Gcn4-Mediator Specificity Is Mediated by a Large and Dynamic Fuzzy Protein-Protein Complex.

PubMed

Tuttle, Lisa M; Pacheco, Derek; Warfield, Linda; Luo, Jie; Ranish, Jeff; Hahn, Steven; Klevit, Rachel E

2018-03-20

Transcription activation domains (ADs) are inherently disordered proteins that often target multiple coactivator complexes, but the specificity of these interactions is not understood. Efficient transcription activation by yeast Gcn4 requires its tandem ADs and four activator-binding domains (ABDs) on its target, the Mediator subunit Med15. Multiple ABDs are a common feature of coactivator complexes. We find that the large Gcn4-Med15 complex is heterogeneous and contains nearly all possible AD-ABD interactions. Gcn4-Med15 forms via a dynamic fuzzy protein-protein interface, where ADs bind the ABDs in multiple orientations via hydrophobic regions that gain helicity. This combinatorial mechanism allows individual low-affinity and specificity interactions to generate a biologically functional, specific, and higher affinity complex despite lacking a defined protein-protein interface. This binding strategy is likely representative of many activators that target multiple coactivators, as it allows great flexibility in combinations of activators that can cooperate to regulate genes with variable coactivator requirements. Copyright © 2018 The Authors. Published by Elsevier Inc. All rights reserved.

PRIC320, a transcription coactivator, isolated from peroxisome proliferator-binding protein complex.

PubMed

Surapureddi, Sailesh; Viswakarma, Navin; Yu, Songtao; Guo, Dongsheng; Rao, M Sambasiva; Reddy, Janardan K

2006-05-05

Ciprofibrate, a potent peroxisome proliferator, induces pleiotropic responses in liver by activating peroxisome proliferator-activated receptor alpha (PPARalpha), a nuclear receptor. Transcriptional regulation by liganded nuclear receptors involves the participation of coregulators that form multiprotein complexes possibly to achieve cell and gene specific transcription. SDS-PAGE and matrix-assisted laser desorption/ionization reflection time-of-flight mass spectrometric analyses of ciprofibrate-binding proteins from liver nuclear extracts obtained using ciprofibrate-Sepharose affinity matrix resulted in the identification of a new high molecular weight nuclear receptor coactivator, which we designated PRIC320. The full-length human cDNA encoding this protein has an open-reading frame that codes for a 320kDa protein containing 2882 amino acids. PRIC320 contains five LXXLL signature motifs that mediate interaction with nuclear receptors. PRIC320 binds avidly to nuclear receptors PPARalpha, CAR, ERalpha, and RXR, but only minimally with PPARgamma. PRIC320 also interacts with transcription cofactors CBP, PRIP, and PBP. Immunoprecipitation-immunoblotting as well as cellular localization studies confirmed the interaction between PPARalpha and PRIC320. PRIC320 acts as a transcription coactivator by stimulating PPARalpha-mediated transcription. We conclude that ciprofibrate, a PPARalpha ligand, binds a multiprotein complex and PRIC320 cloned from this complex functions as a nuclear receptor coactivator.

Inositol polyphosphate multikinase is a coactivator for serum response factor-dependent induction of immediate early genes

PubMed Central

Kim, Eunha; Tyagi, Richa; Lee, Joo-Young; Park, Jina; Kim, Young-ran; Beon, Jiyoon; Chen, Po Yu; Cha, Jiyoung Y.; Snyder, Solomon H.; Kim, Seyun

2013-01-01

Inositol polyphosphate multikinase (IPMK) is a notably pleiotropic protein. It displays both inositol phosphate kinase and phosphatidylinositol kinase catalytic activities. Noncatalytically, IPMK stabilizes the mammalian target of rapamycin complex 1 and acts as a transcriptional coactivator for CREB-binding protein/E1A binding protein p300 and tumor suppressor protein p53. Serum response factor (SRF) is a major transcription factor for a wide range of immediate early genes. We report that IPMK, in a noncatalytic role, is a transcriptional coactivator for SRF mediating the transcription of immediate early genes. Stimulation by serum of many immediate early genes is greatly reduced by IPMK deletion. IPMK stimulates expression of these genes, an influence also displayed by catalytically inactive IPMK. IPMK acts by binding directly to SRF and thereby enhancing interactions of SRF with the serum response element of diverse genes. PMID:24248338

Ligand-independent activation of the oestrogen receptor by mutation of a conserved tyrosine.

PubMed Central

White, R; Sjöberg, M; Kalkhoven, E; Parker, M G

1997-01-01

The oestrogen receptor is a member of the nuclear receptor family of transcription factors which, on binding the steroid hormone 17beta-oestradiol, interacts with co-activator proteins and stimulates gene expression. Replacement of a single tyrosine in the hormone-binding domain generated activated forms of the receptor which stimulated transcription in the absence of hormone. This increased activation is related to a decrease in hydrophobicity and a reduction in size of the side chain of the amino acid with which the tyrosine is replaced. Ligand-independent, in common with ligand-dependent transcriptional activation, requires an amphipathic alpha-helix at the C-terminus of the ligand-binding domain which is essential for the interaction of the receptor with a number of potential co-activator proteins. In contrast to the wild-type protein, constitutively active receptors were able to bind both the receptor-interacting protein RIP-140 and the steroid receptor co-activator SRC-1 in a ligand-independent manner, although in the case of SRC-1 this was only evident when the receptors were prebound to DNA. We propose, therefore, that this tyrosine is required to maintain the receptor in a transcriptionally inactive state in the absence of hormone. Modification of this residue may generate a conformational change in the ligand-binding domain of the receptor to form an interacting surface which allows the recruitment of co-activators independent of hormone binding. This suggests that this tyrosine may be a target for a different signalling pathway which forms an alternative mechanism of activating oestrogen receptor-mediated transcription. PMID:9135157

Phosphorylation of ETS Transcription Factor ER81 in a Complex with Its Coactivators CREB-Binding Protein and p300

PubMed Central

Papoutsopoulou, Stamatia; Janknecht, Ralf

2000-01-01

The ETS protein ER81 is a DNA-binding factor capable of enhancing gene transcription and is implicated in cellular transformation, but presently the mechanisms of its actions are unclear. In this report, ER81 is shown to coimmunoprecipitate with the transcriptional coactivator CREB-binding protein (CBP) and the related p300 protein (together referred to as CBP/p300). Moreover, confocal laser microscopic studies demonstrated that ER81 and p300 colocalized to nuclear speckles. In vitro and in vivo interaction studies revealed that ER81 amino acids 249 to 429, which encompass the ETS DNA-binding domain, are responsible for binding to CBP/p300. However, mutation of a putative protein-protein interaction motif, LXXLL, in the ETS domain of ER81 did not affect interaction with CBP/p300, whereas DNA binding of ER81 was abolished. Furthermore, two regions within CBP, amino acids 451 to 721 and 1891 to 2175, are capable of binding to ER81. Consistent with the physical interaction between ER81 and the coactivators CBP and p300, ER81 transcriptional activity was potentiated by CBP/p300 overexpression. Moreover, an ER81-associated protein kinase activity was enhanced upon p300 overexpression. This protein kinase phosphorylates ER81 on serines 191 and 216, and mutation of these phosphorylation sites increased ER81 transcriptional activity in Mv1Lu cells but not in HeLa cells. Altogether, our data elucidate the mechanism of how ER81 regulates gene transcription, through interaction with the coactivators CBP and p300 and an associated kinase that may cell type specifically modulate the ability of ER81 to activate gene transcription. PMID:10982847

Coiled-coil coactivators play a structural role mediating interactions in hypoxia-inducible factor heterodimerization

DOE PAGES

Guo, Yirui; Scheuermann, Thomas H.; Partch, Carrie L.; ...

2015-01-27

The hypoxia-inducible factor complex (HIF-α·aryl hydrocarbon receptor nuclear translocator (ARNT)) requires association with several transcription coactivators for a successful cellular response to hypoxic stress. In addition to the conventional global transcription coactivator CREB-binding protein/p300 (CBP/p300) that binds to the HIF-α transactivation domain, a new group of transcription coactivators called the coiled-coil coactivators (CCCs) interact directly with the second PER-ARNT-SIM (PAS) domain of ARNT (ARNT PAS-B). These less studied transcription coactivators play essential roles in the HIF-dependent hypoxia response, and CCC misregulation is associated with several forms of cancer. To better understand CCC protein recruitment by the heterodimeric HIF transcription factor,more » we used x-ray crystallography, NMR spectroscopy, and biochemical methods to investigate the structure of the ARNT PAS-B domain in complex with the C-terminal fragment of a coiled-coil coactivator protein, transforming acidic coiled-coil coactivator 3 (TACC3). We found that the HIF-2α PAS-B domain also directly interacts with TACC3, motivating an NMR data-derived model suggesting a means by which TACC3 could form a ternary complex with HIF-2α PAS-B and ARNT PAS-B via β-sheet/coiled-coil interactions. Furthermore, these findings suggest that TACC3 could be recruited as a bridge to cooperatively mediate between the HIF-2α PAS-B·ARNT PAS-B complex, thereby participating more directly in HIF-dependent gene transcription than previously anticipated.« less

Structural and Biochemical Basis for the Binding Selectivity of Peroxisome Proliferator-activated Receptor [gamma] to PGC-1[alpha

DOE Office of Scientific and Technical Information (OSTI.GOV)

Li, Yong; Kovach, Amanda; Suino-Powell, Kelly

2008-07-23

The functional interaction between the peroxisome proliferator-activated receptor {gamma} (PPAR{gamma}) and its coactivator PGC-1{alpha} is crucial for the normal physiology of PPAR{gamma} and its pharmacological response to antidiabetic treatment with rosiglitazone. Here we report the crystal structure of the PPAR{gamma} ligand-binding domain bound to rosiglitazone and to a large PGC-1{alpha} fragment that contains two LXXLL-related motifs. The structure reveals critical contacts mediated through the first LXXLL motif of PGC-1{alpha} and the PPAR{gamma} coactivator binding site. Through a combination of biochemical and structural studies, we demonstrate that the first LXXLL motif is the most potent among all nuclear receptor coactivator motifsmore » tested, and only this motif of the two LXXLL-related motifs in PGC-1{alpha} is capable of binding to PPAR{gamma}. Our studies reveal that the strong interaction of PGC-1{alpha} and PPAR{gamma} is mediated through both hydrophobic and specific polar interactions. Mutations within the context of the full-length PGC-1{alpha} indicate that the first PGC-1{alpha} motif is necessary and sufficient for PGC-1{alpha} to coactivate PPAR{gamma} in the presence or absence of rosiglitazone. These results provide a molecular basis for specific recruitment and functional interplay between PPAR{gamma} and PGC-1{alpha} in glucose homeostasis and adipocyte differentiation.« less

DOE Office of Scientific and Technical Information (OSTI.GOV)

Guo, Yirui; Scheuermann, Thomas H.; Partch, Carrie L.

The hypoxia-inducible factor complex (HIF-α·aryl hydrocarbon receptor nuclear translocator (ARNT)) requires association with several transcription coactivators for a successful cellular response to hypoxic stress. In addition to the conventional global transcription coactivator CREB-binding protein/p300 (CBP/p300) that binds to the HIF-α transactivation domain, a new group of transcription coactivators called the coiled-coil coactivators (CCCs) interact directly with the second PER-ARNT-SIM (PAS) domain of ARNT (ARNT PAS-B). These less studied transcription coactivators play essential roles in the HIF-dependent hypoxia response, and CCC misregulation is associated with several forms of cancer. To better understand CCC protein recruitment by the heterodimeric HIF transcription factor,more » we used x-ray crystallography, NMR spectroscopy, and biochemical methods to investigate the structure of the ARNT PAS-B domain in complex with the C-terminal fragment of a coiled-coil coactivator protein, transforming acidic coiled-coil coactivator 3 (TACC3). We found that the HIF-2α PAS-B domain also directly interacts with TACC3, motivating an NMR data-derived model suggesting a means by which TACC3 could form a ternary complex with HIF-2α PAS-B and ARNT PAS-B via β-sheet/coiled-coil interactions. Furthermore, these findings suggest that TACC3 could be recruited as a bridge to cooperatively mediate between the HIF-2α PAS-B·ARNT PAS-B complex, thereby participating more directly in HIF-dependent gene transcription than previously anticipated.« less

Structural and Functional Impacts of ER Coactivator Sequential Recruitment.

PubMed

Yi, Ping; Wang, Zhao; Feng, Qin; Chou, Chao-Kai; Pintilie, Grigore D; Shen, Hong; Foulds, Charles E; Fan, Guizhen; Serysheva, Irina; Ludtke, Steven J; Schmid, Michael F; Hung, Mien-Chie; Chiu, Wah; O'Malley, Bert W

2017-09-07

Nuclear receptors recruit multiple coactivators sequentially to activate transcription. This "ordered" recruitment allows different coactivator activities to engage the nuclear receptor complex at different steps of transcription. Estrogen receptor (ER) recruits steroid receptor coactivator-3 (SRC-3) primary coactivator and secondary coactivators, p300/CBP and CARM1. CARM1 recruitment lags behind the binding of SRC-3 and p300 to ER. Combining cryo-electron microscopy (cryo-EM) structure analysis and biochemical approaches, we demonstrate that there is a close crosstalk between early- and late-recruited coactivators. The sequential recruitment of CARM1 not only adds a protein arginine methyltransferase activity to the ER-coactivator complex, it also alters the structural organization of the pre-existing ERE/ERα/SRC-3/p300 complex. It induces a p300 conformational change and significantly increases p300 HAT activity on histone H3K18 residues, which, in turn, promotes CARM1 methylation activity on H3R17 residues to enhance transcriptional activity. This study reveals a structural role for a coactivator sequential recruitment and biochemical process in ER-mediated transcription. Copyright © 2017 Elsevier Inc. All rights reserved.

The transcriptional co-activator p/CIP (NCoA-3) is up-regulated by STAT6 and serves as a positive regulator of transcriptional activation by STAT6.

PubMed

Arimura, Akinori; vn Peer, Maartje; Schröder, Andreas J; Rothman, Paul B

2004-07-23

Transcriptional activation by signal transducer and activator of transcription 6 (STAT6) has been shown to require the direct interaction not only with co-activators such as p300 and cAMP-responsive element-binding protein-binding protein (CBP) but also with nuclear co-activator 1, a member of the p160/steroid receptor co-activator family. Among the p160/steroid receptor co-activators, only p/CIP (nuclear co-activator 3) has been shown to be up-regulated by interleukin (IL)-4 in B cells through a STAT-6-dependent mechanism using Gene-Chip analysis. In this study, we have investigated the function of p/CIP in the transcriptional activation by STAT6. We found that p/CIP indirectly interacted with STAT6 via p300, and overexpression of the CBP-interacting domain of p/CIP (p/CIP(947-1084)) prevented the interaction of p/CIP with STAT6 by blocking the binding of p/CIP to p300. Whereas expression of p/CIP(947-1084) resulted in a marked reduction of STAT6-mediated transactivation, overexpression of wild type p/CIP resulted in significant enhancement of it. In addition, p/CIP(947-1084) markedly reduced CD23 expression on B cells stimulated with IL-4, whereas overexpression of wild type p/CIP enhanced it. Chromatin immunoprecipitations demonstrate that IL-4 increases the interaction of p/CIP with the murine immunoglobulin heavy chain germ line epsilon promoter in B cells. These results suggest that p/CIP positively regulates STAT6 transcriptional activation through formation of a STAT6, p300/CBP, and p/CIP complex.

Nuclear receptor ERR alpha and coactivator PGC-1 beta are effectors of IFN-gamma-induced host defense.

PubMed

Sonoda, Junichiro; Laganière, Josée; Mehl, Isaac R; Barish, Grant D; Chong, Ling-Wa; Li, Xiangli; Scheffler, Immo E; Mock, Dennis C; Bataille, Alain R; Robert, Francois; Lee, Chih-Hao; Giguère, Vincent; Evans, Ronald M

2007-08-01

Macrophage activation by the proinflammatory cytokine interferon-gamma (IFN-gamma) is a critical component of the host innate response to bacterial pathogenesis. However, the precise nature of the IFN-gamma-induced activation pathway is not known. Here we show using genome-wide expression and chromatin-binding profiling that IFN-gamma induces the expression of many nuclear genes encoding mitochondrial respiratory chain machinery via activation of the nuclear receptor ERR alpha (estrogen-related receptor alpha, NR3B1). Studies with macrophages lacking ERR alpha demonstrate that it is required for induction of mitochondrial reactive oxygen species (ROS) production and efficient clearance of Listeria monocytogenes (LM) in response to IFN-gamma. As a result, mice lacking ERR alpha are susceptible to LM infection, a phenotype that is localized to bone marrow-derived cells. Furthermore, we found that IFN-gamma-induced activation of ERR alpha depends on coactivator PGC-1 beta (peroxisome proliferator-activated receptor gamma coactivator-1 beta), which appears to be a direct target for the IFN-gamma/STAT-1 signaling cascade. Thus, ERR alpha and PGC-1 beta act together as a key effector of IFN-gamma-induced mitochondrial ROS production and host defense.

Pax6 Represses Androgen Receptor-Mediated Transactivation by Inhibiting Recruitment of the Coactivator SPBP

PubMed Central

Johnsen, Sylvia Sagen; Kaino, Katrine; Sjøttem, Eva; Johansen, Terje

2011-01-01

The androgen receptor (AR) has a central role in development and maintenance of the male reproductive system and in the etiology of prostate cancer. The transcription factor Pax6 has recently been reported to act as a repressor of AR and to be hypermethylated in prostate cancer cells. SPBP is a transcriptional regulator that previously has been shown to enhance the activity of Pax6. In this study we have identified SPBP to act as a transcriptional coactivator of AR. We also show that Pax6 inhibits SPBP-mediated enhancement of AR activity on the AR target gene probasin promoter, a repression that was partly reversed by increased expression of SPBP. Enhanced expression of Pax6 reduced the amount of SPBP associated with the probasin promoter when assayed by ChIP in HeLa cells. We mapped the interaction between both AR and SPBP, and AR and Pax6 to the DNA-binding domains of the involved proteins. Further binding studies revealed that Pax6 and SPBP compete for binding to AR. These results suggest that Pax6 represses AR activity by displacing and/or inhibiting recruitment of coactivators to AR target promoters. Understanding the mechanism for inhibition of AR coactivators can give rise to molecular targeted drugs for treatment of prostate cancer. PMID:21935435

A novel principle for partial agonism of liver X receptor ligands. Competitive recruitment of activators and repressors.

PubMed

Albers, Michael; Blume, Beatrix; Schlueter, Thomas; Wright, Matthew B; Kober, Ingo; Kremoser, Claus; Deuschle, Ulrich; Koegl, Manfred

2006-02-24

Partial, selective activation of nuclear receptors is a central issue in molecular endocrinology but only partly understood. Using LXRs as an example, we show here that purely agonistic ligands can be clearly and quantitatively differentiated from partial agonists by the cofactor interactions they induce. Although a pure agonist induces a conformation that is incompatible with the binding of repressors, partial agonists such as GW3965 induce a state where the interaction not only with coactivators, but also corepressors is clearly enhanced over the unliganded state. The activities of the natural ligand 22(R)-hydroxycholesterol and of a novel quinazolinone ligand, LN6500 can be further differentiated from GW3965 and T0901317 by their weaker induction of coactivator binding. Using biochemical and cell-based assays, we show that the natural ligand of LXR is a comparably weak partial agonist. As predicted, we find that a change in the coactivator to corepressor ratio in the cell will affect NCoR recruiting compounds more dramatically than NCoR-dissociating compounds. Our data show how competitive binding of coactivators and corepressors can explain the tissue-specific behavior of partial agonists and open up new routes to a rational design of partial agonists for LXRs.

The coactivator CBP stimulates human T-cell lymphotrophic virus type I Tax transactivation in vitro.

PubMed

Kashanchi, F; Duvall, J F; Kwok, R P; Lundblad, J R; Goodman, R H; Brady, J N

1998-12-18

Tax interacts with the cellular cyclic AMP-responsive element binding protein (CREB) and facilitates the binding of the coactivator CREB binding protein (CBP), forming a multimeric complex on the cyclic AMP-responsive element (CRE)-like sites in the human T-cell lymphotrophic virus type I (HTLV-I) promoter. The trimeric complex is believed to recruit additional regulatory proteins to the HTLV-I long terminal repeat, but there has been no direct evidence that CBP is required for Tax-mediated transactivation. We present evidence that Tax and CBP activate transcription from the HTLV-I 21 base pair repeats on naked DNA templates. Transcriptional activation of the HTLV-I sequences required both Tax and CBP and could be mediated by either the N-terminal activation domain of CBP or the full-length protein. Fluorescence polarization binding assays indicated that CBP does not markedly enhance the affinity of Tax for the trimeric complex. Transcription analyses suggest that CBP activates Tax-dependent transcription by promoting transcriptional initiation and reinitiation. The ability of CBP to activate the HTLV-I promoter does not involve the stabilization of Tax binding, but rather depends upon gene activation properties of the co-activator that function in the context of a naked DNA template.

Multiple Binding Modes between HNF4[alpha] and the LXXLL Motifs of PGC-1[alpha] Lead to Full Activation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rha, Geun Bae; Wu, Guangteng; Shoelson, Steven E.

2010-04-15

Hepatocyte nuclear factor 4{alpha} (HNF4{alpha}) is a novel nuclear receptor that participates in a hierarchical network of transcription factors regulating the development and physiology of such vital organs as the liver, pancreas, and kidney. Among the various transcriptional coregulators with which HNF4{alpha} interacts, peroxisome proliferation-activated receptor {gamma} (PPAR{gamma}) coactivator 1{alpha} (PGC-1{alpha}) represents a novel coactivator whose activation is unusually robust and whose binding mode appears to be distinct from that of canonical coactivators such as NCoA/SRC/p160 family members. To elucidate the potentially unique molecular mechanism of PGC-1{alpha} recruitment, we have determined the crystal structure of HNF4{alpha} in complex with amore » fragment of PGC-1{alpha} containing all three of its LXXLL motifs. Despite the presence of all three LXXLL motifs available for interactions, only one is bound at the canonical binding site, with no additional contacts observed between the two proteins. However, a close inspection of the electron density map indicates that the bound LXXLL motif is not a selected one but an averaged structure of more than one LXXLL motif. Further biochemical and functional studies show that the individual LXXLL motifs can bind but drive only minimal transactivation. Only when more than one LXXLL motif is involved can significant transcriptional activity be measured, and full activation requires all three LXXLL motifs. These findings led us to propose a model wherein each LXXLL motif has an additive effect, and the multiple binding modes by HNF4{alpha} toward the LXXLL motifs of PGC-1{alpha} could account for the apparent robust activation by providing a flexible mechanism for combinatorial recruitment of additional coactivators and mediators.« less

Interaction of the Transactivation Domain of B-Myb with the TAZ2 Domain of the Coactivator p300: Molecular Features and Properties of the Complex

PubMed Central

Oka, Ojore; Waters, Lorna C.; Strong, Sarah L.; Dosanjh, Nuvjeevan S.; Veverka, Vaclav; Muskett, Frederick W.; Renshaw, Philip S.; Klempnauer, Karl-Heinz; Carr, Mark D.

2012-01-01

The transcription factor B-Myb is a key regulator of the cell cycle in vertebrates, with activation of transcription involving the recognition of specific DNA target sites and the recruitment of functional partner proteins, including the coactivators p300 and CBP. Here we report the results of detailed studies of the interaction between the transactivation domain of B-Myb (B-Myb TAD) and the TAZ2 domain of p300. The B-Myb TAD was characterized using circular dichroism, fluorescence and NMR spectroscopy, which revealed that the isolated domain exists as a random coil polypeptide. Pull-down and spectroscopic experiments clearly showed that the B-Myb TAD binds to p300 TAZ2 to form a moderately tight (Kd ∼1.0–10 µM) complex, which results in at least partial folding of the B-Myb TAD. Significant changes in NMR spectra of p300 TAZ2 suggest that the B-Myb TAD binds to a relatively large patch on the surface of the domain (∼1200 Å2). The apparent B-Myb TAD binding site on p300 TAZ2 shows striking similarity to the surface of CBP TAZ2 involved in binding to the transactivation domain of the transcription factor signal transducer and activator of transcription 1 (STAT1), which suggests that the structure of the B-Myb TAD-p300 TAZ2 complex may share many features with that reported for STAT1 TAD-p300 TAZ2. PMID:23300815

Nuclear Receptor Coactivator Function in Reproductive Physiology and Behavior

PubMed Central

Molenda, Heather A.; Kilts, Caitlin P.; Allen, Rachel L.; Tetel, Marc J.

2009-01-01

Gonadal steroid hormones act throughout the body to elicit changes in gene expression that result in profound effects on reproductive physiology and behavior. Steroid hormones exert many of these effects by binding to their respective intracellular receptors, which are members of a nuclear receptor superfamily of transcriptional activators. A variety of in vitro studies indicate that nuclear receptor coactivators are required for efficient transcriptional activity of steroid receptors. Many of these coactivators are found in a variety of steroid hormone-responsive reproductive tissues, including the reproductive tract, mammary gland, and brain. While many nuclear receptor coactivators have been investigated in vitro, we are only now beginning to understand their function in reproductive physiology and behavior. In this review, we discuss the general mechanisms of action of nuclear receptor coactivators in steroid-dependent gene transcription. We then review some recent and exciting findings on the function of nuclear receptor coactivators in steroid-dependent brain development and reproductive physiology and behavior. PMID:12855594

Nuclear localization of coactivator RAC3 is mediated by a bipartite NLS and importin {alpha}3

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yeung, Percy Luk; Zhang, Aihua; Chen, J. Don

2006-09-15

The nuclear receptor coactivator RAC3 (also known as SRC-3/ACTR/AIB1/p/CIP/TRAM-1) belongs to the p160 coactivator family, which are involved in several physiological processes and diseases. Here we have investigated how RAC3 is translocated into the nucleus and show that it is mediated through a bipartite NLS and importin {alpha}3. This bipartite NLS is located within the conserved bHLH domain, and its mutation abolished nuclear localization. The NLS is also sufficient to cause nuclear import of EGFP, and the activity requires basic amino acids within the NLS. RAC3 binds strongly to importin {alpha}3, which also depends on the basic amino acids. Functionally,more » RAC3 cytoplasmic mutant loses its ability to enhance transcription, suggesting that nuclear localization is essential for coactivator function. Together, these results reveal a previous unknown mechanism for nuclear translocation of p160 coactivators and a critical function of the conserved bHLH within the coactivator.« less

Binding Rate Constants Reveal Distinct Features of Disordered Protein Domains.

PubMed

Dogan, Jakob; Jonasson, Josefin; Andersson, Eva; Jemth, Per

2015-08-04

Intrinsically disordered proteins (IDPs) are abundant in the proteome and involved in key cellular functions. However, experimental data about the binding kinetics of IDPs as a function of different environmental conditions are scarce. We have performed an extensive characterization of the ionic strength dependence of the interaction between the molten globular nuclear co-activator binding domain (NCBD) of CREB binding protein and five different protein ligands, including the intrinsically disordered activation domain of p160 transcriptional co-activators (SRC1, TIF2, ACTR), the p53 transactivation domain, and the folded pointed domain (PNT) of transcription factor ETS-2. Direct comparisons of the binding rate constants under identical conditions show that the association rate constant, kon, for interactions between NCBD and disordered protein domains is high at low salt concentrations (90-350 × 10(6) M(-1) s(-1) at 4 °C) but is reduced significantly (10-30-fold) with an increasing ionic strength and reaches a plateau around physiological ionic strength. In contrast, the kon for the interaction between NCBD and the folded PNT domain is only 7 × 10(6) M(-1) s(-1) (4 °C and low salt) and displays weak ionic strength dependence, which could reflect a distinctly different association that relies less on electrostatic interactions. Furthermore, the basal rate constant (in the absence of electrostatic interactions) is high for the NCBD interactions, exceeding those typically observed for folded proteins. One likely interpretation is that disordered proteins have a large number of possible collisions leading to a productive on-pathway encounter complex, while folded proteins are more restricted in terms of orientation. Our results highlight the importance of electrostatic interactions in binding involving IDPs and emphasize the significance of including ionic strength as a factor in studies that compare the binding properties of IDPs to those of ordered proteins.

X-Ray Crystal Structure of the Ancestral 3-Ketosteroid Receptor-Progesterone-Mifepristone Complex Shows Mifepristone Bound at the Coactivator Binding Interface

DOE Office of Scientific and Technical Information (OSTI.GOV)

Colucci, Jennifer K.; Ortlund, Eric A.

2013-12-12

Steroid receptors are a subfamily of nuclear receptors found throughout all metazoans. They are highly important in the regulation of development, inflammation, and reproduction and their misregulation has been implicated in hormone insensitivity syndromes and cancer. Steroid binding to SRs drives a conformational change in the ligand binding domain that promotes nuclear localization and subsequent interaction with coregulator proteins to affect gene regulation. SRs are important pharmaceutical targets, yet most SR-targeting drugs have off-target pharmacology leading to unwanted side effects. A better understanding of the structural mechanisms dictating ligand specificity and the evolution of the forces that created the SR-hormonemore » pairs will enable the design of better pharmaceutical ligands. In order to investigate this relationship, we attempted to crystallize the ancestral 3-ketosteroid receptor (ancSR2) with mifepristone, a SR antagonist. Here, we present the x-ray crystal structure of the ancestral 3-keto steroid receptor (ancSR2)-progesterone complex at a resolution of 2.05 Å. This improves upon our previously reported structure of the ancSR2-progesterone complex, permitting unambiguous assignment of the ligand conformation within the binding pocket. Surprisingly, we find mifepristone, fortuitously docked at the protein surface, poised to interfere with coregulator binding. Recent attention has been given to generating pharmaceuticals that block the coregulator binding site in order to obstruct coregulator binding and achieve tissue-specific SR regulation independent of hormone binding. Mifepristone’s interaction with the coactivator cleft of this SR suggests that it may be a useful molecular scaffold for further coactivator binding inhibitor development.« less

Distinct p300-Responsive Mechanisms Promote Caspase-Dependent Apoptosis by Human T-Cell Lymphotropic Virus Type 1 Tax Protein

PubMed Central

Nicot, Christophe; Harrod, Robert

2000-01-01

The dysregulation of cellular apoptosis pathways has emerged as a critical early event associated with the development of many types of human cancers. Numerous viral and cellular oncogenes, aside from their inherent transforming properties, are known to induce programmed cell death, consistent with the hypothesis that genetic defects are required to support tumor survival. Here, we report that nuclear expression of the CREB-binding protein (CBP)/p300-binding domain of the human T-cell lymphotropic virus type 1 (HTLV-1) transactivator, Tax, triggers an apoptotic death-inducing signal during short-term clonal analyses, as well as in transient cell death assays. Coexpression of the antiapoptotic factor Bcl-2 increased serum stimulation; incubation with the chemical caspase inhibitor z-Val-Ala-dl-Asp fluoromethylketone antagonized Tax-induced cell death. The CBP/p300-binding defective Tax mutants K88A and V89A exhibited markedly reduced cytotoxic effects compared to the wild-type Tax protein. Importantly, nuclear expression of the minimal CBP/p300-binding peptide of Tax induced apoptosis in the absence of Tax-dependent transcriptional activities, while its K88A counterpart did not cause cell death. Further, Tax-mediated apoptosis was effectively prevented by ectopic expression of the p300 coactivator. We also report that activation of the NF-κB transcription pathway by Tax, under growth arrest conditions, results in apoptosis that occurs independent of direct Tax coactivator effects. Our results allude to a novel pivotal role for the transcriptional coactivator p300 in determining cell fate and raise the possibility that dysregulated coactivator usage may pose an early barrier to transformation that must be selectively overcome as a prerequisite for the initiation of neoplasia. PMID:11046153

Distinct p300-responsive mechanisms promote caspase-dependent apoptosis by human T-cell lymphotropic virus type 1 Tax protein.

PubMed

Nicot, C; Harrod, R

2000-11-01

The dysregulation of cellular apoptosis pathways has emerged as a critical early event associated with the development of many types of human cancers. Numerous viral and cellular oncogenes, aside from their inherent transforming properties, are known to induce programmed cell death, consistent with the hypothesis that genetic defects are required to support tumor survival. Here, we report that nuclear expression of the CREB-binding protein (CBP)/p300-binding domain of the human T-cell lymphotropic virus type 1 (HTLV-1) transactivator, Tax, triggers an apoptotic death-inducing signal during short-term clonal analyses, as well as in transient cell death assays. Coexpression of the antiapoptotic factor Bcl-2 increased serum stimulation; incubation with the chemical caspase inhibitor z-Val-Ala-DL-Asp fluoromethylketone antagonized Tax-induced cell death. The CBP/p300-binding defective Tax mutants K88A and V89A exhibited markedly reduced cytotoxic effects compared to the wild-type Tax protein. Importantly, nuclear expression of the minimal CBP/p300-binding peptide of Tax induced apoptosis in the absence of Tax-dependent transcriptional activities, while its K88A counterpart did not cause cell death. Further, Tax-mediated apoptosis was effectively prevented by ectopic expression of the p300 coactivator. We also report that activation of the NF-kappaB transcription pathway by Tax, under growth arrest conditions, results in apoptosis that occurs independent of direct Tax coactivator effects. Our results allude to a novel pivotal role for the transcriptional coactivator p300 in determining cell fate and raise the possibility that dysregulated coactivator usage may pose an early barrier to transformation that must be selectively overcome as a prerequisite for the initiation of neoplasia.

Transactivation mediated by B-Myb is dependent on TAF(II)250.

PubMed

Bartusel, Thorsten; Klempnauer, Karl-Heinz

2003-05-15

B-Myb is a highly conserved member of the Myb family of transcription factors, which has been implicated in cell cycle regulation. B-Myb is expressed in most proliferating cells and its activity is highly regulated around the G1/S-phase border of the cell cycle. It is generally assumed that B-Myb regulates the expression of genes that are crucial for cell proliferation; however, the identity of these genes, the molecular mechanisms by which B-Myb stimulates their expression and the involvement of other proteins have not been sufficiently clarified. We have employed the hamster cell line ts13 as a tool to demonstrate a functional link between B-Myb and the coactivator TAF(II)250, a key component of the transcriptional machinery which itself is essential for cell proliferation. ts13 cells express a point-mutated version of TAF(II)250 whose intrinsic histone acetyl transferase activity is temperature sensitive. Transactivation of Myb-responsive reporter genes by B-Myb is temperature-dependent in ts13 cells but not in ts13 cells, which have been rescued by transfection with an expression vector for wild-type TAF(II)250. Furthermore, B-Myb and TAF(II)250 can be coprecipitated, suggesting that both proteins are present in a complex. The formation of this complex is dependent on the DNA-binding domain of B-Myb and not on its transactivation domain. Taken together, these observations provide the first evidence that the coactivator TAF(II)250 is involved in the activation of Myb responsive promoters by B-Myb. The finding that B-Myb transactivation is dependent on a key coactivator involved in cell cycle control is consistent with and strengthens the idea that B-Myb plays a crucial role as a transcription factor in proliferating cells.

The PDZ-binding motif of Yes-associated protein is required for its co-activation of TEAD-mediated CTGF transcription and oncogenic cell transforming activity

DOE Office of Scientific and Technical Information (OSTI.GOV)

Shimomura, Tadanori; Miyamura, Norio; Hata, Shoji

2014-01-17

Highlights: •Loss of the PDZ-binding motif inhibits constitutively active YAP (5SA)-induced oncogenic cell transformation. •The PDZ-binding motif of YAP promotes its nuclear localization in cultured cells and mouse liver. •Loss of the PDZ-binding motif inhibits YAP (5SA)-induced CTGF transcription in cultured cells and mouse liver. -- Abstract: YAP is a transcriptional co-activator that acts downstream of the Hippo signaling pathway and regulates multiple cellular processes, including proliferation. Hippo pathway-dependent phosphorylation of YAP negatively regulates its function. Conversely, attenuation of Hippo-mediated phosphorylation of YAP increases its ability to stimulate proliferation and eventually induces oncogenic transformation. The C-terminus of YAP contains amore » highly conserved PDZ-binding motif that regulates YAP’s functions in multiple ways. However, to date, the importance of the PDZ-binding motif to the oncogenic cell transforming activity of YAP has not been determined. In this study, we disrupted the PDZ-binding motif in the YAP (5SA) protein, in which the sites normally targeted by Hippo pathway-dependent phosphorylation are mutated. We found that loss of the PDZ-binding motif significantly inhibited the oncogenic transformation of cultured cells induced by YAP (5SA). In addition, the increased nuclear localization of YAP (5SA) and its enhanced activation of TEAD-dependent transcription of the cell proliferation gene CTGF were strongly reduced when the PDZ-binding motif was deleted. Similarly, in mouse liver, deletion of the PDZ-binding motif suppressed nuclear localization of YAP (5SA) and YAP (5SA)-induced CTGF expression. Taken together, our results indicate that the PDZ-binding motif of YAP is critical for YAP-mediated oncogenesis, and that this effect is mediated by YAP’s co-activation of TEAD-mediated CTGF transcription.« less

Targeting AR Variant-Coactivator Interactions to Exploit Prostate Cancer Vulnerabilities.

PubMed

Magani, Fiorella; Peacock, Stephanie O; Rice, Meghan A; Martinez, Maria J; Greene, Ann M; Magani, Pablo S; Lyles, Rolando; Weitz, Jonathan R; Burnstein, Kerry L

2017-11-01

Castration-resistant prostate cancer (CRPC) progresses rapidly and is incurable. Constitutively active androgen receptor splice variants (AR-Vs) represent a well-established mechanism of therapeutic resistance and disease progression. These variants lack the AR ligand-binding domain and, as such, are not inhibited by androgen deprivation therapy (ADT), which is the standard systemic approach for advanced prostate cancer. Signaling by AR-Vs, including the clinically relevant AR-V7, is augmented by Vav3, an established AR coactivator in CRPC. Using mutational and biochemical studies, we demonstrated that the Vav3 Diffuse B-cell lymphoma homology (DH) domain interacted with the N-terminal region of AR-V7 (and full length AR). Expression of the Vav3 DH domain disrupted Vav3 interaction with and enhancement of AR-V7 activity. The Vav3 DH domain also disrupted AR-V7 interaction with other AR coactivators: Src1 and Vav2, which are overexpressed in PC. This Vav3 domain was used in proof-of-concept studies to evaluate the effects of disrupting the interaction between AR-V7 and its coactivators on CRPC cells. This disruption decreased CRPC cell proliferation and anchorage-independent growth, caused increased apoptosis, decreased migration, and resulted in the acquisition of morphological changes associated with a less aggressive phenotype. While disrupting the interaction between FL-AR and its coactivators decreased N-C terminal interaction, disrupting the interaction of AR-V7 with its coactivators decreased AR-V7 nuclear levels. Implications: This study demonstrates the potential therapeutic utility of inhibiting constitutively active AR-V signaling by disrupting coactivator binding. Such an approach is significant, as AR-Vs are emerging as important drivers of CRPC that are particularly recalcitrant to current therapies. Mol Cancer Res; 15(11); 1469-80. ©2017 AACR . ©2017 American Association for Cancer Research.

Structure, mechanics, and binding mode heterogeneity of LEDGF/p75-DNA nucleoprotein complexes revealed by scanning force microscopy

NASA Astrophysics Data System (ADS)

Vanderlinden, Willem; Lipfert, Jan; Demeulemeester, Jonas; Debyser, Zeger; de Feyter, Steven

2014-04-01

LEDGF/p75 is a transcriptional coactivator implicated in the pathogenesis of AIDS and leukemia. In these contexts, LEDGF/p75 acts as a cofactor by tethering protein cargo to transcriptionally active regions in the human genome. Our study - based on scanning force microscopy (SFM) imaging - is the first to provide structural information on the interaction of LEDGF/p75 with DNA. Two novel approaches that allow obtaining insights into the DNA conformation inside nucleoprotein complexes revealed (1) that LEDGF/p75 can bind at least in three different binding modes, (2) how DNA topology and protein dimerization affect these binding modes, and (3) geometrical and mechanical aspects of the nucleoprotein complexes. These structural and mechanical details will help us to better understand the cellular mechanisms of LEDGF/p75 as a transcriptional coactivator and as a cofactor in disease.LEDGF/p75 is a transcriptional coactivator implicated in the pathogenesis of AIDS and leukemia. In these contexts, LEDGF/p75 acts as a cofactor by tethering protein cargo to transcriptionally active regions in the human genome. Our study - based on scanning force microscopy (SFM) imaging - is the first to provide structural information on the interaction of LEDGF/p75 with DNA. Two novel approaches that allow obtaining insights into the DNA conformation inside nucleoprotein complexes revealed (1) that LEDGF/p75 can bind at least in three different binding modes, (2) how DNA topology and protein dimerization affect these binding modes, and (3) geometrical and mechanical aspects of the nucleoprotein complexes. These structural and mechanical details will help us to better understand the cellular mechanisms of LEDGF/p75 as a transcriptional coactivator and as a cofactor in disease. Electronic supplementary information (ESI) available: SFM topographs of phage lambda DNA in situ, in the absence and presence of LEDGF/p75; model-independent tests for DNA chain equilibration in 2D; SFM topographs of plasmid DNA substrates I-IV in the absence of LEDGF/p75; proof-of-principle of bend angle determination on supercoiled plasmid DNA-EcoRV binding to cognate and non-cognate sites in pBR322 plasmid DNA. See DOI: 10.1039/c4nr00022f

Effects of atorvastatin metabolites on induction of drug-metabolizing enzymes and membrane transporters through human pregnane X receptor

PubMed Central

Hoffart, E; Ghebreghiorghis, L; Nussler, AK; Thasler, WE; Weiss, TS; Schwab, M; Burk, O

2012-01-01

BACKGROUND AND PURPOSE Atorvastatin metabolites differ in their potential for drug interaction because of differential inhibition of drug-metabolizing enzymes and transporters. We here investigate whether they exert differential effects on the induction of these genes via activation of pregnane X receptor (PXR) and constitutive androstane receptor (CAR). EXPERIMENTAL APPROACH Ligand binding to PXR or CAR was analysed by mammalian two-hybrid assembly and promoter/reporter gene assays. Additionally, surface plasmon resonance was used to analyse ligand binding to CAR. Primary human hepatocytes were treated with atorvastatin metabolites, and mRNA and protein expression of PXR-regulated genes was measured. Two-hybrid co-activator interaction and co-repressor release assays were utilized to elucidate the molecular mechanism of PXR activation. KEY RESULTS All atorvastatin metabolites induced the assembly of PXR and activated CYP3A4 promoter activity. Ligand binding to CAR could not be proven. In primary human hepatocytes, the para-hydroxy metabolite markedly reduced or abolished induction of cytochrome P450 and transporter genes. While significant differences in co-activator recruitment were not observed, para-hydroxy atorvastatin demonstrated only 50% release of co-repressors. CONCLUSIONS AND IMPLICATIONS Atorvastatin metabolites are ligands of PXR but not of CAR. Atorvastatin metabolites demonstrate differential induction of PXR target genes, which results from impaired release of co-repressors. Consequently, the properties of drug metabolites have to be taken into account when analysing PXR-dependent induction of drug metabolism and transport. The drug interaction potential of the active metabolite, para-hydroxy atorvastatin, might be lower than that of the parent compound. PMID:21913896

A truncated human peroxisome proliferator-activated receptor alpha splice variant with dominant negative activity.

PubMed

Gervois, P; Torra, I P; Chinetti, G; Grötzinger, T; Dubois, G; Fruchart, J C; Fruchart-Najib, J; Leitersdorf, E; Staels, B

1999-09-01

The peroxisome proliferator-activated receptor alpha (PPARalpha) plays a key role in lipid and lipoprotein metabolism. However, important inter- and intraspecies differences exist in the response to PPARalpha activators. This incited us to screen for PPARalpha variants with different signaling functions. In the present study, using a RT-PCR approach a variant human PPARalpha mRNA species was identified, which lacks the entire exon 6 due to alternative splicing. This deletion leads to the introduction of a premature stop codon, resulting in the formation of a truncated PPARalpha protein (PPARalphatr) lacking part of the hinge region and the entire ligand-binding domain. RNase protection analysis demonstrated that PPARalphatr mRNA is expressed in several human tissues and cells, representing between 20-50% of total PPARalpha mRNA. By contrast, PPARalphatr mRNA could not be detected in rodent tissues. Western blot analysis using PPARalpha-specific antibodies demonstrated the presence of an immunoreactive protein migrating at the size of in vitro produced PPARalphatr protein both in human hepatoma HepG2 cells and in human hepatocytes. Both in the presence or absence of 9-cis-retinoic acid receptor, PPARalphatr did not bind to DNA in gel shift assays. Immunocytochemical analysis of transfected CV-1 cells indicated that, whereas transfected PPARalphawt was mainly nuclear localized, the majority of PPARalphatr resided in the cytoplasm, with presence in the nucleus depending on cell culture conditions. Whereas a chimeric PPARalphatr protein containing a nuclear localization signal cloned at its N-terminal localized into the nucleus and exhibited strong negative activity on PPARalphawt transactivation function, PPARalphatr interfered with PPARalphatr transactivation function only under culture conditions inducing its nuclear localization. Cotransfection of the coactivator CREB-binding protein relieved the transcriptional repression of PPARalphawt by PPARalphatr, suggesting that the dominant negative effect of PPARalphatr might occur through competition for essential coactivators. In addition, PPARalphatr interfered with transcriptional activity of other nuclear receptors such as PPARgamma, hepatic nuclear factor-4, and glucocorticoid receptor-alpha, which share CREB-binding protein/p300 as a coactivator. Thus, we have identified a human PPARalpha splice variant that may negatively interfere with PPARalphawt function. Factors regulating either the ratio of PPARalphawt vs. PPARalphatr mRNA or the nuclear entry of PPARalphatr protein should therefore lead to altered signaling via the PPARalpha and, possibly also, other nuclear receptor pathways.

Synthesis and biological evaluation of guanylhydrazone coactivator binding inhibitors for the estrogen receptor.

PubMed

LaFrate, Andrew L; Gunther, Jillian R; Carlson, Kathryn E; Katzenellenbogen, John A

2008-12-01

Most patients with hormone-responsive breast cancer eventually develop resistance to traditional antiestrogens such as tamoxifen, and this has become a major obstacle in their treatment. We prepared and characterized the activity of a series of 16 guanylhydrazone small molecules that are designed to block estrogen receptor (ER) activity through a non-traditional mechanism, by directly interfering with coactivator binding to agonist-liganded ER. The inhibitory activity of these compounds was determined in cell-based transcription assays using ER-responsive reporter gene and mammalian two-hybrid assays. Several of the compounds gave IC(50) values in the low micromolar range. Two secondary assays were used to confirm that these compounds were acting through the proposed non-traditional mode of estrogen inhibitory action and not as conventional antagonists at the ligand binding site.

Structure of an APC3–APC16 Complex: Insights into Assembly of the Anaphase-Promoting Complex/Cyclosome

DOE PAGES

Yamaguchi, Masaya; Yu, Shanshan; Qiao, Renping; ...

2014-12-06

The anaphase-promoting complex/cyclosome (APC/C) is a massive E3 ligase that controls mitosis by catalyzing ubiquitination of key cell cycle regulatory proteins. The APC/C assembly contains two subcomplexes: the “Platform” centers around a cullin-RING-like E3 ligase catalytic core; the “Arc Lamp” is a hub that mediates transient association with regulators and ubiquitination substrates. The Arc Lamp contains the small subunits APC16, CDC26, and APC13, and tetratricopeptide repeat (TPR) proteins (APC7, APC3, APC6, and APC8) that homodimerize and stack with quasi-2-fold symmetry. Within the APC/C complex, APC3 serves as center for regulation. APC3's TPR motifs recruit substrate-binding coactivators, CDC20 and CDH1, viamore » their C-terminal conserved Ile-Arg (IR) tail sequences. Human APC3 also binds APC16 and APC7 and contains a > 200-residue loop that is heavily phosphorylated during mitosis, although the basis for APC3 interactions and whether loop phosphorylation is required for ubiquitination are unclear. Here, we map the basis for human APC3 assembly with APC16 and APC7, report crystal structures of APC3Δloop alone and in complex with the C-terminal domain of APC16, and test roles of APC3's loop and IR tail binding surfaces in APC/C-catalyzed ubiquitination. The structures show how one APC16 binds asymmetrically to the symmetric APC3 dimer and, together with biochemistry and prior data, explain how APC16 recruits APC7 to APC3, show how APC3's C-terminal domain is rearranged in the full APC/C assembly, and visualize residues in the IR tail binding cleft important for coactivator-dependent ubiquitination. Overall, the results provide insights into assembly, regulation, and interactions of TPR proteins and the APC/C.« less

The CRTC1-SIK1 Pathway Regulates Entrainment of the Circadian Clock

PubMed Central

Jagannath, Aarti; Butler, Rachel; Godinho, Sofia I.H.; Couch, Yvonne; Brown, Laurence A.; Vasudevan, Sridhar R.; Flanagan, Kevin C.; Anthony, Daniel; Churchill, Grant C.; Wood, Matthew J.A.; Steiner, Guido; Ebeling, Martin; Hossbach, Markus; Wettstein, Joseph G.; Duffield, Giles E.; Gatti, Silvia; Hankins, Mark W.; Foster, Russell G.; Peirson, Stuart N.

2013-01-01

Summary Retinal photoreceptors entrain the circadian system to the solar day. This photic resetting involves cAMP response element binding protein (CREB)-mediated upregulation of Per genes within individual cells of the suprachiasmatic nuclei (SCN). Our detailed understanding of this pathway is poor, and it remains unclear why entrainment to a new time zone takes several days. By analyzing the light-regulated transcriptome of the SCN, we have identified a key role for salt inducible kinase 1 (SIK1) and CREB-regulated transcription coactivator 1 (CRTC1) in clock re-setting. An entrainment stimulus causes CRTC1 to coactivate CREB, inducing the expression of Per1 and Sik1. SIK1 then inhibits further shifts of the clock by phosphorylation and deactivation of CRTC1. Knockdown of Sik1 within the SCN results in increased behavioral phase shifts and rapid re-entrainment following experimental jet lag. Thus SIK1 provides negative feedback, acting to suppress the effects of light on the clock. This pathway provides a potential target for the regulation of circadian rhythms. PMID:23993098

CREB and the CRTC co-activators: sensors for hormonal and metabolic signals

PubMed Central

Altarejos, Judith Y.; Montminy, Marc

2014-01-01

The cyclic AMP-responsive element-binding protein (CREB) is phosphorylated in response to a wide variety of signals, yet target gene transcription is only increased in a subset of cases. Recent studies indicate that CREB functions in concert with a family of latent cytoplasmic co-activators called cAMP-regulated transcriptional co-activators (CRTCs), which are activated through dephosphorylation. A dual requirement for CREB phosphorylation and CRTC dephosphorylation is likely to explain how these activator–co-activator cognates discriminate between different stimuli. Following their activation, CREB and CRTCs mediate the effects of fasting and feeding signals on the expression of metabolic programmes in insulin-sensitive tissues. PMID:21346730

Prefrontal Consolidation Supports the Attainment of Fear Memory Accuracy

ERIC Educational Resources Information Center

Vieira, Philip A.; Lovelace, Jonathan W.; Corches, Alex; Rashid, Asim J.; Josselyn, Sheena A.; Korzus, Edward

2014-01-01

The neural mechanisms underlying the attainment of fear memory accuracy for appropriate discriminative responses to aversive and nonaversive stimuli are unclear. Considerable evidence indicates that coactivator of transcription and histone acetyltransferase cAMP response element binding protein (CREB) binding protein (CBP) is critically required…

Mechanism of Mediator recruitment by tandem Gcn4 activation domains and three Gal11 activator-binding domains.

PubMed

Herbig, Eric; Warfield, Linda; Fish, Lisa; Fishburn, James; Knutson, Bruce A; Moorefield, Beth; Pacheco, Derek; Hahn, Steven

2010-05-01

Targets of the tandem Gcn4 acidic activation domains in transcription preinitiation complexes were identified by site-specific cross-linking. The individual Gcn4 activation domains cross-link to three common targets, Gal11/Med15, Taf12, and Tra1, which are subunits of four conserved coactivator complexes, Mediator, SAGA, TFIID, and NuA4. The Gcn4 N-terminal activation domain also cross-links to the Mediator subunit Sin4/Med16. The contribution of the two Gcn4 activation domains to transcription was gene specific and varied from synergistic to less than additive. Gcn4-dependent genes had a requirement for Gal11 ranging from 10-fold dependence to complete Gal11 independence, while the Gcn4-Taf12 interaction did not significantly contribute to the expression of any gene studied. Complementary methods identified three conserved Gal11 activator-binding domains that bind each Gcn4 activation domain with micromolar affinity. These Gal11 activator-binding domains contribute additively to transcription activation and Mediator recruitment at Gcn4- and Gal11-dependent genes. Although we found that the conserved Gal11 KIX domain contributes to Gal11 function, we found no evidence of specific Gcn4-KIX interaction and conclude that the Gal11 KIX domain does not function by specific interaction with Gcn4. Our combined results show gene-specific coactivator requirements, a surprising redundancy in activator-target interactions, and an activator-coactivator interaction mediated by multiple low-affinity protein-protein interactions.

Molecular mechanism of R-bicalutamide switching from androgen receptor antagonist to agonist induced by amino acid mutations using molecular dynamics simulations and free energy calculation

NASA Astrophysics Data System (ADS)

Liu, Hongli; Han, Rui; Li, Jiazhong; Liu, Huanxiang; Zheng, Lifang

2016-12-01

R-bicalutamide, a first generation antiandrogen, was used to treat prostate cancer for decades. Although it is very effective at the beginning, resistance appears after 2-3 years of treatment. Mutation of androgen receptor (AR) is considered a main reason for drug resistance. It is reported that AR W741C, W741L, W741C_T877A, T877A, F876L, F876L_T877A and L701H mutations can convert R-bicalutamide from AR antagonist to agonist, but the switching mechanisms are not clear. In this study, molecular dynamics simulations and molecular mechanics generalized Born surface area (MM-GBSA) calculations were performed to analyze the interaction mechanisms between R-bicalutamide and wild type/mutant ARs. The results indicate that helix H12, which lies on the top of AR LBD like a cover, plays a vital role in R-bicalutamide binding. When interacting with AR, the B-ring of R-bicalutamide pushes H12 aside, distorting the coactivator binding site (AF2) resulting in the inactivation of transcription. Several residue mutations appear to enlarge the distance between the B-ring of R-bicalutamide and H12, reducing steric clash, which is conducive to a closed H12 conformation, leading to the formation of the coactivator binding site AF2 and increased transcription. Hydrogen bond and per-residue free energy decomposition analyses are also investigated to explore the interacting mechanisms, and M895 is found to be a key residue in the antagonist mechanism. The obtained molecular mechanisms will aid rational screening and design of novel AR antagonists, even to mutant AR.

Molecular mechanism of R-bicalutamide switching from androgen receptor antagonist to agonist induced by amino acid mutations using molecular dynamics simulations and free energy calculation.

PubMed

Liu, Hongli; Han, Rui; Li, Jiazhong; Liu, Huanxiang; Zheng, Lifang

2016-12-01

R-bicalutamide, a first generation antiandrogen, was used to treat prostate cancer for decades. Although it is very effective at the beginning, resistance appears after 2-3 years of treatment. Mutation of androgen receptor (AR) is considered a main reason for drug resistance. It is reported that AR W741C, W741L, W741C_T877A, T877A, F876L, F876L_T877A and L701H mutations can convert R-bicalutamide from AR antagonist to agonist, but the switching mechanisms are not clear. In this study, molecular dynamics simulations and molecular mechanics generalized Born surface area (MM-GBSA) calculations were performed to analyze the interaction mechanisms between R-bicalutamide and wild type/mutant ARs. The results indicate that helix H12, which lies on the top of AR LBD like a cover, plays a vital role in R-bicalutamide binding. When interacting with AR, the B-ring of R-bicalutamide pushes H12 aside, distorting the coactivator binding site (AF2) resulting in the inactivation of transcription. Several residue mutations appear to enlarge the distance between the B-ring of R-bicalutamide and H12, reducing steric clash, which is conducive to a closed H12 conformation, leading to the formation of the coactivator binding site AF2 and increased transcription. Hydrogen bond and per-residue free energy decomposition analyses are also investigated to explore the interacting mechanisms, and M895 is found to be a key residue in the antagonist mechanism. The obtained molecular mechanisms will aid rational screening and design of novel AR antagonists, even to mutant AR.

Flightless I (Drosophila) homolog facilitates chromatin accessibility of the estrogen receptor α target genes in MCF-7 breast cancer cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jeong, Kwang Won, E-mail: kwjeong@gachon.ac.kr

2014-04-04

Highlights: • H3K4me3 and Pol II binding at TFF1 promoter were reduced in FLII-depleted MCF-7 cells. • FLII is required for chromatin accessibility of the enhancer of ERalpha target genes. • Depletion of FLII causes inhibition of proliferation of MCF-7 cells. - Abstract: The coordinated activities of multiple protein complexes are essential to the remodeling of chromatin structure and for the recruitment of RNA polymerase II (Pol II) to the promoter in order to facilitate the initiation of transcription in nuclear receptor-mediated gene expression. Flightless I (Drosophila) homolog (FLII), a nuclear receptor coactivator, is associated with the SWI/SNF-chromatin remodeling complexmore » during estrogen receptor (ER)α-mediated transcription. However, the function of FLII in estrogen-induced chromatin opening has not been fully explored. Here, we show that FLII plays a critical role in establishing active histone modification marks and generating the open chromatin structure of ERα target genes. We observed that the enhancer regions of ERα target genes are heavily occupied by FLII, and histone H3K4me3 and Pol II binding induced by estrogen are decreased in FLII-depleted MCF-7 cells. Furthermore, formaldehyde-assisted isolation of regulatory elements (FAIRE)-quantitative polymerase chain reaction (qPCR) experiments showed that depletion of FLII resulted in reduced chromatin accessibility of multiple ERα target genes. These data suggest FLII as a key regulator of ERα-mediated transcription through its role in regulating chromatin accessibility for the binding of RNA Polymerase II and possibly other transcriptional coactivators.« less

Complex Actions of Thyroid Hormone Receptor Antagonist NH-3 on Gene Promoters in Different Cell Lines

PubMed Central

Shah, Vanya; Nguyen, Phuong; Nguyen, Ngoc-Ha; Togashi, Marie; Scanlan, Thomas S.; Baxter, John D.; Webb, Paul

2014-01-01

It is desirable to obtain new antagonists for thyroid hormone (TRs) and other nuclear receptors (NRs). We previously used X-ray structural models of TR ligand binding domains (LBDs) to design compounds, such as NH-3, that impair coactivator binding to activation function 2 (AF-2) and block thyroid hormone (triiodothyronine, T3) actions. However, TRs bind DNA and are transcriptionally active without ligand. Thus, NH-3 could modulate TR activity via effects on other coregulator interaction surfaces, such as activation function (AF-1) and corepressor binding sites. Here, we find that NH-3 blocks TR-LBD interactions with coactivators and corepressors and also inhibits activities of AF-1 and AF-2 in transfections. While NH-3 lacks detectable agonist activity at T3-activated genes in GC pituitary cells it nevertheless activates spot 14 (S14) in HTC liver cells with the latter effect accompanied by enhanced histone H4 acetylation and coactivator recruitment at the S14 promoter. Surprisingly, T3 promotes corepressor recruitment to target promoters. NH-3 effects vary; we observe transient recruitment of N-CoR to S14 in GC cells and dismissal and rebinding of N-CoR to the same promoter in HTC cells. We propose that NH-3 will generally behave as an antagonist by blocking AF-1 and AF-2 but that complex effects on coregulator recruitment may result in partial/mixed agonist effects that are independent of blockade of T3 binding in some contexts. These properties could ultimately be utilized in drug design and development of new selective TR modulators. PMID:18930112

Location-Unbound Color-Shape Binding Representations in Visual Working Memory.

PubMed

Saiki, Jun

2016-02-01

The mechanism by which nonspatial features, such as color and shape, are bound in visual working memory, and the role of those features' location in their binding, remains unknown. In the current study, I modified a redundancy-gain paradigm to investigate these issues. A set of features was presented in a two-object memory display, followed by a single object probe. Participants judged whether the probe contained any features of the memory display, regardless of its location. Response time distributions revealed feature coactivation only when both features of a single object in the memory display appeared together in the probe, regardless of the response time benefit from the probe and memory objects sharing the same location. This finding suggests that a shared location is necessary in the formation of bound representations but unnecessary in their maintenance. Electroencephalography data showed that amplitude modulations reflecting location-unbound feature coactivation were different from those reflecting the location-sharing benefit, consistent with the behavioral finding that feature-location binding is unnecessary in the maintenance of color-shape binding. © The Author(s) 2015.

Architecture of the Saccharomyces cerevisiae SAGA transcription coactivator complex

PubMed Central

Han, Yan; Luo, Jie; Ranish, Jeffrey; Hahn, Steven

2014-01-01

The conserved transcription coactivator SAGA is comprised of several modules that are involved in activator binding, TBP binding, histone acetylation (HAT) and deubiquitination (DUB). Crosslinking and mass spectrometry, together with genetic and biochemical analyses, were used to determine the molecular architecture of the SAGA-TBP complex. We find that the SAGA Taf and Taf-like subunits form a TFIID-like core complex at the center of SAGA that makes extensive interactions with all other SAGA modules. SAGA-TBP binding involves a network of interactions between subunits Spt3, Spt8, Spt20, and Spt7. The HAT and DUB modules are in close proximity, and the DUB module modestly stimulates HAT function. The large activator-binding subunit Tra1 primarily connects to the TFIID-like core via its FAT domain. These combined results were used to derive a model for the arrangement of the SAGA subunits and its interactions with TBP. Our results provide new insight into SAGA function in gene regulation, its structural similarity with TFIID, and functional interactions between the SAGA modules. PMID:25216679

The Orphan Nuclear Receptor TR4 Is a Vitamin A-activated Nuclear Receptor

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhou, X. Edward; Suino-Powell, Kelly M.; Xu, Yong

2015-11-30

Testicular receptors 2 and 4 (TR2/4) constitute a subgroup of orphan nuclear receptors that play important roles in spermatogenesis, lipid and lipoprotein regulation, and the development of the central nervous system. Currently, little is known about the structural features and the ligand regulation of these receptors. Here we report the crystal structure of the ligand-free TR4 ligand binding domain, which reveals an autorepressed conformation. The ligand binding pocket of TR4 is filled by the C-terminal half of helix 10, and the cofactor binding site is occupied by the AF-2 helix, thus preventing ligand-independent activation of the receptor. However, TR4 exhibitsmore » constitutive transcriptional activity on multiple promoters, which can be further potentiated by nuclear receptor coactivators. Mutations designed to disrupt cofactor binding, dimerization, or ligand binding substantially reduce the transcriptional activity of this receptor. Importantly, both retinol and retinoic acid are able to promote TR4 to recruit coactivators and to activate a TR4-regulated reporter. These findings demonstrate that TR4 is a ligand-regulated nuclear receptor and suggest that retinoids might have a much wider regulatory role via activation of orphan receptors such as TR4.« less

Acetylation of nucleosomal histones by p300 facilitates transcription from tax-responsive human T-cell leukemia virus type 1 chromatin template.

PubMed

Lu, Hanxin; Pise-Masison, Cynthia A; Fletcher, Terace M; Schiltz, R Louis; Nagaich, Akhilesh K; Radonovich, Michael; Hager, Gordon; Cole, Philip A; Brady, John N

2002-07-01

Expression of human T-cell leukemia virus type 1 (HTLV-1) is regulated by the viral transcriptional activator Tax. Tax activates viral transcription through interaction with the cellular transcription factor CREB and the coactivators CBP/p300. One key property of the coactivators is the presence of histone acetyltransferase (HAT) activity, which enables p300/CBP to modify nucleosome structure. The data presented in this manuscript demonstrate that full-length p300 and CBP facilitate transcription of a reconstituted chromatin template in the presence of Tax and CREB. The ability of p300 and CBP to activate transcription from the chromatin template is dependent upon the HAT activity. Moreover, the coactivator HAT activity must be tethered to the template by Tax and CREB, since a p300 mutant that fails to interact with Tax did not facilitate transcription or acetylate histones. p300 acetylates histones H3 and H4 within nucleosomes located in the promoter and 5' proximal regions of the template. Nucleosome acetylation is accompanied by an increase in the level of binding of RNA polymerase II transcription factor TFIID and RNA polymerase II to the promoter. Interestingly, we found distinct transcriptional activities between CBP and p300. CBP, but not p300, possesses an N-terminal activation domain which directly activates Tax-mediated HTLV-1 transcription from a naked DNA template. Finally, using the chromatin immunoprecipitation assay, we provide the first direct experimental evidence that p300 and CBP are associated with the HTLV-1 long terminal repeat in vivo.

Structural basis for corepressor assembly by the orphan nuclear receptor TLX

PubMed Central

Zhou, X. Edward; He, Yuanzheng; Searose-Xu, Kelvin; Zhang, Chun-Li; Tsai, Chih-Cheng; Melcher, Karsten

2015-01-01

The orphan nuclear receptor TLX regulates neural stem cell self-renewal in the adult brain and functions primarily as a transcription repressor through recruitment of Atrophin corepressors, which bind to TLX via a conserved peptide motif termed the Atro box. Here we report crystal structures of the human and insect TLX ligand-binding domain in complex with Atro box peptides. In these structures, TLX adopts an autorepressed conformation in which its helix H12 occupies the coactivator-binding groove. Unexpectedly, H12 in this autorepressed conformation forms a novel binding pocket with residues from helix H3 that accommodates a short helix formed by the conserved ALXXLXXY motif of the Atro box. Mutations that weaken the TLX–Atrophin interaction compromise the repressive activity of TLX, demonstrating that this interaction is required for Atrophin to confer repressor activity to TLX. Moreover, the autorepressed conformation is conserved in the repressor class of orphan nuclear receptors, and mutations of corresponding residues in other members of this class of receptors diminish their repressor activities. Together, our results establish the functional conservation of the autorepressed conformation and define a key sequence motif in the Atro box that is essential for TLX-mediated repression. PMID:25691470

Structural basis for corepressor assembly by the orphan nuclear receptor TLX

DOE PAGES

Zhi, Xiaoyong; Zhou, X. Edward; He, Yuanzheng; ...

2015-02-15

The orphan nuclear receptor TLX regulates neural stem cell self-renewal in the adult brain and functions primarily as a transcription repressor through recruitment of Atrophin corepressors, which bind to TLX via a conserved peptide motif termed the Atro box. Here we report crystal structures of the human and insect TLX ligand-binding domain in complex with Atro box peptides. In these structures, TLX adopts an autorepressed conformation in which its helix H12 occupies the coactivator-binding groove. Unexpectedly, H12 in this autorepressed conformation forms a novel binding pocket with residues from helix H3 that accommodates a short helix formed by the conservedmore » ALXXLXXY motif of the Atro box. Mutations that weaken the TLX–Atrophin interaction compromise the repressive activity of TLX, demonstrating that this interaction is required for Atrophin to confer repressor activity to TLX. Moreover, the autorepressed conformation is conserved in the repressor class of orphan nuclear receptors, and mutations of corresponding residues in other members of this class of receptors diminish their repressor activities. Together, our results establish the functional conservation of the autorepressed conformation and define a key sequence motif in the Atro box that is essential for TLX-mediated repression.« less

Genome-wide localization and expression profiling establish Sp2 as a sequence-specific transcription factor regulating vitally important genes

PubMed Central

Terrados, Gloria; Finkernagel, Florian; Stielow, Bastian; Sadic, Dennis; Neubert, Juliane; Herdt, Olga; Krause, Michael; Scharfe, Maren; Jarek, Michael; Suske, Guntram

2012-01-01

The transcription factor Sp2 is essential for early mouse development and for proliferation of mouse embryonic fibroblasts in culture. Yet its mechanisms of action and its target genes are largely unknown. In this study, we have combined RNA interference, in vitro DNA binding, chromatin immunoprecipitation sequencing and global gene-expression profiling to investigate the role of Sp2 for cellular functions, to define target sites and to identify genes regulated by Sp2. We show that Sp2 is important for cellular proliferation that it binds to GC-boxes and occupies proximal promoters of genes essential for vital cellular processes including gene expression, replication, metabolism and signalling. Moreover, we identified important key target genes and cellular pathways that are directly regulated by Sp2. Most significantly, Sp2 binds and activates numerous sequence-specific transcription factor and co-activator genes, and represses the whole battery of cholesterol synthesis genes. Our results establish Sp2 as a sequence-specific regulator of vitally important genes. PMID:22684502

Lithocholic acid is an endogenous inhibitor of MDM4 and MDM2

PubMed Central

Vogel, Simon M.; Bauer, Matthias R.; Joerger, Andreas C.; Wilcken, Rainer; Brandt, Tobias; Veprintsev, Dmitry B.; Rutherford, Trevor J.; Fersht, Alan R.; Boeckler, Frank M.

2012-01-01

The proteins MDM2 and MDM4 are key negative regulators of the tumor suppressor protein p53, which are frequently upregulated in cancer cells. They inhibit the transactivation activity of p53 by binding separately or in concert to its transactivation domain. MDM2 is also a ubiquitin ligase that leads to the degradation of p53. Accordingly, MDM2 and MDM4 are important targets for drugs to inhibit their binding to p53. We found from in silico screening and confirmed by experiment that lithocholic acid (LCA) binds to the p53 binding sites of both MDM2 and MDM4 with a fivefold preference for MDM4. LCA is an endogenous steroidal bile acid, variously reported to have both carcinogenic and apoptotic activities. The comparison of LCA effects on apoptosis in HCT116 p53+/+ vs. p53-/- cells shows a predominantly p53-mediated induction of caspase-3/7. The dissociation constants are in the μM region, but only modest inhibition of binding of MDM2 and MDM4 is required to negate their upregulation because they have to compete with transcriptional coactivator p300 for binding to p53. Binding was weakened by structural changes in LCA, and so it may be a natural ligand of MDM2 and MDM4, raising the possibility that MDM proteins may be sensors for specific steroids. PMID:23035244

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mays, Suzanne G.; Okafor, C. Denise; Tuntland, Micheal L.

Peroxisome proliferator-activated gamma coactivator 1-α (PGC1α) regulates energy metabolism by directly interacting with transcription factors to modulate gene expression. Among the PGC1α binding partners is liver receptor homolog 1 (LRH-1; NR5A2), an orphan nuclear hormone receptor that controls lipid and glucose homeostasis. Although PGC1α is known to bind and activate LRH-1, mechanisms through which PGC1α changes LRH-1 conformation to drive transcription are unknown. Here, we used biochemical and structural methods to interrogate the LRH-1–PGC1α complex. Purified, full-length LRH-1, as well as isolated ligand binding domain, bound to PGC1α with higher affinity than to the coactivator, nuclear receptor coactivator-2 (Tif2), inmore » coregulator peptide recruitment assays. We present the first crystal structure of the LRH-1–PGC1α complex, which depicts several hydrophobic contacts and a strong charge clamp at the interface between these partners. In molecular dynamics simulations, PGC1α induced correlated atomic motion throughout the entire LRH-1 activation function surface, which was dependent on charge-clamp formation. In contrast, Tif2 induced weaker signaling at the activation function surface than PGC1α but promoted allosteric signaling from the helix 6/β-sheet region of LRH-1 to the activation function surface. These studies are the first to probe mechanisms underlying the LRH-1–PGC1α interaction and may illuminate strategies for selective therapeutic targeting of PGC1α-dependent LRH-1 signaling pathways.« less

Insight into the tumor suppressor function of CBP through the viral oncoprotein tax.

PubMed

Van Orden, K; Nyborg, J K

2000-01-01

CREB binding protein (CBP) is a cellular coactivator protein that regulates essentially all known pathways of gene expression. The transcriptional coactivator properties of CBP are utilized by at least 25 different transcription factors representing nearly all known classes of DNA binding proteins. Once bound to their target genes, these transcription factors are believed to tether CBP to the promoter, leading to activated transcription. CBP functions to stimulate transcription through direct recruitment of the general transcription machinery as well as acetylation of both histone and transcription factor substrates. Recent observations indicate that a critical dosage of CBP is required for normal development and tumor suppression, and that perturbations in CBP concentrations may disrupt cellular homeostasis. Furthermore, there is accumulating evidence that CBP deregulation plays a direct role in hematopoietic malignancies. However, the molecular events linking CBP deregulation and malignant transformation are unclear. Further insight into the function of CBP, and its role as a tumor suppressor, can be gained through recent studies of the human T-cell leukemia virus, type I (HTLV-I) Tax oncoprotein. Tax is known to utilize CBP to stimulate transcription from the viral promoter. However, recent data suggest that as a consequence of the Tax-CBP interaction, many cellular transcription factor pathways may be deregulated. Tax disruption of CBP function may play a key role in transformation of the HTLV-I-infected cell. Thus, Tax derailment of CBP may lend important information about the tumor suppressor properties of CBP and serve as a model for the role of CBP in hematopoietic malignancies.

The viral protein A238L inhibits TNF-alpha expression through a CBP/p300 transcriptional coactivators pathway.

PubMed

Granja, Aitor G; Nogal, Maria L; Hurtado, Carolina; Del Aguila, Carmen; Carrascosa, Angel L; Salas, María L; Fresno, Manuel; Revilla, Yolanda

2006-01-01

African swine fever virus (ASFV) is able to inhibit TNF-alpha-induced gene expression through the synthesis of A238L protein. This was shown by the use of deletion mutants lacking the A238L gene from the Vero cell-adapted Ba71V ASFV strain and from the virulent isolate E70. To further analyze the molecular mechanism by which the viral gene controls TNF-alpha, we have used Jurkat cells stably transfected with the viral gene to identify the TNF-alpha regulatory elements involved in the induction of the gene after stimulation with PMA and calcium ionophore. We have thus identified the cAMP-responsive element and kappa3 sites on the TNF-alpha promoter as the responsible of the gene activation, and demonstrate that A238L inhibits TNF-alpha expression through these DNA binding sites. This inhibition was partially reverted by overexpression of the transcriptional factors NF-AT, NF-kappaB, and c-Jun. Furthermore, we present evidence that A238L inhibits the activation of TNF-alpha by modulating NF-kappaB, NF-AT, and c-Jun trans activation through a mechanism that involves CREB binding protein/p300 function, because overexpression of these transcriptional coactivators recovers TNF-alpha promoter activity. In addition, we show that A238L is a nuclear protein that binds to the cyclic AMP-responsive element/kappa3 complex, thus displacing the CREB binding protein/p300 coactivators. Taken together, these results establish a novel mechanism in the control of TNF-alpha gene expression by a viral protein that could represent an efficient strategy used by ASFV to evade the innate immune response.

Role of co-regulators in metabolic and transcriptional actions of thyroid hormone.

PubMed

Astapova, Inna

2016-04-01

Thyroid hormone (TH) controls a wide range of physiological processes through TH receptor (TR) isoforms. Classically, TRs are proposed to function as tri-iodothyronine (T3)-dependent transcription factors: on positively regulated target genes, unliganded TRs mediate transcriptional repression through recruitment of co-repressor complexes, while T3 binding leads to dismissal of co-repressors and recruitment of co-activators to activate transcription. Co-repressors and co-activators were proposed to play opposite roles in the regulation of negative T3 target genes and hypothalamic-pituitary-thyroid axis, but exact mechanisms of the negative regulation by TH have remained elusive. Important insights into the roles of co-repressors and co-activators in different physiological processes have been obtained using animal models with disrupted co-regulator function. At the same time, recent studies interrogating genome-wide TR binding have generated compelling new data regarding effects of T3, local chromatin structure, and specific response element configuration on TR recruitment and function leading to the proposal of new models of transcriptional regulation by TRs. This review discusses data obtained in various mouse models with manipulated function of nuclear receptor co-repressor (NCoR or NCOR1) and silencing mediator of retinoic acid receptor and thyroid hormone receptor (SMRT or NCOR2), and family of steroid receptor co-activators (SRCs also known as NCOAs) in the context of TH action, as well as insights into the function of co-regulators that may emerge from the genome-wide TR recruitment analysis. © 2016 Society for Endocrinology.

Hydrogen-Deuterium Exchange Mass Spectrometry Reveals Calcium Binding Properties and Allosteric Regulation of Downstream Regulatory Element Antagonist Modulator (DREAM).

PubMed

Zhang, Jun; Li, Jing; Craig, Theodore A; Kumar, Rajiv; Gross, Michael L

2017-07-18

Downstream regulatory element antagonist modulator (DREAM) is an EF-hand Ca 2+ -binding protein that also binds to a specific DNA sequence, downstream regulatory elements (DRE), and thereby regulates transcription in a calcium-dependent fashion. DREAM binds to DRE in the absence of Ca 2+ but detaches from DRE under Ca 2+ stimulation, allowing gene expression. The Ca 2+ binding properties of DREAM and the consequences of the binding on protein structure are key to understanding the function of DREAM. Here we describe the application of hydrogen-deuterium exchange mass spectrometry (HDX-MS) and site-directed mutagenesis to investigate the Ca 2+ binding properties and the subsequent conformational changes of full-length DREAM. We demonstrate that all EF-hands undergo large conformation changes upon calcium binding even though the EF-1 hand is not capable of binding to Ca 2+ . Moreover, EF-2 is a lower-affinity site compared to EF-3 and -4 hands. Comparison of HDX profiles between wild-type DREAM and two EF-1 mutated constructs illustrates that the conformational changes in the EF-1 hand are induced by long-range structural interactions. HDX analyses also reveal a conformational change in an N-terminal leucine-charged residue-rich domain (LCD) remote from Ca 2+ -binding EF-hands. This LCD domain is responsible for the direct interaction between DREAM and cAMP response element-binding protein (CREB) and regulates the recruitment of the co-activator, CREB-binding protein. These long-range interactions strongly suggest how conformational changes transmit the Ca 2+ signal to CREB-mediated gene transcription.

Doubling the Size of the Glucocorticoid Receptor Ligand Binding Pocket by Deacylcortivazol

DOE Office of Scientific and Technical Information (OSTI.GOV)

Suino-Powell, Kelly; Xu, Yong; Zhang, Chenghai

A common feature of nuclear receptor ligand binding domains (LBD) is a helical sandwich fold that nests a ligand binding pocket within the bottom half of the domain. Here we report that the ligand pocket of glucocorticoid receptor (GR) can be continuously extended into the top half of the LBD by binding to deacylcortivazol (DAC), an extremely potent glucocorticoid. It has been puzzling for decades why DAC, which contains a phenylpyrazole replacement at the conserved 3-ketone of steroid hormones that are normally required for activation of their cognate receptors, is a potent GR activator. The crystal structure of the GRmore » LBD bound to DAC and the fourth LXXLL motif of steroid receptor coactivator 1 reveals that the GR ligand binding pocket is expanded to a size of 1,070 {angstrom}{sup 3}, effectively doubling the size of the GR dexamethasone-binding pocket of 540 {angstrom}{sup 3} and yet leaving the structure of the coactivator binding site intact. DAC occupies only {approx}50% of the space of the pocket but makes intricate interactions with the receptor around the phenylpyrazole group that accounts for the high-affinity binding of DAC. The dramatic expansion of the DAC-binding pocket thus highlights the conformational adaptability of GR to ligand binding. The new structure also allows docking of various nonsteroidal ligands that cannot be fitted into the previous structures, thus providing a new rational template for drug discovery of steroidal and nonsteroidal glucocorticoids that can be specifically designed to reach the unoccupied space of the expanded pocket.« less

Serine 133 Phosphorylation Is Not Required for Hippocampal CREB-Mediated Transcription and Behavior

ERIC Educational Resources Information Center

Brian, Lisa A.; Lee, Bridgin G.; Lelay, John; Kaestner, Klaus H.; Blendy, Julie A.

2015-01-01

The cAMP response element (CRE)-binding protein, CREB, is a transcription factor whose activity in the brain is critical for long-term memory formation. Phosphorylation of Ser133 in the kinase-inducible domain (KID), that in turn leads to the recruitment of the transcriptional coactivator CREB-binding protein (CBP), is thought to mediate the…

Development and application of a quantitative multiplexed small GTPase activity assay using targeted proteomics.

PubMed

Zhang, Cheng-Cheng; Li, Ru; Jiang, Honghui; Lin, Shujun; Rogalski, Jason C; Liu, Kate; Kast, Juergen

2015-02-06

Small GTPases are a family of key signaling molecules that are ubiquitously expressed in various types of cells. Their activity is often analyzed by western blot, which is limited by its multiplexing capability, the quality of isoform-specific antibodies, and the accuracy of quantification. To overcome these issues, a quantitative multiplexed small GTPase activity assay has been developed. Using four different binding domains, this assay allows the binding of up to 12 active small GTPase isoforms simultaneously in a single experiment. To accurately quantify the closely related small GTPase isoforms, a targeted proteomic approach, i.e., selected/multiple reaction monitoring, was developed, and its functionality and reproducibility were validated. This assay was successfully applied to human platelets and revealed time-resolved coactivation of multiple small GTPase isoforms in response to agonists and differential activation of these isoforms in response to inhibitor treatment. This widely applicable approach can be used for signaling pathway studies and inhibitor screening in many cellular systems.

Mutations on the DNA Binding Surface of TBP Discriminate between Yeast TATA and TATA-Less Gene Transcription

PubMed Central

Kamenova, Ivanka; Warfield, Linda

2014-01-01

Most RNA polymerase (Pol) II promoters lack a TATA element, yet nearly all Pol II transcription requires TATA binding protein (TBP). While the TBP-TATA interaction is critical for transcription at TATA-containing promoters, it has been unclear whether TBP sequence-specific DNA contacts are required for transcription at TATA-less genes. Transcription factor IID (TFIID), the TBP-containing coactivator that functions at most TATA-less genes, recognizes short sequence-specific promoter elements in metazoans, but analogous promoter elements have not been identified in Saccharomyces cerevisiae. We generated a set of mutations in the yeast TBP DNA binding surface and found that most support growth of yeast. Both in vivo and in vitro, many of these mutations are specifically defective for transcription of two TATA-containing genes with only minor defects in transcription of two TATA-less, TFIID-dependent genes. TBP binds several TATA-less promoters with apparent high affinity, but our results suggest that this binding is not important for transcription activity. Our results are consistent with the model that sequence-specific TBP-DNA contacts are not important at yeast TATA-less genes and suggest that other general transcription factors or coactivator subunits are responsible for recognition of TATA-less promoters. Our results also explain why yeast TBP derivatives defective for TATA binding appear defective in activated transcription. PMID:24865972

Mutations on the DNA binding surface of TBP discriminate between yeast TATA and TATA-less gene transcription.

PubMed

Kamenova, Ivanka; Warfield, Linda; Hahn, Steven

2014-08-01

Most RNA polymerase (Pol) II promoters lack a TATA element, yet nearly all Pol II transcription requires TATA binding protein (TBP). While the TBP-TATA interaction is critical for transcription at TATA-containing promoters, it has been unclear whether TBP sequence-specific DNA contacts are required for transcription at TATA-less genes. Transcription factor IID (TFIID), the TBP-containing coactivator that functions at most TATA-less genes, recognizes short sequence-specific promoter elements in metazoans, but analogous promoter elements have not been identified in Saccharomyces cerevisiae. We generated a set of mutations in the yeast TBP DNA binding surface and found that most support growth of yeast. Both in vivo and in vitro, many of these mutations are specifically defective for transcription of two TATA-containing genes with only minor defects in transcription of two TATA-less, TFIID-dependent genes. TBP binds several TATA-less promoters with apparent high affinity, but our results suggest that this binding is not important for transcription activity. Our results are consistent with the model that sequence-specific TBP-DNA contacts are not important at yeast TATA-less genes and suggest that other general transcription factors or coactivator subunits are responsible for recognition of TATA-less promoters. Our results also explain why yeast TBP derivatives defective for TATA binding appear defective in activated transcription. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

Distinct nuclear body components, PML and SMRT, regulate the trans-acting function of HTLV-1 Tax oncoprotein.

PubMed

Ariumi, Yasuo; Ego, Takeshi; Kaida, Atsushi; Matsumoto, Mikiko; Pandolfi, Pier Paolo; Shimotohno, Kunitada

2003-03-20

Several viruses target cellular promyelocytic leukemia (PML)-nuclear bodies (PML-NBs) to induce their disruption, marked morphological changes in these structures or the relocation to PML-NB components to the cytoplasm of infected cells. PML conversely interferes with viral replication. We demonstrate that PML acts as a coactivator for the human T-cell leukemia virus type 1 (HTLV-1) Tax oncoprotein without direct binding. Tax was identified within interchromatin granule clusters (IGCs)/RNA splicing bodies (SBs), not PML-NBs; Tax expression did not affect PML-NB formation. Moreover, PML and CBP/p300 cooperatively activated Tax-mediated HTLV-1-LTR-dependent gene expression. Interestingly, two PML mutants, PML-RAR and PMLDelta216-331, which fail to form PML-NBs, could also coactivate Tax-mediated trans-acting function but had no effect on retinoic acid receptor (RAR)- or p53-dependent gene expression. In contrast, SMRT (silencing mediator for retinoic acid and thyroid hormone receptors), a nuclear corepressor found within the matrix-associated deacetylase (MAD) nuclear body, relocalized into Tax-associated nuclear bodies upon coexpression with Tax. SMRT coactivated the trans-acting function of Tax through direct binding. Coexpression of SMRT and PML resulted in an additive activation of Tax trans-acting function. Thus, crosstalk between distinct nuclear bodies may control Tax function.

Isoflavones enhance interleukin-17 gene expression via retinoic acid receptor-related orphan receptors α and γ

PubMed Central

Kojima, Hiroyuki; Takeda, Yukimasa; Muromoto, Ryuta; Takahashi, Miki; Hirao, Toru; Takeuchi, Shinji; Jetten, Anton M.; Matsuda, Tadashi

2018-01-01

The retinoic acid receptor-related orphan receptors α and γ (RORα and RORγ), are key regulators of helper T (Th)17 cell differentiation, which is involved in the innate immune system and autoimmune disorders. In this study, we investigated the effects of isoflavones on RORα/γ activity and the gene expression of interleukin (IL)-17, which mediates the function of Th17 cells. In doxycycline-inducible CHO stable cell lines, we found that four isoflavones, biochanin A (BA), genistein, formononetin, and daidzein, enhanced RORα- or RORγ-mediated transcriptional activity in a dose-dependent manner. In an activation assay of the Il17a promoter using Jurkat cells, these compounds enhanced the RORα- or RORγ-mediated activation of the Il17a promoter at concentrations of 1 × 10−6 M to 1 × 10−5 M. In mammalian two-hybrid assays, the four isoflavones enhanced the interaction between the RORα- or RORγ-ligand binding domain and the co-activator LXXLL peptide in a dose-dependent manner. In addition, these isoflavones potently enhanced Il17a mRNA expression in mouse T lymphoma EL4 cells treated with phorbol myristate acetate and ionomycin, but showed slight enhancement of Il17a gene expression in RORα/γ-knockdown EL4 cells. Immunoprecipitation and immunoblotting assays also revealed that BA enhanced the interaction between RORγt and SRC-1, which is a co-activator for nuclear receptors. Taken together, these results suggest that the isoflavones have the ability to enhance IL-17 gene expression by stabilizing the interactions between RORα/γ and co-activators. This also provides the first evidence that dietary chemicals can enhance IL-17 gene expression in immune cells. PMID:25583575

Crystal Structure of the Dimeric Oct6 (Pou3fl) POU Domain Bound to Palindromic MORE DNA

DOE Office of Scientific and Technical Information (OSTI.GOV)

R Jauch; S Choo; C Ng

POU domains (named after their identification in Pit1, Oct1 unc86) are found in around 15 transcription factors encoded in mammalian genomes many of which feature prominently as key regulators at development bifurcations. For example, the POU III class Octamer binding protein 6 (Oct6) is expressed in embryonic stem cells and during neural development and drives the differentia5tion of myelinated cells in the central and peripheral nervous system. Defects in oct6 expression levels are linked to neurological disorders such as schizophrenia. POU proteins contain a bi-partite DNA binding domain that assembles on various DNA motifs with differentially configured subdomains. Intriguingly, alternativemore » configurations of POU domains on different DNA sites were shown to affect the subsequent recruitment of transcriptional coactivators. Namely, binding of Oct1 to a Palindromic Oct-factor Recognition Element (PORE) was shown to facilitate the recruitment of the OBF1 coactivator whereas More of PORE (MORE) bound Oct1 does not. Moreover, Pit1 was shown to recruit the corepressor N-CoR only when bound to a variant MORE motif with a 2 bp half-site spacing. Therefore, POU proteins are seen as a paradigm for DNA induced allosteric effects on transcription factors modulating their regulatory potential. However, a big unresolved conundrum for the POU class and for most if not all other transcription factor classes is how highly similar proteins regulate different sets of genes causing fundamentally different biological responses. Ultimately, there must be subtle features enabling those factors to engage in contrasting molecular interactions in the cell. Thus, the dissection of the molecular details of the transcription-DNA recognition in general, and the formation of multimeric regulatory complexes, in particular, is highly desirable. To contribute to these efforts they solved the 2.05 {angstrom} crystal structure of Oct6 bound as a symmetrical homodimer to palindromic MORE DNA.« less

The zinc-binding region (ZBR) fragment of Emi2 can inhibit APC/C by targeting its association with the coactivator Cdc20 and UBE2C-mediated ubiquitylation

PubMed Central

Shoji, Shisako; Muto, Yutaka; Ikeda, Mariko; He, Fahu; Tsuda, Kengo; Ohsawa, Noboru; Akasaka, Ryogo; Terada, Takaho; Wakiyama, Motoaki; Shirouzu, Mikako; Yokoyama, Shigeyuki

2014-01-01

Anaphase-promoting complex or cyclosome (APC/C) is a multisubunit ubiquitin ligase E3 that targets cell-cycle regulators. Cdc20 is required for full activation of APC/C in M phase, and mediates substrate recognition. In vertebrates, Emi2/Erp1/FBXO43 inhibits APC/C-Cdc20, and functions as a cytostatic factor that causes long-term M phase arrest of mature oocytes. In this study, we found that a fragment corresponding to the zinc-binding region (ZBR) domain of Emi2 inhibits cell-cycle progression, and impairs the association of Cdc20 with the APC/C core complex in HEK293T cells. Furthermore, we revealed that the ZBR fragment of Emi2 inhibits in vitro ubiquitin chain elongation catalyzed by the APC/C cullin-RING ligase module, the ANAPC2–ANAPC11 subcomplex, in combination with the ubiquitin chain-initiating E2, E2C/UBE2C/UbcH10. Structural analyses revealed that the Emi2 ZBR domain uses different faces for the two mechanisms. Thus, the double-faced ZBR domain of Emi2 antagonizes the APC/C function by inhibiting both the binding with the coactivator Cdc20 and ubiquitylation mediated by the cullin-RING ligase module and E2C. In addition, the tail region between the ZBR domain and the C-terminal RL residues [the post-ZBR (PZ) region] interacts with the cullin subunit, ANAPC2. In the case of the ZBR fragment of the somatic paralogue of Emi2, Emi1/FBXO5, these inhibitory activities against cell division and ubiquitylation were not observed. Finally, we identified two sets of key residues in the Emi2 ZBR domain that selectively exert each of the dual Emi2-specific modes of APC/C inhibition, by their mutation in the Emi2 ZBR domain and their transplantation into the Emi1 ZBR domain. PMID:25161877

Transcription coactivator SAYP combines chromatin remodeler Brahma and transcription initiation factor TFIID into a single supercomplex

PubMed Central

Vorobyeva, Nadezhda E.; Soshnikova, Nataliya V.; Nikolenko, Julia V.; Kuzmina, Julia L.; Nabirochkina, Elena N.; Georgieva, Sofia G.; Shidlovskii, Yulii V.

2009-01-01

Transcription activation by RNA polymerase II is a complicated process driven by combined, precisely coordinated action of a wide array of coactivator complexes, which carry out chromatin-directed activities and nucleate the assembly of the preinitiation complex on the promoter. Using various techniques, we have shown the existence of a stable coactivator supercomplex consisting of the chromatin-remodeling factor Brahma (SWI/SNF) and the transcription initiation factor TFIID, named BTFly (Brahma and TFIID in one assembly). The coupling of Brahma and TFIID is mediated by the SAYP factor, whose evolutionarily conserved activation domain SAY can directly bind to both BAP170 subunit of Brahma and TAF5 subunit of TFIID. The integrity of BTFly is crucial for its ability to activate transcription. BTFly is distributed genome-wide and appears to be a means of effective transcription activation. PMID:19541607

CRTC2 is required for β-cell function and proliferation.

PubMed

Eberhard, Chandra E; Fu, Accalia; Reeks, Courtney; Screaton, Robert A

2013-07-01

Previous work in insulinoma cell lines has established that calcineurin plays a critical role in the activation of cAMP-responsive element binding protein (Creb), a key transcription factor required for β-cell function and survival, by dephosphorylating the Creb coactivator Creb-regulated transcription coactivator (Crtc)2 at 2 regulatory sites, Ser171 and Ser275. Here, we report that Crtc2 is essential both for glucose-stimulated insulin secretion and cell survival in the β-cell. Endogenous Crtc2 activation is achieved via increasing glucose levels to the physiological feeding range, indicating that Crtc2 is a sensor that couples ambient glucose concentrations to Creb activity in the β-cell. Immunosuppressant drugs such as cyclosporin A and tacrolimus that target the protein phosphatase calcineurin are commonly administered after organ transplantation. Chronic use is associated with reduced insulin secretion and new onset diabetes, suggestive of pancreatic β-cell dysfunction. Importantly, we show that overexpression of a Crtc2 mutant rendered constitutively active by introduction of nonphosphorylatable alanine residues at Ser171 and Ser275 permits Creb target gene activation under conditions when calcineurin is inhibited. Taken together, these data suggest that promoting Crtc2-Creb activity is required for β-cell function and proliferation and promoting this pathway could ameliorate symptoms of new onset diabetes after transplantation.

KDM4A Coactivates E2F1 to Regulate the PDK-Dependent Metabolic Switch between Mitochondrial Oxidation and Glycolysis.

PubMed

Wang, Ling-Yu; Hung, Chiu-Lien; Chen, Yun-Ru; Yang, Joy C; Wang, Junjian; Campbell, Mel; Izumiya, Yoshihiro; Chen, Hong-Wu; Wang, Wen-Ching; Ann, David K; Kung, Hsing-Jien

2016-09-13

The histone lysine demethylase KDM4A/JMJD2A has been implicated in prostate carcinogenesis through its role in transcriptional regulation. Here, we describe KDM4A as a E2F1 coactivator and demonstrate a functional role for the E2F1-KDM4A complex in the control of tumor metabolism. KDM4A associates with E2F1 on target gene promoters and enhances E2F1 chromatin binding and transcriptional activity, thereby modulating the transcriptional profile essential for cancer cell proliferation and survival. The pyruvate dehydrogenase kinases (PDKs) PDK1 and PDK3 are direct targets of KDM4A and E2F1 and modulate the switch between glycolytic metabolism and mitochondrial oxidation. Downregulation of KDM4A leads to elevated activity of pyruvate dehydrogenase and mitochondrial oxidation, resulting in excessive accumulation of reactive oxygen species. The altered metabolic phenotypes can be partially rescued by ectopic expression of PDK1 and PDK3, indicating a KDM4A-dependent tumor metabolic regulation via PDK. Our results suggest that KDM4A is a key regulator of tumor metabolism and a potential therapeutic target for prostate cancer. Copyright © 2016 The Author(s). Published by Elsevier Inc. All rights reserved.

Structure and Dynamics of the Liver Receptor Homolog 1-PGC1α Complex.

PubMed

Mays, Suzanne G; Okafor, C Denise; Tuntland, Micheal L; Whitby, Richard J; Dharmarajan, Venkatasubramanian; Stec, Józef; Griffin, Patrick R; Ortlund, Eric A

2017-07-01

Peroxisome proliferator-activated gamma coactivator 1- α (PGC1 α ) regulates energy metabolism by directly interacting with transcription factors to modulate gene expression. Among the PGC1 α binding partners is liver receptor homolog 1 (LRH-1; NR5A2), an orphan nuclear hormone receptor that controls lipid and glucose homeostasis. Although PGC1 α is known to bind and activate LRH-1, mechanisms through which PGC1 α changes LRH-1 conformation to drive transcription are unknown. Here, we used biochemical and structural methods to interrogate the LRH-1-PGC1 α complex. Purified, full-length LRH-1, as well as isolated ligand binding domain, bound to PGC1 α with higher affinity than to the coactivator, nuclear receptor coactivator-2 (Tif2), in coregulator peptide recruitment assays. We present the first crystal structure of the LRH-1-PGC1 α complex, which depicts several hydrophobic contacts and a strong charge clamp at the interface between these partners. In molecular dynamics simulations, PGC1 α induced correlated atomic motion throughout the entire LRH-1 activation function surface, which was dependent on charge-clamp formation. In contrast, Tif2 induced weaker signaling at the activation function surface than PGC1 α but promoted allosteric signaling from the helix 6/ β -sheet region of LRH-1 to the activation function surface. These studies are the first to probe mechanisms underlying the LRH-1-PGC1 α interaction and may illuminate strategies for selective therapeutic targeting of PGC1 α -dependent LRH-1 signaling pathways. Copyright © 2017 by The American Society for Pharmacology and Experimental Therapeutics.

Mediator subunit MED1 is a T3-dependent and T3-independent coactivator on the thyrotropin β gene promoter

DOE Office of Scientific and Technical Information (OSTI.GOV)

Matsui, Keiji; Oda, Kasumi; Mizuta, Shumpei

2013-10-11

Highlights: •MED1 is a bona fide T3-dependent coactivator on TSHB promoter. •Mice with LxxLL-mutant MED1 have attenuated TSHβ mRNA and thyroid hormone levels. •MED1 activates TSHB promoter T3-dependently in cultured cells. •T3-dependent MED1 action is enhanced when SRC1/SRC2 or HDAC2 is downregulated. •MED1 is also a T3-independent GATA2/Pit1 coactivator on TSHB promoter. -- Abstract: The MED1 subunit of the Mediator transcriptional coregulator complex is a nuclear receptor-specific coactivator. A negative feedback mechanism of thyroid-stimulating hormone (TSH, or thyrotropin) expression in the thyrotroph in the presence of triiodothyronine (T3) is employed by liganded thyroid hormone receptor β (TRβ) on the TSHβmore » gene promoter, where conventional histone-modifying coactivators act as corepressors. We now provide evidence that MED1 is a ligand-dependent positive cofactor on this promoter. TSHβ gene transcription was attenuated in MED1 mutant mice in which the nuclear receptor-binding ability of MED1 was specifically disrupted. MED1 stimulated GATA2- and Pit1-mediated TSHβ gene promoter activity in a ligand-independent manner in cultured cells. MED1 also stimulated transcription from the TSHβ gene promoter in a T3-dependent manner. The transcription was further enhanced when the T3-dependent corepressors SRC1, SRC2, and HDAC2 were downregulated. Hence, MED1 is a T3-dependent and -independent coactivator on the TSHβ gene promoter.« less

Transcriptional regulation of human papillomavirus type 18 P105 promoter by the co-activator CBP.

PubMed

Valencia-Hernández, Armando; Cuevas-Bennett, Christian; Garrido, Efraín

2007-01-01

Human papillomaviruses (HPVs) are the etiological agents of cervical cancer, with HPV-16 and 18 being the representative types of the higher risk group. The expression of the viral genes with transforming activity (E6 and E7) is controlled by the upstream regulatory region (URR), a segment of the viral genome that contains elements recognized by several transcription factors. We have analyzed the participation of the cellular co-activator CBP on the transcriptional regulation of the HPV-18 URR. We generated mutants and 5' end deletion constructs derived from the HPV-18 URR and evaluated their transcriptional activity performing transient co-transfection assays on C-33A cells with a plasmid that over-expresses the co-activator CBP. We also performed quantitative chromatin immunoprecipitation assays to analyze the participation of the co-activator CBP on the HPV-18 P105 promoter. Our results demonstrate that in C-33A cells CBP acts as a strong activator of the HPV-18 P105 promoter by a mechanism that depends on the integrity of the SP1-binding site, directly correlating with the acetylation of the histone H3 that is involved in nucleosomal stability. We propose a mechanism of regulation of the HPV-18 P105 promoter by the cellular co-activator CBP, recruited by the transcription factor SP1. (c) 2008 S. Karger AG, Basel

Nuclear receptor coactivators function in estrogen receptor- and progestin receptor-dependent aspects of sexual behavior in female rats

PubMed Central

Molenda-Figueira, Heather A.; Williams, Casey A.; Griffin, Andreana L.; Rutledge, Eric M.; Blaustein, Jeffrey D.; Tetel, Marc J.

2008-01-01

The ovarian hormones, estradiol (E) and progesterone (P) facilitate the expression of sexual behavior in female rats. E and P mediate many of these behavioral effects by binding to their respective intracellular receptors in specific brain regions. Nuclear receptor coactivators, including Steroid Receptor Coactivator-1 (SRC-1) and CREB Binding Protein (CBP), dramatically enhance ligand-dependent steroid receptor transcriptional activity in vitro. Previously, our lab has shown that SRC-1 and CBP modulate estrogen receptor (ER)-mediated induction of progestin receptor (PR) gene expression in the ventromedial nucleus of the hypothalamus (VMN) and hormone-dependent sexual receptivity in female rats. Female sexual behaviors can be activated by high doses of E alone in ovariectomized rats, and thus are believed to be ER-dependent. However, the full repertoire of female sexual behavior, in particular, proceptive behaviors such as hopping, darting and ear wiggling, are considered to be PR-dependent. In the present experiments, the function of SRC-1 and CBP in distinct ER- (Exp. 1) and PR- (Exp. 2) dependent aspects of female sexual behavior was investigated. In Exp. 1, infusion of antisense oligodeoxynucleotides to SRC-1 and CBP mRNA into the VMN decreased lordosis intensity in rats treated with E alone, suggesting that these coactivators modulate ER-mediated female sexual behavior. In Exp. 2, antisense to SRC-1 and CBP mRNA around the time of P administration reduced PR-dependent ear wiggling and hopping and darting. Taken together, these data suggest that SRC-1 and CBP modulate ER and PR action in brain and influence distinct aspects of hormone-dependent sexual behaviors. These findings support our previous studies and provide further evidence that SRC-1 and CBP function together to regulate ovarian hormone action in behaviorally-relevant brain regions. PMID:16769066

Structural basis for corepressor assembly by the orphan nuclear receptor TLX.

PubMed

Zhi, Xiaoyong; Zhou, X Edward; He, Yuanzheng; Searose-Xu, Kelvin; Zhang, Chun-Li; Tsai, Chih-Cheng; Melcher, Karsten; Xu, H Eric

2015-02-15

The orphan nuclear receptor TLX regulates neural stem cell self-renewal in the adult brain and functions primarily as a transcription repressor through recruitment of Atrophin corepressors, which bind to TLX via a conserved peptide motif termed the Atro box. Here we report crystal structures of the human and insect TLX ligand-binding domain in complex with Atro box peptides. In these structures, TLX adopts an autorepressed conformation in which its helix H12 occupies the coactivator-binding groove. Unexpectedly, H12 in this autorepressed conformation forms a novel binding pocket with residues from helix H3 that accommodates a short helix formed by the conserved ALXXLXXY motif of the Atro box. Mutations that weaken the TLX-Atrophin interaction compromise the repressive activity of TLX, demonstrating that this interaction is required for Atrophin to confer repressor activity to TLX. Moreover, the autorepressed conformation is conserved in the repressor class of orphan nuclear receptors, and mutations of corresponding residues in other members of this class of receptors diminish their repressor activities. Together, our results establish the functional conservation of the autorepressed conformation and define a key sequence motif in the Atro box that is essential for TLX-mediated repression. © 2015 Zhi et al.; Published by Cold Spring Harbor Laboratory Press.

Kinetic and Thermodynamic Characterization of Dihydrotestosterone-Induced Conformational Perturbations in Androgen Receptor Ligand-Binding Domain

PubMed Central

Jasuja, Ravi; Ulloor, Jagadish; Yengo, Christopher M.; Choong, Karen; Istomin, Andrei Y.; Livesay, Dennis R.; Jacobs, Donald J.; Swerdloff, Ronald S.; Mikšovská, Jaroslava; Larsen, Randy W.; Bhasin, Shalender

2009-01-01

Ligand-induced conformational perturbations in androgen receptor (AR) are important in coactivator recruitment and transactivation. However, molecular rearrangements in AR ligand-binding domain (AR-LBD) associated with agonist binding and their kinetic and thermodynamic parameters are poorly understood. We used steady-state second-derivative absorption and emission spectroscopy, pressure and temperature perturbations, and 4,4′-bis-anilinonaphthalene 8-sulfonate (bis-ANS) partitioning to determine the kinetics and thermodynamics of the conformational changes in AR-LBD after dihydrotestosterone (DHT) binding. In presence of DHT, the second-derivative absorption spectrum showed a red shift and a change in peak-to-peak distance. Emission intensity increased upon DHT binding, and center of spectral mass was blue shifted, denoting conformational changes resulting in more hydrophobic environment for tyrosines and tryptophans within a more compact DHT-bound receptor. In pressure perturbation calorimetry, DHT-induced energetic stabilization increased the Gibbs free energy of unfolding to 8.4 ± 1.3 kcal/mol from 3.5 ± 1.6 kcal/mol. Bis-ANS partitioning studies revealed that upon DHT binding, AR-LBD underwent biphasic rearrangement with a high activation energy (13.4 kcal/mol). An initial, molten globule-like burst phase (k ∼30 sec−1) with greater solvent accessibility was followed by rearrangement (k ∼0.01 sec−1), leading to a more compact conformation than apo-AR-LBD. Molecular simulations demonstrated unique sensitivity of tyrosine and tryptophan residues during pressure unfolding with rearrangement of residues in the coactivator recruitment surfaces distant from the ligand-binding pocket. In conclusion, DHT binding leads to energetic stabilization of AR-LBD domain and substantial rearrangement of residues distant from the ligand-binding pocket. DHT binding to AR-LBD involves biphasic receptor rearrangement including population of a molten globule-like intermediate state. PMID:19443608

Epstein-Barr Virus Nuclear Antigen Leader Protein Coactivates EP300.

PubMed

Wang, Chong; Zhou, Hufeng; Xue, Yong; Liang, Jun; Narita, Yohei; Gerdt, Catherine; Zheng, Amy Y; Jiang, Runsheng; Trudeau, Stephen; Peng, Chih-Wen; Gewurz, Benjamin E; Zhao, Bo

2018-05-01

Epstein-Barr virus nuclear antigen (EBNA) leader protein (EBNALP) is one of the first viral genes expressed upon B-cell infection. EBNALP is essential for EBV-mediated B-cell immortalization. EBNALP is thought to function primarily by coactivating EBNA2-mediated transcription. Chromatin immune precipitation followed by deep sequencing (ChIP-seq) studies highlight that EBNALP frequently cooccupies DNA sites with host cell transcription factors (TFs), in particular, EP300, implicating a broader role in transcription regulation. In this study, we investigated the mechanisms of EBNALP transcription coactivation through EP300. EBNALP greatly enhanced EP300 transcription activation when EP300 was tethered to a promoter. EBNALP coimmunoprecipitated endogenous EP300 from lymphoblastoid cell lines (LCLs). EBNALP W repeat serine residues 34, 36, and 63 were required for EP300 association and coactivation. Deletion of the EP300 histone acetyltransferase (HAT) domain greatly reduced EBNALP coactivation and abolished the EBNALP association. An EP300 bromodomain inhibitor also abolished EBNALP coactivation and blocked the EP300 association with EBNALP. EBNALP sites cooccupied by EP300 had significantly higher ChIP-seq signals for sequence-specific TFs, including SPI1, RelA, EBF1, IRF4, BATF, and PAX5. EBNALP- and EP300-cooccurring sites also had much higher H3K4me1 and H3K27ac signals, indicative of activated enhancers. EBNALP-only sites had much higher signals for DNA looping factors, including CTCF and RAD21. EBNALP coactivated reporters under the control of NF-κB or SPI1. EP300 inhibition abolished EBNALP coactivation of these reporters. Clustered regularly interspaced short palindromic repeat interference targeting of EBNALP enhancer sites significantly reduced target gene expression, including that of EP300 itself. These data suggest a previously unrecognized mechanism by which EBNALP coactivates transcription through subverting of EP300 and thus affects the expression of LCL genes regulated by a broad range of host TFs. IMPORTANCE Epstein-Barr virus was the first human DNA tumor virus discovered over 50 years ago. EBV is causally linked to ∼200,000 human malignancies annually. These cancers include endemic Burkitt lymphoma, Hodgkin lymphoma, lymphoma/lymphoproliferative disease in transplant recipients or HIV-infected people, nasopharyngeal carcinoma, and ∼10% of gastric carcinoma cases. EBV-immortalized human B cells faithfully model key aspects of EBV lymphoproliferative diseases and are useful models of EBV oncogenesis. EBNALP is essential for EBV to transform B cells and transcriptionally coactivates EBNA2 by removing repressors from EBNA2-bound DNA sites. Here, we found that EBNALP can also modulate the activity of the key transcription activator EP300, an acetyltransferase that activates a broad range of transcription factors. Our data suggest that EBNALP regulates a much broader range of host genes than was previously appreciated. A small-molecule inhibitor of EP300 abolished EBNALP coactivation of multiple target genes. These findings suggest novel therapeutic approaches to control EBV-associated lymphoproliferative diseases. Copyright © 2018 American Society for Microbiology.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Michael, Alicia K.; Fribourgh, Jennifer L.; Chelliah, Yogarany

The basic helix-loop-helix PAS domain (bHLH-PAS) transcription factor CLOCK:BMAL1 (brain and muscle Arnt-like protein 1) sits at the core of the mammalian circadian transcription/translation feedback loop. Precise control of CLOCK:BMAL1 activity by coactivators and repressors establishes the ~24-h periodicity of gene expression. Formation of a repressive complex, defined by the core clock proteins cryptochrome 1 (CRY1):CLOCK:BMAL1, plays an important role controlling the switch from repression to activation each day. Here in this paper, we show that CRY1 binds directly to the PAS domain core of CLOCK: BMAL1, driven primarily by interaction with the CLOCK PAS-B domain. Integrative modeling and solutionmore » X-ray scattering studies unambiguously position a key loop of the CLOCK PAS-B domain in the secondary pocket of CRY1, analogous to the antenna chromophore-binding pocket of photolyase. CRY1 docks onto the transcription factor alongside the PAS domains, extending above the DNA-binding bHLH domain. Single point mutations at the interface on either CRY1 or CLOCK disrupt formation of the ternary complex, highlighting the importance of this interface for direct regulation of CLOCK:BMAL1 activity by CRY1.« less

Conformational Control of the Binding of the Transactivation Domain of the MLL Protein and c-Myb to the KIX Domain of CREB

PubMed Central

Korkmaz, Elif Nihal; Nussinov, Ruth; Haliloğlu, Türkan

2012-01-01

The KIX domain of CBP is a transcriptional coactivator. Concomitant binding to the activation domain of proto-oncogene protein c-Myb and the transactivation domain of the trithorax group protein mixed lineage leukemia (MLL) transcription factor lead to the biologically active ternary MLL∶KIX∶c-Myb complex which plays a role in Pol II-mediated transcription. The binding of the activation domain of MLL to KIX enhances c-Myb binding. Here we carried out molecular dynamics (MD) simulations for the MLL∶KIX∶c-Myb ternary complex, its binary components and KIX with the goal of providing a mechanistic explanation for the experimental observations. The dynamic behavior revealed that the MLL binding site is allosterically coupled to the c-Myb binding site. MLL binding redistributes the conformational ensemble of KIX, leading to higher populations of states which favor c-Myb binding. The key element in the allosteric communication pathways is the KIX loop, which acts as a control mechanism to enhance subsequent binding events. We tested this conclusion by in silico mutations of loop residues in the KIX∶MLL complex and by comparing wild type and mutant dynamics through MD simulations. The loop assumed MLL binding conformation similar to that observed in the KIX∶c-Myb state which disfavors the allosteric network. The coupling with c-Myb binding site faded, abolishing the positive cooperativity observed in the presence of MLL. Our major conclusion is that by eliciting a loop-mediated allosteric switch between the different states following the binding events, transcriptional activation can be regulated. The KIX system presents an example how nature makes use of conformational control in higher level regulation of transcriptional activity and thus cellular events. PMID:22438798

Hydroxylated polybrominated diphenyl ethers exhibit different activities on thyroid hormone receptors depending on their degree of bromination.

PubMed

Ren, Xiao-Min; Guo, Liang-Hong; Gao, Yu; Zhang, Bin-Tian; Wan, Bin

2013-05-01

Polybrominated diphenyl ethers (PBDEs) have been shown to disrupt thyroid hormone (TH) functions in experimental animals, and one of the proposed disruption mechanisms is direct binding of hydroxylated PBDE (OH-PBDE) to TH receptors (TRs). However, previous data on TH receptor binding and TH activity of OH-PBDEs were very limited and sometimes inconsistent. In the present paper, we examined the binding potency of ten OH-PBDEs with different degrees of bromination to TR using a fluorescence competitive binding assay. The results showed that the ten OH-PBDEs bound to TR with potency that correlated to their bromination level. We further examined their effect on TR using a coactivator binding assay and GH3 cell proliferation assay. Different TR activities of OH-PBDEs were observed depending on their degree of bromination. Four low-brominated OH-PBDEs (2'-OH-BDE-28, 3'-OH-BDE-28, 5-OH-BDE-47, 6-OH-BDE-47) were found to be TR agonists, which recruited the coactivator peptide and enhanced GH3 cell proliferation. However, three high-brominated OH-PBDEs (3-OH-BDE-100, 3'-OH-BDE-154, 4-OH-BDE-188) were tested to be antagonists. Molecular docking was employed to simulate the interactions of OH-PBDEs with TR and identify the structural determinants for TR binding and activity. According to the docking results, low-brominated OH-PBDEs, which are weak binders but TR agonists, bind with TR at the inner side of its binding pocket, whereas high-brominated compounds, which are potent binders but TR antagonists, reside at the outer region. These results indicate that OH-PBDEs have different activities on TR (agonistic or antagonistic), possibly due to their different binding geometries with the receptor. Copyright © 2013 Elsevier Inc. All rights reserved.

Validation of chemical compound library screening for transcriptional co-activator with PDZ-binding motif inhibitors using GFP-fused transcriptional co-activator with PDZ-binding motif.

PubMed

Nagashima, Shunta; Maruyama, Junichi; Kawano, Shodai; Iwasa, Hiroaki; Nakagawa, Kentaro; Ishigami-Yuasa, Mari; Kagechika, Hiroyuki; Nishina, Hiroshi; Hata, Yutaka

2016-06-01

Transcriptional co-activator with PDZ-binding motif (TAZ) plays versatile roles in cell proliferation and differentiation. It is phosphorylated by large tumor suppressor kinases, the core kinases of the tumor-suppressive Hippo pathway. Phosphorylation induces the cytoplasmic accumulation of TAZ and its degradation. In human cancers, the deregulation of the Hippo pathway and gene amplification enhance TAZ activity. TAZ interacts with TEA domain family members (TEAD), and upregulates genes implicated in epithelial-mesenchymal transition. It also confers stemness to cancer cells. Thus, TAZ activation provides cancer cells with malignant properties and worsens the clinical prognosis. Therefore, TAZ attracts attention as a therapeutic target in cancer therapy. We applied 18 606 small chemical compounds to human osteosarcoma U2OS cells expressing GFP-fused TAZ (GFP-TAZ), monitored the subcellular localization of GFP-TAZ, and selected 33 compounds that shifted GFP-TAZ to the cytoplasm. Unexpectedly, only a limited number of compounds suppressed TAZ-mediated enhancement of TEAD-responsive reporter activity. Moreover, the compounds that weakened TEAD reporter activity did not necessarily decrease the unphosphorylated TAZ. In this study, we focused on three compounds that decreased both TEAD reporter activity and unphosphorylated TAZ, and treated several human cancer cells with these compounds. One compound did not show a remarkable effect, whereas the other two compounds compromised the cell viability in certain cancer cells. In conclusion, the GFP-TAZ-based assay can be used as the first screening for compounds that inhibit TAZ and show anticancer properties. To develop anticancer drugs, we need additional assays to select the compounds. © 2016 The Authors. Cancer Science published by John Wiley & Sons Australia, Ltd on behalf of Japanese Cancer Association.

Design and structure of stapled peptides binding to estrogen receptors.

PubMed

Phillips, Chris; Roberts, Lee R; Schade, Markus; Bazin, Richard; Bent, Andrew; Davies, Nichola L; Moore, Rob; Pannifer, Andrew D; Pickford, Andrew R; Prior, Stephen H; Read, Christopher M; Scott, Andrew; Brown, David G; Xu, Bin; Irving, Stephen L

2011-06-29

Synthetic peptides that specifically bind nuclear hormone receptors offer an alternative approach to small molecules for the modulation of receptor signaling and subsequent gene expression. Here we describe the design of a series of novel stapled peptides that bind the coactivator peptide site of estrogen receptors. Using a number of biophysical techniques, including crystal structure analysis of receptor-stapled peptide complexes, we describe in detail the molecular interactions and demonstrate that all-hydrocarbon staples modulate molecular recognition events. The findings have implications for the design of stapled peptides in general.

Identification of a Novel LXXLL Motif in α-Actinin 4-spliced Isoform That Is Critical for Its Interaction with Estrogen Receptor α and Co-activators*

PubMed Central

Khurana, Simran; Chakraborty, Sharmistha; Zhao, Xuan; Liu, Yu; Guan, Dongyin; Lam, Minh; Huang, Wei; Yang, Sichun; Kao, Hung-Ying

2012-01-01

α-Actinins (ACTNs) are a family of proteins cross-linking actin filaments that maintain cytoskeletal organization and cell motility. Recently, it has also become clear that ACTN4 can function in the nucleus. In this report, we found that ACTN4 (full length) and its spliced isoform ACTN4 (Iso) possess an unusual LXXLL nuclear receptor interacting motif. Both ACTN4 (full length) and ACTN4 (Iso) potentiate basal transcription activity and directly interact with estrogen receptor α, although ACTN4 (Iso) binds ERα more strongly. We have also found that both ACTN4 (full length) and ACTN4 (Iso) interact with the ligand-independent and the ligand-dependent activation domains of estrogen receptor α. Although ACTN4 (Iso) interacts efficiently with transcriptional co-activators such as p300/CBP-associated factor (PCAF) and steroid receptor co-activator 1 (SRC-1), the full length ACTN4 protein either does not or does so weakly. More importantly, the flanking sequences of the LXXLL motif are important not only for interacting with nuclear receptors but also for the association with co-activators. Taken together, we have identified a novel extended LXXLL motif that is critical for interactions with both receptors and co-activators. This motif functions more efficiently in a spliced isoform of ACTN4 than it does in the full-length protein. PMID:22908231

The dyskerin ribonucleoprotein complex as an OCT4/SOX2 coactivator in embryonic stem cells

PubMed Central

Fong, Yick W; Ho, Jaclyn J; Inouye, Carla; Tjian, Robert

2014-01-01

Acquisition of pluripotency is driven largely at the transcriptional level by activators OCT4, SOX2, and NANOG that must in turn cooperate with diverse coactivators to execute stem cell-specific gene expression programs. Using a biochemically defined in vitro transcription system that mediates OCT4/SOX2 and coactivator-dependent transcription of the Nanog gene, we report the purification and identification of the dyskerin (DKC1) ribonucleoprotein complex as an OCT4/SOX2 coactivator whose activity appears to be modulated by a subset of associated small nucleolar RNAs (snoRNAs). The DKC1 complex occupies enhancers and regulates the expression of key pluripotency genes critical for self-renewal in embryonic stem (ES) cells. Depletion of DKC1 in fibroblasts significantly decreased the efficiency of induced pluripotent stem (iPS) cell generation. This study thus reveals an unanticipated transcriptional role of the DKC1 complex in stem cell maintenance and somatic cell reprogramming. DOI: http://dx.doi.org/10.7554/eLife.03573.001 PMID:25407680

Transient α-helices in the disordered RPEL motifs of the serum response factor coactivator MKL1

NASA Astrophysics Data System (ADS)

Mizuguchi, Mineyuki; Fuju, Takahiro; Obita, Takayuki; Ishikawa, Mitsuru; Tsuda, Masaaki; Tabuchi, Akiko

2014-06-01

The megakaryoblastic leukemia 1 (MKL1) protein functions as a transcriptional coactivator of the serum response factor. MKL1 has three RPEL motifs (RPEL1, RPEL2, and RPEL3) in its N-terminal region. MKL1 binds to monomeric G-actin through RPEL motifs, and the dissociation of MKL1 from G-actin promotes the translocation of MKL1 to the nucleus. Although structural data are available for RPEL motifs of MKL1 in complex with G-actin, the structural characteristics of RPEL motifs in the free state have been poorly defined. Here we characterized the structures of free RPEL motifs using NMR and CD spectroscopy. NMR and CD measurements showed that free RPEL motifs are largely unstructured in solution. However, NMR analysis identified transient α-helices in the regions where helices α1 and α2 are induced upon binding to G-actin. Proline mutagenesis showed that the transient α-helices are locally formed without helix-helix interactions. The helix content is higher in the order of RPEL1, RPEL2, and RPEL3. The amount of preformed structure may correlate with the binding affinity between the intrinsically disordered protein and its target molecule.

Taiman acts as a coactivator of Yorkie in the Hippo pathway to promote tissue growth and intestinal regeneration.

PubMed

Wang, Chao; Yin, Meng-Xin; Wu, Wei; Dong, Liang; Wang, Shimin; Lu, Yi; Xu, Jinjin; Wu, Wenqing; Li, Sheng; Zhao, Yun; Zhang, Lei

2016-01-01

The Hippo signaling pathway regulates tissue growth and organ size through controlling cell growth, proliferation and apoptosis. During these processes, the coactivator Yorkie partners with the transcription factor Scalloped to mediate Hippo pathway-regulated cellular functions. Here, we demonstrate that Taiman facilitates the activity of Yorkie. First, Taiman overexpression upregulates Hippo pathway-responsive genes and induces tissue overgrowth. Second, the loss of tai downregulates the expression of Hippo pathway target genes and reduces organ size as well as tissue overgrowth caused by Yorkie overexpression. Furthermore, we provide evidence that Taiman binds to Yorkie and facilitates the activity of Yorkie-Scalloped to activate the transcription of several Hippo pathway target genes. Moreover, we found that the C-terminus of Taiman is indispensable for the function of Taiman in Hippo signaling. Finally, we demonstrate that Taiman is also required in intestinal stem cell proliferation. Our findings suggest Taiman is an essential coactivator of Yorkie.

Cardiopathogenic mediators generated by GATA4 signaling upon co-activation with endothelin-1 and Trypanosoma cruzi infection.

PubMed

Rigazio, Cristina S; Hernández, Matías; Corral, Ricardo S

2014-08-01

Trypanosoma cruzi (Tc), the etiological agent of Chagas disease, triggers multiple responses in the myocardium, a central organ of infection and pathology in the host. Parasite-driven induction of diverse regulators of cardiovascular function, including the vasoconstrictor endothelin-1 (ET-1), the inducible form of nitric oxide synthase (iNOS) and the B-type natriuretic peptide (BNP), has been linked to the development of severe chagasic cardiomyopathy. Our current goal was to analyze the participation of the zinc finger transcription factor GATA4, critically implicated in pathological cardiac hypertrophic response, in the generation of key mediators involved in the pathogenesis of Tc-elicited heart dysfunction. In this study, we found that the combined effects of Tc and ET-1 on atrial myocytes promoted the protein expression, phosphorylation and DNA-binding activity of GATA4, leading to augmented protein levels of iNOS and increased nitric oxide release. Moreover, Tc- and ET-1-co-activation of cardiomyocytes resulted in enhanced GATA4-dependent secretion of BNP. Accordingly, mice with chronic chagasic cardiomyopathy showed increased expression of GATA4, iNOS and BNP at inflammatory lesions in cardiac muscle. Our findings support a role for the GATA4 signaling pathway in the myocardial production of pathogenic mediators associated with Chagas heart disease, and may help define novel therapeutic targets. Copyright © 2014 Elsevier Ltd. All rights reserved.

Structural insight into the antagonistic action of diarylheptanoid on human estrogen receptor alpha.

PubMed

Geetha Rani, Yuvaraj; Lakshmi, Baddireddi Subhadra

2018-03-30

Estrogen receptor α (ER α) is an important therapeutic target in the regulation of ligand dependent signaling in breast cancer. The current study investigates the anti-estrogenic potential of the Diarylheptanoid, 5-hydroxy-7-(4-hydroxy-3 methoxyphenyl)-1-phenyl-3-heptanone (DAH) in silico. Rigid Docking analysis of DAH at the ligand binding domain (LBD) of ER α showed hydrogen bond interactions with Arg394 and Glu353 at the active site, similar to the positive controls 4-Hydroxy Tamoxifen (4-OHT) and Fulvestrant (FUL). The protein and the protein-DAH complexes were further analyzed using molecular dynamics simulations for a time scale of 50 ns using GROMACS. Root mean square fluctuation (RMSF) analysis showed large fluctuations at the N-terminal region of Helices (H) 3, 9 and at the C-terminal region of H11, which could be involved in the antagonistic conformational change. Interestingly, H12 appeared to move away from the ligand binding pocket and occupy the co-activator binding groove at the LBD of ER α. Secondary structure analysis of the protein upon binding of DAH and CUR showed structural change from α-helix to Turn conformation at H4. We hypothesize that this structural change at H4, similar to the positive control, could hinder the activity of AF-2 by blocking the binding of co-activator. These conformational changes in ER α indicate an anti-estrogenic and therapeutic potential of the DAH.

Selective binding of the fluorescent dye 1-anilinonaphthalene-8-sulfonic acid to peroxisome proliferator-activated receptor gamma allows ligand identification and characterization.

PubMed

Zorrilla, Silvia; Garzón, Beatriz; Pérez-Sala, Dolores

2010-04-01

Peroxisome proliferator-activated receptor gamma (PPARgamma) is a member of the nuclear receptor superfamily involved in insulin sensitization, atherosclerosis, inflammation, and carcinogenesis. PPARgamma transcriptional activity is modulated by specific ligands that promote conformational changes allowing interaction with coactivators. Here we show that the fluorophore 1-anilinonaphthalene-8-sulfonic acid (ANS) binds to PPARgamma-LBD (ligand binding domain), displaying negligible interaction with other nuclear receptors such as PPARalpha and retinoid X receptor alpha (RXRalpha). ANS binding is competed by PPARgamma agonists such as rosiglitazone, 15-deoxy-Delta(12,14)-prostaglandin J(2) (15d-PGJ(2)), and 9,10-dihydro-15-deoxy-Delta(12,14)-prostaglandin J(2) (CAY10410). Moreover, the affinity of PPARgamma for these ligands, determined through ANS competition titrations, is within the range of that reported previously, thereby suggesting that ANS competition could be useful in the screening and characterization of novel PPARgamma agonists. In contrast, gel-based competition assays showed limited performance with noncovalently bound ligands. We applied the ANS binding assay to characterize a biotinylated analog of 15d-PGJ(2) that does not activate PPAR in cells. We found that although this compound bound to PPARgamma with low affinity, it failed to promote PPARgamma interaction with a fluorescent SRC-1 peptide, indicating a lack of receptor activation. Therefore, combined approaches using ANS and fluorescent coactivator peptides to monitor PPARgamma binding and interactions may provide valuable strategies to fully understand the role of PPARgamma ligands. Copyright 2009 Elsevier Inc. All rights reserved.

Interaction of the Transcription Start Site Core Region and Transcription Factor YY1 Determine Ascorbate Transporter SVCT2 Exon 1a Promoter Activity

PubMed Central

Qiao, Huan; May, James M.

2012-01-01

Transcription of the ascorbate transporter, SVCT2, is driven by two distinct promoters in exon 1 of the transporter sequence. The exon 1a promoter lacks a classical transcription start site and little is known about regulation of promoter activity in the transcription start site core (TSSC) region. Here we present evidence that the TSSC binds the multifunctional initiator-binding protein YY1. Electrophoresis shift assays using YY1 antibody showed that YY1 is present as one of two major complexes that specifically bind to the TSSC. The other complex contains the transcription factor NF-Y. Mutations in the TSSC that decreased YY1 binding also impaired the exon 1a promoter activity despite the presence of an upstream activating NF-Y/USF complex, suggesting that YY1 is involved in the regulation of the exon 1a transcription. Furthermore, YY1 interaction with NF-Y and/or USF synergistically enhanced the exon 1a promoter activity in transient transfections and co-activator p300 enhanced their synergistic activation. We propose that the TSSC plays a vital role in the exon 1a transcription and that this function is partially carried out by the transcription factor YY1. Moreover, co-activator p300 might be able to synergistically enhance the TSSC function via a “bridge” mechanism with upstream sequences. PMID:22532872

An Arabidopsis Ran-binding protein, AtRanBP1c, is a co-activator of Ran GTPase-activating protein and requires the C-terminus for its cytoplasmic localization

NASA Technical Reports Server (NTRS)

Kim, Soo-Hwan; Roux, Stanley J.

2003-01-01

Ran-binding proteins (RanBPs) are a group of proteins that bind to Ran (Ras-related nuclear small GTP-binding protein), and thus either control the GTP/GDP-bound states of Ran or help couple the Ran GTPase cycle to a cellular process. AtRanBP1c is a Ran-binding protein from Arabidopsis thaliana (L.) Heynh. that was recently shown to be critically involved in the regulation of auxin-induced mitotic progression [S.-H. Kim et al. (2001) Plant Cell 13:2619-2630]. Here we report that AtRanBP1c inhibits the EDTA-induced release of GTP from Ran and serves as a co-activator of Ran-GTPase-activating protein (RanGAP) in vitro. Transient expression of AtRanBP1c fused to a beta-glucuronidase (GUS) reporter reveals that the protein localizes primarily to the cytosol. Neither the N- nor C-terminus of AtRanBP1c, which flank the Ran-binding domain (RanBD), is necessary for the binding of PsRan1-GTP to the protein, but both are needed for the cytosolic localization of GUS-fused AtRanBP1c. These findings, together with a previous report that AtRanBP1c is critically involved in root growth and development, imply that the promotion of GTP hydrolysis by the Ran/RanGAP/AtRanBP1c complex in the cytoplasm, and the resulting concentration gradient of Ran-GDP to Ran-GTP across the nuclear membrane could be important in the regulation of auxin-induced mitotic progression in root tips of A. thaliana.

Protein arginine methyltransferase 5 (PRMT5) is a novel coactivator of constitutive androstane receptor (CAR)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kanno, Yuichiro, E-mail: ykanno@phar.toho-u.ac.jp; Inajima, Jun; Kato, Sayaka

The constitutive androstane receptor (CAR) plays a key role in the expression of xenobiotic/steroid and drug metabolizing enzymes and their transporters. In this study, we demonstrated that protein arginine methyltransferase 5 (PRMT5) is a novel CAR-interacting protein. Furthermore, the PRMT-dependent induction of a CAR reporter gene, which was independent of methyltransferase activity, was enhanced in the presence of steroid receptor coactivator 1 (SRC1), peroxisome proliferator-activated receptor-gamma coactivator 1 alpha (PGC-1α) or DEAD box DNA/RNA helicase DP97. Using tetracycline inducible-hCAR system in HepG2 cells, we showed that knockdown of PRMT5 with small interfering RNA suppressed tetracycline -induced mRNA expression of CYP2B6more » but not of CYP2C9 or CYP3A4. PRMT5 enhanced phenobarbital-mediated transactivation of a phenobarbital-responsive enhancer module (PBREM)-driven reporter gene in co-operation with PGC-1α in rat primary hepatocytes. Based on these findings, we suggest PRMT5 to be a gene (or promoter)-selective coactivator of CAR by mediating the formation of complexes between hCAR and appropriate coactivators. - Highlights: • Nuclear receptor CAR interact with PRMT5. • PRMT5 enhances transcriptional activity of CAR. • PRMT5 synergistically enhances transactivity of CAR by the co-expression of SRC-1, DP97 or PGC1α. • PRMT5 is a gene-selective co-activator for hCAR.« less

Genome-wide characterization of Mediator recruitment, function, and regulation.

PubMed

Grünberg, Sebastian; Zentner, Gabriel E

2017-05-27

Mediator is a conserved and essential coactivator complex broadly required for RNA polymerase II (RNAPII) transcription. Recent genome-wide studies of Mediator binding in budding yeast have revealed new insights into the functions of this critical complex and raised new questions about its role in the regulation of gene expression.

The Role of Nuclear Receptor Coactivators in Recurrent Prostate Cancer

DTIC Science & Technology

2006-02-01

hyp- oplasia congenita and hypogonadotropic hypogonadism (34). From an evolutionary perspective, the AR AF2 region of the ligand binding domain is more...linked adrenal hypoplasia congenita and hypogo- nadotropic hypogonadism . Nature 372:672–676. 35. Muscatelli, F., A. P. Walker, E. De Plaen, A. N

Transcriptional activation by MEIS1A in response to protein kinase A signaling requires the transducers of regulated CREB family of CREB co-activators.

PubMed

Goh, Siew-Lee; Looi, Yvonne; Shen, Hui; Fang, Jun; Bodner, Caroline; Houle, Martin; Ng, Andy Cheuk-Him; Screaton, Robert A; Featherstone, Mark

2009-07-10

The transcription factor encoded by the murine ecotropic integration site 1 gene (MEIS1) is a partner of HOX and PBX proteins. It has been implicated in embryonic patterning and leukemia, and causally linked to restless legs syndrome. The MEIS1A C terminus harbors a transcriptional activation domain that is stimulated by protein kinase A (PKA) in a manner dependent on the co-activator of cAMP response element-binding protein (CREB), CREB-binding protein (CBP). We explored the involvement of another mediator of PKA-inducible transcription, namely the CREB co-activators transducers of regulated CREB activity (TORCs). Overexpression of TORC1 or TORC2 bypassed PKA for activation by MEIS1A. Co-immunoprecipitation experiments demonstrated a physical interaction between MEIS1 and TORC2 that is dependent on the MEIS1A C terminus, whereas chromatin immunoprecipitation revealed PKA-inducible recruitment of MEIS1, PBX1, and TORC2 on the MEIS1 target genes Hoxb2 and Meis1. The MEIS1 interaction domain on TORC1 was mapped to the N-terminal coiled-coil region, and TORC1 mutants lacking this domain attenuated the response to PKA on a natural MEIS1A target enhancer. Thus, TORCs physically cooperate with MEIS1 to achieve PKA-inducible transactivation through the MEIS1A C terminus, suggesting a concerted action in developmental and oncogenic processes.

Transcriptional Activation by MEIS1A in Response to Protein Kinase A Signaling Requires the Transducers of Regulated CREB Family of CREB Co-activators*

PubMed Central

Goh, Siew-Lee; Looi, Yvonne; Shen, Hui; Fang, Jun; Bodner, Caroline; Houle, Martin; Ng, Andy Cheuk-Him; Screaton, Robert A.; Featherstone, Mark

2009-01-01

The transcription factor encoded by the murine ecotropic integration site 1 gene (MEIS1) is a partner of HOX and PBX proteins. It has been implicated in embryonic patterning and leukemia, and causally linked to restless legs syndrome. The MEIS1A C terminus harbors a transcriptional activation domain that is stimulated by protein kinase A (PKA) in a manner dependent on the co-activator of cAMP response element-binding protein (CREB), CREB-binding protein (CBP). We explored the involvement of another mediator of PKA-inducible transcription, namely the CREB co-activators transducers of regulated CREB activity (TORCs). Overexpression of TORC1 or TORC2 bypassed PKA for activation by MEIS1A. Co-immunoprecipitation experiments demonstrated a physical interaction between MEIS1 and TORC2 that is dependent on the MEIS1A C terminus, whereas chromatin immunoprecipitation revealed PKA-inducible recruitment of MEIS1, PBX1, and TORC2 on the MEIS1 target genes Hoxb2 and Meis1. The MEIS1 interaction domain on TORC1 was mapped to the N-terminal coiled-coil region, and TORC1 mutants lacking this domain attenuated the response to PKA on a natural MEIS1A target enhancer. Thus, TORCs physically cooperate with MEIS1 to achieve PKA-inducible transactivation through the MEIS1A C terminus, suggesting a concerted action in developmental and oncogenic processes. PMID:19473990

Sensitivity of Lipid Metabolism and Insulin Signaling to Genetic Alterations in Hepatic Peroxisome Proliferator–Activated Receptor-γ Coactivator-1α Expression

PubMed Central

Estall, Jennifer L.; Kahn, Mario; Cooper, Marcus P.; Fisher, ffolliott Martin; Wu, Michele K.; Laznik, Dina; Qu, Lishu; Cohen, David E.; Shulman, Gerald I.; Spiegelman, Bruce M.

2009-01-01

OBJECTIVE The peroxisome proliferator–activated receptor-γ coactivator (PGC)-1 family of transcriptional coactivators controls hepatic function by modulating the expression of key metabolic enzymes. Hepatic gain of function and complete genetic ablation of PGC-1α show that this coactivator is important for activating the programs of gluconeogenesis, fatty acid oxidation, oxidative phosphorylation, and lipid secretion during times of nutrient deprivation. However, how moderate changes in PGC-1α activity affect metabolism and energy homeostasis has yet to be determined. RESEARCH DESIGN AND METHODS To identify key metabolic pathways that may be physiologically relevant in the context of reduced hepatic PGC-1α levels, we used the Cre/Lox system to create mice heterozygous for PGC-1α specifically within the liver (LH mice). RESULTS These mice showed fasting hepatic steatosis and diminished ketogenesis associated with decreased expression of genes involved in mitochondrial β-oxidation. LH mice also exhibited high circulating levels of triglyceride that correlated with increased expression of genes involved in triglyceride-rich lipoprotein assembly. Concomitant with defects in lipid metabolism, hepatic insulin resistance was observed both in LH mice fed a high-fat diet as well as in primary hepatocytes. CONCLUSIONS These data highlight both the dose-dependent and long-term effects of reducing hepatic PGC-1α levels, underlining the importance of tightly regulated PGC-1α expression in the maintenance of lipid homeostasis and glucose metabolism. PMID:19366863

Small Molecule Inhibition of cAMP Response Element Binding Protein in Human Acute Myeloid Leukemia Cells

PubMed Central

Mitton, Bryan; Chae, Hee-Don; Hsu, Katie; Dutta, Ritika; Aldana-Masangkay, Grace; Ferrari, Roberto; Davis, Kara; Tiu, Bruce C.; Kaul, Arya; Lacayo, Norman; Dahl, Gary; Xie, Fuchun; Li, Bingbing X.; Breese, Marcus R.; Landaw, Elliot M.; Nolan, Garry; Pellegrini, Matteo; Romanov, Sergei; Xiao, Xiangshu; Sakamoto, Kathleen M.

2016-01-01

The transcription factor CREB (cAMP Response Element Binding Protein) is overexpressed in the majority of acute myeloid leukemia (AML) patients, and this is associated with a worse prognosis. Previous work revealed that CREB overexpression augmented AML cell growth, while CREB knockdown disrupted key AML cell functions in vitro. In contrast, CREB knockdown had no effect on long-term hematopoietic stem cell activity in mouse transduction/transplantation assays. Together, these studies position CREB as a promising drug target for AML. To test this concept, a small molecule inhibitor of CREB, XX-650-23, was developed. This molecule blocks a critical interaction between CREB and its required co-activator CBP (CREB Binding Protein), leading to disruption of CREB-driven gene expression. Inhibition of CBP-CREB interaction induced apoptosis and cell cycle arrest in AML cells, and prolonged survival in vivo in mice injected with human AML cells. XX-650-23 had little toxicity on normal human hematopoietic cells and tissues in mice. To understand the mechanism of XX-650-23, we performed RNA-seq, ChIP-seq and Cytometry Time of Flight with human AML cells. Our results demonstrate that small molecule inhibition of CBP-CREB interaction mostly affects apoptotic, cell cycle, and survival pathways, which may represent a novel approach for AML therapy. PMID:27211267

Formation of a repressive complex in the mammalian circadian clock is mediated by the secondary pocket of CRY1

DOE PAGES

Michael, Alicia K.; Fribourgh, Jennifer L.; Chelliah, Yogarany; ...

2017-01-31

The basic helix-loop-helix PAS domain (bHLH-PAS) transcription factor CLOCK:BMAL1 (brain and muscle Arnt-like protein 1) sits at the core of the mammalian circadian transcription/translation feedback loop. Precise control of CLOCK:BMAL1 activity by coactivators and repressors establishes the ~24-h periodicity of gene expression. Formation of a repressive complex, defined by the core clock proteins cryptochrome 1 (CRY1):CLOCK:BMAL1, plays an important role controlling the switch from repression to activation each day. Here in this paper, we show that CRY1 binds directly to the PAS domain core of CLOCK: BMAL1, driven primarily by interaction with the CLOCK PAS-B domain. Integrative modeling and solutionmore » X-ray scattering studies unambiguously position a key loop of the CLOCK PAS-B domain in the secondary pocket of CRY1, analogous to the antenna chromophore-binding pocket of photolyase. CRY1 docks onto the transcription factor alongside the PAS domains, extending above the DNA-binding bHLH domain. Single point mutations at the interface on either CRY1 or CLOCK disrupt formation of the ternary complex, highlighting the importance of this interface for direct regulation of CLOCK:BMAL1 activity by CRY1.« less

The activity and stability of the transcriptional coactivator p/CIP/SRC-3 are regulated by CARM1-dependent methylation.

PubMed

Naeem, Hina; Cheng, Donghang; Zhao, Qingshi; Underhill, Caroline; Tini, Marc; Bedford, Marc T; Torchia, Joseph

2007-01-01

The transcriptional coactivator p/CIP(SRC-3/AIB1/ACTR/RAC3) binds liganded nuclear hormone receptors and facilitates transcription by directly recruiting accessory factors such as acetyltransferase CBP/p300 and the coactivator arginine methyltransferase CARM1. In the present study, we have established that recombinant p/CIP (p300/CBP interacting protein) is robustly methylated by CARM1 in vitro but not by other protein arginine methyltransferase family members. Metabolic labeling of MCF-7 breast cancer cells with S-adenosyl-L-[methyl-(3)H]methionine and immunoblotting using dimethyl arginine-specific antibodies demonstrated that p/CIP is specifically methylated in intact cells. In addition, methylation of full-length p/CIP is not supported by extracts derived from CARM1(-/-) mouse embryo fibroblasts, indicating that CARM1 is required for p/CIP methylation. Using mass spectrometry, we have identified three CARM1-dependent methylation sites located in a glutamine-rich region within the carboxy terminus of p/CIP which are conserved among all steroid receptor coactivator proteins. These results were confirmed by in vitro methylation of p/CIP using carboxy-terminal truncation mutants and synthetic peptides as substrates for CARM1. Analysis of methylation site mutants revealed that arginine methylation causes an increase in full-length p/CIP turnover as a result of enhanced degradation. Additionally, methylation negatively impacts transcription via a second mechanism by impairing the ability of p/CIP to associate with CBP. Collectively, our data highlight coactivator methylation as an important regulatory mechanism in hormonal signaling.

COACTIVATOR ACTIVATOR (CoAA) PREVENTS THE TRANSCRIPTIONAL ACTIVITY OF RUNT DOMAIN TRANSCRIPTION FACTORS

PubMed Central

Li, Xiaodong; Hoeppner, Luke H.; Jensen, Eric D.; Gopalakrishnan, Rajaram; Westendorf, Jennifer J.

2013-01-01

Runx proteins are essential for a number of developmental processes and are aberrantly expressed in many human cancers. Runx factors bind DNA and co-factors to activate or repress genes crucial for bone formation, hematopoiesis, and neuronal development. Co-activator activator (CoAA) is a nuclear protein that regulates gene expression, RNA splicing and is overexpressed in many human tumors. In this study, we identified CoAA as a Runx2 binding protein. CoAA repressed Runx factor-dependent activation of reporter genes in a histone deacetylase-independent manner. CoAA also blocked Runx2-mediated repression of the Axin2 promoter, a novel Runx target gene. The carboxy-terminus of CoAA is essential for binding the Runt domains of Runx1 and Runx2. In electophoretic mobility shift assays, CoAA inhibited Runx2 interactions with DNA. These data indicate that CoAA is an inhibitor of Runx factors and can negate Runx factor regulation of gene expression. CoAA is expressed at high levels in human fetal osteoblasts and osteosarcoma cell lines. Suppression of CoAA expression by RNA interference reduced osteosarcoma cell viability in vitro, suggesting that it contributes to the proliferation and/or survival of osteoblast lineage cells. PMID:19585539

Coactivator-associated arginine methyltransferase 1 enhances transcriptional activity of the human T-cell lymphotropic virus type 1 long terminal repeat through direct interaction with Tax.

PubMed

Jeong, Soo-Jin; Lu, Hanxin; Cho, Won-Kyung; Park, Hyeon Ung; Pise-Masison, Cynthia; Brady, John N

2006-10-01

In this study, we demonstrate that the coactivator-associated arginine methyltransferase 1 (CARM1), which methylates histone H3 and other proteins such as p300/CBP, is positively involved in the regulation of Tax transactivation. First, transfection studies demonstrated that overexpression of CARM1 wild-type protein resulted in increased Tax transactivation of the human T-cell lymphotropic virus type 1 (HTLV-1) long terminal repeat (LTR). In contrast, transfection of a catalytically inactive CARM1 methyltransferase mutant did not enhance Tax transactivation. CARM1 facilitated Tax transactivation of the CREB-dependent cellular GEM promoter. A direct physical interaction between HTLV-1 Tax and CARM1 was demonstrated using in vitro glutathione S-transferase-Tax binding assays, in vivo coimmunoprecipitation, and confocal microscopy experiments. Finally, chromatin immunoprecipitation analysis of the activated HTLV-1 LTR promoter showed the association of CARM1 and methylated histone H3 with the template DNA. In vitro, Tax facilitates the binding of CARM1 to the transcription complex. Together, our data provide evidence that CARM1 enhances Tax transactivation of the HTLV-1 LTR through a direct interaction between CARM1 and Tax and this binding promotes methylation of histone H3 (R2, R17, and R26).

Fungal mediator tail subunits contain classical transcriptional activation domains.

PubMed

Liu, Zhongle; Myers, Lawrence C

2015-04-01

Classical activation domains within DNA-bound eukaryotic transcription factors make weak interactions with coactivator complexes, such as Mediator, to stimulate transcription. How these interactions stimulate transcription, however, is unknown. The activation of reporter genes by artificial fusion of Mediator subunits to DNA binding domains that bind to their promoters has been cited as evidence that the primary role of activators is simply to recruit Mediator. We have identified potent classical transcriptional activation domains in the C termini of several tail module subunits of Saccharomyces cerevisiae, Candida albicans, and Candida dubliniensis Mediator, while their N-terminal domains are necessary and sufficient for their incorporation into Mediator but do not possess the ability to activate transcription when fused to a DNA binding domain. This suggests that Mediator fusion proteins actually are functioning in a manner similar to that of a classical DNA-bound activator rather than just recruiting Mediator. Our finding that deletion of the activation domains of S. cerevisiae Med2 and Med3, as well as C. dubliniensis Tlo1 (a Med2 ortholog), impairs the induction of certain genes shows these domains function at native promoters. Activation domains within coactivators are likely an important feature of these complexes and one that may have been uniquely leveraged by a common fungal pathogen. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

Mapping perception to action in piano practice: a longitudinal DC-EEG study

PubMed Central

Bangert, Marc; Altenmüller, Eckart O

2003-01-01

Background Performing music requires fast auditory and motor processing. Regarding professional musicians, recent brain imaging studies have demonstrated that auditory stimulation produces a co-activation of motor areas, whereas silent tapping of musical phrases evokes a co-activation in auditory regions. Whether this is obtained via a specific cerebral relay station is unclear. Furthermore, the time course of plasticity has not yet been addressed. Results Changes in cortical activation patterns (DC-EEG potentials) induced by short (20 minute) and long term (5 week) piano learning were investigated during auditory and motoric tasks. Two beginner groups were trained. The 'map' group was allowed to learn the standard piano key-to-pitch map. For the 'no-map' group, random assignment of keys to tones prevented such a map. Auditory-sensorimotor EEG co-activity occurred within only 20 minutes. The effect was enhanced after 5-week training, contributing elements of both perception and action to the mental representation of the instrument. The 'map' group demonstrated significant additional activity of right anterior regions. Conclusion We conclude that musical training triggers instant plasticity in the cortex, and that right-hemispheric anterior areas provide an audio-motor interface for the mental representation of the keyboard. PMID:14575529

Characterization of a unique motif in LIM mineralization protein-1 that interacts with jun activation-domain-binding protein 1.

PubMed

Sangadala, Sreedhara; Yoshioka, Katsuhito; Enyo, Yoshio; Liu, Yunshan; Titus, Louisa; Boden, Scott D

2014-01-01

Development and repair of the skeletal system and other organs are highly dependent on precise regulation of the bone morphogenetic protein (BMP) pathway. The use of BMPs clinically to induce bone formation has been limited in part by the requirement of much higher doses of recombinant proteins in primates than were needed in cell culture or rodents. Therefore, increasing cellular responsiveness to BMPs has become our focus. We determined that an osteogenic LIM mineralization protein, LMP-1 interacts with Smurf1 (Smad ubiquitin regulatory factor 1) and prevents ubiquitination of Smads resulting in potentiation of BMP activity. In the region of LMP-1 responsible for bone formation, there is a motif that directly interacts with the Smurf1 WW2 domain and thus effectively competes for binding with Smad1 and Smad5, key signaling proteins in the BMP pathway. Here we show that the same region also contains a motif that interacts with Jun activation-domain-binding protein 1 (Jab1) which targets a common Smad, Smad4, shared by both the BMP and transforming growth factor-β (TGF-β) pathways, for proteasomal degradation. Jab1 was first identified as a coactivator of the transcription factor c-Jun. Jab1 binds to Smad4, Smad5, and Smad7, key intracellular signaling molecules of the TGF-β superfamily, and causes ubiquitination and/or degradation of these Smads. We confirmed a direct interaction of Jab1 with LMP-1 using recombinantly expressed wild-type and mutant proteins in slot-blot-binding assays. We hypothesized that LMP-1 binding to Jab1 prevents the binding and subsequent degradation of these Smads causing increased accumulation of osteogenic Smads in cells. We identified a sequence motif in LMP-1 that was predicted to interact with Jab1 based on the MAME/MAST sequence analysis of several cellular signaling molecules that are known to interact with Jab-1. We further mutated the potential key interacting residues in LMP-1 and showed loss of binding to Jab1 in binding assays in vitro. The activities of various wild-type and mutant LMP-1 proteins were evaluated using a BMP-responsive luciferase reporter and alkaline phosphatase assay in mouse myoblastic cells that were differentiated toward the osteoblastic phenotype. Finally, to strengthen physiological relevance of LMP-1 and Jab1 interaction, we showed that overexpression of LMP-1 caused nuclear accumulation of Smad4 upon BMP treatment which is reflective of increased Smad signaling in cells.

Methylglyoxal, a glycolysis side-product, induces Hsp90 glycation and YAP-mediated tumor growth and metastasis

PubMed Central

Nokin, Marie-Julie; Durieux, Florence; Peixoto, Paul; Chiavarina, Barbara; Peulen, Olivier; Blomme, Arnaud; Turtoi, Andrei; Costanza, Brunella; Smargiasso, Nicolas; Baiwir, Dominique; Scheijen, Jean L; Schalkwijk, Casper G; Leenders, Justine; De Tullio, Pascal; Bianchi, Elettra; Thiry, Marc; Uchida, Koji; Spiegel, David A; Cochrane, James R; Hutton, Craig A; De Pauw, Edwin; Delvenne, Philippe; Belpomme, Dominique; Castronovo, Vincent; Bellahcène, Akeila

2016-01-01

Metabolic reprogramming toward aerobic glycolysis unavoidably induces methylglyoxal (MG) formation in cancer cells. MG mediates the glycation of proteins to form advanced glycation end products (AGEs). We have recently demonstrated that MG-induced AGEs are a common feature of breast cancer. Little is known regarding the impact of MG-mediated carbonyl stress on tumor progression. Breast tumors with MG stress presented with high nuclear YAP, a key transcriptional co-activator regulating tumor growth and invasion. Elevated MG levels resulted in sustained YAP nuclear localization/activity that could be reverted using Carnosine, a scavenger for MG. MG treatment affected Hsp90 chaperone activity and decreased its binding to LATS1, a key kinase of the Hippo pathway. Cancer cells with high MG stress showed enhanced growth and metastatic potential in vivo. These findings reinforce the cumulative evidence pointing to hyperglycemia as a risk factor for cancer incidence and bring renewed interest in MG scavengers for cancer treatment. DOI: http://dx.doi.org/10.7554/eLife.19375.001 PMID:27759563

Novel mutations of the SRD5A2 and AR genes in Thai patients with 46, XY disorders of sex development.

PubMed

Ittiwut, Chupong; Pratuangdejkul, Jaturong; Supornsilchai, Vichit; Muensri, Sasipa; Hiranras, Yodporn; Sahakitrungruang, Taninee; Watcharasindhu, Suttipong; Suphapeetiporn, Kanya; Shotelersuk, Vorasuk

2017-01-01

Abnormalities of dihydrotestosterone conversion [5α-reductase deficiency: online Mendelian inheritance in man (OMIM) 607306] or actions of androgens [partial androgen insensitivity syndrome (PAIS): OMIM 312300] during the 8th-12th weeks of gestation cause varying degrees of undervirilized external genitalia in 46, XY disorders of sex development (DSD) with increased testosterone production. The objective of the study was to determine clinical and genetic characteristics of Thai patients with 46, XY DSD. A cross-sectional study was conducted in 46, XY DSD with increased testosterone production (n=43) evaluated by a human chorionic gonadotropin (hCG) stimulation test or clinical features consistent with 5α-reductase deficiency or PAIS. PCR sequencing of the entire coding regions of the SRD5A2 and AR genes was performed. Molecular modeling analysis of the androgen receptor-ligand-binding domain (AR-LBD) of a novel mutation was constructed. Mutations were found in seven patients (16.3%): five (11.6%) and two (4.7%) patients had mutations in SRD5A2 and AR, respectively. Two novel mutations, SRD5A2 c.383A>G (p.Y128C) and AR c.2176C>T (p.R726C), were identified. Dimensional structural analysis of the novel mutated AR (p.R726C) revealed that it affected the co-activator binding [binding function-3 (BF-3)], not the testosterone binding site. Short phallus length was associated with 5α-reductase deficiency. Around 16.3% of our patients with 46, XY DSD had 5α-reductase deficiency or PAIS. Two novel mutations of SRD5A2 and AR were identified. The novel mutated AR (p.R726C) might affect the co-activator binding (BF-3), not the testosterone binding site.

Activation of p53 Transcriptional Activity by SMRT: a Histone Deacetylase 3-Independent Function of a Transcriptional Corepressor

PubMed Central

Adikesavan, Anbu Karani; Karmakar, Sudipan; Pardo, Patricia; Wang, Liguo; Liu, Shuang; Li, Wei

2014-01-01

The silencing mediator of retinoic acid and thyroid hormone receptors (SMRT) is an established histone deacetylase 3 (HDAC3)-dependent transcriptional corepressor. Microarray analyses of MCF-7 cells transfected with control or SMRT small interfering RNA revealed SMRT regulation of genes involved in DNA damage responses, and the levels of the DNA damage marker γH2AX as well as poly(ADP-ribose) polymerase cleavage were elevated in SMRT-depleted cells treated with doxorubicin. A number of these genes are established p53 targets. SMRT knockdown decreased the activity of two p53-dependent reporter genes as well as the expression of p53 target genes, such as CDKN1A (which encodes p21). SMRT bound directly to p53 and was recruited to p53 binding sites within the p21 promoter. Depletion of GPS2 and TBL1, components of the SMRT corepressor complex, but not histone deacetylase 3 (HDAC3) decreased p21-luciferase activity. p53 bound to the SMRT deacetylase activation domain (DAD), which mediates HDAC3 binding and activation, and HDAC3 could attenuate p53 binding to the DAD region of SMRT. Moreover, an HDAC3 binding-deficient SMRT DAD mutant coactivated p53 transcriptional activity. Collectively, these data highlight a biological role for SMRT in mediating DNA damage responses and suggest a model where p53 binding to the DAD limits HDAC3 interaction with this coregulator, thereby facilitating SMRT coactivation of p53-dependent gene expression. PMID:24449765

Genome-wide characterization of Mediator recruitment, function, and regulation

PubMed Central

2017-01-01

ABSTRACT Mediator is a conserved and essential coactivator complex broadly required for RNA polymerase II (RNAPII) transcription. Recent genome-wide studies of Mediator binding in budding yeast have revealed new insights into the functions of this critical complex and raised new questions about its role in the regulation of gene expression. PMID:28301289

PGC-1 Coactivator Activity Is Required for Murine Erythropoiesis

PubMed Central

Cui, Shuaiying; Tanabe, Osamu; Lim, Kim-Chew; Xu, H. Eric; Zhou, X. Edward; Lin, Jiandie D.; Shi, Lihong; Schmidt, Lindsay; Campbell, Andrew; Shimizu, Ritsuko; Yamamoto, Masayuki

2014-01-01

Peroxisome proliferator-activated receptor gamma (PPARγ) coactivator 1α (PGC-1α) and PGC-1β have been shown to be intimately involved in the transcriptional regulation of cellular energy metabolism as well as other biological processes, but both coactivator proteins are expressed in many other tissues and organs in which their function is, in essence, unexplored. Here, we found that both PGC-1 proteins are abundantly expressed in maturing erythroid cells. PGC-1α and PGC-1β compound null mutant (Pgc-1c) animals express less β-like globin mRNAs throughout development; consequently, neonatal Pgc-1c mice exhibit growth retardation and profound anemia. Flow cytometry shows that the number of mature erythrocytes is markedly reduced in neonatal Pgc-1c pups, indicating that erythropoiesis is severely compromised. Furthermore, hematoxylin and eosin staining revealed necrotic cell death and cell loss in Pgc-1c livers and spleen. Chromatin immunoprecipitation studies revealed that both PGC-1α and -1β, as well as two nuclear receptors, TR2 and TR4, coordinately bind to the various globin gene promoters. In addition, PGC-1α and -1β can interact with TR4 to potentiate transcriptional activation. These data provide new insights into our understanding of globin gene regulation and raise the interesting possibility that the PGC-1 coactivators can interact with TR4 to elicit differential stage-specific effects on globin gene transcription. PMID:24662048

The Role of JMY in p53 Regulation.

PubMed

Adighibe, Omanma; Pezzella, Francesco

2018-05-31

Following the event of DNA damage, the level of tumour suppressor protein p53 increases inducing either cell cycle arrest or apoptosis. Junctional Mediating and Regulating Y protein (JMY) is a transcription co-factor involved in p53 regulation. In event of DNA damage, JMY levels also upregulate in the nucleus where JMY forms a co-activator complex with p300/CREB-binding protein (p300/CBP), Apoptosis-stimulating protein of p53 (ASPP) and Stress responsive activator of p53 (Strap). This co-activator complex then binds to and increases the ability of p53 to induce transcription of proteins triggering apoptosis but not cell cycle arrest. This then suggests that the increase of JMY levels due to DNA damage putatively "directs" p53 activity toward triggering apoptosis. JMY expression is also linked to increased cell motility as it: (1) downregulates the expression of adhesion molecules of the Cadherin family and (2) induces actin nucleation, making cells less adhesive and more mobile, favouring metastasis. All these characteristics taken together imply that JMY possesses both tumour suppressive and tumour metastasis promoting capabilities.

DAX1 suppresses FXR transactivity as a novel co-repressor

DOE Office of Scientific and Technical Information (OSTI.GOV)

Li, Jin; Lu, Yan; Liu, Ruya

2011-09-09

Highlights: {yields} DAX1 is co-localized with FXR and interacts with FXR. {yields} DAX1 acts as a negative regulator of FXR. {yields} Three LXXLL motifs in the N-terminus of DAX1 were required. {yields} DAX1 suppresses FXR transactivation by competing with co-activators. -- Abstract: Bile acid receptor FXR (farnesoid X receptor) is a key regulator of hepatic bile acid, glucose and lipid homeostasis through regulation of numerous genes involved in the process of bile acid, triglyceride and glucose metabolism. DAX1 (dosage-sensitive sex reversal adrenal hypoplasia congenital critical region on X chromosome, gene 1) is an atypical member of the nuclear receptor familymore » due to lack of classical DNA-binding domains and acts primarily as a co-repressor of many nuclear receptors. Here, we demonstrated that DAX1 is co-localized with FXR in the nucleus and acted as a negative regulator of FXR through a physical interaction with FXR. Our study showed that over-expression of DAX1 down-regulated the expression of FXR target genes, whereas knockdown of DAX1 led to their up-regulation. Furthermore, three LXXLL motifs in the N-terminus of DAX1 were required for the full repression of FXR transactivation. In addition, our study characterized that DAX1 suppresses FXR transactivation via competing with co-activators such as SRC-1 and PGC-1{alpha}. In conclusion, DAX1 acts as a co-repressor to negatively modulate FXR transactivity.« less

Molecular Determinants of Magnolol Targeting Both RXRα and PPARγ

PubMed Central

Chen, Lili; Chen, Jing; Hu, Lihong; Jiang, Hualiang; Shen, Xu

2011-01-01

Nuclear receptors retinoic X receptor α (RXRα) and peroxisome proliferator activated receptor γ (PPARγ) function potently in metabolic diseases, and are both important targets for anti-diabetic drugs. Coactivation of RXRα and PPARγ is believed to synergize their effects on glucose and lipid metabolism. Here we identify the natural product magnolol as a dual agonist targeting both RXRα and PPARγ. Magnolol was previously reported to enhance adipocyte differentiation and glucose uptake, ameliorate blood glucose level and prevent development of diabetic nephropathy. Although magnolol can bind and activate both of these two nuclear receptors, the transactivation assays indicate that magnolol exhibits biased agonism on the transcription of PPAR-response element (PPRE) mediated by RXRα:PPARγ heterodimer, instead of RXR-response element (RXRE) mediated by RXRα:RXRα homodimer. To further elucidate the molecular basis for magnolol agonism, we determine both the co-crystal structures of RXRα and PPARγ ligand-binding domains (LBDs) with magnolol. Structural analyses reveal that magnolol adopts its two 5-allyl-2-hydroxyphenyl moieties occupying the acidic and hydrophobic cavities of RXRα L-shaped ligand-binding pocket, respectively. While, two magnolol molecules cooperatively accommodate into PPARγ Y-shaped ligand-binding pocket. Based on these two complex structures, the key interactions for magnolol activating RXRα and PPARγ are determined. As the first report on the dual agonist targeting RXRα and PPARγ with receptor-ligand complex structures, our results are thus expected to help inspect the potential pharmacological mechanism for magnolol functions, and supply useful hits for nuclear receptor multi-target ligand design. PMID:22140563

Identification and Biological Evaluation of Coactivator Binding Inhibitors for the Estrogen Receptor

ERIC Educational Resources Information Center

Gunther, Jillian Rebecca

2009-01-01

The physiologic effects of estrogen action through the estrogen receptor (ER) are widespread, as this hormone exerts actions in both reproductive (e.g., uterus) and non-reproductive (e.g., bone, brain) tissues in both men and women. As such, the regulation of the activity of this ligand-activated transcription factor is highly relevant to the…

Hydroxylated polybrominated diphenyl ethers exhibit different activities on thyroid hormone receptors depending on their degree of bromination

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ren, Xiao-Min, E-mail: rxm200318@gmail.com; Guo, Liang-Hong, E-mail: LHGuo@rcees.ac.cn; Gao, Yu, E-mail: francesscototti@gmail.com

2013-05-01

Polybrominated diphenyl ethers (PBDEs) have been shown to disrupt thyroid hormone (TH) functions in experimental animals, and one of the proposed disruption mechanisms is direct binding of hydroxylated PBDE (OH-PBDE) to TH receptors (TRs). However, previous data on TH receptor binding and TH activity of OH-PBDEs were very limited and sometimes inconsistent. In the present paper, we examined the binding potency of ten OH-PBDEs with different degrees of bromination to TR using a fluorescence competitive binding assay. The results showed that the ten OH-PBDEs bound to TR with potency that correlated to their bromination level. We further examined their effectmore » on TR using a coactivator binding assay and GH3 cell proliferation assay. Different TR activities of OH-PBDEs were observed depending on their degree of bromination. Four low-brominated OH-PBDEs (2′-OH-BDE-28, 3′-OH-BDE-28, 5-OH-BDE-47, 6-OH-BDE-47) were found to be TR agonists, which recruited the coactivator peptide and enhanced GH3 cell proliferation. However, three high-brominated OH-PBDEs (3-OH-BDE-100, 3′-OH-BDE-154, 4-OH-BDE-188) were tested to be antagonists. Molecular docking was employed to simulate the interactions of OH-PBDEs with TR and identify the structural determinants for TR binding and activity. According to the docking results, low-brominated OH-PBDEs, which are weak binders but TR agonists, bind with TR at the inner side of its binding pocket, whereas high-brominated compounds, which are potent binders but TR antagonists, reside at the outer region. These results indicate that OH-PBDEs have different activities on TR (agonistic or antagonistic), possibly due to their different binding geometries with the receptor. - Highlights: ► Thyroid hormone (TH) activity of OH-PBDEs with different Br number was evaluated. ► Four different experimental approaches were employed to investigate the mechanism. ► Low-brominated OH-PBDEs were agonists, but high-brominated ones were antagonists. ► Low-brominated OH-PBDEs bind to TH receptor differently than high-brominated ones.« less

Human T-cell leukemia virus type 1 Tax requires direct access to DNA for recruitment of CREB binding protein to the viral promoter.

PubMed

Lenzmeier, B A; Giebler, H A; Nyborg, J K

1998-02-01

Efficient human T-cell leukemia virus type 1 (HTLV-1) replication and viral gene expression are dependent upon the virally encoded oncoprotein Tax. To activate HTLV-1 transcription, Tax interacts with the cellular DNA binding protein cyclic AMP-responsive element binding protein (CREB) and recruits the coactivator CREB binding protein (CBP), forming a nucleoprotein complex on the three viral cyclic AMP-responsive elements (CREs) in the HTLV-1 promoter. Short stretches of dG-dC-rich (GC-rich) DNA, immediately flanking each of the viral CREs, are essential for Tax recruitment of CBP in vitro and Tax transactivation in vivo. Although the importance of the viral CRE-flanking sequences is well established, several studies have failed to identify an interaction between Tax and the DNA. The mechanistic role of the viral CRE-flanking sequences has therefore remained enigmatic. In this study, we used high resolution methidiumpropyl-EDTA iron(II) footprinting to show that Tax extended the CREB footprint into the GC-rich DNA flanking sequences of the viral CRE. The Tax-CREB footprint was enhanced but not extended by the KIX domain of CBP, suggesting that the coactivator increased the stability of the nucleoprotein complex. Conversely, the footprint pattern of CREB on a cellular CRE lacking GC-rich flanking sequences did not change in the presence of Tax or Tax plus KIX. The minor-groove DNA binding drug chromomycin A3 bound to the GC-rich flanking sequences and inhibited the association of Tax and the Tax-CBP complex without affecting CREB binding. Tax specifically cross-linked to the viral CRE in the 5'-flanking sequence, and this cross-link was blocked by chromomycin A3. Together, these data support a model where Tax interacts directly with both CREB and the minor-groove viral CRE-flanking sequences to form a high-affinity binding site for the recruitment of CBP to the HTLV-1 promoter.

Steroid receptor coactivator-3 regulates glucose metabolism in bladder cancer cells through coactivation of hypoxia inducible factor 1α.

PubMed

Zhao, Wei; Chang, Cunjie; Cui, Yangyan; Zhao, Xiaozhi; Yang, Jun; Shen, Lan; Zhou, Ji; Hou, Zhibo; Zhang, Zhen; Ye, Changxiao; Hasenmayer, Donald; Perkins, Robert; Huang, Xiaojing; Yao, Xin; Yu, Like; Huang, Ruimin; Zhang, Dianzheng; Guo, Hongqian; Yan, Jun

2014-04-18

Cancer cell proliferation is a metabolically demanding process, requiring high glycolysis, which is known as "Warburg effect," to support anabolic growth. Steroid receptor coactivator-3 (SRC-3), a steroid receptor coactivator, is overexpressed and/or amplified in multiple cancer types, including non-steroid targeted cancers, such as urinary bladder cancer (UBC). However, whether SRC-3 regulates the metabolic reprogramming for cancer cell growth is unknown. Here, we reported that overexpression of SRC-3 accelerated UBC cell growth, accompanied by the increased expression of genes involved in glycolysis. Knockdown of SRC-3 reduced the UBC cell glycolytic rate under hypoxia, decreased tumor growth in nude mice, with reduction of proliferating cell nuclear antigen and lactate dehydrogenase expression levels. We further revealed that SRC-3 could interact with hypoxia inducible factor 1α (HIF1α), which is a key transcription factor required for glycolysis, and coactivate its transcriptional activity. SRC-3 was recruited to the promoters of HIF1α-target genes, such as glut1 and pgk1. The positive correlation of expression levels between SRC-3 and Glut1 proteins was demonstrated in human UBC patient samples. Inhibition of glycolysis through targeting HK2 or LDHA decelerated SRC-3 overexpression-induced cell growth. In summary, overexpression of SRC-3 promoted glycolysis in bladder cancer cells through HIF1α to facilitate tumorigenesis, which may be an intriguing drug target for bladder cancer therapy.

Analysis of PGC-1{alpha} variants Gly482Ser and Thr612Met concerning their PPAR{gamma}2-coactivation function

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nitz, Inke; Ewert, Agnes; Klapper, Maja

2007-02-09

Peroxisome proliferator-activated receptor-{gamma} coactivator-1{alpha} (PGC-1{alpha}) is a cofactor involved in adaptive thermogenesis, fatty acid oxidation, and gluconeogenesis. Dysfunctions of this protein are likely to contribute to the development of obesity and the metabolic syndrome. This is in part but not definitely confirmed by results of population studies. The aim of this study was to investigate if common genetic variants rs8192678 (Gly482Ser) and rs3736265 (Thr612Met) in the PGC-1{alpha} gene lead to a functional consequence in cofactor activity using peroxisome proliferator-activated receptor-{gamma} 2 (PPAR{gamma}2) as interacting transcription factor. Reporter gene assays in HepG2 cells with wildtype and mutant proteins of both PGC1{alpha}more » and PPAR{gamma}2 (Pro12Ala, rs1801282) using the acyl-CoA-binding protein (ACBP) promoter showed no difference in coactivator activity. This is First study implicating that the Gly482Ser and Thr612Met polymorphisms in PGC-1{alpha} and Pro12Ala polymorphism in PPAR{gamma}2 do not affect the functional integrity of these proteins.« less

Downstream promoter interactions of TFIID TAFs facilitate transcription reinitiation

PubMed Central

Joo, Yoo Jin; Ficarro, Scott B.; Soares, Luis M.; Chun, Yujin; Marto, Jarrod A.; Buratowski, Stephen

2017-01-01

TFIID binds promoter DNA to recruit RNA polymerase II and other basal factors for transcription. Although the TATA-binding protein (TBP) subunit of TFIID is necessary and sufficient for in vitro transcription, the TBP-associated factor (TAF) subunits recognize downstream promoter elements, act as coactivators, and interact with nucleosomes. In yeast nuclear extracts, transcription induces stable TAF binding to downstream promoter DNA, promoting subsequent activator-independent transcription reinitiation. In vivo, promoter responses to TAF mutations correlate with the level of downstream, rather than overall, Taf1 cross-linking. We propose a new model in which TAFs function as reinitiation factors, accounting for the differential responses of promoters to various transcription factor mutations. PMID:29203645

Targeting the Hippo Signaling Pathway for Tissue Regeneration and Cancer Therapy

PubMed Central

Juan, Wen Chun; Hong, Wanjin

2016-01-01

The Hippo signaling pathway is a highly-conserved developmental pathway that plays an essential role in organ size control, tumor suppression, tissue regeneration and stem cell self-renewal. The YES-associated protein (YAP) and the transcriptional co-activator with PDZ-binding motif (TAZ) are two important transcriptional co-activators that are negatively regulated by the Hippo signaling pathway. By binding to transcription factors, especially the TEA domain transcription factors (TEADs), YAP and TAZ induce the expression of growth-promoting genes, which can promote organ regeneration after injury. Therefore, controlled activation of YAP and TAZ can be useful for regenerative medicine. However, aberrant activation of YAP and TAZ due to deregulation of the Hippo pathway or overexpression of YAP/TAZ and TEADs can promote cancer development. Hence, pharmacological inhibition of YAP and TAZ may be a useful approach to treat tumors with high YAP and/or TAZ activity. In this review, we present the mechanisms regulating the Hippo pathway, the role of the Hippo pathway in tissue repair and cancer, as well as a detailed analysis of the different strategies to target the Hippo signaling pathway and the genes regulated by YAP and TAZ for regenerative medicine and cancer therapy. PMID:27589805

Targeting the Hippo Signaling Pathway for Tissue Regeneration and Cancer Therapy.

PubMed

Juan, Wen Chun; Hong, Wanjin

2016-08-30

The Hippo signaling pathway is a highly-conserved developmental pathway that plays an essential role in organ size control, tumor suppression, tissue regeneration and stem cell self-renewal. The YES-associated protein (YAP) and the transcriptional co-activator with PDZ-binding motif (TAZ) are two important transcriptional co-activators that are negatively regulated by the Hippo signaling pathway. By binding to transcription factors, especially the TEA domain transcription factors (TEADs), YAP and TAZ induce the expression of growth-promoting genes, which can promote organ regeneration after injury. Therefore, controlled activation of YAP and TAZ can be useful for regenerative medicine. However, aberrant activation of YAP and TAZ due to deregulation of the Hippo pathway or overexpression of YAP/TAZ and TEADs can promote cancer development. Hence, pharmacological inhibition of YAP and TAZ may be a useful approach to treat tumors with high YAP and/or TAZ activity. In this review, we present the mechanisms regulating the Hippo pathway, the role of the Hippo pathway in tissue repair and cancer, as well as a detailed analysis of the different strategies to target the Hippo signaling pathway and the genes regulated by YAP and TAZ for regenerative medicine and cancer therapy.

Cardiac tissue enriched factors serum response factor and GATA-4 are mutual coregulators

NASA Technical Reports Server (NTRS)

Belaguli, N. S.; Sepulveda, J. L.; Nigam, V.; Charron, F.; Nemer, M.; Schwartz, R. J.

2000-01-01

Combinatorial interaction among cardiac tissue-restricted enriched transcription factors may facilitate the expression of cardiac tissue-restricted genes. Here we show that the MADS box factor serum response factor (SRF) cooperates with the zinc finger protein GATA-4 to synergistically activate numerous myogenic and nonmyogenic serum response element (SRE)-dependent promoters in CV1 fibroblasts. In the absence of GATA binding sites, synergistic activation depends on binding of SRF to the proximal CArG box sequence in the cardiac and skeletal alpha-actin promoter. GATA-4's C-terminal activation domain is obligatory for synergistic coactivation with SRF, and its N-terminal domain and first zinc finger are inhibitory. SRF and GATA-4 physically associate both in vivo and in vitro through their MADS box and the second zinc finger domains as determined by protein A pullout assays and by in vivo one-hybrid transfection assays using Gal4 fusion proteins. Other cardiovascular tissue-restricted GATA factors, such as GATA-5 and GATA-6, were equivalent to GATA-4 in coactivating SRE-dependent targets. Thus, interaction between the MADS box and C4 zinc finger proteins, a novel regulatory paradigm, mediates activation of SRF-dependent gene expression.

A high-confidence interaction map identifies SIRT1 as a mediator of acetylation of USP22 and the SAGA coactivator complex.

PubMed

Armour, Sean M; Bennett, Eric J; Braun, Craig R; Zhang, Xiao-Yong; McMahon, Steven B; Gygi, Steven P; Harper, J Wade; Sinclair, David A

2013-04-01

Although many functions and targets have been attributed to the histone and protein deacetylase SIRT1, a comprehensive analysis of SIRT1 binding proteins yielding a high-confidence interaction map has not been established. Using a comparative statistical analysis of binding partners, we have assembled a high-confidence SIRT1 interactome. Employing this method, we identified the deubiquitinating enzyme ubiquitin-specific protease 22 (USP22), a component of the deubiquitinating module (DUBm) of the SAGA transcriptional coactivating complex, as a SIRT1-interacting partner. We found that this interaction is highly specific, requires the ZnF-UBP domain of USP22, and is disrupted by the inactivating H363Y mutation within SIRT1. Moreover, we show that USP22 is acetylated on multiple lysine residues and that alteration of a single lysine (K129) within the ZnF-UBP domain is sufficient to alter interaction of the DUBm with the core SAGA complex. Furthermore, USP22-mediated recruitment of SIRT1 activity promotes the deacetylation of individual SAGA complex components. Our results indicate an important role of SIRT1-mediated deacetylation in regulating the formation of DUBm subcomplexes within the larger SAGA complex.

Fasting launches CRTC to facilitate long-term memory formation in Drosophila.

PubMed

Hirano, Yukinori; Masuda, Tomoko; Naganos, Shintaro; Matsuno, Motomi; Ueno, Kohei; Miyashita, Tomoyuki; Horiuchi, Junjiro; Saitoe, Minoru

2013-01-25

Canonical aversive long-term memory (LTM) formation in Drosophila requires multiple spaced trainings, whereas appetitive LTM can be formed after a single training. Appetitive LTM requires fasting prior to training, which increases motivation for food intake. However, we found that fasting facilitated LTM formation in general; aversive LTM formation also occurred after single-cycle training when mild fasting was applied before training. Both fasting-dependent LTM (fLTM) and spaced training-dependent LTM (spLTM) required protein synthesis and cyclic adenosine monophosphate response element-binding protein (CREB) activity. However, spLTM required CREB activity in two neural populations--mushroom body and DAL neurons--whereas fLTM required CREB activity only in mushroom body neurons. fLTM uses the CREB coactivator CRTC, whereas spLTM uses the coactivator CBP. Thus, flies use distinct LTM machinery depending on their hunger state.

Ablation of Steroid Receptor Coactivator-3 resembles the human CACT metabolic myopathy

PubMed Central

York, Brian; Reineke, Erin L.; Sagen, Jørn V.; Nikolai, Bryan C.; Zhou, Suoling; Louet, Jean-Francois; Chopra, Atul R.; Chen, Xian; Reed, Graham; Noebels, Jeffrey; Adesina, Adekunle M.; Yu, Hui; Wong, Lee-Jun C.; Tsimelzon, Anna; Hilsenbeck, Susan; Stevens, Robert D.; Wenner, Brett R.; Ilkayeva, Olga; Xu, Jianming; Newgard, Christopher B.; O’Malley, Bert W.

2012-01-01

Summary Oxidation of lipid substrates is essential for survival in fasting and other catabolic conditions, sparing glucose for the brain and other glucose-dependent tissues. Here we show Steroid Receptor Coactivator-3 (SRC-3) plays a central role in long chain fatty acid metabolism by directly regulating carnitine/acyl-carnitine translocase (CACT) gene expression. Genetic deficiency of CACT in humans is accompanied by a constellation of metabolic and toxicity phenotypes including hypoketonemia, hypoglycemia, hyperammonemia, and impaired neurologic, cardiac and skeletal muscle performance, each of which is apparent in mice lacking SRC-3 expression. Consistent with human cases of CACT deficiency, dietary rescue with short chain fatty acids drastically attenuates the clinical hallmarks of the disease in mice devoid of SRC-3. Collectively, our results position SRC-3 as a key regulator of β-oxidation. Moreover, these findings allow us to consider platform coactivators such as the SRCs as potential contributors to syndromes such as CACT deficiency, previously considered as monogenic. PMID:22560224

Metabolomic and Lipidomic Analysis of the Heart of Peroxisome Proliferator-Activated Receptor-γ Coactivator 1-β Knock Out Mice on a High Fat Diet.

PubMed

McCombie, Gregor; Medina-Gomez, Gema; Lelliott, Christopher J; Vidal-Puig, Antonio; Griffin, Julian L

2012-06-18

The peroxisome proliferator-activated receptor-γ coactivators (PGC-1) are transcriptional coactivators with an important role in mitochondrial biogenesis and regulation of genes involved in the electron transport chain and oxidative phosphorylation in oxidative tissues including cardiac tissue. These coactivators are thought to play a key role in the development of obesity, type 2 diabetes and the metabolic syndrome. In this study we have used a combined metabolomic and lipidomic analysis of cardiac tissue from the PGC-1β null mouse to examine the effects of a high fat diet on this organ. Multivariate statistics readily separated tissue from PGC-1β null mice from their wild type controls either in gender specific models or in combined datasets. This was associated with an increase in creatine and a decrease in taurine in the null mouse, and an increase in myristic acid and a reduction in long chain polyunsaturated fatty acids for both genders. The most profound changes were detected by liquid chromatography mass spectrometry analysis of intact lipids with the tissue from the null mouse having a profound increase in a number of triglycerides. The metabolomic and lipodomic changes indicate PGC-1β has a profound influence on cardiac metabolism.

Steroid Receptor Coactivator-1 Knockdown Decreases Synaptic Plasticity and Impairs Spatial Memory in the Hippocampus of Mice.

PubMed

Bian, Chen; Huang, Yan; Zhu, Haitao; Zhao, Yangang; Zhao, Jikai; Zhang, Jiqiang

2018-05-01

Steroids have been demonstrated to play profound roles in the regulation of hippocampal function by acting on their receptors, which need coactivators for their transcriptional activities. Previous studies have shown that steroid receptor coactivator-1 (SRC-1) is the predominant coactivator in the hippocampus, but its exact role and the underlying mechanisms remain unclear. In this study, we constructed SRC-1 RNA interference (RNAi) lentiviruses, injected them into the hippocampus of male mice, and then examined the changes in the expression of selected synaptic proteins, CA1 synapse density, postsynaptic density (PSD) thickness, and in vivo long-term potentiation (LTP). Spatial learning and memory behavior changes were investigated using the Morris water maze. We then transfected the lentiviruses into cultured hippocampal cells and examined the changes in synaptic protein and phospho-cyclic AMP response element-binding protein (pCREB) expression. The in vivo results showed that SRC-1 knockdown significantly decreased the expression of synaptic proteins and CA1 synapse density as well as PSD thickness; SRC-1 knockdown also significantly impaired in vivo LTP and disrupted spatial learning and memory. The in vitro results showed that while the expression of synaptic proteins was significantly decreased by SRC-1 knockdown, pCREB expression was also significantly decreased. The above results suggest a pivotal role of SRC-1 in the regulation of hippocampal synaptic plasticity and spatial learning and memory, strongly indicating SRC-1 may serve as a novel therapeutic target for hippocampus-dependent memory disorders. Copyright © 2018 IBRO. Published by Elsevier Ltd. All rights reserved.

Molecular mechanism of APC/C activation by mitotic phosphorylation

PubMed Central

Alfieri, Claudio; Zhang, Ziguo; Yang, Jing; Maslen, Sarah; Skehel, Mark; Barford, David

2016-01-01

In eukaryotes, the anaphase-promoting complex/cyclosome (APC/C) regulates the ubiquitin-dependent proteolysis of specific cell cycle proteins to coordinate chromosome segregation in mitosis and entry into G1 (refs 1,2). The APC/C’s catalytic activity and ability to specify the destruction of particular proteins at different phases of the cell cycle are controlled by its interaction with two structurally related coactivator subunits (Cdc20 and Cdh1). Coactivators recognize substrate degrons3, and enhance the APC/C’s affinity for its cognate E2 (refs 4–6). During mitosis, cyclin-dependent kinase and polo kinase control Cdc20 and Cdh1-mediated activation of the APC/C. Hyper-phosphorylation of APC/C subunits, notably Apc1 and Apc3, is required for Cdc20 to activate the APC/C7–12, whereas phosphorylation of Cdh1 prevents its association with the APC/C9,13,14. Since both coactivators associate with the APC/C through their common C box15 and IR (Ile-Arg) tail motifs16,17, the mechanism underlying this differential regulation is unclear, as is the role of specific APC/C phosphorylation sites. Here, using cryo-electron microscopy (cryo-EM) and biochemical analysis, we define the molecular basis of how APC/C phosphorylation allows for its control by Cdc20. An auto-inhibitory (AI) segment of Apc1 acts as a molecular switch that in apo unphosphorylated APC/C interacts with the C-box binding site and obstructs engagement of Cdc20. Phosphorylation of the AI segment displaces it from the C-box binding site. Efficient phosphorylation of the AI segment, and thus relief of auto-inhibition, requires the recruitment of Cdk-cyclin-Cks to a hyper-phosphorylated loop of Apc3. We also find that the small molecule inhibitor, tosyl-L-arginine methyl ester (TAME), preferentially suppresses APC/CCdc20 rather than APC/CCdh1, and interacts with both the C-box and IR-tail binding sites. Our results reveal the mechanism for the regulation of mitotic APC/C by phosphorylation and provide a rationale for the development of selective inhibitors of this state. PMID:27120157

Molecular mechanism of APC/C activation by mitotic phosphorylation.

PubMed

Zhang, Suyang; Chang, Leifu; Alfieri, Claudio; Zhang, Ziguo; Yang, Jing; Maslen, Sarah; Skehel, Mark; Barford, David

2016-05-12

In eukaryotes, the anaphase-promoting complex (APC/C, also known as the cyclosome) regulates the ubiquitin-dependent proteolysis of specific cell-cycle proteins to coordinate chromosome segregation in mitosis and entry into the G1 phase. The catalytic activity of the APC/C and its ability to specify the destruction of particular proteins at different phases of the cell cycle are controlled by its interaction with two structurally related coactivator subunits, Cdc20 and Cdh1. Coactivators recognize substrate degrons, and enhance the affinity of the APC/C for its cognate E2 (refs 4-6). During mitosis, cyclin-dependent kinase (Cdk) and polo-like kinase (Plk) control Cdc20- and Cdh1-mediated activation of the APC/C. Hyperphosphorylation of APC/C subunits, notably Apc1 and Apc3, is required for Cdc20 to activate the APC/C, whereas phosphorylation of Cdh1 prevents its association with the APC/C. Since both coactivators associate with the APC/C through their common C-box and Ile-Arg tail motifs, the mechanism underlying this differential regulation is unclear, as is the role of specific APC/C phosphorylation sites. Here, using cryo-electron microscopy and biochemical analysis, we define the molecular basis of how phosphorylation of human APC/C allows for its control by Cdc20. An auto-inhibitory segment of Apc1 acts as a molecular switch that in apo unphosphorylated APC/C interacts with the C-box binding site and obstructs engagement of Cdc20. Phosphorylation of the auto-inhibitory segment displaces it from the C-box-binding site. Efficient phosphorylation of the auto-inhibitory segment, and thus relief of auto-inhibition, requires the recruitment of Cdk-cyclin in complex with a Cdk regulatory subunit (Cks) to a hyperphosphorylated loop of Apc3. We also find that the small-molecule inhibitor, tosyl-l-arginine methyl ester, preferentially suppresses APC/C(Cdc20) rather than APC/C(Cdh1), and interacts with the binding sites of both the C-box and Ile-Arg tail motifs. Our results reveal the mechanism for the regulation of mitotic APC/C by phosphorylation and provide a rationale for the development of selective inhibitors of this state.

Activator Gcn4 employs multiple segments of Med15/Gal11, including the KIX domain, to recruit mediator to target genes in vivo.

PubMed

Jedidi, Iness; Zhang, Fan; Qiu, Hongfang; Stahl, Stephen J; Palmer, Ira; Kaufman, Joshua D; Nadaud, Philippe S; Mukherjee, Sujoy; Wingfield, Paul T; Jaroniec, Christopher P; Hinnebusch, Alan G

2010-01-22

Mediator is a multisubunit coactivator required for initiation by RNA polymerase II. The Mediator tail subdomain, containing Med15/Gal11, is a target of the activator Gcn4 in vivo, critical for recruitment of native Mediator or the Mediator tail subdomain present in sin4Delta cells. Although several Gal11 segments were previously shown to bind Gcn4 in vitro, the importance of these interactions for recruitment of Mediator and transcriptional activation by Gcn4 in cells was unknown. We show that interaction of Gcn4 with the Mediator tail in vitro and recruitment of this subcomplex and intact Mediator to the ARG1 promoter in vivo involve additive contributions from three different segments in the N terminus of Gal11. These include the KIX domain, which is a critical target of other activators, and a region that shares a conserved motif (B-box) with mammalian coactivator SRC-1, and we establish that B-box is a critical determinant of Mediator recruitment by Gcn4. We further demonstrate that Gcn4 binds to the Gal11 KIX domain directly and, by NMR chemical shift analysis combined with mutational studies, we identify the likely binding site for Gcn4 on the KIX surface. Gcn4 is distinctive in relying on comparable contributions from multiple segments of Gal11 for efficient recruitment of Mediator in vivo.

Emerging role of Hippo pathway in gastric and other gastrointestinal cancers.

PubMed

Kang, Wei; Cheng, Alfred S L; Yu, Jun; To, Ka Fai

2016-01-21

More evidence has underscored the importance of Hippo signaling pathway in gastrointestinal tissue homeostasis, whereas its deregulation induces tumorigenesis. Yes-associated protein 1 (YAP1) and its close paralog TAZ, transcriptional co-activator with a PDZ-binding motif, function as key effectors negatively controlled by the Hippo pathway. YAP1/TAZ exerts oncogenic activities by transcriptional regulation via physical interaction with TEAD transcription factors. In various cancers, Hippo pathway cross-talks with pro- or anti-tumorigenic pathways such as GPCR, Wnt/β-catenin, Notch and TGF-β signaling and is deregulated by multiple factors including cell density/junction and microRNAs. As YAP1 expression is significantly associated with poor prognosis of gastric and other gastrointestinal cancers, detailed delineation of Hippo regulation in tumorigenesis provides novel insight for therapeutic intervention. In current review, we summarized the recent research progresses on the deregulation of Hippo pathway in the gastrointestinal tract including stomach and discuss the molecular consequences leading to tumorigenesis.

Dynamics of the Ternary Complex Formed by c-Myc Interactor JPO2, Transcriptional Co-activator LEDGF/p75, and Chromatin*

PubMed Central

Hendrix, Jelle; van Heertum, Bart; Vanstreels, Els; Daelemans, Dirk; De Rijck, Jan

2014-01-01

Lens epithelium-derived growth factor (LEDGF/p75) is a transcriptional co-activator involved in targeting human immunodeficiency virus (HIV) integration and the development of MLL fusion-mediated acute leukemia. A previous study revealed that LEDGF/p75 dynamically scans the chromatin, and upon interaction with HIV-1 integrase, their complex is locked on chromatin. At present, it is not known whether LEDGF/p75-mediated chromatin locking is typical for interacting proteins. Here, we employed continuous photobleaching and fluorescence correlation and cross-correlation spectroscopy to investigate in vivo chromatin binding of JPO2, a LEDGF/p75- and c-Myc-interacting protein involved in transcriptional regulation. In the absence of LEDGF/p75, JPO2 performs chromatin scanning inherent to transcription factors. However, whereas the dynamics of JPO2 chromatin binding are decelerated upon interaction with LEDGF/p75, very strong locking of their complex onto chromatin is absent. Similar results were obtained with the domesticated transposase PogZ, another cellular interaction partner of LEDGF/p75. We furthermore show that diffusive JPO2 can oligomerize; that JPO2 and LEDGF/p75 interact directly and specifically in vivo through the specific interaction domain of JPO2 and the C-terminal domain of LEDGF/p75, comprising the integrase-binding domain; and that modulation of JPO2 dynamics requires a functional PWWP domain in LEDGF/p75. Our results suggest that the dynamics of the LEDGF/p75-chromatin interaction depend on the specific partner and that strong chromatin locking is not a property of all LEDGF/p75-binding proteins. PMID:24634210

Characterization of a new ARID family transcription factor (Brightlike/ARID3C) that co-activates Bright/ARID3A-mediated immunoglobulin gene transcription

PubMed Central

Tidwell, Josephine A.; Schmidt, Christian; Heaton, Phillip; Wilson, Van; Tucker, Philip W.

2011-01-01

Two members, Bright/ARID3A and Bdp/ARID3B, of the ARID (AT-Rich Interaction Domain) transcription family are distinguished by their ability to specifically bind to DNA and to self-associate via a second domain, REKLES. Bright and Bdp positively regulate immunoglobulin heavy chain gene (IgH) transcription by binding to AT-rich motifs within Matrix Associating Regions (MARs) residing within a subset of VH promoters and the Eµ intronic enhancer. In addition, REKLES provides Bright nuclear export function, and a small pool of Bright is directed to plasma membrane sub-domains/lipid rafts where it associates with and modulates signaling of the B cell antigen receptor (BCR). Here, we characterize a third, highly conserved, physically condensed ARID3 locus, Brightlike/ARID3C. Brightlike encodes two alternatively spliced, SUMO-I-modified isoforms that include or exclude (Δ6) the REKLES-encoding exon 6. Brightlike transcripts and proteins are expressed preferentially within B lineage lymphocytes and coordinate with highest Bright expression--in activated follicular B cells. Brightlike, but not BrightlikeΔ6, undergoes nuclear-cytoplasmic shuttling with a fraction localizing within lipid rafts following BCR stimulation. Brightlike, but not BrightlikeΔ6, associates with Bright in solution, at common DNA binding sites in vitro, and is enriched at Bright binding sites in chromatin. Although possessing little transactivation capacity of its own, Brightlike significantly co-activates Bright-dependent IgH transcription with maximal activity mediated by the unsumoylated form. In sum, this report introduces Brightlike as an additional functional member of the family of ARID proteins, which should be considered in regulatory circuits, previously ascribed to be mediated by Bright. PMID:21955986

Gain in Transcriptional Activity by Primate-specific Coevolution of Melanoma Antigen-A11 and Its Interaction Site in Androgen Receptor*

PubMed Central

Liu, Qiang; Su, Shifeng; Blackwelder, Amanda J.; Minges, John T.; Wilson, Elizabeth M.

2011-01-01

Male sex development and growth occur in response to high affinity androgen binding to the androgen receptor (AR). In contrast to complete amino acid sequence conservation in the AR DNA and ligand binding domains among mammals, a primate-specific difference in the AR NH2-terminal region that regulates the NH2- and carboxyl-terminal (N/C) interaction enables direct binding to melanoma antigen-A11 (MAGE-11), an AR coregulator that is also primate-specific. Human, mouse, and rat AR share the same NH2-terminal 23FQNLF27 sequence that mediates the androgen-dependent N/C interaction. However, the mouse and rat AR FXXLF motif is flanked by Ala33 that evolved to Val33 in primates. Human AR Val33 was required to interact directly with MAGE-11 and for the inhibitory effect of the AR N/C interaction on activation function 2 that was relieved by MAGE-11. The functional importance of MAGE-11 was indicated by decreased human AR regulation of an androgen-dependent endogenous gene using lentivirus short hairpin RNAs and by the greater transcriptional strength of human compared with mouse AR. MAGE-11 increased progesterone and glucocorticoid receptor activity independently of binding an FXXLF motif by interacting with p300 and p160 coactivators. We conclude that the coevolution of the AR NH2-terminal sequence and MAGE-11 expression among primates provides increased regulatory control over activation domain dominance. Primate-specific expression of MAGE-11 results in greater steroid receptor transcriptional activity through direct interactions with the human AR FXXLF motif region and indirectly through steroid receptor-associated p300 and p160 coactivators. PMID:21730049

Estrogen promotes megakaryocyte polyploidization via estrogen receptor beta-mediated transcription of GATA1.

PubMed

Du, C; Xu, Y; Yang, K; Chen, S; Wang, X; Wang, S; Wang, C; Shen, M; Chen, F; Chen, M; Zeng, D; Li, F; Wang, T; Wang, F; Zhao, J; Ai, G; Cheng, T; Su, Y; Wang, J

2017-04-01

Estrogen is reported to be involved in thrombopoiesis and the disruption of its signaling may cause myeloproliferative disease, yet the underlying mechanisms remain largely unknown. GATA-binding factor 1 (GATA1) is a key regulator of megakaryocyte (MK) differentiation and its deficiency will lead to megakaryoblastic leukemia. Here we show that estrogen can dose-dependently promote MK polyploidization and maturation via activation of estrogen receptor beta (ERβ), accompanied by a significant upregulation of GATA1. Chromatin immunoprecipitation and a dual luciferase assay demonstrate that ERβ can directly bind the promoter region of GATA1 and activate its transcription. Steroid receptor coactivator 3 (SRC3) is involved in ERβ-mediated GATA1 transcription. The deficiency of ERβ or SRC3, similar to the inhibition of GATA1, leads to the impediment of estrogen-induced MK polyploidization and platelet production. Further investigations reveal that signal transducer and activator of transcription 1 signaling pathway downstream of GATA1 has a crucial role in estrogen-induced MK polyploidization, and ERβ-mediated GATA1 upregulation subsequently enhances nuclear factor erythroid-derived 2 expression, thereby promoting proplatelet formation and platelet release. Our study provides a deep insight into the molecular mechanisms of estrogen signaling in regulating thrombopoiesis and the pathogenesis of ER deficiency-related leukemia.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Li, Yong; Choi, Mihwa; Cavey, Greg

The orphan nuclear receptor steroidogenic factor 1 (SF-1) regulates the differentiation and function of endocrine glands. Although SF-1 is constitutively active in cell-based assays, it is not known whether this transcriptional activity is modulated by ligands. Here, we describe the 1.5 {angstrom} crystal structure of the SF-1 ligand binding domain in complex with an LXXLL motif from a coregulator protein. The structure reveals the presence of a phospholipid ligand in a surprisingly large pocket ({approx}1600 {angstrom}{sup 3}), with the receptor adopting the canonical active conformation. The bound phospholipid is readily exchanged and modulates SF-1 interactions with coactivators. Mutations designed tomore » reduce the size of the SF-1 pocket or to disrupt hydrogen bonds with the phospholipid abolish SF-1/coactivator interactions and significantly reduce SF-1 transcriptional activity. These findings provide evidence that SF-1 is regulated by endogenous ligands and suggest an unexpected relationship between phospholipids and endocrine development and function.« less

OCA-B regulation of B-cell development and function.

PubMed

Teitell, Michael A

2003-10-01

The transcriptional co-activator OCA-B [for Oct co-activator from B cells, also known as OBF-1 (OCT-binding factor-1) and Bob1] is not required for B-cell genesis but does regulate subsequent B-cell development and function. OCA-B deficient mice show strain-specific, partial blocks at multiple stages of B-cell maturation and a complete disruption of germinal center formation in all strains, causing humoral immune deficiency and susceptibility to infection. OCA-B probably exerts its effects through the regulation of octamer-motif controlled gene expression. The OCA-B gene encodes two proteins of distinct molecular weight, designated p34 and p35. The p34 isoform localizes in the nucleus, whereas the p35 isoform is myristoylated and is bound to the cytoplasmic membrane. p35 can traffic to the nucleus and probably activates octamer-dependent transcription, although this OCA-B isoform might regulate B cells through membrane-related signal transduction.

Transcription coactivator Arabidopsis ANGUSTIFOLIA3 modulates anthocyanin accumulation and light-induced root elongation through transrepression of Constitutive Photomorphogenic1.

PubMed

Meng, Lai-Sheng

2015-04-01

ANGUSTIFOLIA3 (AN3), a transcription coactivator, is implicated in modulating cell proliferation. In this study, I found that AN3 is a novel regulator of anthocyanin biosynthesis and light-induced root elongation. Seedlings and seeds lacking AN3 activity presented significantly reduced anthocyanin accumulation and light-induced root elongation, whereas those of transgenic plants harbouring the 35S:AN3 construct exhibited increased anthocyanin accumulation. AN3 is required for the proper expression of other genes that affect anthocyanin accumulation and light-induced root elongation, Constitutive Photomorphogenic1 (COP1), encoding a RING motif - containing E3 ubiquitin ligase. AN3 was associated with COP1 promoter in vivo. Thus, AN3 may act with other proteins that bind to COP1 promoter to promote anthocyanin accumulation and inhibit light-induced root elongation. © 2014 John Wiley & Sons Ltd.

Steroid Receptor Coactivator-interacting Protein (SIP) Inhibits Caspase-independent Apoptosis by Preventing Apoptosis-inducing Factor (AIF) from Being Released from Mitochondria*

PubMed Central

Wang, Dandan; Liang, Jing; Zhang, Yu; Gui, Bin; Wang, Feng; Yi, Xia; Sun, Luyang; Yao, Zhi; Shang, Yongfeng

2012-01-01

Apoptosis-inducing factor (AIF) is a caspase-independent death effector. Normally residing in the mitochondrial intermembrane space, AIF is released and translocated to the nucleus in response to proapoptotic stimuli. Nuclear AIF binds to DNA and induces chromatin condensation and DNA fragmentation, characteristics of apoptosis. Until now, it remained to be clarified how the mitochondrial-nuclear translocation of AIF is regulated. Here we report that steroid receptor coactivator-interacting protein (SIP) interacts directly with AIF in mitochondria and specifically inhibits caspase-independent and AIF-dependent apoptosis. Challenging cells with apoptotic stimuli leads to rapid degradation of SIP, and subsequently AIF is liberated from mitochondria and translocated to the nucleus to induce apoptosis. Together, our data demonstrate that SIP is a novel regulator in caspase-independent and AIF-mediated apoptosis. PMID:22371500

Cryptochrome 1 regulates the circadian clock through dynamic interactions with the BMAL1 C-terminus

PubMed Central

Sammons, Patrick J.; Khan, Sanjoy K.; Parsley, Nicole C.; Ramanathan, Chidambaram; Lee, Hsiau-Wei; Liu, Andrew C.; Partch, Carrie L.

2015-01-01

The molecular circadian clock in mammals is generated from transcriptional activation by the bHLH-PAS transcription factor CLOCK–BMAL1 and subsequent repression by PERIOD and CRYPTOCHROME (CRY). The mechanism by which CRYs repress CLOCK–BMAL1 to close the negative feedback loop and generate 24-hour timing is not known. Here we show that CRY1 competes for binding with coactivators to the intrinsically unstructured C-terminal transactivation domain (TAD) of BMAL1 to establish a functional switch between activation and repression of CLOCK–BMAL1. Mutations within the TAD that alter affinities for coregulators change the balance of repression and activation to consequently change intrinsic circadian period or eliminate cycling altogether. Our results suggest that CRY1 fulfills its role as an essential circadian repressor by sequestering the TAD from coactivators and highlight regulation of the BMAL1 TAD as a critical mechanism for establishing circadian timing. PMID:25961797

The metazoan Mediator co-activator complex as an integrative hub for transcriptional regulation.

PubMed

Malik, Sohail; Roeder, Robert G

2010-11-01

The Mediator is an evolutionarily conserved, multiprotein complex that is a key regulator of protein-coding genes. In metazoan cells, multiple pathways that are responsible for homeostasis, cell growth and differentiation converge on the Mediator through transcriptional activators and repressors that target one or more of the almost 30 subunits of this complex. Besides interacting directly with RNA polymerase II, Mediator has multiple functions and can interact with and coordinate the action of numerous other co-activators and co-repressors, including those acting at the level of chromatin. These interactions ultimately allow the Mediator to deliver outputs that range from maximal activation of genes to modulation of basal transcription to long-term epigenetic silencing.

The DEK oncogene activates VEGF expression and promotes tumor angiogenesis and growth in HIF-1α-dependent and -independent manners

PubMed Central

Li, Yang; Lv, Zhaohui; Zhu, Jie; Lin, Jing; Ding, Lihua; Ye, Qinong

2016-01-01

The DEK oncogene is overexpressed in various cancers and overexpression of DEK correlates with poor clinical outcome. Vascular endothelial growth factor (VEGF) is the most important regulator of tumor angiogenesis, a process essential for tumor growth and metastasis. However, whether DEK enhances tumor angiogenesis remains unclear. Here, we show that DEK is a key regulator of VEGF expression and tumor angiogenesis. Using chromatin immunoprecipitation assay, we found that DEK promoted VEGF transcription in breast cancer cells (MCF7, ZR75-1 and MDA-MB-231) by directly binding to putative DEK-responsive element (DRE) of the VEGF promoter and indirectly binding to hypoxia response element (HRE) upstream of the DRE through its interaction with the transcription factor hypoxia-inducible factor 1α (HIF-1α), a master regulator of tumor angiogenesis and growth. DEK is responsible for recruitment of HIF-1α and the histone acetyltransferase p300 to the VEGF promoter. DEK-enhanced VEGF increases vascular endothelial cell proliferation, migration and tube formation as well as angiogenesis in the chick chorioallantoic membrane. DEK promotes tumor angiogenesis and growth in nude mice in HIF-1α-dependent and -independent manners. Immunohistochemical staining showed that DEK expression positively correlates with the expression of VEGF and microvessel number in 58 breast cancer patients. Our data establish DEK as a sequence-specific binding transcription factor, a novel coactivator for HIF-1α in regulation of VEGF transcription and a novel promoter of angiogenesis. PMID:26988756

Quantification of silkworm coactivator of MBF1 mRNA by SYBR Green I real-time RT-PCR reveals tissue- and stage-specific transcription levels.

PubMed

Li, Guang-li; Roy, Bhaskar; Li, Xing-hua; Yue, Wan-fu; Wu, Xiao-feng; Liu, Jian-mei; Zhang, Chuan-xi; Miao, Yun-gen

2009-05-01

Transcriptional coactivators play a crucial role in gene transcription and expression. Multiprotein bridging factor 1 (MBF1) is a transcriptional coactivator necessary for transcriptional activation caused by DNA-binding activators, such as FTZ-F1 and GCN4. Until now, very few studies have been reported in the silkworm. We selected the Bombyx mori because it is a model insect and acts as an economic animal for silk industry. In this study, we conducted the quantitative analysis of MBF1 mRNA in silkworm B. mori L. with actin (A3) as internal standard by means of SYBR Green I real-time RT-PCR method. The total RNA was extracted from the silk gland, epidermis, fat body, and midguts of the fifth instar B. mori larvae. The mRNA was reverse transcripted, and the cDNA fragments of MBF1 mRNA and actin gene were amplified by RT-PCR using specific primers. MBF1 mRNA expression in different tissues of silkworm B. mori L. was quantified using standardized SYBR Green I RT-PCR. The results suggested MBF1 gene was expressed in all investigated organs but highly expressed in the silk gland, showing its relation to biosynthesis of silk proteins.

Dual Role of Protein Phosphorylation in DNA Activator/Coactivator Binding

PubMed Central

Dadarlat, Voichita M.; Skeel, Robert D.

2011-01-01

Binding free energies are calculated for the phosphorylated and unphosphorylated complexes between the kinase inducible domain (KID) of the DNA transcriptional activator cAMP response element binding (CREB) protein and the KIX domain of its coactivator, CREB-binding protein (CBP). To our knowledge, this is the first application of a method based on a potential of mean force (PMF) with restraining potentials to compute the binding free energy of protein-protein complexes. The KID:KIX complexes are chosen here because of their biological relevance to the DNA transcription process and their relatively small size (81 residues for the KIX domain of CBP, and 28 residues for KID). The results for pKID:KIX and KID:KIX are −9.55 and −4.96 kcal/mol, respectively, in good agreement with experimental estimates (−8.8 and −5.8 kcal/mol, respectively). A comparison between specific contributions to protein-protein binding for the phosphorylated and unphosphorylated complexes reveals a dual role for the phosphorylation of KID at Ser-133 in effecting a more favorable free energy of the bound system: 1), stabilization of the unbound conformation of phosphorylated KID due to favorable intramolecular interactions of the phosphate group of Ser-133 with the charged groups of an arginine-rich region spanning both α-helices, which lowers the configurational entropy; and 2), more favorable intermolecular electrostatic interactions between pSer-133 and Arg-131 of KID, and Lys-662, Tyr-658, and Glu-666 of KIX. Charge reduction through ligand phosphorylation emerges as a possible mechanism for controlling the unbound state conformation of KID and, ultimately, gene expression. This work also demonstrates that the PMF-based method with restraining potentials provides an added benefit in that important elements of the binding pathway are evidenced. Furthermore, the practicality of the PMF-based method for larger systems is validated by agreement with experiment. In addition, we provide a somewhat differently structured exposition of the PMF-based method with restraining potentials and outline its generalization to systems in which both protein and ligand may adopt unbound conformations that are different from those of the bound state. PMID:21244843

Cooperative activation of cardiac transcription through myocardin bridging of paired MEF2 sites

DOE Office of Scientific and Technical Information (OSTI.GOV)

Anderson, Courtney M.; Hu, Jianxin; Thomas, Reuben

2017-03-28

Enhancers frequently contain multiple binding sites for the same transcription factor. These homotypic binding sites often exhibit synergy, whereby the transcriptional output from two or more binding sites is greater than the sum of the contributions of the individual binding sites alone. Although this phenomenon is frequently observed, the mechanistic basis for homotypic binding site synergy is poorly understood. Here in this paper, we identify a bona fide cardiac-specific Prkaa2 enhancer that is synergistically activated by homotypic MEF2 binding sites. We show that two MEF2 sites in the enhancer function cooperatively due to bridging of the MEF2C-bound sites by themore » SAP domain-containing co-activator protein myocardin, and we show that paired sites buffer the enhancer from integration site-dependent effects on transcription in vivo. Paired MEF2 sites are prevalent in cardiac enhancers, suggesting that this might be a common mechanism underlying synergy in the control of cardiac gene expression in vivo.« less

Molecular characterization of SMILE as a novel corepressor of nuclear receptors.

PubMed

Xie, Yuan-Bin; Nedumaran, Balachandar; Choi, Hueng-Sik

2009-07-01

SMILE (small heterodimer partner interacting leucine zipper protein) has been identified as a coregulator in ER signaling. In this study, we have examined the effects of SMILE on other NRs (nuclear receptors). SMILE inhibits GR, CAR and HNF4 alpha-mediated transactivation. Knockdown of SMILE gene expression increases the transactivation of the NRs. SMILE interacts with GR, CAR and HNF4 alpha in vitro and in vivo. SMILE and these NRs colocalize in the nucleus. SMILE binds to the ligand-binding domain or AF2 domain of the NRs. Competitions between SMILE and the coactivators GRIP1 or PGC-1 alpha have been demonstrated in vitro and in vivo. Furthermore, an intrinsic repressive activity of SMILE is observed in Gal4-fusion system, and the intrinsic repressive domain is mapped to the C-terminus of SMILE, spanning residues 203-354. Moreover, SMILE interacts with specific HDACs (histone deacetylases) and SMILE-mediated repression is released by HDAC inhibitor trichostatin A, in a NR-specific manner. Finally, ChIP (chromatin immunoprecipitation) assays reveal that SMILE associates with the NRs on the target gene promoters. Adenoviral overexpression of SMILE represses GR-, CAR- and HNF4 alpha-mediated target gene expression. Overall, these results suggest that SMILE functions as a novel corepressor of NRs via competition with coactivators and the recruitment of HDACs.

A High-Confidence Interaction Map Identifies SIRT1 as a Mediator of Acetylation of USP22 and the SAGA Coactivator Complex

PubMed Central

Armour, Sean M.; Bennett, Eric J.; Braun, Craig R.; Zhang, Xiao-Yong; McMahon, Steven B.; Gygi, Steven P.; Harper, J. Wade

2013-01-01

Although many functions and targets have been attributed to the histone and protein deacetylase SIRT1, a comprehensive analysis of SIRT1 binding proteins yielding a high-confidence interaction map has not been established. Using a comparative statistical analysis of binding partners, we have assembled a high-confidence SIRT1 interactome. Employing this method, we identified the deubiquitinating enzyme ubiquitin-specific protease 22 (USP22), a component of the deubiquitinating module (DUBm) of the SAGA transcriptional coactivating complex, as a SIRT1-interacting partner. We found that this interaction is highly specific, requires the ZnF-UBP domain of USP22, and is disrupted by the inactivating H363Y mutation within SIRT1. Moreover, we show that USP22 is acetylated on multiple lysine residues and that alteration of a single lysine (K129) within the ZnF-UBP domain is sufficient to alter interaction of the DUBm with the core SAGA complex. Furthermore, USP22-mediated recruitment of SIRT1 activity promotes the deacetylation of individual SAGA complex components. Our results indicate an important role of SIRT1-mediated deacetylation in regulating the formation of DUBm subcomplexes within the larger SAGA complex. PMID:23382074

Molecular mechanisms of the mammalian Hippo signaling pathway.

PubMed

Ji, Xin-yan; Zhong, Guoxuan; Zhao, Bin

2017-07-20

The Hippo pathway plays an evolutionarily conserved fundamental role in controlling organ size in multicellular organisms. Importantly, evidence from studies of patient samples and mouse models clearly indicates that deregulation of the Hippo signaling pathway plays a crucial role in the initiation and progression of many different types of human cancers. The Hippo signaling pathway is regulated by various stimuli, such as mechanical stress, G-protein coupled receptor signaling, and cellular energy status. When activated, the Hippo kinase cascade phosphorylates and inhibits the transcription co-activator YAP (Yes-associated protein), and its paralog TAZ (transcriptional coactivator with PDZ-binding motif), resulting in their cytoplasmic retention and degradation. When the Hippo signaling pathway is inactive, dephosphorylated YAP/TAZ translocate into the nucleus and activate gene transcription through binding to TEAD (TEA domain) family and other transcription factors. Such changes in gene expression promote cell proliferation and stem cell/progenitor cell self-renewal but inhibit apoptosis, thereby coordinately promote increase in organ size, tissue regeneration, and tumorigenesis. In this review, we summarize the molecular mechanisms of the mammalian Hippo signaling pathway with special emphasis on the Hippo kinase cascade and its upstream signals, the Hippo signaling pathway regulation of YAP and the mechanisms of YAP in regulation of gene transcription.

Bacteriophage T5 encodes a homolog of the eukaryotic transcription coactivator PC4 implicated in recombination-dependent DNA replication.

PubMed

Steigemann, Birthe; Schulz, Annina; Werten, Sebastiaan

2013-11-15

The RNA polymerase II cofactor PC4 globally regulates transcription of protein-encoding genes through interactions with unwinding DNA, the basal transcription machinery and transcription activators. Here, we report the surprising identification of PC4 homologs in all sequenced representatives of the T5 family of bacteriophages, as well as in an archaeon and seven phyla of eubacteria. We have solved the crystal structure of the full-length T5 protein at 1.9Å, revealing a striking resemblance to the characteristic single-stranded DNA (ssDNA)-binding core domain of PC4. Intriguing novel structural features include a potential regulatory region at the N-terminus and a C-terminal extension of the homodimerisation interface. The genome organisation of T5-related bacteriophages points at involvement of the PC4 homolog in recombination-dependent DNA replication, strongly suggesting that the protein corresponds to the hitherto elusive replicative ssDNA-binding protein of the T5 family. Our findings imply that PC4-like factors intervene in multiple unwinding-related processes by acting as versatile modifiers of nucleic acid conformation and raise the possibility that the eukaryotic transcription coactivator derives from ancestral DNA replication, recombination and repair factors. © 2013.

Coactivation of cognitive control networks during task switching.

PubMed

Yin, Shouhang; Deák, Gedeon; Chen, Antao

2018-01-01

The ability to flexibly switch between tasks is considered an important component of cognitive control that involves frontal and parietal cortical areas. The present study was designed to characterize network dynamics across multiple brain regions during task switching. Functional magnetic resonance images (fMRI) were captured during a standard rule-switching task to identify switching-related brain regions. Multiregional psychophysiological interaction (PPI) analysis was used to examine effective connectivity between these regions. During switching trials, behavioral performance declined and activation of a generic cognitive control network increased. Concurrently, task-related connectivity increased within and between cingulo-opercular and fronto-parietal cognitive control networks. Notably, the left inferior frontal junction (IFJ) was most consistently coactivated with the 2 cognitive control networks. Furthermore, switching-dependent effective connectivity was negatively correlated with behavioral switch costs. The strength of effective connectivity between left IFJ and other regions in the networks predicted individual differences in switch costs. Task switching was supported by coactivated connections within cognitive control networks, with left IFJ potentially acting as a key hub between the fronto-parietal and cingulo-opercular networks. (PsycINFO Database Record (c) 2018 APA, all rights reserved).

Lipin-1 Phosphatidic Phosphatase Activity Modulates Phosphatidate Levels to Promote Peroxisome Proliferator-activated Receptor γ (PPARγ) Gene Expression during Adipogenesis*

PubMed Central

Zhang, Peixiang; Takeuchi, Kazuharu; Csaki, Lauren S.; Reue, Karen

2012-01-01

Adipose tissue plays a key role in metabolic homeostasis. Disruption of the Lpin1 gene encoding lipin-1 causes impaired adipose tissue development and function in rodents. Lipin-1 functions as a phosphatidate phosphatase (PAP) enzyme in the glycerol 3-phosphate pathway for triglyceride storage and as a transcriptional coactivator/corepressor for metabolic nuclear receptors. Previous studies established that lipin-1 is required at an early step in adipocyte differentiation for induction of the adipogenic gene transcription program, including the key regulator peroxisome proliferator-activated receptor γ (PPARγ). Here, we investigate the requirement of lipin-1 PAP versus coactivator function in the establishment of Pparg expression during adipocyte differentiation. We demonstrate that PAP activity supplied by lipin-1, lipin-2, or lipin-3, but not lipin-1 coactivator activity, can rescue Pparg gene expression and lipogenesis during adipogenesis in lipin-1-deficient preadipocytes. In adipose tissue from lipin-1-deficient mice, there is an accumulation of phosphatidate species containing a range of medium chain fatty acids and an activation of the MAPK/extracellular signal-related kinase (ERK) signaling pathway. Phosphatidate inhibits differentiation of cultured adipocytes, and this can be rescued by the expression of lipin-1 PAP activity or by inhibition of ERK signaling. These results emphasize the importance of lipid intermediates as choreographers of gene regulation during adipogenesis, and the results highlight a specific role for lipins as determinants of levels of a phosphatidic acid pool that influences Pparg expression. PMID:22157014

CREBBP mutations in relapsed acute lymphoblastic leukaemia

PubMed Central

Mullighan, Charles G.; Zhang, Jinghui; Kasper, Lawryn H.; Lerach, Stephanie; Payne-Turner, Debbie; Phillips, Letha A.; Heatley, Sue L.; Holmfeldt, Linda; Collins-Underwood, J. Racquel; Ma, Jing; Buetow, Kenneth H.; Pui, Ching-Hon; Baker, Sharyn D.; Brindle, Paul K.; Downing, James R.

2010-01-01

Relapsed acute lymphoblastic leukaemia (ALL) is a leading cause of death due to disease in young people, but the biologic determinants of treatment failure remain poorly understood. Recent genome-wide profiling of structural DNA alterations in ALL have identified multiple submicroscopic somatic mutations targeting key cellular pathways1,2, and have demonstrated substantial evolution in genetic alterations from diagnosis to relapse3. However, detailed analysis of sequence mutations in ALL has not been performed. To identify novel mutations in relapsed ALL, we resequenced 300 genes in matched diagnosis and relapse samples from 23 patients with ALL. This identified 52 somatic non-synonymous mutations in 32 genes, many of which were novel, including the transcriptional coactivators CREBBP and NCOR1, the transcription factors ERG, SPI1, TCF4 and TCF7L2, components of the Ras signalling pathway, histone genes, genes involved in histone modification (CREBBP and CTCF), and genes previously shown to be targets of recurring DNA copy number alteration in ALL. Analysis of an extended cohort of 71 diagnosis-relapse cases and 270 acute leukaemia cases that did not relapse found that 18.3% of relapse cases had sequence or deletion mutations of CREBBP, which encodes the transcriptional coactivator and histone acetyltransferase (HAT) CREB-binding protein (CBP)4. The mutations were either present at diagnosis or acquired at relapse, and resulted in truncated alleles or deleterious substitutions in conserved residues of the HAT domain. Functionally, the mutations impaired histone acetylation and transcriptional regulation of CREBBP targets, including glucocorticoid responsive genes. Several mutations acquired at relapse were detected in subclones at diagnosis, suggesting that the mutations may confer resistance to therapy. These results extend the landscape of genetic alterations in leukaemia, and identify mutations targeting transcriptional and epigenetic regulation as a mechanism of resistance in ALL. PMID:21390130

Structural insights into alternative splicing-mediated desensitization of jasmonate signaling.

PubMed

Zhang, Feng; Ke, Jiyuan; Zhang, Li; Chen, Rongzhi; Sugimoto, Koichi; Howe, Gregg A; Xu, H Eric; Zhou, Mingguo; He, Sheng Yang; Melcher, Karsten

2017-02-14

Jasmonate ZIM-domain (JAZ) transcriptional repressors play a key role in regulating jasmonate (JA) signaling in plants. Below a threshold concentration of jasmonoyl isoleucine (JA-Ile), the active form of JA, the C-terminal Jas motif of JAZ proteins binds MYC transcription factors to repress JA signaling. With increasing JA-Ile concentration, the Jas motif binds to JA-Ile and the COI1 subunit of the SCF COI1 E3 ligase, which mediates ubiquitination and proteasomal degradation of JAZ repressors, resulting in derepression of MYC transcription factors. JA signaling subsequently becomes desensitized, in part by feedback induction of JAZ splice variants that lack the C-terminal Jas motif but include an N-terminal cryptic MYC-interaction domain (CMID). The CMID sequence is dissimilar to the Jas motif and is incapable of recruiting SCF COI1 , allowing CMID-containing JAZ splice variants to accumulate in the presence of JA and to re-repress MYC transcription factors as an integral part of reestablishing signal homeostasis. The mechanism by which the CMID represses MYC transcription factors remains elusive. Here we describe the crystal structure of the MYC3-CMID JAZ10 complex. In contrast to the Jas motif, which forms a single continuous helix when bound to MYC3, the CMID adopts a loop-helix-loop-helix architecture with modular interactions with both the Jas-binding groove and the backside of the Jas-interaction domain of MYC3. This clamp-like interaction allows the CMID to bind MYC3 tightly and block access of MED25 (a subunit of the Mediator coactivator complex) to the MYC3 transcriptional activation domain, shedding light on the enigmatic mechanism by which JAZ splice variants desensitize JA signaling.

Naphthol AS-E Phosphate Inhibits the Activity of the Transcription Factor Myb by Blocking the Interaction with the KIX Domain of the Coactivator p300.

PubMed

Uttarkar, Sagar; Dukare, Sandeep; Bopp, Bertan; Goblirsch, Michael; Jose, Joachim; Klempnauer, Karl-Heinz

2015-06-01

The transcription factor c-Myb is highly expressed in hematopoietic progenitor cells and controls the transcription of genes important for lineage determination, cell proliferation, and differentiation. Deregulation of c-Myb has been implicated in the development of leukemia and certain other types of human cancer. c-Myb activity is highly dependent on the interaction of the c-Myb with the KIX domain of the coactivator p300, making the disruption of this interaction a reasonable strategy for the development of Myb inhibitors. Here, we have used bacterial Autodisplay to develop an in vitro binding assay that mimics the interaction of Myb and the KIX domain of p300. We have used this binding assay to investigate the potential of Naphthol AS-E phosphate, a compound known to bind to the KIX domain, to disrupt the interaction between Myb and p300. Our data show that Naphthol AS-E phosphate interferes with the Myb-KIX interaction in vitro and inhibits Myb activity in vivo. By using several human leukemia cell lines, we demonstrate that Naphthol AS-E phosphate suppresses the expression of Myb target genes and induces myeloid differentiation and apoptosis. Our work identifies Naphthol AS-E phosphate as the first low molecular weight compound that inhibits Myb activity by disrupting its interaction with p300, and suggests that inhibition of the Myb-KIX interaction might be a useful strategy for the treatment of leukemia and other tumors caused by deregulated c-Myb. ©2015 American Association for Cancer Research.

Role of ART-27, a Novel Androgen Receptor Coactivator, in Normal Prostate and Prostate Cancer

DTIC Science & Technology

2005-04-01

associates with pro- teins that include RBP5, a subunit shared by RNA polymerases I, II , and Ill, an RBP5 binding protein called unconventional prefoldin ...of a large multiprotein complex that contains RNA polymerase II subunit 5, a subunit shared by all three RNA polymerases; unconventional prefoldin ...dithiothreitol; GRIP, glucocorticoid re- ceptor Interacting p rotein; HA, hemagglutinin; MMTV, mouse mamm ary tumor virus ; PAIS, partial AIS; SDS

Phosphorylation of an intrinsically disordered segment in Ets1 shifts conformational sampling toward binding-competent substates.

PubMed

Bui, Jennifer M; Gsponer, Jörg

2014-08-05

Functions of many proteins are affected by posttranslational modifications of intrinsically disordered (ID) regions, yet little is known about the underlying molecular mechanisms. By combining molecular dynamics simulations and protein docking, we demonstrate that the addition of phosphates to an ID segment adjacent to the PNT domain of Ets1 directs conformational sampling toward substates that are most compatible with high-affinity binding of the TAZ1 domain of its coactivator CBP. The phosphate charges disrupt salt bridges and thereby open a hydrophobic cleft and expose hydrophobic residues at the ID N terminus. The structure of the PNT-TAZ1 complex that we determined shows that PNT binds to TAZ1 via these hydrophobic regions in a similar manner to how it interacts with other partners. Our calculations reveal a dual effect of phosphorylation in that it changes the dynamics of PNT so that it becomes more compatible for TAZ1 binding and increases complementarity with this binding partner. Copyright © 2014 Elsevier Ltd. All rights reserved.

Mediator binding to UASs is broadly uncoupled from transcription and cooperative with TFIID recruitment to promoters.

PubMed

Grünberg, Sebastian; Henikoff, Steven; Hahn, Steven; Zentner, Gabriel E

2016-11-15

Mediator is a conserved, essential transcriptional coactivator complex, but its in vivo functions have remained unclear due to conflicting data regarding its genome-wide binding pattern obtained by genome-wide ChIP Here, we used ChEC-seq, a method orthogonal to ChIP, to generate a high-resolution map of Mediator binding to the yeast genome. We find that Mediator associates with upstream activating sequences (UASs) rather than the core promoter or gene body under all conditions tested. Mediator occupancy is surprisingly correlated with transcription levels at only a small fraction of genes. Using the same approach to map TFIID, we find that TFIID is associated with both TFIID- and SAGA-dependent genes and that TFIID and Mediator occupancy is cooperative. Our results clarify Mediator recruitment and binding to the genome, showing that Mediator binding to UASs is widespread, partially uncoupled from transcription, and mediated in part by TFIID. © 2016 The Authors.

PRMT4 Is a Novel Coactivator of c-Myb-Dependent Transcription in Haematopoietic Cell Lines

PubMed Central

Berberich, Hannah; Zeller, Marc S.; Teichmann, Sophia; Adamkiewicz, Jürgen; Müller, Rolf; Klempnauer, Karl-Heinz; Bauer, Uta-Maria

2013-01-01

Protein arginine methyltransferase 4 (PRMT4)–dependent methylation of arginine residues in histones and other chromatin-associated proteins plays an important role in the regulation of gene expression. However, the exact mechanism of how PRMT4 activates transcription remains elusive. Here, we identify the chromatin remodeller Mi2α as a novel interaction partner of PRMT4. PRMT4 binds Mi2α and its close relative Mi2β, but not the other components of the repressive Mi2-containing NuRD complex. In the search for the biological role of this interaction, we find that PRMT4 and Mi2α/β interact with the transcription factor c-Myb and cooperatively coactivate c-Myb target gene expression in haematopoietic cell lines. This coactivation requires the methyltransferase and ATPase activity of PRMT4 and Mi2, respectively. Chromatin immunoprecipitation analysis shows that c-Myb target genes are direct transcriptional targets of PRMT4 and Mi2. Knockdown of PRMT4 or Mi2α/β in haematopoietic cells of the erythroid lineage results in diminished transcriptional induction of c-Myb target genes, attenuated cell growth and survival, and deregulated differentiation resembling the effects caused by c-Myb depletion. These findings reveal an important and so far unknown connection between PRMT4 and the chromatin remodeller Mi2 in c-Myb signalling. PMID:23505388

PRMT4 is a novel coactivator of c-Myb-dependent transcription in haematopoietic cell lines.

PubMed

Streubel, Gundula; Bouchard, Caroline; Berberich, Hannah; Zeller, Marc S; Teichmann, Sophia; Adamkiewicz, Jürgen; Müller, Rolf; Klempnauer, Karl-Heinz; Bauer, Uta-Maria

2013-01-01

Protein arginine methyltransferase 4 (PRMT4)-dependent methylation of arginine residues in histones and other chromatin-associated proteins plays an important role in the regulation of gene expression. However, the exact mechanism of how PRMT4 activates transcription remains elusive. Here, we identify the chromatin remodeller Mi2α as a novel interaction partner of PRMT4. PRMT4 binds Mi2α and its close relative Mi2β, but not the other components of the repressive Mi2-containing NuRD complex. In the search for the biological role of this interaction, we find that PRMT4 and Mi2α/β interact with the transcription factor c-Myb and cooperatively coactivate c-Myb target gene expression in haematopoietic cell lines. This coactivation requires the methyltransferase and ATPase activity of PRMT4 and Mi2, respectively. Chromatin immunoprecipitation analysis shows that c-Myb target genes are direct transcriptional targets of PRMT4 and Mi2. Knockdown of PRMT4 or Mi2α/β in haematopoietic cells of the erythroid lineage results in diminished transcriptional induction of c-Myb target genes, attenuated cell growth and survival, and deregulated differentiation resembling the effects caused by c-Myb depletion. These findings reveal an important and so far unknown connection between PRMT4 and the chromatin remodeller Mi2 in c-Myb signalling.

Hierarchical interactions between Fnr orthologs allows fine-tuning of transcription in response to oxygen in Herbaspirillum seropedicae

PubMed Central

Batista, Marcelo Bueno; Chandra, Govind; Monteiro, Rose Adele; de Souza, Emanuel Maltempi; Dixon, Ray

2018-01-01

Abstract Bacteria adjust the composition of their electron transport chain (ETC) to efficiently adapt to oxygen gradients. This involves differential expression of various ETC components to optimize energy generation. In Herbaspirillum seropedicae, reprogramming of gene expression in response to oxygen availability is controlled at the transcriptional level by three Fnr orthologs. Here, we characterised Fnr regulons using a combination of RNA-Seq and ChIP-Seq analysis. We found that Fnr1 and Fnr3 directly regulate discrete groups of promoters (Groups I and II, respectively), and that a third group (Group III) is co-regulated by both transcription factors. Comparison of DNA binding motifs between the three promoter groups suggests Group III promoters are potentially co-activated by Fnr3–Fnr1 heterodimers. Specific interaction between Fnr1 and Fnr3, detected in two-hybrid assays, was dependent on conserved residues in their dimerization interfaces, indicative of heterodimer formation in vivo. The requirements for co-activation of the fnr1 promoter, belonging to Group III, suggest either sequential activation by Fnr3 and Fnr1 homodimers or the involvement of Fnr3–Fnr1 heterodimers. Analysis of Fnr proteins with swapped activation domains provides evidence that co-activation by Fnr1 and Fnr3 at Group III promoters optimises interactions with RNA polymerase to fine-tune transcription in response to prevailing oxygen concentrations. PMID:29529262

Hierarchical interactions between Fnr orthologs allows fine-tuning of transcription in response to oxygen in Herbaspirillum seropedicae.

PubMed

Batista, Marcelo Bueno; Chandra, Govind; Monteiro, Rose Adele; de Souza, Emanuel Maltempi; Dixon, Ray

2018-05-04

Bacteria adjust the composition of their electron transport chain (ETC) to efficiently adapt to oxygen gradients. This involves differential expression of various ETC components to optimize energy generation. In Herbaspirillum seropedicae, reprogramming of gene expression in response to oxygen availability is controlled at the transcriptional level by three Fnr orthologs. Here, we characterised Fnr regulons using a combination of RNA-Seq and ChIP-Seq analysis. We found that Fnr1 and Fnr3 directly regulate discrete groups of promoters (Groups I and II, respectively), and that a third group (Group III) is co-regulated by both transcription factors. Comparison of DNA binding motifs between the three promoter groups suggests Group III promoters are potentially co-activated by Fnr3-Fnr1 heterodimers. Specific interaction between Fnr1 and Fnr3, detected in two-hybrid assays, was dependent on conserved residues in their dimerization interfaces, indicative of heterodimer formation in vivo. The requirements for co-activation of the fnr1 promoter, belonging to Group III, suggest either sequential activation by Fnr3 and Fnr1 homodimers or the involvement of Fnr3-Fnr1 heterodimers. Analysis of Fnr proteins with swapped activation domains provides evidence that co-activation by Fnr1 and Fnr3 at Group III promoters optimises interactions with RNA polymerase to fine-tune transcription in response to prevailing oxygen concentrations.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Li, Qun-Yi; Zhang, Meng; State Key Laboratory of Drug Research, Shanghai Institute of Materia Medica, Chinese Academy of Sciences, Shanghai

Selective antagonists of the glucocorticoid receptor (GR) are desirable for the treatment of hypercortisolemia associated with Cushing's syndrome, psychic depression, obesity, diabetes, neurodegenerative diseases, and glaucoma. NC3327, a non-steroidal small molecule with potent binding affinity to GR (K{sub i} = 13.2 nM), was identified in a high-throughput screening effort. As a full GR antagonist, NC3327 greatly inhibits the dexamethasone (Dex) induction of marker genes involved in hepatic gluconeogenesis, but has a minimal effect on matrix metalloproteinase 9 (MMP-9), a GR responsive pro-inflammatory gene. Interestingly, the compound recruits neither coactivators nor corepressors to the GR complex but competes with glucocorticoids formore » the interaction between GR and a coactivator peptide. Moreover, NC3327 does not trigger GR nuclear translocation, but significantly blocks Dex-induced GR transportation to the nucleus, and thus appears to be a 'competitive' GR antagonist. Therefore, the non-steroidal compound, NC3327, may represent a new class of GR antagonists as potential therapeutics for a variety of cortisol-related endocrine disorders.« less

CREB binding protein is required for both short-term and long-term memory formation.

PubMed

Chen, Guiquan; Zou, Xiaoyan; Watanabe, Hirotaka; van Deursen, Jan M; Shen, Jie

2010-09-29

CREB binding protein (CBP) is a transcriptional coactivator with histone acetyltransferase activity. Our prior study suggested that CBP might be a key target of presenilins in the regulation of memory formation and neuronal survival. To elucidate the role of CBP in the adult brain, we generated conditional knock-out (cKO) mice in which CBP is completely inactivated in excitatory neurons of the postnatal forebrain. Histological analysis revealed normal neuronal morphology and absence of age-dependent neuronal degeneration in the CBP cKO cerebral cortex. CBP cKO mice exhibited robust impairment in the formation of spatial, associative, and object-recognition memory. In addition to impaired long-term memory, CBP cKO mice also displayed deficits in short-term associative and object-recognition memory. Administration of a histone deacetylase inhibitor, trichostatin A, rescued the reduction of acetylated histones in the CBP cKO cortex but failed to rescue either short- or long-term memory deficits, suggesting that the memory impairment may not be caused by general reduction of histone acetyltransferase activity in CBP cKO mice. Further microarray and Western analysis showed decreased expression of calcium-calmodulin-dependent kinase isoforms and NMDA and AMPA receptor subunits in the cerebral cortex of CBP cKO mice. Collectively, these findings suggest a crucial role for CBP in the formation of both short- and long-term memory.

Tax relieves transcriptional repression by promoting histone deacetylase 1 release from the human T-cell leukemia virus type 1 long terminal repeat.

PubMed

Lu, Hanxin; Pise-Masison, Cynthia A; Linton, Rebecca; Park, Hyeon Ung; Schiltz, R Louis; Sartorelli, Vittorio; Brady, John N

2004-07-01

Expression of human T-cell leukemia virus type 1 (HTLV-1) is regulated by the viral transcriptional activator Tax. Tax activates viral transcription through interaction with the cellular transcription factor CREB and the coactivators CBP/p300. In this study, we have analyzed the role of histone deacetylase 1 (HDAC1) on HTLV-1 gene expression from an integrated template. First we show that trichostatin A, an HDAC inhibitor, enhances Tax expression in HTLV-1-transformed cells. Second, using a cell line containing a single-copy HTLV-1 long terminal repeat, we demonstrate that overexpression of HDAC1 represses Tax transactivation. Furthermore, a chromatin immunoprecipitation assay allowed us to analyze the interaction of transcription factors, coactivators, and HDACs with the basal and activated HTLV-1 promoter. We demonstrate that HDAC1 is associated with the inactive, but not the Tax-transactivated, HTLV-1 promoter. In vitro and in vivo glutathione S-transferase-Tax pull-down and coimmunoprecipitation experiments demonstrated that there is a direct physical association between Tax and HDAC1. Importantly, biotinylated chromatin pull-down assays demonstrated that Tax inhibits and/or dissociates the binding of HDAC1 to the HTLV-1 promoter. Our results provide evidence that Tax interacts directly with HDAC1 and regulates binding of the repressor to the HTLV-1 promoter.

Discriminating binding mechanisms of an intrinsically disordered protein via a multi-state coarse-grained model

NASA Astrophysics Data System (ADS)

Knott, Michael; Best, Robert B.

2014-05-01

Many proteins undergo a conformational transition upon binding to their cognate binding partner, with intrinsically disordered proteins (IDPs) providing an extreme example in which a folding transition occurs. However, it is often not clear whether this occurs via an "induced fit" or "conformational selection" mechanism, or via some intermediate scenario. In the first case, transient encounters with the binding partner favour transitions to the bound structure before the two proteins dissociate, while in the second the bound structure must be selected from a subset of unbound structures which are in the correct state for binding, because transient encounters of the incorrect conformation with the binding partner are most likely to result in dissociation. A particularly interesting situation involves those intrinsically disordered proteins which can bind to different binding partners in different conformations. We have devised a multi-state coarse-grained simulation model which is able to capture the binding of IDPs in alternate conformations, and by applying it to the binding of nuclear coactivator binding domain (NCBD) to either ACTR or IRF-3 we are able to determine the binding mechanism. By all measures, the binding of NCBD to either binding partner appears to occur via an induced fit mechanism. Nonetheless, we also show how a scenario closer to conformational selection could arise by choosing an alternative non-binding structure for NCBD.

The orphan nuclear receptor DAX-1 acts as a novel transcriptional corepressor of PPAR{gamma}

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kim, Gwang Sik; Lee, Gha Young; Nedumaran, Balachandar

2008-05-30

DAX-1 is an atypical nuclear receptor (NR) which functions primarily as a transcriptional corepressor of other NRs via heterodimerization. Peroxisome proliferator-activated receptor (PPAR) {gamma} is a ligand-dependent NR which performs a key function in adipogenesis. In this study, we evaluated a novel cross-talk mechanism between DAX-1 and PPAR{gamma}. Transient transfection assays demonstrated that DAX-1 inhibits the transactivity of PPAR{gamma} in a dose-dependent manner. DAX-1 directly competed with the PPAR{gamma} coactivator (PGC)-1{alpha} for binding to PPAR{gamma}. Endogenous levels of DAX-1 were significantly lower in differentiated 3T3-L1 adipocytes as compared to preadipocytes. Using a retroviral expression system, we demonstrated that DAX-1 overexpressionmore » downregulates the expression of PPAR{gamma} target genes, resulting in an attenuation of adipogenesis in 3T3-L1 cells. Our results suggest that DAX-1 acts as a corepressor of PPAR{gamma} and performs a potential function in the regulation of PPAR{gamma}-mediated cellular differentiation.« less

A novel CARD containing splice-isoform of CIITA regulates nitric oxide synthesis in dendritic cells.

PubMed

Huang, Dachuan; Lim, Sylvia; Chua, Rong Yuan Ray; Shi, Hong; Ng, Mah Lee; Wong, Siew Heng

2010-03-01

MHC class II expression is controlled mainly at transcriptional level by class II transactivator (CIITA), which is a non-DNA binding coactivator and serves as a master control factor for MHC class II genes expression. Here, we describe the function of a novel splice-isoform of CIITA, DC-expressed caspase inhibitory isoform of CIITA (or DC-CASPIC), and we show that the expression of DCCASPIC in DC is upregulated upon lipopolysaccharides (LPS) induction. DC-CASPIC localizes to mitochondria, and protein-protein interaction study demonstrates that DC-CASPIC interacts with caspases and inhibits its activity in DC. Consistently, DC-CASPIC suppresses caspases-induced degradation of nitric oxide synthase-2 (NOS2) and subsequently promotes the synthesis of nitric oxide (NO). NO is an essential regulatory molecule that modulates the capability of DC in stimulating T cell proliferation/activation in vitro; hence, overexpression of DC-CASPIC in DC enhances this stimulation. Collectively, our findings reveal that DC-CASPIC is a key molecule that regulates caspases activity and NO synthesis in DC.

Mechanisms of Hippo pathway regulation

PubMed Central

Meng, Zhipeng; Moroishi, Toshiro; Guan, Kun-Liang

2016-01-01

The Hippo pathway was initially identified in Drosophila melanogaster screens for tissue growth two decades ago and has been a subject extensively studied in both Drosophila and mammals in the last several years. The core of the Hippo pathway consists of a kinase cascade, transcription coactivators, and DNA-binding partners. Recent studies have expanded the Hippo pathway as a complex signaling network with >30 components. This pathway is regulated by intrinsic cell machineries, such as cell–cell contact, cell polarity, and actin cytoskeleton, as well as a wide range of signals, including cellular energy status, mechanical cues, and hormonal signals that act through G-protein-coupled receptors. The major functions of the Hippo pathway have been defined to restrict tissue growth in adults and modulate cell proliferation, differentiation, and migration in developing organs. Furthermore, dysregulation of the Hippo pathway leads to aberrant cell growth and neoplasia. In this review, we focus on recent developments in our understanding of the molecular actions of the core Hippo kinase cascade and discuss key open questions in the regulation and function of the Hippo pathway. PMID:26728553

Hippo Pathway: An Emerging Regulator of Craniofacial and Dental Development.

PubMed

Wang, J; Martin, J F

2017-10-01

The evolutionarily conserved Hippo signaling pathway is a vital regulator of organ size that fine-tunes cell proliferation, apoptosis, and differentiation. A number of important studies have revealed critical roles of Hippo signaling and its effectors Yap (Yes-associated protein) and Taz (transcriptional coactivator with PDZ binding motif) in tissue development, homeostasis, and regeneration, as well as in tumorigenesis. In addition, recent studies have shown evidence of crosstalk between the Hippo pathway and other key signaling pathways, such as Wnt signaling, that not only regulates developmental processes but also contributes to disease pathogenesis. In this review, we summarize the major discoveries in the field of Hippo signaling and what has been learned about its regulation and crosstalk with other signaling pathways, with a particular focus on recent findings involving the Hippo-Yap pathway in craniofacial and tooth development. New and exciting studies of the Hippo pathway are anticipated that will significantly improve our understanding of the molecular mechanisms of human craniofacial and tooth development and disease and will ultimately lead to the development of new therapies.

Human transcriptional coactivator with PDZ-binding motif (TAZ) is downregulated during decidualization.

PubMed

Strakova, Zuzana; Reed, Jennifer; Ihnatovych, Ivanna

2010-06-01

Transcriptional coactivator with PDZ-binding motif (TAZ) is known to bind to a variety of transcription factors to control cell differentiation and organ development. However, its role in uterine physiology has not yet been described. To study its regulation during the unique process of differentiation of fibroblasts into decidual cells (decidualization), we utilized the human uterine fibroblast (HuF) in vitro cell model. Immunocytochemistry data demonstrated that the majority of the TAZ protein is localized in the nucleus. Treatment of HuF cells with the embryonic stimulus cytokine interleukin 1 beta in the presence of steroid hormones (estradiol-17 beta and medroxyprogesterone acetate) for 13 days did not cause any apparent TAZ mRNA changes but resulted in a significant TAZ protein decline (approximately 62%) in total cell lysates. Analysis of cytosolic and nuclear extracts revealed that the decline of total TAZ was caused primarily by a drop of TAZ protein levels in the nucleus. TAZ was localized on the peroxisome proliferator-activated receptor response element site (located at position -1200 bp relative to the transcription start site) of the genomic region of decidualization marker insulin-like growth factor-binding protein 1 (IGFBP1) in HuF cells as detected by chromatin immunoprecipitation. TAZ is also present in human endometrium tissue as confirmed by immunohistochemistry. During the secretory phase of the menstrual cycle, specific TAZ staining particularly diminishes in the stroma, suggesting its participation during the decidualization process, as well as implantation. During early baboon pregnancy, TAZ protein expression remains minimal in the endometrium close to the implantation site. In summary, the presented evidence shows for the first time to date TAZ protein in the human uterine tract, its downregulation during in vitro decidualization, and its localization on the IGFBP1 promoter region, all of which indicate its presence in the uterine differentiation program during pregnancy.

Structure-Function Analysis of the Drosophila melanogaster Caudal Transcription Factor Provides Insights into Core Promoter-preferential Activation.

PubMed

Shir-Shapira, Hila; Sharabany, Julia; Filderman, Matan; Ideses, Diana; Ovadia-Shochat, Avital; Mannervik, Mattias; Juven-Gershon, Tamar

2015-07-10

Regulation of RNA polymerase II transcription is critical for the proper development, differentiation, and growth of an organism. The RNA polymerase II core promoter is the ultimate target of a multitude of transcription factors that control transcription initiation. Core promoters encompass the RNA start site and consist of functional elements such as the TATA box, initiator, and downstream core promoter element (DPE), which confer specific properties to the core promoter. We have previously discovered that Drosophila Caudal, which is a master regulator of genes involved in development and differentiation, is a DPE-specific transcriptional activator. Here, we show that the mouse Caudal-related homeobox (Cdx) proteins (mCdx1, mCdx2, and mCdx4) are also preferential core promoter transcriptional activators. To elucidate the mechanism that enables Caudal to preferentially activate DPE transcription, we performed structure-function analysis. Using a systematic series of deletion mutants (all containing the intact DNA-binding homeodomain) we discovered that the C-terminal region of Caudal contributes to the preferential activation of the fushi tarazu (ftz) Caudal target gene. Furthermore, the region containing both the homeodomain and the C terminus of Caudal was sufficient to confer core promoter-preferential activation to the heterologous GAL4 DNA-binding domain. Importantly, we discovered that Drosophila CREB-binding protein (dCBP) is a co-activator for Caudal-regulated activation of ftz. Strikingly, dCBP conferred the ability to preferentially activate the DPE-dependent ftz reporter to mini-Caudal proteins that were unable to preferentially activate ftz transcription themselves. Taken together, it is the unique combination of dCBP and Caudal that enables the co-activation of ftz in a core promoter-preferential manner. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

Reciprocal regulation of YAP/TAZ by the Hippo pathway and the Small GTPase pathway.

PubMed

Jang, Ju-Won; Kim, Min-Kyu; Bae, Suk-Chul

2018-04-20

Yes-associated protein 1 (YAP) and transcriptional co-activator with PDZ-binding motif (TAZ) (YAP/TAZ) are transcriptional coactivators that regulate genes involved in proliferation and transformation by interacting with DNA-binding transcription factors. Remarkably, YAP/TAZ are essential for cancer initiation or growth of most solid tumors. Their activation induces cancer stem cell attributes, proliferation, and metastasis. The oncogenic activity of YAP/TAZ is inhibited by the Hippo cascade, an evolutionarily conserved pathway that is governed by two kinases, mammalian Ste20-like kinases 1/2 (MST1/2) and Large tumor suppressor kinase 1/2 (LATS1/2), corresponding to Drosophila's Hippo (Hpo) and Warts (Wts), respectively. One of the most influential aspects of YAP/TAZ biology is that these factors are transducers of cell structural features, including polarity, shape, and cytoskeletal organization. In turn, these features are intimately related to the cell's ability to attach to other cells and to the surrounding extracellular matrix (ECM), and are also influenced by the cell's microenvironment. Thus, YAP/TAZ respond to changes that occur at the level of whole tissues. Notably, small GTPases act as master organizers of the actin cytoskeleton. Recent studies provided convincing genetic evidence that small GTPase signaling pathways activate YAP/TAZ, while the Hippo pathway inhibits them. Biochemical studies showed that small GTPases facilitate the YAP-Tea domain transcription factor (TEAD) interaction by inhibiting YAP phosphorylation in response to serum stimulation, while the Hippo pathway facilitates the YAP-RUNX3 interaction by increasing YAP phosphorylation. Therefore, small GTPase pathways activate YAP/TAZ by switching its DNA-binding transcription factors. In this review, we summarize the relationship between the Hippo pathway and small GTPase pathways in the regulation of YAP/TAZ.

Profiling of 3696 Nuclear Receptor-Coregulator Interactions: A Resource for Biological and Clinical Discovery.

PubMed

Broekema, Marjoleine F; Hollman, Danielle A A; Koppen, Arjen; van den Ham, Henk-Jan; Melchers, Diana; Pijnenburg, Dirk; Ruijtenbeek, Rob; van Mil, Saskia W C; Houtman, René; Kalkhoven, Eric

2018-06-01

Nuclear receptors (NRs) are ligand-inducible transcription factors that play critical roles in metazoan development, reproduction, and physiology and therefore are implicated in a broad range of pathologies. The transcriptional activity of NRs critically depends on their interaction(s) with transcriptional coregulator proteins, including coactivators and corepressors. Short leucine-rich peptide motifs in these proteins (LxxLL in coactivators and LxxxIxxxL in corepressors) are essential and sufficient for NR binding. With 350 different coregulator proteins identified to date and with many coregulators containing multiple interaction motifs, an enormous combinatorial potential is present for selective NR-mediated gene regulation. However, NR-coregulator interactions have often been determined experimentally on a one-to-one basis across diverse experimental conditions. In addition, NR-coregulator interactions are difficult to predict because the molecular determinants that govern specificity are not well established. Therefore, many biologically and clinically relevant NR-coregulator interactions may remain to be discovered. Here, we present a comprehensive overview of 3696 NR-coregulator interactions by systematically characterizing the binding of 24 nuclear receptors with 154 coregulator peptides. We identified unique ligand-dependent NR-coregulator interaction profiles for each NR, confirming many well-established NR-coregulator interactions. Hierarchical clustering based on the NR-coregulator interaction profiles largely recapitulates the classification of NR subfamilies based on the primary amino acid sequences of the ligand-binding domains, indicating that amino acid sequence is an important, although not the only, molecular determinant in directing and fine-tuning NR-coregulator interactions. This NR-coregulator peptide interactome provides an open data resource for future biological and clinical discovery as well as NR-based drug design.

Piperine activates human pregnane X receptor to induce the expression of cytochrome P450 3A4 and multidrug resistance protein 1

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wang, Yue-Ming; Lin, Wenwei; Chai, Sergio C.

2013-10-01

Activation of the pregnane X receptor (PXR) and subsequently its target genes, including those encoding drug transporters and metabolizing enzymes, while playing substantial roles in xenobiotic detoxification, might cause undesired drug-drug interactions. Recently, an increased awareness has been given to dietary components for potential induction of diet–drug interactions through activation of PXR. Here, we studied, whether piperine (PIP), a major component extracted from the widely-used daily spice black pepper, could induce PXR-mediated expression of cytochrome P450 3A4 (CYP3A4) and multidrug resistance protein 1 (MDR1). Our results showed that PIP activated human PXR (hPXR)-mediated CYP3A4 and MDR1 expression in human hepatocytes,more » intestine cells, and a mouse model; PIP activated hPXR by recruiting its coactivator SRC-1 in both cellular and cell-free systems; PIP bound to the hPXR ligand binding domain in a competitive ligand binding assay in vitro. The dichotomous effects of PIP on induction of CYP3A4 and MDR1 expression observed here and inhibition of their activity reported elsewhere challenges the potential use of PIP as a bioavailability enhancer and suggests that caution should be taken in PIP consumption during drug treatment in patients, particularly those who favor daily pepper spice or rely on certain pepper remedies. - Highlights: • Piperine induces PXR-mediated CYP3A4 and MDR1 expression. • Piperine activates PXR by binding to PXR and recruiting coactivator SRC-1. • Piperine induces PXR activation in vivo. • Caution should be taken in piperine consumption during drug treatment.« less

Bisphenol A alternatives bisphenol S and bisphenol F interfere with thyroid hormone signaling pathway in vitro and in vivo.

PubMed

Zhang, Yin-Feng; Ren, Xiao-Min; Li, Yuan-Yuan; Yao, Xiao-Fang; Li, Chuan-Hai; Qin, Zhan-Fen; Guo, Liang-Hong

2018-06-01

The wide use of the alternatives to bisphenol A (BPA) has raised concerns about their potential toxicities. Considering the disrupting activity of BPA on thyroid hormone (TH) signaling, we investigated whether bisphenol S (BPS) and bisphenol F (BPF), two leading alternatives, could interfere with TH signaling pathway using a series of assays in vitro and in vivo. In the fluorescence competitive binding assay, we found BPS and BPF, like BPA, bound to TH receptors (TRα and TRβ), with the binding potencies an order of magnitude lower than BPA (BPA > BPF > BPS). Molecular docking data also show their binding potencies to TRs. In the coactivator recruitment assay, BPS and BPF recruited coactivator to TRβ but not TRα, with weaker potencies than BPA. Correspondingly, agonistic actions of the three bisphenols in the absence or presence of T3 were observed in the TR-mediated reporter gene transcription assay. Also, all the three bisphenols induced TH-dependent GH3 cell proliferation, whereas BPA and BPF inhibited T3 induction in the presence of T3. As for in vivo assay, the three bisphenols like T3 induced TH-response gene transcription in Pelophylax nigromaculatus tadpoles, but in the presence of T3 altered T3-induced gene transcription in a biphasic concentration-response manner. These results for the first time demonstrate that BPS and BPF, like BPA, have potential to interfere with TH signaling pathway, i.e., they generally activate TH signaling in the absence of T3, but in the presence of TH, display agonistic or/and antagonistic actions under certain condition. Our study highlights the potential risks of BPS and BPF as BPA alternatives. Copyright © 2017 Elsevier Ltd. All rights reserved.

Exploring variations in functional connectivity of the resting state default mode network in mild traumatic brain injury.

PubMed

Nathan, Dominic E; Oakes, Terrence R; Yeh, Ping Hong; French, Louis M; Harper, Jamie F; Liu, Wei; Wolfowitz, Rachel D; Wang, Bin Quan; Graner, John L; Riedy, Gerard

2015-03-01

A definitive diagnosis of mild traumatic brain injury (mTBI) is difficult due to the absence of biomarkers in standard clinical imaging. The brain is a complex network of interconnected neurons and subtle changes can modulate key networks of cognitive function. The resting state default mode network (DMN) has been shown to be sensitive to changes induced by pathology. This study seeks to determine whether quantitative measures of the DMN are sensitive in distinguishing mTBI subjects. Resting state functional magnetic resonance imaging data were obtained for healthy (n=12) and mTBI subjects (n=15). DMN maps were computed using dual-regression Independent Component Analysis (ICA). A goodness-of-fit (GOF) index was calculated to assess the degree of spatial specificity and sensitivity between healthy controls and mTBI subjects. DMN regions and neuropsychological assessments were examined to identify potential relationships. The resting state DMN maps indicate an increase in spatial coactivity in mTBI subjects within key regions of the DMN. Significant coactivity within the cerebellum and supplementary motor areas of mTBI subjects were also observed. This has not been previously reported in seed-based resting state network analysis. The GOF suggested the presence of high variability within the mTBI subject group, with poor sensitivity and specificity. The neuropsychological data showed correlations between areas of coactivity within the resting state network in the brain with a number of measures of emotion and cognitive functioning. The poor performance of the GOF highlights the key challenge associated with mTBI injury: the high variability in injury mechanisms and subsequent recovery. However, the quantification of the DMN using dual-regression ICA has potential to distinguish mTBI from healthy subjects, and provide information on the relationship of aspects of cognitive and emotional functioning with their potential neural correlates.

Epstein-Barr virus-derived EBNA2 regulates STAT3 activation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Muromoto, Ryuta; Ikeda, Osamu; Okabe, Kanako

The Epstein-Barr virus (EBV)-encoded latency protein EBNA2 is a nuclear transcriptional activator that is essential for EBV-induced cellular transformation. Here, we show that EBNA2 interacts with STAT3, a signal transducer for an interleukin-6 family cytokine, and enhances the transcriptional activity of STAT3 by influencing its DNA-binding activity. Furthermore, EBNA2 cooperatively acts on STAT3 activation with LMP1. These data demonstrate that EBNA2 acts as a transcriptional coactivator of STAT3.

Obstructing Androgen Receptor Activation in Prostate Cancer Cells Through Post-translational Modification by NEDD8

DTIC Science & Technology

2012-11-01

FACS flow cytometer analysis . In addition, we will measure the steady state protein level of p53, p21, p27, and pRb. In the Jab1 silencing cell...affected by DHT treatment, and the endogenous AR level was not affected by Jab1 silencing. Interestingly, Western blot analysis of immunoprecipitated AR...Avantaggiati, and R. G. Pestell . 2003. Acetylation of androgen receptor enhances coactivator binding and promotes prostate cancer cell growth. Mol

Computational repositioning of ethno medicine elucidated gB-gH-gL complex as novel anti herpes drug target

PubMed Central

2013-01-01

Background Herpes viruses are important human pathogens that can cause mild to severe lifelong infections with high morbidity. They remain latent in the host cells and can cause recurrent infections that might prove fatal. These viruses are known to infect the host cells by causing the fusion of viral and host cell membrane proteins. Fusion is achieved with the help of conserved fusion machinery components, glycoproteins gB, heterodimer gH-gL complex along with other non-conserved components. Whereas, another important glycoprotein gD without which viral entry to the cell is not possible, acts as a co-activator for the gB-gH-gL complex formation. Thus, this complex formation interface is the most promising drug target for the development of novel anti-herpes drug candidates. In the present study, we propose a model for binding of gH-gL to gB glycoprotein leading from pre to post conformational changes during gB-gH-gL complex formation and reported the key residues involved in this binding activity along with possible binding site locations. To validate the drug targetability of our proposed binding site, we have repositioned some of the most promising in vitro, in vivo validated anti-herpes molecules onto the proposed binding site of gH-gL complex in a computational approach. Methods Hex 6.3 standalone software was used for protein-protein docking studies. Arguslab 4.0.1 and Accelrys® Discovery Studio 3.1 Visualizer softwares were used for semi-flexible docking studies and visualizing the interactions respectively. Protein receptors and ethno compounds were retrieved from Protein Data Bank (PDB) and Pubchem databases respectively. Lipinski’s Filter, Osiris Property Explorer and Lazar online servers were used to check the pharmaceutical fidelity of the drug candidates. Results Through protein-protein docking studies, it was identified that the amino acid residues VAL342, GLU347, SER349, TYR355, SER388, ASN395, HIS398 and ALA387 of gH-gL complex play an active role in its binding activity with gB. Semi flexible docking analysis of the most promising in vitro, in vivo validated anti-herpes molecules targeting the above mentioned key residues of gH-gL complex showed that all the analyzed ethno medicinal compounds have successfully docked into the proposed binding site of gH-gL glycoprotein with binding energy range between -10.4 to -6.4 K.cal./mol. Conclusions Successful repositioning of the analyzed compounds onto the proposed binding site confirms the drug targetability of gH-gL complex. Based on the free binding energy and pharmacological properties, we propose (3-chloro phenyl) methyl-3,4,5 trihydroxybenzoate as worth a small ethno medicinal lead molecule for further development as potent anti-herpes drug candidate targeting gB-gH-gL complex formation interface. PMID:23587166

Increased lower limb muscle coactivation reduces gait performance and increases metabolic cost in patients with hereditary spastic paraparesis.

PubMed

Rinaldi, Martina; Ranavolo, Alberto; Conforto, Silvia; Martino, Giovanni; Draicchio, Francesco; Conte, Carmela; Varrecchia, Tiwana; Bini, Fabiano; Casali, Carlo; Pierelli, Francesco; Serrao, Mariano

2017-10-01

The aim of this study was to investigate the lower limb muscle coactivation and its relationship with muscles spasticity, gait performance, and metabolic cost in patients with hereditary spastic paraparesis. Kinematic, kinetic, electromyographic and energetic parameters of 23 patients and 23 controls were evaluated by computerized gait analysis system. We computed ankle and knee antagonist muscle coactivation indexes throughout the gait cycle and during the subphases of gait. Energy consumption and energy recovery were measured as well. In addition to the correlation analysis between coactivation indexes and clinical variables, correlations between coactivation indexes and time-distance, kinematic, kinetic, and energetic parameters were estimated. Increased coactivity indexes of both knee and ankle muscles throughout the gait cycle and during the subphases of gait were observed in patients compared with controls. Energetic parameters were significantly higher in patients than in controls. Both knee and ankle muscle coactivation indexes were positively correlated with knee and ankle spasticity (Ashworth score), respectively. Knee and ankle muscle coactivation indexes were both positively correlated with energy consumption and both negatively correlated with energy recovery. Positive correlations between the Ashworth score and lower limb muscle coactivation suggest that abnormal lower limb muscle coactivation in patients with hereditary spastic paraparesis reflects a primary deficit linked to lower limb spasticity. Furthermore, these abnormalities influence the energetic mechanisms during walking. Identifying excessive muscle coactivation may be helpful in individuating the rehabilitative treatments and designing specific orthosis to restrain spasticity. Copyright © 2017 Elsevier Ltd. All rights reserved.

Complementary Phosphorylation Sites in the Adaptor Protein SLP-76 Promote Synergistic Activation of Natural Killer Cells

PubMed Central

Kim, Hun Sik; Long, Eric O.

2013-01-01

The cytotoxic effects of natural killer (NK) cells and their ability to secrete cytokines require the induction of synergistic signals from co-activation receptors, such as CD314 (NKG2D) and CD244 (2B4), which bind to ligands expressed on target cells. Synergy is required to overcome inhibition of the guanine nucleotide exchange factor (GEF) Vav1, a central regulator of NK cell activation, by the E3 ubiquitin ligase c-Cbl. However, the molecular basis for this synergy is unknown. Here, we showed that the adaptor protein Src homology 2 (SH2) domain–containing leukocyte phosphoprotein of 76 kD (SLP-76) was required for this synergy, and that distinct tyrosine residues in SLP-76 were phosphorylated by each receptor of a synergistic pair. Selective phosphorylation of tyrosine 113 or tyrosine 128 in SLP-76, each of which enables binding of SLP-76 to Vav1, was unique to receptors that stimulate ligand-dependent target cell killing, because antibody-dependent stimulation by Fc receptor CD16 promoted phosphorylation at both sites. Knockdown and reconstitution experiments with SLP-76 showed the distinct role of each tyrosine in the synergistic mobilization of Ca2+, revealing an unexpected degree of selectivity in the phosphorylation of SLP-76 by NK cell co-activation receptors. Together, these data suggest that complementation of separate phospho-tyrosine targets in SLP-76 forms the basis of synergistic NK cell activation. PMID:22786724

Complementary phosphorylation sites in the adaptor protein SLP-76 promote synergistic activation of natural killer cells.

PubMed

Kim, Hun Sik; Long, Eric O

2012-07-10

The cytotoxic effects of natural killer (NK) cells and their ability to secrete cytokines require synergistic signals from specific pairs of co-activation receptors, such as CD314 (also known as NKG2D) and CD244 (2B4), which bind to distinct ligands present on target cells. These signals are required to overcome inhibition mediated by the E3 ubiquitin ligase c-Cbl of the guanine nucleotide exchange factor Vav1, which promotes activation of NK cells. Here, we showed that the adaptor protein SLP-76 (Src homology 2 domain-containing leukocyte phosphoprotein of 76 kilodaltons) was required for this synergy and that distinct tyrosine residues in SLP-76 were phosphorylated by each member of a pair of synergistic receptors. Selective phosphorylation of tyrosine 113 or tyrosine 128 in SLP-76 enabled binding of SLP-76 to Vav1. Selective phosphorylation of SLP-76 at these residues was restricted to receptors that stimulated ligand-dependent target cell killing; antibody-dependent stimulation of the Fc receptor CD16 promoted phosphorylation at both sites. Knockdown and reconstitution experiments with SLP-76 mutant proteins showed the distinct role of each tyrosine in the synergistic mobilization of Ca2+, revealing an unexpected degree of selectivity in the phosphorylation of SLP-76 by NK cell co-activation receptors. Together, these data suggest that combined phosphorylation of separate tyrosine residues in SLP-76 forms the basis of synergistic NK cell activation.

Ras signaling requires dynamic properties of Ets1 for phosphorylation-enhanced binding to coactivator CBP.

PubMed

Nelson, Mary L; Kang, Hyun-Seo; Lee, Gregory M; Blaszczak, Adam G; Lau, Desmond K W; McIntosh, Lawrence P; Graves, Barbara J

2010-06-01

Ras/MAPK signaling is often aberrantly activated in human cancers. The downstream effectors are transcription factors, including those encoded by the ETS gene family. Using cell-based assays and biophysical measurements, we have determined the mechanism by which Ras/MAPK signaling affects the function of Ets1 via phosphorylation of Thr38 and Ser41. These ERK2 phosphoacceptors lie within the unstructured N-terminal region of Ets1, immediately adjacent to the PNT domain. NMR spectroscopic analyses demonstrated that the PNT domain is a four-helix bundle (H2-H5), resembling the SAM domain, appended with two additional helices (H0-H1). Phosphorylation shifted a conformational equilibrium, displacing the dynamic helix H0 from the core bundle. The affinity of Ets1 for the TAZ1 (or CH1) domain of the coactivator CBP was enhanced 34-fold by phosphorylation, and this binding was sensitive to ionic strength. NMR-monitored titration experiments mapped the interaction surfaces of the TAZ1 domain and Ets1, the latter encompassing both the phosphoacceptors and PNT domain. Charge complementarity of these surfaces indicate that electrostatic forces act in concert with a conformational equilibrium to mediate phosphorylation effects. We conclude that the dynamic helical elements of Ets1, appended to a conserved structural core, constitute a phospho-switch that directs Ras/MAPK signaling to downstream changes in gene expression. This detailed structural and mechanistic information will guide strategies for targeting ETS proteins in human disease.

Eating habits modulate short term memory and epigenetical regulation of brain derived neurotrophic factor in hippocampus of low- and high running capacity rats.

PubMed

Torma, Ferenc; Bori, Zoltan; Koltai, Erika; Felszeghy, Klara; Vacz, Gabriella; Koch, Lauren; Britton, Steven; Boldogh, Istvan; Radak, Zsolt

2014-08-01

Exercise capacity and dietary restriction (DR) are linked to improved quality of life, including enhanced brain function and neuro-protection. Brain derived neurotrophic factor (BDNF) is one of the key proteins involved in the beneficial effects of exercise on brain. Low capacity runner (LCR) and high capacity runner (HCR) rats were subjected to DR in order to investigate the regulation of BDNF. HCR-DR rats out-performed other groups in a passive avoidance test. BDNF content increased significantly in the hippocampus of HCR-DR groups compared to control groups (p<0.05). The acetylation of H3 increased significantly only in the LCR-DR group. However, chip-assay revealed that the specific binding between acetylated histone H3 and BNDF promoter was increased in both LCR-DR and HCR-DR groups. In spite of these increases in binding, at the transcriptional level only, the LCR-DR group showed an increase in BDNF mRNA content. Additionally, DR also induced the activity of cAMP response element-binding protein (CREB), while the content of SIRT1 was not altered. Peroxisome proliferator-activated receptor gamma coactivator-1 alpha (PGC-1α) was elevated in HCR-DR groups. But, based on the levels of nuclear respiratory factor-1 and cytocrome c oxidase, it appears that DR did not cause mitochondrial biogenesis. The data suggest that DR-mediated induction of BDNF levels includes chromatin remodeling. Moreover, DR does not induce mitochondrial biogenesis in the hippocampus of LCR/HCR rats. DR results in different responses to a passive avoidance test, and BDNF regulation in LCR and HCR rats. Copyright © 2014 Elsevier Inc. All rights reserved.

A NMDA receptor glycine site partial agonist, GLYX-13, simultaneously enhances LTP and reduces LTD at Schaffer collateral-CA1 synapses in hippocampus.

PubMed

Zhang, Xiao-lei; Sullivan, John A; Moskal, Joseph R; Stanton, Patric K

2008-12-01

N-methyl-D-aspartate glutamate receptors (NMDARs) are a key route for Ca2+ influx into neurons important to both activity-dependent synaptic plasticity and, when uncontrolled, triggering events that cause neuronal degeneration and death. Among regulatory binding sites on the NMDAR complex is a glycine binding site, distinct from the glutamate binding site, which must be co-activated for NMDAR channel opening. We developed a novel glycine site partial agonist, GLYX-13, which is both nootropic and neuroprotective in vivo. Here, we assessed the effects of GLYX-13 on long-term synaptic plasticity and NMDAR transmission at Schaffer collateral-CA1 synapses in hippocampal slices in vitro. GLYX-13 simultaneously enhanced the magnitude of long-term potentiation (LTP) of synaptic transmission, while reducing long-term depression (LTD). GLYX-13 reduced NMDA receptor-mediated synaptic currents in CA1 pyramidal neurons evoked by low frequency Schaffer collateral stimulation, but enhanced NMDAR currents during high frequency bursts of activity, and these actions were occluded by a saturating concentration of the glycine site agonist d-serine. Direct two-photon imaging of Schaffer collateral burst-evoked increases in [Ca2+] in individual dendritic spines revealed that GLYX-13 selectively enhanced burst-induced NMDAR-dependent spine Ca2+ influx. Examining the rate of MK-801 block of synaptic versus extrasynaptic NMDAR-gated channels revealed that GLYX-13 selectively enhanced activation of burst-driven extrasynaptic NMDARs, with an action that was blocked by the NR2B-selective NMDAR antagonist ifenprodil. Our data suggest that GLYX-13 may have unique therapeutic potential as a learning and memory enhancer because of its ability to simultaneously enhance LTP and suppress LTD.

HOXB7 and Hsa-miR-222 as the Potential Therapeutic Candidates for Metastatic Colorectal Cancer.

PubMed

Iman, Maryam; Mostafavi, Seyede Samaneh; Arab, Seyed Shahriar; Azimzadeh, Sadegh; Poorebrahim, Mansour

2016-01-01

Recent studies have shown that the high mortality of patients with colorectal cancer (CRC) is related to its ability to spread the surrounding tissues, thus there is a need for designing and developing new drugs. Here, we proposed a combinational therapy strategy, an inhibitory peptide in combination with miRNA targeting, for modulating CRC metastasis. In this study, some of the recent patents were also reviewed. After data analysis with GEO2R and gene annotation using DAVID server, regulatory interactions of differentially expressed genes (DEGs) were obtained from STRING, GeneMANIA, KEGG and TRED databases. In parallel, the corresponding validated microRNAs (miRNAs) were obtained from mirDIP web server and a miRNA-DEG regulatory network was also reconstructed. Clustering and topological analyses of the regulatory networks were performed using Cytoscape plug-ins. We found the HOXB family as the most important functional complex in DEG-derived regulatory network. Accordingly, an anti-HOXB7 peptide was designed based on the binding interface of its coactivator, PBX1. Topological analysis of miRNA-DEG network indicated that hsa-miR-222 is one of the most important oncomirs involved in regulation of DEGs activities. Thus, this miRNA, along with HOXB7, was also considered as the potential target for inhibiting CRC metastasis. Molecular docking studies exhibited that the designed peptide can bind to desired binding pocket of HOXB7 in a highaffinity manner. Further confirmations were also observed in Molecular dynamics (MD) simulations carried out by GROMACS v5.0.2 simulation package. In conclusion, our findings suggest that simultaneous targeting of key regulatory genes and miRNAs may be a useful strategy for prevention of CRC metastasis.

Differential effects of clinically used derivatives and metabolites of artemisinin in the activation of constitutive androstane receptor isoforms

PubMed Central

Burk, O; Piedade, R; Ghebreghiorghis, L; Fait, JT; Nussler, AK; Gil, JP; Windshügel, B; Schwab, M

2012-01-01

BACKGROUND AND PURPOSE Widespread resistance to antimalarial drugs requires combination therapies with increasing risk of pharmacokinetic drug–drug interactions. Here, we explore the capacity of antimalarial drugs to induce drug metabolism via activation of constitutive androstane receptors (CAR) by ligand binding. EXPERIMENTAL APPROACH A total of 21 selected antimalarials and 11 major metabolites were screened for binding to CAR isoforms using cellular and in vitro CAR-coactivator interaction assays, combined with in silico molecular docking. Identified ligands were further characterized by cell-based assays and primary human hepatocytes were used to elucidate induction of gene expression. KEY RESULTS Only two artemisinin derivatives arteether and artemether, the metabolite deoxyartemisinin and artemisinin itself demonstrated agonist binding to the major isoforms CAR1 and CAR3, while arteether and artemether were also inverse agonists of CAR2. Dihydroartemisinin and artesunate acted as weak inverse agonists of CAR1. While arteether showed the highest activities in vitro, it was less active than artemisinin in inducing hepatic CYP3A4 gene expression in hepatocytes. CONCLUSIONS AND IMPLICATIONS Artemisinin derivatives and metabolites differentially affect the activities of CAR isoforms and of the pregnane X receptor (PXR). This negates a common effect of these drugs on CAR/PXR-dependent induction of drug metabolism and further provides an explanation for artemisinin consistently inducing cytochrome P450 genes in vivo, whereas arteether and artemether do not. All these drugs are metabolized very rapidly, but only artemisinin is converted to an enzyme-inducing metabolite. For better understanding of pharmacokinetic drug–drug interaction possibilities, the inducing properties of artemisinin metabolites should be considered. PMID:22577882

Metabolic actions of estrogen receptor beta (ERbeta) are mediated by a negative cross-talk with PPARgamma.

PubMed

Foryst-Ludwig, Anna; Clemenz, Markus; Hohmann, Stephan; Hartge, Martin; Sprang, Christiane; Frost, Nikolaj; Krikov, Maxim; Bhanot, Sanjay; Barros, Rodrigo; Morani, Andrea; Gustafsson, Jan-Ake; Unger, Thomas; Kintscher, Ulrich

2008-06-27

Estrogen receptors (ER) are important regulators of metabolic diseases such as obesity and insulin resistance (IR). While ERalpha seems to have a protective role in such diseases, the function of ERbeta is not clear. To characterize the metabolic function of ERbeta, we investigated its molecular interaction with a master regulator of insulin signaling/glucose metabolism, the PPARgamma, in vitro and in high-fat diet (HFD)-fed ERbeta -/- mice (betaERKO) mice. Our in vitro experiments showed that ERbeta inhibits ligand-mediated PPARgamma-transcriptional activity. That resulted in a blockade of PPARgamma-induced adipocytic gene expression and in decreased adipogenesis. Overexpression of nuclear coactivators such as SRC1 and TIF2 prevented the ERbeta-mediated inhibition of PPARgamma activity. Consistent with the in vitro data, we observed increased PPARgamma activity in gonadal fat from HFD-fed betaERKO mice. In consonance with enhanced PPARgamma activation, HFD-fed betaERKO mice showed increased body weight gain and fat mass in the presence of improved insulin sensitivity. To directly demonstrate the role of PPARgamma in HFD-fed betaERKO mice, PPARgamma signaling was disrupted by PPARgamma antisense oligonucleotide (ASO). Blockade of adipose PPARgamma by ASO reversed the phenotype of betaERKO mice with an impairment of insulin sensitization and glucose tolerance. Finally, binding of SRC1 and TIF2 to the PPARgamma-regulated adiponectin promoter was enhanced in gonadal fat from betaERKO mice indicating that the absence of ERbeta in adipose tissue results in exaggerated coactivator binding to a PPARgamma target promoter. Collectively, our data provide the first evidence that ERbeta-deficiency protects against diet-induced IR and glucose intolerance which involves an augmented PPARgamma signaling in adipose tissue. Moreover, our data suggest that the coactivators SRC1 and TIF2 are involved in this interaction. Impairment of insulin and glucose metabolism by ERbeta may have significant implications for our understanding of hormone receptor-dependent pathophysiology of metabolic diseases, and may be essential for the development of new ERbeta-selective agonists.

Tristetraprolin Represses Estrogen Receptor α Transactivation in Breast Cancer Cells*

PubMed Central

Barrios-García, Tonatiuh; Tecalco-Cruz, Angeles; Gómez-Romero, Vania; Reyes-Carmona, Sandra; Meneses-Morales, Iván; León-Del-Río, Alfonso

2014-01-01

Estrogen receptor α (ERα) mediates the effects of 17β-estradiol (E2) in normal mammary gland, and it is a key participant in breast cancer tumor development. ERα transactivation activity is mediated by the synergistic interaction of two domains designated AF1 and AF2. The function of AF2 is to recruit coactivator and corepressor proteins that allow ERα to oscillate between the roles of transcriptional activator and repressor. In contrast, the mechanism responsible for AF-1 transcriptional activity is not completely understood. In this study, we identified tristetraproline (TTP) as a novel ERα-associated protein. TTP expression in MCF7 cells repressed ERα transactivation and reduced MCF7 cell proliferation and the ability of the cells to form tumors in a mouse model. We show that TTP transcriptional activity is mediated through its recruitment to the promoter region of ERα target genes and its interaction with histone deacetylases, in particular with HDAC1. TTP expression attenuates the coactivating activity of SRC-1, suggesting that exchange between TTP and other coactivators may play an important role in fine-tuning ERα transactivation. These results indicate that TTP acts as a bona fide ERα corepressor and suggest that this protein may be a contributing factor in the development of E2-dependent tumors in breast cancer. PMID:24737323

Peroxisome proliferator-activated receptor gamma coactivator-1 alpha acts as a tumor suppressor in hepatocellular carcinoma.

PubMed

Liu, Rui; Zhang, Haiyang; Zhang, Yan; Li, Shuang; Wang, Xinyi; Wang, Xia; Wang, Cheng; Liu, Bin; Zen, Ke; Zhang, Chen-Yu; Zhang, Chunni; Ba, Yi

2017-04-01

Peroxisome proliferator-activated receptor gamma coactivator-1 alpha plays a crucial role in regulating the biosynthesis of mitochondria, which is closely linked to the energy metabolism in various tumors. This study investigated the regulatory role of peroxisome proliferator-activated receptor gamma coactivator-1 alpha in the pathogenesis of hepatocellular carcinoma. In this study, the changes of peroxisome proliferator-activated receptor gamma coactivator-1 alpha messenger RNA levels between normal human liver and hepatocellular carcinoma tissue were examined by quantitative reverse transcription polymerase chain reaction. Knockdown of peroxisome proliferator-activated receptor gamma coactivator-1 alpha was conducted by RNA interference in the human liver cell line L02, while overexpression of peroxisome proliferator-activated receptor gamma coactivator-1 alpha was conducted by adenovirus encoding peroxisome proliferator-activated receptor gamma coactivator-1 alpha complementary DNA in the human hepatocarcinoma cell line HepG2. Cellular morphological changes were observed via optical and electron microscopy. Cellular apoptosis was determined by Hoechst 33258 staining. In addition, the expression levels of 21,400 genes in tissues and cells were detected by microarray. It was shown that peroxisome proliferator-activated receptor gamma coactivator-1 alpha expression was significantly downregulated in hepatocellular carcinoma compared with normal liver tissues. After knockdown of peroxisome proliferator-activated receptor gamma coactivator-1 alpha expression in L02 cells, cells reverted to immature and dedifferentiated morphology exhibiting cancerous tendency. Apoptosis occurred in the HepG2 cells after transfection by adenovirus encoding peroxisome proliferator-activated receptor gamma coactivator-1 alpha. Microarray analysis showed consistent results. The results suggest that peroxisome proliferator-activated receptor gamma coactivator-1 alpha acts as a tumor suppressor in the formation and development of hepatocellular carcinoma and that peroxisome proliferator-activated receptor gamma coactivator-1 alpha may be a potential therapeutic target for hepatocellular carcinoma.

P300/CBP acts as a coactivator to cartilage homeoprotein-1 (Cart1), paired-like homeoprotein, through acetylation of the conserved lysine residue adjacent to the homeodomain.

PubMed

Iioka, Takashi; Furukawa, Keizo; Yamaguchi, Akira; Shindo, Hiroyuki; Yamashita, Shunichi; Tsukazaki, Tomoo

2003-08-01

The paired-like homeoprotein, Cart1, is involved in skeletal development. We describe here that the general coactivator p300/CBP controls the transcription activity of Cart1 through acetylation of a lysine residue that is highly conserved in other homeoproteins. Acetylation of this residue increases the interaction between p300/CBP and Cart1 and enhances its transcriptional activation. Cart1 encodes a paired-like homeoprotein expressed selectively in chondrocyte lineage during embryonic development. Although its target gene remains unknown, gene disruption studies have revealed that Cart1 plays an important role for craniofacial bone formation as well as limb development by cooperating with another homeoprotein, Alx4. In this report, we study the functional involvement of p300/CBP, coactivators with intrinsic histone acetyltransferase (HAT) activity, in the transcriptional control of Cart1. To study the transcription activity of Cart1, a reporter construct containing a putative Cart1 binding site was transiently transfected with the expression vectors of each protein. The interaction between p300/CBP and Cart1 was investigated by glutathione S-transferase (GST) pull-down, yeast two-hybrid, and immunoprecipitation assays. In vitro acetylation assay was performed with the recombinant p300-HAT domain and Cart1 in the presence of acetyl-CoA. p300 and CBP stimulate Cart1-dependent transcription activity, and this transactivation is inhibited by E1A and Tax, oncoproteins that suppress the activity of p300/CBP. Cart1 binds to p300 in vivo and in vitro, and this requires the homeodomain of Cart 1 and N-terminal 139 amino acids of p300. Confocal microscopy analysis shows that Cart1 recruits overexpressed and endogenous p300 to a Cart1-specific subnuclear compartment. Cart1 is acetylated in vivo and sodium butyrate and trichostatin A, histone deacetylase inhibitors, markedly enhance the transcription activity of Cart1. Deletion and mutagenesis analysis identifies the 131st lysine that locates immediately adjacent to the homeodomain as a target of p300-HAT, and a point mutation to this residue attenuates the binding affinity to p300 as well as p300-dependent transcription activity. Together, these results indicate that p300/CBP acts as a cotransactivator to Cart1 through a direct interaction and specific lysine acetylation. In addition, because 131st lysine is highly conserved in other types of homeoprotein, this lysine may be a common target for HAT of p300/CBP for these proteins.

MED12 Regulates HSC-Specific Enhancers Independently of Mediator Kinase Activity to Control Hematopoiesis.

PubMed

Aranda-Orgilles, Beatriz; Saldaña-Meyer, Ricardo; Wang, Eric; Trompouki, Eirini; Fassl, Anne; Lau, Stephanie; Mullenders, Jasper; Rocha, Pedro P; Raviram, Ramya; Guillamot, María; Sánchez-Díaz, María; Wang, Kun; Kayembe, Clarisse; Zhang, Nan; Amoasii, Leonela; Choudhuri, Avik; Skok, Jane A; Schober, Markus; Reinberg, Danny; Sicinski, Piotr; Schrewe, Heinrich; Tsirigos, Aristotelis; Zon, Leonard I; Aifantis, Iannis

2016-12-01

Hematopoietic-specific transcription factors require coactivators to communicate with the general transcription machinery and establish transcriptional programs that maintain hematopoietic stem cell (HSC) self-renewal, promote differentiation, and prevent malignant transformation. Mediator is a large coactivator complex that bridges enhancer-localized transcription factors with promoters, but little is known about Mediator function in adult stem cell self-renewal and differentiation. We show that MED12, a member of the Mediator kinase module, is an essential regulator of HSC homeostasis, as in vivo deletion of Med12 causes rapid bone marrow aplasia leading to acute lethality. Deleting other members of the Mediator kinase module does not affect HSC function, suggesting kinase-independent roles of MED12. MED12 deletion destabilizes P300 binding at lineage-specific enhancers, resulting in H3K27Ac depletion, enhancer de-activation, and consequent loss of HSC stemness signatures. As MED12 mutations have been described recently in blood malignancies, alterations in MED12-dependent enhancer regulation may control both physiological and malignant hematopoiesis. Copyright © 2016 Elsevier Inc. All rights reserved.

Vitamin E tocotrienols improve insulin sensitivity through activating peroxisome proliferator-activated receptors.

PubMed

Fang, Fang; Kang, Zhanfang; Wong, Chiwai

2010-03-01

Vitamin E is comprised of two classes of compounds: tocopherols and tocotrienols. Tocotrienol-enriched palm oil has been shown to help reduce blood glucose levels in patients and preclinical animal models. However, the mechanistic basis for tocotrienol action is not well established. Peroxisome proliferator-activated receptors alpha, gamma, and delta (PPARalpha, PPARgamma, and PPARdelta) are ligand-regulated transcription factors that play essential roles in energy metabolism. Importantly, synthetic PPARalpha and PPARgamma ligands are currently used for treating hyperlipidemia and diabetes. In this study, we present data that tocotrienols within palm oil functioned as PPAR modulators. Specifically, both alpha- and gamma-tocotrienol activated PPARalpha, while delta-tocotrienol activated PPARalpha, PPARgamma, and PPARdelta in reporter-based assays. Tocotrienols enhanced the interaction between the purified ligand-binding domain of PPARalpha with the receptor-interacting motif of coactivator PPARgamma coactivator-1alpha. In addition, the tocotrienol-rich fraction of palm oil improved whole body glucose utilization and insulin sensitivity of diabetic Db/Db mice by selectively regulating PPAR target genes. These lines of evidence collectively suggested that PPARs represent a set of molecular targets of tocotrienols.

An energetic orphan in an endocrine tissue: a revised perspective of the function of estrogen receptor-related receptor alpha in bone and cartilage.

PubMed

Bonnelye, Edith; Aubin, Jane E

2013-02-01

Estrogen receptor-related receptor alpha (ERRα) is an orphan nuclear receptor with sequence homology to the estrogen receptors, ERα/β, but it does not bind estrogen. ERRα not only plays a functional role in osteoblasts but also in osteoclasts and chondrocytes. In addition, the ERRs, including ERRα, can be activated by coactivators such as peroxisome proliferator-activated receptor-gamma coactivator-1 (PGC1α and β) and are implicated in adipogenesis, fatty acid oxidation, and oxidative stress defense, suggesting that ERRα-through its activity in bone resorption and adipogenesis--may regulate the insulin and leptin pathways and contribute to aging-related changes in bone and cartilage. In this review, we discuss data on ERRα and its cellular and molecular modes of action, which have broad implications for considering the potential role of this orphan receptor in cartilage and bone endocrine function, on whole-organism physiology, and in the bone aging process. Copyright © 2013 American Society for Bone and Mineral Research.

Hepatic CREB3L3 controls whole-body energy homeostasis and improves obesity and diabetes.

PubMed

Nakagawa, Yoshimi; Satoh, Aoi; Yabe, Sachiko; Furusawa, Mika; Tokushige, Naoko; Tezuka, Hitomi; Mikami, Motoki; Iwata, Wakiko; Shingyouchi, Akiko; Matsuzaka, Takashi; Kiwata, Shiori; Fujimoto, Yuri; Shimizu, Hidehisa; Danno, Hirosuke; Yamamoto, Takashi; Ishii, Kiyoaki; Karasawa, Tadayoshi; Takeuchi, Yoshinori; Iwasaki, Hitoshi; Shimada, Masako; Kawakami, Yasushi; Urayama, Osamu; Sone, Hirohito; Takekoshi, Kazuhiro; Kobayashi, Kazuto; Yatoh, Shigeru; Takahashi, Akimitsu; Yahagi, Naoya; Suzuki, Hiroaki; Yamada, Nobuhiro; Shimano, Hitoshi

2014-12-01

Transcriptional regulation of metabolic genes in the liver is the key to maintaining systemic energy homeostasis during starvation. The membrane-bound transcription factor cAMP-responsive element-binding protein 3-like 3 (CREB3L3) has been reported to be activated during fasting and to regulate triglyceride metabolism. Here, we show that CREB3L3 confers a wide spectrum of metabolic responses to starvation in vivo. Adenoviral and transgenic overexpression of nuclear CREB3L3 induced systemic lipolysis, hepatic ketogenesis, and insulin sensitivity with increased energy expenditure, leading to marked reduction in body weight, plasma lipid levels, and glucose levels. CREB3L3 overexpression activated gene expression levels and plasma levels of antidiabetic hormones, including fibroblast growth factor 21 and IGF-binding protein 2. Amelioration of diabetes by hepatic activation of CREB3L3 was also observed in several types of diabetic obese mice. Nuclear CREB3L3 mutually activates the peroxisome proliferator-activated receptor (PPAR) α promoter in an autoloop fashion and is crucial for the ligand transactivation of PPARα by interacting with its transcriptional regulator, peroxisome proliferator-activated receptor gamma coactivator-1α. CREB3L3 directly and indirectly controls fibroblast growth factor 21 expression and its plasma level, which contributes at least partially to the catabolic effects of CREB3L3 on systemic energy homeostasis in the entire body. Therefore, CREB3L3 is a therapeutic target for obesity and diabetes.

Functional organization of human subgenual cortical areas: Relationship between architectonical segregation and connectional heterogeneity.

PubMed

Palomero-Gallagher, Nicola; Eickhoff, Simon B; Hoffstaedter, Felix; Schleicher, Axel; Mohlberg, Hartmut; Vogt, Brent A; Amunts, Katrin; Zilles, Karl

2015-07-15

Human subgenual anterior cingulate cortex (sACC) is involved in affective experiences and fear processing. Functional neuroimaging studies view it as a homogeneous cortical entity. However, sACC comprises several distinct cyto- and receptorarchitectonical areas: 25, s24, s32, and the ventral portion of area 33. Thus, we hypothesized that the areas may also be connectionally and functionally distinct. We performed structural post mortem and functional in vivo analyses. We computed probabilistic maps of each area based on cytoarchitectonical analysis of ten post mortem brains. Maps, publicly available via the JuBrain atlas and the Anatomy Toolbox, were used to define seed regions of task-dependent functional connectivity profiles and quantitative functional decoding. sACC areas presented distinct co-activation patterns within widespread networks encompassing cortical and subcortical regions. They shared common functional domains related to emotion, perception and cognition. A more specific analysis of these domains revealed an association of s24 with sadness, and of s32 with fear processing. Both areas were activated during taste evaluation, and co-activated with the amygdala, a key node of the affective network. s32 co-activated with areas of the executive control network, and was associated with tasks probing cognition in which stimuli did not have an emotional component. Area 33 was activated by painful stimuli, and co-activated with areas of the sensorimotor network. These results support the concept of a connectional and functional specificity of the cyto- and receptorarchitectonically defined areas within the sACC, which can no longer be seen as a structurally and functionally homogeneous brain region. Copyright © 2015 Elsevier Inc. All rights reserved.

Cytosolic iron chaperones: Proteins delivering iron cofactors in the cytosol of mammalian cells.

PubMed

Philpott, Caroline C; Ryu, Moon-Suhn; Frey, Avery; Patel, Sarju

2017-08-04

Eukaryotic cells contain hundreds of metalloproteins that are supported by intracellular systems coordinating the uptake and distribution of metal cofactors. Iron cofactors include heme, iron-sulfur clusters, and simple iron ions. Poly(rC)-binding proteins are multifunctional adaptors that serve as iron ion chaperones in the cytosolic/nuclear compartment, binding iron at import and delivering it to enzymes, for storage (ferritin) and export (ferroportin). Ferritin iron is mobilized by autophagy through the cargo receptor, nuclear co-activator 4. The monothiol glutaredoxin Glrx3 and BolA2 function as a [2Fe-2S] chaperone complex. These proteins form a core system of cytosolic iron cofactor chaperones in mammalian cells. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

Regulation of the Hippo Pathway Transcription Factor TEAD.

PubMed

Lin, Kimberly C; Park, Hyun Woo; Guan, Kun-Liang

2017-11-01

The TEAD transcription factor family is best known for transcriptional output of the Hippo signaling pathway and has been implicated in processes such as development, cell growth and proliferation, tissue homeostasis, and regeneration. Our understanding of the functional importance of TEADs has increased dramatically since its initial discovery three decades ago. The majority of our knowledge of TEADs is in the context of Hippo signaling as nuclear DNA-binding proteins passively activated by Yes-associated protein (YAP) and transcriptional activator with PDZ-binding domain (TAZ), transcription coactivators downstream of the Hippo pathway. However, recent studies suggest that TEAD itself is actively regulated. Here, we highlight evidence demonstrating Hippo-independent regulation of TEADs and the potential impacts these studies may have on new cancer therapeutics. Copyright © 2017 Elsevier Ltd. All rights reserved.

The high mobility group protein 1 enhances binding of the estrogen receptor DNA binding domain to the estrogen response element.

PubMed

Romine, L E; Wood, J R; Lamia, L A; Prendergast, P; Edwards, D P; Nardulli, A M

1998-05-01

We have examined the ability of the high-mobility group protein 1 (HMG1) to alter binding of the estrogen receptor DNA-binding domain (DBD) to the estrogen response element (ERE). HMG1 dramatically enhanced binding of purified, bacterially expressed DBD to the consensus vitellogenin A2 ERE in a dose-dependent manner. The ability of HMG1 to stabilize the DBD-ERE complex resulted in part from a decrease in the dissociation rate of the DBD from the ERE. Antibody supershift experiments demonstrated that HMG1 was also capable of forming a ternary complex with the ERE-bound DBD in the presence of HMG1-specific antibody. HMG1 did not substantially affect DBD-ERE contacts as assessed by methylation interference assays, nor did it alter the ability of the DBD to induce distortion in ERE-containing DNA fragments. Because HMG1 dramatically enhanced estrogen receptor DBD binding to the ERE, and the DBD is the most highly conserved region among the nuclear receptor superfamily members, HMG1 may function to enhance binding of other nuclear receptors to their respective response elements and act in concert with coactivator proteins to regulate expression of hormone-responsive genes.

Characterization of a SUMO Ligase that is Essential for DNA Damage-Induced NF-Kappa B Activation

DTIC Science & Technology

2008-03-01

DNA damage. Oncogene 18, 2261 – 2271. 80 Jung , M., Zhang, Y., Lee, S. and Dritschilo, A. (1995) Correction of radiation sensitivity in ataxia...telangiectasia cells by a truncated I kappaB-alpha. Science 268, 1619 – 1621. 81 Lee, S. J., Dimtchev, A., Lavin,M. F., Dritschilo, A. and Jung , M. (1998) A...CREB-binding protein/p300 are transcriptional coactivators of p65. Proc. Natl. Acad. Sci. USA 94, 2927 – 2932. 98 Kuo , H. Y., Chang, C. C., Jeng, J. C

Toward a New Chemotherapy for Breast Cancer: Structural and Functional Mechanism of the Retinoid Receptors Addressed by a Novel Computer Approach

DTIC Science & Technology

2002-01-01

the surface of the receptor. This pocket is the target for several known and unknown coactivator proteins, which bind the LBD through a conserved LxxLL...was and to Not se FLKAILN) and the LBDs of several receptors (TRo was used as an example in prisingly, the LBD of TR13 was also found to interact with...receptors. 541 ATTCCTTAAAGCCATTTTAAACTGAGGCATTAAGAAGAAATGCACTCACCATGAGCACCA The LBDs of several nuclear receptors were examined for FL. K. A • 1,...N

Peroxisome proliferator-activated receptor (PPAR)-binding protein (PBP) but not PPAR-interacting protein (PRIP) is required for nuclear translocation of constitutive androstane receptor in mouse liver.

PubMed

Guo, Dongsheng; Sarkar, Joy; Ahmed, Mohamed R; Viswakarma, Navin; Jia, Yuzhi; Yu, Songtao; Sambasiva Rao, M; Reddy, Janardan K

2006-08-25

The constitutive androstane receptor (CAR) regulates transcription of phenobarbital-inducible genes that encode xenobiotic-metabolizing enzymes in liver. CAR is localized to the hepatocyte cytoplasm but to be functional, it translocates into the nucleus in the presence of phenobarbital-like CAR ligands. We now demonstrate that adenovirally driven EGFP-CAR, as expected, translocates into the nucleus of normal wild-type hepatocytes following phenobarbital treatment under both in vivo and in vitro conditions. Using this approach we investigated the role of transcription coactivators PBP and PRIP in the translocation of EGFP-CAR into the nucleus of PBP and PRIP liver conditional null mouse hepatocytes. We show that coactivator PBP is essential for nuclear translocation of CAR but not PRIP. Adenoviral expression of both PBP and EGFP-CAR restored phenobarbital-mediated nuclear translocation of exogenously expressed CAR in PBP null livers in vivo and in PBP null primary hepatocytes in vitro. CAR translocation into the nucleus of PRIP null livers resulted in the induction of CAR target genes such as CYP2B10, necessary for the conversion of acetaminophen to its hepatotoxic intermediate metabolite, N-acetyl-p-benzoquinone imine. As a consequence, PRIP-deficiency in liver did not protect from acetaminophen-induced hepatic necrosis, unlike that exerted by PBP deficiency. These results establish that transcription coactivator PBP plays a pivotal role in nuclear localization of CAR, that it is likely that PBP either enhances nuclear import or nuclear retention of CAR in hepatocytes, and that PRIP is redundant for CAR function.

Co-activation: its association with weakness and specific neurological pathology

PubMed Central

Busse, Monica E; Wiles, Charles M; van Deursen, Robert WM

2006-01-01

Background Net agonist muscle strength is in part determined by the degree of antagonist co-activation. The level of co-activation might vary in different neurological disorders causing weakness or might vary with agonist strength. Aim This study investigated whether antagonist co-activation changed a) with the degree of muscle weakness and b) with the nature of the neurological lesion causing weakness. Methods Measures of isometric quadriceps and hamstrings strength were obtained. Antagonist (hamstring) co-activation during knee extension was calculated as a ratio of hamstrings over quadriceps activity both during an isometric and during a functional sit to stand (STS) task (using kinematics) in groups of patients with extrapyramidal (n = 15), upper motor neuron (UMN) (n = 12), lower motor neuron (LMN) with (n = 18) or without (n = 12) sensory loss, primary muscle or neuromuscular junction disorder (n = 17) and in healthy matched controls (n = 32). Independent t-tests or Mann Witney U tests were used to compare between the groups. Correlations between variables were also investigated. Results In healthy subjects mean (SD) co-activation of hamstrings during isometric knee extension was 11.8 (6.2)% and during STS was 20.5 (12.9)%. In patients, co-activation ranged from 7 to 17% during isometric knee extension and 15 to 25% during STS. Only the extrapyramidal group had lower co-activation levels than healthy matched controls (p < 0.05). Agonist isometric muscle strength and co-activation correlated only in muscle disease (r = -0.6, p < 0.05) and during STS in UMN disorders (r = -0.7, p < 0.5). Conclusion It is concluded that antagonist co-activation does not systematically vary with the site of neurological pathology when compared to healthy matched controls or, in most patient groups, with strength. The lower co-activation levels found in the extrapyramidal group require confirmation and further investigation. Co-activation may be relevant to individuals with muscle weakness. Within patient serial studies in the presence of changing muscle strength may help to understand these relationships more clearly. PMID:17116259

Structural basis for the versatile interactions of Smad7 with regulator WW domains in TGF-β pathways

PubMed Central

Aragón, Eric; Goerner, Nina; Xi, Qiaoran; Gomes, Tiago; Gao, Sheng; Massagué, Joan; Macias, Maria J.

2012-01-01

Summary TGF-β and BMP signaling is mediated by Smads 1–5 (R-Smads and Co-Smads) and inhibited by Smad7, a major hub of regulation of TGF-β and BMP receptors by negative feedback and antagonistic signals. The transcription coactivator YAP and the E3 ubiquitin ligases Smurf1/2 and Nedd4L target R-Smads for activation or degradation, respectively. Pairs of WW domain in these regulators bind PY motifs and adjacent CDK/MAPK and GSK3 phosphorylation sites in R-Smads in a selective and regulated manner. In contrast, here we show that Smad7 binds YAP, Smurf1, Smurf2 and Nedd4L constitutively, the binding involving a PY motif in Smad7 and no phosphorylation. We also provide a structural basis for how regulators that use WW domain pairs for selective interactions with R-Smads, resort to one single versatile WW domain for binding Smad7 to centralize regulation in the TGF-β and BMP pathways. PMID:22921829

The association between antagonist hamstring coactivation and episodes of knee joint shifting and buckling

PubMed Central

Segal, N.A.; Nevitt, M.C.; Welborn, R.D.; Nguyen, U.-S.D.T.; Niu, J.; Lewis, C.E.; Felson, D.T.; Frey-Law, L.

2016-01-01

SUMMARY Objective Hamstring coactivation during quadriceps activation is necessary to counteract the quadriceps pull on the tibia, but coactivation can be elevated with symptomatic knee osteoarthritis (OA). To guide rehabilitation to attenuate risk for mobility limitations and falls, this study evaluated whether higher antagonistic open kinetic chain hamstring coactivation is associated with knee joint buckling (sudden loss of support) and shifting (a sensation that the knee might give way). Design At baseline, median hamstring coactivation was assessed during maximal isokinetic knee extensor strength testing and at baseline and 24-month follow-up, knee buckling and shifting was self-reported. Associations between tertiles of co-activation and knee (1) buckling, (2) shifting and (3) either buckling or shifting were assessed using logistic regression, adjusted for age, sex, knee OA and pain. Results 1826 participants (1089 women) were included. Mean ± SD age was 61.7 ± 7.7 years, BMI was 30.3 ± 5.5 kg/m2 and 38.2% of knees had OA. There were no consistent statistically significant associations between hamstring coactivation and ipsilateral prevalent or incident buckling or the combination of buckling and shifting. The odds ratios for incident shifting in the highest in comparison with the lowest tertile of coactivation had similar magnitudes in the combined and medial hamstrings, but only reached statistical significance for lateral hamstring coactivation, OR(95%CI) 1.53 (0.99, 2.36). Conclusions Hamstring coactivation during an open kinetic chain quadriceps exercise was not consistently associated with prevalent or incident self-reported knee buckling or shifting in older adults with or at risk for knee OA. PMID:25765501

Effect of higher muscle coactivation on standing postural response to perturbation in older adults.

PubMed

Nagai, Koutatsu; Okita, Yusuke; Ogaya, Shinya; Tsuboyama, Tadao

2017-04-01

Although several studies have reported that muscle coactivation during postural control increases with age, the effect of higher muscle coactivation on standing postural response to perturbation is unknown. To investigate whether higher muscle coactivation affects standing postural response to perturbation in older adults. Thirty-four community-dwelling older participants were randomly assigned either to the coactivation group (CG), where muscle coactivation was increased intentionally, or to the non-coactivation group (NCG). The participants were instructed to stand on a force plate that moved forward or backward. Electromyography data were collected from the lower leg muscles. We requested the participants in the CG to increase the activity of their tibialis anterior, and to maintain this posture during the tasks. We moved the force plate with a constant amplitude and velocity, and measured kinematic data with a camera during the tasks. During forward transfer, the knee extension and hip flexion decreased in the CG after perturbation compared to NCG, and the trunk extension angle increased. The center of pressure (COP) displacement decreased around the peak of the movement in the CG compared to NCG. During backward transfer, ankle dorsal and knee flexion changed after perturbation in the CG compared to NCG. Our study found that higher muscle coactivation inhibits lower limb and COP movement as well as increases trunk tilt and the risk for falls during forward perturbations. Postural control with higher coactivation appears to be inefficient for maintaining balance during the backward sway of posture.

ω-3 PUFAs ameliorate liver fibrosis and inhibit hepatic stellate cells proliferation and activation by promoting YAP/TAZ degradation.

PubMed

Zhang, Kun; Chang, Yanan; Shi, Zhemin; Han, Xiaohui; Han, Yawei; Yao, Qingbin; Hu, Zhimei; Cui, Hongmei; Zheng, Lina; Han, Tao; Hong, Wei

2016-07-20

Elevated levels of the transcriptional regulators Yes-associated protein (YAP) and transcriptional coactivators with PDZ-binding motif (TAZ), key effectors of the Hippo pathway, have been shown to play essential roles in controlling liver cell fate and the activation of hepatic stellate cells (HSCs). The dietary intake of omega-3 polyunsaturated fatty acids (ω-3 PUFAs) has been positively associated with a number of health benefits including prevention and reduction of cardiovascular diseases, inflammation and cancers. However, little is known about the impact of ω-3 PUFAs on liver fibrosis. In this study, we used CCl4-induced liver fibrosis mouse model and found that YAP/TAZ is over-expressed in the fibrotic liver and activated HSCs. Fish oil administration to the model mouse attenuates CCl4-induced liver fibrosis. Further study revealed that ω-3 PUFAs down-regulate the expression of pro-fibrogenic genes in activated HSCs and fibrotic liver, and the down-regulation is mediated via YAP, thus identifying YAP as a target of ω-3 PUFAs. Moreover, ω-3 PUFAs promote YAP/TAZ degradation in a proteasome-dependent manner. Our data have identified a mechanism of ω-3 PUFAs in ameliorating liver fibrosis.

Effects of High Velocity Elastic Band versus Heavy Resistance Training on Hamstring Strength, Activation, and Sprint Running Performance

PubMed Central

Janusevicius, Donatas; Snieckus, Audrius; Skurvydas, Albertas; Silinskas, Viktoras; Trinkunas, Eugenijus; Cadefau, Joan Aureli; Kamandulis, Sigitas

2017-01-01

Hamstring muscle injuries occur during high-speed activities, which suggests that muscular strength at high velocities may be more important than maximal strength. This study examined hamstring adaptations to training for maximal strength and for strength at high velocities. Physically active men (n = 25; age, 23.0 ± 3.2 years) were randomly divided into: (1) a resistance training (RT, n = 8) group, which performed high-load, low-velocity concentric–eccentric hamstring contractions; (2) a resistance training concentric (RTC; n = 9) group, which performed high-load, low-velocity concentric-only hamstring contractions; and (3) a high-velocity elastic band training (HVT, n = 8) group, which performed low-load, high-velocity concentric–eccentric hamstring contractions. Pre- and posttraining tests included hamstring strength on a hamstring-curl apparatus, concentric knee extension–flexion at 60°/s, 240°/s, and 450°/s, eccentric knee flexion at 60°/s and 240°/s, hamstring and quadriceps coactivation, knee flexion and extension frequency in the prone position, and 30-m sprint running speed from a stationary start and with a running start. Knee flexor torque increased significantly by 21.1% ± 8.1% in the RTC group and 16.2% ± 4.2% in the RT group (p < 0.05 for both groups). Hamstring coactivation decreased significantly in both groups. In the HVT group, knee flexion and extension frequency increased by 17.8% ± 8.2%, concentric peak torque of the knee flexors at 450°/s increased by 31.0% ± 12.0%, hamstring coactivation decreased, and running performance over 30 m improved (p < 0.05 for all parameters). These findings suggest that resistance training at high velocities is superior to traditional heavy resistance training for increasing knee flexor strength at high velocities, movement frequency, and sprint running performance. These findings also indicate that traditional training approaches are effective for increasing knee flexor strength and reducing knee extensor coactivation, but this outcome is limited to low and moderate speeds. Key points Resistance training performed at high load and low velocities increases knee flexor strength and decreases hamstring coactivation, whereas does not change strength at high velocity. Elastic band training at high velocities increases strength and decreases hamstring coactivation, particularly at high muscle velocities. Elastic band hamstring training at high velocities has positive effects on both knee flexors and knee extensors, and these benefits transfer positively to sprint performance. PMID:28630577

Muscle Co-activation: Definitions, Mechanisms, and Functions.

PubMed

Latash, Mark L

2018-03-28

The phenomenon of agonist-antagonist muscle co-activation is discussed with respect to its consequences for movement mechanics (such as increasing joint apparent stiffness, facilitating faster movements, and effects on action stability), implication for movement optimization, and involvement of different neurophysiological structures. Effects of co-activation on movement stability are ambiguous and depend on the effector representing a kinematic chain with a fixed origin or free origin. Further, co-activation is discussed within the framework of the equilibrium-point hypothesis and the idea of hierarchical control with spatial referent coordinates. Relations of muscle co-activation to changes in one of the basic commands, the c-command, are discussed and illustrated. A hypothesis is suggested that agonist-antagonist co-activation reflects a deliberate neural control strategy to preserve effector-level control and avoid making it degenerate and facing the necessity to control at the level of signals to individual muscles. This strategy, in particular, allows stabilizing motor actions by co-varied adjustments in spaces of control variables. This hypothesis is able to account for higher levels of co-activation in young healthy persons performing challenging tasks and across various populations with movement impairments.

Targeting YAP/TAZ-TEAD protein-protein interactions using fragment-based and computational modeling approaches

PubMed Central

Verma, Chandra

2017-01-01

The Hippo signaling pathway, which is implicated in the regulation of organ size, has emerged as a potential target for the development of cancer therapeutics. YAP, TAZ (transcription co-activators) and TEAD (transcription factor) are the downstream transcriptional machinery and effectors of the pathway. Formation of the YAP/TAZ-TEAD complex leads to transcription of growth-promoting genes. Conversely, disrupting the interactions of the complex decreases cell proliferation. Herein, we screened a 1000-member fragment library using Thermal Shift Assay and identified a hit fragment. We confirmed its binding at the YAP/TAZ-TEAD interface by X-ray crystallography, and showed that it occupies the same hydrophobic pocket as a conserved phenylalanine of YAP/TAZ. This hit fragment serves as a scaffold for the development of compounds that have the potential to disrupt YAP/TAZ-TEAD interactions. Structure-activity relationship studies and computational modeling were also carried out to identify more potent compounds that may bind at this validated druggable binding site. PMID:28570566

Direct interactions of OCA-B and TFII-I regulate immunoglobulin heavy-chain gene transcription by facilitating enhancer-promoter communication.

PubMed

Ren, Xiaodi; Siegel, Rachael; Kim, Unkyu; Roeder, Robert G

2011-05-06

B cell-specific coactivator OCA-B, together with Oct-1/2, binds to octamer sites in promoters and enhancers to activate transcription of immunoglobulin (Ig) genes, although the mechanisms underlying their roles in enhancer-promoter communication are unknown. Here, we demonstrate a direct interaction of OCA-B with transcription factor TFII-I, which binds to DICE elements in Igh promoters, that affects transcription at two levels. First, OCA-B relieves HDAC3-mediated Igh promoter repression by competing with HDAC3 for binding to promoter-bound TFII-I. Second, and most importantly, Igh 3' enhancer-bound OCA-B and promoter-bound TFII-I mediate promoter-enhancer interactions, in both cis and trans, that are important for Igh transcription. These and other results reveal an important function for OCA-B in Igh 3' enhancer function in vivo and strongly favor an enhancer mechanism involving looping and facilitated factor recruitment rather than a tracking mechanism. Copyright © 2011 Elsevier Inc. All rights reserved.

Direct interactions of OCA-B and TFII-I regulate immunoglobulin heavy-chain gene transcription by facilitating enhancer-promoter communication

PubMed Central

Ren, Xiaodi; Siegel, Rachael; Kim, Unkyu; Roeder, Robert G.

2011-01-01

Summary B cell-specific coactivator OCA-B, together with Oct-1/2, binds to octamer sites in promoters and enhancers to activate transcription of immunoglobulin (Ig) genes, although the mechanisms underlying their roles in enhancer-promoter communication are unknown. Here, we demonstrate a direct interaction of OCA-B with transcription factor TFII-I, which binds to DICE elements in IgH promoters, that affects transcription at two levels. First, OCA-B relieves HDAC3-mediated IgH promoter repression by competing with HDAC3 for binding to promoter-bound TFII-I. Second, and most importantly, Igh 3′enhancer-bound OCA-B and promoter-bound TFII-I mediate promoter-enhancer interactions, in both cis and trans, that are important for Igh transcription. These and other results reveal an important function for OCA-B in Igh 3′enhancer function in vivo and strongly favor an enhancer mechanism involving looping and facilitated factor recruitment rather than a tracking mechanism. PMID:21549311

Architecture of the RNA polymerase II-Mediator core initiation complex.

PubMed

Plaschka, C; Larivière, L; Wenzeck, L; Seizl, M; Hemann, M; Tegunov, D; Petrotchenko, E V; Borchers, C H; Baumeister, W; Herzog, F; Villa, E; Cramer, P

2015-02-19

The conserved co-activator complex Mediator enables regulated transcription initiation by RNA polymerase (Pol) II. Here we reconstitute an active 15-subunit core Mediator (cMed) comprising all essential Mediator subunits from Saccharomyces cerevisiae. The cryo-electron microscopic structure of cMed bound to a core initiation complex was determined at 9.7 Å resolution. cMed binds Pol II around the Rpb4-Rpb7 stalk near the carboxy-terminal domain (CTD). The Mediator head module binds the Pol II dock and the TFIIB ribbon and stabilizes the initiation complex. The Mediator middle module extends to the Pol II foot with a 'plank' that may influence polymerase conformation. The Mediator subunit Med14 forms a 'beam' between the head and middle modules and connects to the tail module that is predicted to bind transcription activators located on upstream DNA. The Mediator 'arm' and 'hook' domains contribute to a 'cradle' that may position the CTD and TFIIH kinase to stimulate Pol II phosphorylation.

Activation of Basal Gluconeogenesis by Coactivator p300 Maintains Hepatic Glycogen Storage

PubMed Central

Cao, Jia; Meng, Shumei; Ma, Anlin; Radovick, Sally; Wondisford, Fredric E.

2013-01-01

Because hepatic glycogenolysis maintains euglycemia during early fasting, proper hepatic glycogen synthesis in the fed/postprandial states is critical. It has been known for decades that gluconeogenesis is essential for hepatic glycogen synthesis; however, the molecular mechanism remains unknown. In this report, we show that depletion of hepatic p300 reduces glycogen synthesis, decreases hepatic glycogen storage, and leads to relative hypoglycemia. We previously reported that insulin suppressed gluconeogenesis by phosphorylating cAMP response element binding protein-binding protein (CBP) at S436 and disassembling the cAMP response element-binding protein-CBP complex. However, p300, which is closely related to CBP, lacks the corresponding S436 phosphorylation site found on CBP. In a phosphorylation-competent p300G422S knock-in mouse model, we found that mutant mice exhibited reduced hepatic glycogen content and produced significantly less glycogen in a tracer incorporation assay in the postprandial state. Our study demonstrates the important and unique role of p300 in glycogen synthesis through maintaining basal gluconeogenesis. PMID:23770612

Recruitment of CREB1 and Histone Deacetylase 2 (HDAC2) to the Mouse Ltbp-1 Promoter Regulates its Constitutive Expression in a Dioxin Receptor-dependent Manner

PubMed Central

Gomez-Duran, Aurea; Ballestar, Esteban; Carvajal-Gonzalez, Jose M.; Marlowe, Jennifer L.; Puga, Alvaro; Esteller, Manel; Fernandez-Salguero, Pedro M.

2010-01-01

Latent TGFβ-binding protein 1 (LTBP-1) is a key regulator of TGFβ targeting and activation in the extracellular matrix. LTBP-1 is recognized as a major docking molecule to localize, and possibly to activate, TGFβ in the extracellular matrix. Despite this relevant function, the molecular mechanisms regulating Ltbp-1 transcription remain largely unknown. Previous results from our laboratory revealed that mouse embryonic fibroblasts (MEF) lacking dioxin receptor (AhR) had increased Ltbp-1 mRNA expression and elevated TGFβ activity, suggesting that AhR repressed Ltbp-1 transcription. Here, we have cloned the mouse Ltbp-1 gene promoter and analysed its mechanism of transcriptional repression by AhR. Reporter gene assays, AhR over-expression and site-directed mutagenesis showed that basal Ltbp-1 transcription is AhR-dependent. Chromatin immunoprecipitation (ChIP) and RNA interference (RNAi) revealed that AhR regulates Ltbp-1 transcription by a mechanism involving recruitment of co-activators such as CREB1 and co-repressors such as HDAC2 to the Ltbp-1 promoter. In AhR-expressing (AhR+/+) MEF cells, the recruitment of HDAC1, 2 and 4 correlated with decreased K8H4 acetylation and impaired binding of pCREBSer133 to the Ltbp-1 promoter, likely maintaining a constitutive repressed state. AhR−/− MEF cells had the opposite pattern of HDACs and pCREB1Ser133 binding to Ltbp-1 promoter, and therefore, over-expressed Ltbp-1 mRNA. In agreement, siRNA for HDAC2 increased Ltbp-1 expression and K8H4 acetylation in AhR+/+ but not in AhR−/− MEF cells. We suggest that HDAC2 binding keeps Ltbp-1 promoter repressed in AhR+/+ MEF cells, whereas in AhR-null MEF cells the absence of HDAC2 and the binding of pCREBSer133 allow Ltbp-1 transcription. Thus, epigenetics can contribute to constitutive Ltbp-1 repression by a mechanism requiring AhR activity. PMID:18508077

Differential transcriptional activation by human T-cell leukemia virus type 1 Tax mutants is mediated by distinct interactions with CREB binding protein and p300.

PubMed

Bex, F; Yin, M J; Burny, A; Gaynor, R B

1998-04-01

The human T-cell leukemia virus type 1 Tax protein transforms human T lymphocytes, which can lead to the development of adult T-cell leukemia. Tax transformation is related to its ability to activate gene expression via the ATF/CREB and the NF-kappaB pathways. Transcriptional activation of these pathways is mediated by the actions of the related coactivators CREB binding protein (CBP) and p300. In this study, immunocytochemistry and confocal microscopy were used to localize CBP and p300 in cells expressing wild-type Tax or Tax mutants that are able to selectively activate gene expression from either the NF-kappaB or ATF/CREB pathway. Wild-type Tax colocalized with both CBP and p300 in nuclear bodies which also contained ATF-1 and the RelA subunit of NF-kappaB. However, a Tax mutant that selectively activates gene expression from only the ATF/CREB pathway colocalized with CBP but not p300, while a Tax mutant that selectively activates gene expression from only the NF-kappaB pathway colocalized with p300 but not CBP. In vitro and in vivo protein interaction studies indicated that the integrity of two independent domains of Tax delineated by these mutants was involved in the direct interaction of Tax with either CBP or p300. These studies are consistent with a model in which activation of either the NF-kappaB or the ATF/CREB pathway by specific Tax mutants is mediated by distinct interactions with related coactivator proteins.

Mutations of glucocorticoid receptor differentially affect AF2 domain activity in a steroid-selective manner to alter the potency and efficacy of gene induction and repression†

PubMed Central

Tao, Yong-guang; Xu, Yong; Xu, H. Eric; Simons, S. Stoney

2009-01-01

The transcriptional activity of steroid hormones is intimately associated with their structure. Deacylcortivazol (DAC) contains several features that were predicted to make it an inactive glucocorticoid. Nevertheless, gene induction and repression by complexes of glucocorticoid receptor (GR) with DAC occurs with greater potency (lower EC50) than, and equal efficacy (maximal activity, or Amax) to, the very active and smaller synthetic glucocorticoid dexamethasone (Dex). Guided by a recent x-ray structure of DAC bound to the GR ligand binding domain (LBD), we now report that several point mutants in the LBD have little effect on the binding of either agonist steroid. However, these same mutations dramatically alter the Amax and/or EC50 of exogenous and endogenous genes in a manner that depends on steroid structure. In some cases, Dex is no longer a full agonist. These properties appear to result from a preferential inactivation of the AF2 activation domain in the GR LBD of Dex-, but not DAC-, bound receptors. The Dex-bound receptors display normal binding to, but greatly reduced response to, the coactivator TIF2, thus indicating a defect in the transmission efficiency of GR-steroid complex information to the coactivator TIF2. In addition, all GR mutants that are active in gene induction with either Dex or DAC have greatly reduced activity in gene repression. This contrasts with the reports of GR mutations preferentially suppressing GR-mediated induction. The properties of these GR mutants in gene induction support the hypothesis that the Amax and EC50 of GR-controlled gene expression can be independently modified, indicate that the receptor can be modified to favor activity with a specific agonist steroid, and suggest that new ligands with suitable substituents may be able to affect the same LBD conformational changes and thereby broaden the therapeutic applications of glucocorticoid steroids PMID:18578507

A selective peroxisome proliferator-activated receptor-gamma modulator, telmisartan, binds to the receptor in a different fashion from thiazolidinediones.

PubMed

Tagami, Tetsuya; Yamamoto, Hiroyuki; Moriyama, Kenji; Sawai, Kuniko; Usui, Takeshi; Shimatsu, Akira; Naruse, Mitsuhide

2009-02-01

Angiotensin type 1 receptor blockers are widely used for the treatment of hypertension, and one angiotensin type 1 receptor blocker, telmisartan, specifically activates the peroxisome proliferator-activated receptor (PPAR)-gamma. We studied the impact of PPARgamma mutants on transcriptional control and interaction with cofactors to elucidate differences in the molecular mechanism between telmisartan and other PPARgamma agonists, thiazolidinediones (TZDs). We created several amino acid substitutions in the ligand binding domain of PPARgamma that, based on molecular modeling, may affect the binding of these agents. In transient expression experiments, wild-type PPARgamma-mediated transcription stimulated by telmisartan was more than one third of that stimulated by TZDs. The activation stimulated by TZDs was impaired, whereas activation stimulated by telmisartan was retained, in the H323Y, S342A, and H449A mutants. In the Y473A mutant, the TZD-induced activation was further impaired and lower than that of telmisartan-induced activation. Coexpression of coactivators enhanced the activation by both telmisartan and TZDs, but activation by telmisartan always exceeded that of TZDs in the Y473A mutant. Based on a mammalian two-hybrid assay, the interaction with corepressors was retained in Y473A. Telmisartan and TZDs, but not 9cis retinoic acid, dissociated corepressors from the wild-type PPARgamma. Telmisartan most effectively dissociated corepressors from Y473A. The interaction with coactivators was enhanced by TZD activation of wild-type PPARgamma and both telmisartan and TZD activation of Y473A. Thus, the Y473A mutant is selectively stimulated by telmisartan but not TZDs, suggesting that telmisartan and TZDs have differential effects on the transcriptional control. In conclusion, these PPARgamma mutants could be powerful tools for developing novel therapeutic agents that retain the metabolic efficacy of PPARgamma activation with fewer adverse effects, such as the increase in body weight associated with TZDs.

Structural Analysis on the Pathologic Mutant Glucocorticoid Receptor Ligand-Binding Domains.

PubMed

Hurt, Darrell E; Suzuki, Shigeru; Mayama, Takafumi; Charmandari, Evangelia; Kino, Tomoshige

2016-02-01

Glucocorticoid receptor (GR) gene mutations may cause familial or sporadic generalized glucocorticoid resistance syndrome. Most of the missense forms distribute in the ligand-binding domain and impair its ligand-binding activity and formation of the activation function (AF)-2 that binds LXXLL motif-containing coactivators. We performed molecular dynamics simulations to ligand-binding domain of pathologic GR mutants to reveal their structural defects. Several calculated parameters including interaction energy for dexamethasone or the LXXLL peptide indicate that destruction of ligand-binding pocket (LBP) is a primary character. Their LBP defects are driven primarily by loss/reduction of the electrostatic interaction formed by R611 and T739 of the receptor to dexamethasone and a subsequent conformational mismatch, which deacylcortivazol resolves with its large phenylpyrazole moiety and efficiently stimulates transcriptional activity of the mutant receptors with LBP defect. Reduced affinity of the LXXLL peptide to AF-2 is caused mainly by disruption of the electrostatic bonds to the noncore leucine residues of this peptide that determine the peptide's specificity to GR, as well as by reduced noncovalent interaction against core leucines and subsequent exposure of the AF-2 surface to solvent. The results reveal molecular defects of pathologic mutant receptors and provide important insights to the actions of wild-type GR.

Relationship between metabolic cost and muscular coactivation across running speeds.

PubMed

Moore, Isabel S; Jones, Andrew M; Dixon, Sharon J

2014-11-01

Muscular coactivation can help stabilise a joint, but contrasting results in previous gait studies highlight that it is not clear whether this is metabolically beneficial. The aim was to assess the relationship between the metabolic cost of running and muscular coactivation across different running speeds, in addition to assessing the reliability and precision of lower limb muscular coactivation. Eleven female recreational runners visited the laboratory on two separate occasions. On both occasions subjects ran at three speeds (9.1, 11 and 12 km h(-1)) for six minutes each. Oxygen consumption and electromyographic data were simultaneously recorded during the final two minutes of each speed. Temporal coactivations of lower limb muscles during the stance phase were calculated. Five muscles were assessed: rectus femoris, vastus lateralis, biceps femoris, tibialis anterior and gastrocnemius lateralis. Nonparametric correlations revealed at least one significant, positive association between lower limb muscular coactivation and the metabolic cost of running for each speed. The length of tibialis anterior activation and muscular coactivation of the biceps femoris-tibialis anterior and gastrocnemius lateralis-tibialis anterior decreased with speed. These results show that longer coactivations of the proximal (rectus femoris-biceps femoris and vastus lateralis-biceps femoris) and leg extensor (rectus femoris-gastrocnemius lateralis) muscles were related to a greater metabolic cost of running, which could be detrimental to performance. The decrease in coactivation in the flexor and distal muscles at faster speeds occurs due to the shorter duration of tibialis anterior activation as speed increases, yet stability may be maintained. Copyright © 2013 Sports Medicine Australia. Published by Elsevier Ltd. All rights reserved.

Nuclear receptor coactivators: regulators of steroid action in brain and behaviour.

PubMed

Tetel, M J; Acharya, K D

2013-11-01

Steroid hormones act in specific regions of the brain to alter behaviour and physiology. Although it has been well established that the bioavailability of the steroid and the expression of its receptor is critical for understanding steroid action in the brain, the importance of nuclear receptor coactivators in the brain is becoming more apparent. The present review focuses on the function of the p160 family of coactivators, which includes steroid receptor coactivator-1 (SRC-1), SRC-2 and SRC-3, in steroid receptor action in the brain. The expression, regulation and function of these coactivators in steroid-dependent gene expression in both brain and behaviour are discussed. © 2013 British Society for Neuroendocrinology.

Mechanosignaling through YAP and TAZ drives fibroblast activation and fibrosis

PubMed Central

Liu, Fei; Lagares, David; Choi, Kyoung Moo; Stopfer, Lauren; Marinković, Aleksandar; Vrbanac, Vladimir; Probst, Clemens K.; Hiemer, Samantha E.; Sisson, Thomas H.; Horowitz, Jeffrey C.; Rosas, Ivan O.; Fredenburgh, Laura E.; Feghali-Bostwick, Carol; Varelas, Xaralabos; Tager, Andrew M.

2014-01-01

Pathological fibrosis is driven by a feedback loop in which the fibrotic extracellular matrix is both a cause and consequence of fibroblast activation. However, the molecular mechanisms underlying this process remain poorly understood. Here we identify yes-associated protein (YAP) (homolog of drosophila Yki) and transcriptional coactivator with PDZ-binding motif (TAZ) (also known as Wwtr1), transcriptional effectors of the Hippo pathway, as key matrix stiffness-regulated coordinators of fibroblast activation and matrix synthesis. YAP and TAZ are prominently expressed in fibrotic but not healthy lung tissue, with particularly pronounced nuclear expression of TAZ in spindle-shaped fibroblastic cells. In culture, both YAP and TAZ accumulate in the nuclei of fibroblasts grown on pathologically stiff matrices but not physiologically compliant matrices. Knockdown of YAP and TAZ together in vitro attenuates key fibroblast functions, including matrix synthesis, contraction, and proliferation, and does so exclusively on pathologically stiff matrices. Profibrotic effects of YAP and TAZ operate, in part, through their transcriptional target plasminogen activator inhibitor-1, which is regulated by matrix stiffness independent of transforming growth factor-β signaling. Immortalized fibroblasts conditionally expressing active YAP or TAZ mutant proteins overcome soft matrix limitations on growth and promote fibrosis when adoptively transferred to the murine lung, demonstrating the ability of fibroblast YAP/TAZ activation to drive a profibrotic response in vivo. Together, these results identify YAP and TAZ as mechanoactivated coordinators of the matrix-driven feedback loop that amplifies and sustains fibrosis. PMID:25502501

The role of nNOS and PGC-1α in skeletal muscle cells.

PubMed

Baldelli, Sara; Lettieri Barbato, Daniele; Tatulli, Giuseppe; Aquilano, Katia; Ciriolo, Maria Rosa

2014-11-15

Neuronal nitric oxide synthase (nNOS) and peroxisome proliferator activated receptor γ co-activator 1α (PGC-1α) are two fundamental factors involved in the regulation of skeletal muscle cell metabolism. nNOS exists as several alternatively spliced variants, each having a specific pattern of subcellular localisation. Nitric oxide (NO) functions as a second messenger in signal transduction pathways that lead to the expression of metabolic genes involved in oxidative metabolism, vasodilatation and skeletal muscle contraction. PGC-1α is a transcriptional coactivator and represents a master regulator of mitochondrial biogenesis by promoting the transcription of mitochondrial genes. PGC-1α can be induced during physical exercise, and it plays a key role in coordinating the oxidation of intracellular fatty acids with mitochondrial remodelling. Several lines of evidence demonstrate that NO could act as a key regulator of PGC-1α expression; however, the link between nNOS and PGC-1α in skeletal muscle remains only poorly understood. In this Commentary, we review important metabolic pathways that are governed by nNOS and PGC-1α, and aim to highlight how they might intersect and cooperatively regulate skeletal muscle mitochondrial and lipid energetic metabolism and contraction. © 2014. Published by The Company of Biologists Ltd.

Ligand-dependent interactions of the Ah receptor with coactivators in a mammalian two-hybrid assay

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhang Shu; Rowlands, Craig; Safe, Stephen

2008-03-01

2,3,7,8-Tetrachlorodibenzo-p-dioxin (TCDD) is a high affinity ligand for the aryl hydrocarbon receptor (AhR). In this study, we investigated structure-dependent differences in activation of the AhR by a series of halogenated aromatic hydrocarbons. TCDD, 1,2,3,7,8-pentachlorodibenzo-p-dioxin (PeCDD), 2,3,7,8-tetrachlorodibenzofuran (TCDF), 2,3,4,7,8-pentachlorodibenzofuran (PeCDF), and 3,3',4,4',5-pentachlorobiphenyl (PCB126) induced CYP1A1-dependent activities in HEK293 human embryonic kidney, Panc1 pancreatic cancer, and Hepa1c1c7 mouse hepatoma cell lines. There was a structure-dependent difference in the efficacy of TCDF and PCB126 in HEK293 and Panc1 cells since induced CYP1A1 mRNA levels were lower than observed for the other congeners. A mammalian two-hybrid assay in cells transfected with GAL4-coactivator and AhR-VP16more » chimeras was used to investigate structure-dependent interactions of these chimeras in Panc1, HEK293, and Hepa1c1c7 cells. The reporter construct pGAL4-luc contains five tandem GAL4 response elements linked to the luciferase gene and the GAL4-coactivator chimeras express several coactivators including steroid receptor coactivator 1 (SRC-1), SRC-2 and SRC-3, the mediator coactivator TRAP220, coactivator associated arginine methyl transferase 1 (CARM-1), and peroxisome proliferator-activated receptor {gamma} coactivator 1 (PGC-1). Results of the mammalian two-hybrid studies clearly demonstrate that activation of pGAL4-luc in cells transfected with VP-AhR and GAL4-coactivator chimeras is dependent on the structure of the HAH congener, cell context, and coactivator, suggesting that the prototypical HAH congeners used in this study exhibit selective AhR modulator activity.« less

Selenoprotein W enhances skeletal muscle differentiation by inhibiting TAZ binding to 14-3-3 protein.

PubMed

Jeon, Yeong Ha; Park, Yong Hwan; Lee, Jea Hwang; Hong, Jeong-Ho; Kim, Ick Young

2014-07-01

Selenoprotein W (SelW) is expressed in various tissues, particularly in skeletal muscle. We have previously reported that SelW is up-regulated during C2C12 skeletal muscle differentiation and inhibits binding of 14-3-3 to its target proteins. 14-3-3 reduces myogenic differentiation by inhibiting nuclear translocation of transcriptional co-activator with PDZ-binding motif (TAZ). Phosphorylation of TAZ at Ser89 is required for binding to 14-3-3, leading to cytoplasmic retention of TAZ and a delay in myogenic differentiation. Here, we show that myogenic differentiation was delayed in SelW-knockdown C2C12 cells. Down-regulation of SelW also increased TAZ binding to 14-3-3, which eventually resulted in decreasing translocation of TAZ to the nucleus. However, phosphorylation of TAZ at Ser89 was not affected. Although phosphorylation of TAZ at Ser89 was sustained by the phosphatase inhibitor okadaic acid, nuclear translocation of TAZ was increased by ectopic expression of SelW. This result was due to decreased binding of TAZ to 14-3-3. We also found that the interaction between TAZ and MyoD was increased by ectopic expression of SelW. Taken together, these findings strongly demonstrate that SelW enhances C2C12 cell differentiation by inhibiting TAZ binding to 14-3-3. Copyright © 2014 Elsevier B.V. All rights reserved.

Physical association and functional interaction between beta1 integrin and CD98 on human T lymphocytes

NASA Technical Reports Server (NTRS)

Miyamoto, Yuko J.; Mitchell, Jason S.; McIntyre, Bradley W.

2003-01-01

CD98 is a cell surface protein previously characterized as a cell activation marker, an amino acid transporter, and has recently been implicated in integrin-related functions. Integrins are cell surface proteins, important for homotypic cell aggregation, cell adhesion, and coactivation of T lymphocytes. We have previously shown that the anti-CD98 mAb 80A10, when coimmobilized with anti-CD3 mAb OKT3, is able to mediate human T cell coactivation that is inhibited by anti-beta1 integrin specific mAb 18D3. These results indicated a functional association of CD98 and beta1 integrin signaling but left open the question of a physical association. We now show the induction of homotypic aggregation through CD98 among human T cells and this aggregation was inhibited by anti-beta1 integrin mAb. Therefore, CD98-dependent lymphocyte proliferation and adhesion may involve integrins. Competitive binding assays and fluorescence colocalization analysis suggested that CD98 and beta1 integrin were physically associated. Differential extraction techniques and immunoprecipitations provided the first evidence that the alpha4beta1 integrin and CD98 are specifically associated on human T lymphocytes.

Cutaneous Papillomavirus E6 oncoproteins associate with MAML1 to repress transactivation and NOTCH signaling

PubMed Central

Brimer, Nicole; Lyons, Charles; Wallberg, Annika E.; Vande Pol, Scott B.

2011-01-01

Papillomavirus E6 oncoproteins associate with LXXLL motifs on target cellular proteins to alter their function. Using a proteomic approach, we found the E6 oncoproteins of cutaneous papillomaviruses Bovine Papillomavirus Type 1 (BE6) and HPV types 1 and 8 (1E6 and 8E6) associated with the MAML1 transcriptional co-activator. All three E6 proteins bind to an acidic LXXLL motif at the carboxy-terminus of MAML1 and repress transactivation by MAML1. MAML1 is best known as the co-activator and effector of NOTCH induced transcription, and BPV-1 E6 represses synthetic NOTCH responsive promoters, endogenous NOTCH responsive promoters, and is found in a complex with MAML1 in stably transformed cells. BPV-1 induced papillomas show characteristics of repressed NOTCH signal transduction, including suprabasal expression of integrins, talin, and basal type keratins, and delayed expression of the NOTCH dependent HES1 transcription factor. These observations give rise to a model whereby papillomavirus oncoproteins including BPV-1 E6 and the cancer associated HPV-8 E6 repress Notch induced transcription, thereby delaying keratinocyte differentiation. PMID:22249263

Development of a homogeneous, fluorescence resonance energy transfer-based in vitro recruitment assay for peroxisome proliferator-activated receptor delta via selection of active LXXLL coactivator peptides.

PubMed

Drake, Katherine A; Zhang, Ji-Hu; Harrison, Richard K; McGeehan, Gerald M

2002-05-01

The peroxisome proliferator-activated receptors (PPARs) are nuclear receptors activated by fatty acids and their metabolites. The PPARdelta subtype is believed to be involved in lipoprotein regulation and may have a role in reverse cholesterol transport. While the range of biological roles of PPARdelta still remains unclear, it is of therapeutic interest in cardiovascular diseases. Here we report a homogeneous in vitro assay for studying ligand activation of PPARdelta. We surveyed a panel of peptides containing the LXXLL motifs derived from coactivator protein sequences. Peptides with the best response were used to develop a sensitive and homogeneous recruitment assay for PPARdelta. The optimized assay has a signal-to-background ratio of about 8:1 and an assay quality parameter Z'-factor value of 0.8. The assay signal generated is stable for hours to even overnight. This simple recruitment assay can provide agonist and/or antagonist information that cannot be assessed by receptor-binding assay, and can be used for characterization and screening of ligands that modulate the activation of PPARdelta. (c)2002 Elsevier Science (USA).

Critical components of the pluripotency network are targets for the p300/CBP interacting protein (p/CIP) in embryonic stem cells.

PubMed

Chitilian, J M; Thillainadesan, G; Manias, J L; Chang, W Y; Walker, E; Isovic, M; Stanford, W L; Torchia, J

2014-01-01

p/CIP, also known as steroid receptor coactivator 3 (SRC-3)/Nuclear Receptor Coactivator 3 (NCoA3), is a transcriptional coactivator that binds liganded nuclear hormone receptors, as well as other transcription factors, and facilitates transcription through direct recruitment of accessory factors. We have found that p/CIP is highly expressed in undifferentiated mouse embryonic stem cells (mESCs) and is downregulated during differentiation. siRNA-mediated knockdown of p/CIP decreased transcript levels of Nanog, but not Oct4 or Sox2. Microarray expression analysis showed that Klf4, Tbx3, and Dax-1 are significantly downregulated in mESCs when p/CIP is knocked down. Subsequent chromatin immunoprecipitation (ChIP) analysis demonstrated that Tbx3, Klf4, and Dax-1 are direct transcriptional targets of p/CIP. Using the piggyBac transposition system, a mouse ESC line that expresses Flag-p/CIP in a doxycycline-dependent manner was generated. p/CIP overexpression increased the level of target genes and promoted the formation of undifferentiated colonies. Collectively, these results indicate that p/CIP contributes to the maintenance of ESC pluripotency through direct regulation of essential pluripotency genes. To better understand the mechanism by which p/CIP functions in ESC pluripotency, we integrated our ChIP and transcriptome data with published protein-protein interaction and promoter occupancy data to draft a p/CIP gene regulatory network. The p/CIP gene regulatory network identifies various feed-forward modules including one in which p/CIP activates members of the extended pluripotency network, demonstrating that p/CIP is a component of this extended network. © AlphaMed Press.

6-Mercaptopurine attenuates tumor necrosis factor-α production in microglia through Nur77-mediated transrepression and PI3K/Akt/mTOR signaling-mediated translational regulation.

PubMed

Huang, Hsin-Yi; Chang, Hui-Fen; Tsai, Ming-Jen; Chen, Jhih-Si; Wang, Mei-Jen

2016-04-13

The pathogenesis of several neurodegenerative diseases often involves the microglial activation and associated inflammatory processes. Activated microglia release pro-inflammatory factors that may be neurotoxic. 6-Mercaptopurine (6-MP) is a well-established immunosuppressive drug. Common understanding of their immunosuppressive properties is largely limited to peripheral immune cells. However, the effect of 6-MP in the central nervous system, especially in microglia in the context of neuroinflammation is, as yet, unclear. Tumor necrosis factor-α (TNF-α) is a key cytokine of the immune system that initiates and promotes neuroinflammation. The present study aimed to investigate the effect of 6-MP on TNF-α production by microglia to discern the molecular mechanisms of this modulation. Lipopolysaccharide (LPS) was used to induce an inflammatory response in cultured primary microglia or murine BV-2 microglial cells. Released TNF-α was measured by enzyme-linked immunosorbent assay (ELISA). Gene expression was determined by real-time reverse transcription polymerase chain reaction (RT-PCR). Signaling molecules were analyzed by western blotting, and activation of NF-κB was measured by ELISA-based DNA binding analysis and luciferase reporter assay. Chromatin immunoprecipitation (ChIP) analysis was performed to examine NF-κB p65 and coactivator p300 enrichments and histone modifications at the endogenous TNF-α promoter. Treatment of LPS-activated microglia with 6-MP significantly attenuated TNF-α production. In 6-MP pretreated microglia, LPS-induced MAPK signaling, IκB-α degradation, NF-κB p65 nuclear translocation, and in vitro p65 DNA binding activity were not impaired. However, 6-MP suppressed transactivation activity of NF-κB and TNF-α promoter by inhibiting phosphorylation and acetylation of p65 on Ser276 and Lys310, respectively. ChIP analyses revealed that 6-MP dampened LPS-induced histone H3 acetylation of chromatin surrounding the TNF-α promoter, ultimately leading to a decrease in p65/coactivator-mediated transcription of TNF-α gene. Furthermore, 6-MP enhanced orphan nuclear receptor Nur77 expression. Using RNA interference approach, we further demonstrated that Nur77 upregulation contribute to 6-MP-mediated inhibitory effect on TNF-α production. Additionally, 6-MP also impeded TNF-α mRNA translation through prevention of LPS-activated PI3K/Akt/mTOR signaling cascades. These results suggest that 6-MP might have a therapeutic potential in neuroinflammation-related neurodegenerative disorders through downregulation of microglia-mediated inflammatory processes.

Combining Fungicides and Prospective NPR1-Based "Just-in-Time" Immunomodulating Chemistries for Crop Protection.

PubMed

Kuai, Xiahezi; Barraco, Charles; Després, Charles

2017-01-01

Each year, crop yield is lost to weeds competing for resources, insect herbivory and diseases caused by pathogens. To thwart these insults and preserve yield security and a high quality of traits, conventional agriculture makes use of improved cultivars combined with fertilizer and agrochemical applications. However, given that regulatory bodies and consumers are demanding environmentally safer agrochemicals, while at the same time resistance to agrochemicals is mounting, it is crucial to adopt a "holistic" approach to agriculture by not excluding any number of management tools at our disposal. One such tool includes chemicals that stimulate plant immunity. The development of this particular type of alternative crop protection strategy has been of great interest to us. We have approached this paradigm by studying plant immunity, specifically systemic acquired resistance (SAR). The deployment of SAR immunity requires the production by the crop plant of an endogenous small molecule metabolite called salicylic acid (SA). Furthermore, immunity can only be deployed if SA can bind to its receptor and activate the genes responsible for the SAR program. The key receptor for SAR is a transcription coactivator called NPR1. Since discovering this NPR1-SA receptor-ligand pair, we have embarked on a journey to develop novel chemistries capable of deploying SAR in the field. The journey begins with the development of a scalable assay to identify these novel chemistries. One such assay, presented here, is based on differential scanning fluorimetry technology and demonstrates that NPR1 is destabilized by binding to SA.

Combining Fungicides and Prospective NPR1-Based “Just-in-Time” Immunomodulating Chemistries for Crop Protection

PubMed Central

Kuai, Xiahezi; Barraco, Charles; Després, Charles

2017-01-01

Each year, crop yield is lost to weeds competing for resources, insect herbivory and diseases caused by pathogens. To thwart these insults and preserve yield security and a high quality of traits, conventional agriculture makes use of improved cultivars combined with fertilizer and agrochemical applications. However, given that regulatory bodies and consumers are demanding environmentally safer agrochemicals, while at the same time resistance to agrochemicals is mounting, it is crucial to adopt a “holistic” approach to agriculture by not excluding any number of management tools at our disposal. One such tool includes chemicals that stimulate plant immunity. The development of this particular type of alternative crop protection strategy has been of great interest to us. We have approached this paradigm by studying plant immunity, specifically systemic acquired resistance (SAR). The deployment of SAR immunity requires the production by the crop plant of an endogenous small molecule metabolite called salicylic acid (SA). Furthermore, immunity can only be deployed if SA can bind to its receptor and activate the genes responsible for the SAR program. The key receptor for SAR is a transcription coactivator called NPR1. Since discovering this NPR1-SA receptor–ligand pair, we have embarked on a journey to develop novel chemistries capable of deploying SAR in the field. The journey begins with the development of a scalable assay to identify these novel chemistries. One such assay, presented here, is based on differential scanning fluorimetry technology and demonstrates that NPR1 is destabilized by binding to SA. PMID:29046686

Logical-rules and the classification of integral dimensions: individual differences in the processing of arbitrary dimensions

PubMed Central

Blunden, Anthea G.; Wang, Tony; Griffiths, David W.; Little, Daniel R.

2015-01-01

A variety of converging operations demonstrate key differences between separable dimensions, which can be analyzed independently, and integral dimensions, which are processed in a non-analytic fashion. A recent investigation of response time distributions, applying a set of logical rule-based models, demonstrated that integral dimensions are pooled into a single coactive processing channel, in contrast to separable dimensions, which are processed in multiple, independent processing channels. This paper examines the claim that arbitrary dimensions created by factorially morphing four faces are processed in an integral manner. In two experiments, 16 participants completed a categorization task in which either upright or inverted morph stimuli were classified in a speeded fashion. Analyses focused on contrasting different assumptions about the psychological representation of the stimuli, perceptual and decisional separability, and the processing architecture. We report consistent individual differences which demonstrate a mixture of some observers who demonstrate coactive processing with other observers who process the dimensions in a parallel self-terminating manner. PMID:25620941

Transcription co-activator SAYP mediates the action of STAT activator.

PubMed

Panov, Vladislav V; Kuzmina, Julia L; Doronin, Semen A; Kopantseva, Marina R; Nabirochkina, Elena N; Georgieva, Sofia G; Vorobyeva, Nadezhda E; Shidlovskii, Yulii V

2012-03-01

Jak/STAT is an important signaling pathway mediating multiple events in development. We describe participation of metazoan co-activator SAYP/PHF10 in this pathway downstream of STAT. The latter, via its activation domain, interacts with the conserved core of SAYP. STAT is associated with the SAYP-containing co-activator complex BTFly and recruits BTFly onto genes. SAYP is necessary for stimulating STAT-driven transcription of numerous genes. Mutation of SAYP leads to maldevelopments similar to those observed in STAT mutants. Thus, SAYP is a novel co-activator mediating the action of STAT.

An Extension of SIC Predictions to the Wiener Coactive Model

PubMed Central

Houpt, Joseph W.; Townsend, James T.

2011-01-01

The survivor interaction contrasts (SIC) is a powerful measure for distinguishing among candidate models of human information processing. One class of models to which SIC analysis can apply are the coactive, or channel summation, models of human information processing. In general, parametric forms of coactive models assume that responses are made based on the first passage time across a fixed threshold of a sum of stochastic processes. Previous work has shown that that the SIC for a coactive model based on the sum of Poisson processes has a distinctive down-up-down form, with an early negative region that is smaller than the later positive region. In this note, we demonstrate that a coactive process based on the sum of two Wiener processes has the same SIC form. PMID:21822333

An Extension of SIC Predictions to the Wiener Coactive Model.

PubMed

Houpt, Joseph W; Townsend, James T

2011-06-01

The survivor interaction contrasts (SIC) is a powerful measure for distinguishing among candidate models of human information processing. One class of models to which SIC analysis can apply are the coactive, or channel summation, models of human information processing. In general, parametric forms of coactive models assume that responses are made based on the first passage time across a fixed threshold of a sum of stochastic processes. Previous work has shown that that the SIC for a coactive model based on the sum of Poisson processes has a distinctive down-up-down form, with an early negative region that is smaller than the later positive region. In this note, we demonstrate that a coactive process based on the sum of two Wiener processes has the same SIC form.

Gluteus medius coactivation response in field hockey players with and without low back pain.

PubMed

Bussey, Melanie D; Kennedy, James E; Kennedy, Gavin

2016-01-01

To examine the effect of prolonged standing on gluteus medius coactivation and to observe whether the changes in gluteus medius coactivation over time were related to the development of low back pain in elite female field hockey players. Prospective cohort design. Participants were 39 elite female field hockey players (14 with a history of low back pain). Before the prolonged stand, maximal hip abduction strength, side bridge hold endurance and hip abduction range of motion were measured bilaterally. Surface electromyography was collected from the gluteus medius for coactivation analysis during a prolonged stand for 70 min. Low back pain was rated every 10 min on a visual analogue scale. Fourteen of 39 participants developed low back pain. The Time effect was significant for gluteus medius coactivation response (p = 0.003) and visual analogue scale score (p < 0.001). There were no significant group × time interactions. Yet athletes who developed pain had higher coactivation for the majority of the stand task. While female field hockey players have high agonist-antagonist coactivation patterns during prolonged standing, stand task is a useful tool to predict low back pain occurrence in players with and without history of pain. Copyright © 2015 Elsevier Ltd. All rights reserved.

Contrasting roles for MyoD in organizing myogenic promoter structures during embryonic skeletal muscle development.

PubMed

Cho, Ok Hyun; Mallappa, Chandrashekara; Hernández-Hernández, J Manuel; Rivera-Pérez, Jaime A; Imbalzano, Anthony N

2015-01-01

Among the complexities of skeletal muscle differentiation is a temporal distinction in the onset of expression of different lineage-specific genes. The lineage-determining factor MyoD is bound to myogenic genes at the onset of differentiation whether gene activation is immediate or delayed. How temporal regulation of differentiation-specific genes is established remains unclear. Using embryonic tissue, we addressed the molecular differences in the organization of the myogenin and muscle creatine kinase (MCK) gene promoters by examining regulatory factor binding as a function of both time and spatial organization during somitogenesis. At the myogenin promoter, binding of the homeodomain factor Pbx1 coincided with H3 hyperacetylation and was followed by binding of co-activators that modulate chromatin structure. MyoD and myogenin binding occurred subsequently, demonstrating that Pbx1 facilitates chromatin remodeling and modification before myogenic regulatory factor binding. At the same time, the MCK promoter was bound by HDAC2 and MyoD, and activating histone marks were largely absent. The association of HDAC2 and MyoD was confirmed by co-immunoprecipitation, proximity ligation assay (PLA), and sequential ChIP. MyoD differentially promotes activated and repressed chromatin structures at myogenic genes early after the onset of skeletal muscle differentiation in the developing mouse embryo. © 2014 Wiley Periodicals, Inc.

Kindlin-2 directly binds actin and regulates integrin outside-in signaling

PubMed Central

Bledzka, Kamila; Bialkowska, Katarzyna; Sossey-Alaoui, Khalid; Vaynberg, Julia; Pluskota, Elzbieta

2016-01-01

Reduced levels of kindlin-2 (K2) in endothelial cells derived from K2+/− mice or C2C12 myoblastoid cells treated with K2 siRNA showed disorganization of their actin cytoskeleton and decreased spreading. These marked changes led us to examine direct binding between K2 and actin. Purified K2 interacts with F-actin in cosedimentation and surface plasmon resonance analyses and induces actin aggregation. We further find that the F0 domain of K2 binds actin. A mutation, LK47/AA, within a predicted actin binding site (ABS) of F0 diminishes its interaction with actin by approximately fivefold. Wild-type K2 and K2 bearing the LK47/AA mutation were equivalent in their ability to coactivate integrin αIIbβ3 in a CHO cell system when coexpressed with talin. However, K2-LK47/AA exhibited a diminished ability to support cell spreading and actin organization compared with wild-type K2. The presence of an ABS in F0 of K2 that influences outside-in signaling across integrins establishes a new foundation for considering how kindlins might regulate cellular responses. PMID:27044892

Protein arginine deiminase 2 binds calcium in an ordered fashion: Implications for inhibitor design

DOE PAGES

Slade, Daniel J.; Fang, Pengfei; Dreyton, Christina J.; ...

2015-01-26

Protein arginine deiminases (PADs) are calcium-dependent histone-modifying enzymes whose activity is dysregulated in inflammatory diseases and cancer. PAD2 functions as an Estrogen Receptor (ER) coactivator in breast cancer cells via the citrullination of histone tail arginine residues at ER binding sites. Although an attractive therapeutic target, the mechanisms that regulate PAD2 activity are largely unknown, especially the detailed role of how calcium facilitates enzyme activation. To gain insights into these regulatory processes, we determined the first structures of PAD2 (27 in total), and through calcium-titrations by X-ray crystallography, determined the order of binding and affinity for the six calcium ionsmore » that bind and activate this enzyme. These structures also identified several PAD2 regulatory elements, including a calcium switch that controls proper positioning of the catalytic cysteine residue, and a novel active site shielding mechanism. Additional biochemical and mass-spectrometry-based hydrogen/deuterium exchange studies support these structural findings. The identification of multiple intermediate calcium-bound structures along the PAD2 activation pathway provides critical insights that will aid the development of allosteric inhibitors targeting the PADs.« less

Protein Arginine Deiminase 2 Binds Calcium in an Ordered Fashion: Implications for Inhibitor Design

PubMed Central

2015-01-01

Protein arginine deiminases (PADs) are calcium-dependent histone-modifying enzymes whose activity is dysregulated in inflammatory diseases and cancer. PAD2 functions as an Estrogen Receptor (ER) coactivator in breast cancer cells via the citrullination of histone tail arginine residues at ER binding sites. Although an attractive therapeutic target, the mechanisms that regulate PAD2 activity are largely unknown, especially the detailed role of how calcium facilitates enzyme activation. To gain insights into these regulatory processes, we determined the first structures of PAD2 (27 in total), and through calcium-titrations by X-ray crystallography, determined the order of binding and affinity for the six calcium ions that bind and activate this enzyme. These structures also identified several PAD2 regulatory elements, including a calcium switch that controls proper positioning of the catalytic cysteine residue, and a novel active site shielding mechanism. Additional biochemical and mass-spectrometry-based hydrogen/deuterium exchange studies support these structural findings. The identification of multiple intermediate calcium-bound structures along the PAD2 activation pathway provides critical insights that will aid the development of allosteric inhibitors targeting the PADs. PMID:25621824

The nuclear receptor PPARγ individually responds to serotonin- and fatty acid-metabolites

PubMed Central

Waku, Tsuyoshi; Shiraki, Takuma; Oyama, Takuji; Maebara, Kanako; Nakamori, Rinna; Morikawa, Kosuke

2010-01-01

The nuclear receptor, peroxisome proliferator-activated receptor γ (PPARγ), recognizes various synthetic and endogenous ligands by the ligand-binding domain. Fatty-acid metabolites reportedly activate PPARγ through conformational changes of the Ω loop. Here, we report that serotonin metabolites act as endogenous agonists for PPARγ to regulate macrophage function and adipogenesis by directly binding to helix H12. A cyclooxygenase inhibitor, indomethacin, is a mimetic agonist of these metabolites. Crystallographic analyses revealed that an indole acetate functions as a common moiety for the recognition by the sub-pocket near helix H12. Intriguingly, a serotonin metabolite and a fatty-acid metabolite each bind to distinct sub-pockets, and the PPARγ antagonist, T0070907, blocked the fatty-acid agonism, but not that of the serotonin metabolites. Mutational analyses on receptor-mediated transcription and coactivator binding revealed that each metabolite individually uses coregulator and/or heterodimer interfaces in a ligand-type-specific manner. Furthermore, the inhibition of the serotonin metabolism reduced the expression of the endogenous PPARγ-target gene. Collectively, these results suggest a novel agonism, in which PPARγ functions as a multiple sensor in response to distinct metabolites. PMID:20717101

DNA Sequence Variants in PPARGC1A, a Gene Encoding a Coactivator of the ω-3 LCPUFA Sensing PPAR-RXR Transcription Complex, Are Associated with NV AMD and AMD-Associated Loci in Genes of Complement and VEGF Signaling Pathways

PubMed Central

SanGiovanni, John Paul; Chen, Jing; Sapieha, Przemyslaw; Aderman, Christopher M.; Stahl, Andreas; Clemons, Traci E.; Chew, Emily Y.; Smith, Lois E. H.

2013-01-01

Background Increased intake of ω-3 long-chain polyunsaturated fatty acids (LCPUFAs) and use of peroxisome proliferator activator receptor (PPAR)-activating drugs are associated with attenuation of pathologic retinal angiogenesis. ω-3 LCPUFAs are endogenous agonists of PPARs. We postulated that DNA sequence variation in PPAR gamma (PPARG) co-activator 1 alpha (PPARGC1A), a gene encoding a co-activator of the LCPUFA-sensing PPARG-retinoid X receptor (RXR) transcription complex, may influence neovascularization (NV) in age-related macular degeneration (AMD). Methods We applied exact testing methods to examine distributions of DNA sequence variants in PPARGC1A for association with NV AMD and interaction of AMD-associated loci in genes of complement, lipid metabolism, and VEGF signaling systems. Our sample contained 1858 people from 3 elderly cohorts of western European ancestry. We concurrently investigated retinal gene expression profiles in 17-day-old neonatal mice on a 2% LCPUFA feeding paradigm to identify LCPUFA-regulated genes both associated with pathologic retinal angiogenesis and known to interact with PPARs or PPARGC1A. Results A DNA coding variant (rs3736265) and a 3'UTR-resident regulatory variant (rs3774923) in PPARGC1A were independently associated with NV AMD (exact P = 0.003, both SNPs). SNP-SNP interactions existed for NV AMD (P<0.005) with rs3736265 and a AMD-associated variant in complement factor B (CFB, rs512559). PPARGC1A influences activation of the AMD-associated complement component 3 (C3) promoter fragment and CFB influences activation and proteolysis of C3. We observed interaction (P≤0.003) of rs3736265 with a variant in vascular endothelial growth factor A (VEGFA, rs3025033), a key molecule in retinal angiogenesis. Another PPARGC1A coding variant (rs8192678) showed statistical interaction with a SNP in the VEGFA receptor fms-related tyrosine kinase 1 (FLT1, rs10507386; P≤0.003). C3 expression was down-regulated 2-fold in retinas of ω-3 LCPUFA-fed mice – these animals also showed 70% reduction in retinal NV (P≤0.001). Conclusion Ligands and co-activators of the ω-3 LCPUFA sensing PPAR-RXR axis may influence retinal angiogenesis in NV AMD via the complement and VEGF signaling systems. We have linked the co-activator of a lipid-sensing transcription factor (PPARG co-activator 1 alpha, PPARGC1A) to age-related macular degeneration (AMD) and AMD-associated genes. PMID:23335958

Effect of Knee Joint Angle and Contraction Intensity on Hamstrings Coactivation.

PubMed

Wu, Rui; Delahunt, Eamonn; Ditroilo, Massimiliano; Lowery, Madeleine M; DE Vito, Giuseppe

2017-08-01

This study investigated the effect of knee joint angle and contraction intensity on the coactivation of the hamstring muscles (when acting as antagonists to the quadriceps) in young and older individuals of both sexes. A total of 25 young (24 ± 2.6 yr) and 26 older (70 ± 2.5 yr) healthy men and women participated. Maximal voluntary isometric contraction of the knee extensors and flexors was assessed at two knee joint angles (90° and 60°, 0° = full extension). At each angle, participants performed submaximal contractions of the knee extensors (20%, 50%, and 80% maximal voluntary isometric contraction), whereas surface EMG was simultaneously acquired from the vastus lateralis and biceps femoris muscles to assess the level (EMG root-mean-square) of agonist activation and antagonist coactivation. Subcutaneous adipose tissue in the areas corresponding to surface EMG electrode placements was measured via ultrasonography. The contractions performed at 90° knee flexion demonstrated higher levels of antagonist coactivation (all P < 0.01) and agonist activation (all P < 0.01) as a function of contraction intensity compared with the 60° knee flexion. Furthermore, after controlling for subcutaneous adipose tissue, older participants exhibited a higher level of antagonist coactivation at 60° knee flexion compared with young participants (P < 0.05). The results of the present study suggest that 1) the antagonist coactivation is dependent on knee joint angle and contraction intensity and 2) subcutaneous adipose tissue may affect the measured coactivation level likely because of a cross-talk effect. Antagonist coactivation may play a protective role in stabilizing the knee joint and maintaining constant motor output.

The quaternary architecture of RARβ–RXRα heterodimer facilitates domain–domain signal transmission

DOE PAGES

Chandra, Vikas; Wu, Dalei; Li, Sheng; ...

2017-10-11

Assessing the physical connections and allosteric communications in multi-domain nuclear receptor (NR) polypeptides has remained challenging, with few crystal structures available to show their overall structural organizations. Here we report the quaternary architecture of multi-domain retinoic acid receptor beta-retinoic X receptor alpha (RAR beta-RXR alpha) heterodimer bound to DNA, ligands and coactivator peptides, examined through crystallographic, hydrogen-deuterium exchange mass spectrometry, mutagenesis and functional studies. The RAR beta ligand-binding domain (LBD) and DNA-binding domain (DBD) are physically connected to foster allosteric signal transmission between them. Direct comparisons among all the multi-domain NRs studied crystallographically to date show significant variations within theirmore » quaternary architectures, rather than a common architecture adhering to strict rules. RXR remains flexible and adaptive by maintaining loosely organized domains, while its hetero-dimerization partners use a surface patch on their LBDs to form domain-domain interactions with DBDs.« less

The quaternary architecture of RARβ–RXRα heterodimer facilitates domain–domain signal transmission

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chandra, Vikas; Wu, Dalei; Li, Sheng

Assessing the physical connections and allosteric communications in multi-domain nuclear receptor (NR) polypeptides has remained challenging, with few crystal structures available to show their overall structural organizations. Here we report the quaternary architecture of multi-domain retinoic acid receptor beta-retinoic X receptor alpha (RAR beta-RXR alpha) heterodimer bound to DNA, ligands and coactivator peptides, examined through crystallographic, hydrogen-deuterium exchange mass spectrometry, mutagenesis and functional studies. The RAR beta ligand-binding domain (LBD) and DNA-binding domain (DBD) are physically connected to foster allosteric signal transmission between them. Direct comparisons among all the multi-domain NRs studied crystallographically to date show significant variations within theirmore » quaternary architectures, rather than a common architecture adhering to strict rules. RXR remains flexible and adaptive by maintaining loosely organized domains, while its hetero-dimerization partners use a surface patch on their LBDs to form domain-domain interactions with DBDs.« less

Cleaved thioredoxin fusion protein enables the crystallization of poorly soluble ERα in complex with synthetic ligands

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cura, Vincent; Gangloff, Monique; Eiler, Sylvia

2008-01-01

A new crystallization strategy: the presence of cleaved thioredoxin fusion is critical for crystallization of the estrogen nuclear receptor ligand binding domain in complex with synthetic ligands. This novel technique should be regarded as an interesting alternative for crystallization of difficult proteins. The ligand-binding domain (LBD) of human oestrogen receptor α was produced in Escherichia coli as a cleavable thioredoxin (Trx) fusion in order to improve solubility. Crystallization trials with either cleaved and purified LBD or with the purified fusion protein both failed to produce crystals. In another attempt, Trx was not removed from the LBD after endoproteolytic cleavage andmore » its presence promoted nucleation and subsequent crystal growth, which allowed the structure determination of two different LBD–ligand–coactivator peptide complexes at 2.3 Å resolution. This technique is likely to be applicable to other low-solubility proteins.« less

The Retinoid X Receptors and Their Ligands

PubMed Central

Dawson, Marcia I.; Xia, Zebin

2014-01-01

This chapter presents an overview of the current status of studies on the structural and molecular biology of the retinoid X receptor subtypes α, β, and γ (RXRs, NR2B1–3), their nuclear and cytoplasmic functions, post-transcriptional processing, and recently reported ligands. Points of interest are the different changes in the ligand-binding pocket induced by variously shaped agonists, the communication of the ligand–bound pocket with the coactivator binding surface and the heterodimerization interface, and recently identified ligands that are natural products, those that function as environmental toxins or drugs that had been originally designed to interact with other targets, as well as those that were deliberately designed as RXR-selective transcriptional agonists, synergists, or antagonists. Of these synthetic ligands, the general trend in design appears to be away from fully aromatic rigid structures to those containing partial elements of the flexible tetraene side chain of 9-cis-retinoic acid. PMID:22020178

Resveratrol modulates the inflammatory response via an estrogen receptor-signal integration network

PubMed Central

Nwachukwu, Jerome C; Srinivasan, Sathish; Bruno, Nelson E; Parent, Alexander A; Hughes, Travis S; Pollock, Julie A; Gjyshi, Olsi; Cavett, Valerie; Nowak, Jason; Garcia-Ordonez, Ruben D; Houtman, René; Griffin, Patrick R; Kojetin, Douglas J; Katzenellenbogen, John A; Conkright, Michael D; Nettles, Kendall W

2014-01-01

Resveratrol has beneficial effects on aging, inflammation and metabolism, which are thought to result from activation of the lysine deacetylase, sirtuin 1 (SIRT1), the cAMP pathway, or AMP-activated protein kinase. In this study, we report that resveratrol acts as a pathway-selective estrogen receptor-α (ERα) ligand to modulate the inflammatory response but not cell proliferation. A crystal structure of the ERα ligand-binding domain (LBD) as a complex with resveratrol revealed a unique perturbation of the coactivator-binding surface, consistent with an altered coregulator recruitment profile. Gene expression analyses revealed significant overlap of TNFα genes modulated by resveratrol and estradiol. Furthermore, the ability of resveratrol to suppress interleukin-6 transcription was shown to require ERα and several ERα coregulators, suggesting that ERα functions as a primary conduit for resveratrol activity. DOI: http://dx.doi.org/10.7554/eLife.02057.001 PMID:24771768

Specialized rules of gene transcription in male germ cells: the CREM paradigm.

PubMed

Monaco, Lucia; Kotaja, Noora; Fienga, Giulia; Hogeveen, Kevin; Kolthur, Ullas S; Kimmins, Sarah; Brancorsini, Stefano; Macho, Betina; Sassone-Corsi, Paolo

2004-12-01

Specialized transcription complexes that coordinate the differentiation programme of spermatogenesis have been found in germ cells, which display specific differences in the components of the general transcription machinery. The TATA-binding protein family and its associated cofactors, for example, show upregulated expression in testis. In this physiological context, transcriptional control mediated by the activator cAMP response element modulator (CREM) represents an established paradigm. Somatic cell activation by CREM requires its phosphorylation at a unique regulatory site (Ser117) and subsequent interaction with the ubiquitous coactivator CREB-binding protein. In testis, CREM transcriptional activity is controlled through interaction with a tissue-specific partner, activator of CREM in the testis (ACT), which confers a powerful, phosphorylation-independent activation capacity. The function of ACT was found to be regulated by the testis-specific kinesin KIF17b. Here we discuss some aspects of the testis-specific transcription machinery, whose function is essential for the process of spermatogenesis.

Peroxisome proliferator-activated receptor-gamma co-activator 1alpha-mediated metabolic remodeling of skeletal myocytes mimics exercise training and reverses lipid-induced mitochondrial inefficiency.

PubMed

Koves, Timothy R; Li, Ping; An, Jie; Akimoto, Takayuki; Slentz, Dorothy; Ilkayeva, Olga; Dohm, G Lynis; Yan, Zhen; Newgard, Christopher B; Muoio, Deborah M

2005-09-30

Peroxisome proliferator-activated receptor-gamma co-activator 1alpha (PGC1alpha) is a promiscuous co-activator that plays a key role in regulating mitochondrial biogenesis and fuel homeostasis. Emergent evidence links decreased skeletal muscle PGC1alpha activity and coincident impairments in mitochondrial performance to the development of insulin resistance in humans. Here we used rodent models to demonstrate that muscle mitochondrial efficiency is compromised by diet-induced obesity and is subsequently rescued by exercise training. Chronic high fat feeding caused accelerated rates of incomplete fatty acid oxidation and accumulation of beta-oxidative intermediates. The capacity of muscle mitochondria to fully oxidize a heavy influx of fatty acid depended on factors such as fiber type and exercise training and was positively correlated with expression levels of PGC1alpha. Likewise, an efficient lipid-induced substrate switch in cultured myocytes depended on adenovirus-mediated increases in PGC1alpha expression. Our results supported a novel paradigm in which a high lipid supply, occurring under conditions of low PGC1alpha, provokes a disconnect between mitochondrial beta-oxidation and tricarboxylic acid cycle activity. Conversely, the metabolic remodeling that occurred in response to PGC1alpha overexpression favored a shift from incomplete to complete beta-oxidation. We proposed that PGC1alpha enables muscle mitochondria to better cope with a high lipid load, possibly reflecting a fundamental metabolic benefit of exercise training.

The transcriptional coactivators p/CIP and SRC-1 control insulin resistance through IRS1 in obesity models.

PubMed

Wang, Zhiyong; Shah, O Jameel; Hunter, Tony

2012-01-01

Three p160 family members, p/CIP, SRC1, and TIF2, have been identified as transcriptional coactivators for nuclear hormone receptors and other transcription factors in vitro. In a previous study, we reported initial characterization of the obesity-resistant phenotypes of p/CIP and SRC-1 double knockout (DKO) mice, which exhibit increased energy expenditure, and suggested that nuclear hormone receptor target genes were involved in these phenotypes. In this study, we demonstrate that p/CIP and SRC1 control insulin signaling in a cell-autonomous manner both in vitro and in vivo. Genetic deletion of p/CIP and SRC-1 increases glucose uptake and enhances insulin sensitivity in both regular chow- and high fat diet-fed DKO mice despite increased food intake. Interestingly, we discover that loss of p/CIP and SRC-1 results in resistance to age-related obesity and glucose intolerance. We show that expression levels of a key insulin signaling component, insulin receptor substrate 1 (IRS1), are significantly increased in two cell lines representing fat and muscle lineages with p/CIP and SRC-1 deletions and in white adipose tissue and skeletal muscle of DKO mice; this may account for increased glucose metabolism and insulin sensitivity. This is the first evidence that the p160 coactivators control insulin signaling and glucose metabolism through IRS1. Therefore, our studies indicate that p/CIP and SRC-1 are potential therapeutic targets not only for obesity but also for diabetes.

The Transcriptional Coactivators p/CIP and SRC-1 Control Insulin Resistance through IRS1 in Obesity Models

PubMed Central

Wang, Zhiyong; Shah, O. Jameel; Hunter, Tony

2012-01-01

Three p160 family members, p/CIP, SRC1, and TIF2, have been identified as transcriptional coactivators for nuclear hormone receptors and other transcription factors in vitro. In a previous study, we reported initial characterization of the obesity-resistant phenotypes of p/CIP and SRC-1 double knockout (DKO) mice, which exhibit increased energy expenditure, and suggested that nuclear hormone receptor target genes were involved in these phenotypes. In this study, we demonstrate that p/CIP and SRC1 control insulin signaling in a cell-autonomous manner both in vitro and in vivo. Genetic deletion of p/CIP and SRC-1 increases glucose uptake and enhances insulin sensitivity in both regular chow- and high fat diet-fed DKO mice despite increased food intake. Interestingly, we discover that loss of p/CIP and SRC-1 results in resistance to age-related obesity and glucose intolerance. We show that expression levels of a key insulin signaling component, insulin receptor substrate 1 (IRS1), are significantly increased in two cell lines representing fat and muscle lineages with p/CIP and SRC-1 deletions and in white adipose tissue and skeletal muscle of DKO mice; this may account for increased glucose metabolism and insulin sensitivity. This is the first evidence that the p160 coactivators control insulin signaling and glucose metabolism through IRS1. Therefore, our studies indicate that p/CIP and SRC-1 are potential therapeutic targets not only for obesity but also for diabetes. PMID:22859932

Yes-associated protein 1 and transcriptional coactivator with PDZ-binding motif activate the mammalian target of rapamycin complex 1 pathway by regulating amino acid transporters in hepatocellular carcinoma.

PubMed

Park, Yun-Yong; Sohn, Bo Hwa; Johnson, Randy L; Kang, Myoung-Hee; Kim, Sang Bae; Shim, Jae-Jun; Mangala, Lingegowda S; Kim, Ji Hoon; Yoo, Jeong Eun; Rodriguez-Aguayo, Cristian; Pradeep, Sunila; Hwang, Jun Eul; Jang, Hee-Jin; Lee, Hyun-Sung; Rupaimoole, Rajesha; Lopez-Berestein, Gabriel; Jeong, Woojin; Park, Inn Sun; Park, Young Nyun; Sood, Anil K; Mills, Gordon B; Lee, Ju-Seog

2016-01-01

Metabolic activation is a common feature of many cancer cells and is frequently associated with the clinical outcomes of various cancers, including hepatocellular carcinoma. Thus, aberrantly activated metabolic pathways in cancer cells are attractive targets for cancer therapy. Yes-associated protein 1 (YAP1) and transcriptional coactivator with PDZ-binding motif (TAZ) are oncogenic downstream effectors of the Hippo tumor suppressor pathway, which is frequently inactivated in many cancers. Our study revealed that YAP1/TAZ regulates amino acid metabolism by up-regulating expression of the amino acid transporters solute carrier family 38 member 1 (SLC38A1) and solute carrier family 7 member 5 (SLC7A5). Subsequently, increased uptake of amino acids by the transporters (SLC38A1 and SLC7A5) activates mammalian target of rapamycin complex 1 (mTORC1), a master regulator of cell growth, and stimulates cell proliferation. We also show that high expression of SLC38A1 and SLC7A5 is significantly associated with shorter survival in hepatocellular carcinoma patients. Furthermore, inhibition of the transporters and mTORC1 significantly blocks YAP1/TAZ-mediated tumorigenesis in the liver. These findings elucidate regulatory networks connecting the Hippo pathway to mTORC1 through amino acid metabolism and the mechanism's potential clinical implications for treating hepatocellular carcinoma. YAP1 and TAZ regulate cancer metabolism and mTORC1 through regulation of amino acid transportation, and two amino acid transporters, SLC38A1 and SLC7A5, might be important therapeutic targets. © 2015 by the American Association for the Study of Liver Diseases.

NOVEL MECHANISMS FOR THE VITAMIN D RECEPTOR (VDR) IN THE SKIN AND IN SKIN CANCER

PubMed Central

Bikle, Daniel D.; Oda, Yuko; Tu, Chia-Ling; Jiang, Yan

2014-01-01

The VDR acting with or without its principal ligand 1,25(OH)2D regulates two central processes in the skin, interfollicular epidermal (IFE) differentiation and hair follicle cycling (HFC). Calcium is an important co-regulator with 1,25(OH)2 D at least of epidermal differentiation. Knockout of the calcium sensing receptor (CaSR) in addition to VDR accelerates the development of skin cancer in mice on a low calcium diet. Coactivators such as Mediator 1 (aka DRIP205) and steroid receptor coactivator 3 (SRC3) regulate VDR function at different stages of the differentiation process, with Med1 essential for hair follicle differentiation and early stages of epidermal differentiation and proliferation and SRC3 essential for the latter stages of differentiation including formation of the permeability barrier and innate immunity. The corepressor of VDR, hairless (HR), is essential for hair follicle cycling, although its effect on epidermal differentiation in vivo is minimal. In its regulation of HFC and IFE VDR controls two pathways—wnt/β-catenin and sonic hedgehog (Shh). In the absence of VDR these pathways are overexpressed leading to tumor formation. Whereas VDR binding to β-catenin may block its activation of TCF/LEF1 sites, β-catenin binding to VDR may enhance its activation of VDREs. 1,25(OH)2D promotes but may not be required for these interactions. Suppression of Shh expression by VDR, on the other hand, requires 1,25(OH)2D. The major point of emphasis is that the role of VDR in the skin involves a number of novel mechanisms, both 1,25(OH)2D dependent and independent, that when disrupted interfere with IFE differentiation and HFC, predisposing to cancer formation. PMID:25445917

Measuring Mathematics Teachers' Professional Competence by Using Video Clips (COACTIV Video)

ERIC Educational Resources Information Center

Bruckmaier, G.; Krauss, S.; Blum, W.; Leiss, D.

2016-01-01

The COACTIV video study is part of the COACTIV research program in which secondary mathematics teachers whose students participated in PISA 03/04 were examined, with respect to their professional knowledge, motivational orientations, beliefs, and self-regulation. In the video study, 284 German secondary mathematics teachers were asked to specify…

Molecular Dynamics of "Fuzzy" Transcriptional Activator-Coactivator Interactions

PubMed Central

Scholes, Natalie S.; Weinzierl, Robert O. J.

2016-01-01

Transcriptional activation domains (ADs) are generally thought to be intrinsically unstructured, but capable of adopting limited secondary structure upon interaction with a coactivator surface. The indeterminate nature of this interface made it hitherto difficult to study structure/function relationships of such contacts. Here we used atomistic accelerated molecular dynamics (aMD) simulations to study the conformational changes of the GCN4 AD and variants thereof, either free in solution, or bound to the GAL11 coactivator surface. We show that the AD-coactivator interactions are highly dynamic while obeying distinct rules. The data provide insights into the constant and variable aspects of orientation of ADs relative to the coactivator, changes in secondary structure and energetic contributions stabilizing the various conformers at different time points. We also demonstrate that a prediction of α-helical propensity correlates directly with the experimentally measured transactivation potential of a large set of mutagenized ADs. The link between α-helical propensity and the stimulatory activity of ADs has fundamental practical and theoretical implications concerning the recruitment of ADs to coactivators. PMID:27175900

Transcription co-activator SAYP mediates the action of STAT activator

PubMed Central

Panov, Vladislav V.; Kuzmina, Julia L.; Doronin, Semen A.; Kopantseva, Marina R.; Nabirochkina, Elena N.; Georgieva, Sofia G.; Vorobyeva, Nadezhda E.; Shidlovskii, Yulii V.

2012-01-01

Jak/STAT is an important signaling pathway mediating multiple events in development. We describe participation of metazoan co-activator SAYP/PHF10 in this pathway downstream of STAT. The latter, via its activation domain, interacts with the conserved core of SAYP. STAT is associated with the SAYP-containing co-activator complex BTFly and recruits BTFly onto genes. SAYP is necessary for stimulating STAT-driven transcription of numerous genes. Mutation of SAYP leads to maldevelopments similar to those observed in STAT mutants. Thus, SAYP is a novel co-activator mediating the action of STAT. PMID:22123744

Transcriptional Network Analysis in Muscle Reveals AP-1 as a Partner of PGC-1α in the Regulation of the Hypoxic Gene Program

PubMed Central

Baresic, Mario; Salatino, Silvia; Kupr, Barbara

2014-01-01

Skeletal muscle tissue shows an extraordinary cellular plasticity, but the underlying molecular mechanisms are still poorly understood. Here, we use a combination of experimental and computational approaches to unravel the complex transcriptional network of muscle cell plasticity centered on the peroxisome proliferator-activated receptor γ coactivator 1α (PGC-1α), a regulatory nexus in endurance training adaptation. By integrating data on genome-wide binding of PGC-1α and gene expression upon PGC-1α overexpression with comprehensive computational prediction of transcription factor binding sites (TFBSs), we uncover a hitherto-underestimated number of transcription factor partners involved in mediating PGC-1α action. In particular, principal component analysis of TFBSs at PGC-1α binding regions predicts that, besides the well-known role of the estrogen-related receptor α (ERRα), the activator protein 1 complex (AP-1) plays a major role in regulating the PGC-1α-controlled gene program of the hypoxia response. Our findings thus reveal the complex transcriptional network of muscle cell plasticity controlled by PGC-1α. PMID:24912679

DOE Office of Scientific and Technical Information (OSTI.GOV)

Slade, Daniel J.; Fang, Pengfei; Dreyton, Christina J.

Protein arginine deiminases (PADs) are calcium-dependent histone-modifying enzymes whose activity is dysregulated in inflammatory diseases and cancer. PAD2 functions as an Estrogen Receptor (ER) coactivator in breast cancer cells via the citrullination of histone tail arginine residues at ER binding sites. Although an attractive therapeutic target, the mechanisms that regulate PAD2 activity are largely unknown, especially the detailed role of how calcium facilitates enzyme activation. To gain insights into these regulatory processes, we determined the first structures of PAD2 (27 in total), and through calcium-titrations by X-ray crystallography, determined the order of binding and affinity for the six calcium ionsmore » that bind and activate this enzyme. These structures also identified several PAD2 regulatory elements, including a calcium switch that controls proper positioning of the catalytic cysteine residue, and a novel active site shielding mechanism. Additional biochemical and mass-spectrometry-based hydrogen/deuterium exchange studies support these structural findings. The identification of multiple intermediate calcium-bound structures along the PAD2 activation pathway provides critical insights that will aid the development of allosteric inhibitors targeting the PADs.« less

A Novel Function of the Fe65 Neuronal Adaptor in Estrogen Receptor Action in Breast Cancer Cells*

PubMed Central

Sun, Yuefeng; Kasiappan, Ravi; Tang, Jinfu; Webb, Panida L.; Quarni, Waise; Zhang, Xiaohong; Bai, Wenlong

2014-01-01

Fe65 is a multidomain adaptor with established functions in neuronal cells and neurodegeneration diseases. It binds to the C terminus of the Aβ amyloid precursor protein and is involved in regulating gene transcription. The present studies show that Fe65 is expressed in breast cancer (BCa) cells and acts as an ERα transcriptional coregulator that is recruited by 17β-estradiol to the promoters of estrogen target genes. Deletion analyses mapped the ERα binding domain to the phosphotyrosine binding domain 2 (PTB2). Ectopic Fe65 increased the transcriptional activity of the ERα in a PTB2-dependent manner in reporter assays. Fe65 knockdown decreased, whereas its stable expression increased the transcriptional activity of endogenous ERα in BCa cells and the ability of estrogens to stimulate target gene expression, ERα, and coactivator recruitment to target gene promoters and cell growth. Furthermore, Fe65 expression decreased the antagonistic activity of tamoxifen (TAM), suggesting a role for Fe65 in TAM resistance. Overall, the studies define a novel role for the neuronal adaptor in estrogen actions in BCa cells. PMID:24619425

Conifer Diterpene Resin Acids Disrupt Juvenile Hormone-Mediated Endocrine Regulation in the Indian Meal Moth Plodia interpunctella.

PubMed

Oh, Hyun-Woo; Yun, Chan-Seok; Jeon, Jun Hyoung; Kim, Ji-Ae; Park, Doo-Sang; Ryu, Hyung Won; Oh, Sei-Ryang; Song, Hyuk-Hwan; Shin, Yunhee; Jung, Chan Sik; Shin, Sang Woon

2017-07-01

Diterpene resin acids (DRAs) are important components of oleoresin and greatly contribute to the defense strategies of conifers against herbivorous insects. In the present study, we determined that DRAs function as insect juvenile hormone (JH) antagonists that interfere with the juvenile hormone-mediated binding of the JH receptor Methoprene-tolerant (Met) and steroid receptor coactivator (SRC). Using a yeast two-hybrid system transformed with Met and SRC from the Indian meal moth Plodia interpunctella, we tested the interfering activity of 3704 plant extracts against JH III-mediated Met-SRC binding. Plant extracts from conifers, especially members of the Pinaceae, exhibited strong interfering activity, and four active interfering DRAs (7α-dehydroabietic acid, 7-oxodehydroabietic acid, dehydroabietic acid, and sandaracopimaric acid) were isolated from roots of the Japanese pine Pinus densiflora. The four isolated DRAs, along with abietic acid, disrupted the juvenile hormone-mediated binding of P. interpunctella Met and SRC, although only 7-oxodehydroabietic acid disrupted larval development. These results demonstrate that DRAs may play a defensive role against herbivorous insects via insect endocrine-disrupting activity.

Global Conformational Selection and Local Induced Fit for the Recognition between Intrinsic Disordered p53 and CBP

PubMed Central

Yu, Qingfen; Ye, Wei; Wang, Wei; Chen, Hai-Feng

2013-01-01

The transactivation domain (TAD) of tumor suppressor p53 can bind with the nuclear coactivator binding domain (NCBD) of cyclic-AMP response element binding protein (CBP) and activate transcription. NMR experiments demonstrate that both apo-NCBD and TAD are intrinsic disordered and bound NCBD/TAD undergoes a transition to well folded. The recognition mechanism between intrinsic disordered proteins is still hotly debated. Molecular dynamics (MD) simulations in explicit solvent are used to study the recognition mechanism between intrinsic disordered TAD and NCBD. The average RMSD values between bound and corresponding apo states and Kolmogorov-Smirnov P test analysis indicate that TAD and NCBD may follow an induced fit mechanism. Quantitative analysis indicates there is also a global conformational selection. In summary, the recognition of TAD and NCBD might obey a local induced fit and global conformational selection. These conclusions are further supported by high-temperature unbinding kinetics and room temperature landscape analysis. These methods can be used to study the recognition mechanism of other intrinsic disordered proteins. PMID:23555731

Vascular risk factor burden correlates with cerebrovascular reactivity but not resting state coactivation in the default mode network.

PubMed

Tchistiakova, Ekaterina; Crane, David E; Mikulis, David J; Anderson, Nicole D; Greenwood, Carol E; Black, Sandra E; MacIntosh, Bradley J

2015-11-01

White matter hyperintensities (WMH) are prevalent among older adults and are often associated with cognitive decline and increased risk of stroke and dementia. Vascular risk factors (VRFs) are linked to WMH, yet the impact of multiple VRFs on gray matter function is still unclear. The goal of this study was to test for associations between the number of VRFs and cerebrovascular reactivity (CVR) and resting state (RS) coactivation among individuals with WMH. Twenty-nine participants with suspected WMH were grouped based on the number of VRFs (subgroups: 0, 1, or ≥2). CVR and RS coactivation were measured with blood oxygenation level-dependent (BOLD) imaging on a 3T magnetic resonance imaging (MRI) system during hypercapnia and rest, respectively. Default-mode (DMN), sensory-motor, and medial-visual networks, generated using independent component analysis of RS-BOLD, were selected as networks of interest (NOIs). CVR-BOLD was analyzed using two methods: 1) a model-based approach using CO2 traces, and 2) a dual-regression (DR) approach using NOIs as spatial inputs. Average CVR and RS coactivations within NOIs were compared between VRF subgroups. A secondary analysis investigated the correlation between CVR and RS coactivation. VRF subgroup differences were detected using DR-based CVR in the DMN (F20,2  = 5.17, P = 0.015) but not the model-based CVR nor RS coactivation. DR-based CVR was correlated with RS coactivation in the DMN (r(2)  = 0.28, P = 0.006) but not the sensory-motor nor medial-visual NOIs. In individuals with WMH, CVR in the DMN was inversely associated with the number of VRFs and correlated with RS coactivation. © 2015 Wiley Periodicals, Inc.

A role for peroxisome proliferator-activated receptor γ coactivator-1 in the control of mitochondrial dynamics during postnatal cardiac growth.

PubMed

Martin, Ola J; Lai, Ling; Soundarapandian, Mangala M; Leone, Teresa C; Zorzano, Antonio; Keller, Mark P; Attie, Alan D; Muoio, Deborah M; Kelly, Daniel P

2014-02-14

Increasing evidence has shown that proper control of mitochondrial dynamics (fusion and fission) is required for high-capacity ATP production in the heart. Transcriptional coactivators, peroxisome proliferator-activated receptor γ coactivator-1 (PGC-1) α and PGC-1β, have been shown to regulate mitochondrial biogenesis in the heart at the time of birth. The function of PGC-1 coactivators in the heart after birth has been incompletely understood. Our aim was to assess the role of PGC-1 coactivators during postnatal cardiac development and in adult hearts in mice. Conditional gene targeting was used in mice to explore the role of PGC-1 coactivators during postnatal cardiac development and in adult hearts. Marked mitochondrial structural derangements were observed in hearts of PGC-1α/β-deficient mice during postnatal growth, including fragmentation and elongation, associated with the development of a lethal cardiomyopathy. The expression of genes involved in mitochondrial fusion (Mfn1, Opa1) and fission (Drp1, Fis1) was altered in the hearts of PGC-1α/β-deficient mice. PGC-lα was shown to directly regulate Mfn1 gene transcription by coactivating the estrogen-related receptor α on a conserved DNA element. Surprisingly, PGC-1α/β deficiency in the adult heart did not result in evidence of abnormal mitochondrial dynamics or heart failure. However, transcriptional profiling demonstrated that PGC-1 coactivators are required for high-level expression of nuclear- and mitochondrial-encoded genes involved in mitochondrial dynamics and energy transduction in the adult heart. These results reveal distinct developmental stage-specific programs involved in cardiac mitochondrial dynamics.

Temporal activation of β-catenin signaling in the chondrogenic process of mesenchymal stem cells affects the phenotype of the cartilage generated.

PubMed

Yang, Zheng; Zou, Yu; Guo, Xi Min; Tan, Hwee San; Denslin, Vinitha; Yeow, Chen Hua; Ren, Xia Fei; Liu, Tong Ming; Hui, James Hp; Lee, Eng Hin

2012-07-20

Adult mesenchymal stem cells (MSCs) are an attractive cell source for cartilage tissue engineering. In vitro predifferentiation of MSCs has been explored as a means to enhance MSC-based articular cartilage repair. However, there remain challenges to control and prevent the premature progression of MSC-derived chondrocytes to the hypertrophy. This study investigated the temporal effect of transforming growth factor (TGF)-β and β-catenin signaling co-activation during MSC chondrogenic differentiation and evaluated the influence of these predifferentiation conditions to subsequent phenotypic development of the cartilage. MSCs were differentiated in chondrogenic medium that contained either TGFβ alone, TGFβ with transient β-catenin coactivation, or TGFβ with continuous β-catenin coactivation. After in vitro differentiation, the pellets were transplanted into SCID mice. Both coactivation protocols resulted in the enhancement of chondrogenic differentiation of MSCs. Compared with TGFβ activation, transient coactivation of TGFβ-induction with β-catenin activation resulted in heightened hypertrophy and formed highly ossified tissues with marrow-like hematopoietic tissue in vivo. The continuous coactivation of the 2 signaling pathways, however, resulted in inhibition of progression to hypertrophy, marked by the suppression of type X collagen, Runx2, and alkaline phosphatase expression, and did not result in ossified tissue in vivo. Chondrocytes of the continuous co-activation samples secreted significantly more parathyroid hormone-related protein (PTHrP) and expressed cyclin D1. Our results suggest that temporal co-activation of the TGFβ signaling pathway with β-catenin can yield cartilage of different phenotype, represents a potential MSC predifferentiation protocol before clinical implantation, and has potential applications for the engineering of cartilage tissue.

A truncated, activin-induced Smad3 isoform acts as a transcriptional repressor of FSHβ expression in mouse pituitary

PubMed Central

Kim, So-Youn; Zhu, Jie; Woodruff, Teresa K.

2011-01-01

The receptor-regulated protein Smad3 is key player in the signaling cascade stimulated by the binding of activin to its cell surface receptor. Upon phosphorylation, Smad3 forms a heterocomplex with Smad2 and Smad4, translocates to the nucleus and acts as a transcriptional co-activator. We have identified a unique isoform of Smad3 that is expressed in mature pituitary gonadotropes. 5' RACE revealed that this truncated Smad3 isoform is transcribed from an ATG site within exon 4 and consists of 7 exons encoding half of the linker region and the MH2 region. In pituitary cells, the truncated Smad3 isoform was phosphorylated upon activin treatment, in a manner that was temporally distinct from the phosphorylation of full-length Smad3. Activin-induced phosphorylation of Smad3 and the truncated Smad3 isoform was blocked by both follistatin and siRNA-mediated knockdown of Smad3. The truncated Smad3 isoform antagonized Smad3-mediated, activin-responsive promoter activity. We propose that the pituitary gonadotrope contains an ultra-short, activin-responsive feedback loop utilizing two different isoforms of Smad3, one which acts as an agonist (Smad3) and another that acts as an intracrine antagonist (truncated Smad3 isoform) to regulate FSHβ production. PMID:21664424

The Hippo pathway member Yap plays a key role in influencing fate decisions in muscle satellite cells

PubMed Central

Judson, Robert N.; Tremblay, Annie M.; Knopp, Paul; White, Robert B.; Urcia, Roby; De Bari, Cosimo; Zammit, Peter S.; Camargo, Fernando D.; Wackerhage, Henning

2012-01-01

Summary Satellite cells are the resident stem cells of skeletal muscle. Mitotically quiescent in mature muscle, they can be activated to proliferate and generate myoblasts to supply further myonuclei to hypertrophying or regenerating muscle fibres, or self-renew to maintain the resident stem cell pool. Here, we identify the transcriptional co-factor Yap as a novel regulator of satellite cell fate decisions. Yap expression increases during satellite cell activation and Yap remains highly expressed until after the differentiation versus self-renewal decision is made. Constitutive expression of Yap maintains Pax7+ and MyoD+ satellite cells and satellite cell-derived myoblasts, promotes proliferation but prevents differentiation. In contrast, Yap knockdown reduces the proliferation of satellite cell-derived myoblasts by ≈40%. Consistent with the cellular phenotype, microarrays show that Yap increases expression of genes associated with Yap inhibition, the cell cycle, ribosome biogenesis and that it represses several genes associated with angiotensin signalling. We also identify known regulators of satellite cell function such as BMP4, CD34 and Myf6 (Mrf4) as genes whose expression is dependent on Yap activity. Finally, we confirm in myoblasts that Yap binds to Tead transcription factors and co-activates MCAT elements which are enriched in the proximal promoters of Yap-responsive genes. PMID:23038772

Rational design and validation of a Tip60 histone acetyltransferase inhibitor

NASA Astrophysics Data System (ADS)

Gao, Chunxia; Bourke, Emer; Scobie, Martin; Famme, Melina Arcos; Koolmeister, Tobias; Helleday, Thomas; Eriksson, Leif A.; Lowndes, Noel F.; Brown, James A. L.

2014-06-01

Histone acetylation is required for many aspects of gene regulation, genome maintenance and metabolism and dysfunctional acetylation is implicated in numerous diseases, including cancer. Acetylation is regulated by histone acetyltransferases (HATs) and histone deacetylases and currently, few general HAT inhibitors have been described. We identified the HAT Tip60 as an excellent candidate for targeted drug development, as Tip60 is a key mediator of the DNA damage response and transcriptional co-activator. Our modeling of Tip60 indicated that the active binding pocket possesses opposite charges at each end, with the positive charges attributed to two specific side chains. We used structure based drug design to develop a novel Tip60 inhibitor, TH1834, to fit this specific pocket. We demonstrate that TH1834 significantly inhibits Tip60 activity in vitro and treating cells with TH1834 results in apoptosis and increased unrepaired DNA damage (following ionizing radiation treatment) in breast cancer but not control cell lines. Furthermore, TH1834 did not affect the activity of related HAT MOF, as indicated by H4K16Ac, demonstrating specificity. The modeling and validation of the small molecule inhibitor TH1834 represents a first step towards developing additional specific, targeted inhibitors of Tip60 that may lead to further improvements in the treatment of breast cancer.

Cyclic AMP-dependent modification of gonad-selective TAF(II)105 in a human ovarian granulosa cell line.

PubMed

Wu, Yimin; Lu, Yunzhe; Hu, Yanfen; Li, Rong

2005-11-01

In response to gonadotropins, the elevated level of intracellular-cyclic AMP (cAMP) in ovarian granulosa cells triggers an ordered activation of multiple ovarian genes, which in turn promotes various ovarian functions including folliculogenesis and steroidogenesis. Identification and characterization of transcription factors that control ovarian gene expression are pivotal to the understanding of the molecular basis of the tissue-specific gene regulation programs. The recent discovery of the mouse TATA binding protein (TBP)-associated factor 105 (TAF(II)105) as a gonad-selective transcriptional co-activator strongly suggests that general transcription factors such as TFIID may play a key role in regulating tissue-specific gene expression. Here we show that the human TAF(II)105 protein is preferentially expressed in ovarian granulosa cells. We also identified a novel TAF(II)105 mRNA isoform that results from alternative exon inclusion and is predicted to encode a dominant negative mutant of TAF(II)105. Following stimulation by the adenylyl cyclase activator forskolin, TAF(II)105 in granulosa cells undergoes rapid and transient phosphorylation that is dependent upon protein kinase A (PKA). Thus, our work suggests that pre-mRNA processing and post-translational modification represent two important regulatory steps for the gonad-specific functions of human TAF(II)105. Copyright 2005 Wiley-Liss, Inc.

Heterodimers of Retinoic Acid Receptors and Thyroid Hormone Receptors Display Unique Combinatorial Regulatory Properties

PubMed Central

Lee, Sangho; Privalsky, Martin L.

2009-01-01

Nuclear receptors are ligand-regulated transcription factors that regulate key aspects of metazoan development, differentiation, and homeostasis. Nuclear receptors recognize target genes by binding to specific DNA recognition sequences, denoted hormone response elements (HREs). Many nuclear receptors can recognize HREs as either homodimers or heterodimers. Retinoid X receptors (RXRs), in particular, serve as important heterodimer partners for many other nuclear receptors, including thyroid hormone receptors (TRs), and RXR/TR heterodimers have been proposed to be the primary mediators of target gene regulation by T3 hormone. Here, we report that the retinoic acid receptors (RARs), a distinct class of nuclear receptors, are also efficient heterodimer partners for TRs. These RAR/TR heterodimers form with similar affinities as RXR/TR heterodimers on an assortment of consensus and natural HREs, and preferentially assemble with the RAR partner 5′ of the TR moiety. The corepressor and coactivator recruitment properties of these RAR/TR heterodimers and their transcriptional activities in vivo are distinct from those observed with the corresponding RXR heterodimers. Our studies indicate that RXRs are not unique in their ability to partner with TRs, and that RARs can also serve as robust heterodimer partners and combinatorial regulators of T3-modulated gene expression. PMID:15650024

Thyroid function in mice with compound heterozygous and homozygous disruptions of SRC-1 and TIF-2 coactivators: evidence for haploinsufficiency.

PubMed

Weiss, Roy E; Gehin, Martine; Xu, Jianming; Sadow, Peter M; O'Malley, Bert W; Chambon, Pierre; Refetoff, Samuel

2002-04-01

Steroid receptor coactivator (SRC)-1 and transcriptional intermediary factor (TIF)-2 are homologous nuclear receptor coactivators. We have investigated their possible redundancy as thyroid hormone (TH) coactivators by measuring thyroid function in compound SRC-1 and TIF-2 knock out (KO) mice. Whereas SRC-1 KO (SRC-1(-/-)) mice are resistant to TH and SRC-1(+/-) are not, we now demonstrate that TIF-2 KO (TIF-2(-/-)) mice have normal thyroid function. Yet double heterozygous, SRC-1(+/-)/TIF-2(+/-) mice manifested resistance to TH of a similar degree as that in mice completely deficient in SRC-1. KO of both SRC-1 and TIF-2 resulted in marked increases of serum TH and thyrotropin concentrations. This work demonstrates gene dosage effect in nuclear coactivators manifesting as haploinsufficiency and functional redundancy of SRC-1 and TIF-2.

YAP and TAZ: a nexus for Hippo signaling and beyond

PubMed Central

Guan, Kun-Liang

2015-01-01

The Hippo pathway is a potent regulator of cellular proliferation, differentiation, and tissue homeostasis. Here we review the regulatory mechanisms of the Hippo pathway and discuss the function of Yes-associated protein (YAP)/transcriptional coactivator with a PDZ-binding domain (TAZ), the prime mediators of the Hippo pathway, in stem cell biology and tissue regeneration. We highlight their activities in both the nucleus and the cytoplasm and discuss their role as a signaling nexus and integrator of several other prominent signaling pathways such as the Wnt, G protein-coupled receptor (GPCR), epidermal growth factor (EGF), BMP/transforming growth factor beta (TGFβ), and Notch pathways. PMID:26045258

Coactivation of lower leg muscles during body weight-supported treadmill walking decreases with age in adolescents.

PubMed

Deffeyes, Joan E; Karst, Gregory M; Stuberg, Wayne A; Kurz, Max J

2012-08-01

The kinematics of children's walking are nearly adult-like by about age 3-4 years, but metabolic efficiency of walking does not reach adult values until late in adolescence or early adulthood, perhaps due to higher coactivation of agonist/antagonist muscle pairs in adolescents. Additionally, it is unknown how use of a body weight-supported treadmill device affects coactivation, but because unloading will alter the activity of anti-gravity muscles, it was hypothesized that muscle coactivation will be altered as well. Muscle coactivation during treadmill walking was evaluated for adolescents (ages 10 to 17 years, M = 13.2, SD = 2.2) and adults (ages 22 to 35 years, M = 25.2, SD = 4.3), for thigh muscles (vastus lateralis/biceps femoris) and lower leg muscles (tibialis anterior/gastrocnemius). Conditions included body weight unloadings from nearly 0% to 80% of body weight, while walking at a preferred speed (self-selected, overground speed) or a reduced speed. Unloading was accomplished using a lower body positive pressure support system. Coactivation was found to be higher in adolescents than in adults, but only for the lower leg muscles.

Task vs. rest-different network configurations between the coactivation and the resting-state brain networks.

PubMed

Di, Xin; Gohel, Suril; Kim, Eun H; Biswal, Bharat B

2013-01-01

There is a growing interest in studies of human brain networks using resting-state functional magnetic resonance imaging (fMRI). However, it is unclear whether and how brain networks measured during the resting-state exhibit comparable properties to brain networks during task performance. In the present study, we investigated meta-analytic coactivation patterns among brain regions based upon published neuroimaging studies, and compared the coactivation network configurations with those in the resting-state network. The strength of resting-state functional connectivity between two regions were strongly correlated with the coactivation strength. However, the coactivation network showed greater global efficiency, smaller mean clustering coefficient, and lower modularity compared with the resting-state network, which suggest a more efficient global information transmission and between system integrations during task performing. Hub shifts were also observed within the thalamus and the left inferior temporal cortex. The thalamus and the left inferior temporal cortex exhibited higher and lower degrees, respectively in the coactivation network compared with the resting-state network. These results shed light regarding the reconfiguration of the brain networks between task and resting-state conditions, and highlight the role of the thalamus in change of network configurations in task vs. rest.

Task vs. rest—different network configurations between the coactivation and the resting-state brain networks

PubMed Central

Di, Xin; Gohel, Suril; Kim, Eun H.; Biswal, Bharat B.

2013-01-01

There is a growing interest in studies of human brain networks using resting-state functional magnetic resonance imaging (fMRI). However, it is unclear whether and how brain networks measured during the resting-state exhibit comparable properties to brain networks during task performance. In the present study, we investigated meta-analytic coactivation patterns among brain regions based upon published neuroimaging studies, and compared the coactivation network configurations with those in the resting-state network. The strength of resting-state functional connectivity between two regions were strongly correlated with the coactivation strength. However, the coactivation network showed greater global efficiency, smaller mean clustering coefficient, and lower modularity compared with the resting-state network, which suggest a more efficient global information transmission and between system integrations during task performing. Hub shifts were also observed within the thalamus and the left inferior temporal cortex. The thalamus and the left inferior temporal cortex exhibited higher and lower degrees, respectively in the coactivation network compared with the resting-state network. These results shed light regarding the reconfiguration of the brain networks between task and resting-state conditions, and highlight the role of the thalamus in change of network configurations in task vs. rest. PMID:24062654

HER4 selectively coregulates estrogen stimulated genes associated with breast tumor cell proliferation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Han, Wen; Jones, Frank E., E-mail: fjones3@tulane.edu

2014-01-10

Highlights: •HER4/4ICD is an obligate coactivator for 37% of estrogen regulated genes. •HER4/4ICD coactivated genes selectively regulate estrogen stimulated proliferation. •Estrogen stimulated tumor cell migration occurs independent of HER4/4ICD. •Disrupting HER4/4ICD and ER coactivated gene expression may suppress breast cancer. -- Abstract: The EGFR-family member HER4 undergoes regulated intramembrane proteolysis (RIP) to generate an intracellular domain (4ICD) that functions as a transcriptional coactivator. Accordingly, 4ICD coactivates the estrogen receptor (ER) and associates with ER at target gene promoters in breast tumor cells. However, the extent of 4ICD coactivation of ER and the functional significance of the 4ICD/ER transcriptional complex ismore » unclear. To identify 4ICD coactivated genes we performed a microarray gene expression analysis of β-estradiol treated cells comparing control MCF-7 breast cancer cells to MCF-7 cells where HER4 expression was stably suppressed using a shRNA. In the MCF-7 cell line, β-estradiol significantly stimulated or repressed by 2-fold or more 726 or 53 genes, respectively. Significantly, HER4/4ICD was an obligate coactivator for 277 or 38% of the β-estradiol stimulated genes. Ingenuity Pathway Analysis of β-estradiol regulated genes identified significant associations with multiple cellular functions regulating cellular growth and proliferation, cell cycle progression, cancer metastasis, decreased hypoplasia, tumor cell migration, apoptotic resistance of tumor cells, and increased transcription. Genes coactivated by 4ICD displayed functional specificity by only significantly contributing to cellular growth and proliferation, cell cycle progression, and decreased hypoplasia. In direct concordance with these in situ results we show that HER4 knockdown in MCF-7 cells results in a loss of estrogen stimulated tumor cell proliferation and cell cycle progression, whereas, estrogen stimulated tumor cell migration was unaffected by loss of HER4 expression. In summary, we demonstrate for the first time that a cell surface receptor functions as an obligate ER coactivator with functional specificity associated with breast tumor cell proliferation and cell cycle progression. Nearly 90% of ER positive tumors coexpress HER4, therefore we predict that the majority of breast cancer patients would benefit from a strategy to therapeutic disengage ER/4ICD coregulated tumor cell proliferation.« less

The Hippo signaling pathway in liver regeneration and tumorigenesis.

PubMed

Hong, Lixin; Cai, Yabo; Jiang, Mingting; Zhou, Dawang; Chen, Lanfen

2015-01-01

The Hippo signaling pathway is an evolutionarily conserved signaling module that plays critical roles in liver size control and tumorigenesis. The Hippo pathway consists of a core kinase cascade in which the mammalian Ste20-like kinases (Mst1/2, orthologs of Drosophila Hippo) and their cofactor Salvador (Sav1) form a complex to phosphorylate and activate the large tumor suppressor (Lats1/2). Lats1/2 kinases in turn phosphorylate and inhibit the transcription co-activators, the Yes-associated protein (YAP) and the transcriptional co-activator with PDZ-binding motif (TAZ), two major downstream effectors of the Hippo pathway. Losses of the Hippo pathway components induce aberrant hepatomegaly and tumorigenesis, in which YAP coordinates regulation of cell proliferation and apoptosis and plays an essential role. This review summarizes the current findings of the regulation of Hippo signaling in liver regeneration and tumorigenesis, focusing on how the loss of tumor suppressor components of the Hippo pathway results in liver cancers and discussing the molecular mechanisms that regulate the expression and activation of its downstream effector YAP in liver tumorigenesis. © The Author 2014. Published by ABBS Editorial Office in association with Oxford University Press on behalf of the Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences.

Inappropriate activation of the androgen receptor by nonsteroids: involvement of the Src kinase pathway and its therapeutic implications.

PubMed

Desai, Sonal J; Ma, Ai-Hong; Tepper, Clifford G; Chen, Hong-Wu; Kung, Hsing-Jien

2006-11-01

The inappropriate activation of androgen receptor (AR) by nonsteroids is considered a potential mechanism in the emergence of hormone-refractory prostate tumors, but little is known about the properties of these "pseudoactivated" AR. Here, we present the first comprehensive analysis closely examining the properties of AR activated by the neuropeptide bombesin that distinguish it from androgen-activated AR. We show that bombesin-activated AR (a) is required for bombesin-induced growth of LNCaP cells, (b) has a transcriptional profile overlapping with, but not identical to, androgen-activated AR, (c) activates prostate-specific antigen by preferentially binding to its proximal promoter, and (d) assembles a distinct coactivator complex. Significantly, we found that Src kinase is critical for bombesin-induced AR-mediated activity and is required for translocation and transactivation of AR. Additionally, we identify c-Myc, a Src target gene, to be activated by bombesin and a potential coactivator of AR-mediated activity specific to bombesin-induced signaling. Because Src kinase is often activated by other nonsteroids, such as other neuropeptides, growth factors, chemokines, and cytokines, our findings have general applicability and provide rationale for investigating the efficacy of the Src kinase pathway as a target for the prevention of relapsed prostate cancers.

A novel acetylation cycle of transcription co-activator Yes-associated protein that is downstream of Hippo pathway is triggered in response to SN2 alkylating agents.

PubMed

Hata, Shoji; Hirayama, Jun; Kajiho, Hiroaki; Nakagawa, Kentaro; Hata, Yutaka; Katada, Toshiaki; Furutani-Seiki, Makoto; Nishina, Hiroshi

2012-06-22

Yes-associated protein (YAP) is a transcriptional co-activator that acts downstream of the Hippo signaling pathway and regulates multiple cellular processes. Although cytoplasmic retention of YAP is known to be mediated by Hippo pathway-dependent phosphorylation, post-translational modifications that regulate YAP in the nucleus remain unclear. Here we report the discovery of a novel cycle of acetylation/deacetylation of nuclear YAP induced in response to S(N)2 alkylating agents. We show that after treatment of cells with the S(N)2 alkylating agent methyl methanesulfonate, YAP phosphorylation mediated by the Hippo pathway is markedly reduced, leading to nuclear translocation of YAP and its acetylation. This YAP acetylation occurs on specific and highly conserved C-terminal lysine residues and is mediated by the nuclear acetyltransferases CBP (CREB binding protein) and p300. Conversely, the nuclear deacetylase SIRT1 is responsible for YAP deacetylation. Intriguingly, we found that YAP acetylation is induced specifically by S(N)2 alkylating agents and not by other DNA-damaging stimuli. These results identify a novel YAP acetylation cycle that occurs in the nucleus downstream of the Hippo pathway. Intriguingly, our findings also indicate that YAP acetylation is involved in responses to a specific type of DNA damage.

A Novel Acetylation Cycle of Transcription Co-activator Yes-associated Protein That Is Downstream of Hippo Pathway Is Triggered in Response to SN2 Alkylating Agents*

PubMed Central

Hata, Shoji; Hirayama, Jun; Kajiho, Hiroaki; Nakagawa, Kentaro; Hata, Yutaka; Katada, Toshiaki; Furutani-Seiki, Makoto; Nishina, Hiroshi

2012-01-01

Yes-associated protein (YAP) is a transcriptional co-activator that acts downstream of the Hippo signaling pathway and regulates multiple cellular processes. Although cytoplasmic retention of YAP is known to be mediated by Hippo pathway-dependent phosphorylation, post-translational modifications that regulate YAP in the nucleus remain unclear. Here we report the discovery of a novel cycle of acetylation/deacetylation of nuclear YAP induced in response to SN2 alkylating agents. We show that after treatment of cells with the SN2 alkylating agent methyl methanesulfonate, YAP phosphorylation mediated by the Hippo pathway is markedly reduced, leading to nuclear translocation of YAP and its acetylation. This YAP acetylation occurs on specific and highly conserved C-terminal lysine residues and is mediated by the nuclear acetyltransferases CBP (CREB binding protein) and p300. Conversely, the nuclear deacetylase SIRT1 is responsible for YAP deacetylation. Intriguingly, we found that YAP acetylation is induced specifically by SN2 alkylating agents and not by other DNA-damaging stimuli. These results identify a novel YAP acetylation cycle that occurs in the nucleus downstream of the Hippo pathway. Intriguingly, our findings also indicate that YAP acetylation is involved in responses to a specific type of DNA damage. PMID:22544757

The peroxisome proliferator-activated receptor β/δ (PPARβ/δ) agonist GW501516 prevents TNF-α-induced NF-κB activation in human HaCaT cells by reducing p65 acetylation through AMPK and SIRT1.

PubMed

Barroso, Emma; Eyre, Elena; Palomer, Xavier; Vázquez-Carrera, Manuel

2011-02-15

Nuclear factor (NF)-κB is a ubiquitously expressed transcription factor controlling the expression of numerous genes involved in inflammation. The aim of this study was to evaluate whether activation of the peroxisome proliferator-activated receptor (PPAR) β/δ prevented TNF-α-induced NF-κB activation in human HaCaT keratinocytes and, if so, to determine the mechanism involved. The PPARβ/δ agonist GW501516 inhibited the increase caused by TNF-α in the mRNA levels of the NF-κB target genes interleukin 8 (IL-8), TNF-α and thymic stromal lymphopoietin (TSLP). Likewise, GW501516 prevented the increase in NF-κB DNA-binding activity observed in cells exposed to TNF-α. The reduction in NF-κB activity following GW501516 treatment in cells stimulated with TNF-α did not involve either increased IκBα protein levels or a reduction in the translocation of the p65 subunit of NF-κB. In contrast, GW501516 treatment decreased TNF-α-induced p65 acetylation. Acetylation of p65 is mainly regulated by p300, a transcriptional co-activator that binds to and acetylates p65. Of note, AMP kinase (AMPK) activation phosphorylates p300 and reduces its binding to p65. GW501516 increased AMPK phosphorylation and the subsequent p300 phosphorylation, leading to a marked reduction in the association between p65 and this transcriptional co-activator. In addition, treatment with the PPARβ/δ agonist increased SIRT1 protein levels. Finally, the reduction in IL-8 mRNA levels following GW501516 treatment in TNF-α-stimulated cells was abolished in the presence of the PPARβ/δ antagonist GSK0660, the AMPK inhibitor compound C and the SIRT1 inhibitor sirtinol, indicating that the effects of GW501516 on NF-κB activity were dependent on PPARβ/δ, AMPK and SIRT1, respectively. Copyright © 2010 Elsevier Inc. All rights reserved.

Inverse antagonist activities of parabens on human oestrogen-related receptor γ (ERRγ): In vitro and in silico studies

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhang, Zhaobin; Sun, Libei; Hu, Ying

2013-07-01

Parabens are p-hydroxybenzoic acid esters that have been used extensively as preservatives in foods, cosmetics, drugs and toiletries. These intact esters are commonly detected in human breast cancer tissues and other human samples, thus arousing concern about the involvement of parabens in human breast cancer. In this study, an in vitro nuclear receptor coactivator recruiting assay was developed and used to evaluate the binding activities of parabens, salicylates and benzoates via antagonist competitive binding on the human oestrogen-related receptor γ (ERRγ), which is known as both a diagnostic biomarker and a treatment target of breast cancer. The results showed thatmore » all of the test parabens (methyl-, ethyl-, propyl-, butyl- and benzylparaben) possessed clear inverse antagonist activities on ERRγ, with a lowest observed effect level (LOEL) of 10{sup −7} M and the 50% relative effective concentrations (REC50) varying from 3.09 × 10{sup −7} to 5.88 × 10{sup −7} M, whereas the salicylates possessed much lower activities and the benzoates showed no obvious activity. In silico molecular docking analyses showed that parabens fitted well into the active site of ERRγ, with hydrogen bonds forming between the p-hydroxyl group of parabens and the Glu275/Arg316 of ERRγ. As the paraben levels reported in breast cancer tissues are commonly higher than the LOELs observed in this study, parabens may play some role via ERRγ in the carcinogenesis of human breast cancer. In addition, parabens may have significant effects on breast cancer patients who are taking tamoxifen, as ERRγ is regarded as a treatment target for tamoxifen. - Highlights: • An oestrogen-related receptor γ coactivator recruiting assay was developed. • Strong binding activities of parabens with oestrogen-related receptor γ were found. • The paraben levels reported in breast cancer tissues were higher than their LOELs. • Parabens may play some role via ERRγ in the carcinogenesis of human breast cancer. • Parabens may have significant effects in breast cancer patients taking tamoxifen.« less

PPARγ activation attenuates cold-induced upregulation of thyroid status and brown adipose tissue PGC-1α and D2

PubMed Central

Festuccia, William T.; Blanchard, Pierre-Gilles; Oliveira, Thiago B.; Magdalon, Juliana; Paschoal, Vivian A.; Richard, Denis

2012-01-01

Here, we investigated whether pharmacological PPARγ activation modulates key early events in brown adipose tissue (BAT) recruitment induced by acute cold exposure with the aim of unraveling the interrelationships between sympathetic and PPARγ signaling. Sprague-Dawley rats treated or not with the PPARγ ligand rosiglitazone (15 mg·kg−1·day−1, 7 days) were kept at 23°C or exposed to cold (5°C) for 24 h and evaluated for BAT gene expression, sympathetic activity, thyroid status, and adrenergic signaling. Rosiglitazone did not affect the reduction in body weight gain and the increase in feed efficiency, V̇o2, and BAT sympathetic activity induced by 24-h cold exposure. Rosiglitazone strongly attenuated the increase in serum total and free T4 and T3 levels and BAT iodothyronine deiodinase type 2 (D2) and PGC-1α mRNA levels and potentiated the reduction in BAT thyroid hormone receptor (THR) β mRNA levels induced by cold. Administration of T3 to rosiglitazone-treated rats exacerbated the cold-induced increase in energy expenditure but did not restore a proper activation of D2 and PGC-1α, nor further increased uncoupling protein 1 expression. Regarding adrenergic signaling, rosiglitazone did not affect the changes in BAT cAMP content and PKA activity induced by cold. Rosiglitazone alone or in combination with cold increased CREB binding to DNA, but it markedly reduced the expression of one of its major coactivators, CREB binding protein. In conclusion, pharmacological PPARγ activation impairs short-term cold elicitation of BAT adrenergic and thyroid signaling, which may result in abnormal tissue recruitment and thermogenic activity. PMID:23100029

Improvement and decline in tactile discrimination behavior after cortical plasticity induced by passive tactile coactivation.

PubMed

Hodzic, Amra; Veit, Ralf; Karim, Ahmed A; Erb, Michael; Godde, Ben

2004-01-14

Perceptual learning can be induced by passive tactile coactivation without attention or reinforcement. We used functional MRI (fMRI) and psychophysics to investigate in detail the specificity of this type of learning for different tactile discrimination tasks and the underlying cortical reorganization. We found that a few hours of Hebbian coactivation evoked a significant increase of primary (SI) and secondary (SII) somatosensory cortical areas representing the stimulated body parts. The amount of plastic changes was strongly correlated with improvement in spatial discrimination performance. However, in the same subjects, frequency discrimination was impaired after coactivation, indicating that even maladaptive processes can be induced by intense passive sensory stimulation.

Dual-mode fluorophore-doped nickel nitrilotriacetic acid-modified silica nanoparticles combine histidine-tagged protein purification with site-specific fluorophore labeling.

PubMed

Kim, Sung Hoon; Jeyakumar, M; Katzenellenbogen, John A

2007-10-31

We present the first example of a fluorophore-doped nickel chelate surface-modified silica nanoparticle that functions in a dual mode, combining histidine-tagged protein purification with site-specific fluorophore labeling. Tetramethylrhodamine (TMR)-doped silica nanoparticles, estimated to contain 700-900 TMRs per ca. 23 nm particle, were surface modified with nitrilotriacetic acid (NTA), producing TMR-SiO2-NTA-Ni2+. Silica-embedded TMR retains very high quantum yield, is resistant to quenching by buffer components, and is modestly quenched and only to a certain depth (ca. 2 nm) by surface-attached Ni2+. When exposed to a bacterial lysate containing estrogen receptor alpha ligand binding domain (ERalpha) as a minor component, these beads showed very high specificity binding, enabling protein purification in one step. The capacity and specificity of these beads for binding a his-tagged protein were characterized by electrophoresis, radiometric counting, and MALDI-TOF MS. ERalpha, bound to TMR-SiO2-NTA-Ni++ beads in a site-specific manner, exhibited good activity for ligand binding and for ligand-induced binding to coactivators in solution FRET experiments and protein microarray fluorometric and FRET assays. This dual-mode type TMR-SiO2-NTA-Ni2+ system represents a powerful combination of one-step histidine-tagged protein purification and site-specific labeling with multiple fluorophore species.

DNA wrapping and distortion by an oligomeric homeodomain protein.

PubMed

Williams, Hannah; Jayaraman, Padma-Sheela; Gaston, Kevin

2008-10-31

Many transcription factors alter DNA or chromatin structure. Changes in chromatin structure are often brought about by the recruitment of chromatin-binding proteins, chromatin-modifying proteins, or other transcription co-activator or co-repressor proteins. However, some transcription factors form oligomeric assemblies that may themselves induce changes in DNA conformation and chromatin structure. The proline-rich homeodomain (PRH/Hex) protein is a transcription factor that regulates cell differentiation and cell proliferation, and has multiple roles in embryonic development. Earlier, we showed that PRH can repress transcription by multiple mechanisms, including the recruitment of co-repressor proteins belonging to the TLE family of chromatin-binding proteins. Our in vivo crosslinking studies have shown that PRH forms oligomeric complexes in cells and a variety of biophysical techniques suggest that the protein forms octamers. However, as yet we have little knowledge of the role played by PRH oligomerisation in the regulation of promoter activity or of the architecture of promoters that are regulated directly by PRH in cells. Here, we compare the binding of PRH and the isolated PRH homeodomain to DNA fragments with single and multiple PRH sites, using gel retardation assays and DNase I and chemical footprinting. We show that the PRH oligomer binds to multiple sites within the human Goosecoid promoter with high affinity and that the binding of PRH brings about DNA distortion. We suggest that PRH octamers wrap DNA in order to bring about transcriptional repression.

TAF(II)250: a transcription toolbox.

PubMed

Wassarman, D A; Sauer, F

2001-08-01

Activation of RNA-polymerase-II-dependent transcription involves conversion of signals provided by gene-specific activator proteins into the synthesis of messenger RNA. This conversion requires dynamic structural changes in chromatin and assembly of general transcription factors (GTFs) and RNA polymerase II at core promoter sequence elements surrounding the transcription start site of genes. One hallmark of transcriptional activation is the interaction of DNA-bound activators with coactivators such as the TATA-box binding protein (TBP)-associated factors (TAF(II)s) within the GTF TFIID. TAF(II)250 possesses a variety of activities that are likely to contribute to the initial steps of RNA polymerase II transcription. TAF(II)250 is a scaffold for assembly of other TAF(II)s and TBP into TFIID, TAF(II)250 binds activators to recruit TFIID to particular promoters, TAF(II)250 regulates binding of TBP to DNA, TAF(II)250 binds core promoter initiator elements, TAF(II)250 binds acetylated lysine residues in core histones, and TAF(II)250 possesses protein kinase, ubiquitin-activating/conjugating and acetylase activities that modify histones and GTFs. We speculate that these activities achieve two goals--(1) they aid in positioning and stabilizing TFIID at particular promoters, and (2) they alter chromatin structure at the promoter to allow assembly of GTFs--and we propose a model for how TAF(II)250 converts activation signals into active transcription.

The Hippo signal transduction network for exercise physiologists

PubMed Central

Hamilton, D. Lee; Tremblay, Annie M.

2016-01-01

The ubiquitous transcriptional coactivators Yap (gene symbol Yap1) and Taz (gene symbol Wwtr1) regulate gene expression mainly by coactivating the Tead transcription factors. Being at the center of the Hippo signaling network, Yap and Taz are regulated by the Hippo kinase cassette and additionally by a plethora of exercise-associated signals and signaling modules. These include mechanotransduction, the AKT-mTORC1 network, the SMAD transcription factors, hypoxia, glucose homeostasis, AMPK, adrenaline/epinephrine and angiotensin II through G protein-coupled receptors, and IL-6. Consequently, exercise should alter Hippo signaling in several organs to mediate at least some aspects of the organ-specific adaptations to exercise. Indeed, Tead1 overexpression in muscle fibers has been shown to promote a fast-to-slow fiber type switch, whereas Yap in muscle fibers and cardiomyocytes promotes skeletal muscle hypertrophy and cardiomyocyte adaptations, respectively. Finally, genome-wide association studies in humans have linked the Hippo pathway members LATS2, TEAD1, YAP1, VGLL2, VGLL3, and VGLL4 to body height, which is a key factor in sports. PMID:26940657

Programmable Payload Release from Transient Polymer Microcapsules Triggered by a Specific Ion Coactivation Effect.

PubMed

Tang, Shijia; Tang, Liuyan; Lu, Xiaocun; Liu, Huiying; Moore, Jeffrey S

2018-01-10

Stimuli-responsive materials activated by a pair of molecular or ionic species are of interest in the design of chemical logic gates and signal amplification schemes. There are relatively few materials whose coactivated response has been well-characterized. Here, we demonstrate a specific ion coactivation (SICA) effect at the interfaces of transient polymer solids and liquid solutions. We found that depolymerization of the transient polymer, cyclic poly(phthalaldehyde) (cPPA), exhibited a SICA effect when the cPPA core-shell microcapsules were suspended in ion-containing acidic methanol solutions. Significant acceleration in cPPA depolymerization rate is triggered by the combination of acid and ion coactivators. Intriguingly, the SICA effect is related to the Hofmeister behavior. The SICA effect is primarily determined by anions, and cations exhibit a secondary effect that modulates the coactivation strength. Based on these observations, we developed cPPA programmable microcapsules whose payload release rates depend on the composition and concentration of the salt/acidic-methanol solutions.

Mechanisms of pseudosubstrate inhibition of the anaphase promoting complex by Acm1

PubMed Central

Burton, Janet L; Xiong, Yong; Solomon, Mark J

2011-01-01

The anaphase promoting complex (APC) is a ubiquitin ligase that promotes the degradation of cell-cycle regulators by the 26S proteasome. Cdc20 and Cdh1 are WD40-containing APC co-activators that bind destruction boxes (DB) and KEN boxes within substrates to recruit them to the APC for ubiquitination. Acm1 is an APCCdh1 inhibitor that utilizes a DB and a KEN box to bind Cdh1 and prevent substrate binding, although Acm1 itself is not a substrate. We investigated what differentiates an APC substrate from an inhibitor. We identified the Acm1 A-motif that interacts with Cdh1 and together with the DB and KEN box is required for APCCdh1 inhibition. A genetic screen identified Cdh1 WD40 domain residues important for Acm1 A-motif interaction and inhibition that appears to reside near Cdh1 residues important for DB recognition. Specific lysine insertion mutations within Acm1 promoted its ubiquitination by APCCdh1 whereas lysine removal from the APC substrate Hsl1 converted it into a potent APCCdh1 inhibitor. These findings suggest that tight Cdh1 binding combined with the inaccessibility of ubiquitinatable lysines contributes to pseudosubstrate inhibition of APCCdh1. PMID:21460798

Structural properties of the promiscuous VP16 activation domain.

PubMed

Jonker, Hendrik R A; Wechselberger, Rainer W; Boelens, Rolf; Folkers, Gert E; Kaptein, Rob

2005-01-25

Herpes simplex virion protein 16 (VP16) contains two strong activation regions that can independently and cooperatively activate transcription in vivo. We have identified the regions and residues involved in the interaction with the human transcriptional coactivator positive cofactor 4 (PC4) and the general transcription factor TFIIB. NMR and biochemical experiments revealed that both VP16 activation regions are required for the interaction and undergo a conformational transition from random coil to alpha-helix upon binding to its target PC4. The interaction is strongly electrostatically driven and the binding to PC4 is enhanced by the presence of its amino-terminal domain. We propose models for binding of VP16 to the core domains of PC4 and TFIIB that are based on two independent docking approaches using NMR chemical shift changes observed in titration experiments. The models are consistent with results from site-directed mutagenesis and provide an explanation for the contribution of both acidic and hydrophobic residues for transcriptional activation by VP16. Both intrinsically unstructured activation domains are attracted to their interaction partner by electrostatic interactions, and adopt an alpha-helical conformation around the important hydrophobic residues. The models showed multiple distinct binding surfaces upon interaction with various partners, providing an explanation for the promiscuous properties, cooperativity, and the high activity of this activation domain.

Co-activation of RanGTPase and inhibition of GTP dissociation by Ran-GTP binding protein RanBP1.

PubMed Central

Bischoff, F R; Krebber, H; Smirnova, E; Dong, W; Ponstingl, H

1995-01-01

RCC1 (the regulator of chromosome condensation) stimulates guanine nucleotide dissociation on the Ras-related nuclear protein Ran. Both polypeptides are components of a regulatory pathway that has been implicated in regulating DNA replication, onset of and exit from mitosis, mRNA processing and transport, and import of proteins into the nucleus. In a search for further members of the RCC1-Ran signal pathway, we have identified proteins of 23, 45 and 300 kDa which tightly bind to Ran-GTP but not Ran-GDP. The purified soluble 23 kDa Ran binding protein RanBP1 does not activate RanGTPase, but increases GTP hydrolysis induced by the RanGTPase-activating protein RanGAP1 by an order of magnitude. In the absence of RanGAP, it strongly inhibits RCC1-induced exchange of Ran-bound GTP. In addition, it forms a stable complex with nucleotide-free RCC1-Ran. With these properties, it differs markedly from guanine diphosphate dissociation inhibitors which preferentially prevent the exchange of protein-bound GDP and in some cases were shown to inhibit GAP-induced GTP hydrolysis. RanBP1 is the first member of a new class of proteins regulating the binding and hydrolysis of GTP by Ras-related proteins. Images PMID:7882974

MOLECULAR CHARACTERIZATION OF HTLV-1 TAX INTERACTION WITH THE KIX DOMAIN OF CBP/p300

PubMed Central

Ramírez, Julita A.; Nyborg, Jennifer K.

2007-01-01

Summary The viral oncoprotein Tax mediates transcriptional activation of human T-cell leukemia virus type 1 (HTLV-1). Both Tax and the cellular transcription factor CREB bind to viral cyclic AMP response elements (vCREs) located in the viral promoter. Tax and serine 133 phosphorylated CREB (pCREB) bound to the HTLV-1 promoter facilitate viral transcription via the recruitment of the large cellular coactivators CBP/p300. While the interaction between the phosphorylated kinase inducible domain (pKID) of pCREB and the KIX domain of CBP/p300 has been well-characterized, the molecular interactions between KIX, full-length Tax, and pCREB have not been examined. In this study we biochemically characterized the interaction between Tax and KIX in a physiologically relevant complex containing pCREB and vCRE DNA. Our data show that Tax and pCREB simultaneously and independently bind two distinct surfaces on the KIX domain: Tax binds KIX at the previously-characterized mixed-lineage leukemia (MLL) protein interaction surface while pCREB binds KIX at the pKID-KIX interface. These results provide evidence for a model in which Tax and pCREB bind distinct surfaces of KIX for effective CBP/p300 recruitment to the HTLV-1 promoter. We also show that MLL competes with Tax for KIX binding, suggesting a novel mechanism of Tax oncogenesis in which normal MLL function is disrupted by Tax. PMID:17707401

Exploring novel objective functions for simulating muscle coactivation in the neck.

PubMed

Mortensen, J; Trkov, M; Merryweather, A

2018-04-11

Musculoskeletal modeling allows for analysis of individual muscles in various situations. However, current techniques to realistically simulate muscle response when significant amounts of intentional coactivation is required are inadequate. This would include stiffening the neck or spine through muscle coactivation in preparation for perturbations or impacts. Muscle coactivation has been modeled previously in the neck and spine using optimization techniques that seek to maximize the joint stiffness by maximizing total muscle activation or muscle force. These approaches have not sought to replicate human response, but rather to explore the possible effects of active muscle. Coactivation remains a challenging feature to include in musculoskeletal models, and may be improved by extracting optimization objective functions from experimental data. However, the components of such an objective function must be known before fitting to experimental data. This study explores the effect of components in several objective functions, in order to recommend components to be used for fitting to experimental data. Four novel approaches to modeling coactivation through optimization techniques are presented, two of which produce greater levels of stiffness than previous techniques. Simulations were performed using OpenSim and MATLAB cooperatively. Results show that maximizing the moment generated by a particular muscle appears analogous to maximizing joint stiffness. The approach of optimizing for maximum moment generated by individual muscles may be a good candidate for developing objective functions that accurately simulate muscle coactivation in complex joints. This new approach will be the focus of future studies with human subjects. Copyright © 2018 Elsevier Ltd. All rights reserved.

YAP and MRTF-A, transcriptional co-activators of RhoA-mediated gene expression, are critical for glioblastoma tumorigenicity.

PubMed

Yu, Olivia M; Benitez, Jorge A; Plouffe, Steven W; Ryback, Daniel; Klein, Andrea; Smith, Jeff; Greenbaum, Jason; Delatte, Benjamin; Rao, Anjana; Guan, Kun-Liang; Furnari, Frank B; Chaim, Olga Meiri; Miyamoto, Shigeki; Brown, Joan Heller

2018-06-11

The role of YAP (Yes-associated protein 1) and MRTF-A (myocardin-related transcription factor A), two transcriptional co-activators regulated downstream of GPCRs (G protein-coupled receptors) and RhoA, in the growth of glioblastoma cells and in vivo glioblastoma multiforme (GBM) tumor development was explored using human glioblastoma cell lines and tumor-initiating cells derived from patient-derived xenografts (PDX). Knockdown of these co-activators in GSC-23 PDX cells using short hairpin RNA significantly attenuated in vitro self-renewal capability assessed by limiting dilution, oncogene expression, and neurosphere formation. Orthotopic xenografts of the MRTF-A and YAP knockdown PDX cells formed significantly smaller tumors and were of lower morbidity than wild-type cells. In vitro studies used PDX and 1321N1 glioblastoma cells to examine functional responses to sphingosine 1-phosphate (S1P), a GPCR agonist that activates RhoA signaling, demonstrated that YAP signaling was required for cell migration and invasion, whereas MRTF-A was required for cell adhesion; both YAP and MRTF-A were required for proliferation. Gene expression analysis by RNA-sequencing of S1P-treated MRTF-A or YAP knockout cells identified 44 genes that were induced through RhoA and highly dependent on YAP, MRTF-A, or both. Knockdown of F3 (tissue factor (TF)), a target gene regulated selectively through YAP, blocked cell invasion and migration, whereas knockdown of HBEGF (heparin-binding epidermal growth factor-like growth factor), a gene selectively induced through MRTF-A, prevented cell adhesion in response to S1P. Proliferation was sensitive to knockdown of target genes regulated through either or both YAP and MRTF-A. Expression of TF and HBEGF was also selectively decreased in tumors from PDX cells lacking YAP or MRTF-A, indicating that these transcriptional pathways are regulated in preclinical GBM models and suggesting that their activation through GPCRs and RhoA contributes to growth and maintenance of human GBM.

Enhancer Activation Requires Trans-Recruitment of a Mega Transcription Factor Complex

PubMed Central

Liu, Zhijie; Merkurjev, Daria; Yang, Feng; Li, Wenbo; Oh, Soohwan; Friedman, Meyer J.; Song, Xiaoyuan; Zhang, Feng; Ma, Qi; Ohgi, Kenneth; Krones, Anna; Rosenfeld, Michael G.

2014-01-01

Summary Enhancers provide critical information directing cell-type specific transcriptional programs, regulated by binding of signal-dependent transcription factors and their associated cofactors. Here we report that the most strongly activated estrogen (E2)-responsive enhancers are characterized by trans-recruitment and in situ assembly of a large 1-2 MDa complex of diverse DNA-binding transcription factors by ERα at ERE-containing enhancers. We refer to enhancers recruiting these factors as mega transcription factor-bound in trans (MegaTrans) enhancers. The MegaTrans complex is a signature of the most potent functional enhancers and is required for activation of enhancer RNA transcription and recruitment of coactivators, including p300 and Med1. The MegaTrans complex functions, in part, by recruiting specific enzymatic machinery, exemplified by DNA-dependent protein kinase. Thus, MegaTrans-containing enhancers represent a cohort of functional enhancers that mediate a broad and important transcriptional program and provide a molecular explanation for transcription factor clustering and hotspots noted in the genome. PMID:25303530

The Expanding Complexity of Estrogen Receptor Signaling in the Cardiovascular System

PubMed Central

Menazza, Sara; Murphy, Elizabeth

2016-01-01

Estrogen has important effects on cardiovascular function including regulation of vascular function, blood pressure, endothelial relaxation, the development of hypertrophy and cardioprotection. However, the mechanisms by which estrogen mediates these effects are still poorly understood. As detailed in this review, estrogen can regulate transcription by binding to two nuclear receptors, ERα and ERβ, which differentially regulate gene transcription. ERα and ERβ regulation of gene transcription is further modulated by tissue specific co-activators and co-repressors. Estrogen can bind to ERα and ERβ localized at the plasma membrane as well as GPER to initiate membrane delimited signaling, which enhances kinase signaling pathways that can have acute and long term effects. The kinase signaling pathways can also mediate transcriptional changes, and can synergize with the estrogen receptor to regulate cell function. This review will summarize the beneficial effects of estrogen in protecting the cardiovascular system through ER-dependent mechanisms with an emphasis on the role of the recently described ER-membrane signaling mechanisms. PMID:26838792

Folding propensity of intrinsically disordered proteins by osmotic stress

DOE PAGES

Mansouri, Amanda L.; Grese, Laura N.; Rowe, Erica L.; ...

2016-10-11

Proteins imparted with intrinsic disorder conduct a range of essential cellular functions. To better understand the folding and hydration properties of intrinsically disordered proteins (IDPs), we used osmotic stress to induce conformational changes in nuclear co-activator binding domain (NCBD) and activator for thyroid hormone and retinoid receptor (ACTR). Osmotic stress was applied by the addition of small and polymeric osmolytes, where we discovered that water contributions to NCBD folding always exceeded those for ACTR. Both NCBD and ACTR were found to gain a-helical structure with increasing osmotic stress, consistent with their folding upon NCBD/ACTR complex formation. Using small-angle neutron scatteringmore » (SANS), we further characterized NCBD structural changes with the osmolyte ethylene glycol. Here a large reduction in overall size initially occurred before substantial secondary structural change. In conclusion, by focusing on folding propensity, and linked hydration changes, we uncover new insights that may be important for how IDP folding contributes to binding.« less

Identification of Natural RORγ Ligands that Regulate the Development of Lymphoid Cells

PubMed Central

Santori, Fabio R.; Huang, Pengxiang; van de Pavert, Serge A.; Douglass, Eugene F.; Leaver, David J.; Haubrich, Brad A.; Keber, Rok; Lorbek, Gregor; Konijn, Tanja; Rosales, Brittany N.; Horvat, Simon; Rozman, Damjana; Rahier, Alain; Mebius, Reina E.; Rastinejad, Fraydoon; Nes, W. David; Littman, Dan R.

2015-01-01

SUMMARY Mice deficient in the nuclear hormone receptor RORγt have defective development of thymocytes, lymphoid organs, Th17 cells and type 3 innate lymphoid cells. RORγt binds to oxysterols derived from cholesterol catabolism but it is not clear whether these are its natural ligands. Here, we show that sterol lipids are necessary and sufficient to drive RORγt-dependent transcription. We combined overexpression, RNA interference and genetic deletion of metabolic enzymes to study RORγ-dependent transcription. Our results are consistent with the RORγt ligand(s) being a cholesterol biosynthetic intermediate (CBI) downstream of lanosterol and upstream of zymosterol. Analysis of lipids bound to RORγ identified molecules with molecular weights consistent with CBIs. Furthermore, CBIs stabilized the RORγ ligand-binding domain and induced co-activator recruitment. Genetic deletion of metabolic enzymes upstream of the RORγt-ligand(s) affected the development of lymph nodes and Th17 cells. Our data suggest that CBIs play a role in lymphocyte development potentially through regulation of RORγt. PMID:25651181

Roles of mono-ubiquitinated Smad4 in the formation of Smad transcriptional complexes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wang Bei; Suzuki, Hiroyuki; Kato, Mitsuyasu

2008-11-14

TGF-{beta} activates receptor-regulated Smad (R-Smad) through phosphorylation by type I receptors. Activated R-Smad binds to Smad4 and the complex translocates into the nucleus and stimulates the transcription of target genes through association with co-activators including p300. It is not clear, however, how activated Smad complexes are removed from target genes. In this study, we show that TGF-{beta} enhances the mono-ubiquitination of Smad4. Smad4 mono-ubiquitination was promoted by p300 and suppressed by the c-Ski co-repressor. Smad4 mono-ubiquitination disrupted the interaction with Smad2 in the presence of constitutively active TGF-{beta} type I receptor. Furthermore, mono-ubiquitinated Smad4 was not found in DNA-binding Smadmore » complexes. A Smad4-Ubiquitin fusion protein, which mimics mono-ubiquitinated Smad4, enhanced localization to the cytoplasm. These results suggest that mono-ubiquitination of Smad4 occurs in the transcriptional activator complex and facilitates the turnover of Smad complexes at target genes.« less

Roles of mono-ubiquitinated Smad4 in the formation of Smad transcriptional complexes.

PubMed

Wang, Bei; Suzuki, Hiroyuki; Kato, Mitsuyasu

2008-11-14

TGF-beta activates receptor-regulated Smad (R-Smad) through phosphorylation by type I receptors. Activated R-Smad binds to Smad4 and the complex translocates into the nucleus and stimulates the transcription of target genes through association with co-activators including p300. It is not clear, however, how activated Smad complexes are removed from target genes. In this study, we show that TGF-beta enhances the mono-ubiquitination of Smad4. Smad4 mono-ubiquitination was promoted by p300 and suppressed by the c-Ski co-repressor. Smad4 mono-ubiquitination disrupted the interaction with Smad2 in the presence of constitutively active TGF-beta type I receptor. Furthermore, mono-ubiquitinated Smad4 was not found in DNA-binding Smad complexes. A Smad4-Ubiquitin fusion protein, which mimics mono-ubiquitinated Smad4, enhanced localization to the cytoplasm. These results suggest that mono-ubiquitination of Smad4 occurs in the transcriptional activator complex and facilitates the turnover of Smad complexes at target genes.

CREB-binding protein (CBP) regulates β-adrenoceptor (β-AR)−mediated apoptosis

PubMed Central

Lee, Y Y; Moujalled, D; Doerflinger, M; Gangoda, L; Weston, R; Rahimi, A; de Alboran, I; Herold, M; Bouillet, P; Xu, Q; Gao, X; Du, X-J; Puthalakath, H

2013-01-01

Catecholamines regulate the β-adrenoceptor/cyclic AMP-regulated protein kinase A (cAMP/PKA) pathway. Deregulation of this pathway can cause apoptotic cell death and is implicated in a range of human diseases, such as neuronal loss during aging, cardiomyopathy and septic shock. The molecular mechanism of this process is, however, only poorly understood. Here we demonstrate that the β-adrenoceptor/cAMP/PKA pathway triggers apoptosis through the transcriptional induction of the pro-apoptotic BH3-only Bcl-2 family member Bim in tissues such as the thymus and the heart. In these cell types, the catecholamine-mediated apoptosis is abrogated by loss of Bim. Induction of Bim is driven by the transcriptional co-activator CBP (CREB-binding protein) together with the proto-oncogene c-Myc. Association of CBP with c-Myc leads to altered histone acetylation and methylation pattern at the Bim promoter site. Our findings have implications for understanding pathophysiology associated with a deregulated neuroendocrine system and for developing novel therapeutic strategies for these diseases. PMID:23579242

Folding propensity of intrinsically disordered proteins by osmotic stress

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mansouri, Amanda L.; Grese, Laura N.; Rowe, Erica L.

Proteins imparted with intrinsic disorder conduct a range of essential cellular functions. To better understand the folding and hydration properties of intrinsically disordered proteins (IDPs), we used osmotic stress to induce conformational changes in nuclear co-activator binding domain (NCBD) and activator for thyroid hormone and retinoid receptor (ACTR). Osmotic stress was applied by the addition of small and polymeric osmolytes, where we discovered that water contributions to NCBD folding always exceeded those for ACTR. Both NCBD and ACTR were found to gain a-helical structure with increasing osmotic stress, consistent with their folding upon NCBD/ACTR complex formation. Using small-angle neutron scatteringmore » (SANS), we further characterized NCBD structural changes with the osmolyte ethylene glycol. Here a large reduction in overall size initially occurred before substantial secondary structural change. In conclusion, by focusing on folding propensity, and linked hydration changes, we uncover new insights that may be important for how IDP folding contributes to binding.« less

Development of a lumbar EMG-based coactivation index for the assessment of complex dynamic tasks.

PubMed

Le, Peter; Aurand, Alexander; Walter, Benjamin A; Best, Thomas M; Khan, Safdar N; Mendel, Ehud; Marras, William S

2018-03-01

The objective of this study was to develop and test an EMG-based coactivation index and compare it to a coactivation index defined by a biologically assisted lumbar spine model to differentiate between tasks. The purpose was to provide a universal approach to assess coactivation of a multi-muscle system when a computational model is not accessible. The EMG-based index developed utilised anthropometric-defined muscle characteristics driven by torso kinematics and EMG. Muscles were classified as agonists/antagonists based upon 'simulated' moments of the muscles relative to the total 'simulated' moment. Different tasks were used to test the range of the index including lifting, pushing and Valsalva. Results showed that the EMG-based index was comparable to the index defined by a biologically assisted model (r 2  = 0.78). Overall, the EMG-based index provides a universal, usable method to assess the neuromuscular effort associated with coactivation for complex dynamic tasks when the benefit of a biomechanical model is not available. Practitioner Summary: A universal coactivation index for the lumbar spine was developed to assess complex dynamic tasks. This method was validated relative to a model-based index for use when a high-end computational model is not available. Its simplicity allows for fewer inputs and usability for assessment of task ergonomics and rehabilitation.

A sequence-specific transcription activator motif and powerful synthetic variants that bind Mediator using a fuzzy protein interface.

PubMed

Warfield, Linda; Tuttle, Lisa M; Pacheco, Derek; Klevit, Rachel E; Hahn, Steven

2014-08-26

Although many transcription activators contact the same set of coactivator complexes, the mechanism and specificity of these interactions have been unclear. For example, do intrinsically disordered transcription activation domains (ADs) use sequence-specific motifs, or do ADs of seemingly different sequence have common properties that encode activation function? We find that the central activation domain (cAD) of the yeast activator Gcn4 functions through a short, conserved sequence-specific motif. Optimizing the residues surrounding this short motif by inserting additional hydrophobic residues creates very powerful ADs that bind the Mediator subunit Gal11/Med15 with high affinity via a "fuzzy" protein interface. In contrast to Gcn4, the activity of these synthetic ADs is not strongly dependent on any one residue of the AD, and this redundancy is similar to that of some natural ADs in which few if any sequence-specific residues have been identified. The additional hydrophobic residues in the synthetic ADs likely allow multiple faces of the AD helix to interact with the Gal11 activator-binding domain, effectively forming a fuzzier interface than that of the wild-type cAD.

Bipartite functions of the CREB co-activators selectively direct alternative splicing or transcriptional activation

PubMed Central

Amelio, Antonio L; Caputi, Massimo; Conkright, Michael D

2009-01-01

The CREB regulated transcription co-activators (CRTCs) regulate many biological processes by integrating and converting environmental inputs into transcriptional responses. Although the mechanisms by which CRTCs sense cellular signals are characterized, little is known regarding how CRTCs contribute to the regulation of cAMP inducible genes. Here we show that these dynamic regulators, unlike other co-activators, independently direct either pre-mRNA splice-site selection or transcriptional activation depending on the cell type or promoter context. Moreover, in other scenarios, the CRTC co-activators coordinately regulate transcription and splicing. Mutational analyses showed that CRTCs possess distinct functional domains responsible for regulating either pre-mRNA splicing or transcriptional activation. Interestingly, the CRTC1–MAML2 oncoprotein lacks the splicing domain and is incapable of altering splice-site selection despite robustly activating transcription. The differential usage of these distinct domains allows CRTCs to selectively mediate multiple facets of gene regulation, indicating that co-activators are not solely restricted to coordinating alternative splicing with increase in transcriptional activity. PMID:19644446

Coactivation index of children with congenital upper limb reduction deficiencies before and after using a wrist-driven 3D printed partial hand prosthesis.

PubMed

Zuniga, Jorge M; Dimitrios, Katsavelis; Peck, Jean L; Srivastava, Rakesh; Pierce, James E; Dudley, Drew R; Salazar, David A; Young, Keaton J; Knarr, Brian A

2018-06-08

Co-contraction is the simultaneous activation of agonist and antagonist muscles that produces forces around a joint. It is unknown if the use of a wrist-driven 3D printed transitional prostheses has any influence on the neuromuscular motor control strategies of the affected hand of children with unilateral upper-limb reduction deficiencies. Thus, the purpose of the current investigation was to examine the coactivation index (CI) of children with congenital upper-limb reduction deficiencies before and after 6 months of using a wrist-driven 3D printed partial hand prosthesis. Electromyographic activity of wrist flexors and extensors (flexor carpi ulnaris and extensor digitorum) was recorded during maximal voluntary contraction of the affected and non-affected wrists. Co-contraction was calculated using the coactivation index and was expressed as percent activation of antagonist over agonist. Nine children (two girls and seven boys, 6 to 16 years of age) with congenital upper-limb deficiencies participated in this study and were fitted with a wrist-driven 3D printed prosthetic hand. From the nine children, five (two girls and three boys, 7 to 10 years of age) completed a second visit after using the wrist-driven 3D printed partial hand prosthesis for 6 months. Separate two-way repeated measures ANOVAs were performed to analyze the coactivation index and strength data. There was a significant main effect for hand with the affected hand resulting in a higher coactivation index for flexion and extension than the non-affected hand. For wrist flexion there was a significant main effect for time indicating that the affected and non-affected hand had a significantly lower coactivation index after a period of 6 months. The use of a wrist-driven 3D printed hand prosthesis lowered the coactivation index by 70% in children with congenital upper limb reduction deficiencies. This reduction in coactivation and possible improvement in motor control strategies can potentially improve prosthetic rehabilitation outcomes.

A truncated, activin-induced Smad3 isoform acts as a transcriptional repressor of FSHβ expression in mouse pituitary.

PubMed

Kim, So-Youn; Zhu, Jie; Woodruff, Teresa K

2011-08-06

The receptor-regulated protein Smad3 is key player in the signaling cascade stimulated by the binding of activin to its cell surface receptor. Upon phosphorylation, Smad3 forms a heterocomplex with Smad2 and Smad4, translocates to the nucleus and acts as a transcriptional co-activator. We have identified a unique isoform of Smad3 that is expressed in mature pituitary gonadotropes. 5' RACE revealed that this truncated Smad3 isoform is transcribed from an ATG site within exon 4 and consists of 7 exons encoding half of the linker region and the MH2 region. In pituitary cells, the truncated Smad3 isoform was phosphorylated upon activin treatment, in a manner that was temporally distinct from the phosphorylation of full-length Smad3. Activin-induced phosphorylation of Smad3 and the truncated Smad3 isoform was blocked by both follistatin and siRNA-mediated knockdown of Smad3. The truncated Smad3 isoform antagonized Smad3-mediated, activin-responsive promoter activity. We propose that the pituitary gonadotrope contains an ultra-short, activin-responsive feedback loop utilizing two different isoforms of Smad3, one which acts as an agonist (Smad3) and another that acts as an intracrine antagonist (truncated Smad3 isoform) to regulate FSHβ production. Copyright © 2011 Elsevier Ltd. All rights reserved.

Nr-CAM is a target gene of the beta-catenin/LEF-1 pathway in melanoma and colon cancer and its expression enhances motility and confers tumorigenesis.

PubMed

Conacci-Sorrell, Maralice E; Ben-Yedidia, Tamar; Shtutman, Michael; Feinstein, Elena; Einat, Paz; Ben-Ze'ev, Avri

2002-08-15

beta-catenin and plakoglobin (gamma-catenin) are homologous molecules involved in cell adhesion, linking cadherin receptors to the cytoskeleton. beta-catenin is also a key component of the Wnt pathway by being a coactivator of LEF/TCF transcription factors. To identify novel target genes induced by beta-catenin and/or plakoglobin, DNA microarray analysis was carried out with RNA from cells overexpressing either protein. This analysis revealed that Nr-CAM is the gene most extensively induced by both catenins. Overexpression of either beta-catenin or plakoglobin induced Nr-CAM in a variety of cell types and the LEF/TCF binding sites in the Nr-CAM promoter were required for its activation by catenins. Retroviral transduction of Nr-CAM into NIH3T3 cells stimulated cell growth, enhanced motility, induced transformation, and produced rapidly growing tumors in nude mice. Nr-CAM and LEF-1 expression was elevated in human colon cancer tissue and cell lines and in human malignant melanoma cell lines but not in melanocytes or normal colon tissue. Dominant negative LEF-1 decreased Nr-CAM expression and antibodies to Nr-CAM inhibited the motility of B16 melanoma cells. The results indicate that induction of Nr-CAM transcription by beta-catenin or plakoglobin plays a role in melanoma and colon cancer tumorigenesis, probably by promoting cell growth and motility.

A KAP1 phosphorylation switch controls MyoD function during skeletal muscle differentiation.

PubMed

Singh, Kulwant; Cassano, Marco; Planet, Evarist; Sebastian, Soji; Jang, Suk Min; Sohi, Gurjeev; Faralli, Hervé; Choi, Jinmi; Youn, Hong-Duk; Dilworth, F Jeffrey; Trono, Didier

2015-03-01

The transcriptional activator MyoD serves as a master controller of myogenesis. Often in partnership with Mef2 (myocyte enhancer factor 2), MyoD binds to the promoters of hundreds of muscle genes in proliferating myoblasts yet activates these targets only upon receiving cues that launch differentiation. What regulates this off/on switch of MyoD function has been incompletely understood, although it is known to reflect the action of chromatin modifiers. Here, we identify KAP1 (KRAB [Krüppel-like associated box]-associated protein 1)/TRIM28 (tripartite motif protein 28) as a key regulator of MyoD function. In myoblasts, KAP1 is present with MyoD and Mef2 at many muscle genes, where it acts as a scaffold to recruit not only coactivators such as p300 and LSD1 but also corepressors such as G9a and HDAC1 (histone deacetylase 1), with promoter silencing as the net outcome. Upon differentiation, MSK1-mediated phosphorylation of KAP1 releases the corepressors from the scaffold, unleashing transcriptional activation by MyoD/Mef2 and their positive cofactors. Thus, our results reveal KAP1 as a previously unappreciated interpreter of cell signaling, which modulates the ability of MyoD to drive myogenesis. © 2015 Singh et al.; Published by Cold Spring Harbor Laboratory Press.

Low-ω3 Fatty Acid and Soy Protein Attenuate Alcohol-Induced Fatty Liver and Injury by Regulating the Opposing Lipid Oxidation and Lipogenic Signaling Pathways

PubMed Central

Reyes-Gordillo, Karina; Shah, Ruchi; Varatharajalu, Ravi; Garige, Mamatha; Leckey, Leslie C.

2016-01-01

Chronic ethanol-induced downregulation of peroxisome proliferator-activated receptor gamma coactivator 1-alpha (PGC1α) and upregulation of peroxisome proliferator-activated receptor gamma coactivator 1-beta (PGC1β) affect hepatic lipid oxidation and lipogenesis, respectively, leading to fatty liver injury. Low-ω3 fatty acid (Low-ω3FA) that primarily regulates PGC1α and soy protein (SP) that seems to have its major regulatory effect on PGC1β were evaluated for their protective effects against ethanol-induced hepatosteatosis in rats fed with Lieber-deCarli control or ethanol liquid diets with high or low ω3FA fish oil and soy protein. Low-ω3FA and SP opposed the actions of chronic ethanol by reducing serum and liver lipids with concomitant decreased fatty liver. They also prevented the downregulation of hepatic Sirtuin 1 (SIRT1) and PGC1α and their target fatty acid oxidation pathway genes and attenuated the upregulation of hepatic PGC1β and sterol regulatory element-binding protein 1c (SREBP1c) and their target lipogenic pathway genes via the phosphorylation of 5′ adenosine monophosphate-activated protein kinase (AMPK). Thus, these two novel modulators attenuate ethanol-induced hepatosteatosis and consequent liver injury potentially by regulating the two opposing lipid oxidation and lipogenic pathways. PMID:28074114

Antitumor activity of curcumin is involved in down-regulation of YAP/TAZ expression in pancreatic cancer cells.

PubMed

Zhou, Xiuxia; Su, Jingna; Feng, Shaoyan; Wang, Lixia; Yin, Xuyuan; Yan, Jingzhe; Wang, Zhiwei

2016-11-29

Pancreatic cancer (PC) is one of the most aggressive human malignancies worldwide and is the fourth leading cause of cancer-related deaths. Curcumin (diferuloylmethane) is a polyphenol derived from the Curcuma longa plant. Certain studies have demonstrated that curcumin exerts its anti-tumor function in a variety of human cancers including PC, via targeting multiple therapeutically important cancer signaling pathways. However, the detailed molecular mechanisms are not fully understood. Two transcriptional co-activators, YAP (Yes-associated protein) and its close paralog TAZ (transcriptional coactivator with PDZ-binding motif) exert oncogenic activities in various cancers. Therefore, in this study we aimed to determine the molecular basis of curcumin-induced cell proliferation inhibition in PC cells. First, we detected the anti-tumor effects of curcumin on PC cell lines using CTG assay, Flow cytometry, clonogenic assay, wound healing assay and Transwell invasion assay. We found that curcumin significantly suppressed cell growth, weakened clonogenic potential, inhibited migration and invasion, and induced apoptosis and cell cycle arrest in PC cells. We further measured that overexpression of YAP enhanced cell proliferation and abrogated the cytotoxic effects of curcumin on PC cells. Moreover, we found that curcumin markedly down-regulated YAP and TAZ expression and subsequently suppressed Notch-1 expression. Collectively, these findings suggest that pharmacological inhibition of YAP and TAZ activity may be a promising anticancer strategy for the treatment of PC patients.

Regulation of androgen receptor and histone deacetylase 1 by Mdm2-mediated ubiquitylation.

PubMed

Gaughan, Luke; Logan, Ian R; Neal, David E; Robson, Craig N

2005-01-01

The androgen receptor (AR) is a member of the nuclear hormone receptor family of transcription factors and plays a critical role in regulating the expression of genes involved in androgen-dependent and -independent tumour formation. Regulation of the AR is achieved by alternate binding of either histone acetyltransferase (HAT)-containing co-activator proteins, or histone deacetylase 1 (HDAC1). Factors that control AR stability may also constitute an important regulatory mechanism, a notion that has been confirmed with the finding that the AR is a direct target for Mdm2-mediated ubiquitylation and proteolysis. Using chromatin immunoprecipitation (ChIP) and re-ChIP analyses, we show that Mdm2 associates with AR and HDAC1 at the active androgen-responsive PSA promoter in LNCaP prostate cancer cells. Furthermore, we demonstrate that Mdm2-mediated modification of AR and HDAC1 catalyses protein destabilization and attenuates AR sactivity, suggesting that ubiquitylation of the AR and HDAC1 may constitute an additional mechanism for regulating AR function. We also show that HDAC1 and Mdm2 function co-operatively to reduce AR-mediated transcription that is attenuated by the HAT activity of the AR co-activator Tip60, suggesting interplay between acetylation status and receptor ubiquitylation in AR regulation. In all, our data indicates a novel role for Mdm2 in regulating components of the AR transcriptosome.

Activation of orphan nuclear constitutive androstane receptor requires subnuclear targeting by peroxisome proliferator-activated receptor gamma coactivator-1 alpha. A possible link between xenobiotic response and nutritional state.

PubMed

Shiraki, Takuma; Sakai, Noriko; Kanaya, Eiko; Jingami, Hisato

2003-03-28

In contrast to the classical nuclear receptors, the constitutive androstane receptor (CAR) is transcriptionally active in the absence of ligand. In the course of searching for the mediator of CAR activation, we found that ligand-independent activation of CAR was achieved in cooperation with the peroxisome proliferator-activated receptor gamma coactivator-1 alpha (PGC-1 alpha). PGC-1 beta, a PGC-1 alpha homologue, also activated CAR to less of an extent than PGC-1 alpha. Coexpression of the ligand-binding domain of a heterodimerization partner, retinoid X receptor alpha, enhanced the PGC-1 alpha-mediated activation of CAR, although it had a weak effect on the basal activity of CAR in the absence of PGC-1 alpha. Both the N-terminal region, with the LXXLL motif, and the C-terminal region, with a serine/arginine-rich domain (RS domain), in PGC-1 alpha were required for full activation of CAR. Pull-down experiments using recombinant proteins revealed that CAR directly interacted with both the LXXLL motif and the RS domain. Furthermore, we demonstrated that the RS domain of PGC-1 alpha was required for CAR localization at nuclear speckles. These results indicate that PGC-1 alpha mediates the ligand-independent activation of CAR by means of subnuclear targeting through the RS domain of PGC-1 alpha.

A liver X receptor (LXR)-{beta} alternative splicing variant (LXRBSV) acts as an RNA co-activator of LXR-{beta}

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hashimoto, Koshi, E-mail: khashi@med.gunma-u.ac.jp; Ishida, Emi; Matsumoto, Shunichi

2009-12-25

We report the isolation and functional characterization of a novel transcriptional co-activator, termed LXRBSV. LXRBSV is an alternative splicing variant of liver X receptor (LXR)-{beta} LXRBSV has an intronic sequence between exons 2 and 3 in the mouse LXR-{beta} gene. The LXRBSV gene is expressed in various tissues including the liver and brain. We sub-cloned LXRBSV into pSG5, a mammalian expression vector, and LXRBSV in pSG5 augmented human Sterol Response Element Binding Protein (SREBP)-1c promoter activity in HepG2 cells in a ligand (TO901317) dependent manner. The transactivation mediated by LXRBSV is selective for LXR-{beta}. The LXRBSV protein was deduced tomore » be 64 amino acids in length; however, a GAL4-LXRBSV fusion protein was not able to induce transactivation. Serial deletion constructs of LXRBSV demonstrated that the intronic sequence inserted in LXRBSV is required for its transactivation activity. An ATG mutant of LXRBSV was able to induce transactivation as wild type. Furthermore, LXRBSV functions in the presence of cycloheximide. Taken together, we have concluded that LXRBSV acts as an RNA transcript not as a protein. In the current study, we have demonstrated for the first time that an alternative splicing variant of a nuclear receptor acts as an RNA co-activator.« less

Interaction of the B cell-specific transcriptional coactivator OCA-B and galectin-1 and a possible role in regulating BCR-mediated B cell proliferation.

PubMed

Yu, Xin; Siegel, Rachael; Roeder, Robert G

2006-06-02

OCA-B is a B cell-specific transcriptional coactivator for OCT factors during the activation of immunoglobulin genes. In addition, OCA-B is crucial for B cell activation and germinal center formation. However, the molecular mechanisms for OCA-B function in these processes are not clear. Our previous studies documented two OCA-B isoforms and suggested a novel mechanism for the function of the myristoylated, membrane-bound form of OCA-B/p35 as a signaling molecule. Here, we report the identification of galectin-1, and related galectins, as a novel OCA-B-interacting protein. The interaction of OCA-B and galectin-1 can be detected both in vivo and in vitro. The galectin-1 binding domain in OCA-B has been localized to the N terminus of OCA-B. In B cells lacking OCA-B expression, increased galectin-1 expression, secretion, and cell surface association are observed. Consistent with these observations, and a reported inhibitory interaction of galectin-1 with CD45, the phosphatase activity of CD45 is reduced modestly, but significantly, in OCA-B-deficient B cells. Finally, galectin-1 is shown to negatively regulate B cell proliferation and tyrosine phosphorylation upon BCR stimulation. Together, these results raise the possibility that OCA-B may regulate BCR signaling through an association with galectin-1.

Oxaloacetate activates brain mitochondrial biogenesis, enhances the insulin pathway, reduces inflammation and stimulates neurogenesis.

PubMed

Wilkins, Heather M; Harris, Janna L; Carl, Steven M; E, Lezi; Lu, Jianghua; Eva Selfridge, J; Roy, Nairita; Hutfles, Lewis; Koppel, Scott; Morris, Jill; Burns, Jeffrey M; Michaelis, Mary L; Michaelis, Elias K; Brooks, William M; Swerdlow, Russell H

2014-12-15

Brain bioenergetic function declines in some neurodegenerative diseases, this may influence other pathologies and administering bioenergetic intermediates could have therapeutic value. To test how one intermediate, oxaloacetate (OAA) affects brain bioenergetics, insulin signaling, inflammation and neurogenesis, we administered intraperitoneal OAA, 1-2 g/kg once per day for 1-2 weeks, to C57Bl/6 mice. OAA altered levels, distributions or post-translational modifications of mRNA and proteins (proliferator-activated receptor-gamma coactivator 1α, PGC1 related co-activator, nuclear respiratory factor 1, transcription factor A of the mitochondria, cytochrome oxidase subunit 4 isoform 1, cAMP-response element binding, p38 MAPK and adenosine monophosphate-activated protein kinase) in ways that should promote mitochondrial biogenesis. OAA increased Akt, mammalian target of rapamycin and P70S6K phosphorylation. OAA lowered nuclear factor κB nucleus-to-cytoplasm ratios and CCL11 mRNA. Hippocampal vascular endothelial growth factor mRNA, doublecortin mRNA, doublecortin protein, doublecortin-positive neuron counts and neurite length increased in OAA-treated mice. (1)H-MRS showed OAA increased brain lactate, GABA and glutathione thereby demonstrating metabolic changes are detectable in vivo. In mice, OAA promotes brain mitochondrial biogenesis, activates the insulin signaling pathway, reduces neuroinflammation and activates hippocampal neurogenesis. © The Author 2014. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Antitumor activity of curcumin is involved in down-regulation of YAP/TAZ expression in pancreatic cancer cells

PubMed Central

Wang, Lixia; Yin, Xuyuan; Yan, Jingzhe; Wang, Zhiwei

2016-01-01

Pancreatic cancer (PC) is one of the most aggressive human malignancies worldwide and is the fourth leading cause of cancer-related deaths. Curcumin (diferuloylmethane) is a polyphenol derived from the Curcuma longa plant. Certain studies have demonstrated that curcumin exerts its anti-tumor function in a variety of human cancers including PC, via targeting multiple therapeutically important cancer signaling pathways. However, the detailed molecular mechanisms are not fully understood. Two transcriptional co-activators, YAP (Yes-associated protein) and its close paralog TAZ (transcriptional coactivator with PDZ-binding motif) exert oncogenic activities in various cancers. Therefore, in this study we aimed to determine the molecular basis of curcumin-induced cell proliferation inhibition in PC cells. First, we detected the anti-tumor effects of curcumin on PC cell lines using CTG assay, Flow cytometry, clonogenic assay, wound healing assay and Transwell invasion assay. We found that curcumin significantly suppressed cell growth, weakened clonogenic potential, inhibited migration and invasion, and induced apoptosis and cell cycle arrest in PC cells. We further measured that overexpression of YAP enhanced cell proliferation and abrogated the cytotoxic effects of curcumin on PC cells. Moreover, we found that curcumin markedly down-regulated YAP and TAZ expression and subsequently suppressed Notch-1 expression. Collectively, these findings suggest that pharmacological inhibition of YAP and TAZ activity may be a promising anticancer strategy for the treatment of PC patients. PMID:27738325

Procollagen Lysyl Hydroxylase 2 Expression Is Regulated by an Alternative Downstream Transforming Growth Factor β-1 Activation Mechanism*

PubMed Central

Gjaltema, Rutger A. F.; de Rond, Saskia; Rots, Marianne G.; Bank, Ruud A.

2015-01-01

PLOD2 (procollagen-lysine, 2-oxoglutarate 5-dioxygenase 2) hydroxylates lysine residues in collagen telopeptides and is essential for collagen pyridinoline cross-link formation. PLOD2 expression and subsequent pyridinoline cross-links are increased in fibrotic pathologies by transforming growth factor β-1 (TGFβ1). In this report we examined the molecular processes underlying TGFβ1-induced PLOD2 expression. We found that binding of the TGFβ1 pathway related transcription factors SMAD3 and SP1-mediated TGFβ1 enhanced PLOD2 expression and could be correlated to an increase of acetylated histone H3 and H4 at the PLOD2 promoter. Interestingly, the classical co-activators of SMAD3 complexes, p300 and CBP, were not responsible for the enhanced H3 and H4 acetylation. Depletion of SMAD3 reduced PLOD2 acetylated H3 and H4, indicating that another as of yet unidentified histone acetyltransferase binds to SMAD3 at PLOD2. Assessing histone methylation marks at the PLOD2 promoter depicted an increase of the active histone mark H3K79me2, a decrease of the repressive H4K20me3 mark, but no role for the generally strong transcription-related modifications: H3K4me3, H3K9me3 and H3K27me3. Collectively, our findings reveal that TGFβ1 induces a SP1- and SMAD3-dependent recruitment of histone modifying enzymes to the PLOD2 promoter other than the currently known TGFβ1 downstream co-activators and epigenetic modifications. This also suggests that additional activation strategies are used downstream of the TGFβ1 pathway, and hence their unraveling could be of great importance to fully understand TGFβ1 activation of genes. PMID:26432637

Novel mechanisms for the vitamin D receptor (VDR) in the skin and in skin cancer.

PubMed

Bikle, Daniel D; Oda, Yuko; Tu, Chia-Ling; Jiang, Yan

2015-04-01

The VDR acting with or without its principal ligand 1,25(OH)2D regulates two central processes in the skin, interfollicular epidermal (IFE) differentiation and hair follicle cycling (HFC). Calcium is an important co-regulator with 1,25(OH)2D at least of epidermal differentiation. Knockout of the calcium sensing receptor (CaSR) in addition to VDR accelerates the development of skin cancer in mice on a low calcium diet. Coactivators such as mediator 1 (aka DRIP205) and steroid receptor coactivator 3 (SRC3) regulate VDR function at different stages of the differentiation process, with Med 1 essential for hair follicle differentiation and early stages of epidermal differentiation and proliferation and SRC3 essential for the latter stages of differentiation including formation of the permeability barrier and innate immunity. The corepressor of VDR, hairless (HR), is essential for hair follicle cycling, although its effect on epidermal differentiation in vivo is minimal. In its regulation of HFC and IFE VDR controls two pathways-wnt/β-catenin and sonic hedgehog (SHH). In the absence of VDR these pathways are overexpressed leading to tumor formation. Whereas, VDR binding to β-catenin may block its activation of TCF/LEF1 sites, β-catenin binding to VDR may enhance its activation of VDREs. 1,25(OH)2D promotes but may not be required for these interactions. Suppression of SHH expression by VDR, on the other hand, requires 1,25(OH)2D. The major point of emphasis is that the role of VDR in the skin involves a number of novel mechanisms, both 1,25(OH)2D dependent and independent, that when disrupted interfere with IFE differentiation and HFC, predisposing to cancer formation. This article is part of a Special Issue entitled '17th Vitamin D Workshop'. Copyright © 2014 Elsevier Ltd. All rights reserved.

BRCA1-IRIS regulates cyclin D1 expression in breast cancer cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nakuci, Enkeleda; Mahner, Sven; DiRenzo, James

2006-10-01

The regulator of cell cycle progression, cyclin D1, is up-regulated in breast cancer cells; its expression is, in part, dependent on ER{alpha} signaling. However, many ER{alpha}-negative tumors and tumor cell lines (e.g., SKBR3) also show over-expression of cyclin D1. This suggests that, in addition to ER{alpha} signaling, cyclin D1 expression is under the control of other signaling pathways; these pathways may even be over-expressed in the ER{alpha}-negative cells. We previously noticed that both ER{alpha}-positive and -negative cell lines over-express BRCA1-IRIS mRNA and protein. Furthermore, the level of over-expression of BRCA1-IRIS in ER{alpha}-negative cell lines even exceeded its over-expression level inmore » ER{alpha}-positive cell lines. In this study, we show that: (1) BRCA1-IRIS forms complex with two of the nuclear receptor co-activators, namely, SRC1 and SRC3 (AIB1) in an ER{alpha}-independent manner. (2) BRCA1-IRIS alone, or in connection with co-activators, is recruited to the cyclin D1 promoter through its binding to c-Jun/AP1 complex; this binding activates the cyclin D1 expression. (3) Over-expression of BRCA1-IRIS in breast cells over-activates JNK/c-Jun; this leads to the induction of cyclin D1 expression and cellular proliferation. (4) BRCA1-IRIS activation of JNK/c-Jun/AP1 appears to account for this, because in cells that were depleted from BRCA1-IRIS, JNK remained inactive. However, depletion of SRC1 or SRC3 instead reduced c-Jun expression. Our data suggest that this novel signaling pathway links BRCA1-IRIS to cellular proliferation through c-Jun/AP1 nuclear pathway; finally, this culminates in the increased expression of the cyclin D1 gene.« less

Regulation of cyclic adenosine monophosphate response element binding protein on renin expression in kidney via complex cyclic adenosine monophosphate response element-binding-protein-binding protein/P300 recruitment.

PubMed

Li, Pei; Zhang, Jing; Zhu, Yuanfang; Liu, Ming; Xuan, Jin

2015-11-01

Renin synthesis and release is the rate-limiting step in the renin-angiotensin system, because cyclic adenosine monophosphate (cAMP) has been identified as dominant pathway for renin gene expression, and cAMP response element-binding protein (CREB) is found in the human and mouse renin promoter. This study aimed to evaluate the role of CREB in expression of the renin gene. We created conditional deletion of CREB in mice with low-sodium diet, specifically in renin cells of the kidney. To assess the effect of CREB on renin expression, immunostaining of renin was used in samples from wild-type mice and mice with gene knock-down of CREB. Cyclic AMP response element-binding-protein-binding protein (CBP) and p300 were measured in cultured renin cells of the mice, and RNA detection was done with real-time polymerase chain reaction. With low-sodium diet, renin was expressed along the whole wall of the afferent glomerular arterioles in wild-type mice, while there was no increase or even decrease in renin expression in CREB-specific deletion mice; RNA level of renin in cultured cells decreased by 50% with single knock-down of CREB, CBP, or p300, and decreased 70% with triple knock-down of CREB, CBP, and p300. This study found that CREB was important for renin synthesis and the role of CREB can be achieved through the recruitment of co-activators CBP and p300.

Contributions of Torpedo nicotinic acetylcholine receptor gamma Trp-55 and delta Trp-57 to agonist and competitive antagonist function.

PubMed

Xie, Y; Cohen, J B

2001-01-26

Results of affinity-labeling studies and mutational analyses provide evidence that the agonist binding sites of the nicotinic acetylcholine receptor (nAChR) are located at the alpha-gamma and alpha-delta subunit interfaces. For Torpedo nAChR, photoaffinity-labeling studies with the competitive antagonist d-[(3)H]tubocurarine (dTC) identified two tryptophans, gammaTrp-55 and deltaTrp-57, as the primary sites of photolabeling in the non-alpha subunits. To characterize the importance of gammaTrp-55 and deltaTrp-57 to the interactions of agonists and antagonists, Torpedo nAChRs were expressed in Xenopus oocytes, and equilibrium binding assays and electrophysiological recordings were used to examine the functional consequences when either or both tryptophans were mutated to leucine. Neither substitution altered the equilibrium binding of dTC. However, the deltaW57L and gammaW55L mutations decreased acetylcholine (ACh) binding affinity by 20- and 7,000-fold respectively. For the wild-type, gammaW55L, and deltaW57L nAChRs, the concentration dependence of channel activation was characterized by Hill coefficients of 1.8, 1.1, and 1.7. For the gammaW55L mutant, dTC binding at the alpha-gamma site acts not as a competitive antagonist but as a coactivator or partial agonist. These results establish that interactions with gamma Trp-55 of the Torpedo nAChR play a crucial role in agonist binding and in the agonist-induced conformational changes that lead to channel opening.

Hippo Signaling: Key Emerging Pathway in Cellular and Whole-Body Metabolism.

PubMed

Ardestani, Amin; Lupse, Blaz; Maedler, Kathrin

2018-05-05

The evolutionarily conserved Hippo pathway is a key regulator of organ size and tissue homeostasis. Its dysregulation is linked to multiple pathological disorders. In addition to regulating development and growth, recent studies show that Hippo pathway components such as MST1/2 and LATS1/2 kinases, as well as YAP/TAZ transcriptional coactivators, are regulated by metabolic pathways and that the Hippo pathway controls metabolic processes at the cellular and organismal levels in physiological and metabolic disease states such as obesity, type 2 diabetes (T2D), nonalcoholic fatty liver disease (NAFLD), cardiovascular disorders, and cancer. In this review we summarize the connection between key Hippo components and metabolism, and how this interplay regulates cellular metabolism and metabolic pathways. The emerging function of Hippo in the regulation of metabolic homeostasis under physiological and pathological conditions is highlighted. Copyright © 2018 Elsevier Ltd. All rights reserved.

Synergic co-activation of muscles in elbow flexion via fractional Brownian motion.

PubMed

Chang, Shyang; Hsyu, Ming-Chun; Cheng, Hsiu-Yao; Hsieh, Sheng-Hwu

2008-12-31

In reflex and volitional actions, co-activations of agonist and antagonist muscles are believed to be present. Recent studies indicate that such co-activations can be either synergic or dyssynergic. The aim of this paper is to investigate if the co-activations of biceps brachii, brachialis, and triceps brachii during volitional elbow flexion are in the synergic or dyssynergic state. In this study, two groups with each containing six healthy male volunteers participated. Each person of the first group performed 30 trials of volitional elbow flexion while each of the second group performed 30 trials of passive elbow flexion as control experiments. Based on the model of fractional Brownian motion, the intensity and frequency information of the surface electromyograms (EMGs) could be extracted simultaneously. No statistically significant changes were found in the control group. As to the other group, results indicated that the surface EMGs of all five muscle groups were temporally synchronized in frequencies with persistent intensities during each elbow flexion. In addition, the mean values of fractal dimensions for rest and volitional flexion states revealed significant differences with P < 0.01. The obtained positive results suggest that these muscle groups work together synergically to facilitate elbow flexion during the co-activations.

MicroRNA-22 and microRNA-140 suppress NF-{kappa}B activity by regulating the expression of NF-{kappa}B coactivators

DOE Office of Scientific and Technical Information (OSTI.GOV)

Takata, Akemi; Otsuka, Motoyuki, E-mail: otsukamo-tky@umin.ac.jp; Kojima, Kentaro

2011-08-12

Highlights: {yields} miRNAs were screened for their ability to regulate NF-{kappa}B activity. {yields} miRNA-22 and miRNA-140-3p suppress NF-{kappa}B activity by regulating coactivators. {yields} miRNA-22 targets nuclear receptor coactivator 1 (NCOA1). {yields} miRNA-140-3p targets nuclear receptor-interacting protein 1 (NRIP1). -- Abstract: Nuclear factor {kappa}B (NF-{kappa}B) is a transcription factor that regulates a set of genes that are critical to many biological phenomena, including liver tumorigenesis. To identify microRNAs (miRNAs) that regulate NF-{kappa}B activity in the liver, we screened 60 miRNAs expressed in hepatocytes for their ability to modulate NF-{kappa}B activity. We found that miRNA-22 and miRNA-140-3p significantly suppressed NF-{kappa}B activity bymore » regulating the expression of nuclear receptor coactivator 1 (NCOA1) and nuclear receptor-interacting protein 1 (NRIP1), both of which are NF-{kappa}B coactivators. Our results provide new information about the roles of miRNAs in the regulation of NF-{kappa}B activity.« less

Differential coactivation in a redundant signals task with weak and strong go/no-go stimuli.

PubMed

Minakata, Katsumi; Gondan, Matthias

2018-05-01

When participants respond to stimuli of two sources, response times (RTs) are often faster when both stimuli are presented together relative to the RTs obtained when presented separately (redundant signals effect [RSE]). Race models and coactivation models can explain the RSE. In race models, separate channels process the two stimulus components, and the faster processing time determines the overall RT. In audiovisual experiments, the RSE is often higher than predicted by race models, and coactivation models have been proposed that assume integrated processing of the two stimuli. Where does coactivation occur? We implemented a go/no-go task with randomly intermixed weak and strong auditory, visual, and audiovisual stimuli. In one experimental session, participants had to respond to strong stimuli and withhold their response to weak stimuli. In the other session, these roles were reversed. Interestingly, coactivation was only observed in the experimental session in which participants had to respond to strong stimuli. If weak stimuli served as targets, results were widely consistent with the race model prediction. The pattern of results contradicts the inverse effectiveness law. We present two models that explain the result in terms of absolute and relative thresholds.

Competition between Ski and CREB-binding protein for binding to Smad proteins in transforming growth factor-beta signaling.

PubMed

Chen, Weijun; Lam, Suvana S; Srinath, Hema; Schiffer, Celia A; Royer, William E; Lin, Kai

2007-04-13

The family of Smad proteins mediates transforming growth factor-beta (TGF-beta) signaling in cell growth and differentiation. Smads repress or activate TGF-beta signaling by interacting with corepressors (e.g. Ski) or coactivators (e.g. CREB-binding protein (CBP)), respectively. Specifically, Ski has been shown to interfere with the interaction between Smad3 and CBP. However, it is unclear whether Ski competes with CBP for binding to Smads and whether they can interact with Smad3 at the same binding surface on Smad3. We investigated the interactions among purified constructs of Smad, Ski, and CBP in vitro by size-exclusion chromatography, isothermal titration calorimetry, and mutational studies. Here, we show that Ski-(16-192) interacted directly with a homotrimer of receptor-regulated Smad protein (R-Smad), e.g. Smad2 or Smad3, to form a hexamer; Ski-(16-192) interacted with an R-Smad.Smad4 heterotrimer to form a pentamer. CBP-(1941-1992) was also found to interact directly with an R-Smad homotrimer to form a hexamer and with an R-Smad.Smad4 heterotrimer to form a pentamer. Moreover, these domains of Ski and CBP competed with each other for binding to Smad3. Our mutational studies revealed that domains of Ski and CBP interacted with Smad3 at a portion of the binding surface of the Smad anchor for receptor activation. Our results suggest that Ski negatively regulates TGF-beta signaling by replacing CBP in R-Smad complexes. Our working model suggests that Smad protein activity is delicately balanced by Ski and CBP in the TGF-beta pathway.

The Acetylase/Deacetylase Couple CREB-binding Protein/Sirtuin 1 Controls Hypoxia-inducible Factor 2 Signaling*

PubMed Central

Chen, Rui; Xu, Min; Hogg, Richard T.; Li, Jiwen; Little, Bertis; Gerard, Robert D.; Garcia, Joseph A.

2012-01-01

Hypoxia-inducible factors (HIFs) are oxygen-sensitive transcription factors. HIF-1α plays a prominent role in hypoxic gene induction. HIF-2α target genes are more restricted but include erythropoietin (Epo), one of the most highly hypoxia-inducible genes in mammals. We previously reported that HIF-2α is acetylated during hypoxia but is rapidly deacetylated by the stress-responsive deacetylase Sirtuin 1. We now demonstrate that the lysine acetyltransferases cAMP-response element-binding protein-binding protein (CBP) and p300 are required for efficient Epo induction during hypoxia. However, despite close structural similarity, the roles of CBP and p300 differ in HIF signaling. CBP acetylates HIF-2α, is a major coactivator for HIF-2-mediated Epo induction, and is required for Sirt1 augmentation of HIF-2 signaling during hypoxia in Hep3B cells. In comparison, p300 is a major contributor for HIF-1 signaling as indicated by induction of Pgk1. Whereas CBP can bind with HIF-2α independent of the HIF-2α C-terminal activation domain via enzyme/substrate interactions, p300 only complexes with HIF-2α through the C-terminal activation domain. Maximal CBP/HIF-2 signaling requires intact CBP acetyltransferase activity in both Hep3B cells as well as in mice. PMID:22807441

Gain-of-Function Alleles in Caenorhabditis elegans Nuclear Hormone Receptor nhr-49 Are Functionally Distinct

PubMed Central

Lee, Kayoung; Goh, Grace Ying Shyen; Wong, Marcus Andrew; Klassen, Tara Leah

2016-01-01

Nuclear hormone receptors (NHRs) are transcription factors that regulate numerous physiological and developmental processes and represent important drug targets. NHR-49, an ortholog of Hepatocyte Nuclear Factor 4 (HNF4), has emerged as a key regulator of lipid metabolism and life span in the nematode worm Caenorhabditis elegans. However, many aspects of NHR-49 function remain poorly understood, including whether and how it regulates individual sets of target genes and whether its activity is modulated by a ligand. A recent study identified three gain-of-function (gof) missense mutations in nhr-49 (nhr-49(et7), nhr-49(et8), and nhr-49(et13), respectively). These substitutions all affect the ligand-binding domain (LBD), which is critical for ligand binding and protein interactions. Thus, these alleles provide an opportunity to test how three specific residues contribute to NHR-49 dependent gene regulation. We used computational and molecular methods to delineate how these mutations alter NHR-49 activity. We find that despite originating from a screen favoring the activation of specific NHR-49 targets, all three gof alleles cause broad upregulation of NHR-49 regulated genes. Interestingly, nhr-49(et7) and nhr-49(et8) exclusively affect nhr-49 dependent activation, whereas the nhr-49(et13) surprisingly affects both nhr-49 mediated activation and repression, implicating the affected residue as dually important. We also observed phenotypic non-equivalence of these alleles, as they unexpectedly caused a long, short, and normal life span, respectively. Mechanistically, the gof substitutions altered neither protein interactions with the repressive partner NHR-66 and the coactivator MDT-15 nor the subcellular localization or expression of NHR-49. However, in silico structural modeling revealed that NHR-49 likely interacts with small molecule ligands and that the missense mutations might alter ligand binding, providing a possible explanation for increased NHR-49 activity. In sum, our findings indicate that the three nhr-49 gof alleles are non-equivalent, and highlight the conserved V411 residue affected by et13 as critical for gene activation and repression alike. PMID:27618178

Ankle muscle coactivation and its relationship with ankle joint kinematics and kinetics during gait in hemiplegic patients after stroke.

PubMed

Kitatani, Ryosuke; Ohata, Koji; Sato, Shuhei; Watanabe, Aki; Hashiguchi, Yu; Yamakami, Natsuki; Sakuma, Kaoru; Yamada, Shigehito

2016-06-01

Increased ankle muscle coactivation during gait is a compensation strategy for enhancing postural stability in patients after stroke. However, no previous studies have demonstrated that increased ankle muscle coactivation influenced ankle joint movements during gait in patients after stroke. To investigate the relationship between ankle muscle coactivation and ankle joint movements in hemiplegic patients after stroke. Seventeen patients after stroke participated. The coactivation index (CoI) at the ankle joint was calculated separately for the first and second double support (DS1 and DS2, respectively) and single support (SS) phases on the paretic and non-paretic sides during gait using surface electromyography. Simultaneously, three-dimensional motion analysis was performed to measure the peak values of the ankle joint angle, moment, and power in the sagittal plane. Ground reaction forces (GRFs) of the anterior and posterior components and centers of pressure (COPs) trajectory ranges and velocities were also measured. The CoI during the SS phase on the paretic side was negatively related to ankle dorsiflexion angle, ankle plantarflexion moment, ankle joint power generation, and COP velocity on the paretic side. Furthermore, the CoI during the DS2 phase on both sides was negatively related to anterior GRF amplitude on each side. Increased ankle muscle coactivation is related to decreased ankle joint movement during the SS phase on the paretic side to enhance joint stiffness and compensate for stance limb instability, which may be useful for patients who have paretic instability during the stance phase after stroke.

The Independence and Interdependence of Coacting Observers in Regard to Performance Efficiency, Workload, and Stress in a Vigilance Task.

PubMed

Funke, Gregory J; Warm, Joel S; Baldwin, Carryl L; Garcia, Andre; Funke, Matthew E; Dillard, Michael B; Finomore, Victor S; Matthews, Gerald; Greenlee, Eric T

2016-09-01

We investigated performance, workload, and stress in groups of paired observers who performed a vigilance task in a coactive (independent) manner. Previous studies have demonstrated that groups of coactive observers detect more signals in a vigilance task than observers working alone. Therefore, the use of such groups might be effective in enhancing signal detection in operational situations. However, concern over appearing less competent than one's cohort might induce elevated levels of workload and stress in coactive group members and thereby undermine group performance benefits. Accordingly, we performed the initial experiment comparing workload and stress in observers who performed a vigilance task coactively with those of observers who performed the vigilance task alone. Observers monitored a video display for collision flight paths in a simulated unmanned aerial vehicle control task. Self-reports of workload and stress were secured via the NASA-Task Load Index and the Dundee Stress State Questionnaire, respectively. Groups of coactive observers detected significantly more signals than did single observers. Coacting observers did not differ significantly from those operating by themselves in terms of workload but did in regard to stress; posttask distress was significantly lower for coacting than for single observers. Performing a visual vigilance task in a coactive manner with another observer does not elevate workload above that of observers working alone and serves to attenuate the stress associated with vigilance task performance. The use of coacting observers could be an effective vehicle for enhancing performance efficiency in operational vigilance. © 2016, Human Factors and Ergonomics Society.

The role of the putamen in language: a meta-analytic connectivity modeling study.

PubMed

Viñas-Guasch, Nestor; Wu, Yan Jing

2017-12-01

The putamen is a subcortical structure that forms part of the dorsal striatum of basal ganglia, and has traditionally been associated with reinforcement learning and motor control, including speech articulation. However, recent studies have shown involvement of the left putamen in other language functions such as bilingual language processing (Abutalebi et al. 2012) and production, with some authors arguing for functional segregation of anterior and posterior putamen (Oberhuber et al. 2013). A further step in exploring the role of putamen in language would involve identifying the network of coactivations of not only the left, but also the right putamen, given the involvement of right hemisphere in high order language functions (Vigneau et al. 2011). Here, a meta-analytic connectivity modeling technique was used to determine the patterns of coactivation of anterior and bilateral putamen in the language domain. Based on previous evidence, we hypothesized that left putamen coactivations would include brain regions directly associated with language processing, whereas right putamen coactivations would encompass regions involved in broader semantic processes, such as memory and visual imagery. The results showed that left anterior putamen coactivated with clusters predominantly in left hemisphere, encompassing regions directly associated with language processing, a left posterior putamen network spanning both hemispheres, and cerebellum. In right hemisphere, coactivations were in both hemispheres, in regions associated with visual and orthographic processing. These results confirm the differential involvement of right and left putamen in different language components, thus highlighting the need for further research into the role of putamen in language.

Imprinting and Recalling Cortical Ensembles

PubMed Central

Carrillo-Reid, Luis; Yang, Weijian; Bando, Yuki; Peterka, Darcy S.; Yuste, Rafael

2017-01-01

Neuronal ensembles are coactive groups of neurons that may represent emergent building blocks of neural circuits. They could be formed by Hebbian plasticity, whereby synapses between coactive neurons are strengthened. Here we report that repetitive activation with two-photon optogenetics of neuronal populations in visual cortex of awake mice generates artificially induced ensembles which recur spontaneously after being imprinted and do not disrupt preexistent ones. Moreover, imprinted ensembles can be recalled by single cell stimulation and remain coactive on consecutive days. Our results demonstrate the persistent reconfiguration of cortical circuits by two-photon optogenetics into neuronal ensembles that can perform pattern completion. PMID:27516599

The single-strand DNA binding activity of human PC4 preventsmutagenesis and killing by oxidative DNA damage

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wang, Jen-Yeu; Sarker, Altaf Hossain; Cooper, Priscilla K.

Human positive cofactor 4 (PC4) is a transcriptional coactivator with a highly conserved single-strand DNA (ssDNA) binding domain of unknown function. We identified PC4 as a suppressor of the oxidative mutator phenotype of the Escherichia coli fpg mutY mutant and demonstrate that this suppression requires its ssDNA binding activity. Yeast mutants lacking their PC4 ortholog Sub1 are sensitive to hydrogen peroxide and exhibit spontaneous and peroxide induced hypermutability. PC4 expression suppresses the peroxide sensitivity of the yeast sub l{Delta} mutant, suggesting that the human protein has a similar function. A role for yeast and human proteins in DNA repair ismore » suggested by the demonstration that Sub1 acts in a peroxide-resistance pathway involving Rad2 and by the physical interaction of PC4 with the human Rad2 homolog XPG. We show XPG recruits PC4 to a bubble-containing DNA substrate with resulting displacement of XPG and formation of a PC4-DNA complex. We discuss the possible requirement for PC4 in either global or transcription-coupled repair of oxidative DNA damage to mediate the release of XPG bound to its substrate.« less

Association with AflR in Endosomes Reveals New Functions for AflJ in Aflatoxin Biosynthesis

PubMed Central

Ehrlich, Kenneth C.; Mack, Brian M.; Wei, Qijian; Li, Ping; Roze, Ludmila V.; Dazzo, Frank; Cary, Jeffrey W.; Bhatnagar, Deepak; Linz, John E.

2012-01-01

Aflatoxins are the most potent naturally occurring carcinogens of fungal origin. Biosynthesis of aflatoxin involves the coordinated expression of more than 25 genes. The function of one gene in the aflatoxin gene cluster, aflJ, is not entirely understood but, because previous studies demonstrated a physical interaction between the Zn2Cys6 transcription factor AflR and AflJ, AflJ was proposed to act as a transcriptional co-activator. Image analysis revealed that, in the absence of aflJ in A. parasiticus, endosomes cluster within cells and near septa. AflJ fused to yellow fluorescent protein complemented the mutation in A. parasiticus ΔaflJ and localized mainly in endosomes. We found that AflJ co-localizes with AflR both in endosomes and in nuclei. Chromatin immunoprecipitation did not detect AflJ binding at known AflR DNA recognition sites suggesting that AflJ either does not bind to these sites or binds to them transiently. Based on these data, we hypothesize that AflJ assists in AflR transport to or from the nucleus, thus controlling the availability of AflR for transcriptional activation of aflatoxin biosynthesis cluster genes. AflJ may also assist in directing endosomes to the cytoplasmic membrane for aflatoxin export. PMID:23342682

A role for neuronal cAMP responsive-element binding (CREB)-1 in brain responses to calorie restriction

PubMed Central

Fusco, Salvatore; Ripoli, Cristian; Podda, Maria Vittoria; Ranieri, Sofia Chiatamone; Leone, Lucia; Toietta, Gabriele; McBurney, Michael W.; Schütz, Günther; Riccio, Antonella; Grassi, Claudio; Galeotti, Tommaso; Pani, Giovambattista

2012-01-01

Calorie restriction delays brain senescence and prevents neurodegeneration, but critical regulators of these beneficial responses other than the NAD+-dependent histone deacetylase Sirtuin-1 (Sirt-1) are unknown. We report that effects of calorie restriction on neuronal plasticity, memory and social behavior are abolished in mice lacking cAMP responsive-element binding (CREB)-1 in the forebrain. Moreover, CREB deficiency drastically reduces the expression of Sirt-1 and the induction of genes relevant to neuronal metabolism and survival in the cortex and hippocampus of dietary-restricted animals. Biochemical studies reveal a complex interplay between CREB and Sirt-1: CREB directly regulates the transcription of the sirtuin in neuronal cells by binding to Sirt-1 chromatin; Sirt-1, in turn, is recruited by CREB to DNA and promotes CREB-dependent expression of target gene peroxisome proliferator-activated receptor-γ coactivator-1α and neuronal NO Synthase. Accordingly, expression of these CREB targets is markedly reduced in the brain of Sirt KO mice that are, like CREB-deficient mice, poorly responsive to calorie restriction. Thus, the above circuitry, modulated by nutrient availability, links energy metabolism with neurotrophin signaling, participates in brain adaptation to nutrient restriction, and is potentially relevant to accelerated brain aging by overnutrition and diabetes. PMID:22190495

The SAGA/TREX-2 subunit Sus1 binds widely to transcribed genes and affects mRNA turnover globally.

PubMed

García-Molinero, Varinia; García-Martínez, José; Reja, Rohit; Furió-Tarí, Pedro; Antúnez, Oreto; Vinayachandran, Vinesh; Conesa, Ana; Pugh, B Franklin; Pérez-Ortín, José E; Rodríguez-Navarro, Susana

2018-03-29

Eukaryotic transcription is regulated through two complexes, the general transcription factor IID (TFIID) and the coactivator Spt-Ada-Gcn5 acetyltransferase (SAGA). Recent findings confirm that both TFIID and SAGA contribute to the synthesis of nearly all transcripts and are recruited genome-wide in yeast. However, how this broad recruitment confers selectivity under specific conditions remains an open question. Here we find that the SAGA/TREX-2 subunit Sus1 associates with upstream regulatory regions of many yeast genes and that heat shock drastically changes Sus1 binding. While Sus1 binding to TFIID-dominated genes is not affected by temperature, its recruitment to SAGA-dominated genes and RP genes is significantly disturbed under heat shock, with Sus1 relocated to environmental stress-responsive genes in these conditions. Moreover, in contrast to recent results showing that SAGA deubiquitinating enzyme Ubp8 is dispensable for RNA synthesis, genomic run-on experiments demonstrate that Sus1 contributes to synthesis and stability of a wide range of transcripts. Our study provides support for a model in which SAGA/TREX-2 factor Sus1 acts as a global transcriptional regulator in yeast but has differential activity at yeast genes as a function of their transcription rate or during stress conditions.

Myocardin-Related Transcription Factor A Activation by Competition with WH2 Domain Proteins for Actin Binding

PubMed Central

Weissbach, Julia; Schikora, Franziska; Weber, Anja; Kessels, Michael

2016-01-01

The myocardin-related transcription factors (MRTFs) are coactivators of serum response factor (SRF)-mediated gene expression. Activation of MRTF-A occurs in response to alterations in actin dynamics and critically requires the dissociation of repressive G-actin–MRTF-A complexes. However, the mechanism leading to the release of MRTF-A remains unclear. Here we show that WH2 domains compete directly with MRTF-A for actin binding. Actin nucleation-promoting factors, such as N-WASP and WAVE2, as well as isolated WH2 domains, including those of Spire2 and Cobl, activate MRTF-A independently of changes in actin dynamics. Simultaneous inhibition of Arp2-Arp3 or mutation of the CA region only partially reduces MRTF-A activation by N-WASP and WAVE2. Recombinant WH2 domains and the RPEL domain of MRTF-A bind mutually exclusively to cellular and purified G-actin in vitro. The competition by different WH2 domains correlates with MRTF-SRF activation. Following serum stimulation, nonpolymerizable actin dissociates from MRTF-A, and de novo formation of the G-actin–RPEL complex is impaired by a transferable factor. Our work demonstrates that WH2 domains activate MRTF-A and contribute to target gene regulation by a competitive mechanism, independently of their role in actin filament formation. PMID:26976641

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hirano, Hidemi; Matsuura, Yoshiyuki, E-mail: matsuura.yoshiyuki@d.mbox.nagoya-u.ac.jp

Highlights: {yields} MAL has a bipartite NLS that binds to Imp{alpha} in an extended conformation. {yields} Mutational analyses verified the functional significance of MAL-Imp{alpha} interactions. {yields} Induced folding and NLS-masking by G-actins inhibit nuclear import of MAL. -- Abstract: The coordination of cytoskeletal actin dynamics with gene expression reprogramming is emerging as a crucial mechanism to control diverse cellular processes, including cell migration, differentiation and neuronal circuit assembly. The actin-binding transcriptional coactivator MAL (also known as MRTF-A/MKL1/BSAC) senses G-actin concentration and transduces Rho GTPase signals to serum response factor (SRF). MAL rapidly shuttles between the cytoplasm and the nucleus inmore » unstimulated cells but Rho-induced depletion of G-actin leads to MAL nuclear accumulation and activation of transcription of SRF:MAL-target genes. Although the molecular and structural basis of actin-regulated nucleocytoplasmic shuttling of MAL is not understood fully, it is proposed that nuclear import of MAL is mediated by importin {alpha}/{beta} heterodimer, and that G-actin competes with importin {alpha}/{beta} for the binding to MAL. Here we present structural, biochemical and cell biological evidence that MAL has a classical bipartite nuclear localization signal (NLS) in the N-terminal 'RPEL' domain containing Arg-Pro-X-X-X-Glu-Leu (RPEL) motifs. The NLS residues of MAL adopt an extended conformation and bind along the surface groove of importin-{alpha}, interacting with the major- and minor-NLS binding sites. We also present a crystal structure of wild-type MAL RPEL domain in complex with five G-actins. Comparison of the importin-{alpha}- and actin-complexes revealed that the binding of G-actins to MAL is associated with folding of NLS residues into a helical conformation that is inappropriate for importin-{alpha} recognition.« less

A conserved phosphorylation switch controls the interaction between cadherin and β-catenin in vitro and in vivo

DOE PAGES

Choi, Hee -Jung; Loveless, Timothy; Lynch, Allison M.; ...

2015-04-06

In metazoan adherens junctions, β-catenin links the cytoplasmic tail of classical cadherins to the F-actin-binding protein α-catenin. Phosphorylation of a Ser/Thr-rich region in the cadherin tail dramatically enhances affinity for β-catenin and promotes cell-cell adhesion in cell culture systems, but its importance has not been demonstrated in vivo. In this paper, we identify a critical phosphorylated serine in the C. elegans cadherin HMR-1 required for strong binding to the β-catenin homolog HMP-2. Ablation of this phosphoserine interaction produces developmental defects that resemble full loss-of-function (Hammerhead and Humpback) phenotypes. Most metazoans possess a single gene for β-catenin, which is also amore » transcriptional coactivator in Wnt signaling. Nematodes and planaria, however, have a set of paralogous β-catenins; for example, C. elegans HMP-2 functions only in cell-cell adhesion, whereas SYS-1 mediates transcriptional activation through interactions with POP-1/Tcf. Finally, our structural data define critical sequence differences responsible for the unique ligand specificities of these two proteins.« less

LWD-TCP complex activates the morning gene CCA1 in Arabidopsis.

PubMed

Wu, Jing-Fen; Tsai, Huang-Lung; Joanito, Ignasius; Wu, Yi-Chen; Chang, Chin-Wen; Li, Yi-Hang; Wang, Ying; Hong, Jong Chan; Chu, Jhih-Wei; Hsu, Chao-Ping; Wu, Shu-Hsing

2016-10-13

A double-negative feedback loop formed by the morning genes CIRCADIAN CLOCK ASSOCIATED1 (CCA1)/LATE ELONGATED HYPOCOTYL (LHY) and the evening gene TIMING OF CAB EXPRESSION1 (TOC1) contributes to regulation of the circadian clock in Arabidopsis. A 24-h circadian cycle starts with the peak expression of CCA1 at dawn. Although CCA1 is targeted by multiple transcriptional repressors, including PSEUDO-RESPONSE REGULATOR9 (PRR9), PRR7, PRR5 and CCA1 HIKING EXPEDITION (CHE), activators of CCA1 remain elusive. Here we use mathematical modelling to infer a co-activator role for LIGHT-REGULATED WD1 (LWD1) in CCA1 expression. We show that the TEOSINTE BRANCHED 1-CYCLOIDEA-PCF20 (TCP20) and TCP22 proteins act as LWD-interacting transcriptional activators. The concomitant binding of LWD1 and TCP20/TCP22 to the TCP-binding site in the CCA1 promoter activates CCA1. Our study reveals activators of the morning gene CCA1 and provides an action mechanism that ensures elevated expression of CCA1 at dawn to sustain a robust clock.

LWD–TCP complex activates the morning gene CCA1 in Arabidopsis

PubMed Central

Wu, Jing-Fen; Tsai, Huang-Lung; Joanito, Ignasius; Wu, Yi-Chen; Chang, Chin-Wen; Li, Yi-Hang; Wang, Ying; Hong, Jong Chan; Chu, Jhih-Wei; Hsu, Chao-Ping; Wu, Shu-Hsing

2016-01-01

A double-negative feedback loop formed by the morning genes CIRCADIAN CLOCK ASSOCIATED1 (CCA1)/LATE ELONGATED HYPOCOTYL (LHY) and the evening gene TIMING OF CAB EXPRESSION1 (TOC1) contributes to regulation of the circadian clock in Arabidopsis. A 24-h circadian cycle starts with the peak expression of CCA1 at dawn. Although CCA1 is targeted by multiple transcriptional repressors, including PSEUDO-RESPONSE REGULATOR9 (PRR9), PRR7, PRR5 and CCA1 HIKING EXPEDITION (CHE), activators of CCA1 remain elusive. Here we use mathematical modelling to infer a co-activator role for LIGHT-REGULATED WD1 (LWD1) in CCA1 expression. We show that the TEOSINTE BRANCHED 1-CYCLOIDEA-PCF20 (TCP20) and TCP22 proteins act as LWD-interacting transcriptional activators. The concomitant binding of LWD1 and TCP20/TCP22 to the TCP-binding site in the CCA1 promoter activates CCA1. Our study reveals activators of the morning gene CCA1 and provides an action mechanism that ensures elevated expression of CCA1 at dawn to sustain a robust clock. PMID:27734958

Functional analysis of the OCA-B promoter.

PubMed

Stevens, S; Wang, L; Roeder, R G

2000-06-15

OCA-B was identified as a B cell-specific coactivator that functions with either Oct-1 or Oct-2 to mediate efficient cell type-specific transcription via the octamer site (ATGCAAAT) both in vivo and in vitro. Mice lacking OCA-B exhibit normal Ag-independent B cell maturation. In contrast, Ag-dependent functions, including production of secondary Ig isotypes and germinal center formation, are greatly affected. To better understand OCA-B expression and, ultimately, the defects observed in the OCA-B knockout mice, we have cloned the OCA-B promoter and examined its function in both transformed and primary B cells. We show here that the OCA-B promoter is developmentally regulated, with activity increasing throughout B cell differentiation. Through physical and functional assays, we have found an activating transcription factor/cAMP response element binding protein binding site (or cAMP response element) that is crucial for OCA-B promoter activity. Furthermore, we demonstrate that IL-4 and anti-CD40 induce both the OCA-B promoter and octamer-dependent promoters, thus implicating OCA-B in B cell signaling events in the nucleus.

Suppression of HTLV-1 replication by Tax-mediated rerouting of the p13 viral protein to nuclear speckles

PubMed Central

Andresen, Vibeke; Pise-Masison, Cynthia A.; Sinha-Datta, Uma; Bellon, Marcia; Valeri, Valerio; Washington Parks, Robyn; Cecchinato, Valentina; Fukumoto, Risaku; Nicot, Christophe

2011-01-01

Disease development in human T-cell leukemia virus type 1 (HTLV-1)–infected individuals is positively correlated with the level of integrated viral DNA in T cells. HTLV-1 replication is positively regulated by Tax and Rex and negatively regulated by the p30 and HBZ proteins. In the present study, we demonstrate that HTLV-1 encodes another negative regulator of virus expression, the p13 protein. Expressed separately, p13 localizes to the mitochondria, whereas in the presence of Tax, part of it is ubiquitinated, stabilized, and rerouted to the nuclear speckles. The p13 protein directly binds Tax, decreases Tax binding to the CBP/p300 transcriptional coactivator, and, by reducing Tax transcriptional activity, suppresses viral expression. Because Tax stabilizes its own repressor, these findings suggest that HTLV-1 has evolved a complex mechanism to control its own replication. Further, these results highlight the importance of studying the function of the HTLV-1 viral proteins, not only in isolation, but also in the context of full viral replication. PMID:21677314

DOE Office of Scientific and Technical Information (OSTI.GOV)

Asally, Munehiro; Yoneda, Yoshihiro

Nuclear accumulation of {beta}-catenin plays an important role in the Wnt signaling pathway. In the nucleus, {beta}-catenin acts as a transcriptional co-activator for TCF/LEF family of transcription factors. It has been shown that lef-1 contains a typical basic type nuclear localization signal (NLS) and is transported into the nucleus by the conventional import pathway. In this study, we found that a mutant lef-1 lacking the classical NLS accumulated in the nucleus of living cells, when {beta}-catenin was co-expressed. In addition, in a cell-free import assay, lef-1 migrated into the nucleus in the presence of {beta}-catenin alone without any other solublemore » factors. In contrast, another mutant lef-1 lacking the {beta}-catenin binding domain failed to migrate into the nucleus, even in the presence of {beta}-catenin. These findings indicate that {beta}-catenin alone can mediate the nuclear import of lef-1 through the direct binding. Collectively, we propose that there are two distinct pathways for the nuclear import of lef-1: importin {alpha}/{beta}-mediated and {beta}-catenin-mediated one, which provides a novel paradigm for Wnt signaling pathway.« less

G-actin sequestering protein thymosin-β4 regulates the activity of myocardin-related transcription factor

DOE Office of Scientific and Technical Information (OSTI.GOV)

Morita, Tsuyoshi, E-mail: tsuyo@nbiochem.med.osaka-u.ac.jp; Hayashi, Ken’ichiro

2013-08-02

Highlights: •Tβ4 competed with MRTF-A for G-actin binding. •Tβ4 activated the MRTF–SRF signaling pathway. •Tβ4 increased the endogenous expression of SRF-dependent genes. -- Abstract: Myocardin-related transcription factors (MRTFs) are robust coactivators of serum response factor (SRF). MRTFs contain three copies of the RPEL motif at their N-terminus, and they bind to monomeric globular actin (G-actin). Previous studies illustrate that G-actin binding inhibits MRTF activity by preventing the MRTFs nuclear accumulation. In the living cells, the majority of G-actin is sequestered by G-actin binding proteins that prevent spontaneous actin polymerization. Here, we demonstrate that the most abundant G-actin sequestering protein thymosin-β4more » (Tβ4) was involved in the regulation of subcellular localization and activity of MRTF-A. Tβ4 competed with MRTF-A for G-actin binding; thus, interfering with G-actin–MRTF-A complex formation. Tβ4 overexpression induced the MRTF-A nuclear accumulation and activation of MRTF–SRF signaling. The activation rate of MRTF-A by the Tβ4 mutant L17A, whose affinity for G-actin is very low, was lower than that by wild-type Tβ4. In contrast, the β-actin mutant 3DA, which has a lower affinity for Tβ4, more effectively suppressed MRTF-A activity than wild-type β-actin. Furthermore, ectopic Tβ4 increased the endogenous expression of SRF-dependent actin cytoskeletal genes. Thus, Tβ4 is an important MRTF regulator that controls the G-actin–MRTFs interaction.« less

A novel point mutation of the human glucocorticoid receptor gene causes primary generalized glucocorticoid resistance through impaired interaction with the LXXLL motif of the p160 coactivators: dissociation of the transactivating and transreppressive activities.

PubMed

Nicolaides, Nicolas C; Roberts, Michael L; Kino, Tomoshige; Braatvedt, Geoffrey; Hurt, Darrell E; Katsantoni, Eleni; Sertedaki, Amalia; Chrousos, George P; Charmandari, Evangelia

2014-05-01

Primary generalized glucocorticoid resistance is a rare genetic disorder characterized by generalized, partial, target-tissue insensitivity to glucocorticoids. The molecular basis of the condition has been ascribed to inactivating mutations in the human glucocorticoid receptor (hGR) gene. The objective of the study was to present three new cases caused by a novel mutation in the hGR gene and to delineate the molecular mechanisms through which the mutant receptor impairs glucocorticoid signal transduction. The index case (father) and his two daughters presented with increased urinary free cortisol excretion and resistance of the hypothalamic-pituitary-adrenal axis to dexamethasone suppression in the absence of clinical manifestations suggestive of Cushing syndrome. All subjects harbored a novel, heterozygous, point mutation (T→G) at nucleotide position 1724 of the hGR gene, which resulted in substitution of valine by glycine at amino acid 575 of the receptor. Compared with the wild-type receptor, the hGRαV575G demonstrated a significant (33%) reduction in its ability to transactivate the mouse mammary tumor virus promoter in response to dexamethasone, a 50% decrease in its affinity for the ligand, and a 2.5-fold delay in nuclear translocation. Although it did not exert a dominant negative effect on the wild-type receptor and preserved its ability to bind to DNA, hGRαV575G displayed significantly enhanced (∼80%) ability to transrepress the nuclear factor-κΒ signaling pathway. Finally, the mutant receptor hGRαV575G demonstrated impaired interaction with the LXXLL motif of the glucocorticoid receptor-interacting protein 1 coactivator in vitro and in computer-based structural simulation via its defective activation function-2 (AF-2) domain. The natural mutant receptor hGRαV575G causes primary generalized glucocorticoid resistance by affecting multiple steps in the glucocorticoid signaling cascade, including the affinity for the ligand, the time required for nuclear translocation, and the interaction with the glucocorticoid-interacting protein-1 coactivator.

CITED2 modulates estrogen receptor transcriptional activity in breast cancer cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lau, Wen Min; Doucet, Michele; Huang, David

2013-07-26

Highlights: •The effects of elevated CITED2 on ER function in breast cancer cells are examined. •CITED2 enhances cell growth in the absence of estrogen and presence of tamoxifen. •CITED2 functions as a transcriptional co-activator of ER in breast cancer cells. -- Abstract: Cbp/p300-interacting transactivator with Glu/Asp-rich carboxy-terminal domain 2 (CITED2) is a member of the CITED family of non-DNA binding transcriptional co-activators of the p300/CBP-mediated transcription complex. Previously, we identified CITED2 as being overexpressed in human breast tumors relative to normal mammary epithelium. Upon further investigation within the estrogen receptor (ER)-positive subset of these breast tumor samples, we found thatmore » CITED2 mRNA expression was elevated in those associated with poor survival. In light of this observation, we investigated the effect of elevated CITED2 levels on ER function. While ectopic overexpression of CITED2 in three ER-positive breast cancer cell lines (MCF-7, T47D, and CAMA-1) did not alter cell proliferation in complete media, growth was markedly enhanced in the absence of exogenous estrogen. Correspondingly, cells overexpressing CITED2 demonstrated reduced sensitivity to the growth inhibitory effects of the selective estrogen receptor modulator, 4-hydroxytamoxifen. Subsequent studies revealed that basal ER transcriptional activity was elevated in CITED2-overexpressing cells and was further increased upon the addition of estrogen. Similarly, basal and estrogen-induced expression of the ER-regulated genes trefoil factor 1 (TFF1) and progesterone receptor (PGR) was higher in cells overexpressing CITED2. Concordant with this observation, ChIP analysis revealed higher basal levels of CITED2 localized to the TFF-1 and PGR promoters in cells with ectopic overexpression of CITED2, and these levels were elevated further in response to estrogen stimulation. Taken together, these data indicate that CITED2 functions as a transcriptional co-activator of ER in breast cancer cells and that its increased expression in tumors may result in estrogen-independent ER activation, thereby reducing estrogen dependence and response to anti-estrogen therapy.« less

Zac1, an Sp1-like protein, regulates human p21{sup WAF1/Cip1} gene expression in HeLa cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Liu, Pei-Yao; Hsieh, Tsai-Yuan; Liu, Shu-Ting

2011-12-10

Zac1 functions as both a transcription factor and a transcriptional cofactor for p53, nuclear receptors (NRs) and NR coactivators. Zac1 might also act as a transcriptional repressor via the recruitment of histone deacetylase 1 (HDAC1). The ability of Zac1 to interact directly with GC-specific elements indicates that Zac1 possibly binds to Sp1-responsive elements. In the present study, our data show that Zac1 is able to interact directly with the Sp1-responsive element in the p21{sup WAF1/Cip1} gene promoter and enhance the transactivation activity of Sp1 through direct physical interaction. Our data further demonstrate that Zac1 might enhance Sp1-specific promoter activity bymore » interacting with the Sp1-responsive element, affecting the transactivation activity of Sp1 via a protein-protein interaction, or competing the HDAC1 protein away from the pre-existing Sp1/HDAC1 complex. Finally, the synergistic regulation of p21{sup WAF1/Cip1} gene expression by Zac1 and Sp1 is mediated by endogenous p53 protein and p53-responsive elements in HeLa cells. Our work suggests that Zac1 might serve as an Sp1-like protein that directly interacts with the Sp1-responsive element to oligomerize with and/or to coactivate Sp1.« less

Estrogen-related receptor {alpha} modulates the expression of adipogenesis-related genes during adipocyte differentiation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ijichi, Nobuhiro; Ikeda, Kazuhiro; Horie-Inoue, Kuniko

2007-07-06

Estrogen-related receptor {alpha} (ERR{alpha}) is an orphan nuclear receptor that regulates cellular energy metabolism by modulating gene expression involved in fatty acid oxidation and mitochondrial biogenesis in brown adipose tissue. However, the physiological role of ERR{alpha} in adipogenesis and white adipose tissue development has not been well studied. Here, we show that ERR{alpha} and ERR{alpha}-related transcriptional coactivators, peroxisome proliferator-activated receptor {gamma} (PPAR{gamma}) coactivator-1{alpha} (PGC-1{alpha}) and PGC-1{beta}, can be up-regulated in 3T3-L1 preadipocytes at mRNA levels under the adipogenic differentiation condition including the inducer of cAMP, glucocorticoid, and insulin. Gene knockdown by ERR{alpha}-specific siRNA results in mRNA down-regulation of fatty acidmore » binding protein 4, PPAR{gamma}, and PGC-1{alpha} in 3T3-L1 cells in the adipogenesis medium. ERR{alpha} and PGC-1{beta} mRNA expression can be also up-regulated in another preadipocyte lineage DFAT-D1 cells and a pluripotent mesenchymal cell line C3H10T1/2 under the differentiation condition. Furthermore, stable expression of ERR{alpha} in 3T3-L1 cells up-regulates adipogenic marker genes and promotes triglyceride accumulation during 3T3-L1 differentiation. These results suggest that ERR{alpha} may play a critical role in adipocyte differentiation by modulating the expression of various adipogenesis-related genes.« less

A substance P-opioid chimeric peptide as a unique nontolerance-forming analgesic

PubMed Central

Foran, Stacy E.; Carr, Daniel B.; Lipkowski, Andrzej W.; Maszczynska, Iwona; Marchand, James E.; Misicka, Aleksandra; Beinborn, Martin; Kopin, Alan S.; Kream, Richard M.

2000-01-01

To elucidate mechanisms of acute and chronic pain, it is important to understand how spinal excitatory systems influence opioid analgesia. The tachykinin substance P (SP) represents the prototypic spinal excitatory peptide neurotransmitter/neuromodulator, acting in concert with endogenous opioid systems to regulate analgesic responses to nociceptive stimuli. We have synthesized and pharmacologically characterized a chimeric peptide containing overlapping NH2- and COOH-terminal functional domains of the endogenous opioid endomorphin-2 (EM-2) and the tachykinin SP, respectively. Repeated administration of the chimeric molecule YPFFGLM-NH2, designated ESP7, into the rat spinal cord produces opioid-dependent analgesia without loss of potency over 5 days. In contrast, repeated administration of ESP7 with concurrent SP receptor (SPR) blockade results in a progressive loss of analgesic potency, consistent with the development of tolerance. Furthermore, tolerant animals completely regain opioid sensitivity after post hoc administration of ESP7 alone, suggesting that coactivation of SPRs is essential to maintaining opioid responsiveness. Radioligand binding and signaling assays, using recombinant receptors, confirm that ESP7 can coactivate μ-opioid receptors (MOR) and SPRs in vitro. We hypothesize that coincidental activation of the MOR- and SPR-expressing systems in the spinal cord mimics an ongoing state of reciprocal excitation and inhibition, which is normally encountered in nociceptive processing. Due to the ability of ESP7 to interact with both MOR and SPRs, it represents a unique prototypic, anti-tolerance-forming analgesic with future therapeutic potential. PMID:10852965

Yes-Associated Protein (YAP) Promotes the Nuclear Import of p73

NASA Astrophysics Data System (ADS)

Zhang, Heng; Wu, Shengnan

2011-01-01

p73 has been identified as a structural and functional homolog of the tumor suppressor p53. However, mechanisms that regulate the localization of p73 have not been fully clarified. The Yes-associated protein (YAP) is a transcriptional coactivator. As a transcriptional coactivator, YAP needs to bind transcription factors to stimulate gene expression. p73 is a reported YAP target transcription factors and YAP has been shown to positively regulate p73 in promoting apoptosis. Previous studies show that p73 interacts with YAP through its PPPY motif, and increases p73 transactivation of apoptotic genes. In this study, we focused on YAP's regulation of the localization of p73. After transient transfection into Rat pheochromocytoma (PC12) cells and Human embryonic kidney 293T cells with GFP-YAP and/or YFP-p73, and incubated for 24 hours expression. p73 was fused to YFP to allow the examination of its subcellular localization. When expressed alone, YFP-p73 was distributed throughout the cell. When coexpressed with YAP, nuclear accumulation of YFP-p73 became evident. We quantitated the effect of YAP on the redistribution of YFP-p73 by counting cells with nuclear-only YFP signal. We found that YAP can influence the subcellular distribution of p73. Altogether, coexpression with YAP affected the subcellular distribution of the p73 protein. Our studies attribute a central role to YAP in regulating p73 accumulation and YAP, at least in part, might promote the nuclear import of p73.

A Review: Molecular Aberrations within Hippo Signaling in Bone and Soft-Tissue Sarcomas

PubMed Central

Deel, Michael D.; Li, Jenny J.; Crose, Lisa E. S.; Linardic, Corinne M.

2015-01-01

The Hippo signaling pathway is an evolutionarily conserved developmental network vital for the regulation of organ size, tissue homeostasis, repair and regeneration, and cell fate. The Hippo pathway has also been shown to have tumor suppressor properties. Hippo transduction involves a series of kinases and scaffolding proteins that are intricately connected to proteins in developmental cascades and in the tissue microenvironment. This network governs the downstream Hippo transcriptional co-activators, YAP and TAZ, which bind to and activate the output of TEADs, as well as other transcription factors responsible for cellular proliferation, self-renewal, differentiation, and survival. Surprisingly, there are few oncogenic mutations within the core components of the Hippo pathway. Instead, dysregulated Hippo signaling is a versatile accomplice to commonly mutated cancer pathways. For example, YAP and TAZ can be activated by oncogenic signaling from other pathways, or serve as co-activators for classical oncogenes. Emerging evidence suggests that Hippo signaling couples cell density and cytoskeletal structural changes to morphogenic signals and conveys a mesenchymal phenotype. While much of Hippo biology has been described in epithelial cell systems, it is clear that dysregulated Hippo signaling also contributes to malignancies of mesenchymal origin. This review will summarize the known molecular alterations within the Hippo pathway in sarcomas and highlight how several pharmacologic compounds have shown activity in modulating Hippo components, providing proof-of-principle that Hippo signaling may be harnessed for therapeutic application in sarcomas. PMID:26389076

A Review: Molecular Aberrations within Hippo Signaling in Bone and Soft-Tissue Sarcomas.

PubMed

Deel, Michael D; Li, Jenny J; Crose, Lisa E S; Linardic, Corinne M

2015-01-01

The Hippo signaling pathway is an evolutionarily conserved developmental network vital for the regulation of organ size, tissue homeostasis, repair and regeneration, and cell fate. The Hippo pathway has also been shown to have tumor suppressor properties. Hippo transduction involves a series of kinases and scaffolding proteins that are intricately connected to proteins in developmental cascades and in the tissue microenvironment. This network governs the downstream Hippo transcriptional co-activators, YAP and TAZ, which bind to and activate the output of TEADs, as well as other transcription factors responsible for cellular proliferation, self-renewal, differentiation, and survival. Surprisingly, there are few oncogenic mutations within the core components of the Hippo pathway. Instead, dysregulated Hippo signaling is a versatile accomplice to commonly mutated cancer pathways. For example, YAP and TAZ can be activated by oncogenic signaling from other pathways, or serve as co-activators for classical oncogenes. Emerging evidence suggests that Hippo signaling couples cell density and cytoskeletal structural changes to morphogenic signals and conveys a mesenchymal phenotype. While much of Hippo biology has been described in epithelial cell systems, it is clear that dysregulated Hippo signaling also contributes to malignancies of mesenchymal origin. This review will summarize the known molecular alterations within the Hippo pathway in sarcomas and highlight how several pharmacologic compounds have shown activity in modulating Hippo components, providing proof-of-principle that Hippo signaling may be harnessed for therapeutic application in sarcomas.

SIP1/NHERF2 enhances estrogen receptor alpha transactivation in breast cancer cells

PubMed Central

Meneses-Morales, Ivan; Tecalco-Cruz, Angeles C.; Barrios-García, Tonatiuh; Gómez-Romero, Vania; Trujillo-González, Isis; Reyes-Carmona, Sandra; García-Zepeda, Eduardo; Méndez-Enríquez, Erika; Cervantes-Roldán, Rafael; Pérez-Sánchez, Víctor; Recillas-Targa, Félix; Mohar-Betancourt, Alejandro; León-Del-Río, Alfonso

2014-01-01

The estrogen receptor alpha (ERα) is a ligand-activated transcription factor that possesses two activating domains designated AF-1 and AF-2 that mediate its transcriptional activity. The role of AF-2 is to recruit coregulator protein complexes capable of modifying chromatin condensation status. In contrast, the mechanism responsible for the ligand-independent AF-1 activity and for its synergistic functional interaction with AF-2 is unclear. In this study, we have identified the protein Na+/H+ Exchanger RegulatoryFactor 2 (NHERF2) as an ERα-associated coactivator that interacts predominantly with the AF-1 domain of the nuclear receptor. Overexpression of NHERF2 in breast cancer MCF7 cells produced an increase in ERα transactivation. Interestingly, the presence of SRC-1 in NHERF2 stably overexpressing MCF7 cells produced a synergistic increase in ERα activity. We show further that NHERF2 interacts with ERα and SRC-1 in the promoter region of ERα target genes. The binding of NHERF2 to ERα in MCF7 cells increased cell proliferation and the ability of MCF7 cells to form tumors in a mouse model. We analyzed the expression of NHERF2 in breast cancer tumors finding a 2- to 17-fold increase in its mRNA levels in 50% of the tumor samples compared to normal breast tissue. These results indicate that NHERF2 is a coactivator of ERα that may participate in the development of estrogen-dependent breast cancer tumors. PMID:24771346

Proactive and coactive interference in age-related performance in a recognition-based operation span task.

PubMed

Zeintl, Melanie; Kliegel, Matthias

2010-01-01

Generally, older adults perform worse than younger adults in complex working memory span tasks. So far, it is unclear which processes mainly contribute to age-related differences in working memory span. The aim of the present study was to investigate age effects and the roles of proactive and coactive interference in a recognition-based version of the operation span task. Younger and older adults performed standard versions and distracter versions of the operation span task. At retrieval, participants had to recognize target words in word lists containing targets as well as proactive and/or coactive interference-related lures. Results show that, overall, younger adults outperformed older adults in the recognition of target words. Furthermore, analyses of error types indicate that, while younger adults were only affected by simultaneously presented distracter words, older adults had difficulties with both proactive and coactive interference. Results suggest that age effects in complex span tasks may not be mainly due to retrieval deficits in old age. Copyright 2009 S. Karger AG, Basel.

Imprinting and recalling cortical ensembles.

PubMed

Carrillo-Reid, Luis; Yang, Weijian; Bando, Yuki; Peterka, Darcy S; Yuste, Rafael

2016-08-12

Neuronal ensembles are coactive groups of neurons that may represent building blocks of cortical circuits. These ensembles could be formed by Hebbian plasticity, whereby synapses between coactive neurons are strengthened. Here we report that repetitive activation with two-photon optogenetics of neuronal populations from ensembles in the visual cortex of awake mice builds neuronal ensembles that recur spontaneously after being imprinted and do not disrupt preexisting ones. Moreover, imprinted ensembles can be recalled by single- cell stimulation and remain coactive on consecutive days. Our results demonstrate the persistent reconfiguration of cortical circuits by two-photon optogenetics into neuronal ensembles that can perform pattern completion. Copyright © 2016, American Association for the Advancement of Science.

SRC-2 is an essential coactivator for orchastrating metabolism and circadian rhythm

USDA-ARS?s Scientific Manuscript database

Synchrony of the mammalian circadian clock is achieved by complex transcriptional and translational feedback loops centered on the BMAL1:CLOCK heterodimer. Modulation of circadian feedback loops is essential for maintaining rhythmicity, yet the role of transcriptional coactivators in driving BMAL1:C...

SRC-1 regulates blood pressure and aortic stiffness in female mice

USDA-ARS?s Scientific Manuscript database

Framingham Heart Study suggests that dysfunction of steroid receptor coactivator-1 may be involved in the development of hypertension. However, there is no functional evidence linking steroid receptor coactivator-1 to the regulation of blood pressure. We used immunohistochemistry to map the expressi...

14-3-3 proteins mediate inhibitory effects of cAMP on salt-inducible kinases (SIKs).

PubMed

Sonntag, Tim; Vaughan, Joan M; Montminy, Marc

2018-02-01

The salt-inducible kinase (SIK) family regulates cellular gene expression via the phosphorylation of cAMP-regulated transcriptional coactivators (CRTCs) and class IIA histone deacetylases, which are sequestered in the cytoplasm by phosphorylation-dependent 14-3-3 interactions. SIK activity toward these substrates is inhibited by increases in cAMP signaling, although the underlying mechanism is unclear. Here, we show that the protein kinase A (PKA)-dependent phosphorylation of SIKs inhibits their catalytic activity by inducing 14-3-3 protein binding. SIK1 and SIK3 contain two functional PKA/14-3-3 sites, while SIK2 has four. In keeping with the dimeric nature of 14-3-3s, the presence of multiple binding sites within target proteins dramatically increases binding affinity. As a result, loss of a single 14-3-3-binding site in SIK1 and SIK3 abolished 14-3-3 association and rendered them insensitive to cAMP. In contrast, mutation of three sites in SIK2 was necessary to fully block cAMP regulation. Superimposed on the effects of PKA phosphorylation and 14-3-3 association, an evolutionary conserved domain in SIK1 and SIK2 (the so called RK-rich region; 595-624 in hSIK2) is also required for the inhibition of SIK2 activity. Collectively, these results point to a dual role for 14-3-3 proteins in repressing a family of Ser/Thr kinases as well as their substrates. © 2017 Federation of European Biochemical Societies.

Location analysis for the estrogen receptor-α reveals binding to diverse ERE sequences and widespread binding within repetitive DNA elements

PubMed Central

Mason, Christopher E.; Shu, Feng-Jue; Wang, Cheng; Session, Ryan M.; Kallen, Roland G.; Sidell, Neil; Yu, Tianwei; Liu, Mei Hui; Cheung, Edwin; Kallen, Caleb B.

2010-01-01

Location analysis for estrogen receptor-α (ERα)-bound cis-regulatory elements was determined in MCF7 cells using chromatin immunoprecipitation (ChIP)-on-chip. Here, we present the estrogen response element (ERE) sequences that were identified at ERα-bound loci and quantify the incidence of ERE sequences under two stringencies of detection: <10% and 10–20% nucleotide deviation from the canonical ERE sequence. We demonstrate that ∼50% of all ERα-bound loci do not have a discernable ERE and show that most ERα-bound EREs are not perfect consensus EREs. Approximately one-third of all ERα-bound ERE sequences reside within repetitive DNA sequences, most commonly of the AluS family. In addition, the 3-bp spacer between the inverted ERE half-sites, rather than being random nucleotides, is C(A/T)G-enriched at bona fide receptor targets. Diverse ERα-bound loci were validated using electrophoretic mobility shift assay and ChIP-polymerase chain reaction (PCR). The functional significance of receptor-bound loci was demonstrated using luciferase reporter assays which proved that repetitive element ERE sequences contribute to enhancer function. ChIP-PCR demonstrated estrogen-dependent recruitment of the coactivator SRC3 to these loci in vivo. Our data demonstrate that ERα binds to widely variant EREs with less sequence specificity than had previously been suspected and that binding at repetitive and nonrepetitive genomic targets is favored by specific trinucleotide spacers. PMID:20047966

Location analysis for the estrogen receptor-alpha reveals binding to diverse ERE sequences and widespread binding within repetitive DNA elements.

PubMed

Mason, Christopher E; Shu, Feng-Jue; Wang, Cheng; Session, Ryan M; Kallen, Roland G; Sidell, Neil; Yu, Tianwei; Liu, Mei Hui; Cheung, Edwin; Kallen, Caleb B

2010-04-01

Location analysis for estrogen receptor-alpha (ERalpha)-bound cis-regulatory elements was determined in MCF7 cells using chromatin immunoprecipitation (ChIP)-on-chip. Here, we present the estrogen response element (ERE) sequences that were identified at ERalpha-bound loci and quantify the incidence of ERE sequences under two stringencies of detection: <10% and 10-20% nucleotide deviation from the canonical ERE sequence. We demonstrate that approximately 50% of all ERalpha-bound loci do not have a discernable ERE and show that most ERalpha-bound EREs are not perfect consensus EREs. Approximately one-third of all ERalpha-bound ERE sequences reside within repetitive DNA sequences, most commonly of the AluS family. In addition, the 3-bp spacer between the inverted ERE half-sites, rather than being random nucleotides, is C(A/T)G-enriched at bona fide receptor targets. Diverse ERalpha-bound loci were validated using electrophoretic mobility shift assay and ChIP-polymerase chain reaction (PCR). The functional significance of receptor-bound loci was demonstrated using luciferase reporter assays which proved that repetitive element ERE sequences contribute to enhancer function. ChIP-PCR demonstrated estrogen-dependent recruitment of the coactivator SRC3 to these loci in vivo. Our data demonstrate that ERalpha binds to widely variant EREs with less sequence specificity than had previously been suspected and that binding at repetitive and nonrepetitive genomic targets is favored by specific trinucleotide spacers.

Dual roles for coactivator activator and its counterbalancing isoform coactivator modulator in human kidney cell tumorigenesis.

PubMed

Kang, Yun Kyoung; Schiff, Rachel; Ko, Lan; Wang, Tao; Tsai, Sophia Y; Tsai, Ming-Jer; O'Malley, Bert W

2008-10-01

Coactivator activator (CoAA) has been reported to be a coactivator that regulates steroid receptor-mediated transcription and alternative RNA splicing. Herein, we show that CoAA is a dual-function coregulator that inhibits G(1)-S transition in human kidney cells and suppresses anchorage-independent growth and xenograft tumor formation. Suppression occurs in part by down-regulating c-myc and its downstream effectors ccnd1 and skp2 and causing accumulation of p27/Kip1 protein. In this cellular setting, CoAA directly represses the proto-oncogene c-myc by recruiting HDAC3 protein and decreasing both the acetylation of histone H3 and the presence of RNA polymerase II on the c-myc promoter. Interestingly, a splicing isoform of CoAA, coactivator modulator (CoAM), antagonizes CoAA-induced G(1)-S transition and growth inhibition by negatively regulating the mRNA levels of the endogenous CoAA isoform. In addition, we found that expression of CoAA protein is significantly decreased in human renal cell carcinoma compared with normal kidney. Our study presents evidence that CoAA is a potential tumor suppressor in renal carcinoma and that CoAM is a counterbalancing splice isoform. This is, thus far, the only example of a nuclear receptor coregulator involved in suppression of kidney cancer and suggests potentially significant new roles for coregulators in renal cancer biology.

The emerging role of Hippo signaling pathway in regulating osteoclast formation.

PubMed

Yang, Wanlei; Han, Weiqi; Qin, An; Wang, Ziyi; Xu, Jiake; Qian, Yu

2018-06-01

A delicate balance between osteoblastic bone formation and osteoclastic bone resorption is crucial for bone homeostasis. This process is regulated by the Hippo signaling pathway including key regulatory molecules RASSF2, NF2, MST1/2, SAV1, LATS1/2, MOB1, YAP, and TAZ. It is well established that the Hippo signaling pathway plays an important part in regulating osteoblast differentiation, but its role in osteoclast formation and activation remains poorly understood. In this review, we discuss the emerging role of Hippo-signaling pathway in osteoclast formation and bone homeostasis. It is revealed that specific molecules of the Hippo-signaling pathway take part in a stage specific regulation in pre-osteoclast proliferation, osteoclast differentiation and osteoclast apoptosis and survival. Upon activation, MST and LAST, transcriptional co-activators YAP and TAZ bind to the members of the TEA domain (TEAD) family transcription factors, and influence osteoclast differentiation via regulating the expression of downstream target genes such as connective tissue growth factor (CTGF/CCN2) and cysteine-rich protein 61 (CYR61/CCN1). In addition, through interacting or cross talking with RANKL-mediated signaling cascades including NF-κB, MAPKs, AP1, and NFATc1, Hippo-signaling molecules such as YAP/TAZ/TEAD complex, RASSF2, MST2, and Ajuba could also potentially modulate osteoclast differentiation and function. Elucidating the roles of the Hippo-signaling pathway in osteoclast development and specific molecules involved is important for understanding the mechanism of bone homeostasis and diseases. © 2017 Wiley Periodicals, Inc.

Parkin New Cargos: a New ROS Independent Role for Parkin in Regulating Cell Division.

PubMed

Stieg, David C; Cooper, Katrina F

2016-01-01

Cell cycle progression requires the destruction of key cell cycle regulators by the multi-subunit E3 ligase called the anaphase promoting complex (APC/C). As the cell progresses through the cell cycle, the APC/C is sequentially activated by two highly conserved co-activators called Cdc20 and Cdh1. Importantly, APC/C Cdc20 is required to degrade substrates in G2/M whereas APC Cdh1 drives the cells into G1. Recently, Parkin, a monomeric E3 ligase that is required for ubiquitin-mediated mitophagy following mitochondrial stress, was shown to both bind and be activated by Cdc20 or Cdh1 during the cell cycle. This mitotic role for Parkin does not require an activating phosphorylation by its usual kinase partner PINK. Rather, mitotic Parkin activity requires phosphorylation on a different serine by the polo-like kinase Plk1. Interestingly, although Parkin Cdc20 and Parkin Cdh1 activity is independent of the APC/C, it mediates degradation of an overlapping subset of substrates. However, unlike the APC/C, Parkin is not necessary for cell cycle progression. Despite this, loss of Parkin activity accelerates genome instability and tumor growth in xenograft models. These findings provide a mechanism behind the previously described, but poorly understood, tumor suppressor role for Parkin. Taken together, studies suggest that the APC/C and Parkin have similar and unique roles to play in cell division, possibly being dependent upon the different subcellular address of these two ligases.

Partial rescue of defects in Cited2-deficient embryos by HIF-1alpha heterozygosity.

PubMed

Xu, Bing; Doughman, Yongqiu; Turakhia, Mona; Jiang, Weihong; Landsettle, Chad E; Agani, Faton H; Semenza, Gregg L; Watanabe, Michiko; Yang, Yu-Chung

2007-01-01

Hypoxia inducible factor-1 (HIF-1) initiates key cellular and tissue responses to physiological and pathological hypoxia. Evidence from in vitro and structural analyses supports a critical role for Cited2 in down-regulating HIF-1-mediated transcription by competing for binding with oxygen-sensitive HIF-1alpha to transcriptional co-activators CBP/p300. We previously detected elevated expression of HIF-1 target genes in Cited2(-/-) embryonic hearts, indicating that Cited2 inhibits HIF-1 transactivation in vivo. In this study, we show for the first time that highly hypoxic cardiac regions in mouse embryos corresponded to the sites of defects in Cited2(-/-) embryos and that defects of the outflow tract, interventricular septum, cardiac vasculature, and hyposplenia were largely rescued by HIF-1alpha haploinsufficiency. The hypoxia of the outflow tract and interventricular septum peaked at E13.5 and dissipated by E15.5 in wild-type hearts, but persisted in E15.5 Cited2(-/-) hearts. The persistent hypoxia and abnormal vasculature in the myocardium of interventricular septum in E15.5 Cited2(-/-) hearts were rescued with decreased HIF-1alpha gene dosage. Accordingly, mRNA levels of HIF-1-responsive genes were reduced in Cited2(-/-) embryonic hearts by HIF-1alpha heterozygosity. These findings suggest that a precise level of HIF-1 transcriptional activity critical for normal development is triggered by differential hypoxia and regulated through feedback inhibition by Cited2.

Sirtuin 3 (SIRT3) maintains bone homeostasis by regulating AMPK-PGC-1β axis in mice

PubMed Central

Huh, Jeong-Eun; Shin, Ji Hye; Jang, Eun Sun; Park, So Jeong; Park, Doo Ri; Ko, Ryeojin; Seo, Dong-Hyun; Kim, Han-Sung; Lee, Seoung Hoon; Choi, Yongwon; Kim, Hyun Seok; Lee, Soo Young

2016-01-01

The mitochondrial sirtuin 3 (SIRT3) is involved in suppressing the onset of multiple pathologies, including cardiovascular disease, fatty liver, age-related hearing loss, and breast cancer. But a physiological role of SIRT3 in bone metabolism is not known. Here we show that SIRT3 is a key regulatory molecule to maintain bone homeostasis. Mice deficient in SIRT3 exhibited severe osteopenia owing to increased numbers of osteoclasts. Osteoclast precursors from Sirt3−/− mice underwent increased osteoclastogenesis in response to receptor activator of nuclear factor-κB ligand (RANKL), an essential cytokine for osteoclast differentiation. SIRT3 expression from RANKL induction depended on the transcription coactivator PGC-1β (peroxisome proliferator-activated receptor-γ co-activator-1β) and the nuclear receptor ERRα (estrogen receptor-related receptor α), and that SIRT3 inhibited the differentiation by interfering with the RANKL-induced expression of PGC-1β. Thus an auto-regulatory feedback mechanism operates to induce its own inhibitor SIRT3 by PGC-1β. Moreover, Sirt3−/− osteoclast precursors reduced AMP-activated protein kinase (AMPK) phosphorylation through down-regulating the expression of AMPK. Our results suggest that a mitochondrial SIRT3 is an intrinsic inhibitor for RANKL-mediated osteoclastogenesis. PMID:26928655

DP97, a DEAD box DNA/RNA helicase, is a target gene-selective co-regulator of the constitutive androstane receptor

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kanno, Yuichiro, E-mail: ykanno@phar.toho-u.ac.jp; Serikawa, Takafumi; Inajima, Jun

Highlights: Black-Right-Pointing-Pointer DP97 interacts with nuclear receptor CAR. Black-Right-Pointing-Pointer DP97 enhances CAR-mediated transcriptional activation. Black-Right-Pointing-Pointer DP97 synergistically enhances transactivity of CAR by the co-expression of SRC-1 or PGC1{alpha}. Black-Right-Pointing-Pointer DP97 is a gene-selective co-activator for hCAR. -- Abstract: The constitutive androstane receptor (CAR) plays a key role in the expression of xenobiotic/steroid and drug metabolizing enzymes and their transporters. In this study, we demonstrated that DP97, a member of the DEAD box DNA/RNA helicase protein family, is a novel CAR-interacting protein. Using HepG2 cells expressing human CAR in the presence of tetracycline, we showed that knockdown of DP97 with smallmore » interfering RNAs suppressed tetracycline-inducible mRNA expression of CYP2B6 and UGT1A1 but not CYP3A4. Thus, DP97 was found to be a gene (or promoter)-selective co-activator for hCAR. DP97-mediated CAR transactivation was synergistically enhanced by the co-expression of SRC-1 or PGC1{alpha}, therefore it might act as mediator between hCAR and appropriate co-activators.« less

PPARγ coactivator-1α contributes to exercise-induced regulation of intramuscular lipid droplet programming in mice and humans.

PubMed

Koves, Timothy R; Sparks, Lauren M; Kovalik, J P; Mosedale, Merrie; Arumugam, Ramamani; DeBalsi, Karen L; Everingham, Karen; Thorne, Leigh; Phielix, Esther; Meex, Ruth C; Kien, C Lawrence; Hesselink, Matthijs K C; Schrauwen, Patrick; Muoio, Deborah M

2013-02-01

Intramuscular accumulation of triacylglycerol, in the form of lipid droplets (LD), has gained widespread attention as a hallmark of metabolic disease and insulin resistance. Paradoxically, LDs also amass in muscles of highly trained endurance athletes who are exquisitely insulin sensitive. Understanding the molecular mechanisms that mediate the expansion and appropriate metabolic control of LDs in the context of habitual physical activity could lead to new therapeutic opportunities. Herein, we show that acute exercise elicits robust upregulation of a broad program of genes involved in regulating LD assembly, morphology, localization, and mobilization. Prominent among these was perilipin-5, a scaffolding protein that affects the spatial and metabolic interactions between LD and their surrounding mitochondrial reticulum. Studies in transgenic mice and primary human skeletal myocytes established a key role for the exercise-responsive transcriptional coactivator PGC-1α in coordinating intramuscular LD programming with mitochondrial remodeling. Moreover, translational studies comparing physically active versus inactive humans identified a remarkably strong association between expression of intramuscular LD genes and enhanced insulin action in exercise-trained subjects. These results reveal an intimate molecular connection between intramuscular LD biology and mitochondrial metabolism that could prove relevant to the etiology and treatment of insulin resistance and other disorders of lipid imbalance.

PPARγ coactivator-1α contributes to exercise-induced regulation of intramuscular lipid droplet programming in mice and humans

PubMed Central

Koves, Timothy R.; Sparks, Lauren M.; Kovalik, J. P.; Mosedale, Merrie; Arumugam, Ramamani; DeBalsi, Karen L.; Everingham, Karen; Thorne, Leigh; Phielix, Esther; Meex, Ruth C.; Kien, C. Lawrence; Hesselink, Matthijs K. C.; Schrauwen, Patrick; Muoio, Deborah M.

2013-01-01

Intramuscular accumulation of triacylglycerol, in the form of lipid droplets (LD), has gained widespread attention as a hallmark of metabolic disease and insulin resistance. Paradoxically, LDs also amass in muscles of highly trained endurance athletes who are exquisitely insulin sensitive. Understanding the molecular mechanisms that mediate the expansion and appropriate metabolic control of LDs in the context of habitual physical activity could lead to new therapeutic opportunities. Herein, we show that acute exercise elicits robust upregulation of a broad program of genes involved in regulating LD assembly, morphology, localization, and mobilization. Prominent among these was perilipin-5, a scaffolding protein that affects the spatial and metabolic interactions between LD and their surrounding mitochondrial reticulum. Studies in transgenic mice and primary human skeletal myocytes established a key role for the exercise-responsive transcriptional coactivator PGC-1α in coordinating intramuscular LD programming with mitochondrial remodeling. Moreover, translational studies comparing physically active versus inactive humans identified a remarkably strong association between expression of intramuscular LD genes and enhanced insulin action in exercise-trained subjects. These results reveal an intimate molecular connection between intramuscular LD biology and mitochondrial metabolism that could prove relevant to the etiology and treatment of insulin resistance and other disorders of lipid imbalance. PMID:23175776

Multilingual Stroop Performance: Effects of Trilingualism and Proficiency on Inhibitory Control

ERIC Educational Resources Information Center

Marian, Viorica; Blumenfeld, Henrike K.; Mizrahi, Elena; Kania, Ursula; Cordes, Anne-Kristin

2013-01-01

Previous research suggests that multilinguals' languages are constantly co-activated and that experience managing this co-activation changes inhibitory control function. The present study examined language interaction and inhibitory control using a colour-word Stroop task. Multilingual participants were tested in their three most proficient…

Candida albicans Swi/Snf and Mediator Complexes Differentially Regulate Mrr1-Induced MDR1 Expression and Fluconazole Resistance.

PubMed

Liu, Zhongle; Myers, Lawrence C

2017-11-01

Long-term azole treatment of patients with chronic Candida albicans infections can lead to drug resistance. Gain-of-function (GOF) mutations in the transcription factor Mrr1 and the consequent transcriptional activation of MDR1 , a drug efflux coding gene, is a common pathway by which this human fungal pathogen acquires fluconazole resistance. This work elucidates the previously unknown downstream transcription mechanisms utilized by hyperactive Mrr1. We identified the Swi/Snf chromatin remodeling complex as a key coactivator for Mrr1, which is required to maintain basal and induced open chromatin, and Mrr1 occupancy, at the MDR1 promoter. Deletion of snf2 , the catalytic subunit of Swi/Snf, largely abrogates the increases in MDR1 expression and fluconazole MIC observed in MRR1 GOF mutant strains. Mediator positively and negatively regulates key Mrr1 target promoters. Deletion of the Mediator tail module med3 subunit reduces, but does not eliminate, the increased MDR1 expression and fluconazole MIC conferred by MRR1 GOF mutations. Eliminating the kinase activity of the Mediator Ssn3 subunit suppresses the decreased MDR1 expression and fluconazole MIC of the snf2 null mutation in MRR1 GOF strains. Ssn3 deletion also suppresses MDR1 promoter histone displacement defects in snf2 null mutants. The combination of this work with studies on other hyperactive zinc cluster transcription factors that confer azole resistance in fungal pathogens reveals a complex picture where the induction of drug efflux pump expression requires the coordination of multiple coactivators. The observed variations in transcription factor and target promoter dependence of this process may make the search for azole sensitivity-restoring small molecules more complicated. Copyright © 2017 American Society for Microbiology.

The pregnane X receptor down‐regulates organic cation transporter 1 (SLC22A1) in human hepatocytes by competing for (“squelching”) SRC‐1 coactivator

PubMed Central

Hyrsova, Lucie; Smutny, Tomas; Carazo, Alejandro; Moravcik, Stefan; Mandikova, Jana; Trejtnar, Frantisek; Gerbal‐Chaloin, Sabine

2016-01-01

Background and Purpose The organic cation transporter 1 (OCT1) transports cationic drugs into hepatocytes. The high hepatic expression of OCT1 is controlled by the HNF4α and USF transcription factors. Pregnane X receptor (PXR) mediates induction of the principal xenobiotic metabolizing enzymes and transporters in the liver. Here, we have assessed the down‐regulation of OCT1 expression by PXR activation. Experimental Approach We used primary human hepatocytes and related cell lines to measure OCT1 expression and activity, by assaying MPP+ accumulation. Western blotting, qRT‐PCR, the OCT1 promoter gene reporter constructs and chromatin immunoprecipitation assays were also used. Key Results OCT1 mRNA in human hepatocytes was down‐regulated along with reduced [3H]MPP+ accumulation in differentiated HepaRG cells after treatment with rifampicin. Rifampicin and hyperforin as well as the constitutively active PXR mutant T248D suppressed activity of the 1.8 kb OCT1 promoter construct in gene reporter assays. Silencing of both PXR and HNF4α in HepaRG cells blocked the PXR ligand‐mediated down‐regulation of OCT1 expression. The mutation of HNF4α and USF1 (E‐box) responsive elements reversed the PXR‐mediated inhibition in gene reporter assays. Chromatin immunoprecipitation assays indicated that PXR activation sequestrates the SRC‐1 coactivator from the HNF4α response element and E‐box of the OCT1 promoter. Consistent with these findings, exogenous overexpression of the SRC‐1, but not the PGC1α coactivator, relieved the PXR‐mediated repression of OCT1 transactivation. Conclusions and Implications PXR ligands reduced the HNF4α‐mediated and USF‐mediated transactivation of OCT1 gene expression by competing for SRC‐1 and decreased delivery of a model OCT1 substrate into hepatocytes. PMID:26920453

The Race that Precedes Coactivation: Development of Multisensory Facilitation in Children

ERIC Educational Resources Information Center

Barutchu, Ayla; Crewther, David P.; Crewther, Sheila G.

2009-01-01

Rationale: The facilitating effect of multisensory integration on motor responses in adults is much larger than predicted by race-models and is in accordance with the idea of coactivation. However, the development of multisensory facilitation of endogenously driven motor processes and its relationship to the development of complex cognitive skills…

Transgenic Mice Expressing an Inhibitory Truncated Form of p300 Exhibit Long-Term Memory Deficits

ERIC Educational Resources Information Center

Oliveira, Ana M. M.; Wood, Marcelo A.; McDonough, Conor B.; Abel, Ted

2007-01-01

The formation of many forms of long-term memory requires several molecular mechanisms including regulation of gene expression. The mechanisms directing transcription require not only activation of individual transcription factors but also recruitment of transcriptional coactivators. CBP and p300 are transcriptional coactivators that interact with…

Characterization of a Novel Small Molecule Subtype Specific Estrogen-Related Receptor α Antagonist in MCF-7 Breast Cancer Cells

PubMed Central

Chisamore, Michael J.; Cunningham, Michael E.; Flores, Osvaldo; Wilkinson, Hilary A.; Chen, J. Don

2009-01-01

Background The orphan nuclear receptor estrogen-related receptor α (ERRα) is a member of the nuclear receptor superfamily. It was identified through a search for genes encoding proteins related to estrogen receptor α (ERα). An endogenous ligand has not been found. Novel ERRα antagonists that are highly specific for binding to the ligand binding domain (LBD) of ERRα have been recently reported. Research suggests that ERRα may be a novel drug target to treat breast cancer and/or metabolic disorders and this has led to an effort to characterize the mechanisms of action of N-[(2Z)-3-(4,5-dihydro-1,3-thiazol-2-yl)-1,3-thiazolidin-2-yl idene]-5H dibenzo[a,d][7]annulen-5-amine, a novel ERRα specific antagonist. Methodology/Principal Findings We demonstrate this ERRα ligand inhibits ERRα transcriptional activity in MCF-7 cells by luciferase assay but does not affect mRNA levels measured by real-time RT-PCR. Also, ERα (ESR1) mRNA levels were not affected upon treatment with the ERRα antagonist, but other ERRα (ESRRA) target genes such as pS2 (TFF1), osteopontin (SPP1), and aromatase (CYP19A1) mRNA levels decreased. In vitro, the ERRα antagonist prevents the constitutive interaction between ERRα and nuclear receptor coactivators. Furthermore, we use Western blots to demonstrate ERRα protein degradation via the ubiquitin proteasome pathway is increased by the ERRα-subtype specific antagonist. We demonstrate by chromatin immunoprecipitation (ChIP) that the interaction between ACADM, ESRRA, and TFF1 endogenous gene promoters and ERRα protein is decreased when cells are treated with the ligand. Knocking-down ERRα (shRNA) led to similar genomic effects seen when MCF-7 cells were treated with our ERRα antagonist. Conclusions/Significance We report the mechanism of action of a novel ERRα specific antagonist that inhibits transcriptional activity of ERRα, disrupts the constitutive interaction between ERRα and nuclear coactivators, and induces proteasome-dependent ERRα protein degradation. Additionally, we confirmed that knocking-down ERRα lead to similar genomic effects demonstrated in vitro when treated with the ERRα specific antagonist. PMID:19462000

WD40 domain of Apc1 is critical for the coactivator-induced allosteric transition that stimulates APC/C catalytic activity.

PubMed

Li, Qiuhong; Chang, Leifu; Aibara, Shintaro; Yang, Jing; Zhang, Ziguo; Barford, David

2016-09-20

The anaphase-promoting complex/cyclosome (APC/C) is a large multimeric cullin-RING E3 ubiquitin ligase that orchestrates cell-cycle progression by targeting cell-cycle regulatory proteins for destruction via the ubiquitin proteasome system. The APC/C assembly comprises two scaffolding subcomplexes: the platform and the TPR lobe that together coordinate the juxtaposition of the catalytic and substrate-recognition modules. The platform comprises APC/C subunits Apc1, Apc4, Apc5, and Apc15. Although the role of Apc1 as an APC/C scaffolding subunit has been characterized, its specific functions in contributing toward APC/C catalytic activity are not fully understood. Here, we report the crystal structure of the N-terminal domain of human Apc1 (Apc1N) determined at 2.2-Å resolution and provide an atomic-resolution description of the architecture of its WD40 (WD40 repeat) domain (Apc1(WD40)). To understand how Apc1(WD40) contributes to APC/C activity, a mutant form of the APC/C with Apc1(WD40) deleted was generated and evaluated biochemically and structurally. We found that the deletion of Apc1(WD40) abolished the UbcH10-dependent ubiquitination of APC/C substrates without impairing the Ube2S-dependent ubiquitin chain elongation activity. A cryo-EM structure of an APC/C-Cdh1 complex with Apc1(WD40) deleted showed that the mutant APC/C is locked into an inactive conformation in which the UbcH10-binding site of the catalytic module is inaccessible. Additionally, an EM density for Apc15 is not visible. Our data show that Apc1(WD40) is required to mediate the coactivator-induced conformational change of the APC/C that is responsible for stimulating APC/C catalytic activity by promoting UbcH10 binding. In contrast, Ube2S activity toward APC/C substrates is not dependent on the initiation-competent conformation of the APC/C.

WD40 domain of Apc1 is critical for the coactivator-induced allosteric transition that stimulates APC/C catalytic activity

PubMed Central

Li, Qiuhong; Chang, Leifu; Aibara, Shintaro; Yang, Jing; Zhang, Ziguo; Barford, David

2016-01-01

The anaphase-promoting complex/cyclosome (APC/C) is a large multimeric cullin–RING E3 ubiquitin ligase that orchestrates cell-cycle progression by targeting cell-cycle regulatory proteins for destruction via the ubiquitin proteasome system. The APC/C assembly comprises two scaffolding subcomplexes: the platform and the TPR lobe that together coordinate the juxtaposition of the catalytic and substrate-recognition modules. The platform comprises APC/C subunits Apc1, Apc4, Apc5, and Apc15. Although the role of Apc1 as an APC/C scaffolding subunit has been characterized, its specific functions in contributing toward APC/C catalytic activity are not fully understood. Here, we report the crystal structure of the N-terminal domain of human Apc1 (Apc1N) determined at 2.2-Å resolution and provide an atomic-resolution description of the architecture of its WD40 (WD40 repeat) domain (Apc1WD40). To understand how Apc1WD40 contributes to APC/C activity, a mutant form of the APC/C with Apc1WD40 deleted was generated and evaluated biochemically and structurally. We found that the deletion of Apc1WD40 abolished the UbcH10-dependent ubiquitination of APC/C substrates without impairing the Ube2S-dependent ubiquitin chain elongation activity. A cryo-EM structure of an APC/C–Cdh1 complex with Apc1WD40 deleted showed that the mutant APC/C is locked into an inactive conformation in which the UbcH10-binding site of the catalytic module is inaccessible. Additionally, an EM density for Apc15 is not visible. Our data show that Apc1WD40 is required to mediate the coactivator-induced conformational change of the APC/C that is responsible for stimulating APC/C catalytic activity by promoting UbcH10 binding. In contrast, Ube2S activity toward APC/C substrates is not dependent on the initiation-competent conformation of the APC/C. PMID:27601667

Association of papillomavirus E6 proteins with either MAML1 or E6AP clusters E6 proteins by structure, function, and evolutionary relatedness

PubMed Central

Brimer, Nicole

2017-01-01

Papillomavirus E6 proteins bind to LXXLL peptide motifs displayed on targeted cellular proteins. Alpha genus HPV E6 proteins associate with the cellular ubiquitin ligase E6AP (UBE3A), by binding to an LXXLL peptide (ELTLQELLGEE) displayed by E6AP, thereby stimulating E6AP ubiquitin ligase activity. Beta, Gamma, and Delta genera E6 proteins bind a similar LXXLL peptide (WMSDLDDLLGS) on the cellular transcriptional co-activator MAML1 and thereby repress Notch signaling. We expressed 45 different animal and human E6 proteins from diverse papillomavirus genera to ascertain the overall preference of E6 proteins for E6AP or MAML1. E6 proteins from all HPV genera except Alpha preferentially interacted with MAML1 over E6AP. Among animal papillomaviruses, E6 proteins from certain ungulate (SsPV1 from pigs) and cetacean (porpoises and dolphins) hosts functionally resembled Alpha genus HPV by binding and targeting the degradation of E6AP. Beta genus HPV E6 proteins functionally clustered with Delta, Pi, Tau, Gamma, Chi, Mu, Lambda, Iota, Dyokappa, Rho, and Dyolambda E6 proteins to bind and repress MAML1. None of the tested E6 proteins physically and functionally interacted with both MAML1 and E6AP, indicating an evolutionary split. Further, interaction of an E6 protein was insufficient to activate degradation of E6AP, indicating that E6 proteins that target E6AP co-evolved to separately acquire both binding and triggering of ubiquitin ligase activation. E6 proteins with similar biological function clustered together in phylogenetic trees and shared structural features. This suggests that the divergence of E6 proteins from either MAML1 or E6AP binding preference is a major event in papillomavirus evolution. PMID:29281732

Spatiotemporal Regulation of the Anaphase-Promoting Complex in Mitosis

PubMed Central

Sivakumar, Sushama; Gorbsky, Gary J

2015-01-01

The appropriate timing of events that lead to chromosome segregation during mitosis and cytokinesis is essential to prevent aneuploidy, and defects in these processes can contribute to tumorigenesis. Key mitotic regulators are controlled through ubiquitylation and proteasome-mediated degradation. The Anaphase-Promoting Complex or Cyclosome (APC/C) is an E3 ubiquitin ligase that has a crucial function in the regulation of the mitotic cell cycle, particularly at the onset of anaphase and during mitotic exit. Co-activator proteins, inhibitor proteins, protein kinases and phosphatases interact with the APC/C to temporally and spatially control its activity and thus ensure accurate timing of mitotic events. PMID:25604195

Prediction of binding affinity and efficacy of thyroid hormone receptor ligands using QSAR and structure based modeling methods

PubMed Central

Politi, Regina; Rusyn, Ivan; Tropsha, Alexander

2016-01-01

The thyroid hormone receptor (THR) is an important member of the nuclear receptor family that can be activated by endocrine disrupting chemicals (EDC). Quantitative Structure-Activity Relationship (QSAR) models have been developed to facilitate the prioritization of THR-mediated EDC for the experimental validation. The largest database of binding affinities available at the time of the study for ligand binding domain (LBD) of THRβ was assembled to generate both continuous and classification QSAR models with an external accuracy of R2=0.55 and CCR=0.76, respectively. In addition, for the first time a QSAR model was developed to predict binding affinities of antagonists inhibiting the interaction of coactivators with the AF-2 domain of THRβ (R2=0.70). Furthermore, molecular docking studies were performed for a set of THRβ ligands (57 agonists and 15 antagonists of LBD, 210 antagonists of the AF-2 domain, supplemented by putative decoys/non-binders) using several THRβ structures retrieved from the Protein Data Bank. We found that two agonist-bound THRβ conformations could effectively discriminate their corresponding ligands from presumed non-binders. Moreover, one of the agonist conformations could discriminate agonists from antagonists. Finally, we have conducted virtual screening of a chemical library compiled by the EPA as part of the Tox21 program to identify potential THRβ-mediated EDCs using both QSAR models and docking. We concluded that the library is unlikely to have any EDC that would bind to the THRβ. Models developed in this study can be employed either to identify environmental chemicals interacting with the THR or, conversely, to eliminate the THR-mediated mechanism of action for chemicals of concern. PMID:25058446

Identification of a transcriptional activation domain in yeast repressor activator protein 1 (Rap1) using an altered DNA-binding specificity variant

PubMed Central

Johnson, Amanda N.; Weil, P. Anthony

2017-01-01

Repressor activator protein 1 (Rap1) performs multiple vital cellular functions in the budding yeast Saccharomyces cerevisiae. These include regulation of telomere length, transcriptional repression of both telomere-proximal genes and the silent mating type loci, and transcriptional activation of hundreds of mRNA-encoding genes, including the highly transcribed ribosomal protein- and glycolytic enzyme-encoding genes. Studies of the contributions of Rap1 to telomere length regulation and transcriptional repression have yielded significant mechanistic insights. However, the mechanism of Rap1 transcriptional activation remains poorly understood because Rap1 is encoded by a single copy essential gene and is involved in many disparate and essential cellular functions, preventing easy interpretation of attempts to directly dissect Rap1 structure-function relationships. Moreover, conflicting reports on the ability of Rap1-heterologous DNA-binding domain fusion proteins to serve as chimeric transcriptional activators challenge use of this approach to study Rap1. Described here is the development of an altered DNA-binding specificity variant of Rap1 (Rap1AS). We used Rap1AS to map and characterize a 41-amino acid activation domain (AD) within the Rap1 C terminus. We found that this AD is required for transcription of both chimeric reporter genes and authentic chromosomal Rap1 enhancer-containing target genes. Finally, as predicted for a bona fide AD, mutation of this newly identified AD reduced the efficiency of Rap1 binding to a known transcriptional coactivator TFIID-binding target, Taf5. In summary, we show here that Rap1 contains an AD required for Rap1-dependent gene transcription. The Rap1AS variant will likely also be useful for studies of the functions of Rap1 in other biological pathways. PMID:28196871

Pathophysiology of Glucocorticoid Signaling.

PubMed

Vitellius, Géraldine; Trabado, Séverine; Bouligand, Jérôme; Delemer, Brigitte; Lombès, Marc

2018-06-01

Glucocorticoids (GC), such as cortisol or dexamethasone, control various physiological functions, notably those involved in development, metabolism, inflammatory processes and stress, and exert most of their effects upon binding to the glucocorticoid receptor (GR, encoded by NR3C1 gene). GC signaling follows several consecutive steps leading to target gene transactivation, including ligand binding, nuclear translocation of ligand-activated GR complexes, DNA binding, coactivator interaction and recruitment of functional transcriptional machinery. Any step may be impaired and may account for altered GC signaling. Partial or generalized glucocorticoid resistance syndrome may result in a reduced level of functional GR, a decreased hormone affinity and binding, a defect in nuclear GR translocation, a decrease or lack of DNA binding and/or post-transcriptional GR modifications. To date, 26 loss-of-function NR3C1 mutations have been reported in the context of hypertension, hirsutism, adrenal hyperplasia or metabolic disorders. These clinical signs are generally associated with biological features including hypercortisolism without negative regulatory feedback loop on the hypothalamic-pituitary-adrenal axis. Patients had often low plasma aldosterone and renin levels despite hypertension. Only one GR gain-of-function mutation has been described associating Cushing's syndrome phenotype with normal urinary-free cortisol. Some GR polymorphisms (ER22/23EK, GR-9β) have been linked to glucocorticoid resistance and a healthier metabolic profile whereas some others seemed to be associated with GC hypersensitivity (N363S, BclI), increasing cardiovascular risk (diabetes type 2, visceral obesity). This review focuses on the earlier findings on the pathophysiology of GR signaling and presents criteria facilitating identification of novel NR3C1 mutations in selected patients. Copyright © 2018 Elsevier Masson SAS. All rights reserved.

Androgen Receptor Antagonism By Divalent Ethisterone Conjugates In Castrate-Resistant Prostate Cancer Cells

PubMed Central

Levine, Paul M.; Lee, Eugine; Greenfield, Alex; Bonneau, Richard; Logan, Susan K.; Garabedian, Michael J.; Kirshenbaum, Kent

2013-01-01

Sustained treatment of prostate cancer with Androgen Receptor (AR) antagonists can evoke drug resistance, leading to castrate-resistant disease. Elevated activity of the AR is often associated with this highly aggressive disease state. Therefore, new therapeutic regimens that target and modulate AR activity could prove beneficial. We previously introduced a versatile chemical platform to generate competitive and non-competitive multivalent peptoid oligomer conjugates that modulate AR activity. In particular, we identified a linear and a cyclic divalent ethisterone conjugate that exhibit potent anti-proliferative properties in LNCaP-abl cells, a model of castrate-resistant prostate cancer. Here, we characterize the mechanism of action of these compounds utilizing confocal microscopy, time-resolved fluorescence resonance energy transfer, chromatin immunoprecipitation, flow cytometry, and microarray analysis. The linear conjugate competitively blocks AR action by inhibiting DNA binding. In addition, the linear conjugate does not promote AR nuclear localization or co-activator binding. In contrast, the cyclic conjugate promotes AR nuclear localization and induces cell-cycle arrest, despite its inability to compete against endogenous ligand for binding to AR in vitro. Genome-wide expression analysis reveals that gene transcripts are differentially affected by treatment with the linear or cyclic conjugate. Although the divalent ethisterone conjugates share extensive chemical similarities, we illustrate that they can antagonize the AR via distinct mechanisms of action, establishing new therapeutic strategies for potential applications in AR pharmacology. PMID:22871957

Analysis of the interaction between human RITA and Drosophila Suppressor of Hairless.

PubMed

Brockmann, Birgit; Mastel, Helena; Oswald, Franz; Maier, Dieter

2014-12-01

Notch signalling mediates intercellular communication, which is effected by the transcription factor CSL, an acronym for vertebrate CBF1/RBP-J, Drosophila Suppressor of Hairless [Su(H)] and C. elegans Lag1. Nuclear import of CBF1/RBP-J depends on co-activators and co-repressors, whereas the export relies on RITA. RITA is a tubulin and CBF1/RBP-J binding protein acting as a negative regulator of Notch signalling in vertebrates. RITA protein is highly conserved in eumatazoa, but no Drosophila homologue was yet identified. In this work, the activity of human RITA in the fly was addressed. To this end, we generated transgenic flies that allow a tissue specific induction of human RITA, which was demonstrated by Western blotting and in fly tissues. Unexpectedly, overexpression of RITA during fly development had little phenotypic consequences, even when overexpressed simultaneously with either Su(H) or the Notch antagonist Hairless. We demonstrate the in vivo binding of human RITA to Su(H) and to tubulin by co-immune precipitation. Moreover, RITA and tubulin co-localized to some degree in several Drosophila tissues. Overall our data show that human RITA, albeit binding to Drosophila Su(H) and tubulin, cannot influence the Notch signalling pathway in the fly, suggesting that a nuclear export mechanism of Su(H), if existent in Drosophila, does not depend on RITA. © 2015 The Authors.

Myocardin-Related Transcription Factor A Activation by Competition with WH2 Domain Proteins for Actin Binding.

PubMed

Weissbach, Julia; Schikora, Franziska; Weber, Anja; Kessels, Michael; Posern, Guido

2016-05-15

The myocardin-related transcription factors (MRTFs) are coactivators of serum response factor (SRF)-mediated gene expression. Activation of MRTF-A occurs in response to alterations in actin dynamics and critically requires the dissociation of repressive G-actin-MRTF-A complexes. However, the mechanism leading to the release of MRTF-A remains unclear. Here we show that WH2 domains compete directly with MRTF-A for actin binding. Actin nucleation-promoting factors, such as N-WASP and WAVE2, as well as isolated WH2 domains, including those of Spire2 and Cobl, activate MRTF-A independently of changes in actin dynamics. Simultaneous inhibition of Arp2-Arp3 or mutation of the CA region only partially reduces MRTF-A activation by N-WASP and WAVE2. Recombinant WH2 domains and the RPEL domain of MRTF-A bind mutually exclusively to cellular and purified G-actin in vitro The competition by different WH2 domains correlates with MRTF-SRF activation. Following serum stimulation, nonpolymerizable actin dissociates from MRTF-A, and de novo formation of the G-actin-RPEL complex is impaired by a transferable factor. Our work demonstrates that WH2 domains activate MRTF-A and contribute to target gene regulation by a competitive mechanism, independently of their role in actin filament formation. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

Promoting Parent and Child Physical Activity Together: Elicitation of Potential Intervention Targets and Preferences

ERIC Educational Resources Information Center

Rhodes, Ryan E.; Lim, Clarise

2018-01-01

Promoting physical activities that involve both parents and their children would be very useful to the improved health and well-being of families, yet coactivity interventions have been particularly unsuccessful in past research. The purpose of this study was to elicit the salient parental beliefs about coactivity framed through theory of planned…

Premetazoan origin of the Hippo signaling pathway

PubMed Central

Sebé-Pedrós, Arnau; Zheng, Yonggang; Ruiz-Trillo, Iñaki; Pan, Duojia

2012-01-01

Summary Non-aggregative multicellularity requires strict control of cell number. The Hippo signaling pathway coordinates cell proliferation and apoptosis and is a central regulator of organ size in animals. Recent studies have shown the presence of key members of the Hippo pathway in non-bilaterian animals, but failed to identify this pathway outside Metazoa. Through comparative analyses of recently sequenced holozoan genomes, we show that Hippo pathway components, such as the kinases Hippo and Warts, the co-activator Yorkie and the transcription factor Scalloped, were already present in the unicellular ancestors of animals. Remarkably, functional analysis of Hippo components of the amoeboid holozoan Capsaspora owczarzaki, performed in Drosophila, demonstrate that the growth-regulatory activity of the Hippo pathway is conserved in this unicellular lineage. Our findings show that the Hippo pathway evolved well before the origin of Metazoa and highlight the importance of Hippo signaling as a key developmental mechanism pre-dating the origin of Metazoa. PMID:22832104

Hypoxic adaptation engages the CBP/CREST-induced coactivator complex of Creb-HIF-1α in transactivating murine neuroblastic glucose transporter

PubMed Central

Thamotharan, Shanthie; Raychaudhuri, Nupur; Tomi, Masatoshi; Shin, Bo-Chul

2013-01-01

We have shown in vitro a hypoxia-induced time-dependent increase in facilitative glucose transporter isoform 3 (GLUT3) expression in N2A murine neuroblasts. This increase in GLUT3 expression is partially reliant on a transcriptional increase noted in actinomycin D and cycloheximide pretreatment experiments. Transient transfection assays in N2A neuroblasts using murine glut3-luciferase reporter constructs mapped the hypoxia-induced enhancer activities to −857- to −573-bp and −203- to −177-bp regions. Hypoxia-exposed N2A nuclear extracts demonstrated an increase in HIF-1α and p-Creb binding to HRE (−828 to −824 bp) and AP-1 (−187 to −180 bp) cis-elements, respectively, in electromobility shift and supershift assays, which was confirmed by chromatin immunoprecipitation assays. In addition, the interaction of CBP with Creb and HIF-1α and CREST with CBP in hypoxia was detected by coimmunoprecipitation. Furthermore, small interference (si)RNA targeting Creb in these cells decreased endogenous Creb concentrations that reduced by twofold hypoxia-induced glut3 gene transcription. Thus, in N2A neuroblasts, phosphorylated HIF-1α and Creb mediated the hypoxia-induced increase in glut3 transcription. Coactivation by the Ca++-dependent CREST and CBP proteins may enhance cross-talk between p-Creb-AP-1 and HIF-1α/HRE of the glut3 gene. Collectively, these processes can facilitate an adaptive response to hypoxic energy depletion targeted at enhancing glucose transport and minimizing injury while fueling the proliferative potential of neuroblasts. PMID:23321477

Bioinformatics Knowledge Map for Analysis of Beta-Catenin Function in Cancer

PubMed Central

Arighi, Cecilia N.; Wu, Cathy H.

2015-01-01

Given the wealth of bioinformatics resources and the growing complexity of biological information, it is valuable to integrate data from disparate sources to gain insight into the role of genes/proteins in health and disease. We have developed a bioinformatics framework that combines literature mining with information from biomedical ontologies and curated databases to create knowledge “maps” of genes/proteins of interest. We applied this approach to the study of beta-catenin, a cell adhesion molecule and transcriptional regulator implicated in cancer. The knowledge map includes post-translational modifications (PTMs), protein-protein interactions, disease-associated mutations, and transcription factors co-activated by beta-catenin and their targets and captures the major processes in which beta-catenin is known to participate. Using the map, we generated testable hypotheses about beta-catenin biology in normal and cancer cells. By focusing on proteins participating in multiple relation types, we identified proteins that may participate in feedback loops regulating beta-catenin transcriptional activity. By combining multiple network relations with PTM proteoform-specific functional information, we proposed a mechanism to explain the observation that the cyclin dependent kinase CDK5 positively regulates beta-catenin co-activator activity. Finally, by overlaying cancer-associated mutation data with sequence features, we observed mutation patterns in several beta-catenin PTM sites and PTM enzyme binding sites that varied by tissue type, suggesting multiple mechanisms by which beta-catenin mutations can contribute to cancer. The approach described, which captures rich information for molecular species from genes and proteins to PTM proteoforms, is extensible to other proteins and their involvement in disease. PMID:26509276

Functional analysis of TamA, a coactivator of nitrogen-regulated gene expression in Aspergillus nidulans.

PubMed

Small, A J; Todd, R B; Zanker, M C; Delimitrou, S; Hynes, M J; Davis, M A

2001-06-01

The tam A gene of Aspergillus nidulans encodes a 739-amino acid protein with similarity to Uga35p/Dal81p/DurLp of Saccharomyces cerevisiae. It has been proposed that TamA functions as a co-activator of AreA, the major nitrogen regulatory protein in A. nidulans. Because AreA functions as a transcriptional activator under nitrogen-limiting conditions, we investigated whether TamA was also present in the nucleus. We found that a GFP-TamA fusion protein was predominantly localised to the nucleus in the presence and absence of ammonium, and that AreA was not required for this distribution. As the predicted DNA-binding domain of TamA is not essential for function, we have used a number of approaches to further define functionally important regions. We have cloned the tamA gene of A. oryzae and compared its functional and sequence characteristics with those of A. nidulans tamA and S. cerevisiae UGA35/DAL81/DURL. The Aspergillus homologues are highly conserved and functionally interchangeable, whereas the S. cerevisiae gene does not complement a tamA mutant when expressed in A. nidulans. Uga35p/Dal81p/DurLp was also found to be unable to recruit AreA. The sequence changes in a number of tamA mutant alleles were determined, and altered versions of TamA were tested for tamA complementation and interaction with AreA. Changes in most regions of TamA appeared to destroy its function, suggesting that the overall conformation of the protein may be critical for its activity.

Smad7 Protein Induces Interferon Regulatory Factor 1-dependent Transcriptional Activation of Caspase 8 to Restore Tumor Necrosis Factor-related Apoptosis-inducing Ligand (TRAIL)-mediated Apoptosis

PubMed Central

Hong, Suntaek; Kim, Hye-Youn; Kim, Jooyoung; Ha, Huyen Trang; Kim, Young-Mi; Bae, Eunjin; Kim, Tae Hyung; Lee, Kang Choon; Kim, Seong-Jin

2013-01-01

Smad7 has been known as a negative regulator for the transforming growth factor-β (TGF-β) signaling pathway through feedback regulation. However, Smad7 has been suspected to have other biological roles through the regulation of gene transcription. By screening differentially regulated genes, we found that the caspase 8 gene was highly up-regulated in Smad7-expressing cells. Smad7 was able to activate the caspase 8 promoter through recruitment of the interferon regulatory factor 1 (IRF1) transcription factor to the interferon-stimulated response element (ISRE) site. Interaction of Smad7 on the caspase 8 promoter was confirmed with electrophoretic mobility shift assay and chromatin immunoprecipitation experiment. Interestingly, Smad7 did not directly interact with the ISRE site, but it increased the binding activity of IRF1 with ISRE. These results support that Smad7 recruits IRF1 protein on the caspase 8 promoter and functions as a transcriptional coactivator. To confirm the biological significance of caspase 8 up-regulation, we tested tumor necrosis factor (TNF)-related apoptosis-inducing ligand (TRAIL)-mediated cell death assay in breast cancer cells. Smad7 in apoptosis-resistant MCF7 cells markedly sensitized the cells to TRAIL-induced cell death by restoring the caspase cascade. Furthermore, restoration of caspase 8-mediated apoptosis pathway repressed the tumor growth in the xenograft model. In conclusion, we suggest a novel role for Smad7 as a transcriptional coactivator for caspase 8 through the interaction with IRF1 in regulation of the cell death pathway. PMID:23255602

DOE Office of Scientific and Technical Information (OSTI.GOV)

Arpiainen, Satu; Jaervenpaeae, Sanna-Mari; Manninen, Aki

The nutritional state of organisms and energy balance related diseases such as diabetes regulate the metabolism of xenobiotics such as drugs, toxins and carcinogens. However, the mechanisms behind this regulation are mostly unknown. The xenobiotic-metabolizing cytochrome P450 (CYP) 2A5 enzyme has been shown to be induced by fasting and by glucagon and cyclic AMP (cAMP), which mediate numerous fasting responses. Peroxisome proliferator-activated receptor {gamma} coactivator (PGC)-1{alpha} triggers many of the important hepatic fasting effects in response to elevated cAMP levels. In the present study, we were able to show that cAMP causes a coordinated induction of PGC-1{alpha} and CYP2A5 mRNAsmore » in murine primary hepatocytes. Furthermore, the elevation of the PGC-1{alpha} expression level by adenovirus mediated gene transfer increased CYP2A5 transcription. Co-transfection of Cyp2a5 5' promoter constructs with the PGC-1{alpha} expression vector demonstrated that PGC-1{alpha} is able to activate Cyp2a5 transcription through the hepatocyte nuclear factor (HNF)-4{alpha} response element in the proximal promoter of the Cyp2a5 gene. Chromatin immunoprecipitation assays showed that PGC-1{alpha} binds, together with HNF-4{alpha}, to the same region at the Cyp2a5 proximal promoter. In conclusion, PGC-1{alpha} mediates the expression of CYP2A5 induced by cAMP in mouse hepatocytes through coactivation of transcription factor HNF-4{alpha}. This strongly suggests that PGC-1{alpha} is the major factor mediating the fasting response of CYP2A5.« less

ATF3 mediates inhibitory effects of ethanol on hepatic gluconeogenesis.

PubMed

Tsai, Wen-Wei; Matsumura, Shigenobu; Liu, Weiyi; Phillips, Naomi G; Sonntag, Tim; Hao, Ergeng; Lee, Soon; Hai, Tsonwin; Montminy, Marc

2015-03-03

Increases in circulating glucagon during fasting maintain glucose balance by stimulating hepatic gluconeogenesis. Acute ethanol intoxication promotes fasting hypoglycemia through an increase in hepatic NADH, which inhibits hepatic gluconeogenesis by reducing the conversion of lactate to pyruvate. Here we show that acute ethanol exposure also lowers fasting blood glucose concentrations by inhibiting the CREB-mediated activation of the gluconeogenic program in response to glucagon. Ethanol exposure blocked the recruitment of CREB and its coactivator CRTC2 to gluconeogenic promoters by up-regulating ATF3, a transcriptional repressor that also binds to cAMP-responsive elements and thereby down-regulates gluconeogenic genes. Targeted disruption of ATF3 decreased the effects of ethanol in fasted mice and in cultured hepatocytes. These results illustrate how the induction of transcription factors with overlapping specificity can lead to cross-coupling between stress and hormone-sensitive pathways.

Inhibition of FoxO1 acetylation by INHAT subunit SET/TAF-Iβ induces p21 transcription.

PubMed

Chae, Yun-Cheol; Kim, Kee-Beom; Kang, Joo-Young; Kim, Se-Ryeon; Jung, Hyeon-Soo; Seo, Sang-Beom

2014-08-25

Post-translational modification of forkhead family transcription factor, FoxO1, is an important regulatory mode for its diverse activities. FoxO1 is acetylated by HAT coactivators and its transcriptional activity is decreased via reduced DNA binding affinity. Here, we report that SET/TAF-Iβ inhibited p300-mediated FoxO1 acetylation in an INHAT domain-dependent manner. SET/TAF-Iβ interacted with FoxO1 and activated transcription of FoxO1 target gene, p21. Moreover, SET/TAF-Iβ inhibited acetylation of FoxO1 and increased p21 transcription induced by oxidative stress. Our results suggest that SET/TAF-Iβ inhibits FoxO1 acetylation and activates its transcriptional activity toward p21. Copyright © 2014 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

Amplification of TLO Mediator Subunit Genes Facilitate Filamentous Growth in Candida Spp.

PubMed Central

Liu, Zhongle; Moran, Gary P.; Myers, Lawrence C.

2016-01-01

Filamentous growth is a hallmark of C. albicans pathogenicity compared to less-virulent ascomycetes. A multitude of transcription factors regulate filamentous growth in response to specific environmental cues. Our work, however, suggests the evolutionary history of C. albicans that resulted in its filamentous growth plasticity may be tied to a change in the general transcription machinery rather than transcription factors and their specific targets. A key genomic difference between C. albicans and its less-virulent relatives, including its closest relative C. dubliniensis, is the unique expansion of the TLO (TeLOmere-associated) gene family in C. albicans. Individual Tlo proteins are fungal-specific subunits of Mediator, a large multi-subunit eukaryotic transcriptional co-activator complex. This amplification results in a large pool of ‘free,’ non-Mediator associated, Tlo protein present in C. albicans, but not in C. dubliniensis or other ascomycetes with attenuated virulence. We show that engineering a large ‘free’ pool of the C. dubliniensis Tlo2 (CdTlo2) protein in C. dubliniensis, through overexpression, results in a number of filamentation phenotypes typically associated only with C. albicans. The amplitude of these phenotypes is proportional to the amount of overexpressed CdTlo2 protein. Overexpression of other C. dubliniensis and C. albicans Tlo proteins do result in these phenotypes. Tlo proteins and their orthologs contain a Mediator interaction domain, and a potent transcriptional activation domain. Nuclear localization of the CdTlo2 activation domain, facilitated naturally by the Tlo Mediator binding domain or artificially through an appended nuclear localization signal, is sufficient for the CdTlo2 overexpression phenotypes. A C. albicans med3 null mutant causes multiple defects including the inability to localize Tlo proteins to the nucleus and reduced virulence in a murine systemic infection model. Our data supports a model in which the activation domain of ‘free’ Tlo protein competes with DNA bound transcription factors for targets that regulate key aspects of C. albicans cell physiology. PMID:27741243

Amplification of TLO Mediator Subunit Genes Facilitate Filamentous Growth in Candida Spp.

PubMed

Liu, Zhongle; Moran, Gary P; Sullivan, Derek J; MacCallum, Donna M; Myers, Lawrence C

2016-10-01

Filamentous growth is a hallmark of C. albicans pathogenicity compared to less-virulent ascomycetes. A multitude of transcription factors regulate filamentous growth in response to specific environmental cues. Our work, however, suggests the evolutionary history of C. albicans that resulted in its filamentous growth plasticity may be tied to a change in the general transcription machinery rather than transcription factors and their specific targets. A key genomic difference between C. albicans and its less-virulent relatives, including its closest relative C. dubliniensis, is the unique expansion of the TLO (TeLOmere-associated) gene family in C. albicans. Individual Tlo proteins are fungal-specific subunits of Mediator, a large multi-subunit eukaryotic transcriptional co-activator complex. This amplification results in a large pool of 'free,' non-Mediator associated, Tlo protein present in C. albicans, but not in C. dubliniensis or other ascomycetes with attenuated virulence. We show that engineering a large 'free' pool of the C. dubliniensis Tlo2 (CdTlo2) protein in C. dubliniensis, through overexpression, results in a number of filamentation phenotypes typically associated only with C. albicans. The amplitude of these phenotypes is proportional to the amount of overexpressed CdTlo2 protein. Overexpression of other C. dubliniensis and C. albicans Tlo proteins do result in these phenotypes. Tlo proteins and their orthologs contain a Mediator interaction domain, and a potent transcriptional activation domain. Nuclear localization of the CdTlo2 activation domain, facilitated naturally by the Tlo Mediator binding domain or artificially through an appended nuclear localization signal, is sufficient for the CdTlo2 overexpression phenotypes. A C. albicans med3 null mutant causes multiple defects including the inability to localize Tlo proteins to the nucleus and reduced virulence in a murine systemic infection model. Our data supports a model in which the activation domain of 'free' Tlo protein competes with DNA bound transcription factors for targets that regulate key aspects of C. albicans cell physiology.

Small-Molecule “BRCA1-Mimetics” Are Antagonists of Estrogen Receptor-α

PubMed Central

Ma, Yongxian; Tomita, York; Preet, Anju; Clarke, Robert; Englund, Erikah; Grindrod, Scott; Nathan, Shyam; De Oliveira, Eliseu; Brown, Milton L.

2014-01-01

Context: Resistance to conventional antiestrogens is a major cause of treatment failure and, ultimately, death in breast cancer. Objective: The objective of the study was to identify small-molecule estrogen receptor (ER)-α antagonists that work differently from tamoxifen and other selective estrogen receptor modulators. Design: Based on in silico screening of a pharmacophore database using a computed model of the BRCA1-ER-α complex (with ER-α liganded to 17β-estradiol), we identified a candidate group of small-molecule compounds predicted to bind to a BRCA1-binding interface separate from the ligand-binding pocket and the coactivator binding site of ER-α. Among 40 candidate compounds, six inhibited estradiol-stimulated ER-α activity by at least 50% in breast carcinoma cells, with IC50 values ranging between 3 and 50 μM. These ER-α inhibitory compounds were further studied by molecular and cell biological techniques. Results: The compounds strongly inhibited ER-α activity at concentrations that yielded little or no nonspecific toxicity, but they produced only a modest inhibition of progesterone receptor activity. Importantly, the compounds blocked proliferation and inhibited ER-α activity about equally well in antiestrogen-sensitive and antiestrogen-resistant breast cancer cells. Representative compounds disrupted the interaction of BRCA1 and ER-α in the cultured cells and blocked the interaction of ER-α with the estrogen response element. However, the compounds had no effect on the total cellular ER-α levels. Conclusions: These findings suggest that we have identified a new class of ER-α antagonists that work differently from conventional antiestrogens (eg, tamoxifen and fulvestrant). PMID:25264941

DOE Office of Scientific and Technical Information (OSTI.GOV)

Togi, Sumihito; Nakasuji, Misa; Muromoto, Ryuta

Kaposi's sarcoma-associated herpesvirus (KSHV)-encoded latency-associated nuclear antigen (LANA), which interacts with cellular proteins, plays a central role in modification of viral and/or cellular gene expression. Here, we show that LANA associates with glucocorticoid receptor (GR), and that LANA enhances the transcriptional activity of GR. Co-immunoprecipitation revealed a physical interaction between LANA and GR in transiently transfected 293T and HeLa cells. In human B-lymphoma cells, LANA overexpression enhanced GR activity and cell growth suppression following glucocorticoid stimulation. Furthermore, confocal microscopy showed that activated GR was bound to LANA and accumulated in the nucleus, leading to an increase in binding of activatedmore » GR to the glucocorticoid response element of target genes. Taken together, KSHV-derived LANA acts as a transcriptional co-activator of GR. Our results might suggest a careful use of glucocorticoids in the treatment of patients with KSHV-related malignancies such as Kaposi's sarcoma, primary effusion lymphoma, and multicentric Castleman disease. - Highlights: • KSHV-LANA enhances the transcriptional activity of GR in 293T and HeLa cells. • KSHV-LANA physically associates with GR. • KSHV-LANA enhances GR activation and cell growth suppression in human B-lymphocytes. • KSHV-LANA influences the nuclear retention and DNA binding activity of GR.« less

The region of CQQQKPQRRP of PGC-1{alpha} interacts with the DNA-binding complex of FXR/RXR{alpha}

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kanaya, Eiko; Jingami, Hisato

2006-04-14

PGC-1{alpha} co-activates transcription by several nuclear receptors. To study the interaction among PGC-1{alpha}, RXR{alpha}/FXR, and DNA, we performed electrophoresis mobility shift assays. The RXR{alpha}/FXR proteins specifically bound to DNA containing the IR-1 sequence in the absence of ligand. When the fusion protein of GST-PGC-1{alpha} was added to the mixture of RXR{alpha}/FXR/DNA, the ligand-influenced retardation of the mobility was observed. The ligand for RXR{alpha} (9-cis-retinoic acid) was necessary for this retardation, whereas, the ligand for FXR, chenodeoxycholic acid, barely had an effect. The results obtained using truncated PGC-1{alpha} proteins suggested that two regions are necessary for PGC-1{alpha} to interact with themore » DNA-binding complex of RXR{alpha}/FXR. One is the region of the second leucine-rich motif, and the other is that of the amino acid sequence CQQQKPQRRP, present between the second and third leucine-rich motifs. The results obtained with the SPQSS mutation for KPQRR suggested that the basic amino acids are important for the interaction.« less

Retinoic acid signaling pathways in development and diseases.

PubMed

Das, Bhaskar C; Thapa, Pritam; Karki, Radha; Das, Sasmita; Mahapatra, Sweta; Liu, Ting-Chun; Torregroza, Ingrid; Wallace, Darren P; Kambhampati, Suman; Van Veldhuizen, Peter; Verma, Amit; Ray, Swapan K; Evans, Todd

2014-01-15

Retinoids comprise a group of compounds each composed of three basic parts: a trimethylated cyclohexene ring that is a bulky hydrophobic group, a conjugated tetraene side chain that functions as a linker unit, and a polar carbon-oxygen functional group. Biochemical conversion of carotenoid or other retinoids to retinoic acid (RA) is essential for normal regulation of a wide range of biological processes including development, differentiation, proliferation, and apoptosis. Retinoids regulate various physiological outputs by binding to nuclear receptors called retinoic acid receptors (RARs) and retinoid X receptors (RXRs), which themselves are DNA-binding transcriptional regulators. The functional response of RA and their receptors are modulated by a host of coactivators and corepressors. Retinoids are essential in the development and function of several organ systems; however, deregulated retinoid signaling can contribute to serious diseases. Several natural and synthetic retinoids are in clinical use or undergoing trials for treating specific diseases including cancer. In this review, we provide a broad overview on the importance of retinoids in development and various diseases, highlighting various retinoids in the drug discovery process, ranging all the way from retinoid chemistry to clinical uses and imaging. Copyright © 2013 Elsevier Ltd. All rights reserved.

Human Krüppel-related 3 (HKR3) Is a Novel Transcription Activator of Alternate Reading Frame (ARF) Gene*

PubMed Central

Yoon, Jae-Hyeon; Choi, Won-Il; Jeon, Bu-Nam; Koh, Dong-In; Kim, Min-Kyeong; Kim, Myung-Hwa; Kim, Jungho; Hur, Sujin Susanne; Kim, Kyung-Sup; Hur, Man-Wook

2014-01-01

HKR3 (Human Krüppel-related 3) is a novel POK (POZ-domain Krüppel-like zinc-finger) family transcription factor. Recently, some of the POK (POZ-domain Krüppel-like zinc finger) family proteins have been shown to play roles in cell cycle arrest, apoptosis, cell proliferation, and oncogenesis. We investigated whether HKR3, an inhibitor of cell proliferation and an uncharacterized POK family protein, could regulate the cell cycle by controlling expression of genes within the p53 pathway (ARF-MDM2-TP53-p21WAF/CDKN1A). HKR3 potently activated the transcription of the tumor suppressor gene ARF by acting on the proximal promoter region (bp, −149∼+53), which contains Sp1 and FBI-1 binding elements (FREs). HKR3 interacted with the co-activator p300 to activate ARF transcription, which increased the acetylation of histones H3 and H4 within the proximal promoter. Oligonucleotide pull-down assays and ChIP assays revealed that HKR3 interferes with the binding of the proto-oncogenic transcription repressor FBI-1 to proximal FREs, thus derepressing ARF transcription. PMID:24382891

IMP3 Stabilization of WNT5B mRNA Facilitates TAZ Activation in Breast Cancer.

PubMed

Samanta, Sanjoy; Guru, Santosh; Elaimy, Ameer L; Amante, John J; Ou, Jianhong; Yu, Jun; Zhu, Lihua J; Mercurio, Arthur M

2018-05-29

Insulin-like growth factor-2 mRNA-binding protein 3 (IMP3) is an oncofetal protein associated with many aggressive cancers and implicated in the function of breast cancer stem cells (CSCs). The mechanisms involved, however, are poorly understood. We observed that IMP3 facilitates the activation of TAZ, a transcriptional co-activator of Hippo signaling that is necessary for the function of breast CSCs. The mechanism by which IMP3 activates TAZ involves both mRNA stability and transcriptional regulation. IMP3 stabilizes the mRNA of an alternative WNT ligand (WNT5B) indirectly by repressing miR145-5p, which targets WNT5B, resulting in TAZ activation by alternative WNT signaling. IMP3 also facilitates the transcription of SLUG, which is necessary for TAZ nuclear localization and activation, by a mechanism that is also mediated by WNT5B. These results demonstrate that TAZ can be regulated by an mRNA-binding protein and that this regulation involves the integration of Hippo and alternative WNT-signaling pathways. Copyright © 2018 The Author(s). Published by Elsevier Inc. All rights reserved.

Nuclear receptor co-activators and HER-2/neu are upregulated in breast cancer patients during neo-adjuvant treatment with aromatase inhibitors

PubMed Central

Flågeng, M Hauglid; Haugan Moi, L L; Dixon, J M; Geisler, J; Lien, E A; Miller, W R; Lønning, P E; Mellgren, G

2009-01-01

Background: Acquired resistance to endocrine therapy in breast cancer is poorly understood. Characterisation of the molecular response to aromatase inhibitors in breast cancer tissue may provide important information regarding development of oestrogen hypersensitivity. Methods: We examined the expression levels of nuclear receptor co-regulators, the orphan nuclear receptor liver receptor homologue-1 and HER-2/neu growth factor receptor using real-time RT-PCR before and after 13–16 weeks of primary medical treatment with the aromatase inhibitors anastrozole or letrozole. Results: mRNA expression of the steroid receptor co-activator 1 (SRC-1) and peroxisome-proliferator-activated receptor γ co-activator-1α (PGC-1α) was correlated (P=0.002), and both co-activators increased during treatment in the patient group as a whole (P=0.008 and P=0.032, respectively), as well as in the subgroup of patients achieving an objective treatment response (P=0.002 and P=0.006). Although we recorded no significant change in SRC-3/amplified in breast cancer 1 level, the expression correlated positively to the change of SRC-1 (P=0.002). Notably, we recorded an increase in HER-2/neu levels during therapy in the total patient group (18 out of 26; P=0.016), but in particular among responders (15 out of 21; P=0.008). Conclusion: Our results show an upregulation of co-activator mRNA and HER-2/neu during treatment with aromatase inhibitors. These mechanisms may represent an early adaption of the breast cancer cells to oestrogen deprivation in vivo. PMID:19755984

Preparatory co-activation of the ankle muscles may prevent ankle inversion injuries

PubMed Central

DeMers, Matthew S.; Hicks, Jennifer L.; Delp, Scott L.

2018-01-01

Ankle inversion sprains are the most frequent acute musculoskeletal injuries occurring in physical activity. Interventions that retrain muscle coordination have helped rehabilitate injured ankles, but it is unclear which muscle coordination strategies, if any, can prevent ankle sprains. The purpose of this study was to determine whether coordinated activity of the ankle muscles could prevent excessive ankle inversion during a simulated landing on a 30-degree incline. We used a set of musculoskeletal simulations to evaluate the efficacy of two strategies for coordinating the ankle evertor and invertor muscles during simulated landing scenarios: planned co-activation and stretch reflex activation with physiologic latency (60-millisecond delay). A full-body musculoskeletal model of landing was used to generate simulations of a subject dropping onto an inclined surface with each coordination condition. Within each condition, the intensity of evertor and invertor co-activity or stretch reflexes were varied systematically. The simulations revealed that strong preparatory co-activation of the ankle evertors and invertors prior to ground contact prevented ankle inversion from exceeding injury thresholds by rapidly generating eversion moments after initial contact. Conversely, stretch reflexes were too slow to generate eversion moments before the simulations reached the threshold for inversion injury. These results suggest that training interventions to protect the ankle should focus on stiffening the ankle with muscle co-activation prior to landing. The musculoskeletal models, controllers, software, and simulation results are freely available online at http://simtk.org/home/ankle-sprains, enabling others to reproduce the results and explore new injury scenarios and interventions. PMID:28057351

Older adults learn less, but still reduce metabolic cost, during motor adaptation

PubMed Central

Huang, Helen J.

2013-01-01

The ability to learn new movements and dynamics is important for maintaining independence with advancing age. Age-related sensorimotor changes and increased muscle coactivation likely alter the trial-and-error-based process of adapting to new movement demands (motor adaptation). Here, we asked, to what extent is motor adaptation to novel dynamics maintained in older adults (≥65 yr)? We hypothesized that older adults would adapt to the novel dynamics less well than young adults. Because older adults often use muscle coactivation, we expected older adults to use greater muscle coactivation during motor adaptation than young adults. Nevertheless, we predicted that older adults would reduce muscle activity and metabolic cost with motor adaptation, similar to young adults. Seated older (n = 11, 73.8 ± 5.6 yr) and young (n = 15, 23.8 ± 4.7 yr) adults made targeted reaching movements while grasping a robotic arm. We measured their metabolic rate continuously via expired gas analysis. A force field was used to add novel dynamics. Older adults had greater movement deviations and compensated for just 65% of the novel dynamics compared with 84% in young adults. As expected, older adults used greater muscle coactivation than young adults. Last, older adults reduced muscle activity with motor adaptation and had consistent reductions in metabolic cost later during motor adaptation, similar to young adults. These results suggest that despite increased muscle coactivation, older adults can adapt to the novel dynamics, albeit less accurately. These results also suggest that reductions in metabolic cost may be a fundamental feature of motor adaptation. PMID:24133222

Effects of Response Task and Accessory Stimuli on Redundancy Gain: Tests of the Hemispheric Coactivation Model

ERIC Educational Resources Information Center

Miller, Jeff; Van Nes, Fenna

2007-01-01

Two experiments tested predictions of the hemispheric coactivation model for redundancy gain (J. O. Miller, 2004). Simple reaction time was measured in divided attention tasks with visual stimuli presented to the left or right of fixation or redundantly to both sides. Experiment 1 tested the prediction that redundancy gain--the decrease in…

"Leading Better Care": An evaluation of an accelerated coaching intervention for clinical nursing leadership development.

PubMed

Cable, Stuart; Graham, Edith

2018-03-30

Outcomes of an accelerated co-active coaching intervention for senior clinical nursing leadership development. Co-active coaching is characterized by a whole person approach, commitment to deep learning and conscious action through supportive compassionate and courageous coach-coachee partnership. The national leadership capabilities framework, "Step into Leadership", was used for development and evaluation. 116 senior clinical nurse leaders attended one face-to-face induction day and received a total of 3 hours of one-to-one telephone coaching and two virtual peer group facilitated sessions. Evaluation used primarily qualitative descriptive methods with iterative review of emerging themes. Capability mapping indicated self-leadership development as the most frequently cited need. Improvements in self-confidence, capacity for reflection and bringing whole self into the work were reported to deliver enhancement in team and service performance. Co-active coaching supported deep analysis by individuals. Focus on self, rather than behaviours provoked reflection on perspectives, mindsets, beliefs and approaches which can lead to more sustainable behaviour and support service change. Investment in a co-active coaching approach offers bespoke support for clinical leaders to develop self-leadership capability, a precursor to delivering positive impacts on care. © 2018 John Wiley & Sons Ltd.

Phase-dependence of elbow muscle coactivation in front crawl swimming.

PubMed

Lauer, Jessy; Figueiredo, Pedro; Vilas-Boas, João Paulo; Fernandes, Ricardo J; Rouard, Annie Hélène

2013-08-01

Propulsion in swimming is achieved by complex sculling movements with elbow quasi-fixed on the antero-posterior axis to transmit forces from the hand and the forearm to the body. The purpose of this study was to investigate how elbow muscle coactivation was influenced by the front crawl stroke phases. Ten international level male swimmers performed a 200-m front crawl race-pace bout. Sagittal views were digitized frame by frame to determine the stroke phases (aquatic elbow flexion and extension, aerial elbow flexion and extension). Surface electromyograms (EMG) of the right biceps brachii and triceps brachii were recorded and processed using the integrated EMG to calculate a coactivation index (CI) for each phase. A significant effect of the phases on the CI was revealed with highest levels of coactivation during the aquatic elbow flexion and the aerial elbow extension. Swimmers stabilize the elbow joint to overcome drag during the aquatic phase, and act as a brake at the end of the recovery to replace the arm for the next stroke. The CI can provide insight into the magnitude of mechanical constraints supported by a given joint, in particular during a complex movement. Copyright © 2013 Elsevier Ltd. All rights reserved.

Skeletal muscle adaptation to fatty acid depends on coordinated actions of the PPARs and PGC1 alpha: implications for metabolic disease.

PubMed

Muoio, Deborah M; Koves, Timothy R

2007-10-01

Dyslipidemia and intramuscular accumulation of fatty acid metabolites are increasingly recognized as core features of obesity and type 2 diabetes. Emerging evidence suggests that normal physiological adaptations to a heavy lipid load depend on the coordinated actions of broad transcriptional regulators such as the peroxisome proliferator activated receptors (PPARs) and PPAR gamma coactivator 1 alpha (PGC1 alpha). The application of transcriptomics and targeted metabolic profiling tools based on mass spectrometry has led to our finding that lipid-induced insulin resistance is a condition in which upregulation of PPAR-targeted genes and high rates of beta-oxidation are not supported by a commensurate upregulation of tricarboxylic acid (TCA) cycle activity. In contrast, exercise training enhances mitochondrial performance, favoring tighter coupling between beta-oxidation and the TCA cycle, and concomitantly restores insulin sensitivity in animals fed a chronic high-fat diet. The exercise-activated transcriptional coactivator, PGC1 alpha, plays a key role in coordinating metabolic flux through these 2 intersecting metabolic pathways, and its suppression by overfeeding may contribute to diet-induced mitochondrial dysfunction. Our emerging model predicts that muscle insulin resistance arises from a mitochondrial disconnect between beta-oxidation and TCA cycle activity. Understanding of this "disconnect" and its molecular basis may lead to new therapeutic approaches to combatting metabolic disease.

Different ankle muscle coordination patterns and co-activation during quiet stance between young adults and seniors do not change after a bout of high intensity training.

PubMed

Donath, Lars; Kurz, Eduard; Roth, Ralf; Zahner, Lukas; Faude, Oliver

2015-03-04

Available evidence suggests that young adults and seniors use different strategies to adjust for increasing body sway during quiet standing. Altered antagonist muscle co-activation and different ankle muscle coordination patterns may account for this finding. Consequently, we aimed at addressing whether aging leads to changes in neuromuscular coordination patterns as well as co-activation during quiet stance. We additionally investigated whether a bout of high intensity interval training additionally alters these patterns. Twenty healthy seniors (age: 70 ± 4 y) and twenty young adults (age: 27 ± 3 y) were enrolled in the present study. In between the testing procedures, four consecutive high-intensity intervals of 4 min duration at a target exercise intensity of 90 to 95% HRmax were completed on a treadmill. The total center of pressure (COP) path length displacement served as standing balance performance outcome. In order to assess ankle muscle coordination patterns, amplitude ratios (AR) were calculated for each muscle (e.g. tibialis anterior (TA) [%] = (TA × 100)/(gastrocnemius medialis (GM) + soleus (SOL) + peroneus longus (PL) + TA). The co-activation was calculated for the SOL and TA muscles computing the co-activation index (CAI = 2 × TA/TA + SOL). Seniors showed an inverted ankle muscle coordination pattern during single limb stance with eyes open (SLEO), compared to young adults (rest: GM, S: 15 ± 8% vs Y: 24 ± 9%; p = 0.03; SOL, S: 27 ± 14% vs Y: 37 ± 18%; p = 0.009; TA, S: 31 ± 13% vs Y: 13 ± 7%; p = 0.003). These patterns did not change after a high-intensity training session. A moderate correlation between amplitude ratios of the TA-contribution and postural sway was observed for seniors during SLEO (r = 0.61). Ankle co-activation was twofold elevated in seniors compared to young adults during SLEO (p < 0.001). These findings were also not affected by high intensity training. Increased ankle co-activation in the anterior-posterior plane and inverted ankle muscle coordination pattern merely occurred during single-leg stance. Seniors with decreased postural control showed higher TA contributions during SLEO. These neuromuscular changes are not affected by acute intermittent high intensity aerobic exercise.

Voluntary enhanced cocontraction of hamstring muscles during open kinetic chain leg extension exercise: its potential unloading effect on the anterior cruciate ligament.

PubMed

Biscarini, Andrea; Benvenuti, Paolo; Botti, Fabio M; Brunetti, Antonella; Brunetti, Orazio; Pettorossi, Vito E

2014-09-01

A number of research studies provide evidence that hamstring cocontraction during open kinetic chain knee extension exercises enhances tibiofemoral (TF) stability and reduces the strain on the anterior cruciate ligament. To determine the possible increase in hamstring muscle coactivation caused by a voluntary cocontraction effort during open kinetic chain leg-extension exercises, and to assess whether an intentional hamstring cocontraction can completely suppress the anterior TF shear force during these exercises. Descriptive laboratory study. Knee kinematics as well as electromyographic activity in the semitendinosus (ST), semimembranosus (SM), biceps femoris (BF), and quadriceps femoris muscles were measured in 20 healthy men during isotonic leg extension exercises with resistance (R) ranging from 10% to 80% of the 1-repetition maximum (1RM). The same exercises were also performed while the participants attempted to enhance hamstring coactivation through a voluntary cocontraction effort. The data served as input parameters for a model to calculate the shear and compressive TF forces in leg extension exercises for any set of coactivation patterns of the different hamstring muscles. For R≤ 40% 1RM, the peak coactivation levels obtained with intentional cocontraction (l) were significantly higher (P < 10(-3)) than those obtained without intentional cocontraction (l 0). For each hamstring muscle, maximum level l was reached at R = 30% 1RM, corresponding to 9.2%, 10.5%, and 24.5% maximum voluntary isometric contraction (MVIC) for the BF, ST, and SM, respectively, whereas the ratio l/l 0 reached its maximum at R = 20% 1RM and was approximately 2, 3, and 4 for the BF, SM, and ST, respectively. The voluntary enhanced coactivation level l obtained for R≤ 30% 1RM completely suppressed the anterior TF shear force developed by the quadriceps during the exercise. In leg extension exercises with resistance R≤ 40% 1RM, coactivation of the BF, SM, and ST can be significantly enhanced (up to 2, 3, and 4 times, respectively) by a voluntary hamstring cocontraction effort. The enhanced coactivation levels obtained for R≤ 30% 1RM can completely suppress the anterior TF shear force developed by the quadriceps during the exercise. This laboratory study suggests that leg extension exercise with intentional hamstring cocontraction may have the potential to be a safe and effective quadriceps-strengthening intervention in the early stages of rehabilitation programs for anterior cruciate ligament injury or reconstruction recovery. Further studies, including clinical trials, are needed to investigate the relevance of this therapeutic exercise in clinical practice. © 2014 The Author(s).

Changes in Convictions and Attitudes to the Teaching Profession and Classroom Management Due to Practical Teaching Experience

ERIC Educational Resources Information Center

Gawlitza, Gaby; Perels, Franziska

2014-01-01

The aim of this study is to analyze changes in beliefs and attitudes to the teaching profession and to classroom management as a result of teaching experience. The structure of this study is based partly on the COACTIV-model of professional competence of teachers. The COACTIV-model is divided into motivational orientations, convictions and basic…

Unmanned Tactical Autonomous Control and Collaboration Coactive Design

DTIC Science & Technology

2016-06-01

AUTONOMOUS CONTROL AND COLLABORATION COACTIVE DESIGN by Matthew S. Zach June 2016 Thesis Advisor: Dan Boger Second Reader: Scot Miller...POSTGRADUATE SCHOOL June 2016 Approved by: Dan Boger, Ph.D. Thesis Advisor Scot Miller Second Reader Dan Boger, Ph.D...assistance, and mentoring, I remain most grateful. I begin by thanking Dr. Dan Boger and Scot Miller for taking me on as a thesis student. You

The Role of Nuclear Receptor Coactivator A1B1 in Growth Factor-Mediated Mammary Tumorigenesis

DTIC Science & Technology

2007-03-01

study display dwarfism and the retardation of mammary gland growth [9]. At the 4-month time point, I similarly observed an overall decrease in mammary...Coactivator A1B1 in Growth Factor- Mediated Mammary Tumorigenesis PRINCIPAL INVESTIGATOR: Mark P Fereshteh (BS) CONTRACTING ORGANIZATION...U.S. Army Medical Research and Materiel Command Fort Detrick, Maryland 21702-5012 DISTRIBUTION

Co-Activity during Maximum Voluntary Contraction: A Study of Four Lower-Extremity Muscles in Children with and without Cerebral Palsy

ERIC Educational Resources Information Center

Tedroff, Kristina; Knutson, Loretta M.; Soderberg, Gary L.

2008-01-01

This study was designed to determine whether children with cerebral palsy (CP) showed more co-activity than comparison children in non-prime mover muscles with regard to the prime mover during maximum voluntary isometric contraction (MVIC) of four lower-extremity muscles. Fourteen children with spastic diplegic CP (10 males, four females; age…

LIM-domain protein AJUBA suppresses malignant mesothelioma cell proliferation via Hippo signaling cascade.

PubMed

Tanaka, I; Osada, H; Fujii, M; Fukatsu, A; Hida, T; Horio, Y; Kondo, Y; Sato, A; Hasegawa, Y; Tsujimura, T; Sekido, Y

2015-01-02

Malignant mesothelioma (MM) is one of the most aggressive neoplasms usually associated with asbestos exposure and is highly refractory to current therapeutic modalities. MMs show frequent activation of a transcriptional coactivator Yes-associated protein (YAP), which is attributed to the neurofibromatosis type 2 (NF2)-Hippo pathway dysfunction, leading to deregulated cell proliferation and acquisition of a malignant phenotype. However, the whole mechanism of disordered YAP activation in MMs has not yet been well clarified. In the present study, we investigated various components of the NF2-Hippo pathway, and eventually found that MM cells frequently showed downregulation of LIM-domain protein AJUBA, a binding partner of large tumor suppressor type 2 (LATS2), which is one of the last-step kinases of the NF2-Hippo pathway. Although loss of AJUBA expression was independent of the alteration status of other Hippo pathway components, MM cell lines with AJUBA inactivation showed a more dephosphorylated (activated) level of YAP. Immunohistochemical analysis showed frequent downregulation of AJUBA in primary MMs, which was associated with YAP constitutive activation. We found that AJUBA transduction into MM cells significantly suppressed promoter activities of YAP-target genes, and the suppression of YAP activity by AJUBA was remarkably canceled by knockdown of LATS2. In connection with these results, transduction of AJUBA-expressing lentivirus significantly inhibited the proliferation and anchorage-independent growth of the MM cells that harbored ordinary LATS family expression. Taken together, our findings indicate that AJUBA negatively regulates YAP activity through the LATS family, and inactivation of AJUBA is a novel key mechanism in MM cell proliferation.

Machine Learning Helps Identify CHRONO as a Circadian Clock Component

PubMed Central

Venkataraman, Anand; Ramanathan, Chidambaram; Kavakli, Ibrahim H.; Hughes, Michael E.; Baggs, Julie E.; Growe, Jacqueline; Liu, Andrew C.; Kim, Junhyong; Hogenesch, John B.

2014-01-01

Over the last decades, researchers have characterized a set of “clock genes” that drive daily rhythms in physiology and behavior. This arduous work has yielded results with far-reaching consequences in metabolic, psychiatric, and neoplastic disorders. Recent attempts to expand our understanding of circadian regulation have moved beyond the mutagenesis screens that identified the first clock components, employing higher throughput genomic and proteomic techniques. In order to further accelerate clock gene discovery, we utilized a computer-assisted approach to identify and prioritize candidate clock components. We used a simple form of probabilistic machine learning to integrate biologically relevant, genome-scale data and ranked genes on their similarity to known clock components. We then used a secondary experimental screen to characterize the top candidates. We found that several physically interact with known clock components in a mammalian two-hybrid screen and modulate in vitro cellular rhythms in an immortalized mouse fibroblast line (NIH 3T3). One candidate, Gene Model 129, interacts with BMAL1 and functionally represses the key driver of molecular rhythms, the BMAL1/CLOCK transcriptional complex. Given these results, we have renamed the gene CHRONO (computationally highlighted repressor of the network oscillator). Bi-molecular fluorescence complementation and co-immunoprecipitation demonstrate that CHRONO represses by abrogating the binding of BMAL1 to its transcriptional co-activator CBP. Most importantly, CHRONO knockout mice display a prolonged free-running circadian period similar to, or more drastic than, six other clock components. We conclude that CHRONO is a functional clock component providing a new layer of control on circadian molecular dynamics. PMID:24737000

Discovery of a selective catalytic p300/CBP inhibitor that targets lineage-specific tumours

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lasko, Loren M.; Jakob, Clarissa G.; Edalji, Rohinton P.

The dynamic and reversible acetylation of proteins, catalysed by histone acetyltransferases (HATs) and histone deacetylases (HDACs), is a major epigenetic regulatory mechanism of gene transcription1 and is associated with multiple diseases. Histone deacetylase inhibitors are currently approved to treat certain cancers, but progress on the development of drug-like histone actyltransferase inhibitors has lagged behind2. The histone acetyltransferase paralogues p300 and CREB-binding protein (CBP) are key transcriptional co-activators that are essential for a multitude of cellular processes, and have also been implicated in human pathological conditions (including cancer3). Current inhibitors of the p300 and CBP histone acetyltransferase domains, including natural products4,more » bi-substrate analogues5 and the widely used small molecule C6466,7, lack potency or selectivity. Here, we describe A-485, a potent, selective and drug-like catalytic inhibitor of p300 and CBP. We present a high resolution (1.95 Å) co-crystal structure of a small molecule bound to the catalytic active site of p300 and demonstrate that A-485 competes with acetyl coenzyme A (acetyl-CoA). A-485 selectively inhibited proliferation in lineage-specific tumour types, including several haematological malignancies and androgen receptor-positive prostate cancer. A-485 inhibited the androgen receptor transcriptional program in both androgen-sensitive and castration-resistant prostate cancer and inhibited tumour growth in a castration-resistant xenograft model. These results demonstrate the feasibility of using small molecule inhibitors to selectively target the catalytic activity of histone acetyltransferases, which may provide effective treatments for transcriptional activator-driven malignancies and diseases.« less

The AMPK-PPARGC1A pathway is required for antimicrobial host defense through activation of autophagy.

PubMed

Yang, Chul-Su; Kim, Jwa-Jin; Lee, Hye-Mi; Jin, Hyo Sun; Lee, Sang-Hee; Park, Ji-Hoon; Kim, Soung Jung; Kim, Jin-Man; Han, Yong-Mahn; Lee, Myung-Shik; Kweon, Gi Ryang; Shong, Minho; Jo, Eun-Kyeong

2014-05-01

AMP-activated protein kinase (AMPK) is a crucial energy sensor and plays a key role in integration of cellular functions to maintain homeostasis. Despite this, it is largely unknown whether targeting the AMPK pathway can be used as a therapeutic strategy for infectious diseases. Herein, we show that AMPK activation robustly induces antibacterial autophagy, which contributes to antimicrobial defense against Mycobacterium tuberculosis (Mtb). AMPK activation led to inhibition of Mtb-induced phosphorylation of the mechanistic target of rapamycin (MTOR) in macrophages. In addition, AMPK activation increased the genes involved in oxidative phosphorylation, mitochondrial ATP production, and biogenesis in Mtb-infected macrophages. Notably, peroxisome proliferator-activated receptor-gamma, coactivator 1α (PPARGC1A) was required for AMPK-mediated antimicrobial activity, as well as enhancement of mitochondrial function and biogenesis, in macrophages. Further, the AMPK-PPARGC1A pathway was involved in the upregulation of multiple autophagy-related genes via CCAAT/enhancer binding protein (C/EBP), β (CEBPB). PPARGC1A knockdown inhibited the AMPK-mediated induction of autophagy and impaired the fusion of phagosomes with MAP1LC3B (LC3B) autophagosomes in Mtb-infected macrophages. The link between autophagy, mitochondrial function, and antimicrobial activity was further demonstrated by studying LysMCre-mediated knockout of atg7, demonstrating mitochondrial ultrastructural defects and dysfunction, as well as blockade of antimicrobial activity against mycobacteria. Collectively, our results identify the AMPK-PPARGC1A axis as contributing to autophagy activation leading to an antimicrobial response, as a novel host defense mechanism.

14,15-EET promotes mitochondrial biogenesis and protects cortical neurons against oxygen/glucose deprivation-induced apoptosis.

PubMed

Wang, Lai; Chen, Man; Yuan, Lin; Xiang, Yuting; Zheng, Ruimao; Zhu, Shigong

2014-07-18

14,15-Epoxyeicosatrienoic acid (14,15-EET), a metabolite of arachidonic acid, is enriched in the brain cortex and exerts protective effect against neuronal apoptosis induced by ischemia/reperfusion. Although apoptosis has been well recognized to be closely associated with mitochondrial biogenesis and function, it is still unclear whether the neuroprotective effect of 14,15-EET is mediated by promotion of mitochondrial biogenesis and function in cortical neurons under the condition of oxygen-glucose deprivation (OGD). In this study, we found that 14,15-EET improved cell viability and inhibited apoptosis of cortical neurons. 14,15-EET significantly increased the mitochondrial mass and the ratio of mitochondrial DNA to nuclear DNA. Key makers of mitochondrial biogenesis, peroxisome proliferator activator receptor gamma-coactivator 1 alpha (PGC-1α), nuclear respiratory factor 1 (NRF-1) and mitochondrial transcription factor A (TFAM), were elevated at both mRNA and protein levels in the cortical neurons treated with 14,15-EET. Moreover, 14,15-EET markedly attenuated the decline of mitochondrial membrane potential, reduced ROS, while increased ATP synthesis. Knockdown of cAMP-response element binding protein (CREB) by siRNA blunted the up-regulation of PGC-1α and NRF-1 stimulated by 14,15-EET, and consequently abolished the neuroprotective effect of 14,15-EET. Our results indicate that 14,15-EET protects neurons from OGD-induced apoptosis by promoting mitochondrial biogenesis and function through CREB mediated activation of PGC-1α and NRF-1. Copyright © 2014 Elsevier Inc. All rights reserved.

The Hippo signaling pathway in stem cell biology and cancer

PubMed Central

Mo, Jung-Soon; Park, Hyun Woo; Guan, Kun-Liang

2014-01-01

The Hippo signaling pathway, consisting of a highly conserved kinase cascade (MST and Lats) and downstream transcription coactivators (YAP and TAZ), plays a key role in tissue homeostasis and organ size control by regulating tissue-specific stem cells. Moreover, this pathway plays a prominent role in tissue repair and regeneration. Dysregulation of the Hippo pathway is associated with cancer development. Recent studies have revealed a complex network of upstream inputs, including cell density, mechanical sensation, and G-protein-coupled receptor (GPCR) signaling, that modulate Hippo pathway activity. This review focuses on the role of the Hippo pathway in stem cell biology and its potential implications in tissue homeostasis and cancer. PMID:24825474

Hippo Pathway in Organ Size Control, Tissue Homeostasis, and Cancer

PubMed Central

Yu, Fa-Xing; Zhao, Bin; Guan, Kun-Liang

2015-01-01

Two decades of studies in multiple model organisms have established the Hippo pathway as a key regulator of organ size and tissue homeostasis. By inhibiting YAP and TAZ transcription co-activators, the Hippo pathway regulates cell proliferation, apoptosis, and stemness in response to a wide range of extracellular and intracellular signals, including cell-cell contact, cell polarity, mechanical cues, ligands of G-protein coupled receptors, and cellular energy status. Dysregulation of the Hippo pathway exerts a significant impact on cancer development. Further investigation of the functions and regulatory mechanisms of this pathway will help uncovering the mystery of organ size control and identify new targets for cancer treatment. PMID:26544935

Ankle muscle activity modulation during single-leg stance differs between children, young adults and seniors.

PubMed

Kurz, Eduard; Faude, Oliver; Roth, Ralf; Zahner, Lukas; Donath, Lars

2018-02-01

Incomplete maturation and aging-induced declines of the neuromuscular system affect postural control both in children and older adults and lead to high fall rates. Age-specific comparisons of the modulation of ankle muscle activation and behavioral center of pressure (COP) indices during upright stance have been rarely conducted. The objective of the present study was to quantify aging effects on a neuromuscular level. Thus, surface electromyography (SEMG) modulation and co-activity of ankle muscles during single-leg standing was compared in healthy children, young adults and seniors. Postural steadiness (velocity and mean sway frequency of COP), relative muscle activation (SEMG modulation) and co-activation of two ankle muscles (tibialis anterior, TA; soleus, SO) were examined during single-leg stance in 19 children [age, 9.7 (SD 0.5) years], 30 adults [23.3 (1.5) years] and 29 seniors [62.7 (6.1) years]. Velocity of COP in medio-lateral and anterior-posterior directions, mean sway frequency in anterior-posterior direction, relative muscle activation (TA and SO) and co-activation revealed large age effects (P < 0.003, η p 2  > 0.14). Post-hoc comparisons indicated higher COP velocities, anterior-posterior frequencies, relative SO activation and co-activation in children and seniors when compared with adults. Relative TA activation was higher in children and adults compared with seniors (P < 0.001). Increased postural sway in children and seniors seems to be counteracted with higher TA/SO co-activity and SO modulation. However, TA modulation is higher in children and adults, whereas seniors' TA modulation capacity is diminished. An aging-induced decline of TA motor units might account for deteriorations of TA modulation in seniors.

Carbidopa abrogates L-dopa decarboxylase coactivation of the androgen receptor and delays prostate tumor progression.

PubMed

Wafa, Latif A; Cheng, Helen; Plaa, Nathan; Ghaidi, Fariba; Fukumoto, Takahiro; Fazli, Ladan; Gleave, Martin E; Cox, Michael E; Rennie, Paul S

2012-06-15

The androgen receptor (AR) plays a central role in prostate cancer progression to the castration-resistant (CR) lethal state. L-Dopa decarboxylase (DDC) is an AR coactivator that increases in expression with disease progression and is coexpressed with the receptor in prostate adenocarcinoma cells, where it may enhance AR activity. Here, we hypothesize that the DDC enzymatic inhibitor, carbidopa, can suppress DDC-coactivation of AR and retard prostate tumor growth. Treating LNCaP prostate cancer cells with carbidopa in transcriptional assays suppressed the enhanced AR transactivation seen with DDC overexpression and decreased prostate-specific antigen (PSA) mRNA levels. Carbidopa dose-dependently inhibited cell growth and decreased survival in LNCaP cell proliferation and apoptosis assays. The inhibitory effect of carbidopa on DDC-coactivation of AR and cell growth/survival was also observed in PC3 prostate cancer cells (stably expressing AR). In vivo studies demonstrated that serum PSA velocity and tumor growth rates elevated ∼2-fold in LNCaP xenografts, inducibly overexpressing DDC, were reverted to control levels with carbidopa administration. In castrated mice, treating LNCaP tumors, expressing endogenous DDC, with carbidopa delayed progression to the CR state from 6 to 10 weeks, while serum PSA and tumor growth decreased 4.3-fold and 5.4-fold, respectively. Our study is a first time demonstration that carbidopa can abrogate DDC-coactivation of AR in prostate cancer cells and tumors, decrease serum PSA, reduce tumor growth and delay CR progression. Since carbidopa is clinically approved, it may be readily used as a novel therapeutic strategy to suppress aberrant AR activity and delay prostate cancer progression. Copyright © 2011 UICC.

Cognitive Stress Reduces the Effect of Levodopa on Parkinson's Resting Tremor.

PubMed

Zach, Heidemarie; Dirkx, Michiel F; Pasman, Jaco W; Bloem, Bastiaan R; Helmich, Rick C

2017-03-01

Resting tremor in Parkinson's disease (PD) increases markedly during cognitive stress. Dopamine depletion in the basal ganglia is involved in the pathophysiology of resting tremor, but it is unclear whether this contribution is altered under cognitive stress. We test the hypothesis that cognitive stress modulates the levodopa effect on resting tremor. Tremulous PD patients (n = 69) were measured in two treatment conditions (OFF vs. ON levodopa) and in two behavioral contexts (rest vs. cognitive co-activation). Using accelerometry, we tested the effect of both interventions on tremor intensity and tremor variability. Levodopa significantly reduced tremor intensity (across behavioral contexts), while cognitive co-activation increased it (across treatment conditions). Crucially, the levodopa effect was significantly smaller during cognitive co-activation than during rest. Resting tremor variability increased after levodopa and decreased during cognitive co-activation. Cognitive stress reduces the levodopa effect on Parkinson's tremor. This effect may be explained by a stress-related depletion of dopamine in the basal ganglia motor circuit, by stress-related involvement of nondopaminergic mechanisms in tremor (e.g., noradrenaline), or both. Targeting these mechanisms may open new windows for treatment. Clinical tremor assessments under evoked cognitive stress (e.g., counting tasks) may avoid overestimation of treatment effects in real life. © 2017 The Authors. CNS Neuroscience & Therapeutics Published by John Wiley & Sons Ltd.

Neuroimaging meta-analysis of cannabis use studies reveals convergent functional alterations in brain regions supporting cognitive control and reward processing.

PubMed

Yanes, Julio A; Riedel, Michael C; Ray, Kimberly L; Kirkland, Anna E; Bird, Ryan T; Boeving, Emily R; Reid, Meredith A; Gonzalez, Raul; Robinson, Jennifer L; Laird, Angela R; Sutherland, Matthew T

2018-03-01

Lagging behind rapid changes to state laws, societal views, and medical practice is the scientific investigation of cannabis's impact on the human brain. While several brain imaging studies have contributed important insight into neurobiological alterations linked with cannabis use, our understanding remains limited. Here, we sought to delineate those brain regions that consistently demonstrate functional alterations among cannabis users versus non-users across neuroimaging studies using the activation likelihood estimation meta-analysis framework. In ancillary analyses, we characterized task-related brain networks that co-activate with cannabis-affected regions using data archived in a large neuroimaging repository, and then determined which psychological processes may be disrupted via functional decoding techniques. When considering convergent alterations among users, decreased activation was observed in the anterior cingulate cortex, which co-activated with frontal, parietal, and limbic areas and was linked with cognitive control processes. Similarly, decreased activation was observed in the dorsolateral prefrontal cortex, which co-activated with frontal and occipital areas and linked with attention-related processes. Conversely, increased activation among users was observed in the striatum, which co-activated with frontal, parietal, and other limbic areas and linked with reward processing. These meta-analytic outcomes indicate that cannabis use is linked with differential, region-specific effects across the brain.

Muscle co-activation and its influence on running performance and risk of injury in elite Kenyan runners.

PubMed

Tam, Nicholas; Santos-Concejero, Jordan; Coetzee, Devon R; Noakes, Timothy D; Tucker, Ross

2017-01-01

The relationship between muscle co-activation and energy cost of transport and risk of injury (initial loading rate and joint stiffness) has not been jointly studied. Fourteen elite Kenyan male runners were tested at two speeds (12 and 20 km · h -1 ), where oxygen consumption, kinematic, kinetic and electromyography were recorded. Electromyography of seven lower limb muscles was recorded. Pre-activation and ground contact of agonist:antagonist co-activation was determined. All muscles displayed higher activity during pre-activation except rectus femoris (RF). Conversely, no differences were found during ground contact except for higher biceps femoris (BF) at 20 km · h -1 . Knee stiffness was correlated to RF-BF co-activation during both pre-activation and ground contact at both running speeds. However, energy cost of transport was only positively correlated to the above-mentioned muscle pairs at 20 km · h -1 (r = 0620, P = 0.032; r = 0.682, P = 0.015, respectively). These findings emphasise the influence of neuromuscular control and performance and its support to musculoskeletal system to optimise function and modulate risk of injury. Further, neuromuscular activity during terminal swing is also important and necessary to execute and maintain performance.

ATF3 mediates inhibitory effects of ethanol on hepatic gluconeogenesis

PubMed Central

Tsai, Wen-Wei; Matsumura, Shigenobu; Liu, Weiyi; Phillips, Naomi G.; Sonntag, Tim; Hao, Ergeng; Lee, Soon; Hai, Tsonwin; Montminy, Marc

2015-01-01

Increases in circulating glucagon during fasting maintain glucose balance by stimulating hepatic gluconeogenesis. Acute ethanol intoxication promotes fasting hypoglycemia through an increase in hepatic NADH, which inhibits hepatic gluconeogenesis by reducing the conversion of lactate to pyruvate. Here we show that acute ethanol exposure also lowers fasting blood glucose concentrations by inhibiting the CREB-mediated activation of the gluconeogenic program in response to glucagon. Ethanol exposure blocked the recruitment of CREB and its coactivator CRTC2 to gluconeogenic promoters by up-regulating ATF3, a transcriptional repressor that also binds to cAMP-responsive elements and thereby down-regulates gluconeogenic genes. Targeted disruption of ATF3 decreased the effects of ethanol in fasted mice and in cultured hepatocytes. These results illustrate how the induction of transcription factors with overlapping specificity can lead to cross-coupling between stress and hormone-sensitive pathways. PMID:25730876

Myocardin: A novel player in atherosclerosis.

PubMed

Xia, Xiao-Dan; Zhou, Zhen; Yu, Xiao-Hua; Zheng, Xi-Long; Tang, Chao-Ke

2017-02-01

Myocardin (MYOCD) the most important coactivator of serum response factor (SRF), plays a critical role specifically in the development of cardiac myocytes and vascular smooth muscle cells (VSMCs). Binding of Myocardin to the SRF on the CArG box-containing target genes can transcriptionally activate a variety of downstream muscle-specific genes, such as Sm22α, Acta2, Myh11, and several other signaling pathways. Myocardin expression represents a contractile and differentiated SMC phenotype. Loss of Myocardin, however, represents a synthetic and dedifferentiated phenotype, a hallmark in atherosclerosis. Growing evidence shows that Myocardin is involved in lipid metabolism and vascular inflammation, the primary pathogenesis of atherosclerosis. Moreover, Myocardin expression level is altered in atherosclerotic patients and animal models, suggesting more extensive and important roles for Myocardin in atherosclerosis. In the current review, we summarized recent progress on the regulation and signaling of Myocardin, and highlighted its impacts on atherosclerotic disease. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

Histones: Controlling Tumor Signaling Circuitry

PubMed Central

Martins, Manoela D.; Castilho, Rogerio M.

2014-01-01

Epigenetic modifications constitute the next frontier in tumor biology research. Post-translation modification of histones dynamically influences gene expression independent of alterations to the DNA sequence. These mechanisms are often mediated by histone linkers or by proteins associated with the recruitment of DNA-binding proteins, HDAC I and II interacting proteins and transcriptional activators, coactivators or corepressors. Early evidence suggested that histones and their modifiers are involved in sophisticated processes that modulate tumor behavior and cellular phenotype. In this review, we discuss how recent discoveries about chromatin modifications, particularly histone acetylation, are shaping our knowledge of cell biology and our understanding of the molecular circuitry governing tumor progression and consider whether recent insights may extend to novel therapeutic approaches. Furthermore, we discuss the latest oncogenomic findings in Head and Neck Squamous Cell Carcinoma (HNSCC) from studies using Next Generation Sequencing (NGS) technology and highlight the impact of mutations identified in histones and their modifiers. PMID:25177526

Effect of Stapling Architecture on Physiochemical Properties and Cell Permeability of Stapled α-Helical Peptides: A Comparative Study.

PubMed

Tian, Yuan; Jiang, Yanhong; Li, Jingxu; Wang, Dongyuan; Zhao, Hui; Li, Zigang

2017-11-02

Stapled peptides have emerged as a new class of targeting molecules with high binding affinity and specificity for intracellular undruggable targets. Their ability to penetrate cell membranes is exceptionally intriguing but remains elusively and controversially discussed. To understand the effect of stapling architectures on their physiochemical properties and to aid in promoting their cell permeability, we report herein a comparative study on the physiochemical properties and cell permeability of stapled α-helical peptides with different types of crosslinks. We highlight the decisive impact of the intrinsic properties of the crosslinks on cell permeability rather than the helical contents of the peptides in model amphipathic sequences targeting estrogen receptor-coactivator interaction. We envision this finding to shed further light on the chemical optimization of stapled α-helical peptides or macrocyclic cell-penetrating peptides for enhanced cell penetration. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Molecular interactions involved in the transactivation of the human T-cell leukemia virus type 1 promoter mediated by Tax and CREB-2 (ATF-4).

PubMed

Gachon, F; Thebault, S; Peleraux, A; Devaux, C; Mesnard, J M

2000-05-01

The human T-cell leukemia virus type 1 (HTLV-1) Tax protein activates viral transcription through three 21-bp repeats located in the U3 region of the HTLV-1 long terminal repeat and called Tax-responsive elements (TxREs). Each TxRE contains nucleotide sequences corresponding to imperfect cyclic AMP response elements (CRE). In this study, we demonstrate that the bZIP transcriptional factor CREB-2 is able to bind in vitro to the TxREs and that CREB-2 binding to each of the 21-bp motifs is enhanced by Tax. We also demonstrate that Tax can weakly interact with CREB-2 bound to a cellular palindromic CRE motif such as that found in the somatostatin promoter. Mutagenesis of Tax and CREB-2 demonstrates that both N- and C-terminal domains of Tax and the C-terminal region of CREB-2 are required for direct interaction between the two proteins. In addition, the Tax mutant M47, defective for HTLV-1 activation, is unable to form in vitro a ternary complex with CREB-2 and TxRE. In agreement with recent results suggesting that Tax can recruit the coactivator CREB-binding protein (CBP) on the HTLV-1 promoter, we provide evidence that Tax, CREB-2, and CBP are capable of cooperating to stimulate viral transcription. Taken together, our data highlight the major role played by CREB-2 in Tax-mediated transactivation.

De-repression of RaRF-mediated RAR repression by adenovirus E1A in the nucleolus.

PubMed

Um, Soo-Jong; Youn, Hye Sook; Kim, Eun-Joo

2014-02-21

Transcriptional activity of the retinoic acid receptor (RAR) is regulated by diverse binding partners, including classical corepressors and coactivators, in response to its ligand retinoic acid (RA). Recently, we identified a novel corepressor of RAR called the retinoic acid resistance factor (RaRF) (manuscript submitted). Here, we report how adenovirus E1A stimulates RAR activity by associating with RaRF. Based on immunoprecipitation (IP) assays, E1A interacts with RaRF through the conserved region 2 (CR2), which is also responsible for pRb binding. The first coiled-coil domain of RaRF was sufficient for this interaction. An in vitro glutathione-S-transferase (GST) pull-down assay was used to confirm the direct interaction between E1A and RaRF. Further fluorescence microscopy indicated that E1A and RaRF were located in the nucleoplasm and nucleolus, respectively. However, RaRF overexpression promoted nucleolar translocation of E1A from the nucleoplasm. Both the RA-dependent interaction of RAR with RaRF and RAR translocation to the nucleolus were disrupted by E1A. RaRF-mediated RAR repression was impaired by wild-type E1A, but not by the RaRF binding-defective E1A mutant. Taken together, our data suggest that E1A is sequestered to the nucleolus by RaRF through a specific interaction, thereby leaving RAR in the nucleoplasm for transcriptional activation. Copyright © 2014 Elsevier Inc. All rights reserved.

Molecular Interactions Involved in the Transactivation of the Human T-Cell Leukemia Virus Type 1 Promoter Mediated by Tax and CREB-2 (ATF-4)

PubMed Central

Gachon, Frederic; Thebault, Sabine; Peleraux, Annick; Devaux, Christian; Mesnard, Jean-Michel

2000-01-01

The human T-cell leukemia virus type 1 (HTLV-1) Tax protein activates viral transcription through three 21-bp repeats located in the U3 region of the HTLV-1 long terminal repeat and called Tax-responsive elements (TxREs). Each TxRE contains nucleotide sequences corresponding to imperfect cyclic AMP response elements (CRE). In this study, we demonstrate that the bZIP transcriptional factor CREB-2 is able to bind in vitro to the TxREs and that CREB-2 binding to each of the 21-bp motifs is enhanced by Tax. We also demonstrate that Tax can weakly interact with CREB-2 bound to a cellular palindromic CRE motif such as that found in the somatostatin promoter. Mutagenesis of Tax and CREB-2 demonstrates that both N- and C-terminal domains of Tax and the C-terminal region of CREB-2 are required for direct interaction between the two proteins. In addition, the Tax mutant M47, defective for HTLV-1 activation, is unable to form in vitro a ternary complex with CREB-2 and TxRE. In agreement with recent results suggesting that Tax can recruit the coactivator CREB-binding protein (CBP) on the HTLV-1 promoter, we provide evidence that Tax, CREB-2, and CBP are capable of cooperating to stimulate viral transcription. Taken together, our data highlight the major role played by CREB-2 in Tax-mediated transactivation. PMID:10779337

HER2 signaling drives DNA anabolism and proliferation through SRC-3 phosphorylation and E2F1-regulated genes

PubMed Central

Nikolai, Bryan C.; Lanz, Rainer B.; York, Brian; Dasgupta, Subhamoy; Mitsiades, Nicholas; Creighton, Chad J.; Tsimelzon, Anna; Hilsenbeck, Susan G.; Lonard, David M.; Smith, Carolyn L.; O’Malley, Bert W.

2016-01-01

Approximately 20% of early-stage breast cancers display amplification or overexpression of the ErbB2/HER2 oncogene, conferring poor prognosis and resistance to endocrine therapy. Targeting HER2+ tumors with trastuzumab or the receptor tyrosine kinase (RTK) inhibitor lapatinib significantly improves survival, yet tumor resistance and progression of metastatic disease still develop over time. While the mechanisms of cytosolic HER2 signaling are well studied, nuclear signaling components and gene regulatory networks that bestow therapeutic resistance and limitless proliferative potential are incompletely understood. Here, we use biochemical and bioinformatic approaches to identify effectors and targets of HER2 transcriptional signaling in human breast cancer. Phosphorylation and activity of the Steroid Receptor Coactivator-3 (SRC-3) is reduced upon HER2 inhibition, and recruitment of SRC-3 to regulatory elements of endogenous genes is impaired. Transcripts regulated by HER2 signaling are highly enriched with E2F1 binding sites and define a gene signature associated with proliferative breast tumor subtypes, cell cycle progression, and DNA replication. We show that HER2 signaling promotes breast cancer cell proliferation through regulation of E2F1-driven DNA metabolism and replication genes together with phosphorylation and activity of the transcriptional coactivator SRC-3. Furthermore, our analyses identified a cyclin dependent kinase (CDK) signaling node that, when targeted using the CDK4/6 inhibitor Palbociclib, defines overlap and divergence of adjuvant pharmacological targeting. Importantly, lapatinib and palbociclib strictly block de novo synthesis of DNA, mostly through disruption of E2F1 and its target genes. These results have implications for rational discovery of pharmacological combinations in pre-clinical models of adjuvant treatment and therapeutic resistance. PMID:26833126

Baicalein suppresses the androgen receptor (AR)-mediated prostate cancer progression via inhibiting the AR N-C dimerization and AR-coactivators interaction.

PubMed

Xu, Defeng; Chen, Qiulu; Liu, Yalin; Wen, Xingqiao

2017-12-01

Androgen receptor (AR) plays a critical role in prostate cancer (PCa) development and progression. Androgen deprivation therapy with antiandrogens to reduce androgen biosynthesis or prevent androgens from binding to AR are widely used to suppress AR-mediated PCa growth. However, most of ADT may eventually fail with development of the castration resistance after 12-24 months. Here we found that a natural product baicalein can effectively suppress the PCa progression via targeting the androgen-induced AR transactivation with little effect to AR protein expression. PCa cells including LNCaP, CWR22Rv1, C4-2, PC-3, and DU145, were treated with baicalein and luciferase assay was used to evaluate their effect on the AR transactivation. Cell growth and IC 50 were determined by MTT assay after 48 hrs treatment. RT-PCR was used to evaluate the mRNA levels of AR target genes including PSA, TMPRSS2, and TMEPA1. Western blot was used to determine AR and PSA protein expression. The natural product of baicalein can selectively inhibit AR transactivation with little effect on the other nuclear receptors, including ERα, and GR. At a low concentration, 2.5 μM of baicalein effectively suppresses the growth of AR-positive PCa cells, and has little effect on AR-negative PCa cells. Mechanism dissection suggest that baicalein can suppress AR target genes (PSA, TMPRSS2, and TMEPA1) expression in both androgen responsive LNCaP cells and castration resistant CWR22Rv1 cells, that may involve the inhibiting the AR N/C dimerization and AR-coactivators interaction. Baicalein may be developed as an effective anti-AR therapy via its ability to inhibit AR transactivation and AR-mediated PCa cell growth.

Interaction of human biliverdin reductase with Akt/protein kinase B and phosphatidylinositol-dependent kinase 1 regulates glycogen synthase kinase 3 activity: a novel mechanism of Akt activation

PubMed Central

Miralem, Tihomir; Lerner-Marmarosh, Nicole; Gibbs, Peter E. M.; Jenkins, Jermaine L.; Heimiller, Chelsea; Maines, Mahin D.

2016-01-01

Biliverdin reductase A (BVR) and Akt isozymes have overlapping pleiotropic functions in the insulin/PI3K/MAPK pathway. Human BVR (hBVR) also reduces the hemeoxygenase activity product biliverdin to bilirubin and is directly activated by insulin receptor kinase (IRK). Akt isoenzymes (Akt1–3) are downstream of IRK and are activated by phosphatidylinositol-dependent kinase 1 (PDK1) phosphorylating T308 before S473 autophosphorylation. Akt (RxRxxSF) and PDK1 (RFxFPxFS) binding motifs are present in hBVR. Phosphorylation of glycogen synthase kinase 3 (GSK3) isoforms α/β by Akts inhibits their activity; nonphosphorylated GSK3β inhibits activation of various genes. We examined the role of hBVR in PDK1/Akt1/GSK3 signaling and Akt1 in hBVR phosphorylation. hBVR activates phosphorylation of Akt1 at S473 independent of hBVR’s kinase competency. hBVR and Akt1 coimmunoprecipitated, and in-cell Förster resonance energy transfer (FRET) and glutathione S-transferase pulldown analyses identified Akt1 pleckstrin homology domain as the interactive domain. hBVR activates phosphorylation of Akt1 at S473 independent of hBVR’s kinase competency. Site-directed mutagenesis, mass spectrometry, and kinetic analyses identified S230 in hBVR 225RNRYLSF sequence as the Akt1 target. Underlined amino acids are the essential residues of the signaling motifs. In cells, hBVR-activated Akt1 increased both GSK3α/β and forkhead box of the O class transcription class 3 (FoxO3) phosphorylation and inhibited total GSK3 activity; depletion of hBVR released inhibition and stimulated glucose uptake. Immunoprecipitation analysis showed that PDK1 and hBVR interact through hBVR’s PDK1 binding 161RFGFPAFS motif and formation of the PDK1/hBVR/Akt1 complex. sihBVR blocked complex formation. Findings identify hBVR as a previously unknown coactivator of Akt1 and as a key mediator of Akt1/GSK3 pathway, as well as define a key role for hBVR in Akt1 activation by PDK1.—Miralem, T., Lerner-Marmarosh, N., Gibbs, P. E. M., Jenkins, J. L., Heimiller, C., Maines, M. D. Interaction of human biliverdin reductase with Akt/protein kinase B and phosphatidylinositol-dependent kinase 1 regulates glycogen synthase kinase 3 activity: a novel mechanism of Akt activation. PMID:27166089

Interaction of human biliverdin reductase with Akt/protein kinase B and phosphatidylinositol-dependent kinase 1 regulates glycogen synthase kinase 3 activity: a novel mechanism of Akt activation.

PubMed

Miralem, Tihomir; Lerner-Marmarosh, Nicole; Gibbs, Peter E M; Jenkins, Jermaine L; Heimiller, Chelsea; Maines, Mahin D

2016-08-01

Biliverdin reductase A (BVR) and Akt isozymes have overlapping pleiotropic functions in the insulin/PI3K/MAPK pathway. Human BVR (hBVR) also reduces the hemeoxygenase activity product biliverdin to bilirubin and is directly activated by insulin receptor kinase (IRK). Akt isoenzymes (Akt1-3) are downstream of IRK and are activated by phosphatidylinositol-dependent kinase 1 (PDK1) phosphorylating T(308) before S(473) autophosphorylation. Akt (RxRxxSF) and PDK1 (RFxFPxFS) binding motifs are present in hBVR. Phosphorylation of glycogen synthase kinase 3 (GSK3) isoforms α/β by Akts inhibits their activity; nonphosphorylated GSK3β inhibits activation of various genes. We examined the role of hBVR in PDK1/Akt1/GSK3 signaling and Akt1 in hBVR phosphorylation. hBVR activates phosphorylation of Akt1 at S(473) independent of hBVR's kinase competency. hBVR and Akt1 coimmunoprecipitated, and in-cell Förster resonance energy transfer (FRET) and glutathione S-transferase pulldown analyses identified Akt1 pleckstrin homology domain as the interactive domain. hBVR activates phosphorylation of Akt1 at S(473) independent of hBVR's kinase competency. Site-directed mutagenesis, mass spectrometry, and kinetic analyses identified S(230) in hBVR (225)RNRYLSF sequence as the Akt1 target. Underlined amino acids are the essential residues of the signaling motifs. In cells, hBVR-activated Akt1 increased both GSK3α/β and forkhead box of the O class transcription class 3 (FoxO3) phosphorylation and inhibited total GSK3 activity; depletion of hBVR released inhibition and stimulated glucose uptake. Immunoprecipitation analysis showed that PDK1 and hBVR interact through hBVR's PDK1 binding (161)RFGFPAFS motif and formation of the PDK1/hBVR/Akt1 complex. sihBVR blocked complex formation. Findings identify hBVR as a previously unknown coactivator of Akt1 and as a key mediator of Akt1/GSK3 pathway, as well as define a key role for hBVR in Akt1 activation by PDK1.-Miralem, T., Lerner-Marmarosh, N., Gibbs, P. E. M., Jenkins, J. L., Heimiller, C., Maines, M. D. Interaction of human biliverdin reductase with Akt/protein kinase B and phosphatidylinositol-dependent kinase 1 regulates glycogen synthase kinase 3 activity: a novel mechanism of Akt activation. © FASEB.

A fingerprint key binding algorithm based on vector quantization and error correction

NASA Astrophysics Data System (ADS)

Li, Liang; Wang, Qian; Lv, Ke; He, Ning

2012-04-01

In recent years, researches on seamless combination cryptosystem with biometric technologies, e.g. fingerprint recognition, are conducted by many researchers. In this paper, we propose a binding algorithm of fingerprint template and cryptographic key to protect and access the key by fingerprint verification. In order to avoid the intrinsic fuzziness of variant fingerprints, vector quantization and error correction technique are introduced to transform fingerprint template and then bind with key, after a process of fingerprint registration and extracting global ridge pattern of fingerprint. The key itself is secure because only hash value is stored and it is released only when fingerprint verification succeeds. Experimental results demonstrate the effectiveness of our ideas.

Metabolic Control of Virulence Genes in Brucella abortus: HutC Coordinates virB Expression and the Histidine Utilization Pathway by Direct Binding to Both Promoters ▿ †

PubMed Central

Sieira, Rodrigo; Arocena, Gastón M.; Bukata, Lucas; Comerci, Diego J.; Ugalde, Rodolfo A.

2010-01-01

Type IV secretion systems (T4SS) are multicomponent machineries involved in the translocation of effector molecules across the bacterial cell envelope. The virB operon of Brucella abortus codes for a T4SS that is essential for virulence and intracellular multiplication of the bacterium in the host. Previous studies showed that the virB operon of B. abortus is tightly regulated within the host cells. In order to identify factors implicated in the control of virB expression, we searched for proteins of Brucella that directly bind to the virB promoter (PvirB). Using different procedures, we isolated a 27-kDa protein that binds specifically to PvirB. This protein was identified as HutC, the transcriptional repressor of the histidine utilization (hut) genes. Analyses of virB and hut promoter activity revealed that HutC exerts two different roles: it acts as a coactivator of transcription of the virB operon, whereas it represses the hut genes. Such activities were observed both intracellularly and in bacteria incubated under conditions that resemble the intracellular environment. Electrophoresis mobility shift assays (EMSA) and DNase I footprinting experiments revealed the structure, affinity, and localization of the HutC-binding sites and supported the regulatory role of HutC in both hut and virB promoters. Taken together, these results indicate that Brucella coopted the function of HutC to coordinate the Hut pathway with transcriptional regulation of the virB genes, probably as a way to sense its own metabolic state and develop adaptive responses to overcome intracellular host defenses. PMID:19854911

Cellular Retinoic Acid Binding Proteins: Genomic and Non-genomic Functions and their Regulation.

PubMed

Wei, Li-Na

Cellular retinoic acid binding proteins (CRABPs) are high-affinity retinoic acid (RA) binding proteins that mainly reside in the cytoplasm. In mammals, this family has two members, CRABPI and II, both highly conserved during evolution. The two proteins share a very similar structure that is characteristic of a "β-clam" motif built up from10-strands. The proteins are encoded by two different genes that share a very similar genomic structure. CRABPI is widely distributed and CRABPII has restricted expression in only certain tissues. The CrabpI gene is driven by a housekeeping promoter, but can be regulated by numerous factors, including thyroid hormones and RA, which engage a specific chromatin-remodeling complex containing either TRAP220 or RIP140 as coactivator and corepressor, respectively. The chromatin-remodeling complex binds the DR4 element in the CrabpI gene promoter to activate or repress this gene in different cellular backgrounds. The CrabpII gene promoter contains a TATA-box and is rapidly activated by RA through an RA response element. Biochemical and cell culture studies carried out in vitro show the two proteins have distinct biological functions. CRABPII mainly functions to deliver RA to the nuclear RA receptors for gene regulation, although recent studies suggest that CRABPII may also be involved in other cellular events, such as RNA stability. In contrast, biochemical and cell culture studies suggest that CRABPI functions mainly in the cytoplasm to modulate intracellular RA availability/concentration and to engage other signaling components such as ERK activity. However, these functional studies remain inconclusive because knocking out one or both genes in mice does not produce definitive phenotypes. Further studies are needed to unambiguously decipher the exact physiological activities of these two proteins.

Identification of the interleukin 4 receptor alpha gene as a direct target for p73.

PubMed

Sasaki, Yasushi; Mita, Hiroaki; Toyota, Minoru; Ishida, Setsuko; Morimoto, Ichiro; Yamashita, Toshiharu; Tanaka, Toshihiro; Imai, Kohzoh; Nakamura, Yusuke; Tokino, Takashi

2003-12-01

p73 has a high degree of structural homology to p53 and can activate transcription of p53-responsive genes. However, analysis of p73-deficient mice revealed a marked divergence in the physiological activities of p53 family genes and distinguishes p73 from p53. Mice deficient for p73 exhibit profound defects, including hippocampal dysgenesis, chronic infection, and inflammation, as well as abnormalities in pheromone sensory pathways. p73 plays important roles in neurogenesis, sensory pathways, and homeostatic regulation. Here, we found that the interleukin 4 receptor alpha (IL-4Ralpha) gene is up-regulated by p73 but not significantly by p53 in several human cancer cell lines. IL-4Ralphatranscription is also activated in response to cisplatin, a DNA-damaging agent known to induce p73. By using small interference RNA designed to target p73, we demonstrated that silencing endogenous p73 abrogates the induction of the IL-4Ralpha gene after cisplatin treatment. Furthermore, we identified a p73-binding site in the first intron of the IL-4Ralpha gene that can directly interact with the p73 protein in vivo. This p73-binding site consists of eight copies of a 10-bp consensus p53-binding motif and is a functional response element that is relatively specific for p73 among the p53 family. p73beta promoted localized nucleosomal acetylation through recruitment of coactivator p300, indicating that p73 regulates transcription of IL-4Ralpha through the unique p73-binding site. We also found that p73beta-transfected tumor cells are sensitive to IL-4-mediated apoptosis. Our data suggest that IL-4Ralpha could mediate, in part, certain immune responses and p73-dependent cell death.

ERK2-Mediated Phosphorylation of Transcriptional Coactivator Binding Protein PIMT/NCoA6IP at Ser298 Augments Hepatic Gluconeogenesis

PubMed Central

Parsa, Kishore V. L.; Kain, Vasundhara; Behera, Soma; Suraj, Sashidhara Kaimal; Babu, Phanithi Prakash; Kar, Anand; Panda, Sunanda; Zhu, Yi-jun; Jia, Yuzhi; Thimmapaya, Bayar; Reddy, Janardan K.; Misra, Parimal

2013-01-01

PRIP-Interacting protein with methyl transferase domain (PIMT) serves as a molecular bridge between CREB-binding protein (CBP)/ E1A binding protein p300 (Ep300) -anchored histone acetyl transferase and the Mediator complex sub-unit1 (Med1) and modulates nuclear receptor transcription. Here, we report that ERK2 phosphorylates PIMT at Ser298 and enhances its ability to activate PEPCK promoter. We observed that PIMT is recruited to PEPCK promoter and adenoviral-mediated over-expression of PIMT in rat primary hepatocytes up-regulated expression of gluconeogenic genes including PEPCK. Reporter experiments with phosphomimetic PIMT mutant (PIMTS298D) suggested that conformational change may play an important role in PIMT-dependent PEPCK promoter activity. Overexpression of PIMT and Med1 together augmented hepatic glucose output in an additive manner. Importantly, expression of gluconeogenic genes and hepatic glucose output were suppressed in isolated liver specific PIMT knockout mouse hepatocytes. Furthermore, consistent with reporter experiments, PIMTS298D but not PIMTS298A augmented hepatic glucose output via up-regulating the expression of gluconeogenic genes. Pharmacological blockade of MAPK/ERK pathway using U0126, abolished PIMT/Med1-dependent gluconeogenic program leading to reduced hepatic glucose output. Further, systemic administration of T4 hormone to rats activated ERK1/2 resulting in enhanced PIMT ser298 phosphorylation. Phosphorylation of PIMT led to its increased binding to the PEPCK promoter, increased PEPCK expression and induction of gluconeogenesis in liver. Thus, ERK2-mediated phosphorylation of PIMT at Ser298 is essential in hepatic gluconeogenesis, demonstrating an important role of PIMT in the pathogenesis of hyperglycemia. PMID:24358311

Identification and Characterization of CINPA1 Metabolites Facilitates Structure-Activity Studies of the Constitutive Androstane Receptor

PubMed Central

Cherian, Milu T.; Yang, Lei; Chai, Sergio C.; Lin, Wenwei

2016-01-01

The constitutive androstane receptor (CAR) regulates the expression of genes involved in drug metabolism and other processes. A specific inhibitor of CAR is critical for modulating constitutive CAR activity. We recently described a specific small-molecule inhibitor of CAR, CINPA1 (ethyl (5-(diethylglycyl)-10,11-dihydro-5H-dibenzo[b,f]azepin-3-yl)carbamate), which is capable of reducing CAR-mediated transcription by changing the coregulator recruitment pattern and reducing CAR occupancy at the promoter regions of its target genes. In this study, we showed that CINPA1 is converted to two main metabolites in human liver microsomes. By using cell-based reporter gene and biochemical coregulator recruitment assays, we showed that although metabolite 1 was very weak in inhibiting CAR function and disrupting CAR-coactivator interaction, metabolite 2 was inactive in this regard. Docking studies using the CAR ligand-binding domain structure showed that although CINPA1 and metabolite 1 can bind in the CAR ligand-binding pocket, metabolite 2 may be incapable of the molecular interactions required for binding. These results indicate that the metabolites of CINPA1 may not interfere with the action of CINPA1. We also used in vitro enzyme assays to identify the cytochrome P450 enzymes responsible for metabolizing CINPA1 in human liver microsomes and showed that CINPA1 was first converted to metabolite 1 by CYP3A4 and then further metabolized by CYP2D6 to metabolite 2. Identification and characterization of the metabolites of CINPA1 enabled structure-activity relationship studies of this family of small molecules and provided information to guide in vivo pharmacological studies. PMID:27519550

Long-term hypoxia modulates expression of key genes regulating adipose function in the late-gestation ovine fetus.

PubMed

Myers, Dean A; Hanson, Krista; Mlynarczyk, Malgorzata; Kaushal, Kanchan M; Ducsay, Charles A

2008-04-01

A major function of abdominal adipose in the newborn is nonshivering thermogenesis. Uncoupling protein (UCP) UCP1 and UCP2 play major roles in thermogenesis. The present study tested the hypothesis that long-term hypoxia (LTH) modulates expression of UCP1 and UCP2, and key genes regulating expression of these genes in the late-gestation ovine fetus. Ewes were maintained at high altitude (3,820 m) from 30 to 138 days gestation (dG); perirenal adipose tissue was collected from LTH and age-matched, normoxic control fetuses at 139-141 dG. Quantitative real-time PCR was used to analyze mRNA for UCP1, UCP2, 11beta hydroxysteroid dehydrogenase type 1 (HSD11B1) and 2 (HSD11B2), glucocorticoid receptor (GR), beta3 adrenergic receptor (beta3AR), deiodinase type 1 (DIO1) and DIO2, peroxisome proliferator activated receptor (PPAR) alpha and gamma and PPARgamma coactivator 1 (PGC1alpha). Concentrations of mRNA for UCP1, HSD11B1, PPARgamma, PGC1, DIO1, and DIO2 were significantly higher in perirenal adipose of LTH compared with control fetuses, while mRNA for HSD11B2, GR, or PPARalpha in perirenal adipose did not differ between control and LTH fetuses. The increased expression of UCP1 is likely an adaptive response to LTH, assuring adequate thermogenesis in the event of birth under oxygen-limiting conditions. Because both glucocorticoids and thyroid hormone regulate UCP1 expression, the increase in HSD11B1, DIO1, and DIO2 implicate increased adipose capacity for local synthesis of these hormones. PPARgamma and its coactivator may provide an underlying mechanism via which LTH alters development of the fetal adipocyte. These findings have important implications regarding fetal/neonatal adipose tissue function in response to LTH.

MTA family of coregulators in nuclear receptor biology and pathology

PubMed Central

Manavathi, Bramanandam; Singh, Kamini; Kumar, Rakesh

2007-01-01

Nuclear receptors (NRs) rely on coregulators (coactivators and corepressors) to modulate the transcription of target genes. By interacting with nucleosome remodeling complexes, NR coactivators potentiate transcription, whereas corepressors inhibit transcription of the target genes. Metastasis-associated proteins (MTA) represent an emerging family of novel NR coregulators. In general, MTA family members form independent nucleosome remodeling and deacetylation (NuRD) complexes and repress the transcription of different genes by recruiting histone deacetylases onto their target genes. However, MTA1 also acts as a coactivator in a promoter-context dependent manner. Recent findings that repression of estrogen receptor transactivation functions by MTA1, MTA1s, and MTA2 and regulation of MTA3 by estrogen signaling have indicated the significance of these proteins in NR signaling. Here, we highlight the action of MTA proteins on NR signaling and their roles in pathophysiological conditions. PMID:18174918

Pomegranate juice and prostate cancer: importance of the characterisation of the active principle.

PubMed

Chrubasik-Hausmann, Sigrun; Vlachojannis, Christian; Zimmermann, Benno

2014-11-01

Two exploratory clinical studies investigating proprietary pomegranate products showed a trend of effectiveness in increasing prostate-specific antigen doubling time in patients with prostate cancer. A recent clinical study did not support these results. We therefore analysed a lot of the marketed pomegranate blend for co-active pomegranate compounds. The high-performance liquid chromatography method was used to detect punicalagin, ellagic acid and anthocyanins. Total polyphenoles were determined by the Folin-Ciocalteu method using gallic acid as reference. The results show that the co-active compounds in the daily dose of the pomegranate blend were far below those previously tested and that the photometric assessment is not reliable for the standardisation of study medications. Not pomegranate but the low amount of co-active compounds in the proprietary pomegranate blend was responsible for its clinical ineffectiveness. Copyright © 2014 John Wiley & Sons, Ltd.

A tandem regression-outlier analysis of a ligand cellular system for key structural modifications around ligand binding.

PubMed

Lin, Ying-Ting

2013-04-30

A tandem technique of hard equipment is often used for the chemical analysis of a single cell to first isolate and then detect the wanted identities. The first part is the separation of wanted chemicals from the bulk of a cell; the second part is the actual detection of the important identities. To identify the key structural modifications around ligand binding, the present study aims to develop a counterpart of tandem technique for cheminformatics. A statistical regression and its outliers act as a computational technique for separation. A PPARγ (peroxisome proliferator-activated receptor gamma) agonist cellular system was subjected to such an investigation. Results show that this tandem regression-outlier analysis, or the prioritization of the context equations tagged with features of the outliers, is an effective regression technique of cheminformatics to detect key structural modifications, as well as their tendency of impact to ligand binding. The key structural modifications around ligand binding are effectively extracted or characterized out of cellular reactions. This is because molecular binding is the paramount factor in such ligand cellular system and key structural modifications around ligand binding are expected to create outliers. Therefore, such outliers can be captured by this tandem regression-outlier analysis.

Activation of Nrf2 contributes to the protective effect of Exendin-4 against angiotensin II-induced vascular smooth muscle cell senescence.

PubMed

Zhou, Tengfei; Zhang, Mengqian; Zhao, Liang; Li, Aiqin; Qin, Xiaomei

2016-10-01

Oxidative stress and impaired antioxidant defense are believed to be contributors to the cardiovascular aging process. The transcription factor nuclear factor-E2-related factor 2 (Nrf2) plays a key role in orchestrating cellular antioxidant defenses and maintaining redox homeostasis. Our previous study showed that Exendin-4, a glucagon-like peptide-1 analog, alleviates angiotensin II (ANG II)-induced vascular smooth muscle cell (VSMC) senescence by inhibiting Rac1 activation via cAMP/PKA (Zhao L, Li AQ, Zhou TF, Zhang MQ, Qin XM. Am J Physiol Cell Physiol 307: C1130-C1141, 2014). The objective of this study is to investigate if Nrf2 mediates the antisenescent effect of Exendin-4 in ANG II-induced VSMCs. Here we report that Exendin-4 triggered Nrf2 nuclear translocation, a downstream target of cAMP-responsive element-binding protein (CREB) and expressions of antioxidant genes heme oxygenase-1 (HO-1) and NAD(P)H quinone oxidoreductase-1 (NQO-1) in a dose- and time-dependent manner. In addition, knock-down of Nrf2 attenuated the inhibitory effects of Exendin-4 on ANG II-induced superoxidant generation and VSMC senescence. PKA/CREB pathway participated in the upregulations of HO-1 and NQO-1 induced by Exendin-4. Notably, our study revealed that Exendin-4 dose-dependently increased the acetylation of Nrf2 and the recruitment of transcriptional coactivator CREB binding protein (CBP) to Nrf2. The Exendin-4-induced Nrf2 transactivation was diminished in the presence of CBP small interfering RNA. Microscope imaging of Nrf2, as well as immunoblotting for Nrf2, showed that the Exendin-4-evoked Nrf2 acetylation favored its nuclear retention. Importantly, CBP silencing attenuated the suppressing effects of Exendin-4 on ANG II-induced VSMC senescence and superoxidant production. In conclusion, these results provide a mechanistic insight into how Nrf2 signaling mediates the antisenescent and antioxidative effects induced by Exendin-4 in VSMCs. Copyright © 2016 the American Physiological Society.

Activation of β-catenin and Yap1 in human hepatoblastoma and induction of hepatocarcinogenesis in mice.

PubMed

Tao, Junyan; Calvisi, Diego F; Ranganathan, Sarangarajan; Cigliano, Antonio; Zhou, Lili; Singh, Sucha; Jiang, Lijie; Fan, Biao; Terracciano, Luigi; Armeanu-Ebinger, Sorin; Ribback, Silvia; Dombrowski, Frank; Evert, Matthias; Chen, Xin; Monga, Satdarshan P S

2014-09-01

Aberrant activation of β-catenin and Yes-associated protein 1 (Yap1) signaling pathways have been associated with the development of multiple tumor types. Yap functions as a transcriptional coactivator by interacting with TEA domain DNA binding proteins. We investigated the interactions among these pathways during hepatic tumorigenesis. We used immunohistochemical analysis to determine expression of β-catenin and Yap1 in liver cancer specimens collected from patients in Europe and the United States, consisting of 104 hepatocellular carcinoma, 62 intrahepatic cholangiocarcinoma, and 94 hepatoblastoma samples. We assessed β-catenin and Yap1 signaling and interactions in hepatoblastoma cell lines ((HuH6, HepG2, HepT1, HC-AFW1, HepG2, and HC-AFW1); proteins were knocked down with small interfering RNAs, and effects on proliferation and cell death were measured. Sleeping beauty-mediated hydrodynamic transfection was used to overexpress constitutively active forms of β-catenin (ΔN90/β-catenin) and Yap1 (YapS127A) in livers of mice; tissues were collected, and histological and immunohistochemical analyses were performed. We observed nuclear localization of β-catenin and Yap1 in 79% of hepatoblastoma samples but not in most hepatocellular carcinoma or intrahepatic cholangiocarcinoma samples. Yap1 and β-catenin coprecipitated in hepatoblastoma but not hepatocellular carcinoma cells. Small interfering RNA-mediated knockdown of Yap1 or β-catenin in hepatoblastoma cells reduced proliferation in an additive manner. Knockdown of Yap1 reduced its ability to coactivate transcription with β-catenin; β-catenin inhibitors inactivated Yap1. Overexpression of constitutively active forms of Yap1 and β-catenin in mouse liver led to rapid tumorigenesis, with 100% mortality by 11 weeks. Tumor cells expressed both proteins, and human hepatoblastoma cells expressed common targets of their 2 signaling pathways. Yap1 binding of TEA domain factors was required for tumorigenesis in mice. β-catenin and the transcriptional regulator Yap1 interact physically and are activated in most human hepatoblastoma tissues; overexpression of activated forms of these proteins in livers of mice leads to rapid tumor development. Further analysis of these mice will allow further studies of these pathways in hepatoblastoma pathogenesis and could lead to the identification of new therapeutic targets. Copyright © 2014 AGA Institute. Published by Elsevier Inc. All rights reserved.

Activation of β Catenin and Yap1 in Human Hepatoblastoma and Induction of Hepatocarcinogenesis in Mice

PubMed Central

Cigliano, Antonio; Zhou, Lili; Singh, Sucha; Jiang, Lijie; Fan, Biao; Terracciano, Luigi; Armeanu-Ebinger, Sorin; Ribback, Silvia; Dombrowski, Frank; Evert, Matthias; Chen, Xin; Monga, Satdarshan P. S.

2014-01-01

Background & Aims Aberrant activation of βcatenin and Yes-associated protein 1 (Yap1) signaling pathways have been associated with development of multiple tumor types. Yap functions as a transcriptional co-activator by interacting with TEAD DNA binding proteins. We investigated the interactions among these pathways during hepatic tumorigenesis. Methods We used immunohistochemical analysis to determine expression of β-catenin and Yap1 in liver cancer specimens collected from patients in Europe and the US, consisting of 104 hepatocellular carcinoma (HCC), 62 intrahepatic cholangiocarcinoma (ICC), and 94 hepatoblastoma samples. We assessed βcatenin and Yap1 signaling and interactions in hepatoblastoma cell lines ((HuH6, HepG2, HepT1, HC-AFW1, HepG2, and HC-AFW1); proteins were knocked down with small interfering (si)RNAs and effects on proliferation and cell death were measured. Sleeping beauty-mediated hydrodynamic transfection was used to overexpress constitutively active forms of β catenin ( N90-βcatenin) and Yap1 (YapS127A) in livers of mice; tissues were collected and histologic and immunohistochemical analyses were performed. Results We observed nuclear localization of βcatenin and Yap1 in 79% of hepatoblastoma samples, but not in most HCC or ICC tissues. Yap1 and β catenin co-precipitated in hepatoblastoma but not HCC cells. siRNA-mediated knockdown of Yap1 or β catenin in hepatoblastoma cells reduced proliferation in an additive manner. Knockdown of Yap1 reduced its ability to co-activate transcription with βcatenin; βcatenin inhibitors inactivated Yap1. Overexpression of constitutively active forms of Yap1 and βcatenin in mouse liver led to rapid tumorigenesis, with 100% mortality by 11 weeks. Tumors cells expressed both proteins, and human hepatoblastoma cells expressed common targets of their 2 signaling pathways. Yap1 binding of TEAD factors was required for tumorigenesis in mice. Conclusions β catenin and the transcriptional regulator Yap1 interact physically and are activated in most human hepatoblastoma tissues; overexpression of activated forms of these proteins in livers of mice leads to rapid tumor development. Further analysis of these mice will allow further studies of these pathways in hepatoblastoma pathogenesis and could lead to the identification of new therapeutic targets. PMID:24837480

The single nucleotide polymorphism Gly482Ser in the PGC-1α gene impairs exercise-induced slow-twitch muscle fibre transformation in humans.

PubMed

Steinbacher, Peter; Feichtinger, René G; Kedenko, Lyudmyla; Kedenko, Igor; Reinhardt, Sandra; Schönauer, Anna-Lena; Leitner, Isabella; Sänger, Alexandra M; Stoiber, Walter; Kofler, Barbara; Förster, Holger; Paulweber, Bernhard; Ring-Dimitriou, Susanne

2015-01-01

PGC-1α (peroxisome proliferator-activated receptor γ co-activator 1α) is an important regulator of mitochondrial biogenesis and a master regulator of enzymes involved in oxidative phosphorylation. Recent evidence demonstrated that the Gly482Ser single nucleotide polymorphism (SNP) in the PGC-1α gene affects insulin sensitivity, blood lipid metabolism and binding to myocyte enhancer factor 2 (MEF2). Individuals carrying this SNP were shown to have a reduced cardiorespiratory fitness and a higher risk to develop type 2 diabetes. Here, we investigated the responses of untrained men with the Gly482Ser SNP to a 10 week programme of endurance training (cycling, 3 x 60 min/week, heart rate at 70-90% VO2peak). Quantitative data from analysis of biopsies from vastus lateralis muscle revealed that the SNP group, in contrast to the control group, lacked a training-induced increase in content of slow contracting oxidative fibres. Capillary supply, mitochondrial density, mitochondrial enzyme activities and intramyocellular lipid content increased similarly in both groups. These results indicate that the impaired binding of MEF2 to PGC-1α in humans with this SNP impedes exercise-induced fast-to-slow muscle fibre transformation.

Targeting Yes-associated Protein with Evolved Peptide Aptamers to Disrupt TGF-β Signaling Pathway: Therapeutic Implication for Bone Tumor.

PubMed

Ji, Wei-Ping; Dong, Yang

2015-11-01

The binding of transcription coactivator Yes-associated protein (YAP) to Smad transcription factors is an important event in activating transforming growth factor-β (TGF-β) signaling pathway, which is involved in the tumorigenicity and metastasis of bone tumor. Design of peptide aptamers to disrupt YAPSmad interaction has been established as a promising approach for bone tumor therapy. Here, an evolution strategy was used to optimize Smad-derived peptides for high potency binding to YAP WW2 domain, resulting in an improved peptide population, from which those high-scoring candidates were characterized rigorously using molecular dynamics (MD) simulations and interaction free energy calculations. With the computational protocol we were able to generate a number of potential domain binders, which were then substantiated by using fluorescence spectroscopy assay. Subsequently, the complex structure of YAP WW2 domain with a high-affinity peptide was modeled and examined in detail, which was then used to guide structure-based peptide optimization to obtain several strong domain binders. Structural and energetic analysis revealed that electrostatic complementarity is primarily responsible for domainpeptide recognition, while other nonbonded interactions such as hydrogen bonding and salt bridges can contribute significantly to the recognition specificity. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

ReMap 2018: an updated atlas of regulatory regions from an integrative analysis of DNA-binding ChIP-seq experiments

PubMed Central

Chèneby, Jeanne; Gheorghe, Marius; Artufel, Marie

2018-01-01

Abstract With this latest release of ReMap (http://remap.cisreg.eu), we present a unique collection of regulatory regions in human, as a result of a large-scale integrative analysis of ChIP-seq experiments for hundreds of transcriptional regulators (TRs) such as transcription factors, transcriptional co-activators and chromatin regulators. In 2015, we introduced the ReMap database to capture the genome regulatory space by integrating public ChIP-seq datasets, covering 237 TRs across 13 million (M) peaks. In this release, we have extended this catalog to constitute a unique collection of regulatory regions. Specifically, we have collected, analyzed and retained after quality control a total of 2829 ChIP-seq datasets available from public sources, covering a total of 485 TRs with a catalog of 80M peaks. Additionally, the updated database includes new search features for TR names as well as aliases, including cell line names and the ability to navigate the data directly within genome browsers via public track hubs. Finally, full access to this catalog is available online together with a TR binding enrichment analysis tool. ReMap 2018 provides a significant update of the ReMap database, providing an in depth view of the complexity of the regulatory landscape in human. PMID:29126285

The Single Nucleotide Polymorphism Gly482Ser in the PGC-1α Gene Impairs Exercise-Induced Slow-Twitch Muscle Fibre Transformation in Humans

PubMed Central

Steinbacher, Peter; Feichtinger, René G.; Kedenko, Lyudmyla; Kedenko, Igor; Reinhardt, Sandra; Schönauer, Anna-Lena; Leitner, Isabella; Sänger, Alexandra M.; Stoiber, Walter; Kofler, Barbara; Förster, Holger; Paulweber, Bernhard; Ring-Dimitriou, Susanne

2015-01-01

PGC-1α (peroxisome proliferator-activated receptor γ co-activator 1α) is an important regulator of mitochondrial biogenesis and a master regulator of enzymes involved in oxidative phosphorylation. Recent evidence demonstrated that the Gly482Ser single nucleotide polymorphism (SNP) in the PGC-1α gene affects insulin sensitivity, blood lipid metabolism and binding to myocyte enhancer factor 2 (MEF2). Individuals carrying this SNP were shown to have a reduced cardiorespiratory fitness and a higher risk to develop type 2 diabetes. Here, we investigated the responses of untrained men with the Gly482Ser SNP to a 10 week programme of endurance training (cycling, 3 x 60 min/week, heart rate at 70-90% VO2peak). Quantitative data from analysis of biopsies from vastus lateralis muscle revealed that the SNP group, in contrast to the control group, lacked a training-induced increase in content of slow contracting oxidative fibres. Capillary supply, mitochondrial density, mitochondrial enzyme activities and intramyocellular lipid content increased similarly in both groups. These results indicate that the impaired binding of MEF2 to PGC-1α in humans with this SNP impedes exercise-induced fast-to-slow muscle fibre transformation. PMID:25886402

The Arabidopsis mediator complex subunits MED16, MED14, and MED2 regulate mediator and RNA polymerase II recruitment to CBF-responsive cold-regulated genes.

PubMed

Hemsley, Piers A; Hurst, Charlotte H; Kaliyadasa, Ewon; Lamb, Rebecca; Knight, Marc R; De Cothi, Elizabeth A; Steele, John F; Knight, Heather

2014-01-01

The Mediator16 (MED16; formerly termed SENSITIVE TO FREEZING6 [SFR6]) subunit of the plant Mediator transcriptional coactivator complex regulates cold-responsive gene expression in Arabidopsis thaliana, acting downstream of the C-repeat binding factor (CBF) transcription factors to recruit the core Mediator complex to cold-regulated genes. Here, we use loss-of-function mutants to show that RNA polymerase II recruitment to CBF-responsive cold-regulated genes requires MED16, MED2, and MED14 subunits. Transcription of genes known to be regulated via CBFs binding to the C-repeat motif/drought-responsive element promoter motif requires all three Mediator subunits, as does cold acclimation-induced freezing tolerance. In addition, these three subunits are required for low temperature-induced expression of some other, but not all, cold-responsive genes, including genes that are not known targets of CBFs. Genes inducible by darkness also required MED16 but required a different combination of Mediator subunits for their expression than the genes induced by cold. Together, our data illustrate that plants control transcription of specific genes through the action of subsets of Mediator subunits; the specific combination defined by the nature of the stimulus but also by the identity of the gene induced.

HOXA9 Methylation by PRMT5 Is Essential for Endothelial Cell Expression of Leukocyte Adhesion Molecules

PubMed Central

Bandyopadhyay, Smarajit; Harris, Daniel P.; Adams, Gregory N.; Lause, Gregory E.; McHugh, Anne; Tillmaand, Emily G.; Money, Angela; Willard, Belinda; Fox, Paul L.

2012-01-01

The induction of proinflammatory proteins in stimulated endothelial cells (EC) requires activation of multiple transcription programs. The homeobox transcription factor HOXA9 has an important regulatory role in cytokine induction of the EC-leukocyte adhesion molecules (ELAM) E-selectin and vascular cell adhesion molecule 1 (VCAM-1). However, the mechanism underlying stimulus-dependent activation of HOXA9 is completely unknown. Here, we elucidate the molecular mechanism of HOXA9 activation by tumor necrosis factor alpha (TNF-α) and show an unexpected requirement for arginine methylation by protein arginine methyltransferase 5 (PRMT5). PRMT5 was identified as a TNF-α-dependent binding partner of HOXA9 by mass spectrometry. Small interfering RNA (siRNA)-mediated depletion of PRMT5 abrogated stimulus-dependent HOXA9 methylation with concomitant loss in E-selectin or VCAM-1 induction. Chromatin immunoprecipitation analysis revealed that PRMT5 is recruited to the E-selectin promoter following transient HOXA9 binding to its cognate recognition sequence. PRMT5 induces symmetric dimethylation of Arg140 on HOXA9, an event essential for E-selectin induction. In summary, PRMT5 is a critical coactivator component in a newly defined, HOXA9-containing transcription complex. Moreover, stimulus-dependent methylation of HOXA9 is essential for ELAM expression during the EC inflammatory response. PMID:22269951

CD86 and beta2-adrenergic receptor signaling pathways, respectively, increase Oct-2 and OCA-B Expression and binding to the 3'-IgH enhancer in B cells.

PubMed

Podojil, Joseph R; Kin, Nicholas W; Sanders, Virginia M

2004-05-28

Stimulation of CD86 (formerly known as B7-2) and/or the beta2-adrenergic receptor on a CD40 ligand/interleukin-4-activated B cell increased the rate of mature IgG1 transcription. To identify the mechanism responsible for this effect, we determined whether CD86 and/or beta2-adrenergic receptor stimulation regulated transcription factor expression and binding to the 3'-IgH enhancer in vitro and in vivo. We showed that CD86 stimulation increased the nuclear localization of NF-kappaB1 (p50) and phosphorylated RelA (p65) and increased Oct-2 expression and binding to the 3'-IgH enhancer, in a protein kinase C-dependent manner. These effects were lost when CD86-deficient or NF-kappaB1-deficient B cells were used. CD86 stimulation also increased the level of IkappaB-alpha phosphorylation but in a protein kinase C-independent manner. Beta2-adrenergic receptor stimulation increased CREB phosphorylation, OCA-B expression, and OCA-B binding to the 3'-IgH enhancer in a protein kinase A-dependent manner, an effect lost when beta2-adrenergic receptor-deficient B cells were used. Also, the beta2-adrenergic receptor-induced increase in the level of mature IgG1 transcript was lost when OCA-B-deficient B cells were used. These data are the first to show that CD86 stimulation up-regulates the expression of the transcription factor Oct-2 in a protein kinase C- and NF-kappaB1-dependent manner, and that beta2-adrenergic receptor stimulation up-regulates the expression of the coactivator OCA-B in a protein kinase A-dependent manner to cooperate with Oct-2 binding to the 3'-IgH enhancer.

Development of Coactivator-Dependent, First-in-Class Therapies for Breast Cancer

DTIC Science & Technology

2014-09-01

star: AMP-activated protein kinase stimulates fat absorption. Cell Metab. 13:1–2 53. Reineke EL, York B, Stashi E, et al. 2012. SRC-2 coactivator...receptor/SRC-3 protein complexes achieved by our group are providing powerful new insights into understanding the conformation of intact, full...length proteins in a complex and should provide valuable new information on the mechanism of action of SRC SMIs as well. 15. SUBJECT TERMS Breast

Training through gametherapy promotes coactivation of the pelvic floor and abdominal muscles in young women, nulliparous and continents

PubMed Central

Silva, Valeria Regina; Riccetto, Cássio; Martinho, Natalia Miguel; Marques, Joseane; Carvalho, Leonardo Cesar; Botelho, Simone

2016-01-01

ABSTRACT Introduction and objectives: Several studies have been investigated co-activation can enhance the effectveness of PFM training protocols allowing preventive and therapeutic goals in pelvic floor dysfunctions. The objective of the present study was to investigate if an abdominal-pelvic protocol of training (APT) using gametherapy would allow co-activation of PFM and transversus abdominis/oblique internal (TrA/OI) muscles. Patients and methods: Twenty-five nulliparous, continent, young females, with median age 24.76 (±3.76) years were evaluated using digital palpation (DP) of PFM and surface electromyography of PFM and TrA/OI simultaneously, during maximal voluntary contraction (MVC), alternating PFM and TrA/OI contraction requests. All women participated on a supervised program of APT using gametherapy, that included exercises of pelvic mobilization associated to contraction of TrA/OI muscles oriented by virtual games, for 30 minutes, three times a week, in a total of 10 sessions. Electromyographic data were processed and analyzed by ANOVA - analysis of variance. Results: When MVC of TrA/OI was solicited, it was observed simultaneous increase of electromyographic activity of PFM (p=0.001) following ATP. However, EMG activity did not change significantly during MVC of PFM. Conclusion: Training using gametherapy allowed better co-activation of pelvic floor muscles in response to contraction of TrA, in young nulliparous and continent women. PMID:27564290

T:G mismatch-specific thymine-DNA glycosylase (TDG) as a coregulator of transcription interacts with SRC1 family members through a novel tyrosine repeat motif

PubMed Central

Lucey, Marie J.; Chen, Dongsheng; Lopez-Garcia, Jorge; Hart, Stephen M.; Phoenix, Fladia; Al-Jehani, Rajai; Alao, John P.; White, Roger; Kindle, Karin B.; Losson, Régine; Chambon, Pierre; Parker, Malcolm G.; Schär, Primo; Heery, David M.; Buluwela, Lakjaya; Ali, Simak

2005-01-01

Gene activation involves protein complexes with diverse enzymatic activities, some of which are involved in chromatin modification. We have shown previously that the base excision repair enzyme thymine DNA glycosylase (TDG) acts as a potent coactivator for estrogen receptor-α. To further understand how TDG acts in this context, we studied its interaction with known coactivators of nuclear receptors. We find that TDG interacts in vitro and in vivo with the p160 coactivator SRC1, with the interaction being mediated by a previously undescribed motif encoding four equally spaced tyrosine residues in TDG, each tyrosine being separated by three amino acids. This is found to interact with two motifs in SRC1 also containing tyrosine residues separated by three amino acids. Site-directed mutagenesis shows that the tyrosines encoded in these motifs are critical for the interaction. The related p160 protein TIF2 does not interact with TDG and has the altered sequence, F-X-X-X-Y, at the equivalent positions relative to SRC1. Substitution of the phenylalanines to tyrosines is sufficient to bring about interaction of TIF2 with TDG. These findings highlight a new protein–protein interaction motif based on Y-X-X-X-Y and provide new insight into the interaction of diverse proteins in coactivator complexes. PMID:16282588

Identification of potential compensatory muscle strategies in a breast cancer survivor population: A combined computational and experimental approach.

PubMed

Chopp-Hurley, Jaclyn N; Brookham, Rebecca L; Dickerson, Clark R

2016-12-01

Biomechanical models are often used to estimate the muscular demands of various activities. However, specific muscle dysfunctions typical of unique clinical populations are rarely considered. Due to iatrogenic tissue damage, pectoralis major capability is markedly reduced in breast cancer population survivors, which could influence arm internal and external rotation muscular strategies. Accordingly, an optimization-based muscle force prediction model was systematically modified to emulate breast cancer population survivors through adjusting pectoralis capability and enforcing an empirical muscular co-activation relationship. Model permutations were evaluated through comparisons between predicted muscle forces and empirically measured muscle activations in survivors. Similarities between empirical data and model outputs were influenced by muscle type, hand force, pectoralis major capability and co-activation constraints. Differences in magnitude were lower when the co-activation constraint was enforced (-18.4% [31.9]) than unenforced (-23.5% [27.6]) (p<0.0001). This research demonstrates that muscle dysfunction in breast cancer population survivors can be reflected through including a capability constraint for pectoralis major. Further refinement of the co-activation constraint for survivors could improve its generalizability across this population and activities. Improving biomechanical models to more accurately represent clinical populations can provide novel information that can help in the development of optimal treatment programs for breast cancer population survivors. Copyright © 2016 Elsevier Ltd. All rights reserved.

Selective ligand activity at Nur/retinoid X receptor complexes revealed by dimer-specific bioluminescence resonance energy transfer-based sensors

PubMed Central

Giner, Xavier C; Cotnoir-White, David; Mader, Sylvie; Lévesque, Daniel

2017-01-01

Retinoid X receptors (RXR) play a role as master regulators due to their capacity to form heterodimers with other nuclear receptors. Accordingly, retinoid signaling is involved in multiple biological processes, including development, cell differentiation, metabolism and cell death. However, the role and functions of RXR in different heterodimer complexes remain unsolved, mainly because most RXR drugs (called rexinoids) are not selective to specific heterodimer complexes. This also strongly limits the use of rexinoids for specific therapeutic approaches. In order to better characterize rexinoids at specific nuclear receptor complexes, we have developed and optimized luciferase protein complementation-based Bioluminescence Resonance Energy Transfer (BRET) assays, which can directly measure recruitment of a co-activator motif fused to yellow fluorescent protein (YFP) by specific nuclear receptor dimers. To validate the assays, we compared rexinoid modulation of co-activator recruitment by RXR homodimer, and heterodimers Nur77/RXR and Nurr1/RXR. Results reveal that some rexinoids display selective co-activator recruitment activities with homo- or hetero-dimer complexes. In particular, SR11237 (BMS649) has increased potency for recruitment of co-activator motif and transcriptional activity with the Nur77/RXR heterodimer compared to other complexes. This technology should prove useful to identify new compounds with specificity for individual dimeric species formed by nuclear receptors. PMID:26148973

Composite faces are not (necessarily) processed coactively: A test using systems factorial technology and logical-rule models.

PubMed

Cheng, Xue Jun; McCarthy, Callum J; Wang, Tony S L; Palmeri, Thomas J; Little, Daniel R

2018-06-01

Upright faces are thought to be processed more holistically than inverted faces. In the widely used composite face paradigm, holistic processing is inferred from interference in recognition performance from a to-be-ignored face half for upright and aligned faces compared with inverted or misaligned faces. We sought to characterize the nature of holistic processing in composite faces in computational terms. We use logical-rule models (Fifić, Little, & Nosofsky, 2010) and Systems Factorial Technology (Townsend & Nozawa, 1995) to examine whether composite faces are processed through pooling top and bottom face halves into a single processing channel-coactive processing-which is one common mechanistic definition of holistic processing. By specifically operationalizing holistic processing as the pooling of features into a single decision process in our task, we are able to distinguish it from other processing models that may underlie composite face processing. For instance, a failure of selective attention might result even when top and bottom components of composite faces are processed in serial or in parallel without processing the entire face coactively. Our results show that performance is best explained by a mixture of serial and parallel processing architectures across all 4 upright and inverted, aligned and misaligned face conditions. The results indicate multichannel, featural processing of composite faces in a manner inconsistent with the notion of coactivity. (PsycINFO Database Record (c) 2018 APA, all rights reserved).

Training through gametherapy promotes coactivation of the pelvic floor and abdominal muscles in young women, nulliparous and continents.

PubMed

Silva, Valeria Regina; Riccetto, Cássio Luis Zanettini; Martinho, Natalia Miguel; Marques, Joseane; Carvalho, Leonardo Cesar; Botelho, Simone

2016-01-01

several studies have been investigated co-activation can enhance the effectveness of PFM training protocols allowing preventive and therapeutic goals in pelvic floor dysfunctions. The objective of the present study was to investigate if an abdominal-pelvic protocol of training (APT) using gametherapy would allow co-activation of PFM and transversus abdominis/oblique internal (TrA/OI) muscles. Twenty-five nulliparous, continent, young females, with median age 24.76 (±3.76) years were evaluated using digital palpation (DP) of PFM and surfasse electromyography of PFM and TrA/OI simultaneously, during maximal voluntary contraction (MVC), alternating PFM and TrA/OI contraction requests. All women participated on a supervised program of APT using gametherapy, that included exercises of pelvic mobilization associated to contraction of TrA/OI muscles oriented by virtual games, for 30 minutes, three times a week, in a total of 10 sessions. Electromyographic data were processed and analyzed by ANOVA - analysis of variance. When MVC of TrA/OI was solicited, it was observed simultaneous increase of electromyographic activity of PFM (p=0.001) following ATP. However, EMG activity did not change significantly during MVC of PFM. Training using gametherapy allowed better co-activation of pelvic floor muscles in response to contraction of TrA, in young nulliparous and continent women. Copyright© by the International Brazilian Journal of Urology.

Regulation of Ketone Body Metabolism and the Role of PPARα

PubMed Central

Grabacka, Maja; Pierzchalska, Malgorzata; Dean, Matthew; Reiss, Krzysztof

2016-01-01

Ketogenesis and ketolysis are central metabolic processes activated during the response to fasting. Ketogenesis is regulated in multiple stages, and a nuclear receptor peroxisome proliferator activated receptor α (PPARα) is one of the key transcription factors taking part in this regulation. PPARα is an important element in the metabolic network, where it participates in signaling driven by the main nutrient sensors, such as AMP-activated protein kinase (AMPK), PPARγ coactivator 1α (PGC-1α), and mammalian (mechanistic) target of rapamycin (mTOR) and induces hormonal mediators, such as fibroblast growth factor 21 (FGF21). This work describes the regulation of ketogenesis and ketolysis in normal and malignant cells and briefly summarizes the positive effects of ketone bodies in various neuropathologic conditions. PMID:27983603

EXERCISES THAT FACILITATE OPTIMAL HAMSTRING AND QUADRICEPS CO-ACTIVATION TO HELP DECREASE ACL INJURY RISK IN HEALTHY FEMALES: A SYSTEMATIC REVIEW OF THE LITERATURE.

PubMed Central

Dedinsky, Rachel; Baker, Lindsey; Imbus, Samuel; Bowman, Melissa

2017-01-01

Background Anterior cruciate ligament (ACL) injury is common among females due to many anatomic, hormonal, and neuromuscular risk factors. One modifiable risk factor that places females at increased risk of ACL injury is a poor hamstrings: quadriceps (H:Q) co-activation ratio, which should be 0.6 or greater in order to decrease the stress placed on the ACL. Exercises that produce more quadriceps dominant muscle activation can add to the tension placed upon the ACL, potentially increasing the risk of ACL injury. Hypothesis/Purpose The purpose of this systematic review was to compare quadriceps and hamstring muscle activation during common closed kinetic chain therapeutic exercises in healthy female knees to determine what exercises are able to produce adequate H:Q co-activation ratios. Study Design Systematic Review Methods Multiple online databases were systematically searched and screened for inclusion. Eight articles were identified for inclusion. Data on mean electromyography (EMG) activation of both quadriceps and hamstring muscles, % maximal voluntary isometric contraction (MVIC), and H:Q co-activation ratios were extracted from the studies. Quality assessment was performed on all included studies. Results Exercises analyzed in the studies included variations of the double leg squat, variations of the single leg squat, lateral step-up, Fitter, Stairmaster® (Core Health and Fitness, Vancouver, WA), and slide board. All exercises, except the squat machine with posterior support at the level of the scapula and feet placed 50 cm in front of the hips, produced higher quadriceps muscle activation compared to hamstring muscle activation. Conclusion Overall, two leg squats demonstrate poor H:Q co-activation ratios. Single leg exercises, when performed between 30 and 90 degrees of knee flexion, produce adequate H:Q ratios, thereby potentially reducing the risk of tensile stress on the ACL and ACL injury. Level of Evidence 2a- Systematic Review of Cohort Studies PMID:28217412

Targeting of the Nuclear Receptor Coactivator Isoform DELTA3AIB1 in Breast Cancer

DTIC Science & Technology

2007-03-01

lab showed that the downregulation of overall levels of AIB1 plus ∆3AIB1, using a regulatable AIB1 directed ribozyme , resulted in reduced tumor...overall levels of AIB1 plus ∆3AIB1, using a regulatable AIB1 directed ribozyme , resulted in reduced tumor growth in vivo. Overall, these data indicate a...Reiter R, Powers C, Wellstein A, Riegel AT. Ribozyme targeting shows that the nuclear receptor coactivator AIB1 is a rate-limiting factor for estrogen

GCN5 regulates the activation of PI3K/Akt survival pathway in B cells exposed to oxidative stress via controlling gene expressions of Syk and Btk.

PubMed

Kikuchi, Hidehiko; Kuribayashi, Futoshi; Takami, Yasunari; Imajoh-Ohmi, Shinobu; Nakayama, Tatsuo

2011-02-25

Histone acetyltransferase(s) (HATs) are involved in the acetylation of core histones, which is an important event for transcription regulation through alterations in the chromatin structure in eukaryotes. General control non-depressible 5 (GCN5) was first identified as a global coactivator and transcription-related HAT. Here we report that GCN5 regulates the activation of phosphatidylinositol 3-kinase (PI3K)/acutely transforming retrovirus AKT8 in rodent T cell lymphoma (Akt) survival pathway in B cells exposed to oxidative stress via controlling gene expressions of spleen tyrosine kinase (Syk) and Bruton's tyrosine kinase (Btk). The GCN5-deficiency remarkably caused apoptotic cell death by treatment with exogenous hydrogen peroxide (H(2)O(2)) in chicken DT40 cells. In GCN5-deficient DT40 cells, gene expressions of Syk and Btk, which are involved in activation of PI3K/Akt survival pathway in DT40 cells exposed to exogenous H(2)O(2), were remarkably decreased compared with those in wild type DT40 cells. In addition, phosphorylation of Akt in H(2)O(2)-treated GCN5-deficient cells was remarkably suppressed as compared to that of DT40. Chromatin immunoprecipitation assay revealed that GCN5 binds to proximal 5'-upstream regions of Syk and Btk genes in vivo. These results suggest that GCN5 takes part in transcriptional regulations of the Syk and Btk genes, and plays a key role in epigenetic regulation of PI3K/Akt survival pathway in B cells exposed to reactive oxygen species such as H(2)O(2). Copyright © 2011 Elsevier Inc. All rights reserved.

In SilicoModel-driven Assessment of the Effects of Brain-derived Neurotrophic Factor Deficiency on Glutamate and Gamma-Aminobutyric Acid: Implications for Understanding Schizophrenia Pathophysiology.

PubMed

Agrawal, Rimjhim; Kalmady, Sunil Vasu; Venkatasubramanian, Ganesan

2017-05-31

Deficient brain-derived neurotrophic factor (BDNF) is one of the important mechanisms underlying the neuroplasticity abnormalities in schizophrenia. Aberration in BDNF signaling pathways directly or circuitously influences neurotransmitters like glutamate and gamma-aminobutyric acid (GABA). For the first time, this study attempts to construct and simulate the BDNF-neurotransmitter network in order to assess the effects of BDNF deficiency on glutamate and GABA. Using CellDesigner, we modeled BDNF interactions with calcium influx via N-methyl-D-aspartate receptor (NMDAR)- Calmodulin activation; synthesis of GABA via cell cycle regulators protein kinase B, glycogen synthase kinase and β-catenin; transportation of glutamate and GABA. Steady state stability, perturbation time-course simulation and sensitivity analysis were performed in COPASI after assigning the kinetic functions, optimizing the unknown parameters using random search and genetic algorithm. Study observations suggest that increased glutamate in hippocampus, similar to that seen in schizophrenia, could potentially be contributed by indirect pathway originated from BDNF. Deficient BDNF could suppress Glutamate decarboxylase 67-mediated GABA synthesis. Further, deficient BDNF corresponded to impaired transport via vesicular glutamate transporter, thereby further increasing the intracellular glutamate in GABAergic and glutamatergic cells. BDNF also altered calcium dependent neuroplasticity via NMDAR modulation. Sensitivity analysis showed that Calmodulin, cAMP response element-binding protein (CREB) and CREB regulated transcription coactivator-1 played significant role in this network. The study presents in silico quantitative model of biochemical network constituting the key signaling molecules implicated in schizophrenia pathogenesis. It provides mechanistic insights into putative contribution of deficient BNDF towards alterations in neurotransmitters and neuroplasticity that are consistent with current understanding of the disorder.

In Silico Model-driven Assessment of the Effects of Brain-derived Neurotrophic Factor Deficiency on Glutamate and Gamma-Aminobutyric Acid: Implications for Understanding Schizophrenia Pathophysiology

PubMed Central

Agrawal, Rimjhim; Kalmady, Sunil Vasu; Venkatasubramanian, Ganesan

2017-01-01

Objective Deficient brain-derived neurotrophic factor (BDNF) is one of the important mechanisms underlying the neuroplasticity abnormalities in schizophrenia. Aberration in BDNF signaling pathways directly or circuitously influences neurotransmitters like glutamate and gamma-aminobutyric acid (GABA). For the first time, this study attempts to construct and simulate the BDNF-neurotransmitter network in order to assess the effects of BDNF deficiency on glutamate and GABA. Methods Using CellDesigner, we modeled BDNF interactions with calcium influx via N-methyl-D-aspartate receptor (NMDAR)-Calmodulin activation; synthesis of GABA via cell cycle regulators protein kinase B, glycogen synthase kinase and β-catenin; transportation of glutamate and GABA. Steady state stability, perturbation time-course simulation and sensitivity analysis were performed in COPASI after assigning the kinetic functions, optimizing the unknown parameters using random search and genetic algorithm. Results Study observations suggest that increased glutamate in hippocampus, similar to that seen in schizophrenia, could potentially be contributed by indirect pathway originated from BDNF. Deficient BDNF could suppress Glutamate decarboxylase 67-mediated GABA synthesis. Further, deficient BDNF corresponded to impaired transport via vesicular glutamate transporter, thereby further increasing the intracellular glutamate in GABAergic and glutamatergic cells. BDNF also altered calcium dependent neuroplasticity via NMDAR modulation. Sensitivity analysis showed that Calmodulin, cAMP response element-binding protein (CREB) and CREB regulated transcription coactivator-1 played significant role in this network. Conclusion The study presents in silico quantitative model of biochemical network constituting the key signaling molecules implicated in schizophrenia pathogenesis. It provides mechanistic insights into putative contribution of deficient BNDF towards alterations in neurotransmitters and neuroplasticity that are consistent with current understanding of the disorder. PMID:28449558

A Model for Aryl Hydrocarbon Receptor-Activated Gene Expression Shows Potency and Efficacy Changes and Predicts Squelching Due to Competition for Transcription Co-Activators

PubMed Central

Simon, Ted W.; Budinsky, Robert A.; Rowlands, J. Craig

2015-01-01

A stochastic model of nuclear receptor-mediated transcription was developed based on activation of the aryl hydrocarbon receptor (AHR) by 2,3,7,8-tetrachlorodibenzodioxin (TCDD) and subsequent binding the activated AHR to xenobiotic response elements (XREs) on DNA. The model was based on effects observed in cells lines commonly used as in vitro experimental systems. Following ligand binding, the AHR moves into the cell nucleus and forms a heterodimer with the aryl hydrocarbon nuclear translocator (ARNT). In the model, a requirement for binding to DNA is that a generic coregulatory protein is subsequently bound to the AHR-ARNT dimer. Varying the amount of coregulator available within the nucleus altered both the potency and efficacy of TCDD for inducing for transcription of CYP1A1 mRNA, a commonly used marker for activation of the AHR. Lowering the amount of available cofactor slightly increased the EC50 for the transcriptional response without changing the efficacy or maximal response. Further reduction in the amount of cofactor reduced the efficacy and produced non-monotonic dose-response curves (NMDRCs) at higher ligand concentrations. The shapes of these NMDRCs were reminiscent of the phenomenon of squelching. Resource limitations for transcriptional machinery are becoming apparent in eukaryotic cells. Within single cells, nuclear receptor-mediated gene expression appears to be a stochastic process; however, intercellular communication and other aspects of tissue coordination may represent a compensatory process to maintain an organism’s ability to respond on a phenotypic level to various stimuli within an inconstant environment. PMID:26039703

The effect of resistance level and stability demands on recruitment patterns and internal loading of spine in dynamic flexion and extension using a simple trunk model.

PubMed

Zeinali-Davarani, Shahrokh; Shirazi-Adl, Aboulfazl; Dariush, Behzad; Hemami, Hooshang; Parnianpour, Mohamad

2011-07-01

The effects of external resistance on the recruitment of trunk muscles in sagittal movements and the coactivation mechanism to maintain spinal stability were investigated using a simple computational model of iso-resistive spine sagittal movements. Neural excitation of muscles was attained based on inverse dynamics approach along with a stability-based optimisation. The trunk flexion and extension movements between 60° flexion and the upright posture against various resistance levels were simulated. Incorporation of the stability constraint in the optimisation algorithm required higher antagonistic activities for all resistance levels mostly close to the upright position. Extension movements showed higher coactivation with higher resistance, whereas flexion movements demonstrated lower coactivation indicating a greater stability demand in backward extension movements against higher resistance at the neighbourhood of the upright posture. Optimal extension profiles based on minimum jerk, work and power had distinct kinematics profiles which led to recruitment patterns with different timing and amplitude of activation.

Pontin functions as an essential coactivator for Oct4-dependent lincRNA expression in mouse embryonic stem cells.

PubMed

Boo, Kyungjin; Bhin, Jinhyuk; Jeon, Yoon; Kim, Joomyung; Shin, Hi-Jai R; Park, Jong-Eun; Kim, Kyeongkyu; Kim, Chang Rok; Jang, Hyonchol; Kim, In-Hoo; Kim, V Narry; Hwang, Daehee; Lee, Ho; Baek, Sung Hee

2015-04-10

The actions of transcription factors, chromatin modifiers and noncoding RNAs are crucial for the programming of cell states. Although the importance of various epigenetic machineries for controlling pluripotency of embryonic stem (ES) cells has been previously studied, how chromatin modifiers cooperate with specific transcription factors still remains largely elusive. Here, we find that Pontin chromatin remodelling factor plays an essential role as a coactivator for Oct4 for maintenance of pluripotency in mouse ES cells. Genome-wide analyses reveal that Pontin and Oct4 share a substantial set of target genes involved in ES cell maintenance. Intriguingly, we find that the Oct4-dependent coactivator function of Pontin extends to the transcription of large intergenic noncoding RNAs (lincRNAs) and in particular linc1253, a lineage programme repressing lincRNA, is a Pontin-dependent Oct4 target lincRNA. Together, our findings demonstrate that the Oct4-Pontin module plays critical roles in the regulation of genes involved in ES cell fate determination.

Implicit co-activation of American Sign Language in deaf readers: An ERP study.

PubMed

Meade, Gabriela; Midgley, Katherine J; Sevcikova Sehyr, Zed; Holcomb, Phillip J; Emmorey, Karen

2017-07-01

In an implicit phonological priming paradigm, deaf bimodal bilinguals made semantic relatedness decisions for pairs of English words. Half of the semantically unrelated pairs had phonologically related translations in American Sign Language (ASL). As in previous studies with unimodal bilinguals, targets in pairs with phonologically related translations elicited smaller negativities than targets in pairs with phonologically unrelated translations within the N400 window. This suggests that the same lexicosemantic mechanism underlies implicit co-activation of a non-target language, irrespective of language modality. In contrast to unimodal bilingual studies that find no behavioral effects, we observed phonological interference, indicating that bimodal bilinguals may not suppress the non-target language as robustly. Further, there was a subset of bilinguals who were aware of the ASL manipulation (determined by debrief), and they exhibited an effect of ASL phonology in a later time window (700-900ms). Overall, these results indicate modality-independent language co-activation that persists longer for bimodal bilinguals. Copyright © 2017 Elsevier Inc. All rights reserved.

Nontranscriptional regulation of SYK by the coactivator OCA-B is required at multiple stages of B cell development.

PubMed

Siegel, Rachael; Kim, Unkyu; Patke, Alina; Yu, Xin; Ren, Xiaodi; Tarakhovsky, Alexander; Roeder, Robert G

2006-05-19

OCA-B was originally identified as a nuclear transcriptional coactivator that is essential for antigen-driven immune responses. The later identification of a membrane bound, myristoylated form of OCA-B suggested additional, unique functions in B cell signaling pathways. This study has shown that OCA-B also functions in the pre-B1-to-pre-B2 cell transition and, most surprisingly, that it directly interacts with SYK, a tyrosine kinase critical for pre-BCR and BCR signaling. This unprecedented type of interaction-a transcriptional coactivator with a signaling kinase-occurs in the cytoplasm and directly regulates SYK stability. This study indicates that OCA-B is required for pre-BCR and BCR signaling at multiple stages of B cell development through its nontranscriptional regulation of SYK. Combined with the deregulation of OCA-B target genes, this may help explain the multitude of defects observed in B cell development and immune responses of Oca-b-/- mice.

Coactivation of response initiation processes with redundant signals.

PubMed

Maslovat, Dana; Hajj, Joëlle; Carlsen, Anthony N

2018-05-14

During reaction time (RT) tasks, participants respond faster to multiple stimuli from different modalities as compared to a single stimulus, a phenomenon known as the redundant signal effect (RSE). Explanations for this effect typically include coactivation arising from the multiple stimuli, which results in enhanced processing of one or more response production stages. The current study compared empirical RT data with the predictions of a model in which initiation-related activation arising from each stimulus is additive. Participants performed a simple wrist extension RT task following either a visual go-signal, an auditory go-signal, or both stimuli with the auditory stimulus delayed between 0 and 125 ms relative to the visual stimulus. Results showed statistical equivalence between the predictions of an additive initiation model and the observed RT data, providing novel evidence that the RSE can be explained via a coactivation of initiation-related processes. It is speculated that activation summation occurs at the thalamus, leading to the observed facilitation of response initiation. Copyright © 2018 Elsevier B.V. All rights reserved.

An Exposed KID-Like Domain in Human T-Cell Lymphotropic Virus Type 1 Tax Is Responsible for the Recruitment of Coactivators CBP/p300

PubMed Central

Harrod, Robert; Tang, Yong; Nicot, Christophe; Lu, Hsieng S.; Vassilev, Alex; Nakatani, Yoshihiro; Giam, Chou-Zen

1998-01-01

Human T-cell lymphotropic virus type 1 (HTLV-1) transcriptional activation is mediated by the viral transactivator, Tax, and three 21-bp repeats (Tax response element [TxRE]) located in the U3 region of the viral long terminal repeat (LTR). Each TxRE contains a core cyclic AMP response element (CRE) flanked by 5′ G-rich and 3′ C-rich sequences. The TxRE binds CREB (CRE-binding protein) and Tax to form a ternary complex and confers Tax-dependent transactivation. Recent data indicate that Tax functions as a specific link to connect CREB-binding protein (CBP)/p300 in a phosphorylation-independent manner to CREB/ATF-1 assembled on the viral 21-bp repeats. Glutathione S-transferase pull-down performed with Tax deletion mutants and peptide competition have localized the site in Tax critical for binding CBP/p300 to a highly protease-sensitive region around amino acid residues 81 to 95 (81QRTSKTLKVLTPPIT95) which lies between the domains previously proposed to be important for CREB binding and Tax subunit dimerization. Amino acid residues around the trypsin- and chymotrypsin-sensitive sites (88KVL90) of Tax bear resemblance to those in the kinase-inducible domain of CREB (129SRRPSYRKILNE140) surrounding Ser-133, which undergoes signal-induced phosphorylation to recruit CBP/p300. Site-directed mutagenesis of residues in this domain (R82A, K85A, K88A, and V89A) resulted in proteins which failed to transactivate from the HTLV-1 LTR in vivo. These mutants (K85A, K88A, and V89A) bind CREB with similar affinities as wild-type Tax, yet interaction with CBP/p300 is abrogated in various biochemical assays, indicating that the recruitment of CBP/p300 is crucial for Tax transactivation. A Tax mutant, M47, defective in the COOH-terminal transactivation domain, continued to interact with CBP/p300, suggesting that interactions with additional cellular factors are required for proper Tax function. PMID:9710589

Shoulder Muscle Activation Levels During the Push-Up-Plus Exercise on Stable and Unstable Surfaces.

PubMed

Torres, Rafaela J B; Pirauá, André L T; Nascimento, Vinícius Y S; Dos Santos, Priscila S; Beltrão, Natália B; de Oliveira, Valéria M A; Pitangui, Ana Carolina R; de Araújo, Rodrigo C

2017-07-01

The aim of this study was to evaluate the acute effect of the use of stable and unstable surfaces on electromyography (EMG) activity and coactivation of the scapular and upper-limb muscles during the push-up plus (with full protraction of the scapula). Muscle activation of anterior deltoid (AD), posterior deltoid (PD), pectoralis major, biceps brachii (BB), triceps brachii (TB), upper trapezius (UT), middle trapezius (MT), lower trapezius (LT), and serratus anterior (SA) levels and coactivation index were determined by surface EMG in 20 young men during push-up plus performed on a stable and unstable condition (2 unstable devices applied to hands and feet). The paired t test and Cohen d were used for statistical analysis. The results showed that during the execution of the push-up plus on the unstable surface an increased EMG activity of the scapular stabilizing muscles (SA, MT, and LT) was observed, while AD and PD muscles showed a decrease. During exercise execution on the unstable surface there was a higher index of coactivation of the scapular muscles (SA-MT and UT-LT pairs). No significant differences were observed in TB-BB and AD-PD pairs. These results suggest that the push-up-plus exercise associated with unstable surfaces produced greater EMG activity levels and coactivation index of the scapular stabilizing muscle. On the other hand, the use of an unstable surface does not promote the same effect for the shoulder muscles.

Identification of Poly(ADP-Ribose) Polymerase as a Transcriptional Coactivator of the Human T-Cell Leukemia Virus Type 1 Tax Protein

PubMed Central

Anderson, Mark G.; Scoggin, Kirsten E. S.; Simbulan-Rosenthal, Cynthia M.; Steadman, Jennifer A.

2000-01-01

Human T-cell leukemia virus type 1 (HTLV-1) encodes a transcriptional activator, Tax, whose activity is believed to contribute significantly to cellular transformation. Tax stimulates transcription from the proviral promoter as well as from promoters for a variety of cellular genes. The mechanism through which Tax communicates to the general transcription factors and RNA polymerase II has not been completely determined. We investigated whether Tax could function directly through the general transcription factors and RNA polymerase II or if other intermediary factors or coactivators were required. Our results show that a system consisting of purified recombinant TFIIA, TFIIB, TFIIE, TFIIF, CREB, and Tax, along with highly purified RNA polymerase II, affinity-purified epitope-tagged TFIID, and semipurified TFIIH, supports basal transcription of the HTLV-1 promoter but is not responsive to Tax. Two additional activities were required for Tax to stimulate transcription. We demonstrate that one of these activities is poly(ADP-ribose) polymerase (PARP), a molecule that has been previously identified to be the transcriptional coactivator PC1. PARP functions as a coactivator in our assays at molar concentrations approximately equal to those of the DNA and equal to or less than those of the transcription factors in the assay. We further demonstrate that PARP stimulates Tax-activated transcription in vivo, demonstrating that this biochemical approach has functionally identified a novel target for the retroviral transcriptional activator Tax. PMID:10666246

Responses of magnocellular neurons to osmotic stimulation involves coactivation of excitatory and inhibitory input: an experimental and theoretical analysis.

PubMed

Leng, G; Brown, C H; Bull, P M; Brown, D; Scullion, S; Currie, J; Blackburn-Munro, R E; Feng, J; Onaka, T; Verbalis, J G; Russell, J A; Ludwig, M

2001-09-01

How does a neuron, challenged by an increase in synaptic input, display a response that is independent of the initial level of activity? Here we show that both oxytocin and vasopressin cells in the supraoptic nucleus of normal rats respond to intravenous infusions of hypertonic saline with gradual, linear increases in discharge rate. In hyponatremic rats, oxytocin and vasopressin cells also responded linearly to intravenous infusions of hypertonic saline but with much lower slopes. The linearity of response was surprising, given both the expected nonlinearity of neuronal behavior and the nonlinearity of the oxytocin secretory response to such infusions. We show that a simple computational model can reproduce these responses well, but only if it is assumed that hypertonic infusions coactivate excitatory and inhibitory synaptic inputs. This hypothesis was tested first by applying the GABA(A) antagonist bicuculline to the dendritic zone of the supraoptic nucleus by microdialysis. During local blockade of GABA inputs, the response of oxytocin cells to hypertonic infusion was greatly enhanced. We then went on to directly measure GABA release in the supraoptic nucleus during hypertonic infusion, confirming the predicted rise. Together, the results suggest that hypertonic infusions lead to coactivation of excitatory and inhibitory inputs and that this coactivation may confer appropriate characteristics on the output behavior of oxytocin cells. The nonlinearity of oxytocin secretion that accompanies the linear increase in oxytocin cell firing rate reflects frequency-facilitation of stimulus-secretion coupling at the neurohypophysis.

A temporal examination of co-activated emotion valence networks in schizophrenia and schizotypy

PubMed Central

Cohen, Alex S.; Callaway, Dallas A.; Mitchell, Kyle R.; Larsen, Jeff T.; Strauss, Gregory P.

2016-01-01

Emotional abnormalities are prominent across the schizophrenia spectrum. To better define these abnormalities, we examined state emotional functions across opposing ends of the spectrum, notably in chronic outpatients with schizophrenia (Study 1) and college students with psychometrically defined schizotypy (Study 2). In line with existing studies, we predicted that individuals with schizophrenia would show unusually co-activated positive and negative emotions while college students with schizotypy would show abnormally low positive and abnormally high negative emotions. Drawing from the affective science literature, we employed continuous emotion ratings in response to a dynamic and evocatively “bittersweet” stimulus. Participants included 27 individuals with schizophrenia, 39 individuals with psychometrically defined schizotypy and 26 community and 35 college control participants. Participants continuously rated their state happiness and sadness throughout a six-minute clip from a tragicomic film (i.e., Life is Beautiful). In contrast to expectations as well as the extant literature, there were no state emotional abnormalities noted from either schizophrenia-spectrum group. Of particular note, neither individuals with schizophrenia nor individuals with schizotypy were abnormal in their experience of state negative, positive or coactivated emotions. Conversely, abnormalities in trait emotion were observed in both groups relative to their respective control groups. These results help confirm that the schizophrenia-spectrum is not characterized by deficits in state emotional experience and suggest that sadness is not abnormally co-activated with pleasant emotions. These results are critical for clarifying the “chronometry” of emotional dysfunctions across the schizophrenia-spectrum. PMID:26711714

Winnetka deformation zone: Surface expression of coactive slip on a blind fault during the Northridge earthquake sequence, California. Evidence that coactive faulting occurred in the Canoga Park, Winnetka, and Northridge areas during the 17 January 1994, Northridge, California earthquake

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cruikshank, K.M.; Johnson, A.M.; Fleming, R.W.

1996-12-31

Measurements of normalized length changes of streets over an area of 9 km{sup 2} in San Fernando Valley of Los Angeles, California, define a distinctive strain pattern that may well reflect blind faulting during the 1994 Northridge earthquake. Strain magnitudes are about 3 {times} 10{sup {minus}4}, locally 10{sup {minus}3}. They define a deformation zone trending diagonally from near Canoga Park in the southwest, through Winnetka, to near Northridge in the northeast. The deformation zone is about 4.5 km long and 1 km wide. The northwestern two-thirds of the zone is a belt of extension of streets, and the southeastern one-thirdmore » is a belt of shortening of streets. On the northwest and southeast sides of the deformation zone the magnitude of the strains is too small to measure, less than 10{sup {minus}4}. Complete states of strain measured in the northeastern half of the deformation zone show that the directions of principal strains are parallel and normal to the walls of the zone, so the zone is not a strike-slip zone. The magnitudes of strains measured in the northeastern part of the Winnetka area were large enough to fracture concrete and soils, and the area of larger strains correlates with the area of greater damage to such roads and sidewalks. All parts of the pattern suggest a blind fault at depth, most likely a reverse fault dipping northwest but possibly a normal fault dipping southeast. The magnitudes of the strains in the Winnetka area are consistent with the strains produced at the ground surface by a blind fault plane extending to depth on the order of 2 km and a net slip on the order of 1 m, within a distance of about 100 to 500 m of the ground surface. The pattern of damage in the San Fernando Valley suggests a fault segment much longer than the 4.5 km defined by survey data in the Winnetka area. The blind fault segment may extend several kilometers in both directions beyond the Winnetka area. This study of the Winnetka area further supports observations that a large earthquake sequence can include rupture along both a main fault and nearby faults with quite different senses of slip. Faults near the main fault that approach the ground surface or cut the surface in an area have the potential of moving coactively in a major earthquake. Movement on such faults is associated with significant damage during an earthquake. The fault that produced the main Northridge shock and the faults that moved coactively in the Northridge area probably are parts of a large structure. Such interrelationships may be key to understanding earthquakes and damage caused by tectonism.« less

The role of steroid receptor coactivator-3 (SRC-3) in human malignant disease.

PubMed

Gojis, O; Rudraraju, B; Alifrangis, C; Krell, J; Libalova, P; Palmieri, C

2010-03-01

The p160 steroid receptor coactivator (SRC) family is critical to the transcriptional activation function of nuclear hormone receptors. A key member of this family is SRC-3, initially found to be amplified and expressed in breast cancer it has subsequent been shown to be expressed in malignant disease arising from a wide range of other organs. An understanding of the potential role of SRC-3 in the pathogenesis and its possible prognostic role in a broad range of tumours will improve our general understanding of carcinogenesis as well as potentially leading to a new prognostic marker as well as new therapeutic targets. Relevant papers were identified by searching the PubMed and MEDLINE databases for article published until 28th February 2009. Only articles published in English were considered. The search terms included "SRC-3", "AIB1" in association with the following terms: "human", "cancer" and "malignant disease". The search focused on malignant disease arising outside of the mammary gland. Full articles were obtained and references were checked for additional material when appropriate. SRC-3 is amplified and expressed in a wide spectrum of human malignant diseases and appears to be a potential prognostic marker in a number of different tumours. SRC-3 appears to be implicated in the possible risk of developing prostate and ovarian cancer. Its presence appears to be a marker of aggressive disease. Further research is required to determine its predictive and prognostic utility given the relative paucity of studies for each specific malignant disease. Copyright (c) 2009. Published by Elsevier Ltd.