/kristensen/pVOGs/home.html. PMID:27789703

  13. Prokaryotic Virus Orthologous Groups (pVOGs): a resource for comparative genomics and protein family annotation.

    PubMed

    Grazziotin, Ana Laura; Koonin, Eugene V; Kristensen, David M

    2017-01-04

    Viruses are the most abundant and diverse biological entities on earth, and while most of this diversity remains completely unexplored, advances in genome sequencing have provided unprecedented glimpses into the virosphere. The Prokaryotic Virus Orthologous Groups (pVOGs, formerly called Phage Orthologous Groups, POGs) resource has aided in this task over the past decade by using automated methods to keep pace with the rapid increase in genomic data. The uses of pVOGs include functional annotation of viral proteins, identification of genes and viruses in uncharacterized DNA samples, phylogenetic analysis, large-scale comparative genomics projects, and more. The pVOGs database represents a comprehensive set of orthologous gene families shared across multiple complete genomes of viruses that infect bacterial or archaeal hosts (viruses of eukaryotes will be added at a future date). The pVOGs are constructed within the Clusters of Orthologous Groups (COGs) framework that is widely used for orthology identification in prokaryotes. Since the previous release of the POGs, the size has tripled to nearly 3000 genomes and 300 000 proteins, and the number of conserved orthologous groups doubled to 9518. User-friendly webpages are available, including multiple sequence alignments and HMM profiles for each VOG. These changes provide major improvements to the pVOGs database, at a time of rapid advances in virus genomics. The pVOGs database is hosted jointly at the University of Iowa at http://dmk-brain.ecn.uiowa.edu/pVOGs and the NCBI at ftp://ftp.ncbi.nlm.nih.gov/pub/kristensen/pVOGs/home.html. Published by Oxford University Press on behalf of Nucleic Acids Research 2016. This work is written by (a) US Government employee(s) and is in the public domain in the US.

  14. Genomic Definition of Hypervirulent and Multidrug-Resistant Klebsiella pneumoniae Clonal Groups

    PubMed Central

    Bialek-Davenet, Suzanne; Criscuolo, Alexis; Ailloud, Florent; Passet, Virginie; Jones, Louis; Delannoy-Vieillard, Anne-Sophie; Garin, Benoit; Le Hello, Simon; Arlet, Guillaume; Nicolas-Chanoine, Marie-Hélène; Decré, Dominique

    2014-01-01

    Multidrug-resistant and highly virulent Klebsiella pneumoniae isolates are emerging, but the clonal groups (CGs) corresponding to these high-risk strains have remained imprecisely defined. We aimed to identify K. pneumoniae CGs on the basis of genome-wide sequence variation and to provide a simple bioinformatics tool to extract virulence and resistance gene data from genomic data. We sequenced 48 K. pneumoniae isolates, mostly of serotypes K1 and K2, and compared the genomes with 119 publicly available genomes. A total of 694 highly conserved genes were included in a core-genome multilocus sequence typing scheme, and cluster analysis of the data enabled precise definition of globally distributed hypervirulent and multidrug-resistant CGs. In addition, we created a freely accessible database, BIGSdb-Kp, to enable rapid extraction of medically and epidemiologically relevant information from genomic sequences of K. pneumoniae. Although drug-resistant and virulent K. pneumoniae populations were largely nonoverlapping, isolates with combined virulence and resistance features were detected. PMID:25341126

  15. Genomic definition of hypervirulent and multidrug-resistant Klebsiella pneumoniae clonal groups.

    PubMed

    Bialek-Davenet, Suzanne; Criscuolo, Alexis; Ailloud, Florent; Passet, Virginie; Jones, Louis; Delannoy-Vieillard, Anne-Sophie; Garin, Benoit; Le Hello, Simon; Arlet, Guillaume; Nicolas-Chanoine, Marie-Hélène; Decré, Dominique; Brisse, Sylvain

    2014-11-01

    Multidrug-resistant and highly virulent Klebsiella pneumoniae isolates are emerging, but the clonal groups (CGs) corresponding to these high-risk strains have remained imprecisely defined. We aimed to identify K. pneumoniae CGs on the basis of genome-wide sequence variation and to provide a simple bioinformatics tool to extract virulence and resistance gene data from genomic data. We sequenced 48 K. pneumoniae isolates, mostly of serotypes K1 and K2, and compared the genomes with 119 publicly available genomes. A total of 694 highly conserved genes were included in a core-genome multilocus sequence typing scheme, and cluster analysis of the data enabled precise definition of globally distributed hypervirulent and multidrug-resistant CGs. In addition, we created a freely accessible database, BIGSdb-Kp, to enable rapid extraction of medically and epidemiologically relevant information from genomic sequences of K. pneumoniae. Although drug-resistant and virulent K. pneumoniae populations were largely nonoverlapping, isolates with combined virulence and resistance features were detected.

  16. Genetic and environmental factors affecting early rooting of six Populus genomic groups: implications for tree improvement

    Treesearch

    Ronald S., Jr. Zalesny

    2006-01-01

    Genetic and environmental factors affect the early rooting of Populus planted as unrooted hardwood cuttings. Populus genotypes of six genomic groups were tested in numerous studies for the quantitative genetics of rooting, along with effects of preplanting treatments and soil temperature. Genetics data (e.g. heritabilities,...

  17. Genome Sequencing and Analysis of Catopsilia pomona nucleopolyhedrovirus: A Distinct Species in Group I Alphabaculovirus

    PubMed Central

    Wang, Jun; Zhu, Zheng; Zhang, Lei; Hou, Dianhai; Wang, Manli; Arif, Basil; Kou, Zheng; Wang, Hualin; Deng, Fei; Hu, Zhihong

    2016-01-01

    The genome sequence of Catopsilia pomona nucleopolyhedrovirus (CapoNPV) was determined by the Roche 454 sequencing system. The genome consisted of 128,058 bp and had an overall G+C content of 40%. There were 130 hypothetical open reading frames (ORFs) potentially encoding proteins of more than 50 amino acids and covering 92% of the genome. Among all the hypothetical ORFs, 37 baculovirus core genes, 23 lepidopteran baculovirus conserved genes and 10 genes conserved in Group I alphabaculoviruses were identified. In addition, the genome included regions of 8 typical baculoviral homologous repeat sequences (hrs). Phylogenic analysis showed that CapoNPV was in a distinct branch of clade “a” in Group I alphabaculoviruses. Gene parity plot analysis and overall similarity of ORFs indicated that CapoNPV is more closely related to the Group I alphabaculoviruses than to other baculoviruses. Interesting, CapoNPV lacks the genes encoding the fibroblast growth factor (fgf) and ac30, which are conserved in most lepidopteran and Group I baculoviruses, respectively. Sequence analysis of the F-like protein of CapoNPV showed that some amino acids were inserted into the fusion peptide region and the pre-transmembrane region of the protein. All these unique features imply that CapoNPV represents a member of a new baculovirus species. PMID:27166956

  18. Complete genome sequence of the bioleaching bacterium Leptospirillum sp. group II strain CF-1.

    PubMed

    Ferrer, Alonso; Bunk, Boyke; Spröer, Cathrin; Biedendieck, Rebekka; Valdés, Natalia; Jahn, Martina; Jahn, Dieter; Orellana, Omar; Levicán, Gloria

    2016-03-20

    We describe the complete genome sequence of Leptospirillum sp. group II strain CF-1, an acidophilic bioleaching bacterium isolated from an acid mine drainage (AMD). This work provides data to gain insights about adaptive response of Leptospirillum spp. to the extreme conditions of bioleaching environments.

  19. Genome Sequence of Borrelia chilensis VA1, a South American Member of the Lyme Borreliosis Group.

    PubMed

    Huang, Weihua; Ojaimi, Caroline; Fallon, John T; Travisany, Dante; Maass, Alejandro; Ivanova, Larisa; Tomova, Alexandra; González-Acuña, Daniel; Godfrey, Henry P; Cabello, Felipe C

    2015-02-12

    Borrelia chilensis strain VA1 is a recently described South American member of the Borrelia burgdorferi sensu lato complex from Chile. Whole-genome sequencing analysis determined its linear chromosome and plasmids lp54 and cp26, confirmed its membership in the Lyme borreliosis group, and will open new research avenues regarding its pathogenic potential. Copyright © 2015 Huang et al.

  20. Multiple Group Testing Procedures for Analysis of High-Dimensional Genomic Data

    PubMed Central

    Ko, Hyoseok; Kim, Kipoong

    2016-01-01

    In genetic association studies with high-dimensional genomic data, multiple group testing procedures are often required in order to identify disease/trait-related genes or genetic regions, where multiple genetic sites or variants are located within the same gene or genetic region. However, statistical testing procedures based on an individual test suffer from multiple testing issues such as the control of family-wise error rate and dependent tests. Moreover, detecting only a few of genes associated with a phenotype outcome among tens of thousands of genes is of main interest in genetic association studies. In this reason regularization procedures, where a phenotype outcome regresses on all genomic markers and then regression coefficients are estimated based on a penalized likelihood, have been considered as a good alternative approach to analysis of high-dimensional genomic data. But, selection performance of regularization procedures has been rarely compared with that of statistical group testing procedures. In this article, we performed extensive simulation studies where commonly used group testing procedures such as principal component analysis, Hotelling's T2 test, and permutation test are compared with group lasso (least absolute selection and shrinkage operator) in terms of true positive selection. Also, we applied all methods considered in simulation studies to identify genes associated with ovarian cancer from over 20,000 genetic sites generated from Illumina Infinium HumanMethylation27K Beadchip. We found a big discrepancy of selected genes between multiple group testing procedures and group lasso. PMID:28154510

  1. Genomic and metabolic diversity of Marine Group I Thaumarchaeota in the mesopelagic of two subtropical gyres.

    PubMed

    Swan, Brandon K; Chaffin, Mark D; Martinez-Garcia, Manuel; Morrison, Hilary G; Field, Erin K; Poulton, Nicole J; Masland, E Dashiell P; Harris, Christopher C; Sczyrba, Alexander; Chain, Patrick S G; Koren, Sergey; Woyke, Tanja; Stepanauskas, Ramunas

    2014-01-01

    Marine Group I (MGI) Thaumarchaeota are one of the most abundant and cosmopolitan chemoautotrophs within the global dark ocean. To date, no representatives of this archaeal group retrieved from the dark ocean have been successfully cultured. We used single cell genomics to investigate the genomic and metabolic diversity of thaumarchaea within the mesopelagic of the subtropical North Pacific and South Atlantic Ocean. Phylogenetic and metagenomic recruitment analysis revealed that MGI single amplified genomes (SAGs) are genetically and biogeographically distinct from existing thaumarchaea cultures obtained from surface waters. Confirming prior studies, we found genes encoding proteins for aerobic ammonia oxidation and the hydrolysis of urea, which may be used for energy production, as well as genes involved in 3-hydroxypropionate/4-hydroxybutyrate and oxidative tricarboxylic acid pathways. A large proportion of protein sequences identified in MGI SAGs were absent in the marine cultures Cenarchaeum symbiosum and Nitrosopumilus maritimus, thus expanding the predicted protein space for this archaeal group. Identifiable genes located on genomic islands with low metagenome recruitment capacity were enriched in cellular defense functions, likely in response to viral infections or grazing. We show that MGI Thaumarchaeota in the dark ocean may have more flexibility in potential energy sources and adaptations to biotic interactions than the existing, surface-ocean cultures.

  2. Genomic and physiological variability within Group II (non-proteolytic) Clostridium botulinum

    PubMed Central

    2013-01-01

    Background Clostridium botulinum is a group of four physiologically and phylogenetically distinct bacteria that produce botulinum neurotoxin. While studies have characterised variability between strains of Group I (proteolytic) C. botulinum, the genetic and physiological variability and relationships between strains within Group II (non-proteolytic) C. botulinum are not well understood. In this study the genome of Group II strain C. botulinum Eklund 17B (NRP) was sequenced and used to construct a whole genome DNA microarray. This was used in a comparative genomic indexing study to compare the relatedness of 43 strains of Group II C. botulinum (14 type B, 24 type E and 5 type F). These results were compared with characteristics determined from physiological tests. Results Whole genome indexing showed that strains of Group II C. botulinum isolated from a wide variety of environments over more than 75 years clustered together indicating the genetic background of Group II C. botulinum is stable. Further analysis showed that strains forming type B or type F toxin are closely related with only toxin cluster genes targets being unique to either type. Strains producing type E toxin formed a separate subset. Carbohydrate fermentation tests supported the observation that type B and F strains form a separate subset to type E strains. All the type F strains and most of type B strains produced acid from amylopectin, amylose and glycogen whereas type E strains did not. However, these two subsets did not differ strongly in minimum growth temperature or maximum NaCl concentration for growth. No relationship was found between tellurite resistance and toxin type despite all the tested type B and type F strains carrying tehB, while the sequence was absent or diverged in all type E strains. Conclusions Although Group II C. botulinum form a tight genetic group, genomic and physiological analysis indicates there are two distinct subsets within this group. All type B strains and type F

  3. Evolutionary Genomics of Genes Involved in Olfactory Behavior in the Drosophila melanogaster Species Group

    PubMed Central

    Lavagnino, Nicolás; Serra, François; Arbiza, Leonardo; Dopazo, Hernán; Hasson, Esteban

    2012-01-01

    Previous comparative genomic studies of genes involved in olfactory behavior in Drosophila focused only on particular gene families such as odorant receptor and/or odorant binding proteins. However, olfactory behavior has a complex genetic architecture that is orchestrated by many interacting genes. In this paper, we present a comparative genomic study of olfactory behavior in Drosophila including an extended set of genes known to affect olfactory behavior. We took advantage of the recent burst of whole genome sequences and the development of powerful statistical tools to analyze genomic data and test evolutionary and functional hypotheses of olfactory genes in the six species of the Drosophila melanogaster species group for which whole genome sequences are available. Our study reveals widespread purifying selection and limited incidence of positive selection on olfactory genes. We show that the pace of evolution of olfactory genes is mostly independent of the life cycle stage, and of the number of life cycle stages, in which they participate in olfaction. However, we detected a relationship between evolutionary rates and the position that the gene products occupy in the olfactory system, genes occupying central positions tend to be more constrained than peripheral genes. Finally, we demonstrate that specialization to one host does not seem to be associated with bursts of adaptive evolution in olfactory genes in D. sechellia and D. erecta, the two specialists species analyzed, but rather different lineages have idiosyncratic evolutionary histories in which both historical and ecological factors have been involved. PMID:22346339

  4. A genomic insight into diversity among tribal and nontribal population groups of Manipur, India.

    PubMed

    Saraswathy, K N; Kiranmala, Naorem; Murry, Benrithung; Sinha, Ekata; Saksena, Deepti; Kaur, Harpreet; Sachdeva, M P; Kalla, A K

    2009-10-01

    Twenty autosomal markers, including linked markers at two gene markers, are used to understand the genomic similarity and diversity among three tribal (Paite, Thadou, and Kom) and one nontribal communities of Manipur (Northeast India). Two of the markers (CD4 and HB9) are monomorphic in Paite and one (the CD4 marker) in Kom. Data suggest the Meitei (nontribal groups) stand apart from the three tribal groups with respect to higher heterozygosity (0.366) and presence of the highest ancestor haplotypes of DRD2 markers (0.228); this is also supported by principal co-ordinate analysis. These populations are found to be genomically closer to the Chinese population than to other Indian populations.

  5. Analysis of the full genome of human group C rotaviruses reveals lineage diversification and reassortment.

    PubMed

    Medici, Maria Cristina; Tummolo, Fabio; Martella, Vito; Arcangeletti, Maria Cristina; De Conto, Flora; Chezzi, Carlo; Fehér, Enikő; Marton, Szilvia; Calderaro, Adriana; Bányai, Krisztián

    2016-08-01

    Group C rotaviruses (RVC) are enteric pathogens of humans and animals. Whole-genome sequences are available only for few RVCs, leaving gaps in our knowledge about their genetic diversity. We determined the full-length genome sequence of two human RVCs (PR2593/2004 and PR713/2012), detected in Italy from hospital-based surveillance for rotavirus infection in 2004 and 2012. In the 11 RNA genomic segments, the two Italian RVCs segregated within separate intra-genotypic lineages showed variation ranging from 1.9 % (VP6) to 15.9 % (VP3) at the nucleotide level. Comprehensive analysis of human RVC sequences available in the databases allowed us to reveal the existence of at least two major genome configurations, defined as type I and type II. Human RVCs of type I were all associated with the M3 VP3 genotype, including the Italian strain PR2593/2004. Conversely, human RVCs of type II were all associated with the M2 VP3 genotype, including the Italian strain PR713/2012. Reassortant RVC strains between these major genome configurations were identified. Although only a few full-genome sequences of human RVCs, mostly of Asian origin, are available, the analysis of human RVC sequences retrieved from the databases indicates that at least two intra-genotypic RVC lineages circulate in European countries. Gathering more sequence data is necessary to develop a standardized genotype and intra-genotypic lineage classification system useful for epidemiological investigations and avoiding confusion in the literature.

  6. Genome sequence of Candidatus Nitrososphaera evergladensis from group I.1b enriched from Everglades soil reveals novel genomic features of the ammonia-oxidizing archaea.

    PubMed

    Zhalnina, Kateryna V; Dias, Raquel; Leonard, Michael T; Dorr de Quadros, Patricia; Camargo, Flavio A O; Drew, Jennifer C; Farmerie, William G; Daroub, Samira H; Triplett, Eric W

    2014-01-01

    The activity of ammonia-oxidizing archaea (AOA) leads to the loss of nitrogen from soil, pollution of water sources and elevated emissions of greenhouse gas. To date, eight AOA genomes are available in the public databases, seven are from the group I.1a of the Thaumarchaeota and only one is from the group I.1b, isolated from hot springs. Many soils are dominated by AOA from the group I.1b, but the genomes of soil representatives of this group have not been sequenced and functionally characterized. The lack of knowledge of metabolic pathways of soil AOA presents a critical gap in understanding their role in biogeochemical cycles. Here, we describe the first complete genome of soil archaeon Candidatus Nitrososphaera evergladensis, which has been reconstructed from metagenomic sequencing of a highly enriched culture obtained from an agricultural soil. The AOA enrichment was sequenced with the high throughput next generation sequencing platforms from Pacific Biosciences and Ion Torrent. The de novo assembly of sequences resulted in one 2.95 Mb contig. Annotation of the reconstructed genome revealed many similarities of the basic metabolism with the rest of sequenced AOA. Ca. N. evergladensis belongs to the group I.1b and shares only 40% of whole-genome homology with the closest sequenced relative Ca. N. gargensis. Detailed analysis of the genome revealed coding sequences that were completely absent from the group I.1a. These unique sequences code for proteins involved in control of DNA integrity, transporters, two-component systems and versatile CRISPR defense system. Notably, genomes from the group I.1b have more gene duplications compared to the genomes from the group I.1a. We suggest that the presence of these unique genes and gene duplications may be associated with the environmental versatility of this group.

  7. Genome Sequence of Candidatus Nitrososphaera evergladensis from Group I.1b Enriched from Everglades Soil Reveals Novel Genomic Features of the Ammonia-Oxidizing Archaea

    PubMed Central

    Zhalnina, Kateryna V.; Dias, Raquel; Leonard, Michael T.; Dorr de Quadros, Patricia; Camargo, Flavio A. O.; Drew, Jennifer C.; Farmerie, William G.; Daroub, Samira H.; Triplett, Eric W.

    2014-01-01

    The activity of ammonia-oxidizing archaea (AOA) leads to the loss of nitrogen from soil, pollution of water sources and elevated emissions of greenhouse gas. To date, eight AOA genomes are available in the public databases, seven are from the group I.1a of the Thaumarchaeota and only one is from the group I.1b, isolated from hot springs. Many soils are dominated by AOA from the group I.1b, but the genomes of soil representatives of this group have not been sequenced and functionally characterized. The lack of knowledge of metabolic pathways of soil AOA presents a critical gap in understanding their role in biogeochemical cycles. Here, we describe the first complete genome of soil archaeon Candidatus Nitrososphaera evergladensis, which has been reconstructed from metagenomic sequencing of a highly enriched culture obtained from an agricultural soil. The AOA enrichment was sequenced with the high throughput next generation sequencing platforms from Pacific Biosciences and Ion Torrent. The de novo assembly of sequences resulted in one 2.95 Mb contig. Annotation of the reconstructed genome revealed many similarities of the basic metabolism with the rest of sequenced AOA. Ca. N. evergladensis belongs to the group I.1b and shares only 40% of whole-genome homology with the closest sequenced relative Ca. N. gargensis. Detailed analysis of the genome revealed coding sequences that were completely absent from the group I.1a. These unique sequences code for proteins involved in control of DNA integrity, transporters, two-component systems and versatile CRISPR defense system. Notably, genomes from the group I.1b have more gene duplications compared to the genomes from the group I.1a. We suggest that the presence of these unique genes and gene duplications may be associated with the environmental versatility of this group. PMID:24999826

  8. Analysis of virus genomes from glacial environments reveals novel virus groups with unusual host interactions

    PubMed Central

    Bellas, Christopher M.; Anesio, Alexandre M.; Barker, Gary

    2015-01-01

    Microbial communities in glacial ecosystems are diverse, active, and subjected to strong viral pressures and infection rates. In this study we analyse putative virus genomes assembled from three dsDNA viromes from cryoconite hole ecosystems of Svalbard and the Greenland Ice Sheet to assess the potential hosts and functional role viruses play in these habitats. We assembled 208 million reads from the virus-size fraction and developed a procedure to select genuine virus scaffolds from cellular contamination. Our curated virus library contained 546 scaffolds up to 230 Kb in length, 54 of which were circular virus consensus genomes. Analysis of virus marker genes revealed a wide range of viruses had been assembled, including bacteriophages, cyanophages, nucleocytoplasmic large DNA viruses and a virophage, with putative hosts identified as Cyanobacteria, Alphaproteobacteria, Gammaproteobacteria, Actinobacteria, Firmicutes, eukaryotic algae and amoebae. Whole genome comparisons revealed the majority of circular genome scaffolds (CGS) formed 12 novel groups, two of which contained multiple phage members with plasmid-like properties, including a group of phage-plasmids possessing plasmid-like partition genes and toxin-antitoxin addiction modules to ensure their replication and a satellite phage-plasmid group. Surprisingly we also assembled a phage that not only encoded plasmid partition genes, but a clustered regularly interspaced short palindromic repeat (CRISPR)/Cas adaptive bacterial immune system. One of the spacers was an exact match for another phage in our virome, indicating that in a novel use of the system, the lysogen was potentially capable of conferring immunity on its bacterial host against other phage. Together these results suggest that highly novel and diverse groups of viruses are present in glacial environments, some of which utilize very unusual life strategies and genes to control their replication and maintain a long-term relationship with their hosts

  9. Analysis of virus genomes from glacial environments reveals novel virus groups with unusual host interactions.

    PubMed

    Bellas, Christopher M; Anesio, Alexandre M; Barker, Gary

    2015-01-01

    Microbial communities in glacial ecosystems are diverse, active, and subjected to strong viral pressures and infection rates. In this study we analyse putative virus genomes assembled from three dsDNA viromes from cryoconite hole ecosystems of Svalbard and the Greenland Ice Sheet to assess the potential hosts and functional role viruses play in these habitats. We assembled 208 million reads from the virus-size fraction and developed a procedure to select genuine virus scaffolds from cellular contamination. Our curated virus library contained 546 scaffolds up to 230 Kb in length, 54 of which were circular virus consensus genomes. Analysis of virus marker genes revealed a wide range of viruses had been assembled, including bacteriophages, cyanophages, nucleocytoplasmic large DNA viruses and a virophage, with putative hosts identified as Cyanobacteria, Alphaproteobacteria, Gammaproteobacteria, Actinobacteria, Firmicutes, eukaryotic algae and amoebae. Whole genome comparisons revealed the majority of circular genome scaffolds (CGS) formed 12 novel groups, two of which contained multiple phage members with plasmid-like properties, including a group of phage-plasmids possessing plasmid-like partition genes and toxin-antitoxin addiction modules to ensure their replication and a satellite phage-plasmid group. Surprisingly we also assembled a phage that not only encoded plasmid partition genes, but a clustered regularly interspaced short palindromic repeat (CRISPR)/Cas adaptive bacterial immune system. One of the spacers was an exact match for another phage in our virome, indicating that in a novel use of the system, the lysogen was potentially capable of conferring immunity on its bacterial host against other phage. Together these results suggest that highly novel and diverse groups of viruses are present in glacial environments, some of which utilize very unusual life strategies and genes to control their replication and maintain a long-term relationship with their hosts.

  10. Retrofitting the Genome: L1 Extinction Follows Endogenous Retroviral Expansion in a Group of Muroid Rodents▿

    PubMed Central

    Erickson, Issac K.; Cantrell, Michael A.; Scott, LuAnn; Wichman, Holly A.

    2011-01-01

    Long interspersed nuclear element 1 (LINE-1; L1) retrotransposons are the most common retroelements in mammalian genomes. Unlike individual families of endogenous retroviruses (ERVs), they have remained active throughout the mammalian radiation and are responsible for most of the retroelement movement and much genome rearrangement within mammals. They can be viewed as occupying a substantial niche within mammalian genomes. Our previous demonstration that L1s and B1 short interspersed nuclear elements (SINEs) are inactive in a group of South American rodents led us to ask if other elements have amplified to fill the empty niche. We identified a novel and highly active family of ERVs (mysTR). To determine whether loss of L1 activity was correlated with expansion of mysTR, we examined mysTR activity in four South American rodent species that have lost L1 and B1 activity and four sister species with active L1s. The copy number of recent mysTR insertions was extremely high, with an average of 4,200 copies per genome. High copy numbers exist in both L1-active and L1-extinct species, so the mysTR expansion appears to have preceded the loss of both SINE and L1 activity rather than to have filled an empty niche created by their loss. It may be coincidental that two unusual genomic events—loss of L1 activity and massive expansion of an ERV family—occur in the same group of mammals. Alternatively, it is possible that this large ERV expansion set the stage for L1 extinction. PMID:21957310

  11. Whole-Genome Comparison Uncovers Genomic Mutations between Group B Streptococci Sampled from Infected Newborns and Their Mothers

    PubMed Central

    Almeida, Alexandre; Villain, Adrien; Joubrel, Caroline; Touak, Gérald; Sauvage, Elisabeth; Rosinski-Chupin, Isabelle

    2015-01-01

    ABSTRACT Streptococcus agalactiae (group B Streptococcus or GBS), a commensal of the human gut and genitourinary tract, is a leading cause of neonatal infections, in which vertical transmission from mother to child remains the most frequent route of contamination. Here, we investigated whether the progression of GBS from carriage to disease is associated with genomic adaptation. Whole-genome comparison of 47 GBS samples from 19 mother-child pairs uncovered 21 single nucleotide polymorphisms (SNPs) and seven insertions/deletions. Of the SNPs detected, 16 appear to have been fixed in the population sampled whereas five mutations were found to be polymorphic. In the infant strains, 14 mutations were detected, including two independently fixed variants affecting the covRS locus, which is known to encode a major regulatory system of virulence. A one-nucleotide insertion was also identified in the promoter region of the highly immunogenic surface protein Rib gene. Gene expression analysis after incubation in human blood showed that these mutations influenced the expression of virulence-associated genes. Additional identification of three mutated strains in the mothers' milk raised the possibility of the newborns also being a source of contamination for their mothers. Overall, our work showed that GBS strains in carriage and disease scenarios might undergo adaptive changes following colonization. The types and locations of the mutations found, together with the experimental results showing their phenotypic impact, suggest that those in a context of infection were positively selected during the transition of GBS from commensal to pathogen, contributing to an increased capacity to cause disease. IMPORTANCE Group B Streptococcus (GBS) is a major pathogen responsible for neonatal infections. Considering that its colonization of healthy adults is mostly asymptomatic, the mechanisms behind its switch from a commensal to an invasive state are largely unknown. In this work, we

  12. Extending the cereus group genomics to putative food-bornepathogens of different toxicity

    SciTech Connect

    Lapidus, Alla; Goltsman, Eugene; Auger, Sandrine; Galleron,Nathalie; Segurens, Beatrice; Dossat, Carole; Land, Miriam L.; Broussole,Veronique; Brillard, Julien; Guinebretiere, Marie-Helene; Sanchis,Vincent; Nguen-the, Christophe; Lereclus, Didier; Richardson, Paul; Winker, Patrick; Weissenbach, Jean; Ehrlich, S.Dusko; Sorokin, Alexei

    2006-08-24

    The cereus group represents sporulating soil bacteriacontaining pathogenic strains which may cause diarrheic or emetic foodpoisoning outbreaks. Multiple locus sequence typing revealed a presencein natural samples of these bacteria of about thirty clonal complexes.Application of genomic methods to this group was however biased due tothe major interest for representatives closely related to B. anthracis.Albeit the most important food-borne pathogens were not yet defined,existing dataindicate that they are scattered all over the phylogenetictree. The preliminary analysis of the sequences of three genomesdiscussed in this paper narrows down the gaps in our knowledge of thecereus group. The strain NVH391-98 is a rare but particularly severefood-borne pathogen. Sequencing revealed that the strain must be arepresentative of a novel bacterial species, for which the name Bacilluscytotoxis is proposed. This strain has a reduced genome size compared toother cereus group strains. Genome analysis revealed absence of sigma Bfactor and the presence of genes encoding diarrheic Nhe toxin, notdetected earlier. The strain B. cereus F837/76 represents a clonalcomplex close to that of B. anthracis. Including F837/76, three such B.cereus strains had been sequenced. Alignment of genomes suggests that B.anthracis is their common ancestor. Since such strains often emerge fromclinical cases, they merit a special attention. The third strain, KBAB4,is a typical psychrotrophe characteristic to unbiased soil communities.Phylogenic studies show that in nature it is the most active group interms of gene exchange. Genomic sequence revealed high presence ofextra-chromosomal genetic material (about 530 kb) that may account forthis phenomenon. Genes coding Nhe-like toxin were found on a big plasmidin this strain. This may indicate a potential mechanism of toxicityspread from the psychrotrophic strain community. The results of thisgenomic work and ecological compartments of different strains incite

  13. Complementary genetic and genomic approaches help characterize the linkage group I seed protein QTL in soybean

    PubMed Central

    2010-01-01

    Background The nutritional and economic value of many crops is effectively a function of seed protein and oil content. Insight into the genetic and molecular control mechanisms involved in the deposition of these constituents in the developing seed is needed to guide crop improvement. A quantitative trait locus (QTL) on Linkage Group I (LG I) of soybean (Glycine max (L.) Merrill) has a striking effect on seed protein content. Results A soybean near-isogenic line (NIL) pair contrasting in seed protein and differing in an introgressed genomic segment containing the LG I protein QTL was used as a resource to demarcate the QTL region and to study variation in transcript abundance in developing seed. The LG I QTL region was delineated to less than 8.4 Mbp of genomic sequence on chromosome 20. Using Affymetrix® Soy GeneChip and high-throughput Illumina® whole transcriptome sequencing platforms, 13 genes displaying significant seed transcript accumulation differences between NILs were identified that mapped to the 8.4 Mbp LG I protein QTL region. Conclusions This study identifies gene candidates at the LG I protein QTL for potential involvement in the regulation of protein content in the soybean seed. The results demonstrate the power of complementary approaches to characterize contrasting NILs and provide genome-wide transcriptome insight towards understanding seed biology and the soybean genome. PMID:20199683

  14. Draft Genome Comparison of Representatives of the Three Dominant Genotype Groups of Dairy Bacillus licheniformis Strains

    PubMed Central

    Dhakal, Rajat; Seale, R. Brent; Deeth, Hilton C.; Craven, Heather

    2014-01-01

    The spore-forming bacterium Bacillus licheniformis is a common contaminant of milk and milk products. Strains of this species isolated from dairy products can be differentiated into three major groups, namely, G, F1, and F2, using random amplification of polymorphic DNA (RAPD) analysis; however, little is known about the genomic differences between these groups and the identity of the fragments that make up their RAPD profiles. In this work we obtained high-quality draft genomes of representative strains from each of the three RAPD groups (designated strain G-1, strain F1-1, and strain F2-1) and compared them to each other and to B. licheniformis ATCC 14580 and Bacillus subtilis 168. Whole-genome comparison and multilocus sequence typing revealed that strain G-1 contains significant sequence variability and belongs to a lineage distinct from the group F strains. Strain G-1 was found to contain genes coding for a type I restriction modification system, urease production, and bacitracin synthesis, as well as the 8-kbp plasmid pFL7, and these genes were not present in strains F1-1 and F2-1. In agreement with this, all isolates of group G, but no group F isolates, were found to possess urease activity and antimicrobial activity against Micrococcus. Identification of RAPD band sequences revealed that differences in the RAPD profiles were due to differences in gene lengths, 3′ ends of predicted primer binding sites, or gene presence or absence. This work provides a greater understanding of the phylogenetic and phenotypic differences observed within the B. licheniformis species. PMID:24657871

  15. Draft genome comparison of representatives of the three dominant genotype groups of dairy Bacillus licheniformis strains.

    PubMed

    Dhakal, Rajat; Seale, R Brent; Deeth, Hilton C; Craven, Heather; Turner, Mark S

    2014-06-01

    The spore-forming bacterium Bacillus licheniformis is a common contaminant of milk and milk products. Strains of this species isolated from dairy products can be differentiated into three major groups, namely, G, F1, and F2, using random amplification of polymorphic DNA (RAPD) analysis; however, little is known about the genomic differences between these groups and the identity of the fragments that make up their RAPD profiles. In this work we obtained high-quality draft genomes of representative strains from each of the three RAPD groups (designated strain G-1, strain F1-1, and strain F2-1) and compared them to each other and to B. licheniformis ATCC 14580 and Bacillus subtilis 168. Whole-genome comparison and multilocus sequence typing revealed that strain G-1 contains significant sequence variability and belongs to a lineage distinct from the group F strains. Strain G-1 was found to contain genes coding for a type I restriction modification system, urease production, and bacitracin synthesis, as well as the 8-kbp plasmid pFL7, and these genes were not present in strains F1-1 and F2-1. In agreement with this, all isolates of group G, but no group F isolates, were found to possess urease activity and antimicrobial activity against Micrococcus. Identification of RAPD band sequences revealed that differences in the RAPD profiles were due to differences in gene lengths, 3' ends of predicted primer binding sites, or gene presence or absence. This work provides a greater understanding of the phylogenetic and phenotypic differences observed within the B. licheniformis species.

  16. 5′-Transducing SVA retrotransposon groups spread efficiently throughout the human genome

    PubMed Central

    Damert, Annette; Raiz, Julija; Horn, Axel V.; Löwer, Johannes; Wang, Hui; Xing, Jinchuan; Batzer, Mark A.; Löwer, Roswitha; Schumann, Gerald G.

    2009-01-01

    SVA elements represent the youngest family of hominid non-LTR retrotransposons, which alter the human genome continuously. They stand out due to their organization as composite repetitive elements. To draw conclusions on the assembly process that led to the current organization of SVA elements and on their transcriptional regulation, we initiated our study by assessing differences in structures of the 116 SVA elements located on human chromosome 19. We classified SVA elements into seven structural variants, including novel variants like 3′-truncated elements and elements with 5′-flanking sequence transductions. We established a genome-wide inventory of 5′-transduced SVA elements encompassing ∼8% of all human SVA elements. The diversity of 5′ transduction events found indicates transcriptional control of their SVA source elements by a multitude of external cellular promoters in germ cells in the course of their evolution and suggests that SVA elements might be capable of acquiring 5′ promoter sequences. Our data indicate that SVA-mediated 5′ transduction events involve alternative RNA splicing at cryptic splice sites. We analyzed one remarkably successful human-specific SVA 5′ transduction group in detail because it includes at least 32% of all SVA subfamily F members. An ancient retrotransposition event brought an SVA insertion under transcriptional control of the MAST2 gene promoter, giving rise to the primal source element of this group. Members of this group are currently transcribed. Here we show that SVA-mediated 5′ transduction events lead to structural diversity of SVA elements and represent a novel source of genomic rearrangements contributing to genomic diversity. PMID:19652014

  17. Group-theoretic models of the inversion process in bacterial genomes.

    PubMed

    Egri-Nagy, Attila; Gebhardt, Volker; Tanaka, Mark M; Francis, Andrew R

    2014-07-01

    The variation in genome arrangements among bacterial taxa is largely due to the process of inversion. Recent studies indicate that not all inversions are equally probable, suggesting, for instance, that shorter inversions are more frequent than longer, and those that move the terminus of replication are less probable than those that do not. Current methods for establishing the inversion distance between two bacterial genomes are unable to incorporate such information. In this paper we suggest a group-theoretic framework that in principle can take these constraints into account. In particular, we show that by lifting the problem from circular permutations to the affine symmetric group, the inversion distance can be found in polynomial time for a model in which inversions are restricted to acting on two regions. This requires the proof of new results in group theory, and suggests a vein of new combinatorial problems concerning permutation groups on which group theorists will be needed to collaborate with biologists. We apply the new method to inferring distances and phylogenies for published Yersinia pestis data.

  18. Recombinant transfer in the basic genome of E. coli

    DOE PAGES

    Dixit, Purushottam; Studier, F. William; Pang, Tin Yau; ...

    2015-07-07

    An approximation to the ~4-Mbp basic genome shared by 32 strains of E. coli representing six evolutionary groups has been derived and analyzed computationally. A multiple-alignment of the 32 complete genome sequences was filtered to remove mobile elements and identify the most reliable ~90% of the aligned length of each of the resulting 496 basic-genome pairs. Patterns of single bp mutations (SNPs) in aligned pairs distinguish clonally inherited regions from regions where either genome has acquired DNA fragments from diverged genomes by homologous recombination since their last common ancestor. Such recombinant transfer is pervasive across the basic genome, mostly betweenmore » genomes in the same evolutionary group, and generates many unique mosaic patterns. The six least-diverged genome-pairs have one or two recombinant transfers of length ~40–115 kbp (and few if any other transfers), each containing one or more gene clusters known to confer strong selective advantage in some environments. Moderately diverged genome pairs (0.4–1% SNPs) show mosaic patterns of interspersed clonal and recombinant regions of varying lengths throughout the basic genome, whereas more highly diverged pairs within an evolutionary group or pairs between evolutionary groups having >1.3% SNPs have few clonal matches longer than a few kbp. Many recombinant transfers appear to incorporate fragments of the entering DNA produced by restriction systems of the recipient cell. A simple computational model can closely fit the data. As a result, most recombinant transfers seem likely to be due to generalized transduction by co-evolving populations of phages, which could efficiently distribute variability throughout bacterial genomes.« less

  19. Genomic data do not support comb jellies as the sister group to all other animals.

    PubMed

    Pisani, Davide; Pett, Walker; Dohrmann, Martin; Feuda, Roberto; Rota-Stabelli, Omar; Philippe, Hervé; Lartillot, Nicolas; Wörheide, Gert

    2015-12-15

    Understanding how complex traits, such as epithelia, nervous systems, muscles, or guts, originated depends on a well-supported hypothesis about the phylogenetic relationships among major animal lineages. Traditionally, sponges (Porifera) have been interpreted as the sister group to the remaining animals, a hypothesis consistent with the conventional view that the last common animal ancestor was relatively simple and more complex body plans arose later in evolution. However, this premise has recently been challenged by analyses of the genomes of comb jellies (Ctenophora), which, instead, found ctenophores as the sister group to the remaining animals (the "Ctenophora-sister" hypothesis). Because ctenophores are morphologically complex predators with true epithelia, nervous systems, muscles, and guts, this scenario implies these traits were either present in the last common ancestor of all animals and were lost secondarily in sponges and placozoans (Trichoplax) or, alternatively, evolved convergently in comb jellies. Here, we analyze representative datasets from recent studies supporting Ctenophora-sister, including genome-scale alignments of concatenated protein sequences, as well as a genomic gene content dataset. We found no support for Ctenophora-sister and conclude it is an artifact resulting from inadequate methodology, especially the use of simplistic evolutionary models and inappropriate choice of species to root the metazoan tree. Our results reinforce a traditional scenario for the evolution of complexity in animals, and indicate that inferences about the evolution of Metazoa based on the Ctenophora-sister hypothesis are not supported by the currently available data.

  20. Genomic data do not support comb jellies as the sister group to all other animals

    PubMed Central

    Pisani, Davide; Pett, Walker; Dohrmann, Martin; Feuda, Roberto; Rota-Stabelli, Omar; Philippe, Hervé; Lartillot, Nicolas; Wörheide, Gert

    2015-01-01

    Understanding how complex traits, such as epithelia, nervous systems, muscles, or guts, originated depends on a well-supported hypothesis about the phylogenetic relationships among major animal lineages. Traditionally, sponges (Porifera) have been interpreted as the sister group to the remaining animals, a hypothesis consistent with the conventional view that the last common animal ancestor was relatively simple and more complex body plans arose later in evolution. However, this premise has recently been challenged by analyses of the genomes of comb jellies (Ctenophora), which, instead, found ctenophores as the sister group to the remaining animals (the “Ctenophora-sister” hypothesis). Because ctenophores are morphologically complex predators with true epithelia, nervous systems, muscles, and guts, this scenario implies these traits were either present in the last common ancestor of all animals and were lost secondarily in sponges and placozoans (Trichoplax) or, alternatively, evolved convergently in comb jellies. Here, we analyze representative datasets from recent studies supporting Ctenophora-sister, including genome-scale alignments of concatenated protein sequences, as well as a genomic gene content dataset. We found no support for Ctenophora-sister and conclude it is an artifact resulting from inadequate methodology, especially the use of simplistic evolutionary models and inappropriate choice of species to root the metazoan tree. Our results reinforce a traditional scenario for the evolution of complexity in animals, and indicate that inferences about the evolution of Metazoa based on the Ctenophora-sister hypothesis are not supported by the currently available data. PMID:26621703

  1. A survey of oenophages during wine making reveals a novel group with unusual genomic characteristics.

    PubMed

    Philippe, Cécile; Jaomanjaka, Fety; Claisse, Olivier; Laforgue, Rémi; Maupeu, Julie; Petrel, Melina; Le Marrec, Claire

    2017-09-18

    Oenophages have so far been mostly isolated from red wines under malolactic fermentation (MLF), and correspond to temperate or ex-temperate phages of Oenococcus oeni. Their genomes are clustered into 4 integrase gene sequence groups, which are also related to the chromosomal integration site. Our aims were to survey the occurrence of oenophages in a broader and more diverse collection of samples than those previously explored. Active phages were isolated from 33 out of 166 samples, which mostly originated from must and MLF. Seventy one phage lysates were produced and 30% were assigned to a novel group with unusual genomic characteristics, called unk. All unk members produced similar RAPD and DNA restriction patterns, were negative by PCR for the signature sequences previously identified in the integrase and endolysin genes of oenophages, and lacked any BamHI restriction site in their genome. The data support that development of additional and novel signature genes for assessing oenophage diversity is now required. Copyright © 2017 Elsevier B.V. All rights reserved.

  2. Comparative Genomic Analysis of the Streptococcus dysgalactiae Species Group: Gene Content, Molecular Adaptation, and Promoter Evolution

    PubMed Central

    Suzuki, Haruo; Lefébure, Tristan; Hubisz, Melissa Jane; Pavinski Bitar, Paulina; Lang, Ping; Siepel, Adam; Stanhope, Michael J.

    2011-01-01

    Comparative genomics of closely related bacterial species with different pathogenesis and host preference can provide a means of identifying the specifics of adaptive differences. Streptococcus dysgalactiae (SD) is comprised of two subspecies: S. dysgalactiae subsp. equisimilis is both a human commensal organism and a human pathogen, and S. dysgalactiae subsp. dysgalactiae is strictly an animal pathogen. Here, we present complete genome sequences for both taxa, with analyses involving other species of Streptococcus but focusing on adaptation in the SD species group. We found little evidence for enrichment in biochemical categories of genes carried by each SD strain, however, differences in the virulence gene repertoire were apparent. Some of the differences could be ascribed to prophage and integrative conjugative elements. We identified approximately 9% of the nonrecombinant core genome to be under positive selection, some of which involved known virulence factors in other bacteria. Analyses of proteomes by pooling data across genes, by biochemical category, clade, or branch, provided evidence for increased rates of evolution in several gene categories, as well as external branches of the tree. Promoters were primarily evolving under purifying selection but with certain categories of genes evolving faster. Many of these fast-evolving categories were the same as those associated with rapid evolution in proteins. Overall, these results suggest that adaptation to changing environments and new hosts in the SD species group has involved the acquisition of key virulence genes along with selection of orthologous protein-coding loci and operon promoters. PMID:21282711

  3. Single-cell genomics reveals co-metabolic interactions within uncultivated Marine Group A bacteria

    NASA Astrophysics Data System (ADS)

    Hawley, A. K.; Hallam, S. J.

    2016-02-01

    Marine Group A (MGA) bacteria represent a ubiquitous and abundant candidate phylum enriched in oxygen minimum zones (OMZs) and the deep ocean. Despite MGA prevalence little is known about their ecology and biogeochemistry. Here we chart the metabolic potential of 26 MGA single-cell amplified genomes sourced from different environments spanning ecothermodynamic gradients including open ocean waters, OMZs and methanogenic environments including a terephthalate-degrading bioreactor. Metagenomic contig recruitment to SAGs combined with tetra-nucleotide frequency distribution patterns resolved nine MGA population genome bins. All population genomes exhibited genomic streamlining with open ocean MGA being the most reduced. Different strategies for carbohydrate utilization, carbon fixation energy metabolism and respiratory pathways were identified between population genome bins, including various roles in the nitrogen and sulfur cycles. MGA inhabiting OMZ oxyclines encoded genes for partial denitrification with potential to feed into anammox and nitrification as well as a polysulfide reductase with a potential role in the cryptic sulfur cycle. MGA inhabiting anoxic waters, encoded NiFe hydrogenase and nitrous oxide reductase with the potential to complete partial denitrification pathways previously linked to sulfur oxidation in SUP05 bacteria. MGA from methanogenic environments encoded genes mediating cascading syntrophic interactions with fatty acid degraders and methanogens including reverse electron transport potential. The MGA phylum appears to have evolved alternative metabolic innovations adapting specific subgroups to occupy specific niches along ecothermodynamic gradients. Additionally, expression of MGA genes from different OMZ environments supports that these subgroups manifest an increasing propensity for co-metabolic interactions under energy limiting conditions that mandates a cooperative mode of existence with important implications for C, N and S cycling in

  4. Developing improved durum wheat germplasm by altering the cytoplasmic genome

    USDA-ARS?s Scientific Manuscript database

    In eukaryotic organisms, nuclear and cytoplasmic genomes interact to drive cellular functions. These genomes have co-evolved to form specific nuclear-cytoplasmic interactions that are essential to the origin, success, and evolution of diploid and polyploid species. Hundreds of genetic diseases in h...

  5. The co-evolved Helicobacter pylori and gastric cancer: trinity of bacterial virulence, host susceptibility and lifestyle

    PubMed Central

    Akhter, Yusuf; Ahmed, Irshad; Devi, S Manjulata; Ahmed, Niyaz

    2007-01-01

    Helicobacter pylori is an important yet unproven etiological agent of gastric cancer. H. pylori infection is more prevalent in developing Asian countries like India and it is usually acquired at an early age. It has been two decades since Marshall and Warren (1984) first described curved bacilli in the stomach of ulcer and gastritis patients. This discovery has won them the Nobel Prize recently, but the debate whether H. pylori is a pathogen or a commensal organism is still hot. Associations with disease-specific factors remain illusive years after the genome sequences were made available. Cytotoxin-associated antigen A (CagA) and the so-called plasticity region cluster genes are implicated in pathogenesis of the carcinoma of stomach. Another virulence factor VacA whose role is still debatable, has recently been projected in pathology of gastric cancer. Studies of the evolution through genetic variation in H. pylori populations have provided a window into the history of human population migrations and a possible co-evolution of this pathogen with its human host. Possible symbiotic relationships were seriously debated since the discovery of this pathogen. The debate has been further intensified as some studies proposed H. pylori infection to be beneficial in some humans. In this commentary, we attempt to briefly discuss about H. pylori as a human pathogen, and some of the important issues linked to its pathophysiology in different hosts. 'We dance around in a ring and suppose, the secret sits in the middle and knows' – Robert Frost PMID:17201930

  6. Genomic analysis reveals hidden biodiversity within colugos, the sister group to primates

    PubMed Central

    Mason, Victor C.; Li, Gang; Minx, Patrick; Schmitz, Jürgen; Churakov, Gennady; Doronina, Liliya; Melin, Amanda D.; Dominy, Nathaniel J.; Lim, Norman T-L.; Springer, Mark S.; Wilson, Richard K.; Warren, Wesley C.; Helgen, Kristofer M.; Murphy, William J.

    2016-01-01

    Colugos are among the most poorly studied mammals despite their centrality to resolving supraordinal primate relationships. Two described species of these gliding mammals are the sole living members of the order Dermoptera, distributed throughout Southeast Asia. We generated a draft genome sequence for a Sunda colugo and a Philippine colugo reference alignment, and used these to identify colugo-specific genetic changes that were enriched in sensory and musculoskeletal-related genes that likely underlie their nocturnal and gliding adaptations. Phylogenomic analysis and catalogs of rare genomic changes overwhelmingly support the contested hypothesis that colugos are the sister group to primates (Primatomorpha), to the exclusion of treeshrews. We captured ~140 kb of orthologous sequence data from colugo museum specimens sampled across their range and identified large genetic differences between many geographically isolated populations that may result in a >300% increase in the number of recognized colugo species. Our results identify conservation units to mitigate future losses of this enigmatic mammalian order. PMID:27532052

  7. TYPE-I X-RAY BURSTS REVEAL A FAST CO-EVOLVING BEHAVIOR OF THE CORONA IN AN X-RAY BINARY

    SciTech Connect

    Chen, Yu-Peng; Zhang, Shu; Zhang, Shuang-Nan; Li, Jian; Wang, Jian-Min E-mail: szhang@ihep.ac.cn

    2012-06-20

    The coronae in X-ray binaries (XRBs) still remain poorly understood, although they have been believed for a long time to play a key role in modeling the characteristic outbursts of XRBs. Type-I X-ray bursts, the thermonuclear flashes happening on the surface of a neutron star (NS), can be used as a probe to the innermost region of an NS XRB, where the corona is believed to be located very close to the NS. We report the discovery of a tiny life cycle of the corona that is promptly co-evolved with the type-I bursts superimposed on the outburst of the NS XRB IGR J17473-2721. This finding may serve as the first evidence of directly seeing the rapid disappearance and formation of a corona in an XRB with a cooling/heating timescale of less than a second, which can strongly constrain the accretion models in XRBs at work.

  8. Inactivation of group II intron RmInt1 in the Sinorhizobium meliloti genome.

    PubMed

    Molina-Sánchez, María Dolores; Toro, Nicolás

    2015-07-09

    Group II introns are self-splicing catalytic RNAs that probably originated in bacteria and act as mobile retroelements. The dispersal and dynamics of group II intron spread within a bacterial genome are thought to follow a selection-driven extinction model. Likewise, various studies on the evolution of group II introns have suggested that they are evolving toward an inactive form by fragmentation, with the loss of the intron 3'-terminus, but with some intron fragments remaining and continuing to evolve in the genome. RmInt1 is a mobile group II intron that is widespread in natural populations of Sinorhizobium meliloti, but some strains of this species have no RmInt1 introns. We studied the splicing ability and mobility of the three full-length RmInt1 copies harbored by S. meliloti 1021, and obtained evidence suggesting that specific mutations may lead to the impairment of intron splicing and retrohoming. Our data suggest that the RmInt1 copies in this strain are undergoing a process of inactivation.

  9. New Insights into the Genetic Diversity of Clostridium botulinum Group III through Extensive Genome Exploration

    PubMed Central

    Woudstra, Cédric; Le Maréchal, Caroline; Souillard, Rozenn; Bayon-Auboyer, Marie-Hélène; Mermoud, Isabelle; Desoutter, Denise; Fach, Patrick

    2016-01-01

    Animal botulism is caused by group III Clostridium botulinum strains producing type C and D toxins, or their chimeric forms C/D and D/C. Animal botulism is considered an emerging disease in Europe, notably in poultry production. Before our study, 14 genomes from different countries were available in the public database, but none were from France. In order to investigate the genetic relationship of French strains with different geographical areas and find new potential typing targets, 17 strains of C. botulinum group III were sequenced (16 from France and one from New Caledonia). Fourteen were type C/D strains isolated from chickens, ducks, guinea fowl and turkeys and three were type D/C strains isolated from cattle. The New Caledonian strain was a type D/C strain. Whole genome sequence analysis showed the French strains to be closely related to European strains from C. botulinum group III lineages Ia and Ib. The investigation of CRISPR sequences as genetic targets for differentiating strains in group III proved to be irrelevant for type C/D due to a deficient CRISPR/Cas mechanism, but not for type D/C. Conversely, the extrachromosomal elements of type C/D strains could be used to generate a genetic ID card. The highest level of discrimination was achieved with SNP core phylogeny, which allowed differentiation up to strain level and provide the most relevant information for genetic epidemiology studies and discrimination. PMID:27242769

  10. The chromosomal distributions of Ty1-copia group retrotransposable elements in higher plants and their implications for genome evolution

    Treesearch

    J.S. (Pat) Heslop-Harrison; Andrea Brandes; Shin Taketa; Thomas Schmidt; Alexander V. Vershinin; Elena G. Alkhimova; Anette Kamm; Robert L. Doudrick; . [and others

    1997-01-01

    Retrotransposons make up a major fraction - sometimes more than 40% - of all plant genomes investigated so far. We have isolated the reverse transcriptase domains of theTyl-copia group elements from several species, ranging in genome size from some 100 Mbp to 23,000 Mbp, and determined the distribution patterns of these retrotransposons on metaphase chromosomes and...

  11. Assigning unknown parent groups to reduce bias in genomic evaluations of final score in US Holsteins.

    PubMed

    Tsuruta, S; Misztal, I; Lourenco, D A L; Lawlor, T J

    2014-09-01

    Assigning unknown parent groups (UPG) in mixed-model equations using single-step genomic BLUP was investigated to reduce bias and to increase accuracy in genomic estimated breeding values (GEBV). The original UPG were defined based on the animal's birth year and the sex of the animal's unknown parents. Combining the last 2 UPG for the animals' birth years and separating the UPG for US and non-US Holsteins were considered in the redefinition. A full data set in the 2011 national genetic evaluation of final score in US Holsteins was used to calculate estimated breeding values (EBV) for validation, and a subset of the 2011 data, which excluded phenotypes recorded after 2007, was used to calculate GEBV for all animals, including 34,500 genotyped bulls. The EBV and GEBV in 2007 were compared with EBV in the 2011 full data. The last group effects for unknown sires and dams were overestimated with the GEBV model using the reduced 2007 data. The genetic trends from EBV in 2011 and GEBV in 2007 with the original UPG in the last few years demonstrated inflation, whereas GEBV with the redefined UPG by combining the last 2 groups showed deflation. On the other hand, the redefined UPG by separating for US and non-US Holsteins reduced the bias in GEBV. Regression coefficients smaller than unity for GEBV for young genotyped bulls with no daughters in 2007 on progeny deviations in 2011 also indicated inflation. The redefining of UPG reduced bias and slightly increased accuracy in GEBV for both US and non-US genotyped bulls. Rank correlations between GEBV in 2007 and in 2011 with the redefined UPG were higher than those with no UPG and the original UPG, especially for non-US bulls. Redefining of UPG in genomic evaluation could improve reliability of GEBV and provide correct genetic trends.

  12. Phylogeny of a genomically diverse group of elymus (poaceae) allopolyploids reveals multiple levels of reticulation.

    PubMed

    Mason-Gamer, Roberta J

    2013-01-01

    The grass tribe Triticeae (=Hordeeae) comprises only about 300 species, but it is well known for the economically important crop plants wheat, barley, and rye. The group is also recognized as a fascinating example of evolutionary complexity, with a history shaped by numerous events of auto- and allopolyploidy and apparent introgression involving diploids and polyploids. The genus Elymus comprises a heterogeneous collection of allopolyploid genome combinations, all of which include at least one set of homoeologs, designated St, derived from Pseudoroegneria. The current analysis includes a geographically and genomically diverse collection of 21 tetraploid Elymus species, and a single hexaploid species. Diploid and polyploid relationships were estimated using four molecular data sets, including one that combines two regions of the chloroplast genome, and three from unlinked nuclear genes: phosphoenolpyruvate carboxylase, β-amylase, and granule-bound starch synthase I. Four gene trees were generated using maximum likelihood, and the phylogenetic placement of the polyploid sequences reveals extensive reticulation beyond allopolyploidy alone. The trees were interpreted with reference to numerous phenomena known to complicate allopolyploid phylogenies, and introgression was identified as a major factor in their history. The work illustrates the interpretation of complicated phylogenetic results through the sequential consideration of numerous possible explanations, and the results highlight the value of careful inspection of multiple independent molecular phylogenetic estimates, with particular focus on the differences among them.

  13. Identification of Copy Number Variants Defining Genomic Differences among Major Human Groups

    PubMed Central

    Armengol, Lluís; Villatoro, Sergi; González, Juan R.; Pantano, Lorena; García-Aragonés, Manel; Rabionet, Raquel; Cáceres, Mario; Estivill, Xavier

    2009-01-01

    Background Understanding the genetic contribution to phenotype variation of human groups is necessary to elucidate differences in disease predisposition and response to pharmaceutical treatments in different human populations. Methodology/Principal Findings We have investigated the genome-wide profile of structural variation on pooled samples from the three populations studied in the HapMap project by comparative genome hybridization (CGH) in different array platforms. We have identified and experimentally validated 33 genomic loci that show significant copy number differences from one population to the other. Interestingly, we found an enrichment of genes related to environment adaptation (immune response, lipid metabolism and extracellular space) within these regions and the study of expression data revealed that more than half of the copy number variants (CNVs) translate into gene-expression differences among populations, suggesting that they could have functional consequences. In addition, the identification of single nucleotide polymorphisms (SNPs) that are in linkage disequilibrium with the copy number alleles allowed us to detect evidences of population differentiation and recent selection at the nucleotide variation level. Conclusions Overall, our results provide a comprehensive view of relevant copy number changes that might play a role in phenotypic differences among major human populations, and generate a list of interesting candidates for future studies. PMID:19789632

  14. Phylogeny of a Genomically Diverse Group of Elymus (Poaceae) Allopolyploids Reveals Multiple Levels of Reticulation

    PubMed Central

    Mason-Gamer, Roberta J.

    2013-01-01

    The grass tribe Triticeae (=Hordeeae) comprises only about 300 species, but it is well known for the economically important crop plants wheat, barley, and rye. The group is also recognized as a fascinating example of evolutionary complexity, with a history shaped by numerous events of auto- and allopolyploidy and apparent introgression involving diploids and polyploids. The genus Elymus comprises a heterogeneous collection of allopolyploid genome combinations, all of which include at least one set of homoeologs, designated St, derived from Pseudoroegneria. The current analysis includes a geographically and genomically diverse collection of 21 tetraploid Elymus species, and a single hexaploid species. Diploid and polyploid relationships were estimated using four molecular data sets, including one that combines two regions of the chloroplast genome, and three from unlinked nuclear genes: phosphoenolpyruvate carboxylase, β-amylase, and granule-bound starch synthase I. Four gene trees were generated using maximum likelihood, and the phylogenetic placement of the polyploid sequences reveals extensive reticulation beyond allopolyploidy alone. The trees were interpreted with reference to numerous phenomena known to complicate allopolyploid phylogenies, and introgression was identified as a major factor in their history. The work illustrates the interpretation of complicated phylogenetic results through the sequential consideration of numerous possible explanations, and the results highlight the value of careful inspection of multiple independent molecular phylogenetic estimates, with particular focus on the differences among them. PMID:24302986

  15. Genomic Characterization of Group C Orthobunyavirus Reference Strains and Recent South American Clinical Isolates

    PubMed Central

    Yang, Yu; Solórzano, Víctor Fiestas; Kuschner, Robert A.; Halsey, Eric S.; Jarman, Richard G.; Kochel, Tadeusz J.

    2014-01-01

    Group C orthobunyaviruses (family Bunyaviridae, genus Orthobunyavirus), discovered in the 1950s, are vector-borne human pathogens in the Americas. Currently there is a gap in genomic information for group C viruses. In this study, we obtained complete coding region sequences of reference strains of Caraparu (CARV), Oriboca (ORIV), Marituba (MTBV) and Madrid (MADV) viruses, and five clinical isolates from Peru and Bolivia, using an unbiased de novo approach consisting of random reverse transcription, random anchored PCR amplification, and high throughput pyrosequencing. The small, medium, and large segments encode for a 235 amino acid nucleocapsid protein, an approximately 1430 amino acid surface glycoprotein polyprotein precursor, and a 2248 amino acid RNA-dependent RNA polymerase, respectively. Additionally, the S segment encodes for an 83 amino acid non-structural protein, although this protein is truncated or silenced in some isolates. Phylogenetically, three clinical isolates clustered with CARV, one clustered with MTBV, and one isolate appeared to be a reassortant or a genetic drift resulted from the high variability of the medium segment which was also seen in a few other orthobunyaviruses. These data represent the first complete coding region sequences for this serocomplex of pathogenic orthobunyaviruses. The genome-wide phylogeny of reference strains is consistent with the antigenic properties of the viruses reported in the original serological studies conducted in the 1960s. Comparative analysis of conserved protein regions across group C virus strains and the other orthobunyavirus groups revealed that these group C viruses contain characteristic domains of potential structural and functional significance. Our results provide the basis for the developments of diagnostics, further genetic analyses, and future epidemiologic studies of group C viruses. PMID:24633174

  16. Genomic identification of Rickettsia slovaca among spotted fever group rickettsia isolates from Dermacentor marginatus in Armenia.

    PubMed

    Balayeva, N M; Eremeeva, M E; Raoult, D

    1994-12-01

    Restriction fragment length polymorphism (RFLP) analysis of polymerase chain reaction (PCR) amplified genes was used for genomic identification of Armenian isolates of the Spotted fever group (SFG) rickettsiae with unclear taxonomic position. Analysis was performed by using one genus-specific primer pair derived from R. prowazekii citrate synthase gene and two species-specific primer pairs derived from R. rickettsii genes for 190 K and 120 K antigens following AluI, PstI and RsaI digestion of amplicons. All tested rickettsial SFG Armenian isolates from Dermacentor marginatus were identified as R. slovaca. The geographic distribution and genetic homogeneity of R. slovaca strains are discussed.

  17. Draft Genome Sequences of 18 Psychrotolerant and 2 Thermotolerant Strains Representative of Particular Ecotypes in the Bacillus cereus Group

    PubMed Central

    Loux, Valentin; Martin, Véronique; Nicolas, Pierre; Sanchis, Vincent; Broussolle, Véronique

    2017-01-01

    ABSTRACT Bacteria from the Bacillus cereus group exhibit genetic and physiological diversity through different ecotypes. Here, we present the draft genome sequences of 20 bacterial strains belonging to the contrasted psychrotolerant and thermotolerant ecotypes. PMID:28153905

  18. Draft Genome Sequences of 18 Psychrotolerant and 2 Thermotolerant Strains Representative of Particular Ecotypes in the Bacillus cereus Group.

    PubMed

    Guinebretière, Marie-Hélène; Loux, Valentin; Martin, Véronique; Nicolas, Pierre; Sanchis, Vincent; Broussolle, Véronique

    2017-02-02

    Bacteria from the Bacillus cereus group exhibit genetic and physiological diversity through different ecotypes. Here, we present the draft genome sequences of 20 bacterial strains belonging to the contrasted psychrotolerant and thermotolerant ecotypes.

  19. Homing endonucleases from mobile group I introns: discovery to genome engineering

    PubMed Central

    2014-01-01

    Homing endonucleases are highly specific DNA cleaving enzymes that are encoded within genomes of all forms of microbial life including phage and eukaryotic organelles. These proteins drive the mobility and persistence of their own reading frames. The genes that encode homing endonucleases are often embedded within self-splicing elements such as group I introns, group II introns and inteins. This combination of molecular functions is mutually advantageous: the endonuclease activity allows surrounding introns and inteins to act as invasive DNA elements, while the splicing activity allows the endonuclease gene to invade a coding sequence without disrupting its product. Crystallographic analyses of representatives from all known homing endonuclease families have illustrated both their mechanisms of action and their evolutionary relationships to a wide range of host proteins. Several homing endonucleases have been completely redesigned and used for a variety of genome engineering applications. Recent efforts to augment homing endonucleases with auxiliary DNA recognition elements and/or nucleic acid processing factors has further accelerated their use for applications that demand exceptionally high specificity and activity. PMID:24589358

  20. Proliferation of group II introns in the chloroplast genome of the green alga Oedocladium carolinianum (Chlorophyceae)

    PubMed Central

    Otis, Christian

    2016-01-01

    Background The chloroplast genome sustained extensive changes in architecture during the evolution of the Chlorophyceae, a morphologically and ecologically diverse class of green algae belonging to the Chlorophyta; however, the forces driving these changes are poorly understood. The five orders recognized in the Chlorophyceae form two major clades: the CS clade consisting of the Chlamydomonadales and Sphaeropleales, and the OCC clade consisting of the Oedogoniales, Chaetophorales, and Chaetopeltidales. In the OCC clade, considerable variations in chloroplast DNA (cpDNA) structure, size, gene order, and intron content have been observed. The large inverted repeat (IR), an ancestral feature characteristic of most green plants, is present in Oedogonium cardiacum (Oedogoniales) but is lacking in the examined members of the Chaetophorales and Chaetopeltidales. Remarkably, the Oedogonium 35.5-kb IR houses genes that were putatively acquired through horizontal DNA transfer. To better understand the dynamics of chloroplast genome evolution in the Oedogoniales, we analyzed the cpDNA of a second representative of this order, Oedocladium carolinianum. Methods The Oedocladium cpDNA was sequenced and annotated. The evolutionary distances separating Oedocladium and Oedogonium cpDNAs and two other pairs of chlorophycean cpDNAs were estimated using a 61-gene data set. Phylogenetic analysis of an alignment of group IIA introns from members of the OCC clade was performed. Secondary structures and insertion sites of oedogonialean group IIA introns were analyzed. Results The 204,438-bp Oedocladium genome is 7.9 kb larger than the Oedogonium genome, but its repertoire of conserved genes is remarkably similar and gene order differs by only one reversal. Although the 23.7-kb IR is missing the putative foreign genes found in Oedogonium, it contains sequences coding for a putative phage or bacterial DNA primase and a hypothetical protein. Intergenic sequences are 1.5-fold longer and

  1. 77 FR 75425 - Interagency Working Group on Plant Genomics (IWGPG): The National Plant Genome Initiative-What's...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-12-20

    ... genomics; Opportunities for Federal agency coordination, cooperation, public/private partnerships; Associated opportunities to enhance training, education, and public outreach. Short presentations will be... research community, including the public and private sectors as well as the international...

  2. Avian picornaviruses: molecular evolution, genome diversity and unusual genome features of a rapidly expanding group of viruses in birds.

    PubMed

    Boros, Ákos; Pankovics, Péter; Reuter, Gábor

    2014-12-01

    Picornaviridae is one of the most diverse families of viruses infecting vertebrate species. In contrast to the relative small number of mammal species compared to other vertebrates, the abundance of mammal-infecting picornaviruses was significantly overrepresented among the presently known picornaviruses. Therefore most of the current knowledge about the genome diversity/organization patterns and common genome features were based on the analysis of mammal-infecting picornaviruses. Beside the well known reservoir role of birds in case of several emerging viral pathogens, little is known about the diversity of picornaviruses circulating among birds, although in the last decade the number of known avian picornavirus species with complete genome was increased from one to at least 15. However, little is known about the geographic distribution, host spectrum or pathogenic potential of the recently described picornaviruses of birds. Despite the low number of known avian picornaviruses, the phylogenetic and genome organization diversity of these viruses were remarkable. Beside the common L-4-3-4 and 4-3-4 genome layouts unusual genome patterns (3-4-4; 3-5-4, 3-6-4; 3-8-4) with variable, multicistronic 2A genome regions were found among avian picornaviruses. The phylogenetic and genomic analysis revealed the presence of several conserved structures at the untranslated regions among phylogenetically distant avian and non-avian picornaviruses as well as at least five different avian picornavirus phylogenetic clusters located in every main picornavirus lineage with characteristic genome layouts which suggests the complex evolution history of these viruses. Based on the remarkable genetic diversity of the few known avian picornaviruses, the emergence of further divergent picornaviruses causing challenges in the current taxonomy and also in the understanding of the evolution and genome organization of picornaviruses will be strongly expected. In this review we would like to

  3. Differentiation of strains from the Bacillus cereus group by RFLP-PFGE genomic fingerprinting.

    PubMed

    Otlewska, Anna; Oltuszak-Walczak, Elzbieta; Walczak, Piotr

    2013-11-01

    Bacillus mycoides, Bacillus pseudomycoides, Bacillus weihenstephanensis, Bacillus anthracis, Bacillus thuringiensis, and Bacillus cereus belong to the B. cereus group. The last three species are characterized by different phenotype features and pathogenicity spectrum, but it has been shown that these species are genetically closely related. The macrorestriction analysis of the genomic DNA with the NotI enzyme was used to generate polymorphism of restriction profiles for 39 food-borne isolates (B. cereus, B. mycoides) and seven reference strains (B. mycoides, B. thuringiensis, B. weihenstephanensis, and B. cereus). The PFGE method was applied to differentiate the examined strains of the B. cereus group. On the basis of the unweighted pair group method with the arithmetic mean method and Dice coefficient, the strains were divided into five clusters (types A-E), and the most numerous group was group A (25 strains). A total of 21 distinct pulsotypes were observed. The RFLP-PFGE analysis was successfully used for the differentiation and characterization of B. cereus and B. mycoides strains isolated from different food products. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  4. Assembly-driven community genomics of a hypersaline microbial ecosystem.

    PubMed

    Podell, Sheila; Ugalde, Juan A; Narasingarao, Priya; Banfield, Jillian F; Heidelberg, Karla B; Allen, Eric E

    2013-01-01

    Microbial populations inhabiting a natural hypersaline lake ecosystem in Lake Tyrrell, Victoria, Australia, have been characterized using deep metagenomic sampling, iterative de novo assembly, and multidimensional phylogenetic binning. Composite genomes representing habitat-specific microbial populations were reconstructed for eleven different archaea and one bacterium, comprising between 0.6 and 14.1% of the planktonic community. Eight of the eleven archaeal genomes were from microbial species without previously cultured representatives. These new genomes provide habitat-specific reference sequences enabling detailed, lineage-specific compartmentalization of predicted functional capabilities and cellular properties associated with both dominant and less abundant community members, including organisms previously known only by their 16S rRNA sequences. Together, these data provide a comprehensive, culture-independent genomic blueprint for ecosystem-wide analysis of protein functions, population structure, and lifestyles of co-existing, co-evolving microbial groups within the same natural habitat. The "assembly-driven" community genomic approach demonstrated in this study advances our ability to push beyond single gene investigations, and promotes genome-scale reconstructions as a tangible goal in the quest to define the metabolic, ecological, and evolutionary dynamics that underpin environmental microbial diversity.

  5. Gegenees: Fragmented Alignment of Multiple Genomes for Determining Phylogenomic Distances and Genetic Signatures Unique for Specified Target Groups

    PubMed Central

    Håfström, Therese; Segerman, Bo

    2012-01-01

    The rapid development of Next Generation Sequencing technologies leads to the accumulation of huge amounts of sequencing data. The scientific community faces an enormous challenge in how to deal with this explosion. Here we present a software tool, ‘Gegenees’, that uses a fragmented alignment approach to facilitate the comparative analysis of hundreds of microbial genomes. The genomes are fragmented and compared, all against all, by a multithreaded BLAST control engine. Ready-made alignments can be complemented with new genomes without recalculating the existing data points. Gegenees gives a phylogenomic overview of the genomes and the alignment can then be mined for genomic regions with conservation patterns matching a defined target group and absent from a background group. The genomic regions are given biomarker scores forming a uniqueness signature that can be viewed and explored, graphically and in tabular form. A primer/probe alignment tool is also included for specificity verification of currently used or new primers. We exemplify the use of Gegenees on the Bacillus cereus group, on Foot and Mouth Disease Viruses, and on strains from the 2011 Escherichia coli O104:H4 outbreak. Gegenees contributes towards an increased capacity of fast and efficient data mining as more and more genomes become sequenced. PMID:22723939

  6. Gegenees: fragmented alignment of multiple genomes for determining phylogenomic distances and genetic signatures unique for specified target groups.

    PubMed

    Agren, Joakim; Sundström, Anders; Håfström, Therese; Segerman, Bo

    2012-01-01

    The rapid development of Next Generation Sequencing technologies leads to the accumulation of huge amounts of sequencing data. The scientific community faces an enormous challenge in how to deal with this explosion. Here we present a software tool, 'Gegenees', that uses a fragmented alignment approach to facilitate the comparative analysis of hundreds of microbial genomes. The genomes are fragmented and compared, all against all, by a multithreaded BLAST control engine. Ready-made alignments can be complemented with new genomes without recalculating the existing data points. Gegenees gives a phylogenomic overview of the genomes and the alignment can then be mined for genomic regions with conservation patterns matching a defined target group and absent from a background group. The genomic regions are given biomarker scores forming a uniqueness signature that can be viewed and explored, graphically and in tabular form. A primer/probe alignment tool is also included for specificity verification of currently used or new primers. We exemplify the use of Gegenees on the Bacillus cereus group, on Foot and Mouth Disease Viruses, and on strains from the 2011 Escherichia coli O104:H4 outbreak. Gegenees contributes towards an increased capacity of fast and efficient data mining as more and more genomes become sequenced.

  7. Investigating the potential for ethnic group harm in collaborative genomics research in Africa: Is ethnic stigmatisation likely?

    PubMed Central

    de Vries, Jantina; Jallow, Muminatou; Williams, Thomas N.; Kwiatkowski, Dominic; Parker, Michael; Fitzpatrick, Raymond

    2013-01-01

    A common assumption in genomics research is that the use of ethnic categories has the potential to lead to ethnic stigmatisation – particularly when the research is done on minority populations. Yet few empirical studies have sought to investigate the relation between genomics and stigma, and fewer still with a focus on Africa. In this paper, we investigate the potential for genomics research to lead to harms to ethnic groups. We carried out 49 semi-structured, open-ended interviews with stakeholders in a current medical genomics research project in Africa, MalariaGEN. Interviews were conducted with MalariaGEN researchers, fieldworkers, members of three ethics committees who reviewed MalariaGEN project proposals, and with members of the two funding bodies providing support to the MalariaGEN project. Interviews were conducted in Kenya, The Gambia and the UK between June 2008 and October 2009. They covered a range of aspects relating to the use of ethnicity in the genomics project, including views on adverse effects of the inclusion of ethnicity in such research. Drawing on the empirical data, we argue that the risk of harm to ethnic groups is likely to be more acute in specific types of genomics research. We develop a typology of research questions and projects that carry a greater risk of harm to the populations included in genomics research. We conclude that the potential of generating harm to ethnic groups in genomics research is present if research includes populations that are already stigmatised or discriminated against, or where the research investigates questions with particular normative implications. We identify a clear need for genomics researchers to take account of the social context of the work they are proposing to do, including understanding the local realities and relations between ethnic groups, and whether diseases are already stigmatised. PMID:22749442

  8. Investigating the potential for ethnic group harm in collaborative genomics research in Africa: is ethnic stigmatisation likely?

    PubMed

    de Vries, Jantina; Jallow, Muminatou; Williams, Thomas N; Kwiatkowski, Dominic; Parker, Michael; Fitzpatrick, Raymond

    2012-10-01

    A common assumption in genomics research is that the use of ethnic categories has the potential to lead to ethnic stigmatisation - particularly when the research is done on minority populations. Yet few empirical studies have sought to investigate the relation between genomics and stigma, and fewer still with a focus on Africa. In this paper, we investigate the potential for genomics research to lead to harms to ethnic groups. We carried out 49 semi-structured, open-ended interviews with stakeholders in a current medical genomics research project in Africa, MalariaGEN. Interviews were conducted with MalariaGEN researchers, fieldworkers, members of three ethics committees who reviewed MalariaGEN project proposals, and with members of the two funding bodies providing support to the MalariaGEN project. Interviews were conducted in Kenya, The Gambia and the UK between June 2008 and October 2009. They covered a range of aspects relating to the use of ethnicity in the genomics project, including views on adverse effects of the inclusion of ethnicity in such research. Drawing on the empirical data, we argue that the risk of harm to ethnic groups is likely to be more acute in specific types of genomics research. We develop a typology of research questions and projects that carry a greater risk of harm to the populations included in genomics research. We conclude that the potential of generating harm to ethnic groups in genomics research is present if research includes populations that are already stigmatised or discriminated against, or where the research investigates questions with particular normative implications. We identify a clear need for genomics researchers to take account of the social context of the work they are proposing to do, including understanding the local realities and relations between ethnic groups, and whether diseases are already stigmatised.

  9. Molecular and genomic characterization of pathogenic traits of group A Streptococcus pyogenes

    PubMed Central

    HAMADA, Shigeyuki; KAWABATA, Shigetada; NAKAGAWA, Ichiro

    2015-01-01

    Group A streptococcus (GAS) or Streptococcus pyogenes causes various diseases ranging from self-limiting sore throat to deadly invasive diseases. The genome size of GAS is 1.85–1.9 Mb, and genomic rearrangement has been demonstrated. GAS possesses various surface-associated substances such as hyaluronic capsule, M proteins, and fibronectin/laminin/immunoglobulin-binding proteins. These are related to the virulence and play multifaceted and mutually reflected roles in the pathogenesis of GAS infections. Invasion of GAS into epithelial cells and deeper tissues provokes immune and non-immune defense or inflammatory responses including the recruitment of neutrophils, macrophages, and dendritic cells in hosts. GAS frequently evades host defense mechanisms by using its virulence factors. Extracellular products of GAS may perturb cellular and subcellular functions and degrade tissues enzymatically, which leads to the aggravation of local and/or systemic disorders in the host. In this review, we summarize some important cellular and extracellular substances that may affect pathogenic processes during GAS infections, and the host responses to these. PMID:26666305

  10. Recommendations from the EGAPP Working Group: genomic profiling to assess cardiovascular risk to improve cardiovascular health.

    PubMed

    2010-12-01

    The Evaluation of Genomic Applications in Practice and Prevention Working Group (EWG) found insufficient evidence to recommend testing for the 9p21 genetic variant or 57 other variants in 28 genes (listed in ) to assess risk for cardiovascular disease (CVD) in the general population, specifically heart disease and stroke. The EWG found that the magnitude of net health benefit from use of any of these tests alone or in combination is negligible. The EWG discourages clinical use unless further evidence supports improved clinical outcomes. Based on the available evidence, the overall certainty of net health benefit is deemed "Low." It has been suggested that an improvement in CVD risk classification (adjusting intermediate risk of CVD into high- or low-risk categories) might lead to management changes (e.g., earlier initiation or higher rates of medical interventions, or targeted recommendations for behavioral change) that improve CVD outcomes. In the absence of direct evidence to support this possibility, this review sought indirect evidence aimed at documenting the extent to which genomic profiling alters CVD risk estimation, alone and in combination with traditional risk factors, and the extent to which risk reclassification improves health outcomes. Assay-related evidence on available genomic profiling tests was deemed inadequate. However, based on existing technologies that have been or may be used and on data from two of the companies performing such testing, the analytic sensitivity and specificity of tests for individual gene variants might be at least satisfactory. Twenty-nine gene candidates were evaluated, with 58 different gene variant/disease associations. Evidence on clinical validity was rated inadequate for 34 of these associations (59%) and adequate for 23 (40%). Inadequate grades were based on limited evidence, poor replication, existence of possible biases, or combinations of these factors. For heart disease (25 combined associations) and stroke (13

  11. How the indirect reciprocity with co-evolving norm and strategy for 2 × 2 prisoner's dilemma game works for emerging cooperation

    NASA Astrophysics Data System (ADS)

    Tanimoto, Jun; Sagara, Hirokji

    2015-11-01

    We built a new indirect reciprocity model based on binary image scores, where an agent's strategy and norm co-evolve. The norm, meaning what behavior is evaluated as "good" or "bad," stipulates how image scores of two agents playing a game is altered, which has been presumed to be a fixed value in most previous studies. Also, unlike former studies, our model allows an agent to play with an agent who has a different norm. This point of relaxing the freedom of the model pulls down cooperation level vis-à-vis the case where an agent always plays with another one having same norm. However, it is observed that a rather larger dilemma shows robust cooperation establishing compared with a smaller dilemma, since a norm that punishes a so-called second-order free-rider is prompted. To encourage the evolution of norms to be able to punish second-order free-riders, a society needs a small number of defectors. This is elucidated by the fact that cases with action error are more cooperative than those without action error.

  12. Clostridium botulinum Group II Isolate Phylogenomic Profiling Using Whole-Genome Sequence Data.

    PubMed

    Weedmark, K A; Mabon, P; Hayden, K L; Lambert, D; Van Domselaar, G; Austin, J W; Corbett, C R

    2015-09-01

    Clostridium botulinum group II isolates (n = 163) from different geographic regions, outbreaks, and neurotoxin types and subtypes were characterized in silico using whole-genome sequence data. Two clusters representing a variety of botulinum neurotoxin (BoNT) types and subtypes were identified by multilocus sequence typing (MLST) and core single nucleotide polymorphism (SNP) analysis. While one cluster included BoNT/B4/F6/E9 and nontoxigenic members, the other comprised a wide variety of different BoNT/E subtype isolates and a nontoxigenic strain. In silico MLST and core SNP methods were consistent in terms of clade-level isolate classification; however, core SNP analysis showed higher resolution capability. Furthermore, core SNP analysis correctly distinguished isolates by outbreak and location. This study illustrated the utility of next-generation sequence-based typing approaches for isolate characterization and source attribution and identified discrete SNP loci and MLST alleles for isolate comparison.

  13. Clostridium botulinum Group II Isolate Phylogenomic Profiling Using Whole-Genome Sequence Data

    PubMed Central

    Weedmark, K. A.; Mabon, P.; Hayden, K. L.; Lambert, D.; Van Domselaar, G.; Austin, J. W.

    2015-01-01

    Clostridium botulinum group II isolates (n = 163) from different geographic regions, outbreaks, and neurotoxin types and subtypes were characterized in silico using whole-genome sequence data. Two clusters representing a variety of botulinum neurotoxin (BoNT) types and subtypes were identified by multilocus sequence typing (MLST) and core single nucleotide polymorphism (SNP) analysis. While one cluster included BoNT/B4/F6/E9 and nontoxigenic members, the other comprised a wide variety of different BoNT/E subtype isolates and a nontoxigenic strain. In silico MLST and core SNP methods were consistent in terms of clade-level isolate classification; however, core SNP analysis showed higher resolution capability. Furthermore, core SNP analysis correctly distinguished isolates by outbreak and location. This study illustrated the utility of next-generation sequence-based typing approaches for isolate characterization and source attribution and identified discrete SNP loci and MLST alleles for isolate comparison. PMID:26116673

  14. Complete Genome Sequence of Nitrosomonas ureae Strain Nm10, an Oligotrophic Group 6a Nitrosomonad

    PubMed Central

    Kozlowski, Jessica A.; Kits, K. Dimitri

    2016-01-01

    The complete genome of Nitrosomonas ureae strain Nm10, a mesophilic betaproteobacterial ammonia oxidizer isolated from Mediterranean soils in Sardinia, Italy, is reported here. This genome represents a cluster 6a nitrosomonad. PMID:26966201

  15. Genome Sequences of Two Bacillus cereus Group Bacteriophages, Eyuki and AvesoBmore

    PubMed Central

    2015-01-01

    The genomes of two double-stranded DNA (dsDNA) bacteriophages isolated on Bacillus thuringiensis show similarity to previously sequenced phages and provide evidence of the mosaicism of phage genomes. PMID:26472840

  16. Extraintestinal Salmonellosis in a General Hospital (1991 to 1996): Relationships between Salmonella Genomic Groups and Clinical Presentations

    PubMed Central

    Rodríguez, Mercedes; de Diego, Isabel; Mendoza, M. Carmen

    1998-01-01

    Episodes of extraintestinal salmonellosis treated at a general hospital (1,522 beds) over a 6-year period (1991 to 1996) were characterized by the analysis of phenotypic and genotypic traits of Salmonella organisms and clinical data from medical reports. Extraintestinal salmonellosis accounted for 8% of all salmonellosis episodes. Fifty-two medical reports, dealing with 6 cases of typhoid fever, 32 cases of bacteremia, and 14 focal infections, were reviewed. All cases of typhoid fever except 1, 7 cases of bacteremia, and 5 focal infections were not related to any underlying disease or predisposing factors, while 25 cases of bacteremia and 9 focal infections were associated with some of these risk factors. All typhoid isolates and 65.4% of the nontyphoid isolates were susceptible to antimicrobials. Fifty-one nontyphoid strains were analyzed and assigned to 21 genomic groups, which were defined by serotype, combined ribotype, and combined randomly amplified polymorphic DNA type (each genomic group could include organisms differing in some phenotypic traits). The relationships between genomic groups and clinical presentations were traced. Organisms causing 22 episodes (17 episodes of bacteremia, 2 of pneumonia, 1 of peritonitis, 1 of pyelonephritis, and 1 of cystitis) belonged to a prevalent Salmonella enterica serotype Enteritidis genomic group, which included organisms assigned to four phage types, five biotypes, and four resistance patterns, causing infections in patients with and without risk factors. Seven other genomic groups, 4 Enteritidis groups (associated with both bacteremia and focal infections), 2 Typhimurium groups (one associated with bacteremia and the other with focal infections) and 1 Brandenburg group (associated with bacteremia) included two or more strains, and the remaining 13 genomic groups consisted of only one strain each. PMID:9774581

  17. Extraintestinal salmonellosis in a general hospital (1991 to 1996): relationships between Salmonella genomic groups and clinical presentations.

    PubMed

    Rodríguez, M; de Diego, I; Mendoza, M C

    1998-11-01

    Episodes of extraintestinal salmonellosis treated at a general hospital (1,522 beds) over a 6-year period (1991 to 1996) were characterized by the analysis of phenotypic and genotypic traits of Salmonella organisms and clinical data from medical reports. Extraintestinal salmonellosis accounted for 8% of all salmonellosis episodes. Fifty-two medical reports, dealing with 6 cases of typhoid fever, 32 cases of bacteremia, and 14 focal infections, were reviewed. All cases of typhoid fever except 1, 7 cases of bacteremia, and 5 focal infections were not related to any underlying disease or predisposing factors, while 25 cases of bacteremia and 9 focal infections were associated with some of these risk factors. All typhoid isolates and 65.4% of the nontyphoid isolates were susceptible to antimicrobials. Fifty-one nontyphoid strains were analyzed and assigned to 21 genomic groups, which were defined by serotype, combined ribotype, and combined randomly amplified polymorphic DNA type (each genomic group could include organisms differing in some phenotypic traits). The relationships between genomic groups and clinical presentations were traced. Organisms causing 22 episodes (17 episodes of bacteremia, 2 of pneumonia, 1 of peritonitis, 1 of pyelonephritis, and 1 of cystitis) belonged to a prevalent Salmonella enterica serotype Enteritidis genomic group, which included organisms assigned to four phage types, five biotypes, and four resistance patterns, causing infections in patients with and without risk factors. Seven other genomic groups, 4 Enteritidis groups (associated with both bacteremia and focal infections), 2 Typhimurium groups (one associated with bacteremia and the other with focal infections) and 1 Brandenburg group (associated with bacteremia) included two or more strains, and the remaining 13 genomic groups consisted of only one strain each.

  18. Assignment of simian rotavirus SA11 temperature-sensitive mutant groups B and E to genome segments

    SciTech Connect

    Gombold, J.L.; Estes, M.K.; Ramig, R.F.

    1985-05-01

    Recombinant (reassortant) viruses were selected from crosses between temperature-sensitive (ts) mutants of simian rotavirus SA11 and wild-type human rotavirus Wa. The double-stranded genome RNAs of the reassortants were examined by electrophoresis in Tris-glycine-buffered polyacrylamide gels and by dot hybridization with a cloned DNA probe for genome segment 2. Analysis of replacements of genome segments in the reassortants allowed construction of a map correlating genome segments providing functions interchangeable between SA11 and Wa. The reassortants revealed a functional correspondence in order of increasing electrophoretic mobility of genome segments. Analysis of the parental origin of genome segments in ts+ SA11/Wa reassortants derived from the crosses SA11 tsB(339) X Wa and SA11 tsE(1400) X Wa revealed that the group B lesion of tsB(339) was located on genome segment 3 and the group E lesion of tsE(1400) was on segment 8.

  19. The Evaluation of Genomic Applications in Practice and Prevention (EGAPP) Initiative: methods of the EGAPP Working Group.

    PubMed

    Teutsch, Steven M; Bradley, Linda A; Palomaki, Glenn E; Haddow, James E; Piper, Margaret; Calonge, Ned; Dotson, W David; Douglas, Michael P; Berg, Alfred O

    2009-01-01

    The Evaluation of Genomic Applications in Practice and Prevention (EGAPP) Initiative, established by the National Office of Public Health Genomics at the Centers for Disease Control and Prevention, supports the development and implementation of a rigorous, evidence-based process for evaluating genetic tests and other genomic applications for clinical and public health practice in the United States. An independent, non-federal EGAPP Working Group (EWG), a multidisciplinary expert panel selects topics, oversees the systematic review of evidence, and makes recommendations based on that evidence. This article describes the EGAPP processes and details the specific methods and approaches used by the EWG.

  20. The Evaluation of Genomic Applications in Practice and Prevention (EGAPP) initiative: methods of the EGAPP Working Group

    PubMed Central

    Teutsch, Steven M.; Bradley, Linda A.; Palomaki, Glenn E.; Haddow, James E.; Piper, Margaret; Calonge, Ned; Dotson, W. David; Douglas, Michael P.; Berg, Alfred O.

    2009-01-01

    The Evaluation of Genomic Applications in Practice and Prevention (EGAPP) Initiative, established by the National Office of Public Health Genomics at the Centers for Disease Control and Prevention, supports the development and implementation of a rigorous, evidence-based process for evaluating genetic tests and other genomic applications for clinical and public health practice in the United States. An independent, non-federal EGAPP Working Group (EWG), a multidisciplinary expert panel selects topics, oversees the systematic review of evidence, and makes recommendations based on that evidence. This article describes the EGAPP processes and details the specific methods and approaches used by the EWG. PMID:18813139

  1. Genomic structures and population histories of linguistically distinct tribal groups of India.

    PubMed

    Roychoudhury, S; Roy, S; Basu, A; Banerjee, R; Vishwanathan, H; Usha Rani, M V; Sil, S K; Mitra, M; Majumder, P P

    2001-09-01

    There are various conflicting hypotheses regarding the origins of the tribal groups of India, who belong to three major language groups--Austro-Asiatic, Dravidian and Tibeto-Burman. To test some of the major hypotheses we designed a genetic study in which we sampled tribal populations belonging to all the three language groups. We used a set of autosomal DNA markers, mtDNA restriction-site polymorphisms (RSPs) and mtDNA hypervariable segment-1 (HVS-1) sequence polymorphisms in this study. Using the unlinked autosomal markers we found that there is a fair correspondence between linguistic and genomic affinities among the Indian tribal groups. We reconstructed mtDNA RSP haplotypes and found that there is extensive haplotype sharing among all tribal populations. However, there is very little sharing of mtDNA HVS-1 sequences across populations, and none across language groups. Haplogroup M is ubiquitous, and the subcluster U2i of haplogroup U occurs in a high frequency. Our analyses of haplogroup and HVS-1 sequence data provides evidence in support of the hypothesis that the Austro-Asiatic speakers are the most ancient inhabitants of India. Our data also support the earlier finding that some of the western Eurasian haplogroups found in India may have been present in India prior to the entry of Aryan speakers. However, we do not find compelling evidence to support the theory that haplogroup M was brought into India on an "out of Africa" wave of migration through a southern exit route from Ethiopia. On the contrary, our data raise the possibility that this haplogroup arose in India and was later carried to East Africa from India.

  2. Extensive Genomic Variability of Knops Blood Group Polymorphisms Is Associated with Sickle Cell Disease in Africa

    PubMed Central

    Duru, Kimberley C; Noble, Jenelle A; Guindo, Aldiouma; Yi, Li; Imumorin, Ikhide G; Diallo, Dapa A; Thomas, Bolaji N

    2015-01-01

    Sickle cell disease (SCD) is a multisystem disorder characterized by chronic hemolytic anemia, vaso-occlusive crises, and marked variability in disease severity. Patients require transfusions to manage disease complications, with complements, directed by complement regulatory genes (CR1) and its polymorphisms, implicated in the development of alloantibodies. We hypothesize that CR1 polymorphisms affect complement regulation and function, leading to adverse outcome in SCD. To this end, we determined the genomic diversity of complement regulatory genes by examining single nucleotide polymorphisms associated with Knops blood group antigens. Genomic DNA samples from 130 SCD cases and 356 control Africans, 331 SCD cases and 497 control African Americans, and 254 Caucasians were obtained and analyzed, utilizing a PCR—RFLP (polymerase chain reaction–restriction fragment length polymorphism) assay. Analyzing for ethnic diversity, we found significant differences in the genotypic and allelic frequencies of Sl1/Sl2 (rs17047661) and McCa/b (rs17047660) polymorphisms between Africans, African Americans, and Caucasians (P < 0.05). The homozygote mutant variants had significantly higher frequencies in Africans and African Americans but were insignificant in Caucasians (80.2% and 59.6% vs 5.9% for Sl1/2; and 36% and 24% vs 1.8% for McCa/b). With SCD, we did not detect any difference among cases and controls either in Africa or in the United States. However, we found significant difference in genotypic (P < 0.0001) and allelic frequencies (P < 0.0001) of Sl1/Sl2 (rs17047661) and McCa/b (rs17047660) polymorphisms between SCD groups from Africa and the United States. There was no difference in haplotype frequencies of these polymorphisms among or between groups. The higher frequency of CR1 homozygote mutant variants in Africa but not United States indicates a potential pathogenic role, possibly associated with complicated disease pathophysiology in the former and potentially

  3. Excision repair in xeroderma pigmentosum group C but not group D is clustered in a small fraction of the total genome.

    PubMed

    Karentz, D; Cleaver, J E

    1986-05-01

    DNA repair in xeroderma pigmentosum complementation groups C and D occurs at a low level. Measurements of pyrimidine dimers remaining in bulk DNA from the whole genome indicated very little excision in either complementation group. The repair sites in group C cells were, however, clustered together in small regions of the genome which appeared to be mended nearly as efficiently as the whole genome is mended in normal cells, while repair in group D cells was randomly distributed. Growth of normal cells in cycloheximide or 3-aminobenzamide neither inhibited repair nor altered the distribution of repair sites. Growth of normal cells in novobiocin or aphidicolin inhibited excision but repair remained randomly distributed. On the basis of these observations, and consideration of other cellular features of group C and D, we suggest that group C may represent a mutation which results in a low level of repair enzymes with normal function. Group D, on the other hand, may represent a mutation resulting in functionally defective repair enzymes.

  4. Genome-Wide Identification of Genes Required for Fitness of Group A Streptococcus in Human Blood

    PubMed Central

    Le Breton, Yoann; Mistry, Pragnesh; Valdes, Kayla M.; Quigley, Jeffrey; Kumar, Nikhil; Tettelin, Hervé

    2013-01-01

    The group A streptococcus (GAS) is a strict human pathogen responsible for a wide spectrum of diseases. Although GAS genome sequences are available, functional genomic analyses have been limited. We developed a mariner-based transposon, osKaR, designed to perform Transposon-Site Hybridization (TraSH) in GAS and successfully tested its use in several invasive serotypes. A complex osKaR mutant library in M1T1 GAS strain 5448 was subjected to negative selection in human blood to identify genes important for GAS fitness in this clinically relevant environment. Mutants underrepresented after growth in blood (output pool) compared to growth in rich media (input pool) were identified using DNA microarray hybridization of transposon-specific tags en masse. Using blood from three different donors, we identified 81 genes that met our criteria for reduced fitness in blood from at least two individuals. Genes known to play a role in survival of GAS in blood were found, including those encoding the virulence regulator Mga (mga), the peroxide response regulator PerR (perR), and the RofA-like regulator Ralp-3 (ralp3). We also identified genes previously reported for their contribution to sepsis in other pathogens, such as de novo nucleotide synthesis (purD, purA, pyrB, carA, carB, guaB), sugar metabolism (scrB, fruA), zinc uptake (adcC), and transcriptional regulation (cpsY). To validate our findings, independent mutants with mutations in 10 different genes identified in our screen were confirmed to be defective for survival in blood bactericidal assays. Overall, this work represents the first use of TraSH in GAS to identify potential virulence genes. PMID:23297387

  5. Xeroderma Pigmentosum Group A Suppresses Mutagenesis Caused by Clustered Oxidative DNA Adducts in the Human Genome

    PubMed Central

    Sassa, Akira; Kamoshita, Nagisa; Kanemaru, Yuki; Honma, Masamitsu; Yasui, Manabu

    2015-01-01

    Clustered DNA damage is defined as multiple sites of DNA damage within one or two helical turns of the duplex DNA. This complex damage is often formed by exposure of the genome to ionizing radiation and is difficult to repair. The mutagenic potential and repair mechanisms of clustered DNA damage in human cells remain to be elucidated. In this study, we investigated the involvement of nucleotide excision repair (NER) in clustered oxidative DNA adducts. To identify the in vivo protective roles of NER, we established a human cell line lacking the NER gene xeroderma pigmentosum group A (XPA). XPA knockout (KO) cells were generated from TSCER122 cells derived from the human lymphoblastoid TK6 cell line. To analyze the mutagenic events in DNA adducts in vivo, we previously employed a system of tracing DNA adducts in the targeted mutagenesis (TATAM), in which DNA adducts were site-specifically introduced into intron 4 of thymidine kinase genes. Using the TATAM system, one or two tandem 7,8-dihydro-8-oxoguanine (8-oxoG) adducts were introduced into the genomes of TSCER122 or XPA KO cells. In XPA KO cells, the proportion of mutants induced by a single 8-oxoG (7.6%) was comparable with that in TSCER122 cells (8.1%). In contrast, the lack of XPA significantly enhanced the mutant proportion of tandem 8-oxoG in the transcribed strand (12%) compared with that in TSCER122 cells (7.4%) but not in the non-transcribed strand (12% and 11% in XPA KO and TSCER122 cells, respectively). By sequencing the tandem 8-oxoG-integrated loci in the transcribed strand, we found that the proportion of tandem mutations was markedly increased in XPA KO cells. These results indicate that NER is involved in repairing clustered DNA adducts in the transcribed strand in vivo. PMID:26559182

  6. Xeroderma Pigmentosum Group A Suppresses Mutagenesis Caused by Clustered Oxidative DNA Adducts in the Human Genome.

    PubMed

    Sassa, Akira; Kamoshita, Nagisa; Kanemaru, Yuki; Honma, Masamitsu; Yasui, Manabu

    2015-01-01

    Clustered DNA damage is defined as multiple sites of DNA damage within one or two helical turns of the duplex DNA. This complex damage is often formed by exposure of the genome to ionizing radiation and is difficult to repair. The mutagenic potential and repair mechanisms of clustered DNA damage in human cells remain to be elucidated. In this study, we investigated the involvement of nucleotide excision repair (NER) in clustered oxidative DNA adducts. To identify the in vivo protective roles of NER, we established a human cell line lacking the NER gene xeroderma pigmentosum group A (XPA). XPA knockout (KO) cells were generated from TSCER122 cells derived from the human lymphoblastoid TK6 cell line. To analyze the mutagenic events in DNA adducts in vivo, we previously employed a system of tracing DNA adducts in the targeted mutagenesis (TATAM), in which DNA adducts were site-specifically introduced into intron 4 of thymidine kinase genes. Using the TATAM system, one or two tandem 7,8-dihydro-8-oxoguanine (8-oxoG) adducts were introduced into the genomes of TSCER122 or XPA KO cells. In XPA KO cells, the proportion of mutants induced by a single 8-oxoG (7.6%) was comparable with that in TSCER122 cells (8.1%). In contrast, the lack of XPA significantly enhanced the mutant proportion of tandem 8-oxoG in the transcribed strand (12%) compared with that in TSCER122 cells (7.4%) but not in the non-transcribed strand (12% and 11% in XPA KO and TSCER122 cells, respectively). By sequencing the tandem 8-oxoG-integrated loci in the transcribed strand, we found that the proportion of tandem mutations was markedly increased in XPA KO cells. These results indicate that NER is involved in repairing clustered DNA adducts in the transcribed strand in vivo.

  7. Big Data: the challenge for small research groups in the era of cancer genomics

    PubMed Central

    Noor, Aisyah Mohd; Holmberg, Lars; Gillett, Cheryl; Grigoriadis, Anita

    2015-01-01

    In the past decade, cancer research has seen an increasing trend towards high-throughput techniques and translational approaches. The increasing availability of assays that utilise smaller quantities of source material and produce higher volumes of data output have resulted in the necessity for data storage solutions beyond those previously used. Multifactorial data, both large in sample size and heterogeneous in context, needs to be integrated in a standardised, cost-effective and secure manner. This requires technical solutions and administrative support not normally financially accounted for in small- to moderate-sized research groups. In this review, we highlight the Big Data challenges faced by translational research groups in the precision medicine era; an era in which the genomes of over 75 000 patients will be sequenced by the National Health Service over the next 3 years to advance healthcare. In particular, we have looked at three main themes of data management in relation to cancer research, namely (1) cancer ontology management, (2) IT infrastructures that have been developed to support data management and (3) the unique ethical challenges introduced by utilising Big Data in research. PMID:26492224

  8. Genome-wide interrogation advances resolution of recalcitrant groups in the tree of life.

    PubMed

    Arcila, Dahiana; Ortí, Guillermo; Vari, Richard; Armbruster, Jonathan W; Stiassny, Melanie L J; Ko, Kyung D; Sabaj, Mark H; Lundberg, John; Revell, Liam J; Betancur-R, Ricardo

    2017-01-13

    Much progress has been achieved in disentangling evolutionary relationships among species in the tree of life, but some taxonomic groups remain difficult to resolve despite increasing availability of genome-scale data sets. Here we present a practical approach to studying ancient divergences in the face of high levels of conflict, based on explicit gene genealogy interrogation (GGI). We show its efficacy in resolving the controversial relationships within the largest freshwater fish radiation (Otophysi) based on newly generated DNA sequences for 1,051 loci from 225 species. Initial results using a suite of standard methodologies revealed conflicting phylogenetic signal, which supports ten alternative evolutionary histories among early otophysan lineages. By contrast, GGI revealed that the vast majority of gene genealogies supports a single tree topology grounded on morphology that was not obtained by previous molecular studies. We also reanalysed published data sets for exemplary groups with recalcitrant resolution to assess the power of this approach. GGI supports the notion that ctenophores are the earliest-branching animal lineage, and adds insight into relationships within clades of yeasts, birds and mammals. GGI opens up a promising avenue to account for incompatible signals in large data sets and to discern between estimation error and actual biological conflict explaining gene tree discordance.

  9. Big Data: the challenge for small research groups in the era of cancer genomics.

    PubMed

    Noor, Aisyah Mohd; Holmberg, Lars; Gillett, Cheryl; Grigoriadis, Anita

    2015-11-17

    In the past decade, cancer research has seen an increasing trend towards high-throughput techniques and translational approaches. The increasing availability of assays that utilise smaller quantities of source material and produce higher volumes of data output have resulted in the necessity for data storage solutions beyond those previously used. Multifactorial data, both large in sample size and heterogeneous in context, needs to be integrated in a standardised, cost-effective and secure manner. This requires technical solutions and administrative support not normally financially accounted for in small- to moderate-sized research groups. In this review, we highlight the Big Data challenges faced by translational research groups in the precision medicine era; an era in which the genomes of over 75,000 patients will be sequenced by the National Health Service over the next 3 years to advance healthcare. In particular, we have looked at three main themes of data management in relation to cancer research, namely (1) cancer ontology management, (2) IT infrastructures that have been developed to support data management and (3) the unique ethical challenges introduced by utilising Big Data in research.

  10. Novel phage group infecting Lactobacillus delbrueckii subsp. lactis, as revealed by genomic and proteomic analysis of bacteriophage Ldl1.

    PubMed

    Casey, Eoghan; Mahony, Jennifer; Neve, Horst; Noben, Jean-Paul; Dal Bello, Fabio; van Sinderen, Douwe

    2015-02-01

    Ldl1 is a virulent phage infecting the dairy starter Lactobacillus delbrueckii subsp. lactis LdlS. Electron microscopy analysis revealed that this phage exhibits a large head and a long tail and bears little resemblance to other characterized phages infecting Lactobacillus delbrueckii. In vitro propagation of this phage revealed a latent period of 30 to 40 min and a burst size of 59.9 +/- 1.9 phage particles. Comparative genomic and proteomic analyses showed remarkable similarity between the genome of Ldl1 and that of Lactobacillus plantarum phage ATCC 8014-B2. The genomic and proteomic characteristics of Ldl1 demonstrate that this phage does not belong to any of the four previously recognized L. delbrueckii phage groups, necessitating the creation of a new group, called group e, thus adding to the knowledge on the diversity of phages targeting strains of this industrially important lactic acid bacterial species.

  11. Fundamental molecules of life are pigments which arose and co-evolved as a response to the thermodynamic imperative of dissipating the prevailing solar spectrum

    NASA Astrophysics Data System (ADS)

    Michaelian, K.; Simeonov, A.

    2015-08-01

    The driving force behind the origin and evolution of life has been the thermodynamic imperative of increasing the entropy production of the biosphere through increasing the global solar photon dissipation rate. In the upper atmosphere of today, oxygen and ozone derived from life processes are performing the short-wavelength UV-C and UV-B dissipation. On Earth's surface, water and organic pigments in water facilitate the near-UV and visible photon dissipation. The first organic pigments probably formed, absorbed, and dissipated at those photochemically active wavelengths in the UV-C and UV-B that could have reached Earth's surface during the Archean. Proliferation of these pigments can be understood as an autocatalytic photochemical process obeying non-equilibrium thermodynamic directives related to increasing solar photon dissipation rate. Under these directives, organic pigments would have evolved over time to increase the global photon dissipation rate by (1) increasing the ratio of their effective photon cross sections to their physical size, (2) decreasing their electronic excited state lifetimes, (3) quenching radiative de-excitation channels (e.g., fluorescence), (4) covering ever more completely the prevailing solar spectrum, and (5) proliferating and dispersing to cover an ever greater surface area of Earth. From knowledge of the evolution of the spectrum of G-type stars, and considering the most probable history of the transparency of Earth's atmosphere, we construct the most probable Earth surface solar spectrum as a function of time and compare this with the history of molecular absorption maxima obtained from the available data in the literature. This comparison supports the conjecture that many fundamental molecules of life are pigments which arose, proliferated, and co-evolved as a response to dissipating the solar spectrum, supports the thermodynamic dissipation theory for the origin of life, constrains models for Earth's early atmosphere, and sheds

  12. Genomic Prediction of Northern Corn Leaf Blight Resistance in Maize with Combined or Separated Training Sets for Heterotic Groups

    PubMed Central

    Technow, Frank; Bürger, Anna; Melchinger, Albrecht E.

    2013-01-01

    Northern corn leaf blight (NCLB), a severe fungal disease causing yield losses worldwide, is most effectively controlled by resistant varieties. Genomic prediction could greatly aid resistance breeding efforts. However, the development of accurate prediction models requires large training sets of genotyped and phenotyped individuals. Maize hybrid breeding is based on distinct heterotic groups that maximize heterosis (the dent and flint groups in Central Europe). The resulting allocation of resources to parallel breeding programs challenges the establishment of sufficiently sized training sets within groups. Therefore, using training sets combining both heterotic groups might be a possibility of increasing training set sizes and thereby prediction accuracies. The objectives of our study were to assess the prospect of genomic prediction of NCLB resistance in maize and the benefit of a training set that combines two heterotic groups. Our data comprised 100 dent and 97 flint lines, phenotyped for NCLB resistance per se and genotyped with high-density single-nucleotide polymorphism marker data. A genomic BLUP model was used to predict genotypic values. Prediction accuracies reached a maximum of 0.706 (dent) and 0.690 (flint), and there was a strong positive response to increases in training set size. The use of combined training sets led to significantly greater prediction accuracies for both heterotic groups. Our results encourage the application of genomic prediction in NCLB-resistance breeding programs and the use of combined training sets. PMID:23390596

  13. Functional gene groups are concentrated within chromosomes, among chromosomes and in the nuclear space of the human genome.

    PubMed

    Thévenin, Annelyse; Ein-Dor, Liat; Ozery-Flato, Michal; Shamir, Ron

    2014-09-01

    Genomes undergo changes in organization as a result of gene duplications, chromosomal rearrangements and local mutations, among other mechanisms. In contrast to prokaryotes, in which genes of a common function are often organized in operons and reside contiguously along the genome, most eukaryotes show much weaker clustering of genes by function, except for few concrete functional groups. We set out to check systematically if there is a relation between gene function and gene organization in the human genome. We test this question for three types of functional groups: pairs of interacting proteins, complexes and pathways. We find a significant concentration of functional groups both in terms of their distance within the same chromosome and in terms of their dispersal over several chromosomes. Moreover, using Hi-C contact map of the tendency of chromosomal segments to appear close in the 3D space of the nucleus, we show that members of the same functional group that reside on distinct chromosomes tend to co-localize in space. The result holds for all three types of functional groups that we tested. Hence, the human genome shows substantial concentration of functional groups within chromosomes and across chromosomes in space.

  14. Northeast African genomic variation shaped by the continuity of indigenous groups and Eurasian migrations.

    PubMed

    Hollfelder, Nina; Schlebusch, Carina M; Günther, Torsten; Babiker, Hiba; Hassan, Hisham Y; Jakobsson, Mattias

    2017-08-01

    Northeast Africa has a long history of human habitation, with fossil-finds from the earliest anatomically modern humans, and housing ancient civilizations. The region is also the gate-way out of Africa, as well as a portal for migration into Africa from Eurasia via the Middle East and the Arabian Peninsula. We investigate the population history of northeast Africa by genotyping ~3.9 million SNPs in 221 individuals from 18 populations sampled in Sudan and South Sudan and combine this data with published genome-wide data from surrounding areas. We find a strong genetic divide between the populations from the northeastern parts of the region (Nubians, central Arab populations, and the Beja) and populations towards the west and south (Nilotes, Darfur and Kordofan populations). This differentiation is mainly caused by a large Eurasian ancestry component of the northeast populations likely driven by migration of Middle Eastern groups followed by admixture that affected the local populations in a north-to-south succession of events. Genetic evidence points to an early admixture event in the Nubians, concurrent with historical contact between North Sudanese and Arab groups. We estimate the admixture in current-day Sudanese Arab populations to about 700 years ago, coinciding with the fall of Dongola in 1315/1316 AD, a wave of admixture that reached the Darfurian/Kordofanian populations some 400-200 years ago. In contrast to the northeastern populations, the current-day Nilotic populations from the south of the region display little or no admixture from Eurasian groups indicating long-term isolation and population continuity in these areas of northeast Africa.

  15. Whole-genome pyrosequencing of an epidemic multidrug-resistant Acinetobacter baumannii strain belonging to the European clone II group.

    PubMed

    Iacono, Michele; Villa, Laura; Fortini, Daniela; Bordoni, Roberta; Imperi, Francesco; Bonnal, Raoul J P; Sicheritz-Ponten, Thomas; De Bellis, Gianluca; Visca, Paolo; Cassone, Antonio; Carattoli, Alessandra

    2008-07-01

    The whole-genome sequence of an epidemic, multidrug-resistant Acinetobacter baumannii strain (strain ACICU) belonging to the European clone II group and carrying the plasmid-mediated bla(OXA)(-)(58) carbapenem resistance gene was determined. The A. baumannii ACICU genome was compared with the genomes of A. baumannii ATCC 17978 and Acinetobacter baylyi ADP1, with the aim of identifying novel genes related to virulence and drug resistance. A. baumannii ACICU has a single chromosome of 3,904,116 bp (which is predicted to contain 3,758 genes) and two plasmids, pACICU1 and pACICU2, of 28,279 and 64,366 bp, respectively. Genome comparison showed 86.4% synteny with A. baumannii ATCC 17978 and 14.8% synteny with A. baylyi ADP1. A conspicuous number of transporters belonging to different superfamilies was predicted for A. baumannii ACICU. The relative number of transporters was much higher in ACICU than in ATCC 17978 and ADP1 (76.2, 57.2, and 62.5 transporters per Mb of genome, respectively). An antibiotic resistance island, AbaR2, was identified in ACICU and had plausibly evolved by reductive evolution from the AbaR1 island previously described in multiresistant strain A. baumannii AYE. Moreover, 36 putative alien islands (pAs) were detected in the ACICU genome; 24 of these had previously been described in the ATCC 17978 genome, 4 are proposed here for the first time and are present in both ATCC 17978 and ACICU, and 8 are unique to the ACICU genome. Fifteen of the pAs in the ACICU genome encode genes related to drug resistance, including membrane transporters and ex novo acquired resistance genes. These findings provide novel insight into the genetic basis of A. baumannii resistance.

  16. Sequencing and analysis of the complete organellar genomes of Parmales, a closely related group to Bacillariophyta (diatoms).

    PubMed

    Tajima, Naoyuki; Saitoh, Kenji; Sato, Shusei; Maruyama, Fumito; Ichinomiya, Mutsuo; Yoshikawa, Shinya; Kurokawa, Ken; Ohta, Hiroyuki; Tabata, Satoshi; Kuwata, Akira; Sato, Naoki

    2016-11-01

    We sequenced the complete plastid and mitochondrial genomes of the unicellular marine phytoplankton Triparma laevis, belonging to the order Parmales (Heterokonta). The cells of Parmales are surrounded by silicified cell walls, similar to Bacillariophyta (diatoms). T. laevis was recognized as a sister group of Bacillariophyta using a molecular phylogenetic analysis based on SSU rDNA and rbcL sequences. Bacillariophyta are the most successful group of phytoplankton in the modern ocean, but the origin and early evolution of them have not been clearly established. Detailed molecular analyses of T. laevis may increase our understanding of the evolutionary relationships among Parmales and Bacillariophyta. The gene contents of the plastid and mitochondrial genomes are similar between T. laevis and Bacillariophyta. The gene order of the plastid genome is also similar to Bacillariophyta, whereas the gene order of the mitochondrial genome is not conserved in Bacillariophyta, but the structure is more compact than Bacillariophyta. Phylogenetic analyses, using plastid-encoded concatenated amino acid datasets and mitochondria-encoded concatenated amino acid datasets suggest that T. laevis is a sister group of Bacillariophyta. These results suggest that the characteristics of the organellar genomes of T. laevis are similar and conserve ancestral characteristics more than Bacillariophyta.

  17. Persistence of a dominant bovine lineage of group B Streptococcus reveals genomic signatures of host adaptation.

    PubMed

    Almeida, Alexandre; Alves-Barroco, Cinthia; Sauvage, Elisabeth; Bexiga, Ricardo; Albuquerque, Pedro; Tavares, Fernando; Santos-Sanches, Ilda; Glaser, Philippe

    2016-11-01

    Group B Streptococcus (GBS) is a host-generalist species, most notably causing disease in humans and cattle. However, the differential adaptation of GBS to its two main hosts, and the risk of animal to human infection remain poorly understood. Despite improvements in control measures across Europe, GBS is still one of the main causative agents of bovine mastitis in Portugal. Here, by whole-genome analysis of 150 bovine GBS isolates we discovered that a single CC61 clone is spreading throughout Portuguese herds since at least the early 1990s, having virtually replaced the previous GBS population. Mutations within an iron/manganese transporter were independently acquired by all of the CC61 isolates, underlining a key adaptive strategy to persist in the bovine host. Lateral transfer of bacteriocin production and antibiotic resistance genes also underscored the contribution of the microbial ecology and genetic pool within the bovine udder environment to the success of this clone. Compared to strains of human origin, GBS evolves twice as fast in bovines and undergoes recurrent pseudogenizations of human-adapted traits. Our work provides new insights into the potentially irreversible adaptation of GBS to the bovine environment.

  18. Detecting non-orthology in the COGs database and other approaches grouping orthologs using genome-specific best hits

    PubMed Central

    Dessimoz, Christophe; Boeckmann, Brigitte; Roth, Alexander C. J.; Gonnet, Gaston H.

    2006-01-01

    Correct orthology assignment is a critical prerequisite of numerous comparative genomics procedures, such as function prediction, construction of phylogenetic species trees and genome rearrangement analysis. We present an algorithm for the detection of non-orthologs that arise by mistake in current orthology classification methods based on genome-specific best hits, such as the COGs database. The algorithm works with pairwise distance estimates, rather than computationally expensive and error-prone tree-building methods. The accuracy of the algorithm is evaluated through verification of the distribution of predicted cases, case-by-case phylogenetic analysis and comparisons with predictions from other projects using independent methods. Our results show that a very significant fraction of the COG groups include non-orthologs: using conservative parameters, the algorithm detects non-orthology in a third of all COG groups. Consequently, sequence analysis sensitive to correct orthology assignments will greatly benefit from these findings. PMID:16835308

  19. Genome characterisation of enteroviruses 117 and 118: a new group within human enterovirus species C.

    PubMed

    Piralla, Antonio; Daleno, Cristina; Scala, Alessia; Greenberg, David; Usonis, Vytautas; Principi, Nicola; Baldanti, Fausto; Esposito, Susanna

    2013-01-01

    The more than 120 genotypes of human enteroviruses (HEVs) reflect a wide range of evolutionary divergence, and there are 23 currently classified as human enterovirus C species (HEV-C). Two new HEV-C (EV-C117 and EV-C118) were identified in the Community-Acquired Pneumonia Pediatric Research Initiative (CAP-PRI) study, and the present paper describes the characterisation of the complete genome of one EV-C117 strain (LIT22) and two EV-C118 (ISR38 and ISR10) strains. The EV-C117 and EV-C118 5'UTR sequences were related to those of EV-C104, EV-C105 and EV-C109, and were slightly shorter than those of other HEV A-D species. Similarity plot analyses showed that EV-C117 and EV-C118 have a P1 region that is highly divergent from that of the other HEV-C, and phylogenetic analyses highly supported a monophyletic group consisting of EV-C117, EV-C118, EV-C104, EV-C105 and EV-C109 strains. Phylogenetic, Simplot and Bootscan analyses indicated that recombination was not the main mechanism of EV-C117 and EV-C118 evolution, thus strengthening the hypothesis of the monophyletic origin of the coding regions, as in the case of other HEV-C. Phylogenetic analysis also revealed the emergence of a new group within HEV-C that is divided into two subgroups. Nucleotide and amino acid identity in VP1 sequences have been established as useful criteria for assigning new HEV types, but analysis of the complete P1 region improves resolution.

  20. RNA-RNA interactions and pre-mRNA mislocalization as drivers of group II intron loss from nuclear genomes.

    PubMed

    Qu, Guosheng; Dong, Xiaolong; Piazza, Carol Lyn; Chalamcharla, Venkata R; Lutz, Sheila; Curcio, M Joan; Belfort, Marlene

    2014-05-06

    Group II introns are commonly believed to be the progenitors of spliceosomal introns, but they are notably absent from nuclear genomes. Barriers to group II intron function in nuclear genomes therefore beg examination. A previous study showed that nuclear expression of a group II intron in yeast results in nonsense-mediated decay and translational repression of mRNA, and that these roadblocks to expression are group II intron-specific. To determine the molecular basis for repression of gene expression, we investigated cellular dynamics of processed group II intron RNAs, from transcription to cellular localization. Our data show pre-mRNA mislocalization to the cytoplasm, where the RNAs are targeted to foci. Furthermore, tenacious mRNA-pre-mRNA interactions, based on intron-exon binding sequences, result in reduced abundance of spliced mRNAs. Nuclear retention of pre-mRNA prevents this interaction and relieves these expression blocks. In addition to providing a mechanistic rationale for group II intron-specific repression, our data support the hypothesis that RNA silencing of the host gene contributed to expulsion of group II introns from nuclear genomes and drove the evolution of spliceosomal introns.

  1. Effects of racial and ethnic group and health literacy on responses to genomic risk information in a medically underserved population.

    PubMed

    Kaphingst, Kimberly A; Stafford, Jewel D; McGowan, Lucy D'Agostino; Seo, Joann; Lachance, Christina R; Goodman, Melody S

    2015-02-01

    Few studies have examined how individuals respond to genomic risk information for common, chronic diseases. This randomized study examined differences in responses by type of genomic information (genetic test/family history) and disease condition (diabetes/heart disease), and by race/ethnicity in a medically underserved population. 1,057 English-speaking adults completed a survey containing 1 of 4 vignettes (2-by-2 randomized design). Differences in dependent variables (i.e., interest in receiving genomic assessment, discussing with doctor or family, changing health habits) by experimental condition and race/ethnicity were examined using chi-squared tests and multivariable regression analysis. No significant differences were found in dependent variables by type of genomic information or disease condition. In multivariable models, Hispanics were more interested in receiving a genomic assessment than Whites (OR = 1.93; p < .0001); respondents with marginal (OR = 1.54; p = .005) or limited (OR = 1.85; p = .009) health literacy had greater interest than those with adequate health literacy. Blacks (OR = 1.78; p = .001) and Hispanics (OR = 1.85; p = .001) had greater interest in discussing information with family than Whites. Non-Hispanic Blacks (OR = 1.45; p = .04) had greater interest in discussing genomic information with a doctor than Whites. Blacks (β = -0.41; p < .001) and Hispanics (β = -0.25; p = .033) intended to change fewer health habits than Whites; health literacy was negatively associated with number of health habits participants intended to change. Findings suggest that race/ethnicity may affect responses to genomic risk information. Additional research could examine how cognitive representations of this information differ across racial/ethnic groups. Health literacy is also critical to consider in developing approaches to communicating genomic information.

  2. Draft Genome Sequences of Salmonella enterica Isolates Containing Incompatibility Group I1 Plasmids from Swine, Poultry, and Human Sources.

    PubMed

    Kaldhone, Pravin R; Khajanchi, Bijay K; Han, Jing; Nayak, Rajesh; Ricke, Steven C; Foley, Steven L

    2017-09-28

    The draft genome sequences of eight Salmonella enterica isolates from various sources were evaluated for the influence of incompatibility group I1 (IncI1) plasmids on virulence. Strains SE142, SE143, SE144, and SE146 originated from swine, SE36N and SE89N from poultry-related sources, and SE991 and SE1148 from human patients.

  3. Draft Genome Sequence of Streptomyces vitaminophilus ATCC 31673, a Producer of Pyrrolomycin Antibiotics, Some of Which Contain a Nitro Group

    PubMed Central

    Klingeman, Dawn M.; Hettich, Robert L.; Parry, Ronald J.

    2016-01-01

    Streptomyces vitaminophilus produces pyrrolomycins, which are halogenated polyketide antibiotics. Some of the pyrrolomycins contain a rare nitro group located on the pyrrole ring. The 6.5-Mbp genome encodes 5,941 predicted protein-coding sequences in 39 contigs with a 71.9% G+C content. PMID:26798098

  4. Draft genome sequence of Streptomyces vitaminophilus ATCC 31673, a producer of pyrrolomycin antibiotics, some of which contain a nitro group

    DOE PAGES

    Mahan, Kristina M.; Klingeman, Dawn Marie; Robert L. Hettich; ...

    2016-01-21

    Streptomyces vitaminophilus produces pyrrolomycins, which are halogenated polyketide antibiotics. Some of the pyrrolomycins contain a rare nitro group located on the pyrrole ring. In addition, the 6.5-Mbp genome encodes 5,941 predicted protein-coding sequences in 39 contigs with a 71.9% G+C content.

  5. Core Genome Multilocus Sequence Typing for Identification of Globally Distributed Clonal Groups and Differentiation of Outbreak Strains of Listeria monocytogenes

    PubMed Central

    Gonzalez-Escalona, Narjol; Hammack, Thomas S.; Allard, Marc W.; Strain, Errol A.; Brown, Eric W.

    2016-01-01

    ABSTRACT Many listeriosis outbreaks are caused by a few globally distributed clonal groups, designated clonal complexes or epidemic clones, of Listeria monocytogenes, several of which have been defined by classic multilocus sequence typing (MLST) schemes targeting 6 to 8 housekeeping or virulence genes. We have developed and evaluated core genome MLST (cgMLST) schemes and applied them to isolates from multiple clonal groups, including those associated with 39 listeriosis outbreaks. The cgMLST clusters were congruent with MLST-defined clonal groups, which had various degrees of diversity at the whole-genome level. Notably, cgMLST could distinguish among outbreak strains and epidemiologically unrelated strains of the same clonal group, which could not be achieved using classic MLST schemes. The precise selection of cgMLST gene targets may not be critical for the general identification of clonal groups and outbreak strains. cgMLST analyses further identified outbreak strains, including those associated with recent outbreaks linked to contaminated French-style cheese, Hispanic-style cheese, stone fruit, caramel apple, ice cream, and packaged leafy green salad, as belonging to major clonal groups. We further developed lineage-specific cgMLST schemes, which can include accessory genes when core genomes do not possess sufficient diversity, and this provided additional resolution over species-specific cgMLST. Analyses of isolates from different common-source listeriosis outbreaks revealed various degrees of diversity, indicating that the numbers of allelic differences should always be combined with cgMLST clustering and epidemiological evidence to define a listeriosis outbreak. IMPORTANCE Classic multilocus sequence typing (MLST) schemes targeting internal fragments of 6 to 8 genes that define clonal complexes or epidemic clones have been widely employed to study L. monocytogenes biodiversity and its relation to pathogenicity potential and epidemiology. We demonstrated

  6. Reptiles: a group of transition in the evolution of genome size and of the nucleotypic effect.

    PubMed

    Olmo, E

    2003-01-01

    A comparison between genome size and some phenotypic parameters, such as developmental length and metabolic rate, showed in reptiles a nucleotypic correlation similar to the one observed in birds and mammals. Indeed, like homeotherms, reptiles exhibit a highly significant, inverse correlation of genome size with metabolic rate but unlike amphibians, no relationship with developmental length. Several lines of evidence suggest that these nucleotypic correlations are influenced by body temperature, which also affects the guanine + cytosine nuclear percentage, and that they play an important role in the adaptation of these amniotes. However, the reptilian suborders exhibit differences in the quantitative and compositional characters of the genome that do not completely correspond to differences in the phenotypic parameters commonly involved in the nucleotypic effect. Thus, additional factors could have influenced genome size in this class. These data could be explained with the model of Hartl and Petrov, who observed an inverse correlation between genome size, non-coding portion of the genome and rate of DNA loss and hypothesized a strong role for different spectra of spontaneous insertions and deletions (indels) in the variations of genome size. It is thus reasonable to surmise that variations in the reptilian genome were initially influenced by different indels spectra typical of the diverse lineages, possibly related to different chromosome compartmentalizations. The consequent size increases or decreases would have influenced various morphological and functional cell parameters, and through these some phenotypic characteristics of the whole organism, especially the metabolic rate, very important for environmental adaptation and thus subject to natural selection. Through this "nucleotypic" bond, natural selection would also have controlled genome size variations.

  7. Complete genome sequence of Lactobacillus plantarum LZ95, a potential probiotic strain producing bacteriocins and B-group vitamin riboflavin.

    PubMed

    Li, Ping; Gu, Qing

    2016-07-10

    Lactobacillus plantarum LZ95 is a potential probiotic isolated from newborn infant fecal and it is identified to produce riboflavin with great antimicrobial activity. The complete genome sequence of this strain was reported in the present study. The genome contains a 3,261,418-bp chromosome and two plasmids. Genes, related to the biosynthesis of bacteriocins and riboflavin, were identified. This work will facilitate to reveal the biosynthetic mechanism of bacteriocins and B-group vitamins in lactic acid bacteria and provide evidence for its potential application in food industry.

  8. Comparative genomic hybridization and telomerase activity analysis identify two biologically different groups of 4s neuroblastomas.

    PubMed Central

    Brinkschmidt, C.; Poremba, C.; Christiansen, H.; Simon, R.; Schäfer, K. L.; Terpe, H. J.; Lampert, F.; Boecker, W.; Dockhorn-Dworniczak, B.

    1998-01-01

    Chromosomal aberrations of 20 stage 4s neuroblastomas were analysed by comparative genomic hybridization (CGH). In a subset of 13/20 tumours, telomerase activity was evaluated by the telomeric repeat amplification protocol (TRAP). The CGH data were compared with the CGH results of ten stage 1 and 2 (stage 1/2) and 22 stage 3 and 4 (stage 3/4) neuroblastomas. A total of 17/20 stage 4s neuroblastomas did not progress clinically, whereas tumour progression with lethal outcome occurred in 3/20 cases. The CGH data of clinically non-progressing stage 4s tumours revealed a high rate of whole-chromosome aberrations (73.4%) with an overrepresentation of mainly chromosomes 2, 6, 7, 12, 13, 17, 18 and an underrepresentation of mainly chromosomes 3, 4, 11, 14. MYCN amplification or 1p deletion was observed in only 1/27 or 2/17 clinically non-progressing stage 4s tumours respectively, whereas all three progressive stage 4s neuroblastomas showed MYCN amplification, 1p deletion and, in 2/3 cases, distal 17q gains. Except for one case, telomerase activity was not observed in non-progressing stage 4s neuroblastomas. In contrast, 4s tumours with lethal outcome revealed elevated telomerase activity levels. Our data suggest that stage 4s neuroblastomas belong to two biologically different groups, one of which displays the genetic features of localized stage 1/2 tumours, whereas the other mimics advanced stage 3/4 neuroblastomas. Images Figure 3 PMID:9649137

  9. Approaching confidentiality at a familial level in genomic medicine: a focus group study with healthcare professionals

    PubMed Central

    Dheensa, Sandi; Fenwick, Angela; Lucassen, Anneke

    2017-01-01

    Objectives Clinical genetics guidelines from 2011 conceptualise genetic information as confidential to families, not individuals. The normative consequence of this is that the family's interest is the primary consideration and genetic information is shared unless there are good reasons not to do so. We investigated healthcare professionals' (HCPs') views about, and reasoning around, individual and familial approaches to confidentiality and how such views influenced their practice. Method 16 focus groups with 80 HCPs working in/with clinical genetics services were analysed, drawing on grounded theory. Results Participants raised seven problems with, and arguments against, going beyond the individual approach to confidentiality. These problems fell into two overlapping categories: ‘relationships’ and ‘structures’. Most participants had never considered ways to—or thought it was impossible to—treat familial genetic information and personal information differently. They worried that putting the familial approach into practice could disrupt family dynamics and erode patient trust in the health service. They also thought they had insufficient resources to share information and feared that sharing might change the standard of care and make them more vulnerable to liability. Conclusions A familial approach to confidentiality has not been accepted or adopted as a standard, but wider research suggests that some of the problems HCPs perceived are surmountable and sharing in the interest of the family can be achieved. However, further research is needed to explore how personal and familial genetic information can be separated in practice. Our findings are relevant to HCPs across health services who are starting to use genome tests as part of their routine investigations. PMID:28159847

  10. A novel virus genome discovered in an extreme environment suggests recombination between unrelated groups of RNA and DNA viruses.

    PubMed

    Diemer, Geoffrey S; Stedman, Kenneth M

    2012-06-11

    Viruses are known to be the most abundant organisms on earth, yet little is known about their collective origin and evolutionary history. With exceptionally high rates of genetic mutation and mosaicism, it is not currently possible to resolve deep evolutionary histories of the known major virus groups. Metagenomics offers a potential means of establishing a more comprehensive view of viral evolution as vast amounts of new sequence data becomes available for comparative analysis. Bioinformatic analysis of viral metagenomic sequences derived from a hot, acidic lake revealed a circular, putatively single-stranded DNA virus encoding a major capsid protein similar to those found only in single-stranded RNA viruses. The presence and circular configuration of the complete virus genome was confirmed by inverse PCR amplification from native DNA extracted from lake sediment. The virus genome appears to be the result of a RNA-DNA recombination event between two ostensibly unrelated virus groups. Environmental sequence databases were examined for homologous genes arranged in similar configurations and three similar putative virus genomes from marine environments were identified. This result indicates the existence of a widespread but previously undetected group of viruses. This unique viral genome carries implications for theories of virus emergence and evolution, as no mechanism for interviral RNA-DNA recombination has yet been identified, and only scant evidence exists that genetic exchange occurs between such distinct virus lineages. This article was reviewed by EK, MK (nominated by PF) and AM. For the full reviews, please go to the Reviewers' comments section.

  11. Group-based variant calling leveraging next-generation supercomputing for large-scale whole-genome sequencing studies.

    PubMed

    Standish, Kristopher A; Carland, Tristan M; Lockwood, Glenn K; Pfeiffer, Wayne; Tatineni, Mahidhar; Huang, C Chris; Lamberth, Sarah; Cherkas, Yauheniya; Brodmerkel, Carrie; Jaeger, Ed; Smith, Lance; Rajagopal, Gunaretnam; Curran, Mark E; Schork, Nicholas J

    2015-09-22

    Next-generation sequencing (NGS) technologies have become much more efficient, allowing whole human genomes to be sequenced faster and cheaper than ever before. However, processing the raw sequence reads associated with NGS technologies requires care and sophistication in order to draw compelling inferences about phenotypic consequences of variation in human genomes. It has been shown that different approaches to variant calling from NGS data can lead to different conclusions. Ensuring appropriate accuracy and quality in variant calling can come at a computational cost. We describe our experience implementing and evaluating a group-based approach to calling variants on large numbers of whole human genomes. We explore the influence of many factors that may impact the accuracy and efficiency of group-based variant calling, including group size, the biogeographical backgrounds of the individuals who have been sequenced, and the computing environment used. We make efficient use of the Gordon supercomputer cluster at the San Diego Supercomputer Center by incorporating job-packing and parallelization considerations into our workflow while calling variants on 437 whole human genomes generated as part of large association study. We ultimately find that our workflow resulted in high-quality variant calls in a computationally efficient manner. We argue that studies like ours should motivate further investigations combining hardware-oriented advances in computing systems with algorithmic developments to tackle emerging 'big data' problems in biomedical research brought on by the expansion of NGS technologies.

  12. Draft Genome Sequences of Xanthomonas sacchari and Two Banana-Associated Xanthomonads Reveal Insights into the Xanthomonas Group 1 Clade

    PubMed Central

    Studholme, David J.; Wasukira, Arthur; Paszkiewicz, Konrad; Aritua, Valente; Thwaites, Richard; Smith, Julian; Grant, Murray

    2011-01-01

    We present draft genome sequences for three strains of Xanthomonas species, each of which was associated with banana plants (Musa species) but is not closely related to the previously sequenced banana-pathogen Xanthomonas campestris pathovar musacearum. Strain NCPPB4393 had been deposited as Xanthomonas campestris pathovar musacearum but in fact falls within the species Xanthomonas sacchari. Strain NCPPB1132 is more distantly related to Xanthomonas sacchari whilst strain NCPPB 1131 grouped in a distinct species-level clade related to X. sacchari, along with strains from ginger, rice, cotton and sugarcane. These three newly sequenced strains share many genomic features with the previously sequenced Xanthomonas albilineans, for example possessing an unsual metE allele and lacking the Hrp type III secretion system. However, they are distinct from Xanthomonas albilineans in many respects, for example showing little evidence of genome reduction. They also lack the SPI-1 type III secretion system found in Xanthomonas albilineans. Unlike X. albilineans, all three strains possess a gum gene cluster. The data reported here provide the first genome-wide survey of non-Hrp Xanthomonas species other than Xanthomonas albilineans, which is an atypical member of this group. We hope that the availability of complete sequence data for this group of organisms is the first step towards understanding their interactions with plants and identifying potential virulence factors. PMID:24710305

  13. Draft Genome Sequences of Xanthomonas sacchari and Two Banana-Associated Xanthomonads Reveal Insights into the Xanthomonas Group 1 Clade.

    PubMed

    Studholme, David J; Wasukira, Arthur; Paszkiewicz, Konrad; Aritua, Valente; Thwaites, Richard; Smith, Julian; Grant, Murray

    2011-12-02

    We present draft genome sequences for three strains of Xanthomonas species, each of which was associated with banana plants (Musa species) but is not closely related to the previously sequenced banana-pathogen Xanthomonas campestris pathovar musacearum. Strain NCPPB4393 had been deposited as Xanthomonas campestris pathovar musacearum but in fact falls within the species Xanthomonas sacchari. Strain NCPPB1132 is more distantly related to Xanthomonas sacchari whilst strain NCPPB 1131 grouped in a distinct species-level clade related to X. sacchari, along with strains from ginger, rice, cotton and sugarcane. These three newly sequenced strains share many genomic features with the previously sequenced Xanthomonas albilineans, for example possessing an unsual metE allele and lacking the Hrp type III secretion system. However, they are distinct from Xanthomonas albilineans in many respects, for example showing little evidence of genome reduction. They also lack the SPI-1 type III secretion system found in Xanthomonas albilineans. Unlike X. albilineans, all three strains possess a gum gene cluster. The data reported here provide the first genome-wide survey of non-Hrp Xanthomonas species other than Xanthomonas albilineans, which is an atypical member of this group. We hope that the availability of complete sequence data for this group of organisms is the first step towards understanding their interactions with plants and identifying potential virulence factors.

  14. Genome Sequence of a Lancefield Group C Streptococcus zooepidemicus Strain Causing Epidemic Nephritis: New Information about an Old Disease

    PubMed Central

    Beres, Stephen B.; Sesso, Ricardo; Pinto, Sergio Wyton L.; Hoe, Nancy P.; Porcella, Stephen F.; DeLeo, Frank R.; Musser, James M.

    2008-01-01

    Outbreaks of disease attributable to human error or natural causes can provide unique opportunities to gain new information about host-pathogen interactions and new leads for pathogenesis research. Poststreptococcal glomerulonephritis (PSGN), a sequela of infection with pathogenic streptococci, is a common cause of preventable kidney disease worldwide. Although PSGN usually occurs after infection with group A streptococci, organisms of Lancefield group C and G also can be responsible. Despite decades of study, the molecular pathogenesis of PSGN is poorly understood. As a first step toward gaining new information about PSGN pathogenesis, we sequenced the genome of Streptococcus equi subsp. zooepidemicus strain MGCS10565, a group C organism that caused a very large and unusually severe epidemic of nephritis in Brazil. The genome is a circular chromosome of 2,024,171 bp. The genome shares extensive gene content, including many virulence factors, with genetically related group A streptococci, but unexpectedly lacks prophages. The genome contains many apparently foreign genes interspersed around the chromosome, consistent with the presence of a full array of genes required for natural competence. An inordinately large family of genes encodes secreted extracellular collagen-like proteins with multiple integrin-binding motifs. The absence of a gene related to speB rules out the long-held belief that streptococcal pyrogenic exotoxin B or antibodies reacting with it singularly cause PSGN. Many proteins previously implicated in GAS PSGN, such as streptokinase, are either highly divergent in strain MGCS10565 or are not more closely related between these species than to orthologs present in other streptococci that do not commonly cause PSGN. Our analysis provides a comparative genomics framework for renewed appraisal of molecular events underlying APSGN pathogenesis. PMID:18716664

  15. The genome sequence of the incompatibility group Iγ plasmid R621a: evolution of IncI plasmids.

    PubMed

    Takahashi, Hiroyuki; Shao, Ming; Furuya, Nobuhisa; Komano, Teruya

    2011-07-01

    We present the complete genome sequence of the tetracycline resistance plasmid R621a isolated from Salmonella typhimurium, which belongs to the incompatibility group Iγ. In the 93,185bp circular double-stranded R621a genome, 96 complete ORFs are predicted. In addition, one and six different kinds of proteins are produced by translational reinitiation and shufflon multiple inversions, respectively. The genome consists of four regions: replication, leading, transfer, and miscellaneous regions. The R621a genome is similar to those of IncI1 plasmids such as R64 and ColIb-P9 and particularly to those of pEK204 and pEC_Bactec. Three major differences including inc, parAB, and excA regions were noted between R621a and prototype IncI1 plasmids. Seven nucleotide replacements and one nucleotide deletion in the putative Inc RNA sequence are found between R621a and IncI1 plasmids irrespective of close similarity in the other parts of the rep system. The sequences of R621a parAB and excA genes are significantly different from those of R64 and ColIb-P9, while those of R621a parAB and excA genes exhibit close similarity to those of pEK204 and pEC_Bactec, respectively. The R621a genome is suggested to be formed by acquiring parAB and excA genes from pEK204 and pEC_Bactec genomes, respectively, and then novel inc function by the mutations. The insertions in the R621a, pEK204, and pEC_Bactec genomes are flanked by direct repeats, suggesting that insertions accompanied by long target duplications have also played an important role in the evolution of IncI plasmids. Copyright © 2011 Elsevier Inc. All rights reserved.

  16. Insights into the evolution of Archaea and eukaryotic protein modifier systems revealed by the genome of a novel archaeal group.

    PubMed

    Nunoura, Takuro; Takaki, Yoshihiro; Kakuta, Jungo; Nishi, Shinro; Sugahara, Junichi; Kazama, Hiromi; Chee, Gab-Joo; Hattori, Masahira; Kanai, Akio; Atomi, Haruyuki; Takai, Ken; Takami, Hideto

    2011-04-01

    The domain Archaea has historically been divided into two phyla, the Crenarchaeota and Euryarchaeota. Although regarded as members of the Crenarchaeota based on small subunit rRNA phylogeny, environmental genomics and efforts for cultivation have recently revealed two novel phyla/divisions in the Archaea; the 'Thaumarchaeota' and 'Korarchaeota'. Here, we show the genome sequence of Candidatus 'Caldiarchaeum subterraneum' that represents an uncultivated crenarchaeotic group. A composite genome was reconstructed from a metagenomic library previously prepared from a microbial mat at a geothermal water stream of a sub-surface gold mine. The genome was found to be clearly distinct from those of the known phyla/divisions, Crenarchaeota (hyperthermophiles), Euryarchaeota, Thaumarchaeota and Korarchaeota. The unique traits suggest that this crenarchaeotic group can be considered as a novel archaeal phylum/division. Moreover, C. subterraneum harbors an ubiquitin-like protein modifier system consisting of Ub, E1, E2 and small Zn RING finger family protein with structural motifs specific to eukaryotic system proteins, a system clearly distinct from the prokaryote-type system recently identified in Haloferax and Mycobacterium. The presence of such a eukaryote-type system is unprecedented in prokaryotes, and indicates that a prototype of the eukaryotic protein modifier system is present in the Archaea.

  17. Insights into the evolution of Archaea and eukaryotic protein modifier systems revealed by the genome of a novel archaeal group

    PubMed Central

    Nunoura, Takuro; Takaki, Yoshihiro; Kakuta, Jungo; Nishi, Shinro; Sugahara, Junichi; Kazama, Hiromi; Chee, Gab-Joo; Hattori, Masahira; Kanai, Akio; Atomi, Haruyuki; Takai, Ken; Takami, Hideto

    2011-01-01

    The domain Archaea has historically been divided into two phyla, the Crenarchaeota and Euryarchaeota. Although regarded as members of the Crenarchaeota based on small subunit rRNA phylogeny, environmental genomics and efforts for cultivation have recently revealed two novel phyla/divisions in the Archaea; the ‘Thaumarchaeota’ and ‘Korarchaeota’. Here, we show the genome sequence of Candidatus ‘Caldiarchaeum subterraneum’ that represents an uncultivated crenarchaeotic group. A composite genome was reconstructed from a metagenomic library previously prepared from a microbial mat at a geothermal water stream of a sub-surface gold mine. The genome was found to be clearly distinct from those of the known phyla/divisions, Crenarchaeota (hyperthermophiles), Euryarchaeota, Thaumarchaeota and Korarchaeota. The unique traits suggest that this crenarchaeotic group can be considered as a novel archaeal phylum/division. Moreover, C. subterraneum harbors an ubiquitin-like protein modifier system consisting of Ub, E1, E2 and small Zn RING finger family protein with structural motifs specific to eukaryotic system proteins, a system clearly distinct from the prokaryote-type system recently identified in Haloferax and Mycobacterium. The presence of such a eukaryote-type system is unprecedented in prokaryotes, and indicates that a prototype of the eukaryotic protein modifier system is present in the Archaea. PMID:21169198

  18. Social and behavioral research in genomic sequencing: approaches from the Clinical Sequencing Exploratory Research Consortium Outcomes and Measures Working Group.

    PubMed

    Gray, Stacy W; Martins, Yolanda; Feuerman, Lindsay Z; Bernhardt, Barbara A; Biesecker, Barbara B; Christensen, Kurt D; Joffe, Steven; Rini, Christine; Veenstra, David; McGuire, Amy L

    2014-10-01

    The routine use of genomic sequencing in clinical medicine has the potential to dramatically alter patient care and medical outcomes. To fully understand the psychosocial and behavioral impact of sequencing integration into clinical practice, it is imperative that we identify the factors that influence sequencing-related decision making and patient outcomes. In an effort to develop a collaborative and conceptually grounded approach to studying sequencing adoption, members of the National Human Genome Research Institute's Clinical Sequencing Exploratory Research Consortium formed the Outcomes and Measures Working Group. Here we highlight the priority areas of investigation and psychosocial and behavioral outcomes identified by the Working Group. We also review some of the anticipated challenges to measurement in social and behavioral research related to genomic sequencing; opportunities for instrument development; and the importance of qualitative, quantitative, and mixed-method approaches. This work represents the early, shared efforts of multiple research teams as we strive to understand individuals' experiences with genomic sequencing. The resulting body of knowledge will guide recommendations for the optimal use of sequencing in clinical practice.

  19. The chimeric nature of the genomes of marine magnetotactic coccoid-ovoid bacteria defines a novel group of Proteobacteria.

    PubMed

    Ji, Boyang; Zhang, Sheng-Da; Zhang, Wei-Jia; Rouy, Zoe; Alberto, François; Santini, Claire-Lise; Mangenot, Sophie; Gagnot, Séverine; Philippe, Nadège; Pradel, Nathalie; Zhang, Lichen; Tempel, Sébastien; Li, Ying; Médigue, Claudine; Henrissat, Bernard; Coutinho, Pedro M; Barbe, Valérie; Talla, Emmanuel; Wu, Long-Fei

    2017-03-01

    Magnetotactic bacteria (MTB) are a group of phylogenetically and physiologically diverse Gram-negative bacteria that synthesize intracellular magnetic crystals named magnetosomes. MTB are affiliated with three classes of Proteobacteria phylum, Nitrospirae phylum, Omnitrophica phylum and probably with the candidate phylum Latescibacteria. The evolutionary origin and physiological diversity of MTB compared with other bacterial taxonomic groups remain to be illustrated. Here, we analysed the genome of the marine magneto-ovoid strain MO-1 and found that it is closely related to Magnetococcus marinus MC-1. Detailed analyses of the ribosomal proteins and whole proteomes of 390 genomes reveal that, among the Proteobacteria analysed, only MO-1 and MC-1 have coding sequences (CDSs) with a similarly high proportion of origins from Alphaproteobacteria, Betaproteobacteria, Deltaproteobacteria and Gammaproteobacteria. Interestingly, a comparative metabolic network analysis with anoxic network enzymes from sequenced MTB and non-MTB successfully allows the eventual prediction of an organism with a metabolic profile compatible for magnetosome production. Altogether, our genomic analysis reveals multiple origins of MO-1 and M. marinus MC-1 genomes and suggests a metabolism-restriction model for explaining whether a bacterium could become an MTB upon acquisition of magnetosome encoding genes. © 2016 Society for Applied Microbiology and John Wiley & Sons Ltd.

  20. Genomic analysis of Melioribacter roseus, facultatively anaerobic organotrophic bacterium representing a novel deep lineage within Bacteriodetes/Chlorobi group.

    PubMed

    Kadnikov, Vitaly V; Mardanov, Andrey V; Podosokorskaya, Olga A; Gavrilov, Sergey N; Kublanov, Ilya V; Beletsky, Alexey V; Bonch-Osmolovskaya, Elizaveta A; Ravin, Nikolai V

    2013-01-01

    Melioribacter roseus is a moderately thermophilic facultatively anaerobic organotrophic bacterium representing a novel deep branch within Bacteriodetes/Chlorobi group. To better understand the metabolic capabilities and possible ecological functions of M. roseus and get insights into the evolutionary history of this bacterial lineage, we sequenced the genome of the type strain P3M-2(T). A total of 2838 open reading frames was predicted from its 3.30 Mb genome. The whole proteome analysis supported phylum-level classification of M. roseus since most of the predicted proteins had closest matches in Bacteriodetes, Proteobacteria, Chlorobi, Firmicutes and deeply-branching bacterium Caldithrix abyssi, rather than in one particular phylum. Consistent with the ability of the bacterium to grow on complex carbohydrates, the genome analysis revealed more than one hundred glycoside hydrolases, glycoside transferases, polysaccharide lyases and carbohydrate esterases. The reconstructed central metabolism revealed pathways enabling the fermentation of complex organic substrates, as well as their complete oxidation through aerobic and anaerobic respiration. Genes encoding the photosynthetic and nitrogen-fixation machinery of green sulfur bacteria, as well as key enzymes of autotrophic carbon fixation pathways, were not identified. The M. roseus genome supports its affiliation to a novel phylum Ignavibateriae, representing the first step on the evolutionary pathway from heterotrophic ancestors of Bacteriodetes/Chlorobi group towards anaerobic photoautotrophic Chlorobi.

  1. Community Genomic and Proteomic Analyses of Chemoautotrophic Iron-Oxidizing "Leptospirillum rubarum" (Group II) and "Leptospirillum ferrodiazotrophum" (Group III) Bacteria in Acid Mine Drainage Biofilms

    SciTech Connect

    Goltsman, Daniela; Denef, Vincent; Singer, Steven; Verberkmoes, Nathan C; Lefsrud, Mark G; Mueller, Ryan; Dick, Gregory J.; Sun, Christine; Wheeler, Korin; Zelma, Adam; Baker, Brett J.; Hauser, Loren John; Land, Miriam L; Shah, Manesh B; Thelen, Michael P.; Hettich, Robert {Bob} L; Banfield, Jillian F.

    2009-01-01

    We analyzed near-complete population (composite) genomic sequences for coexisting acidophilic iron-oxidizing Leptospirillum group II and III bacteria (phylum Nitrospirae) and an extrachromosomal plasmid from a Richmond Mine, Iron Mountain, CA, acid mine drainage biofilm. Community proteomic analysis of the genomically characterized sample and two other biofilms identified 64.6% and 44.9% of the predicted proteins of Leptospirillum groups II and III, respectively, and 20% of the predicted plasmid proteins. The bacteria share 92% 16S rRNA gene sequence identity and >60% of their genes, including integrated plasmid-like regions. The extrachromosomal plasmid carries conjugation genes with detectable sequence similarity to genes in the integrated conjugative plasmid, but only those on the extrachromosomal element were identified by proteomics. Both bacterial groups have genes for community-essential functions, including carbon fixation and biosynthesis of vitamins, fatty acids, and biopolymers (including cellulose); proteomic analyses reveal these activities. Both Leptospirillum types have multiple pathways for osmotic protection. Although both are motile, signal transduction and methyl-accepting chemotaxis proteins are more abundant in Leptospirillum group III, consistent with its distribution in gradients within biofilms. Interestingly, Leptospirillum group II uses a methyl-dependent and Leptospirillum group III a methyl-independent response pathway. Although only Leptospirillum group III can fix nitrogen, these proteins were not identified by proteomics. The abundances of core proteins are similar in all communities, but the abundance levels of unique and shared proteins of unknown function vary. Some proteins unique to one organism were highly expressed and may be key to the functional and ecological differentiation of Leptospirillum groups II and III.

  2. Community genomic and proteomic analyses of chemoautotrophic iron-oxidizing "Leptospirillum rubarum" (Group II) and "Leptospirillum ferrodiazotrophum" (Group III) bacteria in acid mine drainage biofilms.

    PubMed

    Goltsman, Daniela S Aliaga; Denef, Vincent J; Singer, Steven W; VerBerkmoes, Nathan C; Lefsrud, Mark; Mueller, Ryan S; Dick, Gregory J; Sun, Christine L; Wheeler, Korin E; Zemla, Adam; Baker, Brett J; Hauser, Loren; Land, Miriam; Shah, Manesh B; Thelen, Michael P; Hettich, Robert L; Banfield, Jillian F

    2009-07-01

    We analyzed near-complete population (composite) genomic sequences for coexisting acidophilic iron-oxidizing Leptospirillum group II and III bacteria (phylum Nitrospirae) and an extrachromosomal plasmid from a Richmond Mine, Iron Mountain, CA, acid mine drainage biofilm. Community proteomic analysis of the genomically characterized sample and two other biofilms identified 64.6% and 44.9% of the predicted proteins of Leptospirillum groups II and III, respectively, and 20% of the predicted plasmid proteins. The bacteria share 92% 16S rRNA gene sequence identity and >60% of their genes, including integrated plasmid-like regions. The extrachromosomal plasmid carries conjugation genes with detectable sequence similarity to genes in the integrated conjugative plasmid, but only those on the extrachromosomal element were identified by proteomics. Both bacterial groups have genes for community-essential functions, including carbon fixation and biosynthesis of vitamins, fatty acids, and biopolymers (including cellulose); proteomic analyses reveal these activities. Both Leptospirillum types have multiple pathways for osmotic protection. Although both are motile, signal transduction and methyl-accepting chemotaxis proteins are more abundant in Leptospirillum group III, consistent with its distribution in gradients within biofilms. Interestingly, Leptospirillum group II uses a methyl-dependent and Leptospirillum group III a methyl-independent response pathway. Although only Leptospirillum group III can fix nitrogen, these proteins were not identified by proteomics. The abundances of core proteins are similar in all communities, but the abundance levels of unique and shared proteins of unknown function vary. Some proteins unique to one organism were highly expressed and may be key to the functional and ecological differentiation of Leptospirillum groups II and III.

  3. Complete genome sequence of Lactobacillus plantarum LZ227, a potential probiotic strain producing B-group vitamins.

    PubMed

    Li, Ping; Zhou, Qingqing; Gu, Qing

    2016-09-20

    B-group vitamins play an important role in human metabolism, whose deficiencies are associated with a variety of disorders and diseases. Certain microorganisms such as Lactic acid bacteria (LAB) have been shown to have capacities for B-group vitamin production and thus could potentially replace chemically synthesized vitamins for food fortification. A potential probiotic strain named Lactobacillus plantarum LZ227, which was isolated from raw cow milk in this study, exhibits the ability to produce B-group vitamins. Complete genome sequencing of LZ227 was performed to gain insights into the genetic elements involved in B-group vitamin production. The genome of LZ227 contains a circular 3,131,750-bp chromosome, three circular plasmids and two predicted linear plasmids. LZ227 also contains gene clusters for biosynthesis of both riboflavin and folate. This genome sequence provides a basis for further elucidation of its molecular genetics and probiotic functions, and will facilitate its applications as starter cultures in food industry. Copyright © 2016 Elsevier B.V. All rights reserved.

  4. Community genomic and proteomic analysis of chemoautotrophic, iron-oxidizing "Leptospirillum rubarum" (Group II) and Leptospirillum ferrodiazotrophum (Group III) in acid mine drainage biofilms

    SciTech Connect

    Goltsman, Daniela; Denef, Vincent; Singer, Steven; Verberkmoes, Nathan C; Lefsrud, Mark G; Mueller, Ryan; Dick, Gregory J.; Sun, Christine; Wheeler, Korin; Zelma, Adam; Baker, Brett J.; Hauser, Loren John; Land, Miriam L; Shah, Manesh B; Thelen, Michael P.; Hettich, Robert {Bob} L; Banfield, Jillian F.

    2009-01-01

    We analyzed near-complete population (composite) genomic sequences for coexisting acidophilic iron-oxidizing Leptospirillum Groups II and III bacteria (phylum Nitrospirae) and an extrachromosomal plasmid from a Richmond Mine, CA acid mine drainage (AMD) biofilm. Community proteomic analysis of the genomically characterized sample and two other biofilms identified 64.6% and 44.9% of the predicted proteins of Leptospirillum Groups II and III, respectively and 20% of the predicted plasmid proteins. The bacteria share 92% 16S rRNA gene sequence identity and > 60% of their genes, including integrated plasmid-like regions. The extrachromosomal plasmid encodes conjugation genes with detectable sequence similarity to genes in the integrated conjugative plasmid, but only those on the extrachromosomal element were identified by proteomics. Both bacteria have genes for community-essential functions, including carbon fixation, biosynthesis of vitamins, fatty acids and biopolymers (including cellulose); proteomic analyses reveal these activities. Both Leptospirillum types have multiple pathways for osmotic protection. Although both are motile, signal transduction and methyl-accepting chemotaxis proteins are more abundant in Leptospirillum Group III, consistent with its distribution in gradients within biofilms. Interestingly, Leptospirillum Group II uses a methyl-dependent and Leptospirillum Group III a methyl-independent response pathway. Although only Leptospirillum Group III can fix nitrogen, these proteins were not identified by proteomics. Abundances of core proteins are similar in all communities, but abundance levels of unique and shared proteins of unknown function vary. Some proteins unique to one organism were highly expressed and may be key to the functional and ecological differentiation of Leptospirillum Groups II and III.

  5. Comparative analysis of complete genome sequences of three avian coronaviruses reveals a novel group 3c coronavirus.

    PubMed

    Woo, Patrick C Y; Lau, Susanna K P; Lam, Carol S F; Lai, Kenneth K Y; Huang, Yi; Lee, Paul; Luk, Geraldine S M; Dyrting, Kitman C; Chan, Kwok-Hung; Yuen, Kwok-Yung

    2009-01-01

    In this territory-wide molecular epidemiology study of coronaviruses (CoVs) in Hong Kong involving 1,541 dead wild birds, three novel CoVs were identified in three different bird families (bulbul CoV HKU11 [BuCoV HKU11], thrush CoV HKU12 [ThCoV HKU12], and munia CoV HKU13 [MuCoV HKU13]). Four complete genomes of the three novel CoVs were sequenced. Their genomes (26,396 to 26,552 bases) represent the smallest known CoV genomes. In phylogenetic trees constructed using chymotrypsin-like protease (3CL(pro)), RNA-dependent RNA polymerase (Pol), helicase, spike, and nucleocapsid proteins, BuCoV HKU11, ThCoV HKU12, and MuCoV HKU13 formed a cluster distantly related to infectious bronchitis virus and turkey CoV (group 3a CoVs). For helicase, spike, and nucleocapsid, they were also clustered with a CoV recently discovered in Asian leopard cats, for which the complete genome sequence was not available. The 3CL(pro), Pol, helicase, and nucleocapsid of the three CoVs possessed higher amino acid identities to those of group 3a CoVs than to those of group 1 and group 2 CoVs. Unique genomic features distinguishing them from other group 3 CoVs include a distinct transcription regulatory sequence and coding potential for small open reading frames. Based on these results, we propose a novel CoV subgroup, group 3c, to describe this distinct subgroup of CoVs under the group 3 CoVs. Avian CoVs are genetically more diverse than previously thought and may be closely related to some newly identified mammalian CoVs. Further studies would be important to delineate whether the Asian leopard cat CoV was a result of interspecies jumping from birds, a situation analogous to that of bat and civet severe acute respiratory syndrome CoVs.

  6. Group-based and personalized care in an age of genomic and evidence-based medicine: a reappraisal.

    PubMed

    Maglo, Koffi N

    2012-01-01

    This article addresses the philosophical and moral foundations of group-based and individualized therapy in connection with population care equality. The U.S. Food and Drug Administration (FDA) recently modified its public health policy by seeking to enhance the efficacy and equality of care through the approval of group-specific prescriptions and doses for some drugs. In the age of genomics, when individualization of care increasingly has become a major concern, investigating the relationship between population health, stratified medicine, and personalized therapy can improve our understanding of the ethical and biomedical implications of genomic medicine. I suggest that the need to optimize population health through population substructure-sensitive research and the need to individualize care through genetically targeted therapies are not necessarily incompatible. Accordingly, the article reconceptualizes a unified goal for modern scientific medicine in terms of individualized equal care.

  7. Comparative studies of transcriptional regulation mechanisms in a group of eight gamma-proteobacterial genomes.

    PubMed

    Espinosa, Vladimir; González, Abel D; Vasconcelos, Ana T; Huerta, Araceli M; Collado-Vides, Julio

    2005-11-18

    Experimental data on the Escherichia coli transcriptional regulation has enabled the construction of statistical models to predict new regulatory elements within its genome. Far less is known about the transcriptional regulatory elements in other gamma-proteobacteria with sequenced genomes, so it is of great interest to conduct comparative genomic studies oriented to extracting biologically relevant information about transcriptional regulation in these less studied organisms using the knowledge from E. coli. In this work, we use the information stored in the TRACTOR_DB database to conduct a comparative study on the mechanisms of transcriptional regulation in eight gamma-proteobacteria and 38 regulons. We assess the conservation of transcription factors binding specificity across all the eight genomes and show a correlation between the conservation of a regulatory site and the structure of the transcription unit it regulates. We also find a marked conservation of site-promoter distances across the eight organisms and a correspondence of the statistical significance of co-occurrence of pairs of transcription factor binding sites in the regulatory regions, which is probably related to a conserved architecture of higher-order regulatory complexes in the organisms studied. The results obtained in this study using the information on transcriptional regulation in E. coli enable us to conclude that not only transcription factor-binding sites are conserved across related species but also several of the transcriptional regulatory mechanisms previously identified in E. coli.

  8. Telithromycin Susceptibility and Genomic Diversity of Macrolide-Resistant Serotype III Group B Streptococci Isolated in Perinatal Infections

    PubMed Central

    Bingen, Edouard; Doit, Catherine; Bidet, Philippe; Brahimi, Naima; Deforche, Dominique

    2004-01-01

    We studied the telithromycin, erythromycin, azithromycin, and clindamycin susceptibilities of serotype III macrolide-resistant group B streptococci, together with genetic mechanisms of resistance and genomic diversity. ermB, ermA, and mefA were found in, respectively, 57, 32, and 9% of isolates. The telithromycin MIC at which 90% of isolates were inhibited was 0.5 μg/ml. Macrolide resistance was associated with dissemination of resistance determinants among isolates of different genetic backgrounds. PMID:14742237

  9. The genome characteristics and predicted function of methyl-group oxidation pathway in the obligate aceticlastic methanogens, Methanosaeta spp.

    PubMed

    Zhu, Jinxing; Zheng, Huajun; Ai, Guomin; Zhang, Guishan; Liu, Di; Liu, Xiaoli; Dong, Xiuzhu

    2012-01-01

    In this work, we report the complete genome sequence of an obligate aceticlastic methanogen, Methanosaeta harundinacea 6Ac. Genome comparison indicated that the three cultured Methanosaeta spp., M. thermophila, M. concilii and M. harundinacea 6Ac, each carry an entire suite of genes encoding the proteins involved in the methyl-group oxidation pathway, a pathway whose function is not well documented in the obligately aceticlastic methanogens. Phylogenetic analysis showed that the methyl-group oxidation-involving proteins, Fwd, Mtd, Mch, and Mer from Methanosaeta strains cluster with the methylotrophic methanogens, and were not closely related to those from the hydrogenotrophic methanogens. Quantitative PCR detected the expression of all genes for this pathway, albeit ten times lower than the genes for aceticlastic methanogenesis in strain 6Ac. Western blots also revealed the expression of fwd and mch, genes involved in methyl-group oxidation. Moreover, (13)C-labeling experiments suggested that the Methanosaeta strains might use the pathway as a methyl oxidation shunt during the aceticlastic metabolism. Because the mch mutants of Methanosarcina barkeri or M. acetivorans failed to grow on acetate, we suggest that Methanosaeta may use methyl-group oxidation pathway to generate reducing equivalents, possibly for biomass synthesis. An fpo operon, which encodes an electron transport complex for the reduction of CoM-CoB heterodisulfide, was found in the three genomes of the Methanosaeta strains. However, an incomplete protein complex lacking the FpoF subunit was predicted, as the gene for this protein was absent. Thus, F(420)H(2) was predicted not to serve as the electron donor. In addition, two gene clusters encoding the two types of heterodisulfide reductase (Hdr), hdrABC, and hdrED, respectively, were found in the three Methanosaeta genomes. Quantitative PCR determined that the expression of hdrED was about ten times higher than hdrABC, suggesting that hdrED plays a

  10. Identification, characterization, and comparative genomic distribution of the HERV-K (HML-2) group of human endogenous retroviruses

    PubMed Central

    2011-01-01

    Background Integration of retroviral DNA into a germ cell may lead to a provirus that is transmitted vertically to that host's offspring as an endogenous retrovirus (ERV). In humans, ERVs (HERVs) comprise about 8% of the genome, the vast majority of which are truncated and/or highly mutated and no longer encode functional genes. The most recently active retroviruses that integrated into the human germ line are members of the Betaretrovirus-like HERV-K (HML-2) group, many of which contain intact open reading frames (ORFs) in some or all genes, sometimes encoding functional proteins that are expressed in various tissues. Interestingly, this expression is upregulated in many tumors ranging from breast and ovarian tissues to lymphomas and melanomas, as well as schizophrenia, rheumatoid arthritis, and other disorders. Results No study to date has characterized all HML-2 elements in the genome, an essential step towards determining a possible functional role of HML-2 expression in disease. We present here the most comprehensive and accurate catalog of all full-length and partial HML-2 proviruses, as well as solo LTR elements, within the published human genome to date. Furthermore, we provide evidence for preferential maintenance of proviruses and solo LTR elements on gene-rich chromosomes of the human genome and in proximity to gene regions. Conclusions Our analysis has found and corrected several errors in the annotation of HML-2 elements in the human genome, including mislabeling of a newly identified group called HML-11. HML-elements have been implicated in a wide array of diseases, and characterization of these elements will play a fundamental role to understand the relationship between endogenous retrovirus expression and disease. PMID:22067224

  11. The first detection and whole genome characterization of the G6P[15] group A rotavirus strain from roe deer.

    PubMed

    Jamnikar-Ciglenecki, Urska; Kuhar, Urska; Sturm, Sabina; Kirbis, Andrej; Racki, Nejc; Steyer, Andrej

    2016-08-15

    Although rotaviruses have been detected in a variety of host species, there are only limited records of their occurrence in deer, where their role is unknown. In this study, group A rotavirus was identified in roe deer during a study of enteric viruses in game animals. 102 samples of intestinal content were collected from roe deer (56), wild boars (29), chamois (10), red deer (6) and mouflon (1), but only one sample from roe deer was positive. Following whole genome sequence analysis, the rotavirus strain D38/14 was characterized by next generation sequencing. The genotype constellation, comprising 11 genome segments, was G6-P[15]-I2-R2-C2-M2-A3-N2-T6-E2-H3. Phylogenetic analysis of the VP7 genome segment showed that the D38/14 rotavirus strain is closely related to the various G6 zoonotic rotavirus strains of bovine-like origin frequently detected in humans. In the VP4 segment, this strain showed high variation compared to that in the P[15] strain found in sheep and in a goat. This finding suggests that rotaviruses from deer are similar to those in other DS-1 rotavirus groups and could constitute a source of zoonotically transmitted rotaviruses. The epidemiological status of group A rotaviruses in deer should be further investigated.

  12. Genomic analysis of NAC transcription factors in banana (Musa acuminata) and definition of NAC orthologous groups for monocots and dicots.

    PubMed

    Cenci, Albero; Guignon, Valentin; Roux, Nicolas; Rouard, Mathieu

    2014-05-01

    Identifying the molecular mechanisms underlying tolerance to abiotic stresses is important in crop breeding. A comprehensive understanding of the gene families associated with drought tolerance is therefore highly relevant. NAC transcription factors form a large plant-specific gene family involved in the regulation of tissue development and responses to biotic and abiotic stresses. The main goal of this study was to set up a framework of orthologous groups determined by an expert sequence comparison of NAC genes from both monocots and dicots. In order to clarify the orthologous relationships among NAC genes of different species, we performed an in-depth comparative study of four divergent taxa, in dicots and monocots, whose genomes have already been completely sequenced: Arabidopsis thaliana, Vitis vinifera, Musa acuminata and Oryza sativa. Due to independent evolution, NAC copy number is highly variable in these plant genomes. Based on an expert NAC sequence comparison, we propose forty orthologous groups of NAC sequences that were probably derived from an ancestor gene present in the most recent common ancestor of dicots and monocots. These orthologous groups provide a curated resource for large-scale protein sequence annotation of NAC transcription factors. The established orthology relationships also provide a useful reference for NAC function studies in newly sequenced genomes such as M. acuminata and other plant species.

  13. Survey of chimeric IStron elements in bacterial genomes: multiple molecular symbioses between group I intron ribozymes and DNA transposons

    PubMed Central

    Tourasse, Nicolas J.; Stabell, Fredrik B.; Kolstø, Anne-Brit

    2014-01-01

    IStrons are chimeric genetic elements composed of a group I intron associated with an insertion sequence (IS). The group I intron is a catalytic RNA providing the IStron with self-splicing ability, which renders IStron insertions harmless to the host genome. The IS element is a DNA transposon conferring mobility, and thus allowing the IStron to spread in genomes. IStrons are therefore a striking example of a molecular symbiosis between unrelated genetic elements endowed with different functions. In this study, we have conducted the first comprehensive survey of IStrons in sequenced genomes that provides insights into the distribution, diversity, origin and evolution of IStrons. We show that IStrons have a restricted phylogenetic distribution limited to two bacterial phyla, the Firmicutes and the Fusobacteria. Nevertheless, diverse IStrons representing two major groups targeting different insertion site motifs were identified. This taken with the finding that while the intron components of all IStrons belong to the same structural class, they are fused to different IS families, indicates that multiple intron–IS symbioses have occurred during evolution. In addition, introns and IS elements related to those that were at the origin of IStrons were also identified. PMID:25324310

  14. A core phylogeny of Dictyostelia inferred from genomes representative of the eight major and minor taxonomic divisions of the group.

    PubMed

    Singh, Reema; Schilde, Christina; Schaap, Pauline

    2016-11-17

    Dictyostelia are a well-studied group of organisms with colonial multicellularity, which are members of the mostly unicellular Amoebozoa. A phylogeny based on SSU rDNA data subdivided all Dictyostelia into four major groups, but left the position of the root and of six group-intermediate taxa unresolved. Recent phylogenies inferred from 30 or 213 proteins from sequenced genomes, positioned the root between two branches, each containing two major groups, but lacked data to position the group-intermediate taxa. Since the positions of these early diverging taxa are crucial for understanding the evolution of phenotypic complexity in Dictyostelia, we sequenced six representative genomes of early diverging taxa. We retrieved orthologs of 47 housekeeping proteins with an average size of 890 amino acids from six newly sequenced and eight published genomes of Dictyostelia and unicellular Amoebozoa and inferred phylogenies from single and concatenated protein sequence alignments. Concatenated alignments of all 47 proteins, and four out of five subsets of nine concatenated proteins all produced the same consensus phylogeny with 100% statistical support. Trees inferred from just two out of the 47 proteins, individually reproduced the consensus phylogeny, highlighting that single gene phylogenies will rarely reflect correct species relationships. However, sets of two or three concatenated proteins again reproduced the consensus phylogeny, indicating that a small selection of genes suffices for low cost classification of as yet unincorporated or newly discovered dictyostelid and amoebozoan taxa by gene amplification. The multi-locus consensus phylogeny shows that groups 1 and 2 are sister clades in branch I, with the group-intermediate taxon D. polycarpum positioned as outgroup to group 2. Branch II consists of groups 3 and 4, with the group-intermediate taxon Polysphondylium violaceum positioned as sister to group 4, and the group-intermediate taxon Dictyostelium polycephalum

  15. A novel virus genome discovered in an extreme environment suggests recombination between unrelated groups of RNA and DNA viruses

    PubMed Central

    2012-01-01

    Background Viruses are known to be the most abundant organisms on earth, yet little is known about their collective origin and evolutionary history. With exceptionally high rates of genetic mutation and mosaicism, it is not currently possible to resolve deep evolutionary histories of the known major virus groups. Metagenomics offers a potential means of establishing a more comprehensive view of viral evolution as vast amounts of new sequence data becomes available for comparative analysis. Results Bioinformatic analysis of viral metagenomic sequences derived from a hot, acidic lake revealed a circular, putatively single-stranded DNA virus encoding a major capsid protein similar to those found only in single-stranded RNA viruses. The presence and circular configuration of the complete virus genome was confirmed by inverse PCR amplification from native DNA extracted from lake sediment. The virus genome appears to be the result of a RNA-DNA recombination event between two ostensibly unrelated virus groups. Environmental sequence databases were examined for homologous genes arranged in similar configurations and three similar putative virus genomes from marine environments were identified. This result indicates the existence of a widespread but previously undetected group of viruses. Conclusions This unique viral genome carries implications for theories of virus emergence and evolution, as no mechanism for interviral RNA-DNA recombination has yet been identified, and only scant evidence exists that genetic exchange occurs between such distinct virus lineages. Reviewers This article was reviewed by EK, MK (nominated by PF) and AM. For the full reviews, please go to the Reviewers' comments section. PMID:22515485

  16. Social evolution. Genomic signatures of evolutionary transitions from solitary to group living.

    PubMed

    Kapheim, Karen M; Pan, Hailin; Li, Cai; Salzberg, Steven L; Puiu, Daniela; Magoc, Tanja; Robertson, Hugh M; Hudson, Matthew E; Venkat, Aarti; Fischman, Brielle J; Hernandez, Alvaro; Yandell, Mark; Ence, Daniel; Holt, Carson; Yocum, George D; Kemp, William P; Bosch, Jordi; Waterhouse, Robert M; Zdobnov, Evgeny M; Stolle, Eckart; Kraus, F Bernhard; Helbing, Sophie; Moritz, Robin F A; Glastad, Karl M; Hunt, Brendan G; Goodisman, Michael A D; Hauser, Frank; Grimmelikhuijzen, Cornelis J P; Pinheiro, Daniel Guariz; Nunes, Francis Morais Franco; Soares, Michelle Prioli Miranda; Tanaka, Érica Donato; Simões, Zilá Luz Paulino; Hartfelder, Klaus; Evans, Jay D; Barribeau, Seth M; Johnson, Reed M; Massey, Jonathan H; Southey, Bruce R; Hasselmann, Martin; Hamacher, Daniel; Biewer, Matthias; Kent, Clement F; Zayed, Amro; Blatti, Charles; Sinha, Saurabh; Johnston, J Spencer; Hanrahan, Shawn J; Kocher, Sarah D; Wang, Jun; Robinson, Gene E; Zhang, Guojie

    2015-06-05

    The evolution of eusociality is one of the major transitions in evolution, but the underlying genomic changes are unknown. We compared the genomes of 10 bee species that vary in social complexity, representing multiple independent transitions in social evolution, and report three major findings. First, many important genes show evidence of neutral evolution as a consequence of relaxed selection with increasing social complexity. Second, there is no single road map to eusociality; independent evolutionary transitions in sociality have independent genetic underpinnings. Third, though clearly independent in detail, these transitions do have similar general features, including an increase in constrained protein evolution accompanied by increases in the potential for gene regulation and decreases in diversity and abundance of transposable elements. Eusociality may arise through different mechanisms each time, but would likely always involve an increase in the complexity of gene networks.

  17. Phylogenetic analysis of two Plectus mitochondrial genomes (Nematoda: Plectida) supports a sister group relationship between Plectida and Rhabditida within Chromadorea.

    PubMed

    Kim, Jiyeon; Kern, Elizabeth; Kim, Taeho; Sim, Mikang; Kim, Jaebum; Kim, Yuseob; Park, Chungoo; Nadler, Steven A; Park, Joong-Ki

    2017-02-01

    Plectida is an important nematode order with species that occupy many different biological niches. The order includes free-living aquatic and soil-dwelling species, but its phylogenetic position has remained uncertain. We sequenced the complete mitochondrial genomes of two members of this order, Plectus acuminatus and Plectus aquatilis and compared them with those of other major nematode clades. The genome size and base composition of these species are similar to other nematodes; 14,831 and 14,372bp, respectively, with AT contents of 71.0% and 70.1%. Gene content was also similar to other nematodes, but gene order and coding direction of Plectus mtDNAs were dissimilar from other chromadorean species. P. acuminatus and P. aquatilis are the first chromadorean species found to contain a gene inversion. We reconstructed mitochondrial genome phylogenetic trees using nucleotide and amino acid datasets from 87 nematodes that represent major nematode clades, including the Plectus sequences. Trees from phylogenetic analyses using maximum likelihood and Bayesian methods depicted Plectida as the sister group to other sequenced chromadorean nematodes. This finding is consistent with several phylogenetic results based on SSU rDNA, but disagrees with a classification based on morphology. Mitogenomes representing other basal chromadorean groups (Araeolaimida, Monhysterida, Desmodorida, Chromadorida) are needed to confirm their phylogenetic relationships. Copyright © 2016 Elsevier Inc. All rights reserved.

  18. Complete Genome Sequence and Comparative Genomic Analysis of Mycobacterium massiliense JCM 15300 in the Mycobacterium abscessus Group Reveal a Conserved Genomic Island MmGI-1 Related to Putative Lipid Metabolism

    PubMed Central

    Nakanaga, Kazue; Nakata, Noboru; Kazumi, Yuko; Maeda, Shinji; Makino, Masahiko; Hoshino, Yoshihiko; Kuroda, Makoto

    2014-01-01

    Mycobacterium abscessus group subsp., such as M. massiliense, M. abscessus sensu stricto and M. bolletii, are an environmental organism found in soil, water and other ecological niches, and have been isolated from respiratory tract infection, skin and soft tissue infection, postoperative infection of cosmetic surgery. To determine the unique genetic feature of M. massiliense, we sequenced the complete genome of M. massiliense type strain JCM 15300 (corresponding to CCUG 48898). Comparative genomic analysis was performed among Mycobacterium spp. and among M. abscessus group subspp., showing that additional ß-oxidation-related genes and, notably, the mammalian cell entry (mce) operon were located on a genomic island, M. massiliense Genomic Island 1 (MmGI-1), in M. massiliense. In addition, putative anaerobic respiration system-related genes and additional mycolic acid cyclopropane synthetase-related genes were found uniquely in M. massiliense. Japanese isolates of M. massiliense also frequently possess the MmGI-1 (14/44, approximately 32%) and three unique conserved regions (26/44; approximately 60%, 34/44; approximately 77% and 40/44; approximately 91%), as well as isolates of other countries (Malaysia, France, United Kingdom and United States). The well-conserved genomic island MmGI-1 may play an important role in high growth potential with additional lipid metabolism, extra factors for survival in the environment or synthesis of complex membrane-associated lipids. ORFs on MmGI-1 showed similarities to ORFs of phylogenetically distant M. avium complex (MAC), suggesting that horizontal gene transfer or genetic recombination events might have occurred within MmGI-1 among M. massiliense and MAC. PMID:25503461

  19. Insights into the strategies used by related group II introns to adapt successfully for the colonisation of a bacterial genome.

    PubMed

    Martínez-Rodríguez, Laura; García-Rodríguez, Fernando M; Molina-Sánchez, María Dolores; Toro, Nicolás; Martínez-Abarca, Francisco

    2014-01-01

    Group II introns are self-splicing RNAs and site-specific mobile retroelements found in bacterial and organellar genomes. The group II intron RmInt1 is present at high copy number in Sinorhizobium meliloti species, and has a multifunctional intron-encoded protein (IEP) with reverse transcriptase/maturase activities, but lacking the DNA-binding and endonuclease domains. We characterized two RmInt1-related group II introns RmInt2 from S. meliloti strain GR4 and Sr.md.I1 from S. medicae strain WSM419 in terms of splicing and mobility activities. We used both wild-type and engineered intron-donor constructs based on ribozyme ΔORF-coding sequence derivatives, and we determined the DNA target requirements for RmInt2, the element most distantly related to RmInt1. The excision and mobility patterns of intron-donor constructs expressing different combinations of IEP and intron RNA provided experimental evidence for the co-operation of IEPs and intron RNAs from related elements in intron splicing and, in some cases, in intron homing. We were also able to identify the DNA target regions recognized by these IEPs lacking the DNA endonuclease domain. Our results provide new insight into the versatility of related group II introns and the possible co-operation between these elements to facilitate the colonization of bacterial genomes.

  20. A time-varying group sparse additive model for genome-wide association studies of dynamic complex traits.

    PubMed

    Marchetti-Bowick, Micol; Yin, Junming; Howrylak, Judie A; Xing, Eric P

    2016-10-01

    Despite the widespread popularity of genome-wide association studies (GWAS) for genetic mapping of complex traits, most existing GWAS methodologies are still limited to the use of static phenotypes measured at a single time point. In this work, we propose a new method for association mapping that considers dynamic phenotypes measured at a sequence of time points. Our approach relies on the use of Time-Varying Group Sparse Additive Models (TV-GroupSpAM) for high-dimensional, functional regression. This new model detects a sparse set of genomic loci that are associated with trait dynamics, and demonstrates increased statistical power over existing methods. We evaluate our method via experiments on synthetic data and perform a proof-of-concept analysis for detecting single nucleotide polymorphisms associated with two phenotypes used to assess asthma severity: forced vital capacity, a sensitive measure of airway obstruction and bronchodilator response, which measures lung response to bronchodilator drugs. Source code for TV-GroupSpAM freely available for download at http://www.cs.cmu.edu/~mmarchet/projects/tv_group_spam, implemented in MATLAB. epxing@cs.cmu.edu Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  1. Insights into the strategies used by related group II introns to adapt successfully for the colonisation of a bacterial genome

    PubMed Central

    Martínez-Rodríguez, Laura; García-Rodríguez, Fernando M; Molina-Sánchez, María Dolores; Toro, Nicolás; Martínez-Abarca, Francisco

    2014-01-01

    Group II introns are self-splicing RNAs and site-specific mobile retroelements found in bacterial and organellar genomes. The group II intron RmInt1 is present at high copy number in Sinorhizobium meliloti species, and has a multifunctional intron-encoded protein (IEP) with reverse transcriptase/maturase activities, but lacking the DNA-binding and endonuclease domains. We characterized two RmInt1-related group II introns RmInt2 from S. meliloti strain GR4 and Sr.md.I1 from S. medicae strain WSM419 in terms of splicing and mobility activities. We used both wild-type and engineered intron-donor constructs based on ribozyme ΔORF-coding sequence derivatives, and we determined the DNA target requirements for RmInt2, the element most distantly related to RmInt1. The excision and mobility patterns of intron-donor constructs expressing different combinations of IEP and intron RNA provided experimental evidence for the co-operation of IEPs and intron RNAs from related elements in intron splicing and, in some cases, in intron homing. We were also able to identify the DNA target regions recognized by these IEPs lacking the DNA endonuclease domain. Our results provide new insight into the versatility of related group II introns and the possible co-operation between these elements to facilitate the colonization of bacterial genomes. PMID:25482895

  2. The genomes, proteomes, and structures of three novel phages that infect the Bacillus cereus group and carry putative virulence factors.

    PubMed

    Grose, Julianne H; Belnap, David M; Jensen, Jordan D; Mathis, Andrew D; Prince, John T; Merrill, Bryan D; Burnett, Sandra H; Breakwell, Donald P

    2014-10-01

    This article reports the results of studying three novel bacteriophages, JL, Shanette, and Basilisk, which infect the pathogen Bacillus cereus and carry genes that may contribute to its pathogenesis. We analyzed host range and superinfection ability, mapped their genomes, and characterized phage structure by mass spectrometry and transmission electron microscopy (TEM). The JL and Shanette genomes were 96% similar and contained 217 open reading frames (ORFs) and 220 ORFs, respectively, while Basilisk has an unrelated genome containing 138 ORFs. Mass spectrometry revealed 23 phage particle proteins for JL and 15 for Basilisk, while only 11 and 4, respectively, were predicted to be present by sequence analysis. Structural protein homology to well-characterized phages suggested that JL and Shanette were members of the family Myoviridae, which was confirmed by TEM. The third phage, Basilisk, was similar only to uncharacterized phages and is an unrelated siphovirus. Cryogenic electron microscopy of this novel phage revealed a T=9 icosahedral capsid structure with the major capsid protein (MCP) likely having the same fold as bacteriophage HK97 MCP despite the lack of sequence similarity. Several putative virulence factors were encoded by these phage genomes, including TerC and TerD involved in tellurium resistance. Host range analysis of all three phages supports genetic transfer of such factors within the B. cereus group, including B. cereus, B. anthracis, and B. thuringiensis. This study provides a basis for understanding these three phages and other related phages as well as their contributions to the pathogenicity of B. cereus group bacteria. Importance: The Bacillus cereus group of bacteria contains several human and plant pathogens, including B. cereus, B. anthracis, and B. thuringiensis. Phages are intimately linked to the evolution of their bacterial hosts and often provide virulence factors, making the study of B. cereus phages important to understanding the

  3. The Genomes, Proteomes, and Structures of Three Novel Phages That Infect the Bacillus cereus Group and Carry Putative Virulence Factors

    PubMed Central

    Belnap, David M.; Jensen, Jordan D.; Mathis, Andrew D.; Prince, John T.; Merrill, Bryan D.; Burnett, Sandra H.; Breakwell, Donald P.

    2014-01-01

    ABSTRACT This article reports the results of studying three novel bacteriophages, JL, Shanette, and Basilisk, which infect the pathogen Bacillus cereus and carry genes that may contribute to its pathogenesis. We analyzed host range and superinfection ability, mapped their genomes, and characterized phage structure by mass spectrometry and transmission electron microscopy (TEM). The JL and Shanette genomes were 96% similar and contained 217 open reading frames (ORFs) and 220 ORFs, respectively, while Basilisk has an unrelated genome containing 138 ORFs. Mass spectrometry revealed 23 phage particle proteins for JL and 15 for Basilisk, while only 11 and 4, respectively, were predicted to be present by sequence analysis. Structural protein homology to well-characterized phages suggested that JL and Shanette were members of the family Myoviridae, which was confirmed by TEM. The third phage, Basilisk, was similar only to uncharacterized phages and is an unrelated siphovirus. Cryogenic electron microscopy of this novel phage revealed a T=9 icosahedral capsid structure with the major capsid protein (MCP) likely having the same fold as bacteriophage HK97 MCP despite the lack of sequence similarity. Several putative virulence factors were encoded by these phage genomes, including TerC and TerD involved in tellurium resistance. Host range analysis of all three phages supports genetic transfer of such factors within the B. cereus group, including B. cereus, B. anthracis, and B. thuringiensis. This study provides a basis for understanding these three phages and other related phages as well as their contributions to the pathogenicity of B. cereus group bacteria. IMPORTANCE The Bacillus cereus group of bacteria contains several human and plant pathogens, including B. cereus, B. anthracis, and B. thuringiensis. Phages are intimately linked to the evolution of their bacterial hosts and often provide virulence factors, making the study of B. cereus phages important to understanding

  4. Comparative genomics of a plant-parasitic nematode endosymbiont suggest a role in nutritional symbiosis

    USDA-ARS?s Scientific Manuscript database

    Bacterial mutualists can increase the biochemical capacity of animals. Highly co-evolved nutritional mutualists do this by synthesizing nutrients missing from the host's diet. Genomics tools have recently advanced the study of these partnerships. Here we examined the endosymbiont Xiphinematobacter (...

  5. Comparative genomics of a plant-parasitic nematode endosymbiont suggest a role in nutritional symbiosis

    USDA-ARS?s Scientific Manuscript database

    Bacterial mutualists can increase the biochemical capacity of animals. Highly co-evolved nutritional mutualists do this by synthesizing nutrients missing from the host's diet. Genomics tools have recently advanced the study of these partnerships. Here we examined the endosymbiont Xiphinematobacter (...

  6. Viruses within animal genomes.

    PubMed

    De Brognier, A; Willems, L

    2016-04-01

    Viruses and their hosts can co-evolve to reach a fragile equilibrium that allows the survival of both. An excess of pathogenicity in the absence of a reservoir would be detrimental to virus survival. A significant proportion of all animal genomes has been shaped by the insertion of viruses that subsequently became 'fossilised'. Most endogenous viruses have lost the capacity to replicate via an infectious cycle and now replicate passively. The insertion of endogenous viruses has contributed to the evolution of animal genomes, for example in the reproductive biology of mammals. However, spontaneous viral integration still occasionally occurs in a number of virus-host systems. This constitutes a potential risk to host survival but also provides an opportunity for diversification and evolution.

  7. EHR Big Data Deep Phenotyping. Contribution of the IMIA Genomic Medicine Working Group.

    PubMed

    Frey, L J; Lenert, L; Lopez-Campos, G

    2014-08-15

    Given the quickening speed of discovery of variant disease drivers from combined patient genotype and phenotype data, the objective is to provide methodology using big data technology to support the definition of deep phenotypes in medical records. As the vast stores of genomic information increase with next generation sequencing, the importance of deep phenotyping increases. The growth of genomic data and adoption of Electronic Health Records (EHR) in medicine provides a unique opportunity to integrate phenotype and genotype data into medical records. The method by which collections of clinical findings and other health related data are leveraged to form meaningful phenotypes is an active area of research. Longitudinal data stored in EHRs provide a wealth of information that can be used to construct phenotypes of patients. We focus on a practical problem around data integration for deep phenotype identification within EHR data. The use of big data approaches are described that enable scalable markup of EHR events that can be used for semantic and temporal similarity analysis to support the identification of phenotype and genotype relationships. Stead and colleagues' 2005 concept of using light standards to increase the productivity of software systems by riding on the wave of hardware/processing power is described as a harbinger for designing future healthcare systems. The big data solution, using flexible markup, provides a route to improved utilization of processing power for organizing patient records in genotype and phenotype research.

  8. Genome Sequence of Enterobacter cloacae Strain SENG-6, a Bacterium Producing Histo-Blood Group Antigen-Like Substances That Can Bind with Human Noroviruses

    PubMed Central

    Amarasiri, Mohan; Hashiba, Satoshi; Yang, Peiyi; Okabe, Satoshi

    2016-01-01

    Enterobacter sp. strain SENG-6, isolated from healthy human feces, produces histo-blood group antigen (HBGA)-like substances that can bind with human noroviruses. Based on the genome sequence analysis, strain SENG-6 belongs to the species Enterobacter cloacae. The genome sequence of this strain should help identify genes associated with the production of HBGA-like substances. PMID:27563051

  9. Genome Sequence of Enterobacter cloacae Strain SENG-6, a Bacterium Producing Histo-Blood Group Antigen-Like Substances That Can Bind with Human Noroviruses.

    PubMed

    Ishii, Satoshi; Amarasiri, Mohan; Hashiba, Satoshi; Yang, Peiyi; Okabe, Satoshi; Sano, Daisuke

    2016-08-25

    Enterobacter sp. strain SENG-6, isolated from healthy human feces, produces histo-blood group antigen (HBGA)-like substances that can bind with human noroviruses. Based on the genome sequence analysis, strain SENG-6 belongs to the species Enterobacter cloacae The genome sequence of this strain should help identify genes associated with the production of HBGA-like substances.

  10. The genome and linkage map of the northern pike (Esox lucius): conserved synteny revealed between the salmonid sister group and the Neoteleostei.

    PubMed

    Rondeau, Eric B; Minkley, David R; Leong, Jong S; Messmer, Amber M; Jantzen, Johanna R; von Schalburg, Kristian R; Lemon, Craig; Bird, Nathan H; Koop, Ben F

    2014-01-01

    The northern pike is the most frequently studied member of the Esociformes, the closest order to the diverse and economically important Salmoniformes. The ancestor of all salmonids purportedly experienced a whole-genome duplication (WGD) event, making salmonid species ideal for studying the early impacts of genome duplication while complicating their use in wider analyses of teleost evolution. Studies suggest that the Esociformes diverged from the salmonid lineage prior to the WGD, supporting the use of northern pike as a pre-duplication outgroup. Here we present the first genome assembly, reference transcriptome and linkage map for northern pike, and evaluate the suitability of this species to provide a representative pre-duplication genome for future studies of salmonid and teleost evolution. The northern pike genome sequence is composed of 94,267 contigs (N50 = 16,909 bp) contained in 5,688 scaffolds (N50 = 700,535 bp); the total scaffolded genome size is 878 million bases. Multiple lines of evidence suggest that over 96% of the protein-coding genome is present in the genome assembly. The reference transcriptome was constructed from 13 tissues and contains 38,696 transcripts, which are accompanied by normalized expression data in all tissues. Gene-prediction analysis produced a total of 19,601 northern pike-specific gene models. The first-generation linkage map identifies 25 linkage groups, in agreement with northern pike's diploid karyotype of 2N = 50, and facilitates the placement of 46% of assembled bases onto linkage groups. Analyses reveal a high degree of conserved synteny between northern pike and other model teleost genomes. While conservation of gene order is limited to smaller syntenic blocks, the wider conservation of genome organization implies the northern pike exhibits a suitable approximation of a non-duplicated Protacanthopterygiian genome. This dataset will facilitate future studies of esocid biology and empower ongoing examinations of the

  11. Population genomic analysis of strain variation in Leptospirillum group II bacteria involved in acid mine drainage formation.

    PubMed

    Simmons, Sheri L; Dibartolo, Genevieve; Denef, Vincent J; Goltsman, Daniela S Aliaga; Thelen, Michael P; Banfield, Jillian F

    2008-07-22

    Deeply sampled community genomic (metagenomic) datasets enable comprehensive analysis of heterogeneity in natural microbial populations. In this study, we used sequence data obtained from the dominant member of a low-diversity natural chemoautotrophic microbial community to determine how coexisting closely related individuals differ from each other in terms of gene sequence and gene content, and to uncover evidence of evolutionary processes that occur over short timescales. DNA sequence obtained from an acid mine drainage biofilm was reconstructed, taking into account the effects of strain variation, to generate a nearly complete genome tiling path for a Leptospirillum group II species closely related to L. ferriphilum (sampling depth approximately 20x). The population is dominated by one sequence type, yet we detected evidence for relatively abundant variants (>99.5% sequence identity to the dominant type) at multiple loci, and a few rare variants. Blocks of other Leptospirillum group II types ( approximately 94% sequence identity) have recombined into one or more variants. Variant blocks of both types are more numerous near the origin of replication. Heterogeneity in genetic potential within the population arises from localized variation in gene content, typically focused in integrated plasmid/phage-like regions. Some laterally transferred gene blocks encode physiologically important genes, including quorum-sensing genes of the LuxIR system. Overall, results suggest inter- and intrapopulation genetic exchange involving distinct parental genome types and implicate gain and loss of phage and plasmid genes in recent evolution of this Leptospirillum group II population. Population genetic analyses of single nucleotide polymorphisms indicate variation between closely related strains is not maintained by positive selection, suggesting that these regions do not represent adaptive differences between strains. Thus, the most likely explanation for the observed patterns of

  12. Exploring the Potential Emotional and Behavioural Impact of Providing Personalised Genomic Risk Information to the Public: A Focus Group Study.

    PubMed

    Smit, Amelia K; Keogh, Louise A; Newson, Ainsley J; Hersch, Jolyn; Butow, Phyllis; Cust, Anne E

    2015-01-01

    To explore the potential emotional and behavioural impact of providing information on personalised genomic risk to the public, using melanoma as an example, to aid research translation. We conducted four focus groups in which 34 participants were presented with a hypothetical scenario of an individual's lifetime genomic risk of melanoma (using the term 'genetic risk'). We asked about understanding of genetic risk, who would choose to receive this risk information, potential emotional and behavioural impacts, and other concerns or potential benefits. Data were analysed thematically. Participants thought this risk information could potentially motivate preventive behaviours such as sun protection and related it to screening for other diseases including breast cancer. Factors identified as influencing the decision to receive genetic risk information included education level, children, age and gender. Participants identified potential negative impacts on the recipient such as anxiety and worry, and proposed that this could be mitigated by providing additional explanatory and prevention information, and contact details of a health professional for further discussion. Participants' concerns included workplace and insurance discrimination. Participants recognised the potential for both positive and negative emotional and behavioural impacts related to receiving information on the personalised genomic risk of melanoma. © 2015 S. Karger AG, Basel.

  13. Comparative analysis of the complete mitochondrial genomes of three geographical topmouth culter (Culter alburnus) groups and implications for their phylogenetics.

    PubMed

    Shi, Jianwu; Wang, Dexia; Wang, Junhua; Sheng, Junqing; Peng, Kou; Hu, Beijuan; Zeng, Liugen; Xiao, Minghe; Hong, Yijiang

    2017-03-01

    Topmouth culter (C. alburnus) is an important commercial fish in China. We compared the nucleotide variations in the mtDNA genomes among three geographical groups of Culter alburnus: Liangzi Lake, Hubei Province (referred to as LZH); Taihu Lake, Jiangsu Province (TH); and Poyang Lake, Jiangxi Province (PYH). The similarity of whole mtDNA genomes ranged from 0.992 to 0.999. The similarity among 13 protein-coding genes, 2 rRNA genes, and the D-loop sequences was found to range from 0.982 to 0.996. This is useful data for future designing work for making specific molecular marker for distinguishing individuals of C. alburnus from the three geographical groups. An extended termination-associated sequence (ETAS) and several conserved blocks (CSB-F, CSB-E, CSB-D, CSB1, CSB2, and CSB3) were identified in the mtDNA control regions. A phylogenetic analysis shows a monophyletic relationship of the LZF-female and the LZF-male. However, the analysis also showed paraphyletic relationships for the other two geological groups. This result will be useful for the future breeding work of C. alburnus.

  14. Admixture patterns and genetic differentiation in negrito groups from West Malaysia estimated from genome-wide SNP data.

    PubMed

    Jinam, Timothy A; Phipps, Maude E; Saitou, Naruya

    2013-01-01

    Southeast Asia houses various culturally and linguistically diverse ethnic groups. In Malaysia, where the Malay, Chinese, and Indian ethnic groups form the majority, there exist minority groups such as the "negritos" who are believed to be descendants of the earliest settlers of Southeast Asia. Here we report patterns of genetic substructure and admixture in two Malaysian negrito populations (Jehai and Kensiu), using ~50,000 genome-wide single-nucleotide polymorphism (SNP) data. We found traces of recent admixture in both the negrito populations, particularly in the Jehai, with the Malay through principal component analysis and STRUCTURE analysis software, which suggested that the admixture was as recent as one generation ago. We also identified significantly differentiated nonsynonymous SNPs and haplotype blocks related to intracellular transport, metabolic processes, and detection of stimulus. These results highlight the different levels of admixture experienced by the two Malaysian negritos. Delineating admixture and differentiated genomic regions should be of importance in designing and interpretation of molecular anthropology and disease association studies.

  15. Genomic study of the Ket: a Paleo-Eskimo-related ethnic group with significant ancient North Eurasian ancestry

    PubMed Central

    Flegontov, Pavel; Changmai, Piya; Zidkova, Anastassiya; Logacheva, Maria D.; Altınışık, N. Ezgi; Flegontova, Olga; Gelfand, Mikhail S.; Gerasimov, Evgeny S.; Khrameeva, Ekaterina E.; Konovalova, Olga P.; Neretina, Tatiana; Nikolsky, Yuri V.; Starostin, George; Stepanova, Vita V.; Travinsky, Igor V.; Tříska, Martin; Tříska, Petr; Tatarinova, Tatiana V.

    2016-01-01

    The Kets, an ethnic group in the Yenisei River basin, Russia, are considered the last nomadic hunter-gatherers of Siberia, and Ket language has no transparent affiliation with any language family. We investigated connections between the Kets and Siberian and North American populations, with emphasis on the Mal’ta and Paleo-Eskimo ancient genomes, using original data from 46 unrelated samples of Kets and 42 samples of their neighboring ethnic groups (Uralic-speaking Nganasans, Enets, and Selkups). We genotyped over 130,000 autosomal SNPs, identified mitochondrial and Y-chromosomal haplogroups, and performed high-coverage genome sequencing of two Ket individuals. We established that Nganasans, Kets, Selkups, and Yukaghirs form a cluster of populations most closely related to Paleo-Eskimos in Siberia (not considering indigenous populations of Chukotka and Kamchatka). Kets are closely related to modern Selkups and to some Bronze and Iron Age populations of the Altai region, with all these groups sharing a high degree of Mal’ta ancestry. Implications of these findings for the linguistic hypothesis uniting Ket and Na-Dene languages into a language macrofamily are discussed. PMID:26865217

  16. Genomic Analysis of the Emergence and Rapid Global Dissemination of the Clonal Group 258 Klebsiella pneumoniae Pandemic.

    PubMed

    Bowers, Jolene R; Kitchel, Brandon; Driebe, Elizabeth M; MacCannell, Duncan R; Roe, Chandler; Lemmer, Darrin; de Man, Tom; Rasheed, J Kamile; Engelthaler, David M; Keim, Paul; Limbago, Brandi M

    2015-01-01

    Multidrug-resistant Klebsiella pneumoniae producing the KPC carbapenemase have rapidly spread throughout the world, causing severe healthcare-associated infections with limited antimicrobial treatment options. Dissemination of KPC-producing K. pneumoniae is largely attributed to expansion of a single dominant strain, ST258. In this study, we explore phylogenetic relationships and evolution within ST258 and its clonal group, CG258, using whole genome sequence analysis of 167 isolates from 20 countries collected over 17 years. Our results show a common ST258 ancestor emerged from its diverse parental clonal group around 1995 and likely acquired blaKPC prior to dissemination. Over the past two decades, ST258 has remained highly clonal despite diversity in accessory elements and divergence in the capsule polysaccharide synthesis locus. Apart from the large recombination event that gave rise to ST258, few mutations set it apart from its clonal group. However, one mutation occurs in a global transcription regulator. Characterization of outer membrane protein sequences revealed a profile in ST258 that includes a truncated OmpK35 and modified OmpK37. Our work illuminates potential genomic contributors to the pathogenic success of ST258, helps us better understand the global dissemination of this strain, and identifies genetic markers unique to ST258.

  17. Genomic study of the Ket: a Paleo-Eskimo-related ethnic group with significant ancient North Eurasian ancestry.

    PubMed

    Flegontov, Pavel; Changmai, Piya; Zidkova, Anastassiya; Logacheva, Maria D; Altınışık, N Ezgi; Flegontova, Olga; Gelfand, Mikhail S; Gerasimov, Evgeny S; Khrameeva, Ekaterina E; Konovalova, Olga P; Neretina, Tatiana; Nikolsky, Yuri V; Starostin, George; Stepanova, Vita V; Travinsky, Igor V; Tříska, Martin; Tříska, Petr; Tatarinova, Tatiana V

    2016-02-11

    The Kets, an ethnic group in the Yenisei River basin, Russia, are considered the last nomadic hunter-gatherers of Siberia, and Ket language has no transparent affiliation with any language family. We investigated connections between the Kets and Siberian and North American populations, with emphasis on the Mal'ta and Paleo-Eskimo ancient genomes, using original data from 46 unrelated samples of Kets and 42 samples of their neighboring ethnic groups (Uralic-speaking Nganasans, Enets, and Selkups). We genotyped over 130,000 autosomal SNPs, identified mitochondrial and Y-chromosomal haplogroups, and performed high-coverage genome sequencing of two Ket individuals. We established that Nganasans, Kets, Selkups, and Yukaghirs form a cluster of populations most closely related to Paleo-Eskimos in Siberia (not considering indigenous populations of Chukotka and Kamchatka). Kets are closely related to modern Selkups and to some Bronze and Iron Age populations of the Altai region, with all these groups sharing a high degree of Mal'ta ancestry. Implications of these findings for the linguistic hypothesis uniting Ket and Na-Dene languages into a language macrofamily are discussed.

  18. RotaC: a web-based tool for the complete genome classification of group A rotaviruses.

    PubMed

    Maes, Piet; Matthijnssens, Jelle; Rahman, Mustafizur; Van Ranst, Marc

    2009-11-23

    Group A rotaviruses are the most common cause of severe diarrhea in infants and children worldwide and continue to have a major global impact on childhood morbidity and mortality. In recent years, considerable research efforts have been devoted to the development of two new live, orally administered vaccines. Although both vaccines have proven to confer a good protection against severe rotavirus gastroenteritis, these vaccines will have to be screened and may have to be updated regularly to reflect temporal and spatial genotype fluctuations. In this matter, the genetic characterization of circulating and new emerging rotavirus strains will need to be compulsory and accurate. An extended classification system for rotaviruses in which all the 11 genomic RNA segments are used, has been proposed recently. The use of this classification system will help to elucidate the role of gene reassortments in the generation of genetic diversity, host range restriction, co-segregation of certain gene segments, and in adaptation to a new host species. Here we present a web-based tool that can be used for fast rotavirus genotype differentiation of all 11 group A rotavirus gene segments according to the new guidelines proposed by the Rotavirus Classification Working Group (RCWG). With the increasing sequencing efforts that are being conducted around the world to unravel complete rotavirus genomes of human and animal origin, this tool will be of great help to analyze and correctly classify the large amount of new data. The web-based tool is freely available at http://rotac.regatools.be.

  19. Genome-wide association study of HIV-associated neurocognitive disorder (HAND): A CHARTER group study.

    PubMed

    Jia, Peilin; Zhao, Zhongming; Hulgan, Todd; Bush, William S; Samuels, David C; Bloss, Cinnamon S; Heaton, Robert K; Ellis, Ronald J; Schork, Nicholas; Marra, Christina M; Collier, Ann C; Clifford, David B; Gelman, Benjamin B; Sacktor, Ned; Morgello, Susan; Simpson, David M; McCutchan, J Allen; Barnholtz-Sloan, Jill S; Franklin, Donald R; Rosario, Debralee; Letendre, Scott L; Grant, Igor; Kallianpur, Asha R

    2017-06-01

    HIV-associated neurocognitive disorder (HAND) often complicates HIV infection despite combination antiretroviral therapy (ART) and may be influenced by host genomics. We performed a genome-wide association study (GWAS) of HAND in 1,050 CNS HIV Anti-Retroviral Therapy Effects Research (CHARTER) Study participants. All participants underwent standardized, comprehensive neurocognitive, and neuromedical assessments to determine if they had cognitive impairment as assessed by the Global Deficit Score (GDS), and individuals with comorbidities that could confound diagnosis of HAND were excluded. Neurocognitive outcomes included GDS-defined neurocognitive impairment (NCI; binary GDS, 366 cases with GDS ≥ 0.5 and 684 controls with GDS < 0.5, and GDS as a continuous variable) and Frascati HAND definitions that incorporate assessment of functional impairment by self-report and performance-based criteria. Genotype data were obtained using the Affymetrix Human SNP Array 6.0 platform. Multivariable logistic or linear regression-based association tests were performed for GDS-defined NCI and HAND. GWAS results did not reveal SNPs meeting the genome-wide significance threshold (5.0 × 10(-8) ) for GDS-defined NCI or HAND. For binary GDS, the most significant SNPs were rs6542826 (P = 8.1 × 10(-7) ) and rs11681615 (1.2 × 10(-6) ), both located on chromosome 2 in SH3RF3. The most significant SNP for continuous GDS was rs11157436 (P = 1.3 × 10(-7) ) on chromosome 14 in the T-cell-receptor alpha locus; three other SNPs in this gene were also associated with binary GDS (P ≤ 2.9 × 10(-6) ). This GWAS, conducted among ART-era participants from a single cohort with robust neurological phenotyping, suggests roles for several biologically plausible loci in HAND that deserve further exploration. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

  20. Genome-wide Association Study of Atazanavir Pharmacokinetics and Hyperbilirubinemia in AIDS Clinical Trials Group Protocol A5202

    PubMed Central

    Johnson, Daniel H.; Venuto, Charles; Ritchie, Marylyn D.; Morse, Gene D.; Daar, Eric S.; McLaren, Paul J.; Haas, David W.

    2014-01-01

    Background Atazanavir-associated hyperbilirubinemia can cause premature discontinuation of atazanavir and avoidance of its initial prescribing. We used genome-wide genotyping and clinical data to characterize determinants of atazanavir pharmacokinetics and hyperbilirubinemia in AIDS Clinical Trials Group protocol A5202. Methods Plasma atazanavir pharmacokinetics and indirect bilirubin concentrations were characterized in HIV-1-infected subjects randomized to atazanavir/ritonavir-containing regimens. A subset had genome-wide genotype data available. Results Genome-wide assay data were available from 542 subjects, of who 475 also had estimated atazanavir clearance and relevant covariate data available. Peak bilirubin concentration and relevant covariates were available for 443 participants. By multivariate analysis, higher peak on-treatment bilirubin was associated with UGT1A1 rs887829 T allele (P=6.4×10−12), higher baseline hemoglobin (P=4.9×10−13), higher baseline bilirubin (P=6.7×10−12), and slower plasma atazanavir clearance (P=8.6×10−11). For peak bilirubin >3.0 mg/dL, the positive predictive value of baseline bilirubin ≥0.5 mg/dL with hemoglobin ≥14g/dL was 0.51, which increased to 0.85 with rs887829 TT homozygosity. For peak bilirubin ≤3.0 mg/dL, the positive predictive value of baseline bilirubin <0.5 mg/dL with hemoglobin <14 g/dL was 0.91, which increased to 0.96 with rs887829 CC homozygosity. No polymorphism predicted atazanavir pharmacokinetics at genome-wide significance. Conclusions Atazanavir-associated hyperbilirubinemia is best predicted by considering UGT1A1 genotype, baseline bilirubin, and baseline hemoglobin values in combination. Use of ritonavir as a pharmacokinetic enhancer may have abrogated genetic associations with atazanavir pharmacokinetics. PMID:24557078

  1. Genome sequence of Shimia str. SK013, a representative of the Roseobacter group isolated from marine sediment

    DOE PAGES

    Kanukollu, Saranya; Voget, Sonja; Pohlner, Marion; ...

    2016-03-12

    Shimia strain SK013 is an aerobic, Gram-negative, rod shaped alphaproteobacterium affiliated with the Roseobacter group within the family Rhodobacteraceae. The strain was isolated from surface sediment (0-1 cm) of the Skagerrak at 114 m below sea level. The 4,049,808 bp genome of Shimia str. SK013 comprises 3,981 protein-coding genes and 47 RNA genes. It contains one chromosome and no extrachromosomal elements. The genome analysis revealed the presence of genes for a dimethylsulfoniopropionate lyase, demethylase and the trimethylamine methyltransferase (mttB) as well as genes for nitrate, nitrite and dimethyl sulfoxide reduction. This indicates that Shimia str. SK013 is able to switchmore » from aerobic to anaerobic metabolism and thus is capable of aerobic and anaerobic sulfur cycling at the seafloor. Among the ability to convert other sulfur compounds it has the genetic capacity to produce climatically active dimethyl sulfide. Growth on glutamate as a sole carbon source results in formation of cell-connecting filaments, a putative phenotypic adaptation of the surface-associated strain to the environmental conditions at the seafloor. Genome analysis revealed the presence of a flagellum (fla1) and a type IV pilus biogenesis, which is speculated to be a prerequisite for biofilm formation. This is also related to genes responsible for signalling such as N-acyl homoserine lactones, as well as quip-genes responsible for quorum quenching and antibiotic biosynthesis. Pairwise similarities of 16S rRNA genes (98.56 % sequence similarity to the next relative S. haliotis) and the in silico DNA-DNA hybridization (21.20 % sequence similarity to S. haliotis) indicated Shimia str. SK013 to be considered as a new species. In conclusion, the genome analysis of Shimia str. SK013 offered first insights into specific physiological and phenotypic adaptation mechanisms of Roseobacter-affiliated bacteria to the benthic environment.« less

  2. Implications of Genome-Based Discrimination between Clostridium botulinum Group I and Clostridium sporogenes Strains for Bacterial Taxonomy

    PubMed Central

    Weigand, Michael R.; Pena-Gonzalez, Angela; Shirey, Timothy B.; Broeker, Robin G.; Ishaq, Maliha K.; Konstantinidis, Konstantinos T.

    2015-01-01

    Taxonomic classification of Clostridium botulinum is based on the production of botulinum neurotoxin (BoNT), while closely related, nontoxic organisms are classified as Clostridium sporogenes. However, this taxonomic organization does not accurately mirror phylogenetic relationships between these species. A phylogenetic reconstruction using 2,016 orthologous genes shared among strains of C. botulinum group I and C. sporogenes clearly separated these two species into discrete clades which showed ∼93% average nucleotide identity (ANI) between them. Clustering of strains based on the presence of variable orthologs revealed 143 C. sporogenes clade-specific genetic signatures, a subset of which were further evaluated for their ability to correctly classify a panel of presumptive C. sporogenes strains by PCR. Genome sequencing of several C. sporogenes strains lacking these signatures confirmed that they clustered with C. botulinum strains in a core genome phylogenetic tree. Our analysis also identified C. botulinum strains that contained C. sporogenes clade-specific signatures and phylogenetically clustered with C. sporogenes strains. The genome sequences of two bont/B2-containing strains belonging to the C. sporogenes clade contained regions with similarity to a bont-bearing plasmid (pCLD), while two different strains belonging to the C. botulinum clade carried bont/B2 on the chromosome. These results indicate that bont/B2 was likely acquired by C. sporogenes strains through horizontal gene transfer. The genome-based classification of these species used to identify candidate genes for the development of rapid assays for molecular identification may be applicable to additional bacterial species that are challenging with respect to their classification. PMID:26048939

  3. Implications of Genome-Based Discrimination between Clostridium botulinum Group I and Clostridium sporogenes Strains for Bacterial Taxonomy.

    PubMed

    Weigand, Michael R; Pena-Gonzalez, Angela; Shirey, Timothy B; Broeker, Robin G; Ishaq, Maliha K; Konstantinidis, Konstantinos T; Raphael, Brian H

    2015-08-15

    Taxonomic classification of Clostridium botulinum is based on the production of botulinum neurotoxin (BoNT), while closely related, nontoxic organisms are classified as Clostridium sporogenes. However, this taxonomic organization does not accurately mirror phylogenetic relationships between these species. A phylogenetic reconstruction using 2,016 orthologous genes shared among strains of C. botulinum group I and C. sporogenes clearly separated these two species into discrete clades which showed ∼93% average nucleotide identity (ANI) between them. Clustering of strains based on the presence of variable orthologs revealed 143 C. sporogenes clade-specific genetic signatures, a subset of which were further evaluated for their ability to correctly classify a panel of presumptive C. sporogenes strains by PCR. Genome sequencing of several C. sporogenes strains lacking these signatures confirmed that they clustered with C. botulinum strains in a core genome phylogenetic tree. Our analysis also identified C. botulinum strains that contained C. sporogenes clade-specific signatures and phylogenetically clustered with C. sporogenes strains. The genome sequences of two bont/B2-containing strains belonging to the C. sporogenes clade contained regions with similarity to a bont-bearing plasmid (pCLD), while two different strains belonging to the C. botulinum clade carried bont/B2 on the chromosome. These results indicate that bont/B2 was likely acquired by C. sporogenes strains through horizontal gene transfer. The genome-based classification of these species used to identify candidate genes for the development of rapid assays for molecular identification may be applicable to additional bacterial species that are challenging with respect to their classification. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  4. Recent Proliferation and Translocation of Pollen Group 1 Allergen Genes in the Maize Genome1[W][OA

    PubMed Central

    Valdivia, Elene R.; Sampedro, Javier; Lamb, Jonathan C.; Chopra, Surinder; Cosgrove, Daniel J.

    2007-01-01

    The dominant allergenic components of grass pollen are known by immunologists as group 1 allergens. These constitute a set of closely related proteins from the β-expansin family and have been shown to have cell wall-loosening activity. Group 1 allergens may facilitate the penetration of pollen tubes through the grass stigma and style. In maize (Zea mays), group 1 allergens are divided into two classes, A and B. We have identified 15 genes encoding group 1 allergens in maize, 11 genes in class A and four genes in class B, as well as seven pseudogenes. The genes in class A can be divided by sequence relatedness into two complexes, whereas the genes in class B constitute a single complex. Most of the genes identified are represented in pollen-specific expressed sequence tag libraries and are under purifying selection, despite the presence of multiple copies that are nearly identical. Group 1 allergen genes are clustered in at least six different genomic locations. The single class B location and one of the class A locations show synteny with the rice (Oryza sativa) regions where orthologous genes are found. Both classes are expressed at high levels in mature pollen but at low levels in immature flowers. The set of genes encoding maize group 1 allergens is more complex than originally anticipated. If this situation is common in grasses, it may account for the large number of protein variants, or group 1 isoallergens, identified previously in turf grass pollen by immunologists. PMID:17220362

  5. Production of hemolysin BL by Bacillus cereus group isolates of dairy origin is associated with whole-genome phylogenetic clade.

    PubMed

    Kovac, Jasna; Miller, Rachel A; Carroll, Laura M; Kent, David J; Jian, Jiahui; Beno, Sarah M; Wiedmann, Martin

    2016-08-09

    Bacillus cereus group isolates that produce diarrheal or emetic toxins are frequently isolated from raw milk and, in spore form, can survive pasteurization. Several species within the B. cereus group are closely related and cannot be reliably differentiated by established taxonomical criteria. While B. cereus is traditionally recognized as the principal causative agent of foodborne disease in this group, there is a need to better understand the distribution and expression of different toxin and virulence genes among B. cereus group food isolates to facilitate reliable characterization that allows for assessment of the likelihood of a given isolate to cause a foodborne disease. We performed whole genome sequencing of 22 B. cereus group dairy isolates, which represented considerable genetic diversity not covered by other isolates characterized to date. Maximum likelihood analysis of these genomes along with 47 reference genomes representing eight validly published species revealed nine phylogenetic clades. Three of these clades were represented by a single species (B. toyonensis -clade V, B. weihenstephanensis - clade VI, B. cytotoxicus - VII), one by two dairy-associated isolates (clade II; representing a putative new species), one by two species (B. mycoides, B. pseudomycoides - clade I) and four by three species (B. cereus, B. thuringiensis, B. anthracis - clades III-a, b, c and IV). Homologues of genes encoding a principal diarrheal enterotoxin (hemolysin BL) were distributed across all, except the B. cytotoxicus clade. Using a lateral flow immunoassay, hemolysin BL was detected in 13 out of 18 isolates that carried hblACD genes. Isolates from clade III-c (which included B. cereus and B. thuringiensis) consistently did not carry hblACD and did not produce hemolysin BL. Isolates from clade IV (B. cereus, B. thuringiensis) consistently carried hblACD and produced hemolysin BL. Compared to others, clade IV was significantly (p = 0.0001) more likely to produce

  6. Comparative genomic analysis of Pseudomonas aeruginosa phage PaMx25 reveals a novel siphovirus group related to phages infecting hosts of different taxonomic classes.

    PubMed

    Flores, Víctor; Sepúlveda-Robles, Omar; Cazares, Adrián; Kameyama, Luis; Guarneros, Gabriel

    2017-08-01

    Bacteriophages (phages) are estimated to be the most abundant and diverse entities in the biosphere harboring vast amounts of novel genetic information. Despite the genetic diversity observed, many phages share common features, such as virion morphology, genome size and organization, and can readily be associated with clearly defined phage groups. However, other phages display unique genomes or, alternatively, mosaic genomes composed of regions that share homology with those of phages of diverse origins; thus, their relationships cannot be easily assessed. In this work, we present a functional and comparative genomic analysis of Pseudomonas aeruginosa phage PaMx25, a virulent member of the Siphoviridae family. The genomes of PaMx25 and a highly homologous phage NP1, bore sequence homology and synteny with the genomes of phages that infect hosts different than Pseudomonas. In order to understand the relationship of the PaMx25 genome with that of other phages, we employed several computational approaches. We found that PaMx25 and NP1 effectively bridged several phage groups. It is expected that as more phage genomes become available, more gaps will be filled, blurring the boundaries that currently separate phage groups.

  7. Genomic Characterisation of Three Mapputta Group Viruses, a Serogroup of Australian and Papua New Guinean Bunyaviruses Associated with Human Disease

    PubMed Central

    Gauci, Penelope J.; McAllister, Jane; Mitchell, Ian R.; Boyle, David B.; Bulach, Dieter M.; Weir, Richard P.; Melville, Lorna F.; Gubala, Aneta J.

    2015-01-01

    The Mapputta serogroup tentatively contains the mosquito-associated viruses Mapputta, Maprik, Trubanaman and Gan Gan. Interestingly, this serogroup has previously been associated with an acute epidemic polyarthritis-like illness in humans; however, there has been no ensuing genetic characterisation. Here we report the complete genome sequences of Mapputta and Maprik viruses, and a new Mapputta group candidate, Buffalo Creek virus, previously isolated from mosquitoes and detected by serology in a hospitalised patient. Phylogenetic analyses indicate that the group is one of the earliest diverged groups within the genus Orthobunyavirus of the family Bunyaviridae. Analyses show that these three viruses are related to the recently sequenced Australian bunyaviruses from mosquitoes, Salt Ash and Murrumbidgee. A notable feature of the Mapputta group viruses is the absence of the NSs (non-structural) ORF commonly found on the S segment of other orthobunyaviruses. Viruses of the Mapputta group have been isolated from geographically diverse regions ranging from tropical Papua New Guinea to the semi-arid climate of south-eastern Australia. The relevance of this group to human health in the region merits further investigation. PMID:25588016

  8. Comparative genomic analysis of catfish linkage group 8 reveals two homologous chromosomes in zebrafish and other teleosts with extensive inter-chromosomal rearrangements

    PubMed Central

    2013-01-01

    Background Comparative genomics is a powerful tool to transfer genomic information from model species to related non-model species. Channel catfish (Ictalurus punctatus) is the primary aquaculture species in the United States. Its existing genome resources such as genomic sequences generated from next generation sequencing, BAC end sequences (BES), physical maps, linkage maps, and integrated linkage and physical maps using BES-associated markers provide a platform for comparative genomic analysis between catfish and other model teleost fish species. This study aimed to gain understanding of genome organizations and similarities among catfish and several sequenced teleost genomes using linkage group 8 (LG8) as a pilot study. Results With existing genome resources, 287 unique genes were identified in LG8. Comparative genome analysis indicated that most of these 287 genes on catfish LG8 are located on two homologous chromosomes of zebrafish, medaka, stickleback, and three chromosomes of green-spotted pufferfish. Large numbers of conserved syntenies were identified. Detailed analysis of the conserved syntenies in relation to chromosome level similarities revealed extensive inter-chromosomal and intra-chromosomal rearrangements during evolution. Of the 287 genes, 35 genes were found to be duplicated in the catfish genome, with the vast majority of the duplications being interchromosomal. Conclusions Comparative genome analysis is a powerful tool even in the absence of a well-assembled whole genome sequence. In spite of sequence stacking due to low resolution of the linkage and physical maps, conserved syntenies can be identified although the exact gene order and orientation are unknown at present. Through chromosome-level comparative analysis, homologous chromosomes among teleosts can be identified. Syntenic analysis should facilitate annotation of the catfish genome, which in turn, should facilitate functional inference of genes based on their orthology. PMID:23758806

  9. Genomic identification of WRKY transcription factors in carrot (Daucus carota) and analysis of evolution and homologous groups for plants

    PubMed Central

    Li, Meng-Yao; Xu, Zhi-Sheng; Tian, Chang; Huang, Ying; Wang, Feng; Xiong, Ai-Sheng

    2016-01-01

    WRKY transcription factors belong to one of the largest transcription factor families. These factors possess functions in plant growth and development, signal transduction, and stress response. Here, we identified 95 DcWRKY genes in carrot based on the carrot genomic and transcriptomic data, and divided them into three groups. Phylogenetic analysis of WRKY proteins from carrot and Arabidopsis divided these proteins into seven subgroups. To elucidate the evolution and distribution of WRKY transcription factors in different species, we constructed a schematic of the phylogenetic tree and compared the WRKY family factors among 22 species, which including plants, slime mold and protozoan. An in-depth study was performed to clarify the homologous factor groups of nine divergent taxa in lower and higher plants. Based on the orthologous factors between carrot and Arabidopsis, 38 DcWRKY proteins were calculated to interact with other proteins in the carrot genome. Yeast two-hybrid assay showed that DcWRKY20 can interact with DcMAPK1 and DcMAPK4. The expression patterns of the selected DcWRKY genes based on transcriptome data and qRT-PCR suggested that those selected DcWRKY genes are involved in root development, biotic and abiotic stress response. This comprehensive analysis provides a basis for investigating the evolution and function of WRKY genes. PMID:26975939

  10. Random forest fishing: a novel approach to identifying organic group of risk factors in genome-wide association studies

    PubMed Central

    Yang, Wei; Charles Gu, C

    2014-01-01

    Genome-wide association studies (GWAS) has brought methodological challenges in handling massive high-dimensional data and also real opportunities for studying the joint effect of many risk factors acting in concert as an organic group. The random forest (RF) methodology is recognized by many for its potential in examining interaction effects in large data sets. However, RF is not designed to directly handle GWAS data, which typically have hundreds of thousands of single-nucleotide polymorphisms as predictor variables. We propose and evaluate a novel extension of RF, called random forest fishing (RFF), for GWAS analysis. RFF repeatedly updates a relatively small set of predictors obtained by RF tests to find globally important groups predictive of the disease phenotype, using a novel search algorithm based on genetic programming and simulated annealing. A key improvement of RFF results from the use of guidance incorporating empirical test results of genome-wide pairwise interactions. Evaluated using simulated and real GWAS data sets, RFF is shown to be effective in identifying important predictors, particularly when both marginal effects and interactions exist, and is applicable to very large GWAS data sets. PMID:23695277

  11. Genomic identification of WRKY transcription factors in carrot (Daucus carota) and analysis of evolution and homologous groups for plants.

    PubMed

    Li, Meng-Yao; Xu, Zhi-Sheng; Tian, Chang; Huang, Ying; Wang, Feng; Xiong, Ai-Sheng

    2016-03-15

    WRKY transcription factors belong to one of the largest transcription factor families. These factors possess functions in plant growth and development, signal transduction, and stress response. Here, we identified 95 DcWRKY genes in carrot based on the carrot genomic and transcriptomic data, and divided them into three groups. Phylogenetic analysis of WRKY proteins from carrot and Arabidopsis divided these proteins into seven subgroups. To elucidate the evolution and distribution of WRKY transcription factors in different species, we constructed a schematic of the phylogenetic tree and compared the WRKY family factors among 22 species, which including plants, slime mold and protozoan. An in-depth study was performed to clarify the homologous factor groups of nine divergent taxa in lower and higher plants. Based on the orthologous factors between carrot and Arabidopsis, 38 DcWRKY proteins were calculated to interact with other proteins in the carrot genome. Yeast two-hybrid assay showed that DcWRKY20 can interact with DcMAPK1 and DcMAPK4. The expression patterns of the selected DcWRKY genes based on transcriptome data and qRT-PCR suggested that those selected DcWRKY genes are involved in root development, biotic and abiotic stress response. This comprehensive analysis provides a basis for investigating the evolution and function of WRKY genes.

  12. Comparative genomic expression signatures of signal transduction pathways and targets in paediatric Burkitt lymphoma: a Children's Oncology Group report.

    PubMed

    Lee, Sanghoon; Day, Nancy S; Miles, Rodney R; Perkins, Sherrie L; Lim, Megan S; Ayello, Janet; van de Ven, Carmella; Harrison, Lauren; El-Mallawany, Nader K; Goldman, Stanton; Cairo, Mitchell S

    2017-05-01

    Burkitt lymphoma (BL) is the most common histological subtype of non-Hodgkin lymphoma (NHL) in children and adolescents. Through the introduction of short intensive multi-agent chemoimmunotherapy, survival has improved significantly over the past 30 years. However, this successful approach is limited by significant chemotherapy-induced acute toxicity and risk of developing resistant disease, demonstrating the need to identify less toxic and targeted therapies. We analysed the comparative genomic signature and targetable signalling pathways in paediatric BL (PEBL) samples from the Children's Oncology Group study (ANHL01P1) by genomic profiling and selected genes were confirmed by quantitative real time polymerase chain reaction. These results were compared to PEBL samples from public databases and utilised the Gene Expression Omnibus (GEO) Series (GSE) 10172 and 4475 (n = 16), and 4732 (n = 15). Three hundred and seventy-six genes (approximately 25%) were similarly expressed among three PEBL sample groups. Several target genes in Toll-like receptor signalling, JAK-STAT signalling and MAPK signalling were significantly overexpressed in PEBL. In addition, several tyrosine kinases, including Bruton tyrosine kinase, protein tyrosine phosphatase and histone deacetylase inhibitor were highly expressed in PEBL. These pre-clinical results suggest that specific signal transduction pathways are overly expressed in PEBL and several pathways could serve as potential future therapeutic targets. © 2017 John Wiley & Sons Ltd.

  13. Phylogeographic and genome-wide investigations of Vietnam ethnic groups reveal signatures of complex historical demographic movements.

    PubMed

    Pischedda, S; Barral-Arca, R; Gómez-Carballa, A; Pardo-Seco, J; Catelli, M L; Álvarez-Iglesias, V; Cárdenas, J M; Nguyen, N D; Ha, H H; Le, A T; Martinón-Torres, F; Vullo, C; Salas, A

    2017-10-03

    The territory of present-day Vietnam was the cradle of one of the world's earliest civilizations, and one of the first world regions to develop agriculture. We analyzed the mitochondrial DNA (mtDNA) complete control region of six ethnic groups and the mitogenomes from Vietnamese in The 1000 Genomes Project (1000G). Genome-wide data from 1000G (~55k SNPs) were also investigated to explore different demographic scenarios. All Vietnamese carry South East Asian (SEA) haplotypes, which show a moderate geographic and ethnic stratification, with the Mong constituting the most distinctive group. Two new mtDNA clades (M7b1a1f1 and F1f1) point to historical gene flow between the Vietnamese and other neighboring countries. Bayesian-based inferences indicate a time-deep and continuous population growth of Vietnamese, although with some exceptions. The dramatic population decrease experienced by the Cham 700 years ago (ya) fits well with the Nam tiến ("southern expansion") southwards from their original heartland in the Red River Delta. Autosomal SNPs consistently point to important historical gene flow within mainland SEA, and add support to a main admixture event occurring between Chinese and a southern Asian ancestral composite (mainly represented by the Malay). This admixture event occurred ~800 ya, again coinciding with the Nam tiến.

  14. Genome-Wide Identification and Mapping of NBS-Encoding Resistance Genes in Solanum tuberosum Group Phureja

    PubMed Central

    Lozano, Roberto; Ponce, Olga; Ramirez, Manuel; Mostajo, Nelly; Orjeda, Gisella

    2012-01-01

    The majority of disease resistance (R) genes identified to date in plants encode a nucleotide-binding site (NBS) and leucine-rich repeat (LRR) domain containing protein. Additional domains such as coiled-coil (CC) and TOLL/interleukin-1 receptor (TIR) domains can also be present. In the recently sequenced Solanum tuberosum group phureja genome we used HMM models and manual curation to annotate 435 NBS-encoding R gene homologs and 142 NBS-derived genes that lack the NBS domain. Highly similar homologs for most previously documented Solanaceae R genes were identified. A surprising ∼41% (179) of the 435 NBS-encoding genes are pseudogenes primarily caused by premature stop codons or frameshift mutations. Alignment of 81.80% of the 577 homologs to S. tuberosum group phureja pseudomolecules revealed non-random distribution of the R-genes; 362 of 470 genes were found in high density clusters on 11 chromosomes. PMID:22493716

  15. The genomic organization of the Fanconi anemia group A (FAA) gene

    SciTech Connect

    Ianzano, L.; Centra, M.; Savino, M.

    1997-05-01

    Fanconi anemia (FA) is a genetically heterogeneous disease involving at least five genes on the basis of complementation analysis (FAA to FAE). The FAA gene has been recently isolated by two independent approaches, positional and functional cloning. In the present study we describe the genomic structure of the FAA gene. The gene contains 43 exons spanning approximately 80 kb as determined by the alignment of four cosmids and the fine localization of the first and the last exons in restriction fragments of these clones. Exons range from 34 to 188 bp. All but three of the splice sites were consistent with the ag-gt rule. We also describe three alternative splicing events in cDNA clones that result in the loss of exon 37, a 23-bp deletion at the 5{prime} end of exon 41. Sequence analysis of the 5{prime} region upstream of the putative transcription start site showed no obvious TATA and CAAT boxes, but did show a GC-rich region, typical of housekeeping genes. Knowledge of the structure of the FAA gene will provide an invaluable resource for the discovery of mutations in the gene that accounts for about 60-66% of FA patients. 24 refs., 3 figs., 1 tab.

  16. Genomic structure of the luciferase gene and phylogenetic analysis in the Hotaria-group fireflies.

    PubMed

    Choi, Yong Soo; Bae, Jin Sik; Lee, Kwang Sik; Kim, Seong Ryul; Kim, Iksoo; Kim, Jong Gill; Kim, Keun Young; Kim, Sam Eun; Suzuki, Hirobumi; Lee, Sang Mong; Sohn, Hung Dae; Jin, Byung Rae

    2003-02-01

    The luminescent fireflies have species specific flash patterns, being recognized as sexual communication. The luciferase gene is the sole enzyme responsible for bioluminescence. We describe here the complete nucleotide sequence and the exon-intron structure of the luciferase gene of the Hotaria-group fireflies, H. unmunsana, H. papariensis and H. tsushimana. The luciferase gene of the Hotaria-group firefly including the known H. parvula spans 1950 bp and consisted of six introns and seven exons coding for 548 amino acid residues, suggesting highly conserved structure among the Hotaria-group fireflies. Although only one luciferase gene was cloned from H. papariensis, each of the two sequences of the gene was found in H. unmunsana (U1 and Uc) and H. tsushimana (T1 and T2). The amino acid sequence divergence among H. unmunsana, H. papariensis, and H. tsushimana only ranged from zero to three amino acid residues, but H. parvula differed by 10-11 amino acid residues from the other Hotaria-group fireflies, suggesting a divergent relationship of this species. Phylogenetic analysis using the deduced amino acid sequences of the luciferase gene resulted in a monophyletic group in the Hotaria excluding H. parvula, suggesting a close relationship among H. unmunsana, H. papariensis and H. tsushimana. Additionally, we also analyzed the mitochondrial cytochrome oxidase I (COI) gene of the Hotaria-group fireflies. The deduced amino acid sequence of the COI gene of H. unmunsana was identical to that of H. papariensis and H. tsushimana, but different by three positions from H. parvula. In terms of nucleotide sequences of the COI gene, intraspecific sequence divergence was sometimes larger than interspecies level, and phylogenetic analysis placed the three species into monophyletic groups unresolved among them, but excluded H. parvula. In conclusion, our results suggest that H. unmunsana, H. papariensis and H. tsushimana are very closely related or might be an identical species, at

  17. Bacterial genome remodeling through bacteriophage recombination.

    PubMed

    Menouni, Rachid; Hutinet, Geoffrey; Petit, Marie-Agnès; Ansaldi, Mireille

    2015-01-01

    Bacteriophages co-exist and co-evolve with their hosts in natural environments. Virulent phages lyse infected cells through lytic cycles, whereas temperate phages often remain dormant and can undergo lysogenic or lytic cycles. In their lysogenic state, prophages are actually part of the host genome and replicate passively in rhythm with host division. However, prophages are far from being passive residents: they can modify or bring new properties to their host. In this review, we focus on two important phage-encoded recombination mechanisms, i.e. site-specific recombination and homologous recombination, and how they remodel bacterial genomes.

  18. Model comparison on genomic predictions using high-density markers for different groups of bulls in the Nordic Holstein population.

    PubMed

    Gao, H; Su, G; Janss, L; Zhang, Y; Lund, M S

    2013-07-01

    This study compared genomic predictions based on imputed high-density markers (~777,000) in the Nordic Holstein population using a genomic BLUP (GBLUP) model, 4 Bayesian exponential power models with different shape parameters (0.3, 0.5, 0.8, and 1.0) for the exponential power distribution, and a Bayesian mixture model (a mixture of 4 normal distributions). Direct genomic values (DGV) were estimated for milk yield, fat yield, protein yield, fertility, and mastitis, using deregressed proofs (DRP) as response variable. The validation animals were split into 4 groups according to their genetic relationship with the training population. Groupsmgs had both the sire and the maternal grandsire (MGS), Groupsire only had the sire, Groupmgs only had the MGS, and Groupnon had neither the sire nor the MGS in the training population. Reliability of DGV was measured as the squared correlation between DGV and DRP divided by the reliability of DRP for the bulls in validation data set. Unbiasedness of DGV was measured as the regression of DRP on DGV. The results indicated that DGV were more accurate and less biased for animals that were more related to the training population. In general, the Bayesian mixture model and the exponential power model with shape parameter of 0.30 led to higher reliability of DGV than did the other models. The differences between reliabilities of DGV from the Bayesian models and the GBLUP model were statistically significant for some traits. We observed a tendency that the superiority of the Bayesian models over the GBLUP model was more profound for the groups having weaker relationships with training population. Averaged over the 5 traits, the Bayesian mixture model improved the reliability of DGV by 2.0 percentage points for Groupsmgs, 2.7 percentage points for Groupsire, 3.3 percentage points for Groupmgs, and 4.3 percentage points for Groupnon compared with GBLUP. The results showed that a Bayesian model with intense shrinkage of the explanatory

  19. Single-pass classification of all noncoding sequences in a bacterial genome using phylogenetic profiles.

    PubMed

    Marchais, Antonin; Naville, Magali; Bohn, Chantal; Bouloc, Philippe; Gautheret, Daniel

    2009-06-01

    Identification and characterization of functional elements in the noncoding regions of genomes is an elusive and time-consuming activity whose output does not keep up with the pace of genome sequencing. Hundreds of bacterial genomes lay unexploited in terms of noncoding sequence analysis, although they may conceal a wide diversity of novel RNA genes, riboswitches, or other regulatory elements. We describe a strategy that exploits the entirety of available bacterial genomes to classify all noncoding elements of a selected reference species in a single pass. This method clusters noncoding elements based on their profile of presence among species. Most noncoding RNAs (ncRNAs) display specific signatures that enable their grouping in distinct clusters, away from sequence conservation noise and other elements such as promoters. We submitted 24 ncRNA candidates from Staphylococcus aureus to experimental validation and confirmed the presence of seven novel small RNAs or riboswitches. Besides offering a powerful method for de novo ncRNA identification, the analysis of phylogenetic profiles opens a new path toward the identification of functional relationships between co-evolving coding and noncoding elements.

  20. Single-pass classification of all noncoding sequences in a bacterial genome using phylogenetic profiles

    PubMed Central

    Marchais, Antonin; Naville, Magali; Bohn, Chantal; Bouloc, Philippe; Gautheret, Daniel

    2009-01-01

    Identification and characterization of functional elements in the noncoding regions of genomes is an elusive and time-consuming activity whose output does not keep up with the pace of genome sequencing. Hundreds of bacterial genomes lay unexploited in terms of noncoding sequence analysis, although they may conceal a wide diversity of novel RNA genes, riboswitches, or other regulatory elements. We describe a strategy that exploits the entirety of available bacterial genomes to classify all noncoding elements of a selected reference species in a single pass. This method clusters noncoding elements based on their profile of presence among species. Most noncoding RNAs (ncRNAs) display specific signatures that enable their grouping in distinct clusters, away from sequence conservation noise and other elements such as promoters. We submitted 24 ncRNA candidates from Staphylococcus aureus to experimental validation and confirmed the presence of seven novel small RNAs or riboswitches. Besides offering a powerful method for de novo ncRNA identification, the analysis of phylogenetic profiles opens a new path toward the identification of functional relationships between co-evolving coding and noncoding elements. PMID:19237465

  1. Expanded MLST genotyping and comparative genomic hybridization evidence for host preferred groups in Campylobacter coli

    USDA-ARS?s Scientific Manuscript database

    The majority of previous work on campylobacteriosis has centered on the species Campylobacter jejuni, however, Campylobacter coli, the sister group to C. jejuni, is also a significant problem, but remains a much less studied organism. The purpose of this work was to develop and apply an expanded 16 ...

  2. Framework for development of physician competencies in genomic medicine: report of the Competencies Working Group of the Inter-Society Coordinating Committee for Physician Education in Genomics.

    PubMed

    Korf, Bruce R; Berry, Anna B; Limson, Melvin; Marian, Ali J; Murray, Michael F; O'Rourke, P Pearl; Passamani, Eugene R; Relling, Mary V; Tooker, John; Tsongalis, Gregory J; Rodriguez, Laura L

    2014-11-01

    Completion of the Human Genome Project, in conjunction with dramatic reductions in the cost of DNA sequencing and advances in translational research, is gradually ushering genomic discoveries and technologies into the practice of medicine. The rapid pace of these advances is opening up a gap between the knowledge available about the clinical relevance of genomic information and the ability of clinicians to include such information in their medical practices. This educational gap threatens to be rate limiting to the clinical adoption of genomics in medicine. Solutions will require not only a better understanding of the clinical implications of genetic discoveries but also training in genomics at all levels of professional development, including for individuals in formal training and others who long ago completed such training. The National Human Genome Research Institute has convened the Inter-Society Coordinating Committee for Physician Education in Genomics (ISCC) to develop and share best practices in the use of genomics in medicine. The ISCC has developed a framework for development of genomics practice competencies that may serve as a starting point for formulation of competencies for physicians in various medical disciplines.

  3. Use of Longitudinal Data in Genetic Studies in the Genome-wide Association Studies Era: Summary of Group 14

    PubMed Central

    Kerner, Berit; North, Kari E; Fallin, M Daniele

    2010-01-01

    Participants analyzed actual and simulated longitudinal data from the Framingham Heart Study for various metabolic and cardiovascular traits. The genetic information incorporated into these investigations ranged from selected single-nucleotide polymorphisms to genome-wide association arrays. Genotypes were incorporated using a broad range of methodological approaches including conditional logistic regression, linear mixed models, generalized estimating equations, linear growth curve estimation, growth modeling, growth mixture modeling, population attributable risk fraction based on survival functions under the proportional hazards models, and multivariate adaptive splines for the analysis of longitudinal data. The specific scientific questions addressed by these different approaches also varied, ranging from a more precise definition of the phenotype, bias reduction in control selection, estimation of effect sizes and genotype associated risk, to direct incorporation of genetic data into longitudinal modeling approaches and the exploration of population heterogeneity with regard to longitudinal trajectories. The group reached several overall conclusions: 1) The additional information provided by longitudinal data may be useful in genetic analyses. 2) The precision of the phenotype definition as well as control selection in nested designs may be improved, especially if traits demonstrate a trend over time or have strong age-of-onset effects. 3) Analyzing genetic data stratified for high-risk subgroups defined by a unique development over time could be useful for the detection of rare mutations in common multi-factorial diseases. 4) Estimation of the population impact of genomic risk variants could be more precise. The challenges and computational complexity demanded by genome-wide single-nucleotide polymorphism data were also discussed. PMID:19924713

  4. Optimizing the Power of Genome-Wide Association Studies by Using Publicly Available Reference Samples to Expand the Control Group

    PubMed Central

    Zhuang, Joanna J; Zondervan, Krina; Nyberg, Fredrik; Harbron, Chris; Jawaid, Ansar; Cardon, Lon R; Barratt, Bryan J; Morris, Andrew P

    2010-01-01

    Genome-wide association (GWA) studies have proved extremely successful in identifying novel genetic loci contributing effects to complex human diseases. In doing so, they have highlighted the fact that many potential loci of modest effect remain undetected, partly due to the need for samples consisting of many thousands of individuals. Large-scale international initiatives, such as the Wellcome Trust Case Control Consortium, the Genetic Association Information Network, and the database of genetic and phenotypic information, aim to facilitate discovery of modest-effect genes by making genome-wide data publicly available, allowing information to be combined for the purpose of pooled analysis. In principle, disease or control samples from these studies could be used to increase the power of any GWA study via judicious use as “genetically matched controls” for other traits. Here, we present the biological motivation for the problem and the theoretical potential for expanding the control group with publicly available disease or reference samples. We demonstrate that a naïve application of this strategy can greatly inflate the false-positive error rate in the presence of population structure. As a remedy, we make use of genome-wide data and model selection techniques to identify “axes” of genetic variation which are associated with disease. These axes are then included as covariates in association analysis to correct for population structure, which can result in increases in power over standard analysis of genetic information from the samples in the original GWA study. Genet. Epidemiol. 34: 319–326, 2010. © 2010 Wiley-Liss, Inc. PMID:20088020

  5. Insights from the Genome Sequence of Acidovorax citrulli M6, a Group I Strain of the Causal Agent of Bacterial Fruit Blotch of Cucurbits.

    PubMed

    Eckshtain-Levi, Noam; Shkedy, Dafna; Gershovits, Michael; Da Silva, Gustavo M; Tamir-Ariel, Dafna; Walcott, Ron; Pupko, Tal; Burdman, Saul

    2016-01-01

    Acidovorax citrulli is a seedborne bacterium that causes bacterial fruit blotch of cucurbit plants including watermelon and melon. A. citrulli strains can be divided into two major groups based on DNA fingerprint analyses and biochemical properties. Group I strains have been generally isolated from non-watermelon cucurbits, while group II strains are closely associated with watermelon. In the present study, we report the genome sequence of M6, a group I model A. citrulli strain, isolated from melon. We used comparative genome analysis to investigate differences between the genome of strain M6 and the genome of the group II model strain AAC00-1. The draft genome sequence of A. citrulli M6 harbors 139 contigs, with an overall approximate size of 4.85 Mb. The genome of M6 is ∼500 Kb shorter than that of strain AAC00-1. Comparative analysis revealed that this size difference is mainly explained by eight fragments, ranging from ∼35-120 Kb and distributed throughout the AAC00-1 genome, which are absent in the M6 genome. In agreement with this finding, while AAC00-1 was found to possess 532 open reading frames (ORFs) that are absent in strain M6, only 123 ORFs in M6 were absent in AAC00-1. Most of these M6 ORFs are hypothetical proteins and most of them were also detected in two group I strains that were recently sequenced, tw6 and pslb65. Further analyses by PCR assays and coverage analyses with other A. citrulli strains support the notion that some of these fragments or significant portions of them are discriminative between groups I and II strains of A. citrulli. Moreover, GC content, effective number of codon values and cluster of orthologs' analyses indicate that these fragments were introduced into group II strains by horizontal gene transfer events. Our study reports the genome sequence of a model group I strain of A. citrulli, one of the most important pathogens of cucurbits. It also provides the first comprehensive comparison at the genomic level between the

  6. Insights from the Genome Sequence of Acidovorax citrulli M6, a Group I Strain of the Causal Agent of Bacterial Fruit Blotch of Cucurbits

    PubMed Central

    Eckshtain-Levi, Noam; Shkedy, Dafna; Gershovits, Michael; Da Silva, Gustavo M.; Tamir-Ariel, Dafna; Walcott, Ron; Pupko, Tal; Burdman, Saul

    2016-01-01

    Acidovorax citrulli is a seedborne bacterium that causes bacterial fruit blotch of cucurbit plants including watermelon and melon. A. citrulli strains can be divided into two major groups based on DNA fingerprint analyses and biochemical properties. Group I strains have been generally isolated from non-watermelon cucurbits, while group II strains are closely associated with watermelon. In the present study, we report the genome sequence of M6, a group I model A. citrulli strain, isolated from melon. We used comparative genome analysis to investigate differences between the genome of strain M6 and the genome of the group II model strain AAC00-1. The draft genome sequence of A. citrulli M6 harbors 139 contigs, with an overall approximate size of 4.85 Mb. The genome of M6 is ∼500 Kb shorter than that of strain AAC00-1. Comparative analysis revealed that this size difference is mainly explained by eight fragments, ranging from ∼35–120 Kb and distributed throughout the AAC00-1 genome, which are absent in the M6 genome. In agreement with this finding, while AAC00-1 was found to possess 532 open reading frames (ORFs) that are absent in strain M6, only 123 ORFs in M6 were absent in AAC00-1. Most of these M6 ORFs are hypothetical proteins and most of them were also detected in two group I strains that were recently sequenced, tw6 and pslb65. Further analyses by PCR assays and coverage analyses with other A. citrulli strains support the notion that some of these fragments or significant portions of them are discriminative between groups I and II strains of A. citrulli. Moreover, GC content, effective number of codon values and cluster of orthologs’ analyses indicate that these fragments were introduced into group II strains by horizontal gene transfer events. Our study reports the genome sequence of a model group I strain of A. citrulli, one of the most important pathogens of cucurbits. It also provides the first comprehensive comparison at the genomic level between

  7. Perspective: maternal kin groups and the origins of asymmetric genetic systems-genomic imprinting, haplodiploidy, and parthenogenesis.

    PubMed

    Normark, Benjamin B

    2006-04-01

    The genetic systems of animals and plants are typically eumendelian. That is, an equal complement of autosomes is inherited from each of two parents, and at each locus, each parent's allele is equally likely to be expressed and equally likely to be transmitted. Genetic systems that violate any of these eumendelian symmetries are termed asymmetric and include parent-specific gene expression (PSGE), haplodiploidy, thelytoky, and related systems. Asymmetric genetic systems typically arise in lineages with close associations between kin (gregarious siblings, brooding, or viviparity). To date, different explanatory frameworks have been proposed to account for each of the different asymmetric genetic systems. Haig's kinship theory of genomic imprinting argues that PSGE arises when kinship asymmetries between interacting kin create conflicts between maternally and paternally derived alleles. Greater maternal than paternal relatedness within groups selects for more "abstemious" expression of maternally derived alleles and more "greedy" expression of paternally derived alleles. Here, I argue that this process may also underlie origins of haplodiploidy and many origins of thelytoky. The tendency for paternal alleles to be more "greedy" in maternal kin groups means that maternal-paternal conflict is not a zero-sum game: the maternal optimum will more closely correspond to the optimum for family groups and demes and for associated entities such as symbionts. Often in these circumstances, partial or complete suppression of paternal gene expression will evolve (haplodiploidy, thelytoky), or other features of the life cycle will evolve to minimize the conflict (monogamy, inbreeding). Maternally transmitted cytoplasmic elements and maternally imprinted nuclear alleles have a shared interest in minimizing agonistic interactions between female siblings and may cooperate to exclude the paternal genome. Eusociality is the most dramatic expression of the conflict-reducing effects of

  8. Interacting networks of resistance, virulence and core machinery genes identified by genome-wide epistasis analysis

    PubMed Central

    Pesonen, Maiju; Musser, James M.; Bentley, Stephen D.; Aurell, Erik; Corander, Jukka

    2017-01-01

    Recent advances in the scale and diversity of population genomic datasets for bacteria now provide the potential for genome-wide patterns of co-evolution to be studied at the resolution of individual bases. Here we describe a new statistical method, genomeDCA, which uses recent advances in computational structural biology to identify the polymorphic loci under the strongest co-evolutionary pressures. We apply genomeDCA to two large population data sets representing the major human pathogens Streptococcus pneumoniae (pneumococcus) and Streptococcus pyogenes (group A Streptococcus). For pneumococcus we identified 5,199 putative epistatic interactions between 1,936 sites. Over three-quarters of the links were between sites within the pbp2x, pbp1a and pbp2b genes, the sequences of which are critical in determining non-susceptibility to beta-lactam antibiotics. A network-based analysis found these genes were also coupled to that encoding dihydrofolate reductase, changes to which underlie trimethoprim resistance. Distinct from these antibiotic resistance genes, a large network component of 384 protein coding sequences encompassed many genes critical in basic cellular functions, while another distinct component included genes associated with virulence. The group A Streptococcus (GAS) data set population represents a clonal population with relatively little genetic variation and a high level of linkage disequilibrium across the genome. Despite this, we were able to pinpoint two RNA pseudouridine synthases, which were each strongly linked to a separate set of loci across the chromosome, representing biologically plausible targets of co-selection. The population genomic analysis method applied here identifies statistically significantly co-evolving locus pairs, potentially arising from fitness selection interdependence reflecting underlying protein-protein interactions, or genes whose product activities contribute to the same phenotype. This discovery approach greatly

  9. Interacting networks of resistance, virulence and core machinery genes identified by genome-wide epistasis analysis.

    PubMed

    Skwark, Marcin J; Croucher, Nicholas J; Puranen, Santeri; Chewapreecha, Claire; Pesonen, Maiju; Xu, Ying Ying; Turner, Paul; Harris, Simon R; Beres, Stephen B; Musser, James M; Parkhill, Julian; Bentley, Stephen D; Aurell, Erik; Corander, Jukka

    2017-02-01

    Recent advances in the scale and diversity of population genomic datasets for bacteria now provide the potential for genome-wide patterns of co-evolution to be studied at the resolution of individual bases. Here we describe a new statistical method, genomeDCA, which uses recent advances in computational structural biology to identify the polymorphic loci under the strongest co-evolutionary pressures. We apply genomeDCA to two large population data sets representing the major human pathogens Streptococcus pneumoniae (pneumococcus) and Streptococcus pyogenes (group A Streptococcus). For pneumococcus we identified 5,199 putative epistatic interactions between 1,936 sites. Over three-quarters of the links were between sites within the pbp2x, pbp1a and pbp2b genes, the sequences of which are critical in determining non-susceptibility to beta-lactam antibiotics. A network-based analysis found these genes were also coupled to that encoding dihydrofolate reductase, changes to which underlie trimethoprim resistance. Distinct from these antibiotic resistance genes, a large network component of 384 protein coding sequences encompassed many genes critical in basic cellular functions, while another distinct component included genes associated with virulence. The group A Streptococcus (GAS) data set population represents a clonal population with relatively little genetic variation and a high level of linkage disequilibrium across the genome. Despite this, we were able to pinpoint two RNA pseudouridine synthases, which were each strongly linked to a separate set of loci across the chromosome, representing biologically plausible targets of co-selection. The population genomic analysis method applied here identifies statistically significantly co-evolving locus pairs, potentially arising from fitness selection interdependence reflecting underlying protein-protein interactions, or genes whose product activities contribute to the same phenotype. This discovery approach greatly

  10. Identification and Genomic Analysis of a Novel Group C Orthobunyavirus Isolated from a Mosquito Captured near Iquitos, Peru

    PubMed Central

    Treangen, Todd J.; Schoeler, George; Phillippy, Adam M.; Bergman, Nicholas H.; Turell, Michael J.

    2016-01-01

    Group C orthobunyaviruses are single-stranded RNA viruses found in both South and North America. Until very recently, and despite their status as important vector-borne human pathogens, no Group C whole genome sequences containing all three segments were available in public databases. Here we report a Group C orthobunyavirus, named El Huayo virus, isolated from a pool of Culex portesi mosquitoes captured near Iquitos, Peru. Although initial metagenomic analysis yielded only a handful of reads belonging to the genus Orthobunyavirus, single contig assemblies were generated for L, M, and S segments totaling over 200,000 reads (~0.5% of sample). Given the moderately high viremia in hamsters (>107 plaque-forming units/ml) and the propensity for Cx. portesi to feed on rodents, it is possible that El Huayo virus is maintained in nature in a Culex portesi/rodent cycle. El Huayo virus was found to be most similar to Peruvian Caraparu virus isolates and constitutes a novel subclade within Group C. PMID:27074162

  11. The transcriptome of the reference potato genome Solanum tuberosum Group Phureja clone DM1-3 516R44.

    PubMed

    Massa, Alicia N; Childs, Kevin L; Lin, Haining; Bryan, Glenn J; Giuliano, Giovanni; Buell, C Robin

    2011-01-01

    Advances in molecular breeding in potato have been limited by its complex biological system, which includes vegetative propagation, autotetraploidy, and extreme heterozygosity. The availability of the potato genome and accompanying gene complement with corresponding gene structure, location, and functional annotation are powerful resources for understanding this complex plant and advancing molecular breeding efforts. Here, we report a reference for the potato transcriptome using 32 tissues and growth conditions from the doubled monoploid Solanum tuberosum Group Phureja clone DM1-3 516R44 for which a genome sequence is available. Analysis of greater than 550 million RNA-Seq reads permitted the detection and quantification of expression levels of over 22,000 genes. Hierarchical clustering and principal component analyses captured the biological variability that accounts for gene expression differences among tissues suggesting tissue-specific gene expression, and genes with tissue or condition restricted expression. Using gene co-expression network analysis, we identified 18 gene modules that represent tissue-specific transcriptional networks of major potato organs and developmental stages. This information provides a powerful resource for potato research as well as studies on other members of the Solanaceae family.

  12. Genome analysis of Elusimicrobium minutum, the first cultivated representative of the Elusimicrobia phylum (formerly Termite Group 1)

    SciTech Connect

    Herlemann, D. P. R.; Geissinger, O.; Ikeda-Ohtsubo, W.; Kunin, V.; Sun, H.; Lapidus, A.; Hugenholtz, P.; Brune, A.

    2009-02-01

    The candidate phylum Termite group 1 (TG1), is regularly 1 encountered in termite hindguts but is present also in many other habitats. Here we report the complete genome sequence (1.64 Mbp) of Elusimicrobium minutum strain Pei191{sup T}, the first cultured representative of the TG1 phylum. We reconstructed the metabolism of this strictly anaerobic bacterium isolated from a beetle larva gut and discuss the findings in light of physiological data. E. minutum has all genes required for uptake and fermentation of sugars via the Embden-Meyerhof pathway, including several hydrogenases, and an unusual peptide degradation pathway comprising transamination reactions and leading to the formation of alanine, which is excreted in substantial amounts. The presence of genes encoding lipopolysaccharide biosynthesis and the presence of a pathway for peptidoglycan formation are consistent with ultrastructural evidence of a Gram-negative cell envelope. Even though electron micrographs showed no cell appendages, the genome encodes many genes putatively involved in pilus assembly. We assigned some to a type II secretion system, but the function of 60 pilE-like genes remains unknown. Numerous genes with hypothetical functions, e.g., polyketide synthesis, non-ribosomal peptide synthesis, antibiotic transport, and oxygen stress protection, indicate the presence of hitherto undiscovered physiological traits. Comparative analysis of 22 concatenated single-copy marker genes corroborated the status of Elusimicrobia (formerly TG1) as a separate phylum in the bacterial domain, which was so far based only on 16S rRNA sequence analysis.

  13. Increased UV resistance in xeroderma pigmentosum group A cells after transformation with a human genomic DNA clone

    SciTech Connect

    Rinaldy, A.; Bellew, T.; Egli, E.; Lloyd, R.S. )

    1990-09-01

    Xeroderma pigmentosum (XP) is an autosomal recessive disease in which the major clinical manifestation is a 2,000-fold enhanced probability of developing sunlight-induced skin tumors, and the molecular basis for the disease is a defective DNA excision repair system. To clone the gene defective XP complementation group A (XP-A), cDNA clones were isolated by a competition hybridization strategy in which the corresponding mRNAs were more abundant in cells of the obligately heterozygous parents relative to cells to the homozygous proband affected with the disease. In this report, a human genomic DNA clone that contains this cDNA was transformed into two independent homozygous XP-A cell lines, and these transformants displayed partial restoration of resistance to the killing effects of UV irradiation. The abundance of mRNA corresponding to this cDNA appears to correlate well with the observed UV cell survival. The results of unscheduled DNA synthesis after UV exposure indicate that the transformed cells are repair proficient relative to that of the control XP-A cells. However, using this same genomic DNA, transformation of an XP-F cell line did not confer any enhancement of UV survival or promote unscheduled DNA synthesis after UV exposure.

  14. Genomic Characteristics Behind the Spread of Bacteremic Group A Streptococcus Type emm89 in Finland, 2004-2014.

    PubMed

    Latronico, Francesca; Nasser, Waleed; Puhakainen, Kai; Ollgren, Jukka; Hyyryläinen, Hanne-Leena; Beres, Stephen B; Lyytikäinen, Outi; Jalava, Jari; Musser, James M; Vuopio, Jaana

    2016-12-15

     Many countries worldwide have reported increasing numbers of emm89 group A Streptococcus (GAS) infections during last decade. Pathogen genetic factors linked to this increase need assessment.  We investigated epidemiological characteristics of emm89 GAS bacteremic infections, including 7-day and 30-day case-fatality rates, in Finland during 2004-2014 and linked them to whole-genome sequencing data obtained from corresponding strains. The Fisher exact test and exact logistic regression were used to compare differences between bacteremic infections due to emm89 GAS belonging to different genetic clades and subclades.  Out of 1928 cases of GAS bacteremic infection, 278 were caused by emm89 GAS. We identified 2 genetically distinct clades, arbitrarily designated clade 2 and clade 3. Both clades were present during 2004-2008, but clade 3 increased rapidly from 2009 onward. Six subclades (designated subclades A-F) were identified within clade 3, based on phylogenetic core genome analysis. The case-fatality rate differed significantly between subclades (P < .05), with subclade D having the highest 30-day estimated case-fatality rate (19% vs 3%-14%).  A new emm89 clone, clade 3, emerged in 2009 and spread rapidly in Finland. Patients infected with certain subclades of clade 3 were significantly more likely to die. A specific polymerase chain reaction assay was developed to follow the spread of subclade D in 2015. © The Author 2016. Published by Oxford University Press for the Infectious Diseases Society of America.

  15. The Transcriptome of the Reference Potato Genome Solanum tuberosum Group Phureja Clone DM1-3 516R44

    PubMed Central

    Massa, Alicia N.; Childs, Kevin L.; Lin, Haining; Bryan, Glenn J.; Giuliano, Giovanni; Buell, C. Robin

    2011-01-01

    Advances in molecular breeding in potato have been limited by its complex biological system, which includes vegetative propagation, autotetraploidy, and extreme heterozygosity. The availability of the potato genome and accompanying gene complement with corresponding gene structure, location, and functional annotation are powerful resources for understanding this complex plant and advancing molecular breeding efforts. Here, we report a reference for the potato transcriptome using 32 tissues and growth conditions from the doubled monoploid Solanum tuberosum Group Phureja clone DM1-3 516R44 for which a genome sequence is available. Analysis of greater than 550 million RNA-Seq reads permitted the detection and quantification of expression levels of over 22,000 genes. Hierarchical clustering and principal component analyses captured the biological variability that accounts for gene expression differences among tissues suggesting tissue-specific gene expression, and genes with tissue or condition restricted expression. Using gene co-expression network analysis, we identified 18 gene modules that represent tissue-specific transcriptional networks of major potato organs and developmental stages. This information provides a powerful resource for potato research as well as studies on other members of the Solanaceae family. PMID:22046362

  16. Genetic divergence and admixture of ancestral genome groups in the sugarcane variety 'RB867515' (Saccharum spp).

    PubMed

    Maranho, G B; Maranho, R C; Desordi, R; das Neves, A F; Mangolin, C A; Machado, M F P S

    2016-12-02

    We analyzed 80 plants of the sugarcane (Saccharum spp) variety 'RB867515' in order to investigate its diversity and genetic structure at the molecular level. Four simple sequence repeat (SSR) loci (UGSM51, SMC1237, SEGMS1069, and UGSM38) and five expressed sequence tag (EST)-SSR loci (ESTA68, ESTB92, ESTB145, ESTC66, and ESTC84) were used as molecular markers. The polymorphic loci rate was 66.6%. A total of 17 alleles and an average of 1.88 alleles/locus were detected. The number of alleles in the EST-SSR loci was lower than the number of alleles in the SSRs of non-expressed loci. The mean observed heterozygosity among the nine SSR loci was 0.3291. Genetic structure analysis showed that 'RB867515' contains alleles from three ancestral groups (K = 3), but there is little admixing of alleles in the same plant (from 0.8 to 17.3%); only 1.88% of the plants shared alleles from two or three groups. ESTB92, ESTC84, and UGSM38 were monomorphic, but there was evidence of polymorphism in ESTA68, ESTB145, ESTC66, UGSM51, SMC1237, and SEGMS1069, indicating that 'RB867515' has variability at the molecular level and the potential to be used as a parent in breeding programs. The molecular variability observed in 'RB867515' indicates that the clone terminology that is used to identify this cultivar is inconsistent with the original meaning of "clone", which is defined as a sample of genetically identical plants.

  17. An intronic open reading frame was released from one of group II introns in the mitochondrial genome of the haptophyte Chrysochromulina sp. NIES-1333.

    PubMed

    Nishimura, Yuki; Kamikawa, Ryoma; Hashimoto, Tetsuo; Inagaki, Yuji

    2014-01-01

    Mitochondrial (mt) genome sequences, which often bear introns, have been sampled from phylogenetically diverse eukaryotes. Thus, we can anticipate novel insights into intron evolution from previously unstudied mt genomes. We here investigated the origins and evolution of three introns in the mt genome of the haptophyte Chrysochromulina sp. NIES-1333, which was sequenced completely in this study. All the three introns were characterized as group II, on the basis of predicted secondary structure, and the conserved sequence motifs at the 5' and 3' termini. Our comparative studies on diverse mt genomes prompt us to propose that the Chrysochromulina mt genome laterally acquired the introns from mt genomes in distantly related eukaryotes. Many group II introns harbor intronic open reading frames for the proteins (intron-encoded proteins or IEPs), which likely facilitate the splicing of their host introns. However, we propose that a "free-standing," IEP-like protein, which is not encoded within any introns in the Chrysochromulina mt genome, is involved in the splicing of the first cox1 intron that lacks any open reading frames.

  18. An intronic open reading frame was released from one of group II introns in the mitochondrial genome of the haptophyte Chrysochromulina sp. NIES-1333

    PubMed Central

    Nishimura, Yuki; Kamikawa, Ryoma; Hashimoto, Tetsuo; Inagaki, Yuji

    2014-01-01

    Mitochondrial (mt) genome sequences, which often bear introns, have been sampled from phylogenetically diverse eukaryotes. Thus, we can anticipate novel insights into intron evolution from previously unstudied mt genomes. We here investigated the origins and evolution of three introns in the mt genome of the haptophyte Chrysochromulina sp. NIES-1333, which was sequenced completely in this study. All the three introns were characterized as group II, on the basis of predicted secondary structure, and the conserved sequence motifs at the 5′ and 3′ termini. Our comparative studies on diverse mt genomes prompt us to propose that the Chrysochromulina mt genome laterally acquired the introns from mt genomes in distantly related eukaryotes. Many group II introns harbor intronic open reading frames for the proteins (intron-encoded proteins or IEPs), which likely facilitate the splicing of their host introns. However, we propose that a “free-standing,” IEP-like protein, which is not encoded within any introns in the Chrysochromulina mt genome, is involved in the splicing of the first cox1 intron that lacks any open reading frames. PMID:25054084

  19. The Genomics Education Partnership: Successful Integration of Research into Laboratory Classes at a Diverse Group of Undergraduate Institutions

    ERIC Educational Resources Information Center

    Shaffer, Christopher D.; Alvarez, Consuelo; Bailey, Cheryl; Barnard, Daron; Bhalla, Satish; Chandrasekaran, Chitra; Chandrasekaran, Vidya; Chung, Hui-Min; Dorer, Douglas R.; Du, Chunguang; Eckdahl, Todd T.; Poet, Jeff L.; Frohlich, Donald; Goodman, Anya L.; Gosser, Yuying; Hauser, Charles; Hoopes, Laura L. M.; Johnson, Diana; Jones, Christopher J.; Kaehler, Marian; Kokan, Nighat; Kopp, Olga R.; Kuleck, Gary A.; McNeil, Gerard; Moss, Robert; Myka, Jennifer L.; Nagengast, Alexis; Morris, Robert; Overvoorde, Paul J.; Shoop, Elizabeth; Parrish, Susan; Reed, Kelynne; Regisford, E. Gloria; Revie, Dennis; Rosenwald, Anne G.; Saville, Ken; Schroeder, Stephanie; Shaw, Mary; Skuse, Gary; Smith, Christopher; Smith, Mary; Spana, Eric P.; Spratt, Mary; Stamm, Joyce; Thompson, Jeff S.; Wawersik, Matthew; Wilson, Barbara A.; Youngblom, Jim; Leung, Wilson; Buhler, Jeremy; Mardis, Elaine R.; Lopatto, David; Elgin, Sarah C. R.

    2010-01-01

    Genomics is not only essential for students to understand biology but also provides unprecedented opportunities for undergraduate research. The goal of the Genomics Education Partnership (GEP), a collaboration between a growing number of colleges and universities around the country and the Department of Biology and Genome Center of Washington…

  20. The Genomics Education Partnership: Successful Integration of Research into Laboratory Classes at a Diverse Group of Undergraduate Institutions

    ERIC Educational Resources Information Center

    Shaffer, Christopher D.; Alvarez, Consuelo; Bailey, Cheryl; Barnard, Daron; Bhalla, Satish; Chandrasekaran, Chitra; Chandrasekaran, Vidya; Chung, Hui-Min; Dorer, Douglas R.; Du, Chunguang; Eckdahl, Todd T.; Poet, Jeff L.; Frohlich, Donald; Goodman, Anya L.; Gosser, Yuying; Hauser, Charles; Hoopes, Laura L. M.; Johnson, Diana; Jones, Christopher J.; Kaehler, Marian; Kokan, Nighat; Kopp, Olga R.; Kuleck, Gary A.; McNeil, Gerard; Moss, Robert; Myka, Jennifer L.; Nagengast, Alexis; Morris, Robert; Overvoorde, Paul J.; Shoop, Elizabeth; Parrish, Susan; Reed, Kelynne; Regisford, E. Gloria; Revie, Dennis; Rosenwald, Anne G.; Saville, Ken; Schroeder, Stephanie; Shaw, Mary; Skuse, Gary; Smith, Christopher; Smith, Mary; Spana, Eric P.; Spratt, Mary; Stamm, Joyce; Thompson, Jeff S.; Wawersik, Matthew; Wilson, Barbara A.; Youngblom, Jim; Leung, Wilson; Buhler, Jeremy; Mardis, Elaine R.; Lopatto, David; Elgin, Sarah C. R.

    2010-01-01

    Genomics is not only essential for students to understand biology but also provides unprecedented opportunities for undergraduate research. The goal of the Genomics Education Partnership (GEP), a collaboration between a growing number of colleges and universities around the country and the Department of Biology and Genome Center of Washington…

  1. Toward a marker-dense meiotic map of the potato genome: lessons from linkage group I.

    PubMed Central

    Isidore, Edwige; van Os, Hans; Andrzejewski, Sandra; Bakker, Jaap; Barrena, Imanol; Bryan, Glenn J; Caromel, Bernard; van Eck, Herman; Ghareeb, Bilal; de Jong, Walter; van Koert, Paul; Lefebvre, Véronique; Milbourne, Dan; Ritter, Enrique; van der Voort, Jeroen Rouppe; Rousselle-Bourgeois, Françoise; van Vliet, Joke; Waugh, Robbie

    2003-01-01

    Segregation data were obtained for 1260 potato linkage group I-specific AFLP loci from a heterozygous diploid potato population. Analytical tools that identified potential typing errors and/or inconsistencies in the data and that assembled cosegregating markers into bins were applied. Bins contain multiple-marker data sets with an identical segregation pattern, which is defined as the bin signature. The bin signatures were used to construct a skeleton bin map that was based solely on observed recombination events. Markers that did not match any of the bin signatures exactly (and that were excluded from the calculation of the skeleton bin map) were placed on the map by maximum likelihood. The resulting maternal and paternal maps consisted of 95 and 101 bins, respectively. Markers derived from EcoRI/MseI, PstI/MseI, and SacI/MseI primer combinations showed different genetic distributions. Approximately three-fourths of the markers placed into a bin were considered to fit well on the basis of an estimated residual "error rate" of 0-3%. However, twice as many PstI-based markers fit badly, suggesting that parental PstI-site methylation patterns had changed in the population. Recombination frequencies were highly variable across the map. Inert, presumably centromeric, regions caused extensive marker clustering while recombination hotspots (or regions identical by descent) resulted in empty bins, despite the level of marker saturation. PMID:14704190

  2. The 135 kbp mitochondrial genome of Agaricus bisporus is the largest known eukaryotic reservoir of group I introns and plasmid-related sequences.

    PubMed

    Férandon, Cyril; Xu, Jianping; Barroso, Gérard

    2013-06-01

    At 135,005 nt, the mitochondrial genome in Agaricus bisporus represents the largest fungal mitochondrial genome sequenced to date. Its large size is mainly due to the presence of mobile genetic elements, including a total of 43 group I introns, three group II introns, and five DNA fragments that show sequence similarity to linear invertron-like plasmids. The introns are distributed in eight of the 15 protein coding genes. These introns contain a total of 61,092 nt (∼45.3% of the whole mitochondrial genome) and include representatives of most of the group I introns so far found in mitochondrial genomes of Basidiomycota. The plasmid-like sequences include 6730 nt total representing 5.0% of the genome. These sequences showed high-level similarities to two different mitochondrial plasmids reported for basidiomycete mushrooms: the autonomously replicating pEM in Agaricus bitorquis and the integrated linear plasmid sequences in Agrocybe aegerita and Moniliophthora perniciosa. Moreover, the plasmid-related sequences are located within or adjacent to two large (4559 nt) inverted repeats containing also two sets of mitochondrial tRNA genes. Our analyses are consistent with the hypothesis that horizontal DNA transfer has played a significant role in the evolution of the A. bisporus mitochondrial genome.

  3. The Genome and Linkage Map of the Northern Pike (Esox lucius): Conserved Synteny Revealed between the Salmonid Sister Group and the Neoteleostei

    PubMed Central

    Rondeau, Eric B.; Minkley, David R.; Leong, Jong S.; Messmer, Amber M.; Jantzen, Johanna R.; von Schalburg, Kristian R.; Lemon, Craig; Bird, Nathan H.; Koop, Ben F.

    2014-01-01

    The northern pike is the most frequently studied member of the Esociformes, the closest order to the diverse and economically important Salmoniformes. The ancestor of all salmonids purportedly experienced a whole-genome duplication (WGD) event, making salmonid species ideal for studying the early impacts of genome duplication while complicating their use in wider analyses of teleost evolution. Studies suggest that the Esociformes diverged from the salmonid lineage prior to the WGD, supporting the use of northern pike as a pre-duplication outgroup. Here we present the first genome assembly, reference transcriptome and linkage map for northern pike, and evaluate the suitability of this species to provide a representative pre-duplication genome for future studies of salmonid and teleost evolution. The northern pike genome sequence is composed of 94,267 contigs (N50 = 16,909 bp) contained in 5,688 scaffolds (N50 = 700,535 bp); the total scaffolded genome size is 878 million bases. Multiple lines of evidence suggest that over 96% of the protein-coding genome is present in the genome assembly. The reference transcriptome was constructed from 13 tissues and contains 38,696 transcripts, which are accompanied by normalized expression data in all tissues. Gene-prediction analysis produced a total of 19,601 northern pike-specific gene models. The first-generation linkage map identifies 25 linkage groups, in agreement with northern pike's diploid karyotype of 2N = 50, and facilitates the placement of 46% of assembled bases onto linkage groups. Analyses reveal a high degree of conserved synteny between northern pike and other model teleost genomes. While conservation of gene order is limited to smaller syntenic blocks, the wider conservation of genome organization implies the northern pike exhibits a suitable approximation of a non-duplicated Protacanthopterygiian genome. This dataset will facilitate future studies of esocid biology and empower ongoing examinations

  4. Recommendations from the EGAPP Working Group: does genomic profiling to assess type 2 diabetes risk improve health outcomes?

    PubMed

    2013-08-01

    The Evaluation of Genomic Applications in Practice and Prevention (EGAPP) Working Group (EWG) found insufficient evidence to recommend testing for predictive variants in 28 variants (listed in Table 1) to assess risk for type 2 diabetes in the general population, on the basis of studies in populations of northern European descent. The EWG found that the magnitude of net health benefit from the use of any of these tests alone or in combination is close to zero. The EWG discourages clinical use unless further evidence supports improved clinical outcomes.The EWG found insufficient evidence to recommend testing for the TCF7L2 gene to assess risk for type 2 diabetes in high-risk individuals. The EWG found that the magnitude of net health benefit from the use of this test is close to zero. The EWG discourages clinical use unless further evidence supports improved clinical outcomes.On the basis of the available evidence for both the scenarios, the overall certainty of net health benefit is deemed "low." It has been suggested that genomic profiling in the general population or in high-risk populations for type 2 diabetes might lead to management changes (e.g., earlier initiation or higher rates of medical interventions, or targeted recommendations for behavioral change) that improve type 2 diabetes outcomes or prevent type 2 diabetes. The EWG found no direct evidence to support this possibility; therefore, this review sought indirect evidence aimed at documenting the extent to which genomic profiling alters type 2 diabetes risk estimation, alone and in combination with traditional risk factors, and the extent to which risk classification improves health outcomes. Assay-related evidence on available genomic profiling tests was deemed inadequate. However, on the basis of existing technologies that have been or may be used, the analytic sensitivity and specificity of tests for individual gene variants might be at least satisfactory. Twenty-eight candidate markers were

  5. Genome-wide Association Study of Tenofovir Pharmacokinetics and Creatinine Clearance in AIDS Clinical Trials Group Protocol A5202

    PubMed Central

    Wanga, Valentine; Venuto, Charles; Morse, Gene D.; Acosta, Edward P.; Daar, Eric S.; Haas, David W.; Li, Chun; Shepherd, Bryan E.

    2015-01-01

    Background Tenofovir disoproxil fumarate (TDF) causes kidney toxicity in some patients. We performed genome-wide analyses to identify associations with plasma tenofovir clearance and change in creatinine clearance (CrCl) during the first 6 months after initiating therapy among subjects randomized to TDF/emtricitabine-containing regimens in AIDS Clinical Trials Group protocol A5202. Methods Pharmacokinetic analyses involved 501 subjects randomized to the tenofovir arm. The CrCl analyses involved 1096 subjects, including 548 control subjects randomized to abacavir-containing regimens. All had been randomized to also receive atazanavir/ritonavir or efavirenz. Multivariable linear regression and generalized least squares models tested for associations between polymorphisms and tenofovir clearance and CrCl change, with Bonferroni correction. Planned sub-analyses considered candidate genes and polymorphisms. Results Median CrCl at baseline was 116 ml/min (interquartile range [IQR] 99.8 to 135.5). Median change in CrCl after 6 months was −0.5 ml/min (−10.7 to +10.8) and 2.2 (IQR −9.9 to +13.2) in tenofovir and abacavir arms, respectively. In genome-wide analyses SLC17A1 rs12662869 was associated with an increase in tenofovir clearance (P = 7.1x10−9). In candidate gene analysis for tenofovir clearance, most polymorphisms evaluated were in ABCC4. In the ABCC4 region, the lowest p-value was for CLDN10 rs12866697 (P=1.4x10−3). Among African Americans, SLC22A2 rs3127573 was associated with a greater 6-month CrCl increase in the tenofovir arm after correcting for multiple comparisons (P = 3.3x10−5). Conclusions Among subjects randomized to receive TDF/emtricitabine in A5202, there were no genome-wide significant associations with change in CrCl. This study did not replicate polymorphisms previously implicated in tenofovir-associated renal injury. PMID:26148204

  6. Whole genome sequencing of group A Streptococcus: development and evaluation of an automated pipeline for emmgene typing.

    PubMed

    Kapatai, Georgia; Coelho, Juliana; Platt, Steven; Chalker, Victoria J

    2017-01-01

    Streptococcus pyogenes group A Streptococcus (GAS) is the most common cause of bacterial throat infections, and can cause mild to severe skin and soft tissue infections, including impetigo, erysipelas, necrotizing fasciitis, as well as systemic and fatal infections including septicaemia and meningitis. Estimated annual incidence for invasive group A streptococcal infection (iGAS) in industrialised countries is approximately three per 100,000 per year. Typing is currently used in England and Wales to monitor bacterial strains of S. pyogenes causing invasive infections and those isolated from patients and healthcare/care workers in cluster and outbreak situations. Sequence analysis of the emm gene is the currently accepted gold standard methodology for GAS typing. A comprehensive database of emm types observed from superficial and invasive GAS strains from England and Wales informs outbreak control teams during investigations. Each year the Bacterial Reference Department, Public Health England (PHE) receives approximately 3,000 GAS isolates from England and Wales. In April 2014 the Bacterial Reference Department, PHE began genomic sequencing of referred S. pyogenes isolates and those pertaining to selected elderly/nursing care or maternity clusters from 2010 to inform future reference services and outbreak analysis (n = 3, 047). In line with the modernizing strategy of PHE, we developed a novel bioinformatics pipeline that can predict emmtypes using whole genome sequence (WGS) data. The efficiency of this method was measured by comparing the emmtype assigned by this method against the result from the current gold standard methodology; concordance to emmsubtype level was observed in 93.8% (2,852/3,040) of our cases, whereas in 2.4% (n = 72) of our cases concordance was observed to emm type level. The remaining 3.8% (n = 117) of our cases corresponded to novel types/subtypes, contamination, laboratory sample transcription errors or problems arising from high

  7. Attitudes of non-African American focus group participants toward return of results from exome and whole genome sequencing.

    PubMed

    Yu, Joon-Ho; Crouch, Julia; Jamal, Seema M; Bamshad, Michael J; Tabor, Holly K

    2014-09-01

    Exome sequencing and whole genome sequencing (ES/WGS) present individuals with the opportunity to benefit from a broad scope of genetic results of clinical and personal utility. Yet, it is unclear which genetic results people want to receive (i.e., what type of genetic information they want to learn about themselves) or conversely not receive, and how they want to receive or manage results over time. Very little is known about whether and how attitudes toward receiving individual results from ES/WGS vary among racial/ethnic populations. We conducted 13 focus groups with a racially and ethnically diverse parent population (n = 76) to investigate attitudes toward return of individual results from WGS. We report on our findings for non-African American (non-AA) participants. Non-AA participants were primarily interested in genetic results on which they could act or "do something about." They defined "actionability" broadly to include individual medical treatment and disease prevention. The ability to plan for the future was both a motivation for and an expected benefit of receiving results. Their concerns focused on the meaning of results, specifically the potential inaccuracy and uncertainty of results. Non-AA participants expected healthcare providers to be involved in results management by helping them interpret results in the context of their own health and by providing counseling support. We compare and contrast these themes with those we previously reported from our analysis of African American (AA) perspectives to highlight the importance of varying preferences for results, characterize the central role of temporal orientation in framing expectations about the possibility of receiving ES/WGS results, and identify potential avenues by which genomic healthcare disparities may be inadvertently perpetuated. © 2014 Wiley Periodicals, Inc.

  8. Evolutionary pathway to increased virulence and epidemic group A Streptococcus disease derived from 3,615 genome sequences

    PubMed Central

    Nasser, Waleed; Beres, Stephen B.; Olsen, Randall J.; Dean, Melissa A.; Rice, Kelsey A.; Long, S. Wesley; Kristinsson, Karl G.; Gottfredsson, Magnus; Vuopio, Jaana; Raisanen, Kati; Caugant, Dominique A.; Steinbakk, Martin; Low, Donald E.; McGeer, Allison; Darenberg, Jessica; Henriques-Normark, Birgitta; Van Beneden, Chris A.; Hoffmann, Steen; Musser, James M.

    2014-01-01

    We sequenced the genomes of 3,615 strains of serotype Emm protein 1 (M1) group A Streptococcus to unravel the nature and timing of molecular events contributing to the emergence, dissemination, and genetic diversification of an unusually virulent clone that now causes epidemic human infections worldwide. We discovered that the contemporary epidemic clone emerged in stepwise fashion from a precursor cell that first contained the phage encoding an extracellular DNase virulence factor (streptococcal DNase D2, SdaD2) and subsequently acquired the phage encoding the SpeA1 variant of the streptococcal pyrogenic exotoxin A superantigen. The SpeA2 toxin variant evolved from SpeA1 by a single-nucleotide change in the M1 progenitor strain before acquisition by horizontal gene transfer of a large chromosomal region encoding secreted toxins NAD+-glycohydrolase and streptolysin O. Acquisition of this 36-kb region in the early 1980s into just one cell containing the phage-encoded sdaD2 and speA2 genes was the final major molecular event preceding the emergence and rapid intercontinental spread of the contemporary epidemic clone. Thus, we resolve a decades-old controversy about the type and sequence of genomic alterations that produced this explosive epidemic. Analysis of comprehensive, population-based contemporary invasive strains from seven countries identified strong patterns of temporal population structure. Compared with a preepidemic reference strain, the contemporary clone is significantly more virulent in nonhuman primate models of pharyngitis and necrotizing fasciitis. A key finding is that the molecular evolutionary events transpiring in just one bacterial cell ultimately have produced millions of human infections worldwide. PMID:24733896

  9. Extensive Capsule Locus Variation and Large-Scale Genomic Recombination within the Klebsiella pneumoniae Clonal Group 258.

    PubMed

    Wyres, Kelly L; Gorrie, Claire; Edwards, David J; Wertheim, Heiman F L; Hsu, Li Yang; Van Kinh, Nguyen; Zadoks, Ruth; Baker, Stephen; Holt, Kathryn E

    2015-04-10

    Klebsiella pneumoniae clonal group (CG) 258, comprising sequence types (STs) 258, 11, and closely related variants, is associated with dissemination of the K. pneumoniae carbapenemase (KPC). Hospital outbreaks of KPC CG258 infections have been observed globally and are very difficult to treat. As a consequence, there is renewed interest in alternative infection control measures such as vaccines and phage or depolymerase treatments targeting the K. pneumoniae polysaccharide capsule. To date, 78 immunologically distinct capsule variants have been described in K. pneumoniae. Previous investigations of ST258 and a small number of closely related strains suggested that capsular variation was limited within this clone; only two distinct ST258 capsule polysaccharide synthesis (cps) loci have been identified, both acquired through large-scale recombination events (>50 kb). In contrast to previous studies, we report a comparative genomic analysis of the broader K. pneumoniae CG258 (n = 39). We identified 11 different cps loci within CG258, indicating that capsular switching is actually common within the complex. We observed several insertion sequences (IS) within the cps loci, and show further intraclone diversification of two cps loci through IS activity. Our data also indicate that several large-scale recombination events have shaped the genomes of CG258, and that definition of the complex should be broadened to include ST395 (also reported to harbor KPC). As only the second report of extensive intraclonal cps variation among Gram-negative bacterial species, our findings alter our understanding of the evolution of these organisms and have key implications for the design of control measures targeting K. pneumoniae capsules.

  10. Challenges of flow-cytometric estimation of nuclear genome size in orchids, a plant group with both whole-genome and progressively partial endoreplication.

    PubMed

    Trávníček, Pavel; Ponert, Jan; Urfus, Tomáš; Jersáková, Jana; Vrána, Jan; Hřibová, Eva; Doležel, Jaroslav; Suda, Jan

    2015-10-01

    Nuclear genome size is an inherited quantitative trait of eukaryotic organisms with both practical and biological consequences. A detailed analysis of major families is a promising approach to fully understand the biological meaning of the extensive variation in genome size in plants. Although Orchidaceae accounts for ∼10% of the angiosperm diversity, the knowledge of patterns and dynamics of their genome size is limited, in part due to difficulties in flow cytometric analyses. Cells in various somatic tissues of orchids undergo extensive endoreplication, either whole-genome or partial, and the G1-phase nuclei with 2C DNA amounts may be lacking, resulting in overestimated genome size values. Interpretation of DNA content histograms is particularly challenging in species with progressively partial endoreplication, in which the ratios between the positions of two neighboring DNA peaks are lower than two. In order to assess distributions of nuclear DNA amounts and identify tissue suitable for reliable estimation of nuclear DNA content, we analyzed six different tissue types in 48 orchid species belonging to all recognized subfamilies. Although traditionally used leaves may provide incorrect C-values, particularly in species with progressively partial endoreplication, young ovaries and pollinaria consistently yield 2C and 1C peaks of their G1-phase nuclei, respectively, and are, therefore, the most suitable parts for genome size studies in orchids. We also provide new DNA C-values for 22 orchid genera and 42 species. Adhering to the proposed methodology would allow for reliable genome size estimates in this largest plant family. Although our research was limited to orchids, the need to find a suitable tissue with dominant 2C peak of G1-phase nuclei applies to all endopolyploid species.

  11. Group II Intron-Mediated Trans-Splicing in the Gene-Rich Mitochondrial Genome of an Enigmatic Eukaryote, Diphylleia rotans

    PubMed Central

    Kamikawa, Ryoma; Shiratori, Takashi; Ishida, Ken-Ichiro; Miyashita, Hideaki; Roger, Andrew J.

    2016-01-01

    Although mitochondria have evolved from a single endosymbiotic event, present day mitochondria of diverse eukaryotes display a great range of genome structures, content and features. Group I and group II introns are two features that are distributed broadly but patchily in mitochondrial genomes across branches of the tree of eukaryotes. While group I intron-mediated trans-splicing has been reported from some lineages distantly related to each other, findings of group II intron-mediated trans-splicing has been restricted to members of the Chloroplastida. In this study, we found the mitochondrial genome of the unicellular eukaryote Diphylleia rotans possesses currently the second largest gene repertoire. On the basis of a probable phylogenetic position of Diphylleia, which is located within Amorphea, current mosaic gene distribution in Amorphea must invoke parallel gene losses from mitochondrial genomes during evolution. Most notably, although the cytochrome c oxidase subunit (cox) 1 gene was split into four pieces which located at a distance to each other, we confirmed that a single mature mRNA that covered the entire coding region could be generated by group II intron-mediated trans-splicing. This is the first example of group II intron-mediated trans-splicing outside Chloroplastida. Similar trans-splicing mechanisms likely work for bipartitely split cox2 and nad3 genes to generate single mature mRNAs. We finally discuss origin and evolution of this type of trans-splicing in D. rotans as well as in eukaryotes. PMID:26833505

  12. Whole-Genome Pyrosequencing of an Epidemic Multidrug-Resistant Acinetobacter baumannii Strain Belonging to the European Clone II Group ▿ †

    PubMed Central

    Iacono, Michele; Villa, Laura; Fortini, Daniela; Bordoni, Roberta; Imperi, Francesco; Bonnal, Raoul J. P.; Sicheritz-Ponten, Thomas; De Bellis, Gianluca; Visca, Paolo; Cassone, Antonio; Carattoli, Alessandra

    2008-01-01

    The whole-genome sequence of an epidemic, multidrug-resistant Acinetobacter baumannii strain (strain ACICU) belonging to the European clone II group and carrying the plasmid-mediated blaOXA-58 carbapenem resistance gene was determined. The A. baumannii ACICU genome was compared with the genomes of A. baumannii ATCC 17978 and Acinetobacter baylyi ADP1, with the aim of identifying novel genes related to virulence and drug resistance. A. baumannii ACICU has a single chromosome of 3,904,116 bp (which is predicted to contain 3,758 genes) and two plasmids, pACICU1 and pACICU2, of 28,279 and 64,366 bp, respectively. Genome comparison showed 86.4% synteny with A. baumannii ATCC 17978 and 14.8% synteny with A. baylyi ADP1. A conspicuous number of transporters belonging to different superfamilies was predicted for A. baumannii ACICU. The relative number of transporters was much higher in ACICU than in ATCC 17978 and ADP1 (76.2, 57.2, and 62.5 transporters per Mb of genome, respectively). An antibiotic resistance island, AbaR2, was identified in ACICU and had plausibly evolved by reductive evolution from the AbaR1 island previously described in multiresistant strain A. baumannii AYE. Moreover, 36 putative alien islands (pAs) were detected in the ACICU genome; 24 of these had previously been described in the ATCC 17978 genome, 4 are proposed here for the first time and are present in both ATCC 17978 and ACICU, and 8 are unique to the ACICU genome. Fifteen of the pAs in the ACICU genome encode genes related to drug resistance, including membrane transporters and ex novo acquired resistance genes. These findings provide novel insight into the genetic basis of A. baumannii resistance. PMID:18411315

  13. Phylogenetic relationship and virulence inference of Streptococcus Anginosus Group: curated annotation and whole-genome comparative analysis support distinct species designation

    PubMed Central

    2013-01-01

    Background The Streptococcus Anginosus Group (SAG) represents three closely related species of the viridans group streptococci recognized as commensal bacteria of the oral, gastrointestinal and urogenital tracts. The SAG also cause severe invasive infections, and are pathogens during cystic fibrosis (CF) pulmonary exacerbation. Little genomic information or description of virulence mechanisms is currently available for SAG. We conducted intra and inter species whole-genome comparative analyses with 59 publically available Streptococcus genomes and seven in-house closed high quality finished SAG genomes; S. constellatus (3), S. intermedius (2), and S. anginosus (2). For each SAG species, we sequenced at least one numerically dominant strain from CF airways recovered during acute exacerbation and an invasive, non-lung isolate. We also evaluated microevolution that occurred within two isolates that were cultured from one individual one year apart. Results The SAG genomes were most closely related to S. gordonii and S. sanguinis, based on shared orthologs and harbor a similar number of proteins within each COG category as other Streptococcus species. Numerous characterized streptococcus virulence factor homologs were identified within the SAG genomes including; adherence, invasion, spreading factors, LPxTG cell wall proteins, and two component histidine kinases known to be involved in virulence gene regulation. Mobile elements, primarily integrative conjugative elements and bacteriophage, account for greater than 10% of the SAG genomes. S. anginosus was the most variable species sequenced in this study, yielding both the smallest and the largest SAG genomes containing multiple genomic rearrangements, insertions and deletions. In contrast, within the S. constellatus and S. intermedius species, there was extensive continuous synteny, with only slight differences in genome size between strains. Within S. constellatus we were able to determine important SNPs and changes in

  14. Genome-wide evidence of Austronesian–Bantu admixture and cultural reversion in a hunter-gatherer group of Madagascar

    PubMed Central

    Pierron, Denis; Razafindrazaka, Harilanto; Pagani, Luca; Ricaut, François-Xavier; Antao, Tiago; Capredon, Mélanie; Sambo, Clément; Radimilahy, Chantal; Rakotoarisoa, Jean-Aimé; Blench, Roger M.; Letellier, Thierry; Kivisild, Toomas

    2014-01-01

    Linguistic and cultural evidence suggest that Madagascar was the final point of two major dispersals of Austronesian- and Bantu-speaking populations. Today, the Mikea are described as the last-known Malagasy population reported to be still practicing a hunter-gatherer lifestyle. It is unclear, however, whether the Mikea descend from a remnant population that existed before the arrival of Austronesian and Bantu agriculturalists or whether it is only their lifestyle that separates them from the other contemporary populations of South Madagascar. To address these questions we have performed a genome-wide analysis of >700,000 SNP markers on 21 Mikea, 24 Vezo, and 24 Temoro individuals, together with 50 individuals from Bajo and Lebbo populations from Indonesia. Our analyses of these data in the context of data available from other Southeast Asian and African populations reveal that all three Malagasy populations are derived from the same admixture event involving Austronesian and Bantu sources. In contrast to the fact that most of the vocabulary of the Malagasy speakers is derived from the Barito group of the Austronesian language family, we observe that only one-third of their genetic ancestry is related to the populations of the Java-Kalimantan-Sulawesi area. Because no additional ancestry components distinctive for the Mikea were found, it is likely that they have adopted their hunter-gatherer way of life through cultural reversion, and selection signals suggest a genetic adaptation to their new lifestyle. PMID:24395773

  15. Genome-wide evidence of Austronesian-Bantu admixture and cultural reversion in a hunter-gatherer group of Madagascar.

    PubMed

    Pierron, Denis; Razafindrazaka, Harilanto; Pagani, Luca; Ricaut, François-Xavier; Antao, Tiago; Capredon, Mélanie; Sambo, Clément; Radimilahy, Chantal; Rakotoarisoa, Jean-Aimé; Blench, Roger M; Letellier, Thierry; Kivisild, Toomas

    2014-01-21

    Linguistic and cultural evidence suggest that Madagascar was the final point of two major dispersals of Austronesian- and Bantu-speaking populations. Today, the Mikea are described as the last-known Malagasy population reported to be still practicing a hunter-gatherer lifestyle. It is unclear, however, whether the Mikea descend from a remnant population that existed before the arrival of Austronesian and Bantu agriculturalists or whether it is only their lifestyle that separates them from the other contemporary populations of South Madagascar. To address these questions we have performed a genome-wide analysis of >700,000 SNP markers on 21 Mikea, 24 Vezo, and 24 Temoro individuals, together with 50 individuals from Bajo and Lebbo populations from Indonesia. Our analyses of these data in the context of data available from other Southeast Asian and African populations reveal that all three Malagasy populations are derived from the same admixture event involving Austronesian and Bantu sources. In contrast to the fact that most of the vocabulary of the Malagasy speakers is derived from the Barito group of the Austronesian language family, we observe that only one-third of their genetic ancestry is related to the populations of the Java-Kalimantan-Sulawesi area. Because no additional ancestry components distinctive for the Mikea were found, it is likely that they have adopted their hunter-gatherer way of life through cultural reversion, and selection signals suggest a genetic adaptation to their new lifestyle.

  16. Promising genomic transfectant into Xeroderma pigmentosum group A with highly amplified mouse DNA and intermediate UV resistance turns revertant

    SciTech Connect

    Blum, M.; Baumann, I.; Lohrer, H.; Rahmsdorf, H.J.; Herrlich, P.

    1989-04-28

    Following transfection of genomic mouse DNA into an SV40 transformed fibroblast cell line from a patient with Xeroderma pigmentosum (complementation group A, XPA), a single UV resistant cell clone was isolated out of a total of 10(4) independent transfectants. The recipient XPA cell line has as yet not produced spontaneous revertants among 2.2 x 10(8) cells. The isolated cell clone contains 50-70 kb of mouse sequences which are heavily amplified (500-fold), and has acquired both intermediate resistance to UV killing and intermediate unscheduled DNA synthesis (UDS) capacity. By continued passage without selective pressure, cells were generated, which had lost both the dominant marker gene and repetitive mouse sequences. Single colonies of these cells were still intermediately resistant to UV suggesting that either undetected unique mouse DNA had segregated from the bulk of repetitive DNA, or, more likely, that the initially isolated transfectant was a spontaneous revertant. This documents that a persuasive clone isolated can still be a false positive (spontaneous revertant) and that an extremely laborious approach may lead into a dead end.

  17. Genome-Wide Association Study of Ureide Concentration in Diverse Maturity Group IV Soybean [Glycine max (L.) Merr.] Accessions

    PubMed Central

    Ray, Jeffery D.; Dhanapal, Arun Prabhu; Singh, Shardendu K.; Hoyos-Villegas, Valerio; Smith, James R.; Purcell, Larry C.; King, C. Andy; Boykin, Debbie; Cregan, Perry B.; Song, Qijian; Fritschi, Felix B.

    2015-01-01

    Ureides are the N-rich products of N-fixation that are transported from soybean nodules to the shoot. Ureides are known to accumulate in leaves in response to water-deficit stress, and this has been used to identify genotypes with reduced N-fixation sensitivity to drought. Our objectives in this research were to determine shoot ureide concentrations in 374 Maturity Group IV soybean accessions and to identify genomic regions associated with shoot ureide concentration. The accessions were grown at two locations (Columbia, MO, and Stuttgart, AR) in 2 yr (2009 and 2010) and characterized for ureide concentration at beginning flowering to full bloom. Average shoot ureide concentrations across all four environments (two locations and two years) and 374 accessions ranged from 12.4 to 33.1 µmol g−1 and were comparable to previously reported values. SNP–ureide associations within and across the four environments were assessed using 33,957 SNPs with a MAF ≥0.03. In total, 53 putative loci on 18 chromosomes were identified as associated with ureide concentration. Two of the putative loci were located near previously reported QTL associated with ureide concentration and 30 loci were located near genes associated with ureide metabolism. The remaining putative loci were not near chromosomal regions previously associated with shoot ureide concentration and may mark new genes involved in ureide metabolism. Ultimately, confirmation of these putative loci will provide new sources of variation for use in soybean breeding programs. PMID:26374596

  18. The Genomics Education Partnership: Successful Integration of Research into Laboratory Classes at a Diverse Group of Undergraduate Institutions

    PubMed Central

    Shaffer, Christopher D.; Alvarez, Consuelo; Bailey, Cheryl; Barnard, Daron; Bhalla, Satish; Chandrasekaran, Chitra; Chandrasekaran, Vidya; Chung, Hui-Min; Dorer, Douglas R.; Du, Chunguang; Eckdahl, Todd T.; Poet, Jeff L.; Frohlich, Donald; Goodman, Anya L.; Gosser, Yuying; Hauser, Charles; Hoopes, Laura L.M.; Johnson, Diana; Jones, Christopher J.; Kaehler, Marian; Kokan, Nighat; Kopp, Olga R.; Kuleck, Gary A.; McNeil, Gerard; Moss, Robert; Myka, Jennifer L.; Nagengast, Alexis; Morris, Robert; Overvoorde, Paul J.; Shoop, Elizabeth; Parrish, Susan; Reed, Kelynne; Regisford, E. Gloria; Revie, Dennis; Rosenwald, Anne G.; Saville, Ken; Schroeder, Stephanie; Shaw, Mary; Skuse, Gary; Smith, Christopher; Smith, Mary; Spana, Eric P.; Spratt, Mary; Stamm, Joyce; Thompson, Jeff S.; Wawersik, Matthew; Wilson, Barbara A.; Youngblom, Jim; Leung, Wilson; Buhler, Jeremy; Mardis, Elaine R.; Lopatto, David

    2010-01-01

    Genomics is not only essential for students to understand biology but also provides unprecedented opportunities for undergraduate research. The goal of the Genomics Education Partnership (GEP), a collaboration between a growing number of colleges and universities around the country and the Department of Biology and Genome Center of Washington University in St. Louis, is to provide such research opportunities. Using a versatile curriculum that has been adapted to many different class settings, GEP undergraduates undertake projects to bring draft-quality genomic sequence up to high quality and/or participate in the annotation of these sequences. GEP undergraduates have improved more than 2 million bases of draft genomic sequence from several species of Drosophila and have produced hundreds of gene models using evidence-based manual annotation. Students appreciate their ability to make a contribution to ongoing research, and report increased independence and a more active learning approach after participation in GEP projects. They show knowledge gains on pre- and postcourse quizzes about genes and genomes and in bioinformatic analysis. Participating faculty also report professional gains, increased access to genomics-related technology, and an overall positive experience. We have found that using a genomics research project as the core of a laboratory course is rewarding for both faculty and students. PMID:20194808

  19. Genome-wide differentiation of various melon horticultural groups for use in genome wide association study for fruit firmness and construction of a high resolution genetic map

    USDA-ARS?s Scientific Manuscript database

    We generated 13,789 single nucleotide plymorphism (SNP) markers from 97 melon accessions using genotyping by sequencing and anchored them to chromosomes to understand genome-wide fixation index between various melon morphotypes and linkage disequilibrium (LD) decay for inodorus and cantalupensis, th...

  20. Enrichment and genome sequence of the group I.1a ammonia-oxidizing Archaeon "Ca. Nitrosotenuis uzonensis" representing a clade globally distributed in thermal habitats.

    PubMed

    Lebedeva, Elena V; Hatzenpichler, Roland; Pelletier, Eric; Schuster, Nathalie; Hauzmayer, Sandra; Bulaev, Aleksandr; Grigor'eva, Nadezhda V; Galushko, Alexander; Schmid, Markus; Palatinszky, Marton; Le Paslier, Denis; Daims, Holger; Wagner, Michael

    2013-01-01

    The discovery of ammonia-oxidizing archaea (AOA) of the phylum Thaumarchaeota and the high abundance of archaeal ammonia monooxygenase subunit A encoding gene sequences in many environments have extended our perception of nitrifying microbial communities. Moreover, AOA are the only aerobic ammonia oxidizers known to be active in geothermal environments. Molecular data indicate that in many globally distributed terrestrial high-temperature habits a thaumarchaeotal lineage within the Nitrosopumilus cluster (also called "marine" group I.1a) thrives, but these microbes have neither been isolated from these systems nor functionally characterized in situ yet. In this study, we report on the enrichment and genomic characterization of a representative of this lineage from a thermal spring in Kamchatka. This thaumarchaeote, provisionally classified as "Candidatus Nitrosotenuis uzonensis", is a moderately thermophilic, non-halophilic, chemolithoautotrophic ammonia oxidizer. The nearly complete genome sequence (assembled into a single scaffold) of this AOA confirmed the presence of the typical thaumarchaeotal pathways for ammonia oxidation and carbon fixation, and indicated its ability to produce coenzyme F420 and to chemotactically react to its environment. Interestingly, like members of the genus Nitrosoarchaeum, "Candidatus N. uzonensis" also possesses a putative artubulin-encoding gene. Genome comparisons to related AOA with available genome sequences confirmed that the newly cultured AOA has an average nucleotide identity far below the species threshold and revealed a substantial degree of genomic plasticity with unique genomic regions in "Ca. N. uzonensis", which potentially include genetic determinants of ecological niche differentiation.

  1. Genome-wide identification and characterization of the superoxide dismutase gene family in Musa acuminata cv. Tianbaojiao (AAA group).

    PubMed

    Feng, Xin; Lai, Zhongxiong; Lin, Yuling; Lai, Gongti; Lian, Conglong

    2015-10-20

    Superoxide dismutase (SOD) is an essential enzyme of the plant antioxidant system that responds to oxidative stresses caused by adverse conditions. Banana is an important staple and economic crop in tropical and subtropical regions. However, its growth and yield are constantly affected by various abiotic stresses. To analyze the roles of distinct SOD genes under various stresses, a detailed characterization and analysis of the SOD gene family in Cavendish banana is indispensable. The presence and structure of the SOD family genes were experimentally verified using 5'/3' RACE-PCR, reverse transcription PCR and PCR. Then, their syntenic relationships, conserved motifs and phylogenetic relationships were analyzed using software. Cis-elements present in the promoters were predicted via PlantCARE. And the expression levels under abiotic and hormonal stresses were determined using real-time quantitative polymerase chain reaction. In total, 25 'Tianbaojiao' SOD cDNAs (MaSODs), which encoded six Cu/ZnSODs, four MnSODs and two FeSODs, were cloned. The 12 MaSOD genes were divided into four groups based on their conserved motifs, which corroborated their classifications based on gene-structure patterns and subcellular localizations. Eleven MaSOD promoters were isolated and found to contain many cis-acting elements involved in stress responses. Gene expression analysis showed that 11 out of the 12 MaSODs were expressed in all tested tissues (leaf, pseudostem and root), whereas MaCSD2B was expressed only in leaves and roots. Specific MaSOD members exhibited different expression patterns under abiotic and hormonal treatments. Among the 12 MaSOD genes, MaCSD1D was the only one that responded to all eight treatments, suggesting that this gene plays a predominant role in reactive oxygen species scavenging caused by various stresses in banana. A genome-wide analysis showed that the 'Tianbaojiao' banana harbored an expanded SOD gene family. Whole genome duplication, segmental

  2. Whole-Genome Sequences of Four Strains Closely Related to Members of the Mycobacterium chelonae Group, Isolated from Biofilms in a Drinking Water Distribution System Simulator

    EPA Science Inventory

    We report the draft genome sequences of four Mycobacterium chelonae group strains from biofilms obtained after a ‘chlorine burn’ in a chloraminated drinking water distribution system simulator. These opportunistic pathogens have been detected in drinking and hospital water distr...

  3. DNA profiling analysis of 100 consecutive de novo acute myeloid leukemia cases reveals patterns of genomic instability that affect all cytogenetic risk groups.

    PubMed

    Suela, J; Alvarez, S; Cifuentes, F; Largo, C; Ferreira, B I; Blesa, D; Ardanaz, M; García, R; Marquez, J A; Odero, M D; Calasanz, M J; Cigudosa, J C

    2007-06-01

    We have carried out a high-resolution whole genome DNA profiling analysis on 100 bone marrow samples from a consecutive series of de novo acute myeloid leukemia (AML) cases. After discarding copy number changes that are known to be genetic polymorphisms, we found that genomic aberrations (GA) in the form of gains or losses of genetic material were present in 74% of the samples, with a median of 2 GA per case (range 0-35). In addition to the cytogenetically detected aberration, GA were present in cases from all cytogenetic prognostic groups: 79% in the favorable group, 60% in the intermediate group (including 59% of cases with normal karyotype) and 83% in the adverse group. Five aberrant deleted regions were recurrently associated with cases with a highly aberrant genome (e.g., a 1.5 Mb deletion at 17q11.2 and a 750 kb deletion at 5q31.1). Different degrees of genomic instability showed a statistically significant impact on survival curves, even within the normal karyotype cases. This association was independent of other clinical and genetic parameters. Our study provides, for the first time, a detailed picture of the nature and frequency of DNA copy number aberrations in de novo AML.

  4. Whole-Genome Sequences of Four Strains Closely Related to Members of the Mycobacterium chelonae Group, Isolated from Biofilms in a Drinking Water Distribution System Simulator

    EPA Science Inventory

    We report the draft genome sequences of four Mycobacterium chelonae group strains from biofilms obtained after a ‘chlorine burn’ in a chloraminated drinking water distribution system simulator. These opportunistic pathogens have been detected in drinking and hospital water distr...

  5. Genome Sequencing of Bacillus subtilis SC-8, Antagonistic to the Bacillus cereus Group, Isolated from Traditional Korean Fermented-Soybean Food

    PubMed Central

    Yeo, In-Cheol; Lee, Nam Keun

    2012-01-01

    Bacillus subtilis SC-8 is a Gram-positive bacterium displaying narrow antagonistic activity for the Bacillus cereus group. B. subtilis SC-8 was isolated from Korean traditional fermented-soybean food. Here we report the draft genome sequence of B. subtilis SC-8, including biosynthetic genes for antibiotics that may have beneficial effects for control of food-borne pathogens. PMID:22207744

  6. Draft genome sequence of Streptomyces vitaminophilus ATCC 31673, a producer of pyrrolomycin antibiotics, some of which contain a nitro group

    SciTech Connect

    Mahan, Kristina M.; Klingeman, Dawn Marie; Robert L. Hettich; Parry, Ronald J.; Graham, David E.

    2016-01-21

    Streptomyces vitaminophilus produces pyrrolomycins, which are halogenated polyketide antibiotics. Some of the pyrrolomycins contain a rare nitro group located on the pyrrole ring. In addition, the 6.5-Mbp genome encodes 5,941 predicted protein-coding sequences in 39 contigs with a 71.9% G+C content.

  7. Phylogenomic network and comparative genomics reveal a diverged member of the ΦKZ-related group, marine vibrio phage ΦJM-2012.

    PubMed

    Jang, Ho Bin; Fagutao, Fernand F; Nho, Seong Won; Park, Seong Bin; Cha, In Seok; Yu, Jong Earn; Lee, Jung Seok; Im, Se Pyeong; Aoki, Takashi; Jung, Tae Sung

    2013-12-01

    Bacteriophages are the largest reservoir of genetic diversity. Here we describe the novel phage ΦJM-2012. This natural isolate from marine Vibrio cyclitrophicus possesses very few gene contents relevant to other well-studied marine Vibrio phages. To better understand its evolutionary history, we built a mathematical model of pairwise relationships among 1,221 phage genomes, in which the genomes (nodes) are linked by edges representing the normalized number of shared orthologous protein families. This weighted network revealed that ΦJM-2012 was connected to only five members of the Pseudomonas ΦKZ-like phage family in an isolated network, strongly indicating that it belongs to this phage group. However, comparative genomic analyses highlighted an almost complete loss of colinearity with the ΦKZ-related genomes and little conservation of gene order, probably reflecting the action of distinct evolutionary forces on the genome of ΦJM-2012. In this phage, typical conserved core genes, including six RNA polymerase genes, were frequently displaced and the hyperplastic regions were rich in both unique genes and predicted unidirectional promoters with highly correlated orientations. Further, analysis of the ΦJM-2012 genome showed that segments of the conserved N-terminal parts of ΦKZ tail fiber paralogs exhibited evidence of combinatorial assortment, having switched transcriptional orientation, and there was recruitment and/or structural changes among phage endolysins and tail spike protein. Thus, this naturally occurring phage appears to have branched from a common ancestor of the ΦKZ-related groups, showing a distinct genomic architecture and unique genes that most likely reflect adaptation to its chosen host and environment.

  8. Isolation and characterization of Ty1-copia group of LTRs in genome of three species of Datura: D. innoxia, D. stramonium and D. metel.

    PubMed

    Singh, Alka; Nirala, N K; Narula, Alka; Das, Sandip; Srivastava, Prem S

    2011-07-01

    Retrotransposons (RT) constitute a major fraction of plant genome. They are implicated in evolution and sequence organization. These elements have been proposed to have major role in evolution and variation in genome size. The sequence information of these RT regions in terms of divergence and conservation could be utilized for determining the interrelationship among various copia retrotransposons within the genome. In order to assess the diversity of Ty1-copia group of retroelements, reverse transcriptase (RT) sequence was amplified from genomes of three medicinally important Datura species: D. innoxia, D. stramonium and D. metel using the primers derived from two conserved domains of RT region. A total of twenty one independent amplicons from RT regions were cloned, sequenced and compared. The intra-family divergence at amino acid level ranged from 4 to 52 %. Though intra-family RT sequences are conserved, no two sequences are identical. Southern blot hybridization suggested that Ty1-copia-like retrotransposons are dispersed throughout the Datura genome. The results indicate a high degree of heterogeneity among the Ty1-copia group of retroelements in Datura species.

  9. Molecular classification of diffuse cerebral WHO grade II/III gliomas using genome- and transcriptome-wide profiling improves stratification of prognostically distinct patient groups.

    PubMed

    Weller, Michael; Weber, Ruthild G; Willscher, Edith; Riehmer, Vera; Hentschel, Bettina; Kreuz, Markus; Felsberg, Jörg; Beyer, Ulrike; Löffler-Wirth, Henry; Kaulich, Kerstin; Steinbach, Joachim P; Hartmann, Christian; Gramatzki, Dorothee; Schramm, Johannes; Westphal, Manfred; Schackert, Gabriele; Simon, Matthias; Martens, Tobias; Boström, Jan; Hagel, Christian; Sabel, Michael; Krex, Dietmar; Tonn, Jörg C; Wick, Wolfgang; Noell, Susan; Schlegel, Uwe; Radlwimmer, Bernhard; Pietsch, Torsten; Loeffler, Markus; von Deimling, Andreas; Binder, Hans; Reifenberger, Guido

    2015-05-01

    Cerebral gliomas of World Health Organization (WHO) grade II and III represent a major challenge in terms of histological classification and clinical management. Here, we asked whether large-scale genomic and transcriptomic profiling improves the definition of prognostically distinct entities. We performed microarray-based genome- and transcriptome-wide analyses of primary tumor samples from a prospective German Glioma Network cohort of 137 patients with cerebral gliomas, including 61 WHO grade II and 76 WHO grade III tumors. Integrative bioinformatic analyses were employed to define molecular subgroups, which were then related to histology, molecular biomarkers, including isocitrate dehydrogenase 1 or 2 (IDH1/2) mutation, 1p/19q co-deletion and telomerase reverse transcriptase (TERT) promoter mutations, and patient outcome. Genomic profiling identified five distinct glioma groups, including three IDH1/2 mutant and two IDH1/2 wild-type groups. Expression profiling revealed evidence for eight transcriptionally different groups (five IDH1/2 mutant, three IDH1/2 wild type), which were only partially linked to the genomic groups. Correlation of DNA-based molecular stratification with clinical outcome allowed to define three major prognostic groups with characteristic genomic aberrations. The best prognosis was found in patients with IDH1/2 mutant and 1p/19q co-deleted tumors. Patients with IDH1/2 wild-type gliomas and glioblastoma-like genomic alterations, including gain on chromosome arm 7q (+7q), loss on chromosome arm 10q (-10q), TERT promoter mutation and oncogene amplification, displayed the worst outcome. Intermediate survival was seen in patients with IDH1/2 mutant, but 1p/19q intact, mostly astrocytic gliomas, and in patients with IDH1/2 wild-type gliomas lacking the +7q/-10q genotype and TERT promoter mutation. This molecular subgrouping stratified patients into prognostically distinct groups better than histological classification. Addition of gene expression

  10. A diverse group of small circular ssDNA viral genomes in human and non-human primate stools

    PubMed Central

    Ng, Terry Fei Fan; Zhang, Wen; Sachsenröder, Jana; Kondov, Nikola O.; da Costa, Antonio Charlys; Vega, Everardo; Holtz, Lori R.; Wu, Guang; Wang, David; Stine, Colin O.; Antonio, Martin; Mulvaney, Usha S.; Muench, Marcus O.; Deng, Xutao; Ambert-Balay, Katia; Pothier, Pierre; Vinjé, Jan; Delwart, Eric

    2015-01-01

    Viral metagenomics sequencing of fecal samples from outbreaks of acute gastroenteritis from the US revealed the presence of small circular ssDNA viral genomes encoding a replication initiator protein (Rep). Viral genomes were ∼2.5 kb in length, with bi-directionally oriented Rep and capsid (Cap) encoding genes and a stem loop structure downstream of Rep. Several genomes showed evidence of recombination. By digital screening of an in-house virome database (1.04 billion reads) using BLAST, we identified closely related sequences from cases of unexplained diarrhea in France. Deep sequencing and PCR detected such genomes in 7 of 25 US (28 percent) and 14 of 21 French outbreaks (67 percent). One of eighty-five sporadic diarrhea cases in the Gambia was positive by PCR. Twenty-two complete genomes were characterized showing that viruses from patients in the same outbreaks were closely related suggesting common origins. Similar genomes were also characterized from the stools of captive chimpanzees, a gorilla, a black howler monkey, and a lemur that were more diverse than the human stool-associated genomes. The name smacovirus is proposed for this monophyletic viral clade. Possible tropism include mammalian enteric cells or ingested food components such as infected plants. No evidence of viral amplification was found in immunodeficient mice orally inoculated with smacovirus-positive stool supernatants. A role for smacoviruses in diarrhea, if any, remains to be demonstrated. PMID:27774288

  11. Genome-wide Association for Major Depression Through Age at Onset Stratification: Major Depressive Disorder Working Group of the Psychiatric Genomics Consortium.

    PubMed

    Power, Robert A; Tansey, Katherine E; Buttenschøn, Henriette Nørmølle; Cohen-Woods, Sarah; Bigdeli, Tim; Hall, Lynsey S; Kutalik, Zoltán; Lee, S Hong; Ripke, Stephan; Steinberg, Stacy; Teumer, Alexander; Viktorin, Alexander; Wray, Naomi R; Arolt, Volker; Baune, Bernard T; Boomsma, Dorret I; Børglum, Anders D; Byrne, Enda M; Castelao, Enrique; Craddock, Nick; Craig, Ian W; Dannlowski, Udo; Deary, Ian J; Degenhardt, Franziska; Forstner, Andreas J; Gordon, Scott D; Grabe, Hans J; Grove, Jakob; Hamilton, Steven P; Hayward, Caroline; Heath, Andrew C; Hocking, Lynne J; Homuth, Georg; Hottenga, Jouke J; Kloiber, Stefan; Krogh, Jesper; Landén, Mikael; Lang, Maren; Levinson, Douglas F; Lichtenstein, Paul; Lucae, Susanne; MacIntyre, Donald J; Madden, Pamela; Magnusson, Patrik K E; Martin, Nicholas G; McIntosh, Andrew M; Middeldorp, Christel M; Milaneschi, Yuri; Montgomery, Grant W; Mors, Ole; Müller-Myhsok, Bertram; Nyholt, Dale R; Oskarsson, Hogni; Owen, Michael J; Padmanabhan, Sandosh; Penninx, Brenda W J H; Pergadia, Michele L; Porteous, David J; Potash, James B; Preisig, Martin; Rivera, Margarita; Shi, Jianxin; Shyn, Stanley I; Sigurdsson, Engilbert; Smit, Johannes H; Smith, Blair H; Stefansson, Hreinn; Stefansson, Kari; Strohmaier, Jana; Sullivan, Patrick F; Thomson, Pippa; Thorgeirsson, Thorgeir E; Van der Auwera, Sandra; Weissman, Myrna M; Breen, Gerome; Lewis, Cathryn M

    2017-02-15

    Major depressive disorder (MDD) is a disabling mood disorder, and despite a known heritable component, a large meta-analysis of genome-wide association studies revealed no replicable genetic risk variants. Given prior evidence of heterogeneity by age at onset in MDD, we tested whether genome-wide significant risk variants for MDD could be identified in cases subdivided by age at onset. Discovery case-control genome-wide association studies were performed where cases were stratified using increasing/decreasing age-at-onset cutoffs; significant single nucleotide polymorphisms were tested in nine independent replication samples, giving a total sample of 22,158 cases and 133,749 control subjects for subsetting. Polygenic score analysis was used to examine whether differences in shared genetic risk exists between earlier and adult-onset MDD with commonly comorbid disorders of schizophrenia, bipolar disorder, Alzheimer's disease, and coronary artery disease. We identified one replicated genome-wide significant locus associated with adult-onset (>27 years) MDD (rs7647854, odds ratio: 1.16, 95% confidence interval: 1.11-1.21, p = 5.2 × 10(-11)). Using polygenic score analyses, we show that earlier-onset MDD is genetically more similar to schizophrenia and bipolar disorder than adult-onset MDD. We demonstrate that using additional phenotype data previously collected by genetic studies to tackle phenotypic heterogeneity in MDD can successfully lead to the discovery of genetic risk factor despite reduced sample size. Furthermore, our results suggest that the genetic susceptibility to MDD differs between adult- and earlier-onset MDD, with earlier-onset cases having a greater genetic overlap with schizophrenia and bipolar disorder. Copyright © 2016 Society of Biological Psychiatry. Published by Elsevier Inc. All rights reserved.

  12. Three Groups of Transposable Elements with Contrasting Copy Number Dynamics and Host Responses in the Maize (Zea mays ssp. mays) Genome

    PubMed Central

    Diez, Concepcion M.; Meca, Esteban; Tenaillon, Maud I.; Gaut, Brandon S.

    2014-01-01

    Most angiosperm nuclear DNA is repetitive and derived from silenced transposable elements (TEs). TE silencing requires substantial resources from the plant host, including the production of small interfering RNAs (siRNAs). Thus, the interaction between TEs and siRNAs is a critical aspect of both the function and the evolution of plant genomes. Yet the co-evolutionary dynamics between these two entities remain poorly characterized. Here we studied the organization of TEs within the maize (Zea mays ssp mays) genome, documenting that TEs fall within three groups based on the class and copy numbers. These groups included DNA elements, low copy RNA elements and higher copy RNA elements. The three groups varied statistically in characteristics that included length, location, age, siRNA expression and 24∶22 nucleotide (nt) siRNA targeting ratios. In addition, the low copy retroelements encompassed a set of TEs that had previously been shown to decrease expression within a 24 nt siRNA biogenesis mutant (mop1). To investigate the evolutionary dynamics of the three groups, we estimated their abundance in two landraces, one with a genome similar in size to that of the maize reference and the other with a 30% larger genome. For all three accessions, we assessed TE abundance as well as 22 nt and 24 nt siRNA content within leaves. The high copy number retroelements are under targeted similarly by siRNAs among accessions, appear to be born of a rapid bust of activity, and may be currently transpositionally dead or limited. In contrast, the lower copy number group of retrolements are targeted more dynamically and have had a long and ongoing history of transposition in the maize genome. PMID:24743518

  13. Three groups of transposable elements with contrasting copy number dynamics and host responses in the maize (Zea mays ssp. mays) genome.

    PubMed

    Diez, Concepcion M; Meca, Esteban; Tenaillon, Maud I; Gaut, Brandon S

    2014-04-01

    Most angiosperm nuclear DNA is repetitive and derived from silenced transposable elements (TEs). TE silencing requires substantial resources from the plant host, including the production of small interfering RNAs (siRNAs). Thus, the interaction between TEs and siRNAs is a critical aspect of both the function and the evolution of plant genomes. Yet the co-evolutionary dynamics between these two entities remain poorly characterized. Here we studied the organization of TEs within the maize (Zea mays ssp mays) genome, documenting that TEs fall within three groups based on the class and copy numbers. These groups included DNA elements, low copy RNA elements and higher copy RNA elements. The three groups varied statistically in characteristics that included length, location, age, siRNA expression and 24:22 nucleotide (nt) siRNA targeting ratios. In addition, the low copy retroelements encompassed a set of TEs that had previously been shown to decrease expression within a 24 nt siRNA biogenesis mutant (mop1). To investigate the evolutionary dynamics of the three groups, we estimated their abundance in two landraces, one with a genome similar in size to that of the maize reference and the other with a 30% larger genome. For all three accessions, we assessed TE abundance as well as 22 nt and 24 nt siRNA content within leaves. The high copy number retroelements are under targeted similarly by siRNAs among accessions, appear to be born of a rapid bust of activity, and may be currently transpositionally dead or limited. In contrast, the lower copy number group of retrolements are targeted more dynamically and have had a long and ongoing history of transposition in the maize genome.

  14. Complete genome sequence analysis and identification of putative metallo-beta-lactamase and SpoIIIE homologs in Bacillus cereus group phage BCP8-2, a new member of the proposed Bastille-like group.

    PubMed

    Asare, Paul Tetteh; Bandara, Nadeeka; Jeong, Tae-Yong; Ryu, Sangryeol; Klumpp, Jochen; Kim, Kwang-Pyo

    2015-10-01

    Bacillus cereus group-specific bacteriophage BCP8-2 exhibits a broad lysis spectrum among food and human isolates (330/364) of B. cereus while not infecting B. subtilis (50) or B. licheniformis (12) strains. Its genome is 159,071 bp long with 220 open reading frames, including genes for putative methyltransferases, metallo-beta-lactamase, and a sporulation-related SpoIIIE homolog, as wells as 18 tRNAs. Comparative genome analysis showed that BCP8-2 is related to the recently proposed Bastille-like phages, but not with either SPO1-like or Twort-like phages of the subfamily Spounavirinae.

  15. Detection and Whole-Genome Characterization of a G8P[1] Group A Rotavirus Strain from Deer

    PubMed Central

    Peterson, Jessica

    2016-01-01

    Rotavirus A strain 14-02218-2, with genome constellation G8P[1]-I2-R2-C2-M2-A3-N2-T6-E2-H3, was isolated from newborn fawns. The 14-02218-2 rotavirus strain is related to bovine and bovine-like rotavirus strains. To our knowledge, this is the first report on whole-genome-based characterization of a deer rotavirus G8P[1] strain. PMID:27932644

  16. Draft Genome Sequence of the Plant-Pathogenic Soil Fungus Rhizoctonia solani Anastomosis Group 3 Strain Rhs1AP

    PubMed Central

    Cubeta, Marc A.; Dean, Ralph A.; Jabaji, Suha; Neate, Stephen M.; Tavantzis, Stellos; Toda, Takeshi; Vilgalys, Rytas; Bharathan, Narayanaswamy; Fedorova-Abrams, Natalie; Pakala, Suman B.; Pakala, Suchitra M.; Zafar, Nikhat; Joardar, Vinita; Losada, Liliana; Nierman, William C.

    2014-01-01

    The soil fungus Rhizoctonia solani is a pathogen of agricultural crops. Here, we report on the 51,705,945 bp draft consensus genome sequence of R. solani strain Rhs1AP. A comprehensive understanding of the heterokaryotic genome complexity and organization of R. solani may provide insight into the plant disease ecology and adaptive behavior of the fungus. PMID:25359908

  17. Genome sequences of siphoviruses infecting marine Synechococcus unveil a diverse cyanophage group and extensive phage-host genetic exchanges.

    PubMed

    Huang, Sijun; Wang, Kui; Jiao, Nianzhi; Chen, Feng

    2012-02-01

    Investigating the interactions between marine cyanobacteria and their viruses (phages) is important towards understanding the dynamic of ocean's primary productivity. Genome sequencing of marine cyanophages has greatly advanced our understanding about their ecology and evolution. Among 24 reported genomes of cyanophages that infect marine picocyanobacteria, 17 are from cyanomyoviruses and six from cyanopodoviruses, and only one from cyanosiphovirus (Prochlorococcus phage P-SS2). Here we present four complete genome sequences of siphoviruses (S-CBS1, S-CBS2, S-CBS3 and S-CBS4) that infect four different marine Synechococcus strains. Three distinct subtypes were recognized among the five known marine siphoviruses (including P-SS2) in terms of morphology, genome architecture, gene content and sequence similarity. Our study revealed that cyanosiphoviruses are genetically diverse with polyphyletic origin. No core genes were found across these five cyanosiphovirus genomes, and this is in contrast to the fact that many core genes have been found in cyanomyovirus or cyanopodovirus genomes. Interestingly, genes encoding three structural proteins and a lysozyme of S-CBS1 and S-CBS3 showed homology to a prophage-like genetic element in two freshwater Synechococcus elongatus genomes. Re-annotation of the prophage-like genomic region suggests that S. elongatus may contain an intact prophage. Cyanosiphovirus genes involved in DNA metabolism and replication share high sequence homology with those in cyanobacteria, and further phylogenetic analysis based on these genes suggests that ancient and selective genetic exchanges occurred, possibly due to past prophage integration. Metagenomic analysis based on the Global Ocean Sampling database showed that cyanosiphoviruses are present in relatively low abundance in the ocean surface water compared to cyanomyoviruses and cyanopodoviruses. © 2011 Society for Applied Microbiology and Blackwell Publishing Ltd.

  18. Taxonomic Identity Resolution of Highly Phylogenetically Related Strains and Selection of Phylogenetic Markers by Using Genome-Scale Methods: The Bacillus pumilus Group Case

    PubMed Central

    Espariz, Martín; Zuljan, Federico A.; Esteban, Luis; Magni, Christian

    2016-01-01

    Bacillus pumilus group strains have been studied due their agronomic, biotechnological or pharmaceutical potential. Classifying strains of this taxonomic group at species level is a challenging procedure since it is composed of seven species that share among them over 99.5% of 16S rRNA gene identity. In this study, first, a whole-genome in silico approach was used to accurately demarcate B. pumilus group strains, as a case of highly phylogenetically related taxa, at the species level. In order to achieve that and consequently to validate or correct taxonomic identities of genomes in public databases, an average nucleotide identity correlation, a core-based phylogenomic and a gene function repertory analyses were performed. Eventually, more than 50% such genomes were found to be misclassified. Hierarchical clustering of gene functional repertoires was also used to infer ecotypes among B. pumilus group species. Furthermore, for the first time the machine-learning algorithm Random Forest was used to rank genes in order of their importance for species classification. We found that ybbP, a gene involved in the synthesis of cyclic di-AMP, was the most important gene for accurately predicting species identity among B. pumilus group strains. Finally, principal component analysis was used to classify strains based on the distances between their ybbP genes. The methodologies described could be utilized more broadly to identify other highly phylogenetically related species in metagenomic or epidemiological assessments. PMID:27658251

  19. Insights into the history of a bacterial group II intron remnant from the genomes of the nitrogen-fixing symbionts Sinorhizobium meliloti and Sinorhizobium medicae.

    PubMed

    Toro, N; Martínez-Rodríguez, L; Martínez-Abarca, F

    2014-10-01

    Group II introns are self-splicing catalytic RNAs that act as mobile retroelements. In bacteria, they are thought to be tolerated to some extent because they self-splice and home preferentially to sites outside of functional genes, generally within intergenic regions or in other mobile genetic elements, by mechanisms including the divergence of DNA target specificity to prevent target site saturation. RmInt1 is a mobile group II intron that is widespread in natural populations of Sinorhizobium meliloti and was first described in the GR4 strain. Like other bacterial group II introns, RmInt1 tends to evolve toward an inactive form by fragmentation, with loss of the 3' terminus. We identified genomic evidence of a fragmented intron closely related to RmInt1 buried in the genome of the extant S. meliloti/S. medicae species. By studying this intron, we obtained evidence for the occurrence of intron insertion before the divergence of ancient rhizobial species. This fragmented group II intron has thus existed for a long time and has provided sequence variation, on which selection can act, contributing to diverse genetic rearrangements, and to generate pan-genome divergence after strain differentiation. The data presented here suggest that fragmented group II introns within intergenic regions closed to functionally important neighboring genes may have been microevolutionary forces driving adaptive evolution of these rhizobial species.

  20. Genome sequence of the Wenxinia marina type strain (DSM 24838T), a representative of the Roseobacter group isolated from oilfield sediments

    PubMed Central

    Riedel, Thomas; Fiebig, Anne; Han, James; Huntemann, Marcel; Spring, Stefan; Petersen, Jörn; Ivanova, Natalia N.; Markowitz, Victor; Woyke, Tanja; Göker, Markus; Kyrpides, Nikos C.; Klenk, Hans-Peter

    2014-01-01

    Wenxinia marina Ying et al. 2007 is the type species of the genus Wenxinia, a representative of the Roseobacter group within the alphaproteobacterial family Rhodobacteraceae, isolated from oilfield sediments of the South China Sea. This family was shown to harbor the most abundant bacteria especially from coastal and polar waters, but was also found in microbial mats, sediments and attached to different kind of surfaces. Here we describe the features of W. marina strain HY34T together with the genome sequence and annotation of strain DSM 24838T and novel aspects of its phenotype. The 4,181,754 bp containing genome sequence encodes 4,047 protein-coding genes and 59 RNA genes. The genome of W. marina DSM 24838T was sequenced as part of the activities of the Genomic Encyclopedia of Type Strains, Phase I: the one thousand microbial genomes (KMG) project funded by the DoE and the Transregional Collaborative Research Centre 51 (TRR51) funded by the German Research Foundation (DFG). PMID:25197468

  1. Genome sequence of the Wenxinia marina type strain (DSM 24838(T)), a representative of the Roseobacter group isolated from oilfield sediments.

    PubMed

    Riedel, Thomas; Fiebig, Anne; Han, James; Huntemann, Marcel; Spring, Stefan; Petersen, Jörn; Ivanova, Natalia N; Markowitz, Victor; Woyke, Tanja; Göker, Markus; Kyrpides, Nikos C; Klenk, Hans-Peter

    2014-06-15

    Wenxinia marina Ying et al. 2007 is the type species of the genus Wenxinia, a representative of the Roseobacter group within the alphaproteobacterial family Rhodobacteraceae, isolated from oilfield sediments of the South China Sea. This family was shown to harbor the most abundant bacteria especially from coastal and polar waters, but was also found in microbial mats, sediments and attached to different kind of surfaces. Here we describe the features of W. marina strain HY34(T) together with the genome sequence and annotation of strain DSM 24838(T) and novel aspects of its phenotype. The 4,181,754 bp containing genome sequence encodes 4,047 protein-coding genes and 59 RNA genes. The genome of W. marina DSM 24838(T) was sequenced as part of the activities of the Genomic Encyclopedia of Type Strains, Phase I: the one thousand microbial genomes (KMG) project funded by the DoE and the Transregional Collaborative Research Centre 51 (TRR51) funded by the German Research Foundation (DFG).

  2. Group II Intron-Mediated Trans-Splicing in the Gene-Rich Mitochondrial Genome of an Enigmatic Eukaryote, Diphylleia rotans.

    PubMed

    Kamikawa, Ryoma; Shiratori, Takashi; Ishida, Ken-Ichiro; Miyashita, Hideaki; Roger, Andrew J

    2016-02-01

    Although mitochondria have evolved from a single endosymbiotic event, present day mitochondria of diverse eukaryotes display a great range of genome structures, content and features. Group I and group II introns are two features that are distributed broadly but patchily in mitochondrial genomes across branches of the tree of eukaryotes. While group I intron-mediated trans-splicing has been reported from some lineages distantly related to each other, findings of group II intron-mediated trans-splicing has been restricted to members of the Chloroplastida. In this study, we found the mitochondrial genome of the unicellular eukaryote Diphylleia rotans possesses currently the second largest gene repertoire. On the basis of a probable phylogenetic position of Diphylleia, which is located within Amorphea, current mosaic gene distribution in Amorphea must invoke parallel gene losses from mitochondrial genomes during evolution. Most notably, although the cytochrome c oxidase subunit (cox) 1 gene was split into four pieces which located at a distance to each other, we confirmed that a single mature mRNA that covered the entire coding region could be generated by group II intron-mediated trans-splicing. This is the first example of group II intron-mediated trans-splicing outside Chloroplastida. Similar trans-splicing mechanisms likely work for bipartitely split cox2 and nad3 genes to generate single mature mRNAs. We finally discuss origin and evolution of this type of trans-splicing in D. rotans as well as in eukaryotes. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  3. Mitotic index, microvascular proliferation, and necrosis define 3 groups of 1p/19q codeleted anaplastic oligodendrogliomas associated with different genomic alterations

    PubMed Central

    Figarella-Branger, Dominique; Mokhtari, Karima; Dehais, Caroline; Jouvet, Anne; Uro-Coste, Emmanuelle; Colin, Carole; Carpentier, Catherine; Forest, Fabien; Maurage, Claude-Alain; Vignaud, Jean-Michel; Polivka, Marc; Lechapt-Zalcman, Emmanuelle; Eimer, Sandrine; Viennet, Gabriel; Quintin-Roué, Isabelle; Aubriot-Lorton, Marie-Hélène; Diebold, Marie-Danièle; Loussouarn, Delphine; Lacroix, Catherine; Rigau, Valérie; Laquerrière, Annie; Vandenbos, Fanny; Michalak, Sophie; Sevestre, Henri; Peoch, Michel; Labrousse, François; Christov, Christo; Kemeny, Jean-Louis; Chenard, Marie-Pierre; Chiforeanu, Danchristian; Ducray, François; Idbaih, Ahmed; Desenclos, Christine; Menei, Philippe; Al Nader, Edmond; Godard, Joel; Servagi-Vernat, Stéphanie; Carpentier, Antoine; Loiseau, Hugues; Dam-Hieu, Phong; Guillamo, Jean Sebastien; Emery, Evelyne; Verelle, Pierre; Durando, Xavier; Faillot, Thierry; Le Guerinel, Caroline; Ghiringhelli, François; Parker, Fabrice; Adam, Clovis; Dubois, François; Ramirez, Carole; Gueye, Edouard Marcel; Honnorat, Jerome; Chinot, Olivier; Bauchet, Luc; Beauchesne, Patrick; Campone, Mario; Frenel, Jean Sébastien; Fontaine, Denys; Campello, Chantal; Roger, Pascal; Heitzmann, Anne; Fesneau, Mélanie; Delattre, Jean Yves; Elouadhani-Hamdi, Selma; Ricard, Damien; Colin, Philippe; Vauléon, Elodie; Langlois, Olivier; Fotso, Marie Janette Motsuo; Andraud, Marie; Mouton, Servane; Noel, Georges; Desse, Nicolas; Soulard, Raoulin; Cohen-Moyal, Elisabeth; Lubrano, Vincent; Dhermain, Frederic

    2014-01-01

    Background The aim of this study was to correlate histological features and molecular characteristics in anaplastic oligodendrogliomas (AOs). Methods The histological characteristics of 203 AO patients, enrolled in the French national network POLA, were analyzed. The genomic profiles of 191 cases were studied using genomic arrays. IDH mutational status was assessed by immunohistochemistry and direct sequencing. Results 1p/19q codeletion was present in 79% of cases and was associated with alpha-internexin expression (P < 10−4), IDH1/2 mutation (P < 10−4), chromosome 4 loss (P < 10−3), and better overall survival (P < 10−4). Based on mitotic index, microvascular proliferation (MVP), and necrosis, 3 groups of 1p/19q codeleted AOs were identified: (group 1) AO with more than 5 mitoses per 10-HPF, no MVP, and no necrosis; (group 2) AO with MVP and no necrosis; and (group 3) AO with MVP and necrosis. Compared with group 1, groups 2 and 3 AOs had a higher mean Ki-67 proliferation index and a higher rate of 9p and 9q losses. Compared with group 2, group 3 AOs had a higher number of chromosomal alterations including chromosome 4 loss. In the subgroup of 157 1p/19q codeleted AOs, chromosomal instability was associated with shorter progression-free survival (P = .024) and shorter overall survival (P = .023). Conclusions The present study shows that oligodendrogliomas with classic histological features remain a molecularly heterogeneous entity and should be stratified according to 1p/19q status because of its major prognostic relevance. Moreover, 1p/19q codeleted AOs are also heterogeneous. Interestingly, mitotic index, MVP, and necrosis help to classify them into 3 groups associated with distinct genomic alterations. PMID:24723566

  4. Genome sequence of the Roseovarius mucosus type strain (DSM 17069T), a bacteriochlorophyll a-containing representative of the marine Roseobacter group isolated from the dinoflagellate Alexandrium ostenfeldii

    PubMed Central

    2015-01-01

    Roseovarius mucosus Biebl et al. 2005 is a bacteriochlorophyll a-producing representative of the marine Roseobacter group within the alphaproteobacterial family Rhodobacteraceae, which was isolated from the dinoflagellate Alexandrium ostenfeldii. The marine Roseobacter group was found to be abundant in the ocean and plays an important role for global and biogeochemical processes. Here we describe the features of the R. mucosus strain DFL-24T together with its genome sequence and annotation generated from a culture of DSM 17069T. The 4,247,724 bp containing genome sequence encodes 4,194 protein-coding genes and 57 RNA genes. In addition to the presence of four plasmids, genome analysis revealed the presence of genes associated with host colonization, DMSP utilization, cytotoxins, and quorum sensing that could play a role in the interrelationship of R. mucosus with the dinoflagellate A. ostenfeldii and other marine organisms. Furthermore, the genome encodes genes associated with mixotrophic growth, where both reduced inorganic compounds for lithotrophic growth and a photoheterotrophic lifestyle using light as additional energy source could be used. PMID:26203330

  5. Predictive chromatin signatures in the mammalian genome

    PubMed Central

    Hon, Gary C.; Hawkins, R. David; Ren, Bing

    2009-01-01

    The DNA sequence of an organism is a blueprint of life: it harbors not only the information about proteins and other molecules produced in each cell, but also instructions on when and where such molecules are made. Chromatin, the structure of histone and DNA that has co-evolved with eukaryotic genome, also contains information that indicates the function and activity of the underlying DNA sequences. Such information exists in the form of covalent modifications to the histone proteins that comprise the nucleosome. Thanks to the development of high throughput technologies such as DNA microarrays and next generation DNA sequencing, we have begun to associate the various combinations of chromatin modification patterns with functional sequences in the human genome. Here, we review the rapid progress from descriptive observations of histone modification profiles to highly predictive models enabling use of chromatin signatures to enumerate novel functional sequences in mammalian genomes that have escaped previous detection. PMID:19808796

  6. Evaluating direct-to-consumer marketing of race-based pharmacogenomics: a focus group study of public understandings of applied genomic medication.

    PubMed

    Bates, Benjamin R; Poirot, Kristan; Harris, Tina M; Condit, Celeste M; Achter, Paul J

    2004-01-01

    Some medical providers have advocated applied genomics, including the use of genetically linked racial phenotypes in medical practice, raising fear that race-based medication will become justified. As with other emerging medical genetic technologies, pharmaceutical companies may advertise these treatments. Researchers fear that consumers will uncritically accept pharmaceutical messages and demand the product. In this exploratory study, we examined public reactions to advertisements for applied genomic medications. A focus group methodology was employed. Participants tended to resist the message and generated warrants for doing so, indicating critical reception of the messages. Message accepters also provided warrants. Warrants for resistance and acceptance differ between self-identified racial groups. Consumers, health care providers, and pharmaceutical corporations will benefit from a better understanding of direct-to-consumer advertisements as medical communication. Our study concludes that both advocates and opponents of direct-to-consumer advertisements should recognize that potential consumers of pharmacogenomics act as critical consumers of health advertising discourse.

  7. Enrichment and Genome Sequence of the Group I.1a Ammonia-Oxidizing Archaeon “Ca. Nitrosotenuis uzonensis” Representing a Clade Globally Distributed in Thermal Habitats

    PubMed Central

    Pelletier, Eric; Schuster, Nathalie; Hauzmayer, Sandra; Bulaev, Aleksandr; Grigor’eva, Nadezhda V.; Galushko, Alexander; Schmid, Markus; Palatinszky, Marton; Le Paslier, Denis; Daims, Holger; Wagner, Michael

    2013-01-01

    The discovery of ammonia-oxidizing archaea (AOA) of the phylum Thaumarchaeota and the high abundance of archaeal ammonia monooxygenase subunit A encoding gene sequences in many environments have extended our perception of nitrifying microbial communities. Moreover, AOA are the only aerobic ammonia oxidizers known to be active in geothermal environments. Molecular data indicate that in many globally distributed terrestrial high-temperature habits a thaumarchaeotal lineage within the Nitrosopumilus cluster (also called “marine” group I.1a) thrives, but these microbes have neither been isolated from these systems nor functionally characterized in situ yet. In this study, we report on the enrichment and genomic characterization of a representative of this lineage from a thermal spring in Kamchatka. This thaumarchaeote, provisionally classified as “Candidatus Nitrosotenuis uzonensis”, is a moderately thermophilic, non-halophilic, chemolithoautotrophic ammonia oxidizer. The nearly complete genome sequence (assembled into a single scaffold) of this AOA confirmed the presence of the typical thaumarchaeotal pathways for ammonia oxidation and carbon fixation, and indicated its ability to produce coenzyme F420 and to chemotactically react to its environment. Interestingly, like members of the genus Nitrosoarchaeum, “Candidatus N. uzonensis” also possesses a putative artubulin-encoding gene. Genome comparisons to related AOA with available genome sequences confirmed that the newly cultured AOA has an average nucleotide identity far below the species threshold and revealed a substantial degree of genomic plasticity with unique genomic regions in “Ca. N. uzonensis”, which potentially include genetic determinants of ecological niche differentiation. PMID:24278328

  8. Evolutionary Dynamics of the Mitochondrial Genome in the Evaniomorpha (Hymenoptera)—A Group with an Intermediate Rate of Gene Rearrangement

    PubMed Central

    Mao, Meng; Gibson, Tracey; Dowton, Mark

    2014-01-01

    We determined the complete mitochondrial (mt) genomes of three evaniomorph species, Ceraphron sp. (Ceraphronoidea), Gasteruption sp. (Evanioidea), and Orthogonalys pulchella (Trigonalyoidea) as well as the nearly complete mt genome from another evaniomorph species, Megalyra sp. (Megalyroidea). Each of them possesses dramatic gene rearrangements, including protein-coding or rRNA genes. Gene inversions were identified in all of these mt genomes; for example, the two rRNA genes have inverted and moved into the nad2-cox1 junction in the Megalyra sp. mt genome. In addition, we found two copies of a 10-bp complementary repeat at the beginning of rrnS and at the end of trnL2 in the Gasteruption sp. mt genome, consistent with recombination as the possible mechanism for gene inversion and long-range movement. Although each of the genomes contains a number of repeats of varying size, there was no consistent association of the size or number of repeats with the extent or type of gene rearrangement. The breakpoint distance analysis showed the Evaniomorpha has an intermediate rate of gene rearrangement. Sequence-based phylogenetic analyses of 13 protein-coding and 2 rRNA genes in 22 hymenopteran taxa recovered a paraphyletic Evaniomorpha with the Aculeata nested within it. Within the Evaniomorpha, our analyses confirmed the Trigonalyoidea + Megalyroidea as the sister group to the Aculeata and recovered a novel clade, Ceraphronoidea + Evanioidea. In contrast to previous hymenopteran phylogenetic studies, the internal relationships of the Evaniomorpha were highly supported and robust to the variation of alignment approach and phylogenetic inference approach. PMID:25115010

  9. Genome-Wide Differentiation of Various Melon Horticultural Groups for Use in GWAS for Fruit Firmness and Construction of a High Resolution Genetic Map

    PubMed Central

    Nimmakayala, Padma; Tomason, Yan R.; Abburi, Venkata L.; Alvarado, Alejandra; Saminathan, Thangasamy; Vajja, Venkata G.; Salazar, Germania; Panicker, Girish K.; Levi, Amnon; Wechter, William P.; McCreight, James D.; Korol, Abraham B.; Ronin, Yefim; Garcia-Mas, Jordi; Reddy, Umesh K.

    2016-01-01

    Melon (Cucumis melo L.) is a phenotypically diverse eudicot diploid (2n = 2x = 24) has climacteric and non-climacteric morphotypes and show wide variation for fruit firmness, an important trait for transportation and shelf life. We generated 13,789 SNP markers using genotyping-by-sequencing (GBS) and anchored them to chromosomes to understand genome-wide fixation indices (Fst) between various melon morphotypes and genomewide linkage disequilibrium (LD) decay. The FST between accessions of cantalupensis and inodorus was 0.23. The FST between cantalupensis and various agrestis accessions was in a range of 0.19–0.53 and between inodorus and agrestis accessions was in a range of 0.21–0.59 indicating sporadic to wide ranging introgression. The EM (Expectation Maximization) algorithm was used for estimation of 1436 haplotypes. Average genome-wide LD decay for the melon genome was noted to be 9.27 Kb. In the current research, we focused on the genome-wide divergence underlying diverse melon horticultural groups. A high-resolution genetic map with 7153 loci was constructed. Genome-wide segregation distortion and recombination rate across various chromosomes were characterized. Melon has climacteric and non-climacteric morphotypes and wide variation for fruit firmness, a very important trait for transportation and shelf life. Various levels of QTLs were identified with high to moderate stringency and linked to fruit firmness using both genome-wide association study (GWAS) and biparental mapping. Gene annotation revealed some of the SNPs are located in β-D-xylosidase, glyoxysomal malate synthase, chloroplastic anthranilate phosphoribosyltransferase, and histidine kinase, the genes that were previously characterized for fruit ripening and softening in other crops. PMID:27713759

  10. Comparative analysis of three Magnaporthaceae mitochondrial genomes reveals group I introns in the soil-inhabiting pathogens

    USDA-ARS?s Scientific Manuscript database

    A comparison of the mitochrondrial genomes of two soilborne grass pathogens, M. poae of turfgrass and Gaemannomyces graminis var. triciti (Ggt) of wheat, was made to the foliar rice blast pathogen, Magnaporthe oryzae. We sought to extend observations from nuclear-coded genes that the soilborne patho...

  11. First Genome Sequence of Wild Onion Symptomless Virus, a Novel Member of Potyvirus in the Turnip Mosaic Virus Phylogenetic Group

    PubMed Central

    Korkmaz, Savas; Mitoma, Shinichiro; Nomiyama, Rei; Honda, Yuki

    2016-01-01

    The nearly complete genome sequence of a new species of potyvirus was obtained from the symptomless wild onion (Allium sp.) in Turkey. This virus has less than 67% nucleotide sequence identities over the polyprotein to other known potyviruses. We propose the name wild onion symptomless virus for this novel potyvirus. PMID:27540073

  12. [The problem of the transgeneration phenomenon of genome instability in sick children of different age groups after the accident at the Chernobyl Nuclear Power Plant].

    PubMed

    Suskov, I N; Agadzhanian, A V; Kuz'mina, N S; Elisova, T V; Iofa, E L; Nilova, I N; Akaeva, E A; Kuznetsova, G I; Rubanovich, A V; Tskhovrebova, L V; Baleva, L S; Sipiagina, A E

    2006-01-01

    A complex genetic examination of children which belong to two cohorts and their parents were carried out. The first cohort included children and constantly living on territories contaminated with radionuclides (Novozybkov district, Bryansk region). They were subdivided in groups according to the ontogenetic age periods of development of their parents at the time of the Chernobyl accident. In the children born in 1986-1995 the level of aberrant genomes is significantly higher as compared to the control (p < 0.001). In children born in 1998-2002 the differences are insignificant (p > 0.05). The frequency of aberrant genomes had a tendency to decrease with the period of time between the birth date of a child and the moment of the accident. Analysis of the results of cytogenetic investigation for the same living on territories with different densities of radioactive contamination (zone I-- 627-688 kBq/m2, 137Cs and zone II-- 135-402 kBq/m2, 137Cs) revealed insignificant differences in the spectrum and average frequencies of chromosome aberrations. The second cohort included children born in 1987-1991 and 1993-2002 from irradiated fathers (Chernobyl clean-up workers) and unirradiated mothers living on territories without radionuclide contamination. These children also displayed increased frequencies of aberrant genomes as compared to the control (p < 0.001). The analysis of the dynamics years of birth of cytogenetic disturbances in the same cohorts of children showed the average frequencies of aberrant genomes remain higher than the control level. In most of the children of both cohorts the repair synthesis of genome DNA by gamma- and UV-radiation is reduced as compared to one in the children from the control group.

  13. Population structure and comparative genome hybridization of European flor yeast reveal a unique group of Saccharomyces cerevisiae strains with few gene duplications in their genome.

    PubMed

    Legras, Jean-Luc; Erny, Claude; Charpentier, Claudine

    2014-01-01

    Wine biological aging is a wine making process used to produce specific beverages in several countries in Europe, including Spain, Italy, France, and Hungary. This process involves the formation of a velum at the surface of the wine. Here, we present the first large scale comparison of all European flor strains involved in this process. We inferred the population structure of these European flor strains from their microsatellite genotype diversity and analyzed their ploidy. We show that almost all of these flor strains belong to the same cluster and are diploid, except for a few Spanish strains. Comparison of the array hybridization profile of six flor strains originating from these four countries, with that of three wine strains did not reveal any large segmental amplification. Nonetheless, some genes, including YKL221W/MCH2 and YKL222C, were amplified in the genome of four out of six flor strains. Finally, we correlated ICR1 ncRNA and FLO11 polymorphisms with flor yeast population structure, and associate the presence of wild type ICR1 and a long Flo11p with thin velum formation in a cluster of Jura strains. These results provide new insight into the diversity of flor yeast and show that combinations of different adaptive changes can lead to an increase of hydrophobicity and affect velum formation.

  14. Population Structure and Comparative Genome Hybridization of European Flor Yeast Reveal a Unique Group of Saccharomyces cerevisiae Strains with Few Gene Duplications in Their Genome

    PubMed Central

    Legras, Jean-Luc; Erny, Claude; Charpentier, Claudine

    2014-01-01

    Wine biological aging is a wine making process used to produce specific beverages in several countries in Europe, including Spain, Italy, France, and Hungary. This process involves the formation of a velum at the surface of the wine. Here, we present the first large scale comparison of all European flor strains involved in this process. We inferred the population structure of these European flor strains from their microsatellite genotype diversity and analyzed their ploidy. We show that almost all of these flor strains belong to the same cluster and are diploid, except for a few Spanish strains. Comparison of the array hybridization profile of six flor strains originating from these four countries, with that of three wine strains did not reveal any large segmental amplification. Nonetheless, some genes, including YKL221W/MCH2 and YKL222C, were amplified in the genome of four out of six flor strains. Finally, we correlated ICR1 ncRNA and FLO11 polymorphisms with flor yeast population structure, and associate the presence of wild type ICR1 and a long Flo11p with thin velum formation in a cluster of Jura strains. These results provide new insight into the diversity of flor yeast and show that combinations of different adaptive changes can lead to an increase of hydrophobicity and affect velum formation. PMID:25272156

  15. Mitochondrial genomes and comparative analyses of Culex camposi, Culex coronator, Culex usquatus and Culex usquatissimus (Diptera:Culicidae), members of the coronator group.

    PubMed

    Demari-Silva, Bruna; Foster, Peter G; de Oliveira, Tatiane M P; Bergo, Eduardo S; Sanabani, Sabri S; Pessôa, Rodrigo; Sallum, Maria Anice M

    2015-10-21

    The Coronator Group currently encompasses six morphologically similar species (Culex camposi Dyar, Culex coronator Dyar and Knab, Culex covagarciai Forattini, Culex usquatus Dyar, Culex usquatissimus Dyar, and Culex ousqua Dyar). Culex coronator has been incriminated as a potential vector of West Nile Virus (WNV), Saint Louis Encephalitis Virus (SLEV), and Venezuelan Equine Encephalitis Virus (VEEV). The complete mitochondrial genome of Cx. coronator, Cx. usquatus, Cx.usquatissimus, and Cx. camposi was sequenced, annotated, and analyzed to provide genetic information about these species. The mitochondrial genomes of Cx. coronator, Cx. usquatus, Cx.usquatissimus, and Cx. camposi varied from 15,573 base pairs in Cx. usquatus to 15,576 in Cx. coronator. They contained 37 genes (13 protein-encoding genes, 2 rRNA genes, and 22 tRNA genes) and the AT-rich control region. Comparative analyses of the 37 genes demonstrated the mitochondrial genomes to be composed of variable and conserved genes. Despite the small size, the ATP8, ATP6 plus NADH5 protein-encoding genes were polymorphic, whereas tRNAs and rRNAs were conserved. The control region contained some poly-T stretch. The Bayesian phylogenetic tree corroborated that both the Coronator Group and the Culex pipens complex are monophyletic taxa. The mitochondrial genomes of Cx. coronator, Cx. usquatus, Cx. usquatissimus and Cx. camposi share the same gene composition and arrangement features that match to those reported for most Culicidae species. They are composed of the same 37 genes and the AT-rich control region, which contains poly-T stretches that may be involved in the functional role of the mitochondrial genome. Taken together, results of the dN/dS ratios, the sliding window analyses and the Bayesian phylogenetic analyses suggest that ATP6, ATP8 and NADH5 are promising genes to be employed in phylogenetic studies involving species of the Coronator Group, and probably other species groups of the subgenus Culex

  16. Metagenomic identification of novel enteric viruses in urban wild rats and genome characterization of a group A rotavirus

    PubMed Central

    Sachsenröder, Jana; Braun, Anne; Machnowska, Patrycja; Ng, Terry Fei Fan; Deng, Xutao; Guenther, Sebastian; Bernstein, Samuel; Ulrich, Rainer G.; Delwart, Eric

    2014-01-01

    Rats are known as reservoirs and vectors for several zoonotic pathogens. However, information on the viruses shed by urban wild rats that could pose a zoonotic risk to human health is scare. Here, intestinal contents from 20 wild Norway rats (Rattus norvegicus) collected in the city of Berlin, Germany, were subjected to metagenomic analysis of viral nucleic acids. The determined faecal viromes of rats consisted of a variety of known and unknown viruses, and were highly variable among the individuals. Members of the families Parvoviridae and Picobirnaviridae represented the most abundant species. Novel picornaviruses, bocaviruses, sapoviruses and stool-associated circular ssDNA viruses were identified, which showed only low sequence identity to known representatives of the corresponding taxa. In addition, noroviruses and rotaviruses were detected as potential zoonotic gastroenteritis viruses. However, partial-genome sequence analyses indicated that the norovirus was closely related to the recently identified rat norovirus and the rotavirus B was closely related to the rat rotavirus strain IDIR; both viruses clustered separately from respective human virus strains in phylogenetic trees. In contrast, the rotavirus A sequences showed high identity to human and animal strains. Analysis of the nearly complete genome of this virus revealed the known genotypes G3, P[3] and N2 for three of the genome segments, whereas the remaining eight genome segments represented the novel genotypes I20–R11–C11–M10–A22–T14–E18–H13. Our results indicated a high heterogeneity of enteric viruses present in urban wild rats; their ability to be transmitted to humans remains to be assessed in the future. PMID:25121550

  17. Metagenomic identification of novel enteric viruses in urban wild rats and genome characterization of a group A rotavirus.

    PubMed

    Sachsenröder, Jana; Braun, Anne; Machnowska, Patrycja; Ng, Terry Fei Fan; Deng, Xutao; Guenther, Sebastian; Bernstein, Samuel; Ulrich, Rainer G; Delwart, Eric; Johne, Reimar

    2014-12-01

    Rats are known as reservoirs and vectors for several zoonotic pathogens. However, information on the viruses shed by urban wild rats that could pose a zoonotic risk to human health is scare. Here, intestinal contents from 20 wild Norway rats (Rattus norvegicus) collected in the city of Berlin, Germany, were subjected to metagenomic analysis of viral nucleic acids. The determined faecal viromes of rats consisted of a variety of known and unknown viruses, and were highly variable among the individuals. Members of the families Parvoviridae and Picobirnaviridae represented the most abundant species. Novel picornaviruses, bocaviruses, sapoviruses and stool-associated circular ssDNA viruses were identified, which showed only low sequence identity to known representatives of the corresponding taxa. In addition, noroviruses and rotaviruses were detected as potential zoonotic gastroenteritis viruses. However, partial-genome sequence analyses indicated that the norovirus was closely related to the recently identified rat norovirus and the rotavirus B was closely related to the rat rotavirus strain IDIR; both viruses clustered separately from respective human virus strains in phylogenetic trees. In contrast, the rotavirus A sequences showed high identity to human and animal strains. Analysis of the nearly complete genome of this virus revealed the known genotypes G3, P[3] and N2 for three of the genome segments, whereas the remaining eight genome segments represented the novel genotypes I20-R11-C11-M10-A22-T14-E18-H13. Our results indicated a high heterogeneity of enteric viruses present in urban wild rats; their ability to be transmitted to humans remains to be assessed in the future.

  18. NIH working group report-using genomic information to guide weight management: From universal to precision treatment.

    PubMed

    Bray, Molly S; Loos, Ruth J F; McCaffery, Jeanne M; Ling, Charlotte; Franks, Paul W; Weinstock, George M; Snyder, Michael P; Vassy, Jason L; Agurs-Collins, Tanya

    2016-01-01

    Precision medicine utilizes genomic and other data to optimize and personalize treatment. Although more than 2,500 genetic tests are currently available, largely for extreme and/or rare phenotypes, the question remains whether this approach can be used for the treatment of common, complex conditions like obesity, inflammation, and insulin resistance, which underlie a host of metabolic diseases. This review, developed from a Trans-NIH Conference titled "Genes, Behaviors, and Response to Weight Loss Interventions," provides an overview of the state of genetic and genomic research in the area of weight change and identifies key areas for future research. Although many loci have been identified that are associated with cross-sectional measures of obesity/body size, relatively little is known regarding the genes/loci that influence dynamic measures of weight change over time. Although successful short-term weight loss has been achieved using many different strategies, sustainable weight loss has proven elusive for many, and there are important gaps in our understanding of energy balance regulation. Elucidating the molecular basis of variability in weight change has the potential to improve treatment outcomes and inform innovative approaches that can simultaneously take into account information from genomic and other sources in devising individualized treatment plans. © 2015 The Obesity Society.

  19. NIH working group report—using genomic information to guide weight management: From universal to precision treatment

    PubMed Central

    Bray, Molly S; Loos, Ruth JF; McCaffery, Jeanne M; Ling, Charlotte; Franks, Paul W; Weinstock, George M; Snyder, Michael P; Vassy, Jason L; Agurs-Collins, Tanya

    2016-01-01

    Objective Precision medicine utilizes genomic and other data to optimize and personalize treatment. Although more than 2,500 genetic tests are currently available, largely for extreme and/or rare phenotypes, the question remains whether this approach can be used for the treatment of common, complex conditions like obesity, inflammation, and insulin resistance, which underlie a host of metabolic diseases. Methods This review, developed from a Trans-NIH Conference titled “Genes, Behaviors, and Response to Weight Loss Interventions,” provides an overview of the state of genetic and genomic research in the area of weight change and identifies key areas for future research. Results Although many loci have been identified that are associated with cross-sectional measures of obesity/body size, relatively little is known regarding the genes/loci that influence dynamic measures of weight change over time. Although successful short-term weight loss has been achieved using many different strategies, sustainable weight loss has proven elusive for many, and there are important gaps in our understanding of energy balance regulation. Conclusions Elucidating the molecular basis of variability in weight change has the potential to improve treatment outcomes and inform innovative approaches that can simultaneously take into account information from genomic and other sources in devising individualized treatment plans. PMID:26692578

  20. A new group in the Leptospirillum clade: cultivation-independent community genomics, proteomics and transcriptomics of the new species Leptospirillum group IV UBA BS.

    SciTech Connect

    Goltsman, Daniela; Dasari, Mauna; Thomas, BC; Shah, Manesh B; Verberkmoes, Nathan C; Hettich, Robert {Bob} L; Banfield, Jillian F.

    2013-01-01

    Leptospirillum spp. are widespread members of acidophilic microbial communities that catalyze ferrous iron oxidation, thereby increasing sulfide mineral dissolution rates. These bacteria play important roles in environmental acidification and are harnessed for bioleaching-based metal recovery. Known members of the Leptospirillum clade of the Nitrospira phylum are Leptospirillum ferrooxidans (group I), Leptospirillum ferriphilum and Leptospirillum rubarum (group II), and Leptospirillum ferrodiazotrophum (group III). In the Richmond Mine acid mine drainage (AMD) system, biofilm formation is initiated by L. rubarum; L. ferrodiazotrophum appears in later developmental stages. Here we used community metagenomic data from unusual, thick floating biofilms to identify distinguishing metabolic traits in a rare and uncultivated community member, the new species Leptospirillum group IV UBA BS. These biofilms typically also contain a variety of Archaea, Actinobacteria, and a few other Leptospirillum spp. The Leptospirillum group IV UBA BS species shares 98% 16S rRNA sequence identity and 70% average amino acid identity between orthologs with its closest relative, L. ferrodiazotrophum. The presence of nitrogen fixation and reverse tricarboxylic acid (TCA) cycle proteins suggest an autotrophic metabolism similar to that of L. ferrodiazotrophum, while hydrogenase proteins suggest anaerobic metabolism. Community transcriptomic and proteomic analyses demonstrate expression of a multicopper oxidase unique to this species, as well as hydrogenases and core metabolic genes. Results suggest that the Leptospirillum group IV UBA BS species might play important roles in carbon fixation, nitrogen fixation, hydrogen metabolism, and iron oxidation in some acidic environments.

  1. The Finding of a Group IIE Phospholipase A2 Gene in a Specified Segment of Protobothrops flavoviridis Genome and Its Possible Evolutionary Relationship to Group IIA Phospholipase A2 Genes

    PubMed Central

    Yamaguchi, Kazuaki; Chijiwa, Takahito; Ikeda, Naoki; Shibata, Hiroki; Fukumaki, Yasuyuki; Oda-Ueda, Naoko; Hattori, Shosaku; Ohno, Motonori

    2014-01-01

    The genes encoding group IIE phospholipase A2, abbreviated as IIE PLA2, and its 5' and 3' flanking regions of Crotalinae snakes such as Protobothrops flavoviridis, P. tokarensis, P. elegans, and Ovophis okinavensis, were found and sequenced. The genes consisted of four exons and three introns and coded for 22 or 24 amino acid residues of the signal peptides and 134 amino acid residues of the mature proteins. These IIE PLA2s show high similarity to those from mammals and Colubridae snakes. The high expression level of IIE PLA2s in Crotalinae venom glands suggests that they should work as venomous proteins. The blast analysis indicated that the gene encoding OTUD3, which is ovarian tumor domain-containing protein 3, is located in the 3' downstream of IIE PLA2 gene. Moreover, a group IIA PLA2 gene was found in the 5' upstream of IIE PLA2 gene linked to the OTUD3 gene (OTUD3) in the P. flavoviridis genome. It became evident that the specified arrangement of IIA PLA2 gene, IIE PLA2 gene, and OTUD3 in this order is common in the genomes of humans to snakes. The present finding that the genes encoding various secretory PLA2s form a cluster in the genomes of humans to birds is closely related to the previous finding that six venom PLA2 isozyme genes are densely clustered in the so-called NIS-1 fragment of the P. flavoviridis genome. It is also suggested that venom IIA PLA2 genes may be evolutionarily derived from the IIE PLA2 gene. PMID:25529307

  2. Genome sequence and analysis of a broad-host range lytic bacteriophage that infects the Bacillus cereus group

    PubMed Central

    2013-01-01

    Background Comparatively little information is available on members of the Myoviridae infecting low G+C content, Gram-positive host bacteria of the family Firmicutes. While numerous Bacillus phages have been isolated up till now only very few Bacillus cereus phages have been characterized in detail. Results Here we present data on the large, virulent, broad-host-range B. cereus phage vB_BceM_Bc431v3 (Bc431v3). Bc431v3 features a 158,618 bp dsDNA genome, encompassing 239 putative open reading frames (ORFs) and, 20 tRNA genes encoding 17 different amino acids. Since pulsed-field gel electrophoresis indicated that the genome of this phage has a mass of 155-158 kb Bc431v3 DNA appears not to contain long terminal repeats that are found in the genome of Bacillus phage SPO1. Conclusions Bc431v3 displays significant sequence similarity, at the protein level, to B. cereus phage BCP78, Listeria phage A511 and Enterococcus phage ØEF24C and other morphologically related phages infecting Firmicutes such as Staphylococcus phage K and Lactobacillus phage LP65. Based on these data we suggest that Bc431v3 should be included as a member of the Spounavirinae; however, because of all the diverse taxonomical information has been addressed recently, it is difficult to determine the genus. The Bc431v3 phage contains some highly unusual genes such as gp143 encoding putative tRNAHis guanylyltransferase. In addition, it carries some genes that appear to be related to the host sporulation regulators. These are: gp098, which encodes a putative segregation protein related to FstK/SpoIIIE DNA transporters; gp105, a putative segregation protein; gp108, RNA polymerase sigma factor F/B; and, gp109 encoding RNA polymerase sigma factor G. PMID:23388049

  3. Mouse Genome-Wide Association Study of Preclinical Group II Pulmonary Hypertension Identifies Epidermal Growth Factor Receptor.

    PubMed

    Kelly, Neil J; Radder, Josiah E; Baust, Jeffrey J; Burton, Christine L; Lai, Yen-Chun; Potoka, Karin C; Agostini, Brittani A; Wood, John P; Bachman, Timothy N; Vanderpool, Rebecca R; Dandachi, Nadine; Leme, Adriana S; Gregory, Alyssa D; Morris, Alison; Mora, Ana L; Gladwin, Mark T; Shapiro, Steven D

    2017-04-01

    Pulmonary hypertension (PH) is associated with features of obesity and metabolic syndrome that translate to the induction of PH by chronic high-fat diet (HFD) in some inbred mouse strains. We conducted a genome-wide association study (GWAS) to identify candidate genes associated with susceptibility to HFD-induced PH. Mice from 36 inbred and wild-derived strains were fed with regular diet or HFD for 20 weeks beginning at 6-12 weeks of age, after which right ventricular (RV) and left ventricular (LV) end-systolic pressure (ESP) and maximum pressure (MaxP) were measured by cardiac catheterization. We tested for association of RV MaxP and RV ESP and identified genomic regions enriched with nominal associations to both of these phenotypes. We excluded genomic regions if they were also associated with LV MaxP, LV ESP, or body weight. Genes within significant regions were scored based on the shortest-path betweenness centrality, a measure of network connectivity, of their human orthologs in a gene interaction network of human PH-related genes. WSB/EiJ, NON/ShiLtJ, and AKR/J mice had the largest increases in RV MaxP after high-fat feeding. Network-based scoring of GWAS candidates identified epidermal growth factor receptor (Egfr) as having the highest shortest-path betweenness centrality of GWAS candidates. Expression studies of lung homogenate showed that EGFR expression is increased in the AKR/J strain, which developed a significant increase in RV MaxP after high-fat feeding as compared with C57BL/6J, which did not. Our combined GWAS and network-based approach adds evidence for a role for Egfr in murine PH.

  4. Rapid, high-throughput identification of anthrax-causing and emetic Bacillus cereus group genome assemblies using BTyper, a computational tool for virulence-based classification of Bacillus cereus group isolates using nucleotide sequencing data.

    PubMed

    Carroll, Laura M; Kovac, Jasna; Miller, Rachel A; Wiedmann, Martin

    2017-06-16

    The Bacillus cereus group comprises nine species, several of which are pathogenic. Differentiating between isolates that may cause disease and those that do not is a matter of public health and economic importance, but can be particularly challenging due to the high genomic similarity of the group. To this end, we have developed BTyper, a computational tool that employs a combination of (i) virulence gene-based typing, (ii) multi-locus sequence typing (MLST), (iii) panC clade typing, and (iv) rpoB allelic typing to rapidly classify B. cereus group isolates using nucleotide sequencing data. BTyper was applied to a set of 662 B. cereus group genome assemblies to (i) identify anthrax-associated genes in non-B. anthracis members of the B. cereus group, and (iI) identify assemblies from B. cereus group strains with emetic potential. With BTyper, anthrax toxin genes cya, lef and pagA were detected in 8 genomes classified in NCBI as B. cereus that clustered into two distinct groups using k-medoids clustering, while B. anthracis poly-γ-D-glutamate capsule biosynthesis genes capABCDE or hyaluronic acid capsule gene hasA were detected in an additional 16 assemblies classified as either B. cereus or B. thuringiensis isolated from clinical, environmental, and food sources. Emetic toxin genes cesABCD were detected in 24 assemblies belonging to panC clades III and VI that had been isolated from food, clinical, and environmental settings. The command line version of BTyper is available at https://github.com/lmc297/BTyper In addition, BMiner, a companion application for analyzing multiple BTyper output files in aggregate, can be found at https://github.com/lmc297/BMinerImportanceBacillus cereus is a foodborne pathogen that is estimated to cause tens of thousands of illnesses each year in the United States alone. Even with molecular methods, it can be difficult to distinguish non-pathogenic B. cereus group isolates from their pathogenic counterparts, including the human pathogen B

  5. Rapid, High-Throughput Identification of Anthrax-Causing and Emetic Bacillus cereus Group Genome Assemblies via BTyper, a Computational Tool for Virulence-Based Classification of Bacillus cereus Group Isolates by Using Nucleotide Sequencing Data

    PubMed Central

    Carroll, Laura M.; Miller, Rachel A.; Wiedmann, Martin

    2017-01-01

    ABSTRACT The Bacillus cereus group comprises nine species, several of which are pathogenic. Differentiating between isolates that may cause disease and those that do not is a matter of public health and economic importance, but it can be particularly challenging due to the high genomic similarity within the group. To this end, we have developed BTyper, a computational tool that employs a combination of (i) virulence gene-based typing, (ii) multilocus sequence typing (MLST), (iii) panC clade typing, and (iv) rpoB allelic typing to rapidly classify B. cereus group isolates using nucleotide sequencing data. BTyper was applied to a set of 662 B. cereus group genome assemblies to (i) identify anthrax-associated genes in non-B. anthracis members of the B. cereus group, and (ii) identify assemblies from B. cereus group strains with emetic potential. With BTyper, the anthrax toxin genes cya, lef, and pagA were detected in 8 genomes classified by the NCBI as B. cereus that clustered into two distinct groups using k-medoids clustering, while either the B. anthracis poly-γ-d-glutamate capsule biosynthesis genes capABCDE or the hyaluronic acid capsule hasA gene was detected in an additional 16 assemblies classified as either B. cereus or Bacillus thuringiensis isolated from clinical, environmental, and food sources. The emetic toxin genes cesABCD were detected in 24 assemblies belonging to panC clades III and VI that had been isolated from food, clinical, and environmental settings. The command line version of BTyper is available at https://github.com/lmc297/BTyper. In addition, BMiner, a companion application for analyzing multiple BTyper output files in aggregate, can be found at https://github.com/lmc297/BMiner. IMPORTANCE Bacillus cereus is a foodborne pathogen that is estimated to cause tens of thousands of illnesses each year in the United States alone. Even with molecular methods, it can be difficult to distinguish nonpathogenic B. cereus group isolates from their

  6. The mitochondrial genome of the prasinophyte Prasinoderma coloniale reveals two trans-spliced group I introns in the large subunit rRNA gene.

    PubMed

    Pombert, Jean-François; Otis, Christian; Turmel, Monique; Lemieux, Claude

    2013-01-01

    Organelle genes are often interrupted by group I and or group II introns. Splicing of these mobile genetic occurs at the RNA level via serial transesterification steps catalyzed by the introns'own tertiary structures and, sometimes, with the help of external factors. These catalytic ribozymes can be found in cis or trans configuration, and although trans-arrayed group II introns have been known for decades, trans-spliced group I introns have been reported only recently. In the course of sequencing the complete mitochondrial genome of the prasinophyte picoplanktonic green alga Prasinoderma coloniale CCMP 1220 (Prasinococcales, clade VI), we uncovered two additional cases of trans-spliced group I introns. Here, we describe these introns and compare the 54,546 bp-long mitochondrial genome of Prasinoderma with those of four other prasinophytes (clades II, III and V). This comparison underscores the highly variable mitochondrial genome architecture in these ancient chlorophyte lineages. Both Prasinoderma trans-spliced introns reside within the large subunit rRNA gene (rnl) at positions where cis-spliced relatives, often containing homing endonuclease genes, have been found in other organelles. In contrast, all previously reported trans-spliced group I introns occur in different mitochondrial genes (rns or coxI). Each Prasinoderma intron is fragmented into two pieces, forming at the RNA level a secondary structure that resembles those of its cis-spliced counterparts. As observed for other trans-spliced group I introns, the breakpoint of the first intron maps to the variable loop L8, whereas that of the second is uniquely located downstream of P9.1. The breakpoint In each Prasinoderma intron corresponds to the same region where the open reading frame (ORF) occurs when present in cis-spliced orthologs. This correlation between the intron breakpoint and the ORF location in cis-spliced orthologs also holds for other trans-spliced introns; we discuss the possible implications

  7. Two distinct groups of porcine enteropathogenic Escherichia coli strains of serogroup O45 are revealed by comparative genomic hybridization and virulence gene microarray

    PubMed Central

    Bruant, Guillaume; Zhang, Yongxiang; Garneau, Philippe; Wong, Justin; Laing, Chad; Fairbrother, John M; Gannon, Victor PJ; Harel, Josée

    2009-01-01

    Background Porcine enteropathogenic Escherichia coli (PEPEC) strains of serogroup O45 cause post-weaning diarrhea and produce characteristic attaching and effacing (A/E) lesions. Most O45 PEPEC strains possess the locus of enterocyte effacement (LEE), encoding the virulence factors required for production of A/E lesions, and often possess the paa gene, which is thought to contribute to the early stages of PEPEC pathogenicity. In this study, nine O45 PEPEC strains and a rabbit enteropathogenic (REPEC) strain, known to produce A/E lesions in vivo, were characterized using an E. coli O157-E. coli K12 whole genome microarray and a virulence gene-specific microarray, and by PCR experiments. Results Based on their virulence gene profiles, the 10 strains were considered to be atypical EPEC. The differences in their genomes pointed to the identification of two distinct evolutionary groups of O45 PEPEC, Groups I and II, and provided evidence for a contribution of these genetic differences to their virulence in pigs. Group I included the REPEC strain and four O45 PEPEC strains known to induce severe A/E lesions in challenged pigs whereas Group II was composed of the five other O45 PEPEC strains, which induced less severe or no A/E lesions in challenged pigs. Significant differences between Groups I and II were found with respect to the presence or absence of 50 O-Islands (OIs) or S-loops and 13 K-islands (KIs) or K-loops, including the virulence-associated islands OI#1 (S-loop#1), OI#47 (S-loop#71), OI#57 (S-loop#85), OI#71 (S-loop#108), OI#115, OI#122, and OI#154 (S-loop#253). Conclusion We have genetically characterized a collection of O45 PEPEC strains and classified them into two distinct groups. The differences in their virulence gene and genomic island content may influence the pathogenicity of O45 PEPEC strains, and explain why Group I O45 PEPEC strains induced more severe A/E lesions in explants and challenged pigs than Group II strains. PMID:19709428

  8. Description of Bacillus toyonensis sp. nov., a novel species of the Bacillus cereus group, and pairwise genome comparisons of the species of the group by means of ANI calculations.

    PubMed

    Jiménez, Guillermo; Urdiain, Mercedes; Cifuentes, Ana; López-López, Aránzazu; Blanch, Anicet R; Tamames, Javier; Kämpfer, Peter; Kolstø, Anne-Brit; Ramón, Daniel; Martínez, Juan F; Codoñer, Francisco M; Rosselló-Móra, Ramon

    2013-09-01

    Strain BCT-7112(T) was isolated in 1966 in Japan from a survey designed to obtain naturally occurring microorganisms as pure cultures in the laboratory for use as probiotics in animal nutrition. This strain, which was primarily identified as Bacillus cereus var toyoi, has been in use for more than 30 years as the active ingredient of the preparation TOYOCERIN(®), an additive for use in animal nutrition (e.g. swine, poultry, cattle, rabbits and aquaculture). Despite the fact that the strain was initially classified as B. cereus, it showed significant genomic differences from the type strains of the B. cereus group that were large enough (ANI values below 92%) to allow it to be considered as a different species within the group. The polyphasic taxonomic study presented here provides sufficient discriminative parameters to classify BCT-7112(T) as a new species for which the name Bacillus toyonensis sp. nov. is proposed, with BCT-7112(T) (=CECT 876(T); =NCIMB 14858(T)) being designated as the type strain. In addition, a pairwise comparison between the available genomes of the whole B. cereus group by means of average nucleotide identity (ANI) calculations indicated that besides the eight classified species (including B. toyonensis), additional genomospecies could be detected, and most of them also had ANI values below 94%. ANI values were on the borderline of a species definition only in the cases of representatives of B. cereus versus B. thuringiensis, and B. mycoides and B. weihenstephanensis. Copyright © 2013 Elsevier GmbH. All rights reserved.

  9. Prophage Genomics

    PubMed Central

    Canchaya, Carlos; Proux, Caroline; Fournous, Ghislain; Bruttin, Anne; Brüssow, Harald

    2003-01-01

    The majority of the bacterial genome sequences deposited in the National Center for Biotechnology Information database contain prophage sequences. Analysis of the prophages suggested that after being integrated into bacterial genomes, they undergo a complex decay process consisting of inactivating point mutations, genome rearrangements, modular exchanges, invasion by further mobile DNA elements, and massive DNA deletion. We review the technical difficulties in defining such altered prophage sequences in bacterial genomes and discuss theoretical frameworks for the phage-bacterium interaction at the genomic level. The published genome sequences from three groups of eubacteria (low- and high-G+C gram-positive bacteria and γ-proteobacteria) were screened for prophage sequences. The prophages from Streptococcus pyogenes served as test case for theoretical predictions of the role of prophages in the evolution of pathogenic bacteria. The genomes from further human, animal, and plant pathogens, as well as commensal and free-living bacteria, were included in the analysis to see whether the same principles of prophage genomics apply for bacteria living in different ecological niches and coming from distinct phylogenetical affinities. The effect of selection pressure on the host bacterium is apparently an important force shaping the prophage genomes in low-G+C gram-positive bacteria and γ-proteobacteria. PMID:12794192

  10. Harnessing ancient genomes to study the history of human adaptation.

    PubMed

    Marciniak, Stephanie; Perry, George H

    2017-09-11

    The past several years have witnessed an explosion of successful ancient human genome-sequencing projects, with genomic-scale ancient DNA data sets now available for more than 1,100 ancient human and archaic hominin (for example, Neandertal) individuals. Recent 'evolution in action' analyses have started using these data sets to identify and track the spatiotemporal trajectories of genetic variants associated with human adaptations to novel and changing environments, agricultural lifestyles, and introduced or co-evolving pathogens. Together with evidence of adaptive introgression of genetic variants from archaic hominins to humans and emerging ancient genome data sets for domesticated animals and plants, these studies provide novel insights into human evolution and the evolutionary consequences of human behaviour that go well beyond those that can be obtained from modern genomic data or the fossil and archaeological records alone.

  11. A Children's Oncology Group and TARGET initiative exploring the genetic landscape of Wilms tumor. | Office of Cancer Genomics

    Cancer.gov

    We performed genome-wide sequencing and analyzed mRNA and miRNA expression, DNA copy number, and DNA methylation in 117 Wilms tumors, followed by targeted sequencing of 651 Wilms tumors. In addition to genes previously implicated in Wilms tumors (WT1, CTNNB1, AMER1, DROSHA, DGCR8, XPO5, DICER1, SIX1, SIX2, MLLT1, MYCN, and TP53), we identified mutations in genes not previously recognized as recurrently involved in Wilms tumors, the most frequent being BCOR, BCORL1, NONO, MAX, COL6A3, ASXL1, MAP3K4, and ARID1A.

  12. Genome sequence of a serotype M3 strain of group A Streptococcus: phage-encoded toxins, the high-virulence phenotype, and clone emergence.

    PubMed

    Beres, Stephen B; Sylva, Gail L; Barbian, Kent D; Lei, Benfang; Hoff, Jessica S; Mammarella, Nicole D; Liu, Meng-Yao; Smoot, James C; Porcella, Stephen F; Parkins, Larye D; Campbell, David S; Smith, Todd M; McCormick, John K; Leung, Donald Y M; Schlievert, Patrick M; Musser, James M

    2002-07-23

    Genome sequences are available for many bacterial strains, but there has been little progress in using these data to understand the molecular basis of pathogen emergence and differences in strain virulence. Serotype M3 strains of group A Streptococcus (GAS) are a common cause of severe invasive infections with unusually high rates of morbidity and mortality. To gain insight into the molecular basis of this high-virulence phenotype, we sequenced the genome of strain MGAS315, an organism isolated from a patient with streptococcal toxic shock syndrome. The genome is composed of 1,900,521 bp, and it shares approximately 1.7 Mb of related genetic material with genomes of serotype M1 and M18 strains. Phage-like elements account for the great majority of variation in gene content relative to the sequenced M1 and M18 strains. Recombination produces chimeric phages and strains with previously uncharacterized arrays of virulence factor genes. Strain MGAS315 has phage genes that encode proteins likely to contribute to pathogenesis, such as streptococcal pyrogenic exotoxin A (SpeA) and SpeK, streptococcal superantigen (SSA), and a previously uncharacterized phospholipase A(2) (designated Sla). Infected humans had anti-SpeK, -SSA, and -Sla antibodies, indicating that these GAS proteins are made in vivo. SpeK and SSA were pyrogenic and toxic for rabbits. Serotype M3 strains with the phage-encoded speK and sla genes increased dramatically in frequency late in the 20th century, commensurate with the rise in invasive disease caused by M3 organisms. Taken together, the results show that phage-mediated recombination has played a critical role in the emergence of a new, unusually virulent clone of serotype M3 GAS.

  13. Complete genome analyses of the first porcine rotavirus group H identified from a South African pig does not provide evidence for recent interspecies transmission events.

    PubMed

    Nyaga, Martin M; Peenze, Ina; Potgieter, Christiaan A; Seheri, L Mapaseka; Page, Nicola A; Yinda, Claude K; Steele, A Duncan; Matthijnssens, Jelle; Mphahlele, M Jeffrey

    2016-03-01

    Rotaviruses (RVs) are classified into eight species/groups (RVA-RVH) according to the migration patterns of their 11 genome segments, as well as by serological and molecular properties of Viral Protein 6 (VP6). In 1997 a new unclassified RV was reported infecting adults in Bangladesh and China. This virus was initially named novel adult diarrhoea rotavirus (ADRV-N), but later renamed as RVH. Since then, RVH has been detected in humans only very sporadically. However, RVH is increasingly being detected in pig populations in the USA, Brazil and Japan, but not yet in Africa. Unfortunately, whole genome sequence data of porcine RVH strains in GenBank is currently restricted to a single strain (SKA-1) from Japan. Porcine diarrhoeic samples were collected in South Africa and analysed for rotavirus using an RVA ELISA and electropherotyping by PAGE. One sample displayed a 4:2:1:1:1:1:1 migration pattern, typical for RVH. In order to further investigate this strain, sequence-independent amplification followed by random sequencing using the 454/Roche GS FLX Sequencer was performed, resulting in the second complete porcine RVH strain (MRC-DPRU1575) available in databases. Phylogenetically, all segments of MRC-DPRU1575 clustered closely with the SKA-1 strain and in some segments with known porcine RVH strains from Brazil and the USA. In contrast, the porcine RVH strains were only distantly related to human RVH strains from Asia and a partial RVH-like strain recently detected in bats from Cameroon. Overall, strain MRC-DPRU1575 is the first complete genome of a porcine RVH from Africa and allows for the development of improved RVH screening methods. Our analyses indicate that RVH strains cluster according to their host species, not suggesting any evidence of recent interspecies transmission events. However, more RVH genomes from a wider host range are needed to better understand their evolutionary pathways and zoonotic potential.

  14. Kelp Fly Virus: a Novel Group of Insect Picorna-Like Viruses as Defined by Genome Sequence Analysis and a Distinctive Virion Structure

    PubMed Central

    Hartley, C. J.; Greenwood, D. R.; Gilbert, R. J. C.; Masoumi, A.; Gordon, K. H. J.; Hanzlik, T. N.; Fry, E. E.; Stuart, D. I.; Scotti, P. D.

    2005-01-01

    The complete genomic sequence of kelp fly virus (KFV), originally isolated from the kelp fly, Chaetocoelopa sydneyensis, has been determined. Analyses of its genomic and structural organization and phylogeny show that it belongs to a hitherto undescribed group within the picorna-like virus superfamily. The single-stranded genomic RNA of KFV is 11,035 nucleotides in length and contains a single large open reading frame encoding a polypeptide of 3,436 amino acids with 5′ and 3′ untranslated regions of 384 and 343 nucleotides, respectively. The predicted amino acid sequence of the polypeptide shows that it has three regions. The N-terminal region contains sequences homologous to the baculoviral inhibitor of apoptosis repeat domain, an inhibitor of apoptosis commonly found in animals and in viruses with double-stranded DNA genomes. The second region contains at least two capsid proteins. The third region has three sequence motifs characteristic of replicase proteins of many plant and animal viruses, including a helicase, a 3C chymotrypsin-like protease, and an RNA-dependent RNA polymerase. Phylogenetic analysis of the replicase motifs shows that KFV forms a distinct and distant taxon within the picorna-like virus superfamily. Cryoelectron microscopy and image reconstruction of KFV to a resolution of 15 Å reveals an icosahedral structure, with each of its 12 fivefold vertices forming a turret from the otherwise smooth surface of the 20-Å-thick capsid. The architecture of the KFV capsid is unique among the members of the picornavirus superfamily for which structures have previously been determined. PMID:16227260

  15. Comparative Genomics of the Dual-Obligate Symbionts from the Treehopper, Entylia carinata (Hemiptera: Membracidae), Provide Insight into the Origins and Evolution of an Ancient Symbiosis

    PubMed Central

    Yang, Xiushuai; Poff, Kirsten; Bennett, Gordon

    2017-01-01

    Abstract Insect species in the Auchenorrhyncha suborder (Hemiptera) maintain ancient obligate symbioses with bacteria that provide essential amino acids (EAAs) deficient in their plant-sap diets. Molecular studies have revealed that two complementary symbiont lineages, “Candidatus Sulcia muelleri” and a betaproteobacterium (“Ca. Zinderia insecticola” in spittlebugs [Cercopoidea] and “Ca. Nasuia deltocephalinicola” in leafhoppers [Cicadellidae]) may have persisted in the suborder since its origin ∼300 Ma. However, investigation of how this pair has co-evolved on a genomic level is limited to only a few host lineages. We sequenced the complete genomes of Sulcia and a betaproteobacterium from the treehopper, Entylia carinata (Membracidae: ENCA), as the first representative from this species-rich group. It also offers the opportunity to compare symbiont evolution across a major insect group, the Membracoidea (leafhoppers + treehoppers). Genomic analyses show that the betaproteobacteria in ENCA is a member of the Nasuia lineage. Both symbionts have larger genomes (Sulcia = 218 kb and Nasuia = 144 kb) than related lineages in Deltocephalinae leafhoppers, retaining genes involved in basic cellular functions and information processing. Nasuia-ENCA further exhibits few unique gene losses, suggesting that its parent lineage in the common ancestor to the Membracoidea was already highly reduced. Sulcia-ENCA has lost the abilities to synthesize menaquinone cofactor and to complete the synthesis of the branched-chain EAAs. Both capabilities are conserved in other Sulcia lineages sequenced from across the Auchenorrhyncha. Finally, metagenomic sequencing recovered the partial genome of an Arsenophonus symbiont, although it infects only 20% of individuals indicating a facultative role. PMID:28854637

  16. A trans-splicing group I intron and tRNA-hyperediting in the mitochondrial genome of the lycophyte Isoetes engelmannii

    PubMed Central

    Grewe, Felix; Viehoever, Prisca; Weisshaar, Bernd; Knoop, Volker

    2009-01-01

    Plant mitochondrial genomes show much more evolutionary plasticity than those of animals. We analysed the first mitochondrial DNA (mtDNA) of a lycophyte, the quillwort Isoetes engelmannii, which is separated from seed plants by more than 350 million years of evolution. The Isoetes mtDNA is particularly rich in recombination events, and chloroplast as well as nuclear DNA inserts document the incorporation of foreign sequences already in this most ancestral vascular plant lineage. On the other hand, particularly small group II introns and short intergenic regions reveal a tendency of evolution towards a compact mitochondrial genome. RNA editing reaches extreme levels exceeding 100 pyrimidine exchanges in individual mRNAs and, hitherto unobserved in such frequency, also in tRNAs with 18 C-to-U conversions in the tRNA for proline. In total, some 1500 sites of RNA editing can be expected for the Isoetes mitochondrial transcriptome. As a unique molecular novelty, the Isoetes cox1 gene requires trans-splicing via a discontinuous group I intron demonstrating disrupted, but functional, RNAs for yet another class of natural ribozymes. PMID:19553190

  17. Whole-genome phylogenies of the family Bacillaceae and expansion of the sigma factor gene family in the Bacillus cereus species-group

    PubMed Central

    2011-01-01

    Background The Bacillus cereus sensu lato group consists of six species (B. anthracis, B. cereus, B. mycoides, B. pseudomycoides, B. thuringiensis, and B. weihenstephanensis). While classical microbial taxonomy proposed these organisms as distinct species, newer molecular phylogenies and comparative genome sequencing suggests that these organisms should be classified as a single species (thus, we will refer to these organisms collectively as the Bc species-group). How do we account for the underlying similarity of these phenotypically diverse microbes? It has been established for some time that the most rapidly evolving and evolutionarily flexible portions of the bacterial genome are regulatory sequences and transcriptional networks. Other studies have suggested that the sigma factor gene family of these organisms has diverged and expanded significantly relative to their ancestors; sigma factors are those portions of the bacterial transcriptional apparatus that control RNA polymerase recognition for promoter selection. Thus, examining sigma factor divergence in these organisms would concurrently examine both regulatory sequences and transcriptional networks important for divergence. We began this examination by comparison to the sigma factor gene set of B. subtilis. Results Phylogenetic analysis of the Bc species-group utilizing 157 single-copy genes of the family Bacillaceae suggests that several taxonomic revisions of the genus Bacillus should be considered. Within the Bc species-group there is little indication that the currently recognized species form related sub-groupings, suggesting that they are members of the same species. The sigma factor gene family encoded by the Bc species-group appears to be the result of a dynamic gene-duplication and gene-loss process that in previous analyses underestimated the true heterogeneity of the sigma factor content in the Bc species-group. Conclusions Expansion of the sigma factor gene family appears to have preferentially

  18. Comparative genomic analysis of catfish linkage group 8 reveals two homologous chromosomes in zebrafish and other teleosts with extensive inter-chromosomal rearrangements

    USDA-ARS?s Scientific Manuscript database

    Background Comparative genomics is a powerful tool to transfer genomic information from model species to related non-model species. Channel catfish (Ictalurus punctatus) is the primary aquaculture species in the United States. Its existing genome resources such as genomic sequences generated from n...

  19. A genomic assessment of species boundaries and hybridization in a group of highly polymorphic anoles (distichus species complex).

    PubMed

    MacGuigan, Daniel J; Geneva, Anthony J; Glor, Richard E

    2017-06-01

    Delimiting young species is one of the great challenges of systematic biology, particularly when the species in question exhibit little morphological divergence. Anolis distichus, a trunk anole with more than a dozen subspecies that are defined primarily by dewlap color, may actually represent several independent evolutionary lineages. To test this, we utilized amplified fragment length polymorphisms (AFLP) genome scans and genetic clustering analyses in conjunction with a coalescent-based species delimitation method. We examined a geographically widespread set of samples and two heavily sampled hybrid zones. We find that genetic divergence is associated with a major biogeographic barrier, the Hispaniolan paleo-island boundary, but not with dewlap color. Additionally, we find support for hypotheses regarding colonization of two Hispaniolan satellite islands and the Bahamas from mainland Hispaniola. Our results show that A. distichus is composed of seven distinct evolutionary lineages still experiencing a limited degree of gene flow. We suggest that A. distichus merits taxonomic revision, but that dewlap color cannot be relied upon as the primary diagnostic character.

  20. Genome-Wide SNP Analysis of Southern African Populations Provides New Insights into the Dispersal of Bantu-Speaking Groups.

    PubMed

    González-Santos, Miguel; Montinaro, Francesco; Oosthuizen, Ockie; Oosthuizen, Erica; Busby, George B J; Anagnostou, Paolo; Destro-Bisol, Giovanni; Pascali, Vincenzo; Capelli, Cristian

    2015-09-11

    The expansion of Bantu-speaking agropastoralist populations had a great impact on the genetic, linguistic, and cultural variation of sub-Saharan Africa. It is generally accepted that Bantu languages originated in an area around the present border between Cameroon and Nigeria approximately 5,000 years ago, from where they spread South and East becoming the largest African linguistic branch. The demic consequences of this event are reflected in the relatively high genetic homogeneity observed across most of sub-Saharan Africa populations. In this work, we explored genome-wide single nucleotide polymorphism data from 28 populations to characterize the genetic components present in sub-Saharan African populations. Combining novel data from four Southern African populations with previously published results, we reject the hypothesis that the "non-Bantu" genetic component reported in South-Eastern Africa (Mozambique) reflects extensive gene flow between incoming agriculturalist and resident hunter-gatherer communities. We alternatively suggest that this novel component is the result of demographic dynamics associated with the Bantu dispersal. © The Author(s) 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  1. Genome-Wide SNP Analysis of Southern African Populations Provides New Insights into the Dispersal of Bantu-Speaking Groups

    PubMed Central

    González-Santos, Miguel; Montinaro, Francesco; Oosthuizen, Ockie; Oosthuizen, Erica; Busby, George B.J.; Anagnostou, Paolo; Destro-Bisol, Giovanni; Pascali, Vincenzo; Capelli, Cristian

    2015-01-01

    The expansion of Bantu-speaking agropastoralist populations had a great impact on the genetic, linguistic, and cultural variation of sub-Saharan Africa. It is generally accepted that Bantu languages originated in an area around the present border between Cameroon and Nigeria approximately 5,000 years ago, from where they spread South and East becoming the largest African linguistic branch. The demic consequences of this event are reflected in the relatively high genetic homogeneity observed across most of sub-Saharan Africa populations. In this work, we explored genome-wide single nucleotide polymorphism data from 28 populations to characterize the genetic components present in sub-Saharan African populations. Combining novel data from four Southern African populations with previously published results, we reject the hypothesis that the “non-Bantu” genetic component reported in South-Eastern Africa (Mozambique) reflects extensive gene flow between incoming agriculturalist and resident hunter-gatherer communities. We alternatively suggest that this novel component is the result of demographic dynamics associated with the Bantu dispersal. PMID:26363465

  2. Genomic Analysis Reveals Multi-Drug Resistance Clusters in Group B Streptococcus CC17 Hypervirulent Isolates Causing Neonatal Invasive Disease in Southern Mainland China

    PubMed Central

    Campisi, Edmondo; Rosini, Roberto; Ji, Wenjing; Guidotti, Silvia; Rojas-López, Maricarmen; Geng, Guozhu; Deng, Qiulian; Zhong, Huamin; Wang, Weidong; Liu, Haiying; Nan, Cassandra; Margarit, Immaculada; Rinaudo, C. D.

    2016-01-01

    Neonatal invasive disease caused by group B Streptococcus (GBS) represents a significant public health care concern globally. However, data related to disease burden, serotype distribution, and molecular epidemiology in China and other Asian countries are very few and specifically relative to confined regions. The aim of this study was to investigate the genetic characteristics of GBS isolates recovered from neonates with invasive disease during 2013–2014 at Guangzhou and Changsha hospitals in southern mainland China. We assessed the capsular polysaccharide type, pilus islands (PIs) distribution and hvgA gene presence in a panel of 26 neonatal clinical isolates, of which 8 were recovered from Early Onset Disease and 18 from Late Onset Disease (LOD). Among 26 isolates examined, five serotypes were identified. Type III was the most represented (15 cases), particularly among LOD strains (n = 11), followed by types Ib (n = 5), V (n = 3), Ia (n = 2) and II (n = 1). We performed whole-genome sequencing analysis and antimicrobial susceptibility testing on the 14 serotype III isolates belonging to the hypervirulent Clonal Complex 17 (serotype III-CC17). The presence of PI-2b alone was associated with 13 out of 14 serotype III-CC17 strains. Genome analysis led us to identify two multi-drug resistance gene clusters harbored in two new versions of integrative and conjugative elements (ICEs), carrying five or eight antibiotic resistance genes, respectively. These ICEs replaced the 16 kb-locus that normally contains the PI-1 operon. All isolates harboring the identified ICEs showed multiple resistances to aminoglycoside, macrolide, and tetracycline antibiotic classes. In conclusion, we report the first whole-genome sequence analysis of 14 GBS serotype III-CC17 strains isolated in China, representing the most prevalent lineage causing neonatal invasive disease. The acquisition of newly identified ICEs conferring multiple antibiotic resistance could in part explain the spread

  3. Seed colour loci, homoeology and linkage groups of the C genome chromosomes revealed in Brassica rapa–B. oleracea monosomic alien addition lines

    PubMed Central

    Heneen, Waheeb K.; Geleta, Mulatu; Brismar, Kerstin; Xiong, Zhiyong; Pires, J. Chris; Hasterok, Robert; Stoute, Andrew I.; Scott, Roderick J.; King, Graham J.; Kurup, Smita

    2012-01-01

    Background and Aims Brassica rapa and B. oleracea are the progenitors of oilseed rape B. napus. The addition of each chromosome of B. oleracea to the chromosome complement of B. rapa results in a series of monosomic alien addition lines (MAALs). Analysis of MAALs determines which B. oleracea chromosomes carry genes controlling specific phenotypic traits, such as seed colour. Yellow-seeded oilseed rape is a desirable breeding goal both for food and livestock feed end-uses that relate to oil, protein and fibre contents. The aims of this study included developing a missing MAAL to complement an available series, for studies on seed colour control, chromosome homoeology and assignment of linkage groups to B. oleracea chromosomes. Methods A new batch of B. rapa–B. oleracea aneuploids was produced to generate the missing MAAL. Seed colour and other plant morphological features relevant to differentiation of MAALs were recorded. For chromosome characterization, Snow's carmine, fluorescence in situ hybridization (FISH) and genomic in situ hybridization (GISH) were used. Key Results The final MAAL was developed. Morphological traits that differentiated the MAALs comprised cotyledon number, leaf morphology, flower colour and seed colour. Seed colour was controlled by major genes on two B. oleracea chromosomes and minor genes on five other chromosomes of this species. Homoeologous pairing was largely between chromosomes with similar centromeric positions. FISH, GISH and a parallel microsatellite marker analysis defined the chromosomes in terms of their linkage groups. Conclusions A complete set of MAALs is now available for genetic, genomic, evolutionary and breeding perspectives. Defining chromosomes that carry specific genes, physical localization of DNA markers and access to established genetic linkage maps contribute to the integration of these approaches, manifested in the confirmed correspondence of linkage groups with specific chromosomes. Applications include marker

  4. CELF4 Variant and Anthracycline-Related Cardiomyopathy: A Children's Oncology Group Genome-Wide Association Study.

    PubMed

    Wang, Xuexia; Sun, Can-Lan; Quiñones-Lombraña, Adolfo; Singh, Purnima; Landier, Wendy; Hageman, Lindsey; Mather, Molly; Rotter, Jerome I; Taylor, Kent D; Chen, Yii-Der Ida; Armenian, Saro H; Winick, Naomi; Ginsberg, Jill P; Neglia, Joseph P; Oeffinger, Kevin C; Castellino, Sharon M; Dreyer, Zoann E; Hudson, Melissa M; Robison, Leslie L; Blanco, Javier G; Bhatia, Smita

    2016-03-10

    Interindividual variability in the dose-dependent association between anthracyclines and cardiomyopathy suggests that genetic susceptibility could play a role. The current study uses an agnostic approach to identify genetic variants that could modify cardiomyopathy risk. A genome-wide association study was conducted in childhood cancer survivors with and without cardiomyopathy (cases and controls, respectively). Single-nucleotide polymorphisms (SNPs) that surpassed a prespecified threshold for statistical significance were independently replicated. The possible mechanistic significance of validated SNP(s) was sought by using healthy heart samples. No SNP was marginally associated with cardiomyopathy. However, SNP rs1786814 on the CELF4 gene passed the significance cutoff for gene-environment interaction (Pge = 1.14 × 10(-5)). Multivariable analyses adjusted for age at cancer diagnosis, sex, anthracycline dose, and chest radiation revealed that, among patients with the A allele, cardiomyopathy was infrequent and not dose related. However, among those exposed to greater than 300 mg/m(2) of anthracyclines, the rs1786814 GG genotype conferred a 10.2-fold (95% CI, 3.8- to 27.3-fold; P < .001) increased risk of cardiomyopathy compared with those who had GA/AA genotypes and anthracycline exposure of 300 mg/m(2) or less. This gene-environment interaction was successfully replicated in an independent set of anthracycline-related cardiomyopathy. CUG-BP and ETR-3-like factor proteins control developmentally regulated splicing of TNNT2, the gene that encodes for cardiac troponin T (cTnT), a biomarker of myocardial injury. Coexistence of more than one cTnT variant results in a temporally split myofilament response to calcium, which causes decreased contractility. Analysis of TNNT2 splicing variants in healthy human hearts suggested an association between the rs1786814 GG genotype and coexistence of more than one TNNT2 splicing variant (90.5% GG v 41.7% GA/AA; P = .005). We

  5. CELF4 Variant and Anthracycline-Related Cardiomyopathy: A Children’s Oncology Group Genome-Wide Association Study

    PubMed Central

    Wang, Xuexia; Sun, Can-Lan; Quiñones-Lombraña, Adolfo; Singh, Purnima; Landier, Wendy; Hageman, Lindsey; Mather, Molly; Rotter, Jerome I.; Taylor, Kent D.; Chen, Yii-Der Ida; Armenian, Saro H.; Winick, Naomi; Ginsberg, Jill P.; Neglia, Joseph P.; Oeffinger, Kevin C.; Castellino, Sharon M.; Dreyer, Zoann E.; Hudson, Melissa M.; Robison, Leslie L.; Blanco, Javier G.

    2016-01-01

    Purpose Interindividual variability in the dose-dependent association between anthracyclines and cardiomyopathy suggests that genetic susceptibility could play a role. The current study uses an agnostic approach to identify genetic variants that could modify cardiomyopathy risk. Methods A genome-wide association study was conducted in childhood cancer survivors with and without cardiomyopathy (cases and controls, respectively). Single-nucleotide polymorphisms (SNPs) that surpassed a prespecified threshold for statistical significance were independently replicated. The possible mechanistic significance of validated SNP(s) was sought by using healthy heart samples. Results No SNP was marginally associated with cardiomyopathy. However, SNP rs1786814 on the CELF4 gene passed the significance cutoff for gene-environment interaction (Pge = 1.14 × 10−5). Multivariable analyses adjusted for age at cancer diagnosis, sex, anthracycline dose, and chest radiation revealed that, among patients with the A allele, cardiomyopathy was infrequent and not dose related. However, among those exposed to greater than 300 mg/m2 of anthracyclines, the rs1786814 GG genotype conferred a 10.2-fold (95% CI, 3.8- to 27.3-fold; P < .001) increased risk of cardiomyopathy compared with those who had GA/AA genotypes and anthracycline exposure of 300 mg/m2 or less. This gene-environment interaction was successfully replicated in an independent set of anthracycline-related cardiomyopathy. CUG-BP and ETR-3-like factor proteins control developmentally regulated splicing of TNNT2, the gene that encodes for cardiac troponin T (cTnT), a biomarker of myocardial injury. Coexistence of more than one cTnT variant results in a temporally split myofilament response to calcium, which causes decreased contractility. Analysis of TNNT2 splicing variants in healthy human hearts suggested an association between the rs1786814 GG genotype and coexistence of more than one TNNT2 splicing variant (90.5% GG v 41.7% GA

  6. The mitochondrial genome of Paraspadella gotoi is highly reduced and reveals that chaetognaths are a sister-group to protostomes

    SciTech Connect

    Helfenbein, Kevin G.; Fourcade, H. Matthew; Vanjani, Rohit G.; Boore, Jeffrey L.

    2004-05-01

    We report the first complete mitochondrial (mt) DNA sequence from a member of the phylum Chaetognatha (arrow worms). The Paraspadella gotoi mtDNA is highly unusual, missing 23 of the genes commonly found in animal mtDNAs, including atp6, which has otherwise been found universally to be present. Its 14 genes are unusually arranged into two groups, one on each strand. One group is punctuated by numerous non-coding intergenic nucleotides, while the other group is tightly packed, having no non-coding nucleotides, leading to speculation that there are two transcription units with differing modes of expression. The phylogenetic position of the Chaetognatha within the Metazoa has long been uncertain, with conflicting or equivocal results from various morphological analyses and rRNA sequence comparisons. Comparisons here of amino acid sequences from mitochondrially encoded proteins gives a single most parsimonious tree that supports a position of Chaetognatha as sister to the protostomes studied here. From this, one can more clearly interpret the patterns of evolution of various developmental features, especially regarding the embryological fate of the blastopore.

  7. The mitochondrial genome of Paraspadella gotoi is highly reduced and reveals that chaetognaths are a sister group to protostomes

    PubMed Central

    Helfenbein, Kevin G.; Fourcade, H. Matthew; Vanjani, Rohit G.; Boore, Jeffrey L.

    2004-01-01

    We report the complete mtDNA sequence from a member of the phylum Chaetognatha (arrow worms). The Paraspadella gotoi mtDNA is highly unusual, missing 23 of the genes commonly found in animal mtDNAs, including atp6, which has otherwise been found universally to be present. Its 14 genes are unusually arranged into two groups, one on each strand. One group is punctuated by numerous noncoding intergenic nucleotides although the other group is tightly packed, having no noncoding nucleotides, leading to speculation that there are two transcription units with differing modes of expression. The phylogenetic position of the Chaetognatha within the Metazoa has long been uncertain, with conflicting or equivocal results from various morphological analyses and rRNA sequence comparisons. Comparisons here of amino acid sequences from mitochondrially encoded proteins give a single most parsimonious tree that supports a position of Chaetognatha as sister to the protostomes studied here. From this analysis, one can more clearly interpret the patterns of evolution of various developmental features, especially regarding the embryological fate of the blastopore. PMID:15249679

  8. Population Genomic Analysis of 1,777 Extended-Spectrum Beta-Lactamase-Producing Klebsiella pneumoniae Isolates, Houston, Texas: Unexpected Abundance of Clonal Group 307.

    PubMed

    Long, S Wesley; Olsen, Randall J; Eagar, Todd N; Beres, Stephen B; Zhao, Picheng; Davis, James J; Brettin, Thomas; Xia, Fangfang; Musser, James M

    2017-05-16

    Klebsiella pneumoniae is a major human pathogen responsible for high morbidity and mortality rates. The emergence and spread of strains resistant to multiple antimicrobial agents and documented large nosocomial outbreaks are especially concerning. To develop new therapeutic strategies for K. pneumoniae, it is imperative to understand the population genomic structure of strains causing human infections. To address this knowledge gap, we sequenced the genomes of 1,777 extended-spectrum beta-lactamase-producing K. pneumoniae strains cultured from patients in the 2,000-bed Houston Methodist Hospital system between September 2011 and May 2015, representing a comprehensive, population-based strain sample. Strains of largely uncharacterized clonal group 307 (CG307) caused more infections than those of well-studied epidemic CG258. Strains varied markedly in gene content and had an extensive array of small and very large plasmids, often containing antimicrobial resistance genes. Some patients with multiple strains cultured over time were infected with genetically distinct clones. We identified 15 strains expressing the New Delhi metallo-beta-lactamase 1 (NDM-1) enzyme that confers broad resistance to nearly all beta-lactam antibiotics. Transcriptome sequencing analysis of 10 phylogenetically diverse strains showed that the global transcriptome of each strain was unique and highly variable. Experimental mouse infection provided new information about immunological parameters of host-pathogen interaction. We exploited the large data set to develop whole-genome sequence-based classifiers that accurately predict clinical antimicrobial resistance for 12 of the 16 antibiotics tested. We conclude that analysis of large, comprehensive, population-based strain samples can assist understanding of the molecular diversity of these organisms and contribute to enhanced translational research.IMPORTANCEKlebsiella pneumoniae causes human infections that are increasingly difficult to treat

  9. Sinorhizobium meliloti Phage ΦM9 Defines a New Group of T4 Superfamily Phages with Unusual Genomic Features but a Common T=16 Capsid

    PubMed Central

    Johnson, Matthew C.; Tatum, Kelsey B.; Lynn, Jason S.; Brewer, Tess E.; Lu, Stephen; Washburn, Brian K.

    2015-01-01

    ABSTRACT Relatively little is known about the phages that infect agriculturally important nitrogen-fixing rhizobial bacteria. Here we report the genome and cryo-electron microscopy structure of the Sinorhizobium meliloti-infecting T4 superfamily phage ΦM9. This phage and its close relative Rhizobium phage vB_RleM_P10VF define a new group of T4 superfamily phages. These phages are distinctly different from the recently characterized cyanophage-like S. meliloti phages of the ΦM12 group. Structurally, ΦM9 has a T=16 capsid formed from repeating units of an extended gp23-like subunit that assemble through interactions between one subunit and the adjacent E-loop insertion domain. Though genetically very distant from the cyanophages, the ΦM9 capsid closely resembles that of the T4 superfamily cyanophage Syn9. ΦM9 also has the same T=16 capsid architecture as the very distant phage SPO1 and the herpesviruses. Despite their overall lack of similarity at the genomic and structural levels, ΦM9 and S. meliloti phage ΦM12 have a small number of open reading frames in common that appear to encode structural proteins involved in interaction with the host and which may have been acquired by horizontal transfer. These proteins are predicted to encode tail baseplate proteins, tail fibers, tail fiber assembly proteins, and glycanases that cleave host exopolysaccharide. IMPORTANCE Despite recent advances in the phylogenetic and structural characterization of bacteriophages, only a small number of phages of plant-symbiotic nitrogen-fixing soil bacteria have been studied at the molecular level. The effects of phage predation upon beneficial bacteria that promote plant growth remain poorly characterized. First steps in understanding these soil bacterium-phage dynamics are genetic, molecular, and structural characterizations of these groups of phages. The T4 superfamily phages are among the most complex phages; they have large genomes packaged within an icosahedral head and a long

  10. Genomic characterization and molecular investigation of VP7 epitopes of uncommon G10P[8] group A rotavirus strains detected in Italy in 2009.

    PubMed

    Ianiro, Giovanni; Delogu, Roberto; Fiore, Lucia; Ruggeri, Franco M

    2015-07-01

    Rotavirus strains with the uncommon genotype G10 have been detected sporadically in cases of acute gastroenteritis in humans and are thought to be transmitted zoonotically. During 2009, 10 G10P[8] rotavirus strains were detected in the stools of children hospitalized with acute diarrhoea in several paediatric hospitals in Italy. The phylogenetic analysis of the VP7 gene of the Italian G10P[8] strains analysed revealed nucleotide identities ranging from 94 to 99 %. Molecular characterization of the 11 genomic segments was performed for one of the G10 strains, which displayed a complete genomic constellation 1 for the non-G genes. The analysis of the deduced amino acid sequences of the G10 VP7 epitopes revealed low amino acid identity with common human strains of different G genotype and with the VP7 proteins included in both anti-rotavirus commercial vaccines (Rotarix and RotaTeq). Amongst the common G genotypes, the VP7 amino acid sequence of the G10 strains showed a high similarity with sequences from G9 strains. A hydrophobic cluster analysis (HCA) of the VP7 protein including aa 20-298 was performed for the G10 Italian sequences in comparison with the major human group A rotavirus G genotypes. The HCA analysis confirmed the findings obtained previously by amino acid analysis of the VP7 epitopes, detecting a genotype-specific pattern of hydrophobicity in the hypervariable regions of the major outer capsid protein.

  11. Genome sequence of Shimia str. SK013, a representative of the Roseobacter group isolated from marine sediment

    SciTech Connect

    Kanukollu, Saranya; Voget, Sonja; Pohlner, Marion; Vandieken, Verona; Petersen, Jörn; Kyrpides, Nikos C.; Woyke, Tanja; Shapiro, Nicole; Göker, Markus; Klenk, Hans -Peter; Cypionka, Heribert; Engelen, Bert

    2016-03-12

    Shimia strain SK013 is an aerobic, Gram-negative, rod shaped alphaproteobacterium affiliated with the Roseobacter group within the family Rhodobacteraceae. The strain was isolated from surface sediment (0-1 cm) of the Skagerrak at 114 m below sea level. The 4,049,808 bp genome of Shimia str. SK013 comprises 3,981 protein-coding genes and 47 RNA genes. It contains one chromosome and no extrachromosomal elements. The genome analysis revealed the presence of genes for a dimethylsulfoniopropionate lyase, demethylase and the trimethylamine methyltransferase (mttB) as well as genes for nitrate, nitrite and dimethyl sulfoxide reduction. This indicates that Shimia str. SK013 is able to switch from aerobic to anaerobic metabolism and thus is capable of aerobic and anaerobic sulfur cycling at the seafloor. Among the ability to convert other sulfur compounds it has the genetic capacity to produce climatically active dimethyl sulfide. Growth on glutamate as a sole carbon source results in formation of cell-connecting filaments, a putative phenotypic adaptation of the surface-associated strain to the environmental conditions at the seafloor. Genome analysis revealed the presence of a flagellum (fla1) and a type IV pilus biogenesis, which is speculated to be a prerequisite for biofilm formation. This is also related to genes responsible for signalling such as N-acyl homoserine lactones, as well as quip-genes responsible for quorum quenching and antibiotic biosynthesis. Pairwise similarities of 16S rRNA genes (98.56 % sequence similarity to the next relative S. haliotis) and the in silico DNA-DNA hybridization (21.20 % sequence similarity to S. haliotis) indicated Shimia str. SK013 to be considered as a new species. In conclusion, the genome analysis of Shimia str. SK013 offered first insights into specific physiological and phenotypic adaptation mechanisms of Roseobacter-affiliated bacteria to the

  12. TU-CD-BRB-07: Identification of Associations Between Radiologist-Annotated Imaging Features and Genomic Alterations in Breast Invasive Carcinoma, a TCGA Phenotype Research Group Study

    SciTech Connect

    Rao, A; Net, J; Brandt, K; Huang, E; Freymann, J; Kirby, J; Burnside, E; Morris, E; Sutton, E; Bonaccio, E; Giger, M; Jaffe, C; Ganott, M; Zuley, M; Le-Petross, H; Dogan, B; Whitman, G

    2015-06-15

    Purpose: To determine associations between radiologist-annotated MRI features and genomic measurements in breast invasive carcinoma (BRCA) from the Cancer Genome Atlas (TCGA). Methods: 98 TCGA patients with BRCA were assessed by a panel of radiologists (TCGA Breast Phenotype Research Group) based on a variety of mass and non-mass features according to the Breast Imaging Reporting and Data System (BI-RADS). Batch corrected gene expression data was obtained from the TCGA Data Portal. The Kruskal-Wallis test was used to assess correlations between categorical image features and tumor-derived genomic features (such as gene pathway activity, copy number and mutation characteristics). Image-derived features were also correlated with estrogen receptor (ER), progesterone receptor (PR), and human epidermal growth factor receptor 2 (HER2/neu) status. Multiple hypothesis correction was done using Benjamini-Hochberg FDR. Associations at an FDR of 0.1 were selected for interpretation. Results: ER status was associated with rim enhancement and peritumoral edema. PR status was associated with internal enhancement. Several components of the PI3K/Akt pathway were associated with rim enhancement as well as heterogeneity. In addition, several components of cell cycle regulation and cell division were associated with imaging characteristics.TP53 and GATA3 mutations were associated with lesion size. MRI features associated with TP53 mutation status were rim enhancement and peritumoral edema. Rim enhancement was associated with activity of RB1, PIK3R1, MAP3K1, AKT1,PI3K, and PIK3CA. Margin status was associated with HIF1A/ARNT, Ras/ GTP/PI3K, KRAS, and GADD45A. Axillary lymphadenopathy was associated with RB1 and BCL2L1. Peritumoral edema was associated with Aurora A/GADD45A, BCL2L1, CCNE1, and FOXA1. Heterogeneous internal nonmass enhancement was associated with EGFR, PI3K, AKT1, HF/MET, and EGFR/Erbb4/neuregulin 1. Diffuse nonmass enhancement was associated with HGF/MET/MUC20/SHIP

  13. Genomic characterization, phylogenetic comparison and differential expression of the cyclic nucleotide-gated channels gene family in pear (Pyrus bretchneideri Rehd.).

    PubMed

    Chen, Jianqing; Yin, Hao; Gu, Jinping; Li, Leiting; Liu, Zhe; Jiang, Xueting; Zhou, Hongsheng; Wei, Shuwei; Zhang, Shaoling; Wu, Juyou

    2015-01-01

    The cyclic nucleotide-gated channel (CNGC) family is involved in the uptake of various cations, such as Ca(2+), to regulate plant growth and respond to biotic and abiotic stresses. However, there is far less information about this family in woody plants such as pear. Here, we provided a genome-wide identification and analysis of the CNGC gene family in pear. Phylogenetic analysis showed that the 21 pear CNGC genes could be divided into five groups (I, II, III, IVA and IVB). The majority of gene duplications in pear appeared to have been caused by segmental duplication and occurred 32.94-39.14 million years ago. Evolutionary analysis showed that positive selection had driven the evolution of pear CNGCs. Motif analyses showed that Group I CNGCs generally contained 26 motifs, which was the greatest number of motifs in all CNGC groups. Among these, eight motifs were shared by each group, suggesting that these domains play a conservative role in CNGC activity. Tissue-specific expression analysis indicated that functional diversification of the duplicated CNGC genes was a major feature of long-term evolution. Our results also suggested that the P-S6 and PBC & hinge domains had co-evolved during the evolution. These results provide valuable information to increase our understanding of the function, evolution and expression analyses of the CNGC gene family in higher plants.

  14. The Future of Microbial Genomics

    SciTech Connect

    Kyrpides, Nikos

    2010-06-02

    Nikos Kyrpides, head of the Genome Biology group at the DOE Joint Genome Institute discusses current challenges in the field of microbial genomics on June 2, 2010 at the "Sequencing, Finishing, Analysis in the Future" meeting in Santa Fe, NM

  15. Ecological and genetic analyses of the complete genomes of Culex flavivirus strains isolated from Culex tritaeniorhynchus and Culex pipiens (Diptera: Culicidae) group mosquitoes.

    PubMed

    Obara-Nagoya, M; Yamauchi, T; Watanabe, M; Hasegawa, S; Iwai-Itamochi, M; Horimoto, E; Takizawa, T; Takashima, I; Kariwa, H

    2013-03-01

    Culex flavivirus (CxFV) is an insect-specific flavivirus that was first reported in 2007 in Japan. CxFV strains were isolated from Culex tritaeniorhynchus Giles and Culex pipiens L. group mosquitoes and genetically characterized in Toyama Prefecture, Japan, from 2004 to 2009, to reveal host specificity, mode of transmission, and seasonal and geographical distribution. The minimum infection rate (MIR) of CxFV within Cx. tritaeniorhynchus populations was 0.3 and much lower than that within Cx. pipiens group (17.9). The complete genome sequences of 11 CxFV isolates (four from Cx. tritaeniorhynchus and seven from Cx. pipiens group) consisted of 10,835-10,837 nucleotides. When these 11 isolates and five reference strains (NIID-21-2 and Tokyo strains from Japan, Iowa07 and HOU24518 strains from the United States, H0901 strain from China) were compared, there were 95.2-99.2% nucleotide and 98.1-99.8% amino acid identities. Phylogenetic analysis showed that the 11 isolates were divided into four clusters. One cluster consisted of five isolates from Cx. pipiens group and Cx. tritaeniorhynchus from one site and their nucleotide sequences almost completely matched. One cluster consisted of an isolate with a unique sequence from a Cx. pipiens group mosquito captured in an aircraft from Taiwan, suggesting that it was introduced from abroad. CxFV strains were divided into several groups according to countries when nucleotide sequences of CxFV available in GenBank and 11 Toyama isolates were compared. These results suggest that CxFV is maintained in nature among Culex mosquitoes in a mosquito habitat-specific but not a species-specific manner.

  16. Complete mitochondrial genome of Blue-crowned Parakeet (Aratinga acuticaudata)--phylogenetic position of the species among parrots group called Conures.

    PubMed

    Urantowka, Adam Dawid; Grabowski, Krzysztof Aleksander; Strzała, Tomasz

    2013-08-01

    Blue-crowned Parakeet (Aratinga acuticaudata) is a South American parrot species with a taxonomic position not confirmed by molecular studies. We sequenced full mitochondrial genome and constructed phylogenetic tree using sequences of mitochondrial ND2 gene from A. acuticaudata and some other representatives of Conures group. Our results confirmed previously described distribution of Aratinga species into three clades, but surprisingly did not classify Blue-crowned Parakeet to any of them. We found that A. acuticaudata shares the closest relationship with Diopsittaca nobilis and forms a separate clade together with Guaruba guarouba and Leptosittaca branickii species with a significant node. Our results confirm lack of monophyly of the genus Aratinga and underline the need of its taxonomic revision.

  17. Complete Genome Sequence of Pelosinus fermentans JBW45, a Member of a Remarkably Competitive Group of Negativicutes in the Firmicutes Phylum

    DOE PAGES

    De León, Kara B.; Utturkar, Sagar M.; Camilleri, Laura B.; ...

    2015-09-24

    The genome of Pelosinus fermentans JBW45, isolated from a chromium-contaminated site in Hanford, Washington, USA, has been completed with PacBio sequencing. Finally, nine copies of the rRNA gene operon and multiple transposase genes with identical sequences resulted in breaks in the original draft genome and may suggest genomic instability of JBW45.

  18. Comparative genomics of Lactobacillus

    PubMed Central

    Kant, Ravi; Blom, Jochen; Palva, Airi; Siezen, Roland J.; de Vos, Willem M.

    2011-01-01

    Summary The genus Lactobacillus includes a diverse group of bacteria consisting of many species that are associated with fermentations of plants, meat or milk. In addition, various lactobacilli are natural inhabitants of the intestinal tract of humans and other animals. Finally, several Lactobacillus strains are marketed as probiotics as their consumption can confer a health benefit to host. Presently, 154 Lactobacillus species are known and a growing fraction of these are subject to draft genome sequencing. However, complete genome sequences are needed to provide a platform for detailed genomic comparisons. Therefore, we selected a total of 20 genomes of various Lactobacillus strains for which complete genomic sequences have been reported. These genomes had sizes varying from 1.8 to 3.3 Mb and other characteristic features, such as G+C content that ranged from 33% to 51%. The Lactobacillus pan genome was found to consist of approximately 14 000 protein‐encoding genes while all 20 genomes shared a total of 383 sets of orthologous genes that defined the Lactobacillus core genome (LCG). Based on advanced phylogeny of the proteins encoded by this LCG, we grouped the 20 strains into three main groups and defined core group genes present in all genomes of a single group, signature group genes shared in all genomes of one group but absent in all other Lactobacillus genomes, and Group‐specific ORFans present in core group genes of one group and absent in all other complete genomes. The latter are of specific value in defining the different groups of genomes. The study provides a platform for present individual comparisons as well as future analysis of new Lactobacillus genomes. PMID:21375712

  19. National Plant Genome Initiative

    DTIC Science & Technology

    2005-01-01

    JAN 2005 2. REPORT TYPE 3. DATES COVERED 00-00-2005 to 00-00-2005 4. TITLE AND SUBTITLE National Plant Genome Initiative. Progress Report 5a...refl ected in future Administration budgets. Cover Photo: National Plant Genome Initiative Progress Report January 2005 National Science and...Technology Council Committee on Science Interagency Working Group on Plant Genomes [Blank Page] Interagency Working Group on Plant Genomes Committee on

  20. Making sense of genetic risk: A qualitative focus-group study of healthy participants in genomic research.

    PubMed

    Viberg Johansson, Jennifer; Segerdahl, Pär; Ugander, Ulrika Hösterey; Hansson, Mats G; Langenskiöld, Sophie

    2017-09-18

    It is well known that research participants want to receive genetic risk information that is about high risks, serious diseases and potential preventive measures. The aim of this study was to explore, by qualitative means, something less well known: how do healthy research participants themselves make sense of genetic risk information? A phenomenographic approach was chosen to explore research participants' understanding and assessment of genetic risk. We conducted four focus-group (N=16) interviews with participants in a research programme designed to identify biomarkers for cardiopulmonary disease. Among the research participants, we found four ways of understanding genetic risk: as a binary concept, as an explanation, as revealing who I am (knowledge of oneself) and as affecting life ahead. Research participants tend to understand genetic risk as a binary concept. This does not necessarily imply a misunderstanding of, or an irrational approach to, genetic risk. Rather, it may have a heuristic function in decision-making. Risk communication may be enhanced by tailoring the communication to the participants' own lay conceptions. For example, researchers and counselors should address risk in binary terms, maybe looking out for how individual participants search for threshold figures. Copyright © 2017 Elsevier B.V. All rights reserved.

  1. Whole genomic analyses of equine group A rotaviruses from Japan: evidence for bovine-to-equine interspecies transmission and reassortment events.

    PubMed

    Ghosh, Souvik; Taniguchi, Koki; Aida, Satoru; Ganesh, Balasubramanian; Kobayashi, Nobumichi

    2013-10-25

    Equine group A rotaviruses (RVA) are a major cause of severe diarrhea in foals. The whole genomes of only six common and three unusual equine RVA strains have been analyzed so far. To date, there are no reports on whole genomic analyses of equine RVAs from Asian countries. We report here the whole genomic analyses of three common (strains RVA/Horse-tc/JPN/BI/1981/G3P[12], RVA/Horse-tc/JPN/HH-22/1989/G3P[12] and RVA/Horse-tc/JPN/CH-3/1987/G14P[12]) and an unusual (RVA/Horse-tc/JPN/OH-4/1982/G6P[5]) equine RVA strains isolated from diarrheic foals in Japan. Strains BI, HH-22 and CH-3 shared a largely conserved genotype constellation (G3/G14-P[12]-I2/I6-R2-C2-M3-A10-N2-T3-E2-H7) with each other and with those of common equine RVAs from other continents. Phylogenetically, most of the genes of BI, HH-22 and CH-3 were closely related to those of other common equine RVAs. On the other hand, the NSP2 genes of BI and CH-3 formed a distinct lineage, and were distantly related to the other, major equine RVA cluster within the NSP2-N2 genotype. The NSP4 gene of HH-22 appeared to originate from possible reassortment events involving common equine RVAs and co-circulating bovine or bovine-like equine RVAs, revealing the presence of a bovine RVA-like NSP4 gene on a typical equine RVA genetic backbone. All the 11 gene segments of the unusual equine RVA strain OH-4 were found to be more closely related to those of bovine and bovine-like human RVAs than to those of other RVAs, providing the first conclusive evidence for artiodactyl(likely bovine)-to-equine interspecies transmission events. Taken together, these observations provided important insights into the genetic diversity of equine RVAs.

  2. Genome-wide association study of peripheral neuropathy with D-drug-containing regimens in AIDS Clinical Trials Group protocol 384

    PubMed Central

    Leger, Paul D.; Johnson, Daniel H.; Robbins, Gregory K.; Shafer, Robert W.; Clifford, David B.; Li, Jun; McLaren, Paul J.; Haas, David W.

    2014-01-01

    Stavudine (d4T) was, until recently, one of the most widely prescribed antiretroviral drugs worldwide. While there has been a major shift away from d4T use in resource-limited countries, a large number of patients have previously received (or continue to receive) d4T, and many have developed peripheral neuropathy. The identification of genetic predictors of increased risk might suggest novel therapeutic targets for such patients. In AIDS Clinical Trials Group protocol 384, antiretroviral-naïve patients were randomized to d4T/didanosine (ddI)- or zidovudine/lamivudine-containing regimens. Data from d4T/ddI recipients were analyzed for genome-wide associations (approximately 1 million genetic loci) with new onset distal sensory peripheral neuropathy. Analyses involved 254 patients (49 % White, 34 % Black, 17 % Hispanic), comprising 90 peripheral neuropathy cases (32 grade 1, 35 grade 2, 23 grade 3) and 164 controls. After correcting for multiple comparisons, no polymorphism was consistently associated with neuropathy among all patients, among White, Black, and Hispanic patients analyzed separately, both in genome-wide analyses (threshold, P<5.0×10−8) and focused on 46 neuropathy-associated genes (threshold, P<3.5×10−5). In the latter analyses, the lowest P values were in KIF1A among Whites (rs10199388, P=8.4×10−4), in LITAF among Blacks (rs13333308, P=6.0×10−6), and in NEFL among Hispanics (rs17763685, P=5.6×10−6). Susceptibility to d4T/ddI-associated neuropathy is not explained by a single genetic variant with a marked effect. PMID:24554482

  3. Whole-genome sequence analysis of G3 and G14 equine group A rotaviruses isolated in the late 1990s and 2009-2010.

    PubMed

    Nemoto, Manabu; Nagai, Makoto; Tsunemitsu, Hiroshi; Omatsu, Tsutomu; Furuya, Tetsuya; Shirai, Junsuke; Kondo, Takashi; Fujii, Yoshiki; Todaka, Reiko; Katayama, Kazuhiko; Mizutani, Tetsuya

    2015-05-01

    Equine group A rotavirus (RVA) G3P[12] and G14P[12] strains cause gastroenteritis in foals worldwide. Both of these strains have been co-circulating in Japan since G14P[12] strains emerged in the late 1990s. Although it is important to comprehensively understand the evolution of RVA strains, whole-genome sequence data on recent equine RVA strains in Japan are lacking. Therefore, in this study, whole-genome analysis of 23 equine RVA isolates from the late 1990s and 2009-2010 and the vaccine strain RVA/Horse-tc/JPN/HO-5/1982/G3P[12] (HO-5) was performed. The G3 strains, including strain HO-5, shared a G3-P[12]-I6-R2-C2-M3-A10-N2-T3-E2-H7 genotype constellation, and all of their 11 gene segments were highly conserved, regardless of the year of isolation. G14 strains also exhibited an identical genotype constellation (G14-P[12]-I2-R2-C2-M3-A10-N2-T3-E2-H7), but, phylogenetically, segregated into two lineages within the VP7-G14 and NSP4-E2 genotypes. G14 strains were closely related to G3 strains in their VP4, VP1-3, NSP1-3 and NSP5 gene segments. Interestingly, the NSP4 gene of all G3 and G14 strains isolated in the late 1990s branched into a bovine-RVA-like NSP4 gene cluster. These results indicate that, apart from VP7, VP6, and NSP4 genes, the Japanese equine RVA strains share a highly conserved genetic backbone, and that strains possessing a bovine-RVA-like NSP4 gene were predominant in the late 1990s in Japan.

  4. Genomics:GTL Contractor-Grantee Workshop IV and Metabolic Engineering Working Group Inter-Agency Conference on Metabolic Engineering 2006

    SciTech Connect

    Mansfield, Betty Kay; Martin, Sheryl A

    2006-02-01

    Welcome to the 2006 joint meeting of the fourth Genomics:GTL Contractor-Grantee Workshop and the six Metabolic Engineering Working Group Inter-Agency Conference. The vision and scope of the Genomics:GTL program continue to expand and encompass research and technology issues from diverse scientific disciplines, attracting broad interest and support from researchers at universities, DOE national laboratories, and industry. Metabolic engineering's vision is the targeted and purposeful alteration of metabolic pathways to improve the understanding and use of cellular pathways for chemical transformation, energy transduction, and supramolecular assembly. These two programs have much complementarity in both vision and technological approaches, as reflected in this joint workshop. GLT's challenge to the scientific community remains the further development and use of a broad array of innovative technologies and computational tools to systematically leverage the knowledge and capabilities brought to us by DNA sequencing projects. The goal is to seek a broad and predictive understanding of the functioning and control of complex systems--individual microbes, microbial communities, and plants. GTL's prominent position at the interface of the physical, computational, and biological sciences is both a strength and challenge. Microbes remain GTL's principal biological focus. In the complex 'simplicity' of microbes, they find capabilities needed by DOE and the nation for clean and secure energy, cleanup of environmental contamination, and sequestration of atmospheric carbon dioxide that contributes to global warming. An ongoing challenge for the entire GTL community is to demonstrate that the fundamental science conducted in each of your research projects brings us a step closer to biology-based solutions for these important national energy and environmental needs.

  5. Molecular classification of gliomas based on whole genome gene expression: a systematic report of 225 samples from the Chinese Glioma Cooperative Group.

    PubMed

    Yan, Wei; Zhang, Wei; You, Gan; Zhang, Junxia; Han, Lei; Bao, Zhaoshi; Wang, Yongzhi; Liu, Yanwei; Jiang, Chuanlu; Kang, Chunsheng; You, Yongping; Jiang, Tao

    2012-12-01

    Defining glioma subtypes based on objective genetic and molecular signatures may allow for a more rational, patient-specific approach to molecularly targeted therapy. However, prior studies attempting to classify glioma subtypes have given conflicting results. We aim to complement and validate the existing molecular classification system on a large number of samples from an East Asian population. A total of 225 samples from Chinese patients was selected for whole genome gene expression profiling. Consensus clustering was applied. Three major groups of gliomas were identified (referred to as G1, G2, and G3). The G1 subgroup correlates with a good clinical outcome, young age, and extremely high frequency of IDH1 mutations. Relative to the G1 subgroup, the G3 subgroup is correlated with a poorer clinical outcome, older age, and a very low rate of mutations in the IDH1 gene. Correlations of the G2 subgroup with respect to clinical outcome, age, and IDH1 mutation fall between the G1 and G3 subgroups. In addition, the G2 subtype was associated with a higher percentage of loss of 1p/19q when compared with G1 and G3 subtypes. Furthermore, our classification scheme was validated on 2 independent datasets derived from the cancer genome atlas (TCGA) and Rembrandt. With use of the TCGA classification system, proneural, neural, and mesenchymal, but not classical subtype, associated gene signatures were clearly defined. In summary, our results reveal that 3 main subtypes stably exist in Chinese patients with glioma. Our classification scheme may reflect the clinical and genetic alterations more clearly. Classical subtype-associated gene signature was not found in our dataset.

  6. Round and pointed-head grenadier fishes (Actinopterygii: Gadiformes) represent a single sister group: evidence from the complete mitochondrial genome sequences.

    PubMed

    Satoh, Takashi P; Miya, Masaki; Endo, Hiromitsu; Nishida, Mutsumi

    2006-07-01

    The gene order of mitochondrial genomes (mitogenomes) has been employed as a useful phylogenetic marker in various metazoan animals, because it may represent uniquely derived characters shared by members of monophyletic groups. During the course of molecular phylogenetic studies of the order Gadiformes (cods and their relatives) based on whole mitogenome sequences, we found that two deep-sea grenadiers (Squalogadus modificatus and Trachyrincus murrayi: family Macrouridae) revealed a unusually identical gene order (translocation of the tRNA(Leu (UUR))). Both are members of the same family, although their external morphologies differed so greatly (e.g., round vs. pointed head) that they have been placed in different subfamilies Macrouroidinae and Trachyrincinae, respectively. Additionally, we determined the whole mitogenome sequences of two other species, Bathygadus antrodes and Ventrifossa garmani, representing a total of four subfamilies currently recognized within Macrouridae. The latter two species also exhibited gene rearrangements, resulting in a total of three different patterns of unique gene order being observed in the four subfamilies. Partitioned Bayesian analysis was conducted using available whole mitogenome sequences from five macrourids plus five outgroups. The resultant trees clearly indicated that S. modificatus and T. murrayi formed a monophyletic group, having a sister relationship to other macrourids. Thus, monophyly of the two species with disparate head morphologies was corroborated by two different lines of evidence (nucleotide sequences and gene order). The overall topology of the present tree differed from any of the previously proposed, morphology-based phylogenetic hypotheses.

  7. Functional Genomics Group. Program Description

    DTIC Science & Technology

    2008-02-01

    s.expected.to.mpact ..Gene.expresson.research. by.mcroarray.s.a.prmary.component.of.bomarker.ds- covery.because.t.s.hgh.throughput,. scann ...currently. beng. ntegrated. nto. drug . development. decson.makng.and.clncal.practce .”.health.care.prog- nostcators.foresee.a.day.when.an.ndv

  8. Concordance of copy number alterations using a common analytic pipeline for genome-wide analysis of Illumina and Affymetrix genotyping data: a report from the Children's Oncology Group.

    PubMed

    Vujkovic, Marijana; Attiyeh, Edward F; Ries, Rhonda E; Horn, Michelle; Goodman, Elizabeth K; Ding, Yang; Kavcic, Marko; Alonzo, Todd A; Gerbing, Robert B; Hirsch, Betsy; Raimondi, Susana; Gamis, Alan S; Meshinchi, Soheil; Aplenc, Richard

    2015-01-01

    Copy number alterations (CNAs) are a hallmark of pediatric cancer genomes. An increasing number of research groups use multiple platforms and software packages to detect and analyze CNAs. However, different platforms have experimental and analysis-specific biases that may yield different results. We sought to estimate the concordance of CNAs in children with de novo acute myeloid leukemia between two experimental platforms: Affymetrix SNP 6.0 array and Illumina OmniQuad 2.5 BeadChip. Forty-five paired tumor-remission samples were genotyped on both platforms, and CNAs were estimated from total signal intensity and allelic contrast values using the allele-specific copy number analysis of tumors (ASCAT) algorithm. The two platforms were comparable in detection of CNAs, each missing only two segments from a total of 42 CNAs (4.6%). Overall, there was an interplatform agreement of 96% for allele-specific tumor profiles. However, poor quality samples with low signal/noise ratios showed a high rate of false-positive segments independent of the genotyping platform. These results demonstrate that a common analytic pipeline can be utilized for SNP array data from these two platforms. The customized programming template for the preprocessing, data integration, and analysis is publicly available at https://github.com/AplenCHOP/affyLumCNA. Published by Elsevier Inc.

  9. A taxonomic framework for emerging groups of ecologically important marine gammaproteobacteria based on the reconstruction of evolutionary relationships using genome-scale data

    PubMed Central

    Spring, Stefan; Scheuner, Carmen; Göker, Markus; Klenk, Hans-Peter

    2015-01-01

    In recent years a large number of isolates were obtained from saline environments that are phylogenetically related to distinct clades of oligotrophic marine gammaproteobacteria, which were originally identified in seawater samples using cultivation independent methods and are characterized by high seasonal abundances in coastal environments. To date a sound taxonomic framework for the classification of these ecologically important isolates and related species in accordance with their evolutionary relationships is missing. In this study we demonstrate that a reliable allocation of members of the oligotrophic marine gammaproteobacteria (OMG) group and related species to higher taxonomic ranks is possible by phylogenetic analyses of whole proteomes but also of the RNA polymerase beta subunit, whereas phylogenetic reconstructions based on 16S rRNA genes alone resulted in unstable tree topologies with only insignificant bootstrap support. The identified clades could be correlated with distinct phenotypic traits illustrating an adaptation to common environmental factors in their evolutionary history. Genome wide gene-content analyses revealed the existence of two distinct ecological guilds within the analyzed lineage of marine gammaproteobacteria which can be distinguished by their trophic strategies. Based on our results a novel order within the class Gammaproteobacteria is proposed, which is designated Cellvibrionales ord. nov. and comprises the five novel families Cellvibrionaceae fam. nov., Halieaceae fam. nov., Microbulbiferaceae fam. nov., Porticoccaceae fam. nov., and Spongiibacteraceae fam. nov. PMID:25914684

  10. Improved immunogenicity of a H44/76 group B outer membrane vesicle vaccine with over-expressed genome-derived Neisserial antigen 1870.

    PubMed

    Koeberling, Oliver; Welsch, Jo Anne; Granoff, Dan M

    2007-02-26

    A broadly protective vaccine against meningococcal group B disease is not available. We previously reported that an outer membrane vesicle (OMV) vaccine containing over-expressed genome-derived antigen (GNA) 1870 elicited broader protective antibody responses than recombinant GNA1870 or conventional OMV vaccines prepared from a strain that naturally expresses low amounts of GNA1870. Certain wildtype strains such as H44/76 naturally express larger amounts of GNA1870 and, potentially, could be used to prepare an improved OMV vaccine without genetic over-expression of the antigen. We transformed H44/76 with a shuttle vector to over-express variant 1 (v.1) GNA1870 and compared the immunogenicity in mice of OMV vaccines prepared from wildtype H44/76 (v.1), the mutant, and a recombinant v.1 GNA1870 vaccine. Mice immunized with OMV with over-expressed GNA1870 developed broader serum bactericidal and/or greater C3 deposition activity on the surface of encapsulated strains of N. meningitidis than control mice immunized with the OMV vaccine prepared from the wildtype strain, or the rGNA1870 vaccine. When a panel of group B strains from patients in California was tested, sera from mice immunized with the OMV vaccine containing over-expressed GNA1870 were bactericidal against 100% of the v.1 strains. In contrast, only 20% of isolates that expressed subvariants of the v.1 GNA1870 protein were susceptible to bactericidal activity of antibodies elicited by the rGNA1870 or conventional OMV vaccines. Thus, even a modest increase in GNA1870 expression in a strain that naturally is a high producer of GNA1870 results in an OMV vaccine that elicits broader protection against meningococcal disease.

  11. Whole genomic analysis of bovine group A rotavirus strains A5-10 and A5-13 provides evidence for close evolutionary relationship with human rotaviruses.

    PubMed

    Komoto, Satoshi; Pongsuwanna, Yaowapa; Tacharoenmuang, Ratana; Guntapong, Ratigorn; Ide, Tomihiko; Higo-Moriguchi, Kyoko; Tsuji, Takao; Yoshikawa, Tetsushi; Taniguchi, Koki

    2016-11-15

    Bovine group A rotavirus (RVA) is an important cause of acute diarrhea in calves worldwide. In order to obtain precise information on the origin and evolutionary dynamics of bovine RVA strains, we determined and analyzed the complete nucleotide sequences of the whole genomes of six archival bovine RVA strains; four Thai strains (RVA/Cow-tc/THA/A5-10/1988/G8P[1], RVA/Cow-tc/THA/A5-13/1988/G8P[1], RVA/Cow-tc/THA/61A/1989/G10P[5], and RVA/Cow-tc/THA/A44/1989/G10P[11]), one American strain (RVA/Cow-tc/USA/B223/1983/G10P[11]), and one Japanese strain (RVA/Cow-tc/JPN/KK3/1983/G10P[11]). On whole genomic analysis, the 11 gene segments of strains A5-10, A5-13, 61A, A44, B223, and KK3 were found to be considerably genetically diverse, but to share a conserved non-G/P genotype constellation except for the NSP1 gene (I2-R2-C2-M2-(A3/11/13/14)-N2-T6-E2-H3), which is commonly found in RVA strains from artiodactyls such as cattle. Furthermore, phylogenetic analysis revealed that most genes of the six strains were genetically related to bovine and bovine-like strains. Of note is that the VP1, VP3, and NSP2 genes of strains A5-10 and A5-13 exhibited a closer relationship with the cognate genes of human DS-1-like strains than those of other RVA strains. Furthermore, the VP6 genes of strains A5-10 and A5-13 appeared to be equally related to both human DS-1-like and bovine strains. Thus, strains A5-10 and A5-13 were suggested to be derived from the same evolutionary origin as human DS-1-like strains, and were assumed to be examples of bovine RVA strains that provide direct evidence for a close evolutionary relationship between bovine and human DS-1-like strains. Our findings will provide important insights into the origin of bovine RVA strains, and into evolutionary links between bovine and human RVA strains.

  12. Genome sequence of a chimpanzee herpesvirus and its relation to other primate alphaherpesviruses.

    PubMed

    Severini, Alberto; Tyler, Shaun D; Peters, Geoffrey A; Black, Darla; Eberle, R

    2013-08-01

    This study reports the complete genome sequence of chimpanzee herpesvirus (ChHV), an alphaherpesvirus isolated from a chimpanzee. Although closely related to human herpes simplex virus type 2 (HSV2), the level of sequence diversity confirms that ChHV is sufficiently distinct to be considered a member of a different virus species rather than a variant strain of HSV2. Phylogenetic comparison with other simplexviruses at several levels supports the hypothesis that HSV2 and ChHV co-evolved with their respective human and chimpanzee hosts and raises questions regarding the evolutionary origins of HSV1.

  13. Genomic analysis reveals that immune function genes are strongly linked to clinical outcome in the North Central Cancer Treatment Group n9831 Adjuvant Trastuzumab Trial.

    PubMed

    Perez, Edith A; Thompson, E Aubrey; Ballman, Karla V; Anderson, S Keith; Asmann, Yan W; Kalari, Krishna R; Eckel-Passow, Jeanette E; Dueck, Amylou C; Tenner, Kathleen S; Jen, Jin; Fan, Jian-Bing; Geiger, Xochiquetzal J; McCullough, Ann E; Chen, Beiyun; Jenkins, Robert B; Sledge, George W; Winer, Eric P; Gralow, Julie R; Reinholz, Monica M

    2015-03-01

    To develop a genomic signature that predicts benefit from trastuzumab in human epidermal growth factor receptor 2-positive breast cancer. DASL technology was used to quantify mRNA in samples from 1,282 patients enrolled onto the Combination Chemotherapy With or Without Trastuzumab in Treating Women With Breast Cancer (North Central Cancer Treatment Group N9831 [NCCTG-N9831]) adjuvant trastuzumab trial. Cox proportional hazard ratios (HRs), adjusted for significant clinicopathologic risk factors, were used to determine the association of each gene with relapse-free survival (RFS) for 433 patients who received chemotherapy alone (arm A) and 849 patients who received chemotherapy plus trastuzumab (arms B and C). Network and pathway analyses were used to identify key biologic processes linked to RFS. The signature was built by using a voting scheme. Network and functional ontology analyses suggested that increased RFS was linked to a subset of immune function genes. A voting scheme model was used to define immune gene enrichment based on the expression of any nine or more of 14 immune function genes at or above the 0.40 quantile for the population. This model was used to identify immune gene-enriched tumors in arm A and arms B and C. Immune gene enrichment was linked to increased RFS in arms B and C (HR, 0.35; 95% CI, 0.22 to 0.55; P < .001), whereas arm B and C patients who did not exhibit immune gene enrichment did not benefit from trastuzumab (HR, 0.89; 95% CI, 0.62 to 1.28; P = .53). Enriched immune function gene expression as defined by our predictive signature was not associated with increased RFS in arm A (HR, 0.90; 95% CI, 0.60 to 1.37; P = .64). Increased expression of a subset of immune function genes may provide a means of predicting benefit from adjuvant trastuzumab. © 2015 by American Society of Clinical Oncology.

  14. Genome-Wide Association Study Identifies That the ABO Blood Group System Influences Interleukin-10 Levels and the Risk of Clinical Events in Patients with Acute Coronary Syndrome

    PubMed Central

    Johansson, Åsa; Alfredsson, Jenny; Eriksson, Niclas; Wallentin, Lars; Siegbahn, Agneta

    2015-01-01

    Introduction Acute coronary syndrome (ACS) is a major cause of mortality worldwide. We have previously shown that increased interleukin-10 (IL-10) levels are associated with poor outcome in ACS patients. Method We performed a genome-wide association study in 2864 ACS patients and 408 healthy controls, to identify genetic variants associated with IL-10 levels. Then haplotype analyses of the identified loci were done and comparisons to levels of IL-10 and other known ACS related biomarkers. Results Genetic variants at the ABO blood group locus associated with IL-10 levels (top SNP: rs676457, P = 4.4 × 10−10) were identified in the ACS patients. Haplotype analysis, using SNPs tagging the four main ABO antigens (A1, A2, B and O), showed that O and A2 homozygous individuals, or O/A2 heterozygotes have much higher levels of IL-10 compared to individuals with other antigen combinations. In the ACS patients, associations between ABO antigens and von Willebrand factor (VWF, P = 9.2 × 10−13), and soluble tissue factor (sTF, P = 8.6 × 10−4) were also found. In the healthy control cohort, the associations with VWF and sTF were similar to those in ACS patients (P = 1.2 × 10−15 and P = 1.0 × 10−5 respectively), but the healthy cohort showed no association with IL-10 levels (P>0.05). In the ACS patients, the O antigen was also associated with an increased risk of cardiovascular death, all causes of death, and recurrent myocardial infarction (odds ratio [OR] = 1.24–1.29, P = 0.029–0.00067). Conclusion Our results suggest that the ABO antigens play important roles, not only for the immunological response in ACS patients, but also for the outcome of the disease. PMID:26600159

  15. Genomic Analysis Reveals That Immune Function Genes Are Strongly Linked to Clinical Outcome in the North Central Cancer Treatment Group N9831 Adjuvant Trastuzumab Trial

    PubMed Central

    Perez, Edith A.; Thompson, E. Aubrey; Ballman, Karla V.; Anderson, S. Keith; Asmann, Yan W.; Kalari, Krishna R.; Eckel-Passow, Jeanette E.; Dueck, Amylou C.; Tenner, Kathleen S.; Jen, Jin; Fan, Jian-Bing; Geiger, Xochiquetzal J.; McCullough, Ann E.; Chen, Beiyun; Jenkins, Robert B.; Sledge, George W.; Winer, Eric P.; Gralow, Julie R.; Reinholz, Monica M.

    2015-01-01

    Purpose To develop a genomic signature that predicts benefit from trastuzumab in human epidermal growth factor receptor 2–positive breast cancer. Patients and Methods DASL technology was used to quantify mRNA in samples from 1,282 patients enrolled onto the Combination Chemotherapy With or Without Trastuzumab in Treating Women With Breast Cancer (North Central Cancer Treatment Group N9831 [NCCTG-N9831]) adjuvant trastuzumab trial. Cox proportional hazard ratios (HRs), adjusted for significant clinicopathologic risk factors, were used to determine the association of each gene with relapse-free survival (RFS) for 433 patients who received chemotherapy alone (arm A) and 849 patients who received chemotherapy plus trastuzumab (arms B and C). Network and pathway analyses were used to identify key biologic processes linked to RFS. The signature was built by using a voting scheme. Results Network and functional ontology analyses suggested that increased RFS was linked to a subset of immune function genes. A voting scheme model was used to define immune gene enrichment based on the expression of any nine or more of 14 immune function genes at or above the 0.40 quantile for the population. This model was used to identify immune gene–enriched tumors in arm A and arms B and C. Immune gene enrichment was linked to increased RFS in arms B and C (HR, 0.35; 95% CI, 0.22 to 0.55; P < .001), whereas arm B and C patients who did not exhibit immune gene enrichment did not benefit from trastuzumab (HR, 0.89; 95% CI, 0.62 to 1.28; P = .53). Enriched immune function gene expression as defined by our predictive signature was not associated with increased RFS in arm A (HR, 0.90; 95% CI, 0.60 to 1.37; P = .64). Conclusion Increased expression of a subset of immune function genes may provide a means of predicting benefit from adjuvant trastuzumab. PMID:25605861

  16. Microbial genomic taxonomy

    PubMed Central

    2013-01-01

    A need for a genomic species definition is emerging from several independent studies worldwide. In this commentary paper, we discuss recent studies on the genomic taxonomy of diverse microbial groups and a unified species definition based on genomics. Accordingly, strains from the same microbial species share >95% Average Amino Acid Identity (AAI) and Average Nucleotide Identity (ANI), >95% identity based on multiple alignment genes, <10 in Karlin genomic signature, and > 70% in silico Genome-to-Genome Hybridization similarity (GGDH). Species of the same genus will form monophyletic groups on the basis of 16S rRNA gene sequences, Multilocus Sequence Analysis (MLSA) and supertree analysis. In addition to the established requirements for species descriptions, we propose that new taxa descriptions should also include at least a draft genome sequence of the type strain in order to obtain a clear outlook on the genomic landscape of the novel microbe. The application of the new genomic species definition put forward here will allow researchers to use genome sequences to define simultaneously coherent phenotypic and genomic groups. PMID:24365132

  17. Identification of a gene for an ancient cytokine, interleukin 15-like, in mammals; interleukins 2 and 15 co-evolved with this third family member, all sharing binding motifs for IL-15Rα.

    PubMed

    Dijkstra, Johannes M; Takizawa, Fumio; Fischer, Uwe; Friedrich, Maik; Soto-Lampe, Veronica; Lefèvre, Christophe; Lenk, Matthias; Karger, Axel; Matsui, Taei; Hashimoto, Keiichiro

    2014-02-01

    Interleukins 2 and 15 (IL-2 and IL-15) are highly differentiated but related cytokines with overlapping, yet also distinct functions, and established benefits for medical drug use. The present study identified a gene for an ancient third IL-2/15 family member in reptiles and mammals, interleukin 15-like (IL-15L), which hitherto was only reported in fish. IL-15L genes with intact open reading frames (ORFs) and evidence of transcription, and a recent past of purifying selection, were found for cattle, horse, sheep, pig and rabbit. In human and mouse the IL-15L ORF is incapacitated. Although deduced IL-15L proteins share only ~21 % overall amino acid identity with IL-15, they share many of the IL-15 residues important for binding to receptor chain IL-15Rα, and recombinant bovine IL-15L was shown to interact with IL-15Rα indeed. Comparison of sequence motifs indicates that capacity for binding IL-15Rα is an ancestral characteristic of the IL-2/15/15L family, in accordance with a recent study which showed that in fish both IL-2 and IL-15 can bind IL-15Rα. Evidence reveals that the species lineage leading to mammals started out with three similar cytokines IL-2, IL-15 and IL-15L, and that later in evolution (1) IL-2 and IL-2Rα receptor chain acquired a new and specific binding mode and (2) IL-15L was lost in several but not all groups of mammals. The present study forms an important step forward in understanding this potent family of cytokines, and may help to improve future strategies for their application in veterinarian and human medicine.

  18. The African turquoise killifish genome provides insights into evolution and genetic architecture of lifespan

    PubMed Central

    Valenzano, Dario Riccardo; Benayoun, Bérénice A.; Singh, Param Priya; Zhang, Elisa; Etter, Paul D.; Hu, Chi-Kuo; Clément-Ziza, Mathieu; Willemsen, David; Cui, Rongfeng; Harel, Itamar; Machado, Ben E.; Yee, Muh-Ching; Sharp, Sabrina C.; Bustamante, Carlos D.; Beyer, Andreas; Johnson, Eric A.; Brunet, Anne

    2015-01-01

    Summary Lifespan is a remarkably diverse trait ranging from a few days to several hundred years in nature, but the mechanisms underlying the evolution of lifespan differences remain elusive. Here we de novo assemble a reference genome for the naturally short-lived African turquoise killifish, providing a unique resource for comparative and experimental genomics. The identification of genes under positive selection in this fish reveals potential candidates to explain its compressed lifespan. Several aging genes are under positive selection in this short-lived fish and long-lived species, raising the intriguing possibility that the same gene could underlie evolution of both compressed and extended lifespans. Comparative genomics and linkage analysis identify candidate genes associated with lifespan differences between various turquoise killifish strains. Remarkably, these genes are clustered on the sex chromosome, suggesting that short lifespan might have co-evolved with sex determination. Our study provides insights into the evolutionary forces that shape lifespan in nature. PMID:26638078

  19. The African Turquoise Killifish Genome Provides Insights into Evolution and Genetic Architecture of Lifespan.

    PubMed

    Valenzano, Dario Riccardo; Benayoun, Bérénice A; Singh, Param Priya; Zhang, Elisa; Etter, Paul D; Hu, Chi-Kuo; Clément-Ziza, Mathieu; Willemsen, David; Cui, Rongfeng; Harel, Itamar; Machado, Ben E; Yee, Muh-Ching; Sharp, Sabrina C; Bustamante, Carlos D; Beyer, Andreas; Johnson, Eric A; Brunet, Anne

    2015-12-03

    Lifespan is a remarkably diverse trait ranging from a few days to several hundred years in nature, but the mechanisms underlying the evolution of lifespan differences remain elusive. Here we de novo assemble a reference genome for the naturally short-lived African turquoise killifish, providing a unique resource for comparative and experimental genomics. The identification of genes under positive selection in this fish reveals potential candidates to explain its compressed lifespan. Several aging genes are under positive selection in this short-lived fish and long-lived species, raising the intriguing possibility that the same gene could underlie evolution of both compressed and extended lifespans. Comparative genomics and linkage analysis identify candidate genes associated with lifespan differences between various turquoise killifish strains. Remarkably, these genes are clustered on the sex chromosome, suggesting that short lifespan might have co-evolved with sex determination. Our study provides insights into the evolutionary forces that shape lifespan in nature.

  20. UCSC genome browser tutorial.

    PubMed

    Zweig, Ann S; Karolchik, Donna; Kuhn, Robert M; Haussler, David; Kent, W James

    2008-08-01

    The University of California Santa Cruz (UCSC) Genome Bioinformatics website consists of a suite of free, open-source, on-line tools that can be used to browse, analyze, and query genomic data. These tools are available to anyone who has an Internet browser and an interest in genomics. The website provides a quick and easy-to-use visual display of genomic data. It places annotation tracks beneath genome coordinate positions, allowing rapid visual correlation of different types of information. Many of the annotation tracks are submitted by scientists worldwide; the others are computed by the UCSC Genome Bioinformatics group from publicly available sequence data. It also allows users to upload and display their own experimental results or annotation sets by creating a custom track. The suite of tools, downloadable data files, and links to documentation and other information can be found at http://genome.ucsc.edu/.

  1. Draft Genome Sequences of Two Isolates of the Roseobacter Group, Sulfitobacter sp. Strains 3SOLIMAR09 and 1FIGIMAR09, from Harbors of Mallorca Island (Mediterranean Sea)

    PubMed Central

    Mas-Lladó, Maria; Piña-Villalonga, Joana Maria; Brunet-Galmés, Isabel; Nogales, Balbina

    2014-01-01

    We present the draft genome sequences of two isolates of the Roseobacter lineage, 3SOLIMAR09 and 1FIGIMAR09, which were obtained from harbors of Mallorca Island, Spain, and are affiliated with the Sulfitobacter genus. Both isolates harbor the complete gene set for protocatechuate catabolism and incomplete pathways for several additional monoaromatic compounds. PMID:24855294

  2. Analysis of ATP6 sequence diversity in the Triticum-Aegilops group of species reveals the crucial role of rearrangement in mitochondrial genome evolution

    USDA-ARS?s Scientific Manuscript database

    Mutation and chromosomal rearrangements are the two main forces of increasing genetic diversity for natural selection to act upon, and ultimately drive the evolutionary process. Although genome evolution is a function of both forces, simultaneously, the ratio of each can be varied among different ge...

  3. Whole-Genome Sequences of Four Strains Closely Related to Members of the Mycobacterium chelonae Group, Isolated from Biofilms in a Drinking Water Distribution System Simulator

    PubMed Central

    Revetta, Randy P.

    2016-01-01

    We report here the draft genome sequences of four Mycobacterium chelonae strains from biofilms subjected to a “chlorine burn” in a chloraminated drinking water distribution system simulator. These opportunistic pathogens have been detected in hospital and municipal water distribution systems, in which biofilms have been recognized as an important factor for their persistence. PMID:26798093

  4. Evolution and some functions of the NprR-NprRB quorum-sensing system in the Bacillus cereus group.

    PubMed

    Rocha, Jorge; Flores, Victor; Cabrera, Rosina; Soto-Guzmán, Adriana; Granados, Giovana; Juaristi, Eusebio; Guarneros, Gabriel; de la Torre, Mayra

    2012-05-01

    Quorum-sensing (QS) is a bacterial mechanism for regulation of gene expression in response to cell density. In Gram-positive bacteria, oligopeptides are the signaling molecules to elicit QS. The RNPP protein family (Rap, NprR, PlcR, and PrgX) are intracellular QS receptors that bind directly to their specific signaling peptide for regulating the transcription of several genes. NprR is the activator of a neutral protease in Bacillus subtilis, and it has been recently related to sporulation, cry genes transcription and extracellular protease activity in strains from the B. cereus group. In the B. thuringiensis genome, downstream nprR, a gene encoding a putative QS signaling propeptide (nprRB) was found. We hypothesized that the nprR and nprRB co-evolved because of their coordinated function in the B. cereus group. A phylogenetic tree of nucleotide sequences of nprR revealed six pherotypes, each corresponding to one putative mature NprRB sequence. The nprR tree does not match the current taxonomic grouping of the B. cereus group or the phylogenetic arrangement obtained when using MLST markers from the same strains. SKPDI and other synthetic peptides encoded in the nprRB gene from B. thuringiensis serovar thuringiensis strain 8741 had effect on temporal regulation of sporulation and expression of a cry1Aa'Z transcriptional fusion, but those peptides that stimulated earlier detection of spores decreased cry1Aa expression suggesting that NprR may either activate or repress the transcription of different genes.

  5. Analysis of a genome fragment of a deep-sea uncultivated Group II euryarchaeote containing 16S rDNA, a spectinomycin-like operon and several energy metabolism genes.

    PubMed

    Moreira, David; Rodríguez-Valera, Francisco; López-García, Purificación

    2004-09-01

    We have sequenced and analysed a 39.5 kbp genome fragment of a marine Group II euryarchaeote identified in a metagenomic library of 500 m deep plankton at the Antarctic Polar Front. The clone contains a 16S rRNA gene that is separated from the 23S rRNA gene in the genome. This appears to be a trait shared by Thermoplasmatales and Group II euryarchaeota. This genome fragment exhibits a compact organization, including a few overlapping genes in the canonical spectinomycin-like (spc) operon for ribosomal proteins that is immediately upstream the 16S rDNA. Most open reading frames (ORFs) encoded proteins involved in housekeeping processes and, as expected, exhibited a phylogenetic distribution congruent with that of the 16S rRNA. A considerable number of proteins with predicted transmembrane helices was identified. Among those, two proteins encoded by genes likely forming an operon appear to be part of a membrane terminal electron transport chain. One of these proteins has an unusual domain arrangement including ferredoxin, flavodoxin and one succinate dehydrogenase/fumarate reductase subunit. These proteins probably constitute a new succinate dehydrogenase-like oxidoreductase involved in what could be a novel pathway for energy metabolism in Group II euryarchaeota.

  6. Complex recombination patterns arising during geminivirus coinfections preserve and demarcate biologically important intra-genome interaction networks.

    PubMed

    Martin, Darren P; Lefeuvre, Pierre; Varsani, Arvind; Hoareau, Murielle; Semegni, Jean-Yves; Dijoux, Betty; Vincent, Claire; Reynaud, Bernard; Lett, Jean-Michel

    2011-09-01

    Genetic recombination is an important process during the evolution of many virus species and occurs particularly frequently amongst begomoviruses in the single stranded DNA virus family, Geminiviridae. As in many other recombining viruses it is apparent that non-random recombination breakpoint distributions observable within begomovirus genomes sampled from nature are the product of variations both in basal recombination rates across genomes and in the over-all viability of different recombinant genomes. Whereas factors influencing basal recombination rates might include local degrees of sequence similarity between recombining genomes, nucleic acid secondary structures and genomic sensitivity to nuclease attack or breakage, the viability of recombinant genomes could be influenced by the degree to which their co-evolved protein-protein and protein-nucleotide and nucleotide-nucleotide interactions are disreputable by recombination. Here we investigate patterns of recombination that occur over 120 day long experimental infections of tomato plants with the begomoviruses Tomato yellow leaf curl virus and Tomato leaf curl Comoros virus. We show that patterns of sequence exchange between these viruses can be extraordinarily complex and present clear evidence that factors such as local degrees of sequence similarity but not genomic secondary structure strongly influence where recombination breakpoints occur. It is also apparent from our experiment that over-all patterns of recombination are strongly influenced by selection against individual recombinants displaying disrupted intra-genomic interactions such as those required for proper protein and nucleic acid folding. Crucially, we find that selection favoring the preservation of co-evolved longer-range protein-protein and protein DNA interactions is so strong that its imprint can even be used to identify the exact sequence tracts involved in these interactions.

  7. The functional importance of co-evolving residues in proteins.

    PubMed

    Sandler, Inga; Zigdon, Nitzan; Levy, Efrat; Aharoni, Amir

    2014-02-01

    Computational approaches for detecting co-evolution in proteins allow for the identification of protein-protein interaction networks in different organisms and the assignment of function to under-explored proteins. The detection of co-variation of amino acids within or between proteins, moreover, allows for the discovery of residue-residue contacts and highlights functional residues that can affect the binding affinity, catalytic activity, or substrate specificity of a protein. To explore the functional impact of co-evolutionary changes in proteins, a combined experimental and computational approach must be recruited. Here, we review recent studies that apply computational and experimental tools to obtain novel insight into the structure, function, and evolution of proteins. Specifically, we describe the application of co-evolutionary analysis for predicting high-resolution three-dimensional structures of proteins. In addition, we describe computational approaches followed by experimental analysis for identifying specificity-determining residues in proteins. Finally, we discuss studies addressing the importance of such residues in terms of the functional divergence of proteins, allowing proteins to evolve new functions while avoiding crosstalk with existing cellular pathways or forming reproductive barriers and hence promoting speciation.

  8. Fast Algorithms for Mining Co-evolving Time Series

    DTIC Science & Technology

    2011-09-01

    2 log |Q| − T 2 log |R| ] (2.7) where D() is the square of the Mahalanobis distance , i.e. D(~x, ~y,Σ) = (~x− ~y)TΣ−1(~x− ~y). 2.2.6 Parallel...log |Γ| 2 − (T− 1) log |Λ| 2 − T log |Σ| 2 ] (3.7) where D() is the square of the Mahalanobis distance D(~x, ~y,Σ) = (~x− ~y)TΣ−1(~x− ~y) Our proposed...approximations [Keogh et al., 2001]. These are mainly useful for the Euclidean distance , or variations [Rafiei and Mendelzon, 1997, Ogras and Ferhatosmanoglu

  9. Plant-Associated Methylobacteria as Co-Evolved Phytosymbionts

    PubMed Central

    2007-01-01

    Due to their wall-associated pectin metabolism, growing plant cells emit significant amounts of the one-carbon alcohol methanol. Pink-pigmented microbes of the genus Methylobacterium that colonize the surfaces of leaves (epiphytes) are capable of growth on this volatile C1-compound as sole source of carbon and energy. In this article the results of experiments with germ-free (gnotobiotic) sporophytes of angiosperms (sunflower, maize) and gametophytes of bryophytes (a moss and two liverwort species) are summarized. The data show that methylobacteria do not stimulate the growth of these angiosperms, but organ development in moss protonemata and in thalli of liverworts is considerably enhanced. Since methylobacteria produce and secrete cytokinins and auxin, a model of plant-microbe-interaction (symbiosis) is proposed in which the methanol-consuming bacteria are viewed as coevolved partners of the gametophyte that determine its growth, survival and reproduction (fitness). This symbiosis is restricted to the haploid cells of moisture-dependent “living fossil” plants; it does not apply to the diploid sporophytes of higher embryophytes, which are fully adapted to life on land and apparently produce sufficient amounts of endogenous phytohormones. PMID:19516971

  10. Quantifying dynamical spillover in co-evolving multiplex networks

    NASA Astrophysics Data System (ADS)

    Vijayaraghavan, Vikram S.; Noël, Pierre-André; Maoz, Zeev; D'Souza, Raissa M.

    2015-10-01

    Multiplex networks (a system of multiple networks that have different types of links but share a common set of nodes) arise naturally in a wide spectrum of fields. Theoretical studies show that in such multiplex networks, correlated edge dynamics between the layers can have a profound effect on dynamical processes. However, how to extract the correlations from real-world systems is an outstanding challenge. Here we introduce the Multiplex Markov chain to quantify correlations in edge dynamics found in longitudinal data of multiplex networks. By comparing the results obtained from the multiplex perspective to a null model which assumes layers in a network are independent, we can identify real correlations as distinct from simultaneous changes that occur due to random chance. We use this approach on two different data sets: the network of trade and alliances between nation states, and the email and co-commit networks between developers of open source software. We establish the existence of “dynamical spillover” showing the correlated formation (or deletion) of edges of different types as the system evolves. The details of the dynamics over time provide insight into potential causal pathways.

  11. Quantifying dynamical spillover in co-evolving multiplex networks

    PubMed Central

    Vijayaraghavan, Vikram S.; Noël, Pierre-André; Maoz, Zeev; D’Souza, Raissa M.

    2015-01-01

    Multiplex networks (a system of multiple networks that have different types of links but share a common set of nodes) arise naturally in a wide spectrum of fields. Theoretical studies show that in such multiplex networks, correlated edge dynamics between the layers can have a profound effect on dynamical processes. However, how to extract the correlations from real-world systems is an outstanding challenge. Here we introduce the Multiplex Markov chain to quantify correlations in edge dynamics found in longitudinal data of multiplex networks. By comparing the results obtained from the multiplex perspective to a null model which assumes layers in a network are independent, we can identify real correlations as distinct from simultaneous changes that occur due to random chance. We use this approach on two different data sets: the network of trade and alliances between nation states, and the email and co-commit networks between developers of open source software. We establish the existence of “dynamical spillover” showing the correlated formation (or deletion) of edges of different types as the system evolves. The details of the dynamics over time provide insight into potential causal pathways. PMID:26459949

  12. Genome sequence of the pink–pigmented marine bacterium Loktanella hongkongensis type strain (UST950701–009PT), a representative of the Roseobacter group

    SciTech Connect

    Lau, Stanley CK; Riedel, Thomas; Fiebig, Anne; Han, James; Huntemann, Marcel; Petersen, Jörn; Ivanova, Natalia N.; Markowitz, Victor; Woyke, Tanja; Göker, Markus; Kyrpides, Nikos C.; Klenk, Hans-Peter; Qian, Pei-Yuan

    2015-08-11

    Loktanella hongkongensis UST950701-009PT is a Gram-negative, non-motile and rod-shaped bacterium isolated from a marine biofilm in the subtropical seawater of Hong Kong. When growing as a monospecies biofilm on polystyrene surfaces, this bacterium is able to induce larval settlement and metamorphosis of a ubiquitous polychaete tubeworm Hydroides elegans. The inductive cues are low-molecular weight compounds bound to the exopolymeric matrix of the bacterial cells. In the present study we describe the features of L. hongkongensis strain DSM 17492T together with its genome sequence and annotation and novel aspects of its phenotype. The 3,198,444 bp long genome sequence encodes 3104 protein-coding genes and 57 RNA genes. Lastly, the two unambiguously identified extrachromosomal replicons contain replication modules of the RepB and the Rhodobacteraceae-specific DnaA-like type, respectively.

  13. Genome sequence of the pink–pigmented marine bacterium Loktanella hongkongensis type strain (UST950701–009PT), a representative of the Roseobacter group

    DOE PAGES

    Lau, Stanley CK; Riedel, Thomas; Fiebig, Anne; ...

    2015-08-11

    Loktanella hongkongensis UST950701-009PT is a Gram-negative, non-motile and rod-shaped bacterium isolated from a marine biofilm in the subtropical seawater of Hong Kong. When growing as a monospecies biofilm on polystyrene surfaces, this bacterium is able to induce larval settlement and metamorphosis of a ubiquitous polychaete tubeworm Hydroides elegans. The inductive cues are low-molecular weight compounds bound to the exopolymeric matrix of the bacterial cells. In the present study we describe the features of L. hongkongensis strain DSM 17492T together with its genome sequence and annotation and novel aspects of its phenotype. The 3,198,444 bp long genome sequence encodes 3104 protein-codingmore » genes and 57 RNA genes. Lastly, the two unambiguously identified extrachromosomal replicons contain replication modules of the RepB and the Rhodobacteraceae-specific DnaA-like type, respectively.« less

  14. Genome sequence of the pink-pigmented marine bacterium Loktanella hongkongensis type strain (UST950701-009P(T)), a representative of the Roseobacter group.

    PubMed

    Lau, Stanley Ck; Riedel, Thomas; Fiebig, Anne; Han, James; Huntemann, Marcel; Petersen, Jörn; Ivanova, Natalia N; Markowitz, Victor; Woyke, Tanja; Göker, Markus; Kyrpides, Nikos C; Klenk, Hans-Peter; Qian, Pei-Yuan

    2015-01-01

    Loktanella hongkongensis UST950701-009P(T) is a Gram-negative, non-motile and rod-shaped bacterium isolated from a marine biofilm in the subtropical seawater of Hong Kong. When growing as a monospecies biofilm on polystyrene surfaces, this bacterium is able to induce larval settlement and metamorphosis of a ubiquitous polychaete tubeworm Hydroides elegans. The inductive cues are low-molecular weight compounds bound to the exopolymeric matrix of the bacterial cells. In the present study we describe the features of L. hongkongensis strain DSM 17492(T) together with its genome sequence and annotation and novel aspects of its phenotype. The 3,198,444 bp long genome sequence encodes 3104 protein-coding genes and 57 RNA genes. The two unambiguously identified extrachromosomal replicons contain replication modules of the RepB and the Rhodobacteraceae-specific DnaA-like type, respectively.

  15. Genomic evidence for interspecies acquisition of chromosomal DNA from Campylobacter jejuni by Campylobacter coli strains of a turkey-associated clonal group (cluster II).

    PubMed

    Chan, Kamfai; Elhanafi, Driss; Kathariou, Sophia

    2008-08-01

    Previous multilocus sequence typing studies of Campylobacter coli from meat animals identified an unusual cluster of strains, primarily from turkeys, termed "cluster II" and characterized by the presence of the C. jejuni aspA103 allele. To characterize the extent of genomic input from C. jejuni in the aspA region of cluster II C. coli, we sequenced the 6.1 kb genomic region upstream of and including aspA from two turkey-derived cluster II strains (C. coli 6979 and C. coli 7474, of ST-1150 and ST-1161, respectively), as well as from a turkey-derived multidrug-resistant strain (C. coli 6818) representing a major sequence type (ST-1101) outside of cluster II. A gene encoding a putative CRP-family transcriptional regulator (CCO0137) was present in C. coli 6818 and the reference strain C. coli RM2228, whose genome has been sequenced, but not in either cluster II strain evaluated. This gene was also absent from C. jejuni NCTC 11168 and C. jejuni RM1221. Moreover, single nucleotide polymorphism (SNP) analysis revealed that in both cluster II strains, genes encoding subunit II of cytochrome d ubiquinol oxidase (cydB) and a putative aspartate racemase (Cj0085c) harbored numerous C. jejuni-specific SNPs. Interestingly, genes encoding subunit I of cytochrome d ubiquinol oxidase (cydA), uracil-DNA glycosylase (ung), and aspartate ammonia-lyase (aspA) harbored C. coli-specific SNPs in certain portions but C. jejuni-specific SNPs in others, suggesting that these were hybrid genes with C. jejuni-derived segments. Analysis of a ung mutant in C. coli 7474 indicated that the putative hybrid ung of this cluster II strain was functional. Our data suggest the occurrence of recombination events that resulted in genomic import of DNA from C. jejuni in the region between cydA and aspA in cluster II strains of C. coli.

  16. First genomic analysis of the broad-host-range Rhizobium sp. LPU83 strain, a member of the low-genetic diversity Oregon-like Rhizobium sp. group.

    PubMed

    Tejerizo, Gonzalo Torres; Del Papa, María Florencia; Draghi, Walter; Lozano, Mauricio; Giusti, María de Los Ángeles; Martini, Carla; Salas, María Eugenia; Salto, Ileana; Wibberg, Daniel; Szczepanowski, Rafael; Weidner, Stefan; Schlüter, Andreas; Lagares, Antonio; Pistorio, Mariano

    2011-08-20

    Alfalfa (Medicago sativa) is the most cultivated forage legume for cattle and animal feeding, occupying about 32 million hectares over the world. Management of the N₂-fixing symbiosis of this plant to maximize crop production is therefore an important objective. A fundamental constraint to this aim emerges when a moderately low soil pH hampers the establishment of an effective symbiosis with indigenous and/or inoculated rhizobia. Besides the association of alfalfa with Ensifer (Sinorhizobium) meliloti, this legume is able to establish a symbiosis with Ensifer (Sinorhizobium) medicae and with less characterized types of rhizobia, such as the Oregon-like strains, Rhizobium sp. Or191 initially isolated in the USA, and the Rhizobium sp. LPU83 strain, from Argentina. These strains are acid-tolerant, highly competitive for acidic-soil-alfalfa nodulation, but inefficient for biological nitrogen fixation with alfalfa. These features position the Oregon-like rhizobia as strains of potential risk in agricultural soils compared with the efficient symbiont E. meliloti. Moreover, the collected genetic information has revealed that the genomic structure of these rhizobial isolates is complex in terms of sequence similarities shared with other rhizobia. Such a "patched" genetic composition has obviously imposed severe restrictions to the classical taxonomy of these rhizobia. In this work we summarize the accumulated knowledge about the Oregon-like rhizobia and present a phylogenetic analysis based on genome sequence data of Rhizobium sp. LPU83 obtained by a high-throughput sequencing on the Genome Sequencer FLX Titanium platform. The accessibility of the complete genomic sequence will release up more experimental possibilities since this information will then enable biochemical studies as well as proteomics and transcriptomics approaches.

  17. A Preliminary Genome-Wide Association Study of Acute Mountain Sickness Susceptibility in a Group of Nepalese Pilgrims Ascending to 4380 m.

    PubMed

    MacInnis, Martin J; Widmer, Nadia; Timulsina, Utsav; Subedi, Ankita; Siwakoti, Ashmita; Pandit, Bidur Prasad; Freeman, Michael G; Carter, Eric A; Manokhina, Irina; Thapa, Ghan Bahadur; Koehle, Michael S

    2015-12-01

    There is significant interindividual variation in acute mountain sickness (AMS) susceptibility in humans. To identify genes related to AMS susceptibility, we used a genome-wide association study (GWAS) to simultaneously test associations between genetic variants dispersed throughout the genome and the presence and severity of AMS. DNA samples were collected from subjects who ascended rapidly to Gosainkunda, Nepal (4380 m), as part of the 2005, 2010, and 2012 Janai Purnima festivals. The Lake Louise Score was used to measure AMS severity. The primary analysis was based on 99 male subjects (43 with AMS; 56 without AMS). Genotyping for the GWAS was performed using Infinium Human Core Exome Bead Chips (542,556 single-nucleotide polymorphisms were assayed), and validation genotyping was performed with pyrosequencing in two additional cohorts (n = 101 for each). In total, 270,389 single nucleotide polymorphisms (SNPs) passed quality control, and 4 SNPs (one intronic, three nonsynonymous) in the FAM149A gene were associated with AMS severity after correcting for multiple hypothesis testing (p = 1.8E-7); however, in the validation cohorts, FAM149A was not associated with the presence or severity of AMS. No other genes were associated with AMS susceptibility at the genome-wide level. Due to the large influence of environmental factors (i.e., ascent rate and altitude attained) and the difficulties associated with the AMS phenotype (i.e., low repeatability, nonspecific symptoms, potentially independent ailments), we suggest that future studies addressing the variation in the acute human hypoxia response should focus on objective responses to acute hypoxia instead of AMS.

  18. Experimental RNomics and genomic comparative analysis reveal a large group of species-specific small non-message RNAs in the silkworm Bombyx mori.

    PubMed

    Li, Dandan; Wang, Yanhong; Zhang, Kun; Jiao, Zhujin; Zhu, Xiaopeng; Skogerboe, Geir; Guo, Xiangqian; Chinnusamy, Viswanathan; Bi, Lijun; Huang, Yongping; Dong, Shuanglin; Chen, Runsheng; Kan, Yunchao

    2011-05-01

    Accumulating evidences show that small non-protein coding RNAs (ncRNAs) play important roles in development, stress response and other cellular processes. The silkworm is an important model for studies on insect genetics and control of lepidopterous pests. Here, we have performed the first systematic identification and analysis of intermediate size ncRNAs (50-500 nt) in the silkworm. We identified 189 novel ncRNAs, including 141 snoRNAs, six snRNAs, three tRNAs, one SRP and 38 unclassified ncRNAs. Forty ncRNAs showed significantly altered expression during silkworm development or across specific stage transitions. Genomic comparisons revealed that 123 of these ncRNAs are potentially silkworm-specific. Analysis of the genomic organization of the ncRNA loci showed that 32.62% of the novel snoRNA loci are intergenic, and that all the intronic snoRNAs follow the pattern of one-snoRNA-per-intron. Target site analysis predicted a total of 95 2'-O-methylation and pseudouridylation modification sites of rRNAs, snRNAs and tRNAs. Together, these findings provide new clues for future functional study of ncRNA during insect development and evolution.

  19. Experimental RNomics and genomic comparative analysis reveal a large group of species-specific small non-message RNAs in the silkworm Bombyx mori

    PubMed Central

    Li, Dandan; Wang, Yanhong; Zhang, Kun; Jiao, Zhujin; Zhu, Xiaopeng; Skogerboe, Geir; Guo, Xiangqian; Chinnusamy, Viswanathan; Bi, Lijun; Huang, Yongping; Dong, Shuanglin; Chen, Runsheng; Kan, Yunchao

    2011-01-01

    Accumulating evidences show that small non-protein coding RNAs (ncRNAs) play important roles in development, stress response and other cellular processes. The silkworm is an important model for studies on insect genetics and control of lepidopterous pests. Here, we have performed the first systematic identification and analysis of intermediate size ncRNAs (50–500 nt) in the silkworm. We identified 189 novel ncRNAs, including 141 snoRNAs, six snRNAs, three tRNAs, one SRP and 38 unclassified ncRNAs. Forty ncRNAs showed significantly altered expression during silkworm development or across specific stage transitions. Genomic comparisons revealed that 123 of these ncRNAs are potentially silkworm-specific. Analysis of the genomic organization of the ncRNA loci showed that 32.62% of the novel snoRNA loci are intergenic, and that all the intronic snoRNAs follow the pattern of one-snoRNA-per-intron. Target site analysis predicted a total of 95 2′-O-methylation and pseudouridylation modification sites of rRNAs, snRNAs and tRNAs. Together, these findings provide new clues for future functional study of ncRNA during insect development and evolution. PMID:21227919

  20. The Bioinformatics Analysis of Comparative Genomics of Mycobacterium tuberculosis Complex (MTBC) Provides Insight into Dissimilarities between Intraspecific Groups Differing in Host Association, Virulence, and Epitope Diversity

    PubMed Central

    Jia, Xinmiao; Yang, Li; Dong, Mengxing; Chen, Suting; Lv, Lingna; Cao, Dandan; Fu, Jing; Yang, Tingting; Zhang, Ju; Zhang, Xiangli; Shang, Yuanyuan; Wang, Guirong; Sheng, Yongjie; Huang, Hairong; Chen, Fei

    2017-01-01

    Tuberculosis now exceeds HIV as the top infectious disease cause of mortality, and is caused by the Mycobacterium tuberculosis complex (MTBC). MTBC strains have highly conserved genome sequences (similarity >99%) but dramatically different phenotypes. To analyze the relationship between genotype and phenotype, we conducted the comparative genomic analysis on 12 MTBC strains representing different lineages (i.e., Mycobacterium bovis; M. bovis BCG; M. microti; M. africanum; M. tuberculosis H37Rv; M. tuberculosis H37Ra, and six M. tuberculosis clinical isolates). The analysis focused on the three aspects of pathogenicity: host association, virulence, and epitope variations. Host association analysis indicated that eight mce3 genes, two enoyl-CoA hydratases, and five PE/PPE family genes were present only in human isolates; these may have roles in host-pathogen interactions. There were 15 SNPs found on virulence factors (including five SNPs in three ESX secretion proteins) only in the Beijing strains, which might be related to their more virulent phenotype. A comparison between the virulent H37Rv and non-virulent H37Ra strains revealed three SNPs that were likely associated with the virulence attenuation of H37Ra: S219L (PhoP), A219E (MazG) and a newly identified I228M (EspK). Additionally, a comparison of animal-associated MTBC strains showed that the deletion of the first four genes (i.e., pe35, ppe68, esxB, esxA), rather than all eight genes of RD1, might play a central role in the virulence attenuation of animal isolates. Finally, by comparing epitopes among MTBC strains, we found that four epitopes were lost only in the Beijing strains; this may render them better capable of evading the human immune system, leading to enhanced virulence. Overall, our comparative genomic analysis of MTBC strains reveals the relationship between the highly conserved genotypes and the diverse phenotypes of MTBC, provides insight into pathogenic mechanisms, and facilitates the

  1. Life-history traits maintain the genomic integrity of sympatric species of the spruce budworm (Choristoneura fumiferana) group on an isolated forest island

    PubMed Central

    Lumley, Lisa M; Sperling, Felix AH

    2011-01-01

    Identification of widespread species collected from islands can be challenging due to the potential for local ecological and phenotypic divergence in isolated populations. We sought to determine how many species of the spruce budworm (Choristoneura fumiferana) complex reside in Cypress Hills, an isolated remnant coniferous forest in western Canada. We integrated data on behavior, ecology, morphology, mitochondrial DNA, and simple sequence repeats, comparing Cypress Hills populations to those from other regions of North America to determine which species they resembled most. We identified C. fumiferana, C. occidentalis, C. lambertiana, and hybrid forms in Cypress Hills. Adult flight phenology and pheromone attraction were identified as key life-history traits involved in maintaining the genomic integrity of species. Our study highlights the importance of extensive sampling of both specimens and a variety of characters for understanding species boundaries in biodiversity research. PMID:22393489

  2. Life-history traits maintain the genomic integrity of sympatric species of the spruce budworm (Choristoneura fumiferana) group on an isolated forest island.

    PubMed

    Lumley, Lisa M; Sperling, Felix Ah

    2011-10-01

    Identification of widespread species collected from islands can be challenging due to the potential for local ecological and phenotypic divergence in isolated populations. We sought to determine how many species of the spruce budworm (Choristoneura fumiferana) complex reside in Cypress Hills, an isolated remnant coniferous forest in western Canada. We integrated data on behavior, ecology, morphology, mitochondrial DNA, and simple sequence repeats, comparing Cypress Hills populations to those from other regions of North America to determine which species they resembled most. We identified C. fumiferana, C. occidentalis, C. lambertiana, and hybrid forms in Cypress Hills. Adult flight phenology and pheromone attraction were identified as key life-history traits involved in maintaining the genomic integrity of species. Our study highlights the importance of extensive sampling of both specimens and a variety of characters for understanding species boundaries in biodiversity research.

  3. The complete nucleotide sequence of the cassava (Manihot esculenta) chloroplast genome and the evolution of atpF in Malpighiales: RNA editing and multiple losses of a group II intron

    PubMed Central

    Wurdack, Kenneth J.; Kanagaraj, Anderson; Lee, Seung-Bum; Saski, Christopher; Jansen, Robert K.

    2008-01-01

    The complete sequence of the chloroplast genome of cassava (Manihot esculenta, Euphorbiaceae) has been determined. The genome is 161,453 bp in length and includes a pair of inverted repeats (IR) of 26,954 bp. The genome includes 128 genes; 96 are single copy and 16 are duplicated in the IR. There are four rRNA genes and 30 distinct tRNAs, seven of which are duplicated in the IR. The infA gene is absent; expansion of IRb has duplicated 62 amino acids at the 3′ end of rps19 and a number of coding regions have large insertions or deletions, including insertions within the 23S rRNA gene. There are 17 intron-containing genes in cassava, 15 of which have a single intron while two (clpP, ycf3) have two introns. The usually conserved atpF group II intron is absent and this is the first report of its loss from land plant chloroplast genomes. The phylogenetic distribution of the atpF intron loss was determined by a PCR survey of 251 taxa representing 34 families of Malpighiales and 16 taxa from closely related rosids. The atpF intron is not only missing in cassava but also from closely related Euphorbiaceae and other Malpighiales, suggesting that there have been at least seven independent losses. In cassava and all other sequenced Malphigiales, atpF gene sequences showed a strong association between C-to-T substitutions at nucleotide position 92 and the loss of the intron, suggesting that recombination between an edited mRNA and the atpF gene may be a possible mechanism for the intron loss. PMID:18214421

  4. Genome data mining and soil survey for the novel group 5 [NiFe]-hydrogenase to explore the diversity and ecological importance of presumptive high-affinity H(2)-oxidizing bacteria.

    PubMed

    Constant, Philippe; Chowdhury, Soumitra Paul; Hesse, Laura; Pratscher, Jennifer; Conrad, Ralf

    2011-09-01

    Streptomyces soil isolates exhibiting the unique ability to oxidize atmospheric H(2) possess genes specifying a putative high-affinity [NiFe]-hydrogenase. This study was undertaken to explore the taxonomic diversity and the ecological importance of this novel functional group. We propose to designate the genes encoding the small and large subunits of the putative high-affinity hydrogenase hhyS and hhyL, respectively. Genome data mining revealed that the hhyL gene is unevenly distributed in the phyla Actinobacteria, Proteobacteria, Chloroflexi, and Acidobacteria. The hhyL gene sequences comprised a phylogenetically distinct group, namely, the group 5 [NiFe]-hydrogenase genes. The presumptive high-affinity H(2)-oxidizing bacteria constituting group 5 were shown to possess a hydrogenase gene cluster, including the genes encoding auxiliary and structural components of the enzyme and four additional open reading frames (ORFs) of unknown function. A soil survey confirmed that both high-affinity H(2) oxidation activity and the hhyL gene are ubiquitous. A quantitative PCR assay revealed that soil contained 10(6) to 10(8) hhyL gene copies g (dry weight)(-1). Assuming one hhyL gene copy per genome, the abundance of presumptive high-affinity H(2)-oxidizing bacteria was higher than the maximal population size for which maintenance energy requirements would be fully supplied through the H(2) oxidation activity measured in soil. Our data indicate that the abundance of the hhyL gene should not be taken as a reliable proxy for the uptake of atmospheric H(2) by soil, because high-affinity H(2) oxidation is a facultatively mixotrophic metabolism, and microorganisms harboring a nonfunctional group 5 [NiFe]-hydrogenase may occur.

  5. Genome size analyses of Pucciniales reveal the largest fungal genomes.

    PubMed

    Tavares, Sílvia; Ramos, Ana Paula; Pires, Ana Sofia; Azinheira, Helena G; Caldeirinha, Patrícia; Link, Tobias; Abranches, Rita; Silva, Maria do Céu; Voegele, Ralf T; Loureiro, João; Talhinhas, Pedro

    2014-01-01

    Rust fungi (Basidiomycota, Pucciniales) are biotrophic plant pathogens which exhibit diverse complexities in their life cycles and host ranges. The completion of genome sequencing of a few rust fungi has revealed the occurrence of large genomes. Sequencing efforts for other rust fungi have been hampered by uncertainty concerning their genome sizes. Flow cytometry was recently applied to estimate the genome size of a few rust fungi, and confirmed the occurrence of large genomes in this order (averaging 225.3 Mbp, while the average for Basidiomycota was 49.9 Mbp and was 37.7 Mbp for all fungi). In this work, we have used an innovative and simple approach to simultaneously isolate nuclei from the rust and its host plant in order to estimate the genome size of 30 rust species by flow cytometry. Genome sizes varied over 10-fold, from 70 to 893 Mbp, with an average genome size value of 380.2 Mbp. Compared to the genome sizes of over 1800 fungi, Gymnosporangium confusum possesses the largest fungal genome ever reported (893.2 Mbp). Moreover, even the smallest rust genome determined in this study is larger than the vast majority of fungal genomes (94%). The average genome size of the Pucciniales is now of 305.5 Mbp, while the average Basidiomycota genome size has shifted to 70.4 Mbp and the average for all fungi reached 44.2 Mbp. Despite the fact that no correlation could be drawn between the genome sizes, the phylogenomics or the life cycle of rust fungi, it is interesting to note that rusts with Fabaceae hosts present genomes clearly larger than those with Poaceae hosts. Although this study comprises only a small fraction of the more than 7000 rust species described, it seems already evident that the Pucciniales represent a group where genome size expansion could be a common characteristic. This is in sharp contrast to sister taxa, placing this order in a relevant position in fungal genomics research.

  6. Haemonchus contortus: Genome Structure, Organization and Comparative Genomics.

    PubMed

    Laing, R; Martinelli, A; Tracey, A; Holroyd, N; Gilleard, J S; Cotton, J A

    2016-01-01

    One of the first genome sequencing projects for a parasitic nematode was that for Haemonchus contortus. The open access data from the Wellcome Trust Sanger Institute provided a valuable early resource for the research community, particularly for the identification of specific genes and genetic markers. Later, a second sequencing project was initiated by the University of Melbourne, and the two draft genome sequences for H. contortus were published back-to-back in 2013. There is a pressing need for long-range genomic information for genetic mapping, population genetics and functional genomic studies, so we are continuing to improve the Wellcome Trust Sanger Institute assembly to provide a finished reference genome for H. contortus. This review describes this process, compares the H. contortus genome assemblies with draft genomes from other members of the strongylid group and discusses future directions for parasite genomics using the H. contortus model. Copyright © 2016 Elsevier Ltd. All rights reserved.

  7. Maximizing the Reliability of Genomic Selection by Optimizing the Calibration Set of Reference Individuals: Comparison of Methods in Two Diverse Groups of Maize Inbreds (Zea mays L.)

    PubMed Central

    Rincent, R.; Laloë, D.; Nicolas, S.; Altmann, T.; Brunel, D.; Revilla, P.; Rodríguez, V.M.; Moreno-Gonzalez, J.; Melchinger, A.; Bauer, E.; Schoen, C-C.; Meyer, N.; Giauffret, C.; Bauland, C.; Jamin, P.; Laborde, J.; Monod, H.; Flament, P.; Charcosset, A.; Moreau, L.

    2012-01-01

    Genomic selection refers to the use of genotypic information for predicting breeding values of selection candidates. A prediction formula is calibrated with the genotypes and phenotypes of reference individuals constituting the calibration set. The size and the composition of this set are essential parameters affecting the prediction reliabilities. The objective of this study was to maximize reliabilities by optimizing the calibration set. Different criteria based on the diversity or on the prediction error variance (PEV) derived from the realized additive relationship matrix–best linear unbiased predictions model (RA–BLUP) were used to select the reference individuals. For the latter, we considered the mean of the PEV of the contrasts between each selection candidate and the mean of the population (PEVmean) and the mean of the expected reliabilities of the same contrasts (CDmean). These criteria were tested with phenotypic data collected on two diversity panels of maize (Zea mays L.) genotyped with a 50k SNPs array. In the two panels, samples chosen based on CDmean gave higher reliabilities than random samples for various calibration set sizes. CDmean also appeared superior to PEVmean, which can be explained by the fact that it takes into account the reduction of variance due to the relatedness between individuals. Selected samples were close to optimality for a wide range of trait heritabilities, which suggests that the strategy presented here can efficiently sample subsets in panels of inbred lines. A script to optimize reference samples based on CDmean is available on request. PMID:22865733

  8. A genome-wide identification and characterization of mircoRNAs and their targets in 'Suli' pear (Pyrus pyrifolia white pear group).

    PubMed

    Niu, Qingfeng; Qian, Minjie; Liu, Guoqin; Yang, Fengxia; Teng, Yuanwen

    2013-12-01

    MicroRNAs (miRNAs) are a class of small non-coding RNA molecules that are endogenous regulators of gene expression. miRNAs play a crucial role in cells via degradation of target mRNAs or by inhibition of target protein translation. In the present study, 186 new potentially conserved pear miRNAs belonging to 37 families were identified. The length of mature miRNAs ranged from 19 to 24 nt, and most of the miRNAs (154 out of 186) were 21 nt in length. The length of pre-miRNAs in pear was also found to vary from 62 to 282 nt with an average of 105 ± 43 nt. The potential miRNAs belonged to 29 clusters involving 20 different miRNA families. Using these potential miRNAs, we further scoured of the pear genome and found 326 potential target genes, which included transcription factors, stress responsive genes, and the genes involved in transmembrane transport and signal transduction. Gene ontology analysis of these potential targets suggested that 47 biological processes were potentially regulated by miRNAs, including oxidation-reduction, stress response, transport, etc. KEGG pathway analysis showed that the identified miRNAs were found in 15 metabolism networks which were related to starch and sucrose metabolism, and ascorbate and aldarate metabolism, among others. Our study will help in the further understanding of the essential role of miRNAs in growth and development and stress response of pear.

  9. A Group of Genome-Based Biomarkers That Add to a Kattan Nomogram for Predicting Progression in Men with High-Risk Prostate Cancer

    PubMed Central

    Paris, Pamela L.; Weinberg, Vivian; Albo, Giancarlo; Roy, Ritu; Burke, Catherine; Simko, Jeffry; Carroll, Peter; Collins, Colin

    2010-01-01

    Purpose The three main treatment options for primary prostate cancer are surgery, radiation, and active surveillance. Surgical and radiation intervention for prostate cancer can be associated with significant morbidity. Therefore, accurate stratification predictive of outcome for prostate cancer patients is essential for appropriate treatment decisions. Nomograms that use clinical and pathologic variables are often used for risk prediction. Favorable outcomes exist even among men classified by nomograms as being at high risk of recurrence. Experimental Design Previously, we identified a set of DNA-based biomarkers termed Genomic Evaluators of Metastatic Prostate Cancer (GEMCaP) and have shown that they can predict risk of recurrence with 80% accuracy. Here, we examined the risk prediction ability of GEMCaP in a high-risk cohort and compared it to a Kattan nomogram. Results We determined that the GEMCaP genotype alone is comparable with the nomogram, and that for a subset of cases with negative lymph nodes improves upon it. Conclusion Thus, GEMCaP shows promise for predicting unfavorable outcomes for negative lymph node high-risk cases, where the nomogram falls short, and suggests that addition of GEMCaP to nomograms may be warranted. PMID:20028763

  10. Maximizing the reliability of genomic selection by optimizing the calibration set of reference individuals: comparison of methods in two diverse groups of maize inbreds (Zea mays L.).

    PubMed

    Rincent, R; Laloë, D; Nicolas, S; Altmann, T; Brunel, D; Revilla, P; Rodríguez, V M; Moreno-Gonzalez, J; Melchinger, A; Bauer, E; Schoen, C-C; Meyer, N; Giauffret, C; Bauland, C; Jamin, P; Laborde, J; Monod, H; Flament, P; Charcosset, A; Moreau, L

    2012-10-01

    Genomic selection refers to the use of genotypic information for predicting breeding values of selection candidates. A prediction formula is calibrated with the genotypes and phenotypes of reference individuals constituting the calibration set. The size and the composition of this set are essential parameters affecting the prediction reliabilities. The objective of this study was to maximize reliabilities by optimizing the calibration set. Different criteria based on the diversity or on the prediction error variance (PEV) derived from the realized additive relationship matrix-best linear unbiased predictions model (RA-BLUP) were used to select the reference individuals. For the latter, we considered the mean of the PEV of the contrasts between each selection candidate and the mean of the population (PEVmean) and the mean of the expected reliabilities of the same contrasts (CDmean). These criteria were tested with phenotypic data collected on two diversity panels of maize (Zea mays L.) genotyped with a 50k SNPs array. In the two panels, samples chosen based on CDmean gave higher reliabilities than random samples for various calibration set sizes. CDmean also appeared superior to PEVmean, which can be explained by the fact that it takes into account the reduction of variance due to the relatedness between individuals. Selected samples were close to optimality for a wide range of trait heritabilities, which suggests that the strategy presented here can efficiently sample subsets in panels of inbred lines. A script to optimize reference samples based on CDmean is available on request.

  11. The UCSC Genome Browser

    PubMed Central

    Karolchik, Donna; Hinrichs, Angie S.; Kent, W. James

    2011-01-01

    The University of California Santa Cruz (UCSC) Genome Browser is a popular Web-based tool for quickly displaying a requested portion of a genome at any scale, accompanied by a series of aligned annotation “tracks.” The annotations generated by the UCSC Genome Bioinformatics Group and external collaborators include gene predictions, mRNA and expressed sequence tag alignments, simple nucleotide polymorphisms, expression and regulatory data, phenotype and variation data, and pairwise and multiple-species comparative genomics data. All information relevant to a region is presented in one window, facilitating biological analysis and interpretation. The database tables underlying the Genome Browser tracks can be viewed, downloaded, and manipulated using another Web-based application, the UCSC Table Browser. Users can upload personal datasets in a wide variety of formats as custom annotation tracks in both browsers for research or educational purposes. PMID:21975940

  12. Comparative genomics of nematodes.

    PubMed

    Mitreva, Makedonka; Blaxter, Mark L; Bird, David M; McCarter, James P

    2005-10-01

    Recent transcriptome and genome projects have dramatically expanded the biological data available across the phylum Nematoda. Here we summarize analyses of these sequences, which have revealed multiple unexpected results. Despite a uniform body plan, nematodes are more diverse at the molecular level than was previously recognized, with many species- and group-specific novel genes. In the genus Caenorhabditis, changes in chromosome arrangement, particularly local inversions, are also rapid, with breakpoints occurring at 50-fold the rate in vertebrates. Tylenchid plant parasitic nematode genomes contain several genes closely related to genes in bacteria, implicating horizontal gene transfer events in the origins of plant parasitism. Functional genomics techniques are also moving from Caenorhabditis elegans to application throughout the phylum. Soon, eight more draft nematode genome sequences will be available. This unique resource will underpin both molecular understanding of these most abundant metazoan organisms and aid in the examination of the dynamics of genome evolution in animals.

  13. Genomic diversity and affinities in population groups of North West India: an analysis of Alu insertion and a single nucleotide polymorphism.

    PubMed

    Saini, J S; Kumar, A; Matharoo, K; Sokhi, J; Badaruddoza; Bhanwer, A J S

    2012-12-15

    The North West region of India is extremely important to understand the peopling of India, as it acted as a corridor to the foreign invaders from Eurasia and Central Asia. A series of these invasions along with multiple migrations led to intermixture of variable populations, strongly contributing to genetic variations. The present investigation was designed to explore the genetic diversities and affinities among the five major ethnic groups from North West India; Brahmin, Jat Sikh, Bania, Rajput and Gujjar. A total of 327 individuals of the abovementioned ethnic groups were analyzed for 4 Alu insertion marker loci (ACE, PV92, APO and D1) and a Single Nucleotide Polymorphism (SNP) rs2234693 in the intronic region of the ESR1 gene. Statistical analysis was performed to interpret the genetic structure and diversity of the population groups. Genotypes for ACE, APO, ESR1 and PV92 loci were found to be in Hardy-Weinberg equilibrium in all the ethnic groups, while significant departures were observed at the D1 locus in every investigated population after Bonferroni's correction. The average heterozygosity for all the loci in these ethnic groups was fairly substantial ranging from 0.3927 ± 0.1877 to 0.4333 ± 0.1416. Inbreeding coefficient indicated an overall 10% decrease in heterozygosity in these North West Indian populations. The gene differentiation among the populations was observed to be of the order of 0.013. Genetic distance estimates revealed that Gujjars were close to Banias and Jat Sikhs were close to Rajputs. Overall the study favored the recent division of the populations of North West India into largely endogamous groups. It was observed that the populations of North West India represent a more or less homogenous genetic entity, owing to their common ancestral history as well as geographical proximity.

  14. Association of Liver Injury From Specific Drugs, or Groups of Drugs, With Polymorphisms in HLA and Other Genes in a Genome-Wide Association Study.

    PubMed

    Nicoletti, Paola; Aithal, Guruprasad P; Bjornsson, Einar S; Andrade, Raul J; Sawle, Ashley; Arrese, Marco; Barnhart, Huiman X; Bondon-Guitton, Emmanuelle; Hayashi, Paul H; Bessone, Fernando; Carvajal, Alfonso; Cascorbi, Ingolf; Cirulli, Elizabeth T; Chalasani, Naga; Conforti, Anita; Coulthard, Sally A; Daly, Mark J; Day, Christopher P; Dillon, John F; Fontana, Robert J; Grove, Jane I; Hallberg, Pär; Hernández, Nelia; Ibáñez, Luisa; Kullak-Ublick, Gerd A; Laitinen, Tarja; Larrey, Dominique; Lucena, M Isabel; Maitland-van der Zee, Anke H; Martin, Jennifer H; Molokhia, Mariam; Pirmohamed, Munir; Powell, Elizabeth E; Qin, Shengying; Serrano, Jose; Stephens, Camilla; Stolz, Andrew; Wadelius, Mia; Watkins, Paul B; Floratos, Aris; Shen, Yufeng; Nelson, Matthew R; Urban, Thomas J; Daly, Ann K

    2017-04-01

    We performed a genome-wide association study (GWAS) to identify genetic risk factors for drug-induced liver injury (DILI) from licensed drugs without previously reported genetic risk factors. We performed a GWAS of 862 persons with DILI and 10,588 population-matched controls. The first set of cases was recruited before May 2009 in Europe (n = 137) and the United States (n = 274). The second set of cases were identified from May 2009 through May 2013 from international collaborative studies performed in Europe, the United States, and South America. For the GWAS, we included only cases with patients of European ancestry associated with a particular drug (but not flucloxacillin or amoxicillin-clavulanate). We used DNA samples from all subjects to analyze HLA genes and single nucleotide polymorphisms. After the discovery analysis was concluded, we validated our findings using data from 283 European patients with diagnosis of DILI associated with various drugs. We associated DILI with rs114577328 (a proxy for A*33:01 a HLA class I allele; odds ratio [OR], 2.7; 95% confidence interval [CI], 1.9-3.8; P = 2.4 × 10(-8)) and with rs72631567 on chromosome 2 (OR, 2.0; 95% CI, 1.6-2.5; P = 9.7 × 10(-9)). The association with A*33:01 was mediated by large effects for terbinafine-, fenofibrate-, and ticlopidine-related DILI. The variant on chromosome 2 was associated with DILI from a variety of drugs. Further phenotypic analysis indicated that the association between DILI and A*33:01 was significant genome wide for cholestatic and mixed DILI, but not for hepatocellular DILI; the polymorphism on chromosome 2 was associated with cholestatic and mixed DILI as well as hepatocellular DILI. We identified an association between rs28521457 (within the lipopolysaccharide-responsive vesicle trafficking, beach and anchor containing gene) and only hepatocellular DILI (OR, 2.1; 95% CI, 1.6-2.7; P = 4.8 × 10(-9)). We did not associate any specific drug classes with genetic

  15. Radiogenomics of clear cell renal cell carcinoma: preliminary findings of The Cancer Genome Atlas–Renal Cell Carcinoma (TCGA–RCC) Imaging Research Group

    PubMed Central

    Shinagare, Atul B.; Vikram, Raghu; Jaffe, Carl; Akin, Oguz; Kirby, Justin; Huang, Erich; Freymann, John; Sainani, Nisha I.; Sadow, Cheryl A.; Bathala, Tharakeswara K.; Rubin, Daniel L.; Oto, Aytekin; Heller, Matthew T.; Surabhi, Venkateswar R.; Katabathina, Venkat; Silverman, Stuart G.

    2015-01-01

    Purpose To investigate associations between imaging features and mutational status of clear cell renal cell carcinoma (ccRCC). Materials and methods This multi-institutional, multi-reader study included 103 patients (77 men; median age 59 years, range 34–79) with ccRCC examined with CT in 81 patients, MRI in 19, and both CT and MRI in three; images were downloaded from The Cancer Imaging Archive, an NCI-funded project for genome-mapping and analyses. Imaging features [size (mm), margin (well-defined or ill-defined), composition (solid or cystic), necrosis (for solid tumors: 0%, 1%–33%, 34%–66% or >66%), growth pattern (endophytic, <50% exophytic, or ≥50% exophytic), and calcification (present, absent, or indeterminate)] were reviewed independently by three readers blinded to mutational data. The association of imaging features with mutational status (VHL, BAP1, PBRM1, SETD2, KDM5C, and MUC4) was assessed. Results Median tumor size was 49 mm (range 14–162 mm), 73 (71%) tumors had well-defined margins, 98 (95%) tumors were solid, 95 (92%) showed presence of necrosis, 46 (45%) had ≥50% exophytic component, and 18 (19.8%) had calcification. VHL (n = 52) and PBRM1 (n = 24) were the most common mutations. BAP1 mutation was associated with ill-defined margin and presence of calcification (p = 0.02 and 0.002, respectively, Pearson’s χ2 test); MUC4 mutation was associated with an exophytic growth pattern (p = 0.002, Mann–Whitney U test). Conclusions BAP1 mutation was associated with ill-defined tumor margins and presence of calcification; MUC4 mutation was associated with exophytic growth. Given the known prognostic implications of BAP1 and MUC4 mutations, these results support using radiogenomics to aid in prognostication and management. PMID:25753955

  16. Radiogenomics of clear cell renal cell carcinoma: preliminary findings of The Cancer Genome Atlas-Renal Cell Carcinoma (TCGA-RCC) Imaging Research Group.

    PubMed

    Shinagare, Atul B; Vikram, Raghu; Jaffe, Carl; Akin, Oguz; Kirby, Justin; Huang, Erich; Freymann, John; Sainani, Nisha I; Sadow, Cheryl A; Bathala, Tharakeswara K; Rubin, Daniel L; Oto, Aytekin; Heller, Matthew T; Surabhi, Venkateswar R; Katabathina, Venkat; Silverman, Stuart G

    2015-08-01

    To investigate associations between imaging features and mutational status of clear cell renal cell carcinoma (ccRCC). This multi-institutional, multi-reader study included 103 patients (77 men; median age 59 years, range 34-79) with ccRCC examined with CT in 81 patients, MRI in 19, and both CT and MRI in three; images were downloaded from The Cancer Imaging Archive, an NCI-funded project for genome-mapping and analyses. Imaging features [size (mm), margin (well-defined or ill-defined), composition (solid or cystic), necrosis (for solid tumors: 0%, 1%-33%, 34%-66% or >66%), growth pattern (endophytic, <50% exophytic, or ≥50% exophytic), and calcification (present, absent, or indeterminate)] were reviewed independently by three readers blinded to mutational data. The association of imaging features with mutational status (VHL, BAP1, PBRM1, SETD2, KDM5C, and MUC4) was assessed. Median tumor size was 49 mm (range 14-162 mm), 73 (71%) tumors had well-defined margins, 98 (95%) tumors were solid, 95 (92%) showed presence of necrosis, 46 (45%) had ≥50% exophytic component, and 18 (19.8%) had calcification. VHL (n = 52) and PBRM1 (n = 24) were the most common mutations. BAP1 mutation was associated with ill-defined margin and presence of calcification (p = 0.02 and 0.002, respectively, Pearson's χ (2) test); MUC4 mutation was associated with an exophytic growth pattern (p = 0.002, Mann-Whitney U test). BAP1 mutation was associated with ill-defined tumor margins and presence of calcification; MUC4 mutation was associated with exophytic growth. Given the known prognostic implications of BAP1 and MUC4 mutations, these results support using radiogenomics to aid in prognostication and management.

  17. Single-Cell Genome and Group-Specific dsrAB Sequencing Implicate Marine Members of the Class Dehalococcoidia (Phylum Chloroflexi) in Sulfur Cycling

    PubMed Central

    Cooper, Myriel; Schreiber, Lars; Lloyd, Karen G.; Baker, Brett J.; Petersen, Dorthe G.; Jørgensen, Bo Barker; Stepanauskas, Ramunas; Reinhardt, Richard; Schramm, Andreas; Loy, Alexander; Adrian, Lorenz

    2016-01-01

    ABSTRACT The marine subsurface sediment biosphere is widely inhabited by bacteria affiliated with the class Dehalococcoidia (DEH), phylum Chloroflexi, and yet little is known regarding their metabolisms. In this report, genomic content from a single DEH cell (DEH-C11) with a 16S rRNA gene that was affiliated with a diverse cluster of 16S rRNA gene sequences prevalent in marine sediments was obtained from sediments of Aarhus Bay, Denmark. The distinctive gene content of this cell suggests metabolic characteristics that differ from those of known DEH and Chloroflexi. The presence of genes encoding dissimilatory sulfite reductase (Dsr) suggests that DEH could respire oxidized sulfur compounds, although Chloroflexi have never been implicated in this mode of sulfur cycling. Using long-range PCR assays targeting DEH dsr loci, dsrAB genes were amplified and sequenced from various marine sediments. Many of the amplified dsrAB sequences were affiliated with the DEH Dsr clade, which we propose equates to a family-level clade. This provides supporting evidence for the potential for sulfite reduction by diverse DEH species. DEH-C11 also harbored genes encoding reductases for arsenate, dimethyl sulfoxide, and halogenated organics. The reductive dehalogenase homolog (RdhA) forms a monophyletic clade along with RdhA sequences from various DEH-derived contigs retrieved from available metagenomes. Multiple facts indicate that this RdhA may not be a terminal reductase. The presence of other genes indicated that nutrients and energy may be derived from the oxidation of substituted homocyclic and heterocyclic aromatic compounds. Together, these results suggest that marine DEH play a previously unrecognized role in sulfur cycling and reveal the potential for expanded catabolic and respiratory functions among subsurface DEH. PMID:27143384

  18. Molecular cloning, genomic structure, and tissue distribution of EW135, a novel chicken egg white protein with group B scavenger receptor cysteine-rich domains.

    PubMed

    Yoo, Whayoung; Nakamura, Tomohiro; Asanuma, Hideki; Matsushita, Misao

    2013-11-01

    Approximately 80 proteins are reported to be present in chicken egg white. The major function of egg white proteins isolated so far is to defend the egg yolk against infections. We recently isolated a novel protein termed EW135 from chicken egg white. In this paper, we have determined the complete amino acid sequence of EW135 based on cDNA cloning. EW135 consists of 970 amino acids with a putative signal peptide of 17 amino acids. It is composed exclusively of tandem repeats of nine group B scavenger receptor cysteine-rich (SRCR) domains separated by eight seven-amino acid peptides. The features of consensus sequences found in the group B SRCR domain were well conserved in EW135. The EW135 gene consists of putative 11 exons, with each SRCR domain being encoded by a single exon. Reverse transcription PCR showed that EW135 is expressed in only the oviduct among the 11 types of tissues tested. EW135 is a second soluble protein belonging to the group B SRCR domain superfamily identified in chickens. One of the important functions of proteins belonging to the group B SRCR domain superfamily is to recognize pathogens in innate immunity. It is, therefore, conceivable that EW135 could be involved in host defense in egg white.

  19. Comparison of the prevalence and genomic characteristics of Clostridium difficile isolated from various production groups in a vertically integrated swine operation

    USDA-ARS?s Scientific Manuscript database

    The objective of this study was to compare the prevalence of Clostridium difficile among different age and production groups of swine in a vertically integrated swine operation in Texas in 2006. Isolation of C. difficile was performed utilizing an enrichment technique and restrictive media. Prelim...

  20. Transfusion-dependent thalassemia in Northern Sarawak: a molecular study to identify different genotypes in the multi-ethnic groups and the importance of genomic sequencing in unstudied populations.

    PubMed

    Tan, Jin-Ai M A; Chin, Saw-Sian; Ong, Gek-Bee; Mohamed Unni, Mohamed N; Soosay, Ashley E R; Gudum, Henry R; Kho, Siew-Leng; Chua, Kek-Heng; Chen, Jang J; George, Elizabeth

    2015-01-01

    Although thalassemia is a genetic hemoglobinopathy in Malaysia, there is limited data on thalassemia mutations in the indigenous groups. This study aims to identify the types of globin gene mutations in transfusion-dependent patients in Northern Sarawak. Blood was collected from 32 patients from the Malay, Chinese, Kedayan, Bisayah, Kadazandusun, Tagal, and Bugis populations. The α- and β-globin gene mutations were characterized using DNA amplification and genomic sequencing. Ten β- and 2 previously reported α-globin defects were identified. The Filipino β-deletion represented the majority of the β-thalassemia alleles in the indigenous patients. Homozygosity for the deletion was observed in all Bisayah, Kadazandusun and Tagal patients. The β-globin gene mutations in the Chinese patients were similar to the Chinese in West Malaysia. Hb Adana (HBA2:c.179G>A) and the -α(3.7)/αα deletion were detected in 5 patients. A novel 24-bp deletion in the α2-globin gene (HBA2:c.95 + 5_95 + 28delGGCTCCCTCCCCTGCTCCGACCCG) was identified by sequencing. Co-inheritance of α-thalassemia with β-thalassemia did not ameliorate the severity of thalassemia major in the patients. The Filipino β-deletion was the most common gene defect observed. Homozygosity for the Filipino β-deletion appears to be unique to the Malays in Sarawak. Genomic sequencing is an essential tool to detect rare genetic variants in the study of new populations. © 2014 S. Karger AG, Basel.

  1. From genomes to metabolomes: Understanding mechanisms of symbiosis and cell-cell signaling using the archaeal system Ignicoccus-Nanoarchaeum

    SciTech Connect

    Podar, Mircea ; Hettich, Robert ; Copie, Valerie; Bothner, Brian

    2016-12-16

    The main objective of this project was to use symbiotic Nanoarchaeaota, a group of thermophilic Archaea that are obligate symbionts/parasites on other Archaea, to develop an integrated multi-omic approach to study inter-species interactions as well as to understand fundamental mechanism that enable such relationships. As part of this grant we have achieved a number of important milestone on both technical and scientific levels. On the technical side, we developed immunofluorescence labeling and tracking methods to follow Nanoarchaeota in cultures and in environmental samples, we applied such methods in conjunction with flow cytometry to quantify and isolate uncultured representatives from the environment and characterized them by single cell genomics. On the proteomics side, we developed a more efficient and sensitive method to recover and semi-quantitatively measure membrane proteins, while achieving high total cellular proteome coverage (70-80% of the predicted proteome). Metabolomic analyses used complementary NMR and LC/GC mass spectrometry and led to the identification of novel lipids in these organisms as well as quantification of some of the major metabolites. Importantly, using several informatics approaches we were also able to integrate the transcriptomic, proteomic and metabolomic datasets, revealing aspects of the interspecies interaction that were not evident in the single omic analyses (manuscript in review). On the science side we determined that N. equitans and I. hospitalis are metabolically coupled and that N. equitans is strictly dependent on its host both for metabolic precursors and energetic needs. The actual mechanism by which small molecules move across the cell membrane remains unknown. The Ignicoccus host responds to the metabolic and energetic burned by upregulating of key primary metabolism steps and ATP synthesis. The two species have co-evolved, aspect that we determined by comparative genomics with other species of Ignicoccus

  2. Comparative genomics of Brassicaceae crops

    PubMed Central

    Sharma, Ashutosh; Li, Xiaonan; Lim, Yong Pyo

    2014-01-01

    The family Brassicaceae is one of the major groups of the plant kingdom and comprises diverse species of great economic, agronomic and scientific importance, including the model plant Arabidopsis. The sequencing of the Arabidopsis genome has revolutionized our knowledge in the field of plant biology and provides a foundation in genomics and comparative biology. Genomic resources have been utilized in Brassica for diversity analyses, construction of genetic maps and identification of agronomic traits. In Brassicaceae, comparative sequence analysis across the species has been utilized to understand genome structure, evolution and the detection of conserved genomic segments. In this review, we focus on the progress made in genetic resource development, genome sequencing and comparative mapping in Brassica and related species. The utilization of genomic resources and next-generation sequencing approaches in improvement of Brassica crops is also discussed. PMID:24987286

  3. Rethinking the capsid proteins of enveloped viruses: multifunctionality from genome packaging to genome transfection.

    PubMed

    Freire, João M; Santos, Nuno C; Veiga, Ana Salomé; Da Poian, Andrea T; Castanho, Miguel A R B

    2015-06-01

    Regardless of the debate on whether there is a place for viruses in the tree of life, it is consensual that they co-evolve with their hosts under the pressure of genome minimization. The abundance of multifunctional viral structural proteins is a consequence of this pressure. The molecular key to multifunctionality is the existence of intrinsically disordered domains together with ordered domains in the same protein. Capsid proteins, the hallmark of viruses, are not exceptions because they have coexisting ordered and disordered domains that are crucial for multifunctionality. It is also frequent to find supercharged proteins (i.e. proteins for which the net charge per unit molecular mass is > +0.75/kDa) among viral capsid proteins. All flaviviruses having annotated proteins in the ExPASy Viralzone database have supercharged capsid proteins. Moreover, cell-penetrating sequences/domains are frequent in viral proteins, even when they are not supercharged. Altogether, the findings strongly suggest that the ability to translocate membranes was acquired, conserved and optimized throughout the evolution of some viral proteins as part of their multifunctionality. The fitness of capsid proteins to translocate membranes carrying genomes was experimentally demonstrated with dengue virus capsid protein. This protein is potentially able to help the fusion process and translocate the RNA genome across the hemifused membrane formed by the viral envelope and the endosomal membrane. In addition, one of the cell-penetrating domains of the capsid protein also has antibacterial activity. This may be reminiscent of parasitic bacteria-bacteria competition for the same host and shed light on the origins of enveloped viruses. © 2015 FEBS.

  4. Complete genomic sequence analyses of the first group A giraffe rotavirus reveals close evolutionary relationship with rotaviruses infecting other members of the Artiodactyla.

    PubMed

    O'Shea, Helen; Mulherin, Emily; Matthijnssens, Jelle; McCusker, Matthew P; Collins, P J; Cashman, Olivia; Gunn, Lynda; Beltman, Marijke E; Fanning, Séamus

    2014-05-14

    Group A Rotaviruses (RVA) have been established as significant contributory agents of acute gastroenteritis in young children and many animal species. In 2008, we described the first RVA strain detected in a giraffe calf (RVA/Giraffe-wt/IRL/GirRV/2008/G10P[11]), presenting with acute diarrhoea. Molecular characterisation of the VP7 and VP4 genes revealed the bovine-like genotypes G10 and P[11], respectively. To further investigate the origin of this giraffe RVA strain, the 9 remaining gene segments were sequenced and analysed, revealing the following genotype constellation: G10-P[11]-I2-R2-C2-M2-A3-N2-T6-E2-H3. This genotype constellation is very similar to RVA strains isolated from cattle or other members of the artiodactyls. Phylogenetic analyses confirmed the close relationship between GirRV and RVA strains with a bovine-like genotype constellation detected from several host species, including humans. These results suggest that RVA strain GirRV was the result of an interspecies transmission from a bovine host to the giraffe calf. However, we cannot rule out completely that this bovine-like RVA genotype constellation may be enzootic in giraffes. Future RVA surveillance in giraffes may answer this intriguing question. Copyright © 2014 Elsevier B.V. All rights reserved.

  5. Genome Mining of Amino Group Carrier Protein-Mediated Machinery: Discovery and Biosynthetic Characterization of a Natural Product with Unique Hydrazone Unit.

    PubMed

    Matsuda, Kenichi; Hasebe, Fumihito; Shiwa, Yuh; Kanesaki, Yu; Tomita, Takeo; Yoshikawa, Hirofumi; Shin-Ya, Kazuo; Kuzuyama, Tomohisa; Nishiyama, Makoto

    2017-01-20

    We recently revealed that a Streptomyces strain possesses the gene encoding amino group carrier protein (AmCP). AmCP is involved in the biosynthesis of a previously unidentified nonproteinogenic amino acid, (2S,6R)-diamino-(5R,7)-dihydroxy-heptanoic acid (DADH), which is a core compound for the synthesis of the dipeptide-containing novel natural product vazabitide A. We used polymerase chain reaction (PCR) screening to investigate the diversity of the biosynthetic machinery that uses AmCP; the results revealed that genes encoding AmCP are widely distributed among actinomycetes. The heterologous expression of the AmCP-containing gene cluster from Streptomyces sp. SoC090715LN-17 led to the discovery of s56-p1, a novel natural product. The structure of s56-p1 was determined by spectroscopic analysis; the results revealed that s56-p1 has a putative DADH-derived molecule as the core and also possesses a unique hydrazone unit that is rarely observed in natural products. Our results pave the way for investigations of unexploited AmCP-mediated biosynthesis routes among actinomycetes and of the biosynthetic mechanism of the unique hydrazone unit.

  6. Genomic and functional characterization of the modular broad-host-range RA3 plasmid, the archetype of the IncU group.

    PubMed

    Kulinska, Anna; Czeredys, Magdalena; Hayes, Finbarr; Jagura-Burdzy, Grazyna

    2008-07-01

    IncU plasmids are a distinctive group of mobile elements with highly conserved backbone functions and variable antibiotic resistance gene cassettes. The IncU archetype is conjugative plasmid RA3, whose sequence (45,909 bp) shows it to be a mosaic, modular replicon with a class I integron different from that of other IncU replicons. Functional analysis demonstrated that RA3 possesses a broad host range and can efficiently self-transfer, replicate, and be maintained stably in alpha-, beta-, and gammaproteobacteria. RA3 contains 50 open reading frames clustered in distinct functional modules. The replication module encompasses the repA and repB genes embedded in long repetitive sequences. RepA, which is homologous to antitoxin proteins from alpha- and gammaproteobacteria, contains a Cro/cI-type DNA-binding domain present in the XRE family of transcriptional regulators. The repA promoter is repressed by RepA and RepB. The minireplicon encompasses repB and the downstream repetitive sequence r1/r2. RepB shows up to 80% similarity to putative replication initiation proteins from environmental plasmids of beta- and gammaproteobacteria, as well as similarity to replication proteins from alphaproteobacteria and Firmicutes. Stable maintenance functions of RA3 are most like those of IncP-1 broad-host-range plasmids and comprise the active partitioning apparatus formed by IncC (ParA) and KorB (ParB), the antirestriction protein KlcA, and accessory stability components KfrA and KfrC. The RA3 origin of transfer was localized experimentally between the maintenance and conjugative-transfer operons. The putative conjugative-transfer module is highly similar in organization and in its products to transfer regions of certain broad-host-range environmental plasmids.

  7. Comparative mitochondrial genomics in zygomycetes: bacteria-like RNase P RNAs, mobile elements and a close source of the group I intron invasion in angiosperms

    PubMed Central

    Seif, Elias; Leigh, Jessica; Liu, Yu; Roewer, Ingeborg; Forget, Lise; Lang, B. Franz

    2005-01-01

    To generate data for comparative analyses of zygomycete mitochondrial gene expression, we sequenced mtDNAs of three distantly related zygomycetes, Rhizopus oryzae, Mortierella verticillata and Smittium culisetae. They all contain the standard fungal mitochondrial gene set, plus rnpB, the gene encoding the RNA subunit of the mitochondrial RNase P (mtP-RNA) and rps3, encoding ribosomal protein S3 (the latter lacking in R.oryzae). The mtP-RNAs of R.oryzae and of additional zygomycete relatives have the most eubacteria-like RNA structures among fungi. Precise mapping of the 5′ and 3′ termini of the R.oryzae and M.verticillata mtP-RNAs confirms their expression and processing at the exact sites predicted by secondary structure modeling. The 3′ RNA processing of zygomycete mitochondrial mRNAs, SSU-rRNA and mtP-RNA occurs at the C-rich sequence motifs similar to those identified in fission yeast and basidiomycete mtDNAs. The C-rich motifs are included in the mature transcripts, and are likely generated by exonucleolytic trimming of RNA 3′ termini. Zygomycete mtDNAs feature a variety of insertion elements: (i) mtDNAs of R.oryzae and M.verticillata were subject to invasions by double hairpin elements; (ii) genes of all three species contain numerous mobile group I introns, including one that is closest to an intron that invaded angiosperm mtDNAs; and (iii) at least one additional case of a mobile element, characterized by a homing endonuclease insertion between partially duplicated genes [Paquin,B., Laforest,M.J., Forget,L., Roewer,I., Wang,Z., Longcore,J. and Lang,B.F. (1997) Curr. Genet., 31, 380–395]. The combined mtDNA-encoded proteins contain insufficient phylogenetic signal to demonstrate monophyly of zygomycetes. PMID:15689432

  8. Mitochondrial genomics and CD4 T-cell count recovery after antiretroviral therapy initiation in AIDS clinical trials group study 384.

    PubMed

    Grady, Benjamin J; Samuels, David C; Robbins, Gregory K; Selph, Doug; Canter, Jeffrey A; Pollard, Richard B; Haas, David W; Shafer, Robert; Kalams, Spyros A; Murdock, Deborah G; Ritchie, Marylyn D; Hulgan, Todd

    2011-12-01

    Mitochondrial DNA (mtDNA) variation has been associated with time to progression to AIDS and adverse effects from antiretroviral therapy (ART). In this study, full mitochondrial DNA (mtDNA) sequence data from US-based adult participants in the AIDS Clinical Trials Group study 384 was used to assess associations between mtDNA variants and CD4 T-cell recovery with ART. Full mtDNA sequence was determined using chip-based array sequencing. Sequence and CD4 cell count data was available at baseline and after ART initiation for 423 subjects with HIV RNA levels <400 copies per milliliter plasma. The primary outcome was change in CD4 count of ≥100 cells per cubic millimeter from baseline. Analyses were adjusted for baseline age, CD4 cell count, HIV RNA, and naive:memory CD4 cell ratio. Race-stratified analysis of mtDNA variants with a minor allele frequency >1% revealed multiple mtDNA variants marginally associated (P < 0.05 before Bonferroni correction) with CD4 cell recovery. The most significant single nucleotide polymorphism associations were those tagging the African L2 haplogroup, which was associated with a decreased likelihood of ≥100 cells per cubic millimeter CD4 count increase at week 48 in non-Hispanic blacks (adjusted odds ratio = 0.17; 95% confidence interval = 0.06 to 0.53; P = 0.002). An African mtDNA haplogroup was associated with CD4 cell recovery after ART in this clinical trial population. These initial findings warrant replication and further investigation to confirm the role of mtDNA variation in CD4 cell recovery during ART.

  9. The potential role of sexual conflict and sexual selection in shaping the genomic distribution of Mito-nuclear genes.

    PubMed

    Dean, Rebecca; Zimmer, Fabian; Mank, Judith E

    2014-05-01

    Mitochondrial interactions with the nuclear genome represent one of life's most important co-evolved mutualisms. In many organisms, mitochondria are maternally inherited, and in these cases, co-transmission between the mitochondrial and nuclear genes differs across different parts of the nuclear genome, with genes on the X chromosome having two-third probability of co-transmission, compared with one-half for genes on autosomes. These asymmetrical inheritance patterns of mitochondria and different parts of the nuclear genome have the potential to put certain gene combinations in inter-genomic co-adaptation or conflict. Previous work in mammals found strong evidence that the X chromosome has a dearth of genes that interact with the mitochondria (mito-nuclear genes), suggesting that inter-genomic conflict might drive genes off the X onto the autosomes for their male-beneficial effects. Here, we developed this idea to test coadaptation and conflict between mito-nuclear gene combinations across phylogenetically independent sex chromosomes on a far broader scale. We found that, in addition to therian mammals, only Caenorhabditis elegans showed an under-representation of mito-nuclear genes on the sex chromosomes. The remaining species studied showed no overall bias in their distribution of mito-nuclear genes. We discuss possible factors other than inter-genomic conflict that might drive the genomic distribution of mito-nuclear genes.

  10. 78 FR 64222 - National Human Genome Research Institute; Notice of Closed Meetings

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-10-28

    ... HUMAN SERVICES National Institutes of Health National Human Genome Research Institute; Notice of Closed... of Committee: National Human Genome Research Institute Initial Review Group; Genome Research Review..., Ph.D., Scientific Review Officer, Office of Scientific Review, National Human Genome...

  11. 76 FR 28056 - National Human Genome Research Institute; Notice of Closed Meetings

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-05-13

    ... HUMAN SERVICES National Institutes of Health National Human Genome Research Institute; Notice of Closed... of Committee: National Human Genome Research Institute Initial Review Group, Genome Research Review... Scientific Review, National Human Genome Research Institute, National Institutes of Health, Bethesda,...

  12. Genome-to-Watershed Predictive Understanding of Terrestrial Environments

    NASA Astrophysics Data System (ADS)

    Hubbard, S. S.; Agarwal, D.; Banfield, J. F.; Beller, H. R.; Brodie, E.; Long, P.; Nico, P. S.; Steefel, C. I.; Tokunaga, T. K.; Williams, K. H.

    2014-12-01

    Although terrestrial environments play a critical role in cycling water, greenhouse gasses, and other life-critical elements, the complexity of interactions among component microbes, plants, minerals, migrating fluids and dissolved constituents hinders predictive understanding of system behavior. The 'Sustainable Systems 2.0' project is developing genome-to-watershed scale predictive capabilities to quantify how the microbiome affects biogeochemical watershed functioning, how watershed-scale hydro-biogeochemical processes affect microbial functioning, and how these interactions co-evolve with climate and land-use changes. Development of such predictive capabilities is critical for guiding the optimal management of water resources, contaminant remediation, carbon stabilization, and agricultural sustainability - now and with global change. Initial investigations are focused on floodplains in the Colorado River Basin, and include iterative model development, experiments and observations with an early emphasis on subsurface aspects. Field experiments include local-scale experiments at Rifle CO to quantify spatiotemporal metabolic and geochemical responses to O2and nitrate amendments as well as floodplain-scale monitoring to quantify genomic and biogeochemical response to natural hydrological perturbations. Information obtained from such experiments are represented within GEWaSC, a Genome-Enabled Watershed Simulation Capability, which is being developed to allow mechanistic interrogation of how genomic information stored in a subsurface microbiome affects biogeochemical cycling. This presentation will describe the genome-to-watershed scale approach as well as early highlights associated with the project. Highlights include: first insights into the diversity of the subsurface microbiome and metabolic roles of organisms involved in subsurface nitrogen, sulfur and hydrogen and carbon cycling; the extreme variability of subsurface DOC and hydrological controls on carbon and

  13. Sequencing the genome of Marssonina brunnea reveals fungus-poplar co-evolution

    PubMed Central

    2012-01-01

    Background The fungus Marssonina brunnea is a causal pathogen of Marssonina leaf spot that devastates poplar plantations by defoliating susceptible trees before normal fall leaf drop. Results We sequence the genome of M. brunnea with a size of 52 Mb assembled into 89 scaffolds, representing the first sequenced Dermateaceae genome. By inoculating this fungus onto a poplar hybrid clone, we investigate how M. brunnea interacts and co-evolves with its host to colonize poplar leaves. While a handful of virulence genes in M. brunnea, mostly from the LysM family, are detected t