Frisso, Giulia; Detta, Nicola; Coppola, Pamela; Mazzaccara, Cristina; Pricolo, Maria Rosaria; D'Onofrio, Antonio; Limongelli, Giuseppe; Calabrò, Raffaele; Salvatore, Francesco
2016-11-10
Point mutations are the most common cause of inherited diseases. Bioinformatics tools can help to predict the pathogenicity of mutations found during genetic screening, but they may work less well in determining the effect of point mutations in non-coding regions. In silico analysis of intronic variants can reveal their impact on the splicing process, but the consequence of a given substitution is generally not predictable. The aim of this study was to functionally test five intronic variants ( MYBPC3 -c.506-2A>C, MYBPC3 -c.906-7G>T, MYBPC3 -c.2308+3G>C, SCN5A -c.393-5C>A, and ACTC1 -c.617-7T>C) found in five patients affected by inherited cardiomyopathies in the attempt to verify their pathogenic role. Analysis of the MYBPC3 -c.506-2A>C mutation in mRNA from the peripheral blood of one of the patients affected by hypertrophic cardiac myopathy revealed the loss of the canonical splice site and the use of an alternative splicing site, which caused the loss of the first seven nucleotides of exon 5 ( MYBPC3 -G169AfsX14). In the other four patients, we generated minigene constructs and transfected them in HEK-293 cells. This minigene approach showed that MYBPC3 -c.2308+3G>C and SCN5A -c.393-5C>A altered pre-mRNA processing, thus resulting in the skipping of one exon. No alterations were found in either MYBPC3 -c.906-7G>T or ACTC1 -c.617-7T>C. In conclusion, functional in vitro analysis of the effects of potential splicing mutations can confirm or otherwise the putative pathogenicity of non-coding mutations, and thus help to guide the patient's clinical management and improve genetic counseling in affected families.
Bacteriophage 5' untranslated regions for control of plastid transgene expression.
Yang, Huijun; Gray, Benjamin N; Ahner, Beth A; Hanson, Maureen R
2013-02-01
Expression of foreign proteins from transgenes incorporated into plastid genomes requires regulatory sequences that can be recognized by the plastid transcription and translation machinery. Translation signals harbored by the 5' untranslated region (UTR) of plastid transcripts can profoundly affect the level of accumulation of proteins expressed from chimeric transgenes. Both endogenous 5' UTRs and the bacteriophage T7 gene 10 (T7g10) 5' UTR have been found to be effective in combination with particular coding regions to mediate high-level expression of foreign proteins. We investigated whether two other bacteriophage 5' UTRs could be utilized in plastid transgenes by fusing them to the aadA (aminoglycoside-3'-adenyltransferase) coding region that is commonly used as a selectable marker in plastid transformation. Transplastomic plants containing either the T7g1.3 or T4g23 5' UTRs fused to Myc-epitope-tagged aadA were successfully obtained, demonstrating the ability of these 5' UTRs to regulate gene expression in plastids. Placing the Thermobifida fusca cel6A gene under the control of the T7g1.3 or T4g23 5' UTRs, along with a tetC downstream box, resulted in poor expression of the cellulase in contrast with high-level accumulation while using the T7g10 5' UTR. However, transplastomic plants with the bacteriophage 5' UTRs controlling the aadA coding region exhibited fewer undesired recombinant species than plants containing the same marker gene regulated by the Nicotiana tabacum psbA 5' UTR. Furthermore, expression of the T7g1.3 and T4g23 5' UTR::aadA fusions downstream of the cel6A gene provided sufficient spectinomycin resistance to allow selection of homoplasmic transgenic plants and had no effect on Cel6A accumulation.
Code of Federal Regulations, 2011 CFR
2011-10-01
... code 0×2D Lower-left border (⌊), G2 char code 0×7C G0 dash (-), char code 0×2D Horizontal border... (-), char code 0×2D Upper-left border (⌈), G2 char code 0×7F G0 dash (-), char code 0×2D (4) Support for..., if the character to the left of the embedded return is a hyphen, the embedded return should be...
Code of Federal Regulations, 2010 CFR
2010-10-01
... code 0×2D Lower-left border (⌊), G2 char code 0×7C G0 dash (-), char code 0×2D Horizontal border... (-), char code 0×2D Upper-left border (⌈), G2 char code 0×7F G0 dash (-), char code 0×2D (4) Support for..., if the character to the left of the embedded return is a hyphen, the embedded return should be...
The complete mitochondrial genome of Conus tulipa (Neogastropoda: Conidae).
Chen, Po-Wei; Hsiao, Sheng-Tai; Huang, Chih-Wei; Chen, Kao-Sung; Tseng, Chen-Te; Wu, Wen-Lung; Hwang, Deng-Fwu
2016-07-01
The complete mitogenome sequence of the cone snail Conus tulipa (Linnaeus, 1758) has been sequenced by next-generation sequencing method. The assembled mitogenome is 16,599 bp in length, including 13 protein-coding genes, 22 transfer RNA genes and 2 ribosomal RNA genes. The overall base composition of C. tulipa is 28.7% A, 15.2% C, 18.4% G and 37.7% T. It shows 81.1% identity to the cone snail C. consors, 78.5% to C. borgesi and 77.5% to C. textile. Using the 13 protein-coding genes and 2 ribosomal RNA genes of C. tulipa in this study, together with 18 other closely species, we constructed the species phylogenetic tree to verify the accuracy and utility of new determined mitogenome sequence. The complete mitogenome of the C. tulipa provides an essential and important DNA molecular data for further phylogeography and evolutionary analysis for cone snail phylogeny.
Heinecke, K; Thiel, W
2001-06-01
The structure of the anticonvulsant 1-(4-chlorophenyl)-4-(4-morpholinyl)-2,5-dihydro-1H-imidazolin-2-one (Code: AWD 131-138, CAS-No.: 188116-07-6) was proved by IR, UV, 1H NMR, 13C NMR and mass spectra. AWD 131-138 is practically insoluble in a neutral aqueous medium at 20 degrees C (S approximately 0.08 g/l). The solubility of the substance in 0.1 N HCl is about 2.7 g/l. In DMF, AWD 131-138 is sparingly soluble (S approximately 28.5 g/l). The pKa-value is about 2.5. The partition coefficients P = COctanol/Cwater at 37 degrees C range from 0.7 at pH approximately 1 to about 20 at pH > or = 6.
Determination of the Complex Elastic Moduli of Materials Using A Free- Free Bar Technique
1994-03-01
LCDR, Dr. D. L alner 1 Dept. of Physics (Code PH) Naval Postgrdumt School Monterey, CA 93943 10 . Cgimd Ofric. Naval Reserh Labrary ATI’N: Dr. N...Postgraduate School ( fAp~hicbl) Naval Postgraduate School 6c. ADDRESS MclY- $Mae, 02t c7;w 3 7b. ADDRESS (city, MUk and ii? code) Mogntere CA 93943-5=0...Monery CA 93943-5000 Sa. NAME OF FUNDDOISIONS0R]NG G. OFMiCE SYMBOL 9. FUU1ENIICMN IDTFCTONNUMBER ORGANUAT1ON j (If Appkiabie) NSWC. CRANE. NPS
Identification of two allelic IgG1 C(H) coding regions (Cgamma1) of cat.
Kanai, T H; Ueda, S; Nakamura, T
2000-01-31
Two types of cDNA encoding IgG1 heavy chain (gamma1) were isolated from a single domestic short-hair cat. Sequence analysis indicated a higher level of similarity of these Cgamma1 sequences to human Cgamma1 sequence (76.9 and 77.0%) than to mouse sequence (70.0 and 69.7%) at the nucleotide level. Predicted primary structures of both the feline Cgamma1 genes, designated as Cgamma1a and Cgamma1b, were similar to that of human Cgamma1 gene, for instance, as to the size of constant domains, the presence of six conserved cysteine residues involved in formation of the domain structure, and the location of a conserved N-linked glycosylation site. Sequence comparison between the two alleles showed that 7 out of 10 nucleotide differences were within the C(H)3 domain coding region, all leading to nonsynonymous changes in amino acid residues. Partial sequence analysis of genomic clones showed three nucleotide substitutions between the two Cgamma1 alleles in the intron between the CH2 and C(H)3 domain coding regions. In 12 domestic short-hair cats used in this study, the frequency of Cgamma1a allele (62.5%) was higher than that of the Cgamma1b allele (37.5%).
Mutation Screening of 1,237 Cancer Genes across Six Model Cell Lines of Basal-Like Breast Cancer.
Olsson, Eleonor; Winter, Christof; George, Anthony; Chen, Yilun; Törngren, Therese; Bendahl, Pär-Ola; Borg, Åke; Gruvberger-Saal, Sofia K; Saal, Lao H
2015-01-01
Basal-like breast cancer is an aggressive subtype generally characterized as poor prognosis and lacking the expression of the three most important clinical biomarkers, estrogen receptor, progesterone receptor, and HER2. Cell lines serve as useful model systems to study cancer biology in vitro and in vivo. We performed mutational profiling of six basal-like breast cancer cell lines (HCC38, HCC1143, HCC1187, HCC1395, HCC1954, and HCC1937) and their matched normal lymphocyte DNA using targeted capture and next-generation sequencing of 1,237 cancer-associated genes, including all exons, UTRs and upstream flanking regions. In total, 658 somatic variants were identified, of which 378 were non-silent (average 63 per cell line, range 37-146) and 315 were novel (not present in the Catalogue of Somatic Mutations in Cancer database; COSMIC). 125 novel mutations were confirmed by Sanger sequencing (59 exonic, 48 3'UTR and 10 5'UTR, 1 splicing), with a validation rate of 94% of high confidence variants. Of 36 mutations previously reported for these cell lines but not detected in our exome data, 36% could not be detected by Sanger sequencing. The base replacements C/G>A/T, C/G>G/C, C/G>T/A and A/T>G/C were significantly more frequent in the coding regions compared to the non-coding regions (OR 3.2, 95% CI 2.0-5.3, P<0.0001; OR 4.3, 95% CI 2.9-6.6, P<0.0001; OR 2.4, 95% CI 1.8-3.1, P<0.0001; OR 1.8, 95% CI 1.2-2.7, P = 0.024, respectively). The single nucleotide variants within the context of T[C]T/A[G]A and T[C]A/T[G]A were more frequent in the coding than in the non-coding regions (OR 3.7, 95% CI 2.2-6.1, P<0.0001; OR 3.8, 95% CI 2.0-7.2, P = 0.001, respectively). Copy number estimations were derived from the targeted regions and correlated well to Affymetrix SNP array copy number data (Pearson correlation 0.82 to 0.96 for all compared cell lines; P<0.0001). These mutation calls across 1,237 cancer-associated genes and identification of novel variants will aid in the design and interpretation of biological experiments using these six basal-like breast cancer cell lines.
Porto-Fett, Anna C S; Juneja, Vijay K; Tamplin, Mark L; Luchansky, John B
2009-03-01
Irradiated ground beef samples (ca. 3-g portions with ca. 25% fat) inoculated with Yersina pestis strain KIM5 (ca. 6.7 log CFU/g) were heated in a circulating water bath stabilized at 48.9, 50, 52.5, 55, 57.5, or 60 degrees C (120, 122, 126.5, 131, 135.5, and 140 degrees F, respectively). Average D-values were 192.17, 34.38, 17.11, 3.87, 1.32, and 0.56 min, respectively, with a corresponding z-value of 4.67 degrees C (8.41 degrees F). In related experiments, irradiated ground beef patties (ca. 95 g per patty with ca. 25% fat) were inoculated with Y. pestis strains KIMS or CDC-A1122 (ca. 6.0 log CFU/g) and cooked on an open-flame gas grill or on a clam-shell type electric grill to internal target temperatures of 48.9, 60, and 71.1 degrees C (120, 140, and 160 degrees F, respectively). For patties cooked on the gas grill, strain KIM5 populations decreased from ca. 6.24 to 4.32, 3.51, and < or = 0.7 log CFU/g at 48.9, 60, and 71.1 degrees C, respectively, and strain CDC-A1122 populations decreased to 3.46 log CFU/g at 48.9 degrees C and to < or = 0.7 log CFU/g at both 60 and 71.1 degrees C. For patties cooked on the clam-shell grill, strain KIM5 populations decreased from ca. 5.96 to 2.53 log CFU/g at 48.9 degrees C and to < or = 0.7 log CFU/g at 60 or 71.1 degrees C, and strain CDC-A1122 populations decreased from ca. 5.98 to < or = 0.7 log CFU/g at all three cooking temperatures. These data confirm that cooking ground beef on an open-flame gas grill or on a clam-shell type electric grill to the temperatures and times recommended by the U.S. Department of Agriculture and the U.S. Food and Drug Administration Food Code, appreciably lessens the likelihood, severity, and/or magnitude of consumer illness if the ground beef were purposefully contaminated even with relatively high levels of Y. pestis.
49 CFR 565.25 - Content requirements.
Code of Federal Regulations, 2010 CFR
2010-10-01
... for VIN Year Code 1980 A 1981 B 1982 C 1983 D 1984 E 1985 F 1986 G 1987 H 1988 J 1989 K 1990 L 1991 M 1992 N 1993 P 1994 R 1995 S 1996 T 1997 V 1998 W 1999 X 2000 Y 2001 1 2002 2 2003 3 2004 4 2005 5 2006... J = 1 K = 2 L = 3 M = 4 N = 5 P = 7 R = 9 S = 2 T = 3 U = 4 V = 5 W = 6 X = 7 Y = 8 Z = 9 (2...
NASA Astrophysics Data System (ADS)
Redi, Martha; Canik, John; Fredrickson, E.; Fu, G.; Nuehrenberg, C.; Boozer, A. H.
2000-10-01
The standard ballooning-mode beta limit comes from an infinite-n, radially local, ideal magnetohydrodynamic (MHD) calculation. Finite-n ballooning modes have been observed in tokamak plasmas [1]. Investigations of optimized quasiaxially symmetric stellarators with three dimensional, global, ideal MHD codes have recently shown good stability for the external kink, ``vertical" and infinite-n ballooning modes [2,3]. However, infinite-n ballooning stability may be too restrictive, due to its sensitivity to features in the local shear and curvature. The CAS3D [4] code is being used to compare the stability of the high-n ballooning modes to the infinite-n calculations from TERPSICHORE [5]. [1] E. Fredrickson, et al. Phys. Plas. 3 (1996) 2620. [2] G. Fu, Phys. Plas. 7 (2000)1079; Phys. Plas. 7 (2000) 1809. M. Redi, et al. Phys. Plas 7 (2000)1911. [3] A. Reiman, et al., Plas. Phys. Cont. Fus. 41 (1999) B273. [4] C. Nuehrenberg, Phys. Plas. 6 (1999) 275. C. Nuehrenberg, Phys. Plas. 3 (1996) 2401. C. Schwab, Phys. Fluids B5 (1993) 3195. [5] W. A. Cooper, Phys. Plas. 3 (1996) 275.
Modeling of Cavitating Flow through Waterjet Propulsors
2015-02-18
1-0197 5c. PROGRAM ELEMENT NUMBER 6. AUTHOR(S) Jules W. Lindau 5d. PROJECT NUMBER 5e. TASK NUMBER 5f. WORK UNIT NUMBER 7. PERFORMING...RESPONSIBLE PERSON Jules W. Lindau 19b. TELEPONE NUMBER (Include area code) 814-865-8938 ^\\6^G%013 Standard Form 298 (Rev. 8-98) Prescribed by ANSI-Std...239-18 Modeling of Cavitating Flow through Waterjet Propulsors Jules W. Lindau The Pennsylvania State University, Applied Research Laboratory, State
Zaker, Neda; Zehtabian, Mehdi; Sina, Sedigheh; Koontz, Craig; Meigooni, Ali S
2016-03-08
Monte Carlo simulations are widely used for calculation of the dosimetric parameters of brachytherapy sources. MCNP4C2, MCNP5, MCNPX, EGS4, EGSnrc, PTRAN, and GEANT4 are among the most commonly used codes in this field. Each of these codes utilizes a cross-sectional library for the purpose of simulating different elements and materials with complex chemical compositions. The accuracies of the final outcomes of these simulations are very sensitive to the accuracies of the cross-sectional libraries. Several investigators have shown that inaccuracies of some of the cross section files have led to errors in 125I and 103Pd parameters. The purpose of this study is to compare the dosimetric parameters of sample brachytherapy sources, calculated with three different versions of the MCNP code - MCNP4C, MCNP5, and MCNPX. In these simulations for each source type, the source and phantom geometries, as well as the number of the photons, were kept identical, thus eliminating the possible uncertainties. The results of these investigations indicate that for low-energy sources such as 125I and 103Pd there are discrepancies in gL(r) values. Discrepancies up to 21.7% and 28% are observed between MCNP4C and other codes at a distance of 6 cm for 103Pd and 10 cm for 125I from the source, respectively. However, for higher energy sources, the discrepancies in gL(r) values are less than 1.1% for 192Ir and less than 1.2% for 137Cs between the three codes.
Chiriac, Cecilia; Baricz, Andreea
2018-01-01
ABSTRACT The draft genome assembly of Janthinobacterium sp. strain ROICE36 has 207 contigs, with a total genome size of 5,977,006 bp and a G+C content of 62%. Preliminary genome analysis identified 5,363 protein-coding genes and a total of 7 secondary metabolic gene clusters (encoding bacteriocins, nonribosomal peptide-synthetase [NRPS], terpene, hserlactone, and other ketide synthases). PMID:29650588
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zehtabian, M; Zaker, N; Sina, S
2015-06-15
Purpose: Different versions of MCNP code are widely used for dosimetry purposes. The purpose of this study is to compare different versions of the MCNP codes in dosimetric evaluation of different brachytherapy sources. Methods: The TG-43 parameters such as dose rate constant, radial dose function, and anisotropy function of different brachytherapy sources, i.e. Pd-103, I-125, Ir-192, and Cs-137 were calculated in water phantom. The results obtained by three versions of Monte Carlo codes (MCNP4C, MCNPX, MCNP5) were compared for low and high energy brachytherapy sources. Then the cross section library of MCNP4C code was changed to ENDF/B-VI release 8 whichmore » is used in MCNP5 and MCNPX codes. Finally, the TG-43 parameters obtained using the MCNP4C-revised code, were compared with other codes. Results: The results of these investigations indicate that for high energy sources, the differences in TG-43 parameters between the codes are less than 1% for Ir-192 and less than 0.5% for Cs-137. However for low energy sources like I-125 and Pd-103, large discrepancies are observed in the g(r) values obtained by MCNP4C and the two other codes. The differences between g(r) values calculated using MCNP4C and MCNP5 at the distance of 6cm were found to be about 17% and 28% for I-125 and Pd-103 respectively. The results obtained with MCNP4C-revised and MCNPX were similar. However, the maximum difference between the results obtained with the MCNP5 and MCNP4C-revised codes was 2% at 6cm. Conclusion: The results indicate that using MCNP4C code for dosimetry of low energy brachytherapy sources can cause large errors in the results. Therefore it is recommended not to use this code for low energy sources, unless its cross section library is changed. Since the results obtained with MCNP4C-revised and MCNPX were similar, it is concluded that the difference between MCNP4C and MCNPX is their cross section libraries.« less
Zaker, Neda; Sina, Sedigheh; Koontz, Craig; Meigooni1, Ali S.
2016-01-01
Monte Carlo simulations are widely used for calculation of the dosimetric parameters of brachytherapy sources. MCNP4C2, MCNP5, MCNPX, EGS4, EGSnrc, PTRAN, and GEANT4 are among the most commonly used codes in this field. Each of these codes utilizes a cross‐sectional library for the purpose of simulating different elements and materials with complex chemical compositions. The accuracies of the final outcomes of these simulations are very sensitive to the accuracies of the cross‐sectional libraries. Several investigators have shown that inaccuracies of some of the cross section files have led to errors in 125I and 103Pd parameters. The purpose of this study is to compare the dosimetric parameters of sample brachytherapy sources, calculated with three different versions of the MCNP code — MCNP4C, MCNP5, and MCNPX. In these simulations for each source type, the source and phantom geometries, as well as the number of the photons, were kept identical, thus eliminating the possible uncertainties. The results of these investigations indicate that for low‐energy sources such as 125I and 103Pd there are discrepancies in gL(r) values. Discrepancies up to 21.7% and 28% are observed between MCNP4C and other codes at a distance of 6 cm for 103Pd and 10 cm for 125I from the source, respectively. However, for higher energy sources, the discrepancies in gL(r) values are less than 1.1% for 192Ir and less than 1.2% for 137Cs between the three codes. PACS number(s): 87.56.bg PMID:27074460
Tormet Gonzalez, Gabriela D.; Samborsky, Markyian; Marcon, Joelma; Araujo, Welington L.; de Azevedo, João Lucio
2014-01-01
The actinobacterium Streptomyces wadayamensis A23 is an endophyte of Citrus reticulata that produces the antimycin and mannopeptimycin antibiotics, among others. The strain has the capability to inhibit Xylella fastidiosa growth. The draft genome of S. wadayamensis A23 has ~7.0 Mb and 6,006 protein-coding sequences, with a 73.5% G+C content. PMID:24994795
A Measure of Search Efficiency in a Real World Search Task (PREPRINT)
2009-02-16
Search Task 5a. CONTRACT NUMBER N00173-08-1-G030 5b. GRANT NUMBER NRL BAA 08-09, 55-07-01 5c. PROGRAM ELEMENT NUMBER 0602782N 6. AUTHOR(S... Beck , Melissa R. Ph.D (LSU) Maura C. Lohrenz (NRL Code 7440.1) J. Gregory Trafton (NRL Code 5515) 5d. PROJECT NUMBER 08294 5e. TASK NUMBER... Beck 19b. TELEPHONE NUMBER (Include area code) (225)578-7214 Standard Form 298 (Rev. 8/98) Prescribed by ANSI Std. Z39.18 A measure of search
Ferreira, Pedro Eduardo; Veiga, Maria Isabel; Cavaco, Isa; Martins, J Paulo; Andersson, Björn; Mushin, Shaliya; Ali, Abullah S; Bhattarai, Achuyt; Ribeiro, Vera; Björkman, Anders; Gil, José Pedro
2008-02-01
Artemisinin-based combination therapy is a main strategy for malaria control in Africa. Zanzibar introduced this new treatment policy in 2003. The authors have studied the prevalence of a number of functional single nucleotide polymorphisms (SNPs) in genes associated with the elimination of the artemisinin-based combination therapy compounds in use in Zanzibar to investigate the frequencies of subgroups potentially at higher drug exposure and therefore possible higher risk of toxicity. One hundred three unrelated children with uncomplicated malaria from the Unguja and Pemba islands of Zanzibar were enrolled. With use of polymerase chain reaction (PCR)-restriction fragment length polymorphism and real-time PCR-based allele discrimination methods, the CYP2B6 (G15631T), CYP3A4 (A-392G), CYP3A5 (A6986G, G14690A, 27131-132 insT, C3699T) SNPs and MDR1 SNPs C3435T, G2677T/A, and T-129C were analyzed. PCR product sequencing was applied to regulatory regions of MDR1, the CYP3A4 proximal promoter, and to exons 2 and 5 of PXR, a gene coding for a nuclear factor activated by artemisinin antimalarials and associated with the transcription induction of most of the studied genes. Homozygous subjects for alleles coding for low activity proteins were found at the following frequencies: 1) MDR1: 2.9%; 2) CYP2B6: 9.7%; 3) CYP3A5: 14.1%; and 4) CYP3A4: 49.5%. No functionally relevant allele was found in the analyzed regions of PXR. A new MDR1 SNP was found (T-158C), located in a putative antigen recognition element. Ten (10.1%) subjects were predicted to be low metabolizers simultaneously for CYP3A4 and CYP3A5. This fraction of the population is suggested to be under higher exposure to certain antimalarials, including lumefantrine and quinine.
Roque, Jose A.; Mazzola, Eugene P.; Ito, Yoichiro
2014-01-01
Specifications in the U.S. Code of Federal Regulations for the color additive FD&C Yellow No. 5 (Colour Index No. 19140) limit the level of the tetrasodium salt of 4-[(4',5-disulfo[1,1'-biphenyl]-2-yl)hydrazono]-4,5-dihydro-5-oxo-1-(4-sulfophenyl)-1H-pyrazole-3-carboxylic acid and that of the trisodium salt of 4,4'-[4,5-dihydro-5-oxo-4-[(4-sulfophenyl)hydrazono]-1H-pyrazol-1,3-diyl]bis[benzenesulfonic acid], which are subsidiary colors abbreviated as Pk5 and Pk7, respectively. Small amounts of Pk5 and Pk7 are needed by the U.S. Food and Drug Administration for confirmatory analyses and for development of analytical methods. The present study describes the use of spiral high-speed counter-current chromatography (HSCCC) with the recently introduced highly polar organic/high-ionic strength aqueous solvent systems to separate Pk5 and Pk7 from a sample of FD&C Yellow No. 5 containing ~3.5% Pk5 and ~0.7% Pk7. Multiple ~1.0 g portions of FD&C Yellow No. 5 (totaling 6.4 g dye) were separated, using the upper phase of the solvent system 1-BuOH/EtOHabs/saturated ammonium sulfate/water, 1.7:0.3:1:1, v/v/v/v, as the mobile phase. After applying a specially developed method for removing the ammonium sulfate from the HSCCC-collected fractions, these separations resulted in an enriched mixture (~160 mg) of Pk5 and Pk7 (~46% and ~21%, respectively). Separation of the enriched mixture, this time using the lower phase of that solvent system as the mobile phase, resulted in ~ 61 mg of Pk5 collected in fractions whose purity ranged from 88.0% to 92.7% (by HPLC at 254 nm). Pk7 (20.7 mg, ~83% purity) was recovered from the upper phase of the column content. Application of this procedure also resulted in purifying the major component of FD&C Yellow No. 5 to >99% purity. The separated compounds were characterized by high-resolution mass spectrometry and several 1H and 13C nuclear magnetic resonance spectroscopic techniques (COSY, NOESY, HSQC, and HMBC). PMID:24755184
The complete mitochondrial genome of Pomacea canaliculata (Gastropoda: Ampullariidae).
Zhou, Xuming; Chen, Yu; Zhu, Shanliang; Xu, Haigen; Liu, Yan; Chen, Lian
2016-01-01
The mitochondrial genome of Pomacea canaliculata (Gastropoda: Ampullariidae) is the first complete mtDNA sequence reported in the genus Pomacea. The total length of mtDNA is 15,707 bp, which containing 13 protein-coding genes, 2 ribosomal RNAs, 22 transfer RNAs, and a 359 bp non-coding region. The A + T content of the overall base composition of H-strand is 71.7% (T: 41%, C: 12.7%, A: 30.7%, G: 15.6%). ATP6, ATP8, CO1, CO2, ND1-3, ND5, ND6, ND4L and Cyt b genes begin with ATG as start codon, CO3 and ND4 begin with ATA. ATP8, CO2-3, ND4L, ND2-6 and Cyt b genes are terminated with TAA as stop codon, ATP6, ND1, and CO1 end with TAG. A long non-coding region is found and a 23 bp repeat unit repeat 11 times in this region.
The complete mitochondrial genome of Octopus bimaculatus Verrill, 1883 from the Gulf of California.
Domínguez-Contreras, José Francisco; Munguia-Vega, Adrian; Ceballos-Vázquez, Bertha Patricia; García-Rodriguez, Francisco Javier; Arellano-Martinez, Marcial
2016-11-01
The complete mitochondrial genome of Octopus bimaculatus is 16 085 bp in length and includes 13 protein-codes genes, 2 ribosomal RNA genes, 22 transfers RNA genes, and a control region. The composition of genome is A (40.9%), T (34.7%), C (16.9%), and G (7.5%). The control region of O. bimaculatus contains a VNTR locus not present in the genomes from other octopus species. A phylogenetic analysis shows a closer relationship between the mitogenomes from O. bimaculatus and O. vulgaris.
Darris, Maxwell
2017-01-01
ABSTRACT Most of the 24 known Chitinophaga species were originally isolated from soils. We report the draft genome sequence of a putatively novel Chitinophaga sp. from a biofilm in an air conditioner condensate pipe. The genome comprises 7,661,303 bp in one scaffold, 5,694 predicted protein-coding sequences, and a G+C content of 47.6%. PMID:29051259
The complete mitochondrial genome of the Border Collie dog.
Wu, An-Quan; Zhang, Yong-Liang; Li, Li-Li; Chen, Long; Yang, Tong-Wen
2016-01-01
Border Collie dog is one of the famous breed of dog. In the present work we report the complete mitochondrial genome sequence of Border Collie dog for the first time. The total length of the mitogenome was 16,730 bp with the base composition of 31.6% for A, 28.7% for T, 25.5% for C, and 14.2% for G and an A-T (60.3%)-rich feature was detected. It harbored 13 protein-coding genes, two ribosomal RNA genes, 22 transfer RNA genes and one non-coding control region (D-loop region). The arrangement of all genes was identical to the typical mitochondrial genomes of dogs.
1991-05-31
benchmarks ............ .... . .. .. . . .. 220 Appendix G : Source code of the Aquarius Prolog compiler ........ . 224 Chapter I Introduction "You’re given...notation, a tool that is used throughout the compiler’s implementation. Appendix F lists the source code of the C and Prolog benchmarks. Appendix G lists the...source code of the compilcr. 5 "- standard form Prolog / a-sfomadon / head umrvln Convert to tmeikernel Prol g vrans~fonaon 1symbolic execution
Ma, Yuanyuan; Zheng, Xiaodong; Cheng, Rubin; Li, Qi
2016-01-01
In this paper, we determined the complete mitochondrial genome of Octopus conispadiceus (Cephalopoda: Octopodidae). The whole mitogenome of O. conispadiceus is 16,027 basepairs (bp) in length with a base composition of 41.4% A, 34.8% T, 16.1% C, 7.7% G and contains 13 protein-coding genes, 2 ribosomal RNA genes, 22 transfer RNA genes, and a major non-coding region (MNR). The gene arrangements of O. conispadiceus showed remarkable similarity to that of O. vulgaris, Amphioctopus fangsiao, Cistopus chinensis and C. taiwanicus.
Dotres, Carlos P; Puga, Rinaldo; Ricardo, Yariset; Broño, Carmen R; Paredes, Beatriz; Echemendía, Vladimir; Rosell, Sandra; González, Nadezhda; García-Rivera, Dagmar; Valdés, Yury; Goldblatt, David; Vérez-Bencomo, Vicente
2014-09-15
A new heptavalent conjugate vaccine (PCV7-TT) is under development in Cuba. PCV7-TT contains 2 μg of serotypes 1, 5, 14, 18C, 19F, 23F and 4 μg of 6B, each one conjugated to tetanus toxoid (TT). This vaccine was designed with the serotypes that cause most invasive pneumococcal diseases (IPD) worldwide. In the present study, we investigated the safety and explored the immunogenicity of PCV7-TT during a controlled, randomized and double blind clinical trial phase I in 4-5-year-old children. PCV7-TT was well tolerated and as safe as Synflorix used as control vaccine. Following a single-dose vaccination, all individual serotypes included in PCV7-TT induced statistically significant increase of IgG GMC and OPA GMT. These are the first clinical results of PCV7-TT in children and they pave the way toward next clinical trials in children and infants. This clinical trial was published in the Cuban Public Register of Clinical Trials with code RPCEC00000173. Copyright © 2014 Elsevier Ltd. All rights reserved.
Characterization of 1:1 Random Copolymers Obtained from 6-, 7-, 11-, and 12-Carbon Amino Acids.
1993-10-22
Random Copolymers Obtained From 6-, 7-, 11-, and 12-Carbon Amino Acids by C. G. Johnson and L. J. Mathias 0 T .... Prepared for Publication r. t in the...NOOOG4-f-j- From 6-, 7-, 11-, and 12-Carbon Amino Acids 1225 ~~~ :: V Co~de 413m(iUK C. G Johnson, and Lo J. Mathias ś RFORMING ORGANIZA7,iCN ;fAMjjS...distribution is unlimited. Copolymers were prepared from the title amino acids by rr ilt condensation under dry nitrogen. The resulting copolymers were
Wan, Xuehua; Darris, Maxwell; Hou, Shaobin; Donachie, Stuart P
2017-10-19
Most of the 24 known Chitinophaga species were originally isolated from soils. We report the draft genome sequence of a putatively novel Chitinophaga sp. from a biofilm in an air conditioner condensate pipe. The genome comprises 7,661,303 bp in one scaffold, 5,694 predicted protein-coding sequences, and a G+C content of 47.6%. Copyright © 2017 Wan et al.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Xie, Enzhong; Zhu, Lingyu; Zhao, Lingyun
1996-08-01
The complete 4775-nt cDNA encoding the human serotonin 5-HT{sub 2C} receptor (5-HT{sub 2C}R), a G-protein-coupled receptor, has been isolated. It contains a 1377-nt coding region flanked by a 728-nt 5{prime}-untranslated region and a 2670-nt 3{prime}-untranslated region. By using the cloned 5-HT{sub 2C}R cDNA probe, the complete human gene for this receptor has been isolated and shown to contain six exons and five introns spanning at least 230 kb of DNA. The coding region of the human 5-HT{sub 2C}R gene is interrupted by three introns, and the positions of the intron/exon junctions are conserved between the human and the rodent genes.more » In addition, an alternatively spliced 5-HT{sub 2C}R RNA that contains a 95-nt deletion in the region coding for the second intracellular loop and the fourth transmembrane domain of the receptor has been identified. This deletion leads to a frameshift and premature termination so that the short isoform RNA encodes a putative protein of 248 amino acids. The ratio for the short isoform over the 5-HT{sub 2C}R RNA was found to be higher in choroid plexus tumor than in normal brain tissue, suggesting the possibility of differential regulation of the 5-HT{sub 2C}R gene in different neural tissues or during tumorigenesis. Transcription of the human 5-HT{sub 2C}R gene was found to be initiated at multiple sites. No classical TATA-box sequence was found at the appropriate location, and the 5{prime}-flanking sequence contains many potential transcription factor-binding sites. A 7.3-kb 5{prime}-flanking 5-HT{sub 2C}R DNA directed the efficient expression of a luciferase reported gene in SK-N-SH and IMR32 neuroblastoma cells, indicating that is contains a functional promoter. 69 refs., 8 figs., 1 tab.« less
Wang, Feng; Li, Feng; Ganguly, Manjori; Marky, Luis A.; Gold, Barry; Egli, Martin; Stone, Michael P.
2009-01-01
Site-specific insertion of 5-(3-aminopropyl)-2′-deoxyuridine (Z3dU) and 7-deaza-dG into the Dickerson-Drew dodecamers 5′-d(C1G2C3G4A5A6T7T8C9Z10C11G12)-3′ · 5′-d(C13G14C15G16A17A18T19T20-C21Z22C23G24)-3′ (named DDDZ10) and 5′-d(C1G2C3G4A5A6T7X8C9Z10C11G12)-3′ · 5′-d(C13G14C15G16A17A18-T19X20C21Z22C23G24)-3′ (named DDD2+Z10)(X = Z3dU; Z = 7-deaza-dG) suggests a mechanism underlying the formation of interstrand N+2 DNA cross-links by nitrogen mustards, e.g., melphalan and mechlorethamine. Analysis of the DDD2+Z10 duplex reveals that the tethered cations at base pairs A5 · X20 and X8 · A17 extend within the major groove in the 3′-direction, toward conserved Mg2+ binding sites located adjacent to N+2 base pairs C3 · Z22 and Z10 · C15. Bridging waters located between the tethered amines and either Z10 or Z22 O6 stabilize the tethered cations and allow interactions with the N + 2 base pairs without DNA bending. Incorporation of 7-deaza-dG into the DDD2+Z10 duplex weakens but does not eliminate electrostatic interactions between tethered amines and Z10 O6 and Z22 O6. The results suggest a mechanism by which tethered N7-dG aziridinium ions, the active species involved in formation of interstrand 5′-GNC-3′ cross-links by nitrogen mustards, modify the electrostatics of the major groove and position the aziridinium ions proximate to the major groove edge of the N+2 C · G base pair, facilitating interstrand cross-linking. PMID:18549246
7 CFR 801.12 - Design requirements incorporated by reference.
Code of Federal Regulations, 2010 CFR
2010-01-01
... reference: General Code (1.10.) G-S.5.5. Money Values, Mathematical Agreement G-T.1. Acceptance Tolerances G.... Tolerance Values T.3. For Test Weight Per Bushel Indications or Recorded Representations UR.3.2. Other... Standards and Technology's (NIST) Handbook 44, “Specifications, Tolerances, and Other Technical Requirements...
Robust Control of Multivariable and Large Scale Systems.
1986-03-14
AD-A175 $5B ROBUST CONTROL OF MULTIVRRIALE AND LARG SCALE SYSTEMS V2 R75 (U) HONEYWELL SYSTEMS AND RESEARCH CENTER MINNEAPOLIS MN J C DOYLE ET AL...ONIJQ 86 R alFS ja ,.AMIECFOEPF:ORMING ORGANIZATION So OFFICE SYMBOL 7a NAME OF MONITORING ORGANIZATI ON jonevwell Systems & Research If 4000c" Air...Force Office of Scientific Research .~ C :AE S C.rv. Stare arma ZIP Code) 7C ADDRESS (Crty. Stare. am ZIP Code, *3660 Marshall Street NE Building 410
7 CFR 1160.114 - Eligible organization.
Code of Federal Regulations, 2010 CFR
2010-01-01
... 7 Agriculture 9 2010-01-01 2009-01-01 true Eligible organization. 1160.114 Section 1160.114... Order Definitions § 1160.114 Eligible organization. Eligible organization means an organization eligible... organization pursuant to section 501(c) (3), (5), or (6) of the Internal Revenue Code (26 U.S.C. 501(c) (3), (5...
Response of Propellant Combustion to Unsteady Turbulent Flows.
1991-06-01
Proj- ect Manager was Gary L. Vogt. This report has been reviewed and is approved for release and distribution in accor- dance with the distribution...AS RPT 0" DTIC EUSERS UNCLASSIFIED 22a NAME OF RESPONSIBLE INDIVIDUAL 22b. TELEPHONE (include Area Code) 22c OFFICE SYMBOL Gary Vogt 10-7-2 RFT DO...437. 5. Beddini, R. A. "Injection-Induced Flows in Porous Walled Ducts", AIAA Journal, Vol. 24, Nov. 1986, pp. 1766-1773. 6. Flandro , G. A., "Non-linear
Thomas, T K; Ritter, T; Bruden, D; Bruce, M; Byrd, K; Goldberger, R; Dobson, J; Hickel, K; Smith, J; Hennessy, T
2016-02-01
Approximately 20% of rural Alaskan homes lack in-home piped water; residents haul water to their homes. The limited quantity of water impacts the ability to meet basic hygiene needs. We assessed rates of infections impacted by water quality (waterborne, e.g. gastrointestinal infections) and quantity (water-washed, e.g. skin and respiratory infections) in communities transitioning to in-home piped water. Residents of four communities consented to a review of medical records 3 years before and after their community received piped water. We selected health encounters with ICD-9CM codes for respiratory, skin and gastrointestinal infections. We calculated annual illness episodes for each infection category after adjusting for age. We obtained 5,477 person-years of observation from 1032 individuals. There were 9,840 illness episodes with at least one ICD-9CM code of interest; 8,155 (83%) respiratory, 1,666 (17%) skin, 241 (2%) gastrointestinal. Water use increased from an average 1.5 gallons/capita/day (g/c/d) to 25.7 g/c/d. There were significant (P-value < 0.05) declines in respiratory (16, 95% confidence interval (CI): 11-21%), skin (20, 95%CI: 10-30%), and gastrointestinal infections (38, 95%CI: 13-55%). We demonstrated significant declines in respiratory, skin and gastrointestinal infections among individuals who received in-home piped water. This study reinforces the importance of adequate quantities of water for health.
Luchansky, John B; Porto-Fett, Anna C S; Shoyer, Bradley A; Phillips, John; Chen, Vivian; Eblen, Denise R; Cook, L Victor; Mohr, Tim B; Esteban, Emilio; Bauer, Nathan
2013-09-01
Both high-fat and low-fat ground beef (percent lean:fat = ca. 70:30 and 93:7, respectively) were inoculated with a 6-strain cocktail of non-O157:H7 Shiga toxin-producing Escherichia coli (STEC) or a five-strain cocktail of E. coli O157:H7 (ca. 7.0 log CFU/g). Patties were pressed (ca. 2.54 cm thick, ca. 300 g each) and then refrigerated (4°C, 18 to 24 h), or frozen (-18°C, 3 weeks), or frozen (-18°C, 3 weeks) and then thawed (4°C for 18 h or 21°C for 10 h) before being cooked on commercial gas or electric grills to internal temperatures of 60 to 76.6°C. For E. coli O157:H7, regardless of grill type or fat level, cooking refrigerated patties to 71.1 or 76.6°C decreased E. coli O157:H7 numbers from an initial level of ca. 7.0 log CFU/g to a final level of ≤1.0 log CFU/g, whereas decreases to ca. 1.1 to 3.1 log CFU/g were observed when refrigerated patties were cooked to 60.0 or 65.5°C. For patties that were frozen or freeze-thawed and cooked to 71.1 or 76.6°C, E. coli O157:H7 numbers decreased to ca. 1.7 or ≤0.7 log CFU/g. Likewise, pathogen numbers decreased to ca. 0.7 to 3.7 log CFU/g in patties that were frozen or freeze-thawed and cooked to 60.0 or 65.5°C. For STEC, regardless of grill type or fat level, cooking refrigerated patties to 71.1 or 76.6°C decreased pathogen numbers from ca. 7.0 to ≤0.7 log CFU/g, whereas decreases to ca. 0.7 to 3.6 log CFU/g were observed when refrigerated patties were cooked to 60.0 or 65.5°C. For patties that were frozen or freeze-thawed and cooked to 71.1 or 76.6°C, STEC numbers decreased to a final level of ca. 1.5 to ≤0.7 log CFU/g. Likewise, pathogen numbers decreased from ca. 7.0 to ca. 0.8 to 4.3 log CFU/g in patties that were frozen or freeze-thawed and cooked to 60.0 or 65.5°C. Thus, cooking ground beef patties that were refrigerated, frozen, or freeze-thawed to internal temperatures of 71.1 and 76.6°C was effective for eliminating ca. 5.1 to 7.0 log CFU of E. coli O157:H7 and STEC per g.
1993-01-22
elementary con- index p must have memory m > i. We also show that a syndrome stituents of the state group -2k, called " granules ." The controller former...0. dual granules p-1 A syndrome map f: GZ -. GZ//C for a group code C may be Em, - ® H rli,i+j) constructed by setting f(g) gC for g E GZ, where the...syndrome ,=o i4Ejh-jl,& set S is the set GCZ//C of left cosets of C in G7 and the "identity" such that the value of a granule r1ij+j) depends only on
Drying effect on flavonoid composition and antioxidant activity of immature kumquat.
Lou, Shyi-Neng; Lai, Yi-Chun; Huang, Jia-De; Ho, Chi-Tang; Ferng, Lin-Huei A; Chang, Yung-Chung
2015-03-15
A seven flavonoids in hot water extract of immature kumquat (Citrus japonica var. margarita) were identified and quantified (mg/100g fresh fruit): 3',5'-di-C-β-glucopyranosylphloretin (DGPP, 285.9 ± 2.9 mg/100g), acacetin 8-C-neohesperidoside (margaritene, 136.2 ± 2.6 mg/100g), acacetin 6-C-neohesperidoside (isomargaritene, 119.1 ± 1.8 mg/100g), fortunellin (acacetin 7-O-neohesperidoside, 28.5 ± 0.7 mg/100g), apigenin 8-C-neohesperidoside (16.9 ± 0.1mg/100g), poncirin (isosakuranetin 7-O-neohesperidoside, 5.1 ± 0.1mg/100g), and rhoifolin (apigenin 7-O-neohesperidoside, 2.0 ± 0.1mg/100g). When immature kumquat was dried at 110 and 130°C for 0.5h, the antioxidant activity, total phenolic content and identified flavonoids increased. The UV absorbance of browning products of immature kumquat dried at 130°C for 1.5h increased dramatically, while the identified flavonoids decreased. Therefore, it was concluded that drying below 130°C for 1.0 h, could release phenolic compounds, which resulted in the increasing antioxidant activity. Drying at 130°C for 1.5h, it might be due to the effect of formed browning products. Copyright © 2014 Elsevier Ltd. All rights reserved.
Shen, Kang-Ning; Yen, Ta-Chi; Chen, Ching-Hung; Ye, Jeng-Jia; Hsiao, Chung-Der
2016-05-01
In this study, the complete mitogenome sequence of the cryptic "lineage B" big-fin reef squid, Sepioteuthis lessoniana (Cephalopoda: Loliginidae) has been sequenced by next-generation sequencing method. The assembled mitogenome consisting of 16,694 bp, includes 13 protein coding genes, 25 transfer RNAs, 2 ribosomal RNAs genes. The overall base composition of "lineage B" S. lessoniana is 36.7% for A, 18.9 % for C, 34.5 % for T and 9.8 % for G and show 90% identities to "lineage C" S. lessoniana. It is also exhibits high T + A content (71.2%), two non-coding regions with TA tandem repeats. The complete mitogenome of the cryptic "lineage B" S. lessoniana provides essential and important DNA molecular data for further phylogeography and evolutionary analysis for big-fin reef squid species complex.
Code of Federal Regulations, 2014 CFR
2014-10-01
... 49 Transportation 5 2014-10-01 2014-10-01 false Definitions. 398.1 Section 398.1 Transportation....1 Definitions. (a) Migrant worker. “Migrant worker” means any individual proceeding to or returning... amended (29 U.S.C. 203(f)) or section 3121(g) of the Internal Revenue Code of 1954 (26 U.S.C. 3121(g)). (b...
Ensor, Mark; Williams, Jarrod; Smith, Rebecca; Banfield, Amy; Lodder, Robert A
2014-10-01
The primary objective of this study was to evaluate the safety and the effect of D-tagatose on the glycemic control of subjects with type 2 diabetes as determined by HbA 1c levels at the end of 6 months of therapy using the subject's own baseline HbA 1c level as a comparator. The determination of the minimal dose required to cause a statistically significant reduction in HbA 1c was of particular interest. Eight weeks after screening, the qualifying subjects were randomized to receive one of three doses of D-tagatose: 2.5 g TID, 5.0 g TID or 7.5 g TID. Blood levels of HbA 1c , fasting blood glucose concentrations, plasma lipids, changes in body weight, changes in body mass index, and change in insulin levels were checked at each study visit and at the end of the study. Treatment success, as measured by the reduction of HbA 1c , was greatest for the 7.5 g D-tagatose dose group, although the difference between the treatments was not statistically significant. For fasting glucose, only the 7.5 g dosage group exhibited reductions from baseline at the 3- and 6-month time points. Mean body weights reduced in a dose-response fashion, with the 5.0 g and the 7.5 g D-tagatose doses providing the greatest reductions. D-tagatose at dosages of 2.5 g, 5.0 g, and 7.5 g TID for six months were well tolerated by this subject population. D-tagatose at 5.0 g TID was the minimal dose required to reduce HbA 1c . D-tagatose at 7.5 g TID provided the greatest effect in most measured efficacy parameters.
Ensor, Mark; Williams, Jarrod; Smith, Rebecca; Banfield, Amy; Lodder, Robert A.
2014-01-01
The primary objective of this study was to evaluate the safety and the effect of D-tagatose on the glycemic control of subjects with type 2 diabetes as determined by HbA1c levels at the end of 6 months of therapy using the subject’s own baseline HbA1c level as a comparator. The determination of the minimal dose required to cause a statistically significant reduction in HbA1c was of particular interest. Eight weeks after screening, the qualifying subjects were randomized to receive one of three doses of D-tagatose: 2.5 g TID, 5.0 g TID or 7.5 g TID. Blood levels of HbA1c, fasting blood glucose concentrations, plasma lipids, changes in body weight, changes in body mass index, and change in insulin levels were checked at each study visit and at the end of the study. Treatment success, as measured by the reduction of HbA1c, was greatest for the 7.5 g D-tagatose dose group, although the difference between the treatments was not statistically significant. For fasting glucose, only the 7.5 g dosage group exhibited reductions from baseline at the 3- and 6-month time points. Mean body weights reduced in a dose-response fashion, with the 5.0 g and the 7.5 g D-tagatose doses providing the greatest reductions. D-tagatose at dosages of 2.5 g, 5.0 g, and 7.5 g TID for six months were well tolerated by this subject population. D-tagatose at 5.0 g TID was the minimal dose required to reduce HbA1c. D-tagatose at 7.5 g TID provided the greatest effect in most measured efficacy parameters. PMID:25580449
Parallelization of PANDA discrete ordinates code using spatial decomposition
DOE Office of Scientific and Technical Information (OSTI.GOV)
Humbert, P.
2006-07-01
We present the parallel method, based on spatial domain decomposition, implemented in the 2D and 3D versions of the discrete Ordinates code PANDA. The spatial mesh is orthogonal and the spatial domain decomposition is Cartesian. For 3D problems a 3D Cartesian domain topology is created and the parallel method is based on a domain diagonal plane ordered sweep algorithm. The parallel efficiency of the method is improved by directions and octants pipelining. The implementation of the algorithm is straightforward using MPI blocking point to point communications. The efficiency of the method is illustrated by an application to the 3D-Ext C5G7more » benchmark of the OECD/NEA. (authors)« less
Burkhardt, M; Holstein, J H; Moersdorf, P; Kristen, A; Lefering, R; Pohlemann, T; Pizanis, A
2014-08-01
The Abbreviated Injury Scale (AIS) requires the estimation of the lost blood volume for some severity assignments. This study aimed to develop a rule of thumb for facilitating AIS coding by using objective clinical parameters as surrogate markers of blood loss. Using the example of pelvic ring fractures, a retrospective analysis of TraumaRegister DGU(®) data from 2002 to 2011 was performed. As potential surrogate markers of blood loss, we recorded the hemoglobin (Hb) level, systolic blood pressure (SBP), base excess (BE), Quick's value, units of packed red blood cells (PRBCs) transfused before intensive care unit (ICU) admission, and mortality within 24 h. We identified 11,574 patients with pelvic ring fractures (Tile/OTA classification: 39 % type A, 40 % type B, 21 % type C). Type C fractures were 73.1 % AISpelvis 4 and 26.9 % AISpelvis 5. Type B fractures were 47 % AISpelvis 3, 47 % AISpelvis 4, and 6 % AISpelvis 5. In type C fractures, cut-off values of <7 g/dL Hb, <90 mmHg SBP, <-9 mmol/L BE, <35 % Quick's value, >15 units PRBCs, and death within 24 h had a positive predictive value of 47 % and a sensitivity of 62 % for AISpelvis 5. In type B fractures, these cut-off values had poor sensitivity (48 %) and positive predictive value (11 %) for AISpelvis 5. We failed to develop a rule of thumb for facilitating a proper future AIS coding using the example of pelvic ring fractures. The estimation of blood loss for severity assignment still remains a noteworthy weakness in the AIS coding of traumatic injuries.
Highly Conserved Keratin-Associated Protein 7-1 Gene in Yak, Taurine and Zebu Cattle.
Arlud, S; He, N; Sari, E M; Ma, Z-J; Zhang, H; An, T-W; Han, J-L
2017-01-01
Keratin-associated proteins (KRTAPs) play a critical role in cross-linking the keratin intermediate filaments to build a hair shaft. The genetic polymorphisms of the bovine KRTAP7-1 gene were investigated for the first time in this study. The complete coding sequence of the KRTAP7-1 gene in 108 domestic yak, taurine and zebu cattle from China and Indonesia were successfully amplified using polymerase chain reaction and then directly sequenced. Only two single-nucleotide polymorphisms (one nonsynonymous at c.7C/G and another synonymous at c.21C/T) and three haplotypes (BOVIN-KRTAP7-1*A, B and C) were identified in the complete coding sequence of the bovine KRTAP7-1 gene among all animals. There was no polymorphism across three Chinese indigenous yak breeds and one Indonesian zebu cattle population, all sharing the BOVINKRTAP71*A haplotype. The four taurine cattle populations also had BOVIN-KRTAP7-1*A as the most common haplotype with a frequency of 0.80. The frequency of novel haplotype BOVIN-KRTAP7-1*B was only 0.07 present in one heterozygous animal in each of the four taurine cattle populations, while BOVINKRTAP7- 1*C was only found in a Simmental and a local Chinese Yellow cattle population with frequencies of 0.17 and 0.36, respectively. The monomorphic yak KRTAP7-1 gene in particular, and highly conserved bovine, sheep and goat KRTAP7-1 genes in general, demonstrated its unique intrinsic structural property (e.g., > 21% high glycine content) and primary functional importance in supporting the mechanical strength and shape of hair.
RELAP-7 Code Assessment Plan and Requirement Traceability Matrix
DOE Office of Scientific and Technical Information (OSTI.GOV)
Yoo, Junsoo; Choi, Yong-joon; Smith, Curtis L.
2016-10-01
The RELAP-7, a safety analysis code for nuclear reactor system, is under development at Idaho National Laboratory (INL). Overall, the code development is directed towards leveraging the advancements in computer science technology, numerical solution methods and physical models over the last decades. Recently, INL has also been putting an effort to establish the code assessment plan, which aims to ensure an improved final product quality through the RELAP-7 development process. The ultimate goal of this plan is to propose a suitable way to systematically assess the wide range of software requirements for RELAP-7, including the software design, user interface, andmore » technical requirements, etc. To this end, we first survey the literature (i.e., international/domestic reports, research articles) addressing the desirable features generally required for advanced nuclear system safety analysis codes. In addition, the V&V (verification and validation) efforts as well as the legacy issues of several recently-developed codes (e.g., RELAP5-3D, TRACE V5.0) are investigated. Lastly, this paper outlines the Requirement Traceability Matrix (RTM) for RELAP-7 which can be used to systematically evaluate and identify the code development process and its present capability.« less
[Determination of residual solvents in 7-amino-3-chloro cephalosporanic acid by gas chromatography].
Ma, Li; Yao, Tong-wei
2011-01-01
To develop a gas chromatography method for determination of residual solvents in 7-amino-3-chloro cephalosporanic acid (7-ACCA). The residual levels of acetone, methanol, dichloromethane, ethyl acetate, isobutanol, pyridine and toluene in 7-ACCA were measured by gas chromatography using Agilent INNOWAX capillary column (30 m × 0.32 mm,0.5 μm). The initial column temperature was 70° maintained for 6 min and then raised (10°C/min) to 160°C for 1 min. Nitrogen gas was used as carrier and FID as detector. The flow of carrier was 1.0 ml/min, the temperature of injection port and detector was 200°C and 250°C, respectively. The limits of detection for acetone, methanol, dichloromethane, ethyl acetate, isobutanol, pyridine, toluene in 7-ACCA were 2.5 μg/ml, 1.5 μg/ml, 15 μg/ml, 2.5 μg/ml, 2.5 μg/ml, 2.5 μg/ml and 11 μg/ml, respectively. Only acetone was detected in the sample, and was less than the limits of Ch.P. The method can effectively detect the residual solvents in 7-ACCA.
Li, Jinqian; Feng, Shengjun; Liu, Xi; Guo, Mingzhe; Chen, Mingxiao; Chen, Yiyi; Rong, Liang; Xia, Jinyu; Zhou, Yuanping; Zhong, Jin; Li, Yi-Ping
2018-05-01
Genotype 1b strain Con1 represents an important reference in the study of hepatitis C virus (HCV). Here, we aimed to develop an advanced infectious Con1 recombinant. We found that previously identified mutations A1226G/F1464L/A1672S/Q1773H permitted culture adaption of Con1 Core-NS5A (C-5A) recombinant containing 5'UTR and NS5B-3'UTR from JFH1 (genotype 2a), thus acquired additional mutations L725H/F886L/D2415G. C-5A containing all seven mutations (C-5A_7m) replicated efficiently in Huh7.5 and Huh7.5.1 cells and had an increased infectivity in SEC14L2-expressing Huh7.5.1 cells. Incorporation of Con1 NS5B was deleterious to C-5A_7m, however Con1 5'UTR was permissive but attenuated the virus. Nucleotides G1, A4, and G35 primarily accounted for the viral attenuation without affecting RNA translation. C-5A_7m was inhibited dose-dependently by simeprevir and daclatasvir, and substitutions at A4, A29, A34, and G35 conferred resistance to miR-122 antagonism. The novel Con1 5'UTR-NS5A recombinant, adaptive mutations, and critical nucleotides described here will facilitate future studies of HCV culture systems and virus-host interaction. Copyright © 2018 Elsevier Inc. All rights reserved.
Mucilaginibacter vulcanisilvae sp. nov., isolated from a volcanic forest.
Baek, Kyunghwa; Ok Jeon, Che
2015-07-01
A Gram-stain-negative, strictly aerobic, pale-pink-pigmented bacterium, designated strain G27(T), was isolated from a volcanic forest of Jeju Island, South Korea. Cells were catalase- and oxidase-positive, non-motile rods producing exopolysaccharide and flexirubin-type and pale pink pigments. Growth of strain G27(T) was observed at 4-30 °C (optimum, 25 °C) and pH 5.0-8.0 (optimum, pH 7.0). Phylogenetic analyses based on 16S rRNA gene sequences showed that strain G27(T) formed a phyletic lineage within the genus Mucilaginibacter of the family Sphingobacteriaceae. Strain G27(T) was related most closely to Mucilaginibacter gossypii Gh-67(T) at 96.5% 16S rRNA gene sequence similarity. Strain G27(T) contained menaquinone 7 (MK-7) as the sole isoprenoid quinone and summed feature 3 (comprising C16:1ω7c/C16:1ω6c), iso-C15:0, C16:0, C16:1ω5c and C16:1ω5c as the major cellular fatty acids. Phosphatidylethanolamine was identified as the major polar lipid. The G+C content of the genomic DNA was 46.5 mol%. On the basis of phenotypic, chemotaxonomic and molecular properties, strain G27(T) represents a novel species of the genus Mucilaginibacter, for which the name Mucilaginibacter vulcanisilvae sp. nov. is proposed. The type strain is G27(T) ( = KACC 18231(T) = JCM 30363(T)).
Pulse Shaping and Energy Storage Capabilities of Angularly-Multiplexed KrF Laser Fusion Drivers
2009-01-01
6&-7 9)%:5?%1706-?1 6%5&1-J.% 5?./2 (% %x9%)-’%160//C -/%’%16%2 -1 )%0/ 6-’% ?1 0 )%9:)06%2 /07%) 7C76%’" 8&% 7-’./06-? 17 7&?K 6&06 6&-7 ’./6-(%0...8217 7C76%’ 501 05&-%=% 0 &-*& L2%/-6C 9./7% 7&09-1* 5090(-/-6CG %=%1 >?) 0 &-*& *0-1 7&?5B -*1-6-?1 9./7% K&?7% L10/ 79-B% )%J.-)%7 ?.69.6 -16% 17 -6-%7...K-26&7 " 17 " <?) 6&% 5&?7%1 9./7%G K&-5& *-=%7 0 9)%2-56%2 >.7-?1 %1%)*C *0-1 "#$G 6&% 7-’./06-? 17 9)%2-56 6&% ɠ< 501 2%/-=%) 0 6?60/ ?1:60)*%6
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wang, Feng; Li, Feng; Ganguly, Manjori
2008-11-14
Site-specific insertion of t-(3-aminopropyl)-2'-deoxyuridine (Z3dU) and 7-deaza-dG into the Dickerson-Drew dodecamers 5'-d(C{sup 1}G{sup 2}C{sup 3}G{sup 4}A{sup 5}A{sup 6}T{sup 7}T{sup 8}C{sup 9}{und Z}{sup 10}C{sup 11}G{sup 12})-3'{center_dot}5'-d (C{sup 13}G{sup 14}C{sup 15}G{sup 16}A{sup 17}A{sup 18}T{sup 19}T{sup 20}C{sup 21}{und Z}{sup 22}C{sup 23}G{sup 24})-3' (named DDD{sup Z10}) and 5'-d(C{sup 1}G{sup 2}C{sup 3}G{sup 4}A{sup 5}A{sup 6}T{sup 7}{und X}{sup 20}C{sup 21}{und Z}{sup 22}C{sup 23}G{sup 24})-3' (named DDD{sup 2+Z10}) (X = 73dU; Z = 7-deaza-dG) suggests a mechanism underlying the formation of interstrand N+2 DNA cross-links by nitrogen mustards, e.g., melphalan and mechlorethamine. Analysis of the DDD{sup 2+Z10} duplex reveals that the tethered cations at base pairs A{supmore » 5}{center_dot}X{sup 20} and X{sup 8}{center_dot}A{sup 17} extend within the major groove in the 3'-direction, toward conserved Mg{sup 2+} binding sites located adjacent to N+2 base pairs C{sup 3}{center_dot}Z{sup 22} and Z{sup 10}{center_dot}C{sup 15}. Bridging waters located between the tethered amines and either Z{sup 10} or Z{sup 22} O{sup 6} stabilize the tethered cations and allow interactions with the N + 2 base pairs without DNA bending. Incorporation of 7-deaza-dG into the DDD{sup 2+Z10} duplex weakens but does not eliminate electrostatic interactions between tethered amines and Z{sup 10} O{sup 6} and Z{sup 22} O{sup 6}. The results suggest a mechanism by which tethered N7-dG aziridinium ions, the active species involved in formation of interstrand 5'-GNC-3' cross-links by nitrogen mustards, modify the electrostatics of the major groove and position the aziridinium ions proximate to the major groove edge of the N+2 C{center_dot}G base pair, facilitating interstrand cross-linking.« less
Complete mitochondrial genome sequence of northeastern sika deer (Cervus nippon hortulorum).
Shao, Yuanchen; Zha, Daiming; Xing, Xiumei; Su, Weilin; Liu, Huamiao; Zhang, Ranran
2016-01-01
The complete mitochondrial genome of the northeastern sika deer, Cervus nippon hortulorum, was determined by accurate polymerase chain reaction. The entire genome is 16,434 bp in length and contains 13 protein-coding genes, 2 rRNA genes, 22 tRNA genes and 1 control region, all of which are arranged in a typical vertebrate manner. The overall base composition of the northeastern sika deer's mitochondrial genome is 33.3% of A, 24.5% of C, 28.7% of T and 13.5% of G. A termination associated sequence and several conserved central sequence block domains were discovered within the control region.
1983-03-01
PARK MATERIALS RESEARCH LA.. L E CROSS ET AL. MAR 83 N00014-78-C-0291 F/G Pill! I 1.0 ü1- I 2.5 I.I 12.2 - li. 112.0 1.8 125 Ulli 1.4...DTIC L.E. Cross R.E. Newnham S-5- £arsch ÄELECTE J.V. Bi^gers ^k SEP 7 1983 s TABLE OF CONTENTS INTRODUCTION 1 SECTION I 2 1.0 STUDIES...Niobate. 85 87 89 91 93 & i • A • D ity Codes and/or Bial - -. • - 1 • ’ ’• i i i —m^^^mv IV APPENDIX 26 Dielectric Properties of
The complete mitochondrial genome of Chinese green hydra, Hydra sinensis (Hydroida: Hydridae).
Pan, Hong-Chun; Qian, Xiao-Cheng; Li, Ping; Li, Xiao-Fei; Wang, An-Tai
2014-02-01
The complete mitochondrial genome of Chinese green hydra, Hydra sinensis (Hydroida: Hydridae) is a linear molecule of 16,189 bp in length, containing 13 protein-coding genes, small and large subunit ribosomal RNAs, methionine and tryptophan transfer RNAs, a pseudogene consisting of a partial copy of COI and terminal sequences at two ends of the linear mitochondrial DNA. The A + T content of the overall base composition of H-strand is 77.2% (T: 41.7%; C: 10.9%; A: 35.5%; and G: 11.9%). COI and ND1 genes begin with GTG as start codon, while other 11 protein-coding genes start with a typical ATG initiation codon. COII, ATP8, ATP6, COIII, ND5, ND6, ND3, ND1, ND4 and COI genes are terminated with TAA as stop codon, ND4L ends with TAG, ND2 ends with TA and Cyt b ends with T.
A study of tungsten spectra using large helical device and compact electron beam ion trap in NIFS
NASA Astrophysics Data System (ADS)
Morita, S.; Dong, C. F.; Goto, M.; Kato, D.; Murakami, I.; Sakaue, H. A.; Hasuo, M.; Koike, F.; Nakamura, N.; Oishi, T.; Sasaki, A.; Wang, E. H.
2013-07-01
Tungsten spectra have been observed from Large Helical Device (LHD) and Compact electron Beam Ion Trap (CoBIT) in wavelength ranges of visible to EUV. The EUV spectra with unresolved transition array (UTA), e.g., 6g-4f, 5g-4f, 5f-4d and 5p-4d transitions for W+24-+33, measured from LHD plasmas are compared with those measured from CoBIT with monoenergetic electron beam (≤2keV). The tungsten spectra from LHD are well analyzed based on the knowledge from CoBIT tungsten spectra. The C-R model code has been developed to explain the UTA spectra in details. Radial profiles of EUV spectra from highly ionized tungsten ions have been measured and analyzed by impurity transport simulation code with ADPAK atomic database code to examine the ionization balance determined by ionization and recombination rate coefficients. As the first trial, analysis of the tungsten density in LHD plasmas is attempted from radial profile of Zn-like WXLV (W44+) 4p-4s transition at 60.9Å based on the emission rate coefficient calculated with HULLAC code. As a result, a total tungsten ion density of 3.5×1010cm-3 at the plasma center is reasonably obtained. In order to observe the spectra from tungsten ions in lower-ionized charge stages, which can give useful information on the tungsten influx in fusion plasmas, the ablation cloud of the impurity pellet is directly measured with visible spectroscopy. A lot of spectra from neutral and singly ionized tungsten are observed and some of them are identified. A magnetic forbidden line from highly ionized tungsten ions has been examined and Cd-like WXXVII (W26+) at 3893.7Å is identified as the ground-term fine-structure transition of 4f23H5-3H4. The possibility of α particle diagnostic in D-T burning plasmas using the magnetic forbidden line is discussed.
1983-07-08
A(xPCQNWL SEARCI THE. LINE FILE rbN,5, C’ 129 lIE,’ CM-I FOR LINES OF *,A&’,/,5X, III 2-- - ’IS C CFE =’,14,/95xs 131 T’e;NO =,IX .5,’ - ,x5/5, 1 32...15407wE’C8 131 -7e.3(5 221.141 .11Z230"J7 .1462zGE*1e 132 487.34C 22?.w53 .10S47C1-,7 .1.84E01.18 133 %9( Zfl375 22 -,E su 11M -0 7 klu 136 523.410 22M...144 589.530 23C.441 SME0043E-08 .2294301.07 145 59?.fi1C 23r.420 GsC?jlnF- .;cc.2iFtc7 146 604.490 iO35 .5345431-08 E271?53E*C7 14? R1lf LAIC t. 131
Identification of new mutations in primary hyperoxaluria type 1 (PH1).
von Schnakenburg, C; Rumsby, G
1998-01-01
Primary hyperoxaluria type 1 (PH1) is caused by deficiency of the hepatic peroxisomal enzyme alanine:glyoxylate aminotransferase (AGT). The AGXT gene, which codes for the 392 amino acid protein, has been mapped to chromosome 2q37.3. In order to identify new mutations in the AGXT gene we studied 79 PH1 patients using single strand conformation polymorphism analysis. In addition to a cluster of new mutations in exon 7 we report five novel mutations in exons 2, 4, 5, 9 and 10. These are T444C, G640A, G690A, 1008-1010delGCG and G1171A. These five new mutations contribute to our knowledge of the AGXT gene. Their possible consequences for PH1 phenotype and enzyme activity are discussed.
Code of Federal Regulations, 2013 CFR
2013-01-01
... and the other pertaining to on-flight markets. For example, the routing (A-B-C-D) consists of three..., Singapore A-3—Airport code Origin A-4—Airport code Destination A-5—Service class (mark an X) F G L P Q By aircraft type— B-1—Aircraft type code B-2—Revenue aircraft departures B-3—Revenue passengers transported B...
Code of Federal Regulations, 2012 CFR
2012-01-01
... and the other pertaining to on-flight markets. For example, the routing (A-B-C-D) consists of three..., Singapore A-3—Airport code Origin A-4—Airport code Destination A-5—Service class (mark an X) F G L P Q By aircraft type— B-1—Aircraft type code B-2—Revenue aircraft departures B-3—Revenue passengers transported B...
Code of Federal Regulations, 2014 CFR
2014-01-01
... and the other pertaining to on-flight markets. For example, the routing (A-B-C-D) consists of three..., Singapore A-3—Airport code Origin A-4—Airport code Destination A-5—Service class (mark an X) F G L P Q By aircraft type— B-1—Aircraft type code B-2—Revenue aircraft departures B-3—Revenue passengers transported B...
HLA-G coding region polymorphism is skewed in autistic spectrum disorders.
Guerini, Franca R; Bolognesi, Elisabetta; Chiappedi, Matteo; Ripamonti, Enrico; Ghezzo, Alessandro; Zanette, Michela; Sotgiu, Stefano; Mensi, Maria Martina; Carta, Alessandra; Canevini, Maria Paola; Zanzottera, Milena; Agliardi, Cristina; Costa, Andrea S; Balottin, Umberto; Clerici, Mario
2018-01-01
Different isoforms of HLA-G protein are endowed with a differential ability to induce allogenic tolerance during pregnancy. As prenatal immune activation is suggested to play a role in the onset of autistic spectrum disorders (ASD), we evaluated HLA G*01:01-*01:06 allelic polymorphism in a cohort of Italian children affected by ASD (N=111) their mothers (N=81), and their healthy siblings (N=39). DNA sequencing analysis of HLA-G exon 2, 3 and 4 was used to obtain HLA-G allelic frequencies; alleles distribution was compared with that of two control groups of Caucasoid couples of multiparous women and their partners from Brazil and Denmark. HLA-G distribution was significantly different in ASD children compared to both control groups (Brazilian p c =1×10 -4 ; Danish p c =1×10 -3 ). Since HLA-G distribution was similar in the two control groups, their data were pooled. Results indicated that HLA-G*01:01 was significantly less frequent (p c =1×10 -4 ; OR:0.5, 95%CI: 0.3-0.7) whereas HLA-G*01:05N was significantly more frequent (p c =2×10 -3 ; OR:7.3, 95%CI: 2.4-26.6) in ASD children compared to combined controls. Finally, no clear pattern emerged when HLA-G allelic distribution was analyzed in healthy sibs. Notably, HLA-G allelic distribution found in ASD mothers was similar to that observed in the control subgroup of women with recurrent miscarriages, whilst it was significantly different compared to women without miscarriages (p c =6×10 -4 df=12). Since HLA-G*01:01 is associated with the elicitation of KIR-mediated tolerogenic responses and HLA-G*01:05N correlates with NK cells activation, results herein indicate that an immune activating milieu during pregnancy is more likely observed in association with the development of ASD, similarly to what occurs in women with recurrent miscarriages. Copyright © 2017 Elsevier Inc. All rights reserved.
A novel mutation in SCN9A in a child with congenital insensitivity to pain.
Shorer, Zamir; Wajsbrot, Einav; Liran, Tamir-Hostovsky; Levy, Jacov; Parvari, Ruti
2014-01-01
[corrected] Congenital insensitivity to pain (CIP) is a rare condition in which patients have no pain perception and anosmia but are otherwise essentially normal (OMIM 243000). The recent discovery of the genetic defects underlying 3 monogenic pain disorders has provided additional and important insights about some components of human pain. Genetic studies in families demonstrating recessively inherited channelopathy-associated insensitivity to pain have identified nonsense mutations that result in truncation of the voltage-gated sodium channel type IX subunit (SCN9A), a 113.5-kb gene comprising coding 26 exons. Here we describe a patient with CIP with a new mutation in SCN9A not described yet. All exons were sequenced. All 26 coding exons were sequenced and two changes were identified in homozygosity in exon 10: c.1126 A > C causing K376Q and c.1124delG causing p.G375Afs* frame shift. We report a novel, loss-of-function mutation in homozygosity that causes congenital insensitivity to pain and provide a comprehensive clinical description of the patient. This contributes to the clinical and neurophysiological characteristic of the sodium channel Nav1.7 channelopathy and expand our genetic knowledge which might provide more accurate and comprehensive clinical electrophysiological and genetic information. Copyright © 2014 Elsevier Inc. All rights reserved.
1994-03-01
N~~~W 314’ tun ~~ 0 -z -CI RO 9.40. goo I..~rr-0 0N E . z- 0- E. -! t eq 14 R IN~ 0 00 5- h. C, ZWD u L LI 7 I-, ’ Iq CUZZ , UE -U~bU 2 UiI 8 ,a 4 -D...U8 0 U I-~ U UU. U" U cy-ý a I0 .00~o 4. 90 9 0 0’, 1 wO"Q a,~O0 -. h-- 221 * In~ 0u tunN vu) tun -w 0%0% -w%%~c In In.I SRu C, 20 8~98 0 -’C rmjw...0zI oo :9 _l go co AZ u 0~’.A~-( ~ 2(A (C U 0g -0 00 20 En~ýfR RR R R RE .E 0 b4(~ -u u- A u u u U 000Q -0 ýR Z2 0 L~ Es TZ 2 T! :g -’ t3 S tun >4 m
Mechanisms of Polymer Curing and Thermal Degradation
1979-12-01
respectively. 29 0)- Fi . J . IR S e t u f i ( - 3 E hy y p e o y Ph n l S f n .30 z Iii 41 rI2P6i4000 3500 3000 42500 §200010 6010 2010 0 0 0 0...Polymer X Obs.6(_pm) Obs.(ppmA H 7.9,8.0 g,h 7.8 g,h 7.5 I ,e 7.5 i ,c,2 7.3 b,e 6.0-7.2 b,d,f,j,=CH 7.2 d 7.0 f,j 3.1 a HC C =- T O" 7.9 g 7.9 g 7.3 b...e 7.4 b,e 7.1 d 6.0-7.1 c,d,f,=CH 7.0 f,c 3.1 a 3.1 a aFor X 0 H, ggh, f= i b Based on first-order analysis of multiplets. 37 t TABLE 4. SUMMARY OF 13C
6-Oxocytidine a novel protonated C-base analogue for stable triple helix formation.
Berressem, R; Engels, J W
1995-01-01
2'-O-Methyl-3'-O-phosphoramidite building blocks of 6-oxocytidine 6 and its 5-methyl derivative 7, respectively, were synthesized and incorporated via phosphoramidite chemistry in 15 mer oligodeoxynucleotides [d(T72T7), S2; d(T73T7), S3] to obtain potential Py.Pu.Py triplex forming homopyrimidine strands. UV thermal denaturation studies and CD spectroscopy of 1:1 mixtures of these oligomers and a 21 mer target duplex [d(C3A7GA7C3)-d(G3T7CT7G3), D1] with a complementary purine tract showed a nearly pH-independent (6.0-8.0) triple helix formation with melting temperatures of 21-19 degrees C and 18.5-17.5 degrees C, respectively (buffer system: 50 mM sodium cacodylate, 100 mM NaCl, 20 mM MgCl2). In contrast, with the corresponding 15mer deoxy-C-containing oligonucleotide [d(T(7)1T7), S1] triplex formation was observed only below pH 6.6. Specificity for the recognition of Watson-Crick GC-base pairs was observed by pairing the modified C-bases of the 15mers with all other possible Watson-Crick-base compositions in the target duplex [d(C3A7XA7C3)-d(G3T7YT7G3), X = A,C,T; Y = T,G,A, D2-4]. Additionally, the Watson-Crick-pairing of the modified oligomers S2 and S3 was studied. PMID:7567457
6-Oxocytidine a novel protonated C-base analogue for stable triple helix formation.
Berressem, R; Engels, J W
1995-09-11
2'-O-Methyl-3'-O-phosphoramidite building blocks of 6-oxocytidine 6 and its 5-methyl derivative 7, respectively, were synthesized and incorporated via phosphoramidite chemistry in 15 mer oligodeoxynucleotides [d(T72T7), S2; d(T73T7), S3] to obtain potential Py.Pu.Py triplex forming homopyrimidine strands. UV thermal denaturation studies and CD spectroscopy of 1:1 mixtures of these oligomers and a 21 mer target duplex [d(C3A7GA7C3)-d(G3T7CT7G3), D1] with a complementary purine tract showed a nearly pH-independent (6.0-8.0) triple helix formation with melting temperatures of 21-19 degrees C and 18.5-17.5 degrees C, respectively (buffer system: 50 mM sodium cacodylate, 100 mM NaCl, 20 mM MgCl2). In contrast, with the corresponding 15mer deoxy-C-containing oligonucleotide [d(T(7)1T7), S1] triplex formation was observed only below pH 6.6. Specificity for the recognition of Watson-Crick GC-base pairs was observed by pairing the modified C-bases of the 15mers with all other possible Watson-Crick-base compositions in the target duplex [d(C3A7XA7C3)-d(G3T7YT7G3), X = A,C,T; Y = T,G,A, D2-4]. Additionally, the Watson-Crick-pairing of the modified oligomers S2 and S3 was studied.
Molecular Biology of STLV-III and HTLV-IV
1990-08-22
8217 AT( ACCA CTCAT.(3CA 5 Ci.T G,- .... ; . , P P, ( L D O S H s v H I -U" G r L "S " V " " , 3 E E 7 ’ T - ’ ’ ’ TJ - " t f? I f T G A- C-. C .T ’ CA8C P...R S N T V K N S D’ . Y S T m 2: G ! Y ’) V V G v I L L R 7 V T Y I’ ,9 M 3: i E F M C f7 E e I V C? iT C? e S . (N*’ 1 . Flist 5At(3CTAGC’’TAATGrAG
Babbar, Anshu; Itzek, Andreas; Pieper, Dietmar H; Nitsche-Schmitz, D Patric
2018-03-12
Streptococcus dysgalactiae subsp. equisimilis (SDSE), belonging to the group C and G streptococci, are human pathogens reported to cause clinical manifestations similar to infections caused by Streptococcus pyogenes. To scrutinize the distribution of gene coding for S. pyogenes virulence factors in SDSE, 255 isolates were collected from humans infected with SDSE in Vellore, a region in southern India, with high incidence of SDSE infections. Initial evaluation indicated SDSE isolates comprising of 82.35% group G and 17.64% group C. A multiplex PCR system was used to detect 21 gene encoding virulence-associated factors of S. pyogenes, like superantigens, DNases, proteinases, and other immune modulatory toxins. As validated by DNA sequencing of the PCR products, sequences homologous to speC, speG, speH, speI, speL, ssa and smeZ of the family of superantigen coding genes and for DNases like sdaD and sdc were detected in the SDSE collection. Furthermore, there was high abundance (48.12% in group G and 86.6% in group C SDSE) of scpA, the gene coding for C5a peptidase in these isolates. Higher abundance of S. pyogenes virulence factor genes was observed in SDSE of Lancefield group C as compared to group G, even though the incidence rates in former were lower. This study not only substantiates detection of S. pyogenes virulence factor genes in whole genome sequenced SDSE but also makes significant contribution towards the understanding of SDSE and its increasing virulence potential.
Chandramohan, Bathrachalam; Renieri, Carlo; La Manna, Vincenzo; La Terza, Antonietta
2015-01-01
The objectives of the present study were to characterize the MC1R gene, its transcripts and the single nucleotide polymorphisms (SNPs) associated with coat color in alpaca. Full length cDNA amplification revealed the presence of two transcripts, named as F1 and F2, differing only in the length of their 5'-terminal untranslated region (UTR) sequences and presenting a color specific expression. Whereas the F1 transcript was common to white and colored (black and brown) alpaca phenotypes, the shorter F2 transcript was specific to white alpaca. Further sequencing of the MC1R gene in white and colored alpaca identified a total of twelve SNPs; among those nine (four silent mutations (c.126C>A, c.354T>C, c.618G>A, and c.933G>A); five missense mutations (c.82A>G, c.92C>T, c.259A>G, c.376A>G, and c.901C>T)) were observed in coding region and three in the 3'UTR. A 4 bp deletion (c.224 227del) was also identified in the coding region. Molecular segregation analysis uncovered that the combinatory mutations in the MC1R locus could cause eumelanin and pheomelanin synthesis in alpaca. Overall, our data refine what is known about the MC1R gene and provides additional information on its role in alpaca pigmentation.
MILSCAP: Military Standard Contract Administration Procedures. Change 1
1994-06-15
AD-A284 618 DEFENSE LOGISTICS AGENCY 0DoD4000.25-5-K HEADQUARTERSDO40.25- CAMERON STATION ALEXANDRIA, VIRGINIA 22304-6100 DLMSO CHANGE NO. 1 15 Jun...effective upon receipt. II. Incorporated in change 1 are AMCL 1 , recent changes to the Transportation Priority Codes (appendix A29), updates to...A52- 1 xvii to xix xvii to xix Cl-i to C1-3 Cl-i to Cl-3 1 -7 to 1 -10 1 -7 to 1 -10 C19- 1 and C19-2 C19- 1 and C19-2 5-3 and 5-4 5-3 and 5-4 C24- 1 to C24-3
Qian, Yaping; Johnson, Judith A; Connor, Jessica A; Valencia, C Alexander; Barasa, Nathaniel; Schubert, Jeffery; Husami, Ammar; Kissell, Diane; Zhang, Ge; Weirauch, Matthew T; Filipovich, Alexandra H; Zhang, Kejian
2014-06-01
The mutations in UNC13D are responsible for familial hemophagocytic lymphohistiocytosis (FHL) type 3. A 253-kb inversion and two deep intronic mutations, c.118-308C > T and c.118-307G > A, in UNC13D were recently reported in European and Asian FHL3 patients. We sought to determine the prevalence of these three non-coding mutations in North American FHL patients and evaluate the significance of examining these new mutations in genetic testing. We performed DNA sequencing of UNC13D and targeted analysis of these three mutations in 1,709 North American patients with a suspected clinical diagnosis of hemophagocytic lymphohistiocytosis (HLH). The 253-kb inversion, intronic mutations c.118-308C > T and c.118-307G > A were found in 11, 15, and 4 patients, respectively, in which the genetic basis (bi-allelic mutations) explained 25 additional patients. Taken together with previously diagnosed FHL3 patients in our HLH patient registry, these three non-coding mutations were found in 31.6% (25/79) of the FHL3 patients. The 253-kb inversion, c.118-308C > T and c.118-307G > A accounted for 7.0%, 8.9%, and 1.3% of mutant alleles, respectively. Significantly, eight novel mutations in UNC13D are being reported in this study. To further evaluate the expression level of the newly reported intronic mutation c.118-307G > A, reverse transcription PCR and Western blot analysis revealed a significant reduction of both RNA and protein levels suggesting that the c.118-307G > A mutation affects transcription. These specified non-coding mutations were found in a significant number of North American patients and inclusion of them in mutation analysis will improve the molecular diagnosis of FHL3. © 2014 Wiley Periodicals, Inc.
Molecular genetic analysis of patients with sporadic and X-linked infantile nystagmus
Zhao, Hui; Huang, Xiu-Feng; Zheng, Zhi-Li; Deng, Wen-Li; Lei, Xin-Lan; Xing, Dong-Jun; Ye, Liang; Xu, Su-Zhong; Chen, Jie; Zhang, Fang; Yu, Xin-Ping; Jin, Zi-Bing
2016-01-01
Objectives Infantile nystagmus (IN) is a genetically heterogeneous condition characterised by involuntary rhythmic oscillations of the eyes accompanied by different degrees of vision impairment. Two genes have been identified as mainly causing IN: FRMD7 and GPR143. The aim of our study was to identify the genetic basis of both sporadic IN and X-linked IN. Design Prospective analysis. Patients Twenty Chinese patients, including 15 sporadic IN cases and 5 from X-linked IN families, were recruited and underwent molecular genetic analysis. We first performed PCR-based DNA sequencing of the entire coding region and the splice junctions of the FRMD7 and GPR143 genes in participants. Mutational analysis and co-segregation confirmation were then performed. Setting All clinical examinations and genetic experiments were performed in the Eye Hospital of Wenzhou Medical University. Results Two mutations in the FRMD7 gene, including one novel nonsense mutation (c.1090C>T, p.Q364X) and one reported missense mutation (c.781C>G, p.R261G), were identified in two of the five (40%) X-linked IN families. However, none of putative mutations were identified in FRMD7 or GPR143 in any of the sporadic cases. Conclusions The results suggest that mutations in FRMD7 appeared to be the major genetic cause of X-linked IN, but not of sporadic IN. Our findings provide further insights into FRMD7 mutations, which could be helpful for future genetic diagnosis and genetic counselling of Chinese patients with nystagmus. PMID:27036142
Genetic variations of VDR/NR1I1 encoding vitamin D receptor in a Japanese population.
Ukaji, Maho; Saito, Yoshiro; Fukushima-Uesaka, Hiromi; Maekawa, Keiko; Katori, Noriko; Kaniwa, Nahoko; Yoshida, Teruhiko; Nokihara, Hiroshi; Sekine, Ikuo; Kunitoh, Hideo; Ohe, Yuichiro; Yamamoto, Noboru; Tamura, Tomohide; Saijo, Nagahiro; Sawada, Jun-ichi
2007-12-01
The vitamin D receptor (VDR) is a transcriptional factor responsive to 1alpha,25-dihydroxyvitamin D(3) and lithocholic acid, and induces expression of drug metabolizing enzymes CYP3A4, CYP2B6 and CYP2C9. In this study, the promoter regions, 14 exons (including 6 exon 1's) and their flanking introns of VDR were comprehensively screened for genetic variations in 107 Japanese subjects. Sixty-one genetic variations including 25 novel ones were found: 9 in the 5'-flanking region, 2 in the 5'-untranslated region (UTR), 7 in the coding exons (5 synonymous and 2 nonsynonymous variations), 12 in the 3'-UTR, 19 in the introns between the exon 1's, and 12 in introns 2 to 8. Of these, one novel nonsynonymous variation, 154A>G (Met52Val), was detected with an allele frequency of 0.005. The single nucleotide polymorphisms (SNPs) that increase VDR expression or activity, -29649G>A, 2T>C and 1592((*)308)C>A tagging linked variations in the 3'-UTR, were detected at 0.430, 0.636, and 0.318 allele frequencies, respectively. Another SNP, -26930A>G, with reduced VDR transcription was found at a 0.028 frequency. These findings would be useful for association studies on VDR variations in Japanese.
Adaptive Backoff Synchronization Techniques
1989-07-01
The Simple Code. Technical Report, Lawrence Livermore Laboratory, February 1978. [6] F. Darems-Rogers, D. A. George, V. A. Norton, and G . F. Pfister...Heights, November 1986. 20 [7] Daniel Gajski , David Kuck, Duncan Lawrie, and Ahmed Saleh. Cedar - A Large Scale Multiprocessor. In International...17] Janak H. Patel. Analysis of Multiprocessors with Private Cache Memories. IEEE Transactions on Com- puters, C-31(4):296-304, April 1982. [18] G
7 CFR 29.1181 - Summary of standard grades.
Code of Federal Regulations, 2011 CFR
2011-01-01
... Agriculture Regulations of the Department of Agriculture AGRICULTURAL MARKETING SERVICE (Standards, Inspections, Marketing Practices), DEPARTMENT OF AGRICULTURE COMMODITY STANDARDS AND STANDARD CONTAINER... B6KV 7 Mixed Grades M4F M4KR M4KM M4GK M5F M5KM M5GK 15 Grades of Green B4G B4GK C4G C4GK X4G X4GK P4G...
7 CFR 29.1181 - Summary of standard grades.
Code of Federal Regulations, 2010 CFR
2010-01-01
... Agriculture Regulations of the Department of Agriculture AGRICULTURAL MARKETING SERVICE (Standards, Inspections, Marketing Practices), DEPARTMENT OF AGRICULTURE COMMODITY STANDARDS AND STANDARD CONTAINER... B6KV 7 Mixed Grades M4F M4KR M4KM M4GK M5F M5KM M5GK 15 Grades of Green B4G B4GK C4G C4GK X4G X4GK P4G...
NASA Astrophysics Data System (ADS)
Bečka, Michal; Vilková, Mária; Šoral, Michal; Potočňák, Ivan; Breza, Martin; Béres, Tibor; Imrich, Ján
2018-02-01
Acridine thiosemicarbazones 3a-g, obtained through a two-step reaction between aromatic isothiocyanates and hydrazine followed by the treatment with acridin-9-carbaldehyde, in reaction with bifunctional reagents; methyl bromoacetate (MBA) and diethyl acetylenedicarboxylate (DEAD) afforded acridin-thiazolidinone derivatives 4a-g and 7a-f and not their regioisomers 6a-g and 9a-f. Derivatives 4a-g and 7a-f exhibit ZC2N6EN7C8 configuration. Upon standing in DMSO-d6 the thiazolidinones 4a-g and 7a-f spontaneously isomerized into ZC2N6ZN7C8 isomers 5a-g and 8a-f to give a mixture of the both stereoisomers. All compounds were fully characterized by multinuclear NMR, mass spectrometry (MS) and X-ray crystal structure of 4b is also described. X-ray diffraction study revealed that the representative compound 4b crystallized in the monoclinic crystal system with the C2/c space group and Z = 4. Intramolecular C1‧sbnd H1‧⋯N-7 hydrogen bond between the acridine proton H-1‧ and nitrogen N-7 of linker existed. This hydrogen bond is responsible for the E isomerism on C-8 atom which was observed in the NMR experiments. Quantum-chemical calculations and NOESY experiments confirmed ZC2N6ZN7C8 configuration of the transformed stereoisomers 5a-g and 8a-f.
Huang, Dong-Ai; Wang, Xiao-Ying; Wang, Zheng; Zhou, Dai-Feng; Cai, Wang-Wei
2007-04-01
To molecularly analyze in Han and Li individuals of glucose-6-phosphate dehydrogenase deficiency in Hainan, China. The amplification refractory mutation system (ARMS) was employed to detect G1376T, G1388A and A95G mutations. The coding regions and flanking intronic regions from the second to the thirteenth exons of G6PD gene was analyzed by DNA sequencing to characterize the gene mutations in samples without G1376T, G1388A and A95G mutations. Among 29 Han cases of G6PD deficiency, 11 had G1376T (37.9%), 2 G1388A (6.9%), 1 G1376T and G1388A (3.4%) and 1 G1376T and A95G (3.4%) were identified. Mutations of G1376T, G1388A, A95G and their complex accounted for 51.7% of G6PD deficiency in the Han individuals. Among 42 Li cases of G6PD deficiency, 25 had G1376T (59.5%), 6 G1388A (14.3%), 2 A95G (4.8%), 4 G1376T and G1388A (9.5%), 1 G1376T and A95G (2.4% )were identified. These mutations accounted for 90.5% of the Li individuals. Gene mutation of 18 cases (14 Han and 4 Li individuals) remained unknown. Sequencing results of the 18 samples indicated that one case had a single base of T deletion at nucleotide 636 or 637 in the 5th intron (IVS-5 636 or 637 T del) and two cases had C1311T with IVS-11 T93C mutation. G6PD G1376T and G1388A are the most common mutations in the populations of the Han and Li nationalities in Hainan. The IVS-5 636 or 637 T del mutation is first reported in Chinese, and the complex mutation of G1376T/A95G is first found in the Li nationality.
DeWitt, D L; Smith, W L
1988-01-01
Prostaglandin G/H synthase (8,11,14-icosatrienoate, hydrogen-donor:oxygen oxidoreductase, EC 1.14.99.1) catalyzes the first step in the formation of prostaglandins and thromboxanes, the conversion of arachidonic acid to prostaglandin endoperoxides G and H. This enzyme is the site of action of nonsteroidal anti-inflammatory drugs. We have isolated a 2.7-kilobase complementary DNA (cDNA) encompassing the entire coding region of prostaglandin G/H synthase from sheep vesicular glands. This cDNA, cloned from a lambda gt 10 library prepared from poly(A)+ RNA of vesicular glands, hybridizes with a single 2.75-kilobase mRNA species. The cDNA clone was selected using oligonucleotide probes modeled from amino acid sequences of tryptic peptides prepared from the purified enzyme. The full-length cDNA encodes a protein of 600 amino acids, including a signal sequence of 24 amino acids. Identification of the cDNA as coding for prostaglandin G/H synthase is based on comparison of amino acid sequences of seven peptides comprising 103 amino acids with the amino acid sequence deduced from the nucleotide sequence of the cDNA. The molecular weight of the unglycosylated enzyme lacking the signal peptide is 65,621. The synthase is a glycoprotein, and there are three potential sites for N-glycosylation, two of them in the amino-terminal half of the molecule. The serine reported to be acetylated by aspirin is at position 530, near the carboxyl terminus. There is no significant similarity between the sequence of the synthase and that of any other protein in amino acid or nucleotide sequence libraries, and a heme binding site(s) is not apparent from the amino acid sequence. The availability of a full-length cDNA clone coding for prostaglandin G/H synthase should facilitate studies of the regulation of expression of this enzyme and the structural features important for catalysis and for interaction with anti-inflammatory drugs. Images PMID:3125548
Complete Genome Sequence of Thiostrepton-Producing Streptomyces laurentii ATCC 31255
Fujino, Yasuhiro; Nagayoshi, Yuko; Ohshima, Toshihisa; Ogata, Seiya
2016-01-01
Streptomyces laurentii ATCC 31255 produces thiostrepton, a thiopeptide class antibiotic. Here, we report the complete genome sequence for this strain, which contains a total of 8,032,664 bp, 7,452 predicted coding sequences, and a G+C content of 72.3%. PMID:27257211
Sikorav, J L; Duval, N; Anselmet, A; Bon, S; Krejci, E; Legay, C; Osterlund, M; Reimund, B; Massoulié, J
1988-01-01
In this paper, we show the existence of alternative splicing in the 3' region of the coding sequence of Torpedo acetylcholinesterase (AChE). We describe two cDNA structures which both diverge from the previously described coding sequence of the catalytic subunit of asymmetric (A) forms (Schumacher et al., 1986; Sikorav et al., 1987). They both contain a coding sequence followed by a non-coding sequence and a poly(A) stretch. Both of these structures were shown to exist in poly(A)+ RNAs, by S1 mapping experiments. The divergent region encoded by the first sequence corresponds to the precursor of the globular dimeric form (G2a), since it contains the expected C-terminal amino acids, Ala-Cys. These amino acids are followed by a 29 amino acid extension which contains a hydrophobic segment and must be replaced by a glycolipid in the mature protein. Analyses of intact G2a AChE showed that the common domain of the protein contains intersubunit disulphide bonds. The divergent region of the second type of cDNA consists of an adjacent genomic sequence, which is removed as an intron in A and Ga mRNAs, but may encode a distinct, less abundant catalytic subunit. The structures of the cDNA clones indicate that they are derived from minor mRNAs, shorter than the three major transcripts which have been described previously (14.5, 10.5 and 5.5 kb). Oligonucleotide probes specific for the asymmetric and globular terminal regions hybridize with the three major transcripts, indicating that their size is determined by 3'-untranslated regions which are not related to the differential splicing leading to A and Ga forms. Images PMID:3181125
1988-04-01
Ditribufion is unlimited. 4 PERFORMING ORGANIZATION REPORT NUMBER(S) 5. MONITORING ORGANIZATION REPORT NUMBER(S) 88-0825 6a NAME OF PERFORMING ORGANIZATION 6b...OFFICE SYMBOL 7a. NAME OF MONITORING ORGANIZATION ACS C/EDC (If applicable) 6c. ADDRESS (City, State, and ZIP Code) 7b. ADDRESS (City, State, and...ZIP Code) MAXWELL AFB AL 36112-5542 8a. NAME OF FUNDING/SPONSORING 8b. OFFICE SYMBOL 9. PROCUREMENT INSTRUMENT IDENTIFICATION NUMBER ORGANIZATION (If
Interdisciplinary Research in Viscoelasticity and Rheology
1989-09-01
I’tijc -. ease ~ NREORT NUN. SRIS) 5 MONITORING ORCANIZAIO IORT fulf( 4 , AD-A213 630 _ _ __ _ _ _ _ _ _ _ _ _ %-z-CR~MI NORG ANIZATION oo OF iCE...13 6. SUPO!EMENTARY NOTATION -7 L COSATi CODES IS. SUBJECT TERMS (Continue on reverse if necessary and identify by black riumoer) . ABSTR-AC-T...34ON E JCI-SSIDNUMTED C SAME AS RPT D TIC USERS 4 2a 4AM.E !)F aQE-PONSI8LE NOIVODUAL 22b. 7ELEPH-ONE (include Area Code) 22c.Qe iCE SYMBOL ~r je
Lee, Su-Jun; van der Heiden, Ilse P; Goldstein, Joyce A; van Schaik, Ron HN
2012-01-01
A new CYP3A5 variant, CYP3A5*11, was found in a single white European by DNA sequencing. The CYP3A5*11 allele contains a single nucleotide polymorphism (SNP) (g.3775 A>G) in exon 2 which results in a Tyr53Cys substitution and a g.6986A>G splice change, the latter SNP previously reported in the defective CYP3A5*3 allele. However, the CYP3A5*3 is not a null allele because this variant is associated with leaky splicing, resulting in small amounts of functional protein still being produced. We therefore constructed a cDNA coding for the newly identified CYP3A5.11 protein by site-directed mutagenesis, expressed it in Escherichia coli and partially purified it. While bacteria transformed with wild-type CYP3A5*1 cDNA expressed predominantly cytochrome P450, those transfected with CYP3A5*11 expressed a significant amount of denatured cytochrome P420 in addition to cytochrome P450, suggesting the protein to be unstable. CYP3A5.11 exhibited a 38% decrease in the Vmax for nifedipine metabolism, a 2.7-fold increase in the Km, and a 4.4-fold decrease in the CLint of nifedipine compared with CYP3A5.1. A polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) genotyping procedure was developed, and used to genotyping DNA of 500 white individuals for CYP3A5*11. No additional examples of this allele were identified. In summary, individuals carrying the rare CYP3A5*11 allele are predicted to have lower metabolism of CYP3A5 substrates than individuals expressing CYP3A5*3. PMID:17035598
Technology Evaluation for Treatment/Disposal of TNT Red Water
1990-04-01
U.S. Army Toxic and Hazardous Materials Agency Aberdeen Proving Ground , MD 21010-5423 __ E=4N DISTRIBUTION UNLIMITED I I TECHNOLOGY EVALUATION FOR...ABERDEEN PROVING GROUND , MARYLAND 21010-5423 April 1990 I I SECURITY CLASSIFICATION OF T-HI5 PA iiREPORT DOCUMENTATION PAGE W 7"f 4 I. REPORT SECURITY...and ZIP Code) 7b, ADDRESS (City, State, and ZIP Code) ATTN: CETHA-TE-D Aberdeen Proving Ground , MD 21010-5401 BaG. NAME OF FUNDING /SPONSORING 8b
Xu, Zhe; Brodbelt, Jennifer S.
2013-01-01
Liquid chromatography-electrospray ionization-infrared multiphoton dissociation (IRMPD) mass spectrometry was developed to investigate the distributions of intrastrand crosslinks formed between cisplatin and two oligodeoxynucleotides (ODNs), d(A1T2G3G4G5T6A7C8C9C10A11T12) (G3-D) and its analog d(A1T2G3G4G5T6T7C8C9C10A11T12) (G3-H), that have been reported to adopt different secondary structures in solution. Based on the formation of site-specific fragment ions upon IRMPD, two isobaric crosslink products were differentiated for each ODN. The preferential formation of G3G4 and G4G5 crosslinks was determined as a function of reaction conditions, including incubation temperature and presence of metal ions. G3-D consistently exhibited a greater preference for formation of the G4G5 crosslink compared to the G3-H ODN. The ratio of G3G4:G4G5 crosslinks increased for both G3-D and G3-H at higher incubation temperatures or when metal salts were added. Comparison of the IRMPD fragmentation patterns of the unmodified ODNs and the intramolecular platinated crosslinks indicated that backbone cleavage was significantly suppressed near the crosslink. PMID:24135806
Renieri, Carlo; La Terza, Antonietta
2015-01-01
The objectives of the present study were to characterize the MC1R gene, its transcripts and the single nucleotide polymorphisms (SNPs) associated with coat color in alpaca. Full length cDNA amplification revealed the presence of two transcripts, named as F1 and F2, differing only in the length of their 5′-terminal untranslated region (UTR) sequences and presenting a color specific expression. Whereas the F1 transcript was common to white and colored (black and brown) alpaca phenotypes, the shorter F2 transcript was specific to white alpaca. Further sequencing of the MC1R gene in white and colored alpaca identified a total of twelve SNPs; among those nine (four silent mutations (c.126C>A, c.354T>C, c.618G>A, and c.933G>A); five missense mutations (c.82A>G, c.92C>T, c.259A>G, c.376A>G, and c.901C>T)) were observed in coding region and three in the 3′UTR. A 4 bp deletion (c.224 227del) was also identified in the coding region. Molecular segregation analysis uncovered that the combinatory mutations in the MC1R locus could cause eumelanin and pheomelanin synthesis in alpaca. Overall, our data refine what is known about the MC1R gene and provides additional information on its role in alpaca pigmentation. PMID:25685836
NASA Astrophysics Data System (ADS)
Draper, Martin; Usera, Gabriel
2015-04-01
The Scale Dependent Dynamic Model (SDDM) has been widely validated in large-eddy simulations using pseudo-spectral codes [1][2][3]. The scale dependency, particularly the potential law, has been proved also in a priori studies [4][5]. To the authors' knowledge there have been only few attempts to use the SDDM in finite difference (FD) and finite volume (FV) codes [6][7], finding some improvements with the dynamic procedures (scale independent or scale dependent approach), but not showing the behavior of the scale-dependence parameter when using the SDDM. The aim of the present paper is to evaluate the SDDM in the open source code caffa3d.MBRi, an updated version of the code presented in [8]. caffa3d.MBRi is a FV code, second-order accurate, parallelized with MPI, in which the domain is divided in unstructured blocks of structured grids. To accomplish this, 2 cases are considered: flow between flat plates and flow over a rough surface with the presence of a model wind turbine, taking for this case the experimental data presented in [9]. In both cases the standard Smagorinsky Model (SM), the Scale Independent Dynamic Model (SIDM) and the SDDM are tested. As presented in [6][7] slight improvements are obtained with the SDDM. Nevertheless, the behavior of the scale-dependence parameter supports the generalization of the dynamic procedure proposed in the SDDM, particularly taking into account that no explicit filter is used (the implicit filter is unknown). [1] F. Porté-Agel, C. Meneveau, M.B. Parlange. "A scale-dependent dynamic model for large-eddy simulation: application to a neutral atmospheric boundary layer". Journal of Fluid Mechanics, 2000, 415, 261-284. [2] E. Bou-Zeid, C. Meneveau, M. Parlante. "A scale-dependent Lagrangian dynamic model for large eddy simulation of complex turbulent flows". Physics of Fluids, 2005, 17, 025105 (18p). [3] R. Stoll, F. Porté-Agel. "Dynamic subgrid-scale models for momentum and scalar fluxes in large-eddy simulations of neutrally stratified atmospheric boundary layers over heterogeneous terrain". Water Resources Research, 2006, 42, WO1409 (18 p). [4] J. Keissl, M. Parlange, C. Meneveau. "Field experimental study of dynamic Smagorinsky models in the atmospheric surface layer". Journal of the Atmospheric Science, 2004, 61, 2296-2307. [5] E. Bou-Zeid, N. Vercauteren, M.B. Parlange, C. Meneveau. "Scale dependence of subgrid-scale model coefficients: An a priori study". Physics of Fluids, 2008, 20, 115106. [6] G. Kirkil, J. Mirocha, E. Bou-Zeid, F.K. Chow, B. Kosovic, "Implementation and evaluation of dynamic subfilter - scale stress models for large - eddy simulation using WRF". Monthly Weather Review, 2012, 140, 266-284. [7] S. Radhakrishnan, U. Piomelli. "Large-eddy simulation of oscillating boundary layers: model comparison and validation". Journal of Geophysical Research, 2008, 113, C02022. [8] G. Usera, A. Vernet, J.A. Ferré. "A parallel block-structured finite volume method for flows in complex geometry with sliding interfaces". Flow, Turbulence and Combustion, 2008, 81, 471-495. [9] Y-T. Wu, F. Porté-Agel. "Large-eddy simulation of wind-turbine wakes: evaluation of turbine parametrisations". BoundaryLayerMeteorology, 2011, 138, 345-366.
A study of tungsten spectra using large helical device and compact electron beam ion trap in NIFS
DOE Office of Scientific and Technical Information (OSTI.GOV)
Morita, S.; Goto, M.; Murakami, I.
2013-07-11
Tungsten spectra have been observed from Large Helical Device (LHD) and Compact electron Beam Ion Trap (CoBIT) in wavelength ranges of visible to EUV. The EUV spectra with unresolved transition array (UTA), e.g., 6g-4f, 5g-4f, 5f-4d and 5p-4d transitions for W{sup +24-+33}, measured from LHD plasmas are compared with those measured from CoBIT with monoenergetic electron beam ({<=}2keV). The tungsten spectra from LHD are well analyzed based on the knowledge from CoBIT tungsten spectra. The C-R model code has been developed to explain the UTA spectra in details. Radial profiles of EUV spectra from highly ionized tungsten ions have beenmore » measured and analyzed by impurity transport simulation code with ADPAK atomic database code to examine the ionization balance determined by ionization and recombination rate coefficients. As the first trial, analysis of the tungsten density in LHD plasmas is attempted from radial profile of Zn-like WXLV (W{sup 44+}) 4p-4s transition at 60.9A based on the emission rate coefficient calculated with HULLAC code. As a result, a total tungsten ion density of 3.5 Multiplication-Sign 10{sup 10}cm{sup -3} at the plasma center is reasonably obtained. In order to observe the spectra from tungsten ions in lower-ionized charge stages, which can give useful information on the tungsten influx in fusion plasmas, the ablation cloud of the impurity pellet is directly measured with visible spectroscopy. A lot of spectra from neutral and singly ionized tungsten are observed and some of them are identified. A magnetic forbidden line from highly ionized tungsten ions has been examined and Cd-like WXXVII (W{sup 26+}) at 3893.7A is identified as the ground-term fine-structure transition of 4f{sup 23}H{sub 5}-{sup 3}H{sub 4}. The possibility of {alpha} particle diagnostic in D-T burning plasmas using the magnetic forbidden line is discussed.« less
Quantifying Uncertainty in Expert Judgment: Initial Results
2013-03-01
lines of source code were added in . ---------- C++ = 32%; JavaScript = 29%; XML = 15%; C = 7%; CSS = 7%; Java = 5%; Oth- er = 5% LOC = 927,266...much total effort in person years has been spent on this project? CMU/SEI-2013-TR-001 | 33 5 MySQL , the most popular Open Source SQL...as MySQL , Oracle, PostgreSQL, MS SQL Server, ODBC, or Interbase. Features include email reminders, iCal/vCal import/export, re- mote subscriptions
Draft Genome Sequence of Sphingobium sp. Strain HDIPO4, an Avid Degrader of Hexachlorocyclohexane
Mukherjee, Udita; Kumar, Roshan; Mahato, Nitish Kumar; Khurana, J. P.
2013-01-01
Sphingobium sp. strain HDIPO4 was isolated from a hexachlorocyclohexane (HCH) dumpsite and degraded HCH isomers rapidly. The draft genome sequence of HDIPO4 (~4.7 Mbp) contains 143 contigs and 4,646 coding sequences with a G+C content of 65%. PMID:24051321
A Prototype Climate Information System
1991-06-01
estimates of cloud amount. J. Geophys. Res., 89, 5370-5380. Stowe, L. L., C. G. Wellemeyer, T. F. Eck , H. Y. M. Yeh, and the Nimbus-7 Cloud Data...Technical Information Center 2 Cameron Station Alexandria, VA 22304-6145 Library, Code 0142 2 Naval Postgraduate School Monterey, CA 93943-5002 Professor
Adaptive Backoff Synchronization Techniques
1989-06-01
The Simple Code. Technical Report, Lawrence Livermore Laboratory, February 1978. [6J F. Darems-Rogers, D. A. George, V. A. Norton, and G . F. Pfister...Heights, November 1986. 20 [7] Daniel Gajski , David Kuck, Duncan Lawrie, and Ahmed Saleh. Cedar - A Large Scale Multiprocessor. In International Conference...17] Janak H. Patel. Analysis of Multiprocessors with Private Cache Memories. IEEE Transactions on Com- puters, C-31(4):296-304, April 1982. [18] G
Yoon, Kwang Bae; Kim, Ji Young; Park, Yung Chul
2016-05-01
We describe the characteristics of complete mitogenome of C. brachyotis in this article. The complete mitogenome of C. brachyotis is 16,701 bp long with a total base composition of 32.4% A, 25.7% T, 27.7% C and 14.2% G. The mitogenome consists of 13 protein-coding genes (11,408 bp), (KM659865) two rRNA (12S rRNA and 16S rRNA) genes (2,539 bp), 22 tRNA genes (1518 bp) and one control region (1239 bp).
45 CFR Appendix A to Part 13 - Appendix A to Part 13
Code of Federal Regulations, 2011 CFR
2011-10-01
...-3(h)(2)(B)(ii); 1395l(q)(2)(B)(i); 1395m(a)(11)(A), (c)(4)(C); 1395w-2(b)(2)(A); 1395w-4(g)(1), (g)(3)(B), (g)(4)(B)(ii); 1395nn(g)(5); 1395ss(a)(2), (p)(8), (p)(9)(C), (q)(5)(C), (r)(6)(A), (s)(3...-7a(c)(2); 1320b-10(c); 1395i-3(b)(3)(B)(ii), (g)(2)(A)(i); 1395l (h)(5)(D), (i)(6); 1395m(a)(11)(A...
Leong, Wan Mei; Geier, Renae; Engstrom, Sarah; Ingham, Steve; Ingham, Barbara; Smukowski, Marianne
2014-08-01
Potentially hazardous foods require time/temperature control for safety. According to the U.S. Food and Drug Administration Food Code, most cheeses are potentially hazardous foods based on pH and water activity, and a product assessment is required to evaluate safety of storage >6 h at 21°C. We tested the ability of 67 market cheeses to support growth of Listeria monocytogenes (LM), Salmonella spp. (SALM), Escherichia coli O157:H7 (EC), and Staphylococcus aureus (SA) over 15 days at 25°C. Hard (Asiago and Cheddar), semi-hard (Colby and Havarti), and soft cheeses (mozzarella and Mexican-style), and reduced-sodium or reduced-fat types were tested. Single-pathogen cocktails were prepared and individually inoculated onto cheese slices (∼10(5) CFU/g). Cocktails were 10 strains of L. monocytogenes, 6 of Salmonella spp., or 5 of E. coli O157:H7 or S. aureus. Inoculated slices were vacuum packaged and stored at 25°C for ≤ 15 days, with surviving inocula enumerated every 3 days. Percent salt-in-the-moisture phase, percent titratable acidity, pH, water activity, and levels of indigenous/starter bacteria were measured. Pathogens did not grow on 53 cheeses, while 14 cheeses supported growth of SA, 6 of SALM, 4 of LM, and 3 of EC. Of the cheeses supporting pathogen growth, all supported growth of SA, ranging from 0.57 to 3.08 log CFU/g (average 1.70 log CFU/g). Growth of SALM, LM, and EC ranged from 1.01 to 3.02 log CFU/g (average 2.05 log CFU/g), 0.60 to 2.68 log CFU/g (average 1.60 log CFU/g), and 0.41 to 2.90 log CFU/g (average 1.69 log CFU/g), respectively. Pathogen growth varied within cheese types or lots. Pathogen growth was influenced by pH and percent salt-in-the-moisture phase, and these two factors were used to establish growth/no-growth boundary conditions for safe, extended storage (≤25°C) of pasteurized milk cheeses. Pathogen growth/no-growth could not be predicted for Swiss-style cheeses, mold-ripened or bacterial surface-ripened cheeses, and cheeses made with nonbovine milk, as insufficient data were gathered. This challenge study data can support science-based decision making in a regulatory framework.
... Administrative Forms Standard Forms Skip Navigation Z7_0Q0619C0JGR010IFST1G5B10H1 Web Content Viewer (JSR 286) Actions ${title} Loading... / Topics / ... and Thermometers / Kitchen Thermometers / Kitchen Thermometers Z7_0Q0619C0JGR010IFST1G5B10H3 Web Content Viewer (JSR 286) Actions ${title} Loading... Z7_ ...
NASA Astrophysics Data System (ADS)
Piret, Jean-Pascal; Vankoningsloo, Sébastien; Noël, Florence; Mejia Mendoza, Jorge; Lucas, Stéphane; Saout, Christelle; Toussaint, Olivier
2011-07-01
Poor information are currently available about the biological effects of multi-walled carbon nanotubes (MWCNT) on the liver. In this study, we evaluated the effects of MWCNT at the transcriptional level on the classical in vitro model of HepG2 hepatocarcinoma cells. The expression levels of 96 transcript species implicated in the inflammatory and immune responses was studied after a 24h incubation of HepG2 cells in presence of raw MWCNT dispersed in water by stirring. Among the 46 transcript species detected, only a few transcripts including mRNA coding for interleukine-7, chemokines receptor of the C-C families CCR7, as well as Endothelin-1, were statistically more abundant after treatment with MWCNT. Altogether, these data indicate that MWCNT can only induce a weak inflammatory response in HepG2 cells.
Esteves, Aida; Parreira, Ricardo; Piedade, João; Venenno, Teresa; Franco, Margarida; Germano de Sousa, José; Patrício, Luis; Brum, Paula; Costa, António; Canas-Ferreira, Wanda F
2003-06-01
We have evaluated the genetic diversity of HIV-1 strains infecting injecting drug users (IDUs) in Lisbon, Portugal. Heteroduplex mobility assay and/or phylogenetic analysis revealed that env (C2V3C3 or gp41) subtype B is present in 63.7% of the 135 viral samples studied, followed by subtypes G (23.7%), A (6.7%), F (5.2%), and D (0.7%). Similar analysis of gag (p24/p7) performed on 91 of the specimens demonstrated that 49.5% of the infections were caused by subtype G viruses; other gag subtypes identified were B (39.5%), F (3.3%), A and D (1.1.% each), and the recombinant circulating form CRF02_AG (5.5%). Discordant env/gag sub-types were detected in 34.1% of the strains and may reflect the presence of dual infections and/or recombinant viruses. The presumptive B/G recombinant form was highly predominant (21 of 31). The genetic pattern of HIV-1 subtype B and G strains is suggestive of multiple introductions and recombination episodes and of a longstanding presence of both subtypes in the country. C2V3C3 amino acid sequences from IDU-derived subtype G viruses presented highly significant signatures, which distinguish the variants from this transmission group. The unusually high prevalence of subtype G sequences (34.1%), independent of the geographic origin of the infected individuals, makes this IDU HIV-1 epidemic unique.
Novel mutations of MYO7A and USH1G in Israeli Arab families with Usher syndrome type 1.
Rizel, Leah; Safieh, Christine; Shalev, Stavit A; Mezer, Eedy; Jabaly-Habib, Haneen; Ben-Neriah, Ziva; Chervinsky, Elena; Briscoe, Daniel; Ben-Yosef, Tamar
2011-01-01
This study investigated the genetic basis for Usher syndrome type 1 (USH1) in four consanguineous Israeli Arab families. Haplotype analysis for all known USH1 loci was performed in each family. In families for which haplotype analysis was inconclusive, we performed genome-wide homozygosity mapping using a single nucleotide polymorphism (SNP) array. For mutation analysis, specific primers were used to PCR amplify the coding exons of the MYO7A, USH1C, and USH1G genes including intron-exon boundaries. Mutation screening was performed with direct sequencing. A combination of haplotype analysis and genome-wide homozygosity mapping indicated linkage to the USH1B locus in two families, USH1C in one family and USH1G in another family. Sequence analysis of the relevant genes (MYO7A, USH1C, and USH1G) led to the identification of pathogenic mutations in all families. Two of the identified mutations are novel (c.1135-1147dup in MYO7A and c.206-207insC in USH1G). USH1 is a genetically heterogenous condition. Of the five USH1 genes identified to date, USH1C and USH1G are the rarest contributors to USH1 etiology worldwide. It is therefore interesting that two of the four Israeli Arab families reported here have mutations in these two genes. This finding further demonstrates the unique genetic structure of the Israeli population in general, and the Israeli Arab population in particular, which due to high rates of consanguinity segregates many rare autosomal recessive genetic conditions.
Empirical evidence for site coefficients in building code provisions
Borcherdt, R.D.
2002-01-01
Site-response coefficients, Fa and Fv, used in U.S. building code provisions are based on empirical data for motions up to 0.1 g. For larger motions they are based on theoretical and laboratory results. The Northridge earthquake of 17 January 1994 provided a significant new set of empirical data up to 0.5 g. These data together with recent site characterizations based on shear-wave velocity measurements provide empirical estimates of the site coefficients at base accelerations up to 0.5 g for Site Classes C and D. These empirical estimates of Fa and Fnu; as well as their decrease with increasing base acceleration level are consistent at the 95 percent confidence level with those in present building code provisions, with the exception of estimates for Fa at levels of 0.1 and 0.2 g, which are less than the lower confidence bound by amounts up to 13 percent. The site-coefficient estimates are consistent at the 95 percent confidence level with those of several other investigators for base accelerations greater than 0.3 g. These consistencies and present code procedures indicate that changes in the site coefficients are not warranted. Empirical results for base accelerations greater than 0.2 g confirm the need for both a short- and a mid- or long-period site coefficient to characterize site response for purposes of estimating site-specific design spectra.
Yang, Huiqin; Li, Shiqiang; Xiao, Xueshan; Guo, Xiangming; Zhang, Qingjiong
2012-08-01
To screen mutations in the norrin (NDP) gene in 44 unrelated Chinese patients with familial exudative vitreoretinopathy (FEVR, 38 cases) or Norrie disease (6 cases) and to describe the associated phenotypes. Of the 44 patients, mutation in FZD4, LRP5, and TSPAN12 was excluded in 38 patients with FEVR in previous study. Sanger sequencing was used to analyze the 2 coding exons and their adjacent regions of NDP in the 44 patients. Clinical data were presented for patients with mutation. NDP variants in 5 of the 6 patients with Norrie disease were identified, including a novel missense mutation (c.164G>A, p.Cys55Phe) in one patient, two known missense mutations (c.122G>A, p.Arg41Lys; c.220C>T, p.Arg74Cys) in two patients, and a gross deletion encompassing the two coding exons in two patients. Of the 5 patients, 3 had a family history and 2 were singleton cases. No mutation in NDP was detected in the 38 patients with FEVR. NDP mutations are common cause of Norrie disease but might be rare cause for FEVR in Chinese.
Rhoden, D L; Hancock, G A; Miller, J M
1993-03-01
A numerical-code system for the reference identification of Staphylococcus species, Stomatococcus mucilaginosus, and Micrococcus species was established by using a selected panel of conventional biochemicals. Results from 824 cultures (289 eye isolate cultures, 147 reference strains, and 388 known control strains) were used to generate a list of 354 identification code numbers. Each six-digit code number was based on results from 18 conventional biochemical reactions. Seven milliliters of purple agar base with 1% sterile carbohydrate solution added was poured into 60-mm-diameter agar plates. All biochemical tests were inoculated with 1 drop of a heavy broth suspension, incubated at 35 degrees C, and read daily for 3 days. All reactions were read and interpreted by the method of Kloos et al. (G. A. Hebert, C. G. Crowder, G. A. Hancock, W. R. Jarvis, and C. Thornsberry, J. Clin. Microbiol. 26:1939-1949, 1988; W. E. Kloos and D. W. Lambe, Jr., P. 222-237, in A. Balows, W. J. Hansler, Jr., K. L. Herrmann, H. D. Isenberg, and H. J. Shadomy, ed., Manual of Clinical Microbiology, 5th ed., 1991). This modified reference identification method was 96 to 98% accurate and could have value in reference and public health laboratory settings.
1981-09-21
acknowledge and thank A. R. Hislop and D. L. Saul, Code 9262, for their work on tbh mixer design and D. L. Chappelle and K. S. Maynard, Code 8124, for...MTT-28, p 555-563, June 1980 . 33 (a) Mixer matrix, 7 boards, 6-5 mixers, 1-7 mixers. (b) LO power split to boards, 7-way. rN’ o, Ro (c) N-way power...1966. 9. Saleh, A.A.M., Planar Electrically Symmetric N-Way Hybrid Power Dividers/ Combiners, IEEE T-MTT-28, p 555-563, June 1980 . 55
... Administrative Forms Standard Forms Skip Navigation Z7_0Q0619C0JGR010IFST1G5B10H1 Web Content Viewer (JSR 286) Actions ${title} Loading... / Topics / ... Food Safety / Refrigeration and Food Safety Z7_0Q0619C0JGR010IFST1G5B10H3 Web Content Viewer (JSR 286) Actions ${title} Loading... Z7_ ...
Bovine Spongiform Encephalopathy: Production and Inspection
... Administrative Forms Standard Forms Skip Navigation Z7_0Q0619C0JGR010IFST1G5B10H1 Web Content Viewer (JSR 286) Actions ${title} Loading... / Topics / ... FSIS Further Strengthens Protections Against BSE Z7_0Q0619C0JGR010IFST1G5B10H3 Web Content Viewer (JSR 286) Actions ${title} Loading... Z7_ ...
Food Safety Tips for College Students
... Administrative Forms Standard Forms Skip Navigation Z7_0Q0619C0JGR010IFST1G5B10H1 Web Content Viewer (JSR 286) Actions ${title} Loading... / Topics / ... Food Safety Tips for College Students Z7_0Q0619C0JGR010IFST1G5B10H3 Web Content Viewer (JSR 286) Actions ${title} Loading... Z7_ ...
... Administrative Forms Standard Forms Skip Navigation Z7_0Q0619C0JGR010IFST1G5B10H1 Web Content Viewer (JSR 286) Actions ${title} Loading... / Topics / ... Food Safety / Fires and Food Safety Z7_0Q0619C0JGR010IFST1G5B10H3 Web Content Viewer (JSR 286) Actions ${title} Loading... Z7_ ...
Safe Minimum Internal Temperature Chart
... Administrative Forms Standard Forms Skip Navigation Z7_0Q0619C0JGR010IFST1G5B10H1 Web Content Viewer (JSR 286) Actions ${title} Loading... / Topics / ... Chart / Safe Minimum Internal Temperature Chart Z7_0Q0619C0JGR010IFST1G5B10H3 Web Content Viewer (JSR 286) Actions ${title} Loading... Z7_ ...
Parasites and Foodborne Illness
... Administrative Forms Standard Forms Skip Navigation Z7_0Q0619C0JGR010IFST1G5B10H1 Web Content Viewer (JSR 286) Actions ${title} Loading... / Topics / ... and Disease / Parasites and Foodborne Illness Z7_0Q0619C0JGR010IFST1G5B10H3 Web Content Viewer (JSR 286) Actions ${title} Loading... Z7_ ...
... Administrative Forms Standard Forms Skip Navigation Z7_0Q0619C0JGR010IFST1G5B10H1 Web Content Viewer (JSR 286) Actions ${title} Loading... / Topics / ... Food Safety / Freezing and Food Safety Z7_0Q0619C0JGR010IFST1G5B10H3 Web Content Viewer (JSR 286) Actions ${title} Loading... Z7_ ...
GPS, BDS and Galileo ionospheric correction models: An evaluation in range delay and position domain
NASA Astrophysics Data System (ADS)
Wang, Ningbo; Li, Zishen; Li, Min; Yuan, Yunbin; Huo, Xingliang
2018-05-01
The performance of GPS Klobuchar (GPSKlob), BDS Klobuchar (BDSKlob) and NeQuick Galileo (NeQuickG) ionospheric correction models are evaluated in the range delay and position domains over China. The post-processed Klobuchar-style (CODKlob) coefficients provided by the Center for Orbit Determination in Europe (CODE) and our own fitted NeQuick coefficients (NeQuickC) are also included for comparison. In the range delay domain, BDS total electrons contents (TEC) derived from 20 international GNSS Monitoring and Assessment System (iGMAS) stations and GPS TEC obtained from 35 Crust Movement Observation Network of China (CMONC) stations are used as references. Compared to BDS TEC during the short period (doy 010-020, 2015), GPSKlob, BDSKlob and NeQuickG can correct 58.4, 66.7 and 54.7% of the ionospheric delay. Compared to GPS TEC for the long period (doy 001-180, 2015), the three ionospheric models can mitigate the ionospheric delay by 64.8, 65.4 and 68.1%, respectively. For the two comparison cases, CODKlob shows the worst performance, which only reduces 57.9% of the ionospheric range errors. NeQuickC exhibits the best performance, which outperforms GPSKlob, BDSKlob and NeQuickG by 6.7, 2.1 and 6.9%, respectively. In the position domain, single-frequency stand point positioning (SPP) was conducted at the selected 35 CMONC sites using GPS C/A pseudorange with and without ionospheric corrections. The vertical position error of the uncorrected case drops significantly from 10.3 m to 4.8, 4.6, 4.4 and 4.2 m for GPSKlob, CODKlob, BDSKlob and NeQuickG, however, the horizontal position error (3.2) merely decreases to 3.1, 2.7, 2.4 and 2.3 m, respectively. NeQuickG outperforms GPSKlob and BDSKlob by 5.8 and 1.9% in vertical component, and by 25.0 and 3.2% in horizontal component.
The Design and Implementation of a Translator for Arithmetic and Boolean Expressions.
1980-01-01
fault toleranc- P-or imTarop-r token.- or incorrect tok- n or(I-r. F C icD - MUS" hc-IV CnP 2J n,-)2ri 9 Iot t rq 3C003 G~T. 3OD 0L 3COC~ 5G F. 30005 ... 30005 .GE. ph 50015 60. C 30006 .LE. DP 50016 61. C RELPNT-INTEGER, POINTER TO ENTRIES IN RELOPS ARRAYY 62. C TEMP -INTEGER, USED FOR DETERMINING IF...30002, 50012, 30003, 50013, 30004, 50014, 30005 , 50015, 71. 1 30006, 50016/, SUB/50006/, THEN/142408/ 72. C 73. C ******** EXECUTABLE CODE******** 74
Seligmann, Hervé
2015-09-01
During RNA transcription, DNA nucleotides A,C,G, T are usually matched by ribonucleotides A, C, G and U. However occasionally, this rule does not apply: transcript-DNA homologies are detectable only assuming systematic exchanges between ribonucleotides. Nine symmetric (X ↔ Y, e.g. A ↔ C) and fourteen asymmetric (X ↔ Y ↔ Z, e.g. A ↔ C ↔ G) exchanges exist, called swinger transcriptions. Putatively, polymerases occasionally stabilize in unspecified swinger conformations, possibly similar to transient conformations causing punctual misinsertions. This predicts chimeric transcripts, part regular, part swinger-transformed, reflecting polymerases switching to swinger polymerization conformation(s). Four chimeric Genbank transcripts (three from human mitochondrion and one murine cytosolic) are described here: (a) the 5' and 3' extremities reflect regular polymerization, the intervening sequence exchanges systematically between ribonucleotides (swinger rule G ↔ U, transcript (1), with sharp switches between regular and swinger sequences; (b) the 5' half is 'normal', the 3' half systematically exchanges ribonucleotides (swinger rule C ↔ G, transcript (2), with an intercalated sequence lacking homology; (c) the 3' extremity fits A ↔ G exchanges (10% of transcript length), the 5' half follows regular transcription; the intervening region seems a mix of regular and A ↔ G transcriptions (transcript 3); (d) murine cytosolic transcript 4 switches to A ↔ U + C ↔ G, and is fused with A ↔ U + C ↔ G swinger transformed precursor rRNA. In (c), each concomitant transcript 5' and 3' extremities match opposite genome strands. Transcripts 3 and 4 combine transcript fusions with partial swinger transcriptions. Occasional (usually sharp) switches between regular and swinger transcriptions reveal greater coding potential than detected until now, suggest stable polymerase swinger conformations. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.
NASA Astrophysics Data System (ADS)
Yuan, Jian-guo; Zhou, Guang-xiang; Gao, Wen-chun; Wang, Yong; Lin, Jin-zhao; Pang, Yu
2016-01-01
According to the requirements of the increasing development for optical transmission systems, a novel construction method of quasi-cyclic low-density parity-check (QC-LDPC) codes based on the subgroup of the finite field multiplicative group is proposed. Furthermore, this construction method can effectively avoid the girth-4 phenomena and has the advantages such as simpler construction, easier implementation, lower encoding/decoding complexity, better girth properties and more flexible adjustment for the code length and code rate. The simulation results show that the error correction performance of the QC-LDPC(3 780,3 540) code with the code rate of 93.7% constructed by this proposed method is excellent, its net coding gain is respectively 0.3 dB, 0.55 dB, 1.4 dB and 1.98 dB higher than those of the QC-LDPC(5 334,4 962) code constructed by the method based on the inverse element characteristics in the finite field multiplicative group, the SCG-LDPC(3 969,3 720) code constructed by the systematically constructed Gallager (SCG) random construction method, the LDPC(32 640,30 592) code in ITU-T G.975.1 and the classic RS(255,239) code which is widely used in optical transmission systems in ITU-T G.975 at the bit error rate ( BER) of 10-7. Therefore, the constructed QC-LDPC(3 780,3 540) code is more suitable for optical transmission systems.
40 CFR 59.511 - What notifications and reports must I submit?
Code of Federal Regulations, 2010 CFR
2010-07-01
... records are maintained for each site, if different; (5) A description of date coding systems, clearly... in Table 2A, 2B, or 2C of this subpart; (9) For each product category, VOC formulation data for each... required. The formulation data must include the weight fraction (g compound/g product) for each VOC...
Study of Background Radiance in Upper Atmosphere.
1980-01-01
hN2),NE=1,% FANc ) jSET=N A C CC 84C J=19,SET NFC=LEC ( J) N 1M0 C(N E C IQ 000, 0 CC 60E N2=19!At 700 FCRMA(I14A.18HEtNC NC.,I?!’ 7PLA Ce 6 ?PTVrqC M,.X...CHTAB DATA TABLE FOR CHAR GEN ADD A I OFFSET=CODE*02 JNC ADOFF INX H ADOFF EQU I ADD L " A CONTAINS OFFSET JNC G SFG I OHL POINTS INTO CHTAB INR H GTSEG
Niagara Falls IAP NY. Revised Uniform Summary of Surface Weather Observations. Parts A-F.
1987-10-01
14 Date of Report: Oct 1987 15 .tpas Comet: 312 16 Supplementary Notation: 17 COSATI Codes: Field --04, Group--02 18 Subject Term: *climatology...2.’ .3 .6 .3 .2 .0 .3 331. I ~ .3 2.0 7.! .6 .6. 04. 131 1U1 . . Z.9 2.? . .0 1.2 10.3 T(16 I !. 21.3 $S 3s3.. t. 1.2 .3 .2 100.0 . dm-C -LOsAL CLII...SIATL’Tr MILLS [9 3 GE GE GE I.E GE GE GE GE GE or G£ G GE GE 61 GE FEEI I I" b 5 4 32 lie 2 1 112 1 l I4 ! 1/4 518 1/1 ilb 114 U r.0 EIL I 22.7 75.b
Atmospheric Transmittance from 0.25 to 28.5 Microns: Computer Code LOWTRAN 3
1975-05-07
thait worKe’S whIo arc iirca~i) risinig I.A M’ Il V\\ 2 c~in ilwl(ite thir ciu -rd dvciks- ,Aith i nii~wimun of effort. \\ll rh ’,n ; and diir<to the lIt...specified on CARD I. The appropriate meteorological parameters and format for thr atmospheric data are given below. Z, P. T. DP. RH . WHL WO, AHAZE [FORMAT...M.GTOIREA!) 4Z9,ZfKJP(?,K),TM?,)P, RH ,HH(7.KI ,NO(1,KIANAZý (KI A &2,3E .JTIF!W(Z(K) b1.0E-6)#1. A 1:0sF IV(M.EQ.0) UK)=mil A UG IF(7(KI .GF..35.0I Jr(Z
Mahajan, Anubha; Sim, Xueling; Ng, Hui Jin; Manning, Alisa; Rivas, Manuel A.; Highland, Heather M.; Locke, Adam E.; Grarup, Niels; Im, Hae Kyung; Cingolani, Pablo; Flannick, Jason; Fontanillas, Pierre; Fuchsberger, Christian; Gaulton, Kyle J.; Teslovich, Tanya M.; Rayner, N. William; Robertson, Neil R.; Beer, Nicola L.; Rundle, Jana K.; Bork-Jensen, Jette; Ladenvall, Claes; Blancher, Christine; Buck, David; Buck, Gemma; Burtt, Noël P.; Gabriel, Stacey; Gjesing, Anette P.; Groves, Christopher J.; Hollensted, Mette; Huyghe, Jeroen R.; Jackson, Anne U.; Jun, Goo; Justesen, Johanne Marie; Mangino, Massimo; Murphy, Jacquelyn; Neville, Matt; Onofrio, Robert; Small, Kerrin S.; Stringham, Heather M.; Syvänen, Ann-Christine; Trakalo, Joseph; Abecasis, Goncalo; Bell, Graeme I.; Blangero, John; Cox, Nancy J.; Duggirala, Ravindranath; Hanis, Craig L.; Seielstad, Mark; Wilson, James G.; Christensen, Cramer; Brandslund, Ivan; Rauramaa, Rainer; Surdulescu, Gabriela L.; Doney, Alex S. F.; Lannfelt, Lars; Linneberg, Allan; Isomaa, Bo; Tuomi, Tiinamaija; Jørgensen, Marit E.; Jørgensen, Torben; Kuusisto, Johanna; Uusitupa, Matti; Salomaa, Veikko; Spector, Timothy D.; Morris, Andrew D.; Palmer, Colin N. A.; Collins, Francis S.; Mohlke, Karen L.; Bergman, Richard N.; Ingelsson, Erik; Lind, Lars; Tuomilehto, Jaakko; Hansen, Torben; Watanabe, Richard M.; Prokopenko, Inga; Dupuis, Josee; Karpe, Fredrik; Groop, Leif; Laakso, Markku; Pedersen, Oluf; Florez, Jose C.; Morris, Andrew P.; Altshuler, David; Meigs, James B.; Boehnke, Michael; McCarthy, Mark I.; Lindgren, Cecilia M.; Gloyn, Anna L.
2015-01-01
Genome wide association studies (GWAS) for fasting glucose (FG) and insulin (FI) have identified common variant signals which explain 4.8% and 1.2% of trait variance, respectively. It is hypothesized that low-frequency and rare variants could contribute substantially to unexplained genetic variance. To test this, we analyzed exome-array data from up to 33,231 non-diabetic individuals of European ancestry. We found exome-wide significant (P<5×10-7) evidence for two loci not previously highlighted by common variant GWAS: GLP1R (p.Ala316Thr, minor allele frequency (MAF)=1.5%) influencing FG levels, and URB2 (p.Glu594Val, MAF = 0.1%) influencing FI levels. Coding variant associations can highlight potential effector genes at (non-coding) GWAS signals. At the G6PC2/ABCB11 locus, we identified multiple coding variants in G6PC2 (p.Val219Leu, p.His177Tyr, and p.Tyr207Ser) influencing FG levels, conditionally independent of each other and the non-coding GWAS signal. In vitro assays demonstrate that these associated coding alleles result in reduced protein abundance via proteasomal degradation, establishing G6PC2 as an effector gene at this locus. Reconciliation of single-variant associations and functional effects was only possible when haplotype phase was considered. In contrast to earlier reports suggesting that, paradoxically, glucose-raising alleles at this locus are protective against type 2 diabetes (T2D), the p.Val219Leu G6PC2 variant displayed a modest but directionally consistent association with T2D risk. Coding variant associations for glycemic traits in GWAS signals highlight PCSK1, RREB1, and ZHX3 as likely effector transcripts. These coding variant association signals do not have a major impact on the trait variance explained, but they do provide valuable biological insights. PMID:25625282
Mahajan, Anubha; Sim, Xueling; Ng, Hui Jin; Manning, Alisa; Rivas, Manuel A; Highland, Heather M; Locke, Adam E; Grarup, Niels; Im, Hae Kyung; Cingolani, Pablo; Flannick, Jason; Fontanillas, Pierre; Fuchsberger, Christian; Gaulton, Kyle J; Teslovich, Tanya M; Rayner, N William; Robertson, Neil R; Beer, Nicola L; Rundle, Jana K; Bork-Jensen, Jette; Ladenvall, Claes; Blancher, Christine; Buck, David; Buck, Gemma; Burtt, Noël P; Gabriel, Stacey; Gjesing, Anette P; Groves, Christopher J; Hollensted, Mette; Huyghe, Jeroen R; Jackson, Anne U; Jun, Goo; Justesen, Johanne Marie; Mangino, Massimo; Murphy, Jacquelyn; Neville, Matt; Onofrio, Robert; Small, Kerrin S; Stringham, Heather M; Syvänen, Ann-Christine; Trakalo, Joseph; Abecasis, Goncalo; Bell, Graeme I; Blangero, John; Cox, Nancy J; Duggirala, Ravindranath; Hanis, Craig L; Seielstad, Mark; Wilson, James G; Christensen, Cramer; Brandslund, Ivan; Rauramaa, Rainer; Surdulescu, Gabriela L; Doney, Alex S F; Lannfelt, Lars; Linneberg, Allan; Isomaa, Bo; Tuomi, Tiinamaija; Jørgensen, Marit E; Jørgensen, Torben; Kuusisto, Johanna; Uusitupa, Matti; Salomaa, Veikko; Spector, Timothy D; Morris, Andrew D; Palmer, Colin N A; Collins, Francis S; Mohlke, Karen L; Bergman, Richard N; Ingelsson, Erik; Lind, Lars; Tuomilehto, Jaakko; Hansen, Torben; Watanabe, Richard M; Prokopenko, Inga; Dupuis, Josee; Karpe, Fredrik; Groop, Leif; Laakso, Markku; Pedersen, Oluf; Florez, Jose C; Morris, Andrew P; Altshuler, David; Meigs, James B; Boehnke, Michael; McCarthy, Mark I; Lindgren, Cecilia M; Gloyn, Anna L
2015-01-01
Genome wide association studies (GWAS) for fasting glucose (FG) and insulin (FI) have identified common variant signals which explain 4.8% and 1.2% of trait variance, respectively. It is hypothesized that low-frequency and rare variants could contribute substantially to unexplained genetic variance. To test this, we analyzed exome-array data from up to 33,231 non-diabetic individuals of European ancestry. We found exome-wide significant (P<5×10-7) evidence for two loci not previously highlighted by common variant GWAS: GLP1R (p.Ala316Thr, minor allele frequency (MAF)=1.5%) influencing FG levels, and URB2 (p.Glu594Val, MAF = 0.1%) influencing FI levels. Coding variant associations can highlight potential effector genes at (non-coding) GWAS signals. At the G6PC2/ABCB11 locus, we identified multiple coding variants in G6PC2 (p.Val219Leu, p.His177Tyr, and p.Tyr207Ser) influencing FG levels, conditionally independent of each other and the non-coding GWAS signal. In vitro assays demonstrate that these associated coding alleles result in reduced protein abundance via proteasomal degradation, establishing G6PC2 as an effector gene at this locus. Reconciliation of single-variant associations and functional effects was only possible when haplotype phase was considered. In contrast to earlier reports suggesting that, paradoxically, glucose-raising alleles at this locus are protective against type 2 diabetes (T2D), the p.Val219Leu G6PC2 variant displayed a modest but directionally consistent association with T2D risk. Coding variant associations for glycemic traits in GWAS signals highlight PCSK1, RREB1, and ZHX3 as likely effector transcripts. These coding variant association signals do not have a major impact on the trait variance explained, but they do provide valuable biological insights.
1981-11-01
259 1.6. 43*2 7.4 ^7.0 -io.0 56.1 8.2 45. 12.4 54.7 266 . 26.4 5.7 33.3 e.5 50.6 2!6 2 .2 -. 8 16.0 262 1!91 2.*4 C. 2൨ .1 4E&6 P.7 20.. 4.7 4Q.7...ot !; oo ;9 5 27C 2.4 63.9 16.0 54.2 4.5 59.5 32.6 43.3 -1C.3 S3.5 271 15.9 52.3 14.0 58.6 10.1 24.3 5.9 27.2 1.2 21.4 272 (.8 43o.9 .3 30.9 .5...5.4 4640 2!97 42.& 13.2 37.9 9.2 22.6 1*4 46.9P 15. 3495 642 13.3 59.b 4.0 25.0 6.8 29.1 6.0 17. 2.7 37.1 643 16.5 40. -180 28.3 3.9 30.2 13 56.1 Z
Blenau, Wolfgang; Daniel, Stöppler; Balfanz, Sabine; Thamm, Markus; Baumann, Arnd
2017-01-01
Serotonin (5-hydroxytryptamine, 5-HT) is an important regulator of physiological and behavioral processes in both protostomes (e.g., insects) and deuterostomes (e.g., mammals). In insects, serotonin has been found to modulate the heart rate and to control secretory processes, development, circadian rhythms, aggressive behavior, as well as to contribute to learning and memory. Serotonin exerts its activity by binding to and activating specific membrane receptors. The clear majority of these receptors belong to the superfamily of G-protein-coupled receptors. In Drosophila melanogaster , a total of five genes have been identified coding for 5-HT receptors. From this family of proteins, four have been pharmacologically examined in greater detail, so far. While Dm5-HT 1A , Dm5-HT 1B , and Dm5-HT 7 couple to cAMP signaling cascades, the Dm5-HT 2A receptor leads to Ca 2+ signaling in an inositol-1,4,5-trisphosphate-dependent manner. Based on sequence similarity to homologous genes in other insects, a fifth D. melanogaster gene was uncovered coding for a Dm5-HT 2B receptor. Knowledge about this receptor's pharmacological properties is very limited. This is quite surprising because Dm5-HT 2B has been attributed to distinct physiological functions based on genetic interference with its gene expression. Mutations were described reducing the response of the larval heart to 5-HT, and specific knockdown of Dm5-HT 2B mRNA in hemocytes resulted in a higher susceptibility of the flies to bacterial infection. To gain deeper understanding of Dm5-HT 2B 's pharmacology, we evaluated the receptor's response to a series of established 5-HT receptor agonists and antagonists in a functional cell-based assay. Metoclopramide and mianserin were identified as two potent antagonists that may allow pharmacological interference with Dm5-HT 2B signaling in vitro and in vivo .
Blenau, Wolfgang; Daniel, Stöppler; Balfanz, Sabine; Thamm, Markus; Baumann, Arnd
2017-01-01
Serotonin (5-hydroxytryptamine, 5-HT) is an important regulator of physiological and behavioral processes in both protostomes (e.g., insects) and deuterostomes (e.g., mammals). In insects, serotonin has been found to modulate the heart rate and to control secretory processes, development, circadian rhythms, aggressive behavior, as well as to contribute to learning and memory. Serotonin exerts its activity by binding to and activating specific membrane receptors. The clear majority of these receptors belong to the superfamily of G-protein-coupled receptors. In Drosophila melanogaster, a total of five genes have been identified coding for 5-HT receptors. From this family of proteins, four have been pharmacologically examined in greater detail, so far. While Dm5-HT1A, Dm5-HT1B, and Dm5-HT7 couple to cAMP signaling cascades, the Dm5-HT2A receptor leads to Ca2+ signaling in an inositol-1,4,5-trisphosphate-dependent manner. Based on sequence similarity to homologous genes in other insects, a fifth D. melanogaster gene was uncovered coding for a Dm5-HT2B receptor. Knowledge about this receptor’s pharmacological properties is very limited. This is quite surprising because Dm5-HT2B has been attributed to distinct physiological functions based on genetic interference with its gene expression. Mutations were described reducing the response of the larval heart to 5-HT, and specific knockdown of Dm5-HT2B mRNA in hemocytes resulted in a higher susceptibility of the flies to bacterial infection. To gain deeper understanding of Dm5-HT2B’s pharmacology, we evaluated the receptor’s response to a series of established 5-HT receptor agonists and antagonists in a functional cell-based assay. Metoclopramide and mianserin were identified as two potent antagonists that may allow pharmacological interference with Dm5-HT2B signaling in vitro and in vivo. PMID:28553207
Frozen, Fully-Cooked Products and Botulism--Food Safety Advisory
... Administrative Forms Standard Forms Skip Navigation Z7_0Q0619C0JGR010IFST1G5B10H1 Web Content Viewer (JSR 286) Actions ${title} Loading... / Topics / ... Frozen Fully-cooked Products and Botulism Z7_0Q0619C0JGR010IFST1G5B10H3 Web Content Viewer (JSR 286) Actions ${title} Loading... Z7_ ...
Natural Flavorings on Meat and Poultry Labels
... Administrative Forms Standard Forms Skip Navigation Z7_0Q0619C0JGR010IFST1G5B10H1 Web Content Viewer (JSR 286) Actions ${title} Loading... / Topics / ... Flavorings on Meat and Poultry Labels Z7_0Q0619C0JGR010IFST1G5B10H3 Web Content Viewer (JSR 286) Actions ${title} Loading... Z7_ ...
Mutations in the Promoter Region of the Aldolase B Gene that cause Hereditary Fructose Intolerance
Coffee, Erin M.; Tolan, Dean R.
2010-01-01
SUMMARY Hereditary fructose intolerance (HFI) is a potentially fatal inherited metabolic disease caused by a deficiency of aldolase B activity in the liver and kidney. Over 40 disease-causing mutations are known in the protein-coding region of ALDOB. Mutations upstream of the protein-coding portion of ALDOB are reported here for the first time. DNA sequence analysis of 61 HFI patients revealed single base mutations in the promoter, intronic enhancer, and the first exon, which is entirely untranslated. One mutation, g.–132G>A, is located within the promoter at an evolutionarily conserved nucleotide within a transcription factor-binding site. A second mutation, IVS1+1G>C, is at the donor splice site of the first exon. In vitro electrophoretic mobility shift assays show a decrease in nuclear extract-protein binding at the g.–132G>A mutant site. The promoter mutation results in decreased transcription using luciferase reporter plasmids. Analysis of cDNA from cells transfected with plasmids harboring the IVS1+1G>C mutation results in aberrant splicing leading to complete retention of the first intron (~ 5 kb). The IVS1+1G>C splicing mutation results in loss of luciferase activity from a reporter plasmid. These novel mutations in ALDOB represent 2% of alleles in American HFI patients, with IVS1+1G>C representing a significantly higher allele frequency (6%) among HFI patients of Hispanic and African-American ethnicity. PMID:20882353
Cummings, J; MacLellan, A J; Mark, M; Jodrell, D I
1999-09-24
[Arg6, D-Trp7,9 mePhe8]-substance P (6-11), code-named antagonist G, is a novel peptide currently undergoing early clinical trials as an anticancer drug. A sensitive, high efficiency high-performance liquid chromatography (HPLC) method is described for the determination in human plasma of antagonist G and its three major metabolites, deamidated-G (M1), G-minus Met11 (M2) and G[Met11(O)] (M3). Gradient elution was employed using 40 mM ammonium acetate in 0.15% trifluoroacetic acid as buffer A and acetonitrile as solvent B, with a linear gradient increasing from 30 to 100% B over 15 min, together with a microbore analytical column (microBondapak C18, 30 cm X 2 mm I.D.). Detection was by UV at 280 nm and the column was maintained at 40 degrees C. Retention times varied by <1% throughout the day and were as follows: G, 13.0 min; M1, 12.2 min; M2, 11.2 min; M3, 10.8 min, and 18.1 min for a pyrene conjugate of G (G-P). The limit of detection on column (LOD) was 2.5 ng for antagonist G, M1-3 and G-P and the limit of quantitation (LOQ) was 20 ng/ml for G and 100 ng/ml for M1-3. Sample clean-up by solid-phase extraction using C2-bonded 40 microm silica particles (Bond Elut, 1 ml reservoirs) resulted in elimination of interference from plasma constituents. Within-day and between-day precision and accuracy over a broad range of concentrations (100 ng/ml-100 microg/ml) normally varied by < 10%, although at the highest concentrations of M1 and M2 studied (50 microg/ml), increased variability and reduced recovery were observed. The new assay will aid in the clinical development of antagonist G.
The Spectrum of Niemann-Pick Type C Disease in Greece.
Mavridou, Irene; Dimitriou, Evangelia; Vanier, Marie T; Vilageliu, Lluisa; Grinberg, Daniel; Latour, Philippe; Xaidara, Athina; Lycopoulou, Lilia; Bostantjopoulou, Sevasti; Zafeiriou, Dimitrios; Michelakakis, Helen
2017-01-01
Niemann-Pick type C disease (NPC) is a neurovisceral lysosomal storage disease caused by mutations in either the NPC1 or the NPC2 gene. It is a cellular lipid trafficking disorder characterized by the accumulation of unesterified cholesterol and various sphingolipids in the lysosomes and late endosomes, and it exhibits a broad clinical spectrum. Today, over 420 disease-causing mutations have been identified in the NPC1 and the NPC2 genes. We present the clinical, biochemical, and molecular findings in 14 cases diagnosed in Greece during the last 28 years. Age at diagnosis ranged from 2.5 months to 48 years. Systemic manifestations were present in 7/14 patients. All developed neurological manifestations (age of onset 5 months to 42 years). Six patients are still alive (age: 5-50 years). Classical filipin staining pattern was observed in all but four patients (3 NPC1, 1 NPC2). The rate of LDL-induced cholesteryl ester formation was severely reduced in 4/7 and significantly reduced in 3/7 patients studied. Increased chitotriosidase activity was observed in 9/12 patients. Mutation analysis in 11 unrelated patients identified 12 different mutations in the NPC1 gene: eight previously described p.E1089K (c.3265G>A), p.F284Lfs*26 (c.852delT), p.A1132P(c.3394G>C), del promoter region and exons 1-10, p.R1186H (c.3557G>A), p.P1007A (c.3019C>G), p.Q92R(c.275A>G),p.S940L (c.2819C>T), and four novel ones: (p.N701K fs*13 (c.2102-2103insA), p.K1057R (c.3170A>G), IVS23+3insT(c.3591+3insT), p.C1119*(c.3357T>C); and the previously described IVS2+5G>A(c.190+5G>A) mutation in the NPC2 gene. All patients were of Greek origin. Assuming a birth rate of 100,000/year, a rough incidence estimate for NPC disease in Greece would be 0.5/100,000 births.
Two Week Oral Dose Range-Finding Toxicity Study of WR269410 in Rats
1993-07-09
Part 2. IFCC Method for Aspartate Aminotransferase, Amsterdam, Elsevier Scientific Publishing Company (1975) Alanine Aminotransferase (ALT/GPT... IDENTIFICATION NUMBER DAMD17-92-C-2001 [8c ADDRESS (City, State, and ZIP Code) Fort Detrick Frederick, MD 21702-5009 10. SOURCE OF FUNDING NUMBERS...STATEMENT 3 SIGNATURE PAGE 4 TABLE OF CONTENTS 5 1. SUMMARY 7 2. INTRODUCTION 7 3. MATERIALS AND METHODS 7 3.1 Test
Targeting L-Selectin to Improve Neurologic and Urologic Function After Spinal Cord Injury
2014-10-01
doses of DFA, male C57BL/6 mice were subjected to a 2g weight dropped 7.5 cm onto the exposed spinal cord at the thoracic 9 vertebral level (mild...detect the absence of L-selectin on leukocytes 1 day post-SCI. Male C57BL/6 mice were subjected to a 2g weight dropped 7.5 cm onto the exposed spinal...subjected to a 2g weight dropped 7.5 cm onto the exposed spinal cord at the thoracic 9 vertebral level. DFA (40mg/kg) or vehicle was administered
Collision count in rugby union: A comparison of micro-technology and video analysis methods.
Reardon, Cillian; Tobin, Daniel P; Tierney, Peter; Delahunt, Eamonn
2017-10-01
The aim of our study was to determine if there is a role for manipulation of g force thresholds acquired via micro-technology for accurately detecting collisions in rugby union. In total, 36 players were recruited from an elite Guinness Pro12 rugby union team. Player movement profiles and collisions were acquired via individual global positioning system (GPS) micro-technology units. Players were assigned to a sub-category of positions in order to determine positional collision demands. The coding of collisions by micro-technology at g force thresholds between 2 and 5.5 g (0.5 g increments) was compared with collision coding by an expert video analyst using Bland-Altman assessments. The most appropriate g force threshold (smallest mean difference compared with video analyst coding) was lower for all forwards positions (2.5 g) than for all backs positions (3.5 g). The Bland-Altman 95% limits of agreement indicated that there may be a substantial over- or underestimation of collisions coded via GPS micro-technology when using expert video analyst coding as the reference comparator. The manipulation of the g force thresholds applied to data acquired by GPS micro-technology units based on incremental thresholds of 0.5 g does not provide a reliable tool for the accurate coding of collisions in rugby union. Future research should aim to investigate smaller g force threshold increments and determine the events that cause coding of false positives.
Wu, N; Qin, H; Wang, M; Bian, Y; Dong, B; Sun, G; Zhao, W; Chang, G; Xu, Q; Chen, G
2017-04-01
1. Endothelin receptor B subtype 2 (EDNRB2) is a paralog of EDNRB, which encodes a 7-transmembrane G-protein coupled receptor. Previous studies reported that EDNRB was essential for melanoblast migration in mammals and ducks. 2. Muscovy ducks have different plumage colour phenotypes. Variations in EDNRB2 coding sequences (CDSs) and mRNA expression levels were investigated in 4 different Muscovy duck plumage colour phenotypes, including black, black mutant, silver and white head. 3. The EDNRB2 gene from Muscovy duck was cloned; it had a length of 6435 bp and encoded 437 amino acids. The coding region was screened and potential single nucleotide polymorphisms were identified. Eight mutations were obtained, including one missense variant (c.64C > T) and 7 synonymous substitutions. The substitutions were associated with plumage colour phenotypes. 4. The EDNRB2 mRNA expression levels were compared between feather pulp from black birds and black mutant birds. The results indicated that EDNRB2 transcripts in feather pulp were significantly higher in black feathers than in white feathers. 5. The results determined the variation of EDNRB2 CDS and mRNA expression in Muscovy ducks of various plumage colours.
Draft Genome Sequence of Streptomyces specialis Type Strain GW41-1564 (DSM 41924).
Loucif, Lotfi; Michelle, Caroline; Terras, Jérôme; Rolain, Jean-Marc; Raoult, Didier; Fournier, Pierre-Edouard
2017-03-30
Here, we report the draft genome sequence of Streptomyces specialis type strain GW41-1564, which was isolated from soil. This 5.87-Mb genome exhibits a high G+C content of 72.72% and contains 5,486 protein-coding genes. Copyright © 2017 Loucif et al.
Genome Sequence of a Chromium-Reducing Strain, Bacillus cereus S612
Wang, Dongping; Boukhalfa, Hakim; Ware, Doug S.; ...
2015-12-10
We report here the genome sequence of an effective chromium-reducing bacterium,Bacillus cereusstrain S612. We found that the size of the draft genome sequence is approximately 5.4 Mb, with a G+C content of 35%, and it is predicted to contain 5,450 protein-coding genes.
Derivatives of 1,5-diamino-1H-tetrazole: a new family of energetic heterocyclic-based salts.
Gálvez-Ruiz, Juan Carlos; Holl, Gerhard; Karaghiosoff, Konstantin; Klapötke, Thomas M; Löhnwitz, Karolin; Mayer, Peter; Nöth, Heinrich; Polborn, Kurt; Rohbogner, Christoph J; Suter, Max; Weigand, Jan J
2005-06-13
1,5-Diamino-1H-tetrazole (2, DAT) can easily be protonated by reaction with strong mineral acids, yielding the poorly investigated 1,5-diaminotetrazolium nitrate (2a) and perchlorate (2b). A new synthesis for 2 is introduced that avoids lead azide as a hazardous byproduct. The reaction of 1,5-diamino-1H-tetrazole with iodomethane (7a) followed by the metathesis of the iodide (7a) with silver nitrate (7b), silver dinitramide (7c), or silver azide (7d) leads to a new family of heterocyclic-based salts. In all cases, stable salts were obtained and fully characterized by vibrational (IR, Raman) spectroscopy, multinuclear NMR spectroscopy, mass spectrometry, elemental analysis, X-ray structure determination, and initial safety testing (impact and friction sensitivity). Most of the salts exhibit good thermal stabilities, and both the perchlorate (2b) and the dinitramide (7c) have melting points well below 100 degrees C, yet high decomposition onsets, defining them as new (7c), highly energetic ionic liquids. Preliminary sensitivity testing of the crystalline compounds indicates rather low impact sensitivities for all compounds, the highest being that of the perchlorate (2b) and the dinitramide (7c) with a value of 7 J. In contrast, the friction sensitivities of the perchlorate (2b, 60 N) and the dinitramide (7c, 24 N) are relatively high. The enthalpies of combustion (Delta(c)H degrees ) of 7b-d were determined experimentally using oxygen bomb calorimetry: Delta(c)H degrees (7b) = -2456 cal g(-)(1), Delta(c)H degrees (7c) = -2135 cal g(-)(1), and Delta(c)H degrees (7d) = -3594 cal g(-)(1). The standard enthalpies of formation (Delta(f)H degrees ) of 7b-d were obtained on the basis of quantum chemical computations using the G2 (G3) method: Delta(f)H degrees (7b) = 41.7 (41.2) kcal mol(-)(1), Delta(f)H degrees (7c) = 92.1 (91.1) kcal mol(-)(1), and Delta(f)H degrees (7d) = 161.6 (161.5) kcal mol(-)(1). The detonation velocities (D) and detonation pressures (P) of 2b and 7b-d were calculated using the empirical equations of Kamlet and Jacobs: D(2b) = 8383 m s(-)(1), P(2b) = 32.2 GPa; D(7b) = 7682 m s(-)(1), P(7b) = 23.4 GPa; D(7c) = 8827 m s(-)(1), P(7c) = 33.6 GPa; and D(7d) = 7405 m s(-)(1), P(7d) = 20.8 GPa. For all compounds, a structure determination by single-crystal X-ray diffraction was performed. 2a and 2b crystallize in the monoclinic space groups C2/c and P2(1)/n, respectively. The salts of 7 crystallize in the orthorhombic space groups Pna2(1) (7a, 7d) and Fdd2 (7b). The hydrogen-bonded ring motifs are discussed in the formalism of graph-set analysis of hydrogen-bond patterns and compared in the case of 2a, 2b, and 7b.
Guo, Furong; Lu, Jiahua; Liu, Qing; Zhang, Ping; Zhang, Aiqing; Cai, Yingjie; Wang, Qiang
2018-08-01
Carbon-based catalysts have attracted high attention since they are greener and cheaper, while magnetic nanomaterials are very useful in environmental application because of the easy recovery and operation given by the magnetic separability. Therefore, graphitic carbon nitride modified magnetic carbon nanocomposites Fe 3 O 4 @C/g-C 3 N 4 was prepared herein for the first time as a new carbon-based catalyst for the activation of peroxymonosulfate (PMS). The catalytic properties of Fe 3 O 4 @C/g-C 3 N 4 in activating PMS for the degradation of Acid Orange 7 (AO 7), a model organic pollutant, were investigated. AO 7 degradation efficiency was significantly enhanced after modification of Fe 3 O 4 @C with g-C 3 N 4 , and the composite Fe 3 O 4 @C/g-C 3 N 4 from loading of 5 wt% g-C 3 N 4 and calcined at 300 °C for 30 min exhibited the best performance. AO 7 could be efficiently decolorized using the "Fe 3 O 4 @C/C 3 N 4 (5%) + PSM" system within the pH range of 2-6, and 97% of AO 7 could be removed in 20 min without pH adjustment (pH = 4). Radical quenching and EPR studies confirmed that both sulfate and hydroxyl radicals produced from PMS activation were the active species responsible for the oxidation of AO 7. The degradation mechanism was suggested based on the experimental results and XPS analyses. It was proposed that the CO groups on the carbon surface of Fe 3 O 4 @C rather than the CO in g-C 3 N 4 played a key role as the active sites for PMS activation. The catalyst was magnetically separable and displayed good stability and reusability, thus providing a potentially green catalyst for sustainable remediation of organic pollutants. Copyright © 2018 Elsevier Ltd. All rights reserved.
46 CFR 54.01-5 - Scope (modifies U-1 and U-2).
Code of Federal Regulations, 2014 CFR
2014-10-01
... vessels must also comply with the requirements that are listed or prescribed in paragraphs (d) through (g... selected is Class I-L. (g) The design pressure for each interface between two chambers in a multichambered... BCategories C and D in accordance with UW-16 of section VIII of the ASME Boiler and Pressure Vessel Code Spot...
Atmospheric Transmittance/Radiance: Computer Code LOWTRAN 5
1980-02-21
D. 0. 0 4 DNODD *• : 000.1 • 10 -7o. S0 C O EL4 ? • 4 ....5. 40...... ..... 4..........*............ ........ S....... * RMODEL.7 * 0. 071 4’. 2...while the receiver was a Golay cell mounted at the focus of a 76-cm diameter 80. Arnold, D.H., Lake, D. B., and Sanders, R. (1970) Comparative Measui
Yatawara, Lalani; Wickramasinghe, Susiji; Rajapakse, R P V J; Agatsuma, Takeshi
2010-09-01
In the present study, we determined the complete mitochondrial (mt) genome sequence (13,839bp) of parasitic nematode Setaria digitata and its structure and organization compared with Onchocerca volvulus, Dirofilaria immitis and Brugia malayi. The mt genome of S. digitata is slightly larger than the mt genomes of other filarial nematodes. S. digitata mt genome contains 36 genes (12 protein-coding genes, 22 transfer RNAs and 2 ribosomal RNAs) that are typically found in metazoans. This genome contains a high A+T (75.1%) content and low G+C content (24.9%). The mt gene order for S. digitata is the same as those for O. volvulus, D. immitis and B. malayi but it is distinctly different from other nematodes compared. The start codons inferred in the mt genome of S. digitata are TTT, ATT, TTG, ATG, GTT and ATA. Interestingly, the initiation codon TTT is unique to S. digitata mt genome and four protein-coding genes use this codon as a translation initiation codon. Five protein-coding genes use TAG as a stop codon whereas three genes use TAA and four genes use T as a termination codon. Out of 64 possible codons, only 57 are used for mitochondrial protein-coding genes of S. digitata. T-rich codons such as TTT (18.9%), GTT (7.9%), TTG (7.8%), TAT (7%), ATT (5.7%), TCT (4.8%) and TTA (4.1%) are used more frequently. This pattern of codon usage reflects the strong bias for T in the mt genome of S. digitata. In conclusion, the present investigation provides new molecular data for future studies of the comparative mitochondrial genomics and systematic of parasitic nematodes of socio-economic importance. 2010 Elsevier B.V. All rights reserved.
1989-06-01
and ZIP Code ) 10 SOURCE OF FUNDING NU MBERS I O KUI PROGRAM PRO ECCT TASKWOKUI E L E M E N T N O . N O .I 1 2 0 N O A 5 A C C E S S I O N N OlI I1 TITLE... source of by-products formation. Generating Data for Mathematical Modeling of Real Vapor Phase Reaction Systems (tremendously speeds multi -level, multi ...SMCC-RI1 6c AD RS(Ciry,. State, and ZIP Code ) SCRRI 7b. ADDRESS (City, State, and ZIP Code ) IA!hrueýýt Proving Ground, MD 21010-54213 a.NMOFFUNI.DNG
Novel mutations of endothelin-B receptor gene in Pakistani patients with Waardenburg syndrome.
Jabeen, Raheela; Babar, Masroor Ellahi; Ahmad, Jamil; Awan, Ali Raza
2012-01-01
Mutations in EDNRB gene have been reported to cause Waardenburg-Shah syndrome (WS4) in humans. We investigated 17 patients with WS4 for identification of mutations in EDNRB gene using PCR and direct sequencing technique. Four genomic mutations were detected in four patients; a G to C transversion in codon 335 (S335C) in exon 5 and a transition of T to C in codon (S361L) in exon 5, a transition of A to G in codon 277 (L277L) in exon 4, a non coding transversion of T to A at -30 nucleotide position of exon 5. None of these mutations were found in controls. One of the patients harbored two novel mutations (S335C, S361L) in exon 5 and one in Intronic region (-30exon5 A>G). All of the mutations were homozygous and novel except the mutation observed in exon 4. In this study, we have identified 3 novel mutations in EDNRB gene associated with WS4 in Pakistani patients.
Navy Nearshore Ocean Prediction Systems
2014-09-01
SYSTEMS B Y J AYA R A M V E E R A M O N Y, M A R K D . O R Z E C H , K A C E Y L . E D W A R D S , M I C H A E L G I L L I G A N , J E I K O O...tthor(s) Name(s) (FirstMl est), Code, Afliliation not NR,L / layaram Vet~ramony 7 Mark D 01’%ech 732 Kacey L...Edwards 732{ Michael Gilligan NAVO Eric Terrill Unlv. of CA- Soripp~ rony dePaolo Unlv. of CA. Scripps s intend~ d to offer this paper to the (Nt;~m& of
Tang, F; Huang, Y L; Jiang, X; Jia, X F; Li, B; Feng, Y; Chen, Q Y; Tang, C F
2018-05-02
Objective: To reveal the molecular epidemiologic characteristics of glucose-6-phosphate dehydrogenase (G6PD) gene and to evaluate based on the genetic analysis the newborn screening program performance and enzymatic diagnosis of G6PD deficiency in Guangzhou. Methods: G6PD enzyme activities were measured by quantitative fluorescence assay in dry blood spots of 16 319 newborns(8 725 males, 7 594 females) 3-7 days after birth in Guangzhou Newborn Center. They were born in Guangzhou form Oct. 1 to 20, 2016. The cutoff value of G6PD was less than 2.6 U/g Hb in dry blood spots. G6PD deficiency was diagnosed when G6PD<1 700 U/L or G6PD/6PGD<1 in red blood cells. Genetic analysis of G6PD gene was performed on the dry blood spot samples of 823 newborns (including positive 346, negative 477)with various levels of G6PD enzyme activities through fluorescence PCR melting curve analysis(FMCA) to detect 15 kinds of mutations reported to be common among Chinese.G6PD gene Sanger sequency was performed in seven highly suspicious patients with negative results by FMCA. Results: (1) Using the cutoff value of G6PD< 2.6 U/g Hb , a total of 687(4.2%) newborns showed positive screening results, including 560 (6.4%) males and 127(1.7%) females. (2) Among the newborns with positive screening results, 214 males and 122 females were randomly chosen for G6PD gene analysis. The results showed that 197 (92.1%) males were hemizygote and 108(88.6%) females were mutation carriers with one to four alleles. Among the newborns with negative screening results, 41 males with G6PD 2.6-2.8 U/g Hb and 436 females with G6PD 2.6-4.5 U/g Hb were chosen for genetic analysis.Mutations were detected in 5(12.2%)boys, and 226(51.8%) girls were carriers.G6PD gene Sanger sequency of seven highly suspicious patients showed that c.406C>T, c.551C>T, c.835A>T hemizygote were found in 3 male's samples, respectively. (3) The estimated prevalence of harboring mutation was 6.0% in males and 13.5% in females according to rates of mutation in samples with various levels of G6PD enzyme activities. Six common mutations were c.1388G>A、c.1376G>T, c.95A> G, c.871G>A, c.1024C>T, c.392G>T, accounting for 95.5% of detected alleles .(4) based on results of G6PD gene analysis, the newborn scereening of G6PD deficiency with cutoff value G6PD<2.6 U/g Hb yielded a positive predict value(PPV) of 93.5%, a false-positive rate of 0.5%, and a sensitivity of 99.0% for males. A PPV of 88.5%, a false-positive rate of 0.2% . The prevalence of severe type G6PD deficiency in females was about 1.5%. Compared with to genetic analysis, the sensitivity and PPV of G6PD activity assay in red blood cells were 95.5%, 97.2%, respectively. Conclusions: The prevalence of G6PD deficiency in males was 6.0% in Guangzhou. Six mutations c.1388G>A, c.1376G>T, c.95A>G, c.871G>A, c.1024C>T, c.392G>T accounted for 95.5%. The cutoff value of G6PD<2.6 U/g Hb innewborn screening program and the criteria of biochemical diagnosis could accurately identify G6PD deficiency . Combined with biochemical and molecular analysis will improve the accuracy of diagnosis of G6PD deficiency and detect more heterozygous females.
Vertical Windshear Below 5.5 Kilometers in the Vicinity of Berlin, Germany.
1986-08-01
DIRECTORATE- L LEVITT ET AL . UNCL~ASSFE UG 66 AMSMI/TR-RD-RE-96-9 SBIAD-E951 031 F/G 4/2 N smmmmhhhhhm moommhmhhhuo im -~ L L0 MICROCOPY RESOLUTION TEST...AD-RI82 432 VERTICAL NINDSHEAR BELOW 55 KILOMETERS IN THE VICINITY 1/1 OF BERLIN GERMANY..(U) ARMY MISSILE COMMAND REDSTONE ARSENAL AL RESEARCH...ADDRESS (City, State, an ZIP Code) 7b ADDRESS (City, State, and ZIP Code) Comunder US Army Missile Coeypini ATTN4: AISMI-RO-RE Redstone Arsenal,* AL 35898
Characterization of Enterococcus faecium bacteriophage IME-EFm5 and its endolysin LysEFm5.
Gong, Pengjuan; Cheng, Mengjun; Li, Xinwei; Jiang, Haiyan; Yu, Chuang; Kahaer, Nadire; Li, Juecheng; Zhang, Lei; Xia, Feifei; Hu, Liyuan; Sun, Changjiang; Feng, Xin; Lei, Liancheng; Han, Wenyu; Gu, Jingmin
2016-05-01
Due to the worldwide prevalence of antibiotic resistant strains, phages therapy has been revitalized recently. In this study, an Enterococcus faecium phage named IME-EFm5 was isolated from hospital sewage. Whole genomic sequence analysis demonstrated that IME-EFm5 belong to the Siphoviridae family, and has a double-stranded genome of 42,265bp (with a 35.51% G+C content) which contains 70 putative coding sequences. LysEFm5, the endolysin of IME-EFm5, contains an amidase domain in its N-terminal and has a wider bactericidal spectrum than its parental phage IME-EFm5, including 7 strains of vancomycin-resistant E. faecium. The mutagenesis analysis revealed that the zinc ion binding residues (H27, H132, and C140), E90, and T138 are required for the catalysis of LysEFm5. However, the antibacterial activity of LysEFm5 is zinc ion independent, which is inconsistent with most of other amidase members. The phage lysin LysEFm5 might be an alternative treatment strategy for infections caused by multidrug-resistant E. faecium. Copyright © 2016 Elsevier Inc. All rights reserved.
Masha, Roland T; Houreld, Nicolette N; Abrahamse, Heidi
2013-02-01
Low-intensity laser irradiation (LILI) has been shown to stimulate cellular functions leading to increased adenosine triphosphate (ATP) synthesis. This study was undertaken to evaluate the effect of LILI on genes involved in the mitochondrial electron transport chain (ETC, complexes I-IV) and oxidative phosphorylation (ATP synthase). Four human skin fibroblast cell models were used in this study: normal non-irradiated cells were used as controls while wounded, diabetic wounded, and ischemic cells were irradiated. Cells were irradiated with a 660 nm diode laser with a fluence of 5 J/cm(2) and gene expression determined by quantitative real-time reverse transcription (RT) polymerase chain reaction (PCR). LILI upregulated cytochrome c oxidase subunit VIb polypeptide 2 (COX6B2), cytochrome c oxidase subunit VIc (COX6C), and pyrophosphatase (inorganic) 1 (PPA1) in diabetic wounded cells; COX6C, ATP synthase, H+transporting, mitochondrial Fo complex, subunit B1 (ATP5F1), nicotinamide adenine dinucleotide (NADH) dehydrogenase (ubiquinone) 1 alpha subcomplex, 11 (NDUFA11), and NADH dehydrogenase (ubiquinone) Fe-S protein 7 (NDUFS7) in wounded cells; and ATPase, H+/K+ exchanging, beta polypeptide (ATP4B), and ATP synthase, H+ transporting, mitochondrial Fo complex, subunit C2 (subunit 9) (ATP5G2) in ischemic cells. LILI at 660 nm stimulates the upregulation of genes coding for subunits of enzymes involved in complexes I and IV and ATP synthase.
Isolation and characterization of a water stress-specific genomic gene, pwsi 18, from rice.
Joshee, N; Kisaka, H; Kitagawa, Y
1998-01-01
One of the water stress-specific cDNA clones of rice characterised previously, wsi18, was selected for further study. The wsi18 gene can be induced by water stress conditions such as mannitol, NaCl, and dryness, but not by ABA, cold, or heat. A genomic clone for wsi18, pwsi18, contained about 1.7 kbp of the 5' upstream sequence, two introns, and the full coding sequence. The 5'-upstream sequence of pwsi18 contained putative cis-acting elements, namely an ABA-responsive element (ABRE), three G-boxes, three E-boxes, a MEF-2 sequence, four direct and two inverted repeats, and four sequences similar to DRE, which is involved in the dehydration response of Arabidopsis genes. The gusA reporter gene under the control of the pwsi18 promoter showed transient expression in response to water stress. Deletion of the downstream DRE-like sequence between the distal G-boxes-2 and -3 resulted in rather low GUS expression.
Assessment of the 3H and 7Be generation in the IFMIF lithium loop
NASA Astrophysics Data System (ADS)
Simakov, S. P.; Fischer, U.; von Möllendorff, U.
2004-08-01
A complete evaluation of the 7Be and tritium inventory induced in the IFMIF lithium loop by deuterons and neutrons was performed on the basis of 3D Monte Carlo calculations with the M CDeLicious code and evaluated d-Li and n-Li cross-section data. The associated reaction cross-sections and thick lithium target yields were checked against available experimental data. The IFMIF calculations showed that the deuteron beam will produce 1.5 g of 7Be and 6 g of 3H per full power year in the lithium jet. The tritium generation in the whole lithium loop due to neutron induced reactions is at a rate of 1.5 g/fpy. The radio-active decay results in an equilibrium concentration 0.3 mg of 7Be and 50 mg of 3H per 1 kg of circulating lithium if no radioactive products are removed from the loop.
Word Frequency Analysis. MOS: 95B. Skill Levels 1 & 2.
1981-05-01
uU N D 1 A C P A C K1 ? G .I A 2 1 A’J Kt I S , 1 K L S 1 BaRp IF S I ~t2iIAED 5. 1.T’ 6 BATTERY 9!j 2 BECAUSE 17 67EI 2 BEHIND 13 IL 2 RE l1 3 b1...T S :t cTt lIION 5 U It :,4t 5 F L 1%T5 &:, JC.L ME NT 5 ESTIMS4EO 5 F -4 U0 . F- "CL5 UJ 7 "S 5 F-.[377 7i (, IDCAlN5.C1DEINTS 5 I’%SER71NkG .0
Bao, Xuhui; Chandramohan, Vidyalakshmi; Reynolds, Randall P; Norton, John N; Wetsel, William C; Rodriguiz, Ramona M; Aryal, Dipendra K; McLendon, Roger E; Levin, Edward D; Petry, Neil A; Zalutsky, Michael R; Burnett, Bruce K; Kuan, Chien-Tsun; Pastan, Ira H; Bigner, Darell D
2016-04-01
D2C7-(scdsFv)-PE38KDEL (D2C7-IT) is a novel immunotoxin that reacts with wild-type epidermal growth factor receptor (EGFRwt) and mutant EGFRvIII proteins overexpressed in glioblastomas. This study assessed the toxicity of intracerebral administration of D2C7-IT to support an initial Food and Drug Administration Investigational New Drug application. After the optimization of the formulation and administration, two cohorts (an acute and chronic cohort necropsied on study days 5 and 34) of Sprague-Dawley (SD) rats (four groups of 5 males and 5 females) were infused with the D2C7-IT formulation at total doses of 0, 0.05, 0.1, 0.4 μg (the acute cohort) and 0, 0.05, 0.1, 0.35 μg (the chronic cohort) for approximately 72 h by intracerebral convection-enhanced delivery using osmotic pumps. Mortality was observed in the 0.40 μg (5/10 rats) and 0.35 μg (4/10 rats) high-dose groups of each cohort. Body weight loss and abnormal behavior were only revealed in the rats treated with high doses of D2C7-IT. No dose-related effects were observed in clinical laboratory tests in either cohort. A gross pathologic examination of systemic tissues from the high-dose and control groups in both cohorts exhibited no dose-related or drug-related pathologic findings. Brain histopathology revealed the frequent occurrence of dose-related encephalomalacia, edema, and demyelination in the high-dose groups of both cohorts. In this study, the maximum tolerated dose of D2C7-IT was determined to be between 0.10 and 0.35 μg, and the no-observed-adverse-effect-level was 0.05 μg in SD rats. Both parameters were utilized to design the Phase I/II D2C7-IT clinical trial.
Characterization of the Caenorhabditis elegans G protein-coupled serotonin receptors.
Carre-Pierrat, Maïté; Baillie, David; Johnsen, Robert; Hyde, Rhonda; Hart, Anne; Granger, Laure; Ségalat, Laurent
2006-12-01
Serotonin (5-HT) regulates a wide range of behaviors in Caenorhabditis elegans, including egg laying, male mating, locomotion and pharyngeal pumping. So far, four serotonin receptors have been described in the nematode C. elegans, three of which are G protein-coupled receptors (GPCR), (SER-1, SER-4 and SER-7), and one is an ion channel (MOD-1). By searching the C. elegans genome for additional 5-HT GPCR genes, we identified five further genes which encode putative 5-HT receptors, based on sequence similarities to 5-HT receptors from other species. Using loss-of-function mutants and RNAi, we performed a systematic study of the role of the eight GPCR genes in serotonin-modulated behaviors of C. elegans (F59C12.2, Y22D7AR.13, K02F2.6, C09B7.1, M03F4.3, F16D3.7, T02E9.3, C24A8.1). We also examined their expression patterns. Finally, we tested whether the most likely candidate receptors were able to modulate adenylate cyclase activity in transfected cells in a 5-HT-dependent manner. This paper is the first comprehensive study of G protein-coupled serotonin receptors of C. elegans. It provides a direct comparison of the expression patterns and functional roles for 5-HT receptors in C. elegans.
Cloning, tissue expression and polymorphisms of chicken Krüppel-like factor 7 gene.
Zhang, Zhi-Wei; Wang, Zhi-Peng; Zhang, Kun; Wang, Ning; Li, Hui
2013-07-01
Krüppel-like factor 7 (KLF7) has been extensively studied in mammalian species, but its role in birds is still unclear. In the current study, cloning and sequencing showed that the full-length coding region of chicken KLF7 (Gallus gallus KLF7, gKLF7) was 891 bp long, encoding 296 amino acids. In addition, real-time RT-PCR analysis showed that gKLF7 was broadly expressed in all 15 chicken tissues selected, and its expression was significantly different in spleen, proventriculus, abdominal fat, brain, leg muscle, gizzard and heart between fat and lean broilers at 7 weeks of age. Additionally, one novel single nucleotide polymorphism (SNP), XM_426569.3: c. A141G, was identified in the second exon of gKLF7. Association analysis showed that this locus was significantly associated with fatness traits in Arbor Acres broiler random population and the eighth generation of Northeast Agricultural University broiler lines divergently selected for abdominal fat content (NEAUHLF) population (P < 0.05). These results suggest that gKLF7 might be a candidate gene for chicken fatness traits. © 2013 Japanese Society of Animal Science.
Paarup, Maiken; Friedrich, Michael W; Tindall, Brian J; Finster, Kai
2006-01-01
A psychrotolerant, obligate anaerobic, acetogenic bacterium designated strain SyrA5 was isolated from black anoxic sediment of a brackish fjord. Cells were Gram-positive, non-sporeforming rods. The isolate utilized H(2)/CO(2), CO, fructose, glucose, ethanol, ethylene glycol, glycerol, pyruvate, lactate, betaine and the methyl-groups of several methoxylated benzoic derivatives such as syringate, trimethoxybenzoate and vallinate. The optimum temperature for growth was 29 degrees C, whilst slow growth occurred at 2 degrees C. The strain grew optimally with NaCl concentrations below 2.7% (w/v), but growth occurred up to 4.3% (w/v) NaCl. Growth was observed in the range from pH 5.9 to 8.5, optimum at pH 8. The G+C content was 44.1 mol%. Based upon 16S rRNA gene sequence analysis and DNA-DNA reassociation studies, the organism was classified in the genus Acetobacterium. Strain SyrA5 shared a 16S rRNA sequence similarity with A. carbinolicum of 100%, a fthfs gene (which codes for the N5,N10 tetrahydrofolate synthetase) sequence identity of 98.5-98.7% (amino acid sequence similarities were 99.4-100%) and a RNA-DNA hybridization homology of 64-68%. Despite a number of phenotypic differences between strain SyrA5 and A. carbinolicum we propose including strain SyrA5 as a subspecies of A. carbinolicum for which we propose the name Acetobacterium carbinolicum subspecies kysingense. The type strain is SyrA5 (=DSM 16427(T), ATCC BAA-990).
Lu, Y; McMahon, D J; Vollmer, A H
2017-02-01
Highly concentrated micellar casein concentrate (HC-MCC) contains ∼18% casein with ∼70% of whey proteins removed by microfiltration and diafiltration of skim milk, followed by vacuum evaporation for further concentration. When blended with cream, HC-MCC forms recombined concentrated milk (RCM), which could be used as a starting material in cheese making. Our objective was to investigate the rennet coagulation properties of RCM while varying parameters such as casein level, pH, rennet level, and coagulation temperature. The HC-MCC was mixed with cream using low shear at 50°C for 10 min, followed by cooling to 31, 28, or 25°C and adding rennet, and rheological properties were determined. Rennet coagulation time [RCT, the time at which storage modulus (G') = loss modulus (G″)] decreased from 8.7 to 7.4 min as casein level increased from 3.2 to 5.7%, without a significant additional difference in RCT at casein levels >5.7%. The initial G″ (G″ 0 ) increased about 10-fold when casein levels were increased from 3.2 to 10.9%, whereas no change in initial G' (G' 0 ) was observed. When G' was measured relative to RCT (i.e., 1, 1.5, or 2 times RCT after RCT was reached, and expressed as G' 1 , G' 1.5 , and G' 2 ), log relationship was found between relative G' and casein level (R 2 > 0.94). Lowering coagulation temperature from 31 to 25°C increased G″ 0 by 6 fold and extended RCT from 7.4 to 9.5 min. After coagulation, relative G' was initially higher at the lower temperature with G' 1 of 3.6 Pa at 25°C and 2.0 Pa at 31°C, but delayed in further development with G' 2 of 0.8 kPa at 25°C and 1.1 kPa at 31°C. Lowering pH of RCM from 6.6 to 6.2 resulted in reduced RCT from 11.9 to 6.5 min with increased relative G' after coagulation. When less rennet was used, RCT increased in a linear inverse relationship without changes in relative G' or G″. The microstructure of RCM coagulum (∼11% casein), observed using transmission electron microscopy, confirmed that RCM curd had a rigid protein matrix containing extensively cross-linked protein strands. Copyright © 2017 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.
Stress Assisted Transformation in Ti-10V-2Fe-3Al.
1980-02-01
831 0 877 467 0 878 262 00 1 2 3 4 5 6 7 8 9 1,0 TRUE STRAIN I%) Fig. 5 -Illustration showing the- equivalency of the be-c and orthorhombic representa...iddletontG. T Terlinde 7,’ -- 6 -C !_ ~~1 I. c.wiias / NO 4 -76-C-0469JC.!Wil iams 1 9. PERFO IN;G CRIGAMI YI6IN N’ME AND ADDRESS 0. PL EMEN- PRDOJECT...R M MIDDLETON N00014-76-C ARGO UNCLASSIFIED JWTR-7 R ENDEEEE 71. TIT.? ae, 11 TZ RIr - 4 1 .74 Si 4W T $PIN ml STRESS ASSISTED TRANSFORMATION IN
Singla, Anand; Antonino, Mark J; Bliden, Kevin P; Tantry, Udaya S; Gurbel, Paul A
2009-11-01
High platelet reactivity (HPR) during aspirin and clopidogrel therapy in patients with diabetes has been reported and may affect outcomes. However, the relation of platelet reactivity to glycemic control is less studied in patients on dual antiplatelet therapy. Platelet aggregation (PA) in response to 5 and 20 micromol/L adenosine diphosphate (ADP) was compared in type 2 diabetic (n = 36) and nondiabetic patients (n = 35) undergoing elective stenting on aspirin and clopidogrel maintenance therapy. The relation of glycosylated hemoglobin (HbA(1c)) <7 g/dL (n = 16) and HbA(1c) > or =7 g/dL (n = 20) on PA was examined. High platelet reactivity was defined as >46% for 5 micromol/L ADP-induced and >59% for 20 micromol/L ADP-induced PA. Diabetic patients had higher 5 and 20 micromol/L ADP-induced PA than nondiabetic patients (45 +/- 17 vs 33 +/- 12, P = .009 and 52 +/- 19 vs 40 +/- 12, P = .004, respectively). Diabetic patients with HbA(1c) > or =7.0 g/dL had significantly higher 5 and 20 micromol/L ADP-induced PA versus patients with diabetes with HbA(1c) <7.0 g/dL (54 +/- 15 vs 34 +/- 14, P < .001 and 62 +/- 14 vs 40 +/- 17, P < .001, respectively). Among diabetic patients with HbA(1c) > or =7 g/dL, the prevalence of HPR was 65% and 60%; and among diabetic patients with HbA(1c) <7 g/dL, the prevalence of HPR was 19% and 13% as measured by 5 and 20 micromol/L ADP-induced PA, respectively. A correlation was present between 5 and 20 micromol/L ADP-induced PA and HbA(1c) (r = 0.60 and 0.62, P = .0001, respectively). An important relation exists between glycemic control and platelet reactivity in patients with type 2 diabetes mellitus treated with dual antiplatelet therapy. Poorly controlled patients with diabetes have the greatest platelet reactivity and may require alternative antiplatelet strategies, and further clinical investigations are warranted.
Chen, Yiyang; Liu, Baoyuan; Sun, Yani; Li, Huixia; Du, Taofeng; Nan, Yuchen; Hiscox, Julian A; Zhou, En-Min; Zhao, Qin
2018-07-01
Hepatitis E virus (HEV) causes liver disease in humans and is thought to be a zoonotic infection, with domestic animals, including swine and rabbits, being a reservoir. One of the proteins encoded by the virus is the capsid protein. This is likely the major immune-dominant protein and a target for vaccination. Four monoclonal antibodies (MAbs), three novel, 1E4, 2C7, and 2G9, and one previously characterized, 1B5, were evaluated for binding to the capsid protein from genotype 4 swine HEV. The results indicated that 625 DFCP 628 , 458 PSRPF 462 , and 407 EPTV 410 peptides on the capsid protein comprised minimal amino acid sequence motifs recognized by 1E4, 2C7, and 2G9, respectively. The data suggested that 2C7 and 2G9 epitopes were partially exposed on the surface of the capsid protein. Truncated genotype 4 swine HEV capsid protein (sp239, amino acids 368 to 606) can exist in multimeric forms. Preincubation of swine HEV with 2C7, 2G9, or 1B5 before addition to HepG2 cells partially blocked sp239 cell binding and inhibited swine HEV infection. The study indicated that 2C7, 2G9, and 1B5 partially blocked swine HEV infection of rabbits better than 1E4 or normal mouse IgG. The cross-reactivity of antibodies suggested that capsid epitopes recognized by 2C7 and 2G9 are common to HEV strains infecting most host species. Collectively, MAbs 2C7, 2G9, and 1B5 were shown to recognize three novel linear neutralizing B-cell epitopes of genotype 4 HEV capsid protein. These results enhance understanding of HEV capsid protein structure to guide vaccine and antiviral design. IMPORTANCE Genotype 3 and 4 HEVs are zoonotic viruses. Here, genotype 4 HEV was studied due to its prevalence in human populations and pig herds in China. To improve HEV disease diagnosis and prevention, a better understanding of the antigenic structure and neutralizing epitopes of HEV capsid protein are needed. In this study, the locations of three novel linear B-cell recognition epitopes within genotype 4 swine HEV capsid protein were characterized. Moreover, the neutralizing abilities of three MAbs specific for this protein, 2C7, 2G9, and 1B5, were studied in vitro and in vivo Collectively, these findings reveal structural details of genotype 4 HEV capsid protein and should facilitate development of applications for the design of vaccines and antiviral drugs for broader prevention, detection, and treatment of HEV infection of diverse human and animal hosts. Copyright © 2018 American Society for Microbiology.
NASA Astrophysics Data System (ADS)
Hansen, Christian T.; Meixner, Anette; Kasemann, Simone A.; Bach, Wolfgang
2017-11-01
Multiple batch experiments (100 °C, 200 °C; 40 MPa) were conducted, using Dickson-type reactors, to investigate Li and B partitioning and isotope fractionation between rock and water during serpentinization. We reacted fresh olivine (5 g; Fo90; [B] = <0.02 μg/g; δ11BOlivine -14‰; [Li] = 1.7 μg/g; δ7LiOlivine = +5.3‰) with seawater-like fluids (75 ml, 3.2 wt.% NaCl) adjusted with respect to their Li (0.2, 0.5 μg/ml; and δ7LiFluid +55‰) and B (∼10 μg/ml and δ11BFluid -0.3‰) characteristics. At 200 °C a reaction turnover of about 70% and a serpentinization mineral assemblage matching equilibrium thermodynamic computational results (EQ3/6) developed after 224 days runtime. Characterization of concomitant fluid samples indicated a distinct B incorporation into solid phases ([B]final_200 °C = 55.61 μg/g; DS/FB200 °C = 13.42) and a preferential uptake of the lighter 10B isotope (Δ11BS-F = -3.46‰). Despite a low reaction turnover at 100 °C (<12%), considerable amounts of B were again incorporated into solid phases ([B]final_100 °C = 25.33 μg/g; DS/FB100 °C = 24.2) with even a larger isotope fractionation factor (Δ11BS-F = -9.97‰). While magnitude of isotope fraction appears anti-correlated with temperature, we argue for an overall attenuation of the isotopic effect through changes in B speciation in saline solutions (NaB(OH)4(aq) and B(OH)3Cl-) as well as variable B fixation and fractionation for different serpentinization product minerals (brucite, chrysotile). Breakdown of the Li-rich olivine and limited Li incorporation into product mineral phases resulted in an overall lower Li content of the final solid phase assemblage at 200 °C ([Li]final_200 °C = 0.77 μg/g; DS/FLi200 °C = 1.58). First order changes in Li isotopic compositions were defined by mixing of two isotopically distinct sources i.e. the fresh olivine and the fluid rather than by equilibrium isotope fraction. At 200 °C primary olivine is dissolved, releasing its Li budget into the fluid which shifts towards a lower δ7LiF of +38.62‰. Newly formed serpentine minerals (δ7LiS = +30.58‰) incorporate fluid derived Li with a minor preference of the 6Li isotope. At 100 °C Li enrichment of secondary phases exceeded Li release by olivine breakdown ([Li]final_100 °C = 2.10 μg/g; DS/FLi100 °C = 11.3) and it was accompanied by preferential incorporation of heavier 7Li isotope that might be due to incorporation of a 7Li enriched fluid fraction into chrysotile nanotubes.
1983-01-01
ELECTRICAL CONTROL EQUIPMENT 8 A 4 5 A 1015 5 B J 1 L 30 2 L JAlIl 1067 N00383-81-G1902 B C A 1 2 2 6110 000 A3 ELECTRICAL CONTROL EQUIPMENT 8 A 4 5 A I015...6112 N00383-81-G1902 B C A 1 2 2 6110 000 A3 ELECTRICAL CONTROL EQUIPMENT 8 A 4 5 A 1015 5 B J 1 H 67 2 I JAIO0 N799 N00383-81-G1902 B C A 1 2 2 1680...A7 ELECTRICAL CONTROL EQUIPMENT 8 A 4 5 A 1013 4 B J 1 K 37 3 L OFF O 0635 F34601-80-01056 B C A 5 2 2 2925 ATL AIC ENGINE ELECTRICAL SYS COMPS 8 A 4
Bypass of Aflatoxin B[subscript 1] Adducts by the Sulfolobus solfataricus DNA Polymerase IV
DOE Office of Scientific and Technical Information (OSTI.GOV)
Banerjee, Surajit; Brown, Kyle L.; Egli, Martin
Aflatoxin B{sub 1} (AFB{sub 1}) is oxidized to an epoxide in vivo, which forms an N7-dG DNA adduct (AFB{sub 1}-N7-dG). The AFB{sub 1}-N7-dG can rearrange to a formamidopyrimidine (AFB{sub 1}-FAPY) derivative. Both AFB{sub 1}-N7-dG and the {beta}-anomer of the AFB{sub 1}-FAPY adduct yield G {yields} T transversions in Escherichia coli, but the latter is more mutagenic. We show that the Sulfolobus solfataricus P2 DNA polymerase IV (Dpo4) bypasses AFB{sub 1}-N7-dG in an error-free manner but conducts error-prone replication past the AFB{sub 1}-FAPY adduct, including misinsertion of dATP, consistent with the G {yields} T mutations observed in E. coli. Three ternarymore » (Dpo4-DNA-dNTP) structures with AFB{sub 1}-N7-dG adducted template:primers have been solved. These demonstrate insertion of dCTP opposite the AFB{sub 1}-N7-dG adduct, and correct vs incorrect insertion of dATP vs dTTP opposite the 5'-template neighbor dT from a primed AFB{sub 1}-N7-dG:dC pair. The insertion of dTTP reveals hydrogen bonding between the template N3 imino proton and the O{sup 2} oxygen of dTTP, and between the template T O{sup 4} oxygen and the N3 imino proton of dTTP, perhaps explaining why this polymerase does not efficiently catalyze phosphodiester bond formation from this mispair. The AFB{sub 1}-N7-dG maintains the 5'-intercalation of the AFB{sub 1} moiety observed in DNA. The bond between N7-dG and C8 of the AFB{sub 1} moiety remains in plane with the alkylated guanine, creating a 16{sup o} inclination of the AFB{sub 1} moiety with respect to the guanine. A binary (Dpo4-DNA) structure with an AFB{sub 1}-FAPY adducted template:primer also maintains 5'-intercalation of the AFB{sub 1} moiety. The {beta}-deoxyribose anomer is observed. Rotation about the FAPY C5-N{sup 5} bond orients the bond between N{sup 5} and C8 of the AFB{sub 1} moiety out of plane in the 5'-direction, with respect to the FAPY base. The formamide group extends in the 3'-direction. This improves stacking of the AFB{sub 1} moiety above the 5'-face of the FAPY base, as compared to the AFB{sub 1}-N7-dG adduct. Ternary structures with AFB{sub 1}-{beta}-FAPY adducted template:primers show correct vs incorrect insertion of dATP vs dTTP opposite the 5'-template neighbor dT from a primed AFB{sub 1}-{beta}-FAPY:dC pair. For dATP, the oxygen atom of the FAPY formamide group participates in a water-mediated hydrogen bond with Arg332. The insertion of dTTP yields a structure similar to that observed for the AFB{sub 1}-N7-dG adduct. The differential accommodation of these AFB{sub 1} adducts within the active site may, in part, modulate lesion bypass.« less
Shelf life of ground beef patties treated by gamma radiation.
Roberts, W T; Weese, J O
1998-10-01
The effects of irradiation on microbial populations in ground beef patties vacuum package and irradiated frozen at target doses of 0.0, 1.0, 3.0, 5.0, and 7.0 kGy were determined. Irradiated samples were stored at 4 or -18 degrees C for 42 days, and mesophilic aerobic plate counts (APCs) were periodically determined. Fresh ground beef (initial APC of 10(2) CFU/g) treated with 3.0, 5.0, and 7.0 kGy was acceptable (< 10(7) CFU/g) for 42 days at 4 degrees C. The 1.0 kGy-treated beef samples were acceptable microbiologically (< 10(7) CFU/g) after 42 days but developed an unacceptable off-odor after 21 days. Shelf life diminished in fresh ground beef patties with an initial APC of 10(4) CFU/g. Only beef patties treated with 7.0 kGy were found to be acceptable at 42 days. Beef patties treated at 1.0 and 3.0 kGy reached spoilage APC levels (> 10(7) CFU/g) by day 14 and 21, respectively, whereas patties treated at 5.0 kGy did not spoil until 42 days. The nonirradiated control samples for both batches of ground beef spoiled within 7 days. Microbial counts in ground beef patties stored at -18 degrees C did not change over the 42-day period. Shelf life of ground beef patties stored at 4 degrees C may be extended with gamma radiation, especially at 5.0 and 7.0 kGy. Initial microbial load in ground beef samples was an important shelf life factor.
Studies of Millimeter-Wave Diffraction Devices and Materials
1984-12-28
7.0 REFERENCES 1. Andrenko, S . d., Devyatkov, Acad. N. D., and Shestopalov, V. P., "Millimeter Field Band Antenna Arrays", Dokl. Akad. 4auk SSSR, Vol... S UNCLASSTFIED I* .RIT.Y CL.ASSIFICATION OF THIS PAGE REPORT DOCUMENTATION PAGE :kFPOO- SEURITY CLASSIFICATION 1-b. RESTRICTIVE MARKINGS .EM...State and ZIP Code) 10. SOURCE OF FUNDIN.G NOS. ______ C)c \\~ S PROGRAM PROJECT TASK WORK UNIT 2~~V \\~ ~(~ELEMENT NO. NO. No. NO. ATEinciude Security
Mahan, Kristina M.; Klingeman, Dawn Marie; Robert L. Hettich; ...
2016-01-21
Streptomyces vitaminophilus produces pyrrolomycins, which are halogenated polyketide antibiotics. Some of the pyrrolomycins contain a rare nitro group located on the pyrrole ring. In addition, the 6.5-Mbp genome encodes 5,941 predicted protein-coding sequences in 39 contigs with a 71.9% G+C content.
Klingeman, Dawn M.; Hettich, Robert L.; Parry, Ronald J.
2016-01-01
Streptomyces vitaminophilus produces pyrrolomycins, which are halogenated polyketide antibiotics. Some of the pyrrolomycins contain a rare nitro group located on the pyrrole ring. The 6.5-Mbp genome encodes 5,941 predicted protein-coding sequences in 39 contigs with a 71.9% G+C content. PMID:26798098
DOE Office of Scientific and Technical Information (OSTI.GOV)
Mahan, Kristina M.; Klingeman, Dawn Marie; Robert L. Hettich
Streptomyces vitaminophilus produces pyrrolomycins, which are halogenated polyketide antibiotics. Some of the pyrrolomycins contain a rare nitro group located on the pyrrole ring. In addition, the 6.5-Mbp genome encodes 5,941 predicted protein-coding sequences in 39 contigs with a 71.9% G+C content.
Yang, Huirong; Zhang, Jia-En; Luo, Hao; Luo, Mingzhu; Guo, Jing; Deng, Zhixin; Zhao, Benliang
2016-05-01
We present the complete mitochondrial genome of Cipangopaludina cathayensis in this study. The mitochondrial genome is 17,157 bp in length, containing 13 protein-coding genes, 2 rRNA genes, 22 tRNA genes. All of them are encoded on the heavy strand except 7 tRNA genes on the light strand. Overall nucleotide compositions of the light strand are 44.51% of A, 26.74% of T, 20.48% of C and 8.28% of G. All the protein-coding genes start with ATG initiation codon except ATP6 with ATA and ND4 with TTG, and 2 types of termination codons are TAA (ATP6, ND2, COX1, COX2, ATP8, ND1, ND6, Cytb, COX3, ND4) and TAG (ND4L, ND5, ND3). There are 29 intergenic spacers and 5 gene overlaps. The tandem repeat sequences are observed in COX2, tRNA(Asp), ATP6, tRNA(Cys), S-rRNA, ND1, Cytb, ND4 and COX3 genes. Gene arrangement and distribution are different from the typical vertebrates. The absence of D-loop is consistent with the Gastropoda, but at least one lengthy non-coding region is essential regulatory element for the initiation of transcription and replication.
1993-01-01
SECURITY CLASSIFICATION AUTHORITY 3. DISTRIBUTION JAVAILABIUITY OF REPORT 2b. DECLASSIFICATION I OWNGRAD)ING SCHEDULE I4. PERFORMING ORGANIZATION ...REPORT NUMBER(S) 5. MONITORING ORGANIZATION REPORT NUMBER(S) RESEARCH REPORT NO. 9 6a. NAME OF PERFORMING ORGANIZATION 6b. OFFICE SYMBOL 7a. NAME OF...MONITORING ORGANIZATION Markman & Associates, Inc.(I plcbe 6c. ADDRESS (City. State. and ZIP Code) 7b. ADDRESS (City. State. and ZIP Code) 824 N. Bl
El-Sawy, Eslam R.; Ebaid, Manal S.; Abo-Salem, Heba M.; El-Hallouty, Salwa; Kassem, Emad M.; Mandour, Adel H.
2013-01-01
A novel series of 4-methoxy, and 4,9-dimethoxy-5-substituted furo[2,3-g]-1,2,3-benzoxathiazine-7,7-dioxide derivatives 3a,b, 10a–g and 11a–g were prepared in good yields via the reaction of 4-methoxy (1a) and 4,7-dimethoxy-5-acetyl-6-hydroxybenzofurans (1b) and their α,β-unsaturated keto derivatives 6a–g and 7a–g with chlorosulfonyl isocyanate (CSI). On the other hand, N-chlorosulfonyl carbamate derivatives 4a,b, 12a,b and 13a,b were prepared and allowed to react with piperidine to give the corresponding N-piperidinosulfonyl carbamate derivatives 5a,b, 14a,b and 15a,b, respectively. Sixteen new target compounds 3a,b, 10a–g, and 11a–g were tested for their DPPH radical-scavenging, and in vitro antiproliferative activity against A-549, MCF7 and HCT-116 cancer cell lines. Compounds 10a, 11c, 11e, and 11g showed moderate DPPH radical-scavenging activity compared to ascorbic acid at 100 μg/mL. 4,9-Dimethoxy-5-substituted styrylfuro[3,2-g]-1,2,3-benzoxathiazine-7,7-dioxides 11a, 11b, and 11c were found to be highly active against A-549 and HCT-116 cancer cell lines with IC50 values ranging from 0.02 to 0.08 μmol/mL compared to doxorubicin with IC50 = 0.04 and 0.06 μmol/mL, respectively. PMID:25685501
El-Sawy, Eslam R; Ebaid, Manal S; Abo-Salem, Heba M; El-Hallouty, Salwa; Kassem, Emad M; Mandour, Adel H
2014-05-01
A novel series of 4-methoxy, and 4,9-dimethoxy-5-substituted furo[2,3-g]-1,2,3-benzoxathiazine-7,7-dioxide derivatives 3a,b, 10a-g and 11a-g were prepared in good yields via the reaction of 4-methoxy (1a) and 4,7-dimethoxy-5-acetyl-6-hydroxybenzofurans (1b) and their α,β-unsaturated keto derivatives 6a-g and 7a-g with chlorosulfonyl isocyanate (CSI). On the other hand, N-chlorosulfonyl carbamate derivatives 4a,b, 12a,b and 13a,b were prepared and allowed to react with piperidine to give the corresponding N-piperidinosulfonyl carbamate derivatives 5a,b, 14a,b and 15a,b, respectively. Sixteen new target compounds 3a,b, 10a-g, and 11a-g were tested for their DPPH radical-scavenging, and in vitro antiproliferative activity against A-549, MCF7 and HCT-116 cancer cell lines. Compounds 10a, 11c, 11e, and 11g showed moderate DPPH radical-scavenging activity compared to ascorbic acid at 100 μg/mL. 4,9-Dimethoxy-5-substituted styrylfuro[3,2-g]-1,2,3-benzoxathiazine-7,7-dioxides 11a, 11b, and 11c were found to be highly active against A-549 and HCT-116 cancer cell lines with IC50 values ranging from 0.02 to 0.08 μmol/mL compared to doxorubicin with IC50 = 0.04 and 0.06 μmol/mL, respectively.
General Unknown Screening by Ion Trap LC/MS/MS
2010-04-01
Subtitle 5 . Report Date April 2010 General Unknown Screening by Ion Trap LC/MS/MS 6 . Performing Organization Code 7. Author(s) 8... 5 Table 1: Analytical Data for Each of the...359 Compounds in the LC/MS/MS Library . . . . . . . . . . . 6 1 General Unknown ScreeninG by ion Trap lc/MS/MS INTrOduCTION The Federal Aviation
46 CFR 160.051-7 - Design and performance of Coastal Service inflatable liferafts.
Code of Federal Regulations, 2012 CFR
2012-10-01
... diameter of the buoyancy chambers is greater than 500 mm (19.5 in). (g) Stability (IMO LSA Code, chapter IV/4.2.5). Each Coastal Service inflatable liferaft must either meet the stability criteria in § 160.151-17(a) or be fitted with water-containing stability pockets meeting the following requirements: (1...
The complete mitochondrial genome of Cricetulus kamensis (Rodentia: Cricetidae).
Kang, Chunlan; Yue, Hao; Liu, Mengyao; Huang, Ting; Liu, Yang; Zhang, Xiuyue; Yue, Bisong; Zeng, Tao; Liu, Shaoying
2016-01-01
The Cricetulus kamensis is endemic to China and is popular as pet. In the present study, the complete mitogenome of C. kamensis was first determined. It was 16,270 bp in length and the composition and arrangement of its genes are analogous to most other mammals. The overall base composition of heavy strand is 33.2% A, 26.8% T, 27.2% C and 12.7% G. The sequence is highly G-C poor (∼40%) and A is the most numerous nucleotide followed by T >C >G, which is similar to other mammalian mitochondrial genomes. It is notable that three extra bases "CAT" were inserted in cytb at the 3' end position and no stop codon was found for this coding region. The mitogenome sequence of C. kamensis could contribute to a better solution of its phylogenetic position and phylogenetic relationship within Cricetinae in the future.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Katsouleas, Thomas; Decyk, Viktor
Final Report for grant DE-FG02-06ER54888, "Simulation of Beam-Electron Cloud Interactions in Circular Accelerators Using Plasma Models" Viktor K. Decyk, University of California, Los Angeles Los Angeles, CA 90095-1547 The primary goal of this collaborative proposal was to modify the code QuickPIC and apply it to study the long-time stability of beam propagation in low density electron clouds present in circular accelerators. The UCLA contribution to this collaborative proposal was in supporting the development of the pipelining scheme for the QuickPIC code, which extended the parallel scaling of this code by two orders of magnitude. The USC work was as describedmore » here the PhD research for Ms. Bing Feng, lead author in reference 2 below, who performed the research at USC under the guidance of the PI Tom Katsouleas and the collaboration of Dr. Decyk The QuickPIC code [1] is a multi-scale Particle-in-Cell (PIC) code. The outer 3D code contains a beam which propagates through a long region of plasma and evolves slowly. The plasma response to this beam is modeled by slices of a 2D plasma code. This plasma response then is fed back to the beam code, and the process repeats. The pipelining is based on the observation that once the beam has passed a 2D slice, its response can be fed back to the beam immediately without waiting for the beam to pass all the other slices. Thus independent blocks of 2D slices from different time steps can be running simultaneously. The major difficulty was when particles at the edges needed to communicate with other blocks. Two versions of the pipelining scheme were developed, for the the full quasi-static code and the other for the basic quasi-static code used by this e-cloud proposal. Details of the pipelining scheme were published in [2]. The new version of QuickPIC was able to run with more than 1,000 processors, and was successfully applied in modeling e-clouds by our collaborators in this proposal [3-8]. Jean-Luc Vay at Lawrence Berkeley National Lab later implemented a similar basic quasistatic scheme including pipelining in the code WARP [9] and found good to very good quantitative agreement between the two codes in modeling e-clouds. References [1] C. Huang, V. K. Decyk, C. Ren, M. Zhou, W. Lu, W. B. Mori, J. H. Cooley, T. M. Antonsen, Jr., and T. Katsouleas, "QUICKPIC: A highly efficient particle-in-cell code for modeling wakefield acceleration in plasmas," J. Computational Phys. 217, 658 (2006). [2] B. Feng, C. Huang, V. K. Decyk, W. B. Mori, P. Muggli, and T. Katsouleas, "Enhancing parallel quasi-static particle-in-cell simulations with a pipelining algorithm," J. Computational Phys, 228, 5430 (2009). [3] C. Huang, V. K. Decyk, M. Zhou, W. Lu, W. B. Mori, J. H. Cooley, T. M. Antonsen, Jr., and B. Feng, T. Katsouleas, J. Vieira, and L. O. Silva, "QUICKPIC: A highly efficient fully parallelized PIC code for plasma-based acceleration," Proc. of the SciDAC 2006 Conf., Denver, Colorado, June, 2006 [Journal of Physics: Conference Series, W. M. Tang, Editor, vol. 46, Institute of Physics, Bristol and Philadelphia, 2006], p. 190. [4] B. Feng, C. Huang, V. Decyk, W. B. Mori, T. Katsouleas, P. Muggli, "Enhancing Plasma Wakefield and E-cloud Simulation Performance Using a Pipelining Algorithm," Proc. 12th Workshop on Advanced Accelerator Concepts, Lake Geneva, WI, July, 2006, p. 201 [AIP Conf. Proceedings, vol. 877, Melville, NY, 2006]. [5] B. Feng, P. Muggli, T. Katsouleas, V. Decyk, C. Huang, and W. Mori, "Long Time Electron Cloud Instability Simulation Using QuickPIC with Pipelining Algorithm," Proc. of the 2007 Particle Accelerator Conference, Albuquerque, NM, June, 2007, p. 3615. [6] B. Feng, C. Huang, V. Decyk, W. B. Mori, G. H. Hoffstaetter, P. Muggli, T. Katsouleas, "Simulation of Electron Cloud Effects on Electron Beam at ERL with Pipelined QuickPIC," Proc. 13th Workshop on Advanced Accelerator Concepts, Santa Cruz, CA, July-August, 2008, p. 340 [AIP Conf. Proceedings, vol. 1086, Melville, NY, 2008]. [7] B. Feng, C. Huang, V. K. Decyk, W. B. Mori, P. Muggli, and T. Katsouleas, "Enhancing parallel quasi-static particle-in-cell simulations with a pipelining algorithm," J. Computational Phys, 228, 5430 (2009). [8] C. Huang, W. An, V. K. Decyk, W. Lu, W. B. Mori, F. S. Tsung, M. Tzoufras, S. Morshed, T. Antonsen, B. Feng, T. Katsouleas, R., A. Fonseca, S. F. Martins, J. Vieira, L. O. Silva, E. Esarey, C. G. R. Geddes, W. P. Leemans, E. Cormier-Michel, J.-L. Vay, D. L. Bruhwiler, B. Cowan, J. R. Cary, and K. Paul, "Recent results and future challenges for large scale particleion- cell simulations of plasma-based accelerator concepts," Proc. of the SciDAC 2009 Conf., San Diego, CA, June, 2009 [Journal of Physics: Conference Series, vol. 180, Institute of Physics, Bristol and Philadelphia, 2009], p. 012005. [9] J.-L. Vay, C. M. Celata, M. A. Furman, G. Penn, M. Venturini, D. P. Grote, and K. G. Sonnad, ?Update on Electron-Cloud Simulations Using the Package WARP-POSINST.? Proc. of the 2009 Particle Accelerator Conference PAC09, Vancouver, Canada, June, 2009, paper FR5RFP078.« less
Nakamura, Yusuke; Taruno, Yoko; Sugimoto, Masashi; Kitamura, Yusuke; Seng, Hoi Ling; Kong, Siew Ming; Ng, Chew Hee; Chikira, Makoto
2013-03-14
The binding site specificity of the ternary complexes, [M(II)(phen)(edda)] (M(II) = Pt(2+) and Zn(2+); phen = 1,10-phenanthroline; edda = N,N'-ethylenediaminediacetic acid), for the self-complementary oligonucleotides (ODNs), ds(C(1)G(2)C(3)G(4)A(5)A(6)T(7)T(8)C(9)G(10)C(11)G(12))(2) (ODN1) and ds(C(1)G(2)C(3)G(4)T(5)A(6)T(7)A(8)C(9)G(10)C(11)G(12))(2) (ODN2), was studied by NMR measurements. The results indicated that [Pt(ii)(phen)(edda)] was partially intercalated between C(3)/G(10) and G(4)/C(9) base pairs of ODN1 and ODN2 in the major grooves, whereas [Zn(II)(phen)(edda)] was bound specifically to the TATA region of ODN2 in the minor groove and to the terminal G(2)/C(11) base pair of ODN1 in the major groove. The preference for the TATA sequence over the AATT sequence in the binding of [Zn(phen)(edda)] was attributed to the wider minor groove width of the TATA sequence. The bindings of the complexes to ct-DNA were also studied by UV, CD, and fluorescence spectroscopy. Additionally, the antiproliferative property of [Pt(II)(phen)(edda)] towards MCF7 breast cancer cells and normal MCF10-A cells was compared with that of [Zn(II)(phen)(edda)].
1995-01-01
NUMBER 5c. PROGRAM ELEMENT NUMBER 6. AUTHOR(S) Tupaz, Jesus B. ; Hinman, Jr., Kendall G. ; Morss, Dean A. ; 5d. PROJECT NUMBER 5e. TASK NUMBER 5f. WORK...s path, schools, industries and hospitals were damaged or destroyed. Yet despike this extensive destruction, there were just ?ive deaths reported in a...7aBJ”a 7eerm 7e0m 7aerm 7eetEl 7amEl 7em13 ? Bom 7EiElm B 9 072205 092808 3E32 CIRCULfiR 8 52 28 le 1 3833 2823 C IRCULRR 2032 C IRCULRR 10 11 12 892386
Genome sequence of Thalassospira xiamenensis type strain M-5.
Lai, Qiliang; Shao, Zongze
2012-12-01
Thalassospira xiamenensis M-5(T) was isolated from the surface water of a waste oil pool at the oil storage dock in the city of Xiamen, Fujian Province, China. Here, we present the draft genome of strain M-5(T), which contains 4,705,237 bp with a G+C content of 54.65% and contains 4,343 protein-coding genes and 46 tRNA genes.
NASA Astrophysics Data System (ADS)
Rauch, T.; Demleitner, M.; Hoyer, D.; Werner, K.
2018-04-01
The German Astrophysical Virtual Observatory (GAVO) developed the registered service TheoSSA (theoretical stellar spectra access) and the supporting registered VO tool TMAW (Tübingen Model-Atmosphere WWW interface). These allow individual spectral analyses of hot, compact stars with state-of-the-art non-local thermodynamical equilibrium (NLTE) stellar-atmosphere models that presently consider opacities of the elements H, He, C, N, O, Ne, Na, and Mg, without requiring detailed knowledge about the involved background codes and procedures. Presently, TheoSSA provides easy access to about 150 000 pre-calculated stellar spectral energy distributions (SEDs) and is intended to ingest SEDs calculated by any model-atmosphere code. In the case of the exciting star of PN PRTM 1, we demonstrate the easy way to calculate individual NLTE stellar model-atmospheres to reproduce an observed optical spectrum. We measured T_eff = 98 000± 5 000 K, log (g / cm/s^2) = 5.0^{+0.3}_{-0.2}, and photospheric mass fractions of H =7.5 × 10-1 (1.02 times solar), He =2.4 × 10-1 (0.96), C =2.0 × 10-3 (0.84), N =3.2 × 10-4 (0.46), and O =8.5 × 10-3 (1.48) with uncertainties of ±0.2 dex. We determined the stellar mass and luminosity of 0.73^{+0.16}_{-0.15} M_{⊙} and log (L/L⊙) = 4.2 ± 0.4, respectively.
Calvanese, Vincenzo; Mallya, Meera; Campbell, R Duncan; Aguado, Begoña
2008-01-01
Background Regulation of the expression of particular genes can rely on mechanisms that are different from classical transcriptional and translational control. The LY6G5B and LY6G6D genes encode LY-6 domain proteins, whose expression seems to be regulated in an original fashion, consisting of an intron retention event which generates, through an early premature stop codon, a non-coding transcript, preventing expression in most cell lines and tissues. Results The MHC LY-6 non-coding transcripts have shown to be stable and very abundant in the cell, and not subject to Nonsense Mediated Decay (NMD). This retention event appears not to be solely dependent on intron features, because in the case of LY6G5B, when the intron is inserted in the artificial context of a luciferase expression plasmid, it is fully spliced but strongly stabilises the resulting luciferase transcript. In addition, by quantitative PCR we found that the retained and spliced forms are differentially expressed in tissues indicating an active regulation of the non-coding transcript. EST database analysis revealed that these genes have an alternative expression pathway with the formation of Transcription Induced Chimeras (TIC). This data was confirmed by RT-PCR, revealing the presence of different transcripts that would encode the chimeric proteins CSNKβ-LY6G5B and G6F-LY6G6D, in which the LY-6 domain would join to a kinase domain and an Ig-like domain, respectively. Conclusion In conclusion, the LY6G5B and LY6G6D intron-retained transcripts are not subjected to NMD and are more abundant than the properly spliced forms. In addition, these genes form chimeric transcripts with their neighbouring same orientation 5' genes. Of interest is the fact that the 5' genes (CSNKβ or G6F) undergo differential splicing only in the context of the chimera (CSNKβ-LY6G5B or G6F-LY6G6C) and not on their own. PMID:18817541
Inactivation of Salmonella on pecan nutmeats by hot air treatment and oil roasting.
Beuchat, Larry R; Mann, David A
2011-09-01
Studies were done to determine the effectiveness of hot air drying, dry roasting, and oil roasting in killing Salmonella on pecan nutmeats. Pecan halves and pieces were inoculated by immersion in a five-serotype suspension of Salmonella or by surface application of powdered chalk containing the pathogen. Hot air treatment of low-moisture (2.8 to 4.1%) and high-moisture (10.5 to 11.2%) immersion-inoculated nutmeats (initial population, 6.18 to 7.16 log CFU/g) at 120°C for 20 min reduced the number of Salmonella by 1.18 to 1.26 and 1.89 to 2.04 log CFU/g, respectively. However, regardless of the moisture content, hot air treatment of pecan halves containing 0.77 log CFU/g at 120°C for 20 min failed to eliminate Salmonella. Reductions were >7 log CFU/g when dry pieces were dry roasted at 160°C for 15 min. Treatment of halves at 140°C for 20 min, 150°C for 15 min, or 170°C for 10 min reduced Salmonella by 5 log CFU/g. The pathogen was slightly more heat resistant in immersion-inoculated nutmeats than on surface-inoculated nutmeats. Exposure of immersion-inoculated pieces to peanut oil at 127°C for 1.5 min or 132°C for 1.0 min reduced the number of Salmonella by 5 log CFU/g. Treatment of halves at 138°C for 2.0 min reduced Salmonella by 5 log CFU/g; treatment at 132°C for 2.5 to 4.0 min did not always achieve this reduction. Hot air treatment cannot be relied upon to reduce Salmonella by 5 log CFU/g of raw pecan nutmeats without changing sensory qualities. Treatment temperatures and times typically used to oil roast nutmeats appear to be sufficient to reduce Salmonella by 5 log CFU/g.
Acids, sugars, and sugar alcohols in Chinese hawthorn (Crataegus spp.) fruits.
Liu, Pengzhan; Kallio, Heikki; Lü, Deguo; Zhou, Chuansheng; Ou, Shiyi; Yang, Baoru
2010-01-27
Acids, sugars, and sugar alcohols in the fruits of 22 cultivars/origins of three species of hawthorn (Crataegus spp.) were analyzed by gas chromatography and mass spectrometry. Citric acid (2.0-8.4 g/100 g dry mass [DM]), quinic acid (0.5-5.6 g/100 g DM), malic acid (0.3-1.1 g/100 g DM), fructose (5.5-18.4 g/100 g DM), glucose (5.3-16.6 g/100 g DM), sorbitol (3.0-15.7 g/100 g DM), and myo-inositol (0.1-0.3 g/100 g DM) were found in all the samples. Sucrose was present only in C. scabrifolia and three cultivars of C. pinnatifida var. major. C. scabrifolia differed from other species by its high content of quinic acid. The cultivars of C. pinnatifida var. major and C. brettschneideri had a higher content of total sugars and a higher sugar/acid ratio than the natural origins of C. pinnatifida and C. scabrifolia (P < 0.05). The hawthorn samples analyzed fell into two groups rich in sugars and acids respectively. This is the first report of the profiles of sugars and sugar alcohols and the occurrence of quinic acid in hawthorn fruits.
USDA-ARS?s Scientific Manuscript database
The complete circular mitochondrial genome of D. reticulatum is 14,048 bp in length, consisting of 13 protein-coding genes (PCGs), 22 transfer RNA (tRNA) genes, and 2 ribosomal RNA (rRNA) genes (GenBank accession number: KY765589). The overall base composition was 31.0 % A, 12.2 % C, 17.7 % G and 39...
Lai, Chung-Hsu; Yang, Chih-Hui; Huang, Yi-Han; Lin, Hsi-Hsun
2018-01-01
ABSTRACT Elizabethkingia miricola EM798-26 was isolated from the blood of a patient with diffuse large B-cell lymphoma in Taiwan. We report here the complete genome sequence of EM798-26, which contains a G+C content of 35.7% and 3,877 candidate protein-coding genes. PMID:29301886
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sarkar, B; Roy, S; Munshi, A
2015-06-15
Purpose: To evaluate the comparative dosimetric efficacy between field and field 3DCRT(FnF), multiple field Intensity modulated radiotherapy (SnS IMRT) and, partial arc volumetric modulated arc therapy (VMAT) in case of post operative left side breast and chest wall irradiation. Methods: CT study set of fifteen post-operative left breast and chest wall patient was tested for a treatment plan of 50Gy in 25 fraction using partial arc VMAT, SnSIMRT and tangential beam 3DCRT . 3DCRT FnF gantry angle was ranging for left medial tangential 290±17{sup 0} and Lt lateral tangential l14°±12{sup 0}. For IMRT four fixed beam at gantry angle G130{supmore » 0} G110{sup 0} G300{sup 0} and G330{sup 0} was used, in case of insufficient dose another beam G150{sup 0} was added. In case of partial arc VMAT, lateral tangential arc G130{sup 0}-G100{sup 0} and medial tangential arc G280{sup 0}-G310{sup 0}. Inverse optimization was opted to cover at least 95%PTV by 95% prescription dose (RxD) and a strong weightage on reduction of heart and lung dose. PTV coverage was evaluated for it’s clinically acceptability depending on the tumor spatial location and its quadrant. Out of the three plans, any one was used for the actual patient treatment. Results: Dosimetric analysis done for breast PTV, left lung, heart and the opposite breast. PTV mean dose and maximum dose was 5129.8±214.8cGy, 4749.0±329.7cGy, 5024.6±73.4cGy and 5855.2±510.7cGy, 5340.7±146.1cGy, 5347.2±196.8cGy for FnF, VMAT and IMRT respectively. Ipsilateral lung volume receiving 20Gy and 5Gy was 23.6±9.5cGy and 32.7±10.3cGy for FnF, 18.6±8.7cGy and 38.8±15.2cGy for VMAT and 25.7±9.6cGy and 50.7±8.4cGy for IMRT respectively. Heart mean and 2cc dose was 867.9±456.7cGy and 5038.5±184.3cGy for FnF, 532.6±263cGy and 3632.1±990.6 for VMAT, 711±229.9cGy and 4421±463.7cGy for IMRT respectively. VMAT shows minimum contralateral breast dose 168±113.8cGy. Conclusion: VMAT shows a better tumor conformity, minimum heart, ipsilateral lung and opposite breast dose. Cardiac Toxicity and risk of contralateral breast cancer can be reduce using VMAT.« less
Association of genetic variants and expression levels of porcine FABP4 and FABP5 genes.
Ballester, M; Puig-Oliveras, A; Castelló, A; Revilla, M; Fernández, A I; Folch, J M
2017-12-01
The FABP4 and FABP5 genes, coding for fatty acid transport proteins, have long been studied as positional candidate genes for SSC4 QTL affecting fat deposition and composition traits in pigs. Polymorphisms in these genes, FABP4:g.2634_2635insC and FABP5:g.3000T>G, have previously been associated with fatness traits in an Iberian by Landrace cross (IBMAP). The aim of the present work was to evaluate the functional implication of these genetic variants. For this purpose, FABP4 and FABP5 mRNA expression levels in 114 BC1_LD animals (25% Iberian × 75% Landrace) were analyzed using real-time quantitative PCR in backfat and muscle. FABP4 gene expression in backfat, but not in muscle, was associated with FABP4:g.2634_2635insC. In contrast, FABP5:g.3000T>G was not associated with gene expression levels. An expression-based genome-wide association study highlighted the FABP4:g.2634_2635insC polymorphism as the polymorphism most associated with FABP4 gene expression in backfat. Furthermore, other genomic regions associated in trans with the mRNA expression of FABP4 in backfat and FABP5 in muscle were also identified. Finally, two putative transcription binding sites for PPARG and NR4A2 may be affected by the FABP4:g.2634_2635insC polymorphism, modifying FABP4 gene expression. Our results reinforce FABP4 as a candidate gene for fatness traits on SSC4. © 2017 Stichting International Foundation for Animal Genetics.
VizieR Online Data Catalog: C/2012 F6 (Lemmon) and C/2013 R1 (Lovejoy) spectra (Biver+, 2014)
NASA Astrophysics Data System (ADS)
Biver, N.; Bockelee-Morvan, D.; Debout, V.; Crovisier, J.; Boissier, J.; Lis, D. C.; Dello Russo, N.; Moreno, R.; Colom, P.; Paubert, G.; Vervack, R.; Weaver, H. A.
2014-06-01
Sum spectra of the lines of formamide and ethylene-glycol which intensities are listed in Tables 4 and 5. One fits file per spectrum, fits output from class (http://www.iram.fr/IRAMFR/GILDAS/). object.dat : -------------------------------------------------------------------------------- Code Name Elem q e i H1 d AU deg mag -------------------------------------------------------------------------------- C/2012 F6 Lemmon 2456375.5 0.7312461 0.9985125 82.607966 7.96 C/2013 R1 Lovejoy 2456651.5 0.8118182 0.9983297 64.040457 11.66 (2 data files).
Xu, Zhengren; Wang, Qian; Zhu, Jieping
2015-05-27
Enantioselective total syntheses of title natural products from a common cyclohexenone derivative (S)-18 were reported. Ozonolysis of (S)-18 afforded a stable diketo ester (R)-17 that was subsequently converted to two skeletally different natural products, i.e., (-)-mersicarpine (8) with a [6.5.6.7] fused tetracyclic ring system and (-)-scholarisine G (9) with a [6.5.6.6.5] fused pentacyclic skeleton, respectively. The postcyclization diversification was realized by taking advantage of the facile conversion of (+)-melodinine E (6) to N-acyliminium ion 7, from which a hydroxy group was selectively introduced to the C6, C7, C10 and the central C21 position of diazafenestrane system, leading to (-)-leuconodine A (11), (+)-leuconodine F (12), (-)-scholarisine G (9), (-)-leuconodine C (13), and skeletally different (-)-leuconolam (5). Furthermore, an unprecedented non-natural oxabridged oxadiazafenestrane 68 was formed by oxidation of (+)-melodinine E (6). During the course of this study, a strong self-induced diastereomeric anisochronism (SIDA) phenomenon was observed for scholarisine G (9), leuconodines A (11) and C (13). X-ray structures of both the racemic and the enantiopure natural products 9, 11, and 13 were obtained. The different crystal packing of these two forms nicely explained the chemical shift differences observed in the (1)H NMR spectra of the racemic and the enantio-enriched compounds in an achiral environment.
Recombinant Hepatitis E virus like particles can function as RNA nanocarriers.
Panda, Subrat Kumar; Kapur, Neeraj; Paliwal, Daizy; Durgapal, Hemlata
2015-06-24
Assembled virus-like particles (VLPs) without genetic material, with structure similar to infectious virions, have been successfully used as vaccines. We earlier described in vitro assembly, characterisation and tissue specific receptor dependent Clathrin mediated entry of empty HEV VLPs, produced from Escherichia coli expressed HEV capsid protein (pORF2). Similar VLP's have been described as a potential candidate vaccine (Hecolin) against HEV. We have attempted to use such recombinant assembled Hepatitis E virus (HEV) VLPs as a carrier for heterologous RNA with protein coding sequence fused in-frame with HEV 5' region (containing cap and encapsidation signal) and investigated, if the relevant protein could be expressed and elicit an immune response in vivo. In vitro transcribed red fluorescent protein (RFP)/Hepatitis B virus surface antigen (HBsAg) RNA, fused to 5'-HEV sequence with cap and encapsidation signal (1-249 nt), was packaged into the recombinant HEV-VLPs and incubated with five different cell lines (Huh7, A549, Vero, HeLa and SiHa). The pORF2-VLPs could specifically transfer exogenous coding RNA into Huh7 and A549 cells. In vivo, Balb/c mice were immunized (intramuscular injections) with 100 µg pORF2-VLP encapsidated with 5'-methyl-G-HEV (1-249 nt)-HBsAg RNA, blood samples were collected and screened by ELISA for anti-pORF2 and anti-HBsAg antibodies. Humoral immune response could be elicited in Balb/c mice against both HEV capsid protein and cargo RNA encoded HBsAg protein. These findings suggest that other than being a possible vaccine, HEV pORF2-VLPs can be used as a promising non-replicative tissue specific gene delivery system.
The effect of storage conditions on the hygiene and sensory status of wild boar meat.
Borilova, G; Hulankova, R; Svobodova, I; Jezek, F; Hutarova, Z; Vecerek, V; Steinhauserova, I
2016-08-01
The aim of this study was to compare hygiene status of wild boar meat (shoulder and leg) stored up to 21days at 0°C, 7°C or 15°C. The microbial counts increased gradually in the expected sequence of increasing storage temperatures, with TVC at the end of storage ranging from approx. 2logCFU/g (0°C) to 5logCFU/g (15°C). The lactic acid bacteria and psychrotrophic microflora didn't exceed 2logCFU/g and 2.5logCFU/g, respectively. Whereas odor of the meat stored at 0°C and 7°C was still acceptable at the end of storage, the odor of the meat stored at 15°C was barely acceptable after only 7d of storage and also the content of ammonia was significantly higher. Game meat obtained from animals hunted in the correct way and stored at low temperatures had good microbiological and hygiene status which could be maintained for more than 15days of storage. Copyright © 2016 Elsevier Ltd. All rights reserved.
Control of Salmonella enterica and Listeria monocytogenes in hummus using allyl isothiocyanate.
Olaimat, Amin N; Al-Holy, Murad A; Abu Ghoush, Mahmoud; Al-Nabulsi, Anas A; Holley, Richard A
2018-08-02
Hummus (chickpea dip) is a ready-to-eat product which has been implicated in several foodborne outbreaks and food recalls. This study aimed to screen the antimicrobial activity of allyl isothiocyanate (AITC) against 5 strains of each of Salmonella enterica and Listeria monocytogenes using a disc diffusion method. Additionally, the antimicrobial activity of 0.1-1.5% (v/w) AITC against both pathogens and aerobic bacteria in hummus was also investigated. The inhibition zones of AITC were 8.5-15 and 7.0-8.5 mm against the S. enterica and L. monocytogenes strains, respectively, at 37 °C. S. enterica numbers were reduced by >6 log 10 CFU/g in hummus containing ≥0.5% AITC by 3 days at both 4 and 10 °C. While 0.1-0.25% AITC reduced S. enterica by 2.5-5.1 log 10 CFU/g at 4 °C or by 4.7-6.0 log 10 CFU/g at 10 °C by 10 days. Similarly, L. monocytogenes numbers decreased by >6 log 10 CFU/g in hummus with ≥0.5% or ≥1.0% AITC at 4 or 10 °C, respectively, by 3 days. Further, 0.25% AITC significantly reduced L. monocytogenes in hummus by 2.7 and 4.3 log 10 CFU/g at 4 and 10 °C, respectively. Moreover, 0.1% AITC reduced L. monocytogenes by 1.8 log 10 CFU/g in hummus at 10 °C and inhibited the growth at 4 °C for up to 10 days. The aerobic bacterial count also significantly decreased in un-inoculated hummus treated with 1.0-1.5% AITC at both 4 and 10 °C, while a concentration of 0.25-0.5% AITC inhibited their growth at 4 °C. AITC can be used to reduce the risk of salmonellosis or listeriosis in hummus and extend its shelf-life. Copyright © 2018 Elsevier B.V. All rights reserved.
Coordinated Research Program in Pulsed Power Physics.
1985-12-20
8217). Stale. and ZIP Code) 10 SOURCE OF FUNDING NOS. PROGRAM PROJECT TASK WORK UNIT ELE ME NT NO. NO. NO. No. 11.?ILE.ic.ecufC~sjf~aton 1 c 61102F 2301 A7 12...SYMBOLI lncludr Arra Code) 5" Major B. Smith j202/767-4908 AFOSR/NP FORM 1473. E3 APR EDITION OF I..AN 73 IS OBeCLETE Unclassified SEC A17 C! ww...fields at localized points in pulsed power systems*. In addition, as in previous years, new projects will be added as new ideas are generated. Funds for
Guo, Qian-Liang; Su, Hua-Fei; Wang, Ning; Liao, Sheng-Rong; Lu, Yu-Ting; Ou, Tian-Miao; Tan, Jia-Heng; Li, Ding; Huang, Zhi-Shu
2017-04-21
It has been shown that treatment of cancer cells with c-KIT G-quadruplex binding ligands can reduce their c-KIT expression levels thus inhibiting cell proliferation and inducing cell apoptosis. Herein, a series of new 7-substituted-5,6-dihydrobenzo[c]acridine derivatives were designed and synthesized. Subsequent biophysical evaluation demonstrated that the derivatives could effectively bind to and stabilize c-KIT G-quadruplex with good selectivity against duplex DNA. It was found that 12-N-methylated derivatives with a positive charge introduced at 12-position of 5,6-dihydrobenzo[c]acridine ring had similar binding affinity but lower stabilizing ability to c-KIT G-quadruplex DNA, compared with those of nonmethylated derivatives. Further molecular modeling studies showed possible binding modes of G-quadruplex with the ligands. RT-PCR assay and Western blot showed that compound 2b suppressed transcription and translation of c-KIT gene in K562 cells, which was consistent with the property of an effective G-quadruplex binding ligand targeting c-KIT oncogene promoter. Further biological evaluation showed that compound 2b could induce apoptosis through activation of the caspase-3 cascade pathway. Copyright © 2017 Elsevier Masson SAS. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wheeler, E.F.; Roussel, M.F.; Hampe, A.
1986-08-01
The nucleotide sequence of a 5' segment of the human genomic c-fms proto-oncogene suggested that recombination between feline leukemia virus and feline c-fms sequences might have occurred in a region encoding the 5' untranslated portion of c-fms mRNA. The polyprotein precursor gP180/sup gag-fms/ encoded by the McDonough strain of feline sarcoma virus was therefore predicted to contain 34 v-fms-coded amino acids derived from sequences of the c-fms gene that are not ordinarily translated from the proto-oncogene mRNA. The (gP180/sup gag-fms/) polyprotein was cotranslationally cleaved near the gag-fms junction to remove its gag gene-coded portion. Determination of the amino-terminal sequence ofmore » the resulting v-fms-coded glycoprotein, gp120/sup v-fms/, showed that the site of proteolysis corresponded to a predicted signal peptidase cleavage site within the c-fms gene product. Together, these analyses suggested that the linked gag sequences may not be necessary for expression of a biologically active v-fms gene product. The gag-fms sequences of feline sarcoma virus strain McDonough and the v-fms sequences alone were inserted into a murine retroviral vector containing a neomycin resistance gene. The authors conclude that a cryptic hydrophobic signal peptide sequence in v-fms was unmasked by gag deletion, thereby allowing the correct orientation and transport of the v-fms was unmasked by gag deletion, thereby allowing the correct orientation and transport of the v-fms gene product within membranous organelles. It seems likely that the proteolytic cleavage of gP180/gag-fms/ is mediated by signal peptidase and that the amino termini of gp140/sup v-fms/ and the c-fms gene product are identical.« less
Complete genome sequence of Enterobacter aerogenes KCTC 2190.
Shin, Sang Heum; Kim, Sewhan; Kim, Jae Young; Lee, Soojin; Um, Youngsoon; Oh, Min-Kyu; Kim, Young-Rok; Lee, Jinwon; Yang, Kap-Seok
2012-05-01
This is the first complete genome sequence of the Enterobacter aerogenes species. Here we present the genome sequence of E. aerogenes KCTC 2190, which contains 5,280,350 bp with a G + C content of 54.8 mol%, 4,912 protein-coding genes, and 109 structural RNAs.
Benkeblia, Noureddine; Onodera, Shuichi; Yoshihira, Taiki; Kosaka, Shinichi; Shiomi, Norio
2004-06-01
The activity of soluble invertase, and the variation in glucose, fructose and sucrose contents in onion bulbs (Allium cepa) during long-term storage at 10 degrees C and 20 degrees C were investigated. Invertase activity increased progressively after 8 weeks to 0.084 and 0.092 nkat/g fresh weight (FW), then sharply to 0.29 and 0.35 nkat/g FW at 20 degrees C and 10 degrees C, respectively, and remained high during 5 weeks. Then, activity decreased abruptly to 0.039 and 0.041 nkat/g, and remained low during the last 8 weeks and close to that observed initially. Glucose increased to 17.73 and 14.62 mg/g FW after 4 weeks at 20 degrees C and 10 degrees C, respectively, then decreased sharply between week 5 and week 7 to 4.13 and 4.91 mg/g FW, respectively, and remained rather stable ranging from 9 and 10 mg/g FW at both temperatures. Fructose showed a similar pattern and was 14.8 and 21.68 mg/g FW at 20 degrees C and 10 degrees C, respectively. Between week 10 and week 24, fructose ranged from 5 and 6 mg/g FW, and from 6 and 7 mg/g FW at 20 degrees C and 10 degrees C, respectively. Sucrose increased to 19.63 and 14.43 mg/g FW at 20 degrees C and 10 degrees C, respectively, decreased during 3 weeks, and then increased randomly from 5.69 to 9.42 mg/g FW at 20 degrees C, but remained in a steady state at 10 degrees C ranging 5.03 +/- 0.78 mg/g FW. During the last 6 weeks, the sucrose content was higher at 20 degrees C than at 10 degrees C. The fructose-glucose ratio varied during the first 8 weeks but remained at a steady level during the last 16 weeks. The (glucose+fructose)/sucrose ratio increased randomly at 10 degrees C, whereas at 20 degrees C the ratio increased during 10 weeks then decreased progressively during the final 14 weeks.
Stehly, G.R.; Meinertz, J.R.; Gingerich, W.H.
2000-01-01
The effect of temperature (7 degrees C and 16 degrees C) on the extent of accumulation and the elimination of benzocaine (BNZ) and its metabolite, acetylated benzocaine (AcBNZ), in the fillet tissue of rainbow trout was investigated Residues were measured after bath exposure to an anesthetizing concentration of benzocaine (30 mg/l for 5 min) followed by a maintenance concentration (15 mg/l for 30 min). Immediately after exposure, the BNZ concentration in fillet tissue was approximately 27 mu g/g at both temperatures; AcBNZ was 0.3 mu g/g at 7 degrees C and 0.6 mu g/g at 16 degrees C. The rates for elimination (alpha and beta) of BNZ and AcBNZ were not significantly different between the two temperatures. Terminal half-lives of elimination for BNZ were 1.62 h at 7 degrees C and 1.63 h at 16 degrees C; half-lives for AcBNZ were 2.36 h at 7 degrees C and 2.77 h at 16 degrees C.
Picosecond Nonlinear Resonant Interactions in Semiconductors.
1986-03-01
8217 ON PE00O *AUMES A f~?TR. 84 % % AV w, DCA .0 t Z~ amMS N % DC% -i S-A,%G ’- Z.- _ if pe’scov’ 6C. A0CORESS ’Cif, staff and lip Code 7b ADDRESS -C...ROM 01Jan83 To~lPec 8 3 11’ 16. SUPPLEMENTARY NO0TATION 117 COSATI COOES 1It SUBJECT TERMS lContinue on muert 4f "acemaviiY and ideiffifiY by biock
Atmospheric Transmittance/Radiance: Computer Code LOWTRAN 4
1978-02-28
LOWE 74~ A 4L p~i l A 41 C MI=CbgASEAVEQ ALT ITUDE ( kM) LUO ?F bO A 43- C, HT:’=PLPCE At I I 1( 0KI ( KIM) LOWE iTA A 4.3 C ANGLE: 7ENUNH ANriE AT...ANMr, td 400 21’ , 5P9 1- SPHI/P" ANG4 2410 C 2 191 0:05 151RPM I) ANCL . C’ 9 c GO To IANGL 430 2301 5 OtýT 1 -:BEI t ANGI27440O 薷 L *- ANGI
Draft Genome Sequence of Mycobacterium neoaurum Strain DSM 44074T.
Phelippeau, Michael; Robert, Catherine; Croce, Olivier; Raoult, Didier; Drancourt, Michel
2014-07-10
We report the draft genome sequence of Mycobacterium neoaurum strain DSM 44074(T), a nontuberculosis species responsible for opportunistic infections in immunocompromised patients. The strain described here is composed of 5,536,033 bp, with a G+C content of 66.24%, and carries 5,274 protein-coding genes and 72 RNA genes. Copyright © 2014 Phelippeau et al.
Mahan, Kristina M; Klingeman, Dawn M; Hettich, Robert L; Parry, Ronald J; Graham, David E
2016-01-21
Streptomyces vitaminophilus produces pyrrolomycins, which are halogenated polyketide antibiotics. Some of the pyrrolomycins contain a rare nitro group located on the pyrrole ring. The 6.5-Mbp genome encodes 5,941 predicted protein-coding sequences in 39 contigs with a 71.9% G+C content. Copyright © 2016 Mahan et al.
Moghadam, Mortez Mohammadzadeh; Amiri, Mostafa; Riabi, Hamed Ramezani Awal; Riabi, Hamid Ramezani Awal
2016-12-01
The presence of antibiotic residues in milk and other products livestock is a health problem which can endanger public health. Antibiotics are used widely in animal husbandry to treat diseases related to bacterial infections. Antimicrobial drugs have been in use for decades in industry. They are commonly used in livestock facilities to treat mastitis. This study aimed to investigate antibiotic residues in pasteurized milk distributed in schools, in milk collection centers, and in milk production factories in Gonabad city. This cross-sectional study was conducted on 251 samples of commercial pasteurized milk packet distributed in schools (code A), raw milk collection centers in Gonabad city (code B), and pasteurized milk production factories (code C) in Gonabad city. The Copan test kit of Denmark Christian Hansen Company was used to monitor antibiotic residues in milk. The data were analysed employing Chi-square test and one-way analysis of variance (ANOVA) to determine significant differences using SPSS software version 20. The significant level was considered at p<0.05. In total, 251 milk samples were collected out of which 143 (57%) were code A, 84 (33.5%) code B and 24 (9.6%) code C. Total number of 189 samples (75.2%) were negative and 62 (24.8%) were positive. From the three types of milk samples, 41 samples (28.7%) of the code A, 18 samples (21.4%) of the code B and 3 samples (12.5%) of the code C were positive. In general, from the milk samples most contaminated with antibiotics, 17 samples were positive in January and regarding code A, 13 samples were positive in the same month. There was not a significant difference among the three types of milk (p>0.05). The highest number of milk samples (n=7) contaminated with antibiotics were related to code B (38.5%). Most positive cases were related to code A in winter. Also, there was no significant difference among the three types of contaminated milk regarding the year and month (p=0.164 and p=0.917, respectively). Pasteurized milk supplied in the studied city has high level of contamination due to high use of antibiotics. A standard limit needs to be set for the right level of residue of antibiotics in milk to avoid the harmful effects.
Moghadam, Mortez Mohammadzadeh; Amiri, Mostafa; Riabi, Hamid Ramezani Awal
2016-01-01
Introduction The presence of antibiotic residues in milk and other products livestock is a health problem which can endanger public health. Antibiotics are used widely in animal husbandry to treat diseases related to bacterial infections. Antimicrobial drugs have been in use for decades in industry. They are commonly used in livestock facilities to treat mastitis. Aim This study aimed to investigate antibiotic residues in pasteurized milk distributed in schools, in milk collection centers, and in milk production factories in Gonabad city. Materials and Methods This cross-sectional study was conducted on 251 samples of commercial pasteurized milk packet distributed in schools (code A), raw milk collection centers in Gonabad city (code B), and pasteurized milk production factories (code C) in Gonabad city. The Copan test kit of Denmark Christian Hansen Company was used to monitor antibiotic residues in milk. The data were analysed employing Chi-square test and one-way analysis of variance (ANOVA) to determine significant differences using SPSS software version 20. The significant level was considered at p<0.05. Results In total, 251 milk samples were collected out of which 143 (57%) were code A, 84 (33.5%) code B and 24 (9.6%) code C. Total number of 189 samples (75.2%) were negative and 62 (24.8%) were positive. From the three types of milk samples, 41 samples (28.7%) of the code A, 18 samples (21.4%) of the code B and 3 samples (12.5%) of the code C were positive. In general, from the milk samples most contaminated with antibiotics, 17 samples were positive in January and regarding code A, 13 samples were positive in the same month. There was not a significant difference among the three types of milk (p>0.05). The highest number of milk samples (n=7) contaminated with antibiotics were related to code B (38.5%). Most positive cases were related to code A in winter. Also, there was no significant difference among the three types of contaminated milk regarding the year and month (p=0.164 and p=0.917, respectively). Conclusion Pasteurized milk supplied in the studied city has high level of contamination due to high use of antibiotics. A standard limit needs to be set for the right level of residue of antibiotics in milk to avoid the harmful effects. PMID:28208877
NASA Astrophysics Data System (ADS)
Siregar, N.; Indrayana, I. P. T.; Suharyadi, E.; Kato, T.; Iwata, S.
2017-05-01
Mn0.5Zn0.5Fe2O4 nanoparticles have been successfully synthesized through coprecipitation method by varying NaOH concentrations from 0.5 M to 6 M and synthesis temperatures from 30 to 120 °C. The X-ray diffraction (XRD) pattern indicates samples consisting of multiphase structures such as spinel of Mn0.5Zn0.5Fe2O4, α-MnO2, ZnO, λ-MnO2, and γ-Fe2O3. The crystallite size of Mn0.5Zn0.5Fe2O4 is in the range of 14.1 to 26.7 nm. The Transmission electron microscope (TEM) image shows that sample was agglomerate. The hysteresis loops confirm that nanoparticles are soft magnetic materials with low coercivity (H c) in the range of 45.9 to 68.5 Oe. Those values increased relatively with increasing particles size. For NaOH concentration variation, the maximum magnetization of the sample increased from 10.4 emu/g to 11.6 emu/g with increasing ferrite content. Meanwhile, the maximum magnetization increased from 7.9 to 15.7 emu/g for samples with various synthesis temperature. The highest coercivity of 68.5 Oe was attained for a sample of 6 M NaOH under 90 °C. The highest magnetization of 15.7 emu/g was achieved for a sample of 1.5 M NaOH under 120 °C caused by the maximum crystallinity of sample.
Xia, Dan; Zhang, Mengxiang; Shi, Gaoxiang; Xu, Zhiqing; Wu, Daqiang; Shao, Jing; Wang, Tianming; Wang, Changzhong
2016-02-01
To explore the possible regulatory effect of Pulsatilla decoction on Th17 cells and inflammatory cytokines of vulvovaginal candidiasis (VVC) mice. Seventy-two female Kunming mice were randomly assigned into six groups: a blank control group, a VVC model group, a fluconazole group and three Pulsatilla decoction groups (dose levels: 22.5, 15.0 and 7.5 g/kg, respectively). The VVC mouse models were established by vaginal inoculation with Candida albicans (C. albicans) in female mice in pseudoestrus state caused by estradiol injection. After 7-day treatment on VVC mice, the vaginal C. albicans burden was assessed using dilution spread plate method; the vaginal C. albicans morphology was observed by Gram staining method; the levels of interleukin 6 (IL-6), IL-17, IL-21 and tumor necrosis factor α (TNF-α) in sera were detected by ELISA. The content of the transcription factor retinoid related orphan receptor gamma t (RORγt) in vaginal tissues was detected by immunohistochemistry. The VVC mouse models were successfully developed. After treatment, the vaginal C. albicans burden of the fluconazole group and 22.5 g/kg Pulsatilla decoction group dropped significantly compared with that of the VVC model group. Gram staining showed that the VVC mice had lots of C. albicans hyphae in vaginal discharge, that 7.5 g/kg Pulsatilla decoction group remained the mycelia-phase C. albicans, and that 15.0 g/kg Pulsatilla decoction group had the majority of yeast-phase C. albicans and a few of mycelia-phase, while no hyphae and only very few of yeast-phase C. albicans were observed in 22.5 g/kg Pulsatilla decoction group and fluconazole group. After 7-day treatment, compared with the model group, the levels of IL-6, IL- 17, IL-21 and TNF-α in the sera of the fluconazole group, 15.0 and 22.5 g/kg Pulsatilla decoction groups were reduced significantly and the levels of RORγt in the vaginal tissues of the fluconazole group, 15.0 and 22.5 g/kg Pulsatilla decoction groups also decreased significantly. Pulsatilla decoction could inhibit the proliferation of vulvovaginal C. albicans and reduces the levels of inflammatory cytokines in VVC mice.
Smoothing Technique and Variance Propagation for Abel Inversion of Scattered Data
1977-04-01
42 42 44 44 46 46 26 27 29 32 33 35 36 37 39 4 AE DC-TR-76 -163 10, Input Data Defining a Curve with a Sudden...1.000000 E-02 -1.00O000 E-02 35 A E D C - T R - 7 6 - 1 6 3 As a further examination of the technique, the 31 ordinates generated from the function of...TI h -Ol 7. 889482 E-02 5. C~0000 K - 0 ) 7. ?15975 E - 0 I 5.531891 E-90 4 .59 .~ 35 E-C1 5.24~1~0 ~ -02 G. OO0000 E - 0 ) G. 78:933 E-OI -2
Genome Sequence of Thalassospira xiamenensis Type Strain M-5
Lai, Qiliang
2012-01-01
Thalassospira xiamenensis M-5T was isolated from the surface water of a waste oil pool at the oil storage dock in the city of Xiamen, Fujian Province, China. Here, we present the draft genome of strain M-5T, which contains 4,705,237 bp with a G+C content of 54.65% and contains 4,343 protein-coding genes and 46 tRNA genes. PMID:23209216
Ivancic-Jelecki, Jelena; Slovic, Anamarija; Šantak, Maja; Tešović, Goran; Forcic, Dubravko
2016-07-29
The canonical genome organization of measles virus (MV) is characterized by total size of 15 894 nucleotides (nts) and defined length of every genomic region, both coding and non-coding. Only rarely have reports of strains possessing non-canonical genomic properties (possessing indels, with or without the change of total genome length) been published. The observed mutations are mutually compensatory in a sense that the total genome length remains polyhexameric. Although programmed and highly precise pseudo-templated nucleotide additions during transcription are inherent to polymerases of all viruses belonging to family Paramyxoviridae, a similar mechanism that would serve to non-randomly correct genome length, if an indel has occurred during replication, has so far not been described in the context of a complete virus genome. We compiled all complete MV genomic sequences (64 in total) available in open access sequence databases. Multiple sequence comparisons and phylogenetic analyses were performed with the aim of exploring whether non-recombinant and non-evolutionary linked measles strains that show deviations from canonical genome organization possess a common genetic characteristic. In 11 MV sequences we detected deviations from canonical genome organization due to short indels located within homopolymeric stretches or next to them. In nine out of 11 identified non-canonical MV sequences, a common feature was observed: one mutation, either an insertion or a deletion, was located in a 28 nts long region in F gene 5' untranslated region (positions 5051-5078 in genomic cDNA of canonical strains). This segment is composed of five tandemly linked homopolymeric stretches, its consensus sequence is G6-7C7-8A6-7G1-3C5-6. Although none of the mononucleotide repeats within this segment has fixed length, the total number of nts in canonical strains is always 28. These nine non-canonical strains, as well as the tenth (not mutated in 5051-5078 segment), can be grouped in three clusters, based on their passage histories/epidemiological data/genetic similarities. There are no indications that the 3 clusters are evolutionary linked, other than the fact that they all belong to clade D. A common narrow genomic region was found to be mutated in different, non-related, wild type strains suggesting that this region might have a function in non-random genome length corrections occurring during MV replication.
38 CFR 14.804 - Factors to consider.
Code of Federal Regulations, 2011 CFR
2011-07-01
... against disclosure, disclosure will not be made. Examples of such statutes are the Privacy Act, 5 U.S.C. 552a, and sections 5701, 5705 and 7332 of title 38, United States Code.); (g) Whether the testimony or... national security interests, hamper VA or private health care research activities, reveal sensitive patient...
38 CFR 14.804 - Factors to consider.
Code of Federal Regulations, 2010 CFR
2010-07-01
... against disclosure, disclosure will not be made. Examples of such statutes are the Privacy Act, 5 U.S.C. 552a, and sections 5701, 5705 and 7332 of title 38, United States Code.); (g) Whether the testimony or... national security interests, hamper VA or private health care research activities, reveal sensitive patient...
38 CFR 14.804 - Factors to consider.
Code of Federal Regulations, 2012 CFR
2012-07-01
... against disclosure, disclosure will not be made. Examples of such statutes are the Privacy Act, 5 U.S.C. 552a, and sections 5701, 5705 and 7332 of title 38, United States Code.); (g) Whether the testimony or... national security interests, hamper VA or private health care research activities, reveal sensitive patient...
1984-02-01
Additive Particle Size Propellant Binder Oxidizer Metal Mean Metal Diameter, Designation % Weight % Weight* % Weight Microns WGS-5A HTPB 12 AP 83 AL 5 75...88 4 WGS-6A HTPB 12 AP 83 AL 5 45-62 WGS-7A HTPB 12 AP 83 AL 5 23-37 WGS-7 HTPB 12 AP 83 AL 5 6-7 WGS-9 HTPB 12 AP 78 AL 10 23-27 WGS-1O HTPB 12 AP 73...AL 15 23-27 WGS-ZrC HTPB 14 AP 84 ZrC 2 23, irregularly shaped WGS-G HTPB 14 AP 84 G 2 50x20x7, flakes * 65% 180 jim/35% 26 tim These propellants
Structure and Biochemestry of Laccases from the Lignin-Degrading Basidiomycete, Ganoderma lucidum
DOE Office of Scientific and Technical Information (OSTI.GOV)
C.A.Reddy, PI
2005-06-30
G. lucidum is one of the most important and widely distributed ligninolytic white rot fungi from habitats such as forest soils, agricultural soils, and tropical mangrove ecosystems and produce laccases as an important family of lignin modifying enzymes. Biochemically, laccases are blue multi copper oxidases that couple four electron reduction of molecular oxygen to water. There is a growing interest in the use of laccases for a variety of industrial applications such as bio-pulping and biobleaching as well as in their ability to detoxify a wide variety of toxic environmental pollutants. These key oxidative enzymes are found in all themore » three domains of life: Eukaryota. Prokarya, and Archaea. Ganoderma lucidum (strain no.103561) produces laccase with some of the highest activity (17,000 micro katals per mg of protein) reported for any laccases to date. Our results showed that this organism produces at least 11 different isoforms of laccase based on variation in mol. weight and/or PI. Our Studies showed that the presence of copper in the medium yields 15- to 20-fold greater levels of enzyme by G. lucidum. Dialysation of extra cellular fluid of G. lucidum against 10mM sodium tartrate (pH5.5) gave an additional 15 to 17 fold stimulation of activity with an observed specific activity of 17,000 {micro}katals/mg protein. Dialysis against acetate buffer gave five fold increase in activity while dialysis against glycine showed inhibition of activity. Purification by FPLC and preparative gel electrophoresis gave purified fractions that resolved into eleven isoforms as separated by isoelectric focusing, and the PI,s were 4.7, 4.6, 4.5, 4.3, 4.2, 4.1, 3.8, 3.7, 3.5, 3.4 and 3.3. Genomic clones of laccase were isolated using G. lucidum DNA as a template and using inverse PCR and forward/reverse primers corresponding to the sequences of the conserved copper binding region in the N-terminal domain of one of the laccases of this organism. Inverse PCR amplication of HindIII digested and ligated G.lucidum DNA was done using ABI Geneamp XL PCR kit in Ribocycler. The 5 conserved copper binding region of laccase was used for designing forward primer (5TCGACAATTCTTTCCTGTACG3) and reverse primer (5 TGGAGATGGG ACACT GGCTTATC 3). The PCR profile was 95 C for 3min, 94 C for 1min, 57 C for 30 sec and 68 C for 5min. for 30 cycles, and the final extension was at 72 C for 10min. The resulting {approx}2.7 Kb inverse PCR fragment was cloned into ZERO TOPOII blunt ligation vector (INVITROGEN) and screened on Kanamycin plates. Selected putative clones containing inserts were digested with a battery of restriction enzymes and analyzed on 1% agarose gels. Restriction digestion of these clones with BamHI, PstI, SalI, PvuII, EcoRI, and XhoI revealed 8 distinct patterns suggesting gene diversity. Two clones were sequenced using overlapping primers on ABI system. The sequences were aligned using Bioedit program. The aa sequences of the clones were deduced by Genewise2 program using Aspergillus as the reference organism. Eukaryotic gene regulatory sequences were identified using GeneWise2 Program. Laccase sequence alignments and similarity indexes were calculated using ClustalW and BioEdit programs. Blast analysis of two distinct BamHI clones, lac1 and lac4, showed that the proteins encoded by these clones are fungal laccase sequences. The coding sequence of lac1gene is interrupted by 6 introns ranging in size from 37-55 nt and encodes a mature protein consisting of 456 aa (Mr: 50,160), preceded by a putative 37-aa signal sequence. This predicted Mr is in agreement with the range of Mrs previously reported by us for the laccases of G. lucidum. The deduced aa sequence of LAC1 showed relatively high degree of homology with laccases of other basidiomycetes. It showed 96% homology to full-length LAC4 protein and 47-53% similarity to unpublished partial laccase sequences of other G. lucidum strains. Among the other basidiomycete laccases, LAC1 showed the highest similarity of 53-55% to Trametes versicolorLAC3 and LAC4. The consensus copper-binding domains found in other basidiomycete laccases are conserved in the LAC1 protein of G.lucidum. Eight putative N-glycosylation sites as well as consensus eukaryotic promoter sequence and polyadenylation signal sequences are also found. Coding sequence of lac4 is interrupted by 7 introns, encodes a mature protein of 525aa (Mr: 57,750), and has 98% nt homology to lac1, but was otherwise identical. Molecular masses of GLAC1 and GLAC4 were 49.8 kDa (462aa) and 52.5 kDa (524aa) in comparison to T. versicolr laccase which was 56.3 kDa (524aa). Predicted PI values of GLAC1, GLAC4 and T. versicolor laccase are, respectively 4.5, 4.7, and 4.2. Eight other laccase clones, distinct from lac1 and lac4 have recently been isolated from G. lucidum Our results show the existence of a laccase multi-gene family in G. lucidum in agreement with our earlier results showing multiple isoforms of laccase in this organism.« less
Sedlackova, Lenka; Perkins, Keith D; Meyer, Julia; Strain, Anna K; Goldman, Oksana; Rice, Stephen A
2010-03-01
During productive herpes simplex virus type 1 (HSV-1) infection, a subset of viral delayed-early (DE) and late (L) genes require the immediate-early (IE) protein ICP27 for their expression. However, the cis-acting regulatory sequences in DE and L genes that mediate their specific induction by ICP27 are unknown. One viral L gene that is highly dependent on ICP27 is that encoding glycoprotein C (gC). We previously demonstrated that this gene is posttranscriptionally transactivated by ICP27 in a plasmid cotransfection assay. Based on our past results, we hypothesized that the gC gene possesses a cis-acting inhibitory sequence and that ICP27 overcomes the effects of this sequence to enable efficient gC expression. To test this model, we systematically deleted sequences from the body of the gC gene and tested the resulting constructs for expression. In so doing, we identified a 258-bp "silencing element" (SE) in the 5' portion of the gC coding region. When present, the SE inhibits gC mRNA accumulation from a transiently transfected gC gene, unless ICP27 is present. Moreover, the SE can be transferred to another HSV-1 gene, where it inhibits mRNA accumulation in the absence of ICP27 and confers high-level expression in the presence of ICP27. Thus, for the first time, an ICP27-responsive sequence has been identified in a physiologically relevant ICP27 target gene. To see if the SE functions during viral infection, we engineered HSV-1 recombinants that lack the SE, either in a wild-type (WT) or ICP27-null genetic background. In an ICP27-null background, deletion of the SE led to ICP27-independent expression of the gC gene, demonstrating that the SE functions during viral infection. Surprisingly, the ICP27-independent gC expression seen with the mutant occurred even in the absence of viral DNA synthesis, indicating that the SE helps to regulate the tight DNA replication-dependent expression of gC.
Yu, T; Wang, X; Ding, Q; Fu, Q; Dai, J; Lu, Y; Xi, X; Wang, H
2009-11-01
Factor VII deficiency which transmitted as an autosomal recessive disorder is a rare haemorrhagic condition. The aim of this study was to identify the molecular genetic defect and determine its functional consequences in a Chinese pedigree with FVII deficiency. The proband was diagnosed as inherited coagulation FVII deficiency by reduced plasma levels of FVII activity (4.4%) and antigen (38.5%). All nine exons and their flanking sequence of F7 gene were amplified by polymerase chain reaction (PCR) for the proband and the PCR products were directly sequenced. The compound heterozygous mutations of F7 (NM_000131.3) c.572-1G>A and F7 (NM_000131.3) c.1165T>G; p.Cys389Gly were identified in the proband's F7 gene. To investigate the splicing patterns associated with F7 c.572-1G>A, ectopic transcripts in leucocytes of the proband were analyzed. F7 minigenes, spanning from intron 4 to intron 7 and carrying either an A or a G at position -1 of intron 5, were constructed and transiently transfected into human embryonic kidney (HEK) 293T cells, followed by RT-PCR analysis. The aberrant transcripts from the F7 c.572-1G>A mutant allele were not detected by ectopic transcription study. Sequencing of the RT-PCR products from the mutant transfectant demonstrated the production of an erroneously spliced mRNA with exon 6 skipping, whereas a normal splicing occurred in the wide type transfectant. The aberrant mRNA produced from the F7 c.572-1G>A mutant allele is responsible for the factor VII deficiency in this pedigree.
Moschonas, Galatios; Geornaras, Ifigenia; Stopforth, Jarret D; Woerner, Dale R; Belk, Keith E; Smith, Gary C; Sofos, John N
2015-12-01
Not-ready-to-eat breaded chicken products formulated with antimicrobial ingredients were tested for the effect of sample dimensions, surface browning method and final internal sample temperature on inoculated Salmonella populations. Fresh chicken breast meat portions (5 × 5 × 5 cm), inoculated with Salmonella (7-strain mixture; 5 log CFU/g), were mixed with (5% v/w total moisture enhancement) (i) distilled water (control), (ii) caprylic acid (CAA; 0.0625%) and carvacrol (CAR; 0.075%), (iii) CAA (0.25%) and ε-polylysine (POL; 0.5%), (iv) CAR (0.15%) and POL (0.5%), or (v) CAA (0.0625%), CAR (0.075%) and POL (0.5%). Sodium chloride (1.2%) and sodium tripolyphosphate (0.3%) were added to all treatments. The mixtures were then ground and formed into 9 × 5 × 3 cm (150 g) or 9 × 2.5 × 2 cm (50 g) portions. The products were breaded, browned in (i) an oven (208 °C, 15 min) or (ii) deep fryer (190 °C, 15 s), packaged, and stored at -20 °C (8 d). Overall, maximum internal temperatures of 62.4 ± 4.0 °C (9 × 2.5 × 2 cm) and 46.0 ± 3.0 °C (9 × 5 × 3 cm) were reached in oven-browned samples, and 35.0 ± 1.1 °C (9 × 2.5 × 2 cm) and 31.7 ± 2.6 °C (9 × 5 × 3 cm) in fryer-browned samples. Irrespective of formulation treatment, total (after frozen storage) reductions of Salmonella were greater (P < 0.05) for 9 × 2.5 × 2 cm oven-browned samples (3.8 to at least 4.6 log CFU/g) than for 9 × 5 × 3 cm oven-browned samples (0.7 to 2.5 log CFU/g). Product dimensions did not (P ≥ 0.05) affect Salmonella reductions (0.6 to 2.8 log CFU/g) in fryer-browned samples. All antimicrobial treatments reduced Salmonella to undetectable levels (<0.3 log CFU/g) in oven-browned 9 × 2.5 × 2 cm samples. Overall, the data may be useful for the selection of antimicrobials, product dimensions, and surface browning methods for reducing Salmonella contamination. © 2015 Institute of Food Technologists®
Hearing-loss-associated gene detection in neonatal intensive care unit.
Yang, S M; Liu, Ying; Liu, C; Yin, A H; Wu, Y F; Zheng, X E; Yang, H M; Yang, J
2018-02-01
To investigate the frequency and mutation spectrum of hearing loss-associated gene mutation in Neonatal Intensive Care Unit (NICU). Neonates (n=2305) admitted to NICU were enrolled in this study. Nine prominent hearing loss-associated genes, GJB2 (35 del G, 176 del 16,235 del C, 299 del AT), GJB3 (538 C > T), SLC26A4 (IVS7-2A > G, 2168 A > G) and mtDNA 12S rRNA(1555 A > G, 1494 C > T), were detected. There were 73 cases hearing-loss-associated gene mutation among 2305 cases, the mutation frequency was 3.1%, with 40 cases GJB2 (235del C) mutation (54.8%), 6 cases GJB2 (299 del AT) mutation (8.2%), 21 cases SLC26A4 (IVS 7-2 A > G) mutation (28.7%), 4 cases SLC26A4 (2168 A > G) mutation (5.5%), 2 cases of GJB2 (235del C) combined SLC26A4 (IVS 7-2 A > G, 2168 A > G) mutation (2.8%). Among 73 gene mutation cases, preterm neonates presented in 18 cases, accounting for 24.7% (18/73); hyperbilirubinemia in 13 cases, accounting for 17.8% (13/73); Torch Syndrome in 15 cases, with 12 cases CMV, 2 cases rubella, 1 case toxoplasm, respectively, totally accounting for 20.54% (15/73); neonatal pneumonia in 12 cases, accounting for 16.4% (12/73); birth asphyxia in 5 cases, accounting for 6.9% (5/73); sepsis in 5 cases, accounting for 6.9% (5/73); others in 5 cases, accounting for 6.8% (5/73) . The frequency of hearing loss-associated gene mutation was higher in NICU.There were hearing loss-associated gene mutations in the NICU, suggesting this mutation may complicate with perinatal high-risk factors.
Genetic code, hamming distance and stochastic matrices.
He, Matthew X; Petoukhov, Sergei V; Ricci, Paolo E
2004-09-01
In this paper we use the Gray code representation of the genetic code C=00, U=10, G=11 and A=01 (C pairs with G, A pairs with U) to generate a sequence of genetic code-based matrices. In connection with these code-based matrices, we use the Hamming distance to generate a sequence of numerical matrices. We then further investigate the properties of the numerical matrices and show that they are doubly stochastic and symmetric. We determine the frequency distributions of the Hamming distances, building blocks of the matrices, decomposition and iterations of matrices. We present an explicit decomposition formula for the genetic code-based matrix in terms of permutation matrices, which provides a hypercube representation of the genetic code. It is also observed that there is a Hamiltonian cycle in a genetic code-based hypercube.
[Identifying and sequence analysis of HLA-B*2736].
Li, Zhen; Zou, Hong-Yan; Shao, Chao-Peng; Tang, Si; Wang, Da-Ming; Cheng, Liang-Hong
2007-11-01
An unknown HLA-B allele which was similar to HLA-B*270401 was detected by FLOW-SSOPCR-SSP and heterozygous sequence-based typing (SBT) in Chinese Han individual. Its anomalous patterns suggested the possible presence of new allele. Amplifying exon 2-5(include intron 2-4) of the HLA-B*27 allele separately by using allele-specific primers and sequencing in both directions. Identifying the difference between the novel B*27 allele and B*270401. The sequence of novel B*27 from exon 2 to partial exon 5 is 1 815 bp. There are 10 nt changes from B*270401 in exon 3-4, at nt634where A-->C(codon130 AGC-->CGC, 130 S-->R); nt670 where A-->T (codon142 ACC-->TCC, 142 T-->S); nt683 where G-->T (codon146 TGG-->TTG, 146 W-->L); nt698 where A-->T (codon151 GAG-->GTG, 151 E-->V); nt774 where G-->C (codon176 GAG-->GAC, 176 E-->D); nt776 where C-->A (codon177 ACG-->AAG, 177 T-->K); nt781 where C-->G (codon179 CAG-->GAG, 179Q-->E); nt789 where G-->T (codon181 GCG-->GCT) resulting no coding change; nt1438 where C-->T (codon206 GGC-->GGT) resulting no coding change; nt1449 where G-->C (codon210 GGG-->GCG, 210G-->A). In IMGT/HLA database, only three alleles (B*270502/2706/2732) have sequences of introns. The same sequence in intron 2 showed homology between the novel HLA-B*27 allele and B*2706, but their homology could not be supported in intron 3-4. Comparing the sequence of the novel B*27 allele in intron 3 and 4 with B*27 group, it showed there are three mutations at nt106 C-->G, nt179 G-->A, nt536 G-->A and one deletion at nt168 in intron 3 and one mutations at nt82 T-->C in intron 4, but the sequence of the novel B*27 allele in intron 3 and 4 was all the same to B*070201. The sequence was submitted to Gen-Bank and the accession number was DQ915176. The allele has been confirmed as an extension of B*2736 by the WHO Nomenclature committee in November 2006.
Total organic carbon in aggregates as a soil recovery indicator
NASA Astrophysics Data System (ADS)
Luciene Maltoni, Katia; Rodrigues Cassiolato, Ana Maria; Amorim Faria, Glaucia; Dubbin, William
2015-04-01
The soil aggregation promotes physical protection of organic matter, preservation of which is crucial to improve soil structure, fertility and ensure the agro-ecosystems sustainability. The no-tillage cultivation system has been considered as one of the strategies to increase total soil organic carbono (TOC) contents and soil aggregation, both are closely related and influenced by soil management systems. The aim of this study was to evaluate the distribution of soil aggregates and the total organic carbon inside aggregates, with regard to soil recovery, under 3 different soil management systems, i.e. 10 and 20 years of no-tillage cultivation as compared with soil under natural vegetation (Cerrado). Undisturbed soils (0-5; 5-10; and 10-20 cm depth) were collected from Brazil, Central Region. The soils, Oxisols from Cerrado, were collected from a field under Natural Vegetation-Cerrado (NV), and from fields that were under conventional tillage since 1970s, and 10 and 20 years ago were changed to no-tillage cultivation system (NT-10; NT-20 respectively). The undisturbed samples were sieved (4mm) and the aggregates retained were further fractionated by wet sieving through five sieves (2000, 1000, 500, 250, and 50 μm) with the aggregates distribution expressed as percentage retained by each sieve. The TOC was determined, for each aggregate size, by combustion (Thermo-Finnigan). A predominance of aggregates >2000 μm was observed under NV treatment (92, 91, 82 %), NT-10 (64, 73, 61 %), and NT-20 (71, 79, 63 %) for all three depths (0-5; 5-10; 10-20 cm). In addition greater quantities of aggregates in sizes 1000, 500, 250 and 50 μm under NT-10 and NT-20 treatments, explain the lower aggregate stability under these treatments compared to the soil under NV. The organic C concentration for NV in aggregates >2000 μm was 24,4; 14,2; 8,7 mg/g for each depth (0-5; 5-10; 10-20 cm, respectively), higher than in aggregates sized 250-50 μm (7,2; 5,5; 4,4 mg/g) for all depths. Although, with lower organic C contents, NT-10 and NT-20 presented the same behavior, i.e., greater amounts of organic C in bigger aggregates, (NT-10: 10,7; 9,5; 9,0 mg/g and NT-20: 18,8; 15,7; 8,6 mg/g, for each depth respectively 0-5; 5-10; 10-20 cm), and lower C contents in smaller aggregates (NT-10: 5,7; 6,1; 5,6 mg/g and NT-20: 8,2; 7,9; 6,3 mg/g , for each depth respectively 0-5; 5-10; 10-20 cm). The aggregates > 2000 μm, at 10-20 cm depth, showed similar C contents for NV, NT-10 and NT-20 (8,7; 9,0; 8,6 mg/g, respectively) suggesting that the C supply, even in natural environment, is not enough to increase organic C at 10-20 cm depth. The organic C concentration for aggregates sized 250-50 μm, in all three evaluated depths, is similar. Therefore, under NT-10 and NT-20 the smaller aggregates are not influenced by cultivation system, suggesting that the organic C inside the smaller aggregates can be retained for longer time in soil system. The results suggest, with regard to aggregate distribution and organic carbon content under NV, that soil under NT-20 is recovering. Acknowledgement: This study received financial support from CNPq
26 CFR 1.922-1 - Requirements that a corporation must satisfy to be a FSC or a small FSC.
Code of Federal Regulations, 2011 CFR
2011-04-01
... the Caribbean Basin Economic Recovery Act (Code section 274(h)((6)(C)), or (B) a bilateral income tax... counted as a shareholder. (g) Class of stock. Q-7. What is preferred stock for purposes of determining... liquidation. Q-8. Can a corporation have outstanding more than one class of common stock? A-8. Yes. However...
Webb, William M; Sanchez, Richard G; Perez, Gabriella; Butler, Anderson A; Hauser, Rebecca M; Rich, Megan C; O'Bierne, Aidan L; Jarome, Timothy J; Lubin, Farah D
2017-07-01
Epigenetic mechanisms such as DNA methylation and histone methylation are critical regulators of gene transcription changes during memory consolidation. However, it is unknown how these epigenetic modifications coordinate control of gene expression following reactivation of a previously consolidated memory. Here, we found that retrieval of a recent contextual fear conditioned memory increased global levels of H3 lysine 4-trimethylation (H3K4me3) and DNA 5-hydroxymethylation (5hmC) in area CA1 of the dorsal hippocampus. Further experiments revealed increased levels of H3K4me3 and DNA 5hmC within a CpG-enriched coding region of the Npas4, but not c-fos, gene. Intriguingly, retrieval of a 30-day old memory increased H3K4me3 and DNA 5hmC levels at a CpG-enriched coding region of c-fos, but not Npas4, in the anterior cingulate cortex, suggesting that while these two epigenetic mechanisms co-occur following the retrieval of a recent or remote memory, their gene targets differ depending on the brain region. Additionally, we found that in vivo siRNA-mediated knockdown of the H3K4me3 methyltransferase Mll1 in CA1 abolished retrieval-induced increases in DNA 5hmC levels at the Npas4 gene, suggesting that H3K4me3 couples to DNA 5hmC mechanisms. Consistent with this, loss of Mll1 prevented retrieval-induced increases in Npas4 mRNA levels in CA1 and impaired fear memory. Collectively, these findings suggest an important link between histone methylation and DNA hydroxymethylation mechanisms in the epigenetic control of de novo gene transcription triggered by memory retrieval. Copyright © 2017 Elsevier Inc. All rights reserved.
An Analytic Model of Gas Turbine Engine Installations.
1984-09-01
CODE . . . . ............. 37 C. CTHiEi PROGRAM FEAL’RES . . . . . . . . . . . . 38 IV. RESULTS AJD RECOXEMNDTZCINS . . . . . . . . . . . 43 A GEN ER...IP(IIST.L.T.1.O) Go 0 7Q GO T3 55 C COMPU:Z FAN PRESSURE AND0 MATCH FAN PERFORMANCE 70 SYSTEM 70 FANC ;=(DP2.DP£45+DPi2L5.19696 croCf3ZDNIKC) c IF
Jung, Myung-Hwa; Lee, Jehee; Ortega-Villaizan, M; Perez, Luis; Jung, Sung-Ju
2017-06-27
Rock bream iridovirus (RBIV) disease in rock bream (Oplegnathus fasciatus) remains an unsolved problem in Korea aquaculture farms. CpG ODNs are known as immunostimulant, can improve the innate immune system of fish providing resistance to diseases. In this study, we evaluated the potential of CpG ODNs to induce anti-viral status protecting rock bream from different RBIV infection conditions. We found that, when administered into rock bream, CpG ODN 1668 induces better antiviral immune responses compared to other 5 CpG ODNs (2216, 1826, 2133, 2395 and 1720). All CpG ODN 1668 administered fish (1/5µg) at 2days before infection (1.1×10 7 ) held at 26°C died even though mortality was delayed from 8days (1µg) and 4days (5µg). Similarly, CpG ODN 1668 administered (5µg) at 2days before infection (1.2×10 6 ) held at 23/20°C had 100% mortality; the mortality was delayed from 9days (23°C) and 11days (20°C). Moreover, when CpG ODN 1668 administered (1/5/10µg) at 2/4/7days before infection or virus concentration was decreased to 1.1×10 4 and held at 20°C had mortality rates of 20/60/30% (2days), 30/40/60% (4days) and 60/60/20% (7days), respectively, for the respective administration dose, through 100 dpi. To investigate the development of a protective immune response, survivors were re-infected with RBIV (1.1×10 7 ) at 100 and 400 dpi, respectively. While 100% of the previously unexposed fish died, 100% of the previously infected fish survived. The high survival rate of fish following re-challenge with RBIV indicates that protective immunity was established in the surviving rock bream. Our results showed the possibility of developing preventive measures against RBIV using CpG ODN 1668 by reducing RBIV replication speed (i.e. water temperature of 20°C and infection dose of 1.1×10 4 ). Copyright © 2017 Elsevier Ltd. All rights reserved.
Kowal, Ewa A.; Lad, Rahul R.; Pallan, Pradeep S.; Dhummakupt, Elizabeth; Wawrzak, Zdzislaw; Egli, Martin; Sturla, Shana J.; Stone, Michael P.
2013-01-01
The 2′-deoxynucleoside containing the synthetic base 1-[(2R,4S,5R)-4-hydroxy-5-(hydroxymethyl)-tetrahydrofuran-2-yl)-1H-perimidin-2(3H)-one] (dPer) recognizes in DNA the O6-benzyl-2′-deoxyguanosine nucleoside (O6-Bn-dG), formed by exposure to N-benzylmethylnitrosamine. Herein, we show how dPer distinguishes between O6-Bn-dG and dG in DNA. The structure of the modified Dickerson–Drew dodecamer (DDD) in which guanine at position G4 has been replaced by O6-Bn-dG and cytosine C9 has been replaced with dPer to form the modified O6-Bn-dG:dPer (DDD-XY) duplex [5′-d(C1G2C3X4A5A6T7T8Y9G10C11G12)-3′]2 (X = O6-Bn-dG, Y = dPer) reveals that dPer intercalates into the duplex and adopts the syn conformation about the glycosyl bond. This provides a binding pocket that allows the benzyl group of O6-Bn-dG to intercalate between Per and thymine of the 3′-neighbor A:T base pair. Nuclear magnetic resonance data suggest that a similar intercalative recognition mechanism applies in this sequence in solution. However, in solution, the benzyl ring of O6-Bn-dG undergoes rotation on the nuclear magnetic resonance time scale. In contrast, the structure of the modified DDD in which cytosine at position C9 is replaced with dPer to form the dG:dPer (DDD-GY) [5′-d(C1G2C3G4A5A6T7T8Y9G10C11G12)-3′]2 duplex (Y = dPer) reveals that dPer adopts the anti conformation about the glycosyl bond and forms a less stable wobble pairing interaction with guanine. PMID:23748954
Shi, Lei; Zhou, Bo; Li, Pinghua; Schinckel, Allan P; Liang, Tingting; Wang, Han; Li, Huizhi; Fu, Lingling; Chu, Qingpo; Huang, Ruihua
2015-09-01
MicroRNAs (miRNAs or miRs) play a critical role in skeletal muscle development. In a previous study we observed that miR-128 was highly expressed in skeletal muscle. However, its function in regulating skeletal muscle development is not clear. Our hypothesis was that miR-128 is involved in the regulation of the proliferation and differentiation of skeletal myoblasts. In this study, through bioinformatics analyses, we demonstrate that miR-128 specifically targeted mRNA of myostatin (MSTN), a critical inhibitor of skeletal myogenesis, at coding domain sequence (CDS) region, resulting in down-regulating of myostatin post-transcription. Overexpression of miR-128 inhibited proliferation of mouse C2C12 myoblast cells but promoted myotube formation; whereas knockdown of miR-128 had completely opposite effects. In addition, ectopic miR-128 regulated the expression of myogenic factor 5 (Myf5), myogenin (MyoG), paired box (Pax) 3 and 7. Furthermore, an inverse relationship was found between the expression of miR-128 and MSTN protein expression in vivo and in vitro. Taken together, these results reveal that there is a novel pathway in skeletal muscle development in which miR-128 regulates myostatin at CDS region to inhibit proliferation but promote differentiation of myoblast cells. Copyright © 2015 Elsevier Inc. All rights reserved.
Kumar, Roshan; Dwivedi, Vatsala; Negi, Vivek; Khurana, J. P.
2013-01-01
Sphingobium lactosutens DS20T has been isolated from the hexachlorocyclohexane (HCH) dumpsite in Lucknow, India, but does not degrade any of the HCH isomers. Here, we present the ~5.36-Mb draft genome sequence of strain DS20T, which consists of 110 contigs and 5,288 coding sequences, with a G+C content of 63.1%. PMID:24051323
Salen, G; Shefer, S; Setoguchi, T; Mosbach, E H
1975-01-01
To study the role of C25-HYDROXY BILE ALCOHOLS AS PRECURSORS OF CHOlic acid, [G-3-H]5beta-cholestane-3alpha,7alpha12alpha,25-tetrol was administered intravenously to two subjects with cerebrotendinous xanthomatosis (CTX) and two normal individuals. One day after pulse labeling, radioactivity was present in the cholic acid isolated from the bile and feces of the subjects with CTX and the bile of the normal individuals. In the two normal subjects, the sp act decay curves of [G-3-H]-cholic acid were exponential, and no traces of [G-3-H]-5beta-cholestane-3alpha,7alpha,12alpha,25-tetrol were detected. In contrast, appreciable quantities of labeled 5beta-cholestane-3alpha,-7aopha,12alpha,25-tetrol were present in the bile and feces of the CTX subjects. The sp act vs. time curves of fecal [G-3-H]5beta-cholestane-3alpha,7alpha,12alpha,25-tetrol and [G-3-H]-cholic acid showed a precursor-product relationship. Although these results suggest that 5beta-cholestane-3alpha,7alpha,12alpha,25-tetrol may be a precursor of cholic acid in man, the possibility that C26-hydroxy intermediates represent the normal pathway can not be excluded. PMID:1141434
Muthukrishnan, Saradha Devi; Kaliyaperumal, Ashokkumar; Subramaniyan, Annapoorani
2015-01-01
Cynodon dactylon (L.) is a potent medicinal plant in the traditional and current Indian medicinal systems. The objective of this research was to find out the levels of flavonoids, carotenoids and chlorophyll b in C. dactylon leaves by high-performance liquid chromatography (HPLC) equipped with a diode array detector. HPLC analysis revealed that total carotenoid and total flavonoid concentration were 62 mg/100 g and 249.1 μg/g, respectively. The mean chlorophyll b was 85.1 mg/100 g in C. dactylon. Among the flavonoids, quercetin (164.7 μg/g) was the major flavonoid followed by kaempferol (48.2 μg/g), rutin (18.4 μg/g), catechin (12.1 μg/g) and myricetin (5.7 μg/g). Of the carotenoids, β-carotene (35.2 mg/100 g) was predominant followed by lutein (17.0 mg/100 g), violaxanthin (5.8 mg/100 g) and zeaxanthin (4.2 mg/100 g). Chlorophyll b concentration was 85.1 mg/100 g in C. dactylon. The results of this investigation should be useful information for further pharmacological studies.
Ittiwut, Chupong; Pratuangdejkul, Jaturong; Supornsilchai, Vichit; Muensri, Sasipa; Hiranras, Yodporn; Sahakitrungruang, Taninee; Watcharasindhu, Suttipong; Suphapeetiporn, Kanya; Shotelersuk, Vorasuk
2017-01-01
Abnormalities of dihydrotestosterone conversion [5α-reductase deficiency: online Mendelian inheritance in man (OMIM) 607306] or actions of androgens [partial androgen insensitivity syndrome (PAIS): OMIM 312300] during the 8th-12th weeks of gestation cause varying degrees of undervirilized external genitalia in 46, XY disorders of sex development (DSD) with increased testosterone production. The objective of the study was to determine clinical and genetic characteristics of Thai patients with 46, XY DSD. A cross-sectional study was conducted in 46, XY DSD with increased testosterone production (n=43) evaluated by a human chorionic gonadotropin (hCG) stimulation test or clinical features consistent with 5α-reductase deficiency or PAIS. PCR sequencing of the entire coding regions of the SRD5A2 and AR genes was performed. Molecular modeling analysis of the androgen receptor-ligand-binding domain (AR-LBD) of a novel mutation was constructed. Mutations were found in seven patients (16.3%): five (11.6%) and two (4.7%) patients had mutations in SRD5A2 and AR, respectively. Two novel mutations, SRD5A2 c.383A>G (p.Y128C) and AR c.2176C>T (p.R726C), were identified. Dimensional structural analysis of the novel mutated AR (p.R726C) revealed that it affected the co-activator binding [binding function-3 (BF-3)], not the testosterone binding site. Short phallus length was associated with 5α-reductase deficiency. Around 16.3% of our patients with 46, XY DSD had 5α-reductase deficiency or PAIS. Two novel mutations of SRD5A2 and AR were identified. The novel mutated AR (p.R726C) might affect the co-activator binding (BF-3), not the testosterone binding site.
Porto-Fett, Anna C S; Shoyer, Bradley A; Thippareddi, Harshavardhan; Luchansky, John B
2013-03-01
We evaluated the effect of commercial times and temperatures for searing, cooking, and holding on the destruction of Escherichia coli O157:H7 (ECOH) within mechanically tenderized prime rib. Boneless beef ribeye was inoculated on the fat side with ca. 5.7 log CFU/g of a five-strain cocktail of ECOH and then passed once through a mechanical tenderizer with the fat side facing upward. The inoculated and tenderized prime rib was seared by broiling at 260°C for 15 min in a conventional oven and then cooked in a commercial convection oven at 121.1°C to internal temperatures of 37.8, 48.9, 60.0, and 71.1°C before being placed in a commercial holding oven maintained at 60.0°C for up to 8 h. After searing, ECOH levels decreased by ca. 1.0 log CFU/g. Following cooking to internal temperatures of 37.8 to 71.1°C, pathogen levels decreased by an additional ca. 2.7 to 4.0 log CFU/g. After cooking to 37.8, 48.9, or 60.0°C and then warm holding at 60.0°C for 2 h, pathogen levels increased by ca. 0.2 to 0.7 log CFU/g. However, for prime rib cooked to 37.8°C, pathogen levels remained relatively unchanged over the next 6 h of warm holding, whereas for those cooked to 48.9 or 60.0°C pathogen levels decreased by ca. 0.3 to 0.7 log CFU/g over the next 6 h of warm holding. In contrast, after cooking prime rib to 71.1°C and holding for up to 8 h at 60.0°C, ECOH levels decreased by an additional ca. 0.5 log CFU/g. Our results demonstrated that to achieve a 5.0-log reduction of ECOH in blade tenderized prime rib, it would be necessary to sear at 260°C for 15 min, cook prime rib to internal temperatures of 48.9, 60.0, or 71.1°C, and then hold at 60.0°C for at least 8 h.
Renewable Energy Production from DoD Installation Solid Wastes By Anaerobic Digestion
2016-08-06
favorable environmental conditions including a mesophilic (37 oC) or thermophilic (55 oC) temperature , the absence of oxygen , and a pH between 6.5...a high temperature process that uses oxygen -starved combustion to convert dry organic matter to a syngas. Syngas is a low BTU fuel that can be used...production rates are at the 36.7 °C digester temperature . Parameter Units 7gCOD/L-d 12gCOD/L-d Effective SRT days 18.5 10.8 COD Conversion Efficiency % 67
Renewable Energy Production from DoD Installation Solid Wastes by Anaerobic Digestion
2016-06-01
favorable environmental conditions including a mesophilic (37 oC) or thermophilic (55 oC) temperature , the absence of oxygen , and a pH between 6.5...a high temperature process that uses oxygen -starved combustion to convert dry organic matter to a syngas. Syngas is a low BTU fuel that can be used...production rates are at the 36.7 °C digester temperature . Parameter Units 7gCOD/L-d 12gCOD/L-d Effective SRT days 18.5 10.8 COD Conversion Efficiency % 67
Large-Scale Separation and Wake Closure/Reattachment - The Cascade Problem,
1983-05-01
7.3b-d) gives, for all x > xsep K (X) = u(u-l)dy + 1se (11-7.7) 44 UTRC83-13 where Isep is the integrated momentum deficit at separation, from (II...with c1 = (K: o 2/b - Isep /b) positive. So (II-7.5a) requires the underlying form -g ~-1/2_ +- g go (G) + x -1()+..+x 2 (a)+ .... (II-7.10a) for g
Validation and Intercomparison Studies Within GODAE
2009-09-01
unlimited. 13. SUPPLEMENTARY NOTES 20091228154 14. ABSTRACT During the Global Ocean Data Assimilation Experiment (GODAE), seven international... global -ocean and basin-scale forecasting systems of different countries in routine interaction and continuous operation, (2) to assess the quality and... Franchi , 7000 Public Affairs (Unclassified/ Unlimited Only), Code 7o30 4 Division, Code ^VtcV Vs-Jc \\ -Vi<-’/c ••>’ 3^v’.-:5, w. 3Uo|eri 1
Decontamination of green onions and baby spinach by vaporized ethyl pyruvate.
Durak, M Zeki; Churey, John J; Gates, Matthew; Sacks, Gavin L; Worobo, Randy W
2012-06-01
Foodborne illnesses associated with fresh produce continue to be a major concern as consumer demand for healthier and nonthermally processed food increases. The objective of this study was to evaluate vaporized ethyl pyruvate (EP; CAS 617-35-6) as a safe alternative antimicrobial agent for the decontamination of Escherichia coli O157:H7 on green onions and spinach. Baby spinach leaves and green onions were inoculated with a five-strain cocktail of E. coli O157:H7 (pGFP) by the dipping method. Samples were treated with concentrations of 0, 42, 105, and 420 mg/liter vaporized EP in a 2.6-liter enclosed container. The efficacy of EP vapors for reducing E. coli O157:H7((GFP)) populations on green onions and baby spinach at 4 and 10°C was monitored for 7 and 5 days, respectively. The lowest EP concentration (42 mg/liter) resulted in a 1.7-log reduction of E. coli O157:H7((GFP)) on green onions after 7 days at 4°C and a 1.9-log reduction after 5 days at 10°C (P < 0.05). In baby spinach, the same concentration resulted in 0.9-log and 1.4-log reductions (P < 0.05) of E. coli O157:H7((GFP)) after 7 days at 4°C and 5 days at 10°C, respectively. On green onions, the highest concentration of EP (420 mg/liter) reduced the population of E. coli O157:H7((GFP)) by >4.7 log CFU/g after 7 days at 4°C and 5 days at 10°C. The same concentration was also effective for reducing E. coli O157:H7((GFP)) populations in baby spinach by 4.3 log CFU/g after 7 days at 4°C and by >6.5 log CFU/g after 3 days at 10°C. Although the successful EP treatments minimally affected the sensory attributes of green onions, the treatments resulted in significant changes in the sensory attributes of baby spinach samples stored at 4 and 10°C. These results indicate that EP is an effective antimicrobial that could be used to enhance the safety of fresh produce depending on the sensory characteristics of the product.
GH-releasing hormone receptor gene: a novel splice-disrupting mutation and study of founder effects.
Marui, Suemi; Trarbach, Ericka B; Boguszewski, Margaret C S; França, Marcela M; Jorge, Alexander A L; Inoue, Hiroshi; Nishi, Mirian Y; de Lacerda Filho, Luiz; Aguiar-Oliveira, Manuel H; Mendonca, Berenice B; Arnhold, Ivo J P
2012-01-01
Mutations in GH-releasing hormone receptor gene (GHRHR) are emerging as the most common cause of autosomal recessive isolated GH deficiency (IGHD). To search for GHRHR mutations in patients with familial or sporadic IGHD and to investigate founder effects in recurring mutations. The coding region of GHRHR was entirely amplified and sequenced from DNA of 18 patients with IGHD (16 unrelated) with topic posterior pituitary lobe on MRI. Haplotypes containing promoter SNPs and microsatellites flanking GHRHR were analyzed in patients with c.57+1G>A (IVS1+1G>A) mutation of our previously published kindred and also a Brazilian patient and 2 previously reported Japanese sisters with c.1146G>A (p.E382E) mutation. A novel homozygous intronic GHRHR c.752-1G>A (IVS7-1G>A) mutation, predicting loss of the constitutive splice acceptor site, was identified in two siblings with IGHD. A compound heterozygous c.[57+1G>A];[1146G>A] and a heterozygous c.527C>T (p.A176V) were found in two sporadic cases. Haplotype analysis provided evidence for a founder effect for the c.57+1G>A mutation and independent recurrence for the c.1146G>A mutation. We report a novel splice-disrupting mutation in GHRHR in 2 siblings and provide evidence that all c.57+1G>A (IVS1+1G>A) mutant chromosomes have the same haplotype ancestor, indicating the occurrence of a founder effect in Brazilian patients with IGHD. Copyright © 2012 S. Karger AG, Basel.
Draft Genome Sequence of Mycobacterium bohemicum Strain DSM 44277T.
Asmar, Shady; Phelippeau, Michael; Robert, Catherine; Croce, Olivier; Drancourt, Michel
2015-08-06
The Mycobacterium bohemicum strain is a nontuberculosis species mainly responsible for pediatric cervical lymphadenitis. The draft genome of M. bohemicum DSM 44277(T) comprises 5,097,190 bp exhibiting a 68.64% G+C content, 4,840 protein-coding genes, and 75 predicted RNA genes. Copyright © 2015 Asmar et al.
Draft Genome Sequence of Mycobacterium triplex DSM 44626.
Sassi, Mohamed; Croce, Olivier; Robert, Catherine; Raoult, Didier; Drancourt, Michel
2014-05-29
We announce the draft genome sequence of Mycobacterium triplex strain DSM 44626, a nontuberculosis species responsible for opportunistic infections. The genome described here is composed of 6,382,840 bp, with a G+C content of 66.57%, and contains 5,988 protein-coding genes and 81 RNA genes. Copyright © 2014 Sassi et al.
Report of Investigation: Lieutenant General Anthony G. Crutchfield, U.S. Army (Redacted)
2015-06-15
erpployees. Chapter 2 of the JER, "Standards ofEthical Conduct," incorporates Title 5, Code ofFederal Regulations, Patt 2635, "Standards ofConduct for...Regulations, Chapter 4, Patt C explains that an Authorizing Official may authorize or approve the Actual Expense Al lowance, also known as the Actual
Lunova, Mariia; Guldiken, Nurdan; Lienau, Tim C.; Stickel, Felix; Omary, M. Bishr
2012-01-01
Background Keratins 8 and 18 (K8/K18) are intermediate filament proteins that protect the liver from various forms of injury. Exonic K8/K18 variants associate with adverse outcome in acute liver failure and with liver fibrosis progression in patients with chronic hepatitis C infection or primary biliary cirrhosis. Given the association of K8/K18 variants with end-stage liver disease and progression in several chronic liver disorders, we studied the importance of keratin variants in patients with hemochromatosis. Methods The entire K8/K18 exonic regions were analyzed in 162 hemochromatosis patients carrying homozygous C282Y HFE (hemochromatosis gene) mutations. 234 liver-healthy subjects were used as controls. Exonic regions were PCR-amplified and analyzed using denaturing high-performance liquid chromatography and DNA sequencing. Previously-generated transgenic mice overexpressing K8 G62C were studied for their susceptibility to iron overload. Susceptibility to iron toxicity of primary hepatocytes that express K8 wild-type and G62C was also assessed. Results We identified amino-acid-altering keratin heterozygous variants in 10 of 162 hemochromatosis patients (6.2%) and non-coding heterozygous variants in 6 additional patients (3.7%). Two novel K8 variants (Q169E/R275W) were found. K8 R341H was the most common amino-acid altering variant (4 patients), and exclusively associated with an intronic KRT8 IVS7+10delC deletion. Intronic, but not amino-acid-altering variants associated with the development of liver fibrosis. In mice, or ex vivo, the K8 G62C variant did not affect iron-accumulation in response to iron-rich diet or the extent of iron-induced hepatocellular injury. Conclusion In patients with hemochromatosis, intronic but not exonic K8/K18 variants associate with liver fibrosis development. PMID:22412904
Campos, W N; Massaro, J D; Martinelli, A L C; Halliwell, J A; Marsh, S G E; Mendes-Junior, C T; Donadi, E A
2017-10-01
The HFE molecule controls iron uptake from gut, and defects in the molecule have been associated with iron overload, particularly in hereditary hemochromatosis. The HFE gene including both coding and boundary intronic regions were sequenced in 304 Brazilian individuals, encompassing healthy individuals and patients exhibiting hereditary or acquired iron overload. Six sites of variation were detected: (1) H63D C>G in exon 2, (2) IVS2 (+4) T>C in intron 2, (3) a C>G transversion in intron 3, (4) C282Y G>A in exon 4, (5) IVS4 (-44) T>C in intron 4, and (6) a new guanine deletion (G>del) in intron 5, which were used for haplotype inference. Nine HFE alleles were detected and six of these were officially named on the basis of the HLA Nomenclature, defined by the World Health Organization (WHO) Nomenclature Committee for Factors of the HLA System, and published via the IPD-IMGT/HLA website. Four alleles, HFE*001, *002, *003, and *004 exhibited variation within their exon sequences. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Strong Ground Motions Scenarios for Mexico City
NASA Astrophysics Data System (ADS)
Cabrera, E.; Chavez, M.; Madariaga, R.; Mai, P. M.; Frisenda, M.; Perea, N.
2005-12-01
The recordings available in Mexico City (MC) for extreme magnitude Subduction Superficial (SS), Subduction Deep (SD), and Crustal Superficial (CS) events are about 30 accelerograms (obtained at 10 sites) for the SS 19 09 1985 earthquake (Ms 8.1, Mw 8.01). In this work we generated broadband synthetic accelerograms expected in MC stiff (S) and compressive soils (C),for SS (Mw 8.5, 8.7), SD (Mw 7.6) and CS (Mw 7.5) earthquakes.The frequencies lower than 0.5 Hz were simulated by using a 4th order FD method, including a (fractal) finite-fault description of the sources. The frequencies larger than 0.5 Hz were modeled by the empirical Green function technique. We propose upper bounds of 0.4g and 2g (g=9.8m/s2)for the maximum response spectra acceleration(5 percent damping) expected in the S and C soils of MC, respectively.
Eriksson, Mikael; Ka, Jong-Ok; Mohn, William W.
2001-01-01
Degradation of petroleum hydrocarbons was monitored in microcosms with diesel fuel-contaminated Arctic tundra soil incubated for 48 days at low temperatures (−5, 0, and 7°C). An additional treatment was incubation for alternating 24-h periods at 7 and −5°C. Hydrocarbons were biodegraded at or above 0°C, and freeze-thaw cycles may have actually stimulated hydrocarbon biodegradation. Total petroleum hydrocarbon (TPH) removal over 48 days in the 7, 0, and 7 and −5°C treatments, respectively, was 450, 300, and 600 μg/g of soil. No TPH removal was observed at −5°C. Total carbon dioxide production suggested that TPH removal was due to biological mineralization. Bacterial metabolic activity, indicated by RNA/DNA ratios, was higher in the middle of the experiment (day 21) than at the start, in agreement with measured hydrocarbon removal and carbon dioxide production activities. The total numbers of culturable heterotrophs and of hydrocarbon degraders did not change significantly over the 48 days of incubation in any of the treatments. At the end of the experiment, bacterial community structure, evaluated by ribosomal intergenic spacer length analysis, was very similar in all of the treatments but the alternating 7 and −5°C treatment. PMID:11679333
10 CFR 434.517 - HVAC systems and equipment.
Code of Federal Regulations, 2014 CFR
2014-01-01
... DEPARTMENT OF ENERGY ENERGY CONSERVATION ENERGY CODE FOR NEW FEDERAL COMMERCIAL AND MULTI-FAMILY HIGH RISE.... >3 stories 6 Note 6. Restaurant 1 or 3 Note 1. Health: a. Nursing Home (any size) 2 or 7 Note 7. b. ≤15,000 ft 2 1 c. 50,000 ft 2 5 Note 2, 3. Multi-family High Rise Residential >3 stories 7 1 Space and...
10 CFR 434.517 - HVAC systems and equipment.
Code of Federal Regulations, 2012 CFR
2012-01-01
... DEPARTMENT OF ENERGY ENERGY CONSERVATION ENERGY CODE FOR NEW FEDERAL COMMERCIAL AND MULTI-FAMILY HIGH RISE.... >3 stories 6 Note 6. Restaurant 1 or 3 Note 1. Health: a. Nursing Home (any size) 2 or 7 Note 7. b. ≤15,000 ft 2 1 c. 50,000 ft 2 5 Note 2, 3. Multi-family High Rise Residential >3 stories 7 1 Space and...
10 CFR 434.517 - HVAC systems and equipment.
Code of Federal Regulations, 2011 CFR
2011-01-01
... DEPARTMENT OF ENERGY ENERGY CONSERVATION ENERGY CODE FOR NEW FEDERAL COMMERCIAL AND MULTI-FAMILY HIGH RISE.... >3 stories 6 Note 6. Restaurant 1 or 3 Note 1. Health: a. Nursing Home (any size) 2 or 7 Note 7. b. ≤15,000 ft 2 1 c. 50,000 ft 2 5 Note 2, 3. Multi-family High Rise Residential >3 stories 7 1 Space and...
10 CFR 434.517 - HVAC systems and equipment.
Code of Federal Regulations, 2013 CFR
2013-01-01
... DEPARTMENT OF ENERGY ENERGY CONSERVATION ENERGY CODE FOR NEW FEDERAL COMMERCIAL AND MULTI-FAMILY HIGH RISE.... >3 stories 6 Note 6. Restaurant 1 or 3 Note 1. Health: a. Nursing Home (any size) 2 or 7 Note 7. b. ≤15,000 ft 2 1 c. 50,000 ft 2 5 Note 2, 3. Multi-family High Rise Residential >3 stories 7 1 Space and...
Novel compound heterozygous mutations in MYO7A in a Chinese family with Usher syndrome type 1.
Liu, Fei; Li, Pengcheng; Liu, Ying; Li, Weirong; Wong, Fulton; Du, Rong; Wang, Lei; Li, Chang; Jiang, Fagang; Tang, Zhaohui; Liu, Mugen
2013-01-01
To identify the disease-causing mutation(s) in a Chinese family with autosomal recessive Usher syndrome type 1 (USH1). An ophthalmic examination and an audiometric test were conducted to ascertain the phenotype of two affected siblings. The microsatellite marker D11S937, which is close to the candidate gene MYO7A (USH1B locus), was selected for genotyping. From the DNA of the proband, all coding exons and exon-intron boundaries of MYO7A were sequenced to identify the disease-causing mutation(s). Restriction fragment length polymorphism (RFLP) analysis was performed to exclude the alternative conclusion that the mutations are non-pathogenic rare polymorphisms. Based on severe hearing impairment, unintelligible speech, and retinitis pigmentosa, a clinical diagnosis of Usher syndrome type 1 was made. The genotyping results did not exclude the USH1B locus, which suggested that the MYO7A gene was likely the gene associated with the disease-causing mutation(s) in the family. With direct DNA sequencing of MYO7A, two novel compound heterozygous mutations (c.3742G>A and c.6051+1G>A) of MYO7A were identified in the proband. DNA sequence analysis and RFLP analysis of other family members showed that the mutations cosegregated with the disease. Unaffected members, including the parents, uncle, and sister of the proband, carry only one of the two mutations. The mutations were not present in the controls (100 normal Chinese subjects=200 chromosomes) according to the RFLP analysis. In this study, we identified two novel mutations, c.3742G>A (p.E1248K) and c.6051+1G>A (donor splice site mutation in intron 44), of MYO7A in a Chinese non-consanguineous family with USH1. The mutations cosegregated with the disease and most likely cause the phenotype in the two affected siblings who carry these mutations compound heterozygously. Our finding expands the mutational spectrum of MYO7A.
Yang, S E; Chou, C C
2000-07-01
Growth and survival of Escherichia coli O157:H7 and Listeria monocytogenes in steamed eggs and scrambled eggs held at different temperatures (5, 18, 22, 37, 55, and 60 degrees C) were investigated in the present study. Among the holding temperatures tested, both pathogens multiplied best at 37 degrees C followed by 22, 18, and 5 degrees C. In general, E. coli O157:H7 grew better in the egg products than L. monocytogenes did at all the storage temperatures tested except at 5 degrees C. E. coli O157:H7 did not grow in steamed eggs and scrambled eggs held at 5 degrees C. L. monocytogenes showed a slight population increase of approximately 0.6 to 0.9 log CFU/g in these egg products at the end of the 36-h storage period at 5 degrees C. The population of both pathogens detected in the egg products was affected by the initial population, holding temperature, and length of the holding period. It was also noted that L. monocytogenes was more susceptible than E. coli O157:H7 in steamed eggs held at 60 degrees C. After holding at 60 degrees C for 1 h, no detectable viable cells of L. monocytogenes with a population reduction of 5.4 log CFU/g was observed in steamed eggs, whereas a lower population reduction of only approximately 0.5 log CFU/ml was noted for E. coli O157:H7.
Clinical characteristics and STK11 gene mutations in Chinese children with Peutz-Jeghers syndrome.
Huang, Zhiheng; Miao, Shijian; Wang, Lin; Zhang, Ping; Wu, Bingbing; Wu, Jie; Huang, Ying
2015-11-25
Peutz-Jeghers syndrome (PJS) is a rare autosomal dominant inherited disease characterized by gastrointestinal hamartomatous polyps and mucocutaneous melanin spots. Germline mutation of the serine/threonine kinase 11 (STK11) gene are responsible for PJS. In this study, we investigated the clinical characteristics and molecular basis of the disease in Chinese children with PJS. Thirteen children diagnosed with PJS in our hospital were enrolled in this study from 2011 to 2015, and their clinical data on polyp characteristics, intussusceptions events, family histories, etc. were described. Genomic DNA was extracted from whole-blood samples from each subject, and the entire coding sequence of the STK11 gene was amplified by polymerase chain reaction and analyzed by direct sequencing. The median age at the onset of symptoms was 2 years and 4 months. To date, these children have undergone 40 endoscopy screenings, 17 laparotomies and 9 intussusceptions. Polyps were found in the stomach, duodenum, small bowel, colon and rectum, with large polyps found in 7 children. Mutations were found in eleven children, including seven novel mutations (c.481het_dupA, c.943_944het_delCCinsG, c.397het_delG, c.862 + 1G > G/A, c.348_349het_delGT, and c.803_804het_delGGinsC and c.121_139de l19insTT) and four previously reported mutations (c.658C > C/T, c.890G > G/A, c.1062 C > C/G, and c.290 + 1G > G/A). One PJS patient did not have any STK11 mutations. The polyps caused significant clinical consequences in children with PJS, and mutations of the STK11 gene are generally the cause of PJS in Chinese children. This study expands the spectrum of known STK11 gene mutations.
[The genotype analysis of glucose-6-phosphate dehydrogenase deficiency in Yunnan province].
Yang, Z; Chu, J; Ban, G; Huang, X; Xu, S; Li, M
2001-08-01
To identify glucose-6-phosphate dehydrogenase (G6PD) gene mutations in 23 patients with G6PD deficiency and to gain further understanding of the molecular and genetic background of G6PD gene in Yunnan province, China. The mutations located in exons 2-12 and in parts of introns of G6PD gene were analyzed by amplification refractory mutation system(ARMS), natural and mis-match primer PCR/restrict enzyme, polymerase chain reaction-single strand conformation polymorphism(PCR-SSCP ) analysis and automatic DNA sequencing. Among these 23 samples, 5 different point mutations in G6PD gene were identified, and they constituted 5 genotypes. There were 7 Han and 3 Dai patients with G487A mutation, 7 cases with both intron 11 T93C and C1311T mutations, 4 cases with intron 5 636 or 637 T-->del mutation, 1 case with G871A mutation, and 1 case with G487A/T93C/C1311T mutation. Two haplotypes, 93C/1311T and 93C/1311T/487A were identified in Yunnan. A strong association was observed between C1311T and the Nla III restriction site produced by intron 11 T93C. The findings of the investigators on IVS-5 636 or 637T-->del in Chinese, on G871A in mainland of China, and on G487A in the Han people of Yunnan have not been reported previously. G6PD deficiency is very heterogenous in Yunnan; G487A is one of the common mutations in that province and may be of different origins. Possibly IVS-11 T93C mutation is of non-African origin. IVS-11 T93C and C1311T might jointly result in G6PD deficiency. The above data on G6PD gene mutation types could be useful for clinical diagnosis, prevention of G6PD deficiency, and researches in the origin and migration of minorities in Yunnan or other regions.
Word Frequency Analysis, MOS: 67Y. Skill Levels 1 & 2.
1981-05-01
AV’AILABLE I *use? qD AA 2 63r- IAE 29 ŕ- -’ .to ABOUT 2; J ’ ’ 3 ,,~S~I T ------------------.--..-.---------- *-- - -- - - - - - - - - - - - tC~r~7it...6 AOD 3 £flOEj j -* L.~ADL’I46. - 4 1 &D!’ITICNALLY 4 -~a7 VAA l4.- t ;o ’. N. -a4 -. : ~-> 14-*~-air 42 .ADJUSTE ________ ____________________ 5...i 2 CODE -- 2 COLE 9. COLD . . .. ~ _ _ _ _ _ _ 1 Cntoesy I COLL . . . ~ ~ .. 3 COLL4PSE *I~~~~ 56.OLECTION______-- I C OLLER - . 3 CCLLET . _ _. 2 c
Construction of a new regular LDPC code for optical transmission systems
NASA Astrophysics Data System (ADS)
Yuan, Jian-guo; Tong, Qing-zhen; Xu, Liang; Huang, Sheng
2013-05-01
A novel construction method of the check matrix for the regular low density parity check (LDPC) code is proposed. The novel regular systematically constructed Gallager (SCG)-LDPC(3969,3720) code with the code rate of 93.7% and the redundancy of 6.69% is constructed. The simulation results show that the net coding gain (NCG) and the distance from the Shannon limit of the novel SCG-LDPC(3969,3720) code can respectively be improved by about 1.93 dB and 0.98 dB at the bit error rate (BER) of 10-8, compared with those of the classic RS(255,239) code in ITU-T G.975 recommendation and the LDPC(32640,30592) code in ITU-T G.975.1 recommendation with the same code rate of 93.7% and the same redundancy of 6.69%. Therefore, the proposed novel regular SCG-LDPC(3969,3720) code has excellent performance, and is more suitable for high-speed long-haul optical transmission systems.
Ruiz-Narváez, Edward A; Yang, Yadong; Nakanishi, Yukiko; Kirchdorfer, Jill; Campos, Hannia
2005-12-01
Genetic variation in the APOC3 and APOA5 genes has been associated with plasma triglyceride concentrations and may affect the risk of myocardial infarction (MI). To assess whether APOC3/A5 haplotypes are associated with risk of MI, we examined three single-nucleotide polymorphisms (SNPs) in APOC3 (3238C>G, -455T>C, and -482C>T) and six SNPs in the APOA5 gene (-1131T>C, c.-3A>G, c.56C>G, IVS3+476G>A, c.553G>T, and c.1259T>C) in incident cases (n = 1,703) of a first nonfatal MI matched for gender, age, and area of residence with population-based controls (n = 1,703). Conditional logistic regression models, adjusted for potential environmental confounders, were used for analysis. The common APOC3*222 haplotype was more frequent in cases than in controls (17.4% and 13.7%, respectively, P < 0.001) and was associated with increased risk of MI [odds ratio (OR) = 1.27; 95% confidence interval (95% CI), 1.09, 1.48] compared with APOC3*111 wild-type haplotype. This association was independent of the APOA5 SNPs. Although the APOC3 3238G, APOA5 -1131C, APOA5 c.-3G, and APOA5 c.1259C alleles were associated with higher triglyceride plasma concentrations, these effects could not explain the associations with MI in this population. In summary, this study supports the hypothesis that haplotypes in the APOC3 gene but not in the APOA5 gene increase susceptibility to MI.
1995-01-01
1995 Ship Production Symposium Paper No. 24: Absenteeism Manage- ment U.S. DEPARTMENT OF THE NAVY CARDEROCK DIVISION, NAVAL SURFACE WARFARE CENTER...Paper No. 24: Absenteeism Management 5a. CONTRACT NUMBER 5b. GRANT NUMBER 5c. PROGRAM ELEMENT NUMBER 6. AUTHOR(S) 5d. PROJECT NUMBER 5e. TASK NUMBER...5f. WORK UNIT NUMBER 7. PERFORMING ORGANIZATION NAME(S) AND ADDRESS(ES) Naval Surface Warfare Center CD Code 2230 - Design Integration Tools Bldg
Dua, Ankita; Sangwan, Naseer; Kaur, Jasvinder; Saxena, Anjali; Kohli, Puneet; Gupta, A. K.
2013-01-01
We report here the draft genome sequence of the alphaproteobacterium Agrobacterium sp. strain UHFBA-218, which was isolated from rhizosphere soil of crown gall-infected cherry rootstock Colt. The draft genome of strain UHFBA-218 consists of 112 contigs (5,425,303 bp) and 5,063 coding sequences with a G+C content of 59.8%. PMID:23723402
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ebert, D.
1997-07-01
This is a report on the CSNI Workshop on Transient Thermal-Hydraulic and Neutronic Codes Requirements held at Annapolis, Maryland, USA November 5-8, 1996. This experts` meeting consisted of 140 participants from 21 countries; 65 invited papers were presented. The meeting was divided into five areas: (1) current and prospective plans of thermal hydraulic codes development; (2) current and anticipated uses of thermal-hydraulic codes; (3) advances in modeling of thermal-hydraulic phenomena and associated additional experimental needs; (4) numerical methods in multi-phase flows; and (5) programming language, code architectures and user interfaces. The workshop consensus identified the following important action items tomore » be addressed by the international community in order to maintain and improve the calculational capability: (a) preserve current code expertise and institutional memory, (b) preserve the ability to use the existing investment in plant transient analysis codes, (c) maintain essential experimental capabilities, (d) develop advanced measurement capabilities to support future code validation work, (e) integrate existing analytical capabilities so as to improve performance and reduce operating costs, (f) exploit the proven advances in code architecture, numerics, graphical user interfaces, and modularization in order to improve code performance and scrutibility, and (g) more effectively utilize user experience in modifying and improving the codes.« less
1991-01-01
17C, 15 NFG 1.7939 CFMI CFM56 0 NC, 3 C, 11 NFG 1.5600 : GARRETT TFE731 .0 NC, 2C, 2 NFG 1.4643 ALSN 250C 1 NC, 11 C, 20 NFG 1.3349 RR RS211 0 NC. 4...10 14 3.0 0.0 7.5 10.5 PW2037/2040 111 0.3206 4 0 0 4 12.5 0.0 0.0 12.5 SPEY 178 0.3573 6 0 5 11 16.8 0.0 14.0 30.8 TFE731 3697 1.5600 2 0 2 4 1.3 0.0...JT15D/No.1 F D 7 NC 3 870609136 GL62 550 JT15D T B 7 C 10 870930017 GL62 LEAR 35 TFE731 T B 7 C 1 870908097 GL19 G50 TFE731 T B 7 C 5 870421035 GL08 LEAR
Cloning and sequence analysis of Hemonchus contortus HC58cDNA.
Muleke, Charles I; Ruofeng, Yan; Lixin, Xu; Xinwen, Bo; Xiangrui, Li
2007-06-01
The complete coding sequence of Hemonchus contortus HC58cDNA was generated by rapid amplification of cDNA ends and polymerase chain reaction using primers based on the 5' and 3' ends of the parasite mRNA, accession no. AF305964. The HC58cDNA gene was 851 bp long, with open reading frame of 717 bp, precursors to 239 amino acids coding for approximately 27 kDa protein. Analysis of amino acid sequence revealed conserved residues of cysteine, histidine, asparagine, occluding loop pattern, hemoglobinase motif and glutamine of the oxyanion hole characteristic of cathepsin B like proteases (CBL). Comparison of the predicted amino acid sequences showed the protein shared 33.5-58.7% identity to cathepsin B homologues in the papain clan CA family (family C1). Phylogenetic analysis revealed close evolutionary proximity of the protein sequence to counterpart sequences in the CBL, suggesting that HC58cDNA was a member of the papain family.
45 CFR Appendix A to Part 13 - Appendix A to Part 13
Code of Federal Regulations, 2012 CFR
2012-10-01
...-7a(c)(2); 1320b-10(c); 1395i-3(b)(3)(B)(ii), (g)(2)(A)(i); 1395l (h)(5)(D), (i)(6); 1395m(a)(11)(A), (a)(18), (b)(5)(C), (j)(2)(A)(iii); 1395u(j)(2), (k), (l )(3), (m)(3), (n)(3), (p)(3)(A); 1395y(b)(3)(C), (b)(6)(B); 1395cc(g); 1395dd(d)(1)(A), (B); 1395mm(i)(6)(B); 1395nn(g)(3), (4); 1395ss(d...
Xie, Yanli; Zhu, Xiaolu; Li, Yuan; Wang, Chen
2018-02-07
The Fe(III) chelating activity of anthocyanin extracted from black soybean coats was investigated at pH 3.0, 5.0, 6.5, 7.0, and 7.4 with fluorescence spectroscopy and microscale thermophoresis (MST). Cyanidin-3-glucoside (C3G) was determined to be 98% of the total anthocyanin by high-performance liquid chromatography. The binding affinity (K a ) exhibited significant pH-dependent behavior: K a was 9.7167 × 10 4 , 1.0837 × 10 4 , 1.4284 × 10 4 , 5.4550 × 10 4 , and 3.0269 × 10 4 M -1 at pH 3.0, 5.0, 6.5, 7.0, and 7.4, respectively (p < 0.05). The MST data showed that ΔG < 0 and ΔH < 0, demonstrating that chelation is spontaneous and exothermic. Because both ΔH and ΔS < 0, the chelation involves hydrogen bonds and/or van der Waals forces for pH 3.0, 5.0, and 6.5. Electrostatic interactions contributed to chelation at pH 7.0 and 7.4 with ΔH < 0 and ΔS > 0. With the formation of chelates, C3G improved the solubility of Fe(III) at pH 6.5, 7.0, and 7.4 to enhance the ferric ion bioavailability, except for aggregation observed at pH 5.0.
1981-02-10
76.,a41 7S.4 ?R.4’ 7B.q. .4 . I 78.uf 7-.t- . .I 2 V_ 77.71 77.71 72.2 f6 . I 7 -.. 4 78. . ,= , 9Ss 7. 7. ’ 7 .Z 7 7 79.Z 79.2 79.1-3; 77. 7 79.a: 75...cof-. .4r E0C >j a- -- =* C.j C . = ± (i3e!’ afl o oc- g Nta.. a .o.r3azdflloD2Coa.aoc a- f~ie~~z. n.!. G a 4 . ACca . . rx Co.--&Z3Er,0C i1DaI Da...6-=.1 66.4 ;-’ -0 o-b 915 c.01 is 99.2i 90.7 99.7 9 9. 1 99.7s. JO 200 1 5 01 6 ,. 1 66.4! .69 F6 . 1 ? 1 .61 976.1if 97.r1 99. 1 9gs 999 .39 a c .3 c
Effects of Deployment on the Mental Health of Service Members at Fort Hood
2006-07-06
167) Once (n= 1498) More Than Once (n=566) Characteristic 11 Percent n Percent n Percent Gender Male 120 71.9 1150 76.8 439 77.6 Female 47 28.1 348...4,5,6,7,9,10,13,14,15,16) and item 2 in the provider section. Gender was coded as ŕ" for female and Ŕ" for male. The remainder of the nominal level variables...Appendix C Variables, Measures, and Coding of Data VARIBLE DESCRIPTION SPSS DATA CODE & SPSS CODE Male Gender Female FEMALE =0, MALE=1 El 01 Wi E2 02 W2 E3
Condition Based Maintenance Technology Impacts Study for the Military Land Environment
2014-08-01
3a, 2g 3b,3m,3j,3e,3d,3f,3a,3c,3i 3c,3d,3h,3n 3d,3h 3e,3k,3i 3f,3h UNCLASSIFIED DSTO-RR-0404 UNCLASSIFIED 158 3g ,3c 3h,4b 3i,3m,3j,CBM...3e -> 3k 3i Egress of 2: 3n -> 3h 4b Egress of 2: 3k -> 3j 5c Egress of 2: 4d -> 3g 3c Egress of 1: 3a -> 2g Egress of 1: 1b -> 2g Egress...Ingress+Egress of 8: 2d 3b 3g 4d 4f -> 3c -> 3d 3h 3n Ingress+Egress of 7: 1b 2e 3a -> 2g -> 3b 2e 2c 2f Ingress+Egress of 7: 2a 2d 6b 6c -> 2b -> 3a
Hallman, D Michael; Srinivasan, Sathanur R; Chen, Wei; Boerwinkle, Eric; Berenson, Gerald S
2006-12-01
Polymorphisms in the APOC3 and APOA5 genes, from the APOA1/APOC3/APOA4/APOA5 gene cluster on chromosome 11q23, have been associated with interindividual variation in plasma triglycerides. APOA5 polymorphisms implicated include 2 in the promoter region (-1131 T/C and -3 A/G) and 1 in exon 2 (+56 C/G). APOC3 polymorphisms implicated include 1 (SstI) in the 3' untranslated region and 1 (-2854 G/T) in the APOC3-APOA4 intergenic region. We analyzed the associations of haplotypes and multilocus genotypes of these polymorphisms on longitudinal serum triglyceride profiles in 360 African American and 823 white subjects from the Bogalusa Heart Study. Subjects were examined from 2 to 8 times (mean +/- SD, 5.4 +/- 1.3) between 1973 and 1996, at ages ranging from 4 to 38 years, with 1978 observations in African Americans and 4465 in whites. Serum triglycerides were significantly higher among whites across all ages. Allele frequencies differed significantly between African Americans and whites at all but the APOA5 +56 C/G locus. Linkage disequilibrium among the loci was higher in whites and haplotype diversity lower: 6 haplotypes had estimated frequencies of more than 1% in African Americans, 5 in whites. Individually, all polymorphisms except APOC3 -2854 G/T showed significant associations with triglyceride levels in the full sample. However, genotype models including all 5 loci showed significant triglyceride associations for only 3 (APOC3 SstI, APOA5 -1131 T/C, and APOA5 +56 C/G); significant interactions among them indicated their effects were not independent. Neither APOC3 -2854 G/T nor APOA5 -3 A/G had significant effects when the other 3 loci were in the models. The EM algorithm was used to estimate haplotype frequencies and assign haplotype probabilities to individuals, which is conditional on their genotypes; individuals' haplotype probability vectors were then used as predictors in multilevel mixed models of longitudinal triglyceride profiles. Of haplotypes comprising, in order, APOC3 SstI and -2854 G/T and APOA5 -1131 T/C, -3 A/G, and +56 C/G, 3 were significantly associated with higher triglycerides, even after adjusting for multiple tests: GGTAG (P = .002), GTTAG (P < .0001), and CGCGC (P = .0002). Each GGTAG haplotype carried would be expected to raise triglyceride levels (relative to those of GTTAC homozygotes) by approximately 19 mg/dL, each GTTAG haplotype by approximately 15 mg/dL, and each CGCGC haplotype by approximately 7 mg/dL. Haplotypes comprising the 3 loci implicated by genotype analyses (SstI, -1131 T/C, and +56 C/G) were also tested: haplotypes C_C_C and G_T_G significantly raised triglycerides, even after adjustment for multiple comparisons (P < .002 for both), with each copy of C_C_C expected to raise triglycerides by approximately 7 mg/dL and each copy of G_T_G by approximately 15 mg/dL. Overall, our findings support those of others in associating specific polymorphisms and haplotypes in the APOA1/C3/A4/A5 gene cluster with higher serum triglyceride levels. However, the degree to which polymorphisms in the APOC3 and APOA5 genes may be independently associated with triglyceride levels remains to be determined.
Kim, Haeyoung; Cho, Dae-Yeon; Choi, Doo Ho; Oh, Mijin; Shin, Inkyung; Park, Won; Huh, Seung Jae; Nam, Seok Jin; Lee, Jeong Eon; Kim, Seok Won
2017-01-01
This study was performed to evaluate the frequency of mutations in CHEK2, PALB2, MRE11, and RAD50 among Korean patients at high risk for hereditary breast cancer. A total of 235 Korean patients with hereditary breast cancer who tested negative for BRCA1/2 mutation were enrolled to this study. Entire coding regions of CHEK2, PALB2, MRE11, and RAD50 were analyzed using massively parallel sequencing (MPS). Sequence variants detected by MPS were confirmed by Sanger sequencing. Six patients (2.5 %) were found to have pathogenic variants in CHEK2 (n = 1), PALB2 (n = 2), MRE11 (n = 1), and RAD50 (n = 2). Among the pathogenic variants, PALB2 c.2257C>T was previously reported in other studies, while CHEK2 c.1245dupC, PALB2 c.1048C>T, MRE11 c.1773_1774delAA, RAD50 c.1276C>T, and RAD50 c.3811_3813delGAA were newly identified in this study. A total of 15 missense variants were found in the four genes among 26 patients; 7 patients had a variant in CHEK2, 11 in PALB2, 2 in MRE11, and 6 in RAD50. When in silico analyses were performed to the 15 missense variants, six variants (CHEK2 c.686A>G, PALB2 c.1492G>T, PALB2 c.3054G>C, MRE11 c.140C>T, RAD50 c.1456C>T, and RAD50 c.3790C>T) were predicted to be deleterious. Pathogenic variants in CHEK2, PALB2, MRE11, and RAD50 were detected in a small proportion of Korean patients with features of hereditary breast cancer.
7Li(p,n)7Be and 12C(p,n)12N reactions at 200, 300, and 400 MeV
NASA Astrophysics Data System (ADS)
Watson, J. W.; Pourang, R.; Abegg, R.; Alford, W. P.; Celler, A.; El-Kateb, S.; Frekers, D.; Häusser, O.; Helmer, R.; Henderson, R.; Hicks, K.; Jackson, K. P.; Jeppesen, R. G.; Miller, C. A.; Vetterli, M.; Yen, S.; Zafiratos, C. D.
1989-07-01
At 200, 300, and 400 MeV bombarding energies, we measured cross section angular distributions for the 7Li(p,n)7Be(g.s.+0.43 MeV) reaction and 0° cross sections for the 12C(p,n)12N(g.s.) reaction. Systematics of these reactions are presented. The center-of-mass cross section for the 7Li(p,n)7Be(g.s.+0.43 MeV) reaction, when plotted as a function of momentum transfer, is nearly independent of energy. The laboratory cross section for this reaction at 0° in the energy range from 60 to 400 MeV is also independent of energy, having a constant value, to within experimental errors, of 35.5 mb/sr with an estimated uncertainty of +/-1.5 mb/sr.
NASA Astrophysics Data System (ADS)
Fine, A.; Wilson, C. G.; Papanicolaou, T.; Schaeffer, S. M.
2017-12-01
The balance between loss of C to the atmosphere, and the accumulation of soil organic matter is directly controlled by soil microorganisms. A key driver of microbial activity is soil moisture, but it is unclear how microbial C cycling responds to spatiotemporal shifts in hydrological conditions across a heterogeneous, dynamic landscape. We explored the relationship between soil wetness and biogeochemical cycling along landscape positions in two sloping fields of the Intensively Managed Landscape Critical Zone Observatory (IML-CZO) in Iowa, USA. Soils were collected (0-5 cm, 5-10 cm) from four positions (crest, shoulder, backslope, toeslope) along three transects identified as primary flow paths for runoff and sediment. Samples were incubated for 7 days and analyzed pre- and post-incubation for extractable dissolved organic C (DOC), microbial biomass C (MBC), microbial respiration (C-resp), and inorganic N. At both sites, field moisture, MBC, and CUE 0-5 cm increased from summit to toeslope, whereas CUE 5-10 cm decreased. The steeper and drier of the two fields (field 1) showed corresponding increases in C-resp and NO3, but decreases in DOC, moving downslope; the opposite trends were observed in the less erodible, wetter field 2. Comparing the two toeslopes (0-5 cm), field 2 had a larger labile C (DOC + MBC) pool (3.1 mg C g-1 dry soil) than field 1 (2.7 mg g-1 dry soil), but C-resp of field 1 was lower (53 and 42 ug g-1 dry soil for fields 1 and 2, respectively). No differences in MBC between depths were observed in field 1, but in field 2, MBC 5-10 cm (0.6 and 0.7 mg g-1 dry soil at crest and toeslope, respectively) was always less than MBC 0-5 cm (0.9 mg g-1 dry soil). Our findings indicate that wet, poorly drained soil conditions (such as those in lower landscape positions and at depth) decrease microbial activity and allow DOC to accumulate. Despite the relatively enhanced depositional environment of field 1, the low levels of DOC and high C-resp and MBC indicate more suitable conditions for aerobic respiration.
Opposite GC skews at the 5' and 3' ends of genes in unicellular fungi
2011-01-01
Background GC-skews have previously been linked to transcription in some eukaryotes. They have been associated with transcription start sites, with the coding strand G-biased in mammals and C-biased in fungi and invertebrates. Results We show a consistent and highly significant pattern of GC-skew within genes of almost all unicellular fungi. The pattern of GC-skew is asymmetrical: the coding strand of genes is typically C-biased at the 5' ends but G-biased at the 3' ends, with intermediate skews at the middle of genes. Thus, the initiation, elongation, and termination phases of transcription are associated with different skews. This pattern influences the encoded proteins by generating differential usage of amino acids at the 5' and 3' ends of genes. These biases also affect fourfold-degenerate positions and extend into promoters and 3' UTRs, indicating that skews cannot be accounted by selection for protein function or translation. Conclusions We propose two explanations, the mutational pressure hypothesis, and the adaptive hypothesis. The mutational pressure hypothesis is that different co-factors bind to RNA pol II at different phases of transcription, producing different mutational regimes. The adaptive hypothesis is that cytidine triphosphate deficiency may lead to C-avoidance at the 3' ends of transcripts to control the flow of RNA pol II molecules and reduce their frequency of collisions. PMID:22208287
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wilkins, T.A.
1993-06-01
This study investigates the molecular events of vacuole ontogeny in rapidly elongated cotton plant cells. Within the DNA coding region, the cotton and carrot cDNA clones exhibit 82.2% nucleotide sequence homology; at the amino acid level cotton and carrot catalytic subunits exhibited 95.7% identity and 2.1% amino acid similarity. When aligned with the analogous sequences from yeast, the cotton protein shared only 60.5% amino acid identity and 12.7% similarity. 10 refs., 1 tab.
Molecular Markers for Breast Cancer Susceptibility.
1997-09-01
Cells were harvested after 24hrs and stored at -80’C until analyzed. Preparation and analysis of RNA The fourth abdominal mammary glands from virgin...at -80’C. Total cellular RNA was prepared using 4M guanidium isothiocynate and CsCl buoyant density centrifugation (Maniatis, 1988). RNA was...were identified. The RNA expression levels of EDD-C3, C6, C11, C14, C15, C18, G5, G6 and G7 were analyzed by RT-PCR in an attempt to identify clones
NASA Astrophysics Data System (ADS)
Li, L.; Sadofsky, S. J.; Bebout, G. E.
2003-12-01
We are investigating the N and C contents and isotope ratios in subducting sediment sections in the two MARGINS Subduction Factory focus sites, the Izu-Bonin (IB) and Central America (CA) convergent margins (using samples obtained on DSDP/ODP Legs 125, 170, 185, and 205). The sediments from IB (Site 1149, and Leg 129) contain 5 to 661 ppm N with δ 15NAir values of +2.5 to +8.2 per mil (weighted average +4.6 per mil). Reduced-C concentrations range from 0.02 to 0.35% with δ 13CPDB values from -28.1 to -21.7 per mil. Calcite in carbonate-rich layers has δ 13C of +1.7 to +2.8 per mil and δ 18OVSMOW of +28.5 to +29.7 per mil. In comparison with IB, the CA sediment section (Site 1039) has far higher N content (663 to 2380 ppm N with δ 15N of +3.9 to +7.1 per mil; weighted average +5.6 per mil). Calcite in Site 1039 carbonate-rich layers hasδ 13C of +0.1 to +3.0 per mil and δ 18O of +29.9 to +32.1 per mil. At Site 1149, down-section decrease in N content, accompanied by decrease in δ 15N and C/N, is thought to reflect diagenesis, whereas at Site 1039, down-section decrease in N content (near 2000 ppm at surface, near 1000 ppm at 150 km) occurs without an obvious shift in δ 15N (reduced C data not yet available). Based on the C-N concentration data we've obtained, sediment C-N input fluxes are estimated at, for the IB margin, 2.5x106 g/km.year for N, 1.7x107 g/km.year for reduced C, and 9.2x108 g/km.year for oxidized C. For the CA margin, we estimate input fluxes of 8.9x106 g/km.year for N, and 1.3x109 g/km.year for oxidized C (work on reduced C is underway). Our input fluxes for C and N differ significantly from previously published input fluxes for the two margins based on estimated subducting sediment C-N concentrations, but errors are large. For the CA margin, the sediment-only N input flux of 9.8x109 g/year (for the entire 1100 km trench length), based on our results for Site 1039, can be compared with the arc volcanic output flux of 8.1x109 g/year of Fischer et al. (2002, Science; N input flux of 6.4x109 g/year estimated by those authors), indicating the incomplete return of subducted N to the surface in arcs. The magnitude of the N input flux in altered oceanic crust remains unknown (work on AOC N-δ 15N is underway) but should also be considered in such comparisons. All estimates of this type assume uniformity in the incoming sediment section along-strike in active trenches (known not to be the case). Shifts from δ 15N values measured for the two sediment sections to values near +7 per mil for the deeply subducted sediment component as suggested by studies of volcanic gases (e.g., Fischer et al., 2002; Hilton et al., 2002) could be accomplished by moderate loss of isotopically light N during metamorphic devolatilization across forearcs.
Poteet, Ethan; Lewis, Phoebe; Li, Feng; Zhang, Sheng; Gu, Jianhua; Chen, Changyi; Ho, Sam On; Do, Thai; Chiang, SuMing; Fujii, Gary; Yao, Qizhi
2015-01-01
HIV virus-like particles (VLPs) present the HIV envelope protein in its native conformation, providing an ideal vaccine antigen. To enhance the immunogenicity of the VLP vaccine, we sought to improve upon two components; the route of administration and the additional adjuvant. Using HIV VLPs, we evaluated sub-cheek as a novel route of vaccine administration when combined with other conventional routes of immunization. Of five combinations of distinct prime and boost sequences, which included sub-cheek, intranasal, and intradermal routes of administration, intranasal prime and sub-cheek boost (IN+SC) resulted in the highest HIV-specific IgG titers among the groups tested. Using the IN+SC regimen we tested the adjuvant VesiVax Conjugatable Adjuvant Lipid Vesicles (CALV) + monophosphoryl lipid A (MPLA) at MPLA concentrations of 0, 7.5, 12.5, and 25 μg/dose in combination with our VLPs. Mice that received 12.5 or 25 μg/dose MPLA had the highest concentrations of Env-specific IgG2c (20.7 and 18.4 μg/ml respectively), which represents a Th1 type of immune response in C57BL/6 mice. This was in sharp contrast to mice which received 0 or 7.5 μg MPLA adjuvant (6.05 and 5.68 μg/ml of IgG2c respectively). In contrast to IgG2c, MPLA had minor effects on Env-specific IgG1; therefore, 12.5 and 25 μg/dose of MPLA induced the optimal IgG1/IgG2c ratio of 1.3. Additionally, the percentage of germinal center B cells increased significantly from 15.4% in the control group to 31.9% in the CALV + 25 μg MPLA group. These mice also had significantly more IL-2 and less IL-4 Env-specific CD8+ T cells than controls, correlating with an increased percentage of Env-specific central memory CD4+ and CD8+ T cells. Our study shows the strong potential of IN+SC as an efficacious route of administration and the effectiveness of VLPs combined with MPLA adjuvant to induce Env specific Th1-oriented HIV-specific immune responses. PMID:26312747
76 FR 40935 - Sunshine Act Meeting
Federal Register 2010, 2011, 2012, 2013, 2014
2011-07-12
.... Claim No. LIB-I-007; 4 p.m. Claim No. LIB-II-007 Friday, July 22, 2011 10 a.m. Claim No. LIB-II-001; 10...) 616-6975. Judith H. Lock, Executive Officer. [FR Doc. 2011-17632 Filed 7-8-11; 4:15 pm] BILLING CODE... FOREIGN CLAIMS SETTLEMENT COMMISSION [F.C.S.C. Meeting and Hearing Notice No. 5-11] Sunshine Act...
Validity of the coding for herpes simplex encephalitis in the Danish National Patient Registry.
Jørgensen, Laura Krogh; Dalgaard, Lars Skov; Østergaard, Lars Jørgen; Andersen, Nanna Skaarup; Nørgaard, Mette; Mogensen, Trine Hyrup
2016-01-01
Large health care databases are a valuable source of infectious disease epidemiology if diagnoses are valid. The aim of this study was to investigate the accuracy of the recorded diagnosis coding of herpes simplex encephalitis (HSE) in the Danish National Patient Registry (DNPR). The DNPR was used to identify all hospitalized patients, aged ≥15 years, with a first-time diagnosis of HSE according to the International Classification of Diseases, tenth revision (ICD-10), from 2004 to 2014. To validate the coding of HSE, we collected data from the Danish Microbiology Database, from departments of clinical microbiology, and from patient medical records. Cases were classified as confirmed, probable, or no evidence of HSE. We estimated the positive predictive value (PPV) of the HSE diagnosis coding stratified by diagnosis type, study period, and department type. Furthermore, we estimated the proportion of HSE cases coded with nonspecific ICD-10 codes of viral encephalitis and also the sensitivity of the HSE diagnosis coding. We were able to validate 398 (94.3%) of the 422 HSE diagnoses identified via the DNPR. Hereof, 202 (50.8%) were classified as confirmed cases and 29 (7.3%) as probable cases providing an overall PPV of 58.0% (95% confidence interval [CI]: 53.0-62.9). For "Encephalitis due to herpes simplex virus" (ICD-10 code B00.4), the PPV was 56.6% (95% CI: 51.1-62.0). Similarly, the PPV for "Meningoencephalitis due to herpes simplex virus" (ICD-10 code B00.4A) was 56.8% (95% CI: 39.5-72.9). "Herpes viral encephalitis" (ICD-10 code G05.1E) had a PPV of 75.9% (95% CI: 56.5-89.7), thereby representing the highest PPV. The estimated sensitivity was 95.5%. The PPVs of the ICD-10 diagnosis coding for adult HSE in the DNPR were relatively low. Hence, the DNPR should be used with caution when studying patients with encephalitis caused by herpes simplex virus.
Assessment of DNA Damage and Repair in Adults Consuming AllylIsothiocyanate or Brassica Vegetables
Charron, Craig S.; Clevidence, Beverly A.; Albaugh, George A.; Kramer, Matthew H.; Vinyard, Bryan T.; Milner, John A.; Novotny, Janet A.
2012-01-01
Allylisothiocyanate (AITC) is a dietary component with possible anti-cancer effects, though much information about AITC and cancer has been obtained from cell studies. To investigate the effect of AITC on DNA integrity in vivo, a crossover study was conducted. Adults (n=46) consumed AITC, AITC-rich vegetables (mustard and cabbage), or a control treatment with a controlled diet for 10 days each. On day 11, volunteers provided blood and urine before and after consuming treatments. Volunteers were characterized for genotype for GSTM1 and GSTT1 (glutathione S-transferases) and XPD (DNA repair). DNA integrity in peripheral blood mononuclear cells (PBMCs) was assessed by single cell gel electrophoresis. Urine was analyzed for 8-oxo-7,8-dihydro-2’-deoxyguanosine (8-oxodG) and creatinine. Ten day intake of neither AITC nor mustard/cabbage(M/C) resulted in statistically significant differences in DNA strand breaks (LS mean % DNA in tail ± SEM: 4.8 ± 0.6 for control, 5.7 ± 0.7 for AITC, 5.3 ± 0.6 for M/C) or urinary 8-oxodG (LS mean µg 8-oxodG/g creatinine ± SEM: 2.95 ± 0.09 for control, 2.88 ± 0.09 for AITC, 3.06 ± 0.09 for M/C). Both AITC and M/C increased DNA strand breaks 3h post-consumption (LS mean % DNA in tail ± SEM: 3.2 ± 0.7 for control, 8.3 ± 1.7 for AITC, 8.0 ± 1.7 for M/C), and this difference disappeared at 6h (4.2 ± 0.9 for control, 5.7 ± 1.2 for AITC, 5.5 ± 1.2 for M/C). Genotypes for GSTM1, GSTT1, and XPD were not associated with treatment effects. In summary, DNA damage appeared to be induced in the short term by AITC and AITC-rich products, but that damage disappeared quickly, and neither AITC nor AITC-rich products affected DNA base excision repair. PMID:22902324
A novel germline PALB2 deletion in Polish breast and ovarian cancer patients.
Dansonka-Mieszkowska, Agnieszka; Kluska, Anna; Moes, Joanna; Dabrowska, Michalina; Nowakowska, Dorota; Niwinska, Anna; Derlatka, Pawel; Cendrowski, Krzysztof; Kupryjanczyk, Jolanta
2010-02-02
PALB2 protein was recently identified as a partner of BRCA1 and BRCA2 which determines their proper function in DNA repair. Initially, the entire coding sequence of the PALB2 gene with exon/intron boundaries was evaluated by the PCR-SSCP and direct sequencing methods on 70 ovarian carcinomas. Sequence variants of interest were further studied on enlarged groups of ovarian carcinomas (total 339 non-consecutive ovarian carcinomas), blood samples from 334 consecutive sporadic and 648 consecutive familial breast cancer patients, and 1310 healthy controls from central Poland. Ten types of sequence variants were detected, and among them four novel polymorphisms: c.2996+58T>C in intron 9; c.505C>A (p.L169I), c.618T>G (p.L206L), both in exon 4; and c.2135C>T (A712V) in exon 5 of the PALB2 gene. Another two polymorphisms, c.212-58A>C and c.2014G>C (E672Q) were always detected together, both in cancer (7.5% of patients) and control samples (4.9% of controls, p = 0.2). A novel germline truncating mutation, c.509_510delGA (p.R170fs) was found in exon 4: in 2 of 339 (0.6%) unrelated ovarian cancer patients, in 4 of 648 (0.6%) unrelated familial breast cancer patients, and in 1 of 1310 controls (0.08%, p = 0.1, p = 0.044, respectively). One ovarian cancer patient with the PALB2 mutation had also a germline nonsense mutation of the BRCA2 gene. The c.509_510delGA is a novel PALB2 mutation that increases the risk of familial breast cancer. Occurrence of the same PALB2 alteration in seven unrelated women suggests that c.509_510delGA (p.R170fs) is a recurrent mutation for Polish population.
Yousef, Al-Motassem; Zawiah, Mohammed; Al-Yacoub, Shorouq; Kadi, Taha; Tantawi, Dua' A; Al-Ramadhani, Hanguin
2018-05-29
Colorectal cancer (CRC) is one of the major health issues worldwide. 5-Fluorouracil (5-FU) is a cornerstone of chemotherapy for CRC and the major targets of 5-FU are folate-metabolizing enzymes. A total of 103 CRC patients with complete clinical data were included in this prospective cohort study. Genotyping was performed using polymerase chain reaction (PCR) followed by sequencing. Using Kaplan-Meier curves, log-rank tests, and Cox proportional hazard models, we evaluated associations between functional polymorphisms in four genes MTHFR (1298A>C and 677C>T), DPYD (496A>G and 85T>C), DHFR 19 bp del, and MTR (2756 A>G) with disease-free survival (DFS). The minor allele frequencies of MTHFR 1298A>C, MTHFR 677C>T, DPYD 496A>G, DPYD 85T>C, DHFR 19 bp del, and MTR 2756 A>G were 0.364, 0.214, 0.116, 0.209, 0.383, and 0.097, respectively. CRC patients carrying the homozygous GG genotype in DPYD 496A>G had 4.36 times shorter DFS than wild-type AA carriers, (DFS GG vs AA : 8.0 ± 4 vs 69.0 ± 10 months; HR 4.36, 95% CI 1.04-18; p = 0.04). Moreover, female carriers of homozygous CC genotype of DPYD 85T>C had shorter DFS compared to either heterozygous or wild-type genotypes, and were 12.7 times shorter than wild-type TT carriers (DFS CC vs TT : 5.0 ± 1.5 vs 42.0 ± 7.6 months; HR 12.7, 95% CI 2.2-71.4; p = 0.004). However, there were no significant associations with the other studied polymorphisms. Genetic polymorphism in DPYD seems to be associated with DFS in CRC patients receiving an adjuvant regimen of 5-FU/capecitabine-based chemotherapy. Further studies are needed to verify these findings.
Zhao, Tong; Zhao, Ping; Doyle, Michael P
2010-11-01
Studies were conducted to determine the best concentration and exposure time for treatment of alfalfa seeds with levulinic acid plus sodium dodecyl sulfate (SDS) to inactivate Escherichia coli O157:H7 and Salmonella without adversely affecting seed germination. Alfalfa seeds inoculated with a five-strain mixture of E. coli O157:H7 or Salmonella Typhimurium were dried in a laminar flow hood at 21°C for up to 72 h. Inoculated alfalfa seeds dried for 4 h then treated for 5 min at 21°C with 0.5% levulinic acid and 0.05% SDS reduced the population of E. coli O157:H7 and Salmonella Typhimurium by 5.6 and 6.4 log CFU/g, respectively. On seeds dried for 72 h, treatment with 0.5% levulinic acid and 0.05% SDS for 20 min at 21°C reduced E. coli O157:H7 and Salmonella Typhimurium populations by 4 log CFU/g. Germination rates of alfalfa seeds treated with 0.5% levulinic acid plus 0.05% SDS for up to 1 h at 21°C were compared with a treatment of 20,000 ppm of calcium hypochlorite or tap water only. Treatment of alfalfa seeds with 0.5% levulinic acid plus 0.05% SDS for 5 min at 21°C resulted in a >3.0-log inactivation of E. coli O157:H7 and Salmonella.
Liu, Yan-Hua; Liu, Xin-Xin; Zhang, Ming-Hai
2016-07-01
Sika deer (Cervus nippon Temminck 1836) are classified in the order Artiodactyla, family Cervidae, subfamily Cervinae. At present, the phylogenetic studies of C. nippon are problematic. In this study, we first determined and described the complete mitochondrial sequence of the wild C. nippon hortulorum. The complete mitogenome sequence is 16 566 bp in length, including 13 protein-coding genes, two rRNA genes, 22 tRNA genes, a putative control region (CR) and a light-strand replication origin (OL). The overall base composition was 33.4% A, 28.6% T, 24.5% C, 13.5% G, with a 62.0% AT bias. The 13 protein-coding genes encode 3782 amino acids in total. To further validate the new determined sequences and phylogeny of Sika deer, phylogenetic trees involving 15 most closely related species available in GenBank database were constructed. These results are expected to provide useful molecular data for deer species identification and further phylogenetic studies of Artiodactyla.
Flexible wavelength de-multiplexer for elastic optical networking.
Zhou, Rui; Gutierrez Pascual, M Deseada; Anandarajah, Prince M; Shao, Tong; Smyth, Frank; Barry, Liam P
2016-05-15
We report an injection locked flexible wavelength de-multiplexer (de-mux) that shows 24-h frequency stability of 1 kHz for optical comb-based elastic optical networking applications. We demonstrate 50 GHz, 87.5 GHz equal spacing and 6.25G-25G-50 GHz, 75G-50G-100 GHz unequal spacing for the de-multiplexer outputs. We also implement an unequally spaced (75G-50G-100 GHz), mixed symbol rate (12.5 GBaud and 40 GBaud) and modulation format (polarization division multiplexed quadrature phase shift keying and on-off keying) wavelength division multiplexed transmission system using the de-multiplexer outputs. The results show 0.6 dB receiver sensitivity penalty, at 7% hard decision forward error correction coding limit, of the 100 km transmitted de-mux outputs when compared to comb source seeding laser back-to-back.
Patel, Yogesh; Vadgama, Vishalkumar; Baxi, Seema; Chandrabhanu; Tripathi, B
2011-01-01
Our aim of the study was to evaluate the hypolipidemic activity of leaf juice of Catharanthus roseus (Linn.) G. Donn. in guinea pigs. Adult guinea pigs of either sex were divided into seven groups: group 1 - normal diet; group 2 - high fat diet; group 3 and 4 - normal diet plus leaf juice of Catharanthus roseus (Linn.) G. Donn. in the dose of 0.5 and 1 mL/kg, respectively; group 5 and 6- high fat diet with leaf juice of Catharanthus roseus (Linn.) G. Donn. in the dose of 0.5 and 1 mL/kg, respectively; group 7 - high fat diet plus atorvastatin (3 mg/kg). Above diet treatment was given for six weeks and drug was given during last three weeks. Serum lipid profile (total cholesterol, triglycerides, LDL-c, VLDL-c, HDL-c) was performed in each group of animals before and at the end of six weeks. Histological study of aorta, liver and kidney was done in group 1, 2, 6 and 7 and blood cell count was done in animals that were treated juice of C. roseus (Linn.) G. Donn. before and after juice administration. Simultaneous administration of leaf juice of C. roseus (Linn.) G. Donn. in the dose of 0.5 mL/kg prevents the rise of serum lipid parameters and decreases the fatty changes in the tissue induced by high fat diet, whereas in the dose of 1 mL/kg not only counteracts the elevation, but also significantly (p < 0.05) reduces the serum level LDL-c and the ratio of total cholesterol and HDL-c. Leaf juice of C. roseus (Linn.) G. Donn. possesses significant lipid lowering and anti atherosclerotic activity.
Kaur, Jasvinder; Verma, Helianthous; Tripathi, Charu; Khurana, J. P.
2013-01-01
Sphingobium baderi strain LL03T was isolated from hexachlorocyclohexane (HCH)-contaminated soil from Spolana, Czech Republic. Strain LL03T is a mutant that is deficient in linB and linC (genes that encode hexachlorocyclohexane haloalkane dehalogenase and dehydrogenase, respectively). The draft genome sequence of LL03T (~4.85 Mb) consists of 92 contigs and 4,914 coding sequences, with a G+C content of 63.5%. PMID:24051322
A DFT/HF study of the potential energy surface of protonated ethane C2H7+
NASA Astrophysics Data System (ADS)
Hrusak, Jan; Zabka, Jan; Dolejsek, Zdenek; Herman, Zdenek
1997-11-01
Structures and energies of several isomers of the C2H7+ cation have been calculated using the parametrized B3LYP HF/DFT method. The B3LYP/6-31G** geometries of the individual isomers are of at least the same quality as the MP2/6-31G** results. The zero-point-energy corrected relative stabilities of the individual C2H7+ isomers are in excellent agreement with the much more costly MP4SDTQ/6-31G** MO calculations. A structure with a linear C---H---C skeleton and a CC distance of about 2.5 A was found to be a higher order saddle point on the PES resulting from curve crossing between the reactant and product channels CH3+ + CH4; this finding is of importance in interpreting the experimental results on the hydride ion transfer between CH3+ and CH4. The calculations are also consistent with the earlier experimental results on the formation of the products C2H5+ + H2.
Fiedler, Jan; Baker, Andrew H; Dimmeler, Stefanie; Heymans, Stephane; Mayr, Manuel; Thum, Thomas
2018-05-23
Non-coding RNAs are increasingly recognized not only as regulators of various biological functions but also as targets for a new generation of RNA therapeutics and biomarkers. We hereby review recent insights relating to non-coding RNAs including microRNAs (e.g. miR-126, miR-146a), long non-coding RNAs (e.g. MIR503HG, GATA6-AS, SMILR) and circular RNAs (e.g. cZNF292) and their role in vascular diseases. This includes identification and therapeutic use of hypoxia-regulated non-coding RNAs and endogenous non-coding RNAs that regulate intrinsic smooth muscle cell signalling, age-related non-coding RNAs and non-coding RNAs involved in the regulation of mitochondrial biology and metabolic control. Finally, we discuss non-coding RNA species with biomarker potential.
Development of Pantothenate Analogs That Can Treat Combat-Related Infections
2012-01-01
are as follows (Fig. 6): the MIC for E . faecalis was determined as 156 g/ml for N5-Pan and 29 g/ml for N7-Pan, respectively. In the case of S...Crystallogr.D.Biol.Crystallogr. 60, 2126-2132 (2004). 7. G. N. Murshudov, A. A. Vagin , E . J. Dodson, Acta Crystallogr.D.Biol.Crystallogr. 53, 240-255 (1997). 8. I. W...CONTRACT NUMBER 5b. GRANT NUMBER 5c. PROGRAM ELEMENT NUMBER 6. AUTHOR(S) 5d. PROJECT NUMBER 5e. TASK NUMBER E -Mail: 5f. WORK UNIT
2016-11-01
ER D C/ G SL T R- 16 -3 1 Modeling the Blast Load Simulator Airblast Environment Using First Principles Codes Report 1, Blast Load...Simulator Airblast Environment using First Principles Codes Report 1, Blast Load Simulator Environment Gregory C. Bessette, James L. O’Daniel...evaluate several first principles codes (FPCs) for modeling airblast environments typical of those encountered in the BLS. The FPCs considered were
DOE Office of Scientific and Technical Information (OSTI.GOV)
Nouioui, Imen; Göker, Markus; Carro, Lorena
Nakamurella lactea DLS-10 T , isolated from rock in Korea, is one of the four type strains of the genus Nakamurella. In this study, we describe the high quality draft genome of N. lactea DLS-10 T and its annotation. A summary of phenotypic data collected from previously published studies was also included. The genome of strain DLS-10 T presents a size of 5.82 Mpb, 5100 protein coding genes, and a C + G content of 68.9%. Based on the genome analysis, emended description of N. lactea in terms of G + C content was also proposed.
Nouioui, Imen; Göker, Markus; Carro, Lorena; ...
2017-01-06
Nakamurella lactea DLS-10 T , isolated from rock in Korea, is one of the four type strains of the genus Nakamurella. In this study, we describe the high quality draft genome of N. lactea DLS-10 T and its annotation. A summary of phenotypic data collected from previously published studies was also included. The genome of strain DLS-10 T presents a size of 5.82 Mpb, 5100 protein coding genes, and a C + G content of 68.9%. Based on the genome analysis, emended description of N. lactea in terms of G + C content was also proposed.
NASA Astrophysics Data System (ADS)
Xiong, Jiayu; Li, Xingwen; Wu, Jian; Guo, Xiaoxue; Zhao, Hu
2017-11-01
Both fluoroketone C5F10O and fluoronitrile C4F7N are promising substitute gases for SF6. The electron-impact ionization cross sections for these two gases are calculated using the Deutsch-Märk (DM) formula and its modified method. The necessary molecular geometry optimization and electron population were determined by ab initio calculation, which was performed with quantum chemistry code. The level of calculation, including the theoretical method and basis-set, are carefully determined. To eliminate the drawbacks of the DM formula, a modified DM formula is set in this paper. The modified DM formula, of which the weighting factors are changed, has a better agreement with the experimental data on both the peak and shape of the cross-section curves. The results calculated by DM formula and modified DM formula are given as references to fill in gaps in further research into C5F10O and C4F7N.
2006-08-25
interleaving schemes defined in 802.11a standard, although only 6 Mbps data rate with BPSK and 1/2 Convolutional coding and puncturing is used in our...16-QAM/64-QAM Convolutional Code K = 7 (64 states) K = 7 (64 states) Coding Rates 1/2, 2/3, 3/4 1/2, 2/3, 3/4 Channel Spacing (MHz) 20 10 Signal...Since 3G systems need to be backward compatible with 2G systems, they are a combination of existing and evolved equipments with data rate up to 2 Mbps
Biomedical waste disposal: A systems analysis
Jindal, A.K.; Gupta, Arun; Grewal, V.S.; Mahen, Ajoy
2012-01-01
Background In view of the contemporary relevance of BMW Management, a system analysis of BMW management was conducted to ascertain the views of Service hospitals/HCE's on the current system in BMW management in-vogue; to know the composition and quantity of waste generated; to get information on equipment held & equipment required and to explore the possibility of outsourcing, its relevance and feasibility. Methods A qualitative study in which various stake holders in BMW management were studied using both primary (Observation, In-depth Interview of Key Personnel, Group Discussions: and user perspective survey) and secondary data. Results All the stake holders were of the opinion that where ever possible outsourcing should be explored as a viable method of BMW disposal. Waste generated in Colour code Yellow (Cat 1,2,3,5,6) ranged from 64.25 to 27.345 g/day/bed; in Colour code Red (Cat 7) from 19.37 to 10.97 g/day/bed and in Colour code Blue (Cat 4) from 3.295 to 3.82 g/day/bed in type 1 hospitals to type 5 hospitals respectively. Conclusion Outsourcing should be explored as a viable method of BMW disposal, were there are government approved local agencies. Facilities authorized by the Prescribed Authority should be continued and maintained where outsourcing is not feasible. PMID:24600142
Lu, X K; Xin, T Y; Zhang, Q; Xu, Q; Wei, T H; Wang, Y X
2018-08-03
Recently, a series of graphene-like binary monolayers (g-SiC x ), where Si partly substitutes the C positions in graphene, have been obtained by tailoring the band gaps of graphene and silicene that have made them a promising material for application in opto-electronic devices. Subsequently, evaluating the mechanical properties of g-SiC x has assumed great importance for engineering applications. In this study, we quantified the in-plane mechanical properties of g-SiC x (x = 7, 5, 3, 2 and 1) monolayers (also including graphene and silicene) based on density function theory. It was found that the mechanical parameters of g-SiC x , such as the ideal strength, Young's modulus, shear modulus, Poisson's ratio, as well as fracture toughness, are overall related to the ratio of Si-C to C-C bonds, which varies with Si concentration. However, for g-SiC 7 and g-SiC 3 , the mechanical properties seem to depend on the structure because in g-SiC 7 , the C-C bond strength is severely weakened by abnormal stretching, and in g-SiC 3 , conjugation structure is formed. The microscopic failure of g-SiC x exhibits diverse styles depending on the more complex structural deformation modes introduced by Si substitution. We elaborated the structure-properties relationship of g-SiC x during the failure process, and in particular, found that the structural transformation of g-SiC 3 and g-SiC is due to the singular symmetry of their structure. Due to the homogeneous phase, all the g-SiC x investigated in this study preserve rigorous isotropic Young's moduli and Poisson's ratios. With versatile mechanical performances, the family of g-SiC x may facilitate the design of advanced two-dimensional materials to meet the needs for practical mechanical engineering applications. The results offer a fundamental understanding of the mechanical behaviors of g-SiC x monolayers.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kouchakdjian, M.; Patel, D.J.; Bodepudi, V.
1991-02-05
Proton NMR studies are reported on the complementary d(C1-C2-A3-C4-T5-A6-oxo-G7-T8-C9-A10-C11-C12){center dot}d(G13-G14-T15-G16-A17-A18-T19-A20-G21-T22-G23-G24) dodecanucleotide duplex (designated 8-oxo-7H-dG{center dot}dA 12-mer), which contains a centrally located 7-hydro-8-oxodeoxyguanosine (8-oxo-7H-dG) residue, a group commonly found in DNA that has been exposed to ionizing radiation or oxidizing free radicals. From the NMR spectra it can be deduced that this moiety exists as two tautomers, or gives rise to two DNA conformations, that are in equilibrium and that exchange slowly. The present study focuses on the major component of the equilibrium that originates in the 6,8-dioxo tautomer of 8-oxo-7H-dG. The authors have assigned the exchangeable NH1, NH7, and NH{submore » 2}-2 base protons located on the Watson-Crick and Hoogsteen edges of 8-oxo-7H-dG7 in the 8-oxo-7H-dG{center dot}dA 12-mer duplex, using an analysis of one- and two-dimensional nuclear Overhauser enhancement (NOE) data in H{sub 2}O solution. They were able to detect a set of intra- and interstrand NOEs between protons (exchangeable and nonexchangeable) on adjacent residues in the d(A6-oxo-G7-T8){center dot}d(A17-A18-T19) trinucleotide segment centered about the lesion site that establishes stacking of the oxo-dG7(syn){center dot}dA(anti) pair between stable Watson-Crick dA6{center dot}dT19 and dT8{center dot}A17 base pairs with minimal perturbation of the helix. The structural studies demonstrate that 8-oxo-7H-dG(syn){center dot}dA(anti) forms a stable pair in the interior of the helix, providing a basis for the observed incorporation of dA opposite 8-oxo-7H-dG when readthrough occurs past this oxidized nucleoside base.« less
Posukh, Olga L.; Teryutin, Fedor M.; Solovyev, Aisen V.; Klarov, Leonid A.; Romanov, Georgii P.; Gotovtsev, Nyurgun N.; Kozhevnikov, Andrey A.; Kirillina, Elena V.; Sidorova, Oksana G.; Vasilyevа, Lena M.; Fedotova, Elvira E.; Morozov, Igor V.; Bondar, Alexander A.; Solovyevа, Natalya A.; Kononova, Sardana K.; Rafailov, Adyum M.; Sazonov, Nikolay N.; Alekseev, Anatoliy N.; Tomsky, Mikhail I.; Dzhemileva, Lilya U.; Khusnutdinova, Elza K.; Fedorova, Sardana A.
2016-01-01
Pathogenic variants in the GJB2 gene, encoding connexin 26, are known to be a major cause of hearing impairment (HI). More than 300 allelic variants have been identified in the GJB2 gene. Spectrum and allelic frequencies of the GJB2 gene vary significantly among different ethnic groups worldwide. Until now, the spectrum and frequency of the pathogenic variants in exon 1, exon 2 and the flanking intronic regions of the GJB2 gene have not been described thoroughly in the Sakha Republic (Yakutia), which is located in a subarctic region in Russia. The complete sequencing of the non-coding and coding regions of the GJB2 gene was performed in 393 patients with HI (Yakuts—296, Russians—51, mixed and other ethnicities—46) and in 187 normal hearing individuals of Yakut (n = 107) and Russian (n = 80) populations. In the total sample (n = 580), we revealed 12 allelic variants of the GJB2 gene, 8 of which were recessive pathogenic variants. Ten genotypes with biallelic recessive pathogenic variants in the GJB2 gene (in a homozygous or a compound heterozygous state) were found in 192 out of 393 patients (48.85%). We found that the most frequent GJB2 pathogenic variant in the Yakut patients was c.-23+1G>A (51.82%) and that the second most frequent was c.109G>A (2.37%), followed by c.35delG (1.64%). Pathogenic variants с.35delG (22.34%), c.-23+1G>A (5.31%), and c.313_326del14 (2.12%) were found to be the most frequent among the Russian patients. The carrier frequencies of the c.-23+1G>A and с.109G>A pathogenic variants in the Yakut control group were 10.20% and 2.80%, respectively. The carrier frequencies of с.35delG and c.101T>C were identical (2.5%) in the Russian control group. We found that the contribution of the GJB2 gene pathogenic variants in HI in the population of the Sakha Republic (48.85%) was the highest among all of the previously studied regions of Asia. We suggest that extensive accumulation of the c.-23+1G>A pathogenic variant in the indigenous Yakut population (92.20% of all mutant chromosomes in patients) and an extremely high (10.20%) carrier frequency in the control group may indicate a possible selective advantage for the c.-23+1G>A carriers living in subarctic climate. PMID:27224056
Polkam, Naveen; Rayam, Parsharamulu; Anireddy, Jaya Shree; Yennam, Satyanarayana; Anantaraju, Hasitha Shilpa; Dharmarajan, Sriram; Perumal, Yogeeswari; Kotapalli, Sudha Sravanti; Ummanni, Ramesh; Balasubramanian, Sridhar
2015-04-01
A series of 2,5-disubstituted-1,3,4-thiadiazole derivatives 5a-5l, 7a-7e and 9 have been synthesised and screened for in vitro antimycobacterial activity against Mycobacterium smegmatis MC-155. In addition these compounds have also been screened for cytotoxic activity against cancer cell lines HT-29, MDA-MB-231 by MTT colorimetric assay. The compounds are well characterized by spectral analysis viz. (1)H NMR, (13)C NMR, FT-IR, mass and HRMS. Screening results indicate that compounds 5g, 7a possess good antitubercular activity with MIC value 65.74 and 40.86, respectively, compounds 5g, 7a, 7b, 7d, 7e and 9 displayed promising cytotoxic activity against the cell lines tested. 5g and 7a stand out to be potent antimycobacterial and anticancer agents among the tested series. Further the title compounds were also tested on human normal cells HEK293T and are found to be safer with lesser cytotoxicity. It is interesting to observe that compound 5g has come out to be safer, potent anticancer and antimycobacterial agent. Copyright © 2015 Elsevier Ltd. All rights reserved.
Prescott, Natalie J.; Lehne, Benjamin; Stone, Kristina; Lee, James C.; Taylor, Kirstin; Knight, Jo; Papouli, Efterpi; Mirza, Muddassar M.; Simpson, Michael A.; Spain, Sarah L.; Lu, Grace; Fraternali, Franca; Bumpstead, Suzannah J.; Gray, Emma; Amar, Ariella; Bye, Hannah; Green, Peter; Chung-Faye, Guy; Hayee, Bu’Hussain; Pollok, Richard; Satsangi, Jack; Parkes, Miles; Barrett, Jeffrey C.; Mansfield, John C.; Sanderson, Jeremy; Lewis, Cathryn M.; Weale, Michael E.; Schlitt, Thomas; Mathew, Christopher G.
2015-01-01
The contribution of rare coding sequence variants to genetic susceptibility in complex disorders is an important but unresolved question. Most studies thus far have investigated a limited number of genes from regions which contain common disease associated variants. Here we investigate this in inflammatory bowel disease by sequencing the exons and proximal promoters of 531 genes selected from both genome-wide association studies and pathway analysis in pooled DNA panels from 474 cases of Crohn’s disease and 480 controls. 80 variants with evidence of association in the sequencing experiment or with potential functional significance were selected for follow up genotyping in 6,507 IBD cases and 3,064 population controls. The top 5 disease associated variants were genotyped in an extension panel of 3,662 IBD cases and 3,639 controls, and tested for association in a combined analysis of 10,147 IBD cases and 7,008 controls. A rare coding variant p.G454C in the BTNL2 gene within the major histocompatibility complex was significantly associated with increased risk for IBD (p = 9.65x10−10, OR = 2.3[95% CI = 1.75–3.04]), but was independent of the known common associated CD and UC variants at this locus. Rare (<1%) and low frequency (1–5%) variants in 3 additional genes showed suggestive association (p<0.005) with either an increased risk (ARIH2 c.338-6C>T) or decreased risk (IL12B p.V298F, and NICN p.H191R) of IBD. These results provide additional insights into the involvement of the inhibition of T cell activation in the development of both sub-phenotypes of inflammatory bowel disease. We suggest that although rare coding variants may make a modest overall contribution to complex disease susceptibility, they can inform our understanding of the molecular pathways that contribute to pathogenesis. PMID:25671699
Govindarajan, Subramaniam S.; Qi, Feng; Li, Jian-Liang; Sahoo, Malaya K.
2017-01-01
ABSTRACT Paenibacillus sp. strain KS1 was isolated from an epiphyte, Tillandsia usneoides (Spanish moss), in central Florida, USA. Here, we report a draft genome sequence of this strain, which consists of a total of 398 contigs spanning 6,508,195 bp, with a G+C content of 46.5% and comprising 5,401 predicted coding sequences. PMID:28153888
Tiwari, Sandeep; Jamal, Syed Babar; Oliveira, Leticia Castro; Clermont, Dominique; Bizet, Chantal; Mariano, Diego; de Carvalho, Paulo Vinicius Sanches Daltro; Souza, Flavia; Pereira, Felipe Luiz; de Castro Soares, Siomar; Guimarães, Luis C; Dorella, Fernanda; Carvalho, Alex; Leal, Carlos; Barh, Debmalya; Figueiredo, Henrique; Hassan, Syed Shah; Azevedo, Vasco; Silva, Artur
2016-08-11
In this work, we describe a set of features of Corynebacterium auriscanis CIP 106629 and details of the draft genome sequence and annotation. The genome comprises a 2.5-Mbp-long single circular genome with 1,797 protein-coding genes, 5 rRNA, 50 tRNA, and 403 pseudogenes, with a G+C content of 58.50%. Copyright © 2016 Tiwari et al.
Schreier, Theresa M.; Dawson, V.K.; Cho, Yirang; Spanjers, N.J.; Boogaard, M.A.
2000-01-01
Bayluscide [the ethanolamine salt of niclosamide (NIC)] is a registered piscicide used in combination with 3-(trifluoromethyl)-4-nitrophenol (TFM) to control sea lamprey populations in streams tributary to the Great Lakes. A high-performance liquid chromatography (HPLC) method was developed for the determination of NIC residues in muscle fillet tissues of fish exposed to NIC and TFM during sea lamprey control treatments. NIC was extracted from fortified channel catfish and rainbow trout fillet tissue with a series of acetone extractions and cleaned up on C-18 solid-phase extraction cartridges. NIC concentrations were determined by HPLC with detection at 360 and 335 nm for rainbow trout and catfish, respectively. Recovery of NIC from rainbow trout (n = 7) fortified at 0.04 mu g/g was 77 +/- 6.5% and from channel catfish (n = 7) fortified at 0.02 mu g/g was 113 +/- 11%. NIC detection limit was 0.0107 mu g/g for rainbow trout and 0.0063 mu g/g for catfish. Percent recovery of incurred radioactive residues by this method from catfish exposed to [C-14]NIC was 89.3 +/- 4.1%. Percent recoveries of NIC from fortified storage stability tissue samples for rainbow trout (n = 3) analyzed at 5 and 7.5 month periods were 78 +/- 5.1 and 68 +/- 2.4%, respectively. Percent recoveries of NIC from fortified storage stability tissue samples for channel catfish (n = 3) analyzed at 5 and 7.5 month periods were 88 +/- 13 and 76 +/- 21%, respectively.
Li, KaWang; McKeith, Amanda Gipe; Shen, Cangliang; McKeith, Russell
2017-01-01
This study compared the quality variation and thermal inactivation of Escherichia coli O157:H7 in non-intact beef and veal. Coarse ground beef and veal patties (2.1 cm thick, 12.4 cm diameter, 180 g) inoculated with E. coli O157:H7, aerobically stored before double pan-broiling for 0–360 s without rest or to 55, 62.5, 71.1, and 76 °C (internal temperature) with 0.5- or 3.5-min rest. Microbial population and qualities including color, cooking losses, pH, water activity, fat, and moisture content, were tested. After cooking the beef and veal patties, the weight losses were 17.83–29%, the pH increased from 5.53–5.60 to 5.74–6.09, the moisture content decreased from 70.53–76.02% to 62.60–67.07%, and the fat content increased (p < 0.05) from 2.19–6.46% to 2.92–9.45%. Cooking beef and veal samples with increasing internal temperatures decreased a* and b* values and increased the L* value. Escherichia coli O157:H7 was more sensitive to heat in veal compared to beef with shorter D-value and “shoulder” time. Cooking to 71.1 and 76 °C reduced E. coli O157:H7 by >6 log CFU/g regardless of rest time. Cooking to 55 °C and 62.5 °C with a 3.5-min rest achieved an additional 1–3 log CFU/g reduction compared to the 0.5-min rest. Results should be useful for developing risk assessment of non-intact beef and veal products. PMID:29278379
Tantray, Mushtaq A; Khan, Imran; Hamid, Hinna; Alam, Mohammad Sarwar; Dhulap, Abhijeet; Ganai, Ajaz Ahmad
2017-08-01
Recent studies reveal that glycogen synthase kinase-3β (GSK-3β) acts as a pro-inflammatory enzyme, and by inhibiting this kinase, inflammation can be controlled. In this regard, a series of 17 piperazine-linked oxazolo[4,5-b]pyridine-based derivatives was synthesized and evaluated for in vitro GSK-3β inhibitory and in vivo anti-inflammatory activity. The compounds 7d, 7e, 7g, and 7c displayed the best GSK-3β inhibitory activity among all the synthesized compounds, with corresponding IC 50 values of 0.34, 0.39, 0.47, and 0.53 µM. Among the compounds 7d, 7e, 7g, and 7c examined for in vivo anti-inflammatory activity in the rat paw edema model, compound 7d exhibited maximum inhibition, reducing the paw volume by 62.79 and 65.91% at 3 and 5 h post-carrageenan administration, respectively, in comparison to indomethacin (76.74% at 3 h and 79.54% at 5 h after carrageenan administration). Furthermore, these compounds (7d, 7e, 7g, and 7c) were also found to substantially inhibit pro-inflammatory mediators, i.e., TNF-α, IL-1β, and IL-6, ex vivo in comparison to indomethacin and did not pose any gastric ulceration risk, indicating the potential of this oxazolopyridine scaffold for the development of GSK-3β inhibitors and their application as anti-inflammatory agents. © 2017 Deutsche Pharmazeutische Gesellschaft.
Rademakers, Rosa; Cruts, Marc; Sleegers, Kristel; Dermaut, Bart; Theuns, Jessie; Aulchenko, Yurii; Weckx, Stefan; De Pooter, Tim; Van den Broeck, Marleen; Corsmit, Ellen; De Rijk, Peter; Del-Favero, Jurgen; van Swieten, John; van Duijn, Cornelia M; Van Broeckhoven, Christine
2005-10-01
We obtained conclusive linkage of Alzheimer disease (AD) with a candidate region of 19.7 cM at 7q36 in an extended multiplex family, family 1270, ascertained in a population-based study of early-onset AD in the northern Netherlands. Single-nucleotide polymorphism and haplotype association analyses of a Dutch patient-control sample further supported the linkage at 7q36. In addition, we identified a shared haplotype at 7q36 between family 1270 and three of six multiplex AD-affected families from the same geographical region, which is indicative of a founder effect and defines a priority region of 9.3 cM. Mutation analysis of coding exons of 29 candidate genes identified one linked synonymous mutation, g.38030G-->C in exon 10, that affected codon 626 of the PAX transactivation domain interacting protein gene (PAXIP1). It remains to be determined whether PAXIP1 has a functional role in the expression of AD in family 1270 or whether another mutation at this locus explains the observed linkage and sharing. Together, our linkage data from the informative family 1270 and the association data in the population-based early-onset AD patient-control sample strongly support the identification of a novel AD locus at 7q36 and re-emphasize the genetic heterogeneity of AD.
System Data Model (SDM) Source Code
2012-08-23
CROSS_COMPILE=/opt/gumstix/build_arm_nofpu/staging_dir/bin/arm-linux-uclibcgnueabi- 8 : CC=$(CROSS_COMPILE)gcc 9: CXX=$(CROSS_COMPILE)g++ 10 : AR...and flags to pass to it 6: LEX=flex 7: LEXFLAGS=-B 8 : 9: ## The parser generator to invoke and flags to pass to it 10 : YACC=bison 11: YACCFLAGS...5: # Point to default PetaLinux root directory 6: ifndef ROOTDIR 7: ROOTDIR=$(PETALINUX)/software/petalinux-dist 8 : endif 9: 10 : PATH:=$(PATH
Colonization of Chicks by Non-Culturable Campylobacter spp
1994-01-01
epidemiologic assessment for the transmission (8000 g, 5 min) and resuspended in 15 ml of PBS, with 5 of the organism to broiler chickens is needed to...spectrophotometrically (O.D.260 ). The DNA (2 uig) was digested (3-4 h, 37°C), Serotyping with BgIlI or HhaI in a 20 d reaction mixture in buffers Both the...original (0) and the recovered (R) Campylobacter uppliee by the manufacturer. After digestion , 5 pul of spp. strains were coded and sent to cooperating
1987-04-30
El C4E)0 0W:C 1 (D ~ ~ ~ ~ ~ IN C D mMc/i 44- c C-4 v- en q 44 C; 4 n 0- z ! -L Ch4, mO M 0 0 0 m 0o 0o x IN >zW 4 4 . U L 4U 0 UL...wTwA~ Fl Fu~~wjr wjilwvK~l.Wvv 0l 000 Ll.I 0 0 4- LL 4- &n G) CL&.I 0 a C4 -j N 0A- 4- La - E 0. 0 S- If 0 0 C LO EF *( . S Eu IL EEuS-t S-to) en ...002.5W 5 /8 1 .0 C=1000 0.8 C=300 ~0.6 C-) 00 0 00030405 VETCL EOIY)msc La .. N378 1 1 1115(f i 0.2 I11 Su INTERSTITIAL SMOKE (g/cm**3) 60 min 7 6 5 EN
Maximizing the production of butyric acid from food waste as a precursor for ABE-fermentation.
Stein, Ullrich Heinz; Wimmer, B; Ortner, M; Fuchs, W; Bochmann, G
2017-11-15
The current study reports on the maximization of butyric acid production from food waste using a mixed microbial fermentation. In semi-continuous fermentations the effect of three different pH values (5.5, 7.0 and 9.0), three different temperatures (37°C, 55°C and 70°C) and two levels of hydraulic retention time (HRT, 2days and 6days) on the formation of butyric acid as well as total volatile fatty acid production (tVFA) were investigated. Overall, pH5.5 provided the lowest butyric acid concentrations regardless of the temperature and the HRT. At mesophilic temperature (37°C) alkaline conditions (pH9.0) lead to a strong incline of tVFA as well as butyric acid concentration probably due to a decreased solubilization of the substrate. However, most efficient in terms of butyric acid production was the fermentation conducted at 55°C and pH7 where a butyric acid concentrations of 10.55g/L (HRT 2days) and 13.00g/L (HRT 6days) were achieved. Additional experiments at 70°C showed declining butyric acid production. Increase of the HRT from 2days to 6days provided an increment of butyric acid concentration throughout almost all experimental settings. However, regarding volumetric productivity the increase in concentration does not compensate for the bigger reactor volume required to establish a higher HRT. At pH7 and 55°C the resulting volumetric production rates were 5.27g/L∗d at a HRT 2days and only 2.17g/L∗d at a HRT of 6days. Copyright © 2017 Elsevier B.V. All rights reserved.
On the base-stacking in the 5'-terminal cap structure of mRNA: a fluorescence study.
Nishimura, Y; Takahashi, S; Yamamoto, T; Tsuboi, M; Hattori, M; Miura, K; Yamaguchi, K; Ohtani, S; Hata, T
1980-01-01
The fluorescence at 370 nm of the 7-methylguanosine residue (m7G) is found to be quenched when the base residue is involved in a stacking interaction with the adenosine residue in the cap structure m7G5' pppA of an eukaryotic mRNA. On the basis of the observed degree of quenching, the amounts of the stacked and unstacked forms in the cap structure have been determined at various temperatures and pH's. It has been found that at pH 6.2 effective enthalpy and entropy in the unstacked leads to stacked change are delta H degrees = 4.4 +/- 0.1 kcal/mole and delta S degrees = - 14.3 +/- 0.2 e.u., respectively. The pka value for the m7G residue is found to be 7.7 at 10 degrees C and 7.3 at 30 degrees C. The stacked structure seems to be less favourable in the deprotonated form that occurs in the higher pH solution. A similar analysis of some other cap structures indicates that the stacked form in m7G5' pppN structure is favourable if N is a purine nucleoside or a 2'-O-methylpyrimidine nucleoside but not for an unmethylated pyrimidine nucleoside. PMID:7443542
Butanol production from thin stillage using Clostridium pasteurianum.
Ahn, Jae-Hyung; Sang, Byoung-In; Um, Youngsoon
2011-04-01
The production of butanol from thin stillage by Clostridium pasteurianum DSM 525 was evaluated in the paper. At initial pH values ranging from 5.0 to 7.0 C. pasteurianum DSM 525 produced 6.2-7.2 g/L of butanol utilizing glycerol in thin stillage as the main carbon source, with yields of 0.32-0.44 g butanol produced/g glycerol consumed, which are higher than previously reported yields (e.g., 0.14-0.31 g butanol/g glycerol, Biebl, 2001). Lactic acid in the thin stillage acted as a buffering agent, maintaining the pH of the medium within a range of 5.7-6.1. Lactic acid was also utilized along with glycerol, enhancing butanol production (6.5 g/L butanol vs. 8.7 g/L butanol with 0 and 16 g/L lactic acid, respectively). These results demonstrate the feasibility of cost-effective butanol production using thin stillage as a nutrient-containing medium with a pH buffering capacity. Copyright © 2011 Elsevier Ltd. All rights reserved.
Carrasco, Itzíar; Arias, Ana; Benítez-Gutiérrez, Laura; Lledó, Gemma; Requena, Silvia; Cuesta, Miriam; Cuervas-Mons, Valentín; de Mendoza, Carmen
2018-03-01
Oral DAA have demonstrated high efficacy as treatment of hepatitis C. However, the presence of resistance-associated substitutions (RAS) at baseline has occasionally been associated with impaired treatment response. Herein, we examined the impact of baseline RAS at the HCV NS5A gene region on treatment response in a real-life setting. All hepatitis C patients treated with DAA including NS5A inhibitors at our institution were retrospectively examined. The virus NS5A gene was analyzed using population sequencing at baseline and after 24 weeks of completing therapy in all patients that failed. All changes recorded at positions 28, 29, 30, 31, 32, 58, 62, 92, and 93 were considered. A total of 166 patients were analyzed. HCV genotypes were as follows: G1a (31.9%), G1b (48.2%), G3 (10.2%), and G4 (9.6%). Overall, 69 (41.6%) patients were coinfected with HIV and 46.7% had advanced liver fibrosis (Metavir F3-F4). Sixty (36.1%) patients had at least one RAS at baseline, including M28A/G/T (5), Q30X (12), L31I/F/M/V (6), T58P/S (25), Q/E62D (1), A92 K (7), and Y93C/H (15). Overall, 4.8% had two or more RAS, being more frequent in G4 (12.5%) followed by G1b (6.3%) and G1a (1.9%). Of 10 (6%) patients that failed DAA therapy, five had baseline NS5A RAS. No association was found for specific baseline RAS, although changes at position 30 were more frequent in failures than cures (22.2% vs 6.4%, P = 0.074). Moreover, the presence of two or more RAS at baseline was more frequent in failures (HR: 7.2; P = 0.029). Upon failure, six patients showed emerging RAS, including Q30C/H/R (3), L31M (1), and Y93C/H (2). Baseline NS5A RAS are frequently seen in DAA-naïve HCV patients. Two or more baseline NS5A RAS were found in nearly 5% and were significantly associated to DAA failure. Therefore, baseline NS5A testing should be considered when HCV treatment is planned with NS5A inhibitors. © 2017 Wiley Periodicals, Inc.
Basic Research on Processing of Ceramics for Space Structures
1989-01-31
Surfaces, 9, 33-46 (1984). 5 18. R . H. Heistand, II, Y. Oguri, H. Okamura, W. C. Moffatt, B. Novich, E. A. Barringer , and H. K. Bowen, "Synthesis and...1983. E.A. Barringer , R . Brook, and H.K. Bowen, "The Sintering of Monodisperse TiO 2 " pp. 1-21 in Materials Science Research, Vol. 16. Edited by G.C...22a. NAME OF RESPONSIBLE INDIVIDUAL 22b. TELEPHONE (Include Area Code) 22c. OFFICE SYMBOL Donald R . Ulrich (202) 767-4963 1 Al 00 Form 1473, JUN 86
Mutations in PIGY: expanding the phenotype of inherited glycosylphosphatidylinositol deficiencies
Ilkovski, Biljana; Pagnamenta, Alistair T.; O'Grady, Gina L.; Kinoshita, Taroh; Howard, Malcolm F.; Lek, Monkol; Thomas, Brett; Turner, Anne; Christodoulou, John; Sillence, David; Knight, Samantha J.L.; Popitsch, Niko; Keays, David A.; Anzilotti, Consuelo; Goriely, Anne; Waddell, Leigh B.; Brilot, Fabienne; North, Kathryn N.; Kanzawa, Noriyuki; Macarthur, Daniel G.; Taylor, Jenny C.; Kini, Usha; Murakami, Yoshiko; Clarke, Nigel F.
2015-01-01
Glycosylphosphatidylinositol (GPI)-anchored proteins are ubiquitously expressed in the human body and are important for various functions at the cell surface. Mutations in many GPI biosynthesis genes have been described to date in patients with multi-system disease and together these constitute a subtype of congenital disorders of glycosylation. We used whole exome sequencing in two families to investigate the genetic basis of disease and used RNA and cellular studies to investigate the functional consequences of sequence variants in the PIGY gene. Two families with different phenotypes had homozygous recessive sequence variants in the GPI biosynthesis gene PIGY. Two sisters with c.137T>C (p.Leu46Pro) PIGY variants had multi-system disease including dysmorphism, seizures, severe developmental delay, cataracts and early death. There were significantly reduced levels of GPI-anchored proteins (CD55 and CD59) on the surface of patient-derived skin fibroblasts (∼20–50% compared with controls). In a second, consanguineous family, two siblings had moderate development delay and microcephaly. A homozygous PIGY promoter variant (c.-540G>A) was detected within a 7.7 Mb region of autozygosity. This variant was predicted to disrupt a SP1 consensus binding site and was shown to be associated with reduced gene expression. Mutations in PIGY can occur in coding and non-coding regions of the gene and cause variable phenotypes. This article contributes to understanding of the range of disease phenotypes and disease genes associated with deficiencies of the GPI-anchor biosynthesis pathway and also serves to highlight the potential importance of analysing variants detected in 5′-UTR regions despite their typically low coverage in exome data. PMID:26293662
Mutations in PIGY: expanding the phenotype of inherited glycosylphosphatidylinositol deficiencies.
Ilkovski, Biljana; Pagnamenta, Alistair T; O'Grady, Gina L; Kinoshita, Taroh; Howard, Malcolm F; Lek, Monkol; Thomas, Brett; Turner, Anne; Christodoulou, John; Sillence, David; Knight, Samantha J L; Popitsch, Niko; Keays, David A; Anzilotti, Consuelo; Goriely, Anne; Waddell, Leigh B; Brilot, Fabienne; North, Kathryn N; Kanzawa, Noriyuki; Macarthur, Daniel G; Taylor, Jenny C; Kini, Usha; Murakami, Yoshiko; Clarke, Nigel F
2015-11-01
Glycosylphosphatidylinositol (GPI)-anchored proteins are ubiquitously expressed in the human body and are important for various functions at the cell surface. Mutations in many GPI biosynthesis genes have been described to date in patients with multi-system disease and together these constitute a subtype of congenital disorders of glycosylation. We used whole exome sequencing in two families to investigate the genetic basis of disease and used RNA and cellular studies to investigate the functional consequences of sequence variants in the PIGY gene. Two families with different phenotypes had homozygous recessive sequence variants in the GPI biosynthesis gene PIGY. Two sisters with c.137T>C (p.Leu46Pro) PIGY variants had multi-system disease including dysmorphism, seizures, severe developmental delay, cataracts and early death. There were significantly reduced levels of GPI-anchored proteins (CD55 and CD59) on the surface of patient-derived skin fibroblasts (∼20-50% compared with controls). In a second, consanguineous family, two siblings had moderate development delay and microcephaly. A homozygous PIGY promoter variant (c.-540G>A) was detected within a 7.7 Mb region of autozygosity. This variant was predicted to disrupt a SP1 consensus binding site and was shown to be associated with reduced gene expression. Mutations in PIGY can occur in coding and non-coding regions of the gene and cause variable phenotypes. This article contributes to understanding of the range of disease phenotypes and disease genes associated with deficiencies of the GPI-anchor biosynthesis pathway and also serves to highlight the potential importance of analysing variants detected in 5'-UTR regions despite their typically low coverage in exome data. © The Author 2015. Published by Oxford University Press.
Dong, Bitao; Li, Mingyan; Chen, Sheng; Ding, Dawei; Wei, Wei; Gao, Guoxin; Ding, Shujiang
2017-05-31
Nickel hydroxide (Ni(OH) 2 ) has been regarded as a potential next-generation electrode material for supercapacitor owing to its attractive high theoretical capacitance. However, practical application of Ni(OH) 2 is hindered by its lower cycling life. To overcome the inherent defects, herein we demonstrate a unique interconnected honeycomb structure of g-C 3 N 4 and Ni(OH) 2 synthesized by an environmentally friendly one-step method. In this work, g-C 3 N 4 has excellent chemical stability and supports a perpendicular charge-transporting direction in charge-discharge process, facilitating electron transportation along that direction. The as-prepared composite exhibits higher specific capacities (1768.7 F g -1 at 7 A g -1 and 2667 F g -1 at 3 mV s -1 , respectively) compared to Ni(OH) 2 aggregations (968.9 F g -1 at 7 A g -1 ) and g-C 3 N 4 (416.5 F g -1 at 7 A g -1 ), as well as better cycling performance (∼84% retentions after 4000 cycles). As asymmetric supercapacitor, g-C 3 N 4 @Ni(OH) 2 //graphene exhibits high capacitance (51 F g -1 ) and long cycle life (72% retentions after 8000 cycles). Moreover, high energy density of 43.1 Wh kg -1 and power density of 9126 W kg -1 has been achieved. This attractive performance reveals that g-C 3 N 4 @Ni(OH) 2 with honeycomb architecture could find potential application as an electrode material for high-performance supercapacitors.
Fracture Mechanics Analysis for Short Cracks
1990-02-01
OFFICE SYMBOL 7a. NAME OF MONITORING ORGANIZATION I(if applicable ) United Technologies Res. Ctr. JF S 6c ADDRESS (City. State, and ZIP Code) 7b...plastic fracture mechanics ( EPFM ) with the pioneering works of Hult and McClintock (Ref. 3), Dugdale (Ref. 4), Barenblatt (Ref. 5), Bilby, Cottrell and...Swinden (Refs. 6 and 7), Rice (Ref. 8), and Hutchinson (Ref. 9). EPFM is applica- ble and needed especially for high toughness and low strength
Wu, Vivian C H; Qiu, Xujian; de los Reyes, Benildo G; Lin, Chih-Sheng; Pan, Yingjie
2009-02-01
The possible use of cranberry concentrate (CC) as a natural food preservative was studied by examining its antimicrobial effect on the growth of Escherichia coli O157:H7 inoculated in ground beef, its organoleptical effect on beef patties, and its antimicrobial mechanism on the gene regulation level. Inoculated ground beef was added with CC and stored at 4 degrees C for 5 days. Bacteria were detected on day 0, 1, 3, and 5. Cranberry concentrate (2.5%, 5%, and 7.5% w/w) reduced total aerobic bacteria 1.5 log, 2.1 log, and 2.7 log CFU/g and E. coli O157:H7 0.4 log, 0.7 log, and 2.4 log CFU/g, respectively, when compared to the control on day 5. Fifty panelists evaluated the burgers supplemented with CC. No differences in appearance, flavor, and taste were found among burgers with 0%, 2.5%, and 5% CC. The expression of E. coli O157:H7 cyclopropane fatty acyl phospholipid synthase (cfa), hypothetical protein (hdeA), outer membrane porin protein C (ompC), hyperosmotically inducible periplasmic protein (osmY), and outer membrane protein induced after carbon starvation (slp) genes with or without CC (2.5% v/v) treatment was investigated by quantitative real-time PCR. Compared to the control, slp, hdeA, and cfa were markedly downregulated, ompC was slightly downregulated, while osmY was slightly affected.
Code of Federal Regulations, 2013 CFR
2013-04-01
... below 113.5 g/ton. Withdraw 5 days before slaughter for use levels above 113.5 g/ton. 066104 Penicillin... elimination of the drug from edible tissue. Penicillin as procaine penicillin G. Nicarbazin and penicillin as provided by No. 066104 in § 510.600(c) of this chapter. 066104 Penicillin 2.4 to 50 and roxarsone 22.7 to...
Modeling of the illumination driven coma of 67P/Churyumov-Gerasimenko
NASA Astrophysics Data System (ADS)
Bieler, André
2015-04-01
In this paper we present results modeling 67P/Churyumov-Gerasimenko's (C-G) neutral coma properties observed by the Rosetta ROSINA experiment with 3 different model approaches. The basic assumption for all models is the idea that the out-gassing properties of C-G are mainly illumination driven. With this assumption all models are capable of reproducing most features in the neutral coma signature as detected by the ROSINA-COPS instrument over several months. The models include the realistic shape model of the nucleus to calculate the illumination conditions over time which are used to define the boundary conditions for the hydrodynamic (BATS-R-US code) and the Direct Simulation Monte Carlo (AMPS code) simulations. The third model finally computes the projection of the total illumination on the comet surface towards the spacecraft. Our results indicate that at large heliocentric distances (3.5 to 2.8 AU) most gas coma structures observed by the in-situ instruments can be explained by uniformly distributed activity regions spread over the whole nucleus surface.
Zhang, Bao; Zeng, Tao; Zhang, Jiafeng; Peng, Chunli; Zheng, Junchao; Chen, Guomin
2014-01-01
Nanosized spherical LiFePO4/C composite was synthesized from nanosized spherical FePO4 ·2H2O, Li2C2O4, aluminum oxide, titanium oxide, oxalic acid, and sucrose by binary sintering process. The phases and morphologies of LiFePO4/C were characterized using SEM, TEM, CV, EIS, EDS, and EDX as well as charging and discharging measurements. The results showed that the as-prepared LiFePO4/C composite with good conductive webs from nanosized spherical FePO4 ·2H2O exhibits excellent electrochemical performances, delivering an initial discharge capacity of 161.7 mAh·g(-1) at a 0.1 C rate, 152.4 mAh·g(-1) at a 1 C rate and 131.7 mAh·g(-1) at a 5 C rate, and the capacity retention of 99.1%, 98.7%, and 95.8%, respectively, after 50 cycles. Meanwhile, the high and low temperature performance is excellent for 18650 battery, maintaining capacity retention of 101.7%, 95.0%, 88.3%, and 79.3% at 55°C, 0°C, -10°C, and -20°C by comparison withthat of room temperature (25°C) at the 0.5 C rate over a voltage range of 2.2 V to 3.6 V, respectively.
NASA Astrophysics Data System (ADS)
Felsing, Daniel E.
Clinical data show that activation of 5-HT2C G protein-coupled receptors (GPCRs) can treat obesity (lorcaserin/BelviqRTM) and psychotic disorders (aripiprazole/Abilify.), including schizophrenia. 5-HT2C GPCRs are members of the 5-HT2 sub-family of 5-HT GPCRs, which include 5-HT2A, 5-HT2B, and 5-HT 2C GPCRs. 5-HT2C is structurally similar to 5-HT2A and 5-HT2B GPCRs, but activation of 5-HT2A and/or 5-HT 2B causes deleterious effects, including hallucinations and cardiac valvulopathy. Thus, there is a challenge to develop drugs that selectively activate only 5-HT2C. Prolonged activation of GPCRs by agonists reduces their function via a regulatory process called desensitization. This has clinical relevance, as 45% of drugs approved by the FDA target GPCRs, and agonist drugs (e.g., morphine) typically lose efficacy over time due to desensitization, which invites tolerance. Agonists that cause less desensitization may show extended clinical efficacy as well as a more acceptable clinical dose range. We hypothesized that structurally distinct agonists of the 5-HT2C receptor may cause varying degrees of desensitization by stabilizing unique 5-HT2C receptor conformations. Discovery of 5-HT2C agonists that exhibit minimal desensitization is therapeutically relevant for the pharmacotherapeutic treatment of chronic diseases such as obesity and psychotic disorders. The 5-HT7 receptor has recently been discovered as a druggable target, and selective activation of the 5-HT7 receptor has been shown to alleviate locomotor deficits in mouse models of Rett Syndrome. Additionally, buspirone has been shown to display therapeutically relevant affinity at 5-HT 1A and is currently in phase II clinical trials to treat stereotypy in children with autism. The 5-PAT chemical scaffold shows high affinity towards the 5-HT7 and 5-HT1A receptors. Modulations around the 5-phenyl moiety were able to improve selectivity in binding towards the 5-HT 7 receptor, whereas modulations of the alkyl chains bonded to the vital basic nitrogen modulated 5-HT1A selectivity. The lead candidate, (+)-o-F-5-PAT, was shown effective in attenuating three separate murine models of stereotypy and two models of drug-induced hyperlocomotion. Therefore, the 5-PAT chemical scaffold is a unique chemical scaffold enabling discrimination of therapeutic function of the 5-HT7 and 5-HT 1A receptors in vivo..
Bazzoli, Andrea; Vance, David J; Rudolph, Michael J; Rong, Yinghui; Angalakurthi, Siva Krishna; Toth, Ronald T; Middaugh, C Russell; Volkin, David B; Weis, David D; Karanicolas, John; Mantis, Nicholas J
2017-11-01
In this report we investigated, within a group of closely related single domain camelid antibodies (V H Hs), the relationship between binding affinity and neutralizing activity as it pertains to ricin, a fast-acting toxin and biothreat agent. The V1C7-like V H Hs (V1C7, V2B9, V2E8, and V5C1) are similar in amino acid sequence, but differ in their binding affinities and toxin-neutralizing activities. Using the X-ray crystal structure of V1C7 in complex with ricin's enzymatic subunit (RTA) as a template, Rosetta-based homology modeling coupled with energetic decomposition led us to predict that a single pairwise interaction between Arg29 on V5C1 and Glu67 on RTA was responsible for the difference in ricin toxin binding affinity between V1C7, a weak neutralizer, and V5C1, a moderate neutralizer. This prediction was borne out experimentally: substitution of Arg for Gly at position 29 enhanced V1C7's binding affinity for ricin, whereas the reverse (ie, Gly for Arg at position 29) diminished V5C1's binding affinity by >10 fold. As expected, the V5C1 R29G mutant was largely devoid of toxin-neutralizing activity (TNA). However, the TNA of the V1C7 G29R mutant was not correspondingly improved, indicating that in the V1C7 family binding affinity alone does not account for differences in antibody function. V1C7 and V5C1, as well as their respective point mutants, recognized indistinguishable epitopes on RTA, at least at the level of sensitivity afforded by hydrogen-deuterium mass spectrometry. The results of this study have implications for engineering therapeutic antibodies because they demonstrate that even subtle differences in epitope specificity can account for important differences in antibody function. © 2017 Wiley Periodicals, Inc.
Mang, Géraldine M.; Pradervand, Sylvain; Du, Ngoc-Hien; Arpat, Alaaddin Bulak; Preitner, Frédéric; Wigger, Leonore; Gatfield, David; Franken, Paul
2015-01-01
MicroRNAs (miRNAs) are small, non-coding RNA molecules that regulate gene expression post-transcriptionally. MiRNAs are implicated in various biological processes associated with obesity, including adipocyte differentiation and lipid metabolism. We used a neuronal-specific inhibition of miRNA maturation in adult mice to study the consequences of miRNA loss on obesity development. Camk2a-CreERT2 (Cre+) and floxed Dicer (Dicerlox/lox) mice were crossed to generate tamoxifen-inducible conditional Dicer knockouts (cKO). Vehicle- and/or tamoxifen-injected Cre+;Dicerlox/lox and Cre+;Dicer+/+ served as controls. Four cohorts were used to a) measure body composition, b) follow food intake and body weight dynamics, c) evaluate basal metabolism and effects of food deprivation, and d) assess the brain transcriptome consequences of miRNA loss. cKO mice developed severe obesity and gained 18 g extra weight over the 5 weeks following tamoxifen injection, mainly due to increased fat mass. This phenotype was highly reproducible and observed in all 38 cKO mice recorded and in none of the controls, excluding possible effects of tamoxifen or the non-induced transgene. Development of obesity was concomitant with hyperphagia, increased food efficiency, and decreased activity. Surprisingly, after reaching maximum body weight, obese cKO mice spontaneously started losing weight as rapidly as it was gained. Weight loss was accompanied by lowered O2-consumption and respiratory-exchange ratio. Brain transcriptome analyses in obese mice identified several obesity-related pathways (e.g. leptin, somatostatin, and nemo-like kinase signaling), as well as genes involved in feeding and appetite (e.g. Pmch, Neurotensin) and in metabolism (e.g. Bmp4, Bmp7, Ptger1, Cox7a1). A gene cluster with anti-correlated expression in the cerebral cortex of post-obese compared to obese mice was enriched for synaptic plasticity pathways. While other studies have identified a role for miRNAs in obesity, we here present a unique model that allows for the study of processes involved in reversing obesity. Moreover, our study identified the cortex as a brain area important for body weight homeostasis. PMID:25629159
A Comparison of the Optimization and Analysis of Doubly Curved Shells Using MSC/NASTRAN and ASTROS
1990-12-01
BMC(7,5)=I.OD+00 CALL BMAT (X1,RI,X2,R2,0.OD+00,B,DL) CALL EMAT(DNU,E,T,G) C C DO BMC*E*B C DO 100 J1=1,7 DO 100 J2=1,5 DO 100 J3=1,5 DO 100 J4=1,6...ELEMENT LENGTH. C SUBROUTINE BMAT (XI,RI,X2,R2,DKSI,B,DL) DOUBLE PRECISION XI,RI,X2,R2,DKSI,B(S,6),DL,R,PHI,CPR,SPR,R, &DKMDKP, DLINV C C EXPLANATION OF
A Novel Nonsense Mutation in Exon 5 of KIND1 Gene in an Iranian Family with Kindler Syndrome.
Heidari, Mohammad Mehdi; Khatami, Mehri; Kargar, Saeed; Azari, Mojdeh; Hoseinzadeh, Hassan; Fallah, Hamedeh
2016-06-01
Kindler syndrome (KS) is an autosomal recessive skin disease characterized by actual blistering, photosensitivity and a progressive poikiloderma. The disorder results from rare mutations in the KIND1 gene. This gene contains 15 exons and expresses two kindlin-1 isoforms. The aim of this investigation was to analyze mutations in the exons 1 to 15 of KIND1 gene in an Iranian family clinically affected with Kindler syndrome. The mutations analysis of 15 coding exons of KIND1 gene was performed with PCR-SSCP and direct sequencing in 14 subjects from one Iranian family clinically affected with Kindler syndrome. We identified eight new nucleotide changes in KIND1 in this family. These changes were found in g.3892delA, g.3951T>C, g.3962T>G, g.4190G>T, g.7497G>A, g.11076T>C, g.11102C>T and g.13177C>T positions. Among them, the g.13177C>T mutation resulting in the formation of a premature stop codon (Q226X) was detected only in seven affected family individuals as homozygous but was not present in 100 unrelated healthy controls. This study suggests that nonsense mutation may lead to incomplete and non-functional protein products and is pathogenic and has meaningful implications for the diagnosis of patients with Kindler syndrome.
Shen, Cangliang; Geornaras, Ifigenia; Belk, Keith E; Smith, Gary C; Sofos, John N
2011-04-01
This study was conducted to compare thermal inactivation of stress-adapted and nonadapted Escherichia coli O157:H7 in nonintact beef moisture enhanced with different brine formulations and cooked to 65°C. Coarsely ground beef was mixed with acid, cold, heat, starvation, or desiccation stress-adapted or nonadapted rifampin-resistant E. coli O157:H7 (eight-strain mixture, 5 to 6 log CFU/g) and a brine solution for a total moisture enhancement level of 10%. The brine treatments included distilled water (control), sodium chloride (0.5% NaCl) plus sodium tripolyphosphate (0.25% STP), or NaCl + STP combined with cetylpyridinium chloride (0.2% CPC), lactic acid (0.3% LA), or sodium metasilicate (0.2% SM). The treated meat was extruded into bags (15 cm diameter), semifrozen (-20°C for 4.5 h), and cut into 2.54-cm (1-in.)-thick portions. Samples were individually vacuum packaged, frozen (-20°C for 42 h), and tempered at 4°C for 2.5 h before cooking. Partially thawed (-1.8 ± 0.4°C) samples were pan broiled to an internal temperature of 65°C. Pathogen counts of partially thawed (before cooking) samples moisture enhanced with brines containing CPC, LA, or SM were 0.7 to 1.1, 0.0 to 0.4, and 0.2 to 0.4 log CFU/g, respectively, lower than those of the control. Compared with microbial count reductions obtained after pan broiling of beef inoculated with nonadapted E. coli O157:H7 cells, count reductions during cooking of meat inoculated with cold and desiccation stress-adapted, acid stress-adapted, and heat and starvation stress-adapted cells indicated sensitization, cross protection, and no effect, respectively, of these stresses on the pathogen during subsequent exposure to heat. Among all stressed cultures, CPC-treated samples (0.8 to 3.6 log CFU/g) and LA-treated samples (0.8 to 3.5 log CFU/g) had the lowest numbers of E. coli O157:H7 survivors after cooking.
Mechanics of Air-Inflated Drop-Stitch Fabric Panels Subject to Bending Loads
2013-08-15
Division Newport and Navatek, Ltd. The technical reviewer was Geoffrey R. Moss (Code 1522). The authors gratefully acknowledge Martin S . Leff and...to Bending Loads 5a. CONTRACT NUMBER 5b. GRANT NUMBER 5c. PROGRAM ELEMENT NUMBER 6. AUTHOR( S ) Paul V. Cavallaro Christopher J. Hart Ali M...Sadegh 5.d PROJECT NUMBER 5e. TASK NUMBER 5f. WORK UNIT NUMBER 7. PERFORMING ORGANIZATION NAME( S ) AND ADDRESS(ES) Naval Undersea Warfare
7 CFR 1773.5 - Qualifications of CPA.
Code of Federal Regulations, 2011 CFR
2011-01-01
... regulations of professional conduct promulgated by the accountancy board of the state in which the borrower is...: (1) Meets the standards for independence contained in the AICPA Code of Professional Conduct in... the accounting and audit practice conducted by an approved peer review program under paragraph (c)(4...
7 CFR 1773.5 - Qualifications of CPA.
Code of Federal Regulations, 2010 CFR
2010-01-01
... regulations of professional conduct promulgated by the accountancy board of the state in which the borrower is...: (1) Meets the standards for independence contained in the AICPA Code of Professional Conduct in... the accounting and audit practice conducted by an approved peer review program under paragraph (c)(4...
7 CFR 1773.5 - Qualifications of CPA.
Code of Federal Regulations, 2013 CFR
2013-01-01
... regulations of professional conduct promulgated by the accountancy board of the state in which the borrower is...: (1) Meets the standards for independence contained in the AICPA Code of Professional Conduct in... the accounting and audit practice conducted by an approved peer review program under paragraph (c)(4...
7 CFR 1773.5 - Qualifications of CPA.
Code of Federal Regulations, 2014 CFR
2014-01-01
... regulations of professional conduct promulgated by the accountancy board of the state in which the borrower is...: (1) Meets the standards for independence contained in the AICPA Code of Professional Conduct in... the accounting and audit practice conducted by an approved peer review program under paragraph (c)(4...
7 CFR 1773.5 - Qualifications of CPA.
Code of Federal Regulations, 2012 CFR
2012-01-01
... regulations of professional conduct promulgated by the accountancy board of the state in which the borrower is...: (1) Meets the standards for independence contained in the AICPA Code of Professional Conduct in... the accounting and audit practice conducted by an approved peer review program under paragraph (c)(4...
Fredlund, Paul; Hillson, Jan; Gray, Todd; Shemanski, Lynn; Dimitrova, Dessislava; Srinivasan, Subasree
2015-11-01
Peginterferon alfa (alfa) increases the risk of autoimmune disease. Peginterferon lambda-1a (Lambda) acts through a receptor with a more liver-specific distribution compared to the alfa receptor. In a phase-2b study, 525 treatment-naive patients with chronic hepatitis C virus (HCV) infection received ribavirin and Lambda interferon (120, 180, or 240 μg) or alfa interferon (180 μg) for 24 (genotypes 2 and 3) or 48 (genotypes 1 and 4) weeks. Retrospective analysis found that adverse events of MedDRA-coded thyroid dysfunction and abnormal levels of thyroid-stimulating hormone (TSH) were significantly more frequent with alfa versus Lambda (12% versus 2.6% and 15.2% versus 3.4%, respectively, both P<0.0001). Most Lambda recipients with abnormal TSH had levels below the lower limit of normal; the frequency of low and high TSH was similar in alfa recipients with abnormal TSH. Blinded review by an endocrinologist found that new-onset primary hypothyroidism or painless thyroiditis was less frequent with Lambda versus alfa (0.5% and 1.8% versus 5.3% and 7.5%, respectively, P<0.0001). Most TSH elevations reflected new-onset hypothyroidism requiring treatment, while most markedly suppressed TSH values reflected probable painless thyroiditis and resolved without sequelae. In conclusion, HCV-infected patients treated with Lambda/ribavirin experienced fewer adverse events of thyroid dysfunction compared with patients treated with alfa/ribavirin.
Göttig, M; Galland, P
2014-01-01
We investigated gravitropic bending of sporangiophores of the zygomycete fungus Phycomyces blakesleeanus in response to centrifugal accelerations to test the so-called resultant law of gravitropism ('Resultantengesetz'; Jahrbuch der wissenschaftlichen Botanik, 71, 325, 1929; Der Geotropismus der Pflanzen, Gustav Fischer, Jena, Germany, 1932), which predicts that gravitropic organs orient in a centrifuge rotor parallel to the stimulus vector resulting from the centrifugal acceleration and gravity. Sporangiophores of wild-type strain C171 carAcarR and of several gravitropism mutants were subjected for 7 h to centrifugal accelerations in a dynamic range between 0.01 and 3 × g. The stimulus-response curves that were obtained for C171 carA carR, C2 carA geo and C148 carA geo madC were complex and displayed two response components: a low-acceleration component between 0.01 and 0.5 × g and a high-acceleration component above 0.5 × g. The low acceleration component is characterised by bending angles exceeding those predicted by the resultant law and kinetics faster than that of the second component; in contrast, the high-acceleration component is characterised by bending slightly below the predicted level and kinetics slower than that of the first component. Sporangiophores of the wild-type C171 centrifuged horizontally displayed the opposite behaviour, i.e. low accelerations diminished and high accelerations slightly enhanced bending. Further proof for the existence of the two response components was provided by the phenotype of gravitropism mutants that either lacked the first response component or which caused its overexpression. The tropism mutant C148 with defective madC gene, which codes for a RasGap protein (Fungal Genetics Reports, 60 (Suppl.), Abstract # 211, 2013), displayed hypergravitropism and concomitant deviations from the resultant law that were twice as high as in the wild-type C171. Gravitropism mutants with defects in the genes madF, madG and madJ lacked the low-response component below 0.5 × g. Our data are at variance with the so-called resultant law and imply that gravitropic orientation cannot depend exclusively on the classical sine stimulus (i.e. acting perpendicularly on the side walls); it rather must also be controlled by the cosine stimulus acting parallel to the longitudinal axis of the gravisensing organ. Our studies indicate that the threshold for the cosine response is the same as that of the sine response, and thus close to 0.01 × g. © 2013 German Botanical Society and The Royal Botanical Society of the Netherlands.
Psychrophilic Microorganisms from Areas Associated with the Viking Spacecraft
Foster, Terry L.; Winans, Luther
1975-01-01
Microorganisms capable of growth at 7 C were enumerated and isolated from soil samples from the manufacture and assembly areas of the Viking spacecraft. Populations ranging from 4.2 × 103 to 7.7 × 106/g of soil were isolated from the 15 soil samples examined. Temperature requirements were determined, and those growing at 3 C, but not at 32 C, were designated as obligate psychrophiles in this investigation. Populations of soil bacteria, including aerobic sporeformers, ranging from 1.5 × 102 to 9.8 × 105/g were capable of growth at 3 C, but not at 32 C. Bacterial isolates were identified to major generic groups. No psychrophilic sporeformers were isolated from soil from the manufacture area, but psychrophilic sporeformers ranged from 0 to 6.1 × 103/g from soil from the assembly area. PMID:1190759
Wang, Yan; Li, Jun; Cheng, Zhineng; Li, Qilu; Pan, Xiaohui; Zhang, Ruijie; Liu, Di; Luo, Chunling; Liu, Xiang; Katsoyiannis, Athanasios; Zhang, Gan
2013-03-19
Research on the environmental fate of short- and medium-chain chlorinated paraffins (SCCPs and MCCPs) in highly industrialized subtropical areas is still scarce. Air, soil, and atmospheric deposition process in the Pearl River Delta of South China were investigated, and the average SCCP and MCCP concentrations were 5.2 μg/sampler (17.69 ng/m(3)) and 4.1 μg/sampler for passive air samples, 18.3 and 59.3 ng/g for soil samples, and 5.0 and 5.3 μg/(m(2)d) for deposition samples, respectively. Influenced by primary sources and the properties of chlorinated paraffins (CPs), a gradient trend of concentrations and a fractionation of composition from more to less industrialized areas were discovered. Intense seasonal variations with high levels in summer air and winter deposition samples indicated that the air and deposition CP levels were controlled mainly by the vapor and particle phase, respectively. Complex environmental processes like volatilization and fractionation resulted in different CP profiles in different environment matrixes and sampling locations, with C(10-11) C(l6-7) and C(14) C(l6-7), C(10-12) C(l6-7) and C(14) C(l6-8), and C(11-12) C(l6-8) and C(14) C(l7-8) dominating in air, soil, and atmospheric deposition, respectively. Shorter-chain and less chlorinated congeners were enriched in air in the less industrialized areas, while longer-chain and higher chlorinated congeners were concentrated in soil in the more industrialized areas. This is suggesting that the gaseous transport of CPs is the dominant mechanism responsible for the higher concentrations of lighter and likely more mobile CPs in the rural areas.
The physicochemical and thermal properties of Malaysian high free fatty acid crude palm oil
NASA Astrophysics Data System (ADS)
Bahadi, Murad Awadh; Salimon, Jumat; Japir, Abd-Wali M.
2016-11-01
This study was carried out to determine the physicochemical properties and the thermal behavior of Malaysian high free fatty acid crude palm oil (HFFA-CPO). The physicochemical properties showed that the free fatty acid (FFA %), acid value, iodine value, saponification value, unsaponifiable matter, hydroxyl value, specific gravity, refractive index at 28°C, moisture content, viscosity at 28°C and colour at 28°C values were 9.4±0.1 %, 21.3±0.1 mg/g, 50.6±0.2 mg/g, 203.1±0.1 mg/g, 0.7±0.1%, 43.4±0.2 mg/g, 0.878 g/ml, 1.4669, 0.6 %, 52 cP and 50R-40Y respectively. Gas chromatography (GC) was used to determine the fatty acid (FA) composition in HFFA-CPO. The fatty acids were found to be comprised mostly with 45.7 % palmitic acid (C16:0), 39.5 % oleic acid (C18:1), 9.4 % linoleic acid (C18:2) and 4.3 % stearic acid (C18:0). The analysis of triacylglycerol components with high performance liquid chromatography (HPLC) has resulted with 3.5 % triunsaturated (OOO, OLL and OLO), 32.7 % monosaturated (POO, PLO, SOO and PLL), 35.7 % disaturated (MLP, PPL, PPO, POS and SOS) and 2.32 % trisaturated fatty acids (PPP and PPS). The differential scanning calorimetry (DSC) showed that the crystallization of TAG displayed two major exothermic regions of HFFA-CPO with the di and trisaturated TAG at 23.11°C and the di and triunsaturated TAG at 9.31 °C. The melting curve displayed multiple endothermic peak regions at 25.13 °C and 35.31 °C could be attributed to the di and trisaturated TAGs. While the peaks at 0.95 °C, 6.94 °C and 9.77 °C could be attributed to the mono, di and triunsaturated TAGs.
Chang, Chia-Hao; Shao, Kwang-Tsao; Lin, Yeong-Shin; Fang, Yi-Chiao; Ho, Hsuan-Ching
2014-10-01
The complete mitochondrial genome of the great white shark having 16,744 bp and including 13 protein-coding genes, 2 ribosomal RNA, 22 transfer RNA genes, 1 replication origin region and 1 control region. The mitochondrial gene arrangement of the great white shark is the same as the one observed in the most vertebrates. Base composition of the genome is A (30.6%), T (28.7%), C (26.9%) and G (13.9%).
Hu, Shanyao; Lin, Bin; Yan, Dechao; Xu, Zaiyan; Zhang, Zijun; Mao, Yuanliang; Mao, Huimin; Wang, Litong; Wang, Guoshui; Xiong, Yuanzhu; Zuo, Bo
2015-01-01
Peroxisome proliferator-activated receptor delta (PPARD) is a key regulator of lipid metabolism, insulin sensitivity, cell proliferation and differentiation. In this study, we identified two Single Nucleotide Polymorphisms (SNPs, g.1015 A>G and g.1018 T>C) constituting four haplotypes (GT, GC, AC and AT) in the 5’ regulatory region of porcine PPARD gene. Functional analysis of the four haplotypes showed that the transcriptional activity of the PPARD promoter fragment carrying haplotype AC was significantly lower than that of the other haplotypes in 3T3-L1, C2C12 and PK-15 cells, and haplotype AC had the lowest binding capacities to the nuclear extracts. Transcription factor 7-like 2 (TCF7L2) enhanced the transcription activities of promoter fragments of PPARD gene carrying haplotypes GT, GC and AT in C2C12 and 3T3-L1 cells, and increased the protein expression of PPARD gene in C2C12 myoblasts. TCF7L2 differentially bound to the four haplotypes, and the binding capacity of TCF7L2 to haplotype AC was the lowest. There were significant associations between -655A/G and fat deposition traits in three pig populations including the Large White × Meishan F2 pigs, France and American Large White pigs. Pigs with genotype GG had significantly higher expression of PPARD at both mRNA and protein level than those with genotype AG. These results strongly suggested that the SNPs in 5’ regulatory region of PPARD genes had significant impact on pig fat deposition traits. PMID:26599230
Canturk, Zerrin
2018-01-01
This study aimed to investigate the synergy between anticandidal and apoptotic effects of ferulic acid and caspofungin against Candida albicans and Candida glabrata, with the help of a quantitative checkerboard microdilution assay using 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) as a viability dye. Apoptotic effects of caspofungin and ferulic acid concentrations (alone and combined) were analyzed for C. albicans and C. glabrata based on annexin V-propidium iodide binding capacities using flow cytometric analysis. C. albicans showed a synergistic effect, represented by a fractional inhibitory concentration index of < 0.5, but C. glabrata showed no synergistic effect (fractional inhibitory concentration index > 0.5). Early and late apoptotic effects of caspofungin and ferulic acid concentrations (1 μg/mL and 1000 μg/mL) were calculated as 55.7% and 18.3%, respectively, while their necrotic effects were determined as 5.8% and 51.6%, respectively, using flow cytometric analyses. The apoptotic effects of the combination of caspofungin and ferulic acid at concentrations of 1 μg/mL and 1000 μg/mL on C. albicans and C. glabrata were 73.0% and 48.7%, respectively. Ferulic acid also demonstrated a synergistic effect in combination with caspofungin against C. albicans. Another possibility is to combine the existing anticandidal drug with phytochemicals to enhance the efficacy of anticandidal drug. Copyright © 2017. Published by Elsevier B.V.
Abugoch, Lilian; Quitral, Vilma; Larraín, M Angélica; Vinagre, Julia; Kriukov, Andrei; Chávez, Gloria
2006-12-01
The objective of the present work was to study functional and thermal properties of reineta (Brama australis) frozen meat, analysed by water retention capacity (WRC), gel forming capacity (GFC), texture, emulsifying capacity and differential scanning calorimetry (DSC). For this study, reineta fillets were obtained and extracted by the same conditions, and cutted, packaged, frozen and stored at -18 degrees C and -30 degrees C for 7 months. The results obtained, showed that there were no signifficant differences in the responses to thermal treatment for all the specimens. For samples frozen at -18 degrees C and -30 degrees C, the protein contents were 23.5 + 0.0 and 25.4 + 1.0%, respectively. The WRC values were 0.45 + 0.1 and 1.59 +/- 0.0 g water/g protein, respectively. The gel forming capacity was only present in the fresh samples, whereas the frozen stored ones only form protein aggregates. The emulsifying capacity was between 960 and 1400 g oil / g protein, and the storage time increased this value. The miosin denaturation temperature (Td) and denaturation enthalpy (?H), obtained by DSC, fluctuated between 39.2 +/- 0.5 to 44.8 +/- 0.8 degrees C and 1.12 +/- 0.3 to 0.52 +/- 0.2 J/g, respectively. The actina values were between 71.0 +/- 0.6 to 75.3 +/- 0.5 degrees C and between 0.5 +/- 0.1 to 0.7 +/- 0.1 J/g. Cooperativity decreased as the storage time increased. This is showing a certain degree of protein displacement. The values found by thermal analyses showed a direct relationship with the functional properties, both decreasing with storage time.
Bruera, Gemma; Pepe, Francesco; Malapelle, Umberto; Pisapia, Pasquale; Mas, Antonella Dal; Di Giacomo, Daniela; Calvisi, Giuseppe; Troncone, Giancarlo; Ricevuto, Enrico
2018-05-29
First line triplet chemotherapy/BEV significantly improved clinical outcome of MCRC. KRAS/NRAS/BRAF mutations were evaluated by next generation sequencing (NGS) in MCRC patients treated with first line FIr-B/FOx. KRAS exons 2-4 ( KRAS 2-4 ), NRAS 2-4 , BRAF 15 were evaluated in 67 tumours by ION Torrent platform. Mutation detection criteria: >500×sequence coverage (cov); >1% mutant allelic fraction (AF). Clinical outcomes were compared by log-rank. In 63 samples, KRAS 2-4 / NRAS 2-4 / BRAF 15 wild-type (wt) were 14 (22.2%), mutant (mut) 49 (77.8%): KRAS 2-4 42 (66.7%); NRAS 2-4 11 (16.4%); BRAF 15 5 (7.5%). Sixty mutations were detected, range 1-3 mut: 43 (71.7%) >1000×cov/>5% AF; 9 (15%) >500×cov/>5% AF; 8 (13.3%) >1000×cov/<5% AF. Mut distribution in KRAS 2-4 / NRAS 2-4 / BRAF 15 : 40 (63.5%) >1000×cov/>5% AF, 8 (12.7%) >500×cov/>5% AF, 1 (1.6%) >1000×cov/<5% AF; BRAF 15 1 (1.5%) >500×cov/>5% AF, 4 (6%) >1000×cov/<5% AF. Prevalence of ≥2 mut samples: KRAS 2-4 / NRAS 2-4 / BRAF 15 8 (12.7%); KRAS 2-4 7 (11.1%); NRAS 2-4 5 (7.5%). BRAF 15 mutant were all ≥2 mut (7.5%), atypical and associated to KRAS and/or NRAS mut: c.1405 G>A; c.1406 G>C; c.1756 G>A, 2 samples; c.1796 C>T. At 21 months (m) follow-up, clinical outcome wt compared to mut was not significantly different: in KRAS 2-4 / NRAS 2-4 / BRAF 15 , progression-free survival (PFS) 18/12 m, overall survival (OS) 28/22 m; 1/≥2 mutations, PFS 14/11, OS 37/22. PFS was trendy worse in RAS / BRAF wt vs ≥2 mut genes ( P 0.059). Most MCRC harboured KRAS 2-4 / NRAS 2-4 / BRAF 15 mutations by NGS, often multiple and affecting few tumoral clones; 22% were triple wt. Clinical outcome is not significantly affected by KRAS 2-4 / NRAS 2-4 / BRAF 15 genotype, trendy different in triple wt, compared with KRAS 2-4 / NRAS 2-4 / BRAF 15 ≥2 mut.
Bibliography of Soviet Laser Developments, Number 67, September-October 1983.
1984-12-05
5 g. Pb(l-x)Sn(x)Te .................. 5 iv V.--",7 4. Glass a. Mdscellaneous.................... 6- c., Er...the threshold current in injection lasers based on Pbl-xSnxTe semiconductors. FTPPA, no. 9v 1983, 1631-1634. 4. Glass a. Miscellaneous b. Nd 45...Shcherbakov, A.A.; Mak, A.A.; Sklizkov, G.V. (FIAN). Limit efficiency of neodymium glass lasers. KRSFA, no. 9, 1983, 8-12. c . Er 46. Lunter, S.G.; Murzin
Tengilimoglu-Metin, Mercan Merve; Hamzalioglu, Aytul; Gokmen, Vural; Kizil, Mevlude
2017-09-01
This study focused on the inhibitory effect of different levels of hawthorn extract (0, 0.5, and 1%) on the formation of heterocyclic aromatic amines (HAAs) in beef and chicken breast cooked by either pan-cooking or oven-cooking. All meat samples were cooked at three different temperatures (150, 200, and 250°C) and the levels of twelve HAAs were assessed (IQ, IQx, MeIQ, MeIQx, 4,8-DiMeIQx, 7,8-DiMeIQx, PhIP, harman, norharman, AαC, MeAαC, and Trp-P-2). Varying levels of IQ (up to 4.47ng/g), IQx (up to 0.69ng/g), MeIQ (up to 0.82ng/g), MeIQx (up to 1.01ng/g), 4,8-DiMeIQx (up to 0.10ng/g), 7,8-DiMeIQx (up to 0.23ng/g), PhIP (up to 0.75ng/g), harman (up to 2.15ng/g), norharman (up to 1.08ng/g), AαC (up to 1.86ng/g), MeAαC (up to 0.48ng/g), and Trp-P-2 (up to 12.88ng/g), were detected. Samples cooked at 150°C had very low amounts of HAAs, and the levels of HAAs increased gradually when the cooking temperature rose from 150 to 250°C. The total HAA content in chicken breast and beef ranged between not detectable to 17.60ng/g, and not detectable to 11.38ng/g, respectively. The inhibitory effects of hawthorn extract at 0.5% and 1% on total HAAs levels were found to be 12-100% and 19-97% in chicken breast, respectively, and 42-100% and 20-35% in beef, respectively. This study demonstrated that hawthorn extracts at 0.5% and 1% could mitigate HAA formation, especially at high cooking temperatures. Copyright © 2017 Elsevier Ltd. All rights reserved.
Huneau-Salaün, A; Guyard-Nicodème, M; Benzoni, G; Gautier, X; Quesne, S; Poëzevara, T; Chemaly, M
2018-06-01
A randomized controlled trial (RCT) was carried to evaluate the effect of a feed additive on Campylobacter contamination of broilers reared in commercial conditions. Twenty-four broiler flocks naturally contaminated with Campylobacter were enrolled in the RCT: 12 were assigned to a control group (C) fed with a conventional finishing feed from 4 weeks of age to slaughter (around 35 days), and the other group of 12 flocks (S) was fed with a finishing feed supplemented with 250 ppm of a patented feed additive (an ion-exchanged clay compound) previously proven to reduce Campylobacter contamination in broiler caeca under experimental conditions. Enumeration of Campylobacter colonies in caeca (8 per flock) was carried out following ISO standards before feed distribution and at slaughter. Before treatment, the caecal Campylobacter load tended to be lower in C flocks (7.1 ± 1.9 log CFU/g, CI 95% [6.6-7.5]) than in S flocks (7.7 ± 1.0 log UFC/g, CI 95% [7.5-7.9]) (p = .05). At slaughter, the bacterial load was similar in the S (7.7 ± 1.0 log CFU/g, CI 95% [7.5-7.9]) and C groups (7.5 ± 1.2 log CFU/g, CI 95% [7.2-7.8]) (p = .73). Therefore, the feed additive had no significant effect on the caecal Campylobacter load at slaughter under the tested conditions. The logistical constraints inherent in field trials and the natural variability of Campylobacter contamination in naturally infected broiler flocks make it difficult to reproduce experimental results in in situ farm conditions. RCT testing of an intervention strategy in commercial situation is therefore a key step in evaluating pre-harvest interventions against food-borne pathogens. © 2018 Blackwell Verlag GmbH.
Index of FAA Office of Aviation Medicine Reports: 1961 through 1993
1994-01-01
DOT/F~~J~94 11 Index of FAA Office of Office Of Aviation Medicine Aviation M edicine Reports: Washington, D.C. 20591 1961 through 1993 AD-A275 913 lI...and SubMle 5. Report Dab Index to FAA Office of Aviation Medicine Reports: January 1994 1961 through 1993 6. Pwe ng Organization Code 7. Autho(s) 6...Covered Office of Aviation Medicine Federal Aviation Administration 800 Independence Avenue, S.W. Washington, DC 20591 14. Sponsorg Agency Code 1S. &Su
Bactericidal effects of wine on Vibrio parahaemolyticus in oysters.
Liu, Chengchu; Chen, Ruiying; Su, Yi-Cheng
2006-08-01
The bactericidal effects of wines on Vibrio parahaemolyticus in oysters were studied to evaluate potential inactivation of V. parahaemolyticus in contaminated oysters by wine consumption. Shucked whole oyster and oyster meat homogenate were inoculated with V. parahaemolyticus and mixed with red or white wine. Survivals of V. parahaemolyticus in inoculated oysters were determined at 7 and 25 degrees C. Populations of V. parahaemolyticus in inoculated whole oysters (5.52 log most probable number [MPN] per g) decreased slightly to 4.90 log MPN/g (a 0.62-log reduction) after 24 h at 7 degrees C but increased to 7.37 log MPN/g over the same period at 25 degrees C. However, the populations in wine-treated whole oysters decreased by >1.7 and >1.9 log MPN/g after 24 h at 7 and 25 degrees C, respectively. Both red and white wines were more effective in inactivating V. parahaemolyticus in oyster meat homogenate than in whole oyster. Populations of V. parahaemolyticus in oyster meat homogenate (7.8 x 10(3) MPN/g) decreased rapidly to nondetectable levels (< 3 MPN/g) after 30 min of mixing with wine at 25 degrees C (a 3.89-log MPN/g reduction). These results suggest that chewing oysters before swallowing when eating raw oysters may result in greater inactivation of V. parahaemolyticus if wine is consumed. More studies are needed to determine the bactericidal effects of wine on V. parahaemolyticus in the complicated stomach environment.
Lata, Pushpa; Govindarajan, Subramaniam S; Qi, Feng; Li, Jian-Liang; Sahoo, Malaya K
2017-02-02
Paenibacillus sp. strain KS1 was isolated from an epiphyte, Tillandsia usneoides (Spanish moss), in central Florida, USA. Here, we report a draft genome sequence of this strain, which consists of a total of 398 contigs spanning 6,508,195 bp, with a G+C content of 46.5% and comprising 5,401 predicted coding sequences. Copyright © 2017 Lata et al.
Zehra, Siffeen; Shavez Khan, Mohammad; Ahmad, Iqbal; Arjmand, Farukh
2018-05-07
New tailored Cu(II) & Zn(II) metal-based antitumor drug entities were synthesized from substituted benzothiazole o‒vanillin Schiff base ligands. The complexes were thoroughly characterized by elemental analysis, spectroscopic studies {IR, 1 H & 13 C NMR, ESI-MS, EPR} and magnetic susceptibility measurements. The structure activity relationship (SAR) studies of benzothiazole Cu(II) & Zn(II) complexes having molecular formulas [C 30 H 22 CuN 5 O 7 S 2 ], [C 30 H 20 Cl 2 CuN 5 O 7 S 2 ], [C 30 H 20 CuF 2 N 5 O 7 S 2 ], [C 30 H 22 N 4 O 4 S 2 Zn], [C 30 H 20 Cl 2 N 4 O 4 S 2 Zn], and [C 30 H 20 F 2 N 5 O 7 S 2 Zn], with CT‒DNA were performed by employing absorption, emission titrations, and hydrodynamic measurements. The DNA binding affinity was quantified by K b and K sv values which gave higher binding propensity for chloro-substituted Cu(II) [C 30 H 20 Cl 2 CuN 5 O 7 S 2 ] complex, suggestive of groove binding mode with subtle partial intercalation. Molecular properties and drug likeness profile were assessed for the ligands and all the Lipinski's rules were found to be obeyed. The antimicrobial potential of ligands and their Cu(II) & Zn(II) complexes were screened against some notably important pathogens viz., E. coli, S. aureus, P. aeruginosa, B. subtilis, and C. albicans. The cytotoxicity of the complexes [C 30 H 20 Cl 2 CuN 5 O 7 S 2 ], [C 30 H 20 CuF 2 N 5 O 7 S 2 ], [C 30 H 20 Cl 2 N 4 O 4 S 2 Zn], and [C 30 H 20 F 2 N 5 O 7 S 2 Zn] were evaluated against five human cancer cell lines viz., MCF‒7 (breast), MIA‒PA‒CA‒2 (pancreatic), HeLa (cervix) and Hep‒G2 (Hepatoma) and A498 (Kidney) by SRB assay which revealed that chloro-substituted [C 30 H 20 Cl 2 CuN 5 O 7 S 2 ] complex, exhibited pronounced specific cytotoxicity with GI 50 value of 4.8 μg/ml against HeLa cell line. Molecular docking studies were also performed to explore the binding modes and orientation of the complexes in the DNA helix.
DOE Office of Scientific and Technical Information (OSTI.GOV)
David Andrs; Ray Berry; Derek Gaston
The document contains the simulation results of a steady state model PWR problem with the RELAP-7 code. The RELAP-7 code is the next generation nuclear reactor system safety analysis code being developed at Idaho National Laboratory (INL). The code is based on INL's modern scientific software development framework - MOOSE (Multi-Physics Object-Oriented Simulation Environment). This report summarizes the initial results of simulating a model steady-state single phase PWR problem using the current version of the RELAP-7 code. The major purpose of this demonstration simulation is to show that RELAP-7 code can be rapidly developed to simulate single-phase reactor problems. RELAP-7more » is a new project started on October 1st, 2011. It will become the main reactor systems simulation toolkit for RISMC (Risk Informed Safety Margin Characterization) and the next generation tool in the RELAP reactor safety/systems analysis application series (the replacement for RELAP5). The key to the success of RELAP-7 is the simultaneous advancement of physical models, numerical methods, and software design while maintaining a solid user perspective. Physical models include both PDEs (Partial Differential Equations) and ODEs (Ordinary Differential Equations) and experimental based closure models. RELAP-7 will eventually utilize well posed governing equations for multiphase flow, which can be strictly verified. Closure models used in RELAP5 and newly developed models will be reviewed and selected to reflect the progress made during the past three decades. RELAP-7 uses modern numerical methods, which allow implicit time integration, higher order schemes in both time and space, and strongly coupled multi-physics simulations. RELAP-7 is written with object oriented programming language C++. Its development follows modern software design paradigms. The code is easy to read, develop, maintain, and couple with other codes. Most importantly, the modern software design allows the RELAP-7 code to evolve with time. RELAP-7 is a MOOSE-based application. MOOSE (Multiphysics Object-Oriented Simulation Environment) is a framework for solving computational engineering problems in a well-planned, managed, and coordinated way. By leveraging millions of lines of open source software packages, such as PETSC (a nonlinear solver developed at Argonne National Laboratory) and LibMesh (a Finite Element Analysis package developed at University of Texas), MOOSE significantly reduces the expense and time required to develop new applications. Numerical integration methods and mesh management for parallel computation are provided by MOOSE. Therefore RELAP-7 code developers only need to focus on physics and user experiences. By using the MOOSE development environment, RELAP-7 code is developed by following the same modern software design paradigms used for other MOOSE development efforts. There are currently over 20 different MOOSE based applications ranging from 3-D transient neutron transport, detailed 3-D transient fuel performance analysis, to long-term material aging. Multi-physics and multiple dimensional analyses capabilities can be obtained by coupling RELAP-7 and other MOOSE based applications and by leveraging with capabilities developed by other DOE programs. This allows restricting the focus of RELAP-7 to systems analysis-type simulations and gives priority to retain and significantly extend RELAP5's capabilities.« less
Coconut Products Improve Signs of Diet-Induced Metabolic Syndrome in Rats.
Panchal, Sunil K; Carnahan, Sharyn; Brown, Lindsay
2017-12-01
Increasing prevalence of obesity and metabolic syndrome warrants identification of potential therapeutic options for intervention. This study tested commercially available Virgin Coconut Oil and Coconut Nourish, as coconuts are rich sources of lauric and myristic acids. Male Wistar rats were fed either corn starch diet (C); high-carbohydrate, high-fat diet (H); high-carbohydrate, high-virgin coconut oil diet (HV); or high-carbohydrate, high-coconut Nourish diet (HN) for 16 weeks. Metabolic, liver, and cardiovascular health parameters were measured during and at the end of the study. Virgin coconut oil lowered body weight (C 386±8g, H 516±13g, HV 459±10g), blood glucose concentrations (C 4.2±0.1 mmol/L, H 5.4±0.2 mmol/L, HV 4.6±0.2 mmol/L), systolic blood pressure (C 127±5mmHg, H 149±4mmHg, HV 133±3mmHg,) and diastolic stiffness (C 25.0±1.7, H 31.4±1.2, HV 25.2±2.3,) with improved structure and function of the heart and liver. Coconut Nourish increased total body lean mass (C 255±10g, H 270±16g, HN 303±15g) and lowered plasma total cholesterol concentrations (C 1.6±0.2 mmol/L, H 1.7±0.1 mmol/L, HN 1.0±0.0 mmol/L), systolic blood pressure (C 127±5mmHg, H 149±4mmHg, HN 130±3mmHg) and diastolic stiffness (C 25.0±1.7, H 31.4±1.2, HN 26.5±1.0), improved structure and function of the heart and liver but increased plasma concentrations of triglycerides (C 0.3±0.1 mmol/L, H 1.1±0.4 mmol/L, HN 1.8±0.2 mmol/L) and non-esterified fatty acids (C 1.2±0.3 mmol/L, H 3.3±0.8 mmol/L, HN 5.6±0.4 mmol/L). Thus, the fiber and protein in coconut Nourish and the medium-chain saturated fatty acids in virgin coconut oil may improve cardiovascular and liver complications in obesity.
Sukpipat, Wiphat; Komeda, Hidenobu; Prasertsan, Poonsuk; Asano, Yasuhisa
2017-01-01
Meyerozyma caribbica strain 5XY2, which was isolated from an alcohol fermentation starter in Thailand, was found to catabolize l-arabinose as well as d-glucose and d-xylose. The highest production amounts of ethanol from d-glucose, xylitol from d-xylose, and l-arabitol from l-arabinose were 0.45 g/g d-glucose, 0.60 g/g d-xylose, and 0.61 g/g l-arabinose with 21.7 g/L ethanol, 20.2 g/L xylitol, and 30.3 g/l l-arabitol, respectively. The enzyme with l-arabitol dehydrogenase (LAD) activity was purified from the strain and found to exhibit broad specificity to polyols, such as xylitol, d-sorbitol, ribitol, and l-arabitol. Xylitol was the preferred substrate with K m =16.1 mM and k cat /K m =67.0 min -1 mM -1 , while l-arabitol was also a substrate for the enzyme with K m =31.1 mM and k cat /K m =6.5 min -1 mM -1 . Therefore, this enzyme from M. caribbica was named xylitol dehydrogenase (McXDH). McXDH had an optimum temperature and pH at 40°C and 9.5, respectively. The McXDH gene included a coding sequence of 1086 bp encoding a putative 362 amino acid protein of 39 kDa with an apparent homopentamer structure. Native McXDH and recombinant McXDH exhibited relative activities toward l-arabitol of approximately 20% that toward xylitol, suggesting the applicability of this enzyme with the functions of XDH and LAD to the development of pentose-fermenting Saccharomyces cerevisiae. Copyright © 2016 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.
Errors in calculated oncotic pressure of dog plasma.
Gabel, J C; Scott, R L; Adair, T H; Drake, R E; Traber, D L
1980-12-01
Several equations to calculate plasma oncotic pressure (pi) from the total protein concentration (C) have been previously described. These equations were derived empirically from samples with a wide range of C obtained by diluting or concentrating normal plasma samples. To test these equations over a range of naturally occurring C, we measured C and pi of plasma samples from 40 dogs. C ranged from 5.3 to 8.7 g/dl and averaged 6.5 +/- 0.1 (mean +/- SE) and pi averaged 17.9 +/- 0.3 mmHg. The regression equation was pi = 78.14 + 1.67 C (r = 0.74). pi increased with C much less than predicted with the commonly used equations. The albumin-to-globulin concentration ratios (A/G), determined in 27 of the dogs, decreased with increasing C (A/G = 1.56-0.128 C, r = 0.62). The lower A/G at the higher C's could cause the lower than predicted increase in pi with C, because the equations were developed from data in which A/G was constant.
Fuel Property Effects on Diesel Engine and Gas Turbine Combustor Performance.
1981-11-01
REPORT AFLRL No. 149 By A.F. Montemayor D.W. Naegeli -* L.G. Dodge E.C. Owens J.N. Bowden U.S. Army Fuels and Lubricants Research Laboratory Southwest...6800-120/ 1 7 AUTHOR18) S. CONTRACT ORt GRANT NUMBER(a) A.F. Vmotemeyor E. C. Owens DMA7-8O-C-0001 D. W. Naegeli J.N. Bowden DAAK70-82-C-OOO1 L.G...Acquisition Magazine, 18-20, September-October 1980. 5. Noses, C.A. and Naegeli , D.W., "Fuel Property Effects on Combustor Performance," ASME 79-GT-178
Zoller, T; Zeller, W J
2000-04-03
The potential of four man-made vitreous fibres (MMVFs) (glass wool Code A, stone wool Code G, HT-N and MMVF 21) and of two natural mineral fibres (crocidolite, erionite) to induce production of reactive oxygen species (ROS) by differentiated HL-60 cells (HL-60-M cells) was investigated by determination of luminol-enhanced chemiluminescence (CL). Quartz served as positive control. The same system was used to uncover possible influences of fibre preincubation in aqueous solutions on the ROS-generating potential. Following preincubation in unbuffered saline over about 4 weeks, Code A and G fibres showed decreased ROS-generating potential as compared to freshly suspended fibres. On the other hand, MMVF 21 and HT-N fibres as well as crocidolite and erionite showed no decreased CL after incubation in aqueous solutions. The observed decrease of the ROS-generating potential of Code A and G fibres after preincubation may be an expression of fibre surface alterations (leaching, initiation of dissolution) that influences the response of exposed phagocytic cells. After incubation of both fibres in buffered solutions at different pH values (5.0, 7.4) a reduced ROS-generating potential was still discernible as compared to freshly suspended fibres.
Zhang, Yunfang; Zhang, Xudong; Shi, Junchao; Tuorto, Francesca; Li, Xin; Liu, Yusheng; Liebers, Reinhard; Zhang, Liwen; Qu, Yongcun; Qian, Jingjing; Pahima, Maya; Liu, Ying; Yan, Menghong; Cao, Zhonghong; Lei, Xiaohua; Cao, Yujing; Peng, Hongying; Liu, Shichao; Wang, Yue; Zheng, Huili; Woolsey, Rebekah; Quilici, David; Zhai, Qiwei; Li, Lei; Zhou, Tong; Yan, Wei; Lyko, Frank; Zhang, Ying; Zhou, Qi; Duan, Enkui; Chen, Qi
2018-05-01
The discovery of RNAs (for example, messenger RNAs, non-coding RNAs) in sperm has opened the possibility that sperm may function by delivering additional paternal information aside from solely providing the DNA 1 . Increasing evidence now suggests that sperm small non-coding RNAs (sncRNAs) can mediate intergenerational transmission of paternally acquired phenotypes, including mental stress 2,3 and metabolic disorders 4-6 . How sperm sncRNAs encode paternal information remains unclear, but the mechanism may involve RNA modifications. Here we show that deletion of a mouse tRNA methyltransferase, DNMT2, abolished sperm sncRNA-mediated transmission of high-fat-diet-induced metabolic disorders to offspring. Dnmt2 deletion prevented the elevation of RNA modifications (m 5 C, m 2 G) in sperm 30-40 nt RNA fractions that are induced by a high-fat diet. Also, Dnmt2 deletion altered the sperm small RNA expression profile, including levels of tRNA-derived small RNAs and rRNA-derived small RNAs, which might be essential in composing a sperm RNA 'coding signature' that is needed for paternal epigenetic memory. Finally, we show that Dnmt2-mediated m 5 C contributes to the secondary structure and biological properties of sncRNAs, implicating sperm RNA modifications as an additional layer of paternal hereditary information.
2002-09-01
Management .........................15 5. Time Management ..............................16 6. Data Distribution Management .................16 D...50 b. Ownership Management .....................51 c. Data Distribution Management .............51 2. Additional Objects and Interactions...16 Figure 6. Data Distribution Management . (From: ref. 2) ...16 Figure 7. RTI and Federate Code Responsibilities. (From: ref. 2
Code of Federal Regulations, 2010 CFR
2010-07-01
... Freedom of Information Act Program,” March 24, 1980; title 5 U.S.C., section 552. (h) DOD Directive 5400...) DOD Directive 5000.19, “Policies for the Management and Control of Information Requirements,” March 12, 1976. (d) DOD Directive 5000.11, “Data Elements and Data Codes Standardization Program,” December 7...
76 FR 52697 - Meetings of Humanities Panel
Federal Register 2010, 2011, 2012, 2013, 2014
2011-08-23
...., Washington, DC 20506. FOR FURTHER INFORMATION CONTACT: Michael P. McDonald, Advisory Committee Management... subsections (c)(4), and (6) of section 552b of Title 5, United States Code. 1. Date: September 7, 2011. Time... Initiatives at Historically Black Colleges and Universities, High Hispanic Enrollment, and Tribal Colleges and...
Novel compound heterozygous mutations in MYO7A in a Chinese family with Usher syndrome type 1
Liu, Fei; Li, Pengcheng; Liu, Ying; Li, Weirong; Wong, Fulton; Du, Rong; Wang, Lei; Li, Chang; Jiang, Fagang; Tang, Zhaohui
2013-01-01
Purpose To identify the disease-causing mutation(s) in a Chinese family with autosomal recessive Usher syndrome type 1 (USH1). Methods An ophthalmic examination and an audiometric test were conducted to ascertain the phenotype of two affected siblings. The microsatellite marker D11S937, which is close to the candidate gene MYO7A (USH1B locus), was selected for genotyping. From the DNA of the proband, all coding exons and exon-intron boundaries of MYO7A were sequenced to identify the disease-causing mutation(s). Restriction fragment length polymorphism (RFLP) analysis was performed to exclude the alternative conclusion that the mutations are non-pathogenic rare polymorphisms. Results Based on severe hearing impairment, unintelligible speech, and retinitis pigmentosa, a clinical diagnosis of Usher syndrome type 1 was made. The genotyping results did not exclude the USH1B locus, which suggested that the MYO7A gene was likely the gene associated with the disease-causing mutation(s) in the family. With direct DNA sequencing of MYO7A, two novel compound heterozygous mutations (c.3742G>A and c.6051+1G>A) of MYO7A were identified in the proband. DNA sequence analysis and RFLP analysis of other family members showed that the mutations cosegregated with the disease. Unaffected members, including the parents, uncle, and sister of the proband, carry only one of the two mutations. The mutations were not present in the controls (100 normal Chinese subjects=200 chromosomes) according to the RFLP analysis. Conclusions In this study, we identified two novel mutations, c.3742G>A (p.E1248K) and c.6051+1G>A (donor splice site mutation in intron 44), of MYO7A in a Chinese non-consanguineous family with USH1. The mutations cosegregated with the disease and most likely cause the phenotype in the two affected siblings who carry these mutations compound heterozygously. Our finding expands the mutational spectrum of MYO7A. PMID:23559863
U.S. EPA, Pesticide Product Label, SANI-CLOTH PLUS GERMICIDAL DISPOSABLE CLOTH, 10/30/2007
2011-04-21
... Escherichia coli (E. coli) 0157:H7 (AIQGE~5Jj:5P) .... ... k1~~~g~:g~l~~I~r~;,'~ 1~~~~:e!g:'tEi#ure~"wiP.Ei!:c)~~b;s:;[~H~';iji~9J!Ii;~~] ...
SCN1A, ABCC2 and UGT2B7 gene polymorphisms in association with individualized oxcarbazepine therapy.
Ma, Chun-Lai; Wu, Xun-Yi; Jiao, Zheng; Hong, Zhen; Wu, Zhi-Yuan; Zhong, Ming-Kang
2015-01-01
Associations between the effects of SCN1A, SCN2A, ABCC2 and UGT2B7 genetic polymorphisms and oxcarbazepine (OXC) maintenance doses in Han Chinese epileptic patients were investigated. Genetic polymorphisms were detected in 184 epileptic patients receiving OXC monotherapy by high-resolution melting curve and TaqMan method. Carriers of the SCN1A IVS5-91G>A, UGT2B7 c.802T>C and ABCC2 c.1249G>A variant alleles required significantly higher OXC maintenance doses than noncarriers (p < 0.05). Corresponding relative ln (concentration-dose ratios) values for SCN1A IVS5-91 variants differed by the genotypic order GG > GA > AA. SCN1A, UGT2B7 and ABCC2 genetic polymorphisms are associated with OXC maintenance doses and may be useful for the personalization of OXC therapy in epileptic patients. Further studies are needed. Original submitted 6 June 2014; Revision submitted 5 September 2014.
Association between long non-coding RNA polymorphisms and cancer risk: a meta-analysis.
Huang, Xin; Zhang, Weiyue; Shao, Zengwu
2018-05-25
Several studies have suggested that long non-coding RNA (lncRNA) gene polymorphisms are associated with cancer risk. In the present study, we conducted a meta-analysis related to studies on the association between lncRNA single-nucleotide polymorphisms (SNPs) and the overall risk of cancer. A total 12 SNPs in five common lncRNA genes were finally included in the meta-analysis. In the lncRNA antisense noncoding RNA in the INK4 locus (ANRIL), the rs1333048 A/C, rs4977574 A/G, and rs10757278 A/G polymorphisms, but not rs1333045 C/T, were correlated with overall cancer risk. Our study also demonstrated that other SNPs were correlated with overall cancer risk, namely, metastasis-associated lung adenocarcinoma transcript 1 (MALAT1, rs619586 A/G), HOXA distal transcript antisense RNA (HOTTIP, rs1859168 A/C) and highly up-regulated in liver cancer (HULC, rs7763881 A/C). Moreover, four prostate cancer‑associated non‑coding RNA 1 (PRNCR1, rs16901946 G/A, rs13252298 G/A, rs1016343 T/C, and rs1456315 G/A) SNPs were in association with cancer risk. No association was found between the PRNCR1 (rs7007694 C/T) SNP and the risk of cancer. In conclusion, our results suggest that several studied lncRNA SNPs are associated with overall cancer risk. Therefore, they might be potential predictive biomarkers for the risk of cancer. More studies based on larger sample sizes and more lncRNA SNPs are warranted to confirm these findings. ©2018 The Author(s).
The Design of a Secure File Storage System
1979-12-01
ERROR _CODE (Przi SUCO COPE) !01ile not found; write access to dtrectorv not permitted I t := GATEKEFPER?.TICKFT ’MAIL BOX, 0) G ATE KF YP F I ~D iNC...BOX.MS’T.SUCC CODE F’OF COD? (DIOR SUCO CODE) Ifile_ not found.; Fead acceLss to directoryv file t ~TRKEPE.TIKFT MIT BOX C) GATHYP~PE-I.AWAIT (MAILBOX, C. (t+2
Enzymatic Production of Ascorbic Acid-2-phosphate by Recombinant Acid Phosphatase.
Zheng, Kai; Song, Wei; Sun, Anran; Chen, Xiulai; Liu, Jia; Luo, Qiuling; Wu, Jing
2017-05-24
In this study, an environmentally friendly and efficient enzymatic method for the synthesis of l-ascorbic acid-2-phosphate (AsA-2P) from l-ascorbic acid (AsA) was developed. The Pseudomonas aeruginosa acid phosphatase (PaAPase) was expressed in Escherichia coli BL21. The optimal temperature, optimal pH, K m , k cat , and catalytic efficiency of recombinant PaAPase were 50 °C, 5.0, 93 mM, 4.2 s -1 , and 2.7 mM -1 min -1 , respectively. The maximal dry cell weight and PaAPase phosphorylating activity reached 8.5 g/L and 1127.7 U/L, respectively. The highest AsA-2P concentration (50.0 g/L) and the maximal conversion (39.2%) were obtained by incubating 75 g/L intact cells with 88 g/L AsA and 160 g/L sodium pyrophosphate under optimal conditions (0.1 mM Ca 2+ , pH 4.0, 30 °C) for 10 h; the average AsA-2P production rate was 5.0 g/L/h, and the AsA-2P production system was successfully scaled up to a 7.5 L fermenter. Therefore, the enzymatic process showed great potential for production of AsA-2P in industry.
LOINC, a universal standard for identifying laboratory observations: a 5-year update.
McDonald, Clement J; Huff, Stanley M; Suico, Jeffrey G; Hill, Gilbert; Leavelle, Dennis; Aller, Raymond; Forrey, Arden; Mercer, Kathy; DeMoor, Georges; Hook, John; Williams, Warren; Case, James; Maloney, Pat
2003-04-01
The Logical Observation Identifier Names and Codes (LOINC) database provides a universal code system for reporting laboratory and other clinical observations. Its purpose is to identify observations in electronic messages such as Health Level Seven (HL7) observation messages, so that when hospitals, health maintenance organizations, pharmaceutical manufacturers, researchers, and public health departments receive such messages from multiple sources, they can automatically file the results in the right slots of their medical records, research, and/or public health systems. For each observation, the database includes a code (of which 25 000 are laboratory test observations), a long formal name, a "short" 30-character name, and synonyms. The database comes with a mapping program called Regenstrief LOINC Mapping Assistant (RELMA(TM)) to assist the mapping of local test codes to LOINC codes and to facilitate browsing of the LOINC results. Both LOINC and RELMA are available at no cost from http://www.regenstrief.org/loinc/. The LOINC medical database carries records for >30 000 different observations. LOINC codes are being used by large reference laboratories and federal agencies, e.g., the CDC and the Department of Veterans Affairs, and are part of the Health Insurance Portability and Accountability Act (HIPAA) attachment proposal. Internationally, they have been adopted in Switzerland, Hong Kong, Australia, and Canada, and by the German national standards organization, the Deutsches Instituts für Normung. Laboratories should include LOINC codes in their outbound HL7 messages so that clinical and research clients can easily integrate these results into their clinical and research repositories. Laboratories should also encourage instrument vendors to deliver LOINC codes in their instrument outputs and demand LOINC codes in HL7 messages they get from reference laboratories to avoid the need to lump so many referral tests under the "send out lab" code.
Domínguez-Martín, Alicia; Johannsen, Silke; Sigel, Astrid; Operschall, Bert P; Song, Bin; Sigel, Helmut; Okruszek, Andrzej; González-Pérez, Josefa María; Niclós-Gutiérrez, Juan; Sigel, Roland K O
2013-06-17
The intrinsic acid-base properties of the hexa-2'-deoxynucleoside pentaphosphate, d(ApGpGpCpCpT) [=(A1∙G2∙G3∙C4∙C5∙T6)=(HNPP)⁵⁻] have been determined by ¹H NMR shift experiments. The pKa values of the individual sites of the adenosine (A), guanosine (G), cytidine (C), and thymidine (T) residues were measured in water under single-strand conditions (i.e., 10% D₂O, 47 °C, I=0.1 M, NaClO₄). These results quantify the release of H⁺ from the two (N7)H⁺ (G∙G), the two (N3)H⁺ (C∙C), and the (N1)H⁺ (A) units, as well as from the two (N1)H (G∙G) and the (N3)H (T) sites. Based on measurements with 2'-deoxynucleosides at 25 °C and 47 °C, they were transferred to pKa values valid in water at 25 °C and I=0.1 M. Intramolecular stacks between the nucleobases A1 and G2 as well as most likely also between G2 and G3 are formed. For HNPP three pKa clusters occur, that is those encompassing the pKa values of 2.44, 2.97, and 3.71 of G2(N7)H⁺, G3(N7)H⁺, and A1(N1)H⁺, respectively, with overlapping buffer regions. The tautomer populations were estimated, giving for the release of a single proton from five-fold protonated H₅(HNPP)(±) , the tautomers (G2)N7, (G3)N7, and (A1)N1 with formation degrees of about 74, 22, and 4%, respectively. Tautomer distributions reveal pathways for proton-donating as well as for proton-accepting reactions both being expected to be fast and to occur practically at no "cost". The eight pKa values for H₅(HNPP)(±) are compared with data for nucleosides and nucleotides, revealing that the nucleoside residues are in part affected very differently by their neighbors. In addition, the intrinsic acidity constants for the RNA derivative r(A1∙G2∙G3∙C4∙C5∙U6), where U=uridine, were calculated. Finally, the effect of metal ions on the pKa values of nucleobase sites is briefly discussed because in this way deprotonation reactions can easily be shifted to the physiological pH range. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Effect of vitamin C supplements on urinary oxalate and pH in calcium stone-forming patients.
Baxmann, Alessandra Calábria; De O G Mendonça, Claudia; Heilberg, Ita Pfeferman
2003-03-01
The contribution of ascorbate to urinary oxalate is controversial. The present study aimed to determine whether urinary oxalate and pH may be affected by vitamin C supplementation in calcium stone-forming patients. Forty-seven adult calcium stone-forming patients received either 1 g (N=23) or 2 g (N=24) of vitamin C supplement for 3 days and 20 healthy subjects received 1 g. A 24-hour urine sample was obtained both before and after vitamin C for calcium, oxalate, magnesium, citrate, sodium, potassium, and creatinine determination. The Tiselius index was used as a calcium oxalate crystallization index. A spot fasting morning urine sample was also obtained to determine the urinary pH before and after vitamin C. Fasting urinary pH did not change after 1 g (5.8 +/- 0.6 vs. 5.8 +/- 0.7) or 2 g vitamin C (5.8 +/- 0.8 vs. 5.8 +/- 0.7). A significant increase in mean urinary oxalate was observed in calcium stone-forming patients receiving either 1 g (50 +/- 16 vs. 31 +/- 12 mg/24 hours) or 2 g (48 +/- 21 vs. 34 +/- 12 mg/24 hours) of vitamin C and in healthy subjects (25 +/- 12 vs. 39 +/- 13 mg/24 hours). A significant increase in mean Tiselius index was observed in calcium stone-forming patients after 1 g (1.43 +/- 0.70 vs. 0.92 +/- 0.65) or 2 g vitamin C (1.61 +/- 1.05 vs. 0.99 +/- 0.55) and in healthy subjects (1.50 +/- 0.69 vs. 0.91 +/- 0.46). Ancillary analyses of spot urine obtained after vitamin C were performed in 15 control subjects in vessels with or without ethylenediaminetetraacetic acid (EDTA) with no difference in urinary oxalate between them (28 +/- 23 vs. 26 +/- 21 mg/L), suggesting that the in vitro conversion of ascorbate to oxalate did not occur. These data suggest that vitamin C supplementation may increase urinary oxalate excretion and the risk of calcium oxalate crystallization in calcium stone-forming patients.
Cytoadhesion to gC1qR through Plasmodium falciparum Erythrocyte Membrane Protein 1 in Severe Malaria
Magallón-Tejada, Ariel; Machevo, Sónia; Cisteró, Pau; Lavstsen, Thomas; Aide, Pedro; Jiménez, Alfons; Turner, Louise; Gupta, Himanshu; De Las Salas, Briegel; Mandomando, Inacio; Wang, Christian W.; Petersen, Jens E. V.; Muñoz, Jose; Gascón, Joaquim; Macete, Eusebio; Alonso, Pedro L.; Chitnis, Chetan E.
2016-01-01
Cytoadhesion of Plasmodium falciparum infected erythrocytes to gC1qR has been associated with severe malaria, but the parasite ligand involved is currently unknown. To assess if binding to gC1qR is mediated through the P. falciparum erythrocyte membrane protein 1 (PfEMP1) family, we analyzed by static binding assays and qPCR the cytoadhesion and var gene transcriptional profile of 86 P. falciparum isolates from Mozambican children with severe and uncomplicated malaria, as well as of a P. falciparum 3D7 line selected for binding to gC1qR (Pf3D7gC1qR). Transcript levels of DC8 correlated positively with cytoadhesion to gC1qR (rho = 0.287, P = 0.007), were higher in isolates from children with severe anemia than with uncomplicated malaria, as well as in isolates from Europeans presenting a first episode of malaria (n = 21) than Mozambican adults (n = 25), and were associated with an increased IgG recognition of infected erythrocytes by flow cytometry. Pf3D7gC1qR overexpressed the DC8 type PFD0020c (5.3-fold transcript levels relative to Seryl-tRNA-synthetase gene) compared to the unselected line (0.001-fold). DBLβ12 from PFD0020c bound to gC1qR in ELISA-based binding assays and polyclonal antibodies against this domain were able to inhibit binding to gC1qR of Pf3D7gC1qR and four Mozambican P. falciparum isolates by 50%. Our results show that DC8-type PfEMP1s mediate binding to gC1qR through conserved surface epitopes in DBLβ12 domain which can be inhibited by strain-transcending functional antibodies. This study supports a key role for gC1qR in malaria-associated endovascular pathogenesis and suggests the feasibility of designing interventions against severe malaria targeting this specific interaction. PMID:27835682
Robust Self-Authenticating Network Coding
2008-11-30
efficient as traditional point-to-point coding schemes 3m*b*c*ts»tt a«2b»c*dt4g »4.0»C* 3d *Sh Number of symbols that an intermediate node has to...Institute of Technology This work was partly supported by the Fundacao para a Ciencia e Tecnologia (Portuguese foundation lor Science and Technology
Allelic heterogeneity of FGF5 mutations causes the long-hair phenotype in dogs.
Dierks, C; Mömke, S; Philipp, U; Distl, O
2013-08-01
Hitherto, the only known mutant gene leading to the long-hair phenotype in mammals is the fibroblast growth factor 5 (FGF5). In many dog breeds, the previously discovered FGF5:p.Cys95Phe mutation appeared completely concordant with the long-hair phenotype, but for some breeds, the long-hair phenotype could not be resolved. First, we studied the role of the FGF5:p.Cys95Phe and FGF5:g.145_150dupACCAGC mutations in 268 dogs descending from 27 breeds and seven wolves. As these mutations did not explain all the long-hair phenotypes, all exons and their neighbouring regions of FGF5 were re-sequenced. We detected three novel mutations in the coding sequence and one novel non-coding splice-site mutation in FGF5 associated with the long-hair phenotype. The FGF5:p.Ala193Val polymorphism was perfectly consistent with long hair in Akitas and probably in Siberian huskies, too. Dogs of the long-hair breed Samoyed were either homozygous or compound heterozygous for the FGF5:p.Ala193Val or the FGF5:p.Cys95Phe polymorphisms respectively. The two newly detected polymorphisms FGF5:c.559_560dupGG and FGF5:g.8193T>A and the known mutation FGF5:p.Cys95Phe explained the long-hair phenotype of all Afghan hounds analysed. An FGF5:c.556_571del16 mutation was found in one longhaired Eurasier. All long-hair-associated mutations follow a recessive mode of inheritance, and allelic heterogeneity was a common finding in breeds other than Akita. © 2013 The Authors, Animal Genetics © 2013 Stichting International Foundation for Animal Genetics.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Vervoort, R.; Liebaers, I.; Lissens, W.
1996-03-01
Although not all mucopolysaccharidosis type VII (MPS VII) neonates present with hydrops fetalis or with related symptoms, hydrops fetalis is a common form of presentation of this mucopolysaccharidosis. We used reverse-transcription-PCR-SSCP and direct sequencing to screen for mutations in the human {beta}-glucuronidase cDNA of 17 MPS VII patients with severe presentation of the disease. Mutations resulting in an unstable mRNA were detected in genomic DNA with direct sequencing of the PCR-amplified {beta}-glucuronidase exons. We found extensive genetic heterogeneity in MPS VII alleles: in addition to 6 of 12 previously reported mutations (L176F, R216W, R357X, R382C, W507X, and W627C), we detectedmore » 14 undescribed mutations in the {beta}-glucuronidase coding region that produce MPS VII alleles (G136R, E150K, S312X, Y320S, Y320C, H351Y, R382H, R374C, R435P, R477W, G572D, Y508C, K606N, and 1900{Delta}GA). The mutations in hydropic fetuses were widely scattered in the {beta}-glucuronidase gene. Analysis of three polymorphic sites of the mutant alleles (1766T/C, 1972C/T, and a new 1091+27C/G polymorphism) allowed exclusion of identity by descent for some recurrent mutations. Three of four mutations introducing a premature translation stop codon were found to affect mRNA abundance and/or structure. Expression studies provided evidence for the causal relationship between each of the mutations found in MPS VII alleles and the enzyme deficiency, in that all mutations identified exhibited markedly reduced enzyme activity expressed in COS7 cells following transfection with the mutant cDNA. 52 refs., 4 figs., 5 tabs.« less
Word Frequency Analysis. MOS: 51N. Skill Levels 1 & 2.
1981-05-01
C.s~ss t C: 4i,40 16 CoD.J,1U 4 I CE s!Z 26 rCLL 9 CELL ! I CEAENf. 24 CFNT;R 3 C.J7’.1-T-CENTEft 2 CtNT?-AEr’ 4 Mf~ :aL.ZWE 2 e VrAL C ^’f4 t...GOJ4LTy214I7G 27~~~Z r.4MrL2 JN 7fE43ING 26 PUT?e- CELL 26 4126 pPZPING 2 ~76 Pr, ’S U~R 26S*5INh2 P8!P(NTq25 P-.crsS 25 P.AT8 25 INCI 25 PTSVRE 15 u 5...rL 2 CPAL 11? .1 ’G 2 C IrIL2:", I DE I L 2 CIRZCJLL-, 2 CIE!Nv, 2 C~LrFCJLC LJD 2 CUA*.Ll 2 ccCoVM4UICATION 2 CELL ; A S 2 :(LLZkS 2 CO4 It~TIOE
Influence of Crosslinking on the Mechanical Properties of High TG Polymers
1976-07-01
with UV light has been previously described (48). In brief, benzoin was used as the initiator (0.3 percent), acrylic acid anhydride (AAA) as the labile...1.9 1.0 1.8 0.8 1.7 110 4M (th)x 10 1.0 2.0 1.0 2.0 1.0 2.0 4M- -(E) x 10 0.9 1.2 0.9 1.3 0.7 1.2 1.7 EA: 100 ml Benzoin : 0.4 g 22 Table 3. PEA...L) x 10 4.1 9.0 4.0 10.0 2.4 - - c (wg)x 104 5.7 8.7 3.5 8.4 2.7 - - M-c (E) x 10 1.2 2.1 1.0 2.1 0.8 1.0 1.3 EA: 100 ml Benzoin : 0.4 g Table 4. PEA
Santo, David; Graça, Ana; Nunes, Carla; Quintas, Célia
2018-04-01
These studies were aimed at assessing the growing capacity of Escherichia coli and Cronobacter sakazakii and the effectiveness of Ultraviolet-C (UV-C) radiation, acidic electrolyzed (AEW) and neutral electrolyzed (NEW) waters in the inhibition of these bacteria on minimally processed 'Tommy Atkins' mangoes (MPM). The fruits were contaminated by dip inoculation and kept 10 days at 4, 8, 12 and 20 °C while enumerating bacteria. Contaminated mangoes were disinfected using UV-C (2.5, 5, 7.5 and 10 kJ/m 2 ), AEW, NEW and sodium hypochlorite (SH) and the microorganisms were monitored. None of the enterobacteria grew at 4, 8 and 12 °C regardless of having persisted during the 10-day period. At 20 °C, E. coli and C. sakazakii grew, after adaption phases of 48 h and 24 h, to values of 8.7 and 8.5 log cfu/g at day eight, respectively. E. coli showed the highest reduction counts on the MPM washed with NEW and SH (2.2 log cfu/g). UV-C was more effective in reducing C. sakazakii (2.4-2.6 log cfu/g), when compared to AEW, NEW and SH (1.2-1.8 log cfu/g). The efficacy of decontamination technologies depends on microorganisms, highlighting the importance of preventing contamination at the primary production and of combining different methods to increase the safety of fresh-cut fruits. Copyright © 2017 Elsevier Ltd. All rights reserved.
The complete mitochondrial genome of the Longnose skate: Raja rhina (Rajiformes, Rajidae).
Jeong, Dageum; Lee, Youn-Ho
2015-02-01
The complete sequence of mitochondrial DNA of a longnose skate, Raja rhina was determined for the first time. It is 16,910 bp in length containing 2 rRNA, 22 tRNA and 13 protein coding genes with the same gene order and structure as those of other Rajidae species. The nucleotide of L-strand is composed of 30.1% A, 27.2% C, 28.5% T and 14.2% G, showing a slight A + T bias. The G is the least used base and markedly lower at the third codon position (5.4%). Twelve of the 13 protein coding genes use ATG as their start codon while the COX1 starts with GTG. As for stop codon, only ND4 shows incomplete stop codon TA. This mitogenome is the first report for a species of the genus Raja, and providing a valuable resource of genetic information for understanding the phylogenetic relationship and the evolution of the genus Raja as well as the family, Rajidae.
Alignment of Manpower Requirements with Procurement Workload.
1987-03-01
AT FIE( 1O)=.1e; 356 ACT.,P03; 1CA 351 G47? GCCW.1; CA 35t ACTvT PIAG(96.’ 120.’ 16t.)o-vG4f; 35$ G6 GcoD.1; 14CA APFPCVES? FV2 lhA 36C AcI.,A7NI8(J1...1! ATPIE(10)=.5; 51b C&P1 ’SI I A6( ASS I ft PAT FI (10)-1as; 511 A pP 2 515 GelI G60h 1; FORMAT Ci 520 AC Tr..9v A47 No. 5 z1 ACTP..a.A53; VE 5. 521
Chen, Chia-Yen; Lee, Phil H; Castro, Victor M; Minnier, Jessica; Charney, Alexander W; Stahl, Eli A; Ruderfer, Douglas M; Murphy, Shawn N; Gainer, Vivian; Cai, Tianxi; Jones, Ian; Pato, Carlos N; Pato, Michele T; Landén, Mikael; Sklar, Pamela; Perlis, Roy H; Smoller, Jordan W
2018-04-18
Bipolar disorder (BD) is a heritable mood disorder characterized by episodes of mania and depression. Although genomewide association studies (GWAS) have successfully identified genetic loci contributing to BD risk, sample size has become a rate-limiting obstacle to genetic discovery. Electronic health records (EHRs) represent a vast but relatively untapped resource for high-throughput phenotyping. As part of the International Cohort Collection for Bipolar Disorder (ICCBD), we previously validated automated EHR-based phenotyping algorithms for BD against in-person diagnostic interviews (Castro et al. Am J Psychiatry 172:363-372, 2015). Here, we establish the genetic validity of these phenotypes by determining their genetic correlation with traditionally ascertained samples. Case and control algorithms were derived from structured and narrative text in the Partners Healthcare system comprising more than 4.6 million patients over 20 years. Genomewide genotype data for 3330 BD cases and 3952 controls of European ancestry were used to estimate SNP-based heritability (h 2 g ) and genetic correlation (r g ) between EHR-based phenotype definitions and traditionally ascertained BD cases in GWAS by the ICCBD and Psychiatric Genomics Consortium (PGC) using LD score regression. We evaluated BD cases identified using 4 EHR-based algorithms: an NLP-based algorithm (95-NLP) and three rule-based algorithms using codified EHR with decreasing levels of stringency-"coded-strict", "coded-broad", and "coded-broad based on a single clinical encounter" (coded-broad-SV). The analytic sample comprised 862 95-NLP, 1968 coded-strict, 2581 coded-broad, 408 coded-broad-SV BD cases, and 3 952 controls. The estimated h 2 g were 0.24 (p = 0.015), 0.09 (p = 0.064), 0.13 (p = 0.003), 0.00 (p = 0.591) for 95-NLP, coded-strict, coded-broad and coded-broad-SV BD, respectively. The h 2 g for all EHR-based cases combined except coded-broad-SV (excluded due to 0 h 2 g ) was 0.12 (p = 0.004). These h 2 g were lower or similar to the h 2 g observed by the ICCBD + PGCBD (0.23, p = 3.17E-80, total N = 33,181). However, the r g between ICCBD + PGCBD and the EHR-based cases were high for 95-NLP (0.66, p = 3.69 × 10 -5 ), coded-strict (1.00, p = 2.40 × 10 -4 ), and coded-broad (0.74, p = 8.11 × 10 -7 ). The r g between EHR-based BD definitions ranged from 0.90 to 0.98. These results provide the first genetic validation of automated EHR-based phenotyping for BD and suggest that this approach identifies cases that are highly genetically correlated with those ascertained through conventional methods. High throughput phenotyping using the large data resources available in EHRs represents a viable method for accelerating psychiatric genetic research.
Feasibility Study of 5.56 MM Folded Ammunition/Weapon System
1976-09-01
blt 50 nd reeh pn te ct 57 wll nabe hll xhausting operaetively developed pressure gas there- longitudintl5motion ei the holti5505thrwill htii it ful...187 ) N g7 tjN U (1%! I ,c 0,----- o /009 cz U I C5 Zoo-. ’ -.P1 SY .. .............................. oATM ................... SU ,J .C T
Shen, Cangliang; Geornaras, Ifigenia; Belk, Keith E; Smith, Gary C; Sofos, John N
2011-01-01
This study evaluated inactivation of Escherichia coli O157:H7 in moisture-enhanced restructured nonintact beef cooked to 65 °C using different cooking appliances set at different temperatures. Batches (2 kg) of coarse-ground beef (approximately 5% fat) were mixed with an 8-strain composite (100 mL) of rifampicin-resistant E. coli O157:H7 (6.4 ± 0.1 log CFU/g) and a solution (100 mL) of sodium chloride plus sodium tripolyphosphate to yield concentrations (wt/wt) of 0.5% and 0.25%, respectively, in the final product. Beef portions of 2.54 cm thickness (15 cm dia) were prepared and were vacuum-packaged and frozen (-20 °C, 42 h). Partially thawed (-2.5 ± 1.0 °C) portions were pan-broiled (Presto electric skillet and Sanyo grill) or roasted (Oster toaster oven and Magic Chef kitchen oven) to 65 °C. The appliances were set at, and preheated before cooking to 149 or 204 °C (electric skillet), 149 or 218 °C (grill), 149 or 232 °C (toaster oven), and 149, 204, or 260 °C (kitchen oven). Temperatures of appliances and beef samples were monitored with thermocouples, and meat samples were analyzed for surviving microbial populations. In general, the higher the appliance temperature setting, the shorter the time needed to reach 65 °C, and the higher the edge and surface temperatures of the meat samples. Temperatures of 204 to 260 °C, regardless of appliance, resulted in greater (P < 0.05) pathogen reductions (3.3 to 5.5 log CFU/g) than those obtained at 149 °C (1.5 to 2.4 log CFU/g). The highest (P < 0.05) reduction (5.5 log CFU/g) was obtained in samples cooked in the kitchen oven set at 260 °C. The results should be useful to the food service industry for selection of effective nonintact beef cooking protocols, and for use in risk assessments for nonintact meat products. Practical Application: Results of this study should be useful for developing cooking recommendations to enhance the safety of nonintact beef products, and for use in risk assessments of such products.
A new DPYD genotyping assay for improving the safety of 5-fluorouracil therapy.
Sistonen, Johanna; Smith, Chingying; Fu, Yung-Kang; Largiadèr, Carlo R
2012-12-24
Chemotherapeutic use of 5-fluorouracil (5FU) is compromised by 10-20% of patients developing severe toxicity. Recently described genetic variation in dihydropyrimidine dehydrogenase (DPYD) has been shown to be a major predictor of 5FU toxicity. Here, we describe a new genotyping assay for routine clinical use that covers all the major DPYD risk variants. Genomic regions targeting DPYD risk variants (c.1129-5923C>G, c.1679T>G/A, c.1905+1G>A, c.2846A>T) and additional markers (c.234-123G>C, c.496A>G, c.775A>G) were amplified in a multiplex PCR reaction. The subsequent steps including allele-specific primer extension, hybridization of the primers to a microarray, scanning of the array, and data analysis were automated within the INFINITI® Analyzer (AutoGenomics). The assay was validated by analyzing 107 blood samples obtained from patients previously re-sequenced for the DPYD. The genotypes obtained with the developed assay were 100% concordant with the re-sequencing. The procedure is suitable for routine clinical use since the results are obtained within one day. For heterozygous risk variant carriers (~7% of Europeans), the treatment can be adjusted by 5FU dose reduction, whereas carriers of two risk alleles should be treated with an alternative therapy. The developed assay provides a novel tool to improve the safety of commonly used 5FU-based chemotherapies. Copyright © 2012 Elsevier B.V. All rights reserved.
[Neurological manifestations in patients with Gaucher disease and in their relatives].
Giraldo, Pilar; Capablo, José Luis; Alfonso, Pilar; Latre, Paz; García, Beatriz; Pocoví, Miguel
2008-07-05
Gaucher disease (GD) is characterized by a wide spectrum of manifestations. Previous reports indicate that GD relatives could develop neurological abnormalities more frequently than the general population. We aimed to know the presence of neurological symptoms (NS) in GD patients and their relatives. From January to December 2006 we performed a postal survey contacting 42 physicians and 92 families to evaluate NS and correlate them with genetic characteristics. Statistical analysis using descriptive parameters, ANOVA, t-test and a correlation study including Pearson coefficient were performed. Information from 72 families (78.3% responses) including 99 patients and 266 relatives was obtained. Thirty type 1 GD (32.6%) reported NS: tremor 8 (8.7%), uncoordinated movements 9 (9.8%), concentration defects 11 (11.9%), strabism 7 (7.6%), deafness 8 (8.7%), Parkinson disease (PD) 7 (7.6%) and peripheral neuropathy 10 (10.9%). Thirty-six (13.5%) first or second degrees relatives presented the following NS: PD 14 (4.9%), epilepsy 8 (3.0%), tremor 7 (2.6%), deafness 2 (0.7%) and others 5 (1.9%). 17.3% of carriers had NS versus 5.7% in non-carriers (p = 0.0096). Patients with PD had mutations in S364R, D409H, L444P, [IVS4-2a ==> g; c.(-203)A ==> G], c.500insT and L336P. In relatives with PD a wide spectrum of mutations was observed: L444P, N370S, V398I, G202R, c.1439-1445del7, [E326K; N188S] and c.953delT. In other NS, predominant mutations were D409H, G195W, R120W, R147X, L336P and G377S. A higher incidence than expected of PD and other NS in GD type 1 patients and relatives was observed. These manifestations appear frequently in L444P or rare mutations carriers. It is important to perform a systematic neurological exam in type 1 GD patients and carriers with risk mutations.
Jang, Hyein; Addy, Nicole; Ewing, Laura; Jean-Gilles Beaubrun, Junia; Lee, YouYoung; Woo, JungHa; Negrete, Flavia; Finkelstein, Samantha; Tall, Ben D; Lehner, Angelika; Eshwar, Athmanya; Gopinath, Gopal R
2018-04-12
Here, we present draft genome sequences of 29 Cronobacter sakazakii isolates obtained from foods of plant origin and dried-food manufacturing facilities. Assemblies and annotations resulted in genome sizes ranging from 4.3 to 4.5 Mb and 3,977 to 4,256 gene-coding sequences with G+C contents of ∼57.0%.
Lee, Su-Jun; Usmani, Khawja A; Chanas, Brian; Ghanayem, Burhan; Xi, Tina; Hodgson, Ernest; Mohrenweiser, Harvey W; Goldstein, Joyce A
2003-08-01
Genetic polymorphisms of cytochromes P450 (CYPs) are a principal reason for inter-individual variations in the metabolism of therapeutic drugs and environmental chemicals in humans. The present study identifies 34 single nucleotide polymorphisms (SNPs) of CYP3A5 including 27 previously unidentified SNPs by direct sequencing of the exons, intron-exon junctions and 5'-upstream region of CYP3A5 from 92 racially diverse individuals (24 Caucasians, 24 Africans, 24 Asians, and 20 individuals of unknown racial origin). Four new CYP3A5 SNPs produced coding changes: R28C, L82R, A337T, and F446S. CYP3A5 R28C occurred in African populations (allelic frequency of 4%). CYP3A5 A337T occurred in Asians (2% allelic frequency), CYP3A5 L82R (occurred in the racially unidentified group) and CYP3A5 F446S (identified in Caucasians with a 2% allelic frequency) were on an allele containing the splice change g.6986A>G known as CYP3A5*3. The newly identified allelic proteins were constructed by site-directed mutagenesis, expressed in Escherichia coli and purified. CYP3A5 L82R was expressed only as denatured CYP420, suggesting it may be unstable. CYP3A5*1 exhibited the highest maximal clearance for testosterone followed by CYP3A5 A337T > CYP3A5 R28C > CYP3A5 F446S. CYP3A5*1 exhibited a higher V(max) for nifedipine oxidation than CYP3A5 A337T > CYP3A5 R28C > CYP3A5 F446S. CYP3A5 A337T and CYP3A5 R28C exhibited a 42-64% lower V(max) for nifedipine oxidation than CYP3A5*1. CYP3A5 F446S exhibited a > 95% decrease in the intrinsic clearance for both 6beta-hydroxytestosterone and nifedipine oxidation. This study identifies four new potentially defective coding alleles. CYP3A5 F446S is predicted to be more catalytically defective than the splice change alone.
Cespedes, Carlos L; Muñoz, Evelyn; Salazar, Juan R; Yamaguchi, Lydia; Werner, Enrique; Alarcon, Julio; Kubo, Isao
2013-12-01
Extracts, fractions and compounds from Calceolaria talcana and C. integrifolia exhibited strong inhibitory effects of the activity of acetylcholinesterase (AChE) and butyrylcholinesterase (BChE) enzymes using the in vitro Ellman's method. The most active samples were from the ethyl acetate extract, which caused a mixed-type inhibition against AChE (69.8% and 79.5% at 100 and 200 μg/ml, respectively) and against BChE (98.5% and 99.8% at 100 and 200 μg/ml, respectively) and its major components verbascoside 8 (50.9% and 70.0% at 200 μg/ml, against AChE and BChE, respectively), martynoside 9, and fraction F-7 (which corresponds to a mixture of 8, 9, and other phenylethanoids and phenolics that remain unidentified) (80.2% and 85.3% at 100 and 200 μg/ml, against AChE, respectively and 99.1% and 99.7% at 100 and 200 μg/ml, against BChE, respectively) inhibited the acetylcholinesterase enzyme competitively. The most polar fraction F-5 from n-hexane extract (a mixture of naphthoquinones: 2-hydroxy-3-(1,1-dimethylallyl-1,4-naphthoquinone) 6, α-dunnione 7 and other polar compounds that remain unidentified) showed a mixed-type inhibition (71.5% and 72.1% against AChE and BChE at 200 μg/ml, respectively). Finally, the methanol-soluble residue presented a complex, mixed-type inhibition (39.9% and 67.9% against AChE and BChE at 200 μg/ml, respectively). The mixture F-3 with diterpenes was obtained from the n-hexane extract: (1,10-cyclopropyl-9-epi-ent-isopimarol) 1, 19-α-hydroxy-abietatriene 2, and F-4 a mixture of triterpenes α-lupeol 3, β-sitosterol 4, ursolic acid 5 together with a complex mixture of terpenes that did not show activity. In summary, extracts and natural compounds from C. talcana and C. integrifolia were isolated, identified and characterized as cholinesterase inhibitors.
2010-01-01
GRANT NUMBER 5c. PROGRAM ELEMENT NUMBER 6. AUTHOR( S ) 5d. PROJECT NUMBER 5e. TASK NUMBER 5f. WORK UNIT NUMBER 7. PERFORMING ORGANIZATION NAME( S ) AND...REPORT NUMBER 9. SPONSORING/MONITORING AGENCY NAME( S ) AND ADDRESS(ES) 10. SPONSOR/MONITOR’S ACRONYM( S ) 11. SPONSOR/MONITOR’S REPORT NUMBER( S ) 12...retardation, and substance abuse or dependence. Coding was based on the International Classification of Diseases , Ninth Revision, Clinical
Hwang, Cheng-An; Porto-Fett, Anna C S; Juneja, Vijay K; Ingham, Steven C; Ingham, Barbara H; Luchansky, John B
2009-02-28
This study quantified and modeled the survival of Escherichia coli O157:H7, Listeria monocytogenes and Salmonella Typhimurium in soudjouk-style fermented sausage during fermentation, drying, and storage. Batter prepared from ground beef (20% fat), seasonings, starter culture, and dextrose was separately inoculated with a multi-strain mixture of each pathogen to an initial inoculum of ca. 6.5 log(10) CFU/g in the batter. The sausages were subsequently fermented at 24 degrees C with a relative humidity (RH) of 90% to 95% for 3 to 5 days to ca. pH 5.2, pH 4.9 or pH 4.6, then dried at 22 degrees C to a(w) 0.92, a(w) 0.89, or a(w) 0.86, respectively, and then stored at 4, 21, or 30 degrees C for up to 60 days. Lethality of the three pathogens was modeled as a function of pH, a(w) and/or storage temperature. During fermentation to pH 5.2 to pH 4.6, cell reductions ranged from 0 to 0.9 log(10) CFU/g for E. coli O157:H7, 0.1 to 0.5 log(10) CFU/g for L. monocytogenes, and 0 to 2.2 log(10) CFU/g for S. Typhimurium. Subsequent drying of sausages of pH 5.2 to pH 4.6 at 22 degrees C with 80% to 85% RH for 3 to 7 days to a(w) of 0.92 to a(w) 0.86 resulted in additional reductions that ranged from 0 to 3.5 log(10) CFU/g for E. coli O157:H7, 0 to 0.4 log(10) CFU/g for L. monocytogenes, and 0.3 to 2.4 log(10) CFU/g for S. Typhimurium. During storage at 4, 21, or 30 degrees C the reduction rates of the three pathogens were generally higher (p<0.05) in sausages with lower pH and lower a(w) that were stored at higher temperatures. Polynomial equations were developed to describe the inactivation of the three pathogens during fermentation, drying, and storage. The applicability of the resulting models for fermented sausage was evaluated by comparing model predictions with published data. Pathogen reductions estimated by the models for E. coli O157:H7 and S. Typhimurium were comparable to 67% and 73% of published data, respectively. Due to limited published data for L. monocytogenes, the models for L. monocytogenes would need additional validations. Results of pathogen reductions from this study may be used as a reference to assist manufacturers of soudjouk-style sausages to adopt manufacturing processes that meet the regulatory requirements. The resulting models may also be used for estimating the survival of E. coli O157:H7 and S. Typhimurium in other similar fermented sausage during fermentation and storage.
Kassam, Aliya; Sharma, Nishan; Harvie, Margot; O’Beirne, Maeve; Topps, Maureen
2016-01-01
Abstract Objective To conduct a thematic analysis of the College of Family Physicians of Canada’s (CFPC’s) Red Book accreditation standards and the Triple C Competency-based Curriculum objectives with respect to patient safety principles. Design Thematic content analysis of the CFPC’s Red Book accreditation standards and the Triple C curriculum. Setting Canada. Main outcome measures Coding frequency of the patient safety principles (ie, patient engagement; respectful, transparent relationships; complex systems; a just and trusting culture; responsibility and accountability for actions; and continuous learning and improvement) found in the analyzed CFPC documents. Results Within the analyzed CFPC documents, the most commonly found patient safety principle was patient engagement (n = 51 coding references); the least commonly found patient safety principles were a just and trusting culture (n = 5 coding references) and complex systems (n = 5 coding references). Other patient safety principles that were uncommon included responsibility and accountability for actions (n = 7 coding references) and continuous learning and improvement (n = 12 coding references). Conclusion Explicit inclusion of patient safety content such as the use of patient safety principles is needed for residency training programs across Canada to ensure the full spectrum of care is addressed, from community-based care to acute hospital-based care. This will ensure a patient safety culture can be cultivated from residency and sustained into primary care practice. PMID:27965349
Roth, Johannes; Müller, Nicolle; Lehmann, Thomas; Böer, Klas; Löbel, Sven; Pum, Joachim; Müller, Ulrich Alfons
2018-01-01
HbA 1c is the most important surrogate parameter to assess the quality of diabetes care and is also used for the diagnosis of diabetes mellitus (DM) since 2010. We investigated the comparability of 3 HbA 1c methods in the city of Jena (Germany). The HbA 1c determination was carried out in 50 healthy subjects and 24 people with DM (age 51.2±16.3 years, HbA 1c 6.8±2.2%) with 3 different hemoglobin A 1c testing methods at 4 locations in one city. Our laboratory (HPLC method) served as a reference for comparing the results. All methods are IFCC standardized and all devices are certified by the interlaboratory test. The mean HbA 1c of people without diabetes was: laboratory A (TOSOH G8, HPLC) 5.7±0.3%; laboratory B (TOSOH G8, HPLC) 5.5±0.3%, laboratory C (VARIANT II) 5.2±0.3%; laboratory D (COBAS INT.) 5.6±0.3%. All differences are significant (p=0.001).The mean HbA 1c of patients with mild to moderate elevated HbA 1c was: Laboratory A 7.5±0.9%; B 7.3±1.0%; C 7.0±0.9%; D 7.5±1.1%. Differences are significant (p=0.001) except between laboratory A and D (p=0.8).The mean HbA 1c of patients with massively increased HbA 1c was: laboratory A 11.5±1.8%; laboratory B 11.4±1.8%; laboratory C 10.8±1.6%; laboratory D 11.5±1.5%. Differences between laboratory A and C, as well as between C and D were significant (p=0.001). The mean IFCC standardized HbA 1c from 75 people differs by up to 0.5% absolute between 4 laboratories. This difference is clinically significant and may lead to misdiagnosis and wrong treatment decisions, while HbA 1c value from one patient were analyzed in different laboratories within a short time. © Georg Thieme Verlag KG Stuttgart · New York.
Paixão, Susana M; Arez, Bruno F; Roseiro, José C; Alves, Luís
2016-11-01
Biodesulfurization can be a complementary technology to the hydrodesulfurization, the commonly physical-chemical process used for sulfur removal from crude oil. The desulfurizing bacterium Gordonia alkanivorans strain 1B as a fructophilic microorganism requires fructose as C-source. In this context, the main goal of this work was the optimization of a simultaneous saccharification and fermentation (SSF) approach using the Zygosaccharomyces bailii strain Talf1 crude enzymes with invertase activity and sucrose as a cheaper fructose-rich commercial C-source (50% fructose) towards dibenzothiophene (DBT) desulfurization by strain 1B. The determination of optimal conditions, for both sucrose hydrolysis and DBT desulfurization was carried out through two sequential experimental uniform designs according to the Doehlert distribution for two factors: pH (5.5-7.5) and temperature (28-38 °C), with the enzyme load of 1.16 U/g/L; and enzyme load (0-4 U/g/L) and temperature (28-38 °C), with pH at 7.5. Based on 2-hydroxybiphenyl production, the analysis of the response surfaces obtained pointed out for pH 7.5, 32 °C and 1.8 U/g/L as optimal conditions. Further optimized SSF of sucrose during the DBT desulfurization process permitted to attain a 4-fold enhanced biodesulfurization. This study opens a new focus of research through the exploitation of sustainable low cost sucrose-rich feedstocks towards a more economical viable bioprocess scale-up. Copyright © 2016 Elsevier Ltd. All rights reserved.
Doxapram Only Slightly Reduces the Shivering Threshold in Healthy Volunteers
Komatsu, Ryu; Sengupta, Papiya; Cherynak, Grigory; Wadhwa, Anupama; Sessler, Daniel I.; Liu, Jin; Hurst, Harrell E.; Lenhardt, Rainer
2005-01-01
We determined the effects of doxapram on the major autonomic thermoregulatory responses in humans. Nine healthy volunteers were studied on two days: Control and Doxapram (intravenous infusion to a plasma concentration of 2.4 ±0.8 μg/mL, 2.5 ±0.9 μg/mL, and 2.6 ±1.1 μg/mL at the sweating, vasoconstriction, and shivering thresholds, respectively). Each day, skin and core temperatures were increased to provoke sweating, then reduced to elicit peripheral vasoconstriction and shivering. We determined the sweating, vasoconstriction, and shivering thresholds with compensation for changes in skin temperature. Data were analyzed with paired t tests and presented as means ± SDs; P < 0.05 was considered statistically significant. Doxapram did not change the sweating (Control: 37.5±0.4°C, Doxapram: 37.3±0.4°C, P=0.290) or the vasoconstriction threshold (36.8±0.7 vs. 36.4±0.5°C; P=0.110). However, it significantly reduced the shivering threshold from 36.2±0.5 to 35.7±0.7°C (P=0.012). No sedation or symptoms of panic were observed on either study day. The observed reduction in the shivering threshold explains the drug's efficacy for treatment of postoperative shivering; however, a reduction of only 0.5°C is unlikely to markedly facilitate induction of therapeutic hypothermia as a sole agent. PMID:16243996
Molecular Recognition of Endocytic Codes in Receptor Tyrosine Kinases
1999-06-01
and B), substitution of Glu for Thr at residue 508 failed to induce actin aggregation in COS-7 cells (Fig. 9, panels C and D), comparable to lack...of effects of the kinase inactive Kd3-D460N mutant (Fig. 9, panels G and H). In contrast, substitution of 2 Glu residues whose charge may more...studies of Mekl where substitution of an Asp or Glu residue for 1 serine phosphoryl- ation site partially activated the enzyme and substitution of 2
Review of Thermal Properties of Snow, Ice and Sea Ice,
1981-06-01
AD-AL03 734 COLD RE61ONS RESEARCH AND ENGINEERING LAS HANOVER NH F/G 8/12AI3 3REVIEW OF THERMAL PROPERTIES OF SNOW. ICE AND SEA ICE,(U)UNCLASSIFIlED...Distribution/ Availability Codes Avail and/or D~ Dis~t Special D 1 7 C- T > L) UNITED STATES ARMY CORPS OF ENGINEERS COLD REGIONS RESEARCH AND ENGINEERING...PROGRAM ELEMENT, PROJECT. TASK AREA A WORK UNIT NUMBERS U.S. Army Cold Regions Research and Engineering Laboratory Hanover, New Hampshire 03755 DA Pr
The Effect of Alloy Composition and Processing on the Structure and Properties of I/M Al-Li-X Alloys
1990-07-01
ORGANIZATION Department ot Materials Scienci (N aplicable) University of Virginia U. S. Army Research Office 6c. ADDRESS (City, State, and ZIP Code) 7b...27709 Attention: Dr. Andrew Crowson, Program Officer Materials Science Division Submitted by: E. A. Starke Earnest Oglesby Professor of Materials ...Science and Dean G. J. Shiflet Professor of Materials Science Report No. UVA/525140/MS91/101 July 1990 DTIC ELECTFE SAUG3 1190 I DEPARTMENT OF MATERIALS
1985-05-01
ADAlS481 ROUTINES(U), NASSACNUSETTS INST OF TECH CANIRIDGE 1in ARTIFICIAL INTELLIGENCE LAS P E AfiRE NAY 85 AI- N -129 NSSS±4-7?-C-S3S9 UNCLSSIFIED F/G...Process representation 3 0. AGSTRAC? (Cal~ N 411 P011110 @do it 0600 01 MMRN& uIV.i eONlm- Regularities in the world give rise to regularities in, the way...sourcc code can wreak suhstantihd havoc. ............---... ... . . . . ........." ’.pa ". --.-. .. n . .’....p a’’. .. ’ .. ’-’..... ’..... 1
Mannoury La Cour, C; Chaput, C; Touzard, M; Millan, M J
2009-02-01
Though transduction mechanisms recruited by heterologously expressed 5-HT(2A) receptors have been extensively studied, their interaction with specific subtypes of G-protein remains to be directly evaluated in cerebral tissue. Herein, as shown by an immunocapture/scintillation proximity analysis, 5-HT, the prototypical 5-HT(2A) agonist, DOI, and Ro60,0175 all enhanced [(35)S]GTPgammaS binding to G alpha q/11 in rat cortex with pEC(50) values of 6.22, 7.24 and 6.35, respectively. No activation of G o or G s/olf was seen at equivalent concentrations of DOI. Stimulation of G alpha q/11 by 5-HT (30 microM) and DOI (30 microM) was abolished by the selective 5-HT(2A) vs. 5-HT(2C)/5-HT(2B) antagonists, ketanserin (pK(B) values of 9.11 and 8.88, respectively) and MDL100,907 (9.82 and 9.68). By contrast, 5-HT-induced [(35)S]GTPgammaS binding to G alpha q/11 was only weakly inhibited by the preferential 5-HT(2C) receptor antagonists, RS102,221 (6.94) and SB242,084 (7.39), and the preferential 5-HT(2B) receptor antagonist, LY266,097 (6.66). The antipsychotic, clozapine, which had marked affinity for 5-HT(2A) receptors, blocked the recruitment of G alpha q/11 by 5-HT and DOI with pK(B) values of 8.54 and 8.14, respectively. Its actions were mimicked by the "atypical" antidepressant and 5-HT(2A) receptor antagonist, mirtazapine, which likewise blocked 5-HT and DOI-induced G alpha q/11 protein activation with pK(B) values of 7.90 and 7.76, respectively. In conclusion, by use of an immunocapture/scintillation proximity strategy, this study shows that native 5-HT(2A) receptors in rat frontal cortex specifically recruit G alpha q/11 and that this action is blocked by clozapine and mirtazapine. Quantification of 5-HT(2A) receptor-mediated G alpha q/11 activation in frontal cortex should prove instructive in characterizing the actions of diverse classes of psychotropic agent. 2008 Wiley-Liss, Inc.
Biotinidase deficiency: Genotype-biochemical phenotype association in Brazilian patients
Borsatto, Taciane; Sperb-Ludwig, Fernanda; Lima, Samyra E.; S. Carvalho, Maria R.; S. Fonseca, Pablo A.; S. Camelo, José; M. Ribeiro, Erlane; F. V. de Medeiros, Paula; M. Lourenço, Charles; F. M. de Souza, Carolina; Boy, Raquel; Félix, Têmis M.; M. Bittar, Camila; L. C. Pinto, Louise; C. Neto, Eurico; J. Blom, Henk; D. Schwartz, Ida V.
2017-01-01
Introduction The association between the BTD genotype and biochemical phenotype [profound biotinidase deficiency (BD), partial BD or heterozygous activity] is not always consistent. This study aimed to investigate the genotype-biochemical phenotype association in patients with low biotinidase activity. Methods All exons, the 5'UTR and the promoter of the BTD gene were sequenced in 72 Brazilian individuals who exhibited low biotinidase activity. For each patient, the expected biochemical phenotype based on the known genotype was compared with the observed biochemical phenotype. Additional non-genetic factors that could affect the biotinidase activity were also analysed. Results Most individuals were identified by neonatal screening (n = 66/72). When consecutive results for the same patient were compared, age, prematurity and neonatal jaundice appeared to affect the level of biotinidase activity. The biochemical phenotype at the time of the second blood collection changed in 11/22 patients compared to results from the first sample. Three novel variants were found: c.1337T>C (p.L446P), c.1466A>G (p.N489S) and c.962G>A (p.W321*). Some patients with the same genotype presented different biochemical phenotypes. The expected and observed biochemical phenotypes agreed in 68.5% of cases (concordant patients). The non-coding variants c.-183G>A, c.-315A>G and c.-514C>T were present in heterozygosis in 5/17 discordant patients. In addition, c.-183G>A and c.-514C>T were also present in 10/37 concordant patients. Conclusions The variants found in the promoter region do not appear to have a strong impact on biotinidase activity. Since there is a disparity between the BTD genotype and biochemical phenotype, and biotinidase activity may be affected by both genetic and non-genetic factors, we suggest that the diagnosis of BD should be based on more than one measurement of plasma biotinidase activity. DNA analysis can be of additional relevance to differentiate between partial BD and heterozygosity. PMID:28498829
Radiation exposure for manned Mars surface missions
NASA Technical Reports Server (NTRS)
Simonsen, Lisa C.; Nealy, John E.; Townsend, Lawrence W.; Wilson, John W.
1990-01-01
The Langley cosmic ray transport code and the Langley nucleon transport code (BRYNTRN) are used to quantify the transport and attenuation of galactic cosmic rays (GCR) and solar proton flares through the Martian atmosphere. Surface doses are estimated using both a low density and a high density carbon dioxide model of the atmosphere which, in the vertical direction, provides a total of 16 g/sq cm and 22 g/sq cm of protection, respectively. At the Mars surface during the solar minimum cycle, a blood-forming organ (BFO) dose equivalent of 10.5 to 12 rem/yr due to galactic cosmic ray transport and attenuation is calculated. Estimates of the BFO dose equivalents which would have been incurred from the three large solar flare events of August 1972, November 1960, and February 1956 are also calculated at the surface. Results indicate surface BFO dose equivalents of approximately 2 to 5, 5 to 7, and 8 to 10 rem per event, respectively. Doses are also estimated at altitudes up to 12 km above the Martian surface where the atmosphere will provide less total protection.
Space radiation dose estimates on the surface of Mars
NASA Technical Reports Server (NTRS)
Simonsen, Lisa C.; Nealy, John E.; Townsend, Lawrence W.; Wilson, John W.
1990-01-01
The Langley cosmic ray transport code and the Langley nucleon transport code (BRYNTRN) are used to quantify the transport and attenuation of galactic cosmic rays (GCR) and solar proton flares through the Martian atmosphere. Surface doses are estimated using both a low density and a high density carbon dioxide model of the atmosphere which, in the vertical direction, provides a total of 16 g/sq cm and 22 g/sq cm of protection, respectively. At the Mars surface during the solar minimum cycle, a blood-forming organ (BFO) dose equivalent of 10.5 to 12 rem/yr due to galactic cosmic ray transport and attenuation is calculated. Estimates of the BFO dose equivalents which would have been incurred from the three large solar flare events of August 1972, November 1960, and February 1956 are also calculated at the surface. Results indicate surface BFO dose equivalents of approximately 2 to 5, 5 to 7, and 8 to 10 rem per event, respectively. Doses are also estimated at altitudes up to 12 km above the Martian surface where the atmosphere will provide less total protection.
de Ambrosis, A; Vishnumohan, S; Paterson, J; Haber, P; Arcot, J
2017-01-01
The aim of the study was to measure the relative bioavailability of labeled pteroylglutamic acid (13C5-PteGlu) from a pectin-coated fortified rice in vivo to measure any effect of the edible coating on folic acid bioavailability. Healthy volunteers (N=26) aged 18-39 years received three test meals in three randomized short-term cross-over trials: Trial 1: aqueous 400 μg 13C5-PteGlu, Trial 2: 200 g cooked white rice+400 μg 13C5-PteGlu,Trial 3: 200 g fortified cooked white rice with pectin-coated premix containing 400 μg 13C5-PteGlu. Blood samples were drawn at 0,1,2,5 and 8 h postprandial. The concentration of 13C5-5 methyl-tetrahydrofolate appearing in plasma was quantified using high performance liquid chromatography-mass spectrometry (MS)/MS. For 24 h before baseline estimation and during the area under the curve (AUC) study, the subjects were placed on a low folate diet (∼100 μg/day). The relative bioavailability of the folic acid following Trial 3 was measured by comparing the 13C5-5 methyl-tetrahydrofuran (THF) AUC with Trials 1 and 2. The bioavailability of folic acid in a pectin-coated rice premix was 68.7% (range 47-105) and 86.5% (range 65-115) in uncoated fortified rice relative to aqueous folic acid. This study is the first demonstration of the bioavailability of folate in pectin-coated fortified rice in humans.
1974-07-31
Multiple scoring regions are permitted and these may be either finite volume regions or point detectors or both. Other sccres of interest, e.g., collision... Multiplicities ...... . . . . 43 2,3.5.2 Photon Production Cross Sections. . 44 2.3.5.3 Anisotropy of Photon Production . . 44 2.3.5.4 Continuous...hepting, count rates, etc., are calculated as functions of energy, time and position. Multiple scoring regions are permitted and these may be either
1980-09-01
K ( 7 ) D , SOAPSTONE ( 1 3 ) E. lNK (5) F. CRAYON OR PAINT STICK (14) G.DYE (1) H . PE N C I L ( 1 ) 1. ELECTRIC ENGRAVING (1) 2. WHO MANUFACTURES...CHALK ( 2 ) D . DYE (1) H, SOAPSTONE (4) 4. W HAT TYPE OF DISPENSING METHOD IS UTILIZED WITH MARKING MATERIALS? A . BALL POINT TUBE ( 1 3 ) H , STEEL...9 ) L, BAMBOO PEN & INK POT F. SOAPSTONE (12) M . OIL PENCIL ( 1 ) G . L A C S T I C K ( 0 ) N . ELECTRI c ENGRAVER (1) 5, ARE STANDARD COLORS
Alteration of the CP/M-86 Operating System.
1981-06-01
28 1. Har Discs, Floppy Discs ............... 28 2. Orgarization of Data ...................... 28 5 3. Interfaces to t-ne Computer...82174--w wnen code inO. data areas are intermixed. Tne nolel c-onsist5 only of a -,Oie g’roup wnI. ! ir turn, is normal.±y a sinzie segment of 64 or...less. Tne operatine s~stem and tne -old start ioamier ire written In Tte Small molel suoports programs wnere tnere is a separate -oie and data eroup
Effect of irradiation on stored vacuum packaged Wiltshire bacon
NASA Astrophysics Data System (ADS)
Dempster, JF; Halls, NA
Wiltshire cured 'middle-cut' bacon (NaCl, 4.87%; 40 mg/kg NO 2; 53 mg/kg NO 3) was boned, sliced and vacuum packaged. It was irradiated (25 kGy: 10 kGy) and stored aerobically (5 0 : 15 0). At weekly intervals the bacon was evaluated bacteriologically and organoleptically (appearance, odour, colour of lean and fat) against unirradiated (control) samples). Results indicated that irradiation (10 kGy) did not permanently inhibit bacterial growth. After initial reductions in count of 0.99 g -1-1(15 0C) and log 3.61 g -1 (5 0C), maximum numbers were reached in 28 days at 15 0C (log 10.32 g -1) and in 35 days at 5 0C (log 8.05 g -1). However viability was significantly affected by 25 kGy irradiation: final numbers reached being log 2.22 g -1 (15 0C) at 35 days and log 3.38 g -1 (5 0C) at 42 days. Appearance and colour (fat and lean) were not significantly impaired by irradiation. However the interaction of storage temperature (5 0 : 15 0C), irradiation (10 kGy: 25 kGy): duration of storage (42 days) and initial count (log 7.24 g -1) had pronounced adverse effects on odour judgements. Evaluation of odour changes in bacon due to irradiation require further investigation. This is especially so since it is often possible to detect odour changes in raw meat after doses as low as 0.5 kGy (Coleby 1959).
Jeong, Hae Jin; Lim, An Suk; Jang, Se Hyeon; Yih, Won Ho; Kang, Nam Seon; Lee, Sung Yeon; Yoo, Yeong Du; Kim, Hyung Seop
2012-01-01
Gambierdiscus spp. are epiphytic, benthic dinoflagellates. Some species have been shown to be toxic and cause ciguatera fish poisoning. We report, for the first time, the occurrence of Gambierdiscus caribaeus isolated from the waters off Jeju Island in Korea. Its morphology was similar to that of the original Belize strains of G. caribaeus. Gambierdiscus caribaeus has been reported in the tropical and subtropical waters of the Pacific, Gulf of Mexico, Caribbean Sea, and Floridian coast. Our report extends its range to the North Pacific Ocean. The plates of the Korean strain were arranged in a Kofoidian series of Po, 3', 7'', 6c, 6s, 5''', 1p, and 2'''', morphologically closer to other strains of G. caribaeus than to G. carpenteri. When properly aligned, its small subunit (SSU) rDNA was 0.5% different from those of Gambierdiscus sp. C-1, a strain that was isolated from the waters off eastern Japan, but was 2.4-4.0% different from those of the NOAA strains of G. caribaeus and 3.1-3.4% different from those of the NOAA strains of G. carpenteri. Additionally, the D1-D3 large subunit (LSU) rDNA sequence of the Korean strain of G. caribaeus was 4.7-5.3% different from those of the NOAA strains of G. caribaeus and 7.1-7.5% different from those of all reported G. carpenteri strains, including the NOAA strains. In phylogenetic trees based on SSU and LSU rDNA sequences, our Korean strain was basal to the clade consisting of the NOAA strains of G. caribaeus, which in turn was sister clade to all reported G. carpenteri strains. © 2012 The Author(s) Journal of Eukaryotic Microbiology © 2012 International Society of Protistologists.
The complete mitochondrial genome of the bagarius yarrelli from honghe river
NASA Astrophysics Data System (ADS)
Du, M.; Zhou, C. J.; Niu, B. Z.; Liu, Y. H.; Li, N.; Ai, J. L.; Xu, G. L.
2016-08-01
The total length of mitochondrial DNA sequence of the Bagarius yarrelli from the Honghe river of China is determined in this paper. The total length of the circular molecule is 16524 base pair which denoted a similar gene order to that of the other bony fishes, which include a non-coding control region, a replicated origin, two ribosome RNA (rRNA) genes, 22 transfer RNA (tRNA) genes as well as 13 protein-coding genes. Its whole base constitution is 31.4% for A, 26.9% for C, 15.7% for G and 26.0% for T, with an A+T bias of 57.4%. Those mitochondrial data would contribute to further study molecular evolution and population genetics of this species.
Earth and Planetary Science Letters
NASA Technical Reports Server (NTRS)
Nishiizumi, K.; Klein, J.; Middleton, R.; Masarik, J.; Reedy, R. C.; Arnold, J. R.; Fink, D.
1997-01-01
Systematic measurements of the concentrations of cosmogen Ca-41 (half-life = 1.04 x 10(exp 5) yr) in the Apollo 15 long core 15001-15006 were performed by accelerator mass spectroscopy. Earlier measurements of cosmogenic Be-10, C-14, Al-26, Cl-36, and Mn-53 in the same core have provided confirmation and improvement of theoretical models for predicting production profiles of nuclides by cosmic ray induced spallation in the Moon and large meteorites. Unlike these nuclides, Ca-40 in the lunar surface is produced mainly by thermal neutron capture reactions on Ca-40. The maximum production of Ca-41, about 1 dpm/g Ca, was observed at a depth in the Moon of about 150 g/sq cm. For depths below about 300 g/sq cm, Ca-41 production falls off exponentially with an e-folding length of 175 g/sq cm. Neutron production in the Moon was modeled with the Los Alamos High Energy Transport Code System, and yields of nuclei produced by low-energy thermal and epithermal neutrons were calculated with the Monte Carlo N-Particle code. The new theoretical calculations using these codes are in good agreement with our measured Ca-41 concentrations as well as with Co-60 and direct neutron fluence measurements in the Moon.
Subbanding, Charge Transport and Related Applications in Semiconductor Devices.
1977-10-01
3 1) .7., -, ŝ .2 437. 9 7 54.2 •0 373" 11 C 15 12E. 10 .G 4. Vi ? c .11,5i.. 2 - 9 t,5.5 . 1 05 11 .752;’L 10 .3)- 10 .11 4 10 .- ,:C2 9 7...1,- 4 -72. 53,* 7 3-5 71. 1u 3 o6.L13 2 .77d 333. ’.id 471. :j J 7. VI 1.8 71.793 05.566 199.991 335-027 470.315 o05 .753 .2. 1 72.560 o5. 029 199...6;7 ;20430E 2 .20430E 2 ;23430E 2 .20433E 2 .20430! 2 VI ;20430E 2 ;20430E 2 ;20430E 2 ;20433E 2 -20430! 2 9;8 ;20430E 2 ;20430E 2 ;20430E 2 .20430E 2
Elgemeie, Galal H; El-Naggar, Dina H
2018-05-03
A novel method for preparation of a new class of dihydropyridine thioglycosides and their corresponding dehydrogenated forms, via reaction of piperidinium salts of dihydropyridinethiones with 2,3,4,6-tetra-O-acetyl-α-D-gluco- and galactopyranosyl bromides has been studied. The evaluation of antiproliferative activity against HepG-2 cell lines (liver carcinoma cell lines) of the dihydropyridine thioglycosides and pyridine thioglycosides revealed that many of the thioglycosides have interesting antitumor activities specifically 5c, 5g, 5l, 5o, 5p, 7a, 7i, 7p, 8b, 8f, 8s, and 8v.
Wang, Aishuai; Sun, Yuena; Wu, Changwen
2016-11-01
The complete mitochondrial genome of the Cheilodactylus quadricornis was firstly determined in the present study. The mitochondrial genome of C. quadricornis is 16 521 nucleotides, comprising 13 protein-coding genes and 2 ribosomal RNA genes, 22 tRNA genes and 2 main non-coding regions (the control region and the origin of the light-strand replication). The overall base composition was T, 26.3%; C, 29.6%; A, 27.8% and G, 16.3%. The gene arrangement, base composition, and tRNA structures of the complete mitochondrial genome of C. quadricornis is similar to other teleosts. Only two central conserved sequence blocks (CSB-2 and CSB-3) were identified in the control region. In addition, the conserved motif 5'-GCCGG-3' was identified in the origin of light-strand replication of C. quadricornis. The complete mitochondrial genome of C. quadricornis was used to construct phylogenetic tree, which shows that C. quadricornis and C. variegatus clustered in a clade and formed a sister relationship. This mitogenome sequence data would play an important role in population genetics and phylogenetic analysis of the Cheilodactylidae.
2006-12-01
COL Timothy A Mitchener, DC USA 5e. TASK NUMBER 6. AUTHOR( S ) 5f. WORK UNIT NUMBER 7. PERFORMING ORGANIZATION NAME( S ) AND ADDRESS(ES) 8...SPONSORING/MONITORING AGENCY NAME( S ) AND 10. SPONSOR/MONITOR’S ACRONYM( S ) ADDRESS(ES) 11. SPONSOR/MONITOR’S REPORT NUMBER( S ) 12. DISTRIBUTION/AVAILABILITY...NATO) Standardization Agreement (STANAG), 5th edition, coding scheme. (See P.J. Amoroso, G.S. Smith, and N.S. Bell : Qualitative assessment of cause
2015-01-01
1,3-Butadiene (BD) is an environmental and occupational toxicant classified as a human carcinogen. It is oxidized by cytochrome P450 monooxygenases to 1,2-epoxy-3-butene (EB), which alkylates DNA. BD exposures lead to large numbers of mutations at A:T base pairs even though alkylation of guanines is more prevalent, suggesting that one or more adenine adducts of BD play a role in BD-mediated genotoxicity. However, the etiology of BD-mediated genotoxicity at adenine remains poorly understood. EB alkylates the N6 exocyclic nitrogen of adenine to form N6-(hydroxy-3-buten-1-yl)-2′-dA ((2S)-N6-HB-dA) adducts (TretyakovaN., LinY., SangaiahR., UptonP. B., and SwenbergJ. A. (1997) Carcinogenesis18, 137−1479054600). The structure of the (2S)-N6-HB-dA adduct has been determined in the 5′-d(C1G2G3A4C5Y6A7G8A9A10G11)-3′:5′-d(C12T13T14C15T16T17G18T19 C20C21G22)-3′ duplex [Y = (2S)-N6-HB-dA] containing codon 61 (underlined) of the human N-ras protooncogene, from NMR spectroscopy. The (2S)-N6-HB-dA adduct was positioned in the major groove, such that the butadiene moiety was oriented in the 3′ direction. At the Cα carbon, the methylene protons of the modified nucleobase Y6 faced the 5′ direction, which placed the Cβ carbon in the 3′ direction. The Cβ hydroxyl group faced toward the solvent, as did carbons Cγ and Cδ. The Cβ hydroxyl group did not form hydrogen bonds with either T16O4 or T17O4. The (2S)-N6-HB-dA nucleoside maintained the anti conformation about the glycosyl bond, and the modified base retained Watson–Crick base pairing with the complementary base (T17). The adduct perturbed stacking interactions at base pairs C5:G18, Y6:T17, and A7:T16 such that the Y6 base did not stack with its 5′ neighbor C5, but it did with its 3′ neighbor A7. The complementary thymine T17 stacked well with both 5′ and 3′ neighbors T16 and G18. The presence of the (2S)-N6-HB-dA resulted in a 5 °C reduction in the Tm of the duplex, which is attributed to less favorable stacking interactions and adduct accommodation in the major groove. PMID:25238403
Experimental Constraints on a Dark Matter Origin for the DAMA Annual Modulation Effect
DOE Office of Scientific and Technical Information (OSTI.GOV)
Aalseth, Craig E.; Barbeau, Phil; Cerdeno, D. G.
2008-12-17
Abstract Follows: C. E. Aalseth,1 P. S. Barbeau,2 D. G. Cerdeño,3 J. Colaresi,4 J. I. Collar,2 P. de Lurgio,5 G. Drake,5 J. E. Fast,1 C. H. Greenberg,2 T. W. Hossbach,1 J. D. Kephart,1 M. G. Marino,7 H. S. Miley,1 J. L. Orrell,1 D. Reyna,6 R. G. H. Robertson,7 R. L. Talaga,5 O. Tench,4 T. D. Van Wechel,7 J. F. Wilkerson,7 and K. M. Yocum4 (CoGeNT Collaboration) 1Pacific Northwest National Laboratory, Richland, Washington 99352, USA 2Kavli Institute for Cosmological Physics and Enrico Fermi Institute, University of Chicago, Chicago, Illinois 60637, USA 3Departamento de Física Teórica C-XI & Instituto de Física Teóricamore » UAM-CSIC, Universidad Autónoma de Madrid, Cantoblanco, E-28049 Madrid, Spain 4CANBERRA Industries, Meriden, Connecticut 06450, USA 5Argonne National Laboratory, Argonne, Illinois 60439, USA 6Sandia National Laboratories, Livermore, California 94550, USA 7Center for Experimental Nuclear Physics and Astrophysics, and Department of Physics, University of Washington, Seattle, Washington 98195, USA Received 7 July 2008; revised 6 August 2008; published 17 December 2008 A claim for evidence of dark matter interactions in the DAMA experiment has been recently reinforced. We employ a new type of germanium detector to conclusively rule out a standard isothermal galactic halo of weakly interacting massive particles as the explanation for the annual modulation effect leading to the claim. Bounds are similarly imposed on a suggestion that dark pseudoscalars might lead to the effect. We describe the sensitivity to light dark matter particles achievable with our device, in particular, to next-to-minimal supersymmetric model candidates.« less
Performance Analysis of Hybrid ARQ Protocols in a Slotted Code Division Multiple-Access Network
1989-08-01
Convolutional Codes . in Proc Int. Conf. Commun., 21.4.1-21.4.5, 1987. [27] J. Hagenauer. Rate Compatible Punctured Convolutional Codes . in Proc Int. Conf...achieved by using a low rate (r = 0.5), high constraint length (e.g., 32) punctured convolutional code . Code puncturing provides for a variable rate code ...investigated the use of convolutional codes in Type II Hybrid ARQ protocols. The error
Chen, J; Chen, J; Adams, M J
2001-01-01
A universal primer (Sprimer: 5'-GGX AAY AAY AGY GGX CAZ CC-3', X = A, G, C or T; Y = T or C; Z = A or G), designed from the consensus sequences that code for the conserved sequence GNNSGQP in the NIb region of members of the family Potyviridae, was used to amplify by RT-PCR the 3'-terminal genome regions from infected plant samples representing 21 different viruses in the family. Sequencing of some of the fragments (c. 1.7 kb) showed that the type strain (ATTC PV-107) of Oat necrotic mottle virus is not a distinct species in the genus Rymovirus, but is synonymous with Brome streak mosaic virus (genus Tritimovirus) and that Celery mosaic virus is a distinct member of the genus Potyvirus not closely related to any other sequenced species. Potyviruses infecting crops in China were also investigated, showing that viruses on cowpea and maize in Hangzhou, Zhejiang province were respectively Bean common mosaic virus and Sugarcane mosaic virus and that one on garlic in Nanjing, Jiangsu province was Onion yellow dwarf virus. Fragments were also sequenced from Chinese isolates of Lettuce mosaic virus and Soybean mosaic virus (from Hangzhou), Turnip mosaic virus (2 different isolates from Zhejiang province) and RNA1 of Wheat yellow mosaic virus (from Rongcheng, Shandong province).
Mömke, Stefanie; Sickinger, Marlene; Rehage, Jürgen; Doll, Klaus; Distl, Ottmar
2012-01-01
Left-sided displacement of the abomasum (LDA) is a common disease in many dairy cattle breeds. A genome-wide screen for QTL for LDA in German Holstein (GH) cows indicated motilin (MLN) as a candidate gene on bovine chromosome 23. Genomic DNA sequence analysis of MLN revealed a total of 32 polymorphisms. All informative polymorphisms used for association analyses in a random sample of 1,136 GH cows confirmed MLN as a candidate for LDA. A single nucleotide polymorphism (FN298674:g.90T>C) located within the first non-coding exon of bovine MLN affects a NKX2-5 transcription factor binding site and showed significant associations (ORallele = 0.64; −log10Pallele = 6.8, −log10Pgenotype = 7.0) with LDA. An expression study gave evidence of a significantly decreased MLN expression in cows carrying the mutant allele (C). In individuals heterozygous or homozygous for the mutation, MLN expression was decreased by 89% relative to the wildtype. FN298674:g.90T>C may therefore play a role in bovine LDA via the motility of the abomasum. This MLN SNP appears useful to reduce the incidence of LDA in German Holstein cattle and provides a first step towards a deeper understanding of the genetics of LDA. PMID:22536407
36 CFR 1194.22 - Web-based intranet and internet information and applications.
Code of Federal Regulations, 2011 CFR
2011-07-01
... the presentation. (c) Web pages shall be designed so that all information conveyed with color is also...-side image maps except where the regions cannot be defined with an available geometric shape. (g) Row... (b) 1.4 (c) 2.1 (d) 6.1 (e) 1.2 (f) 9.1 (g) 5.1 (h) 5.2 (i) 12.1 (j) 7.1 (k) 11.4 2. Paragraphs (l...
36 CFR 1194.22 - Web-based intranet and internet information and applications.
Code of Federal Regulations, 2010 CFR
2010-07-01
... the presentation. (c) Web pages shall be designed so that all information conveyed with color is also...-side image maps except where the regions cannot be defined with an available geometric shape. (g) Row... (b) 1.4 (c) 2.1 (d) 6.1 (e) 1.2 (f) 9.1 (g) 5.1 (h) 5.2 (i) 12.1 (j) 7.1 (k) 11.4 2. Paragraphs (l...
Nguyen, Hoang Phong; Du Le, Hoang
2015-01-01
Summary The yeast cells of Saccharomyces cerevisiae immobilized on Nypa fruticans leaf sheath pieces were tested for ethanol tolerance (0, 23.7, 47.4, 71.0 and 94.7 g/L). Increase in the initial ethanol concentration from 23.7 to 94.7 g/L decreased the average growth rate and concentration of ethanol produced by the immobilized yeast by 5.2 and 4.1 times, respectively. However, in the medium with initial ethanol concentration of 94.7 g/L, the average growth rate, glucose uptake rate and ethanol formation rate of the immobilized yeast were 3.7, 2.5 and 3.5 times, respectively, higher than those of the free yeast. The ethanol stress inhibited ethanol formation by Saccharomyces cerevisiae cells and the yeast responded to the stress by changing the fatty acid composition of cellular membrane. The adsorption of yeast cells on Nypa fruticans leaf sheath pieces of the growth medium increased the saturated fatty acid (C16:0 and C18:0) mass fraction in the cellular membrane and that improved alcoholic fermentation performance of the immobilized yeast. PMID:27904338
Climate tools in mainstream Linux distributions
NASA Astrophysics Data System (ADS)
McKinstry, Alastair
2015-04-01
Debian/meterology is a project to integrate climate tools and analysis software into the mainstream Debian/Ubuntu Linux distributions. This work describes lessons learnt, and recommends practices for scientific software to be adopted and maintained in OS distributions. In addition to standard analysis tools (cdo,, grads, ferret, metview, ncl, etc.), software used by the Earth System Grid Federation was chosen for integraion, to enable ESGF portals to be built on this base; however exposing scientific codes via web APIs enables security weaknesses, normally ignorable, to be exposed. How tools are hardened, and what changes are required to handle security upgrades, are described. Secondly, to enable libraries and components (e.g. Python modules) to be integrated requires planning by writers: it is not sufficient to assume users can upgrade their code when you make incompatible changes. Here, practices are recommended to enable upgrades and co-installability of C, C++, Fortran and Python codes. Finally, software packages such as NetCDF and HDF5 can be built in multiple configurations. Tools may then expect incompatible versions of these libraries (e.g. serial and parallel) to be simultaneously available; how this was solved in Debian using "pkg-config" and shared library interfaces is described, and best practices for software writers to enable this are summarised.
Validity of the coding for herpes simplex encephalitis in the Danish National Patient Registry
Jørgensen, Laura Krogh; Dalgaard, Lars Skov; Østergaard, Lars Jørgen; Andersen, Nanna Skaarup; Nørgaard, Mette; Mogensen, Trine Hyrup
2016-01-01
Background Large health care databases are a valuable source of infectious disease epidemiology if diagnoses are valid. The aim of this study was to investigate the accuracy of the recorded diagnosis coding of herpes simplex encephalitis (HSE) in the Danish National Patient Registry (DNPR). Methods The DNPR was used to identify all hospitalized patients, aged ≥15 years, with a first-time diagnosis of HSE according to the International Classification of Diseases, tenth revision (ICD-10), from 2004 to 2014. To validate the coding of HSE, we collected data from the Danish Microbiology Database, from departments of clinical microbiology, and from patient medical records. Cases were classified as confirmed, probable, or no evidence of HSE. We estimated the positive predictive value (PPV) of the HSE diagnosis coding stratified by diagnosis type, study period, and department type. Furthermore, we estimated the proportion of HSE cases coded with nonspecific ICD-10 codes of viral encephalitis and also the sensitivity of the HSE diagnosis coding. Results We were able to validate 398 (94.3%) of the 422 HSE diagnoses identified via the DNPR. Hereof, 202 (50.8%) were classified as confirmed cases and 29 (7.3%) as probable cases providing an overall PPV of 58.0% (95% confidence interval [CI]: 53.0–62.9). For “Encephalitis due to herpes simplex virus” (ICD-10 code B00.4), the PPV was 56.6% (95% CI: 51.1–62.0). Similarly, the PPV for “Meningoencephalitis due to herpes simplex virus” (ICD-10 code B00.4A) was 56.8% (95% CI: 39.5–72.9). “Herpes viral encephalitis” (ICD-10 code G05.1E) had a PPV of 75.9% (95% CI: 56.5–89.7), thereby representing the highest PPV. The estimated sensitivity was 95.5%. Conclusion The PPVs of the ICD-10 diagnosis coding for adult HSE in the DNPR were relatively low. Hence, the DNPR should be used with caution when studying patients with encephalitis caused by herpes simplex virus. PMID:27330328
Coding and non-coding gene regulatory networks underlie the immune response in liver cirrhosis.
Gao, Bo; Zhang, Xueming; Huang, Yongming; Yang, Zhengpeng; Zhang, Yuguo; Zhang, Weihui; Gao, Zu-Hua; Xue, Dongbo
2017-01-01
Liver cirrhosis is recognized as being the consequence of immune-mediated hepatocyte damage and repair processes. However, the regulation of these immune responses underlying liver cirrhosis has not been elucidated. In this study, we used GEO datasets and bioinformatics methods to established coding and non-coding gene regulatory networks including transcription factor-/lncRNA-microRNA-mRNA, and competing endogenous RNA interaction networks. Our results identified 2224 mRNAs, 70 lncRNAs and 46 microRNAs were differentially expressed in liver cirrhosis. The transcription factor -/lncRNA- microRNA-mRNA network we uncovered that results in immune-mediated liver cirrhosis is comprised of 5 core microRNAs (e.g., miR-203; miR-219-5p), 3 transcription factors (i.e., FOXP3, ETS1 and FOS) and 7 lncRNAs (e.g., ENTS00000671336, ENST00000575137). The competing endogenous RNA interaction network we identified includes a complex immune response regulatory subnetwork that controls the entire liver cirrhosis network. Additionally, we found 10 overlapping GO terms shared by both liver cirrhosis and hepatocellular carcinoma including "immune response" as well. Interestingly, the overlapping differentially expressed genes in liver cirrhosis and hepatocellular carcinoma were enriched in immune response-related functional terms. In summary, a complex gene regulatory network underlying immune response processes may play an important role in the development and progression of liver cirrhosis, and its development into hepatocellular carcinoma.
Scopolin-hydrolyzing beta-glucosidases in roots of Arabidopsis.
Ahn, Young Ock; Shimizu, Bun-ichi; Sakata, Kanzo; Gantulga, Dashzeveg; Zhou, Changhe; Zhou, Zhanghe; Bevan, David R; Esen, Asim
2010-01-01
Three beta-glucosidases (At1g66270-BGLU21, At1g66280-BGLU22, and At3g09260-BGLU23) were purified from the roots of Arabidopsis and their cDNAs were expressed in insect cells. In addition, two beta-glucosidase binding protein cDNAs (At3g16420; PBPI and At3g16430; PBPII) were expressed in Escherichia coli and their protein products purified. These binding proteins interact with beta-glucosidases and activate them. BGLU21, 22 and 23 hydrolyzed the natural substrate scopolin specifically and also hydrolyzed to some extent substrates whose aglycone moiety is similar to scopolin (e.g. esculin and 4-MU-glucoside). In contrast, they hydrolyzed poorly DIMBOA-glucoside and did not hydrolyze pNP- and oNP-glucosides. We determined the physicochemical properties of native and recombinant BGLUs, and found no differences between them. They were stable in a narrow pH range (5-7.5) and had temperature and pH optima for activity at 35 degrees C and pH 5.5, respectively. As for thermostability, >95% of their activity was retained at 40 degrees C but dramatically decreased at >50 degrees C. The apparent K(m) of native and recombinant enzymes for scopolin was 0.73 and 0.81 mM, respectively, and it was 5.8 and 9.7 mM, respectively, for esculin. Western blot analysis showed that all three enzymes were exclusively expressed in roots of seedlings but not in any other plant part or organ under normal conditions. Furthermore, spatial expression patterns of all eight genes belonging to subfamily 3 were investigated at the transcription level by RT-PCR.
Christiansen, L. N.; Johnston, R. W.; Kautter, D. A.; Howard, J. W.; Aunan, W. J.
1973-01-01
Comminuted ham was formulated with different levels of sodium nitrite and nitrate, inoculated with Clostridium botulinum, and pasteurized to an internal temperature of 68.5 C. When added to the meat, nitrite concentrations decreased, and cooking had little effect on them. Nitrite concentrations decreased more rapidly during storage at 27 than at 7 C; however they remained rather constant at formulated levels throughout the experiment at both incubation temperatures. The level of nitrite added to the meat greatly influenced growth and toxin production of C. botulinum. The concentration of nitrite necessary to effect complete inhibition was dependent on the inoculum level. With 90 C. botulinum spores/g of meat, botulinum toxin developed in samples formulated with 150 but not with 200 μg of nitrite per g of meat. At a spore level of 5,000/g, toxin was detected in samples with 400 but not with 500 μg of nitrite per g of the product incubated at 27 C. At lower concentrations of nitrite, growth was retarded at both spore levels. No toxin developed in samples incubated at 7 C. Nitrate showed a statistically significant inhibitory effect at a given nitrite level; however, the effect was insufficient to be of practical value. Analyses for 14 volatile nitrosamines from samples made with varying levels of nitrite and nitrate were negative at a detection level of 0.01 μg of nitrite or nitrate per g of meat. PMID:4572891
Maurya, Mano Ram; Subramaniam, Shankar
2007-01-01
This article addresses how quantitative models such as the one proposed in the companion article can be used to study cellular network perturbations such as knockdowns and pharmacological perturbations in a predictive manner. Using the kinetic model for cytosolic calcium dynamics in RAW 264.7 cells developed in the companion article, the calcium response to complement 5a (C5a) for the knockdown of seven proteins (C5a receptor; G-β-2; G-α,i-2,3; regulator of G-protein signaling-10; G-protein coupled receptor kinase-2; phospholipase C β-3; arrestin) is predicted and validated against the data from the Alliance for Cellular Signaling. The knockdown responses provide insights into how altered expressions of important proteins in disease states result in intermediate measurable phenotypes. Long-term response and long-term dose response have also been predicted, providing insights into how the receptor desensitization, internalization, and recycle result in tolerance. Sensitivity analysis of long-term response shows that the mechanisms and parameters in the receptor recycle path are important for long-term calcium dynamics. PMID:17483189
PALB2, CHEK2 and ATM rare variants and cancer risk: data from COGS
Southey, Melissa C; Goldgar, David E; Winqvist, Robert; Pylkäs, Katri; Couch, Fergus; Tischkowitz, Marc; Foulkes, William D; Dennis, Joe; Michailidou, Kyriaki; van Rensburg, Elizabeth J; Heikkinen, Tuomas; Nevanlinna, Heli; Hopper, John L; Dörk, Thilo; Claes, Kathleen BM; Reis-Filho, Jorge; Teo, Zhi Ling; Radice, Paolo; Catucci, Irene; Peterlongo, Paolo; Tsimiklis, Helen; Odefrey, Fabrice A; Dowty, James G; Schmidt, Marjanka K; Broeks, Annegien; Hogervorst, Frans B; Verhoef, Senno; Carpenter, Jane; Clarke, Christine; Scott, Rodney J; Fasching, Peter A; Haeberle, Lothar; Ekici, Arif B; Beckmann, Matthias W; Peto, Julian; dos-Santos-Silva, Isabel; Fletcher, Olivia; Johnson, Nichola; Bolla, Manjeet K; Sawyer, Elinor J; Tomlinson, Ian; Kerin, Michael J; Miller, Nicola; Marme, Federik; Burwinkel, Barbara; Yang, Rongxi; Guénel, Pascal; Truong, Thérèse; Menegaux, Florence; Sanchez, Marie; Bojesen, Stig; Nielsen, Sune F; Flyger, Henrik; Benitez, Javier; Zamora, M Pilar; Perez, Jose Ignacio Arias; Menéndez, Primitiva; Anton-Culver, Hoda; Neuhausen, Susan; Ziogas, Argyrios; Clarke, Christina A; Brenner, Hermann; Arndt, Volker; Stegmaier, Christa; Brauch, Hiltrud; Brüning, Thomas; Ko, Yon-Dschun; Muranen, Taru A; Aittomäki, Kristiina; Blomqvist, Carl; Bogdanova, Natalia V; Antonenkova, Natalia N; Lindblom, Annika; Margolin, Sara; Mannermaa, Arto; Kataja, Vesa; Kosma, Veli-Matti; Hartikainen, Jaana M; Spurdle, Amanda B; Investigators, kConFab; Wauters, Els; Smeets, Dominiek; Beuselinck, Benoit; Floris, Giuseppe; Chang-Claude, Jenny; Rudolph, Anja; Seibold, Petra; Flesch-Janys, Dieter; Olson, Janet E; Vachon, Celine; Pankratz, Vernon S; McLean, Catriona; Haiman, Christopher A; Henderson, Brian E; Schumacher, Fredrick; Le Marchand, Loic; Kristensen, Vessela; Alnæs, Grethe Grenaker; Zheng, Wei; Hunter, David J; Lindstrom, Sara; Hankinson, Susan E; Kraft, Peter; Andrulis, Irene; Knight, Julia A; Glendon, Gord; Mulligan, Anna Marie; Jukkola-Vuorinen, Arja; Grip, Mervi; Kauppila, Saila; Devilee, Peter; Tollenaar, Robert A E M; Seynaeve, Caroline; Hollestelle, Antoinette; Garcia-Closas, Montserrat; Figueroa, Jonine; Chanock, Stephen J; Lissowska, Jolanta; Czene, Kamila; Darabi, Hatef; Eriksson, Mikael; Eccles, Diana M; Rafiq, Sajjad; Tapper, William J; Gerty, Sue M; Hooning, Maartje J; Martens, John W M; Collée, J Margriet; Tilanus-Linthorst, Madeleine; Hall, Per; Li, Jingmei; Brand, Judith S; Humphreys, Keith; Cox, Angela; Reed, Malcolm W R; Luccarini, Craig; Baynes, Caroline; Dunning, Alison M; Hamann, Ute; Torres, Diana; Ulmer, Hans Ulrich; Rüdiger, Thomas; Jakubowska, Anna; Lubinski, Jan; Jaworska, Katarzyna; Durda, Katarzyna; Slager, Susan; Toland, Amanda E; Ambrosone, Christine B; Yannoukakos, Drakoulis; Swerdlow, Anthony; Ashworth, Alan; Orr, Nick; Jones, Michael; González-Neira, Anna; Pita, Guillermo; Alonso, M Rosario; Álvarez, Nuria; Herrero, Daniel; Tessier, Daniel C; Vincent, Daniel; Bacot, Francois; Simard, Jacques; Dumont, Martine; Soucy, Penny; Eeles, Rosalind; Muir, Kenneth; Wiklund, Fredrik; Gronberg, Henrik; Schleutker, Johanna; Nordestgaard, Børge G; Weischer, Maren; Travis, Ruth C; Neal, David; Donovan, Jenny L; Hamdy, Freddie C; Khaw, Kay-Tee; Stanford, Janet L; Blot, William J; Thibodeau, Stephen; Schaid, Daniel J; Kelley, Joseph L; Maier, Christiane; Kibel, Adam S; Cybulski, Cezary; Cannon-Albright, Lisa; Butterbach, Katja; Park, Jong; Kaneva, Radka; Batra, Jyotsna; Teixeira, Manuel R; Kote-Jarai, Zsofia; Olama, Ali Amin Al; Benlloch, Sara; Renner, Stefan P; Hartmann, Arndt; Hein, Alexander; Ruebner, Matthias; Lambrechts, Diether; Van Nieuwenhuysen, Els; Vergote, Ignace; Lambretchs, Sandrina; Doherty, Jennifer A; Rossing, Mary Anne; Nickels, Stefan; Eilber, Ursula; Wang-Gohrke, Shan; Odunsi, Kunle; Sucheston-Campbell, Lara E; Friel, Grace; Lurie, Galina; Killeen, Jeffrey L; Wilkens, Lynne R; Goodman, Marc T; Runnebaum, Ingo; Hillemanns, Peter A; Pelttari, Liisa M; Butzow, Ralf; Modugno, Francesmary; Edwards, Robert P; Ness, Roberta B; Moysich, Kirsten B; du Bois, Andreas; Heitz, Florian; Harter, Philipp; Kommoss, Stefan; Karlan, Beth Y; Walsh, Christine; Lester, Jenny; Jensen, Allan; Kjaer, Susanne Krüger; Høgdall, Estrid; Peissel, Bernard; Bonanni, Bernardo; Bernard, Loris; Goode, Ellen L; Fridley, Brooke L; Vierkant, Robert A; Cunningham, Julie M; Larson, Melissa C; Fogarty, Zachary C; Kalli, Kimberly R; Liang, Dong; Lu, Karen H; Hildebrandt, Michelle A T; Wu, Xifeng; Levine, Douglas A; Dao, Fanny; Bisogna, Maria; Berchuck, Andrew; Iversen, Edwin S; Marks, Jeffrey R; Akushevich, Lucy; Cramer, Daniel W; Schildkraut, Joellen; Terry, Kathryn L; Poole, Elizabeth M; Stampfer, Meir; Tworoger, Shelley S; Bandera, Elisa V; Orlow, Irene; Olson, Sara H; Bjorge, Line; Salvesen, Helga B; van Altena, Anne M; Aben, Katja K H; Kiemeney, Lambertus A; Massuger, Leon F A G; Pejovic, Tanja; Bean, Yukie; Brooks-Wilson, Angela; Kelemen, Linda E; Cook, Linda S; Le, Nhu D; Górski, Bohdan; Gronwald, Jacek; Menkiszak, Janusz; Høgdall, Claus K; Lundvall, Lene; Nedergaard, Lotte; Engelholm, Svend Aage; Dicks, Ed; Tyrer, Jonathan; Campbell, Ian; McNeish, Iain; Paul, James; Siddiqui, Nadeem; Glasspool, Rosalind; Whittemore, Alice S; Rothstein, Joseph H; McGuire, Valerie; Sieh, Weiva; Cai, Hui; Shu, Xiao-Ou; Teten, Rachel T; Sutphen, Rebecca; McLaughlin, John R; Narod, Steven A; Phelan, Catherine M; Monteiro, Alvaro N; Fenstermacher, David; Lin, Hui-Yi; Permuth, Jennifer B; Sellers, Thomas A; Chen, Y Ann; Tsai, Ya-Yu; Chen, Zhihua; Gentry-Maharaj, Aleksandra; Gayther, Simon A; Ramus, Susan J; Menon, Usha; Wu, Anna H; Pearce, Celeste L; Van Den Berg, David; Pike, Malcolm C; Dansonka-Mieszkowska, Agnieszka; Plisiecka-Halasa, Joanna; Moes-Sosnowska, Joanna; Kupryjanczyk, Jolanta; Pharoah, Paul DP; Song, Honglin; Winship, Ingrid; Chenevix-Trench, Georgia; Giles, Graham G; Tavtigian, Sean V; Easton, Doug F; Milne, Roger L
2016-01-01
Background The rarity of mutations in PALB2, CHEK2 and ATM make it difficult to estimate precisely associated cancer risks. Population-based family studies have provided evidence that at least some of these mutations are associated with breast cancer risk as high as those associated with rare BRCA2 mutations. We aimed to estimate the relative risks associated with specific rare variants in PALB2, CHEK2 and ATM via a multicentre case-control study. Methods We genotyped 10 rare mutations using the custom iCOGS array: PALB2 c.1592delT, c.2816T>G and c.3113G>A, CHEK2 c.349A>G, c.538C>T, c.715G>A, c.1036C>T, c.1312G>T, and c.1343T>G and ATM c.7271T>G. We assessed associations with breast cancer risk (42 671 cases and 42 164 controls), as well as prostate (22 301 cases and 22 320 controls) and ovarian (14 542 cases and 23 491 controls) cancer risk, for each variant. Results For European women, strong evidence of association with breast cancer risk was observed for PALB2 c.1592delT OR 3.44 (95% CI 1.39 to 8.52, p=7.1×10−5), PALB2 c.3113G>A OR 4.21 (95% CI 1.84 to 9.60, p=6.9×10−8) and ATM c.7271T>G OR 11.0 (95% CI 1.42 to 85.7, p=0.0012). We also found evidence of association with breast cancer risk for three variants in CHEK2, c.349A>G OR 2.26 (95% CI 1.29 to 3.95), c.1036C>T OR 5.06 (95% CI 1.09 to 23.5) and c.538C>T OR 1.33 (95% CI 1.05 to 1.67) (p≤0.017). Evidence for prostate cancer risk was observed for CHEK2 c.1343T>G OR 3.03 (95% CI 1.53 to 6.03, p=0.0006) for African men and CHEK2 c.1312G>T OR 2.21 (95% CI 1.06 to 4.63, p=0.030) for European men. No evidence of association with ovarian cancer was found for any of these variants. Conclusions This report adds to accumulating evidence that at least some variants in these genes are associated with an increased risk of breast cancer that is clinically important. PMID:27595995
An Architecture for Coexistence with Multiple Users in Frequency Hopping Cognitive Radio Networks
2013-03-01
the base WARP system, a custom IP core written in VHDL , and the Virtex IV’s embedded PowerPC core with C code to implement the radio and hopset...shown in Appendix C as Figure C.2. All VHDL code necessary to implement this IP core is included in Appendix G. 69 Figure 3.19: FPGA bus structure...subsystem functionality. A total of 1,430 lines of VHDL code were implemented for this research. 1 library ieee; 2 use ieee.std logic 1164.all; 3 use
Cao, Jianliang; Qin, Cong; Wang, Yan; Zhang, Bo; Gong, Yuxiao; Zhang, Huoli; Sun, Guang; Bala, Hari; Zhang, Zhanying
2017-01-01
The SnO2/g-C3N4 composites were synthesized via a facile calcination method by using SnCl4·5H2O and urea as the precursor. The structure and morphology of the as-synthesized composites were characterized by the techniques of X-ray diffraction (XRD), the field-emission scanning electron microscopy and transmission electron microscopy (SEM and TEM), energy dispersive spectrometry (EDS), thermal gravity and differential thermal analysis (TG-DTA), and N2-sorption. The analysis results indicated that the as-synthesized samples possess the two dimensional structure. Additionally, the SnO2 nanoparticles were highly dispersed on the surface of the g-C3N4nanosheets. The gas-sensing performance of the as-synthesized composites for different gases was tested. Moreover, the composite with 7 wt % g-C3N4 content (SnO2/g-C3N4-7) SnO2/g-C3N4-7 exhibits an admirable gas-sensing property to ethanol, which possesses a higher response and better selectivity than that of the pure SnO2-based sensor. The high surface area of the SnO2/g-C3N4 composite and the good electronic characteristics of the two dimensional graphitic carbon nitride are in favor of the elevated gas-sensing property. PMID:28468245
Microbial evaluation of Alaska salmon caviar.
Himelbloom, B H; Crapo, C A
1998-05-01
Microbial quality of pink salmon caviar (ikura) processed at one plant in Alaska during a 30-day season was examined. Ikura (aw = 0.98; pH 6.1) averaged 49% water, 32% protein, 11% fat, 7% ash, and 3% salt. Aerobic plate counts (APCs) ranged from < 10(2)/g to 4.5 x 10(7)/g with increasing APC toward season's end. Coliform counts ranged from < 3/g to 2.4 x 10(3)/g. Escherichia coli, Staphylococcus aureus, yeasts, and molds were not detected. High-APC (10(7)/g) thawed caviar exhibited predominantly lactic acid bacteria; low-APC (10(3)/g) thawed caviar exhibited predominantly gram-negative bacteria. Freezing had little effect on the microbial counts, and shelf life of thawed caviar was 3 to 5 days at 2 degrees C.
Techniques for On-Line Fault Monitoring in Modular Digital Systems.
1980-01-01
3’~~ 3 7 SE1N 7’S3 j) .3’ SF J 5 0IDN F: 3~2 3 0 1IJr P=!’~ I /* G:!3 A:::,J * -- 3 - ’Ir ) = ’’jI)A~3 3 T:: SCIL (.7 J): G73 1 I A.c:L KFJ) ; 3~~ YJ
NASA Astrophysics Data System (ADS)
Lu, Mi; Tian, Yanyan; Zheng, Xiaodong; Gao, Jun; Huang, Bing
2012-12-01
The natural graphite (NG) is coated with Li4Ti5O12 (LTO) and the composite shows a markedly enhanced rate performance due to the decrease of charge transfer resistance after LTO coating. The specific capacity of the NG charge-discharged at 2 C is increased by 60.3% (128.7 vs. 80.3 mAh g-1) by coating it with 1 wt.% of Li4Ti5O12 (LTO). The comparison of the NG and that coated with 1 wt.% LTO at 0.1 C shows that the initial reversible capacity is increased from 318.1 mAh g-1 to 357.5 mAh g-1 after coating, while the total irreversible capacity loss after 50 cycles is decreased from 122.8 mAh g-1 to 103.9 mAh g-1. The composite improves the energy and power densities, safety, cycle life and lowers the price of the lithium-ion battery while avoiding the gas-swelling of full battery caused by Ti4+ because the final coating material is the lithiated LTO (Li7Ti5O12 or Li9Ti5O12).
30 CFR 902.15 - Approval of Alaska regulatory program amendments.
Code of Federal Regulations, 2011 CFR
2011-07-01
...), .185(a)(3), (4), (5), .207(c)(5)(C), .213(g), (h), .323(a) through (d), .325(b), (c), (d)(1), (2), (3...), .349(2)(A), .353(a)(1), (2), (3), .371(d)(1) through (4), .373(b), (c), (d), .375(b), (e) through (h...), .491(a), (1), (6), (7), (8), (c)(4) through (8), (e), (f), .901(e), .907(c) through (h), (j). December...
30 CFR 902.15 - Approval of Alaska regulatory program amendments.
Code of Federal Regulations, 2010 CFR
2010-07-01
...), .185(a)(3), (4), (5), .207(c)(5)(C), .213(g), (h), .323(a) through (d), .325(b), (c), (d)(1), (2), (3...), .349(2)(A), .353(a)(1), (2), (3), .371(d)(1) through (4), .373(b), (c), (d), .375(b), (e) through (h...), .491(a), (1), (6), (7), (8), (c)(4) through (8), (e), (f), .901(e), .907(c) through (h), (j). December...
Alicyclobacillus fodiniaquatilis sp. nov., isolated from acid mine water.
Zhang, Bo; Wu, Yu-Fan; Song, Jin-Long; Huang, Zhong-Sheng; Wang, Bao-Jun; Liu, Shuang-Jiang; Jiang, Cheng-Ying
2015-12-01
Two novel, Gram-stain-variable, moderately thermophilic, acidophilic, rod-shaped, endospore-forming bacteria, G45-16T and G45-17, were isolated from acid mine water of Zijin copper mine in Fujian Province, China. Phylogenetic analysis of 16S rRNA gene sequences showed that they were closely related to Alicyclobacillus acidoterrestris ATCC 49025T with sequence similarities of 96.8 %. Cells grew aerobically at 20-45 °C (optimum, 40 °C), at pH 2.5-5.5(optimum, pH 3.5) and in the presence of 0-4.0 % (w/v) NaCl. Strains contained MK-7 as the major menaquinone and the major cellular fatty acids were ω-cyclohexane C19 : 0 and ω-cyclohexane C17 : 0. The DNA G+C content was 51.3 and 49.8 mol% (Tm) for G45-16T and G45-17, respectively. On the basis of phenotypic, chemotaxonomic and phylogenetic comparisons with their relatives and DNA-DNA relatedness values, it is concluded that strains G45-16T and G45-17 represent a novel species within the genus Alicyclobacillus, for which the name Alicyclobacillus fodiniaquatilis sp. nov. is proposed; the type strain is G45-16T(=CGMCC 1.15049T=NBRC 111483T).
SiC Nanofibers as Long-Life Lithium-Ion Battery Anode Materials.
Sun, Xuejiao; Shao, Changzhen; Zhang, Feng; Li, Yi; Wu, Qi-Hui; Yang, Yonggang
2018-01-01
The development of high energy lithium-ion batteries (LIBs) has spurred the designing and production of novel anode materials to substitute currently commercial using graphitic materials. Herein, twisted SiC nanofibers toward LIBs anode materials, containing 92.5 wt% cubic β-SiC and 7.5 wt% amorphous C, were successfully synthesized from resin-silica composites. The electrochemical measurements showed that the SiC-based electrode delivered a stable reversible capacity of 254.5 mAh g -1 after 250 cycles at a current density of 0.1 A g -1 . It is interesting that a high discharge capacity of 540.1 mAh g -1 was achieved after 500 cycles at an even higher current density of 0.3 A g -1 , which is higher than the theoretical capacity of graphite. The results imply that SiC nanomaterials are potential anode candidate for LIBs with high stability due to their high structure stability as supported with the transmission electron microscopy images.
Na, Youngjun; Li, Dong Hua; Lee, Sang Rak
2017-07-01
Two experiments were conducted to determine the effects of forage-to-concentrate (F:C) ratio on the nutrient digestibility and enteric methane (CH 4 ) emission in growing goats and Sika deer. Three male growing goats (body weight [BW] = 19.0±0.7 kg) and three male growing deer (BW = 19.3±1.2 kg) were respectively allotted to a 3×3 Latin square design with an adaptation period of 7 d and a data collection period of 3 d. Respiration-metabolism chambers were used for measuring the enteric CH 4 emission. Treatments of low (25:75), moderate (50:50), and high (73:27) F:C ratios were given to both goats and Sika deer. Dry matter (DM) and organic matter (OM) digestibility decreased linearly with increasing F:C ratio in both goats and Sika deer. In both goats and Sika deer, the CH 4 emissions expressed as g/d, g/kg BW 0.75 , % of gross energy intake, g/kg DM intake (DMI), and g/kg OM intake (OMI) decreased linearly as the F:C ratio increased, however, the CH 4 emissions expressed as g/kg digested DMI and OMI were not affected by the F:C ratio. Eight equations were derived for predicting the enteric CH 4 emission from goats and Sika deer. For goat, equation 1 was found to be of the highest accuracy: CH 4 (g/d) = 3.36+4.71×DMI (kg/d)-0.0036×neutral detergent fiber concentrate (NDFC, g/kg)+0.01563×dry matter digestibility (DMD, g/kg)-0.0108×neutral detergent fiber digestibility (NDFD, g/kg). For Sika deer, equation 5 was found to be of the highest accuracy: CH 4 (g/d) = 66.3+27.7×DMI (kg/d)-5.91×NDFC (g/kg)-7.11× DMD (g/kg)+0.0809×NDFD (g/kg). Digested nutrient intake could be considered when determining the CH 4 generation factor in goats and Sika deer. Finally, the enteric CH 4 prediction model for goats and Sika deer were estimated.
Towed Thermistor Chain Observations in JASIN,
1980-07-01
Lij LiJ - S -Ky LJDC cYcc Ql I- 6? F-L T cy D- Hl-m L-L Lo i -,7W LOu CT KK _ _4 C7) 63 -) Ln CD Ln ;Lf FE - CS -JN V LO WLJCNK ua- -~ Lfl CO F (YD... DBD C _W2 + D2 Integrating (A5) yields: G8 bW -1 2cs + b z(s) = (- - 2c 3 / 2 [sinh (d - sinh- (-)] (a7) +- [(A + bs + cs) - /a]c where d = 4ac - b
Code of Federal Regulations, 2010 CFR
2010-01-01
... 4 Accounts 1 2010-01-01 2010-01-01 false References. 2.2 Section 2.2 Accounts GOVERNMENT ACCOUNTABILITY OFFICE PERSONNEL SYSTEM PURPOSE AND GENERAL PROVISION § 2.2 References. (a) Subchapters III and IV of Chapter 7 of Title 31 U.S.C. (b) Title 5, United States Code. [45 FR 68375, Oct. 15, 1980, as...
Code of Federal Regulations, 2014 CFR
2014-01-01
... 4 Accounts 1 2014-01-01 2013-01-01 true References. 2.2 Section 2.2 Accounts GOVERNMENT ACCOUNTABILITY OFFICE PERSONNEL SYSTEM PURPOSE AND GENERAL PROVISION § 2.2 References. (a) Subchapters III and IV of Chapter 7 of Title 31 U.S.C. (b) Title 5, United States Code. [45 FR 68375, Oct. 15, 1980, as...
Code of Federal Regulations, 2011 CFR
2011-01-01
... 4 Accounts 1 2011-01-01 2011-01-01 false References. 2.2 Section 2.2 Accounts GOVERNMENT ACCOUNTABILITY OFFICE PERSONNEL SYSTEM PURPOSE AND GENERAL PROVISION § 2.2 References. (a) Subchapters III and IV of Chapter 7 of Title 31 U.S.C. (b) Title 5, United States Code. [45 FR 68375, Oct. 15, 1980, as...
Code of Federal Regulations, 2012 CFR
2012-01-01
... 4 Accounts 1 2012-01-01 2012-01-01 false References. 2.2 Section 2.2 Accounts GOVERNMENT ACCOUNTABILITY OFFICE PERSONNEL SYSTEM PURPOSE AND GENERAL PROVISION § 2.2 References. (a) Subchapters III and IV of Chapter 7 of Title 31 U.S.C. (b) Title 5, United States Code. [45 FR 68375, Oct. 15, 1980, as...
Code of Federal Regulations, 2013 CFR
2013-01-01
... 4 Accounts 1 2013-01-01 2013-01-01 false References. 2.2 Section 2.2 Accounts GOVERNMENT ACCOUNTABILITY OFFICE PERSONNEL SYSTEM PURPOSE AND GENERAL PROVISION § 2.2 References. (a) Subchapters III and IV of Chapter 7 of Title 31 U.S.C. (b) Title 5, United States Code. [45 FR 68375, Oct. 15, 1980, as...
Ye, Mu; Huang, Yaoxin; Gurtler, Joshua B; Niemira, Brendan A; Sites, Joseph E; Chen, Haiqiang
2013-05-15
The effects of storage conditions on subsequent high-hydrostatic pressure (HHP) inactivation of Vibrio parahaemolyticus and Vibrio vulnificus in oysters were investigated. Live oysters were inoculated with V. parahaemolyticus or V. vulnificus to ca. 7-8 log MPN/g by feeding and stored at varying conditions (i.e., 21 or 35 °C for 5h, 4 or 10 °C for 1 and 2 days and -18 °C for 2 weeks). Oyster meats were then treated at 225-300 MPa for 2 min at 4, 21 or 35 °C. HHP at 300 MPa for 2 min achieved a >5-log MPN/g reduction of V. parahaemolyticus, completely inactivating V. vulnificus (negative by enrichment) in oysters. Treatment temperatures of 4, 21 and 35 °C did not significantly affect pressure inactivation of V. parahaemolyticus or V. vulnificus (P>0.05). Cold storage at -18, 4 and 10 °C, prior to HHP, decreased V. parahaemolyticus or V. vulnificus populations by 1.5-3.0 log MPN/g, but did not increase their sensitivity to subsequent HHP treatments. The effects of cold storage after HHP on inactivation of V. parahaemolyticus in oysters were also determined. Oysters were inoculated with V. parahaemolyticus and stored at 21 °C for 5h or 4 °C for 1 day. Oyster meats were then treated at 250-300 MPa for 2 min at 21 or 35 °C and stored for 15 days in ice or in a freezer. V. parahaemolyticus populations in HHP-treated oysters gradually decreased during post-HHP ice or frozen storage. A validation study using whole-shell oysters was conducted to determine whether the presence of oyster shells influenced HHP inactivation of V. parahaemolyticus. No appreciable differences in inactivation between shucked oyster meat and whole-shell oysters were observed. HPP at 300 MPa for 2 min at 21 °C, followed by 5-day ice storage or 7-day frozen storage, and HPP at 250 MPa for 2 min at 21 °C, followed by 10-day ice or 7-day frozen storage, completely inactivated V. parahaemolyticus in whole-shell oysters (>7 log reductions). The combination of HHP at a relatively low pressure (e.g., 250 MPa) followed by short-term frozen storage (7 days) could potentially be applied by the shellfish industry as a post-harvest process to eliminate V. parahaemolyticus in oysters. Copyright © 2013 Elsevier B.V. All rights reserved.
NASA Astrophysics Data System (ADS)
Valentini, Carla Maria Abido; Sanches, Luciana; de Paula, Sérgio Roberto; Vourlitis, George Louis; de Souza Nogueira, José; Pinto, Osvaldo Borges; de Almeida Lobo, Francisco
2008-12-01
Measurements of soil CO2 efflux, litter production, and the surface litter pool biomass were made over a 1 year period in a tropical transitional forest near Sinop, Mato Grosso, Brazil with the aim of quantifying the seasonal variation in soil respiration and litter decomposition and the annual contribution of litter decomposition to soil CO2 efflux. Average annual soil CO2 efflux (+/-95% confidence interval (CI)) was 7.91 +/- 1.16 g C m-2 d-1. Soil CO2 efflux was highest during the November-February wet season (9.15 +/- 0.90 g C m-2 d-1) and lowest during the May-September dry season (6.19 +/- 1.40 g C m-2 d-1), and over 60% of the variation in seasonal soil CO2 efflux was explained by seasonal variations in soil temperature and moisture. Mass balance estimates of mean (+/-95% CI) decomposition rates were statistically different between the wet and dry seasons (0.66 +/- 0.08 and 1.65 +/- 0.10 g C m-2 d-1, respectively), and overall, decomposition of leaf litter comprised 16% of the average annual soil respiration. Leaf litter production was higher during the dry season, and mean (+/-95% CI) leaf litter fall (5.6 +/- 1.7 Mg ha-1) comprised 73% of the total litter fall (7.8 +/- 2.3 Mg ha-1). Average (+/-95% CI) annual litter pool biomass was estimated to be 5.5 +/- 0.3 Mg ha-1, which was similar to the measured pool size (5.7 +/- 2.2 Mg ha-1). Overall, seasonal variations in environmental variables, specifically water availability (soil moisture and rainfall), had a profound influence on litter production, soil respiration, and surface litter decomposition.
25 Tb/s transmission over 5,530 km using 16QAM at 5.2 b/s/Hz spectral efficiency.
Cai, J-X; Batshon, H G; Zhang, H; Davidson, C R; Sun, Y; Mazurczyk, M; Foursa, D G; Sinkin, O; Pilipetskii, A; Mohs, G; Bergano, Neal S
2013-01-28
We transmit 250x100G PDM RZ-16QAM channels with 5.2 b/s/Hz spectral efficiency over 5,530 km using single-stage C-band EDFAs equalized to 40 nm. We use single parity check coded modulation and all channels are decoded with no errors after iterative decoding between a MAP decoder and an LDPC based FEC algorithm. We also observe that the optimum power spectral density is nearly independent of SE, signal baud rate or modulation format in a dispersion uncompensated system.
NASA Astrophysics Data System (ADS)
Li, Jing-quan; Han, Chong; Jing, Mao-xiang; Yang, Hua; Shen, Xiang-qian; Qin, Shi-biao
2018-06-01
Low electronic and ionic conductivity for LiV3O8 cathode material could lead to poor cycling stability and rate capability, which are considered as the main restraint for its application in Li-ion battery. A novel flake-like LiV3O7.9 material modified by high ionic and electronic conductive Li0.3V2O5/C was fabricated via electrospinning and controlled thermal sintering processes. This oxygen-deficient LiV3O7.9/Li0.3V2O5-C composite electrode sintered at 500 °C exhibits improved rate and cycle stability. The electrode possesses a retention capacity of 151.9mAh/g after 500 cycles at 5C and 84.8mAh/g after 1000 cycles at 10C, respectively. The improvement of the electrochemical performance could be attributed to the synergistic effects of flake-like morphology, oxygen-deficiency and surface modification of Li0.3V2O5/C, which increase the ionic and electronic conductivity of LiV3O8.
Prody, C A; Zevin-Sonkin, D; Gnatt, A; Goldberg, O; Soreq, H
1987-01-01
To study the primary structure and regulation of human cholinesterases, oligodeoxynucleotide probes were prepared according to a consensus peptide sequence present in the active site of both human serum pseudocholinesterase (BtChoEase; EC 3.1.1.8) and Torpedo electric organ "true" acetylcholinesterase (AcChoEase; EC 3.1.1.7). Using these probes, we isolated several cDNA clones from lambda gt10 libraries of fetal brain and liver origins. These include 2.4-kilobase cDNA clones that code for a polypeptide containing a putative signal peptide and the N-terminal, active site, and C-terminal peptides of human BtChoEase, suggesting that they code either for BtChoEase itself or for a very similar but distinct fetal form of cholinesterase. In RNA blots of poly(A)+ RNA from the cholinesterase-producing fetal brain and liver, these cDNAs hybridized with a single 2.5-kilobase band. Blot hybridization to human genomic DNA revealed that these fetal BtChoEase cDNA clones hybridize with DNA fragments of the total length of 17.5 kilobases, and signal intensities indicated that these sequences are not present in many copies. Both the cDNA-encoded protein and its nucleotide sequence display striking homology to parallel sequences published for Torpedo AcChoEase. These findings demonstrate extensive homologies between the fetal BtChoEase encoded by these clones and other cholinesterases of various forms and species. Images PMID:3035536
[Raman Characterization of Hydrate Crystal Structure Influenced by Mine Gas Concentration].
Zhang, Bao-yong; Zhou, Hong-ji; Wu, Qiang; Gao, Xia
2016-01-01
CH4 /C2H6/N2 mixed hydrate formation experiments were performed at 2 degrees C and 5 MPa for three different mine gas concentrations (CH4/C2H6/N2, G1 = 54 : 36 : 10, G2 = 67.5 : 22.5 : 10, G3 = 81 : 9 : 10). Raman spectra for hydration products were obtained by using Microscopic Raman Spectrometer. Hydrate structure is determined by the Raman shift of symmetric C-C stretching vibration mode of C2H6 in the hydrate phase. This work is focused on the cage occupancies and hydration numbers, calculated by the fitting methods of Raman peaks. The results show that structure I (s I) hydrate forms in the G1 and G2 gas systems, while structure II (s II) hydrate forms in the G3 gas system, concentration variation of C2H6 in the gas samples leads to a change in hydrate structure from s I to s II; the percentages of CH4 and C2H6 in s I hydrate phase are less affected by the concentration of gas samples, the percentages of CH4 are respectively 34.4% and 35.7%, C2H6 are respectively 64.6% and 63.9% for gas systems of G1 and G2, the percentages of CH4 and 2 H6 are respectively 73.5% and 22.8% for gas systems of G3, the proportions of object molecules largely depend on the hydrate structure; CH4 and C2H6 molecules occupy 98%, 98% and 92% of the large cages and CH4 molecules occupy 80%, 60% and 84% of the small cages for gas systems of G1, G2 and G3, respectively; additionally, N2 molecules occupy less than 5% of the small cages is due to its weak adsorption ability and the lower partial pressure.
TRIQS: A toolbox for research on interacting quantum systems
NASA Astrophysics Data System (ADS)
Parcollet, Olivier; Ferrero, Michel; Ayral, Thomas; Hafermann, Hartmut; Krivenko, Igor; Messio, Laura; Seth, Priyanka
2015-11-01
We present the TRIQS library, a Toolbox for Research on Interacting Quantum Systems. It is an open-source, computational physics library providing a framework for the quick development of applications in the field of many-body quantum physics, and in particular, strongly-correlated electronic systems. It supplies components to develop codes in a modern, concise and efficient way: e.g. Green's function containers, a generic Monte Carlo class, and simple interfaces to HDF5. TRIQS is a C++/Python library that can be used from either language. It is distributed under the GNU General Public License (GPLv3). State-of-the-art applications based on the library, such as modern quantum many-body solvers and interfaces between density-functional-theory codes and dynamical mean-field theory (DMFT) codes are distributed along with it.
Essien, Emmanuel E.; Newby, Jennifer Schmidt; Walker, Tameka M.; Setzer, William N.; Ekundayo, Olusegun
2015-01-01
Bacterial resistance has been increasingly reported worldwide and is one of the major causes of failure in the treatment of infectious diseases. Natural-based products, including plant secondary metabolites (phytochemicals), can be exploited to ameliorate the problem of microbial resistance. The fruit essential oils of Alchornea cordifolia and Canthium subcordatum were obtained by hydrodistillation and analyzed by gas chromatography-mass spectrometry (GC-MS). The essential oils were subjected to in vitro antibacterial, antifungal and cytotoxic activity screening. Thirty-eight compounds comprising 97.7% of A. cordifolia oil and forty-six constituents representing 98.2% of C. subcordatum oil were identified. The major components in A. cordifolia oil were methyl salicylate (25.3%), citronellol (21.4%), α-phellandrene (7.4%), terpinolene (5.7%) and 1,8-cineole (5.5%). Benzaldehyde (28.0%), β-caryophyllene (15.5%), (E,E)-α-farnesene (5.3%) and methyl salicylate (4.5%) were the quantitatively significant constituents in C. subcordatum fruit essential oil. A. cordifolia essential oil demonstrated potent in vitro antibacterial activity against Staphylococcus aureus (MIC = 78 μg/mL) and marginal antifungal activity against Aspergillus niger (MIC = 156 μg/mL). C. subcordatum showed antibacterial activity against Bacillus cereus and S. aureus (MIC = 156 μg/mL) and notable antifungal activity against A. niger (MIC = 39 μg/mL). However, no appreciable cytotoxic effects on human breast carcinoma cells (Hs 578T) and human prostate carcinoma cells (PC-3) were observed for either essential oil. The antimicrobial activities of A. cordifolia and C. subcordatum fruit essential oils are a function of their distinct chemical profiles; their volatiles and biological activities are reported for the first time. PMID:28930111
1990-02-23
TABQ Lnannounoed 0 Juastification Distri~bution/ 23 FeruaryI~()Availability Codes vai1 and/or Dist Sioa WA LAI 1r.:. 1.’ 1 0 YF I~. 9’. t l ni 1 nn N...5. 4 I S A 1A,1, v 1o.2 4 -2.9 1:3. 1 3 142 N 100 WI ACIIJA|, I 2.3 t 8.2 Ac -5.9 * A ISAIA , 103.7 * 8.2 A 8.5 1 4 42 N 98 W t ACTUAL, 4 4. 0 C 17...parameter at grid points, consideration of the error produced by the objective analysis scheme is necessary. The computer code used for the Cressman (1959
A Three Dimensional Electronic Retina Architecture.
1987-12-01
not guarantee that a biological entity is in fact the best design because of the unique constraining factors of a biological organism and the associated...4. PERFORMING ORGANIZATION REPORT NUMBER(S) 5. MONITORING ORGANIZATION REPORT NUMBER(S) AFIT/GCS/ENG/87D-23 6a. NAME OF PERFORMING ORGANIZATION 6b...OFFICE SYMBOL 7a. NAME OF MONITORING ORGANIZATION (If applicable) School of Engineering AFIT/ENG 6c. ADDRESS (City, State, and ZIP Code) 7b. ADDRESS
Hepatic glycogen in humans. II. Gluconeogenetic formation after oral and intravenous glucose
DOE Office of Scientific and Technical Information (OSTI.GOV)
Radziuk, J.
1989-08-01
The amount of glycogen that is formed by gluconeogenetic pathways during glucose loading was quantitated in human subjects. Oral glucose loading was compared with its intravenous administration. Overnight-fasted subjects received a constant infusion or (3-{sup 3}H)glucose and a marker for gluconeogenesis, (U-{sup 14}C)lactate or sodium ({sup 14}C)bicarbonate ({sup 14}C)bicarbonate. An unlabeled glucose load was then administered. Postabsorptively, or after glucose infusion was terminated, a third tracer ((6-{sup 3}H)glucose) infusion was initiated along with a three-step glucagon infusion. Without correcting for background stimulation of ({sup 14}C)glucose production or for dilution of {sup 14}C with citric acid cycle carbon in the oxaloacetatemore » pool, the amount of glycogen mobilized by the glucagon infusion that was produced by gluconeogenesis during oral glucose loading was 2.9 +/- 0.7 g calculated from (U-{sup 14}C)-lactate incorporation and 7.4 +/- 1.3 g calculated using ({sup 14}C)bicarbonate as a gluconeogenetic marker. During intravenous glucose administration the latter measurement also yielded 7.2 +/- 1.1 g. When the two corrections above are applied, the respective quantities became 5.3 +/- 1.7 g for (U-{sup 14}C)lactate as tracer and 14.7 +/- 4.3 and 13.9 +/- 3.6 g for oral and intravenous glucose with ({sup 14}C)bicarbonate as tracer (P less than 0.05, vs. ({sup 14}C)-lactate as tracer). When (2-{sup 14}C)acetate was infused, the same amount of label was incorporated into mobilized glycogen regardless of which route of glucose administration was used. Comparison with previous data also suggests that {sup 14}CO{sub 2} is a potentially useful marker for the gluconeogenetic process in vivo.« less
Wang, Geping; Wang, Guanghua; Li, Xiuping; Zhang, Xueyong; Karanis, Gabriele; Jian, Yingna; Ma, Liqing; Karanis, Panagiotis
2018-06-01
Cryptosporidium and Giardia are ubiquitous parasites that infect humans and animals. Few reports are available on the prevalence of these two protozoan parasites in yaks (Bos grunniens). In this study, 344 faecal samples were collected from yaks with diarrhoea in the Chenduo and Nangqian counties of Qinghai Province, China. Cryptosporidium spp. and Giardia duodenalis were detected by light and immunofluorescence microscopy and nested PCR (nPCR). Fifteen samples were positive (4.5%) by Kinyoun staining, 40 (11.6%) samples were positive by immunofluorescence test (IFT), and 39 (11.3%) samples were positive by nPCR for Cryptosporidium spp., Cryptosporidium bovis (11/39, 28.2%) was the most prevalent species, followed by C. ryanae (6/39, 15.4%), C. andersoni (5/39, 12.8%), C. struthionis (5/39, 12.8%), C. parvum (5/39, 12.8%), C. hominis (4/39, 10.3%) and C. canis (3/39, 7.7%). Thirteen out of 344 (3.8%) samples were positive for Giardia by simple microscopy, 20 (5.8%) by IFT and 18 samples (5.2%) yak faecal samples were Giardia positive by nPCR. Two G. duodenalis assemblages (B, E) were detected in this study. Nine positive samples for G. duodenalis assemblage E were from the towns of Xiewu (8/9, 4.9%) and Xiangda (1/9, 1.3%), and nine positive samples (9/9, 8.5%) for G. duodenalis assemblage B were from the town of Zhenqin. This report provides information about infection with Cryptosporidium species and G. duodenalis assemblages in domesticated 1-2-month-old highland yaks living in the Qinghai-Tibet Plateau region of China.
1987-01-01
39 27 144 32 333 27 340 96 4 9 Y9 3783 2 3474 6 7 66 2 654 4 3 SI 3 534 34 :47 27 355 3C 2:3 2’ ISO 95 5 9 943 3929 5 1474 7 7 5 6 2 669 3 3 546 3 5...775 27003 105 5 10 922 3557 5 1476 6 14 4 2 5’ 5 46, 3’ 05 27 026 29 870 27 024 108 0 11 086 4121 1 1416 5 11 6 253c :62 4 14 34 7 27 043 25 Q54 27 038...531 1526 4,597 547.7 1483.6 21 7 225 0 223 6 7 427 7.406 33.984 26.562 27588 26 559 ISO 1 4.824 617 9 1483.0 17 8 240 0 236.5 7.254 7.232 33.987
2015-09-03
AGENCY NAME(S) AND ADDRESS(ES) Dr. Benjamin Knott AF Office of Scientific Research 875 North Randolph Street Arlington, VA 22203 10. SPONSOR...NUMBER OF PAGES 2 19a. NAME OF RESPONSIBLE PERSON Michael E. McCullough a. REPORT b. ABSTRACT c . THIS PAGE 19b. TELEPHONE NUMBER (Include area code...Enter all contract numbers as they appear in the report, e.g. F33615-86- C -5169. 5b. GRANT NUMBER. Enter all grant numbers as they appear in the report
Shen, Cangliang; Adler, Jeremy M; Geornaras, Ifigenia; Belk, Keith E; Smith, Gary C; Sofos, John N
2010-03-01
This study compared thermal inactivation of Escherichia coli O157:H7 in nonintact beefsteaks of different thicknesses by different cooking methods and appliances. Coarsely ground beef was inoculated with rifampin-resistant E. coli O157:H7 (eight-strain composite, 6 to 7 log CFU/g) and then mixed with sodium chloride (0.45%) plus sodium tripolyphosphate (0.23%); the total water added was 10%. The meat was stuffed into bags (10-cm diameter), semifrozen (-20 degrees C, 6 h), and cut into 1.5-, 2.5-, and 4.0-cm-thick steaks. Samples were then individually vacuum packaged, frozen (-20 degrees C, 42 h), and tempered (4 degrees C, 2.5 h) before cooking. Partially thawed (-2 +/- 1 degrees C) steaks were pan broiled (Presto electric skillet and Sanyo grill), double pan broiled (George Foreman grill), or roasted (Oster toaster oven and Magic Chef standard kitchen oven) to a geometric center temperature of 65 degrees C. Extent of pathogen inactivation decreased in order of roasting (2.0 to 4.2 log CFU/g) > pan broiling (1.6 to 2.8 log CFU/g) >/= double pan broiling (1.1 to 2.3 log CFU/g). Cooking of 4.0-cm-thick steaks required a longer time (19.8 to 65.0 min; variation was due to different cooking appliances), and caused greater reductions in counts (2.3 to 4.2 log CFU/g) than it did in thinner samples (1.1 to 2.9 log CFU/g). The time to reach the target temperature increased in order of George Foreman grill (3.9 to 19.8 min) < Oster toaster oven (11.3 to 45.0 min) < Presto electric skillet (16.3 to 55.0 min) < Sanyo grill (14.3 to 65.0 min) < standard kitchen oven (20.0 to 63.0 min); variation was due to steak thickness. Results indicated that increased steak thickness allowed greater inactivation of E. coli O157:H7, as time to reach the target internal temperature increased. Roasting in a kitchen oven was most effective for pathogen inactivation.
Word Frequency Analysis. MOS: 57H. Skill Levels 1 & 2.
1981-05-01
8217 . -4 1a’ _________ Palms 1t. FLL& T - VI;:.P - -- S LtrTZE5 I Lu" I rprz l * 4 2lE p:Zn.uAwn PLCU4LLE 14 Piz;* I P RTICULAR 4 PZR1S 7 J _________ 2...I’ I VIn 1 fIV 7 IaIIA!’I TIP 2 1-111 L LAlT P i;10! S II*,s , 11- 1 L Ii1! p UIIIc tInlG Z : S -W (INSf4 2 IZ 1111tE~ ;l ,’I I z a5T p Oil ’(1$I1...p --G 6 RIGGING- I~ V~. 1 5EL~ .1 50:L I SF AFY~~3!.rS_7I; 7 SAFETY I----c- 7 -- ss1 ’_F T_-------- 1 HPPI 7A! I1CEUE SCP .~LaG 3 SHUTWI ~ SC’~J’!LI
Sharma, Neeraj; Sosnay, Patrick R.; Ramalho, Anabela S.; Douville, Christopher; Franca, Arianna; Gottschalk, Laura B.; Park, Jeenah; Lee, Melissa; Vecchio-Pagan, Briana; Raraigh, Karen S.; Amaral, Margarida D.; Karchin, Rachel; Cutting, Garry R.
2015-01-01
Assessment of the functional consequences of variants near splice sites is a major challenge in the diagnostic laboratory. To address this issue, we created expression minigenes (EMGs) to determine the RNA and protein products generated by splice site variants (n = 10) implicated in cystic fibrosis (CF). Experimental results were compared with the splicing predictions of eight in silico tools. EMGs containing the full-length Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) coding sequence and flanking intron sequences generated wild-type transcript and fully processed protein in Human Embryonic Kidney (HEK293) and CF bronchial epithelial (CFBE41o-) cells. Quantification of variant induced aberrant mRNA isoforms was concordant using fragment analysis and pyrosequencing. The splicing patterns of c.1585−1G>A and c.2657+5G>A were comparable to those reported in primary cells from individuals bearing these variants. Bioinformatics predictions were consistent with experimental results for 9/10 variants (MES), 8/10 variants (NNSplice), and 7/10 variants (SSAT and Sroogle). Programs that estimate the consequences of mis-splicing predicted 11/16 (HSF and ASSEDA) and 10/16 (Fsplice and SplicePort) experimentally observed mRNA isoforms. EMGs provide a robust experimental approach for clinical interpretation of splice site variants and refinement of in silico tools. PMID:25066652
Walia, Abhishek; Mehta, Preeti; Guleria, Shiwani; Shirkot, Chand Karan
2015-12-01
The effects of yeast extract (X 1 ), NH 4 NO 3 (X 2 ), peptone (X 3 ), urea (X 4 ), CMC (X 5 ), Tween 20 (X 6 ), MgSO 4 (X 7 ), and CaCO 3 (X 8 ) on production of xylanase from Cellulosimicrobium cellulans CKMX1 were optimized by statistical analysis using response surface methodology (RSM). The RSM was used to optimize xylanase production by implementing the Central composite design. Statistical analysis of the results showed that the linear, interaction and quadric terms of these variables had significant effects. However, only the linear effect of X 4 , X 5 , interaction effect of X 1 X 7 , X 1 X 8 , X 2 X 3 , X 2 X 8 , X 3 X 6 , X 3 X 8 , X 4 X 6 , X 4 X 7 , X 5 X 7 , X 5 X 8 and quadratic effect of X 3 2 , X 5 2 and X 7 2 found to be insignificant terms in the quadratic model and had no response at significant level. The minimum and maximum xylanase production obtained was 331.50 U/g DBP and 1027.65 U/g DBP, respectively. The highest xylanase activity was obtained from Run No. 30, which consisted of yeast extract (X 1 ), 1.00 g (%); NH 4 NO 3 (X 2 ), 0.20 g (%); peptone (X 3 ), 1.00 g (%); urea (X 4 ), 10 mg (%); CMC (X 5 ), 1.00 g (%); Tween 20 (X 6 ), 0.02 mL (%); CaCO 3 (X 7 ), 0.50 g (%) and MgSO 4 (X 8 ), 9.0 g (%). The optimization resulted in 3.1-fold increase of xylanase production, compared with the lowest xylanase production of 331.50 U/g DBP after 72 h of incubation in stationary flask experiment. Application of cellulase-free xylanase in pulp biobleaching from C. cellulans CKMX1 under C-E P -D sequence has been shown to bring about a 12.5 % reduction of chlorine, decrease of 0.8 kappa points (40 %), and gain in brightness was 1.42 % ISO points in 0.5 % enzyme treated pulp as compared to control.
NASA Astrophysics Data System (ADS)
Peng, Liang; Zhang, Huijuan; Fang, Ling; Zhang, Yan; Wang, Yu
2016-01-01
In this paper, a novel peapod-like Li4Ti5O12-C composite architecture with high conductivity is firstly designed and synthesized to be used as anode materials for lithium-ion batteries. In the synthesis, Na2Ti3O7 nanotubes act as precursors and sacrificial templates, and glucose molecules serve as the green carbon source, thus the peapod-like Li4Ti5O12-C composite can be fabricated by a facile hydrothermal reaction and the subsequent solid-state process. Compared to the previous reports, the as-prepared samples obtained by our new strategy exhibit excellent electrochemical performances, such as outstanding rate capability (an extremely reversible capability of 148 mA h g-1, 125 mA h g-1 at 30 C and 90 C, respectively) as well as excellent cycling performance (about 5% capacity loss after 5000 cycles at 10 C with 152 mA h g-1 capacity retained). The low-temperature measurements also demonstrate that the electrochemical performances of the peapod-like Li4Ti5O12-C composite are remarkably improved at various rate currents (at the low-temperature of -25 °C, a high Coulombic efficiency of about 99% can be achieved after 500 cycles at 10 C).In this paper, a novel peapod-like Li4Ti5O12-C composite architecture with high conductivity is firstly designed and synthesized to be used as anode materials for lithium-ion batteries. In the synthesis, Na2Ti3O7 nanotubes act as precursors and sacrificial templates, and glucose molecules serve as the green carbon source, thus the peapod-like Li4Ti5O12-C composite can be fabricated by a facile hydrothermal reaction and the subsequent solid-state process. Compared to the previous reports, the as-prepared samples obtained by our new strategy exhibit excellent electrochemical performances, such as outstanding rate capability (an extremely reversible capability of 148 mA h g-1, 125 mA h g-1 at 30 C and 90 C, respectively) as well as excellent cycling performance (about 5% capacity loss after 5000 cycles at 10 C with 152 mA h g-1 capacity retained). The low-temperature measurements also demonstrate that the electrochemical performances of the peapod-like Li4Ti5O12-C composite are remarkably improved at various rate currents (at the low-temperature of -25 °C, a high Coulombic efficiency of about 99% can be achieved after 500 cycles at 10 C). Electronic supplementary information (ESI) available: More SEM, EDS, TEM, and XPS data are available. See DOI: 10.1039/c5nr08399k
Williams, Emma; Rumsby, Gill
2007-07-01
Definitive diagnosis of primary hyperoxaluria type 1 (PH1) requires analysis of alanine:glyoxylate aminotransferase (AGT) activity in the liver. We have previously shown that targeted screening for the 3 most common mutations in the AGXT gene (c.33_34insC, c.508G>A, and c.731T>C) can provide a molecular diagnosis in 34.5% of PH1 patients, eliminating the need for a liver biopsy. Having reviewed the distribution of all AGXT mutations, we have evaluated a diagnostic strategy that uses selected exon sequencing for the molecular diagnosis of PH1. We sequenced exons 1, 4, and 7 for 300 biopsy-confirmed PH1 patients and expressed the identified missense mutations in vitro. Our identification of at least 1 mutation in 224 patients (75%) and 2 mutations in 149 patients increased the diagnostic sensitivity to 50%. We detected 29 kinds of sequence changes, 15 of which were novel. Four of these mutations were in exon 1 (c.2_3delinsAT, c.30_32delCC, c.122G>A, c.126delG), 7 were in exon 4 (c.447_454delGCTGCTGT, c.449T>C, c.473C>T, c.481G>A, c.481G>T, c.497T>C, c.424-2A>G), and 4 were in exon 7 (c.725insT, c.737G>A, c.757T>C, c.776 + 1G>A). The missense changes were associated with severely decreased AGT catalytic activity and negative immunoreactivity when expressed in vitro. Missense mutation c.26C>A, previously described as a pathological mutation, had activity similar to that of the wild-type enzyme. Selective exon sequencing can allow a definitive diagnosis in 50% of PH1 patients. The test offers a rapid turnaround time (15 days) with minimal risk to the patient. Demonstration of the expression of missense changes is essential to demonstrate pathogenicity.
Ziegel, Rebecca; Shallop, Anthony; Upadhyaya, Pramod; Jones, Roger; Tretyakova, Natalia
2004-01-20
All CG dinucleotides along exons 5-8 of the p53 tumor suppressor gene contain endogenous 5-methylcytosine (MeC). These same sites (e.g., codons 157, 158, 245, 248, and 273) are mutational hot spots in smoking-induced lung cancer. Several groups used the UvrABC endonuclease incision assay to demonstrate that methylated CG dinucleotides of the p53 gene are the preferred binding sites for the diol epoxides of bay region polycyclic aromatic hydrocarbons (PAH). In contrast, effects of endogenous cytosine methylation on the distribution of DNA lesions induced by tobacco-specific nitrosamines, e.g., 4-(methylnitrosamino)-1-(3-pyridyl)-1-butanone (NNK), have not been elucidated. In the work presented here, a stable isotope labeling HPLC-ESI-MS/MS approach was employed to analyze the reactivity of the N7 and O6 positions of guanines within hemimethylated and fully methylated CG dinucleotides toward NNK-derived methylating and pyridyloxobutylating species. 15N3-labeled guanine bases were placed within synthetic DNA sequences representing endogenously methylated p53 codons 154, 157, and 248, followed by treatment with acetylated precursors to NNK diazohydroxides. HPLC-ESI-MS/MS analysis was used to determine the relative yields of N7- and O6-guanine adducts at the 15N3-labeled position. In all cases, the presence of MeC inhibited the formation of N7-methylguanine, O6-methylguanine, and O6-pyridyloxobutylguanine at a neighboring G, with the greatest decrease observed in fully methylated dinucleotides and at guanines preceded by MeC. Furthermore, the O6-Me-dG/N7-Me-G molar ratios were decreased in the presence of the 5'-neighboring MeC, suggesting that the observed decline in O6-alkylguanine adduct yields is, at least partially, a result of an altered reactivity pattern in methylated CG dinucleotides. These results indicate that, unlike N2-guanine adducts of PAH diol epoxides, NNK-induced N7- and O6-alkylguanine adducts are not preferentially formed at the endogenously methylated CG sites within the p53 tumor suppressor gene.
The mitochondrial genome of Cethosia biblis (Drury) (Lepidoptera: Nymphalidae).
Xin, Tianrong; Li, Lei; Yao, Chengyi; Wang, Yayu; Zou, Zhiwen; Wang, Jing; Xia, Bin
2016-07-01
We present the complete mitogenome of Cethosia biblis (Drury) (Lepidoptera: Nymphalidae) in this article. The mitogenome was a circle molecular consisting of 15,286 nucleotides, 37 genes, and an A + T-rich region. The order of 37 genes was typical of insect mitochondrial DNA sequences described to date. The overall base composition of the genome is A (37.41%), T (42.80%), C (11.87%), and G (7.91%) with an A + T-rich hallmark as that of other invertebrate mitochondrial genomes. The start codon was mainly ATA in most of the mitochondrial protein-coding genes such as ND2, COI, ATP8, ND3, ND5, ND4, ND6, and ND1, but COII, ATP6, COIII, ND4L, and Cob genes employing ATG. The stop codon was TAA in all the protein-coding genes. The A + T region is located between 12S rRNA and tRNA(M)(et). The phylogenetic relationships of Lepidoptera species were constructed based on the nucleotides sequences of 13 PCGs of mitogenomes using the neighbor-joining method. The molecular-based phylogeny supported the traditional morphological classification on relationships within Lepidoptera species.
Odyssey's end: lay conceptions of nostalgia reflect its original Homeric meaning.
Hepper, Erica G; Ritchie, Timothy D; Sedikides, Constantine; Wildschut, Tim
2012-02-01
Nostalgia fulfills pivotal functions for individuals, but lacks an empirically derived and comprehensive definition. We examined lay conceptions of nostalgia using a prototype approach. In Study 1, participants generated open-ended features of nostalgia, which were coded into categories. In Study 2, participants rated the centrality of these categories, which were subsequently classified as central (e.g., memories, relationships, happiness) or peripheral (e.g., daydreaming, regret, loneliness). Central (as compared with peripheral) features were more often recalled and falsely recognized (Study 3), were classified more quickly (Study 4), were judged to reflect more nostalgia in a vignette (Study 5), better characterized participants' own nostalgic (vs. ordinary) experiences (Study 6), and prompted higher levels of actual nostalgia and its intrapersonal benefits when used to trigger a personal memory, regardless of age (Study 7). These findings highlight that lay people view nostalgia as a self-relevant and social blended emotional and cognitive state, featuring a mixture of happiness and loss. The findings also aid understanding of nostalgia's functions and identify new methods for future research. PsycINFO Database Record (c) 2012 APA, all rights reserved
A Biologically Based Approach to the Mutation of Code
1999-09-01
SECOND POSITION U c A G u phenyl- alanine serine tyro sine cysteine U C leucine stop stop A stop tryptophan G o c leucine proline histidine...individuals, is a means to explore the fitness landscape and find more solutions. B. INTRODUCTION TO EVOLUTIONARY COMPUTATION There are several...respiration and are responsible for making adenosine triphosphate (ATP), which is the cellular energy source. G. The Lysosomes These organelles are
Brar, Pardeepinder K; Proano, Lisseth G; Friedrich, Loretta M; Harris, Linda J; Danyluk, Michelle D
2015-02-01
Cocktails of lawn-collected cells were used to determine the survival of Salmonella, Escherichia coli O157:H7, and Listeria monocytogenes on the surface of raw peanut and pecan kernels. Kernels were inoculated with mixtures of four to five strains at 3 or 6 log CFU/g, dried at room temperature, and then stored at -24 ± 1, 4 ± 2, and 22 ± 1°C for 28 or 365 days. In most cases, rates of decline of the pathogens did not differ significantly between the two inoculum concentrations in the 28-day study. At 6 log CFU/g, populations of all pathogens were reduced by 0.5 to 1.6 log CFU/g during an initial 3-day drying period on both peanuts and pecans. The moisture content of peanuts and pecans remained stable at -24 ± 1 and 22 ± 1°C; at 4 ± 2°C, the moisture content increased from 3.8 to 5.6% on peanuts and from 2.6 to 3% on pecans over 365 days. Pathogen populations were stable on pecans stored under frozen and refrigerated conditions, except for L. monocytogenes, which declined at a rate of 0.03 log CFU/g/30 days at 4 ± 2°C. Salmonella populations were stable on peanuts stored at -24 ± 1 and 4 ± 2°C, but E. coli O157:H7 and L. monocytogenes declined at rates of 0.03 to 0.12 log CFU/g/30 days. At 22 ± 1°C, Salmonella, E. coli O157:H7, and L. monocytogenes declined at a rate of 0.22, 0.37, and 0.59 log CFU/g/30 days, respectively, on peanuts, and at 0.15, 0.34, and 1.17 log CFU/g/30 days, respectively, on pecans. Salmonella counts were above the limit of detection (0.30 log CFU/g) throughout the study. In most cases during storage, counts obtained from pecans were higher than from peanuts.
Duan, Shaobo; Yu, Jie; Han, Zhiyu; Cheng, Zhigang; Liang, Ping
2016-01-01
Background Hepatocellular carcinoma (HCC) is one of the most common types of liver cancer. It is hypothesized that P2RX7 genetic polymorphisms have strong association with HCC susceptibility. Therefore, a case-control study was designed and performed to verify the association between P2RX7 gene polymorphisms and HCC susceptibility. Material/Methods A total of 646 subjects were recruited in our study, including 323 HCC patients and 323 healthy controls. Five gene polymorphisms, −762C>T (rs2393799), 946G>A (rs28360457), 1513A>C (rs3751143), 1068G>A (rs1718119), and 1096C>G (rs2230911), were selected. Odds ratio (ORs) and 95% confidence interval (CI) were used to quantify the association between P2RX7 gene polymorphisms and the susceptibility to HCC. All tests were performed using SPSS 20 and a 2-sided P value of less than 0.05 was considered to be statistically significant. Results Our results suggest that allelic frequencies of these 5 SNPs all conformed to Hardy-Weinberg equilibrium (HWE). There was no significant difference in genotype and allele distributions of −762C>T and 1096C>G between the case group and the control group. However, an increased risk of HCC was associated with 946G>A (A vs. G: OR=1.48, 95%CI=1.09–2.01, P=0.013; GA+AA vs. GG: OR=1.46, 95%CI=1.03–2.07, P=0.033). A similar increased risk was associated with 1513A>C polymorphism (C vs. A: OR=1.37, 95%CI=1.05–1.79, P=0.021; AC+CC vs. AA: OR=1.40, 95%CI=1.01–1.93, P=0.041). On the other hand, a decreased risk of HCC was associated with gene polymorphism of 1068G>A (A vs. G: OR=0.68, 95%CI=0.51–0.91, P=0.010; GA+AA vs. GG: OR=0.68, 95%CI=0.49–0.96, P=0.027; AA vs. GG: OR=0.42, 95%CI=0.18–0.99, P=0.048). Conclusions Our results suggest that 3 of the 5 polymorphisms of P2RX7 described above (1513A>C, 946G>A, and 1068G>A) are significantly associated with HCC susceptibility in a Chinese Han population. Studies with larger sample sizes are recommended to confirm whether our results will be applicable to different ethnic populations in China. PMID:27272229
Muntner, Paul; Vupputuri, Suma; Coresh, Josef; Uribarri, Jaime; Fox, Caroline S.
2011-01-01
Elevated serum cystatin C may represent an early stage of kidney disease. It is unclear whether metabolic abnormalities typically seen in advanced chronic kidney disease are present in adults with estimated glomerular filtration rate ≥60 ml/min/1.73m2 and elevated cystatin C. Participants of the Third National Health and Nutrition Examination Survey (n=6722) were categorized into three groups: estimated glomerular filtration rate ≥ 60 ml/min/1.73m2 and cystatin C <1.09 mg/L (normal cystatin C); estimated glomerular filtration rate ≥60 ml/min/1.73m2 and cystatin C ≥1.09 mg/L (elevated cystatin C); and estimated glomerular filtration rate of 15-59 ml/min/1.73m2 (stage 3 or 4 chronic kidney disease). Among those with normal cystatin C, elevated cystatin C, and stage 3 or 4 chronic kidney disease, the age, race-ethnicity, sex standardized prevalence of serum hemoglobin <12 g/dL (<13 g/dL for men) was 4.3%, 8.2%, and 13.8%; serum uric acid ≥ 5.9 mg/dL (≥7.4 mg/dL for men) was 12.6%, 30.0%, and 45.0%; serum homocysteine ≥13 μmol/L was 12.1%, 25.1%, and 41.0%; serum phosphorus ≥3.9 mg/dL was 17.2%, 23.2%, and 25.8%; serum albumin <3.8 mg/dL was 14.5%, 20.0%, and 20.4%; plasma fibrinogen ≥352 mg/dL was 10.5%, 21.7%, and 23.2%; and C-reactive protein ≥1.0 g/dL was 7.5%, 22.5%, and 21.6% (each p-trend<0.001). Among adults with estimated glomerular filtration rate ≥60 ml/min/1.73m2, elevated serum cystatin C is associated with an increased prevalence of several metabolic abnormalities. PMID:19295502
Addy, Nicole; Ewing, Laura; Jean-Gilles Beaubrun, Junia; Lee, YouYoung; Woo, JungHa; Negrete, Flavia; Finkelstein, Samantha; Tall, Ben D.; Lehner, Angelika; Eshwar, Athmanya; Gopinath, Gopal R.
2018-01-01
ABSTRACT Here, we present draft genome sequences of 29 Cronobacter sakazakii isolates obtained from foods of plant origin and dried-food manufacturing facilities. Assemblies and annotations resulted in genome sizes ranging from 4.3 to 4.5 Mb and 3,977 to 4,256 gene-coding sequences with G+C contents of ∼57.0%. PMID:29650569
Mu, Dashuai; Zhao, Jinxin; Wang, Zongjie; Chen, Guanjun
2016-01-01
Algoriphagus sp. NH1 is a multidrug-resistant bacterium isolated from coastal sediments of the northern Yellow Sea in China. Here, we report the draft genome sequence of NH1, with a size of 6,131,579 bp, average G+C content of 42.68%, and 5,746 predicted protein-coding sequences. PMID:26769940
Draft Genome Sequence of Lactobacillus sp. Strain TCF032-E4, Isolated from Fermented Radish.
Mao, Yuejian; Chen, Meng; Horvath, Philippe
2015-07-30
Here, we report the draft genome sequence of Lactobacillus sp. strain TCF032-E4 (= CCTCC AB2015090 = DSM 100358), isolated from a Chinese fermented radish. The total length of the 57 contigs is about 2.9 Mb, with a G+C content of 43.5 mol% and 2,797 predicted coding sequences (CDSs). Copyright © 2015 Mao et al.
Draft Genome Sequence of Photorhabdus luminescens Strain DSPV002N Isolated from Santa Fe, Argentina
Del Valle, Eleodoro E.; Frizzo, Laureano; Berry, Colin; Caballero, Primitivo
2016-01-01
Here, we report the draft genome sequence of Photorhabdus luminescens strain DSPV002N, which consists of 177 contig sequences accounting for 5,518,143 bp, with a G+C content of 42.3% and 4,701 predicted protein-coding genes (CDSs). From these, 27 CDSs exhibited significant similarity with insecticidal toxin proteins from Photorhabdus luminescens subsp. laumondii TT01. PMID:27469965
Lymphatic Regeneration within Porous VEGF-C Hydrogels for Secondary Lymphedema
2006-01-01
19a. NAME OF RESPONSIBLE PERSON USAMRMC a. REPORT U b . ABSTRACT U c. THIS PAGE U UU 16 19b. TELEPHONE NUMBER (include area code...0.22 μg/ml, B ) Ang-2 concentration of 0.67 μg/ml, C) Ang-2 concentration of and 2 μg/ml. With these initial results we determined that the...A) Normal lymphatic flow. B ) Obliteration of tail lymphatics with subsequent lymphedema formation. C) Lymphangiogenesis by transplantation
NASA Technical Reports Server (NTRS)
Guisler, Melissa; Pikuta, Elena V.; Townsend, Alisa; Hoover, Richard B.
2009-01-01
The study of a sample collected from a wind-made ice sculpture near Lake Podprudnoe, Antarctica led to the isolation of the psychrotolerant strain ISLP-3. Cells of the new isolate are vibrio-shaped that measure 0.5 x 1.0-3.0 micron in size. Growth occurs within the temperature range 5-35 C with the optimum at 22 C. Salinity range for growth is 0-2 % NaCl with the optimum at 0.25 %. The new isolate grows within a pH range from 6.0 to 9.5 with the optimum at 7.5. Strain ISLP-3 is saccharolytic, growing on the following substrates: D-glucose, D-ribose, D-fructose, D-arabinose, maltose, sucrose, D-trehalose, D-mannose, D-cellobiose, lactose, starch, chitin, triethylamine, N-acetylglucosamine, and urea. The best growth occurred on D-cellobiose. An environmental sample of pond water near a colony of the endemic species of African penguins, Spheniscus demersus, was collected in February 2008 and delivered directly to the Astrobiology laboratory at NSSTC. The microbiological study of this sample led to the isolation of two psychrotolerant strains ARHSd-7G and ARHSd-9G. Both strains are strictly anaerobic bacteria and are able to grow at high pH and low temperatures. The cells of strain ARHSd-7G are motile, vibrio-shaped, spore-forming cells. Optimal growth of this strain occurs at 30 C, 3 % NaCl, and pH 8.9. The isolate ARHSd-7G combines sugarlytic and proteolytic metabolisms, growing on some proteolysis products including peptone and yeast extract and a number of sugars. The second isolate, ARHSd-9G, exhibits thin, elongated rods that measure 0.4 x 3-5 micron. The cells are motile and spore-forming. Optimal growth of strain ARHSd-9G occurs at 30 C, 1.75 % NaCl, and pH 8.5. The strain ARHSd-9G is sugarlytic, growing well on substrates such as D-glucose, sucrose, D-cellobiose, maltose, fructose, D-mannose, and trehalose (the only exception is positive growth on yeast extract). In this report, the physiological and morphological characteristics of the novel psychrotolerant, alkaliphilic, and neutrophilic isolates from the Antarctica 2008 expedition will be discussed.
NASA Astrophysics Data System (ADS)
Guisler, Melissa; Pikuta, Elena V.; Townsend, Alisa; Hoover, Richard B.
2009-08-01
The study of a sample collected from a wind-made ice sculpture near Lake Podprudnoe, Antarctica led to the isolation of the psychrotolerant strain ISLP-3. Cells of the new isolate are vibrio-shaped that measure 0.5 x 1.0-3.0 μm in size. Growth occurs within the temperature range 5-35ºC with the optimum at 22 °C. Salinity range for growth is 0-2 % NaCl with the optimum at 0.25 %. The new isolate grows within a pH range from 6.0 to 9.5 with the optimum at 7.5. Strain ISLP-3 is saccharolytic, growing on the following substrates: D-glucose, D-ribose, D-fructose, D-arabinose, maltose, sucrose, D-trehalose, D-mannose, D-cellobiose, lactose, starch, chitin, triethylamine, N-acetylglucosamine, and urea. The best growth occurred on D-cellobiose. An environmental sample of pond water near a colony of the endemic species of African penguins, Spheniscus demersus, was collected in February 2008 and delivered directly to the Astrobiology laboratory at NSSTC. The microbiological study of this sample led to the isolation of two psychrotolerant strains ARHSd-7G and ARHSd-9G. Both strains are strictly anaerobic bacteria and are able to grow at high pH and low temperatures. The cells of strain ARHSd-7G are motile, vibrio-shaped, spore-forming cells. Optimal growth of this strain occurs at 30 ºC, 3 % NaCl, and pH 8.9. The isolate ARHSd-7G combines sugarlytic and proteolytic metabolisms, growing on some proteolysis products including peptone and yeast extract and a number of sugars. The second isolate, ARHSd-9G, exhibits thin, elongated rods that measure 0.4 x 3-5 μm. The cells are motile and spore-forming. Optimal growth of strain ARHSd-9G occurs at 30 ºC, 1.75 % NaCl, and pH 8.5. The strain ARHSd-9G is sugarlytic, growing well on substrates such as D-glucose, sucrose, D-cellobiose, maltose, fructose, D-mannose, and trehalose (the only exception is positive growth on yeast extract). In this report, the physiological and morphological characteristics of the novel psychrotolerant, alkaliphilic, and neutrophilic isolates from the Antarctica 2008 expedition will be discussed.
Zhang, Hongmei; Qi, Yan; Wang, Lei; Zhang, Shaokang; Deng, Xiangyu
2017-12-18
Salmonella survival was characterized and modeled during thermal dehydration of fresh garlic and storage of dehydrated garlic products. In our experiments that simulated commercial dehydration processing at 80±5°C, moderate level of Salmonella contamination (4-5logCFU/g) on fresh garlic was reduced below the enumeration limit (1.7logCFU/g) after 4.5h of dehydration and not detectable by culture enrichment after 7h. With high level of contamination (7-8logCFU/g), the Salmonella population persisted at 3.6logCFU/g after 8h of processing. By increasing the dehydration temperature to 90±5°C, the moderate and high levels of initial Salmonella load on fresh garlic dropped below the enumeration limit after 1.5 and 3.75h of processing and became undetectable by culture enrichment after 2.5 and 6h, respectively. During the storage of dried garlic products, Salmonella was not able to grow under all tested combinations of temperature (25 and 35°C) and water activity (0.56-0.98) levels, suggesting active inhibition. Storage temperature played a primary role in determining Salmonella survival on dehydrated garlic flakes. Under a typical storage condition at 25°C and ambient relative humidity, Salmonella could persist over months with the population gradually declining (4.3 log reduction over 88days). Granular size of dehydrated garlic had an impact on Salmonella survival, with better survival of the pathogen observed in bigger granules. At the early stage of dehydrated garlic storage (until 7days), rising water activity appeared to initially promote but then inhibited Salmonella survival, resulting in a water activity threshold at 0.73 where Salmonella displayed strongest persistence. However, this phenomenon was less apparent during extended storage (after 14days). Copyright © 2017 Elsevier B.V. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Matyas, Josef; Robinson, Matthew J.; Fryxell, Glen E.
Materials are being developed in U.S. for the removal and immobilization of iodine from gaseous products of nuclear fuel reprocessing in support of the Fuel Cycle Technology Separations and Waste Forms Campaign. The silver-functionalized silica aerogel proved to be an excellent candidate for this treatment because of its high selectivity and sorption capacity for radioiodine and its possible conversion to a durable silica-based waste form. The present study investigated with nitrogen sorption and helium pycnometry the effect of pressureless isothermal sintering at temperatures of 900-1400°C for 2.5-90 min or isothermal hot-pressing at 1200°C for 2.5 min on densification of rawmore » and silver-functionalized silica aerogel granules. Rapid sintering was observed at 1050 and 1200°C. Only 15 min of pressureless sintering at 1200°C resulted in almost complete densification. The macropores disappeared, surface area decreased from 1114 m2/g to 25 m2/g, pore volume from 7.41 cm3/g to 0.09 cm3/g, and adsorption pore size from 18.7 to 7 nm. The skeletal density of sintered granules was similar to the bulk density of amorphous silica (2.2 g/cm3). The hot-pressing accelerated the sintering process, decreasing significantly the pore size and volume.« less
Ambient air pollution exposure and full-term birth weight in California.
Morello-Frosch, Rachel; Jesdale, Bill M; Sadd, James L; Pastor, Manuel
2010-07-28
Studies have identified relationships between air pollution and birth weight, but have been inconsistent in identifying individual pollutants inversely associated with birth weight or elucidating susceptibility of the fetus by trimester of exposure. We examined effects of prenatal ambient pollution exposure on average birth weight and risk of low birth weight in full-term births. We estimated average ambient air pollutant concentrations throughout pregnancy in the neighborhoods of women who delivered term singleton live births between 1996 and 2006 in California. We adjusted effect estimates of air pollutants on birth weight for infant characteristics, maternal characteristics, neighborhood socioeconomic factors, and year and season of birth. 3,545,177 singleton births had monitoring for at least one air pollutant within a 10 km radius of the tract or ZIP Code of the mother's residence. In multivariate models, pollutants were associated with decreased birth weight; -5.4 grams (95% confidence interval -6.8 g, -4.1 g) per ppm carbon monoxide, -9.0 g (-9.6 g, -8.4 g) per pphm nitrogen dioxide, -5.7 g (-6.6 g, -4.9 g) per pphm ozone, -7.7 g (-7.9 g, -6.6 g) per 10 microg/m3 particulate matter under 10 microm, -12.8 g (-14.3 g, -11.3 g) per 10 microg/m3 particulate matter under 2.5 microm, and -9.3 g (-10.7 g, -7.9 g) per 10 microg/m3 of coarse particulate matter. With the exception of carbon monoxide, estimates were largely unchanged after controlling for co-pollutants. Effect estimates for the third trimester largely reflect the results seen from full pregnancy exposure estimates; greater variation in results is seen in effect estimates specific to the first and second trimesters. This study indicates that maternal exposure to ambient air pollution results in modestly lower infant birth weight. A small decline in birth weight is unlikely to have clinical relevance for individual infants, and there is debate about whether a small shift in the population distribution of birth weight has broader health implications. However, the ubiquity of air pollution exposures, the responsiveness of pollutant levels to regulation, and the fact that the highest pollution levels in California are lower than those regularly experienced in other countries suggest that precautionary efforts to reduce pollutants may be beneficial for infant health from a population perspective.
Nadimi, Maryam; Daubois, Laurence; Hijri, Mohamed
2016-05-01
Mitochondrial (mt) genes, such as cytochrome C oxidase genes (cox), have been widely used for barcoding in many groups of organisms, although this approach has been less powerful in the fungal kingdom due to the rapid evolution of their mt genomes. The use of mt genes in phylogenetic studies of Dikarya has been met with success, while early diverging fungal lineages remain less studied, particularly the arbuscular mycorrhizal fungi (AMF). Advances in next-generation sequencing have substantially increased the number of publically available mtDNA sequences for the Glomeromycota. As a result, comparison of mtDNA across key AMF taxa can now be applied to assess the phylogenetic signal of individual mt coding genes, as well as concatenated subsets of coding genes. Here we show comparative analyses of publically available mt genomes of Glomeromycota, augmented with two mtDNA genomes that were newly sequenced for this study (Rhizophagus irregularis DAOM240159 and Glomus aggregatum DAOM240163), resulting in 16 complete mtDNA datasets. R. irregularis isolate DAOM240159 and G. aggregatum isolate DAOM240163 showed mt genomes measuring 72,293bp and 69,505bp with G+C contents of 37.1% and 37.3%, respectively. We assessed the phylogenies inferred from single mt genes and complete sets of coding genes, which are referred to as "supergenes" (16 concatenated coding genes), using Shimodaira-Hasegawa tests, in order to identify genes that best described AMF phylogeny. We found that rnl, nad5, cox1, and nad2 genes, as well as concatenated subset of these genes, provided phylogenies that were similar to the supergene set. This mitochondrial genomic analysis was also combined with principal coordinate and partitioning analyses, which helped to unravel certain evolutionary relationships in the Rhizophagus genus and for G. aggregatum within the Glomeromycota. We showed evidence to support the position of G. aggregatum within the R. irregularis 'species complex'. Copyright © 2016 Elsevier Inc. All rights reserved.
Madhaiyan, Munusamy; Poonguzhali, Selvaraj
2014-02-01
A pink-pigmented, Gram negative, aerobic, facultatively methylotrophic bacterium, strain BL44(T), was isolated from bamboo leaves and identified as a member of the genus Methylobacterium. Phylogenetic analysis based on 16S rRNA gene sequences showed similarity values of 98.7-97.0 % with closely related type strains and showed highest similarity to Methylobacterium zatmanii DSM 5688(T) (98.7 %) and Methylobacterium thiocyanatum DSM 11490(T) (98.7 %). Methylotrophic metabolism in this strain was confirmed by PCR amplification and sequencing of the mxaF gene coding for the α-subunit of methanol dehydrogenase. Strain BL44(T) produced three known quorum sensing signal molecules with similar retention time to C8, C10 and C12-HSLs when characterized by GC-MS. The fatty acid profiles contained major amounts of C18:1 ω7c, iso-3OH C17:0 and summed feature 3 (C16:1 ω7c and/or iso-C15:0 2-OH), which supported the grouping of the isolate in the genus Methylobacterium. The DNA G+C content was 66.9 mol%. DNA relatedness of the strain BL44(T) to its most closely related strains ranged from 12-43.3 %. On the basis of the phenotypic, phylogenetic and DNA-DNA hybridization data, strain BL44(T) is assigned to a novel species of the genus Methylobacterium for which the name Methylobacterium pseudosasae sp. nov. is proposed (type strain BL44(T) = NBRC 105205(T) = ICMP 17622(T)).
Highly selective BSA imprinted polyacrylamide hydrogels facilitated by a metal-coding MIP approach.
El-Sharif, H F; Yapati, H; Kalluru, S; Reddy, S M
2015-12-01
We report the fabrication of metal-coded molecularly imprinted polymers (MIPs) using hydrogel-based protein imprinting techniques. A Co(II) complex was prepared using (E)-2-((2 hydrazide-(4-vinylbenzyl)hydrazono)methyl)phenol; along with iron(III) chloroprotoporphyrin (Hemin), vinylferrocene (VFc), zinc(II) protoporphyrin (ZnPP) and protoporphyrin (PP), these complexes were introduced into the MIPs as co-monomers for metal-coding of non-metalloprotein imprints. Results indicate a 66% enhancement for bovine serum albumin (BSA) protein binding capacities (Q, mg/g) via metal-ion/ligand exchange properties within the metal-coded MIPs. Specifically, Co(II)-complex-based MIPs exhibited 92 ± 1% specific binding with Q values of 5.7 ± 0.45 mg BSA/g polymer and imprinting factors (IF) of 14.8 ± 1.9 (MIP/non-imprinted (NIP) control). The selectivity of our Co(II)-coded BSA MIPs were also tested using bovine haemoglobin (BHb), lysozyme (Lyz), and trypsin (Tryp). By evaluating imprinting factors (K), each of the latter proteins was found to have lower affinities in comparison to cognate BSA template. The hydrogels were further characterised by thermal analysis and differential scanning calorimetry (DSC) to assess optimum polymer composition. The development of hydrogel-based molecularly imprinted polymer (HydroMIPs) technology for the memory imprinting of proteins and for protein biosensor development presents many possibilities, including uses in bio-sample clean-up or selective extraction, replacement of biological antibodies in immunoassays and biosensors for medicine and the environment. Biosensors for proteins and viruses are currently expensive to develop because they require the use of expensive antibodies. Because of their biomimicry capabilities (and their potential to act as synthetic antibodies), HydroMIPs potentially offer a route to the development of new low-cost biosensors. Herein, a metal ion-mediated imprinting approach was employed to metal-code our hydrogel-based MIPs for the selective recognition of bovine serum albumin (BSA). Specifically, Co(II)-complex based MIPs exhibited a 66% enhancement (in comparison to our normal MIPs) exhibiting 92 ± 1% specific binding with Q values of 5.7 ± 0.45 mg BSA/g polymer and imprinting factors (IF) of 14.8 ± 1.9 (MIP/ non-imprinted (NIP) control). The proposed metal-coded MIPs for protein recognition are intended to lead to unprecedented improvement in MIP selectivity and for future biosensor development that rely on an electrochemical redox processes. Copyright © 2015 Acta Materialia Inc. Published by Elsevier Ltd. All rights reserved.
39 CFR Appendix A to Part 121 - Tables Depicting Service Standard Day Ranges
Code of Federal Regulations, 2011 CFR
2011-07-01
... 1-3 (AK)7 (JNU) 7 (KTN) 1 (HI)7 (GU) 1-2 1-2 6-7 5-6 Standard Mail 2 3 3 3-4 10 10 9 Package Services 1 2 2 2-3 8 8 7 AK = Alaska 3-digit ZIP Codes 995-997; JNU = Juneau AK 3-digit ZIP Code 998; KTN = Ketchikan AK 3-digit ZIP Code 999; HI = Hawaii 3-digit ZIP Codes 967 and 968; GU = Guam 3-digit ZIP Code 969...
39 CFR Appendix A to Part 121 - Tables Depicting Service Standard Day Ranges
Code of Federal Regulations, 2010 CFR
2010-07-01
... 1-3 (AK)7 (JNU) 7 (KTN) 1 (HI)7 (GU) 1-2 1-2 6-7 5-6 Standard Mail 2 3 3 3-4 10 10 9 Package Services 1 2 2 2-3 8 8 7 AK = Alaska 3-digit ZIP Codes 995-997; JNU = Juneau AK 3-digit ZIP Code 998; KTN = Ketchikan AK 3-digit ZIP Code 999; HI = Hawaii 3-digit ZIP Codes 967 and 968; GU = Guam 3-digit ZIP Code 969...
Antibacterial effect of lactoferricin B on Escherichia coli O157:H7 in ground beef.
Venkitanarayanan, K S; Zhao, T; Doyle, M P
1999-07-01
The antibacterial activity of lactoferricin B on enterohemorrhagic Escherichia coli O157:H7 in 1% peptone medium and ground beef was studied at 4 and 10 degrees C. In 1% peptone medium, 50 and 100 microg of lactoferricin B per ml reduced E. coli O157:H7 populations by approximately 0.7 and 2.0 log CFU/ml, respectively. Studies comparing the antibacterial effect of lactoferricin B on E. coli O157:H7 in 1% peptone at pH 5.5 and 7.2 did not reveal any significant difference (P > 0.5) at the two pH values. Lactoferricin B (100 microg/g) reduced E. coli O157:H7 population in ground beef by about 0.8 log CFU/g (P < 0.05). No significant difference (P > 0.5) was observed in the total plate count between treatment and control ground beef samples stored at 4 and 10 degrees C. The antibacterial effect of lactoferricin B on E. coli O157:H7 observed in this study is not of sufficient magnitude to merit its use in ground beef for controlling the pathogen.
Lewis, Melanie J.; Wagner, Bettina; Woof, Jenny M.
2008-01-01
Recombinant versions of the seven equine IgG subclasses were expressed in CHO cells. All assembled into intact immunoglobulins stabilised by disulphide bridges, although, reminiscent of human IgG4, a small proportion of equine IgG4 and IgG7 were held together by non-covalent bonds alone. All seven IgGs were N-glycosylated. In addition IgG3 appeared to be O-glycosylated and could bind the lectin jacalin. Staphylococcal protein A displayed weak binding for the equine IgGs in the order: IgG1 > IgG3 > IgG4 > IgG7 > IgG2 = IgG5 > IgG6. Streptococcal protein G bound strongly to IgG1, IgG4 and IgG7, moderately to IgG3, weakly to IgG2 and IgG6, and not at all to IgG5. Analysis of antibody effector functions revealed that IgG1, IgG3, IgG4, IgG5 and IgG7, but not IgG2 and IgG6, were able to elicit a strong respiratory burst from equine peripheral blood leukocytes, predicting that the former five IgG subclasses are able to interact with Fc receptors on effector cells. IgG1, IgG3, IgG4 and IgG7, but not IgG2, IgG5 and IgG6, were able to bind complement C1q and activate complement via the classical pathway. The differential effector function capabilities of the subclasses suggest that, for maximum efficacy, equine vaccine strategies should seek to elicit antibody responses of the IgG1, IgG3, IgG4, and IgG7 subclasses. PMID:17669496
Niabella hibiscisoli sp. nov., isolated from soil of a Rose of Sharon garden.
Ngo, Hien T T; Trinh, Huan; Yan, Zheng-Fei; Moya, Gabriela; Kook, MooChang; Yi, Tae-Hoo
2017-04-01
A Gram-stain-negative, strictly aerobic, non-motile, rod-shaped and yellow-pigmented bacterium, designated strain THG-DN5.5T, was isolated from soil of a Rose of Sharon garden in Daejeon, South Korea. According to 16S rRNA gene sequence comparisons, strain THG-DN5.5T was found to be most closely related to Niabella yanshanensis CCBAU 05354T (97.7 % sequence similarity), Niabella ginsengisoli GR10-1T (97.0 %), 'Niabella terrae' ICM 1-15 (96.0 %), Niabella soli DSM 19437T (95.7 %) and Niabella aquatica RP-2T (95.6 %). The DNA-DNA relatedness between strain THG-DN5.5T and its phylogenetically closest neighbours was below 50.0 %. The DNA G+C content was 43.1 mol%. The major polar lipid of strain THG-DN5.5T was found to be phosphatidylethanolamine. The major fatty acids were identified as C16 : 0, iso-C15 : 0, iso-C15 : 1 G, and iso-C17 : 0 3-OH. MK-7 was the only menaquinone present. These data supported the affiliation of strain THG-DN5.5T to the genus Niabella. Strain THG-DN5.5T was distinguished from related species of the genus Niabellaby physiological and biochemical tests. In conclusion, strain THG-DN5.5T represents a novel species of the genus Niabella, for which the name Niabella hibiscisolisp. nov. is proposed. The type strain is THG-DN5.5T (=KACC 18857T=CCTCC AB 2016086T).
Into the Wind, Against the Tide: Change and the Operational Commander
1994-02-08
j~y ~LY T.C&.C4C SAV "RE 0 DOCUMENTATION AD-A279 635 * -~l; .,Ec*. Ty~’ CA/S5;; CA7:GS Ab RZESiR.CT;Vd A - 27 3 * tUNCLASSIFIED D C.. * -...... €v...Z ;U -C -DISTRIBUTION STATEMENT A : APPROVED FOR . DECLASS CAT:Cr. . PUBLIC RELEASE; DISTRIBUTION IS UNLIMITED. E.NAMY -FPRO~N RAN ZA- ON NAME...this .... . e~efsc~ ..... ,71 p .... ,,--’ a -1 .b --,r,,,-t n ecessarily a ,.-. d ’-,y ’-,e .=avo.=* ,,at 1;. COSATI CODES 18. SU ECt TERIMS (Continue
Jo, Changshin; An, Sunhyung; Kim, Younghoon; Shim, Jongmin; Yoon, Songhun; Lee, Jinwoo
2012-04-28
Mesocellular carbon foam (MSU-F-C) is functionalized with hollow nanographite by a simple solution-phase method to enhance the intrapenetrating electrical percolation network. The electrical conductivity of the resulting material, denoted as MSU-F-C-G, is increased by a factor of 20.5 compared with the pristine MSU-F-C. Hollow graphite nanoparticles are well-dispersed in mesocellular carbon foam, as confirmed by transmission electron microscopy (TEM), and the d spacing of the (002) planes is 0.343 nm, which is only slightly larger than that of pure graphite (0.335 nm), suggesting a random combination of graphitic and turbostratic stacking. After nanographitic functionalization, the BET surface area and total pore volume decreased from 928 m(2) g(-1) and 1.5 cm(3) g(-1) to 394 m(2) g(-1) and 0.7 cm(3) g(-1), respectively. Thermogravimetric analysis in air shows that the thermal stability of MSU-F-C-G is improved relative to that of MSU-F-C, and the one-step weight loss indicates that the nanographite is homogeneously functionalized on the MSU-F-C particles. When the resulting mesocellular carbon materials are used as electrode materials for an electric double layer capacitor (EDLC), the specific capacitances (C(sp)) of the MSU-F-C and MSU-F-C-G electrodes at 4 mV s(-1) are 109 F g(-1) and 93 F g(-1), respectively. The MSU-F-C-G electrode exhibited a very high area capacitance (C(area), 23.5 μF cm(-2)) compared with that of the MSU-F-C electrode (11.7 μF cm(-2)), which is attributed to the enhanced intraparticle conductivity by the nanographitic functionalization. MSU-F-C-G exhibited high capacity retention (52%) at a very high scan rate of 512 mV s(-1), while only a 23% capacity retention at 512 mV s(-1) was observed in the case of the MSU-F-C electrode. When applied as an anode in a lithium ion battery, a significant increase in the initial efficiency (44%), high reversible discharge capacity (580 mA h g(-1)) in the lower voltage region, and a higher rate capability were observed. The high rate capability of the MSU-F-C-G electrode as charge storage was due to the low resistance derived from the nanographitic functionalization. This journal is © the Owner Societies 2012
Burra, Srinivas; Voora, Vani; Rao, Ch Prasad; Vijay Kumar, P; Kancha, Rama Krishna; David Krupadanam, G L
2017-09-15
Forskolin C 1 -isoxazole derivatives (3,5-regioisomers) (11a-e, 14, 15a-h and 15, 16a-g) were synthesized regioselectively by adopting 1,3-dipolar cycloadditions. These derivatives were tested using estrogen receptor positive breast cancer cell lines MCF-7 and BT-474. Majority of the compounds exhibited activity against the p53-positive MCF-7 breast cancer cells but not against the p53-negative BT-474 breast cancer cells. Among forskolin derivatives, compounds 11a, 11c, 14a, 14f, 14g, 14h, 15b, 16g and 17b exhibited higher anti-cancer activity against MCF-7 cell line with an IC 50 ≤1µM. The derivative 14f exhibited highest activity in both p53-positive (MCF-7) and p53-negative (BT-474) breast cancer cell lines with an IC 50 of 0.5µM. Copyright © 2017. Published by Elsevier Ltd.
1988-08-01
OFFICE SYMBOL 7a NAME OF MONITORING ORGANIZATION U.S. Army Construction (if applicable) Engr Research Laboratory CECER-EN 6c. ADDRESS (City, State...and ZIP Code) 7b ADDRESS (City, State, and ZIP Code) P.O. Box 4005 Champaign, IL 61821 8a. NAME OF FUNDING/SPONSORING 8b OFFICE SYMBOL 9 PROCUREMENT...NAME OF RESPONSIBLE INDIVIDUAL 22b TELEPHONE (Include Area Code) 22c OFFICE SYMBOL Jane Andrew 1(217) 352-6511, x388 CECER-IMT DD FORM 1473. 84 MAR 83
Hymenobacter seoulensis sp. nov., isolated from river water.
Lee, Jae-Jin; Lee, Yeon-Hee; Park, Su-Jin; Lee, Seung-Yeol; Park, Sangkyu; Kim, Myung Kyum; Ten, Leonid N; Jung, Hee-Young
2017-04-01
A Gram-stain-negative, aerobic, rod-shaped, non-motile and pink-pigmented bacterial strain, designated 16F7GT, was isolated from river water. Phylogenetic analysis based on 16S rRNA gene sequences indicated that strain 16F7GT belongs to the genus Hymenobacter. The 16S rRNA gene sequence similarity to members of the genus Hymenobacter ranged from 90.5 to 97.4 %, and the most closely related strains were Hymenobacter rigui WPCB131T (97.4 %) and Hymenobacter xinjiangensis X2-1gT (97.3 %). Strain 16F7GT had <70 % DNA-DNA relatedness with H. rigui (32.8±7.8 %) and H. xinjiangensis (30.2±6.2 %), indicating that it represents a novel genospecies. Cells were catalase- and oxidase-positive. The genomic DNA G+C content was 56.6 mol%. The major fatty acids were summed feature 4 (C17 : 1iso I/C17 : 1 anteiso B; 19.8 %), summed feature 3 (C16 : 1ω7c/C16 : 1ω6c; 18.4 %), C15 : 0 iso (17.0 %), C16 : 1ω5c (11.8 %) and C15 : 0 anteiso (9.8 %). The major polar lipid was phosphatidylethanolamine and the predominant respiratory quinone was menaquinone 7 (MK-7). Based on the phylogenetic, phenotypic, genotypic and chemotaxonomic analyses, it is concluded that strain 16F7GT represents a novel species within the genus Hymenobacter, for which the name Hymenobacter seoulensis sp. nov. is proposed. The type strain is 16F7GT (=KCTC 52197T=JCM 31655T).
Furuhata, Katsunori; Goto, Keiichi; Kato, Yuko; Saitou, Keiko; Sugiyama, Jun-ichi; Hara, Motonobu; Yoshida, Shin-ichi; Fukuyama, Masafumi
2007-01-01
Strain K-20, a Gram-negative, non-motile, non-spore-forming and strictly aerobic rod, which produces a pale pink pigment, was isolated from biofilm in a cooling tower in Tokyo, Japan. The taxonomic feature of the strain was studied using phenotypic tests and phylogenetic analysis. Phylogenetic analysis of 16S rRNA gene sequences showed that the strain was related to Roseomonas gilardii subsp. rosea, Roseomonas gilardii subsp. gilardii, Roseomonas cervicalis and Roseomonas mucosa at 94.3-94.6 sequence similarities. Growth occurred at 25-40 C and pH 5.0-10.0, optimal at 35 C and pH 7.0. Growth did not occur in the presence of >or=2% NaCl. The API 20NE identification system gave a positive result for urease, L-arabinose, potassium gluconate, adipic acid, malic acid and trisodium citrate (API code number 0201465). The predominant fatty acids of strain K-20 were C18:1Delta11 (50.8%) and C16:1 (17.2%). Cells contained ubiquinone 10 (Q-10) as the major quinone and the G+C content was 72.0 mol%. Based on phenotypic, chemotaxonomic and phylogenetic data, it was assumed that strain K-20 (=JCM 14634) is a novel species of the genus Roseomonas.
Liu, Yang; Betti, Mirko; Gänzle, Michael G
2012-03-01
This study evaluated the high pressure inactivation of Campylobacter jejuni, Escherichia coli, and poultry meat spoilage organisms. All treatments were performed in aseptically prepared minced poultry meat. Treatment of 19 strains of C. jejuni at 300 MPa and 30°C revealed a large variation of pressure resistance. The recovery of pressure-induced sublethally injured C. jejuni depended on the availability of iron. The addition of iron content to enumeration media was required for resuscitation of sublethally injured cells. Survival of C. jejuni during storage of refrigerated poultry meat was analyzed in fresh and pressuretreated poultry meat, and in the presence or absence of spoilage microbiota. The presence of spoilage microbiota did not significantly influence the survival of C. jejuni. Pressure treatment at 400 MPa and 40°C reduced cell counts of Brochothrix thermosphacta, Carnobacterium divergens, C. jejuni, and Pseudomonas fluorescens to levels below the detection limit. Cell counts of E. coli AW1.7, however, were reduced by only 3.5 log (CFU/g) and remained stable during subsequent refrigerated storage. The resistance to treatment at 600 MPa and 40°C of E. coli AW1.7 was compared with Salmonella enterica, Shiga toxin-producing E. coli and nonpathogenic E. coli strains, and Staphylococcus spp. Cell counts of all organisms except E. coli AW 1.7 were reduced by more than 6 log CFU/g. Cell counts of E. coli AW1.7 were reduced by 4.5 log CFU/g only. Moreover, the ability of E. coli AW1.7 to resist pressure was comparable to the pressure-resistant mutant E. coli LMM1030. Our results indicate that preservation of fresh meat requires a combination of high pressure with high temperature (40 to 60°C) or other antimicrobial hurdles.
Shirai, Ken; Watanabe, Kenichi; Ma, Meilei; Wahed, Mir I I; Inoue, Mikio; Saito, Yuki; Suresh, Palaniyandi Selvaraj; Kashimura, Takeshi; Tachikawa, Hitoshi; Kodama, Makoto; Aizawa, Yoshifusa
2005-01-01
We examined effects of an angiotensin-II receptor blockers, candesartan cilexetil, in rats with dilated cardiomyopathy after autoimmune myocarditis. Candesartan cilexetil showed angiotensin-II blocking action in a dose-dependent manner in rats with dilated cardiomyopathy. Twenty-eight days after immunization, surviving Lewis rats were divided into four groups and given candesartan cilexetil at 0.05 mg/kg, 0.5 mg/kg or 5 mg/kg per day (Group-C0.05, n = 15, Group-C0.5, n = 15 and Group-C5, n = 15, respectively) or vehicle alone (Group-V, n = 15). After oral administration for 1 month, the left ventricular end-diastolic pressure and heart weight/body weight ratio were lower in Group-C0.05 (13.3+/-1.1 mmHg and 3.7+/-0.2 g/kg, respectively), in Group-C0.5 (8.0+/-0.9 mmHg and 3.3+/-0.1 g/kg, respectively) and in Group-C5 (5.5+/-1 mmHg and 3.1+/-0.1 g/kg, respectively) than in Group-V (13.5+/-1.0 mmHg and 3.8+/-0.2 g/kg, respectively). The area of myocardial fibrosis was also lower in Group-C0.05 (25+/-3%), in Group-C0.5 (20+/-3%), and in Group-C5 (12+/-1%) than in Group-V (32+/-4%). Furthermore, expressions of transforming growth factor-beta1 and collagen-III mRNA were suppressed in Group-C0.05 (349+/-23% and 395+/-22%, respectively), Group-C0.5 (292+/-81% and 364+/-42%, respectively) and in Group-C5 (204+/-63% and 259+/-33%, respectively) compared with those in Group-V (367+/-26% and 437+/-18%, respectively). These results suggest that candesartan cilexetil can improve the function of inefficient heart.
Deinococcus antarcticus sp. nov., isolated from soil.
Dong, Ning; Li, Hui-Rong; Yuan, Meng; Zhang, Xiao-Hua; Yu, Yong
2015-02-01
A pink-pigmented, non-motile, coccoid bacterial strain, designated G3-6-20(T), was isolated from a soil sample collected in the Grove Mountains, East Antarctica. This strain was resistant to UV irradiation (810 J m(-2)) and slightly more sensitive to desiccation as compared with Deinococcus radiodurans. Phylogenetic analyses based on the 16S rRNA gene sequence of the isolate indicated that the organism belongs to the genus Deinococcus. Highest sequence similarities were with Deinococcus ficus CC-FR2-10(T) (93.5 %), Deinococcus xinjiangensis X-82(T) (92.8 %), Deinococcus indicus Wt/1a(T) (92.5 %), Deinococcus daejeonensis MJ27(T) (92.3 %), Deinococcus wulumuqiensis R-12(T) (92.3 %), Deinococcus aquaticus PB314(T) (92.2 %) and Deinococcus radiodurans DSM 20539(T) (92.2 %). Major fatty acids were C18 : 1ω7c, summed feature 3 (C16 : 1ω7c and/or C16 : 1ω6c), anteiso-C15 : 0 and C16 : 0. The G+C content of the genomic DNA of strain G3-6-20(T) was 63.1 mol%. Menaquinone 8 (MK-8) was the predominant respiratory quinone. Based on its phylogenetic position, and chemotaxonomic and phenotypic characteristics, strain G3-6-20(T) represents a novel species of the genus Deinococcus, for which the name Deinococcus antarcticus sp. nov. is proposed. The type strain is G3-6-20(T) ( = DSM 27864(T) = CCTCC AB 2013263(T)). © 2015 IUMS.
Algorithm for Surface of Translation Attached Radiators (A-STAR). Volume III. Computer Codes.
1982-05-01
SEGMENT ARRAYS* C2075 CCPMCN /83jTI 44DDFNPTNBAND C2080 COM MCN IBDT21 N’,RL.YR(831, yS(83)eYS1(82).XB1(82) C2085 COMMON /GOT?/ 14(82)PSVt .12).CVt82 C2090...i a.4 ZZaZ lti 12 )-ZCI CI 10 RH020 . XNXX +VV*VV*ZZ*ZZ 2’ REaS REINZ 4 A3mA IUC 49CEXPI-U*SK*ER R14.IP I RR 8 CEDGE(SOT j-E(OOE(CA IMPEOANCE ELEMENTS...FvAv.S~%Lt IAXpSIIs PINER) 57*f ?C ********* ************* i5?C COM ~PLEX SIFIPSON INTEGRATION RflUTINE.j7 i N E.x,!& pSvsIPK Il~~i Agj:;)2c.19v20 5ON
Liu, Pengzhan; Kallio, Heikki; Yang, Baoru
2011-10-26
Phenolics in the fruits and leaves of Crataegus grayana were identified by HPLC-UV-ESI-MS. The contents of these compounds and their changes during autumn were also analyzed. Epicatechin [1-7 mg/g dry mass (DM) in fruits and 1-10 mg/g DM in leaves), procyanidins B2 (2-4 and 1-8 mg/g DM) and C1 (2-4 and 1-8 mg/g DM), hyperoside (0.5-1 and 2-11 mg/g DM), and a quercetin-pentoside (0.3-0.5 and 2-6 mg/g DM) were the major phenolics in both fruits and leaves. C-Glycosyl flavones were present in leaves (2-5 mg/g DM), whereas only trace levels were found in fruits. Ideain and 5-O-caffeoylquinic acid were found only in fruits. An additional 11 phenolics were identified/tentatively identified. Total phenolic contents reached highest levels by the end of August in fruits and by the end of September in leaves. The compositional profiles of phenolics in fruits and leaves of C. grayana were different from those of other Crataegus species.
7 CFR 271.8 - Information collection/recordkeeping-OMB assigned control numbers.
Code of Federal Regulations, 2011 CFR
2011-01-01
...) 0584-0124 273.11 (a), (b), (c), (d), (e), (f), (h) 0584-0064 273.11 (g) 0584-0334 273.11 (i) (1)-(4... 273.18 (i) 0584-0053 273.21 (a), (c), (e), (f), (g), (h), (i), (j), (m), (p), (q) 0584-0064 274.1 (c...), (h) 0584-0083 278.1 (a), (b), (l) 0584-0008 278.1 (e), (f) 0584-0064 278.4 (b), (c) 0584-0085 278.5...