Strategies to Improve Efficiency and Specificity of Degenerate Primers in PCR.
Campos, Maria Jorge; Quesada, Alberto
2017-01-01
PCR with degenerate primers can be used to identify the coding sequence of an unknown protein or to detect a genetic variant within a gene family. These primers, which are complex mixtures of slightly different oligonucleotide sequences, can be optimized to increase the efficiency and/or specificity of PCR in the amplification of a sequence of interest by the introduction of mismatches with the target sequence and balancing their position toward the primers 5'- or 3'-ends. In this work, we explain in detail examples of rational design of primers in two different applications, including the use of specific determinants at the 3'-end, to: (1) improve PCR efficiency with coding sequences for members of a protein family by fully degeneration at a core box of conserved genetic information, with the reduction of degeneration at the 5'-end, and (2) optimize specificity of allelic discrimination of closely related orthologous by 5'-end degenerate primers.
PCR Amplicon Prediction from Multiplex Degenerate Primer and Probe Sets
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gardner, S. N.
2013-08-08
Assessing primer specificity and predicting both desired and off-target amplification products is an essential step for robust PCR assay design. Code is described to predict potential polymerase chain reaction (PCR) amplicons in a large sequence database such as NCBI nt from either singleplex or a large multiplexed set of primers, allowing degenerate primer and probe bases, with target mismatch annotates amplicons with gene information automatically downloaded from NCBI, and optionally it can predict whether there are also TaqMan/Luminex probe matches within predicted amplicons.
MRPrimerV: a database of PCR primers for RNA virus detection
Kim, Hyerin; Kang, NaNa; An, KyuHyeon; Kim, Doyun; Koo, JaeHyung; Kim, Min-Soo
2017-01-01
Many infectious diseases are caused by viral infections, and in particular by RNA viruses such as MERS, Ebola and Zika. To understand viral disease, detection and identification of these viruses are essential. Although PCR is widely used for rapid virus identification due to its low cost and high sensitivity and specificity, very few online database resources have compiled PCR primers for RNA viruses. To effectively detect viruses, the MRPrimerV database (http://MRPrimerV.com) contains 152 380 247 PCR primer pairs for detection of 1818 viruses, covering 7144 coding sequences (CDSs), representing 100% of the RNA viruses in the most up-to-date NCBI RefSeq database. Due to rigorous similarity testing against all human and viral sequences, every primer in MRPrimerV is highly target-specific. Because MRPrimerV ranks CDSs by the penalty scores of their best primer, users need only use the first primer pair for a single-phase PCR or the first two primer pairs for two-phase PCR. Moreover, MRPrimerV provides the list of genome neighbors that can be detected using each primer pair, covering 22 192 variants of 532 RefSeq RNA viruses. We believe that the public availability of MRPrimerV will facilitate viral metagenomics studies aimed at evaluating the variability of viruses, as well as other scientific tasks. PMID:27899620
Primer development to obtain complete coding sequence of HA and NA genes of influenza A/H3N2 virus.
Agustiningsih, Agustiningsih; Trimarsanto, Hidayat; Setiawaty, Vivi; Artika, I Made; Muljono, David Handojo
2016-08-30
Influenza is an acute respiratory illness and has become a serious public health problem worldwide. The need to study the HA and NA genes in influenza A virus is essential since these genes frequently undergo mutations. This study describes the development of primer sets for RT-PCR to obtain complete coding sequence of Hemagglutinin (HA) and Neuraminidase (NA) genes of influenza A/H3N2 virus from Indonesia. The primers were developed based on influenza A/H3N2 sequence worldwide from Global Initiative on Sharing All Influenza Data (GISAID) and further tested using Indonesian influenza A/H3N2 archived samples of influenza-like illness (ILI) surveillance from 2008 to 2009. An optimum RT-PCR condition was acquired for all HA and NA fragments designed to cover complete coding sequence of HA and NA genes. A total of 71 samples were successfully sequenced for complete coding sequence both of HA and NA genes out of 145 samples of influenza A/H3N2 tested. The developed primer sets were suitable for obtaining complete coding sequences of HA and NA genes of Indonesian samples from 2008 to 2009.
A Nested-Splicing by Overlap Extension PCR Improves Specificity of this Standard Method.
Karkhane, Ali Asghar; Yakhchali, Bagher; Rastgar Jazii, Ferdous; Bambai, Bijan; Aminzadeh, Saeed; Rahimi, Fatemeh
2015-06-01
Splicing by overlap extension (SOE) PCR is used to create mutation in the coding sequence of an enzyme in order to study the role of specific residues in protein's structure and function. We introduced a nested-SOE-PCR (N -SOE-PCR) in order to increase the specificity and generating mutations in a gene by SOE-PCR. Genomic DNA from Bacillus thermocatenulatus was extracted. Nested PCR was used to amplify B. thermocatenulatus lipase gene variants, namely wild type and mutant, using gene specific and mutagenic specific primers, followed by cloning in a suitable vector. Briefly in N-SOE-PCR method, instead of two pairs of primers, three pairs of primers are used to amplify a mutagenic fragment. Moreover, the first and second PCR products are slightly longer than PCR products in a conventional SOE. PCR products obtained from the first round of PCR are used for the second PCR by applying the nested and mutated primers. Following to the purification of the amplified fragments, they will be subject of the further purification and will be used as template to perform the third round of PCR using gene specific primers. In the end, the products will be cloned into a suitable vector for subsequent application. In comparison to the conventional SOE-PCR, the improved method (i.e. N-SOE-PCR) increases the yield and specificity of the products. In addition, the proposed method shows a large reduction in the non-specific products. By applying two more primers in the conventional SOE, the specificity of the method will be improved. This would be in part due to annealing of the primers further inside the amplicon that increases both the efficiency and a better attachment of the primers. Positioning of the primer far from both ends of an amplicon leads to an enhanced binding as well as increased affinity in the third round of amplification in SOE.
2015-01-01
Here, we present a universal, simple, efficient, and reliable way to add small BioBrick parts to any BioBrick via PCR that is compatible with BioBrick assembly standard 10. As a proof of principle, we have designed a universal primer, rbs_B0034, that contains a ribosomal binding site (RBS; BBa_B0034) and that can be used in PCR to amplify any coding BioBrick that starts with ATG. We performed test PCRs with rbs_B0034 on 31 different targets and found it to be 93.6% efficient. Moreover, when supplemented with a complementary primer, addition of RBS can be accomplished via whole plasmid site-directed mutagenesis, thus reducing the time required for further assembly of composite parts. The described method brings simplicity to the addition of small parts, such as regulatory elements to existing BioBricks. The final product of the PCR assembly is indistinguishable from the standard or 3A BioBrick assembly. PMID:25524097
Primer3_masker: integrating masking of template sequence with primer design software.
Kõressaar, Triinu; Lepamets, Maarja; Kaplinski, Lauris; Raime, Kairi; Andreson, Reidar; Remm, Maido
2018-06-01
Designing PCR primers for amplifying regions of eukaryotic genomes is a complicated task because the genomes contain a large number of repeat sequences and other regions unsuitable for amplification by PCR. We have developed a novel k-mer based masking method that uses a statistical model to detect and mask failure-prone regions on the DNA template prior to primer design. We implemented the software as a standalone software primer3_masker and integrated it into the primer design program Primer3. The standalone version of primer3_masker is implemented in C. The source code is freely available at https://github.com/bioinfo-ut/primer3_masker/ (standalone version for Linux and macOS) and at https://github.com/primer3-org/primer3/ (integrated version). Primer3 web application that allows masking sequences of 196 animal and plant genomes is available at http://primer3.ut.ee/. maido.remm@ut.ee. Supplementary data are available at Bioinformatics online.
RUCS: rapid identification of PCR primers for unique core sequences.
Thomsen, Martin Christen Frølund; Hasman, Henrik; Westh, Henrik; Kaya, Hülya; Lund, Ole
2017-12-15
Designing PCR primers to target a specific selection of whole genome sequenced strains can be a long, arduous and sometimes impractical task. Such tasks would benefit greatly from an automated tool to both identify unique targets, and to validate the vast number of potential primer pairs for the targets in silico. Here we present RUCS, a program that will find PCR primer pairs and probes for the unique core sequences of a positive genome dataset complement to a negative genome dataset. The resulting primer pairs and probes are in addition to simple selection also validated through a complex in silico PCR simulation. We compared our method, which identifies the unique core sequences, against an existing tool called ssGeneFinder, and found that our method was 6.5-20 times more sensitive. We used RUCS to design primer pairs that would target a set of genomes known to contain the mcr-1 colistin resistance gene. Three of the predicted pairs were chosen for experimental validation using PCR and gel electrophoresis. All three pairs successfully produced an amplicon with the target length for the samples containing mcr-1 and no amplification products were produced for the negative samples. The novel methods presented in this manuscript can reduce the time needed to identify target sequences, and provide a quick virtual PCR validation to eliminate time wasted on ambiguously binding primers. Source code is freely available on https://bitbucket.org/genomicepidemiology/rucs. Web service is freely available on https://cge.cbs.dtu.dk/services/RUCS. mcft@cbs.dtu.dk. Supplementary data are available at Bioinformatics online. © The Author(s) 2017. Published by Oxford University Press.
Kimura, Yasumasa; Soma, Takahiro; Kasahara, Naoko; Delobel, Diane; Hanami, Takeshi; Tanaka, Yuki; de Hoon, Michiel J L; Hayashizaki, Yoshihide; Usui, Kengo; Harbers, Matthias
2016-01-01
Analytical PCR experiments preferably use internal probes for monitoring the amplification reaction and specific detection of the amplicon. Such internal probes have to be designed in close context with the amplification primers, and may require additional considerations for the detection of genetic variations. Here we describe Edesign, a new online and stand-alone tool for designing sets of PCR primers together with an internal probe for conducting quantitative real-time PCR (qPCR) and genotypic experiments. Edesign can be used for selecting standard DNA oligonucleotides like for instance TaqMan probes, but has been further extended with new functions and enhanced design features for Eprobes. Eprobes, with their single thiazole orange-labelled nucleotide, allow for highly sensitive genotypic assays because of their higher DNA binding affinity as compared to standard DNA oligonucleotides. Using new thermodynamic parameters, Edesign considers unique features of Eprobes during primer and probe design for establishing qPCR experiments and genotyping by melting curve analysis. Additional functions in Edesign allow probe design for effective discrimination between wild-type sequences and genetic variations either using standard DNA oligonucleotides or Eprobes. Edesign can be freely accessed online at http://www.dnaform.com/edesign2/, and the source code is available for download.
Kasahara, Naoko; Delobel, Diane; Hanami, Takeshi; Tanaka, Yuki; de Hoon, Michiel J. L.; Hayashizaki, Yoshihide; Usui, Kengo; Harbers, Matthias
2016-01-01
Analytical PCR experiments preferably use internal probes for monitoring the amplification reaction and specific detection of the amplicon. Such internal probes have to be designed in close context with the amplification primers, and may require additional considerations for the detection of genetic variations. Here we describe Edesign, a new online and stand-alone tool for designing sets of PCR primers together with an internal probe for conducting quantitative real-time PCR (qPCR) and genotypic experiments. Edesign can be used for selecting standard DNA oligonucleotides like for instance TaqMan probes, but has been further extended with new functions and enhanced design features for Eprobes. Eprobes, with their single thiazole orange-labelled nucleotide, allow for highly sensitive genotypic assays because of their higher DNA binding affinity as compared to standard DNA oligonucleotides. Using new thermodynamic parameters, Edesign considers unique features of Eprobes during primer and probe design for establishing qPCR experiments and genotyping by melting curve analysis. Additional functions in Edesign allow probe design for effective discrimination between wild-type sequences and genetic variations either using standard DNA oligonucleotides or Eprobes. Edesign can be freely accessed online at http://www.dnaform.com/edesign2/, and the source code is available for download. PMID:26863543
Gao, Xinxin; Yo, Peggy; Keith, Andrew; Ragan, Timothy J.; Harris, Thomas K.
2003-01-01
A novel thermodynamically-balanced inside-out (TBIO) method of primer design was developed and compared with a thermodynamically-balanced conventional (TBC) method of primer design for PCR-based gene synthesis of codon-optimized gene sequences for the human protein kinase B-2 (PKB2; 1494 bp), p70 ribosomal S6 subunit protein kinase-1 (S6K1; 1622 bp) and phosphoinositide-dependent protein kinase-1 (PDK1; 1712 bp). Each of the 60mer TBIO primers coded for identical nucleotide regions that the 60mer TBC primers covered, except that half of the TBIO primers were reverse complement sequences. In addition, the TBIO and TBC primers contained identical regions of temperature- optimized primer overlaps. The TBC method was optimized to generate sequential overlapping fragments (∼0.4–0.5 kb) for each of the gene sequences, and simultaneous and sequential combinations of overlapping fragments were tested for their ability to be assembled under an array of PCR conditions. However, no fully synthesized gene sequences could be obtained by this approach. In contrast, the TBIO method generated an initial central fragment (∼0.4–0.5 kb), which could be gel purified and used for further inside-out bidirectional elongation by additional increments of 0.4–0.5 kb. By using the newly developed TBIO method of PCR-based gene synthesis, error-free synthetic genes for the human protein kinases PKB2, S6K1 and PDK1 were obtained with little or no corrective mutagenesis. PMID:14602936
A new rapid methodological strategy to assess BRCA mutational status.
Vuttariello, Emilia; Borra, Marco; Calise, Celeste; Mauriello, Elvira; Greggi, Stefano; Vecchione, Aldo; Biffali, Elio; Chiappetta, Gennaro
2013-07-01
Hereditary cancers account for approximately 10 % of breast and ovarian cancers. Mutations of the BRCA1 and BRCA2 genes, encoding two proteins involved in DNA repair, underlie most cases of such hereditary cancers. Women with BRCA mutations develop breast cancer in 50-80 % of cases and ovarian cancer in 10-40 % of cases. Assessing BRCA mutational status is needed to direct the clinical management of women with predisposition to these hereditary cancers. However, BRCA screening constitutes a bottleneck in terms of costs and time to deliver results. We developed a PCR-based assay using 73 primer pairs covering the entire coding regions of BRCA1 and BRCA2. PCR primers, containing at the 5' end the universal M13 primer sequences, were pre-spotted in 96-well plates. Following PCR, direct sequencing was performed using M13 primers, allowing to standardize the conditions. PCR amplification and sequencing were successful for each amplicon. We tested and validated the assay on 10 known gDNAs from patients with Hereditary breast and ovarian cancer (HBOC). Our strategy is a promising time and cost-effective method to detect BRCA mutations in the clinical setting, which is essential to formulate a personalized therapy for patients with HBOC.
Detection of the aerolysin gene in Aeromonas hydrophila by the polymerase chain reaction.
Pollard, D R; Johnson, W M; Lior, H; Tyler, S D; Rozee, K R
1990-01-01
Synthetic oligonucleotide primers were used in a polymerase chain reaction (PCR) technique to detect the gene for aerolysin in strains of Aeromonas hydrophila and to screen for identical genes in A. caviae, A. sobria, and A. veronii isolated from patients with diarrheal disease. Primers targeted a 209-bp fragment of the aer gene coding for the beta-hemolysin and detected template DNA only in the PCR using nucleic acid (NA) from hemolytic strains of A. hydrophila which were also cytotoxic to Vero and CHO cells and enterotoxic in suckling-mouse assays. PCR amplification of NA from hemolytic A. sobria or nonhemolytic A. hydrophila and A. caviae strains was consistently negative. Primer specificity was determined in the PCR by using NA extracted from 56 strains of bacteria, including hemolytic Escherichia coli and Listeria monocytogenes as well as several recognized enteric pathogens defined in terms of their toxigenicity. The detection limit for the aerolysin gene by PCR amplification was 1 ng of total NA. The PCR clearly identified aerolysin-producing strains of A. hydrophila and may have application as a species-specific virulence test because other hemolytic Aeromonas species tested were negative. Images PMID:2254423
Gui, Z; Liu, H Q; Wang, Y; Yuan, Q H; Xin, N; Zhang, X; Li, X L; Pi, Y S; Gao, J M
2014-12-04
In this study, 2 approaches were adopted to obtain good single-strand conformation polymorphism (SSCP) data for autotetraploid alfalfa; primers were added to PCR products, and fluorescent-labeled primers were utilized. PCR-SSCP conditions for a 331-bp fragment in the coding region of polygalacturonase-inhibiting protein gene 2 in alfalfa (MsPGIP2) were optimized, and the results showed that the best SSCP gel pattern could be obtained when the loading mixture was made by mixing 1 μL PCR products, 0.2 to 0.8 μL unlabeled primers (50 μM) and 4 to 16 μL loading buffer. Furthermore, the use of the fluorescent-labeled primers resulted in 2 separated electrophoresis images from 2 complementary single DNA strands, thus making the determination of alleles and idiotypes a relatively easy task. In addition, the results of sequencing prove that the determination of alleles and idiotypes were accurate based on SSCP analysis. Finally, a total of 9 alleles with 18 SNP sites were identified for MsPGIP2 in the alfalfa variety 'Algonquin'. In conclusion, MsPGIP2 possessed great genetic variation, and the addition of primers to the PCR products in combination with the fluorescent labeling of primers could significantly improve the sensitivity and resolution of SSCP analysis. This technique could be used for genetic diversity detection and marker-assisted breeding of useful genes in autopolyploid species such as alfalfa.
Kalendar, Ruslan; Tselykh, Timofey V; Khassenov, Bekbolat; Ramanculov, Erlan M
2017-01-01
This chapter introduces the FastPCR software as an integrated tool environment for PCR primer and probe design, which predicts properties of oligonucleotides based on experimental studies of the PCR efficiency. The software provides comprehensive facilities for designing primers for most PCR applications and their combinations. These include the standard PCR as well as the multiplex, long-distance, inverse, real-time, group-specific, unique, overlap extension PCR for multi-fragments assembling cloning and loop-mediated isothermal amplification (LAMP). It also contains a built-in program to design oligonucleotide sets both for long sequence assembly by ligase chain reaction and for design of amplicons that tile across a region(s) of interest. The software calculates the melting temperature for the standard and degenerate oligonucleotides including locked nucleic acid (LNA) and other modifications. It also provides analyses for a set of primers with the prediction of oligonucleotide properties, dimer and G/C-quadruplex detection, linguistic complexity as well as a primer dilution and resuspension calculator. The program consists of various bioinformatical tools for analysis of sequences with the GC or AT skew, CG% and GA% content, and the purine-pyrimidine skew. It also analyzes the linguistic sequence complexity and performs generation of random DNA sequence as well as restriction endonucleases analysis. The program allows to find or create restriction enzyme recognition sites for coding sequences and supports the clustering of sequences. It performs efficient and complete detection of various repeat types with visual display. The FastPCR software allows the sequence file batch processing that is essential for automation. The program is available for download at http://primerdigital.com/fastpcr.html , and its online version is located at http://primerdigital.com/tools/pcr.html .
Primer design for a prokaryotic differential display RT-PCR.
Fislage, R; Berceanu, M; Humboldt, Y; Wendt, M; Oberender, H
1997-01-01
We have developed a primer set for a prokaryotic differential display of mRNA in the Enterobacteriaceae group. Each combination of ten 10mer and ten 11mer primers generates up to 85 bands from total Escherichia coli RNA, thus covering expressed sequences of a complete bacterial genome. Due to the lack of polyadenylation in prokaryotic RNA the type T11VN anchored oligonucleotides for the reverse transcriptase reaction had to be replaced with respect to the original method described by Liang and Pardee [ Science , 257, 967-971 (1992)]. Therefore, the sequences of both the 10mer and the new 11mer oligonucleotides were determined by a statistical evaluation of species-specific coding regions extracted from the EMBL database. The 11mer primers used for reverse transcription were selected for localization in the 3'-region of the bacterial RNA. The 10mer primers preferentially bind to the 5'-end of the RNA. None of the primers show homology to rRNA or other abundant small RNA species. Randomly sampled cDNA bands were checked for their bacterial origin either by re-amplification, cloning and sequencing or by re-amplification and direct sequencing with 10mer and 11mer primers after asymmetric PCR. PMID:9108168
Primer design for a prokaryotic differential display RT-PCR.
Fislage, R; Berceanu, M; Humboldt, Y; Wendt, M; Oberender, H
1997-05-01
We have developed a primer set for a prokaryotic differential display of mRNA in the Enterobacteriaceae group. Each combination of ten 10mer and ten 11mer primers generates up to 85 bands from total Escherichia coli RNA, thus covering expressed sequences of a complete bacterial genome. Due to the lack of polyadenylation in prokaryotic RNA the type T11VN anchored oligonucleotides for the reverse transcriptase reaction had to be replaced with respect to the original method described by Liang and Pardee [ Science , 257, 967-971 (1992)]. Therefore, the sequences of both the 10mer and the new 11mer oligonucleotides were determined by a statistical evaluation of species-specific coding regions extracted from the EMBL database. The 11mer primers used for reverse transcription were selected for localization in the 3'-region of the bacterial RNA. The 10mer primers preferentially bind to the 5'-end of the RNA. None of the primers show homology to rRNA or other abundant small RNA species. Randomly sampled cDNA bands were checked for their bacterial origin either by re-amplification, cloning and sequencing or by re-amplification and direct sequencing with 10mer and 11mer primers after asymmetric PCR.
Codon Optimizing for Increased Membrane Protein Production: A Minimalist Approach.
Mirzadeh, Kiavash; Toddo, Stephen; Nørholm, Morten H H; Daley, Daniel O
2016-01-01
Reengineering a gene with synonymous codons is a popular approach for increasing production levels of recombinant proteins. Here we present a minimalist alternative to this method, which samples synonymous codons only at the second and third positions rather than the entire coding sequence. As demonstrated with two membrane-embedded transporters in Escherichia coli, the method was more effective than optimizing the entire coding sequence. The method we present is PCR based and requires three simple steps: (1) the design of two PCR primers, one of which is degenerate; (2) the amplification of a mini-library by PCR; and (3) screening for high-expressing clones.
Design of primers and probes for quantitative real-time PCR methods.
Rodríguez, Alicia; Rodríguez, Mar; Córdoba, Juan J; Andrade, María J
2015-01-01
Design of primers and probes is one of the most crucial factors affecting the success and quality of quantitative real-time PCR (qPCR) analyses, since an accurate and reliable quantification depends on using efficient primers and probes. Design of primers and probes should meet several criteria to find potential primers and probes for specific qPCR assays. The formation of primer-dimers and other non-specific products should be avoided or reduced. This factor is especially important when designing primers for SYBR(®) Green protocols but also in designing probes to ensure specificity of the developed qPCR protocol. To design primers and probes for qPCR, multiple software programs and websites are available being numerous of them free. These tools often consider the default requirements for primers and probes, although new research advances in primer and probe design should be progressively added to different algorithm programs. After a proper design, a precise validation of the primers and probes is necessary. Specific consideration should be taken into account when designing primers and probes for multiplex qPCR and reverse transcription qPCR (RT-qPCR). This chapter provides guidelines for the design of suitable primers and probes and their subsequent validation through the development of singlex qPCR, multiplex qPCR, and RT-qPCR protocols.
Schneider, Uffe Vest; Mikkelsen, Nikolaj Dam; Lindqvist, Anja; Okkels, Limei Meng; Jøhnk, Nina; Lisby, Gorm
2012-01-01
We introduce quantitative polymerase chain reaction (qPCR) primers and multiplex end-point PCR primers modified by the addition of a single ortho-Twisted Intercalating Nucleic Acid (o-TINA) molecule at the 5′-end. In qPCR, the 5′-o-TINA modified primers allow for a qPCR efficiency of 100% at significantly stressed reaction conditions, increasing the robustness of qPCR assays compared to unmodified primers. In samples spiked with genomic DNA, 5′-o-TINA modified primers improve the robustness by increased sensitivity and specificity compared to unmodified DNA primers. In unspiked samples, replacement of unmodified DNA primers with 5′-o-TINA modified primers permits an increased qPCR stringency. Compared to unmodified DNA primers, this allows for a qPCR efficiency of 100% at lowered primer concentrations and at increased annealing temperatures with unaltered cross-reactivity for primers with single nucleobase mismatches. In a previously published octaplex end-point PCR targeting diarrheagenic Escherichia coli, application of 5′-o-TINA modified primers allows for a further reduction (>45% or approximately one hour) in overall PCR program length, while sustaining the amplification and analytical sensitivity for all targets in crude bacterial lysates. For all crude bacterial lysates, 5′-o-TINA modified primers permit a substantial increase in PCR stringency in terms of lower primer concentrations and higher annealing temperatures for all eight targets. Additionally, crude bacterial lysates spiked with human genomic DNA show lesser formation of non-target amplicons implying increased robustness. Thus, 5′-o-TINA modified primers are advantageous in PCR assays, where one or more primer pairs are required to perform at stressed reaction conditions. PMID:22701644
PD5: a general purpose library for primer design software.
Riley, Michael C; Aubrey, Wayne; Young, Michael; Clare, Amanda
2013-01-01
Complex PCR applications for large genome-scale projects require fast, reliable and often highly sophisticated primer design software applications. Presently, such applications use pipelining methods to utilise many third party applications and this involves file parsing, interfacing and data conversion, which is slow and prone to error. A fully integrated suite of software tools for primer design would considerably improve the development time, the processing speed, and the reliability of bespoke primer design software applications. The PD5 software library is an open-source collection of classes and utilities, providing a complete collection of software building blocks for primer design and analysis. It is written in object-oriented C(++) with an emphasis on classes suitable for efficient and rapid development of bespoke primer design programs. The modular design of the software library simplifies the development of specific applications and also integration with existing third party software where necessary. We demonstrate several applications created using this software library that have already proved to be effective, but we view the project as a dynamic environment for building primer design software and it is open for future development by the bioinformatics community. Therefore, the PD5 software library is published under the terms of the GNU General Public License, which guarantee access to source-code and allow redistribution and modification. The PD5 software library is downloadable from Google Code and the accompanying Wiki includes instructions and examples: http://code.google.com/p/primer-design.
Diagnosis of clinical samples spotted on FTA cards using PCR-based methods.
Jamjoom, Manal; Sultan, Amal H
2009-04-01
The broad clinical presentation of Leishmaniasis makes the diagnosis of current and past cases of this disease rather difficult. Differential diagnosis is important because diseases caused by other aetiologies and a clinical spectrum similar to that of leishmaniasis (e.g. leprosy, skin cancers and tuberculosis for CL; malaria and schistosomiasis for VL) are often present in endemic areas of endemicity. Presently, a variety of methods have been developed and tested to aid the identification and diagnosis of Leishmania. The advent of the PCR technology has opened new channels for the diagnosis of leishmaniasis in a variety of clinical materials. PCR is a simple, rapid procedure that has been adapted for diagnosis of leishmaniasis. A range of tools is currently available for the diagnosis and identification of leishmaniasis and Leishmania species, respectively. However, none of these diagnostic tools are examined and tested using samples spotted on FTA cards. Three different PCR-based approaches were examined including: kDNA minicircle, Leishmania 18S rRNA gene and PCR-RFLP of Intergenic region of ribosomal protein. PCR primers were designed that sit within the coding sequences of genes (relatively well conserved) but which amplify across the intervening intergenic sequence (relatively variable). These were used in PCR-RFLP on reference isolates of 10 of the most important Leishmania species: L. donovani, L. infantum, L. major & L. tropica. Digestion of PCR products with restriction enzymes produced species-specific restriction patterns allowed discrimination of reference isolates. The kDNA minicircle primers are highly sensitive in diagnosis of both bone marrow and skin smears from FTA cards. Leishmania 18S rRNA gene conserved region is sensitive in identification of bone marrow smear but less sensitive in diagnosing skin smears. The intergenic nested PCR-RFLP using P5 & P6 as well as P1 & P2 newly designed primers showed high level of reproducibility and sensitivity. Though, it was less sensitive than kDNA minicircle primers, but easily discriminated between Leishmania species.
Binladen, Jonas; Gilbert, M Thomas P; Bollback, Jonathan P; Panitz, Frank; Bendixen, Christian; Nielsen, Rasmus; Willerslev, Eske
2007-02-14
The invention of the Genome Sequence 20 DNA Sequencing System (454 parallel sequencing platform) has enabled the rapid and high-volume production of sequence data. Until now, however, individual emulsion PCR (emPCR) reactions and subsequent sequencing runs have been unable to combine template DNA from multiple individuals, as homologous sequences cannot be subsequently assigned to their original sources. We use conventional PCR with 5'-nucleotide tagged primers to generate homologous DNA amplification products from multiple specimens, followed by sequencing through the high-throughput Genome Sequence 20 DNA Sequencing System (GS20, Roche/454 Life Sciences). Each DNA sequence is subsequently traced back to its individual source through 5'tag-analysis. We demonstrate that this new approach enables the assignment of virtually all the generated DNA sequences to the correct source once sequencing anomalies are accounted for (miss-assignment rate<0.4%). Therefore, the method enables accurate sequencing and assignment of homologous DNA sequences from multiple sources in single high-throughput GS20 run. We observe a bias in the distribution of the differently tagged primers that is dependent on the 5' nucleotide of the tag. In particular, primers 5' labelled with a cytosine are heavily overrepresented among the final sequences, while those 5' labelled with a thymine are strongly underrepresented. A weaker bias also exists with regards to the distribution of the sequences as sorted by the second nucleotide of the dinucleotide tags. As the results are based on a single GS20 run, the general applicability of the approach requires confirmation. However, our experiments demonstrate that 5'primer tagging is a useful method in which the sequencing power of the GS20 can be applied to PCR-based assays of multiple homologous PCR products. The new approach will be of value to a broad range of research areas, such as those of comparative genomics, complete mitochondrial analyses, population genetics, and phylogenetics.
PrimerZ: streamlined primer design for promoters, exons and human SNPs.
Tsai, Ming-Fang; Lin, Yi-Jung; Cheng, Yu-Chang; Lee, Kuo-Hsi; Huang, Cheng-Chih; Chen, Yuan-Tsong; Yao, Adam
2007-07-01
PrimerZ (http://genepipe.ngc.sinica.edu.tw/primerz/) is a web application dedicated primarily to primer design for genes and human SNPs. PrimerZ accepts genes by gene name or Ensembl accession code, and SNPs by dbSNP rs or AFFY_Probe IDs. The promoter and exon sequence information of all gene transcripts fetched from the Ensembl database (http://www.ensembl.org) are processed before being passed on to Primer3 (http://frodo.wi.mit.edu/cgi-bin/primer3/primer3_www.cgi) for individual primer design. All results returned from Primer 3 are organized and integrated in a specially designed web page for easy browsing. Besides the web page presentation, csv text file export is also provided for enhanced user convenience. PrimerZ automates highly standard but tedious gene primer design to improve the success rate of PCR experiments. More than 2000 primers have been designed with PrimerZ at our institute since 2004 and the success rate is over 70%. The addition of several new features has made PrimerZ even more useful to the research community in facilitating primer design for promoters, exons and SNPs.
Real-time multiplex PCR assay for detection of Yersinia pestis and Yersinia pseudotuberculosis.
Matero, Pirjo; Pasanen, Tanja; Laukkanen, Riikka; Tissari, Päivi; Tarkka, Eveliina; Vaara, Martti; Skurnik, Mikael
2009-01-01
A multiplex real-time polymerase chain reaction (PCR) assay was developed for the detection of Yersinia pestis and Yersinia pseudotuberculosis. The assay includes four primer pairs, two of which are specific for Y. pestis, one for Y. pestis and Y. pseudotuberculosis and one for bacteriophage lambda; the latter was used as an internal amplification control. The Y. pestis-specific target genes in the assay were ypo2088, a gene coding for a putative methyltransferase, and the pla gene coding for the plasminogen activator. In addition, the wzz gene was used as a target to specifically identify both Y. pestis and the closely related Y. pseudotuberculosis group. The primer and probe sets described for the different genes can be used either in single or in multiplex PCR assays because the individual probes were designed with different fluorochromes. The assays were found to be both sensitive and specific; the lower limit of the detection was 10-100 fg of extracted Y. pestis or Y. pseudotuberculosis total DNA. The sensitivity of the tetraplex assay was determined to be 1 cfu for the ypo2088 and pla probe labelled with FAM and JOE fluorescent dyes, respectively.
Byoun, Mun Sub; Yoo, Changhoon; Sim, Sang Jun; Lim, Chae Seung; Kim, Sung Woo
2018-01-01
Real-time PCR, also called quantitative PCR (qPCR), has been powerful analytical tool for detection of nucleic acids since it developed. Not only for biological research but also for diagnostic needs, qPCR technique requires capacity to detect multiple genes in recent years. Solid phase PCR (SP-PCR) where one or two directional primers are immobilized on solid substrates could analyze multiplex genetic targets. However, conventional SP-PCR was subjected to restriction of application for lack of PCR efficiency and quantitative resolution. Here we introduce an advanced qPCR with primer-incorporated network (PIN). One directional primers are immobilized in the porous hydrogel particle by covalent bond and the other direction of primers are temporarily immobilized at so-called 'Supplimers'. Supplimers released the primers to aqueous phase in the hydrogel at the thermal cycling of PCR. It induced the high PCR efficiency over 92% with high reliability. It reduced the formation of primer dimers and improved the selectivity of qPCR thanks to the strategy of 'right primers supplied to right place only'. By conducting a six-plex qPCR of 30 minutes, we analyzed DNA samples originated from malaria patients and successfully identified malaria species in a single reaction. PMID:29293604
Yu, Shihui; Kielt, Matthew; Stegner, Andrew L; Kibiryeva, Nataliya; Bittel, Douglas C; Cooley, Linda D
2009-12-01
The American College of Medical Genetics guidelines for microarray analysis for constitutional cytogenetic abnormalities require abnormal or ambiguous results from microarray-based comparative genomic hybridization (aCGH) analysis be confirmed by an alternative method. We employed quantitative real-time polymerase chain reaction (qPCR) technology using SYBR Green I reagents for confirmation of 93 abnormal aCGH results (50 deletions and 43 duplications) and 54 parental samples. A novel qPCR protocol using DNA sequences coding for X-linked lethal diseases in males for designing reference primers was established. Of the 81 sets of test primers used for confirmation of 93 abnormal copy number variants (CNVs) in 80 patients, 71 sets worked after the initial primer design (88%), 9 sets were redesigned once, and 1 set twice because of poor amplification. Fifty-four parental samples were tested using 33 sets of test primers to follow up 34 CNVs in 30 patients. Nineteen CNVs were confirmed as inherited, 13 were negative in both parents, and 2 were inconclusive due to a negative result in a single parent. The qPCR assessment clarified aCGH results in two cases and corrected a fluorescence in situ hybridization result in one case. Our data illustrate that qPCR methodology using SYBR Green I reagents is accurate, highly sensitive, specific, rapid, and cost-effective for verification of chromosomal imbalances detected by aCGH in the clinical setting.
Germer, Jeffrey J.; Ankoudinova, Irina; Belousov, Yevgeniy S.; Mahoney, Walt; Dong, Chen; Meng, Jihong; Mandrekar, Jayawant N.
2017-01-01
ABSTRACT Hepatitis E virus (HEV) has emerged as a cause of chronic hepatitis among immunocompromised patients. Molecular assays have become important tools for the diagnosis and management of these chronically infected patients. A real-time reverse transcription-quantitative PCR (RT-qPCR) assay utilizing Pleiades probe chemistry and an RNA internal control for the simultaneous detection and quantification of HEV RNA in human serum was developed based on an adaptation of a previously described and broadly reactive primer set targeting the overlapping open reading frame 2/3 (ORF2/3) nucleotide sequence of HEV. A chimeric bovine viral diarrhea virus construct containing an HEV RNA insert (SynTura HEV) was developed, value assigned with the first World Health Organization (WHO) international standard for HEV RNA (code 6329/10), and used to prepare working assay calibrators and controls, which supported an assay quantification range of 100 to 5,000,000 IU/ml. The analytical sensitivity (95% detection rate) of this assay was 25.2 IU/ml (95% confidence interval [CI], 19.2 to 44.1 IU/ml). The assay successfully amplified 16 different HEV sequences with significant nucleotide mismatching in primer/probe binding regions, while evaluation of a WHO international reference panel for HEV genotypes (code 8578/13) showed viral load results falling within the result ranges generated by WHO collaborative study participants for all panel members (genotypes 1 to 4). Broadly reactive RT-qPCR primers targeting HEV ORF2/3 were successfully adapted for use in an assay based on Pleiades probe chemistry. The availability of secondary standards calibrated to the WHO HEV international standard can improve the standardization and performance of assays for the detection and quantification of HEV RNA. PMID:28228493
Adachi, Noboru; Umetsu, Kazuo; Shojo, Hideki
2014-01-01
Mitochondrial DNA (mtDNA) is widely used for DNA analysis of highly degraded samples because of its polymorphic nature and high number of copies in a cell. However, as endogenous mtDNA in deteriorated samples is scarce and highly fragmented, it is not easy to obtain reliable data. In the current study, we report the risks of direct sequencing mtDNA in highly degraded material, and suggest a strategy to ensure the quality of sequencing data. It was observed that direct sequencing data of the hypervariable segment (HVS) 1 by using primer sets that generate an amplicon of 407 bp (long-primer sets) was different from results obtained by using newly designed primer sets that produce an amplicon of 120-139 bp (mini-primer sets). The data aligned with the results of mini-primer sets analysis in an amplicon length-dependent manner; the shorter the amplicon, the more evident the endogenous sequence became. Coding region analysis using multiplex amplified product-length polymorphisms revealed the incongruence of single nucleotide polymorphisms between the coding region and HVS 1 caused by contamination with exogenous mtDNA. Although the sequencing data obtained using long-primer sets turned out to be erroneous, it was unambiguous and reproducible. These findings suggest that PCR primers that produce amplicons shorter than those currently recognized should be used for mtDNA analysis in highly degraded samples. Haplogroup motif analysis of the coding region and HVS should also be performed to improve the reliability of forensic mtDNA data. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.
Yang, Qing-Li; Shen, Ji-Qing; Jiang, Zhi-Hua; Yang, Yi-Chao; Li, Hong-Mei; Chen, Ying-Dan; Zhou, Xiao-Nong
2014-06-01
To identify Clonorchis sinensis metacercariae using PCR targeting ribosomal DNA ITS region and COX1 gene. Pseudorasbora parva were collected from Hengxian County of Guangxi at the end of May 2013. Single metacercaria of C. sinensis and other trematodes were separated from muscle tissue of P. parva by digestion method. Primers targeting ribosomal DNA ITS region and COX1 gene of C. sinensis were designed for PCR and the universal primers were used as control. The sensitivity and specificity of the PCR detection were analyzed. C. sinensis metacercariae at different stages were identified by PCR. DNA from single C. sinensis metacercaria was detected by PCR targeting ribosomal DNA ITS region and COX1 gene. The specific amplicans have sizes of 437/549, 156/249 and 195/166 bp, respectively. The ratio of the two positive numbers in PCR with universal primers and specific primers targeting C. sinensis ribosomal DNA ITS1 and ITS2 regions was 0.905 and 0.952, respectively. The target gene fragments were amplified by PCR using COX1 gene-specific primers. The PCR with specific primers did not show any non-specific amplification. However, the PCR with universal primers targeting ribosomal DNA ITS regions performed serious non-specific amplification. C. sinensis metacercariae at different stages are identified by morphological observation and PCR method. Species-specific primers targeting ribosomal DNA ITS region show higher sensitivity and specificity than the universal primers. PCR targeting COX1 gene shows similar sensitivity and specificity to PCR with specific primers targeting ribosomal DNA ITS regions.
Green, Stefan J.; Venkatramanan, Raghavee; Naqib, Ankur
2015-01-01
The polymerase chain reaction (PCR) is sensitive to mismatches between primer and template, and mismatches can lead to inefficient amplification of targeted regions of DNA template. In PCRs in which a degenerate primer pool is employed, each primer can behave differently. Therefore, inefficiencies due to different primer melting temperatures within a degenerate primer pool, in addition to mismatches between primer binding sites and primers, can lead to a distortion of the true relative abundance of targets in the original DNA pool. A theoretical analysis indicated that a combination of primer-template and primer-amplicon interactions during PCR cycles 3–12 is potentially responsible for this distortion. To test this hypothesis, we developed a novel amplification strategy, entitled “Polymerase-exonuclease (PEX) PCR”, in which primer-template interactions and primer-amplicon interactions are separated. The PEX PCR method substantially and significantly improved the evenness of recovery of sequences from a mock community of known composition, and allowed for amplification of templates with introduced mismatches near the 3’ end of the primer annealing sites. When the PEX PCR method was applied to genomic DNA extracted from complex environmental samples, a significant shift in the observed microbial community was detected. Furthermore, the PEX PCR method provides a mechanism to identify which primers in a primer pool are annealing to target gDNA. Primer utilization patterns revealed that at high annealing temperatures in the PEX PCR method, perfect match annealing predominates, while at lower annealing temperatures, primers with up to four mismatches with templates can contribute substantially to amplification. The PEX PCR method is simple to perform, is limited to PCR mixes and a single exonuclease step which can be performed without reaction cleanup, and is recommended for reactions in which degenerate primer pools are used or when mismatches between primers and template are possible. PMID:25996930
MethPrimer: designing primers for methylation PCRs.
Li, Long-Cheng; Dahiya, Rajvir
2002-11-01
DNA methylation is an epigenetic mechanism of gene regulation. Bisulfite- conversion-based PCR methods, such as bisulfite sequencing PCR (BSP) and methylation specific PCR (MSP), remain the most commonly used techniques for methylation mapping. Existing primer design programs developed for standard PCR cannot handle primer design for bisulfite-conversion-based PCRs due to changes in DNA sequence context caused by bisulfite treatment and many special constraints both on the primers and the region to be amplified for such experiments. Therefore, the present study was designed to develop a program for such applications. MethPrimer, based on Primer 3, is a program for designing PCR primers for methylation mapping. It first takes a DNA sequence as its input and searches the sequence for potential CpG islands. Primers are then picked around the predicted CpG islands or around regions specified by users. MethPrimer can design primers for BSP and MSP. Results of primer selection are delivered through a web browser in text and in graphic view.
2016-01-01
Avoiding complementarity between primers when designing a PCR assay constitutes a central rule strongly anchored in the mind of the molecular scientist. 3’-complementarity will extend the primers during PCR elongation using one another as template, consequently disabling further possible involvement in traditional target amplification. However, a 5’-complementarity will leave the primers unchanged during PCR cycles, albeit sequestered to one another, therefore also suppressing target amplification. We show that 5’-complementarity between primers may be exploited in a new PCR method called COMplementary-Primer-Asymmetric (COMPAS)-PCR, using asymmetric primer concentrations to achieve target PCR amplification. Moreover, such a design may paradoxically reduce spurious non-target amplification by actively sequestering the limiting primer. The general principles were demonstrated using 5S rDNA direct repeats as target sequences to design a species-specific assay for identifying Salmo salar and Salmo trutta using almost fully complementary primers overlapping the same target sequence. Specificity was enhanced by using 3’-penultimate point mutations and the assay was further developed to enable identification of S. salar x S. trutta hybrids by High Resolution Melt analysis in a 35 min one-tube assay. This small paradigm shift, using highly complementary primers for PCR, should help develop robust assays that previously would not be considered. PMID:27783658
A PCR primer bank for quantitative gene expression analysis.
Wang, Xiaowei; Seed, Brian
2003-12-15
Although gene expression profiling by microarray analysis is a useful tool for assessing global levels of transcriptional activity, variability associated with the data sets usually requires that observed differences be validated by some other method, such as real-time quantitative polymerase chain reaction (real-time PCR). However, non-specific amplification of non-target genes is frequently observed in the latter, confounding the analysis in approximately 40% of real-time PCR attempts when primer-specific labels are not used. Here we present an experimentally validated algorithm for the identification of transcript-specific PCR primers on a genomic scale that can be applied to real-time PCR with sequence-independent detection methods. An online database, PrimerBank, has been created for researchers to retrieve primer information for their genes of interest. PrimerBank currently contains 147 404 primers encompassing most known human and mouse genes. The primer design algorithm has been tested by conventional and real-time PCR for a subset of 112 primer pairs with a success rate of 98.2%.
MRPrimer: a MapReduce-based method for the thorough design of valid and ranked primers for PCR
Kim, Hyerin; Kang, NaNa; Chon, Kang-Wook; Kim, Seonho; Lee, NaHye; Koo, JaeHyung; Kim, Min-Soo
2015-01-01
Primer design is a fundamental technique that is widely used for polymerase chain reaction (PCR). Although many methods have been proposed for primer design, they require a great deal of manual effort to generate feasible and valid primers, including homology tests on off-target sequences using BLAST-like tools. That approach is inconvenient for many target sequences of quantitative PCR (qPCR) due to considering the same stringent and allele-invariant constraints. To address this issue, we propose an entirely new method called MRPrimer that can design all feasible and valid primer pairs existing in a DNA database at once, while simultaneously checking a multitude of filtering constraints and validating primer specificity. Furthermore, MRPrimer suggests the best primer pair for each target sequence, based on a ranking method. Through qPCR analysis using 343 primer pairs and the corresponding sequencing and comparative analyses, we showed that the primer pairs designed by MRPrimer are very stable and effective for qPCR. In addition, MRPrimer is computationally efficient and scalable and therefore useful for quickly constructing an entire collection of feasible and valid primers for frequently updated databases like RefSeq. Furthermore, we suggest that MRPrimer can be utilized conveniently for experiments requiring primer design, especially real-time qPCR. PMID:26109350
2009-01-01
Background Polymerase chain reaction (PCR) is very useful in many areas of molecular biology research. It is commonly observed that PCR success is critically dependent on design of an effective primer pair. Current tools for primer design do not adequately address the problem of PCR failure due to mis-priming on target-related sequences and structural variations in the genome. Methods We have developed an integrated graphical web-based application for primer design, called RExPrimer, which was written in Python language. The software uses Primer3 as the primer designing core algorithm. Locally stored sequence information and genomic variant information were hosted on MySQLv5.0 and were incorporated into RExPrimer. Results RExPrimer provides many functionalities for improved PCR primer design. Several databases, namely annotated human SNP databases, insertion/deletion (indel) polymorphisms database, pseudogene database, and structural genomic variation databases were integrated into RExPrimer, enabling an effective without-leaving-the-website validation of the resulting primers. By incorporating these databases, the primers reported by RExPrimer avoid mis-priming to related sequences (e.g. pseudogene, segmental duplication) as well as possible PCR failure because of structural polymorphisms (SNP, indel, and copy number variation (CNV)). To prevent mismatching caused by unexpected SNPs in the designed primers, in particular the 3' end (SNP-in-Primer), several SNP databases covering the broad range of population-specific SNP information are utilized to report SNPs present in the primer sequences. Population-specific SNP information also helps customize primer design for a specific population. Furthermore, RExPrimer offers a graphical user-friendly interface through the use of scalable vector graphic image that intuitively presents resulting primers along with the corresponding gene structure. In this study, we demonstrated the program effectiveness in successfully generating primers for strong homologous sequences. Conclusion The improvements for primer design incorporated into RExPrimer were demonstrated to be effective in designing primers for challenging PCR experiments. Integration of SNP and structural variation databases allows for robust primer design for a variety of PCR applications, irrespective of the sequence complexity in the region of interest. This software is freely available at http://www4a.biotec.or.th/rexprimer. PMID:19958502
A multiplex primer design algorithm for target amplification of continuous genomic regions.
Ozturk, Ahmet Rasit; Can, Tolga
2017-06-19
Targeted Next Generation Sequencing (NGS) assays are cost-efficient and reliable alternatives to Sanger sequencing. For sequencing of very large set of genes, the target enrichment approach is suitable. However, for smaller genomic regions, the target amplification method is more efficient than both the target enrichment method and Sanger sequencing. The major difficulty of the target amplification method is the preparation of amplicons, regarding required time, equipment, and labor. Multiplex PCR (MPCR) is a good solution for the mentioned problems. We propose a novel method to design MPCR primers for a continuous genomic region, following the best practices of clinically reliable PCR design processes. On an experimental setup with 48 different combinations of factors, we have shown that multiple parameters might effect finding the first feasible solution. Increasing the length of the initial primer candidate selection sequence gives better results whereas waiting for a longer time to find the first feasible solution does not have a significant impact. We generated MPCR primer designs for the HBB whole gene, MEFV coding regions, and human exons between 2000 bp to 2100 bp-long. Our benchmarking experiments show that the proposed MPCR approach is able produce reliable NGS assay primers for a given sequence in a reasonable amount of time.
PrimerStation: a highly specific multiplex genomic PCR primer design server for the human genome
Yamada, Tomoyuki; Soma, Haruhiko; Morishita, Shinichi
2006-01-01
PrimerStation () is a web service that calculates primer sets guaranteeing high specificity against the entire human genome. To achieve high accuracy, we used the hybridization ratio of primers in liquid solution. Calculating the status of sequence hybridization in terms of the stringent hybridization ratio is computationally costly, and no web service checks the entire human genome and returns a highly specific primer set calculated using a precise physicochemical model. To shorten the response time, we precomputed candidates for specific primers using a massively parallel computer with 100 CPUs (SunFire 15 K) about 3 months in advance. This enables PrimerStation to search and output qualified primers interactively. PrimerStation can select highly specific primers suitable for multiplex PCR by seeking a wider temperature range that minimizes the possibility of cross-reaction. It also allows users to add heuristic rules to the primer design, e.g. the exclusion of single nucleotide polymorphisms (SNPs) in primers, the avoidance of poly(A) and CA-repeats in the PCR products, and the elimination of defective primers using the secondary structure prediction. We performed several tests to verify the PCR amplification of randomly selected primers for ChrX, and we confirmed that the primers amplify specific PCR products perfectly. PMID:16845094
Optimal pcr primers for rapid and accurate detection of Aspergillus flavus isolates.
Al-Shuhaib, Mohammed Baqur S; Albakri, Ali H; Alwan, Sabah H; Almandil, Noor B; AbdulAzeez, Sayed; Borgio, J Francis
2018-03-01
Aspergillus flavus is among the most devastating opportunistic pathogens of several food crops including rice, due to its high production of carcinogenic aflatoxins. The presence of these organisms in economically important rice strip farming is a serious food safety concern. Several polymerase chain reaction (PCR) primers have been designed to detect this species; however, a comparative assessment of their accuracy has not been conducted. This study aims to identify the optimal diagnostic PCR primers for the identification of A. flavus, among widely available primers. We isolated 122 A. flavus native isolates from randomly collected rice strips (N = 300). We identified 109 isolates to the genus level using universal fungal PCR primer pairs. Nine pairs of primers were examined for their PCR diagnostic specificity on the 109 isolates. FLA PCR was found to be the optimal PCR primer pair for specific identification of the native isolates, over aflP(1), aflM, aflA, aflD, aflP(3), aflP(2), and aflR. The PEP primer pair was found to be the most unsuitable for A. flavus identification. In conclusion, the present study indicates the powerful specificity of the FLA PCR primer over other commonly available diagnostic primers for accurate, rapid, and large-scale identification of A. flavus native isolates. This study provides the first simple, practical comparative guide to PCR-based screening of A. flavus infection in rice strips. Copyright © 2018 Elsevier Ltd. All rights reserved.
Dwivedi, Bhakti; Schmieder, Robert; Goldsmith, Dawn B; Edwards, Robert A; Breitbart, Mya
2012-03-04
Phages (viruses that infect bacteria) have gained significant attention because of their abundance, diversity and important ecological roles. However, the lack of a universal gene shared by all phages presents a challenge for phage identification and characterization, especially in environmental samples where it is difficult to culture phage-host systems. Homologous conserved genes (or "signature genes") present in groups of closely-related phages can be used to explore phage diversity and define evolutionary relationships amongst these phages. Bioinformatic approaches are needed to identify candidate signature genes and design PCR primers to amplify those genes from environmental samples; however, there is currently no existing computational tool that biologists can use for this purpose. Here we present PhiSiGns, a web-based and standalone application that performs a pairwise comparison of each gene present in user-selected phage genomes, identifies signature genes, generates alignments of these genes, and designs potential PCR primer pairs. PhiSiGns is available at (http://www.phantome.org/phisigns/; http://phisigns.sourceforge.net/) with a link to the source code. Here we describe the specifications of PhiSiGns and demonstrate its application with a case study. PhiSiGns provides phage biologists with a user-friendly tool to identify signature genes and design PCR primers to amplify related genes from uncultured phages in environmental samples. This bioinformatics tool will facilitate the development of novel signature genes for use as molecular markers in studies of phage diversity, phylogeny, and evolution.
2012-01-01
Background Phages (viruses that infect bacteria) have gained significant attention because of their abundance, diversity and important ecological roles. However, the lack of a universal gene shared by all phages presents a challenge for phage identification and characterization, especially in environmental samples where it is difficult to culture phage-host systems. Homologous conserved genes (or "signature genes") present in groups of closely-related phages can be used to explore phage diversity and define evolutionary relationships amongst these phages. Bioinformatic approaches are needed to identify candidate signature genes and design PCR primers to amplify those genes from environmental samples; however, there is currently no existing computational tool that biologists can use for this purpose. Results Here we present PhiSiGns, a web-based and standalone application that performs a pairwise comparison of each gene present in user-selected phage genomes, identifies signature genes, generates alignments of these genes, and designs potential PCR primer pairs. PhiSiGns is available at (http://www.phantome.org/phisigns/; http://phisigns.sourceforge.net/) with a link to the source code. Here we describe the specifications of PhiSiGns and demonstrate its application with a case study. Conclusions PhiSiGns provides phage biologists with a user-friendly tool to identify signature genes and design PCR primers to amplify related genes from uncultured phages in environmental samples. This bioinformatics tool will facilitate the development of novel signature genes for use as molecular markers in studies of phage diversity, phylogeny, and evolution. PMID:22385976
Peng, Rui; Zeng, Bo; Meng, Xiuxiang; Yue, Bisong; Zhang, Zhihe; Zou, Fangdong
2007-08-01
The complete mitochondrial genome sequence of the giant panda, Ailuropoda melanoleuca, was determined by the long and accurate polymerase chain reaction (LA-PCR) with conserved primers and primer walking sequence methods. The complete mitochondrial DNA is 16,805 nucleotides in length and contains two ribosomal RNA genes, 13 protein-coding genes, 22 transfer RNA genes and one control region. The total length of the 13 protein-coding genes is longer than the American black bear, brown bear and polar bear by 3 amino acids at the end of ND5 gene. The codon usage also followed the typical vertebrate pattern except for an unusual ATT start codon, which initiates the NADH dehydrogenase subunit 5 (ND5) gene. The molecular phylogenetic analysis was performed on the sequences of 12 concatenated heavy-strand encoded protein-coding genes, and suggested that the giant panda is most closely related to bears.
Huang, Yanyan; Khan, Mazhar; Măndoiu, Ion I.
2013-01-01
We have previously developed a software package called PrimerHunter to design primers for PCR-based virus subtyping. In this study, 9 pairs of primers were designed with PrimerHunter and successfully used to differentiate the 9 neuraminidase (NA) genes of avian influenza viruses (AIVs) in multiple PCR-based assays. Furthermore, primer pools were designed and successfully used to decrease the number of reactions needed for NA subtyping from 9 to 4. The quadruplicate primer-pool method is cost-saving, and was shown to be suitable for the NA subtyping of both cultured AIVs and uncultured AIV swab samples. The primers selected for this study showed excellent sensitivity and specificity in NA subtyping by RT-PCR, SYBR green-based Real-time PCR and Real-time RT-PCR methods. AIV RNA of 2 to 200 copies (varied by NA subtypes) could be detected by these reactions. No unspecific amplification was displayed when detecting RNAs of other avian infectious viruses such as Infectious bronchitis virus, Infectious bursal disease virus and Newcastle disease virus. In summary, this study introduced several sensitive and specific PCR-based assays for NA subtyping of AIVs and also validated again the effectiveness of the PrimerHunter tool for the design of subtyping primers. PMID:24312367
DOE Office of Scientific and Technical Information (OSTI.GOV)
Jothikumar, N., E-mail: jin2@cdc.gov; Hill, Vincent R.
Highlights: •Uses a single-labeled fluorescent primer for real-time PCR. •The detection sensitivity of PET PCR was comparable to TaqMan PCR. •Melt curve analysis can be performed to confirm target amplicon production. •Conventional PCR primers can be converted to PET PCR primers. -- Abstract: We report the development of a fluorescently labeled oligonucleotide primer that can be used to monitor real-time PCR. The primer has two parts, the 3′-end of the primer is complimentary to the target and a universal 17-mer stem loop at the 5′-end forms a hairpin structure. A fluorescent dye is attached to 5′-end of either the forwardmore » or reverse primer. The presence of guanosine residues at the first and second position of the 3′ dangling end effectively quenches the fluorescence due to the photo electron transfer (PET) mechanism. During the synthesis of nucleic acid, the hairpin structure is linearized and the fluorescence of the incorporated primer increases several-fold due to release of the fluorescently labeled tail and the absence of guanosine quenching. As amplicons are synthesized during nucleic acid amplification, the fluorescence increase in the reaction mixture can be measured with commercially available real-time PCR instruments. In addition, a melting procedure can be performed to denature the double-stranded amplicons, thereby generating fluorescence peaks that can differentiate primer dimers and other non-specific amplicons if formed during the reaction. We demonstrated the application of PET-PCR for the rapid detection and quantification of Cryptosporidium parvum DNA. Comparison with a previously published TaqMan® assay demonstrated that the two real-time PCR assays exhibited similar sensitivity for a dynamic range of detection of 6000–0.6 oocysts per reaction. PET PCR primers are simple to design and less-expensive than dual-labeled probe PCR methods, and should be of interest for use by laboratories operating in resource-limited environments.« less
MRPrimer: a MapReduce-based method for the thorough design of valid and ranked primers for PCR.
Kim, Hyerin; Kang, NaNa; Chon, Kang-Wook; Kim, Seonho; Lee, NaHye; Koo, JaeHyung; Kim, Min-Soo
2015-11-16
Primer design is a fundamental technique that is widely used for polymerase chain reaction (PCR). Although many methods have been proposed for primer design, they require a great deal of manual effort to generate feasible and valid primers, including homology tests on off-target sequences using BLAST-like tools. That approach is inconvenient for many target sequences of quantitative PCR (qPCR) due to considering the same stringent and allele-invariant constraints. To address this issue, we propose an entirely new method called MRPrimer that can design all feasible and valid primer pairs existing in a DNA database at once, while simultaneously checking a multitude of filtering constraints and validating primer specificity. Furthermore, MRPrimer suggests the best primer pair for each target sequence, based on a ranking method. Through qPCR analysis using 343 primer pairs and the corresponding sequencing and comparative analyses, we showed that the primer pairs designed by MRPrimer are very stable and effective for qPCR. In addition, MRPrimer is computationally efficient and scalable and therefore useful for quickly constructing an entire collection of feasible and valid primers for frequently updated databases like RefSeq. Furthermore, we suggest that MRPrimer can be utilized conveniently for experiments requiring primer design, especially real-time qPCR. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
PrimerSuite: A High-Throughput Web-Based Primer Design Program for Multiplex Bisulfite PCR.
Lu, Jennifer; Johnston, Andrew; Berichon, Philippe; Ru, Ke-Lin; Korbie, Darren; Trau, Matt
2017-01-24
The analysis of DNA methylation at CpG dinucleotides has become a major research focus due to its regulatory role in numerous biological processes, but the requisite need for assays which amplify bisulfite-converted DNA represents a major bottleneck due to the unique design constraints imposed on bisulfite-PCR primers. Moreover, a review of the literature indicated no available software solutions which accommodated both high-throughput primer design, support for multiplex amplification assays, and primer-dimer prediction. In response, the tri-modular software package PrimerSuite was developed to support bisulfite multiplex PCR applications. This software was constructed to (i) design bisulfite primers against multiple regions simultaneously (PrimerSuite), (ii) screen for primer-primer dimerizing artefacts (PrimerDimer), and (iii) support multiplex PCR assays (PrimerPlex). Moreover, a major focus in the development of this software package was the emphasis on extensive empirical validation, and over 1300 unique primer pairs have been successfully designed and screened, with over 94% of them producing amplicons of the expected size, and an average mapping efficiency of 93% when screened using bisulfite multiplex resequencing. The potential use of the software in other bisulfite-based applications such as methylation-specific PCR is under consideration for future updates. This resource is freely available for use at PrimerSuite website (www.primer-suite.com).
Brown, Judith K; Ur-Rehman, Muhammad Zia; Avelar, Sofia; Chingandu, N; Hameed, Usman; Haider, Saleem; Ilyas, Muhammad
2017-09-15
At least five begomoviral species that cause leaf curl disease of cotton have emerged recently in Asia and Africa, reducing fiber quality and yield. The potential for the spread of these viruses to other cotton-vegetable growing regions throughout the world is extensive, owing to routine, global transport of alternative hosts of the leaf curl viruses, especially ornamentals. The research reported here describes the design and validation of polymerase chain reaction (PCR) primers undertaken to facilitate molecular detection of the two most-prevalent leaf curl-associated begomovirus-betasatellite complexes in the Indian Subcontinent and Africa, the Cotton leaf curl Kokhran virus-Burewala strain and Cotton leaf curl Gezira virus, endemic to Asia and Africa, respectively. Ongoing genomic diversification of these begomoviral-satellite complexes was evident based on nucleotide sequence alignments, and analysis of single nucleotide polymorphisms, both factors that created new challenges for primer design. The additional requirement for species and strain-specific, and betasatellite-specific primer design, imposes further constraints on primer design and validation due to the large number of related species and strains extant in 'core leaf curl virus complex', now with expanded distribution in south Asia, the Pacific region, and Africa-Arabian Peninsula that have relatively highly conserved coding and non-coding regions, which precludes much of the genome-betasatellite sequence when selecting primer 'targets'. Here, PCR primers were successfully designed and validated for detection of cloned viral genomes and betasatellites for representative 'core leaf curl' strains and species, distant relatives, and total DNA isolated from selected plant species. The application of molecular diagnostics to screen plant imports prior to export or release from ports of entry is expected to greatly reduce the likelihood of exotic leaf curl virus introductions that could dramatically affect the production of cotton as well as vegetable and ornamental crop hosts. Copyright © 2017 Elsevier B.V. All rights reserved.
Improved group-specific primers based on the full SILVA 16S rRNA gene reference database.
Pfeiffer, Stefan; Pastar, Milica; Mitter, Birgit; Lippert, Kathrin; Hackl, Evelyn; Lojan, Paul; Oswald, Andreas; Sessitsch, Angela
2014-08-01
Quantitative PCR (qPCR) and community fingerprinting methods, such as the Terminal Restriction Fragment Length Polymorphism (T-RFLP) analysis,are well-suited techniques for the examination of microbial community structures. The use of phylum and class-specific primers can provide enhanced sensitivity and phylogenetic resolution as compared with domain-specific primers. To date, several phylum- and class-specific primers targeting the 16S ribosomal RNA gene have been published. However, many of these primers exhibit low discriminatory power against non-target bacteria in PCR. In this study, we evaluated the precision of certain published primers in silico and via specific PCR. We designed new qPCR and T-RFLP primer pairs (for the classes Alphaproteobacteria and Betaproteobacteria, and the phyla Bacteroidetes, Firmicutes and Actinobacteria) by combining the sequence information from a public dataset (SILVA SSU Ref 102 NR) with manual primer design. We evaluated the primer pairs via PCR using isolates of the above-mentioned groups and via screening of clone libraries from environmental soil samples and human faecal samples. As observed through theoretical and practical evaluation, the primers developed in this study showed a higher level of precision than previously published primers, thus allowing a deeper insight into microbial community dynamics.
PrimerMapper: high throughput primer design and graphical assembly for PCR and SNP detection
O’Halloran, Damien M.
2016-01-01
Primer design represents a widely employed gambit in diverse molecular applications including PCR, sequencing, and probe hybridization. Variations of PCR, including primer walking, allele-specific PCR, and nested PCR provide specialized validation and detection protocols for molecular analyses that often require screening large numbers of DNA fragments. In these cases, automated sequence retrieval and processing become important features, and furthermore, a graphic that provides the user with a visual guide to the distribution of designed primers across targets is most helpful in quickly ascertaining primer coverage. To this end, I describe here, PrimerMapper, which provides a comprehensive graphical user interface that designs robust primers from any number of inputted sequences while providing the user with both, graphical maps of primer distribution for each inputted sequence, and also a global assembled map of all inputted sequences with designed primers. PrimerMapper also enables the visualization of graphical maps within a browser and allows the user to draw new primers directly onto the webpage. Other features of PrimerMapper include allele-specific design features for SNP genotyping, a remote BLAST window to NCBI databases, and remote sequence retrieval from GenBank and dbSNP. PrimerMapper is hosted at GitHub and freely available without restriction. PMID:26853558
Boeri, Eduardo J.; Wanke, María M.; Madariaga, María J.; Teijeiro, María L.; Elena, Sebastian A.; Trangoni, Marcos D.
2018-01-01
Aim: This study aimed to compare the sensitivity (S), specificity (Sp), and positive likelihood ratios (LR+) of four polymerase chain reaction (PCR) assays for the detection of Brucella spp. in dog’s clinical samples. Materials and Methods: A total of 595 samples of whole blood, urine, and genital fluids were evaluated between October 2014 and November 2016. To compare PCR assays, the gold standard was defined using a combination of different serological and microbiological test. Bacterial isolation from urine and blood cultures was carried out. Serological methods such as rapid slide agglutination test, indirect enzyme-linked immunosorbent assay, agar gel immunodiffusion test, and buffered plate antigen test were performed. Four genes were evaluated: (i) The gene coding for the BCSP31 protein, (ii) the ribosomal gene coding for the 16S-23S intergenic spacer region, (iii) the gene coding for porins omp2a/omp2b, and (iv) the gene coding for the insertion sequence IS711. Results: The results obtained were as follows: (1) For the primers that amplify the gene coding for the BCSP31 protein: S: 45.64% (confidence interval [CI] 39.81-51.46), Sp: 95.62% (CI 93.13-98.12), and LR+: 10.43 (CI 6.04-18); (2) for the primers that amplify the ribosomal gene of the 16S-23S rDNA intergenic spacer region: S: 69.80% (CI 64.42-75.18), Sp: 95.62 % (CI 93.13-98.12), and LR+: 11.52 (CI 7.31-18.13); (3) for the primers that amplify the omp2a and omp2b genes: S: 39.26% (CI 33.55-44.97), Sp: 97.31% (CI 95.30-99.32), and LR+ 14.58 (CI 7.25-29.29); and (4) for the primers that amplify the insertion sequence IS711: S: 22.82% (CI 17.89 - 27.75), Sp: 99.66% (CI 98.84-100), and LR+ 67.77 (CI 9.47-484.89). Conclusion: We concluded that the gene coding for the 16S-23S rDNA intergenic spacer region was the one that best detected Brucella spp. in canine clinical samples. PMID:29657404
URPD: a specific product primer design tool
2012-01-01
Background Polymerase chain reaction (PCR) plays an important role in molecular biology. Primer design fundamentally determines its results. Here, we present a currently available software that is not located in analyzing large sequence but used for a rather straight-forward way of visualizing the primer design process for infrequent users. Findings URPD (yoUR Primer Design), a web-based specific product primer design tool, combines the NCBI Reference Sequences (RefSeq), UCSC In-Silico PCR, memetic algorithm (MA) and genetic algorithm (GA) primer design methods to obtain specific primer sets. A friendly user interface is accomplished by built-in parameter settings. The incorporated smooth pipeline operations effectively guide both occasional and advanced users. URPD contains an automated process, which produces feasible primer pairs that satisfy the specific needs of the experimental design with practical PCR amplifications. Visual virtual gel electrophoresis and in silico PCR provide a simulated PCR environment. The comparison of Practical gel electrophoresis comparison to virtual gel electrophoresis facilitates and verifies the PCR experiment. Wet-laboratory validation proved that the system provides feasible primers. Conclusions URPD is a user-friendly tool that provides specific primer design results. The pipeline design path makes it easy to operate for beginners. URPD also provides a high throughput primer design function. Moreover, the advanced parameter settings assist sophisticated researchers in performing experiential PCR. Several novel functions, such as a nucleotide accession number template sequence input, local and global specificity estimation, primer pair redesign, user-interactive sequence scale selection, and virtual and practical PCR gel electrophoresis discrepancies have been developed and integrated into URPD. The URPD program is implemented in JAVA and freely available at http://bio.kuas.edu.tw/urpd/. PMID:22713312
URPD: a specific product primer design tool.
Chuang, Li-Yeh; Cheng, Yu-Huei; Yang, Cheng-Hong
2012-06-19
Polymerase chain reaction (PCR) plays an important role in molecular biology. Primer design fundamentally determines its results. Here, we present a currently available software that is not located in analyzing large sequence but used for a rather straight-forward way of visualizing the primer design process for infrequent users. URPD (yoUR Primer Design), a web-based specific product primer design tool, combines the NCBI Reference Sequences (RefSeq), UCSC In-Silico PCR, memetic algorithm (MA) and genetic algorithm (GA) primer design methods to obtain specific primer sets. A friendly user interface is accomplished by built-in parameter settings. The incorporated smooth pipeline operations effectively guide both occasional and advanced users. URPD contains an automated process, which produces feasible primer pairs that satisfy the specific needs of the experimental design with practical PCR amplifications. Visual virtual gel electrophoresis and in silico PCR provide a simulated PCR environment. The comparison of Practical gel electrophoresis comparison to virtual gel electrophoresis facilitates and verifies the PCR experiment. Wet-laboratory validation proved that the system provides feasible primers. URPD is a user-friendly tool that provides specific primer design results. The pipeline design path makes it easy to operate for beginners. URPD also provides a high throughput primer design function. Moreover, the advanced parameter settings assist sophisticated researchers in performing experiential PCR. Several novel functions, such as a nucleotide accession number template sequence input, local and global specificity estimation, primer pair redesign, user-interactive sequence scale selection, and virtual and practical PCR gel electrophoresis discrepancies have been developed and integrated into URPD. The URPD program is implemented in JAVA and freely available at http://bio.kuas.edu.tw/urpd/.
Barbi, Florian; Bragalini, Claudia; Vallon, Laurent; Prudent, Elsa; Dubost, Audrey; Fraissinet-Tachet, Laurence; Marmeisse, Roland; Luis, Patricia
2014-01-01
Plant biomass degradation in soil is one of the key steps of carbon cycling in terrestrial ecosystems. Fungal saprotrophic communities play an essential role in this process by producing hydrolytic enzymes active on the main components of plant organic matter. Open questions in this field regard the diversity of the species involved, the major biochemical pathways implicated and how these are affected by external factors such as litter quality or climate changes. This can be tackled by environmental genomic approaches involving the systematic sequencing of key enzyme-coding gene families using soil-extracted RNA as material. Such an approach necessitates the design and evaluation of gene family-specific PCR primers producing sequence fragments compatible with high-throughput sequencing approaches. In the present study, we developed and evaluated PCR primers for the specific amplification of fungal CAZy Glycoside Hydrolase gene families GH5 (subfamily 5) and GH11 encoding endo-β-1,4-glucanases and endo-β-1,4-xylanases respectively as well as Basidiomycota class II peroxidases, corresponding to the CAZy Auxiliary Activity family 2 (AA2), active on lignin. These primers were experimentally validated using DNA extracted from a wide range of Ascomycota and Basidiomycota species including 27 with sequenced genomes. Along with the published primers for Glycoside Hydrolase GH7 encoding enzymes active on cellulose, the newly design primers were shown to be compatible with the Illumina MiSeq sequencing technology. Sequences obtained from RNA extracted from beech or spruce forest soils showed a high diversity and were uniformly distributed in gene trees featuring the global diversity of these gene families. This high-throughput sequencing approach using several degenerate primers constitutes a robust method, which allows the simultaneous characterization of the diversity of different fungal transcripts involved in plant organic matter degradation and may lead to the discovery of complex patterns in gene expression of soil fungal communities. PMID:25545363
Real-time PCR (qPCR) primer design using free online software.
Thornton, Brenda; Basu, Chhandak
2011-01-01
Real-time PCR (quantitative PCR or qPCR) has become the preferred method for validating results obtained from assays which measure gene expression profiles. The process uses reverse transcription polymerase chain reaction (RT-PCR), coupled with fluorescent chemistry, to measure variations in transcriptome levels between samples. The four most commonly used fluorescent chemistries are SYBR® Green dyes and TaqMan®, Molecular Beacon or Scorpion probes. SYBR® Green is very simple to use and cost efficient. As SYBR® Green dye binds to any double-stranded DNA product, its success depends greatly on proper primer design. Many types of online primer design software are available, which can be used free of charge to design desirable SYBR® Green-based qPCR primers. This laboratory exercise is intended for those who have a fundamental background in PCR. It addresses the basic fluorescent chemistries of real-time PCR, the basic rules and pitfalls of primer design, and provides a step-by-step protocol for designing SYBR® Green-based primers with free, online software. Copyright © 2010 Wiley Periodicals, Inc.
Java web tools for PCR, in silico PCR, and oligonucleotide assembly and analysis.
Kalendar, Ruslan; Lee, David; Schulman, Alan H
2011-08-01
The polymerase chain reaction is fundamental to molecular biology and is the most important practical molecular technique for the research laboratory. We have developed and tested efficient tools for PCR primer and probe design, which also predict oligonucleotide properties based on experimental studies of PCR efficiency. The tools provide comprehensive facilities for designing primers for most PCR applications and their combinations, including standard, multiplex, long-distance, inverse, real-time, unique, group-specific, bisulphite modification assays, Overlap-Extension PCR Multi-Fragment Assembly, as well as a programme to design oligonucleotide sets for long sequence assembly by ligase chain reaction. The in silico PCR primer or probe search includes comprehensive analyses of individual primers and primer pairs. It calculates the melting temperature for standard and degenerate oligonucleotides including LNA and other modifications, provides analyses for a set of primers with prediction of oligonucleotide properties, dimer and G-quadruplex detection, linguistic complexity, and provides a dilution and resuspension calculator. Copyright © 2011 Elsevier Inc. All rights reserved.
Shimomura, Yumi; Morimoto, Sho; Hoshino, Yuko Takada; Uchida, Yoshitaka; Akiyama, Hiroko; Hayatsu, Masahito
2012-01-01
Ammonia monooxygenase subunit A gene (amoA) is frequently used as a functional gene marker for diversity analysis of ammonia-oxidizing bacteria (AOB). To select a suitable amoA primer for real-time PCR and PCR-denaturing gradient gel electrophoresis (DGGE), three reverse primers (degenerate primer amoA-2R; non-degenerate primers amoA-2R-GG and amoA-2IR) were examined. No significant differences were observed among the three primers in terms of quantitative values of amoA from environmental samples using real-time PCR. We found that PCR-DGGE analysis with the amoA-2IR primer gave the best results in this studied soil. These results indicate that amoA-2IR is a suitable primer for community analysis of AOB in the environment. PMID:22075625
Integrating PCR theory and bioinformatics into a research-oriented primer design exercise.
Robertson, Amber L; Phillips, Allison R
2008-01-01
Polymerase chain reaction (PCR) is a conceptually difficult technique that embodies many fundamental biological processes. Traditionally, students have struggled to analyze PCR results due to an incomplete understanding of the biological concepts (theory) of DNA replication and strand complementarity. Here we describe the design of a novel research-oriented exercise that prepares students to design DNA primers for PCR. Our exercise design includes broad and specific learning goals and assessments of student performance and perceptions. We developed this interactive Primer Design Exercise using the principles of scientific teaching to enhance student understanding of the theory behind PCR and provide practice in designing PCR primers to amplify DNA. In the end, the students were more poised to troubleshoot problems that arose in real experiments using PCR. In addition, students had the opportunity to utilize several bioinformatics tools to gain an increased understanding of primer quality, directionality, and specificity. In the course of this study many misconceptions about DNA replication during PCR and the need for primer specificity were identified and addressed. Students were receptive to the new materials and the majority achieved the learning goals.
Germer, Jeffrey J; Ankoudinova, Irina; Belousov, Yevgeniy S; Mahoney, Walt; Dong, Chen; Meng, Jihong; Mandrekar, Jayawant N; Yao, Joseph D
2017-05-01
Hepatitis E virus (HEV) has emerged as a cause of chronic hepatitis among immunocompromised patients. Molecular assays have become important tools for the diagnosis and management of these chronically infected patients. A real-time reverse transcription-quantitative PCR (RT-qPCR) assay utilizing Pleiades probe chemistry and an RNA internal control for the simultaneous detection and quantification of HEV RNA in human serum was developed based on an adaptation of a previously described and broadly reactive primer set targeting the overlapping open reading frame 2/3 (ORF2/3) nucleotide sequence of HEV. A chimeric bovine viral diarrhea virus construct containing an HEV RNA insert (SynTura HEV) was developed, value assigned with the first World Health Organization (WHO) international standard for HEV RNA (code 6329/10), and used to prepare working assay calibrators and controls, which supported an assay quantification range of 100 to 5,000,000 IU/ml. The analytical sensitivity (95% detection rate) of this assay was 25.2 IU/ml (95% confidence interval [CI], 19.2 to 44.1 IU/ml). The assay successfully amplified 16 different HEV sequences with significant nucleotide mismatching in primer/probe binding regions, while evaluation of a WHO international reference panel for HEV genotypes (code 8578/13) showed viral load results falling within the result ranges generated by WHO collaborative study participants for all panel members (genotypes 1 to 4). Broadly reactive RT-qPCR primers targeting HEV ORF2/3 were successfully adapted for use in an assay based on Pleiades probe chemistry. The availability of secondary standards calibrated to the WHO HEV international standard can improve the standardization and performance of assays for the detection and quantification of HEV RNA. Copyright © 2017 American Society for Microbiology.
miPrimer: an empirical-based qPCR primer design method for small noncoding microRNA
Kang, Shih-Ting; Hsieh, Yi-Shan; Feng, Chi-Ting; Chen, Yu-Ting; Yang, Pok Eric; Chen, Wei-Ming
2018-01-01
MicroRNAs (miRNAs) are 18–25 nucleotides (nt) of highly conserved, noncoding RNAs involved in gene regulation. Because of miRNAs’ short length, the design of miRNA primers for PCR amplification remains a significant challenge. Adding to the challenge are miRNAs similar in sequence and miRNA family members that often only differ in sequences by 1 nt. Here, we describe a novel empirical-based method, miPrimer, which greatly reduces primer dimerization and increases primer specificity by factoring various intrinsic primer properties and employing four primer design strategies. The resulting primer pairs displayed an acceptable qPCR efficiency of between 90% and 110%. When tested on miRNA families, miPrimer-designed primers are capable of discriminating among members of miRNA families, as validated by qPCR assays using Quark Biosciences’ platform. Of the 120 miRNA primer pairs tested, 95.6% and 93.3% were successful in amplifying specifically non-family and family miRNA members, respectively, after only one design trial. In summary, miPrimer provides a cost-effective and valuable tool for designing miRNA primers. PMID:29208706
A tool for design of primers for microRNA-specific quantitative RT-qPCR.
Busk, Peter K
2014-01-28
MicroRNAs are small but biologically important RNA molecules. Although different methods can be used for quantification of microRNAs, quantitative PCR is regarded as the reference that is used to validate other methods. Several commercial qPCR assays are available but they often come at a high price and the sequences of the primers are not disclosed. An alternative to commercial assays is to manually design primers but this work is tedious and, hence, not practical for the design of primers for a larger number of targets. I have developed the software miRprimer for automatic design of primers for the method miR-specific RT-qPCR, which is one of the best performing microRNA qPCR methods available. The algorithm is based on an implementation of the previously published rules for manual design of miR-specific primers with the additional feature of evaluating the propensity of formation of secondary structures and primer dimers. Testing of the primers showed that 76 out of 79 primers (96%) worked for quantification of microRNAs by miR-specific RT-qPCR of mammalian RNA samples. This success rate corresponds to the success rate of manual primer design. Furthermore, primers designed by this method have been distributed to several labs and used successfully in published studies. The software miRprimer is an automatic and easy method for design of functional primers for miR-specific RT-qPCR. The application is available as stand-alone software that will work on the MS Windows platform and in a developer version written in the Ruby programming language.
Kmieciak, Wioletta; Szewczyk, Eligia M; Ciszewski, Marcin
2016-07-01
The paper presents an analysis of 51 Staphylococcus pseudintermedius clinically isolated strains from humans and from animals. Staphylococcus pseudintermedius strains' ability to produce β-haemolysin was evaluated with phenotypic methods (hot-cold effect, reverse CAMP test). In order to determine the hlb gene presence (coding for β-haemolysin) in a genomic DNA, PCR reactions were conducted with two different pairs of primers: one described in the literature for Staphylococcus aureus and recommended for analysing SIG group staphylococci and newly designed one in CLC Main Workbench software. Only reactions with newly designed primers resulted in product amplification, the presence of which was fully compatible with the results of phenotypic β-haemolysin test. Negative results for S. aureus and S. intermedius reference ATCC strains suggest that after further analysis the fragment of hlb gene amplified with primers described in this study might be included in the process of S. pseudintermedius strains identification.
Randall, Luke; Lemma, Fabrizio; Rodgers, John; Vidal, Ana; Clifton-Hadley, Felicity
2010-02-01
A common problem of both conventional and real-time PCR assays is failure of DNA amplification due to the presence of inhibitory substances in samples. In view of this, our aim was to develop and evaluate internal amplification controls (IACs) for use with an existing duplex real-time PCR assay for Campylobacter coli and Campylobacter jejuni. Both competitive and non-competitive IACs were developed and evaluated. The competitive approach involved a DNA fragment of the coding region of the fish viral haemorrhagic septicaemia virus, flanked by the mapA PCR primers, whilst the non-competitive approach utilized an extra set of universal 16S rDNA primers. Both IAC-PCR assay types were evaluated using cultures of Campylobacter and chicken caecal content samples. Both IACs were sensitive to caecal inhibitors, making them suitable for detecting inhibition which could lead to false-negatives. Results showed that both IACs at optimum concentrations worked well without reducing the overall sensitivity of the PCR assay. Compared to culture, the optimized competitive IAC-PCR assay detected 45/47 positives (sensitivity 93.6 %, specificity 80.1 %); however, it had the advantage over culture in that it could detect mixed infections of C. coli and C. jejuni and was capable of giving a result for a sample within a day.
Yang, Lei; Naylor, Gavin J P
2016-01-01
We determined the complete mitochondrial genome sequence (16,760 bp) of the peacock skate Pavoraja nitida using a long-PCR based next generation sequencing method. It has 13 protein-coding genes, 22 tRNA genes, 2 rRNA genes, and 1 control region in the typical vertebrate arrangement. Primers, protocols, and procedures used to obtain this mitogenome are provided. We anticipate that this approach will facilitate rapid collection of mitogenome sequences for studies on phylogenetic relationships, population genetics, and conservation of cartilaginous fishes.
VizPrimer: a web server for visualized PCR primer design based on known gene structure.
Zhou, Yang; Qu, Wubin; Lu, Yiming; Zhang, Yanchun; Wang, Xiaolei; Zhao, Dongsheng; Yang, Yi; Zhang, Chenggang
2011-12-15
The visualization of gene structure plays an important role in polymerase chain reaction (PCR) primer design, especially for eukaryotic genes with a number of splice variants that users need to distinguish between via PCR. Here, we describe a visualized web server for primer design named VizPrimer. It utilizes the new information technology (IT) tools, HTML5 to display gene structure and JavaScript to interact with the users. In VizPrimer, the users can focus their attention on the gene structure and primer design strategy, without wasting time calculating the exon positions of splice variants or manually configuring complicated parameters. In addition, VizPrimer is also suitable for the design of PCR primers for amplifying open reading frames and detecting single nucleotide polymorphisms (SNPs). VizPrimer is freely available at http://biocompute.bmi.ac.cn/CZlab/VizPrimer/. The web server supported browsers: Chrome (≥5.0), Firefox (≥3.0), Safari (≥4.0) and Opera (≥10.0). zhangcg@bmi.ac.cn; yangyi528@vip.sina.com.
Microbeads display of proteins using emulsion PCR and cell-free protein synthesis.
Gan, Rui; Yamanaka, Yumiko; Kojima, Takaaki; Nakano, Hideo
2008-01-01
We developed a method for coupling protein to its coding DNA on magnetic microbeads using emulsion PCR and cell-free protein synthesis in emulsion. A PCR mixture containing streptavidin-coated microbeads was compartmentalized by water-in-oil (w/o) emulsion with estimated 0.5 template molecules per droplet. The template molecules were amplified and immobilized on beads via bead-linked reverse primers and biotinylated forward primers. After amplification, the templates were sequentially labeled with streptavidin and biotinylated anti-glutathione S-transferase (GST) antibody. The pool of beads was then subjected to cell-free protein synthesis compartmentalized in another w/o emulsion, in which templates were coupled to their coding proteins. We mixed two types of DNA templates of Histidine6 tag (His6)-fused and FLAG tag-fused GST in a ratio of 1:1,000 (His6: FLAG) for use as a model DNA library. After incubation with fluorescein isothiocyanate (FITC)-labeled anti-His6 (C-term) antibody, the beads with the His6 gene were enriched 917-fold in a single-round screening by using flow cytometry. A library with a theoretical diversity of 10(6) was constructed by randomizing the middle four residues of the His6 tag. After a two-round screening, the randomized sequences were substantially converged to peptide-encoding sequences recognized by the anti-His6 antibody.
Multiple pathogen biomarker detection using an encoded bead array in droplet PCR.
Periyannan Rajeswari, Prem Kumar; Soderberg, Lovisa M; Yacoub, Alia; Leijon, Mikael; Andersson Svahn, Helene; Joensson, Haakan N
2017-08-01
We present a droplet PCR workflow for detection of multiple pathogen DNA biomarkers using fluorescent color-coded Luminex® beads. This strategy enables encoding of multiple singleplex droplet PCRs using a commercially available bead set of several hundred distinguishable fluorescence codes. This workflow provides scalability beyond the limited number offered by fluorescent detection probes such as TaqMan probes, commonly used in current multiplex droplet PCRs. The workflow was validated for three different Luminex bead sets coupled to target specific capture oligos to detect hybridization of three microorganisms infecting poultry: avian influenza, infectious laryngotracheitis virus and Campylobacter jejuni. In this assay, the target DNA was amplified with fluorescently labeled primers by PCR in parallel in monodisperse picoliter droplets, to avoid amplification bias. The color codes of the Luminex detection beads allowed concurrent and accurate classification of the different bead sets used in this assay. The hybridization assay detected target DNA of all three microorganisms with high specificity, from samples with average target concentration of a single DNA template molecule per droplet. This workflow demonstrates the possibility of increasing the droplet PCR assay detection panel to detect large numbers of targets in parallel, utilizing the scalability offered by the color-coded Luminex detection beads. Copyright © 2017. Published by Elsevier B.V.
Lin, J S; Tsen, H Y
1999-10-01
Salmonella Typhimurium is one of the most important Salmonella serovars that may cause foodborne disease and human salmonellosis infection. Detection of this organism in the clinical samples of persons with gastroenteritis and the food samples associated with such persons may allow us to trace the cause of disease. Because malic acid dehydrogenase, an enzyme of the citric acid cycle, is common to organisms, the gene (mdh) coding for this enzyme was selected for the design of Salmonella Typhimurium-specific polymerase chain reaction (PCR) primers. By comparison of the mdh gene sequences of Salmonella Typhimurium and other Salmonella serotypes and of some isolates of other genera, two oligonucleotides were designed and used as PCR primers for the specific detection of Salmonella Typhimurium. The molecular weight of the PCR product was 261 bp as expected. Salmonella serovars other than Salmonella Typhimurium and isolates of other genera in the Enterobacteriaceae that is closely related to Salmonella did not generate any false-positive results. When this primer pair was used for the detection of Salmonella Typhimurium cells artificially inoculated into human stool specimens and food samples, such as milk and raw chicken meat, levels as low as 10(0) CFU per 0.1 g of stool specimen or per ml of milk or food homogenate could be detected if an 8- to 12-h preculture step using combined lactose-tetrathionate broth was performed prior to the PCR.
An innovative SNP genotyping method adapting to multiple platforms and throughputs.
Long, Y M; Chao, W S; Ma, G J; Xu, S S; Qi, L L
2017-03-01
An innovative genotyping method designated as semi-thermal asymmetric reverse PCR (STARP) was developed for genotyping individual SNPs with improved accuracy, flexible throughputs, low operational costs, and high platform compatibility. Multiplex chip-based technology for genome-scale genotyping of single nucleotide polymorphisms (SNPs) has made great progress in the past two decades. However, PCR-based genotyping of individual SNPs still remains problematic in accuracy, throughput, simplicity, and/or operational costs as well as the compatibility with multiple platforms. Here, we report a novel SNP genotyping method designated semi-thermal asymmetric reverse PCR (STARP). In this method, genotyping assay was performed under unique PCR conditions using two universal priming element-adjustable primers (PEA-primers) and one group of three locus-specific primers: two asymmetrically modified allele-specific primers (AMAS-primers) and their common reverse primer. The two AMAS-primers each were substituted one base in different positions at their 3' regions to significantly increase the amplification specificity of the two alleles and tailed at 5' ends to provide priming sites for PEA-primers. The two PEA-primers were developed for common use in all genotyping assays to stringently target the PCR fragments generated by the two AMAS-primers with similar PCR efficiencies and for flexible detection using either gel-free fluorescence signals or gel-based size separation. The state-of-the-art primer design and unique PCR conditions endowed STARP with all the major advantages of high accuracy, flexible throughputs, simple assay design, low operational costs, and platform compatibility. In addition to SNPs, STARP can also be employed in genotyping of indels (insertion-deletion polymorphisms). As vast variations in DNA sequences are being unearthed by many genome sequencing projects and genotyping by sequencing, STARP will have wide applications across all biological organisms in agriculture, medicine, and forensics.
Chirkov, Sergei; Ivanov, Peter; Sheveleva, Anna
2013-06-01
Atypical isolates of plum pox virus (PPV) were discovered in naturally infected sour cherry in urban ornamental plantings in Moscow, Russia. The isolates were detected by polyclonal double antibody sandwich ELISA and RT-PCR using universal primers specific for the 3'-non-coding and coat protein (CP) regions of the genome but failed to be recognized by triple antibody sandwich ELISA with the universal monoclonal antibody 5B and by RT-PCR using primers specific to for PPV strains D, M, C and W. Sequence analysis of the CP genes of nine isolates revealed 99.2-100 % within-group identity and 62-85 % identity to conventional PPV strains. Phylogenetic analysis showed that the atypical isolates represent a group that is distinct from the known PPV strains. Alignment of the N-terminal amino acid sequences of CP demonstrated their close similarity to those of a new tentative PPV strain, CR.
A Novel Universal Primer-Multiplex-PCR Method with Sequencing Gel Electrophoresis Analysis
Huang, Kunlun; Zhang, Nan; Yuan, Yanfang; Shang, Ying; Luo, Yunbo
2012-01-01
In this study, a novel universal primer-multiplex-PCR (UP-M-PCR) method adding a universal primer (UP) in the multiplex PCR reaction system was described. A universal adapter was designed in the 5′-end of each specific primer pairs which matched with the specific DNA sequences for each template and also used as the universal primer (UP). PCR products were analyzed on sequencing gel electrophoresis (SGE) which had the advantage of exhibiting extraordinary resolution. This method overcame the disadvantages rooted deeply in conventional multiplex PCR such as complex manipulation, lower sensitivity, self-inhibition and amplification disparity resulting from different primers, and it got a high specificity and had a low detection limit of 0.1 ng for single kind of crops when screening the presence of genetically modified (GM) crops in mixture samples. The novel developed multiplex PCR assay with sequencing gel electrophoresis analysis will be useful in many fields, such as verifying the GM status of a sample irrespective of the crop and GM trait and so on. PMID:22272223
Villard, Pierre; Malausa, Thibaut
2013-07-01
SP-Designer is an open-source program providing a user-friendly tool for the design of specific PCR primer pairs from a DNA sequence alignment containing sequences from various taxa. SP-Designer selects PCR primer pairs for the amplification of DNA from a target species on the basis of several criteria: (i) primer specificity, as assessed by interspecific sequence polymorphism in the annealing regions, (ii) the biochemical characteristics of the primers and (iii) the intended PCR conditions. SP-Designer generates tables, detailing the primer pair and PCR characteristics, and a FASTA file locating the primer sequences in the original sequence alignment. SP-Designer is Windows-compatible and freely available from http://www2.sophia.inra.fr/urih/sophia_mart/sp_designer/info_sp_designer.php. © 2013 John Wiley & Sons Ltd.
Specific Primers for Rapid Detection of Microsporum audouinii by PCR in Clinical Samples▿
Roque, H. D.; Vieira, R.; Rato, S.; Luz-Martins, M.
2006-01-01
This report describes application of PCR fingerprinting to identify common species of dermatophytes using the microsatellite primers M13, (GACA)4, and (GTG)5. The initial PCR analysis rendered a specific DNA fragment for Microsporum audouinii, which was cloned and sequenced. Based on the sequencing data of this fragment, forward (MA_1F) and reverse (MA_1R) primers were designed and verified by PCR to establish their reliability in the diagnosis of M. audouinii. These primers produced a singular PCR band of 431 bp specific only to strains and isolates of M. audouinii, based on a global test of 182 strains/isolates belonging to 11 species of dermatophytes. These findings indicate these primers are reliable for diagnostic purposes, and we recommend their use in laboratory analysis. PMID:17005755
Specific primers for rapid detection of Microsporum audouinii by PCR in clinical samples.
Roque, H D; Vieira, R; Rato, S; Luz-Martins, M
2006-12-01
This report describes application of PCR fingerprinting to identify common species of dermatophytes using the microsatellite primers M13, (GACA)4, and (GTG)5. The initial PCR analysis rendered a specific DNA fragment for Microsporum audouinii, which was cloned and sequenced. Based on the sequencing data of this fragment, forward (MA_1F) and reverse (MA_1R) primers were designed and verified by PCR to establish their reliability in the diagnosis of M. audouinii. These primers produced a singular PCR band of 431 bp specific only to strains and isolates of M. audouinii, based on a global test of 182 strains/isolates belonging to 11 species of dermatophytes. These findings indicate these primers are reliable for diagnostic purposes, and we recommend their use in laboratory analysis.
Detection of enteroviruses and hepatitis a virus in water by consensus primer multiplex RT-PCR
Li, Jun-Wen; Wang, Xin-Wei; Yuan, Chang-Qing; Zheng, Jin-Lai; Jin, Min; Song, Nong; Shi, Xiu-Quan; Chao, Fu-Huan
2002-01-01
AIM: To develop a rapid detection method of enteroviruses and Hepatitis A virus (HAV). METHODS: A one-step, single-tube consensus primers multiplex RT-PCR was developed to simultaneously detect Poliovirus, Coxsackie virus, Echovirus and HAV. A general upstream primer and a HAV primer and four different sets of primers (5 primers) specific for Poliovirus, Coxsacki evirus, Echovirus and HAV cDNA were mixed in the PCR mixture to reverse transcript and amplify the target DNA. Four distinct amplified DNA segments representing Poliovirus, Coxsackie virus, Echovirus and HAV were identified by gel electrophoresis as 589-, 671-, 1084-, and 1128 bp sequences, respectively. Semi-nested PCR was used to confirm the amplified products for each enterovirus and HAV. RESULTS: All four kinds of viral genome RNA were detected, and producing four bands which could be differentiated by the band size on the gel. To confirm the specificity of the multiplex PCR products, semi-nested PCR was performed. For all the four strains tested gave positive results. The detection sensitivity of multiplex PCR was similar to that of monoplex RT-PCR which was 24 PFU for Poliovrus, 21 PFU for Coxsackie virus, 60 PFU for Echovirus and 105 TCID50 for HAV. The minimum amount of enteric viral RNA detected by semi-nested PCR was equivalent to 2.4 PFU for Poliovrus, 2.1 PFU for Coxsackie virus, 6.0 PFU for Echovirus and 10.5 TCID50 for HAV. CONCLUSION: The consensus primers multiplex RT-PCR has more advantages over monoplex RT-PCR for enteric viruses detection, namely, the rapid turnaround time and cost effectiveness. PMID:12174381
Stöcher, Markus; Leb, Victoria; Hölzl, Gabriele; Berg, Jörg
2002-12-01
The real-time PCR technology allows convenient detection and quantification of virus derived DNA. This approach is used in many PCR based assays in clinical laboratories. Detection and quantification of virus derived DNA is usually performed against external controls or external standards. Thus, adequacy within a clinical sample is not monitored for. This can be achieved using internal controls that are co-amplified with the specific target within the same reaction vessel. We describe a convenient way to prepare heterologous internal controls as competitors for real-time PCR based assays. The internal controls were devised as competitors in real-time PCR, e.g. LightCycler-PCR. The bacterial neomycin phosphotransferase gene (neo) was used as source for heterologous DNA. Within the neo gene a box was chosen containing sequences for four differently spaced forward primers, one reverse primer, and a pair of neo specific hybridization probes. Pairs of primers were constructed to compose of virus-specific primer sequences and neo box specific primer sequences. Using those composite primers in conventional preparative PCR four types of internal controls were amplified from the neo box and subsequently cloned. A panel of the four differently sized internal controls was generated and tested by LightCycler PCR using their virus-specific primers. All four different PCR products were detected with the single pair of neo specific FRET-hybridization probes. The presented approach to generate competitive internal controls for use in LightCycler PCR assays proved convenient und rapid. The obtained internal controls match most PCR product sizes used in clinical routine molecular assays and will assist to discriminate true from false negative results.
Phytoplasma-specific PCR primers based on sequences of the 16S-23S rRNA spacer region.
Smart, C D; Schneider, B; Blomquist, C L; Guerra, L J; Harrison, N A; Ahrens, U; Lorenz, K H; Seemüller, E; Kirkpatrick, B C
1996-01-01
In order to develop a diagnostic tool to identify phytoplasmas and classify them according to their phylogenetic group, we took advantage of the sequence diversity of the 16S-23S intergenic spacer regions (SRs) of phytoplasmas. Ten PCR primers were developed from the SR sequences and were shown to amplify in a group-specific fashion. For some groups of phytoplasmas, such as elm yellows, ash yellows, and pear decline, the SR primer was paired with a specific primer from within the 16S rRNA gene. Each of these primer pairs was specific for a specific phytoplasma group, and they did not produce PCR products of the correct size from any other phytoplasma group. One primer was designed to anneal within the conserved tRNA(Ile) and, when paired with a universal primer, amplified all phytoplasmas tested. None of the primers produced PCR amplification products of the correct size from healthy plant DNA. These primers can serve as effective tools for identifying particular phytoplasmas in field samples. PMID:8702291
CODEHOP (COnsensus-DEgenerate Hybrid Oligonucleotide Primer) PCR primer design
Rose, Timothy M.; Henikoff, Jorja G.; Henikoff, Steven
2003-01-01
We have developed a new primer design strategy for PCR amplification of distantly related gene sequences based on consensus-degenerate hybrid oligonucleotide primers (CODEHOPs). An interactive program has been written to design CODEHOP PCR primers from conserved blocks of amino acids within multiply-aligned protein sequences. Each CODEHOP consists of a pool of related primers containing all possible nucleotide sequences encoding 3–4 highly conserved amino acids within a 3′ degenerate core. A longer 5′ non-degenerate clamp region contains the most probable nucleotide predicted for each flanking codon. CODEHOPs are used in PCR amplification to isolate distantly related sequences encoding the conserved amino acid sequence. The primer design software and the CODEHOP PCR strategy have been utilized for the identification and characterization of new gene orthologs and paralogs in different plant, animal and bacterial species. In addition, this approach has been successful in identifying new pathogen species. The CODEHOP designer (http://blocks.fhcrc.org/codehop.html) is linked to BlockMaker and the Multiple Alignment Processor within the Blocks Database World Wide Web (http://blocks.fhcrc.org). PMID:12824413
Kamau, Everlyn; Agoti, Charles N; Lewa, Clement S; Oketch, John; Owor, Betty E; Otieno, Grieven P; Bett, Anne; Cane, Patricia A; Nokes, D James
2017-03-01
Direct immuno-fluorescence test (IFAT) and multiplex real-time RT-PCR have been central to RSV diagnosis in Kilifi, Kenya. Recently, these two methods showed discrepancies with an increasing number of PCR undetectable RSV-B viruses. Establish if mismatches in the primer and probe binding sites could have reduced real-time RT-PCR sensitivity. Nucleoprotein (N) and glycoprotein (G) genes were sequenced for real-time RT-PCR positive and negative samples. Primer and probe binding regions in N gene were checked for mismatches and phylogenetic analyses done to determine molecular epidemiology of these viruses. New primers and probe were designed and tested on the previously real-time RT-PCR negative samples. N gene sequences revealed 3 different mismatches in the probe target site of PCR negative, IFAT positive viruses. The primers target sites had no mismatches. Phylogenetic analysis of N and G genes showed that real-time RT-PCR positive and negative samples fell into distinct clades. Newly designed primers-probe pair improved detection and recovered previous PCR undetectable viruses. An emerging RSV-B variant is undetectable by a quite widely used real-time RT-PCR assay due to polymorphisms that influence probe hybridization affecting PCR accuracy. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.
Nakayama, Manabu; Oda, Hirotsugu; Nakagawa, Kenji; Yasumi, Takahiro; Kawai, Tomoki; Izawa, Kazushi; Nishikomori, Ryuta; Heike, Toshio; Ohara, Osamu
2017-03-01
Autoinflammatory diseases occupy one of a group of primary immunodeficiency diseases that are generally thought to be caused by mutation of genes responsible for innate immunity, rather than by acquired immunity. Mutations related to autoinflammatory diseases occur in 12 genes. For example, low-level somatic mosaic NLRP3 mutations underlie chronic infantile neurologic, cutaneous, articular syndrome (CINCA), also known as neonatal-onset multisystem inflammatory disease (NOMID). In current clinical practice, clinical genetic testing plays an important role in providing patients with quick, definite diagnoses. To increase the availability of such testing, low-cost high-throughput gene-analysis systems are required, ones that not only have the sensitivity to detect even low-level somatic mosaic mutations, but also can operate simply in a clinical setting. To this end, we developed a simple method that employs two-step tailed PCR and an NGS system, MiSeq platform, to detect mutations in all coding exons of the 12 genes responsible for autoinflammatory diseases. Using this amplicon sequencing system, we amplified a total of 234 amplicons derived from the 12 genes with multiplex PCR. This was done simultaneously and in one test tube. Each sample was distinguished by an index sequence of second PCR primers following PCR amplification. With our procedure and tips for reducing PCR amplification bias, we were able to analyze 12 genes from 25 clinical samples in one MiSeq run. Moreover, with the certified primers designed by our short program-which detects and avoids common SNPs in gene-specific PCR primers-we used this system for routine genetic testing. Our optimized procedure uses a simple protocol, which can easily be followed by virtually any office medical staff. Because of the small PCR amplification bias, we can analyze simultaneously several clinical DNA samples with low cost and can obtain sufficient read numbers to detect a low level of somatic mosaic mutations.
Pauthenier, Cyrille; Faulon, Jean-Loup
2014-07-01
PrecisePrimer is a web-based primer design software made to assist experimentalists in any repetitive primer design task such as preparing, cloning and shuffling DNA libraries. Unlike other popular primer design tools, it is conceived to generate primer libraries with popular PCR polymerase buffers proposed as pre-set options. PrecisePrimer is also meant to design primers in batches, such as for DNA libraries creation of DNA shuffling experiments and to have the simplest interface possible. It integrates the most up-to-date melting temperature algorithms validated with experimental data, and cross validated with other computational tools. We generated a library of primers for the extraction and cloning of 61 genes from yeast DNA genomic extract using default parameters. All primer pairs efficiently amplified their target without any optimization of the PCR conditions. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.
A mutant screening method by critical annealing temperature-PCR for site-directed mutagenesis.
Liu, Ying; Wu, Ting; Song, Jian; Chen, Xuelian; Zhang, Yu; Wan, Yu
2013-03-11
Distinguishing desired mutants from parental templates and undesired mutants is a problem not well solved in Quikchange™ mutagenesis. Although Dpn I digestion can eliminate methylated parental (WT) DNA, the efficiency is not satisfying due to the existence of hemi-methylated DNA in the PCR products, which is resistant to Dpn I. The present study designed a novel critical annealing temperature (T(c))-PCR to replace Dpn I digestion for more perfect mutant distinguishing, in which part-overlapping primers containing mutation(s) were used to reduce initial concentration of template DNA in mutagenic PCR. A T(c)-PCR with the same mutagenic primers was performed without Dpn I digestion. The T(c) for each pair of the primers was identified by gradient PCR. The relationship between PCR-identified T(c) and T(m) of the primers was analyzed and modeled with correlation and regression. Gradient PCR identified a T(c) for each of 14 tested mutagenic primers, which could discriminate mismatched parental molecules and undesired mutants from desired mutants. The PCR-identified T(c) was correlated to the primer's T(m) (r = 0.804, P<0.0001). Thus, in practical applications, the T(c) can be easily calculated with a regression equation, T(c)= 48.81 + 0.253*T(m). The new protocol introduced a novel T(c)-PCR method for mutant screening which can more efficiently and accurately select against parental molecules and undesired mutations in mutagenic sequence segments.
Bomfim, Maria Rosa Quaresma; Koury, Matilde Cota
2006-12-20
We evaluated the use of low-stringency single specific primer PCR (LSSP-PCR) for genetically typing Leptospira directly from urine samples of cattle with clinical suspicion of leptospirosis. Urine samples obtained from 40 cattle with clinical suspicion of leptospirosis were amplified by specific PCR using the following primers: Internal 1/Internal 2 and G1/G2. The internal primers were designed from the gene sequence of the outer membrane lipoprotein Lip32 from Leptospira kirschneri, strain RM52. The PCR products were amplified with these two pairs of primers, which had approximately 497 and 285bp, respectively, and were subsequently used as a template for LSSP-PCR analysis. The genetic signatures from the leptospires which were present in the urine samples allowed us to make a preliminary identification of the leptospires by comparing the LSSP-PCR profiles obtained directly from urine samples with those from reference leptospires. The LSSP-PCR profiles obtained with the Internal 1 primer or with the G1 primer allowed the grouping of the leptospires into serogroups. LSSP-PCR was found to be a useful and sensitive approach capable of identifying leptospires directly from biological samples without the need for prior bacterial isolation. In conclusion, the LSSP-PCR technique may still be helpful in discriminating serogroups of Leptospira from different animal reservoirs, since the early identification of carrier animals and information on the shedding state are crucial to prevent the spread of leptospiral infection to other animals and humans.
Yang, Litao; Xu, Songci; Pan, Aihu; Yin, Changsong; Zhang, Kewei; Wang, Zhenying; Zhou, Zhigang; Zhang, Dabing
2005-11-30
Because of the genetically modified organisms (GMOs) labeling policies issued in many countries and areas, polymerase chain reaction (PCR) methods were developed for the execution of GMO labeling policies, such as screening, gene specific, construct specific, and event specific PCR detection methods, which have become a mainstay of GMOs detection. The event specific PCR detection method is the primary trend in GMOs detection because of its high specificity based on the flanking sequence of the exogenous integrant. This genetically modified maize, MON863, contains a Cry3Bb1 coding sequence that produces a protein with enhanced insecticidal activity against the coleopteran pest, corn rootworm. In this study, the 5'-integration junction sequence between the host plant DNA and the integrated gene construct of the genetically modified maize MON863 was revealed by means of thermal asymmetric interlaced-PCR, and the specific PCR primers and TaqMan probe were designed based upon the revealed 5'-integration junction sequence; the conventional qualitative PCR and quantitative TaqMan real-time PCR detection methods employing these primers and probes were successfully developed. In conventional qualitative PCR assay, the limit of detection (LOD) was 0.1% for MON863 in 100 ng of maize genomic DNA for one reaction. In the quantitative TaqMan real-time PCR assay, the LOD and the limit of quantification were eight and 80 haploid genome copies, respectively. In addition, three mixed maize samples with known MON863 contents were detected using the established real-time PCR systems, and the ideal results indicated that the established event specific real-time PCR detection systems were reliable, sensitive, and accurate.
Kim, Min Jung; Hwang, Kyung Hwan; Lee, Young-Seok; Park, Jae-Yoon; Kook, Joong-Ki
2011-03-01
The aim of this study was to develop Prevotella intermedia-specific PCR primers based on the P. intermedia-specific DNA probe. The P. intermedia-specific DNA probe was screened by inverted dot blot hybridization and confirmed by Southern blot hybridization. The nucleotide sequences of the species-specific DNA probes were determined using a chain termination method. Southern blot analysis showed that the DNA probe, Pig27, detected only the genomic DNA of P. intermedia strains. PCR showed that the PCR primers, Pin-F1/Pin-R1, had species-specificity for P. intermedia. The detection limits of the PCR primer sets were 0.4pg of the purified genomic DNA of P. intermedia ATCC 49046. These results suggest that the PCR primers, Pin-F1/Pin-R1, could be useful in the detection of P. intermedia as well as in the development of a PCR kit in epidemiological studies related to periodontal diseases. Crown Copyright © 2010. Published by Elsevier B.V. All rights reserved.
Yutin, Natalya; Suzuki, Marcelino T; Rosenberg, Mira; Rotem, Denisse; Madigan, Michael T; Süling, Jörg; Imhoff, Johannes F; Béjà, Oded
2009-12-01
To detect anoxygenic bacteria containing either type 1 or type 2 photosynthetic reaction centers in a single PCR, we designed a degenerate primer set based on the bchY gene. The new primers were validated in silico using the GenBank nucleotide database as well as by PCR on pure strains and environmental DNA.
Long distance PCR in detection of inversion mutations of F8C gene in hemophilia A patients.
Poláková, H; Zmetáková, I; Kádasi, L'
2003-06-01
In the present paper, the experience with detection of intron 22 inversion of F8C gene in severe hemophilia A patients using a recently described long-distance PCR (LD-PCR) method was reported. To test the sensitivity and the specifity of the LD-PCR, analysis of 46 DNA samples of patients and their family members, previously tested by Southern hybridization, was performed. In addition, 16 DNA samples of severe hemophilia A patients in which causative mutation was unknown, were included in analysis. Four-primers, P, Q, A&B, which are able to differentiate between the affected males with or without the inversion, and in female carriers, were used in LD-PCR. Two primers, P&Q, are located within the F8C gene flanking int22h1. Two further primers, A&B, flank int22h2 and int22h3, extragene homologs of int22h1. Nine combinations of four primers were used to identify the optimal one. Four-primers (P, Q, A&B), three-primers (P,Q & B;P, A & B; A, B & Q;P, Q & A) and two-primers (A & B; P & Q; A & Q; P & B) PCR amplifications were performed in the hemophilia A patients as well as in obligate carriers DNA samples. Successful amplification required introduction of some modifications of the original protocol. The most reproducible and uniform results were obtained using two-primers PCR, performed in four single reactions. Thus, a total of 46 DNA samples, 22 were hemizygous for inversion, 6 without the inversion, 14 carriers and 4 non-carriers of inversion. Perfect correlation between genotypes determined using Southern hybridization and LD-PCR was achieved. The optimalized two-primers LD-PCR protocol was used for analysis of 16 DNA samples of severe hemophilia A patients with unknown mutation. Ten cases of inversions and six cases without them were detected. Thus in additional 10 severe hemophilic patients DNA diagnosis was completed. The most successful and reproducible results were obtained performing four single LD-PCR reactions with combinations of two-primers A & B; P & Q; A&Q, and P&B in each DNA sample and this approach is recommended for routine using in clinical practice.
Sato, Naoki; Seo, Genichiro; Benno, Yoshimi
2014-01-01
Strain-specific polymerase chain reaction (PCR) primers for detection of Bacillus mesentericus strain TO-A (BM TO-A) were developed. The randomly amplified polymorphic DNA (RAPD) technique was used to produce potential strain-specific markers. A 991-bp RAPD marker found to be strain-specific was sequenced, and two primer pairs specific to BM TO-A were constructed based on this sequence. In addition, we explored a more specific DNA region using inverse PCR, and designed a strain-specific primer set for use in real-time quantitative PCR (qPCR). These primer pairs were tested against 25 Bacillus subtilis strains and were found to be strain-specific. After examination of the detection limit and linearity of detection of BM TO-A in feces, the qPCR method and strain-specific primers were used to quantify BM TO-A in the feces of healthy volunteers who had ingested 3×10(8) colony forming unit (CFU) of BM TO-A per day in tablets. During the administration period, BM TO-A was detected in the feces of all 24 subjects, and the average number of BM TO-A detected using the culture method and qPCR was about 10(4.8) and 10(5.8) cells per gram of feces, respectively. Using the qPCR method, BM TO-A was detected in the feces of half of the subjects 3 d after withdrawal, and was detected in the feces of only one subject 1 week after withdrawal. These results suggest that the qPCR method using BM TO-A strain-specific primers is useful for the quantitative detection of this strain in feces.
Hu, Yanhui; Sopko, Richelle; Foos, Marianna; Kelley, Colleen; Flockhart, Ian; Ammeux, Noemie; Wang, Xiaowei; Perkins, Lizabeth; Perrimon, Norbert; Mohr, Stephanie E.
2013-01-01
The evaluation of specific endogenous transcript levels is important for understanding transcriptional regulation. More specifically, it is useful for independent confirmation of results obtained by the use of microarray analysis or RNA-seq and for evaluating RNA interference (RNAi)-mediated gene knockdown. Designing specific and effective primers for high-quality, moderate-throughput evaluation of transcript levels, i.e., quantitative, real-time PCR (qPCR), is nontrivial. To meet community needs, predefined qPCR primer pairs for mammalian genes have been designed and sequences made available, e.g., via PrimerBank. In this work, we adapted and refined the algorithms used for the mammalian PrimerBank to design 45,417 primer pairs for 13,860 Drosophila melanogaster genes, with three or more primer pairs per gene. We experimentally validated primer pairs for ~300 randomly selected genes expressed in early Drosophila embryos, using SYBR Green-based qPCR and sequence analysis of products derived from conventional PCR. All relevant information, including primer sequences, isoform specificity, spatial transcript targeting, and any available validation results and/or user feedback, is available from an online database (www.flyrnai.org/flyprimerbank). At FlyPrimerBank, researchers can retrieve primer information for fly genes either one gene at a time or in batch mode. Importantly, we included the overlap of each predicted amplified sequence with RNAi reagents from several public resources, making it possible for researchers to choose primers suitable for knockdown evaluation of RNAi reagents (i.e., to avoid amplification of the RNAi reagent itself). We demonstrate the utility of this resource for validation of RNAi reagents in vivo. PMID:23893746
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gardner, S N; Clague, D S; Vandersall, J A
2006-02-23
The polymerase chain reaction (PCR) stands among the keystone technologies for analysis of biological sequence data. PCR is used to amplify DNA, to generate many copies from as little as a single template. This is essential, for example, in processing forensic DNA samples, pathogen detection in clinical or biothreat surveillance applications, and medical genotyping for diagnosis and treatment of disease. It is used in virtually every laboratory doing molecular, cellular, genetic, ecologic, forensic, or medical research. Despite its ubiquity, we lack the precise predictive capability that would enable detailed optimization of PCR reaction dynamics. In this LDRD, we proposed tomore » develop Virtual PCR (VPCR) software, a computational method to model the kinetic, thermodynamic, and biological processes of PCR reactions. Given a successful completion, these tools will allow us to predict both the sequences and concentrations of all species that are amplified during PCR. The ability to answer the following questions will allow us both to optimize the PCR process and interpret the PCR results: What products are amplified when sequence mixtures are present, containing multiple, closely related targets and multiplexed primers, which may hybridize with sequence mismatches? What are the effects of time, temperature, and DNA concentrations on the concentrations of products? A better understanding of these issues will improve the design and interpretation of PCR reactions. The status of the VPCR project after 1.5 years of funding is consistent with the goals of the overall project which was scoped for 3 years of funding. At half way through the projected timeline of the project we have an early beta version of the VPCR code. We have begun investigating means to improve the robustness of the code, performed preliminary experiments to test the code and begun drafting manuscripts for publication. Although an experimental protocol for testing the code was developed, the preliminary experiments were tainted by contaminated products received from the manufacturer. Much knowledge has been gained in the development of the code thus far, but without final debugging, increasing its robustness and verifying it against experimental results, the papers which we have drafted to share our findings still require the final data necessary for publication. The following sections summarize our final progress on VPCR as it stands after 1.5 years of effort on an ambitious project scoped for a 3 year period. We have additional details of the methods than are provided here, but would like to have legal protection in place before releasing them. The result of this project, a suite of programs that predict PCR products as a function of reaction conditions and sequences, will be used to address outstanding questions in pathogen detection and forensics at LLNL. VPCR should enable scientists to optimize PCR protocols in terms of time, temperature, ion concentration, and primer sequences and concentrations, and to estimate products and error rates in advance of performing experiments. Our proposed capabilities are well ahead of all currently available technologies, which do not model non-equilibrium kinetics, polymerase extension, or predict multiple or undesired PCR products. We are currently seeking DHS funding to complete the project, at which time licensing opportunities will be explored, an updated patent application will be prepared, and a publication will be submitted. A provisional and a full patent application have already been filed (1).« less
van Doorn, J.; Hollinger, T. C.; Oudega, B.
2001-01-01
A sensitive and specific detection method was developed for Xanthomonas hyacinthi; this method was based on amplification of a subsequence of the type IV fimbrial-subunit gene fimA from strain S148. The fimA gene was amplified by PCR with degenerate DNA primers designed by using the N-terminal and C-terminal amino acid sequences of trypsin fragments of FimA. The nucleotide sequence of fimA was determined and compared with the nucleotide sequences coding for the fimbrial subunits in other type IV fimbria-producing bacteria, such as Xanthomonas campestris pv. vesicatoria, Neisseria gonorrhoeae, and Moraxella bovis. In a PCR internal primers JAAN and JARA, designed by using the nucleotide sequences of the variable central and C-terminal region of fimA, amplified a 226-bp DNA fragment in all X. hyacinthi isolates. This PCR was shown to be pathovar specific, as assessed by testing 71 Xanthomonas pathovars and bacterial isolates belonging to other genera, such as Erwinia and Pseudomonas. Southern hybridization experiments performed with the labelled 226-bp DNA amplicon as a probe suggested that there is only one structural type IV fimbrial-gene cluster in X. hyacinthi. Only two Xanthomonas translucens pathovars cross-reacted weakly in PCR. Primers amplifying a subsequence of the fimA gene of X. campestris pv. vesicatoria (T. Ojanen-Reuhs, N. Kalkkinen, B. Westerlund-Wikström, J. van Doorn, K. Haahtela, E.-L. Nurmiaho-Lassila, K. Wengelink, U. Bonas, and T. K. Korhonen, J. Bacteriol. 179: 1280–1290, 1997) were shown to be pathovar specific, indicating that the fimbrial-subunit sequences are more generally applicable in xanthomonads for detection purposes. Under laboratory conditions, approximately 1,000 CFU of X. hyacinthi per ml could be detected. In inoculated leaves of hyacinths the threshold was 5,000 CFU/ml. The results indicated that infected hyacinths with early symptoms could be successfully screened for X. hyacinthi with PCR. PMID:11157222
SSRPrimer and SSR Taxonomy Tree: Biome SSR discovery
Jewell, Erica; Robinson, Andrew; Savage, David; Erwin, Tim; Love, Christopher G.; Lim, Geraldine A. C.; Li, Xi; Batley, Jacqueline; Spangenberg, German C.; Edwards, David
2006-01-01
Simple sequence repeat (SSR) molecular genetic markers have become important tools for a broad range of applications such as genome mapping and genetic diversity studies. SSRs are readily identified within DNA sequence data and PCR primers can be designed for their amplification. These PCR primers frequently cross amplify within related species. We report a web-based tool, SSR Primer, that integrates SPUTNIK, an SSR repeat finder, with Primer3, a primer design program, within one pipeline. On submission of multiple FASTA formatted sequences, the script screens each sequence for SSRs using SPUTNIK. Results are then parsed to Primer3 for locus specific primer design. We have applied this tool for the discovery of SSRs within the complete GenBank database, and have designed PCR amplification primers for over 13 million SSRs. The SSR Taxonomy Tree server provides web-based searching and browsing of species and taxa for the visualisation and download of these SSR amplification primers. These tools are available at . PMID:16845092
SSRPrimer and SSR Taxonomy Tree: Biome SSR discovery.
Jewell, Erica; Robinson, Andrew; Savage, David; Erwin, Tim; Love, Christopher G; Lim, Geraldine A C; Li, Xi; Batley, Jacqueline; Spangenberg, German C; Edwards, David
2006-07-01
Simple sequence repeat (SSR) molecular genetic markers have become important tools for a broad range of applications such as genome mapping and genetic diversity studies. SSRs are readily identified within DNA sequence data and PCR primers can be designed for their amplification. These PCR primers frequently cross amplify within related species. We report a web-based tool, SSR Primer, that integrates SPUTNIK, an SSR repeat finder, with Primer3, a primer design program, within one pipeline. On submission of multiple FASTA formatted sequences, the script screens each sequence for SSRs using SPUTNIK. Results are then parsed to Primer3 for locus specific primer design. We have applied this tool for the discovery of SSRs within the complete GenBank database, and have designed PCR amplification primers for over 13 million SSRs. The SSR Taxonomy Tree server provides web-based searching and browsing of species and taxa for the visualisation and download of these SSR amplification primers. These tools are available at http://bioinformatics.pbcbasc.latrobe.edu.au/ssrdiscovery.html.
Kang, Kang; Zhang, Xiaoying; Liu, Hongtao; Wang, Zhiwei; Zhong, Jiasheng; Huang, Zhenting; Peng, Xiao; Zeng, Yan; Wang, Yuna; Yang, Yi; Luo, Jun; Gou, Deming
2012-01-01
Background MicroRNAs (miRNAs) are small, non-coding RNAs capable of postranscriptionally regulating gene expression. Accurate expression profiling is crucial for understanding the biological roles of miRNAs, and exploring them as biomarkers of diseases. Methodology/Principal Findings A novel, highly sensitive, and reliable miRNA quantification approach,termed S-Poly(T) miRNA assay, is designed. In this assay, miRNAs are subjected to polyadenylation and reverse transcription with a S-Poly(T) primer that contains a universal reverse primer, a universal Taqman probe, an oligo(dT)11 sequence and six miRNA-specific bases. Individual miRNAs are then amplified by a specific forward primer and a universal reverse primer, and the PCR products are detected by a universal Taqman probe. The S-Poly(T) assay showed a minimum of 4-fold increase in sensitivity as compared with the stem-loop or poly(A)-based methods. A remarkable specificity in discriminating among miRNAs with high sequence similarity was also obtained with this approach. Using this method, we profiled miRNAs in human pulmonary arterial smooth muscle cells (HPASMC) and identified 9 differentially expressed miRNAs associated with hypoxia treatment. Due to its outstanding sensitivity, the number of circulating miRNAs from normal human serum was significantly expanded from 368 to 518. Conclusions/Significance With excellent sensitivity, specificity, and high-throughput, the S-Poly(T) method provides a powerful tool for miRNAs quantification and identification of tissue- or disease-specific miRNA biomarkers. PMID:23152780
Molaee, Neda; Abtahi, Hamid; Ghannadzadeh, Mohammad Javad; Karimi, Masoude; Ghaznavi-Rad, Ehsanollah
2015-01-01
Polymerase chain reaction (PCR) is preferred to other methods for detecting Escherichia coli (E. coli) in water in terms of speed, accuracy and efficiency. False positive result is considered as the major disadvantages of PCR. For this reason, reverse transcriptase-polymerase chain reaction (RT-PCR) can be used to solve this problem. The aim of present study was to determine the efficiency of RT-PCR for rapid detection of viable Escherichia coli in drinking water samples and enhance its sensitivity through application of different filter membranes. Specific primers were designed for 16S rRNA and elongation Factor II genes. Different concentrations of bacteria were passed through FHLP and HAWP filters. Then, RT-PCR was performed using 16srRNA and EF -Tu primers. Contamination of 10 wells was determined by RT-PCR in Arak city. To evaluate RT-PCR efficiency, the results were compared with most probable number (MPN) method. RT-PCR is able to detect bacteria in different concentrations. Application of EF II primers reduced false positive results compared to 16S rRNA primers. The FHLP hydrophobic filters have higher ability to absorb bacteria compared with HAWB hydrophilic filters. So the use of hydrophobic filters will increase the sensitivity of RT-PCR. RT-PCR shows a higher sensitivity compared to conventional water contamination detection method. Unlike PCR, RT-PCR does not lead to false positive results. The use of EF-Tu primers can reduce the incidence of false positive results. Furthermore, hydrophobic filters have a higher ability to absorb bacteria compared to hydrophilic filters.
Rapid Differentiation and In Situ Detection of 16 Sourdough Lactobacillus Species by Multiplex PCR
Settanni, Luca; van Sinderen, Douwe; Rossi, Jone; Corsetti, Aldo
2005-01-01
A two-step multiplex PCR-based method was designed for the rapid detection of 16 species of lactobacilli known to be commonly present in sourdough. The first step of multiplex PCR was developed with a mixture of group-specific primers, while the second step included three multiplex PCR assays with a mixture of species-specific primers. Primers were derived from sequences that specify the 16S rRNA, the 16S-23S rRNA intergenic spacer region, and part of the 23S rRNA gene. The primer pairs designed were shown to exclusively amplify the targeted rrn operon fragment of the corresponding species. Due to the reliability of simultaneously identifying Lactobacillus plantarum, Lactobacillus pentosus, and Lactobacillus paraplantarum, a previously described multiplex PCR method employing recA gene-derived primers was included in the multiplex PCR system. The combination of a newly developed, quick bacterial DNA extraction method from sourdough and this multiplex PCR assay allows the rapid in situ detection of several sourdough-associated lactobacilli, including the recently described species Lactobacillus rossii, and thus represents a very useful alternative to culture-based methodologies. PMID:15933001
Hafeez, Mian A; Shivaramaiah, Srichaitanya; Dorsey, Kristi Moore; Ogedengbe, Mosun E; El-Sherry, Shiem; Whale, Julia; Cobean, Julie; Barta, John R
2015-05-01
Species-specific PCR primers targeting the mitochondrial cytochrome c oxidase subunit I (mtCOI) locus were generated that allow for the specific identification of the most common Eimeria species infecting turkeys (i.e., Eimeria adenoeides, Eimeria meleagrimitis, Eimeria gallopavonis, Eimeria meleagridis, Eimeria dispersa, and Eimeria innocua). PCR reaction chemistries were optimized with respect to divalent cation (MgCl2) and dNTP concentrations, as well as PCR cycling conditions (particularly anneal temperature for primers). Genomic DNA samples from single oocyst-derived lines of six Eimeria species were tested to establish specificity and sensitivity of these newly designed primer pairs. A mixed 60-ng total DNA sample containing 10 ng of each of the six Eimeria species was used as DNA template to demonstrate specific amplification of the correct product using each of the species-specific primer pairs. Ten nanograms of each of the five non-target Eimeria species was pooled to provide a non-target, control DNA sample suitable to test the specificity of each primer pair. The amplifications of the COI region with species-specific primer pairs from pooled samples yielded products of expected sizes (209 to 1,012 bp) and no amplification of non-target Eimeria sp. DNA was detected using the non-target, control DNA samples. These primer pairs specific for Eimeria spp. of turkeys did not amplify any of the seven Eimeria species infecting chickens. The newly developed PCR primers can be used as a diagnostic tool capable of specifically identifying six turkey Eimeria species; additionally, sequencing of the PCR amplification products yields sequence-based genotyping data suitable for identification and molecular phylogenetics.
USDA-ARS?s Scientific Manuscript database
The pathogen causing corky root on lettuce, Sphingobium suberifaciens, is recalcitrant to standard epidemiological methods. Primers were selected from 16S rDNA sequences useful for the specific detection and quantification of S. suberifaciens. Conventional (PCR) and quantitative (qPCR) PCR protocols...
Gonzales, J L; Loza, A; Chacon, E
2006-03-15
There are several T. vivax specific primers developed for PCR diagnosis. Most of these primers were validated under different DNA extraction methods and study designs leading to heterogeneity of results. The objective of the present study was to validate PCR as a diagnostic test for T. vivax trypanosomosis by means of determining the test sensitivity of different published specific primers with different sample preparations. Four different DNA extraction methods were used to test the sensitivity of PCR with four different primer sets. DNA was extracted directly from whole blood samples, blood dried on filter papers or blood dried on FTA cards. The results showed that the sensitivity of PCR with each primer set was highly dependant of the sample preparation and DNA extraction method. The highest sensitivities for all the primers tested were determined using DNA extracted from whole blood samples, while the lowest sensitivities were obtained when DNA was extracted from filter paper preparations. To conclude, the obtained results are discussed and a protocol for diagnosis and surveillance for T. vivax trypanosomosis is recommended.
Sheu, Sen-Je; Hwang, Wen-zhe; Chen, Hsin-Chih; Chiang, Yu-Cheng; Tsen, Hau-Yang
2009-01-01
PCR primers specific for the detection of Lactobacillus acidophilus, Lactobacillus casei group, Lactobacillus delbrueckii, and Bifidobacterium longum were designed based on the elongation factor Tu gene (tuf). The specificity of these four primer sets were confirmed by PCR with 88 bacterial strains of Lactobacillus, Enterococcus, Bifidobacterium, and other bacterial species. Results indicated that these primer sets generated predicted PCR products of 397, 230, 202, and 161 bp for L. acidophilus, L. delbrueckii, L. casei group, and B. longum, respectively. Bacterial species other than the target organisms tested did not generate false-positive results. When these four primer sets were combined for the simultaneous detection of the lactic acid bacteria (LAB) in fermented milk products including yogurt, the LAB species listed on the labels of these products could be identified without the preenrichment step. The identification limit for each LAB strain with this multiplex PCR method was N X 10(3) CFU/ml in milk samples. The results of our multiplex PCR method were confirmed by PCR assay using primers based on the 16S rDNA or the 16S-23S intergenic spacer region and by biochemical tests using the API 50 CHL kit. When this multiplex PCR method was used with the determination of counts of total viable LAB and bifidobacteria, the quality of commercial fermented milk products could be assured.
Bokulich, Nicholas A.
2013-01-01
Ultra-high-throughput sequencing (HTS) of fungal communities has been restricted by short read lengths and primer amplification bias, slowing the adoption of newer sequencing technologies to fungal community profiling. To address these issues, we evaluated the performance of several common internal transcribed spacer (ITS) primers and designed a novel primer set and work flow for simultaneous quantification and species-level interrogation of fungal consortia. Primer comparison and validation were predicted in silico and by sequencing a “mock community” of mixed yeast species to explore the challenges of amplicon length and amplification bias for reconstructing defined yeast community structures. The amplicon size and distribution of this primer set are smaller than for all preexisting ITS primer sets, maximizing sequencing coverage of hypervariable ITS domains by very-short-amplicon, high-throughput sequencing platforms. This feature also enables the optional integration of quantitative PCR (qPCR) directly into the HTS preparatory work flow by substituting qPCR with these primers for standard PCR, yielding quantification of individual community members. The complete work flow described here, utilizing any of the qualified primer sets evaluated, can rapidly profile mixed fungal communities and capably reconstructed well-characterized beer and wine fermentation fungal communities. PMID:23377949
Chemidlin Prévost-Bouré, Nicolas; Christen, Richard; Dequiedt, Samuel; Mougel, Christophe; Lelièvre, Mélanie; Jolivet, Claudy; Shahbazkia, Hamid Reza; Guillou, Laure; Arrouays, Dominique; Ranjard, Lionel
2011-01-01
Fungi constitute an important group in soil biological diversity and functioning. However, characterization and knowledge of fungal communities is hampered because few primer sets are available to quantify fungal abundance by real-time quantitative PCR (real-time Q-PCR). The aim in this study was to quantify fungal abundance in soils by incorporating, into a real-time Q-PCR using the SYBRGreen® method, a primer set already used to study the genetic structure of soil fungal communities. To satisfy the real-time Q-PCR requirements to enhance the accuracy and reproducibility of the detection technique, this study focused on the 18S rRNA gene conserved regions. These regions are little affected by length polymorphism and may provide sufficiently small targets, a crucial criterion for enhancing accuracy and reproducibility of the detection technique. An in silico analysis of 33 primer sets targeting the 18S rRNA gene was performed to select the primer set with the best potential for real-time Q-PCR: short amplicon length; good fungal specificity and coverage. The best consensus between specificity, coverage and amplicon length among the 33 sets tested was the primer set FR1 / FF390. This in silico analysis of the specificity of FR1 / FF390 also provided additional information to the previously published analysis on this primer set. The specificity of the primer set FR1 / FF390 for Fungi was validated in vitro by cloning - sequencing the amplicons obtained from a real time Q-PCR assay performed on five independent soil samples. This assay was also used to evaluate the sensitivity and reproducibility of the method. Finally, fungal abundance in samples from 24 soils with contrasting physico-chemical and environmental characteristics was examined and ranked to determine the importance of soil texture, organic carbon content, C∶N ratio and land use in determining fungal abundance in soils. PMID:21931659
2010-01-01
A multiplex reverse transcription-nested polymerase chain reaction (RT-nPCR) method was developed for the detection and differentiation of wild-type and vaccine strains of canine distemper virus (CDV). A pair of primers (P1 and P4) specific for CDV corresponding to the highly conserved region of the CDV genome were used as a common primer pair in the first-round PCR of the nested PCR. Primers P2 specific for CDV wild-type strains, were used as the forward primer together with the common reverse primer P4 in the second round of nested PCR. Primers P3, P5 specific for CDV wild-type strain or vaccine strain, were used as the forward primer together with the common reverse primer P4+P6 in the second round of nested PCR. A fragment of 177 bp was amplified from vaccine strain genomic RNA, and a fragment of 247 bp from wild-type strain genomic RNA in the RT-nPCR, and two fragments of 247 bp and 177 bp were amplified from the mixed samples of vaccine and wild-type strains. No amplification was achieved for uninfected cells, or cells infected with Newcastle disease virus (NDV), canine parvovirus (CPV), canine coronavirus (CCV), rabies virus (RV), or canine adenovirus (CAV). The RT-nPCR method was used to detect 30 field samples suspected of canine distemper from Heilongjiang and Jilin Provinces, and 51 samples in Shandong province. As a result of 30 samples, were found to be wild-type-like, and 5 to be vaccine-strain-like. The RT-nPCR method can be used to effectively detect and differentiate wild-type CDV-infected dogs from dogs vaccinated with CDV vaccine, and thus can be used in clinical detection and epidemiological surveillance. PMID:20433759
Development and evaluation of new primers for PCR-based identification of Prevotella intermedia.
Zhou, Yanbin; Liu, Dali; Wang, Yiwei; Zhu, Cailian; Liang, Jingping; Shu, Rong
2014-08-01
The aim of this study was to develop new Prevotella intermedia-specific PCR primers based on the 16S rRNA. The new primer set, Pi-192 and Pi-468, increased the accuracy of PCR-based P. intermedia identification and could be useful in the detection of P. intermedia as well as epidemiological studies on periodontal disease. Copyright © 2014 Elsevier Ltd. All rights reserved.
A semi-nested PCR assay for molecular detection of Paracoccidioides brasiliensis in tissue samples.
Koishi, Andrea Cristine; Vituri, Débora Fonseca; Dionízio Filho, Pedro Sebastião Raimundo; Sasaki, Alexandre Augusto; Felipe, Maria Sueli Soares; Venancio, Emerson José
2010-01-01
Paracoccidioidomycosis is a systemic infection caused by Paracoccidioides brasiliensis. In this study, a semi-nested PCR for paracoccidioidomycosis diagnosis was developed. The primers ITS1 and ITS4 were used in the first reaction, while the primers MJ03 and ITS1 primer were used in the second reaction. The semi-nested PCR was used to investigate biopsies of five patients with oral lesions that resembled paracoccidioidomycosis. The semi-nested PCR was positive for four samples and negative for a sample from a patient later diagnosed with leishmaniasis. The new semi-nested PCR describe is useful for paracoccidioidomycosis diagnosis.
Evaluation of PCR methods for detection of Brucella strains from culture and tissues.
Çiftci, Alper; İça, Tuba; Savaşan, Serap; Sareyyüpoğlu, Barış; Akan, Mehmet; Diker, Kadir Serdar
2017-04-01
The genus Brucella causes significant economic losses due to infertility, abortion, stillbirth or weak calves, and neonatal mortality in livestock. Brucellosis is still a zoonosis of public health importance worldwide. The study was aimed to optimize and evaluate PCR assays used for the diagnosis of Brucella infections. For this aim, several primers and PCR protocols were performed and compared with Brucella cultures and biological material inoculated with Brucella. In PCR assays, genus- or species-specific oligonucleotide primers derived from 16S rRNA sequences (F4/R2, Ba148/928, IS711, BruP6-P7) and OMPs (JPF/JPR, 31ter/sd) of Brucella were used. All primers except for BruP6-P7 detected the DNA from reference Brucella strains and field isolates. In spiked blood, milk, and semen samples, F4-R2 primer-oriented PCR assays detected minimal numbers of Brucella. In spiked serum and fetal stomach content, Ba148/928 primer-oriented PCR assays detected minimal numbers of Brucella. Field samples collected from sheep and cattle were examined by bacteriological methods and optimized PCR assays. Overall, sensitivity of PCR assays was found superior to conventional bacteriological isolation. Brucella DNA was detected in 35.1, 1.1, 24.8, 5.0, and 8.0% of aborted fetus, blood, milk, semen, and serum samples by PCR assays, respectively. In conclusion, PCR assay in optimized conditions was found to be valuable in sensitive and specific detection of Brucella infections of animals.
Specific primer design of mitochondrial 12S rRNA for species identification in raw meats
NASA Astrophysics Data System (ADS)
Cahyadi, M.; Puruhita; Barido, F. H.; Hertanto, B. S.
2018-01-01
Polymerase chain reaction (PCR) is a molecular technique that widely used in agriculture area including species identification in animal-based products for halalness and food safety reasons. Amplification of DNA using PCR needs a primer pair (forward and reverse primers) to isolate specific DNA fragment in the genome. This objective of this study was to design specific primer from mitochondrial 12S rRNA region for species identification in raw beef, pork and chicken meat. Three published sequences, HQ184045, JN601075, and KT626857, were downloaded from National Center for Biotechnology Information (NCBI) website. Furthermore, those reference sequences were used to design specific primer for bovine, pig, and chicken species using primer3 v.0.4.0. A total of 15 primer pairs were picked up from primer3 software. Of these, an universal forward primer and three reverse primers which are specific for bovine, pig, and chicken species were selected to be optimized using multiplex-PCR technique. The selected primers were namely UNIF (5’-ACC GCG GTC ATA CGA TTA AC-3’), SPR (5’-AGT GCG TCG GCT ATT GTA GG-3’), BBR (5’-GAA TTG GCA AGG GTT GGT AA-3’), and AR (5’-CGG TAT GTA CGT GCC TCA GA-3’). In addition, the PCR products were visualized using 2% agarose gels under the UV light and sequenced to be aligned with reference sequences using Clustal Omega. The result showed that those primers were specifically amplified mitochondrial 12S rRNA regions from bovine, pig, and chicken using PCR. It was indicated by the existence of 155, 357, and 611 bp of DNA bands for bovine, pig, and chicken species, respectively. Moreover, sequence analysis revealed that our sequences were identically similar with reference sequences. It can be concluded that mitochondrial 12S rRNA may be used as a genetic marker for species identification in meat products.
Molecular diagnosis of malaria by photo-induced electron transfer fluorogenic primers: PET-PCR.
Lucchi, Naomi W; Narayanan, Jothikumar; Karell, Mara A; Xayavong, Maniphet; Kariuki, Simon; DaSilva, Alexandre J; Hill, Vincent; Udhayakumar, Venkatachalam
2013-01-01
There is a critical need for developing new malaria diagnostic tools that are sensitive, cost effective and capable of performing large scale diagnosis. The real-time PCR methods are particularly robust for large scale screening and they can be used in malaria control and elimination programs. We have designed novel self-quenching photo-induced electron transfer (PET) fluorogenic primers for the detection of P. falciparum and the Plasmodium genus by real-time PCR. A total of 119 samples consisting of different malaria species and mixed infections were used to test the utility of the novel PET-PCR primers in the diagnosis of clinical samples. The sensitivity and specificity were calculated using a nested PCR as the gold standard and the novel primer sets demonstrated 100% sensitivity and specificity. The limits of detection for P. falciparum was shown to be 3.2 parasites/µl using both Plasmodium genus and P. falciparum-specific primers and 5.8 parasites/µl for P. ovale, 3.5 parasites/µl for P. malariae and 5 parasites/µl for P. vivax using the genus specific primer set. Moreover, the reaction can be duplexed to detect both Plasmodium spp. and P. falciparum in a single reaction. The PET-PCR assay does not require internal probes or intercalating dyes which makes it convenient to use and less expensive than other real-time PCR diagnostic formats. Further validation of this technique in the field will help to assess its utility for large scale screening in malaria control and elimination programs.
Long, Ju
2016-05-01
In China, -(SEA), -α(3.7) and -α(4.2) are common deletional α-thalassemia alleles. Gap-PCR is the currently used detection method for these alleles, whose disadvantages include time-consuming procedure and increased potential for PCR product contamination. Therefore, this detection method needs to be improved. Based on identical-primer homologous fragments, a qPCR system was developed for deletional α-thalassemia genotyping, which was composed of a group of quantitatively-related primers and their corresponding probes plus two groups of qualitatively-related primers and their corresponding probes. In order to verify the accuracy of the qPCR system, known genotype samples and random samples are employed. The standard curve result demonstrated that designed primers and probes all yielded good amplification efficiency. In the tests of known genotype samples and random samples, sample detection results were consistent with verification results. In detecting αα, -(SEA), -α(3.7) and -α(4.2) alleles, deletional α-thalassemia alleles are accurately detected by this method. In addition, this method is provided with a wider detection range, greater speed and reduced PCR product contamination risk when compared with current common gap-PCR detection reagents. Copyright © 2016 Elsevier B.V. All rights reserved.
Clifton, D.R.; Rodriguez, R.J.
1997-01-01
A qualitative male-specific DNA marker (OT-24) was amplified by spPCR (single-primer polymerase chain reaction) from chinook salmon (Oncorhynchus tshawytscha) DNA along with several non-sex-linked products. The termini of the male-specific product were sequenced, and a pair of PeR primers were constructed for marker-specific PCR amplification. Dual primer PCR (dpPCR), with the marker-specific primers, amplified a product from both nudes and females. The amount of dpPCR product amplified from males was at least 100-fold greater than that from females. The quantitative difference between males and females was consistent among geographically distinct populations from western U.S. rivers. In addition, DNA sequence analysis indicated that OT-24 was highly conserved among geographically distinct salmon populations. The qualitative spPCR product segregated through several genetic crosses indicating equal sex ratios among progeny. Identification of the male and female juveniles by dpPCR was consistent with the spPCR analysis. There was no tissue specificity observed by spPCR or dpPCR analysis of this marker. A rapid DNA extraction method and dpPCR analysis were used to nonlethally determine sex ratios in wild spring chinook salmon adults, withheld for genetic and behavioral studies, prior to their development of gross sexual differences in their external morphology.
Clifton, D.R.; Rodriguez, R.J.
1997-01-01
A qualitative male-specific DNA marker (OT-24) was amplified by spPCR (single-primer polymerase chain reaction) from chinook salmon (Oncorhynchus tshawytscha) DNA along with several non-sex-linked products. The termini of the male-specific product were sequenced, and a pair of PeR primers were constructed for marker-specific PCR amplification. Dual primer PCR (dpPCR), with the marker-specific primers, amplified a product from both nudes and females. The amount of dpPCR product amplified from males was at least 100-fold greater than that from females. The quantitative difference between males and females was consistent among geographically distinct populations from western U.S. rivers. In addition, DNA sequence analysis indicated that OT-24 was highly conserved among geographically distinct salmon populations. The qualitative spPCR product segregated through several genetic crosses indicating equal sex ratios among progeny. Identification of the male and female juveniles by dpPCR was consistent with the spPCR analysis. There was no tissue specificity observed by spPCR or dpPCR analysis of this marker. A rapid DNA extraction method and dpPCR analysis were used to nonlethally determine sex ratios in wild spring chinook salmon adults, withheld for genetic and behavioral studies, prior to their development of gross sexual differences in their external morphology.
NASA Astrophysics Data System (ADS)
Kadir, Zaiton Abdul; Daud, Fauzi; Mohamad, Azhar; Senafi, Sahidan; Jamaludin, Ferlynda Fazleen
2015-09-01
Pleurotus pulmonarius is an edible mushroom in Malaysia and commonly known as Oyster mushroom. The species are important not only for nutritional values but also for pharmaceutical importance related to bioactive compounds in polysaccharides such as β glucan. Hence, β-glucan synthase gene (BGS) pathways which are related to the production of the β-glucan might be useful as marker for molecular DNA fingerprinting in P. pulmonarius. Conserved regions of β-glucan gene were mined from public database and aligned. Consensus from the alignment was used to design the primers by using Primer 3 software. Eight primers were designed and a single primer pair (BGF3: 5' TCTTGGCGAGTTCGAAGAAT 3'; BGR3: 5' TTCCGATCTTGGTCTGGAAG 3') was optimized at Ta (annealing temperature) 57.1°C to produce PCR product ranging from 400-500 bp. Optimum components for PCR reactions were 5.0 µl of 10× PCR buffer, 1.5 µl of 25 mM MgCl2, 1 µl of 10 mM dNTP, 1 µl of β-glucan primers, 0.1 µl of 5 units/ml Taq polymerase and 2 µl DNA template. PCR program was set at 34 PCR cycles by using Bio-Rad T100 Thermal Cycler. Initial denaturation was set at 94°C for 2 min, denaturation at 94°C for 1 minute, primer annealing at 45°C to 60°C (gradient temperature) for 50 seconds, followed by elongation at 72°C for 1 minute and further extension 5 minutes for last cycle PCR prior to end the program cycle. Thus, this information revealed that the primer of β-glucan gene designed could be used as targeted markers in screening population strains of P. pulmonarius.
Torriani, Sandra; Zapparoli, Giacomo; Dellaglio, Franco
1999-01-01
Two PCR-based methods, specific PCR and randomly amplified polymorphic DNA PCR (RAPD-PCR), were used for rapid and reliable differentiation of Lactobacillus delbrueckii subsp. bulgaricus and L. delbrueckii subsp. lactis. PCR with a single combination of primers which targeted the proline iminopeptidase (pepIP) gene of L. delbrueckii subsp. bulgaricus allowed amplification of genomic fragments specific for the two subspecies when either DNA from a single colony or cells extracted from dairy products were used. A numerical analysis of the RAPD-PCR patterns obtained with primer M13 gave results that were consistent with the results of specific PCR for all strains except L. delbrueckii subsp. delbrueckii LMG 6412T, which clustered with L. delbrueckii subsp. lactis strains. In addition, RAPD-PCR performed with primer 1254 provided highly polymorphic profiles and thus was superior for distinguishing individual L. delbrueckii strains. PMID:10508059
Torriani, S; Zapparoli, G; Dellaglio, F
1999-10-01
Two PCR-based methods, specific PCR and randomly amplified polymorphic DNA PCR (RAPD-PCR), were used for rapid and reliable differentiation of Lactobacillus delbrueckii subsp. bulgaricus and L. delbrueckii subsp. lactis. PCR with a single combination of primers which targeted the proline iminopeptidase (pepIP) gene of L. delbrueckii subsp. bulgaricus allowed amplification of genomic fragments specific for the two subspecies when either DNA from a single colony or cells extracted from dairy products were used. A numerical analysis of the RAPD-PCR patterns obtained with primer M13 gave results that were consistent with the results of specific PCR for all strains except L. delbrueckii subsp. delbrueckii LMG 6412(T), which clustered with L. delbrueckii subsp. lactis strains. In addition, RAPD-PCR performed with primer 1254 provided highly polymorphic profiles and thus was superior for distinguishing individual L. delbrueckii strains.
Identification of root rot fungi in nursery seedlings by nested multiplex PCR.
Hamelin, R C; Bérubé, P; Gignac, M; Bourassa, M
1996-01-01
The internal transcribed spacer (ITS) of the ribosomal DNA (rDNA) subunit repeat was sequenced in 12 isolates of Cylindrocladium floridanum and 11 isolates of Cylindrocarpon destructans. Sequences were aligned and compared with ITS sequences of other fungi in GenBank. Some intraspecific variability was present within our collections of C. destructans but not in C. floridanum. Three ITS variants were identified within C. destructans, but there was no apparent association between ITS variants and host or geographic origin. Two internal primers were synthesized for the specific amplification of portions of the ITS for C. floridanum, and two primers were designed to amplify all three variants of C. destructans. The species-specific primers amplified PCR products of the expected length when tested with cultures of C, destructans and C. floridanum from white spruce, black spruce, Norway spruce, red spruce, jack pine, red pine, and black walnut from eight nurseries and three plantations in Quebec. No amplification resulted from PCR reactions on fungal DNA from 26 common contaminants of conifer roots. For amplifications directly from infected tissues, a nested primer PCR using two rounds of amplification was combined with multiplex PCR approach resulting in the amplification of two different species-specific PCR fragments in the same reaction. First, the entire ITS was amplified with one universal primer and a second primer specific to fungi; a second round of amplification was carried out with species-specific primers that amplified a 400-bp PCR product from C. destructans and a 328-bp product from C. floridanum. The species-specific fragments were amplified directly from infected roots from which one or the two fungi had been isolated. PMID:8899993
FUNGAL-SPECIFIC PCR PRIMERS DEVELOPED FOR ANALYSIS OF THE ITS REGION OF ENVIRONMENTAL DNA EXTRACTS
Background The Internal Transcribed Spacer (ITS) regions of fungal ribosomal DNA (rDNA) are highly variable sequences of great importance in distinguishing fungal species by PCR analysis. Previously published PCR primers available for amplifying these sequences from environmenta...
Ahlawat, Sonika; Sharma, Rekha; Maitra, A.; Roy, Manoranjan; Tantia, M.S.
2014-01-01
New, quick, and inexpensive methods for genotyping novel caprine Fec gene polymorphisms through tetra-primer ARMS PCR were developed in the present investigation. Single nucleotide polymorphism (SNP) genotyping needs to be attempted to establish association between the identified mutations and traits of economic importance. In the current study, we have successfully genotyped three new SNPs identified in caprine fecundity genes viz. T(-242)C (BMPR1B), G1189A (GDF9) and G735A (BMP15). Tetra-primer ARMS PCR protocol was optimized and validated for these SNPs with short turn-around time and costs. The optimized techniques were tested on 158 random samples of Black Bengal goat breed. Samples with known genotypes for the described genes, previously tested in duplicate using the sequencing methods, were employed for validation of the assay. Upon validation, complete concordance was observed between the tetra-primer ARMS PCR assays and the sequencing results. These results highlight the ability of tetra-primer ARMS PCR in genotyping of mutations in Fec genes. Any associated SNP could be used to accelerate the improvement of goat reproductive traits by identifying high prolific animals at an early stage of life. Our results provide direct evidence that tetra-primer ARMS-PCR is a rapid, reliable, and cost-effective method for SNP genotyping of mutations in caprine Fec genes. PMID:25606428
Phylum- and Class-Specific PCR Primers for General Microbial Community Analysis
Blackwood, Christopher B.; Oaks, Adam; Buyer, Jeffrey S.
2005-01-01
Amplification of a particular DNA fragment from a mixture of organisms by PCR is a common first step in methods of examining microbial community structure. The use of group-specific primers in community DNA profiling applications can provide enhanced sensitivity and phylogenetic detail compared to domain-specific primers. Other uses for group-specific primers include quantitative PCR and library screening. The purpose of the present study was to develop several primer sets targeting commonly occurring and important groups. Primers specific for the 16S ribosomal sequences of Alphaproteobacteria, Betaproteobacteria, Bacilli, Actinobacteria, and Planctomycetes and for parts of both the 18S ribosomal sequence and the internal transcribed spacer region of Basidiomycota were examined. Primers were tested by comparison to sequences in the ARB 2003 database, and chosen primers were further tested by cloning and sequencing from soil community DNA. Eighty-five to 100% of the sequences obtained from clone libraries were found to be placed with the groups intended as targets, demonstrating the specificity of the primers under field conditions. It will be important to reevaluate primers over time because of the continual growth of sequence databases and revision of microbial taxonomy. PMID:16204538
Chun, Jong-Yoon; Kim, Kyoung-Joong; Hwang, In-Taek; Kim, Yun-Jee; Lee, Dae-Hoon; Lee, In-Kyoung; Kim, Jong-Kee
2007-01-01
Successful PCR starts with proper priming between an oligonucleotide primer and the template DNA. However, the inevitable risk of mismatched priming cannot be avoided in the currently used primer system, even though considerable time and effort are devoted to primer design and optimization of reaction conditions. Here, we report a novel dual priming oligonucleotide (DPO) which contains two separate priming regions joined by a polydeoxyinosine linker. The linker assumes a bubble-like structure which itself is not involved in priming, but rather delineates the boundary between the two parts of the primer. This structure results in two primer segments with distinct annealing properties: a longer 5'-segment that initiates stable priming, and a short 3'-segment that determines target-specific extension. This DPO-based system is a fundamental tool for blocking extension of non-specifically primed templates, and thereby generates consistently high PCR specificity even under less than optimal PCR conditions. The strength and utility of the DPO system are demonstrated here using multiplex PCR and SNP genotyping PCR.
Yang, Young Geun; Kim, Jong Yeol; Park, Su Jeong; Kim, Suhng Wook; Jeon, Ok-Hee; Kim, Doo-Sik
2007-08-31
Apolipoprotein E (APOE) plays a critical role in lipoprotein metabolism by binding to both low-density lipoprotein and APOE receptors. The APOE gene has three allelic forms, epsilon2, epsilon3, and epsilon4, which encode different isoforms of the APOE protein. In this study, we have developed a new genotyping method for APOE. Our multiplex tetra-primer amplification refractory mutation system (multiplex T-ARMS) polymerase chain reaction (PCR) was performed in a single reaction tube with six primers consisting of two common primers and two specific primers for each of two single nucleotide polymorphism (SNP) sites. We obtained definitive electropherograms that showed three (epsilon2/epsilon2, epsilon3/epsilon3, and epsilon4/epsilon4), four (epsilon2/epsilon3 and epsilon3/epsilon4), and five (epsilon2/epsilon4) amplicons by multiplex T-ARMS PCR in a single reaction tube. Multiplex T-ARMS PCR for APOE genotyping is a simple and accurate method that requires only a single PCR reaction, without any another treatments or expensive instrumentation, to simultaneously identify two sites of single nucleotide polymorphisms.
2011-01-01
Background The advent of genomics-based technologies has revolutionized many fields of biological enquiry. However, chromosome walking or flanking sequence cloning is still a necessary and important procedure to determining gene structure. Such methods are used to identify T-DNA insertion sites and so are especially relevant for organisms where large T-DNA insertion libraries have been created, such as rice and Arabidopsis. The currently available methods for flanking sequence cloning, including the popular TAIL-PCR technique, are relatively laborious and slow. Results Here, we report a simple and effective fusion primer and nested integrated PCR method (FPNI-PCR) for the identification and cloning of unknown genomic regions flanked known sequences. In brief, a set of universal primers was designed that consisted of various 15-16 base arbitrary degenerate oligonucleotides. These arbitrary degenerate primers were fused to the 3' end of an adaptor oligonucleotide which provided a known sequence without degenerate nucleotides, thereby forming the fusion primers (FPs). These fusion primers are employed in the first step of an integrated nested PCR strategy which defines the overall FPNI-PCR protocol. In order to demonstrate the efficacy of this novel strategy, we have successfully used it to isolate multiple genomic sequences namely, 21 orthologs of genes in various species of Rosaceace, 4 MYB genes of Rosa rugosa, 3 promoters of transcription factors of Petunia hybrida, and 4 flanking sequences of T-DNA insertion sites in transgenic tobacco lines and 6 specific genes from sequenced genome of rice and Arabidopsis. Conclusions The successful amplification of target products through FPNI-PCR verified that this novel strategy is an effective, low cost and simple procedure. Furthermore, FPNI-PCR represents a more sensitive, rapid and accurate technique than the established TAIL-PCR and hiTAIL-PCR procedures. PMID:22093809
PCR Conditions for 16S Primers for Analysis of Microbes in the Colon of Rats.
Guillen, I A; Camacho, H; Tuero, A D; Bacardí, D; Palenzuela, D O; Aguilera, A; Silva, J A; Estrada, R; Gell, O; Suárez, J; Ancizar, J; Brown, E; Colarte, A B; Castro, J; Novoa, L I
2016-09-01
The study of the composition of the intestinal flora is important to the health of the host, playing a key role in maintaining intestinal homeostasis and the evolution of the immune system. For these studies, various universal primers of the 16S rDNA gene are used in microbial taxonomy. Here, we report an evaluation of 5 universal primers to explore the presence of microbial DNA in colon biopsies preserved in RNAlater solution. The DNA extracted was used for the amplification of PCR products containing the variable (V) regions of the microbial 16S rDNA gene. The PCR products were studied by restriction fragment length polymorphism (RFLP) analysis and DNA sequence, whose percent of homology with microbial sequences reported in GenBank was verified using bioinformatics tools. The presence of microbes in the colon of rats was quantified by the quantitative PCR (qPCR) technique. We obtained microbial DNA from rat, useful for PCR analysis with the universal primers for the bacteria 16S rDNA. The sequences of PCR products obtained from a colon biopsy of the animal showed homology with the classes bacilli (Lactobacillus spp) and proteobacteria, normally represented in the colon of rats. The proposed methodology allowed the attainment of DNA of bacteria with the quality and integrity for use in qPCR, sequencing, and PCR-RFLP analysis. The selected universal primers provided knowledge of the abundance of microorganisms and the formation of a preliminary test of bacterial diversity in rat colon biopsies.
Burns, Cara C; Kilpatrick, David R; Iber, Jane C; Chen, Qi; Kew, Olen M
2016-01-01
Virologic surveillance is essential to the success of the World Health Organization initiative to eradicate poliomyelitis. Molecular methods have been used to detect polioviruses in tissue culture isolates derived from stool samples obtained through surveillance for acute flaccid paralysis. This chapter describes the use of realtime PCR assays to identify and serotype polioviruses. In particular, a degenerate, inosine-containing, panpoliovirus (panPV) PCR primer set is used to distinguish polioviruses from NPEVs. The high degree of nucleotide sequence diversity among polioviruses presents a challenge to the systematic design of nucleic acid-based reagents. To accommodate the wide variability and rapid evolution of poliovirus genomes, degenerate codon positions on the template were matched to mixed-base or deoxyinosine residues on both the primers and the TaqMan™ probes. Additional assays distinguish between Sabin vaccine strains and non-Sabin strains. This chapter also describes the use of generic poliovirus specific primers, along with degenerate and inosine-containing primers, for routine VP1 sequencing of poliovirus isolates. These primers, along with nondegenerate serotype-specific Sabin primers, can also be used to sequence individual polioviruses in mixtures.
Panicker, Gitika; Bej, Asim K
2005-10-01
We compared three sets of oligonucleotide primers and two probes designed for Vibrio vulnificus hemolysin A gene (vvhA) for TaqMan-based real-time PCR method enabling specific detection of Vibrio vulnificus in oysters. Two of three sets of primers with a probe were specific for the detection of all 81 V. vulnificus isolates by TaqMan PCR. The 25 nonvibrio and 12 other vibrio isolates tested were negative. However, the third set of primers, F-vvh1059 and R-vvh1159, with the P-vvh1109 probe, although positive for all V. vulnificus isolates, also exhibited positive cycle threshold (C(T)) values for other Vibrio spp. Optimization of the TaqMan PCR assay using F-vvh785/R-vvh990 or F-vvh731/R-vvh1113 primers and the P-vvh874 probe detected 1 pg of purified DNA and 10(3) V. vulnificus CFU/ml in pure cultures. The enriched oyster tissue homogenate did not exhibit detectable inhibition to the TaqMan PCR amplification of vvhA. Detection of 3 x 10(3) CFU V. vulnificus, resulting from a 5-h enrichment of an initial inoculum of 1 CFU/g of oyster tissue homogenate, was achieved with F-vvh785/R-vvh990 or F-vvh731/R-vvh1113 primers and P-vvh875 probe. The application of the TaqMan PCR using these primers and probe, exhibited detection of V. vulnificus on 5-h-enriched natural oysters harvested from the Gulf of Mexico. Selection of appropriate primers and a probe on vvhA for TaqMan-PCR-based detection of V. vulnificus in post-harvest-treated oysters would help avoid false-positive results, thus ensuring a steady supply of safe oysters to consumers and reducing V. vulnificus-related illnesses and deaths.
Pena, S D; Barreto, G; Vago, A R; De Marco, L; Reinach, F C; Dias Neto, E; Simpson, A J
1994-01-01
Low-stringency single specific primer PCR (LSSP-PCR) is an extremely simple PCR-based technique that detects single or multiple mutations in gene-sized DNA fragments. A purified DNA fragment is subjected to PCR using high concentrations of a single specific oligonucleotide primer, large amounts of Taq polymerase, and a very low annealing temperature. Under these conditions the primer hybridizes specifically to its complementary region and nonspecifically to multiple sites within the fragment, in a sequence-dependent manner, producing a heterogeneous set of reaction products resolvable by electrophoresis. The complex banding pattern obtained is significantly altered by even a single-base change and thus constitutes a unique "gene signature." Therefore LSSP-PCR will have almost unlimited application in all fields of genetics and molecular medicine where rapid and sensitive detection of mutations and sequence variations is important. The usefulness of LSSP-PCR is illustrated by applications in the study of mutants of smooth muscle myosin light chain, analysis of a family with X-linked nephrogenic diabetes insipidus, and identity testing using human mitochondrial DNA. Images PMID:8127912
STITCHER: A web resource for high-throughput design of primers for overlapping PCR applications.
O'Halloran, Damien M
2015-06-01
Overlapping PCR is routinely used in a wide number of molecular applications. These include stitching PCR fragments together, generating fluorescent transcriptional and translational fusions, inserting mutations, making deletions, and PCR cloning. Overlapping PCR is also used for genotyping by traditional PCR techniques and in detection experiments using techniques such as loop-mediated isothermal amplification (LAMP). STITCHER is a web tool providing a central resource for researchers conducting all types of overlapping PCR experiments with an intuitive interface for automated primer design that's fast, easy to use, and freely available online (http://ohalloranlab.net/STITCHER.html). STITCHER can handle both single sequence and multi-sequence input, and specific features facilitate numerous other PCR applications, including assembly PCR, adapter PCR, and primer walking. Field PCR, and in particular, LAMP, offers promise as an on site tool for pathogen detection in underdeveloped areas, and STITCHER includes off-target detection features for pathogens commonly targeted using LAMP technology.
Generic detection of poleroviruses using an RT-PCR assay targeting the RdRp coding sequence.
Lotos, Leonidas; Efthimiou, Konstantinos; Maliogka, Varvara I; Katis, Nikolaos I
2014-03-01
In this study a two-step RT-PCR assay was developed for the generic detection of poleroviruses. The RdRp coding region was selected as the primers' target, since it differs significantly from that of other members in the family Luteoviridae and its sequence can be more informative than other regions in the viral genome. Species specific RT-PCR assays targeting the same region were also developed for the detection of the six most widespread poleroviral species (Beet mild yellowing virus, Beet western yellows virus, Cucurbit aphid-borne virus, Carrot red leaf virus, Potato leafroll virus and Turnip yellows virus) in Greece and the collection of isolates. These isolates along with other characterized ones were used for the evaluation of the generic PCR's detection range. The developed assay efficiently amplified a 593bp RdRp fragment from 46 isolates of 10 different Polerovirus species. Phylogenetic analysis using the generic PCR's amplicon sequence showed that although it cannot accurately infer evolutionary relationships within the genus it can differentiate poleroviruses at the species level. Overall, the described generic assay could be applied for the reliable detection of Polerovirus infections and, in combination with the specific PCRs, for the identification of new and uncharacterized species in the genus. Copyright © 2013 Elsevier B.V. All rights reserved.
McKinney, Nancy
2002-01-01
PCR (polymerase chain reaction) primers for the detection of certain Bacillus species, such as Bacillus anthracis. The primers specifically amplify only DNA found in the target species and can distinguish closely related species. Species-specific PCR primers for Bacillus anthracis, Bacillus globigii and Clostridium perfringens are disclosed. The primers are directed to unique sequences within sasp (small acid soluble protein) genes.
Designing Polymerase Chain Reaction (PCR) Primer Multiplexes in the Forensic Laboratory
ERIC Educational Resources Information Center
Elkins, Kelly M.
2011-01-01
The polymerase chain reaction (PCR) is a common experiment in upper-level undergraduate biochemistry, molecular biology, and forensic laboratory courses as reagents and thermocyclers have become more affordable for institutions. Typically, instructors design PCR primers to amplify the region of interest and the students prepare their samples for…
Molecular Diagnosis of Malaria by Photo-Induced Electron Transfer Fluorogenic Primers: PET-PCR
Lucchi, Naomi W.; Narayanan, Jothikumar; Karell, Mara A.; Xayavong, Maniphet; Kariuki, Simon; DaSilva, Alexandre J.; Hill, Vincent; Udhayakumar, Venkatachalam
2013-01-01
There is a critical need for developing new malaria diagnostic tools that are sensitive, cost effective and capable of performing large scale diagnosis. The real-time PCR methods are particularly robust for large scale screening and they can be used in malaria control and elimination programs. We have designed novel self-quenching photo-induced electron transfer (PET) fluorogenic primers for the detection of P. falciparum and the Plasmodium genus by real-time PCR. A total of 119 samples consisting of different malaria species and mixed infections were used to test the utility of the novel PET-PCR primers in the diagnosis of clinical samples. The sensitivity and specificity were calculated using a nested PCR as the gold standard and the novel primer sets demonstrated 100% sensitivity and specificity. The limits of detection for P. falciparum was shown to be 3.2 parasites/µl using both Plasmodium genus and P. falciparum-specific primers and 5.8 parasites/µl for P. ovale, 3.5 parasites/µl for P. malariae and 5 parasites/µl for P. vivax using the genus specific primer set. Moreover, the reaction can be duplexed to detect both Plasmodium spp. and P. falciparum in a single reaction. The PET-PCR assay does not require internal probes or intercalating dyes which makes it convenient to use and less expensive than other real-time PCR diagnostic formats. Further validation of this technique in the field will help to assess its utility for large scale screening in malaria control and elimination programs. PMID:23437209
Hahn, Cassidy M.; Iwanowicz, Luke R.; Cornman, Robert S.; Mazik, Patricia M.; Blazer, Vicki S.
2016-01-01
Environmental studies increasingly identify the presence of both contaminants of emerging concern (CECs) and legacy contaminants in aquatic environments; however, the biological effects of these compounds on resident fishes remain largely unknown. High throughput methodologies were employed to establish partial transcriptomes for three wild-caught, non-model fish species; smallmouth bass (Micropterus dolomieu), white sucker (Catostomus commersonii) and brown bullhead (Ameiurus nebulosus). Sequences from these transcriptome databases were utilized in the development of a custom nCounter CodeSet that allowed for direct multiplexed measurement of 50 transcript abundance endpoints in liver tissue. Sequence information was also utilized in the development of quantitative real-time PCR (qPCR) primers. Cross-species hybridization allowed the smallmouth bass nCounter CodeSet to be used for quantitative transcript abundance analysis of an additional non-model species, largemouth bass (Micropterus salmoides). We validated the nCounter analysis data system with qPCR for a subset of genes and confirmed concordant results. Changes in transcript abundance biomarkers between sexes and seasons were evaluated to provide baseline data on transcript modulation for each species of interest.
Jézéquel, Laetitia; Loeper, Jacqueline; Pompon, Denis
2008-11-01
Combinatorial libraries coding for mosaic enzymes with predefined crossover points constitute useful tools to address and model structure-function relationships and for functional optimization of enzymes based on multivariate statistics. The presented method, called sequence-independent generation of a chimera-ordered library (SIGNAL), allows easy shuffling of any predefined amino acid segment between two or more proteins. This method is particularly well adapted to the exchange of protein structural modules. The procedure could also be well suited to generate ordered combinatorial libraries independent of sequence similarities in a robotized manner. Sequence segments to be recombined are first extracted by PCR from a single-stranded template coding for an enzyme of interest using a biotin-avidin-based method. This technique allows the reduction of parental template contamination in the final library. Specific PCR primers allow amplification of two complementary mosaic DNA fragments, overlapping in the region to be exchanged. Fragments are finally reassembled using a fusion PCR. The process is illustrated via the construction of a set of mosaic CYP2B enzymes using this highly modular approach.
Extraction of High Quality DNA from Seized Moroccan Cannabis Resin (Hashish)
El Alaoui, Moulay Abdelaziz; Melloul, Marouane; Alaoui Amine, Sanaâ; Stambouli, Hamid; El Bouri, Aziz; Soulaymani, Abdelmajid; El Fahime, Elmostafa
2013-01-01
The extraction and purification of nucleic acids is the first step in most molecular biology analysis techniques. The objective of this work is to obtain highly purified nucleic acids derived from Cannabis sativa resin seizure in order to conduct a DNA typing method for the individualization of cannabis resin samples. To obtain highly purified nucleic acids from cannabis resin (Hashish) free from contaminants that cause inhibition of PCR reaction, we have tested two protocols: the CTAB protocol of Wagner and a CTAB protocol described by Somma (2004) adapted for difficult matrix. We obtained high quality genomic DNA from 8 cannabis resin seizures using the adapted protocol. DNA extracted by the Wagner CTAB protocol failed to give polymerase chain reaction (PCR) amplification of tetrahydrocannabinolic acid (THCA) synthase coding gene. However, the extracted DNA by the second protocol permits amplification of THCA synthase coding gene using different sets of primers as assessed by PCR. We describe here for the first time the possibility of DNA extraction from (Hashish) resin derived from Cannabis sativa. This allows the use of DNA molecular tests under special forensic circumstances. PMID:24124454
STITCHER 2.0: primer design for overlapping PCR applications
O’Halloran, Damien M.; Uriagereka-Herburger, Isabel; Bode, Katrin
2017-01-01
Overlapping polymerase chain reaction (PCR) is a common technique used by researchers in very diverse fields that enables the user to ‘stitch’ individual pieces of DNA together. Previously, we have reported a web based tool called STITCHER that provides a platform for researchers to automate the design of primers for overlapping PCR applications. Here we present STITCHER 2.0, which represents a substantial update to STITCHER. STITCHER 2.0 is a newly designed web tool that automates the design of primers for overlapping PCR. Unlike STITCHER, STITCHER 2.0 considers diverse algorithmic parameters, and returns multiple result files that include a facility for the user to draw their own primers as well as comprehensive visual guides to the user’s input, output, and designed primers. These result files provide greater control and insight during experimental design and troubleshooting. STITCHER 2.0 is freely available to all users without signup or login requirements and can be accessed at the following webpage: www.ohalloranlab.net/STITCHER2.html. PMID:28358011
STITCHER 2.0: primer design for overlapping PCR applications.
O'Halloran, Damien M; Uriagereka-Herburger, Isabel; Bode, Katrin
2017-03-30
Overlapping polymerase chain reaction (PCR) is a common technique used by researchers in very diverse fields that enables the user to 'stitch' individual pieces of DNA together. Previously, we have reported a web based tool called STITCHER that provides a platform for researchers to automate the design of primers for overlapping PCR applications. Here we present STITCHER 2.0, which represents a substantial update to STITCHER. STITCHER 2.0 is a newly designed web tool that automates the design of primers for overlapping PCR. Unlike STITCHER, STITCHER 2.0 considers diverse algorithmic parameters, and returns multiple result files that include a facility for the user to draw their own primers as well as comprehensive visual guides to the user's input, output, and designed primers. These result files provide greater control and insight during experimental design and troubleshooting. STITCHER 2.0 is freely available to all users without signup or login requirements and can be accessed at the following webpage: www.ohalloranlab.net/STITCHER2.html.
Selvaraj, Vijayanandraj; Maheshwari, Yogita; Hajeri, Subhas; Chen, Jianchi; McCollum, Thomas Greg; Yokomi, Raymond
2018-01-01
Huanglongbing (HLB, citrus greening) is a devastating citrus disease affecting citrus production worldwide. It is associated with the bacterium "Candidatus Liberibacter asiaticus" (CLas) and is vectored by the Asian citrus psyllid (ACP). Currently, diagnosis of CLas in regulatory samples is based on real-time quantitative polymerase chain reaction (qPCR) using 16S rRNA gene specific primers/probe. The detection of CLas using qPCR is challenging due to low pathogen titer and uneven distribution in infected plants and exacerbated by sampling issues and presence of inhibitors. This study evaluated a duplex droplet digital polymerase chain reaction (ddPCR) using multi-copy gene targets, 16S and RNR, to simultaneously detect CLas DNA targets in the same sample for unambiguous detection of the HLB pathogen in DNA extracts from citrus leaves and ACP. Standard curve analyses on tenfold dilution series with plasmid, citrus leaf and ACP DNA showed that both ddPCR and qPCR exhibited good linearity and efficiency in the duplex assay. CLas-infected low titer samples were used to validate the duplex ddPCR and qPCR performance and demonstrated that detection rate is higher when both 16S and RNR primers were used in duplex assay. However, the receiver operating characteristic analysis indicated that area under the curve for RNR primer was significantly broader, compared to 16S primers for CLas detection at low target titer. The absolute quantification of CLas at variable titers was reproducible and repeatable for both primer sets and the ddPCR showed higher resilience to PCR inhibitors with citrus leaf and ACP extracts. Hence, the resultant duplex ddPCR assay resulted in a significantly improved detection platform for diagnosis of CLas in samples with low pathogen titer.
Hajeri, Subhas; Chen, Jianchi; McCollum, Thomas Greg
2018-01-01
Huanglongbing (HLB, citrus greening) is a devastating citrus disease affecting citrus production worldwide. It is associated with the bacterium “Candidatus Liberibacter asiaticus” (CLas) and is vectored by the Asian citrus psyllid (ACP). Currently, diagnosis of CLas in regulatory samples is based on real-time quantitative polymerase chain reaction (qPCR) using 16S rRNA gene specific primers/probe. The detection of CLas using qPCR is challenging due to low pathogen titer and uneven distribution in infected plants and exacerbated by sampling issues and presence of inhibitors. This study evaluated a duplex droplet digital polymerase chain reaction (ddPCR) using multi-copy gene targets, 16S and RNR, to simultaneously detect CLas DNA targets in the same sample for unambiguous detection of the HLB pathogen in DNA extracts from citrus leaves and ACP. Standard curve analyses on tenfold dilution series with plasmid, citrus leaf and ACP DNA showed that both ddPCR and qPCR exhibited good linearity and efficiency in the duplex assay. CLas-infected low titer samples were used to validate the duplex ddPCR and qPCR performance and demonstrated that detection rate is higher when both 16S and RNR primers were used in duplex assay. However, the receiver operating characteristic analysis indicated that area under the curve for RNR primer was significantly broader, compared to 16S primers for CLas detection at low target titer. The absolute quantification of CLas at variable titers was reproducible and repeatable for both primer sets and the ddPCR showed higher resilience to PCR inhibitors with citrus leaf and ACP extracts. Hence, the resultant duplex ddPCR assay resulted in a significantly improved detection platform for diagnosis of CLas in samples with low pathogen titer. PMID:29772016
Molecular Technique to Understand Deep Microbial Diversity
NASA Technical Reports Server (NTRS)
Vaishampayan, Parag A.; Venkateswaran, Kasthuri J.
2012-01-01
Current sequencing-based and DNA microarray techniques to study microbial diversity are based on an initial PCR (polymerase chain reaction) amplification step. However, a number of factors are known to bias PCR amplification and jeopardize the true representation of bacterial diversity. PCR amplification of the minor template appears to be suppressed by the exponential amplification of the more abundant template. It is widely acknowledged among environmental molecular microbiologists that genetic biosignatures identified from an environment only represent the most dominant populations. The technological bottleneck has overlooked the presence of the less abundant minority population, and underestimated their role in the ecosystem maintenance. To generate PCR amplicons for subsequent diversity analysis, bacterial l6S rRNA genes are amplified by PCR using universal primers. Two distinct PCR regimes are employed in parallel: one using normal and the other using biotinlabeled universal primers. PCR products obtained with biotin-labeled primers are mixed with streptavidin-labeled magnetic beads and selectively captured in the presence of a magnetic field. Less-abundant DNA templates that fail to amplify in this first round of PCR amplification are subjected to a second round of PCR using normal universal primers. These PCR products are then subjected to downstream diversity analyses such as conventional cloning and sequencing. A second round of PCR amplified the minority population and completed the deep diversity picture of the environmental sample.
Desingu, P A; Singh, S D; Dhama, K; Kumar, O R Vinodh; Singh, R; Singh, R K
2015-02-01
A rapid and accurate method of detection and differentiation of virulent and avirulent Newcastle disease virus (NDV) pathotypes was developed. The NDV detection was carried out for different domestic avian field isolates and pigeon paramyxo virus-1 (25 field isolates and 9 vaccine strains) by using APMV-I "fusion" (F) gene Class II specific external primer A and B (535bp), internal primer C and D (238bp) based reverses transcriptase PCR (RT-PCR). The internal degenerative reverse primer D is specific for F gene cleavage position of virulent strain of NDV. The nested RT-PCR products of avirulent strains showed two bands (535bp and 424bp) while virulent strains showed four bands (535bp, 424bp, 349bp and 238bp) on agar gel electrophoresis. This is the first report regarding development and use of degenerate primer based nested RT-PCR for accurate detection and differentiation of NDV pathotypes by demonstrating multiple PCR band patterns. Being a rapid, simple, and economical test, the developed method could serve as a valuable alternate diagnostic tool for characterizing NDV isolates and carrying out molecular epidemiological surveillance studies for this important pathogen of poultry. Copyright © 2014 Elsevier B.V. All rights reserved.
Akerele, David; Ljolje, Dragan; Talundzic, Eldin; Udhayakumar, Venkatachalam
2017-01-01
Accurate diagnosis of malaria infections continues to be challenging and elusive, especially in the detection of submicroscopic infections. Developing new malaria diagnostic tools that are sensitive enough to detect low-level infections, user friendly, cost effective and capable of performing large scale diagnosis, remains critical. We have designed novel self-quenching photo-induced electron transfer (PET) fluorogenic primers for the detection of P. ovale by real-time PCR. In our study, a total of 173 clinical samples, consisting of different malaria species, were utilized to test this novel PET-PCR primer. The sensitivity and specificity were calculated using nested-PCR as the reference test. The novel primer set demonstrated a sensitivity of 97.5% and a specificity of 99.2% (95% CI 85.2–99.8% and 95.2–99.9% respectively). Furthermore, the limit of detection for P. ovale was found to be 1 parasite/μl. The PET-PCR assay is a new molecular diagnostic tool with comparable performance to other commonly used PCR methods. It is relatively easy to perform, and amiable to large scale malaria surveillance studies and malaria control and elimination programs. Further field validation of this novel primer will be helpful to ascertain the utility for large scale malaria screening programs. PMID:28640824
Akerele, David; Ljolje, Dragan; Talundzic, Eldin; Udhayakumar, Venkatachalam; Lucchi, Naomi W
2017-01-01
Accurate diagnosis of malaria infections continues to be challenging and elusive, especially in the detection of submicroscopic infections. Developing new malaria diagnostic tools that are sensitive enough to detect low-level infections, user friendly, cost effective and capable of performing large scale diagnosis, remains critical. We have designed novel self-quenching photo-induced electron transfer (PET) fluorogenic primers for the detection of P. ovale by real-time PCR. In our study, a total of 173 clinical samples, consisting of different malaria species, were utilized to test this novel PET-PCR primer. The sensitivity and specificity were calculated using nested-PCR as the reference test. The novel primer set demonstrated a sensitivity of 97.5% and a specificity of 99.2% (95% CI 85.2-99.8% and 95.2-99.9% respectively). Furthermore, the limit of detection for P. ovale was found to be 1 parasite/μl. The PET-PCR assay is a new molecular diagnostic tool with comparable performance to other commonly used PCR methods. It is relatively easy to perform, and amiable to large scale malaria surveillance studies and malaria control and elimination programs. Further field validation of this novel primer will be helpful to ascertain the utility for large scale malaria screening programs.
Williams-Woods, Jacquelina; González-Escalona, Narjol; Burkhardt, William
2011-12-01
Human norovirus (HuNoV) and hepatitis A (HAV) are recognized as leading causes of non-bacterial foodborne associated illnesses in the United States. DNA sequencing is generally considered the standard for accurate viral genotyping in support of epidemiological investigations. Due to the genetic diversity of noroviruses (NoV), degenerate primer sets are often used in conventional reverse transcription (RT) PCR and real-time RT-quantitative PCR (RT-qPCR) for the detection of these viruses and cDNA fragments are generally cloned prior to sequencing. HAV detection methods that are sensitive and specific for real-time RT-qPCR yields small fragments sizes of 89-150bp, which can be difficult to sequence. In order to overcome these obstacles, norovirus and HAV primers were tailed with M13 forward and reverse primers. This modification increases the sequenced product size and allows for direct sequencing of the amplicons utilizing complementary M13 primers. HuNoV and HAV cDNA products from environmentally contaminated oysters were analyzed using this method. Alignments of the sequenced samples revealed ≥95% nucleotide identities. Tailing NoV and HAV primers with M13 sequence increases the cDNA product size, offers an alternative to cloning, and allows for rapid, accurate and direct sequencing of cDNA products produced by conventional or real time RT-qPCR assays. Published by Elsevier B.V.
Priyadarshini, P; Tiwari, K; Das, A; Kumar, D; Mishra, M N; Desikan, P; Nath, G
2017-02-01
To evaluate the sensitivity and specificity of a new nested set of primers designed for the detection of Mycobacterium tuberculosis complex targeting a highly conserved heat shock protein gene (hsp65). The nested primers were designed using multiple sequence alignment assuming the nucleotide sequence of the M. tuberculosis H37Rv hsp65 genome as base. Multidrug-resistant Mycobacterium species along with other non-mycobacterial and fungal species were included to evaluate the specificity of M. tuberculosis hsp65 gene-specific primers. The sensitivity of the primers was determined using serial 10-fold dilutions, and was 100% as shown by the bands in the case of M. tuberculosis complex. None of the other non M. tuberculosis complex bacterial and fungal species yielded any band on nested polymerase chain reaction (PCR). The first round of amplification could amplify 0.3 ng of the template DNA, while nested PCR could detect 0.3 pg. The present hsp65-specific primers have been observed to be sensitive, specific and cost-effective, without requiring interpretation of biochemical tests, real-time PCR, sequencing or high-performance liquid chromatography. These primer sets do not have the drawbacks associated with those protocols that target insertion sequence 6110, 16S rDNA, rpoB, recA and MPT 64.
Cheng, Yu-Huei
2014-12-01
Specific primers play an important role in polymerase chain reaction (PCR) experiments, and therefore it is essential to find specific primers of outstanding quality. Unfortunately, many PCR constraints must be simultaneously inspected which makes specific primer selection difficult and time-consuming. This paper introduces a novel computational intelligence-based method, Teaching-Learning-Based Optimisation, to select the specific and feasible primers. The specified PCR product lengths of 150-300 bp and 500-800 bp with three melting temperature formulae of Wallace's formula, Bolton and McCarthy's formula and SantaLucia's formula were performed. The authors calculate optimal frequency to estimate the quality of primer selection based on a total of 500 runs for 50 random nucleotide sequences of 'Homo species' retrieved from the National Center for Biotechnology Information. The method was then fairly compared with the genetic algorithm (GA) and memetic algorithm (MA) for primer selection in the literature. The results show that the method easily found suitable primers corresponding with the setting primer constraints and had preferable performance than the GA and the MA. Furthermore, the method was also compared with the common method Primer3 according to their method type, primers presentation, parameters setting, speed and memory usage. In conclusion, it is an interesting primer selection method and a valuable tool for automatic high-throughput analysis. In the future, the usage of the primers in the wet lab needs to be validated carefully to increase the reliability of the method.
Zhou, Shuntai; Jones, Corbin; Mieczkowski, Piotr
2015-01-01
ABSTRACT Validating the sampling depth and reducing sequencing errors are critical for studies of viral populations using next-generation sequencing (NGS). We previously described the use of Primer ID to tag each viral RNA template with a block of degenerate nucleotides in the cDNA primer. We now show that low-abundance Primer IDs (offspring Primer IDs) are generated due to PCR/sequencing errors. These artifactual Primer IDs can be removed using a cutoff model for the number of reads required to make a template consensus sequence. We have modeled the fraction of sequences lost due to Primer ID resampling. For a typical sequencing run, less than 10% of the raw reads are lost to offspring Primer ID filtering and resampling. The remaining raw reads are used to correct for PCR resampling and sequencing errors. We also demonstrate that Primer ID reveals bias intrinsic to PCR, especially at low template input or utilization. cDNA synthesis and PCR convert ca. 20% of RNA templates into recoverable sequences, and 30-fold sequence coverage recovers most of these template sequences. We have directly measured the residual error rate to be around 1 in 10,000 nucleotides. We use this error rate and the Poisson distribution to define the cutoff to identify preexisting drug resistance mutations at low abundance in an HIV-infected subject. Collectively, these studies show that >90% of the raw sequence reads can be used to validate template sampling depth and to dramatically reduce the error rate in assessing a genetically diverse viral population using NGS. IMPORTANCE Although next-generation sequencing (NGS) has revolutionized sequencing strategies, it suffers from serious limitations in defining sequence heterogeneity in a genetically diverse population, such as HIV-1 due to PCR resampling and PCR/sequencing errors. The Primer ID approach reveals the true sampling depth and greatly reduces errors. Knowing the sampling depth allows the construction of a model of how to maximize the recovery of sequences from input templates and to reduce resampling of the Primer ID so that appropriate multiplexing can be included in the experimental design. With the defined sampling depth and measured error rate, we are able to assign cutoffs for the accurate detection of minority variants in viral populations. This approach allows the power of NGS to be realized without having to guess about sampling depth or to ignore the problem of PCR resampling, while also being able to correct most of the errors in the data set. PMID:26041299
Lopez, Isabel; Ruiz-Larrea, Fernanda; Cocolin, Luca; Orr, Erica; Phister, Trevor; Marshall, Megan; VanderGheynst, Jean; Mills, David A.
2003-01-01
Denaturing gradient gel electrophoresis (DGGE) of PCR-amplified ribosomal DNA (rDNA) is routinely used to compare levels of diversity of microbial communities and to monitor population dynamics. While using PCR-DGGE to examine the bacteria in wine fermentations, we noted that several commonly used PCR primers for amplifying bacterial 16S rDNA also coamplified yeast, fungal, or plant DNA present in samples. Unfortunately, amplification of nonbacterial DNA can result in a masking of bacterial populations in DGGE profiles. To surmount this problem, we developed two new primer sets for specific amplification of bacterial 16S rDNA in wine fermentation samples without amplification of eukaryotic DNA. One primer set, termed WLAB1 and WLAB2, amplified lactic acid bacteria, while another, termed WBAC1 and WBAC2, amplified both lactic acid bacterial and acetic acid bacterial populations found in wine. Primer specificity and efficacy were examined with DNA isolated from numerous bacterial, yeast, and fungal species commonly found in wine and must samples. Importantly, both primer sets effectively distinguished bacterial species in wine containing mixtures of yeast and bacteria. PMID:14602643
Chaumeau, V; Andolina, C; Fustec, B; Tuikue Ndam, N; Brengues, C; Herder, S; Cerqueira, D; Chareonviriyaphap, T; Nosten, F; Corbel, V
2016-01-01
Quantitative real-time polymerase chain reaction (qrtPCR) has made a significant improvement for the detection of Plasmodium in anopheline vectors. A wide variety of primers has been used in different assays, mostly adapted from molecular diagnosis of malaria in human. However, such an adaptation can impact the sensitivity of the PCR. Therefore we compared the sensitivity of five primer sets with different molecular targets on blood stages, sporozoites and oocysts standards of Plasmodium falciparum (Pf) and P. vivax (Pv). Dilution series of standard DNA were used to discriminate between methods at low concentrations of parasite and to generate standard curves suitable for the absolute quantification of Plasmodium sporozoites. Our results showed that the best primers to detect blood stages were not necessarily the best ones to detect sporozoites. Absolute detection threshold of our qrtPCR assay varied between 3.6 and 360 Pv sporozoites and between 6 and 600 Pf sporozoites per mosquito according to the primer set used in the reaction mix. In this paper, we discuss the general performance of each primer set and highlight the need to use efficient detection methods for transmission studies.
Chaumeau, V.; Andolina, C.; Fustec, B.; Tuikue Ndam, N.; Brengues, C.; Herder, S.; Cerqueira, D.; Chareonviriyaphap, T.; Nosten, F.; Corbel, V.
2016-01-01
Quantitative real-time polymerase chain reaction (qrtPCR) has made a significant improvement for the detection of Plasmodium in anopheline vectors. A wide variety of primers has been used in different assays, mostly adapted from molecular diagnosis of malaria in human. However, such an adaptation can impact the sensitivity of the PCR. Therefore we compared the sensitivity of five primer sets with different molecular targets on blood stages, sporozoites and oocysts standards of Plasmodium falciparum (Pf) and P. vivax (Pv). Dilution series of standard DNA were used to discriminate between methods at low concentrations of parasite and to generate standard curves suitable for the absolute quantification of Plasmodium sporozoites. Our results showed that the best primers to detect blood stages were not necessarily the best ones to detect sporozoites. Absolute detection threshold of our qrtPCR assay varied between 3.6 and 360 Pv sporozoites and between 6 and 600 Pf sporozoites per mosquito according to the primer set used in the reaction mix. In this paper, we discuss the general performance of each primer set and highlight the need to use efficient detection methods for transmission studies. PMID:27441839
[A novel TaqMan® MGB probe for specifically detecting Streptococcus mutans].
Zheng, Hui; Lin, Jiu-Xiang; DU, Ning; Chen, Feng
2013-10-18
To design a new TaqMan® MGB probe for improving the specificity of Streptococcus mutans's detection. We extracted six DNA samples from different streptococcal strains for PCR reaction. Conventional nested PCR and TaqMan® MGB real-time PCR were applied independently. The first round of nested PCR was carried out with the bacterial universal primers, while a second PCR was conducted by using primers specific for the 16S rRNA gene of Streptococcus mutans. The TaqMan® MGB probe for Streptococcus mutans was designed from sequence analyses, and the primers were the same as nested PCR. Streptococcus mutans DNA with 2.5 mg/L was sequentially diluted at 5-fold intervals to 0.16 μg/L. Standard DNA samples were used to generate standard curves by TaqMan® MGB real-time PCR. In the nested PCR, the primers specific for Streptococcus mutans also detected Streptococcus gordonii with visible band of 282 bp, giving false-positive results. In the TaqMan® MGB real-time PCR reaction, only Streptococcus mutans was detected. The detection limitation of TaqMan® MGB real-time PCR for Streptococcus mutans 16S rRNA gene was 20 μg/L. We designed a new TaqMan® MGB probe, and successfully set up a PCR based method for detecting oral Streptococcus mutans. TaqMan® MGB real-time PCR is a both specific and sensitive bacterial detection method.
Kim, Hyerin; Kang, NaNa; An, KyuHyeon; Koo, JaeHyung; Kim, Min-Soo
2016-01-01
Design of high-quality primers for multiple target sequences is essential for qPCR experiments, but is challenging due to the need to consider both homology tests on off-target sequences and the same stringent filtering constraints on the primers. Existing web servers for primer design have major drawbacks, including requiring the use of BLAST-like tools for homology tests, lack of support for ranking of primers, TaqMan probes and simultaneous design of primers against multiple targets. Due to the large-scale computational overhead, the few web servers supporting homology tests use heuristic approaches or perform homology tests within a limited scope. Here, we describe the MRPrimerW, which performs complete homology testing, supports batch design of primers for multi-target qPCR experiments, supports design of TaqMan probes and ranks the resulting primers to return the top-1 best primers to the user. To ensure high accuracy, we adopted the core algorithm of a previously reported MapReduce-based method, MRPrimer, but completely redesigned it to allow users to receive query results quickly in a web interface, without requiring a MapReduce cluster or a long computation. MRPrimerW provides primer design services and a complete set of 341 963 135 in silico validated primers covering 99% of human and mouse genes. Free access: http://MRPrimerW.com. PMID:27154272
Roy, Subarna; Biswas, Debabrata; Vijayachari, P; Sugunan, A P; Sehgal, Subhash C
2004-11-01
To evaluate the discriminatory power and usefulness of arbitrarily primed-polymerase chain reaction (AP-PCR) characterization of leptospires with M16 primer. AP-PCR fingerprints of 20 reference strains of Leptospira representing 20 different serovars belonging to seven genospecies (Leptospira interrogans, 11; L. noguchii, 2; L. borgpetersenii, 1; L. santarosai, 2; L. biflexa, 2; L. kirschneri, 1; L. weilii, 1) were generated by employing M16 primer. Fingerprints generated with this primer were compared with those generated with two other commonly used primers PB1, and L10. An attempt was also made to type 20 leptospiral isolates with the M16 primer. Fingerprints with M16 primer could not only differentiate between strains of different genospecies, but also between strains of the same genospecies belonging to different serovars. While two commonly used primers (PB1 and L10) failed to discriminate between some of the different serovars belonging to the same genospecies, this primer was able to generate discriminatory fingerprints for all strains tested. All 20 Leptospira isolates, recovered from patients in Andaman Islands, could also be typed by fingerprints generated with the M16 primer. The discriminatory power of M16 primer adds more specificity to the rapidity of this system of characterization and can be used as an excellent tool in epidemiological studies on Leptospira.
Schmoock, Gernot; Elschner, Mandy; Sprague, Lisa D
2015-03-07
A frame-shift mutation in the flagellum motor gene motB coding for the chemotaxis MotB protein of Burkholderia mallei has been utilized to design a conventional duplex PCR assay with fluorescent labelled primers. Species specificity was tested with a panel of 13 Burkholderia type strains. A total of 41 B. mallei field strains, 36 B. pseudomallei field strains, and 1 B. thailandensis field strain from different geographic regions were tested and correctly identified. Testing of 55 non-Burkholderia bacterial species revealed 100% specificity of the assay. The minimum detection limit was 1 pg DNA or 160 GE for B. mallei and 130 GE for B. pseudomallei, respectively. This assay enables the clear distinction between B. mallei and B. pseudomallei/B. thailandensis.
2014-01-01
Background Huanglongbing (HLB) or citrus greening is a devastating disease of citrus. The gram-negative bacterium Candidatus Liberibacter asiaticus (Las) belonging to the α-proteobacteria is responsible for HLB in North America as well as in Asia. Currently, there is no cure for this disease. Early detection and quarantine of Las-infected trees are important management strategies used to prevent HLB from invading HLB-free citrus producing regions. Quantitative real-time PCR (qRT-PCR) based molecular diagnostic assays have been routinely used in the detection and diagnosis of Las. The oligonucleotide primer pairs based on conserved genes or regions, which include 16S rDNA and the β-operon, have been widely employed in the detection of Las by qRT-PCR. The availability of whole genome sequence of Las now allows the design of primers beyond the conserved regions for the detection of Las explicitly. Results We took a complimentary approach by systematically screening the genes in a genome-wide fashion, to identify the unique signatures that are only present in Las by an exhaustive sequence based similarity search against the nucleotide sequence database. Our search resulted in 34 probable unique signatures. Furthermore, by designing the primer pair specific to the identified signatures, we showed that most of our primer sets are able to detect Las from the infected plant and psyllid materials collected from the USA and China by qRT-PCR. Overall, 18 primer pairs of the 34 are found to be highly specific to Las with no cross reactivity to the closely related species Ca. L. americanus (Lam) and Ca. L. africanus (Laf). Conclusions We have designed qRT-PCR primers based on Las specific genes. Among them, 18 are suitable for the detection of Las from Las-infected plant and psyllid samples. The repertoire of primers that we have developed and characterized in this study enhanced the qRT-PCR based molecular diagnosis of HLB. PMID:24533511
Qiming, Chen; Tingting, Tao; Xiaomei, Bie; Yingjian, Lu; Fengxia, Lu; Ligong, Zhai; Zhaoxin, Lu
2015-08-01
Although several studies have reported PCR assays for distinguishing Cronobacter sakazakii from other species in the genus, reports regarding assay sensitivity and specificity, as well as applications for food testing, are lacking. Hence, the objective of this study was to develop a sensitive and reliable PCR-based method for detection of C. sakazakii by screening for specific target genes. The genome sequence of C. sakazakii in the GenBank database was compared with that of other organisms using BLAST. Thirty-eight DNA fragments unique to C. sakazakii were identified, and primers targeting these sequences were designed. Finally, 3 primer sets (CS14, CS21, and CS38) were found to be specific for C. sakazakii by PCR verification. The detection limit of PCR assays using the 3 pairs of primers was 1.35 pg/μL, 135 fg/μL, and 135 fg/μL, respectively, for genomic DNA, and 5.5×10(5), 5.5×10(3), 5.5×10(3) cfu/mL, respectively, using pure cultures of the bacteria, compared with 13.5 pg/μLand 5.5×10(5) cfu/mLfor primer set SpeCronsaka, which has been previously described. Cronobacter sakazakii were detected in artificially contaminated powdered infant formula (PIF) by PCR using primer sets CS21 and CS38 after 8h of enrichment. The detection limit was 5.5×10(-1) cfu/10g of PIF. Thus, the PCR assay can be used for rapid and sensitive detection of C. sakazakii in PIF. Copyright © 2015 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.
Chen, Qianqian; Chen, Xiaoxiang; Zhang, Sichao; Lan, Ke; Lu, Jian; Zhang, Chiyu
2015-01-01
The development of simple, accurate, rapid and cost-effective technologies for mutation detection is crucial to the early diagnosis and prevention of numerous genetic diseases, pharmacogenetics, and drug resistance. Proofreading PCR (PR-PCR) was developed for mutation detection in 1998 but is rarely applied due to its low efficiency in allele discrimination. Here we developed a modified PR-PCR method using a ddNTP-blocked primer and a mixture of DNA polymerases with and without the 3'-5' proofreading function. The ddNTP-blocked primer exhibited the best blocking efficiency to avoid nonspecific primer extension while the mixture of a tiny amount of high-fidelity DNA polymerase with a routine amount of Taq DNA polymerase provided the best discrimination and amplification effects. The modified PR-PCR method is quite capable of detecting various mutation types, including point mutations and insertions/deletions (indels), and allows discrimination amplification when the mismatch is located within the last eight nucleotides from the 3'-end of the ddNTP-blocked primer. The modified PR-PCR has a sensitivity of 1-5 × 102 copies and a selectivity of 5 × 10-5 mutant among 107 copies of wild-type DNA. It showed a 100% accuracy rate in the detection of P72R germ-line mutation in the TP53 gene among 60 clinical blood samples, and a high potential to detect rifampin-resistant mutations at low frequency in Mycobacterium tuberculosis using an adaptor and a fusion-blocked primer. These results suggest that the modified PR-PCR technique is effective in detection of various mutations or polymorphisms as a simple, sensitive and promising approach. PMID:25915410
NASA Astrophysics Data System (ADS)
Jung, Jae-Ho; Choi, Jung Min; Kim, Young-Ok
2018-03-01
We designed a genus-specific primer pair targeting the intracellular parasite Euduboscquella. To increase target specificity and inhibit untargeted PCR, two nucleotides were added at the 3' end of the reverse primer, one being a complementary nucleotide to the Euduboscquella-specific SNP (single-nucleotide polymorphism) and the other a deliberately mismatched nucleotide. Target specificity of the primer set was verified experimentally using PCR of two Euduboscquella species (positive controls) and 15 related species (negative controls composed of ciliates, diatoms and dinoflagellates), and analytical comparison with SILVA SSU rRNA gene database (release 119) in silico. In addition, we applied the Euduboscquella-specific primer set to four environmental samples previously determined by cytological staining to be either positive or negative for Euduboscquella. As expected, only positive controls and environmental samples known to contain Euduboscquella were successfully amplified by the primer set. An inferred SSU rRNA gene phylogeny placed environmental samples containing aloricate ciliates infected by Euduboscquella in a cluster discrete from Euduboscquella groups a-d previously reported from loricate, tintinnid ciliates.
[RAPD analysis of Aspergilli and its application in brewing industry].
Pan, Li; Wang, Bin; Guo, Yong
2007-06-01
Phylogenetic analysis of sixteen Aspergilli was done by RAPD technology, using Aspergillus oryzae AS3.951, Aspergillus flavus GIM3.18 and Aspergillus sojae AS3.495 as controls. First, genome DNA of the sixteen test strains were prepared by improved extraction method, and their quality was verified by electrophoresis and spectrophotometry. They displayed an identical band (approximately 20 kb) in agarose gel electrophoresis, which conformed to the fact that these strains all belong to Aspergillus. OD260/OD280 of the prepared DNA ranged from 1.80 to 1.90, illustrating that they were good enough to be used as templates in the following RAPD-PCR experiment. Then, three appropriate primers (Primerl, Primer2, Primer5) for RAPD-PCR were screened from nine random primers, and repetitive experiments demonstrated that the RAPD-PCR polymorphic patterns of the sixteen test strains based on these three primers were stable. There were usually 8-14 bands in their RADP-PCR patterns, where the number of the main bands was 4-9 and the secondary bands were abundant. There were totally 181 bands in their RAPD-PCR patterns, where the percentage of polymorphic bands reached to 40.9% (74 bands). The similarity coefficient between the strains was calculated based on their RAPD-PCR patterns, ranging from 8.0% to 96.6%. All these data suggests that the genetic polymorphism of the strains is abundant and they have evident genetic differentiation. The phylogenetic tree of the sixteen test strains was reconstructed according to their RAPD-PCR patterns with Primer1, Primer2 and Primer5. It basically corresponded to traditional morphological taxonomy, demonstrating that the application of RAPD molecular marker in the phylogenetic analysis of these Aspergilli is feasible. Besides, the aflatoxin-producing strains (GIM3.17, CICC2219, CICC2357, CICC2390, CICC2402, CICC2404) could be easily discriminated by RAPD molecular marker, whereas it is difficult to distinguish them by conventional morphological taxonomy. Consequently, RAPD molecular marker provides a novel clue to discriminating aflatoxin-producing strains in brewing industry.
SMM-system: A mining tool to identify specific markers in Salmonella enterica.
Yu, Shuijing; Liu, Weibing; Shi, Chunlei; Wang, Dapeng; Dan, Xianlong; Li, Xiao; Shi, Xianming
2011-03-01
This report presents SMM-system, a software package that implements various personalized pre- and post-BLASTN tasks for mining specific markers of microbial pathogens. The main functionalities of SMM-system are summarized as follows: (i) converting multi-FASTA file, (ii) cutting interesting genomic sequence, (iii) automatic high-throughput BLASTN searches, and (iv) screening target sequences. The utility of SMM-system was demonstrated by using it to identify 214 Salmonella enterica-specific protein-coding sequences (CDSs). Eighteen primer pairs were designed based on eighteen S. enterica-specific CDSs, respectively. Seven of these primer pairs were validated with PCR assay, which showed 100% inclusivity for the 101 S. enterica genomes and 100% exclusivity of 30 non-S. enterica genomes. Three specific primer pairs were chosen to develop a multiplex PCR assay, which generated specific amplicons with a size of 180bp (SC1286), 238bp (SC1598) and 405bp (SC4361), respectively. This study demonstrates that SMM-system is a high-throughput specific marker generation tool that can be used to identify genus-, species-, serogroup- and even serovar-specific DNA sequences of microbial pathogens, which has a potential to be applied in food industries, diagnostics and taxonomic studies. SMM-system is freely available and can be downloaded from http://foodsafety.sjtu.edu.cn/SMM-system.html. Copyright © 2011 Elsevier B.V. All rights reserved.
A Web-Based Adaptive Tutor to Teach PCR Primer Design
ERIC Educational Resources Information Center
van Seters, Janneke R.; Wellink, Joan; Tramper, Johannes; Goedhart, Martin J.; Ossevoort, Miriam A.
2012-01-01
When students have varying prior knowledge, personalized instruction is desirable. One way to personalize instruction is by using adaptive e-learning to offer training of varying complexity. In this study, we developed a web-based adaptive tutor to teach PCR primer design: the PCR Tutor. We used part of the Taxonomy of Educational Objectives (the…
Taylor, P.W.; Winton, J.R.
2002-01-01
Nested polymerase chain reaction (PCR) assays were developed using first-round primers complementary to highly conserved regions within the bacterial 16S ribosomal RNA (rRNA) gene (universal eubacterial primers) and second-round primers specific for sequences within the 16S rRNA genes of Aeromonas salmonicida, Yersinia ruckeri, andFlavobacterium psychrophilum. Following optimization of the MgCl2 concentration and primer annealing temperature, PCR employing the universal eubacterial primers was used to amplify a 1,500-base-pair (bp) product visible in agarose gels stained with ethidium bromide. The calculated detection limit of this single-round assay was less than 1.4 × 104 colony-forming units (CFU) per reaction for all bacterial species tested. Single-round PCR using primer sets specific for A. salmonicida, Y. ruckeri, and F. psychrophilumamplified bands of 271, 575, and 1,100 bp, respectively, with detection limits of less than 1.4 × 104, 1.4 × 105, and 1.4 × 105 CFU per reaction. Using the universal eubacterial primers in the first round and the species-specific primer sets in the second round of nested PCR assays improved the detection ability by approximately four orders of magnitude to fewer than 14 CFU per sample for each of the three bacterial species. Such nested assays could be adapted to a wide variety of bacterial fish pathogens for which 16S sequences are available.
Lu, Jennifer; Ru, Kelin; Candiloro, Ida; Dobrovic, Alexander; Korbie, Darren; Trau, Matt
2017-03-22
Multiplex bisulfite-PCR sequencing is a convenient and scalable method for the quantitative determination of the methylation state of target DNA regions. A challenge of this application is the presence of CpGs in the same region where primers are being placed. A common solution to the presence of CpGs within a primer-binding region is to substitute a base degeneracy at the cytosine position. However, the efficacy of different substitutions and the extent to which bias towards methylated or unmethylated templates may occur has never been evaluated in bisulfite multiplex sequencing applications. In response, we examined the performance of four different primer substitutions at the cytosine position of CpG's contained within the PCR primers. In this study, deoxyinosine-, 5-nitroindole-, mixed-base primers and primers with an abasic site were evaluated across a series of methylated controls. Primers that contained mixed- or deoxyinosine- base modifications performed most robustly. Mixed-base primers were further selected to determine the conditions that induce bias towards methylated templates. This identified an optimized set of conditions where the methylated state of bisulfite DNA templates can be accurately assessed using mixed-base primers, and expands the scope of bisulfite resequencing assays when working with challenging templates.
Human papillomavirus detection and typing using a nested-PCR-RFLP assay.
Coser, Janaina; Boeira, Thaís da Rocha; Fonseca, André Salvador Kazantzi; Ikuta, Nilo; Lunge, Vagner Ricardo
2011-01-01
It is clinically important to detect and type human papillomavirus (HPV) in a sensitive and specific manner. Development of a nested-polymerase chain reaction-restriction fragment length polymorphism (nested-PCR-RFLP) assay to detect and type HPV based on the analysis of L1 gene. Analysis of published DNA sequence of mucosal HPV types to select sequences of new primers. Design of an original nested-PCR assay using the new primers pair selected and classical MY09/11 primers. HPV detection and typing in cervical samples using the nested-PCR-RFLP assay. The nested-PCR-RFLP assay detected and typed HPV in cervical samples. Of the total of 128 clinical samples submitted to simple PCR and nested-PCR for detection of HPV, 37 (28.9%) were positive for the virus by both methods and 25 samples were positive only by nested-PCR (67.5% increase in detection rate compared with single PCR). All HPV positive samples were effectively typed by RFLP assay. The method of nested-PCR proved to be an effective diagnostic tool for HPV detection and typing.
Mitchell, Andrew
2015-09-01
Natural history museums are vastly underutilized as a source of material for DNA analysis because of perceptions about the limitations of DNA degradation in older specimens. Despite very few exceptions, most DNA barcoding projects, which aim to obtain sequence data from all species, generally use specimens collected specifically for that purpose, instead of the wealth of identified material in museums, constrained by the lack of suitable PCR methods. Any techniques that extend the utility of museum specimens for DNA analysis therefore are highly valuable. This study first tested the effects of specimen age and PCR amplicon size on PCR success rates in pinned insect specimens, then developed a PCR primer set and amplification strategy allowing greatly increased utilization of older museum specimens for DNA barcoding. PCR success rates compare favourably with the few published studies utilizing similar aged specimens, and this new strategy has the advantage of being easily automated for high-throughput laboratory workflows. The strategy uses hemi-nested, degenerate, M13-tailed PCR primers to amplify two overlapping amplicons, using two PCRs per amplicon (i.e. four PCRs per DNA sample). Initial PCR products are reamplified using an internal primer and a M13 primer. Together the two PCR amplicons yield 559 bp of the COI gene from Coleoptera, Lepidoptera, Diptera, Hemiptera, Odonata and presumably also other insects. BARCODE standard-compliant data were recovered from 67% (56 of 84) of specimens up to 25 years old, and 51% (102 of 197) of specimens up to 55 years old. Given the time, cost and specialist expertise required for fieldwork and identification, 'collecting in collections' is a viable alternative allowing researchers to capitalize on the knowledge captured by curation work in decades past. © 2015 John Wiley & Sons Ltd.
Zhang, Yunqing; Zhang, Xinju; Xu, Xiao; Kang, Zhihua; Li, Shibao; Zhang, Chen; Su, Bing
2014-01-01
A multiplex snapback primer system was developed for the simultaneous detection of JAK2 V617F and MPL W515L/K mutations in Philadelphia chromosome- (Ph-) negative myeloproliferative neoplasms (MPNs). The multiplex system comprises two snapback versus limiting primer sets for JAK2 and MPL mutation enrichment and detection, respectively. Linear-After exponential (LATE) PCR strategy was employed for the primer design to maximize the amplification efficiency of the system. Low ionic strength buffer and rapid PCR protocol allowed for selective amplification of the mutant alleles. Amplification products were analyzed by melting curve analysis for mutation identification. The multiplex system archived 0.1% mutation load sensitivity and <5% coefficient of variation inter-/intra-assay reproducibility. 120 clinical samples were tested by the multiplex snapback primer assay, and verified with amplification refractory system (ARMS), quantitative PCR (qPCR) and Sanger sequencing method. The multiplex system, with a favored versatility, provided the molecular diagnosis of Ph-negative MPNs with a suitable implement and simplified the genetic test process. PMID:24729973
Cao, Youfang; Wang, Lianjie; Xu, Kexue; Kou, Chunhai; Zhang, Yulei; Wei, Guifang; He, Junjian; Wang, Yunfang; Zhao, Liping
2005-07-26
A new algorithm for assessing similarity between primer and template has been developed based on the hypothesis that annealing of primer to template is an information transfer process. Primer sequence is converted to a vector of the full potential hydrogen numbers (3 for G or C, 2 for A or T), while template sequence is converted to a vector of the actual hydrogen bond numbers formed after primer annealing. The former is considered as source information and the latter destination information. An information coefficient is calculated as a measure for fidelity of this information transfer process and thus a measure of similarity between primer and potential annealing site on template. Successful prediction of PCR products from whole genomic sequences with a computer program based on the algorithm demonstrated the potential of this new algorithm in areas like in silico PCR and gene finding.
Comparison and Validation of Some ITS Primer Pairs Useful for Fungal Metabarcoding Studies
Op De Beeck, Michiel; Lievens, Bart; Busschaert, Pieter; Declerck, Stéphan; Vangronsveld, Jaco; Colpaert, Jan V.
2014-01-01
Current metabarcoding studies aiming to characterize microbial communities generally rely on the amplification and sequencing of relatively short DNA regions. For fungi, the internal transcribed spacer (ITS) region in the ribosomal RNA (rRNA) operon has been accepted as the formal fungal barcode. Despite an increasing number of fungal metabarcoding studies, the amplification efficiency of primers is generally not tested prior to their application in metabarcoding studies. Some of the challenges that metabarcoding primers should overcome efficiently are the amplification of target DNA strands in samples rich in non-target DNA and environmental pollutants, such as humic acids, that may have been co-extracted with DNA. In the current study, three selected primer pairs were tested for their suitability as fungal metabarcoding primers. The selected primer pairs include two primer pairs that have been frequently used in fungal metabarcoding studies (ITS1F/ITS2 and ITS3/ITS4) and a primer pair (ITS86F/ITS4) that has been shown to efficiently amplify the ITS2 region of a broad range of fungal taxa in environmental soil samples. The selected primer pairs were evaluated in a 454 amplicon pyrosequencing experiment, real-time PCR (qPCR) experiments and in silico analyses. Results indicate that experimental evaluation of primers provides valuable information that could aid in the selection of suitable primers for fungal metabarcoding studies. Furthermore, we show that the ITS86F/ITS4 primer pair outperforms other primer pairs tested in terms of in silico primer efficiency, PCR efficiency, coverage, number of reads and number of species-level operational taxonomic units (OTUs) obtained. These traits push the ITS86F/ITS4 primer pair forward as highly suitable for studying fungal diversity and community structures using DNA metabarcoding. PMID:24933453
Wadhwa, Ashutosh; Wilkins, Kimberly; Gao, Jinxin; Condori Condori, Rene Edgar; Gigante, Crystal M.; Zhao, Hui; Ma, Xiaoyue; Ellison, James A.; Greenberg, Lauren; Velasco-Villa, Andres; Orciari, Lillian
2017-01-01
Rabies, resulting from infection by Rabies virus (RABV) and related lyssaviruses, is one of the most deadly zoonotic diseases and is responsible for up to 70,000 estimated human deaths worldwide each year. Rapid and accurate laboratory diagnosis of rabies is essential for timely administration of post-exposure prophylaxis in humans and control of the disease in animals. Currently, only the direct fluorescent antibody (DFA) test is recommended for routine rabies diagnosis. Reverse-transcription polymerase chain reaction (RT-PCR) based diagnostic methods have been widely adapted for the diagnosis of other viral pathogens, but there is currently no widely accepted rapid real-time RT-PCR assay for the detection of all lyssaviruses. In this study, we demonstrate the validation of a newly developed multiplex real-time RT-PCR assay named LN34, which uses a combination of degenerate primers and probes along with probe modifications to achieve superior coverage of the Lyssavirus genus while maintaining sensitivity and specificity. The primers and probes of the LN34 assay target the highly conserved non-coding leader region and part of the nucleoprotein (N) coding sequence of the Lyssavirus genome to maintain assay robustness. The probes were further modified by locked nucleotides to increase their melting temperature to meet the requirements for an optimal real-time RT-PCR assay. The LN34 assay was able to detect all RABV variants and other lyssaviruses in a validation panel that included representative RABV isolates from most regions of the world as well as representatives of 13 additional Lyssavirus species. The LN34 assay was successfully used for both ante-mortem and post-mortem diagnosis of over 200 clinical samples as well as field derived surveillance samples. This assay represents a major improvement over previously published rabies specific RT-PCR and real-time RT-PCR assays because of its ability to universally detect RABV and other lyssaviruses, its high throughput capability and its simplicity of use, which can be quickly adapted in a laboratory to enhance the capacity of rabies molecular diagnostics. The LN34 assay provides an alternative approach for rabies diagnostics, especially in rural areas and rabies endemic regions that lack the conditions and broad experience required to run the standard DFA assay. PMID:28081126
Wadhwa, Ashutosh; Wilkins, Kimberly; Gao, Jinxin; Condori Condori, Rene Edgar; Gigante, Crystal M; Zhao, Hui; Ma, Xiaoyue; Ellison, James A; Greenberg, Lauren; Velasco-Villa, Andres; Orciari, Lillian; Li, Yu
2017-01-01
Rabies, resulting from infection by Rabies virus (RABV) and related lyssaviruses, is one of the most deadly zoonotic diseases and is responsible for up to 70,000 estimated human deaths worldwide each year. Rapid and accurate laboratory diagnosis of rabies is essential for timely administration of post-exposure prophylaxis in humans and control of the disease in animals. Currently, only the direct fluorescent antibody (DFA) test is recommended for routine rabies diagnosis. Reverse-transcription polymerase chain reaction (RT-PCR) based diagnostic methods have been widely adapted for the diagnosis of other viral pathogens, but there is currently no widely accepted rapid real-time RT-PCR assay for the detection of all lyssaviruses. In this study, we demonstrate the validation of a newly developed multiplex real-time RT-PCR assay named LN34, which uses a combination of degenerate primers and probes along with probe modifications to achieve superior coverage of the Lyssavirus genus while maintaining sensitivity and specificity. The primers and probes of the LN34 assay target the highly conserved non-coding leader region and part of the nucleoprotein (N) coding sequence of the Lyssavirus genome to maintain assay robustness. The probes were further modified by locked nucleotides to increase their melting temperature to meet the requirements for an optimal real-time RT-PCR assay. The LN34 assay was able to detect all RABV variants and other lyssaviruses in a validation panel that included representative RABV isolates from most regions of the world as well as representatives of 13 additional Lyssavirus species. The LN34 assay was successfully used for both ante-mortem and post-mortem diagnosis of over 200 clinical samples as well as field derived surveillance samples. This assay represents a major improvement over previously published rabies specific RT-PCR and real-time RT-PCR assays because of its ability to universally detect RABV and other lyssaviruses, its high throughput capability and its simplicity of use, which can be quickly adapted in a laboratory to enhance the capacity of rabies molecular diagnostics. The LN34 assay provides an alternative approach for rabies diagnostics, especially in rural areas and rabies endemic regions that lack the conditions and broad experience required to run the standard DFA assay.
PRISE2: software for designing sequence-selective PCR primers and probes.
Huang, Yu-Ting; Yang, Jiue-in; Chrobak, Marek; Borneman, James
2014-09-25
PRISE2 is a new software tool for designing sequence-selective PCR primers and probes. To achieve high level of selectivity, PRISE2 allows the user to specify a collection of target sequences that the primers are supposed to amplify, as well as non-target sequences that should not be amplified. The program emphasizes primer selectivity on the 3' end, which is crucial for selective amplification of conserved sequences such as rRNA genes. In PRISE2, users can specify desired properties of primers, including length, GC content, and others. They can interactively manipulate the list of candidate primers, to choose primer pairs that are best suited for their needs. A similar process is used to add probes to selected primer pairs. More advanced features include, for example, the capability to define a custom mismatch penalty function. PRISE2 is equipped with a graphical, user-friendly interface, and it runs on Windows, Macintosh or Linux machines. PRISE2 has been tested on two very similar strains of the fungus Dactylella oviparasitica, and it was able to create highly selective primers and probes for each of them, demonstrating the ability to create useful sequence-selective assays. PRISE2 is a user-friendly, interactive software package that can be used to design high-quality selective primers for PCR experiments. In addition to choosing primers, users have an option to add a probe to any selected primer pair, enabling design of Taqman and other primer-probe based assays. PRISE2 can also be used to design probes for FISH and other hybridization-based assays.
Couillerot, O; Poirier, M-A; Prigent-Combaret, C; Mavingui, P; Caballero-Mellado, J; Moënne-Loccoz, Y
2010-08-01
To assess the applicability of sequence characterized amplified region (SCAR) markers obtained from BOX, ERIC and RAPD fragments to design primers for real-time PCR quantification of the phytostimulatory maize inoculants Azospirillum brasilense UAP-154 and CFN-535 in the rhizosphere. Primers were designed based on strain-specific SCAR markers and were screened for successful amplification of target strain and absence of cross-reaction with other Azospirillum strains. The specificity of primers thus selected was verified under real-time PCR conditions using genomic DNA from strain collection and DNA from rhizosphere samples. The detection limit was 60 fg DNA with pure cultures and 4 x 10(3) (for UAP-154) and 4 x 10(4) CFU g(-1) (for CFN-535) in the maize rhizosphere. Inoculant quantification was effective from 10(4) to 10(8) CFU g(-1) soil. BOX-based SCAR markers were useful to find primers for strain-specific real-time PCR quantification of each A. brasilense inoculant in the maize rhizosphere. Effective root colonization is a prerequisite for successful Azospirillum phytostimulation, but cultivation-independent monitoring methods were lacking. The real-time PCR methods developed here will help understand the effect of environmental conditions on root colonization and phytostimulation by A. brasilense UAP-154 and CFN-535.
Kim, Hyerin; Kang, NaNa; An, KyuHyeon; Koo, JaeHyung; Kim, Min-Soo
2016-07-08
Design of high-quality primers for multiple target sequences is essential for qPCR experiments, but is challenging due to the need to consider both homology tests on off-target sequences and the same stringent filtering constraints on the primers. Existing web servers for primer design have major drawbacks, including requiring the use of BLAST-like tools for homology tests, lack of support for ranking of primers, TaqMan probes and simultaneous design of primers against multiple targets. Due to the large-scale computational overhead, the few web servers supporting homology tests use heuristic approaches or perform homology tests within a limited scope. Here, we describe the MRPrimerW, which performs complete homology testing, supports batch design of primers for multi-target qPCR experiments, supports design of TaqMan probes and ranks the resulting primers to return the top-1 best primers to the user. To ensure high accuracy, we adopted the core algorithm of a previously reported MapReduce-based method, MRPrimer, but completely redesigned it to allow users to receive query results quickly in a web interface, without requiring a MapReduce cluster or a long computation. MRPrimerW provides primer design services and a complete set of 341 963 135 in silico validated primers covering 99% of human and mouse genes. Free access: http://MRPrimerW.com. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.
Roberts, C H; Turino, C; Madrigal, J A; Marsh, S G E
2007-06-01
DNA enrichment by allele-specific hybridization (DEASH) was used as a means to isolate individual alleles of the killer cell immunoglobulin-like receptor (KIR2DL4) gene from heterozygous genomic DNA. Using long-template polymerase chain reaction (LT-PCR), the complete KIR2DL4 gene was amplified from a cell line that had previously been characterized for its KIR gene content by PCR using sequence-specific primers (PCR-SSP). The whole gene amplicons were sequenced and we identified two heterozygous positions in accordance with the predictions of the PCR-SSP. The amplicons were then hybridized to allele-specific, biotinylated oligonucleotide probes and through binding to streptavidin-coated beads, the targeted alleles were enriched. A second PCR amplified only the exonic regions of the enriched allele, and these were then sequenced in full. We show DEASH to be capable of enriching single alleles from a heterozygous PCR product, and through sequencing the enriched DNA, we are able to produce complete coding sequences of the KIR2DL4 alleles in accordance with the typing predicted by PCR-SSP.
Arancia, Silvia; Sandini, Silvia; De Carolis, Elena; Vella, Antonietta; Sanguinetti, Maurizio; Norelli, Sandro; De Bernardis, Flavia
2016-10-01
Aspergillus species are the cause of invasive mold infections in immunocompromised patients: Aspergillus fumigatus, A. flavus and A. terreus account for most cases of invasive aspergillosis (IA). As certain species are associated with higher mortality and vary in their resistance to antifungal therapy, diagnosis requires increasingly rapid molecular methods that enable sensitive detection and species discrimination. We have developed PCR and Multiplex PCR assays for the detection of six medically important Aspergillus spp. species DNA in bronchoalveolar lavage (BAL) specimens from hematology and intensive care unit (ICU) patients at risk of IA, using different species and genus-specific PCR primers, selected within the SCW4 gene, encoding a cell wall glucanase of A. fumigatus, similar to mannoprotein Mp65 of Candida albicans. The genus-specific PCR primers were able to amplify only Aspergillus DNAs but not that belonging to other fungal genera tested. The species-specific PCR primers allowed differentiation of each Aspergillus species by the amplicon length produced. The methods described in this study are rapid (less than 4 h), reproducible, simple and specific and demonstrate potential application in the clinical laboratory.
Detection of Bacillus spores using PCR and FTA filters.
Lampel, Keith A; Dyer, Deanne; Kornegay, Leroy; Orlandi, Palmer A
2004-05-01
Emphasis has been placed on developing and implementing rapid detection systems for microbial pathogens. We have explored the utility of expanding FTA filter technology for the preparation of template DNA for PCR from bacterial spores. Isolated spores from several Bacillus spp., B. subtilis, B. cereus, and B. megaterium, were applied to FTA filters, and specific DNA products were amplified by PCR. Spore preparations were examined microscopically to ensure that the presence of vegetative cells, if any, did not yield misleading results. PCR primers SRM86 and SRM87 targeted a conserved region of bacterial rRNA genes, whereas primers Bsub5F and Bsub3R amplified a product from a conserved sequence of the B. subtilis rRNA gene. With the use of the latter set of primers for nested PCR, the sensitivity of the PCR-based assay was increased. Overall, 53 spores could be detected after the first round of PCR, and the sensitivity was increased to five spores by nested PCR. FTA filters are an excellent platform to remove PCR inhibitors and have universal applications for environmental, clinical, and food samples.
Beamer, B A; Negri, C; Yen, C J; Gavrilova, O; Rumberger, J M; Durcan, M J; Yarnall, D P; Hawkins, A L; Griffin, C A; Burns, D K; Roth, J; Reitman, M; Shuldiner, A R
1997-04-28
We determined the chromosomal localization and partial genomic structure of the coding region of the human PPAR gamma gene (hPPAR gamma), a nuclear receptor important for adipocyte differentiation and function. Sequence analysis and long PCR of human genomic DNA with primers that span putative introns revealed that intron positions and sizes of hPPAR gamma are similar to those previously determined for the mouse PPAR gamma gene[13]. Fluorescent in situ hybridization localized hPPAR gamma to chromosome 3, band 3p25. Radiation hybrid mapping with two independent primer pairs was consistent with hPPAR gamma being within 1.5 Mb of marker D3S1263 on 3p25-p24.2. These sequences of the intron/exon junctions of the 6 coding exons shared by hPPAR gamma 1 and hPPAR gamma 2 will facilitate screening for possible mutations. Furthermore, D3S1263 is a suitable polymorphic marker for linkage analysis to evaluate PPAR gamma's potential contribution to genetic susceptibility to obesity, lipoatrophy, insulin resistance, and diabetes.
Nimesh, Manoj; Joon, Deepali; Pathak, Anil Kumar; Saluja, Daman
2013-11-01
Indian contribution to global burden of tuberculosis is about 26%. In the present study we have developed an in-house PCR assay using primers for sdaA gene of Mycobacterium tuberculosis and evaluated against already established primers devR, IS6110, MPB64, rpoB primers for diagnosis of pulmonary tuberculosis. Using universal sample preparation (USP) method, DNA was extracted from sputum specimens of 412 symptomatic patients from Delhi, India. The DNA so extracted was used as template for PCR amplification using primers targeting sdaA, devR, IS6110, MPB64 and rpoB genes. Out of 412, 149 specimens were considered positive based on composite reference standard (CRS) criteria. The in-house designed sdaA PCR showed high specificity (96.5%), the high positive likelihood ratio (28), the high sensitivity (95.9%), and the very low negative likelihood ratio (0.04) in comparison to CRS. Based on our results, the sdaA PCR assay can be considered as one of the most reliable diagnostic tests in comparison to other PCR based detection methods. Copyright © 2013 The British Infection Association. Published by Elsevier Ltd. All rights reserved.
TipMT: Identification of PCR-based taxon-specific markers.
Rodrigues-Luiz, Gabriela F; Cardoso, Mariana S; Valdivia, Hugo O; Ayala, Edward V; Gontijo, Célia M F; Rodrigues, Thiago de S; Fujiwara, Ricardo T; Lopes, Robson S; Bartholomeu, Daniella C
2017-02-11
Molecular genetic markers are one of the most informative and widely used genome features in clinical and environmental diagnostic studies. A polymerase chain reaction (PCR)-based molecular marker is very attractive because it is suitable to high throughput automation and confers high specificity. However, the design of taxon-specific primers may be difficult and time consuming due to the need to identify appropriate genomic regions for annealing primers and to evaluate primer specificity. Here, we report the development of a Tool for Identification of Primers for Multiple Taxa (TipMT), which is a web application to search and design primers for genotyping based on genomic data. The tool identifies and targets single sequence repeats (SSR) or orthologous/taxa-specific genes for genotyping using Multiplex PCR. This pipeline was applied to the genomes of four species of Leishmania (L. amazonensis, L. braziliensis, L. infantum and L. major) and validated by PCR using artificial genomic DNA mixtures of the Leishmania species as templates. This experimental validation demonstrates the reliability of TipMT because amplification profiles showed discrimination of genomic DNA samples from Leishmania species. The TipMT web tool allows for large-scale identification and design of taxon-specific primers and is freely available to the scientific community at http://200.131.37.155/tipMT/ .
Development of Strain-Specific Primers for Identification of Bifidobacterium bifidum BGN4.
Youn, So Youn; Ji, Geun Eog; Han, Yoo Ri; Park, Myeong Soo
2017-05-28
Bifidobacterium bifidum BGN4 (BGN4) has many proven beneficial effects, including antiallergy and anticancer properties. It has been commercialized and used in several probiotic products, and thus strain-specific identification of this strain is very valuable for further strain-dependent physiological study. For this purpose, we developed novel multiplex polymerase chain reaction (PCR) primer sets for strain-specific detection of BGN4 in commercial products and fecal samples of animal models. The primer set was tested on seven strains of B. bifidum and 75 strains of the other Bifidobacterium species. The BGN4-specific regions were derived using megaBLAST against genome sequences of various B. bifidum databases and four sets of primers were designed. As a result, only BGN4 produced four PCR products simultaneously whereas the other strains did not. The PCR detection limit using BGN4-specific primer sets was 2.8 × 10 1 CFU/ml of BGN4. Those primer sets also detected and identified BGN4 in the probiotic products containing BNG4 and fecal samples from a BGN4-fed animal model with high specificity. Our results indicate that the PCR assay from this study is an efficient tool for the simple, rapid, and reliable identification of BGN4, for which probiotic strains are known.
Mares-Guia, Maria Angélica M M; Guterres, Alexandro; Rozental, Tatiana; Ferreira, Michelle Dos Santos; Lemos, Elba R S
Q fever is a worldwide zoonosis caused by Coxiella burnetii-a small obligate intracellular Gram-negative bacterium found in a variety of animals. It is transmitted to humans by inhalation of contaminated aerosols from urine, feces, milk, amniotic fluid, placenta, abortion products, wool, and rarely by ingestion of raw milk from infected animals. Nested PCR can improve the sensitivity and specificity of testing while offering a suitable amplicon size for sequencing. Serial dilutions were performed tenfold to test the limit of detection, and the result was 10× detection of C. burnetti DNA with internal nested PCR primers relative to trans-PCR. Different biological samples were tested and identified only in nested PCR. This demonstrates the efficiency and effectiveness of the primers. Of the 19 samples, which amplify the partial sequence of C. burnetii, 12 were positive by conventional PCR and nested PCR. Seven samples-five spleen tissue samples from rodents and two tick samples-were only positive in nested PCR. With these new internal primers for trans-PCR, we demonstrate that our nested PCR assay for C. burnetii can achieve better results than conventional PCR. Published by Elsevier Editora Ltda.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Walters, William; Hyde, Embriette R.; Berg-Lyons, Donna
ABSTRACT Designing primers for PCR-based taxonomic surveys that amplify a broad range of phylotypes in varied community samples is a difficult challenge, and the comparability of data sets amplified with varied primers requires attention. Here, we examined the performance of modified 16S rRNA gene and internal transcribed spacer (ITS) primers for archaea/bacteria and fungi, respectively, with nonaquatic samples. We moved primer bar codes to the 5′ end, allowing for a range of different 3′ primer pairings, such as the 515f/926r primer pair, which amplifies variable regions 4 and 5 of the 16S rRNA gene. We additionally demonstrated that modifications tomore » the 515f/806r (variable region 4) 16S primer pair, which improves detection ofThaumarchaeotaand clade SAR11 in marine samples, do not degrade performance on taxa already amplified effectively by the original primer set. Alterations to the fungal ITS primers did result in differential but overall improved performance compared to the original primers. In both cases, the improved primers should be widely adopted for amplicon studies. ImportanceWe continue to uncover a wealth of information connecting microbes in important ways to human and environmental ecology. As our scientific knowledge and technical abilities improve, the tools used for microbiome surveys can be modified to improve the accuracy of our techniques, ensuring that we can continue to identify groundbreaking connections between microbes and the ecosystems they populate, from ice caps to the human body. It is important to confirm that modifications to these tools do not cause new, detrimental biases that would inhibit the field rather than continue to move it forward. We therefore demonstrated that two recently modified primer pairs that target taxonomically discriminatory regions of bacterial and fungal genomic DNA do not introduce new biases when used on a variety of sample types, from soil to human skin. This confirms the utility of these primers for maintaining currently recommended microbiome research techniques as the state of the art.« less
Structure of the coding region and mRNA variants of the apyrase gene from pea (Pisum sativum)
NASA Technical Reports Server (NTRS)
Shibata, K.; Abe, S.; Davies, E.
2001-01-01
Partial amino acid sequences of a 49 kDa apyrase (ATP diphosphohydrolase, EC 3.6.1.5) from the cytoskeletal fraction of etiolated pea stems were used to derive oligonucleotide DNA primers to generate a cDNA fragment of pea apyrase mRNA by RT-PCR and these primers were used to screen a pea stem cDNA library. Two almost identical cDNAs differing in just 6 nucleotides within the coding regions were found, and these cDNA sequences were used to clone genomic fragments by PCR. Two nearly identical gene fragments containing 8 exons and 7 introns were obtained. One of them (H-type) encoded the mRNA sequence described by Hsieh et al. (1996) (DDBJ/EMBL/GenBank Z32743), while the other (S-type) differed by the same 6 nucleotides as the mRNAs, suggesting that these genes may be alleles. The six nucleotide differences between these two alleles were found solely in the first exon, and these mutation sites had two types of consensus sequences. These mRNAs were found with varying lengths of 3' untranslated regions (3'-UTR). There are some similarities between the 3'-UTR of these mRNAs and those of actin and actin binding proteins in plants. The putative roles of the 3'-UTR and alternative polyadenylation sites are discussed in relation to their possible role in targeting the mRNAs to different subcellular compartments.
A Tale of Tails: Dissecting the Enhancing Effect of Tailed Primers in Real-Time PCR
Vandenbussche, Frank; Mathijs, Elisabeth; Lefebvre, David; De Clercq, Kris; Van Borm, Steven
2016-01-01
Non-specific tail sequences are often added to the 5’-terminus of primers to improve the robustness and overall performance of diagnostic assays. Despite the widespread use of tailed primers, the underlying working mechanism is not well understood. To address this problem, we conducted a detailed in vitro and in silico analysis of the enhancing effect of primer tailing on 2 well-established foot-and-mouth disease virus (FMDV) RT-qPCR assays using an FMDV reference panel. Tailing of the panFMDV-5UTR primers mainly affected the shape of the amplification curves. Modelling of the raw fluorescence data suggested a reduction of the amplification efficiency due to the accumulation of inhibitors. In depth analysis of PCR products indeed revealed the rapid accumulation of forward-primer derived artefacts. More importantly, tailing of the forward primer delayed artefacts formation and concomitantly restored the sigmoidal shape of the amplification curves. Our analysis also showed that primer tailing can alter utilisation patterns of degenerate primers and increase the number of primer variants that are able to participate in the reaction. The impact of tailed primers was less pronounced in the panFMDV-3D assay with only 5 out of 50 isolates showing a clear shift in Cq values. Sequence analysis of the target region of these 5 isolates revealed several mutations in the inter-primer region that extend an existing hairpin structure immediately downstream of the forward primer binding site. Stabilisation of the forward primer with either a tail sequence or cationic spermine units restored the sensitivity of the assay, which suggests that the enhancing effect in the panFMDV-3D assay is due to a more efficient extension of the forward primer. ur results show that primer tailing can alter amplification through various mechanisms that are determined by both the assay and target region. These findings expand our understanding of primer tailing and should enable a more targeted and efficient use of tailed primers. PMID:27723800
Winn-Deen
1998-12-01
Background: Currently analysis of point mutations can be done by allele-specific polymerase chain reaction (PCR) followed by gel analysis or by gene-specific PCR followed by hybridization with an allele-specific probe. Both of these mutation detection methods require post-PCR laboratory time and run the risk of contaminating subsequent experiments with the PCR product liberated during the detection step. The author has combined the PCR amplification and detection steps into a single procedure suitable for closed-tube analysis. Methods and Results: Allele-specific PCR primers were designed as Sunrise energy-transfer primers and contained a 3' terminal mismatch to distinguish between normal and mutant DNA. Cloned normal (W64) and mutant (R64) templates of the beta3-adrenergic receptor gene were tested to verify amplification specificity and yield. A no-target negative control was also run with each reaction. After PCR, each reaction was tested for fluorescence yield by measuring fluorescence on a spectrofluorimeter or fluorescent microtitreplate reader. The cloned controls and 24 patient samples were tested for the W64R mutation by two methods. The direct fluorescence results with the Sunrise allele-specific PCR method gave comparable genotypes to those obtained with the PCR/ restriction digest/gel electrophoresis control method. No PCR artifacts were observed in the negative controls or in the PCR reactions run with the mismatched target. Conclusions: The results of this pilot study indicate good PCR product and fluorescence yield from allele-specific energy-transfer labeled primers, and the capability of distinguishing between normal and mutant alleles based on fluorescence alone, without the need for restriction digestion, gel electrophoresis, or hybridization with an allele-specific probe.
Nguyen, Khue Thi; Nguyen, Nga Thi Bich; Doan, Huong Thi Thanh; Le, Xuyen Thi Kim; Hoang, Chau Thi Minh; De, Nguyen Van
2012-01-01
A single-step multiplex PCR (here referred to as a duplex PCR) has been developed for simultaneous detection and diagnosis of Fasciola hepatica and F. gigantica. These species overlap in distribution in many countries of North and East Africa and Central and Southeast Asia and are similar in egg morphology, making identification from fecal samples difficult. Based on a comparative alignment of mitochondrial DNA (mtDNA) spanning the region of cox1-trnT-rrnL, two species-specific forward primers were designed, FHF (for F. hepatica) and FGF (for F. gigantica), and a single reverse primer, FHGR (common for both species). Conventional PCR followed by sequencing was applied using species-specific primer pairs to verify the specificity of primers and the identity of Fasciola DNA templates. Duplex PCR (using three primers) was used for testing with the DNA extracted from adult worms, miracidia, and eggs, producing amplicons of 1,031 bp for F. hepatica and 615 bp for F. gigantica. The duplex PCR failed to amplify from DNA of other common liver and intestinal trematodes, including two opisthorchiids, three heterophyids, an echinostomid, another fasciolid, and a taeniid cestode. The sensitivity assay showed that the duplex PCR limit of detection for each Fasciola species was between 0.012 ng and 0.006 ng DNA. Evaluation using DNA templates from 32 Fasciola samples (28 adults and 4 eggs) and from 25 field-collected stools of ruminants and humans revealed specific bands of the correct size and the presence of Fasciola species. This novel mtDNA duplex PCR is a sensitive and fast tool for accurate identification of Fasciola species in areas of distributional and zonal overlap. PMID:22692744
Le, Thanh Hoa; Nguyen, Khue Thi; Nguyen, Nga Thi Bich; Doan, Huong Thi Thanh; Le, Xuyen Thi Kim; Hoang, Chau Thi Minh; De, Nguyen Van
2012-08-01
A single-step multiplex PCR (here referred to as a duplex PCR) has been developed for simultaneous detection and diagnosis of Fasciola hepatica and F. gigantica. These species overlap in distribution in many countries of North and East Africa and Central and Southeast Asia and are similar in egg morphology, making identification from fecal samples difficult. Based on a comparative alignment of mitochondrial DNA (mtDNA) spanning the region of cox1-trnT-rrnL, two species-specific forward primers were designed, FHF (for F. hepatica) and FGF (for F. gigantica), and a single reverse primer, FHGR (common for both species). Conventional PCR followed by sequencing was applied using species-specific primer pairs to verify the specificity of primers and the identity of Fasciola DNA templates. Duplex PCR (using three primers) was used for testing with the DNA extracted from adult worms, miracidia, and eggs, producing amplicons of 1,031 bp for F. hepatica and 615 bp for F. gigantica. The duplex PCR failed to amplify from DNA of other common liver and intestinal trematodes, including two opisthorchiids, three heterophyids, an echinostomid, another fasciolid, and a taeniid cestode. The sensitivity assay showed that the duplex PCR limit of detection for each Fasciola species was between 0.012 ng and 0.006 ng DNA. Evaluation using DNA templates from 32 Fasciola samples (28 adults and 4 eggs) and from 25 field-collected stools of ruminants and humans revealed specific bands of the correct size and the presence of Fasciola species. This novel mtDNA duplex PCR is a sensitive and fast tool for accurate identification of Fasciola species in areas of distributional and zonal overlap.
Smith, J K; Parry, J D; Day, J G; Smith, R J
1998-10-01
The use of primers based on the Hip1 sequence as a typing technique for cyanobacteria has been investigated. The discovery of short repetitive sequence structures in bacterial DNA during the last decade has led to the development of PCR-based methods for typing, i.e., distinguishing and identifying, bacterial species and strains. An octameric palindromic sequence known as Hip1 has been shown to be present in the chromosomal DNA of many species of cyanobacteria as a highly repetitious interspersed sequence. PCR primers were constructed that extended the Hip1 sequence at the 3' end by two bases. Five of the 16 possible extended primers were tested. Each of the five primers produced a different set of products when used to prime PCR from cyanobacterial genomic DNA. Each primer produced a distinct set of products for each of the 15 cyanobacterial species tested. The ability of Hip1-based PCR to resolve taxonomic differences was assessed by analysis of independent isolates of Anabaena flos-aquae and Nostoc ellipsosporum obtained from the CCAP (Culture Collection of Algae and Protozoa, IFE, Cumbria, UK). A PCR-based RFLP analysis of products amplified from the 23S-16S rDNA intergenic region was used to characterize the isolates and to compare with the Hip1 typing data. The RFLP and Hip1 typing yielded similar results and both techniques were able to distinguish different strains. On the basis of these results it is suggested that the Hip1 PCR technique may assist in distinguishing cyanobacterial species and strains.
Chen, Huixin; Parimelalagan, Mariya; Takei, Fumie; Hapuarachchi, Hapuarachchige Chanditha; Koay, Evelyn Siew-Chuan; Ng, Lee Ching; Ho, Phui San; Nakatani, Kazuhiko; Chu, Justin Jang Hann
2016-01-01
A molecular diagnostic platform with DANP-anchored hairpin primer was developed and evaluated for the rapid and cost-effective detection of Chikungunya virus (CHIKV) with high sensitivity and specificity. The molecule 2, 7-diamino-1, 8-naphthyridine (DANP) binds to a cytosine-bulge and emits fluorescence at 450 nm when it is excited by 400 nm light. Thus, by measuring the decline in fluorescence emitted from DANP—primer complexes after PCR reaction, we could monitor the PCR progress. By adapting this property of DANP, we have previously developed the first generation DANP-coupled hairpin RT-PCR assay. In the current study, we improved the assay performance by conjugating the DANP molecule covalently onto the hairpin primer to fix the DANP/primer ratio at 1:1; and adjusting the excitation emission wavelength to 365/430 nm to minimize the background signal and a ‘turn-on’ system is achieved. After optimizing the PCR cycle number to 30, we not only shortened the total assay turnaround time to 60 minutes, but also further reduced the background fluorescence. The detection limit of our assay was 0.001 PFU per reaction. The DANP-anchored hairpin primer, targeting nsP2 gene of CHIKV genome, is highly specific to CHIKV, having no cross-reactivity to a panel of other RNA viruses tested. In conclusion, we report here a molecular diagnostic assay that is sensitive, specific, rapid and cost effective for CHIKV detection and can be performed where no real time PCR instrumentation is required. Our results from patient samples indicated 93.62% sensitivity and 100% specificity of this method, ensuring that it can be a useful tool for rapid detection of CHIKV for outbreaks in many parts of the world. PMID:27571201
Chen, Huixin; Parimelalagan, Mariya; Takei, Fumie; Hapuarachchi, Hapuarachchige Chanditha; Koay, Evelyn Siew-Chuan; Ng, Lee Ching; Ho, Phui San; Nakatani, Kazuhiko; Chu, Justin Jang Hann
2016-08-01
A molecular diagnostic platform with DANP-anchored hairpin primer was developed and evaluated for the rapid and cost-effective detection of Chikungunya virus (CHIKV) with high sensitivity and specificity. The molecule 2, 7-diamino-1, 8-naphthyridine (DANP) binds to a cytosine-bulge and emits fluorescence at 450 nm when it is excited by 400 nm light. Thus, by measuring the decline in fluorescence emitted from DANP-primer complexes after PCR reaction, we could monitor the PCR progress. By adapting this property of DANP, we have previously developed the first generation DANP-coupled hairpin RT-PCR assay. In the current study, we improved the assay performance by conjugating the DANP molecule covalently onto the hairpin primer to fix the DANP/primer ratio at 1:1; and adjusting the excitation emission wavelength to 365/430 nm to minimize the background signal and a 'turn-on' system is achieved. After optimizing the PCR cycle number to 30, we not only shortened the total assay turnaround time to 60 minutes, but also further reduced the background fluorescence. The detection limit of our assay was 0.001 PFU per reaction. The DANP-anchored hairpin primer, targeting nsP2 gene of CHIKV genome, is highly specific to CHIKV, having no cross-reactivity to a panel of other RNA viruses tested. In conclusion, we report here a molecular diagnostic assay that is sensitive, specific, rapid and cost effective for CHIKV detection and can be performed where no real time PCR instrumentation is required. Our results from patient samples indicated 93.62% sensitivity and 100% specificity of this method, ensuring that it can be a useful tool for rapid detection of CHIKV for outbreaks in many parts of the world.
Zheng, Qianwang; Mikš-Krajnik, Marta; Yang, Yishan; Xu, Wang; Yuk, Hyun-Gyun
2014-09-01
Conventional culture detection methods are time consuming and labor-intensive. For this reason, an alternative rapid method combining real-time PCR and immunomagnetic separation (IMS) was investigated in this study to detect both healthy and heat-injured Salmonella Typhimurium on raw duck wings. Firstly, the IMS method was optimized by determining the capture efficiency of Dynabeads(®) on Salmonella cells on raw duck wings with different bead incubation (10, 30 and 60 min) and magnetic separation (3, 10 and 30 min) times. Secondly, three Taqman primer sets, Sal, invA and ttr, were evaluated to optimize the real-time PCR protocol by comparing five parameters: inclusivity, exclusivity, PCR efficiency, detection probability and limit of detection (LOD). Thirdly, the optimized real-time PCR, in combination with IMS (PCR-IMS) assay, was compared with a standard ISO and a real-time PCR (PCR) method by analyzing artificially inoculated raw duck wings with healthy and heat-injured Salmonella cells at 10(1) and 10(0) CFU/25 g. Finally, the optimized PCR-IMS assay was validated for Salmonella detection in naturally contaminated raw duck wing samples. Under optimal IMS conditions (30 min bead incubation and 3 min magnetic separation times), approximately 85 and 64% of S. Typhimurium cells were captured by Dynabeads® from pure culture and inoculated raw duck wings, respectively. Although Sal and ttr primers exhibited 100% inclusivity and exclusivity for 16 Salmonella spp. and 36 non-Salmonella strains, the Sal primer showed lower LOD (10(3) CFU/ml) and higher PCR efficiency (94.1%) than the invA and ttr primers. Moreover, for Sal and invA primers, 100% detection probability on raw duck wings suspension was observed at 10(3) and 10(4) CFU/ml with and without IMS, respectively. Thus, the Sal primer was chosen for further experiments. The optimized PCR-IMS method was significantly (P=0.0011) better at detecting healthy Salmonella cells after 7-h enrichment than traditional PCR method. However there was no significant difference between the two methods with longer enrichment time (14 h). The diagnostic accuracy of PCR-IMS was shown to be 98.3% through the validation study. These results indicate that the optimized PCR-IMS method in this study could provide a sensitive, specific and rapid detection method for Salmonella on raw duck wings, enabling 10-h detection. However, a longer enrichment time could be needed for resuscitation and reliable detection of heat-injured cells. Copyright © 2014 Elsevier B.V. All rights reserved.
GETPrime: a gene- or transcript-specific primer database for quantitative real-time PCR.
Gubelmann, Carine; Gattiker, Alexandre; Massouras, Andreas; Hens, Korneel; David, Fabrice; Decouttere, Frederik; Rougemont, Jacques; Deplancke, Bart
2011-01-01
The vast majority of genes in humans and other organisms undergo alternative splicing, yet the biological function of splice variants is still very poorly understood in large part because of the lack of simple tools that can map the expression profiles and patterns of these variants with high sensitivity. High-throughput quantitative real-time polymerase chain reaction (qPCR) is an ideal technique to accurately quantify nucleic acid sequences including splice variants. However, currently available primer design programs do not distinguish between splice variants and also differ substantially in overall quality, functionality or throughput mode. Here, we present GETPrime, a primer database supported by a novel platform that uniquely combines and automates several features critical for optimal qPCR primer design. These include the consideration of all gene splice variants to enable either gene-specific (covering the majority of splice variants) or transcript-specific (covering one splice variant) expression profiling, primer specificity validation, automated best primer pair selection according to strict criteria and graphical visualization of the latter primer pairs within their genomic context. GETPrime primers have been extensively validated experimentally, demonstrating high transcript specificity in complex samples. Thus, the free-access, user-friendly GETPrime database allows fast primer retrieval and visualization for genes or groups of genes of most common model organisms, and is available at http://updepla1srv1.epfl.ch/getprime/. Database URL: http://deplanckelab.epfl.ch.
GETPrime: a gene- or transcript-specific primer database for quantitative real-time PCR
Gubelmann, Carine; Gattiker, Alexandre; Massouras, Andreas; Hens, Korneel; David, Fabrice; Decouttere, Frederik; Rougemont, Jacques; Deplancke, Bart
2011-01-01
The vast majority of genes in humans and other organisms undergo alternative splicing, yet the biological function of splice variants is still very poorly understood in large part because of the lack of simple tools that can map the expression profiles and patterns of these variants with high sensitivity. High-throughput quantitative real-time polymerase chain reaction (qPCR) is an ideal technique to accurately quantify nucleic acid sequences including splice variants. However, currently available primer design programs do not distinguish between splice variants and also differ substantially in overall quality, functionality or throughput mode. Here, we present GETPrime, a primer database supported by a novel platform that uniquely combines and automates several features critical for optimal qPCR primer design. These include the consideration of all gene splice variants to enable either gene-specific (covering the majority of splice variants) or transcript-specific (covering one splice variant) expression profiling, primer specificity validation, automated best primer pair selection according to strict criteria and graphical visualization of the latter primer pairs within their genomic context. GETPrime primers have been extensively validated experimentally, demonstrating high transcript specificity in complex samples. Thus, the free-access, user-friendly GETPrime database allows fast primer retrieval and visualization for genes or groups of genes of most common model organisms, and is available at http://updepla1srv1.epfl.ch/getprime/. Database URL: http://deplanckelab.epfl.ch. PMID:21917859
ERIC Educational Resources Information Center
Elkins, Kelly M.; Kadunc, Raelynn E.
2012-01-01
In this laboratory experiment, real-time polymerase chain reaction (real-time PCR) was conducted using published human TPOX single-locus DNA primers for validation and various student-designed short tandem repeat (STR) primers for Combined DNA Index System (CODIS) loci. SYBR Green was used to detect the amplification of the expected amplicons. The…
Hahn, Cassidy M; Iwanowicz, Luke R; Cornman, Robert S; Mazik, Patricia M; Blazer, Vicki S
2016-12-01
Environmental studies increasingly identify the presence of both contaminants of emerging concern (CECs) and legacy contaminants in aquatic environments; however, the biological effects of these compounds on resident fishes remain largely unknown. High throughput methodologies were employed to establish partial transcriptomes for three wild-caught, non-model fish species; smallmouth bass (Micropterus dolomieu), white sucker (Catostomus commersonii) and brown bullhead (Ameiurus nebulosus). Sequences from these transcriptome databases were utilized in the development of a custom nCounter CodeSet that allowed for direct multiplexed measurement of 50 transcript abundance endpoints in liver tissue. Sequence information was also utilized in the development of quantitative real-time PCR (qPCR) primers. Cross-species hybridization allowed the smallmouth bass nCounter CodeSet to be used for quantitative transcript abundance analysis of an additional non-model species, largemouth bass (Micropterus salmoides). We validated the nCounter analysis data system with qPCR for a subset of genes and confirmed concordant results. Changes in transcript abundance biomarkers between sexes and seasons were evaluated to provide baseline data on transcript modulation for each species of interest. Published by Elsevier Inc.
CHARACTERIZATION OF SEVEN POLYMORPHIC MICROSATELLITE LOCI IN THE COMMON LOON (GAVIA IMMER)
We describe polymerase chain reaction (PCR) primers and conditions to amplify seven microsatellite DNA loci isolated from the Common Loon (Gavia immer). The PCR primers were tested on 83 individuals from ten locations in North America, including breeding, migration stopover, and...
Navarro, B; Daròs, J A; Flores, R
1996-01-01
Two PCR-based methods are described for obtaining clones of small circular RNAs of unknown sequence and for which only minute amounts are available. To avoid introducing any assumption about the RNA sequence, synthesis of the cDNAs is initiated with random primers. The cDNA population is then PCR-amplified using a primer whose sequence is present at both sides of the cDNAs, since they have been obtained with random hexamers and then a linker with the sequence of the PCR primer has been ligated to their termini, or because the cDNAs have been synthesized with an oligonucleotide that contains the sequence of the PCR primer at its 5' end and six randomized positions at its 3' end. The procedures need only approximately 50 ng of purified RNA template. The reasons for the emergence of cloning artifacts and precautions to avoid them are discussed.
Diagnosis of Meningococcal Meningitis by Broad-Range Bacterial PCR with Cerebrospinal Fluid
Kotilainen, Pirkko; Jalava, Jari; Meurman, Olli; Lehtonen, Olli-Pekka; Rintala, Esa; Seppälä, Olli-Pekka; Eerola, Erkki; Nikkari, Simo
1998-01-01
We used broad-range bacterial PCR combined with DNA sequencing to examine prospectively cerebrospinal fluid (CSF) samples from patients with suspected meningitis. Fifty-six CSF samples from 46 patients were studied during the year 1995. Genes coding for bacterial 16S and/or 23S rRNA genes could be amplified from the CSF samples from five patients with a clinical picture consistent with acute bacterial meningitis. For these patients, the sequenced PCR product shared 98.3 to 100% homology with the Neisseria meningitidis sequence. For one patient, the diagnosis was initially made by PCR alone. Of the remaining 51 CSF samples, for 50 (98.0%) samples the negative PCR findings were in accordance with the negative findings by bacterial culture and Gram staining, as well as with the eventual clinical diagnosis for the patient. However, the PCR test failed to detect the bacterial rRNA gene in one CSF sample, the culture of which yielded Listeria monocytogenes. These results invite new research efforts to be focused on the application of PCR with broad-range bacterial primers to improve the etiologic diagnosis of bacterial meningitis. In a clinical setting, Gram staining and bacterial culture still remain the cornerstones of diagnosis. PMID:9665992
Kim, Si Hyun; Jeong, Haeng Soon; Kim, Yeong Hoon; Song, Sae Am; Lee, Ja Young; Oh, Seung Hwan; Kim, Hye Ran; Lee, Jeong Nyeo; Kho, Weon-Gyu; Shin, Jeong Hwan
2012-03-01
The aims of this study were to compare several DNA extraction methods and 16S rDNA primers and to evaluate the clinical utility of broad-range PCR in continuous ambulatory peritoneal dialysis (CAPD) culture fluids. Six type strains were used as model organisms in dilutions from 10(8) to 10(0) colony-forming units (CFU)/mL for the evaluation of 5 DNA extraction methods and 5 PCR primer pairs. Broad-range PCR was applied to 100 CAPD culture fluids, and the results were compared with conventional culture results. There were some differences between the various DNA extraction methods and primer sets with regard to the detection limits. The InstaGene Matrix (Bio-Rad Laboratories, USA) and Exgene Clinic SV kits (GeneAll Biotechnology Co. Ltd, Korea) seem to have higher sensitivities than the others. The results of broad-range PCR were concordant with the results from culture in 97% of all cases (97/100). Two culture-positive cases that were broad-range PCR-negative were identified as Candida albicans, and 1 PCR-positive but culture-negative sample was identified as Bacillus circulans by sequencing. Two samples among 54 broad-range PCR-positive products could not be sequenced. There were differences in the analytical sensitivity of various DNA extraction methods and primers for broad-range PCR. The broad-range PCR assay can be used to detect bacterial pathogens in CAPD culture fluid as a supplement to culture methods.
Nishida, I; Sugiura, M; Enju, A; Nakamura, M
2000-12-01
A new isogene for acyl-(acyl-carrier-protein):glycerol-3-phosphate acyltransferase (GPAT; EC 2.3.1.15) in squash has been cloned and the gene product was identified as oleate-selective GPAT. Using PCR primers that could hybridise with exons for a previously cloned squash GPAT, we obtained two PCR products of different size: one coded for a previously cloned squash GPAT corresponding to non-selective isoforms AT2 and AT3, and the other for a new isozyme, probably the oleate-selective isoform AT1. Full-length amino acid sequences of respective isozymes were deduced from the nucleotide sequences of genomic genes and cDNAs, which were cloned by a series of PCR-based methods. Thus, we designated the new gene CmATS1;1 and the other one CmATS1;2. Genome blot analysis revealed that the squash genome contained the two isogenes at non-allelic loci. AT1-active fractions were partially purified, and three polypeptide bands were identified as being AT1 polypeptides, which exhibited relative molecular masses of 39.5-40.5 kDa, pI values of 6.75-7.15, and oleate selectivity over palmitate. Partial amino-terminal sequences obtained from two of these bands verified that the new isogene codes for AT1 polypeptides.
Pooler, M R; Ritchie, D F; Hartung, J S
1996-01-01
Genetic relationships among 25 isolates of Xanthomonas fragariae from diverse geographic regions were determined by three PCR methods that rely on different amplification priming strategies: random amplified polymorphic DNA (RAPD) PCR, repetitive extragenic palindromic (REP) PCR, and enterobacterial repetitive intergenic consensus (ERIC) PCR. The results of these assays are mutually consistent and indicate that pathogenic strains are very closely related to each other. RAPD, ERIC, and REP PCR assays identified nine, four, and two genotypes, respectively, within X. fragariae isolates. A single nonpathogenic isolate of X. fragariae was not distinguishable by these methods. The results of the PCR assays were also fully confirmed by physiological tests. There was no correlation between DNA amplification product patterns and geographic sites of isolation, suggesting that this bacterium has spread largely through exchange of infected plant germ plasm. Sequences identified through the RAPD assays were used to develop three primer pairs for standard PCR assays to identify X. fragariae. In addition, we developed a stringent multiplexed PCR assay to identify X. fragariae by simultaneously using the three independently derived sets of primers specific for pathogenic strains of the bacteria. PMID:8795198
Gemi: PCR Primers Prediction from Multiple Alignments
Sobhy, Haitham; Colson, Philippe
2012-01-01
Designing primers and probes for polymerase chain reaction (PCR) is a preliminary and critical step that requires the identification of highly conserved regions in a given set of sequences. This task can be challenging if the targeted sequences display a high level of diversity, as frequently encountered in microbiologic studies. We developed Gemi, an automated, fast, and easy-to-use bioinformatics tool with a user-friendly interface to design primers and probes based on multiple aligned sequences. This tool can be used for the purpose of real-time and conventional PCR and can deal efficiently with large sets of sequences of a large size. PMID:23316117
2014-01-01
Background Although sophisticated methodologies are available, the use of endpoint polymerase chain reaction (PCR) to detect 16S rDNA genes remains a good approach for estimating the incidence and prevalence of specific infections and for monitoring infections. Considering the importance of the early diagnosis of sexually transmitted infections (STIs), the development of a sensitive and affordable method for identifying pathogens in clinical samples is needed. Highly specific and efficient primers for a multiplex polymerase chain reaction (m-PCR) system were designed in silico to detect the 16S rDNA genes of four bacteria that cause genital infections, and the PCR method was developed. Methods The Genosensor Probe Designer (GPD) (version 1.0a) software was initially used to design highly specific and efficient primers for in-house m-PCR. Single-locus PCR reactions were performed and standardised, and then primers for each locus in turn were added individually in subsequent amplifications until m-PCR was achieved. Amplicons of the expected size were obtained from each of the four bacterial gene fragments. Finally, the analytical specificity and limits of detection were tested. Results Because they did not amplify any product from non-STI tested species, the primers were specific. The detection limits for the Chlamydia trachomatis, Neisseria gonorrhoeae, Mycoplasma hominis and Ureaplasma urealyticum primer sets were 5.12 × 105, 3.9 × 103, 61.19 × 106 and 6.37 × 105 copies of a DNA template, respectively. Conclusions The methodology designed and standardised here could be applied satisfactorily for the simultaneous or individual detection of Chlamydia trachomatis, Neisseria gonorrhoeae, Mycoplasma hominis and Ureaplasma urealyticum. This method is at least as efficient as other previously described methods; however, this method is more affordable for low-income countries. PMID:24997675
Evaluation of the PCR method for identification of Bifidobacterium species.
Youn, S Y; Seo, J M; Ji, G E
2008-01-01
Bifidobacterium species are known for their beneficial effects on health and their wide use as probiotics. Although various polymerase chain reaction (PCR) methods for the identification of Bifidobacterium species have been published, the reliability of these methods remains open to question. In this study, we evaluated 37 previously reported PCR primer sets designed to amplify 16S rDNA, 23S rDNA, intergenic spacer regions, or repetitive DNA sequences of various Bifidobacterium species. Ten of 37 experimental primer sets showed specificity for B. adolescentis, B. angulatum, B. pseudocatenulatum, B. breve, B. bifidum, B. longum, B. longum biovar infantis and B. dentium. The results suggest that published Bifidobacterium primer sets should be re-evaluated for both reproducibility and specificity for the identification of Bifidobacterium species using PCR. Improvement of existing PCR methods will be needed to facilitate identification of other Bifidobacterium strains, such as B. animalis, B. catenulatum, B. thermophilum and B. subtile.
Detection and Heterogeneity of Herpesviruses Causing Pacheco's Disease in Parrots
Tomaszewski, Elizabeth; Wilson, Van G.; Wigle, William L.; Phalen, David N.
2001-01-01
Pacheco's disease (PD) is a common, often fatal, disease of parrots. We cloned a virus isolate from a parrot that had characteristic lesions of PD. Three viral clones were partially sequenced, demonstrating that this virus was an alphaherpesvirus most closely related to the gallid herpesvirus 1. Five primer sets were developed from these sequences. The primer sets were used with PCR to screen tissues or tissue culture media suspected to contain viruses from 54 outbreaks of PD. The primer sets amplified DNA from all but one sample. Ten amplification patterns were detected, indicating that PD is caused by a genetically heterogeneous population of viruses. A single genetic variant (psittacid herpesvirus variant 1) amplified with all primer sets and was the most common virus variant (62.7%). A single primer set (23F) amplified DNA from all of the positive samples, suggesting that PCR could be used as a rapid postmortem assay for these viruses. PCR was found to be significantly more sensitive than tissue culture for the detection of psittacid herpesviruses. PMID:11158102
Kwon, Hyuk-Sang; Yang, Eun-Hee; Yeon, Seung-Woo; Kang, Byoung-Hwa; Kim, Tae-Yong
2004-10-15
This study aimed to develop a novel multiplex polymerase chain reaction (PCR) primer set for the identification of seven probiotic Lactobacillus species such as Lactobacillus acidophilus, Lactobacillus delbrueckii, Lactobacillus casei, Lactobacillus gasseri, Lactobacillus plantarum, Lactobacillus reuteri and Lactobacillus rhamnosus. The primer set, comprising of seven specific and two conserved primers, was derived from the integrated sequences of 16S and 23S rRNA genes and their rRNA intergenic spacer region of each species. It was able to identify the seven target species with 93.6% accuracy, which exceeds that of the general biochemical methods. The phylogenetic analyses, using 16S rDNA sequences of the probiotic isolates, also provided further support that the results from the multiplex PCR assay were trustworthy. Taken together, we suggest that the multiplex primer set is an efficient tool for simple, rapid and reliable identification of seven Lactobacillus species.
Software-supported USER cloning strategies for site-directed mutagenesis and DNA assembly.
Genee, Hans Jasper; Bonde, Mads Tvillinggaard; Bagger, Frederik Otzen; Jespersen, Jakob Berg; Sommer, Morten O A; Wernersson, Rasmus; Olsen, Lars Rønn
2015-03-20
USER cloning is a fast and versatile method for engineering of plasmid DNA. We have developed a user friendly Web server tool that automates the design of optimal PCR primers for several distinct USER cloning-based applications. Our Web server, named AMUSER (Automated DNA Modifications with USER cloning), facilitates DNA assembly and introduction of virtually any type of site-directed mutagenesis by designing optimal PCR primers for the desired genetic changes. To demonstrate the utility, we designed primers for a simultaneous two-position site-directed mutagenesis of green fluorescent protein (GFP) to yellow fluorescent protein (YFP), which in a single step reaction resulted in a 94% cloning efficiency. AMUSER also supports degenerate nucleotide primers, single insert combinatorial assembly, and flexible parameters for PCR amplification. AMUSER is freely available online at http://www.cbs.dtu.dk/services/AMUSER/.
Position-dependent effects of locked nucleic acid (LNA) on DNA sequencing and PCR primers
Levin, Joshua D.; Fiala, Dean; Samala, Meinrado F.; Kahn, Jason D.; Peterson, Raymond J.
2006-01-01
Genomes are becoming heavily annotated with important features. Analysis of these features often employs oligonucleotides that hybridize at defined locations. When the defined location lies in a poor sequence context, traditional design strategies may fail. Locked Nucleic Acid (LNA) can enhance oligonucleotide affinity and specificity. Though LNA has been used in many applications, formal design rules are still being defined. To further this effort we have investigated the effect of LNA on the performance of sequencing and PCR primers in AT-rich regions, where short primers yield poor sequencing reads or PCR yields. LNA was used in three positional patterns: near the 5′ end (LNA-5′), near the 3′ end (LNA-3′) and distributed throughout (LNA-Even). Quantitative measures of sequencing read length (Phred Q30 count) and real-time PCR signal (cycle threshold, CT) were characterized using two-way ANOVA. LNA-5′ increased the average Phred Q30 score by 60% and it was never observed to decrease performance. LNA-5′ generated cycle thresholds in quantitative PCR that were comparable to high-yielding conventional primers. In contrast, LNA-3′ and LNA-Even did not improve read lengths or CT. ANOVA demonstrated the statistical significance of these results and identified significant interaction between the positional design rule and primer sequence. PMID:17071964
Gell, I; Cubero, J; Melgarejo, P
2007-12-01
To design a protocol for the universal diagnosis of brown rot by polymerase chain reaction (PCR) in plant material and subsequently Monilinia spp. identification. Primers for discrimination of Monilinia spp. from other fungal genera by PCR were designed following a ribosomal DNA analysis. Discrimination among species of Monilinia was subsequently achieved by developing primers using SCAR (Sequence Characterised Amplified Region) markers obtained after a random amplified polymorphic DNA study. In addition, an internal control (IC) based on the utilization of a mimic plasmid was designed to be used in the diagnostic protocol of brown rot to recognize false negatives due to the inhibition of PCR. The four sets of primers designed allowed detection and discrimination of all Monilinia spp. causing brown rot in fruit trees. Addition of an IC in each PCR reaction performed increased the reliability of the diagnostic protocol. The detection protocol presented here, that combined a set of universal primers and the inclusion of the plasmid pGMON as an IC for diagnosis of all Monilinia spp., and three sets of primers to discriminate the most important species of Monilinia, could be an useful and valuable tool for epidemiological studies. The method developed could be used in programmes to avoid the spread and introduction of this serious disease in new areas.
Smielewska-Loś, E
2003-01-01
Tissues from 4 aborted polar foxes (3 samples of brain and 4 samples of liver) were selected for Toxoplasma gondii PCR assay. Positive results of serological tests of mothers and immunofluorescence test (IFT) of fetal organ smears were the criteria of sample selection. Five sets of primers designed from B1 gene and ITS1 sequences of T. gondii were used for detection of the parasite in fetal fox tissues. All used primer sets successfully amplified T. gondii DNA in PCR from organs which were positive by IFT. Single tube nested PCR also showed positive result from a sample negative by IFT, but this product was not confirmed. The studies showed usefullness of PCR for routine diagnosis of toxoplasmosis in carnivores.
Song, Y; Kato, N; Liu, C; Matsumiya, Y; Kato, H; Watanabe, K
2000-06-15
Rapid and reliable two-step multiplex polymerase chain reaction (PCR) assays were established to identify human intestinal lactobacilli; a multiplex PCR was used for grouping of lactobacilli with a mixture of group-specific primers followed by four multiplex PCR assays with four sorts of species-specific primer mixtures for identification at the species level. Primers used were designed from nucleotide sequences of the 16S-23S rRNA intergenic spacer region and its flanking 23S rRNA gene of members of the genus Lactobacillus which are commonly isolated from human stool specimens: Lactobacillus acidophilus, Lactobacillus crispatus, Lactobacillus delbrueckii (ssp. bulgaricus and ssp. lactis), Lactobacillus fermentum, Lactobacillus gasseri, Lactobacillus jensenii, Lactobacillus paracasei (ssp. paracasei and ssp. tolerans), Lactobacillus plantarum, Lactobacillus reuteri, Lactobacillus rhamnosus and Lactobacillus salivarius (ssp. salicinius and ssp. salivarius). The established two-step multiplex PCR assays were applied to the identification of 84 Lactobacillus strains isolated from human stool specimens and the PCR results were consistent with the results from the DNA-DNA hybridization assay. These results suggest that the multiplex PCR system established in this study is a simple, rapid and reliable method for the identification of common Lactobacillus isolates from human stool samples.
Vandenbussche, Frank; Lefebvre, David J; De Leeuw, Ilse; Van Borm, Steven; De Clercq, Kris
2017-08-01
The 3D and 5UTR real-time RT-PCR assays (RT-qPCR) from Callahan et al. (2002) and Reid et al. (2002) are commonly used reference methods for the detection of foot-and-mouth disease virus (FMDV). For an optimal detection of FMDV in clinical samples, it is advised to use both assays simultaneously (King et al., 2006). Recently, Vandenbussche et al. (2016) showed that the addition of 5'-tails to the FMDV-specific primers enhances the detection of FMDV in both the 3D and the 5UTR RT-qPCR assay. To validate the 3D and 5UTR RT-qPCR assays with 5'-tailed primers for diagnostic purposes, both assays were run in parallel in a triplex one-step RT-qPCR protocol with beta-actin as an internal control and synthetic RNA as an external control. We obtained low limits of detection and high linearity's, high repeatability and reproducibility, near 100% analytical specificity and >99% diagnostic accuracy for both assays. It was concluded that the 3D and 5UTR RT-qPCR assays with 5'-tailed primers are particularly suited for the detection of FMDV as well as to exclude the presence of FMDV. Copyright © 2017 Elsevier B.V. All rights reserved.
M. T. Mmbaga; N. B. Klopfenstein; M. -S. Kim; N. C. Mmbaga
2004-01-01
The internal transcribed spacer (ITS) regions of rDNA and the intervening 5.8S rRNA gene for the powdery mildew fungi Erysiphe (sect. Microsphaera) pulchra and Phyllactinia guttata were amplified using standard polymerase chain reaction (PCR) protocols and the universal primer pairs, ITS1 and ITS4. PCR products for ITS were analysed by electrophoresis in a 1.5% agarose...
Ballari, Rajashekhar V; Martin, Asha; Gowda, Lalitha R
2013-01-01
Brinjal is an important vegetable crop. Major crop loss of brinjal is due to insect attack. Insect-resistant EE-1 brinjal has been developed and is awaiting approval for commercial release. Consumer health concerns and implementation of international labelling legislation demand reliable analytical detection methods for genetically modified (GM) varieties. End-point and real-time polymerase chain reaction (PCR) methods were used to detect EE-1 brinjal. In end-point PCR, primer pairs specific to 35S CaMV promoter, NOS terminator and nptII gene common to other GM crops were used. Based on the revealed 3' transgene integration sequence, primers specific for the event EE-1 brinjal were designed. These primers were used for end-point single, multiplex and SYBR-based real-time PCR. End-point single PCR showed that the designed primers were highly specific to event EE-1 with a sensitivity of 20 pg of genomic DNA, corresponding to 20 copies of haploid EE-1 brinjal genomic DNA. The limits of detection and quantification for SYBR-based real-time PCR assay were 10 and 100 copies respectively. The prior development of detection methods for this important vegetable crop will facilitate compliance with any forthcoming labelling regulations. Copyright © 2012 Society of Chemical Industry.
Pham, Dien G.; Madico, Guillermo E.; Quinn, Thomas C.; Enzler, Mark J.; Smith, Thomas F.; Gaydos, Charlotte A.
1998-01-01
An inherent problem in the diagnostic PCR assay is the presence of ill-defined inhibitors of amplification which may cause false-negative results. Addition of an amplifiable fragment of foreign DNA in the PCR to serve as a hybrid internal control (HIC) would allow for a simple way to identify specimens containing inhibitors. Two oligonucleotide hybrid primers were synthesized to contain nucleic acid sequences of the Chlamydia pneumoniae 16S rRNA primers in a position flanking two primers that target the sequences of a 650-bp lambda phage DNA segment. By using the hybrid primers, hybrid DNA comprising a large sequence of lambda phage DNA flanked by short pieces of chlamydia DNA was subsequently generated by PCR, cloned into a plasmid vector, and purified. Plasmids containing the hybrid DNA were diluted and used as a HIC by adding them to each C. pneumoniae PCR test. Consequently, C. pneumoniae primers were able to amplify both chlamydia DNA and the HIC DNA. The production of a 689-bp HIC DNA band on an acrylamide gel indicated that the specimen contained no inhibitors and that internal conditions were compatible with PCR. Subsequently, a biotinylated RNA probe for the HIC was transcribed from a nested sequence of the HIC and was used for its hybridization. Detection of the HIC DNA-RNA hybrid was achieved by enzyme immunoassay (EIA). This PCR-EIA system with a HIC was initially tested with 12 previously PCR-positive and 14 previously PCR-negative specimens. Of the 12 PCR-positive specimens, 11 were reconfirmed as positive; 1 had a negative HIC value, indicating inhibition. Of the 14 previously PCR-negative specimens, 13 were confirmed as true negative; 1 had a negative HIC value, indicating inhibition. The assay was then used with 237 nasopharyngeal specimens from patients with pneumonia. Twenty-one of 237 (8.9%) were positive for C. pneumoniae, and 42 (17.7%) were found to inhibit the PCR. Specimens showing inhibitory activity were diluted 1:10 and were retested. Ten specimens were still inhibitory to the PCR and required further DNA purification. No additional positive samples were detected and 3 nasopharyngeal specimens remained inhibitory to PCR. Coamplification of a HIC DNA can help confirm true-negative PCR results by ruling out the presence of inhibitors of DNA amplification. PMID:9650936
Myers, Michael J; Yancy, Haile F; Araneta, Michael; Armour, Jennifer; Derr, Janice; Hoostelaere, Lawrence A D; Farmer, Doris; Jackson, Falana; Kiessling, William M; Koch, Henry; Lin, Huahua; Liu, Yan; Mowlds, Gabrielle; Pinero, David; Riter, Ken L; Sedwick, John; Shen, Yuelian; Wetherington, June; Younkins, Ronsha
2006-01-01
A method trial was initiated to validate the use of a commercial DNA forensic kit to extract DNA from animal feed as part of a PCR-based method. Four different PCR primer pairs (one bovine pair, one porcine pair, one ovine primer pair, and one multispecies pair) were also evaluated. Each laboratory was required to analyze a total of 120 dairy feed samples either not fortified (control, true negative) or fortified with bovine meat and bone meal, porcine meat and bone meal (PMBM), or lamb meal. Feeds were fortified with the animal meals at a concentration of 0.1% (wt/wt). Ten laboratories participated in this trial, and each laboratory was required to evaluate two different primer pairs, i.e., each PCR primer pair was evaluated by five different laboratories. The method was considered to be validated for a given animal source when three or more laboratories achieved at least 97% accuracy (29 correct of 30 samples for 96.7% accuracy, rounded up to 97%) in detecting the fortified samples for that source. Using this criterion, the method was validated for the bovine primer because three laboratories met the criterion, with an average accuracy of 98.9%. The average false-positive rate was 3.0% in these laboratories. A fourth laboratory was 80% accurate in identifying the samples fortified with bovine meat and bone meal. A fifth laboratory was not able to consistently extract the DNA from the feed samples and did not achieve the criterion for accuracy for either the bovine or multispecies PCR primers. For the porcine primers, the method was validated, with four laboratories meeting the criterion for accuracy with an average accuracy of 99.2%. The fifth laboratory had a 93.3% accuracy outcome for the porcine primer. Collectively, these five laboratories had a 1.3% false-positive rate for the porcine primer. No laboratory was able to meet the criterion for accuracy with the ovine primers, most likely because of problems with the synthesis of the primer pair; none of the positive control DNA samples could be detected with the ovine primers. The multispecies primer pair was validated in three laboratories for use with bovine meat and bone meal and lamb meal but not with PMBM. The three laboratories had an average accuracy of 98.9% for bovine meat and bone meal, 97.8% for lamb meal, and 63.3% for PMBM. When examined on an individual laboratory basis, one of these four laboratories could not identify a single feed sample containing PMBM by using the multispecies primer, whereas the other laboratory identified only one PMBM-fortified sample, suggesting that the limit of detection for PMBM with this primer pair is around 0.1% (wt/wt). The results of this study demonstrated that the DNA forensic kit can be used to extract DNA from animal feed, which can then be used for PCR analysis to detect animal-derived protein present in the feed sample.
Tas, E; Leinonen, P; Saano, A; Räsänen, L A; Kaijalainen, S; Piippola, S; Hakola, S; Lindström, K
1996-02-01
Competition between effective and ineffective Rhizobium galegae strains nodulating Galega orientalis was examined on the basis of plant growth, nodulation, antibiotic resistance, and PCR results. In a preliminary experiment in Leonard's jars, ineffective R. galegae strains HAMBI 1207 and HAMBI 1209 competed in similar manners with the effective strain R. galegae HAMBI 1174. In a pot experiment, soil was inoculated with 0 to 10(5) HAMBI 1207 cells per g before G. orientalis was sown. Seeds of G. orientalis were surface inoculated with 2 x 10(4) and 2 x 10(5) cells of HAMBI 1174 per seed (which represent half and fivefold the commercially recommended amount of inoculant, respectively). Plant yield and nodulation by the effective strain were significantly reduced, with as few as 10(2) ineffective rhizobia per g of soil, and the inoculation response was not improved by the 10-fold greater dose of the inoculant. Bacteria occupying the nodules were identified by antibiotic resistance and PCR with primers specific for R. galegae HAMBI 1174, R. galegae, and genes coding for bacterial 16S rRNA (bacterial 16S rDNA). Sixty-two large nodules examined were occupied by the effective strain HAMBI 1174, as proven by antibiotic resistance and amplification of the strain-specific fragment. From 20 small nodules, only the species-specific fragment could be amplified, and isolated bacteria had the same antibiotic resistance and 16S PCR restriction pattern as strain HAMBI 1207. PCR with our strain-specific and species-specific primers provides a powerful tool for strain identification of R. galegae directly from nodules without genetic modification of the bacteria.
Vela, J; Vitorica, J; Ruano, D
2001-12-01
We describe a fast and easy method for the synthesis of competitor molecules based on non-specific conditions of PCR. RT-competitive PCR is a sensitive technique that allows quantification of very low quantities of mRNA molecules in small tissue samples. This technique is based on the competition established between the native and standard templates for nucleotides, primers or other factors during PCR. Thus, the most critical parameter is the use of good internal standards to generate a standard curve from which the amount of native sequences can be properly estimated. At the present time different types of internal standards and methods for their synthesis have been described. Normally, most of these methods are time-consuming and require the use of different sets of primers, different rounds of PCR or specific modifications, such as site-directed mutagenesis, that need subsequent analysis of the PCR products. Using our method, we obtained in a single round of PCR and with the same primer pair, competitor molecules that were successfully used in RT-competitive PCR experiments. The principal advantage of this method is high versatility and economy. Theoretically it is possible to synthesize a specific competitor molecule for each primer pair used. Finally, using this method we have been able to quantify the increase in the expression of the beta(2) GABA(A) receptor subunit mRNA that occurs during rat hippocampus development.
Nakamura, Mikiko; Suzuki, Ayako; Akada, Junko; Tomiyoshi, Keisuke; Hoshida, Hisashi; Akada, Rinji
2015-12-01
Mammalian gene expression constructs are generally prepared in a plasmid vector, in which a promoter and terminator are located upstream and downstream of a protein-coding sequence, respectively. In this study, we found that front terminator constructs-DNA constructs containing a terminator upstream of a promoter rather than downstream of a coding region-could sufficiently express proteins as a result of end joining of the introduced DNA fragment. By taking advantage of front terminator constructs, FLAG substitutions, and deletions were generated using mutagenesis primers to identify amino acids specifically recognized by commercial FLAG antibodies. A minimal epitope sequence for polyclonal FLAG antibody recognition was also identified. In addition, we analyzed the sequence of a C-terminal Ser-Lys-Leu peroxisome localization signal, and identified the key residues necessary for peroxisome targeting. Moreover, front terminator constructs of hepatitis B surface antigen were used for deletion analysis, leading to the identification of regions required for the particle formation. Collectively, these results indicate that front terminator constructs allow for easy manipulations of C-terminal protein-coding sequences, and suggest that direct gene expression with PCR-amplified DNA is useful for high-throughput protein analysis in mammalian cells.
Ikenaga, Makoto; Tabuchi, Masakazu; Kawauchi, Tomohiro; Sakai, Masao
2016-09-29
The simultaneous extraction of host plant DNA severely limits investigations of the community structures of plant-associated fungi due to the similar homologies of sequences in primer-annealing positions between fungi and host plants. Although fungal-specific primers have been designed, plant DNA continues to be excessively amplified by PCR, resulting in the underestimation of community structures. In order to overcome this limitation, locked nucleic acid (LNA) primers and PCR clamping by LNA oligonucleotides have been applied to enhance the amplification of fungal internal transcribed spacer (ITS) regions. LNA primers were designed by converting DNA into LNA, which is specific to fungi, at the forward primer side. LNA oligonucleotides, the sequences of which are complementary to the host plants, were designed by overlapping a few bases with the annealing position of the reverse primer. Plant-specific DNA was then converted into LNA at the shifted position from the 3' end of the primer-binding position. PCR using the LNA technique enhanced the amplification of fungal ITS regions, whereas those of the host plants were more likely to be amplified without the LNA technique. A denaturing gradient gel electrophoresis (DGGE) analysis displayed patterns that reached an acceptable level for investigating the community structures of plant-associated fungi using the LNA technique. The sequences of the bands detected using the LNA technique were mostly affiliated with known isolates. However, some sequences showed low similarities, indicating the potential to identify novel fungi. Thus, the application of the LNA technique is considered effective for widening the scope of community analyses of plant-associated fungi.
Li, Caijuan; Ling, Qufei; Ge, Chen; Ye, Zhuqing; Han, Xiaofei
2015-02-25
The large-scale loach (Paramisgurnus dabryanus, Cypriniformes) is a bottom-dwelling freshwater species of fish found mainly in eastern Asia. The natural germplasm resources of this important aquaculture species has been recently threatened due to overfishing and artificial propagation. The objective of this study is to obtain the first functional genomic resource and candidate molecular markers for future conservation and breeding research. Illumina paired-end sequencing generated over one hundred million reads that resulted in 71,887 assembled transcripts, with an average length of 1465bp. 42,093 (58.56%) protein-coding sequences were predicted; and 43,837 transcripts had significant matches to NCBI nonredundant protein (Nr) database. 29,389 and 14,419 transcripts were assigned into gene ontology (GO) categories and Eukaryotic Orthologous Groups (KOG), respectively. 22,102 (31.14%) transcripts were mapped to 302 KEGG pathways. In addition, 15,106 candidate SSR markers were identified, with 11,037 pairs of PCR primers designed. 400 primers pairs of SSR selected randomly were validated, of which 364 (91%) pairs of primers were able to produce PCR products. Further test with 41 loci and 20 large-scale loach specimens collected from the four largest lakes in China showed that 36 (87.8%) loci were polymorphic. The transcriptomic profile and SSR repertoire obtained in this study will facilitate population genetic studies and selective breeding of large-scale loach in the future. Copyright © 2015. Published by Elsevier B.V.
Improved PCR primers for the detection and identification of arbuscular mycorrhizal fungi.
Lee, Jaikoo; Lee, Sangsun; Young, J Peter W
2008-08-01
A set of PCR primers that should amplify all subgroups of arbuscular mycorrhizal fungi (AMF, Glomeromycota), but exclude sequences from other organisms, was designed to facilitate rapid detection and identification directly from field-grown plant roots. The small subunit rRNA gene was targeted for the new primers (AML1 and AML2) because phylogenetic relationships among the Glomeromycota are well understood for this gene. Sequence comparisons indicate that the new primers should amplify all published AMF sequences except those from Archaeospora trappei. The specificity of the new primers was tested using 23 different AMF spore morphotypes from trap cultures and Miscanthus sinensis, Glycine max and Panax ginseng roots sampled from the field. Non-AMF DNA of 14 plants, 14 Basidiomycota and 18 Ascomycota was also tested as negative controls. Sequences amplified from roots using the new primers were compared with those obtained using the established NS31 and AM1 primer combination. The new primers have much better specificity and coverage of all known AMF groups.
In Silico PCR Tools for a Fast Primer, Probe, and Advanced Searching.
Kalendar, Ruslan; Muterko, Alexandr; Shamekova, Malika; Zhambakin, Kabyl
2017-01-01
The polymerase chain reaction (PCR) is fundamental to molecular biology and is the most important practical molecular technique for the research laboratory. The principle of this technique has been further used and applied in plenty of other simple or complex nucleic acid amplification technologies (NAAT). In parallel to laboratory "wet bench" experiments for nucleic acid amplification technologies, in silico or virtual (bioinformatics) approaches have been developed, among which in silico PCR analysis. In silico NAAT analysis is a useful and efficient complementary method to ensure the specificity of primers or probes for an extensive range of PCR applications from homology gene discovery, molecular diagnosis, DNA fingerprinting, and repeat searching. Predicting sensitivity and specificity of primers and probes requires a search to determine whether they match a database with an optimal number of mismatches, similarity, and stability. In the development of in silico bioinformatics tools for nucleic acid amplification technologies, the prospects for the development of new NAAT or similar approaches should be taken into account, including forward-looking and comprehensive analysis that is not limited to only one PCR technique variant. The software FastPCR and the online Java web tool are integrated tools for in silico PCR of linear and circular DNA, multiple primer or probe searches in large or small databases and for advanced search. These tools are suitable for processing of batch files that are essential for automation when working with large amounts of data. The FastPCR software is available for download at http://primerdigital.com/fastpcr.html and the online Java version at http://primerdigital.com/tools/pcr.html .
Ghedira, Rim; Papazova, Nina; Vuylsteke, Marnik; Ruttink, Tom; Taverniers, Isabel; De Loose, Marc
2009-10-28
GMO quantification, based on real-time PCR, relies on the amplification of an event-specific transgene assay and a species-specific reference assay. The uniformity of the nucleotide sequences targeted by both assays across various transgenic varieties is an important prerequisite for correct quantification. Single nucleotide polymorphisms (SNPs) frequently occur in the maize genome and might lead to nucleotide variation in regions used to design primers and probes for reference assays. Further, they may affect the annealing of the primer to the template and reduce the efficiency of DNA amplification. We assessed the effect of a minor DNA template modification, such as a single base pair mismatch in the primer attachment site, on real-time PCR quantification. A model system was used based on the introduction of artificial mismatches between the forward primer and the DNA template in the reference assay targeting the maize starch synthase (SSIIb) gene. The results show that the presence of a mismatch between the primer and the DNA template causes partial to complete failure of the amplification of the initial DNA template depending on the type and location of the nucleotide mismatch. With this study, we show that the presence of a primer/template mismatch affects the estimated total DNA quantity to a varying degree.
Detection of small number of Giardia in biological materials prepared from stray dogs.
Esmailikia, Leila; Ebrahimzade, Elahe; Shayan, Parviz; Amininia, Narges
2017-12-20
Giardia lamblia is an intestinal protozoa with intermittent and low shedding especially in dogs, and the detection of Giardia is accompanied with problems such as sampling and diagnostic method. The objective of this study was to detection of Giardia in biological materials with low number of parasite using parasitological and molecular methods, and also to determine whether the examined stray dogs harbor known zoonotic genotype of Giardia. For this aim 85 fecal and duodenal samples were studied from which 1 was positive by Trichrome staining of stool, 4 were positive by staining of duodenal samples. The nested PCR analysis with primers derived from 18 SrRNA showed that the specific PCR product could be amplified in 4 stool and 4 duodenal samples. All positive samples in staining analysis were also positive in nested PCR. No amplification could be observed by nested PCR with primers derived from β giardin gene due to the single copy of gene. Interestingly, the extracted DNA from old fixed stained Giardia positive smears could be also amplified with primers derived from 18SrRNA gene. The sequence analysis of nested PCR products showed that they belong to the genotype D. In conclusion, it is to denote that the Trichrome or Giemsa methods were not suitable for the detection of small number of this parasite in stool and the nested PCR with primers derived from 18S rRNA gene can replace the traditional methods successfully. For detection of Giardia in stool, primers derived from β giardin will not be recommended.
Mahmood, Shahid; Freitag, Thomas E; Prosser, James I
2006-06-01
PCR-based techniques are commonly used to characterize microbial communities, but are subject to bias that is difficult to assess. This study aimed to evaluate bias of several PCR primer-based strategies used to study diversity of autotrophic ammonia oxidizers. 16S rRNA genes from soil- or sediment-DNA were amplified using primers considered either selective or specific for betaproteobacterial ammonia oxidizers. Five approaches were assessed: (a) amplification with primers betaAMO143f-betaAMO1315r; (b) amplification with primers CTO189f-CTO654r; (c) nested amplification with betaAMO143f-betaAMO1315r followed by CTO189f-CTO654r primers; (d) nested amplification with betaAMO143f-betaAMO1315r and CTO189f-Pf1053r primers; (e) nested amplification with 27f-1492r and CTO189f-CTO654r primers. Amplification products were characterized by denaturing gradient gel electrophoresis (DGGE) analysis after further amplification with 357f-GC-518r primers. DGGE profiles of soil communities were heterogeneous and depended on the approach followed. Ammonia oxidizer diversity was higher using approaches (b), (c) and (e) than using (a) and (d), where sequences of the most prominent bands showed similarities to nonammonia oxidizers. Profiles from marine sediments were more consistent, regardless of the approach adopted, and sequence analysis of excised bands indicated that these consisted of ammonia oxidizers only. The study demonstrates the importance of choice of primer, of screening for sequences of nontarget organisms and use of several approaches when characterizing microbial communities in natural environments.
Locus-specific oligonucleotide probes increase the usefulness of inter-Alu polymorphisms
DOE Office of Scientific and Technical Information (OSTI.GOV)
Jarnik, M.; Tang, J.Q.; Korab-Laskowska, M.
1994-09-01
Most of the mapping approaches are based on single-locus codominant markers of known location. Their multiplex ratio, defined as the number of loci that can be simultaneously tested, is typically one. An increased multiplex ratio was obtained by typing anonymous polymorphisms using PCR primers anchored in ubiquitous Alu-repeats. These so called alumorphs are revealed by inter-Alu-PCR and seen as the presence or absence of an amplified band of a given length. We decided to map alumorphs and to develop locus-specific oligonucleotide (LSO) probes to facilitate their use and transfer among different laboratories. We studied the segregation of alumorphs in eightmore » CEPH families, using two distinct Alu-primers, both directing PCR between the repeats in a tail-to-tail orientation. The segregating bands were assigned to chromosomal locations by two-point linkage analysis with CEPH markers (V6.0). They were excised from dried gels, reamplified, cloned and sequenced. The resulting LSOs were used as hybridization probes (i) to confirm chromosomal assignments in a human/hamster somatic cell hybrid panel, and (ii) to group certain allelic length variants, originally coded as separate dominant markres, into more informative codominant loci. These codominants were then placed by multipoint analysis on a microsatellite Genethon map. Finally, the LSO probes were used as polymorphic STSs, to identify by hybridization the corresponding markers among products of inter-Alu-PCR. The use of LSOs converts alumorphs into a system of non-anonymous, often multiallelic codominant markes which can be simultaneously typed, thus achieving the goal of high multiplex ratio.« less
FUNGAL BIOGEOGRAPHY. Response to Comment on "Global diversity and geography of soil fungi".
Tedersoo, Leho; Bahram, Mohammad; Põlme, Sergei; Anslan, Sten; Riit, Taavi; Kõljalg, Urmas; Nilsson, R Henrik; Hildebrand, Falk; Abarenkov, Kessy
2015-08-28
Schadt and Rosling (Technical Comment, 26 June 2015, p. 1438) argue that primer-template mismatches neglected the fungal class Archaeorhizomycetes in a global soil survey. Amplicon-based metabarcoding of nine barcode-primer pair combinations and polymerase chain reaction (PCR)-free shotgun metagenomics revealed that barcode and primer choice and PCR bias drive the diversity and composition of microorganisms in general, but the Archaeorhizomycetes were little affected in the global study. We urge that careful choice of DNA markers and primers is essential for ecological studies using high-throughput sequencing for identification. Copyright © 2015, American Association for the Advancement of Science.
Typing of mutans streptococci by arbitrarily primed polymerase chain reaction.
Saarela, M; Hannula, J; Mättö, J; Asikainen, S; Alaluusua, S
1996-01-01
The discriminative power of the arbitrarily primed polymerase chain reaction (AP-PCR) in differentiating between Streptococcus mutans and Strep. sobrinus species, serotypes and clones was investigated. Mutans streptococcal isolates (12(7)) obtained from 65 individuals (1-10 isolates per individual) were AP-PCR typed separately with two random primers, OPA-05 and OPA-13. Bacterial cell lysates were used as a template in PCR reactions, which made AP-PCR easy and fast to perform. Eighty-one isolates from 19 individuals were also ribotyped to compare the discriminative ability of ribotyping and AP-PCR techniques. AP-PCR performed with the two primers differentiated between Strep. mutans and Strep. sobrinus isolates, but neither primer detected serotype-specific amplification products. OPA-05 distinguished two main AP-PCR patterns among Strep. mutans isolates and one main pattern among Strep. sobrinus isolates, whereas OPA-13 found one main AP-PCR pattern among Strep. mutans isolates and two main patterns among Strep. sobrinus isolates. Ribotyping and AP-PCR revealed 40 and 33 different types among 81 selected isolates, respectively. Both techniques detected intra-individual heterogeneity in 16 out of 19 participants. The results indicate that AP-PCR has good discriminative ability in differentiating between mutans streptococcal clones and that the technique is suitable for epidemiological studies on mutans streptococci.
Krüger, Manuela; Stockinger, Herbert; Krüger, Claudia; Schüssler, Arthur
2009-01-01
* At present, molecular ecological studies of arbuscular mycorrhizal fungi (AMF) are only possible above species level when targeting entire communities. To improve molecular species characterization and to allow species level community analyses in the field, a set of newly designed AMF specific PCR primers was successfully tested. * Nuclear rDNA fragments from diverse phylogenetic AMF lineages were sequenced and analysed to design four primer mixtures, each targeting one binding site in the small subunit (SSU) or large subunit (LSU) rDNA. To allow species resolution, they span a fragment covering the partial SSU, whole internal transcribed spacer (ITS) rDNA region and partial LSU. * The new primers are suitable for specifically amplifying AMF rDNA from material that may be contaminated by other organisms (e.g., samples from pot cultures or the field), characterizing the diversity of AMF species from field samples, and amplifying a SSU-ITS-LSU fragment that allows phylogenetic analyses with species level resolution. * The PCR primers can be used to monitor entire AMF field communities, based on a single rDNA marker region. Their application will improve the base for deep sequencing approaches; moreover, they can be efficiently used as DNA barcoding primers.
Constructing STR multiplex assays.
Butler, John M
2005-01-01
Multiplex polymerase chain reaction (PCR) refers to the simultaneous amplification of multiple regions of deoxyribonucleic acid (DNA) using PCR. Commercial short tandem repeat (STR) assays that can coamplify as many as 16 different loci have become widely used in forensic DNA typing. This chapter will focus on some of the aspects of constructing robust STR multiplex assays, including careful design and quality control of PCR primers. Examples from the development of a cat STR 12plex and a human Y chromosome STR 20plex are used to illustrate the importance of various parts of the protocol. Primer design parameters and Internet-accessible resources are discussed, as are solutions to problems with residual dye artifacts that result from impure primers.
A multiple-alignment based primer design algorithm for genetically highly variable DNA targets
2013-01-01
Background Primer design for highly variable DNA sequences is difficult, and experimental success requires attention to many interacting constraints. The advent of next-generation sequencing methods allows the investigation of rare variants otherwise hidden deep in large populations, but requires attention to population diversity and primer localization in relatively conserved regions, in addition to recognized constraints typically considered in primer design. Results Design constraints include degenerate sites to maximize population coverage, matching of melting temperatures, optimizing de novo sequence length, finding optimal bio-barcodes to allow efficient downstream analyses, and minimizing risk of dimerization. To facilitate primer design addressing these and other constraints, we created a novel computer program (PrimerDesign) that automates this complex procedure. We show its powers and limitations and give examples of successful designs for the analysis of HIV-1 populations. Conclusions PrimerDesign is useful for researchers who want to design DNA primers and probes for analyzing highly variable DNA populations. It can be used to design primers for PCR, RT-PCR, Sanger sequencing, next-generation sequencing, and other experimental protocols targeting highly variable DNA samples. PMID:23965160
DNA polymerase preference determines PCR priming efficiency.
Pan, Wenjing; Byrne-Steele, Miranda; Wang, Chunlin; Lu, Stanley; Clemmons, Scott; Zahorchak, Robert J; Han, Jian
2014-01-30
Polymerase chain reaction (PCR) is one of the most important developments in modern biotechnology. However, PCR is known to introduce biases, especially during multiplex reactions. Recent studies have implicated the DNA polymerase as the primary source of bias, particularly initiation of polymerization on the template strand. In our study, amplification from a synthetic library containing a 12 nucleotide random portion was used to provide an in-depth characterization of DNA polymerase priming bias. The synthetic library was amplified with three commercially available DNA polymerases using an anchored primer with a random 3' hexamer end. After normalization, the next generation sequencing (NGS) results of the amplified libraries were directly compared to the unamplified synthetic library. Here, high throughput sequencing was used to systematically demonstrate and characterize DNA polymerase priming bias. We demonstrate that certain sequence motifs are preferred over others as primers where the six nucleotide sequences at the 3' end of the primer, as well as the sequences four base pairs downstream of the priming site, may influence priming efficiencies. DNA polymerases in the same family from two different commercial vendors prefer similar motifs, while another commercially available enzyme from a different DNA polymerase family prefers different motifs. Furthermore, the preferred priming motifs are GC-rich. The DNA polymerase preference for certain sequence motifs was verified by amplification from single-primer templates. We incorporated the observed DNA polymerase preference into a primer-design program that guides the placement of the primer to an optimal location on the template. DNA polymerase priming bias was characterized using a synthetic library amplification system and NGS. The characterization of DNA polymerase priming bias was then utilized to guide the primer-design process and demonstrate varying amplification efficiencies among three commercially available DNA polymerases. The results suggest that the interaction of the DNA polymerase with the primer:template junction during the initiation of DNA polymerization is very important in terms of overall amplification bias and has broader implications for both the primer design process and multiplex PCR.
Multiplex real-time PCR assays for the identification of the potato cyst and tobacco cyst nematodes
USDA-ARS?s Scientific Manuscript database
TaqMan primer-probe sets were developed for the detection and identification of potato cyst nematodes (PCN) Globodera pallida and G. rostochiensis using two-tube, multiplex real-time PCR. One tube contained a primer-probe set specific for G. pallida (pale cyst nematode) multiplexed with another prim...
Investigation of Seminal Plasma Hypersensitivity Reactions (AIBS GWI 0046)
1999-10-01
Kit (Cat. No. 29304). The sequences for the 20-mer PCR primers for the urease gene off/, urealyticum (termed UU1 and UU2) and PCR methods were adapted...Ureaplasma urealyticum urease primer was unsuccessful. We therefore sent DNA samples of GW and control civilian couples to an outside laboratory to
NASA Astrophysics Data System (ADS)
Christensen, G. A.; Wymore, A. M.; King, A. J.; Podar, M.; Hurt, R. A., Jr.; Santillan, E. F. U.; Gilmour, C. C.; Brandt, C. C.; Brown, S. D.; Palumbo, A. V.; Elias, D. A.
2015-12-01
Two proteins (HgcA and HgcB) have been determined to be essential for mercury (Hg)-methylation and either one alone is not sufficient for this process. Detection and quantification of these genes to determine at risk environments is critical. Universal degenerate polymerase chain reaction (PCR) primers spanning hgcAB were developed to ascertain organismal diversity and validate that both genes were present as an established prerequisite for Hg-methylation. To confirm this approach, an extensive set of pure cultures with published genomes (including methylators and non-methylators: 13 Deltaproteobacteria, 9 Firmicutes, and 10 methanogenic Archaea) were assayed with the newly designed universal hgcAB primer set. A single band within an agarose gel was observed for the majority of the cultures with known hgcAB and confirmed via Sanger sequencing. For environmental applications, once the potential for Hg-methylation is established from PCR amplification with the universal hgcAB primer set, quantification of clade-specific hgcAB gene abundance is desirable. We developed quantitative polymerase chain reaction (qPCR) degenerate primers targeting hgcA from each of the three dominate clades (Deltaproteobacteria, Firmicutes and methanogenic Archaea) known to be associated with anaerobic Hg-methylation. The qPCR primers amplify virtually all hgcA positive cultures overall and are specific for their designed clade. Finally, to ensure the procedure is robust and sensitive in complex environmental matrices, cells from all clades were mixed in different combinations and ratios to assess qPCR primer specificity. The development and validation of these high fidelity quantitative molecular tools now allows for rapid and accurate risk management assessment in any environment.
Assessment of DNA Contamination in RNA Samples Based on Ribosomal DNA
Hashemipetroudi, Seyyed Hamidreza; Nematzadeh, Ghorbanali; Ahmadian, Gholamreza; Yamchi, Ahad; Kuhlmann, Markus
2018-01-01
One method extensively used for the quantification of gene expression changes and transcript abundances is reverse-transcription quantitative real-time PCR (RT-qPCR). It provides accurate, sensitive, reliable, and reproducible results. Several factors can affect the sensitivity and specificity of RT-qPCR. Residual genomic DNA (gDNA) contaminating RNA samples is one of them. In gene expression analysis, non-specific amplification due to gDNA contamination will overestimate the abundance of transcript levels and can affect the RT-qPCR results. Generally, gDNA is detected by qRT-PCR using primer pairs annealing to intergenic regions or an intron of the gene of interest. Unfortunately, intron/exon annotations are not yet known for all genes from vertebrate, bacteria, protist, fungi, plant, and invertebrate metazoan species. Here we present a protocol for detection of gDNA contamination in RNA samples by using ribosomal DNA (rDNA)-based primers. The method is based on the unique features of rDNA: their multigene nature, highly conserved sequences, and high frequency in the genome. Also as a case study, a unique set of primers were designed based on the conserved region of ribosomal DNA (rDNA) in the Poaceae family. The universality of these primer pairs was tested by melt curve analysis and agarose gel electrophoresis. Although our method explains how rDNA-based primers can be applied for the gDNA contamination assay in the Poaceae family, it could be easily used to other prokaryote and eukaryote species PMID:29443017
Liébana, Susana; Brandão, Delfina; Cortés, Pilar; Campoy, Susana; Alegret, Salvador; Pividori, María Isabel
2016-01-21
A magneto-genosensing approach for the detection of the three most common pathogenic bacteria in food safety, such as Salmonella, Listeria and Escherichia coli is presented. The methodology is based on the detection of the tagged amplified DNA obtained by single-tagging PCR with a set of specific primers for each pathogen, followed by electrochemical magneto-genosensing on silica magnetic particles. A set of primers were selected for the amplification of the invA (278 bp), prfA (217 bp) and eaeA (151 bp) being one of the primers for each set tagged with fluorescein, biotin and digoxigenin coding for Salmonella enterica, Listeria monocytogenes and E. coli, respectively. The single-tagged amplicons were then immobilized on silica MPs based on the nucleic acid-binding properties of silica particles in the presence of the chaotropic agent as guanidinium thiocyanate. The assessment of the silica MPs as a platform for electrochemical magneto-genosensing is described, including the main parameters to selectively attach longer dsDNA fragments instead of shorter ssDNA primers based on their negative charge density of the sugar-phosphate backbone. This approach resulted to be a promising detection tool with sensing features of rapidity and sensitivity very suitable to be implemented on DNA biosensors and microfluidic platforms. Copyright © 2015 Elsevier B.V. All rights reserved.
Peková, Sona; Marková, Jana; Pajer, Petr; Dvorák, Michal; Cetkovský, Petr; Schwarz, Jirí
2005-01-01
Patients with chronic lymphocytic leukemia (CLL) can relapse even after aggressive therapy and autografts. It is commonly assumed that to prevent relapse the level of minimal residual disease (MRD) should be as low as possible. To evaluate MRD, highly sensitive quantitative assays are needed. The aim of the study was to develop a robust and sensitive method for detection of the clonal immunoglobulin heavy-chain variable (IgV(H)) rearrangement in CLL and to introduce a highly sensitive and specific methodology for MRD monitoring in patients with CLL who undergo intensive treatment. As a prerequisite for MRD detection, touch-down reverse transcriptase (RT)-PCR using degenerate primers were used for the diagnostic identification of (H) gene rearrangement(s). For quantitative MRD detection in 18 patients, we employed a real-time RT-PCR assay (RQ-PCR) making use of patient-specific primers and the cost-saving Sybr-Green reporter dye (SG). For precise calibration of RQ-PCR, patient-specific IgV(H) sequences were cloned. Touch-down RT-PCR with degenerate primers allowed the successful detection of IgV(H) clonal rearrangement(s) in 252 of 257 (98.1%) diagnostic samples. Biallelic rearrangements were found in 27 of 252 (10.7%) cases. Degenerate primers used for the identification of clonal expansion at diagnosis were not sensitive enough for MRD detection. In contrast, our RQ-PCR assay using patient-specific primers and SG reached the sensitivity of 10(-)(6). We demonstrated MRD in each patient tested, including four of four patients in complete remission following autologous hematopoietic stem cell transplantation (HSCT) and three of three following allogeneic 'mini'-HSCT. Increments in MRD might herald relapse; aggressive chemotherapy could induce molecular remission. Our touch-down RT-PCR has higher efficiency to detect clonal IgV(H) rearrangements including the biallelic ones. MRD quantitation of IgV(H) expression using SG-based RQ-PCR represents a highly specific, sensitive, and economic alternative to the current quantitative methods.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Strizhkov, B. N.; Drobyshev, A. L.; Mikhailovich, V. M.
PCR amplification on a microarray of gel-immobilized primers (microchip) has been developed. One of a pair of PCR primers was immobilized inside a separate microchip polyacrylamide porous gel pad of 0.1 x 0.1 x 0.02 (or 0.04) micron in size and 0.2 (or 0.4) nL in volume. The amplification was carried out simultaneously both in solution covering the microchip array and inside gel pads. Each gel pad contained the immobilized forward primers, while the fluorescently labeled reverse primers, as well as all components of the amplification reaction, diffused into the gel pads from the solution. To increase the amplification efficiency,more » the forward primers were also added into the solution. The kinetics of amplification was measured in real time in parallel for all gel pads with a fluorescent microscope equipped with a charge-coupled device (CCD) camera. The accuracy of the amplification was assessed by using the melting curves obtained for the duplexes formed by the labeled amplification product and the gel-immobilized primers during the amplification process; alternatively, the duplexes were produced by hybridization of the extended immobilized primers with labeled oligonucleotide probes. The on-chip amplification was applied to detect the anthrax toxin genes and the plasmid-borne beta-lactamase gene responsible for bacterial ampicillin resistance. The allele-specific type of PCR amplification was used to identify the Shiga toxin gene and discriminate it from the Shiga-like one. The genomic mutations responsible for rifampicin resistance of the Mycobacterium tuberculosis strains were detected by the same type of PCR amplification of the rpoB gene fragment isolated from sputum of tuberculosis patients. The on-chip PCR amplification has been shown to be a rapid, inexpensive and powerful tool to test genes responsible for bacterial toxin production and drug resistance, as well as to reveal point nucleotide mutations.« less
Nagashima, Shiori; Yoshida, Akihiro; Suzuki, Nao; Ansai, Toshihiro; Takehara, Tadamichi
2005-01-01
Genomic subtractive hybridization was used to design Prevotella nigrescens-specific primers and TaqMan probes. Based on this technique, a TaqMan real-time PCR assay was developed for quantifying four oral black-pigmented Prevotella species. The combination of real-time PCR and genomic subtractive hybridization is useful for preparing species-specific primer-probe sets for closely related species. PMID:15956428
Environmental metabarcodes for insects: in silico PCR reveals potential for taxonomic bias.
Clarke, Laurence J; Soubrier, Julien; Weyrich, Laura S; Cooper, Alan
2014-11-01
Studies of insect assemblages are suited to the simultaneous DNA-based identification of multiple taxa known as metabarcoding. To obtain accurate estimates of diversity, metabarcoding markers ideally possess appropriate taxonomic coverage to avoid PCR-amplification bias, as well as sufficient sequence divergence to resolve species. We used in silico PCR to compare the taxonomic coverage and resolution of newly designed insect metabarcodes (targeting 16S) with that of existing markers [16S and cytochrome oxidase c subunit I (COI)] and then compared their efficiency in vitro. Existing metabarcoding primers amplified in silico <75% of insect species with complete mitochondrial genomes available, whereas new primers targeting 16S provided >90% coverage. Furthermore, metabarcodes targeting COI appeared to introduce taxonomic PCR-amplification bias, typically amplifying a greater percentage of Lepidoptera and Diptera species, while failing to amplify certain orders in silico. To test whether bias predicted in silico was observed in vitro, we created an artificial DNA blend containing equal amounts of DNA from 14 species, representing 11 insect orders and one arachnid. We PCR-amplified the blend using five primer sets, targeting either COI or 16S, with high-throughput amplicon sequencing yielding more than 6 million reads. In vitro results typically corresponded to in silico PCR predictions, with newly designed 16S primers detecting 11 insect taxa present, thus providing equivalent or better taxonomic coverage than COI metabarcodes. Our results demonstrate that in silico PCR is a useful tool for predicting taxonomic bias in mixed template PCR and that researchers should be wary of potential bias when selecting metabarcoding markers. © 2014 John Wiley & Sons Ltd.
Identification of Erwinia species isolated from apples and pears by differential PCR.
Gehring, I; Geider, K
2012-04-01
Many pathogenic and epiphytic bacteria isolated from apples and pears belong to the genus Erwinia; these include the species E. amylovora, E. pyrifoliae, E. billingiae, E. persicina, E. rhapontici and E. tasmaniensis. Identification and classification of freshly isolated bacterial species often requires tedious taxonomic procedures. To facilitate routine identification of Erwinia species, we have developed a PCR method based on species-specific oligonucleotides (SSOs) from the sequences of the housekeeping genes recA and gpd. Using species-specific primers that we report here, differentiation was done with conventional PCR (cPCR) and quantitative PCR (qPCR) applying two consecutive primer annealing temperatures. The specificity of the primers depends on terminal Single Nucleotide Polymorphisms (SNPs) that are characteristic for the target species. These PCR assays enabled us to distinguish eight Erwinia species, as well as to identify new Erwinia isolates from plant surfaces. When performed with mixed bacterial cultures, they only detected a single target species. This method is a novel approach to classify strains within the genus Erwinia by PCR and it can be used to confirm other diagnostic data, especially when specific PCR detection methods are not already available. The method may be applied to classify species within other bacterial genera. Copyright © 2012 Elsevier B.V. All rights reserved.
Concordance of polymerase chain reaction with human immunodeficiency virus antibody detection.
Horsburgh, C R; Ou, C Y; Jason, J; Holmberg, S D; Lifson, A R; Moore, J L; Ward, J W; Seage, G R; Mayer, K H; Evatt, B L
1990-08-01
To evaluate the correlation of detection of human immunodeficiency virus (HIV) by polymerase chain reaction (PCR) with detection of HIV antibody, 271 simultaneous serum and peripheral blood mononuclear cell samples were examined from 242 persons whose activities placed them at increased risk for HIV infection: 142 from homosexual men, 86 from hemophilic men, and 43 from heterosexual partners of HIV-infected persons. PCR was performed using the gag region primer pair SK38/39 and the env region primer pairs SK68/69 and CO71/72. Amplified HIV DNA was detected using specific oligomer probes. Of 63 HIV antibody-positive samples, 58 (92%) had HIV DNA by PCR. Of 208 HIV antibody-negative samples, 7 (3.4%) had HIV DNA by PCR. On follow-up, 4 of the latter persons were seropositive when next tested; 2 were well and antibody- and PCR-negative; 1 had died of a stroke before retesting. Thus, PCR detects HIV in most antibody-positive persons; detection is increased by use of multiple primer pairs. PCR-positive antibody-negative specimens may indicate HIV infection in which antibody has not yet developed or may be false-positive PCR results. When PCR is discordant with HIV antibody, testing of additional specimens and clinical follow-up are necessary to assess HIV infection status.
Lee, I M; Bartoszyk, I M; Gundersen, D E; Mogen, B; Davis, R E
1997-07-01
Oligonucleotide primers derived from sequences of the 16S rRNA gene (CMR16F1, CMR16R1, CMR16F2, and CMR16R2) and insertion element IS1121 of Clavibacter michiganensis subsp. sepedonicus (CMSIF1, CMSIR1, CMSIF2, and CMISR2) were used in nested PCR to detect the potato ring rot bacterium C. michiganensis subsp. sepedonicus. Nested PCR with primer pair CMSIF1-CMSIR1 followed by primer pair CMSIF2-CMSIR2 specifically detected C. michiganensis subsp. sepedonicus, while nested PCR with CMR16F1-CMR16R1 followed by CMR16F2-CMR16R2 detected C. michiganensis subsp. sepedonicus and the other C. michiganensis subspecies. In the latter case, C. michiganensis subsp. sepedonicus can be differentiated from the other subspecies by restriction fragment length polymorphism (RFLP) analyses of the nested PCR products (16S rDNA sequences). The nested PCR assays developed in this work allow ultrasensitive detection of very low titers of C. michiganensis subsp. sepedonicus which may be present in symptomiess potato plants or tubers and which cannot be readily detected by direct PCR (single PCR amplification). RFLP analysis of PCR products provides for an unambiguous confirmation of the identify of C. michiganensis subsp. sepedonicus.
Ito, Takao; Suzaki, Koichi
2017-01-01
Phytoplasmas and Xylella spp. are bacteria that cause many economically important plant diseases worldwide. TaqMan probe-based quantitative real-time polymerase chain reaction (qPCR) assays have been utilized to universally detect phytoplasmas or Xylella fastidiosa. To develop a superior universal qPCR method, we used a dual priming oligonucleotide (DPO) with two annealing sites as a reverse primer to target the well-conserved bacterial 16S rDNA. The new qPCR assays universally detected various species of phytoplasmas and subspecies of X. fastidiosa as well as Xylella taiwanensis, and generally showed superior threshold cycle values when amplifying specific or non-specific products compared to current universal qPCR assays. The proposed qPCR assays were integrated to develop a multiplex qPCR assay that simultaneously detected phytoplasmas, Xylella spp., and an internal plant DNA positive control within 1 hour. This assay could detect a minimum of ten bacterial cells and was compatible with crude extractions used in the rapid screening of various plants. The amplicons were of sufficient lengths to be directly sequenced for preliminary identification, and the primers could be used in universal conventional PCR assays. Additionally, reverse DPO primers can be utilized to improve other probe-based qPCR assays.
Quantitative Real-Time PCR using the Thermo Scientific Solaris qPCR Assay
Ogrean, Christy; Jackson, Ben; Covino, James
2010-01-01
The Solaris qPCR Gene Expression Assay is a novel type of primer/probe set, designed to simplify the qPCR process while maintaining the sensitivity and accuracy of the assay. These primer/probe sets are pre-designed to >98% of the human and mouse genomes and feature significant improvements from previously available technologies. These improvements were made possible by virtue of a novel design algorithm, developed by Thermo Scientific bioinformatics experts. Several convenient features have been incorporated into the Solaris qPCR Assay to streamline the process of performing quantitative real-time PCR. First, the protocol is similar to commonly employed alternatives, so the methods used during qPCR are likely to be familiar. Second, the master mix is blue, which makes setting the qPCR reactions easier to track. Third, the thermal cycling conditions are the same for all assays (genes), making it possible to run many samples at a time and reducing the potential for error. Finally, the probe and primer sequence information are provided, simplifying the publication process. Here, we demonstrate how to obtain the appropriate Solaris reagents using the GENEius product search feature found on the ordering web site (www.thermo.com/solaris) and how to use the Solaris reagents for performing qPCR using the standard curve method. PMID:20567213
Suzaki, Koichi
2017-01-01
Phytoplasmas and Xylella spp. are bacteria that cause many economically important plant diseases worldwide. TaqMan probe-based quantitative real-time polymerase chain reaction (qPCR) assays have been utilized to universally detect phytoplasmas or Xylella fastidiosa. To develop a superior universal qPCR method, we used a dual priming oligonucleotide (DPO) with two annealing sites as a reverse primer to target the well-conserved bacterial 16S rDNA. The new qPCR assays universally detected various species of phytoplasmas and subspecies of X. fastidiosa as well as Xylella taiwanensis, and generally showed superior threshold cycle values when amplifying specific or non-specific products compared to current universal qPCR assays. The proposed qPCR assays were integrated to develop a multiplex qPCR assay that simultaneously detected phytoplasmas, Xylella spp., and an internal plant DNA positive control within 1 hour. This assay could detect a minimum of ten bacterial cells and was compatible with crude extractions used in the rapid screening of various plants. The amplicons were of sufficient lengths to be directly sequenced for preliminary identification, and the primers could be used in universal conventional PCR assays. Additionally, reverse DPO primers can be utilized to improve other probe-based qPCR assays. PMID:28957362
Simple sequence repeat marker loci discovery using SSR primer.
Robinson, Andrew J; Love, Christopher G; Batley, Jacqueline; Barker, Gary; Edwards, David
2004-06-12
Simple sequence repeats (SSRs) have become important molecular markers for a broad range of applications, such as genome mapping and characterization, phenotype mapping, marker assisted selection of crop plants and a range of molecular ecology and diversity studies. With the increase in the availability of DNA sequence information, an automated process to identify and design PCR primers for amplification of SSR loci would be a useful tool in plant breeding programs. We report an application that integrates SPUTNIK, an SSR repeat finder, with Primer3, a PCR primer design program, into one pipeline tool, SSR Primer. On submission of multiple FASTA formatted sequences, the script screens each sequence for SSRs using SPUTNIK. The results are parsed to Primer3 for locus-specific primer design. The script makes use of a Web-based interface, enabling remote use. This program has been written in PERL and is freely available for non-commercial users by request from the authors. The Web-based version may be accessed at http://hornbill.cspp.latrobe.edu.au/
Properties of targeted preamplification in DNA and cDNA quantification.
Andersson, Daniel; Akrap, Nina; Svec, David; Godfrey, Tony E; Kubista, Mikael; Landberg, Göran; Ståhlberg, Anders
2015-01-01
Quantification of small molecule numbers often requires preamplification to generate enough copies for accurate downstream enumerations. Here, we studied experimental parameters in targeted preamplification and their effects on downstream quantitative real-time PCR (qPCR). To evaluate different strategies, we monitored the preamplification reaction in real-time using SYBR Green detection chemistry followed by melting curve analysis. Furthermore, individual targets were evaluated by qPCR. The preamplification reaction performed best when a large number of primer pairs was included in the primer pool. In addition, preamplification efficiency, reproducibility and specificity were found to depend on the number of template molecules present, primer concentration, annealing time and annealing temperature. The amount of nonspecific PCR products could also be reduced about 1000-fold using bovine serum albumin, glycerol and formamide in the preamplification. On the basis of our findings, we provide recommendations how to perform robust and highly accurate targeted preamplification in combination with qPCR or next-generation sequencing.
Identification of hare meat by a species-specific marker of mitochondrial origin.
Santos, Cristina G; Melo, Vitor S; Amaral, Joana S; Estevinho, Letícia; Oliveira, M Beatriz P P; Mafra, Isabel
2012-03-01
Meat species identification in food has gained increasing interest in recent years due to public health, economic and legal concerns. Following the consumer trend towards high quality products, game meat has earned much attention. The aim of the present work was to develop a DNA-based technique able to identify hare meat. Mitochondrial cytochrome b gene was used to design species-specific primers for hare detection. The new primers proved to be highly specific to Lepus species, allowing the detection of 0.01% of hare meat in pork meat by polymerase chain reaction (PCR). A real-time PCR assay with the new intercalating EvaGreen dye was further proposed as a specific and fast tool for hare identification with increased sensitivity (1pg) compared to end-point PCR (10pg). It can be concluded that the proposed new primers can be used by both species-specific end-point PCR or real-time PCR to accurately authenticate hare meat. Copyright © 2011 Elsevier Ltd. All rights reserved.
Ballard, S A; Grabsch, E A; Johnson, P D R; Grayson, M L
2005-01-01
We assessed the sensitivities and specificities of three previously described PCR primers on enrichment broth cultures of feces for the accurate detection of fecal carriage of vancomycin-resistant enterococci (VRE). In addition, we investigated specimens that were vanB PCR positive but VRE culture negative for the presence of other vanB-containing pathogens. Feces from 59 patients (12 patients carrying vanB Enterococcus faecium strains and 47 patients negative for VRE carriage) were cultured for 36 h in aerobic brain heart infusion (BHI) broth, anaerobic BHI (AnO(2)BHI) broth, or aerobic Enterococcosel (EC) broth. DNA was extracted from the cultures and tested for the presence of vanB by using the PCR primers of Dutka-Malen et al. (S. Dutka-Malen, S. Evers, and P. Courvalin, J. Clin. Microbiol. 33:24-27, 1995), Bell et al. (J. M. Bell, J. C. Paton, and J. Turnidge, J. Clin. Microbiol. 36:2187-2190, 1998), and Stinear et al. (T. P. Stinear, D. C. Olden, P. D. R. Johnson, J. K. Davies, and M. L. Grayson, Lancet 357:855-856, 2001). The sensitivity (specificity) of PCR compared with the results of culture on BHI, AnO(2)BHI, and EC broths were 67% (96%), 50% (94%), and 17% (100%), respectively, with the primers of Dutka-Malen et al.; 92% (60%), 92% (45%), and 92% (83%), respectively, with the primers of Bell et al.; and 92% (49%), 92% (43%), and 100% (51%) respectively, with the primers of Stinear et al. The primers of both Bell et al. and Stinear et al. were significantly more sensitive than those of Dutka-Malen et al. in EC broth (P = 0.001 and P < 0.001, respectively). The poor specificities for all primer pairs were due in part to the isolation and identification of six anaerobic gram-positive bacilli, Clostridium hathewayi (n = 3), a Clostridium innocuum-like organism (n = 1), Clostridium bolteae (n = 1), and Ruminococcus lactaris-like (n = 1), from five fecal specimens that were vanB positive but VRE culture negative. All six organisms were demonstrated to contain a vanB gene identical to that of VRE. VanB-containing bowel anaerobes may result in false-positive interpretation of PCR-positive fecal enrichment cultures as VRE, regardless of the primers and protocols used.
Cerón, J; Ortíz, A; Quintero, R; Güereca, L; Bravo, A
1995-01-01
In this paper we describe a PCR strategy that can be used to rapidly identify Bacillus thuringiensis strains that harbor any of the known cryI or cryIII genes. Four general PCR primers which amplify DNA fragments from the known cryI or cryIII genes were selected from conserved regions. Once a strain was identified as an organism that contains a particular type of cry gene, it could be easily characterized by performing additional PCR with specific cryI and cryIII primers selected from variable regions. The method described in this paper can be used to identify the 10 different cryI genes and the five different cryIII genes. One feature of this screening method is that each cry gene is expected to produce a PCR product having a precise molecular weight. The genes which produce PCR products having different sizes probably represent strains that harbor a potentially novel cry gene. Finally, we present evidence that novel crystal genes can be identified by the method described in this paper. PMID:8526493
Cui, Yanyan; Zhang, Yan; Jian, Fuchun; Zhang, Longxian; Wang, Rongjun; Cao, Shuxuan; Wang, Xiaoxing; Yan, Yaqun; Ning, Changshen
2017-05-01
Theileria spp. and Anaplasma spp., which are important tick-borne pathogens (TBPs), impact the health of humans and animals in tropical and subtropical areas. Theileria and Anaplasma co-infections are common in sheep and goats. Following alignment of the relevant DNA sequences, two primer sets were designed to specifically target the Theileria spp. 18S rRNA and Anaplasma spp. 16S rRNA gene sequences. Genomic DNA from the two genera was serially diluted tenfold for testing the sensitivities of detection of the primer sets. The specificities of the primer sets were confirmed when DNA from Anaplasma and Theileria (positive controls), other related hematoparasites (negative controls) and ddH 2 O were used as templates. Fifty field samples were also used to evaluate the utility of single PCR and duplex PCR assays, and the detection results were compared with those of the PCR methods previously published. An optimized duplex PCR assay was established from the two primer sets based on the relevant genes from the two TBPs, and this assay generated products of 298-bp (Theileria spp.) and 139-bp (Anaplasma spp.). The detection limit of the assay was 29.4 × 10 -3 ng per μl, and there was no cross-reaction with the DNA from other hematoparasites. The results showed that the newly developed duplex PCR assay had an efficiency of detection (P > 0.05) similar to other published PCR methods. In this study, a duplex PCR assay was developed that can simultaneously identify Theileria spp. and Anaplasma spp. in sheep and goats. This duplex PCR is a potentially valuable assay for epidemiological studies of TBPs in that it can detect cases of mixed infections of the pathogens. Copyright © 2017 Elsevier Inc. All rights reserved.
Aradaib, Imadeldin E; Majid, Ali A
2006-01-01
A nested polymerase chain reaction (nPCR)-based assay, was developed and evaluated for rapid detection of Trypanosoma evansi in experimentally infected mice and naturally infected camels (Camelus dromedarius). Four oligonucleotide primers (TE1, TE2, TE3 and TE4), selected from nuclear repetitive gene of T. evansi, were designed and used for PCR amplifications. The first amplification, using a pair of outer primers TE1 and TE2, produced a 821-bp primary PCR product from T. evansi DNA. The second amplification, using nested (internal) pair of primers TE3 and TE4, produced a 270-bp PCR product. T. evansi DNAs extracted from blood samples of experimentally infected mice and naturally infected Sudanese breed of dromedary camels were detected by this nested PCR-based assay. The nested primers TE3 and TE4 increased the sensitivity of the PCR assay and as little as 10 fg of T. evansi DNA (equivalent to a single copy of the putative gene of the parasite) was amplified and visualized onto ethidium bromide-stained agarose gels. Amplification products were not detected when the PCR-based assay was applied to DNA from other blood parasites including Thieleria annulata, Babesia bigemina or nucleic acid free samples. Application of this nPCR-based assay to clinical samples resulted in direct detection of T. evansi from a variety of tissue samples collected from experimentally infected mice and blood from naturally infected camels. The described nPCR-based assay provides a valuable tool to study the epidemiology of T. evansi infection in camels and other susceptible animal populations. PMID:16712737
Zongze, Zhang; Xin, Yang; Awais, Ali Ahmad; Weiqiang, Lei; Chunqun, Wang; Di, Wenda; Yanqin, Zhou; Junlong, Zhao; Rui, Fang; Min, Hu
2018-03-15
The tetra-primer ARMS-PCR is a rapid, simple and low cost method for single nucleotide polymorphism (SNP) genotyping and has been used to detect SNPs associated with diseases and drug resistance. E198A in the isotype-1 β-tubulin gene is one of the three SNPs associated with benzimidazole resistance in parasitic nematode Haemonchus contortus. However, up to now, only PCR-RFLP method was used to test E198A in H. contortus. In the present study, we developed a tetra-primer ARMS-PCR to detect E198A in H. contortus and the accuracy of the results was compared with that of PCR-coupled sequencing. The results showed that optimization of PCR reaction system, especially the proportion of the amount of inner and outer primers, could achieve desirable amplification effect. Three different profiles displaying three distinct genotypes could be identified clearly and intuitively on the agarose gel where the samples with amplified PCR products containing two bands of 433 bp and 200 bp in size indicated susceptible homozygous (SS), those with PCR products containing two bands of 433 bp and 284 bp in length indicated resistant homozygous (RR) and the samples with amplified PCR products containing three bands of 433 bp, 284 bp and 200 bp in size indicated heterozygous (RS). The results showed that the established method can be successfully applied to the detection of E198A in H. contortus, which has high accuracy and is easy to perform. Copyright © 2018 Elsevier B.V. All rights reserved.
MIPE: A metagenome-based community structure explorer and SSU primer evaluation tool
Zhou, Quan
2017-01-01
An understanding of microbial community structure is an important issue in the field of molecular ecology. The traditional molecular method involves amplification of small subunit ribosomal RNA (SSU rRNA) genes by polymerase chain reaction (PCR). However, PCR-based amplicon approaches are affected by primer bias and chimeras. With the development of high-throughput sequencing technology, unbiased SSU rRNA gene sequences can be mined from shotgun sequencing-based metagenomic or metatranscriptomic datasets to obtain a reflection of the microbial community structure in specific types of environment and to evaluate SSU primers. However, the use of short reads obtained through next-generation sequencing for primer evaluation has not been well resolved. The software MIPE (MIcrobiota metagenome Primer Explorer) was developed to adapt numerous short reads from metagenomes and metatranscriptomes. Using metagenomic or metatranscriptomic datasets as input, MIPE extracts and aligns rRNA to reveal detailed information on microbial composition and evaluate SSU rRNA primers. A mock dataset, a real Metagenomics Rapid Annotation using Subsystem Technology (MG-RAST) test dataset, two PrimerProspector test datasets and a real metatranscriptomic dataset were used to validate MIPE. The software calls Mothur (v1.33.3) and the SILVA database (v119) for the alignment and classification of rRNA genes from a metagenome or metatranscriptome. MIPE can effectively extract shotgun rRNA reads from a metagenome or metatranscriptome and is capable of classifying these sequences and exhibiting sensitivity to different SSU rRNA PCR primers. Therefore, MIPE can be used to guide primer design for specific environmental samples. PMID:28350876
Identification of common, unique and polymorphic microsatellites among 73 cyanobacterial genomes.
Kabra, Ritika; Kapil, Aditi; Attarwala, Kherunnisa; Rai, Piyush Kant; Shanker, Asheesh
2016-04-01
Microsatellites also known as Simple Sequence Repeats are short tandem repeats of 1-6 nucleotides. These repeats are found in coding as well as non-coding regions of both prokaryotic and eukaryotic genomes and play a significant role in the study of gene regulation, genetic mapping, DNA fingerprinting and evolutionary studies. The availability of 73 complete genome sequences of cyanobacteria enabled us to mine and statistically analyze microsatellites in these genomes. The cyanobacterial microsatellites identified through bioinformatics analysis were stored in a user-friendly database named CyanoSat, which is an efficient data representation and query system designed using ASP.net. The information in CyanoSat comprises of perfect, imperfect and compound microsatellites found in coding, non-coding and coding-non-coding regions. Moreover, it contains PCR primers with 200 nucleotides long flanking region. The mined cyanobacterial microsatellites can be freely accessed at www.compubio.in/CyanoSat/home.aspx. In addition to this 82 polymorphic, 13,866 unique and 2390 common microsatellites were also detected. These microsatellites will be useful in strain identification and genetic diversity studies of cyanobacteria.
Evaluation of different primers for PCR-DGGE analysis of cheese-associated enterococci.
Lorbeg, Petra Mohar; Majhenic, Andreja Canzek; Rogelj, Irena
2009-08-01
Enterococci represent an important part of bacterial microbiota in different types of artisanal cheeses, made from either raw or pasteurized milk. Polymerase chain reaction denaturing gradient gel electrophoresis (PCR-DGGE) of ribosomal DNA is currently one of the most frequently used fingerprinting method to study diversity and dynamics of microbial communities and also a tool for microbial identification. Among several primer pairs for DGGE analysis published so far, six primer pairs amplifying different variable regions of 16S rDNA were selected and applied in our DGGE analysis of 12 species belonging to genus Enterococcus and eight other bacterial species often found in cheeses (seven lactobacilli and one Lactoccocus lactis). When DGGE procedures were optimized, the same set of primers was used for DGGE analysis of five cheese samples. Our study demonstrates that the use of different primer pairs generate significant differences in DGGE analysis of enterococcal population, consequently, appropriate primers regarding the purpose of analysis can be selected. For differentiation and identification of pure enterococcal isolates, primer pair P1V1/P2V1 showed the most promising results since all 12 enterococcal isolates gave distinctive DGGE fingerprints, but with multiple bands patterns; therefore, these primers do not seem to be appropriate for identification of enterococcal species in mixed cultures. Use of primer pairs HDA1/HDA2 and V3f/V3r amplifying V3 region showed better potential for detection and identification of enterococci in mixed communities, but since some bacterial species showed the same fingerprint, for clear identification combination of DGGE and some other method (e.g. species specific PCR) or combined DGGE analysis using two primer pairs generating distinctive results should be used.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Yokoyama, Yoko; Shimizu, Akira; Okada, Etsuko
Highlights: Black-Right-Pointing-Pointer We developed new method to rapidly identify COL1A1-PDGFB fusion in DFSP. Black-Right-Pointing-Pointer New PCR method using a single primer pair detected COL1A1-PDGFB fusion in DFSP. Black-Right-Pointing-Pointer This is the first report of DFSP with a novel COL1A1 breakpoint in exon 5. -- Abstract: The detection of fusion transcripts of the collagen type 1{alpha}1 (COL1A1) and platelet-derived growth factor-BB (PDGFB) genes by genetic analysis has recognized as a reliable and valuable molecular tool for the diagnosis of dermatofibrosarcoma protuberans (DFSP). To detect the COL1A1-PDGFB fusion, almost previous reports performed reverse transcription polymerase chain reaction (RT-PCR) using multiplex forward primersmore » from COL1A1. However, it has possible technical difficulties with respect to the handling of multiple primers and reagents in the procedure. The objective of this study is to establish a rapid, easy, and efficient one-step method of PCR using only a single primer pair to detect the fusion transcripts of the COL1A1 and PDGFB in DFSP. To validate new method, we compared the results of RT-PCR in five patients of DFSP between the previous method using multiplex primers and our established one-step RT-PCR using a single primer pair. In all cases of DFSP, the COL1A1-PDGFB fusion was detected by both previous method and newly established one-step PCR. Importantly, we detected a novel COL1A1 breakpoint in exon 5. The newly developed method is valuable to rapidly identify COL1A1-PDGFB fusion transcripts in DFSP.« less
Randhawa, Rohit; Duseja, Ajay; Changotra, Harish
2017-02-01
Various case-control studies have shown association of single nucleotide polymorphism rs12303764(G/T) in ULK1 with crohn's disease. The techniques used in these studies were time consuming, complicated and require sophisticated/expensive instruments. Therefore, in order to overcome these problems, we have developed a new, rapid and cost effective Tetra-primer ARMS-PCR assay to genotype single nucleotide polymorphism rs12303764(G/T) of ULK1 gene. We manually designed allele specific primers. DNA fragment amplified using outer primers was sequenced to obtain samples with known genotypes (GG, GT and TT) for further use in the development of T-ARMS-PCR assay. Amplification conditions were optimized for parameters; annealing temperature, Taq DNA polymerase and primers. The developed T-ARMS-PCR assay was applied to genotype one hundred samples from healthy individuals. Genotyping results of 10 DNA samples from healthy individuals for rs12303764(G/T) by T-ARMS-PCR assay and sequencing were concordant. The newly developed assay was further applied to genotype samples from 100 healthy individuals of North Indian origin. Genotype frequencies were 9, 34 and 57 % for GG, GT and TT, respectively. Allele frequencies were 0.26 and 0.74 for G and T, respectively. The allele frequencies were in Hardy-Weinberg's equilibrium (p = 0.2443). T-ARMS-PCR assay developed in our laboratory for genotyping rs12303764 (G/T) of ULK1 gene is time saving and cost-effective as compared to the available methods. Furthermore, this is the first study reporting allelic and genotype frequencies of ULK1 rs12303764 (G/T) variants in North Indian population.
Erler, Silvio; Lommatzsch, Stefanie; Lattorff, H Michael G
2012-04-01
Global pollinator decline has recently been discussed in the context of honey and bumble bee infections from various pathogens including viruses, bacteria, microsporidia and mites. The microsporidian pathogens Nosema apis, Nosema ceranae and Nosema bombi may in fact be major candidates contributing to this decline. Different molecular and non-molecular detection methods have been developed; however, a comparison, especially of the highly sensitive PCR based methods, is currently lacking. Here, we present the first comparative quantitative real-time PCR study of nine Nosema spp. primers within the framework of primer specificity and sensitivity. With the help of dilution series of defined numbers of spores, we reveal six primer pairs amplifying N. apis, six for N. bombi and four for N. ceranae. All appropriate primer pairs detected an amount of at least 10(4) spores, the majority of which were even as sensitive to detect such low amounts as 10(3) to ten spores. Species specificity of primers was observed for N. apis and N. bombi, but not for N. ceranae. Additionally, we did not find any significant correlation for the amplified fragments with PCR efficiency or the limit of detection. We discuss our findings on the background of false positive and negative results using quantitative real-time PCR. On the basis of these results, future research might be based on appropriate primer selection depending on the experimental needs. Primers may be selected on the basis of specificity or sensitivity. Pathogen species and load may be determined with higher precision enhancing all kinds of diagnostic studies.
Polymerase chain displacement reaction.
Harris, Claire L; Sanchez-Vargas, Irma J; Olson, Ken E; Alphey, Luke; Fu, Guoliang
2013-02-01
Quantitative PCR assays are now the standard method for viral diagnostics. These assays must be specific, as well as sensitive, to detect the potentially low starting copy number of viral genomic material. We describe a new technique, polymerase chain displacement reaction (PCDR), which uses multiple nested primers in a rapid, capped, one-tube reaction that increases the sensitivity of normal quantitative PCR (qPCR) assays. Sensitivity was increased by approximately 10-fold in a proof-of-principle test on dengue virus sequence. In PCDR, when extension occurs from the outer primer, it displaces the extension strand produced from the inner primer by utilizing a polymerase that has strand displacement activity. This allows a greater than 2-fold increase of amplification product for each amplification cycle and therefore increased sensitivity and speed over conventional PCR. Increased sensitivity in PCDR would be useful in nucleic acid detection for viral diagnostics.
Comparison of nine PCR primer sets designed to detect Pantoea stewartii subsp. stewartii in maize
USDA-ARS?s Scientific Manuscript database
Pantoea stewartii subsp. stewartii, the causal agent of Stewart's bacterial wilt of maize, is a major quarantine pest in maize seed. Verifying freedom from P. stewartii remains a significant hurdle in exporting corn seed from the U.S. Several PCR primer sets have been developed and suggested as bein...
Evaluation of primer and probe mismatches in sensitivity of select RRT-PCR tests for avian influenza
USDA-ARS?s Scientific Manuscript database
The recent outbreak of pH1N1 in animals highlighted an imperfection of the matrix real-time reverse transcriptase-polymerase chain reaction (RRT-PCR) that has become the primary screening test for avian and swine influenza viruses. Four mismatches in one primer resulted in an important loss of sens...
The cDNA-derived amino acid sequence of hemoglobin II from Lucina pectinata.
Torres-Mercado, Elineth; Renta, Jessicca Y; Rodríguez, Yolanda; López-Garriga, Juan; Cadilla, Carmen L
2003-11-01
Hemoglobin II from the clam Lucina pectinata is an oxygen-reactive protein with a unique structural organization in the heme pocket involving residues Gln65 (E7), Tyr30 (B10), Phe44 (CD1), and Phe69 (E11). We employed the reverse transcriptase-polymerase chain reaction (RT-PCR) and methods to synthesize various cDNA(HbII). An initial 300-bp cDNA clone was amplified from total RNA by RT-PCR using degenerate oligonucleotides. Gene-specific primers derived from the HbII-partial cDNA sequence were used to obtain the 5' and 3' ends of the cDNA by RACE. The length of the HbII cDNA, estimated from overlapping clones, was approximately 2114 bases. Northern blot analysis revealed that the mRNA size of HbII agrees with the estimated size using cDNA data. The coding region of the full-length HbII cDNA codes for 151 amino acids. The calculated molecular weight of HbII, including the heme group and acetylated N-terminal residue, is 17,654.07 Da.
Quick, Joshua; Grubaugh, Nathan D; Pullan, Steven T; Claro, Ingra M; Smith, Andrew D; Gangavarapu, Karthik; Oliveira, Glenn; Robles-Sikisaka, Refugio; Rogers, Thomas F; Beutler, Nathan A; Burton, Dennis R; Lewis-Ximenez, Lia Laura; de Jesus, Jaqueline Goes; Giovanetti, Marta; Hill, Sarah C; Black, Allison; Bedford, Trevor; Carroll, Miles W; Nunes, Marcio; Alcantara, Luiz Carlos; Sabino, Ester C; Baylis, Sally A; Faria, Nuno R; Loose, Matthew; Simpson, Jared T; Pybus, Oliver G; Andersen, Kristian G; Loman, Nicholas J
2017-06-01
Genome sequencing has become a powerful tool for studying emerging infectious diseases; however, genome sequencing directly from clinical samples (i.e., without isolation and culture) remains challenging for viruses such as Zika, for which metagenomic sequencing methods may generate insufficient numbers of viral reads. Here we present a protocol for generating coding-sequence-complete genomes, comprising an online primer design tool, a novel multiplex PCR enrichment protocol, optimized library preparation methods for the portable MinION sequencer (Oxford Nanopore Technologies) and the Illumina range of instruments, and a bioinformatics pipeline for generating consensus sequences. The MinION protocol does not require an Internet connection for analysis, making it suitable for field applications with limited connectivity. Our method relies on multiplex PCR for targeted enrichment of viral genomes from samples containing as few as 50 genome copies per reaction. Viral consensus sequences can be achieved in 1-2 d by starting with clinical samples and following a simple laboratory workflow. This method has been successfully used by several groups studying Zika virus evolution and is facilitating an understanding of the spread of the virus in the Americas. The protocol can be used to sequence other viral genomes using the online Primal Scheme primer designer software. It is suitable for sequencing either RNA or DNA viruses in the field during outbreaks or as an inexpensive, convenient method for use in the lab.
Santamaría, Erika; Ponce, Nubia; Puerta, Concepción; Ferro, Cristina
2005-06-01
The applicability of the polymerase chain reaction (PCR) was evaluated for the detection and identification of parasites in sand fly vectors and thereby precluding the necessity of dissecting them. DNA was extracted from individual, laboratory infected sand flies, and subjected to PCR amplification using specific B1 and B2 primers for parasites of the Leishmania (Viannia) subgenus. The sensitivity and specificity of the PCR primers were defined by means of serial dilutions of a Leishmania culture. Pooled samples of 1 to 5 sandflies were examined in association with the parasite dilutions to determine the point at which sensitivity became reduced. Experimentally infected sand flies were used to compare the sensitivity of the PCR with sand fly dissection and searching for flagellated parasites by microscopic examination. As few as a single parasite was detected, and the sensitivity remained unaltered up to 3 female sand flies per pool. Detection rates were 33% for the traditional technique and 33.3% for PCR. The B1 and B2 primers were confirmed as specific for Leishmania (Viannia) parasites. The demonstrably high sensitivity and specificity of PCR warrant the use of PCR in assessing natural infection rates of Leishmania (Viannia) in field populations of sand fly vectors.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bulat, S.A.; Mironenko, N.V.; Zholkevich, Yu.G.
1995-07-01
The genetic structure of three soil populations of fungus Fusarium oxysporum was analyzed using polymerase chain reaction with universal primers (UP-PCR). Distinct UP-PCR variants revealed by means of cross-dot hybridization of amplified DNA and restriction analysis of nuclear ribosomal DNA represent subspecies or sibling species of F. oxysporum. The remaining isolates of F. oxysporum showed moderate UP-PCR polymorphism characterized by numerous types, whose relatedness was analyzed by computer treatment of the UP-PCR patterns. The genetic distance trees based on the UP-PCR patterns, which were obtained with different universal primers, demonstrated similar topology. This suggests that evolutionarily important genome rearrangements correlativelymore » occur within the entire genome. Isolates representing different UP-PCR polymorphisms were encountered in all populations, being distributed asymmetrically in two of these. In general, soil populations of F. oxysporum were represented by numerous genetically isolated groups with a similar genome structure. The genetic heterogeneity of the isolates within these groups is likely to be caused by the parasexual process. The usefulness of the UP-PCR technique for population studies of F. oxysporum was demonstrated. 39 refs., 7 figs., 2 tabs.« less
Junlong, Liu; Li, Youquan; Liu, Aihong; Guan, Guiquan; Xie, Junren; Yin, Hong; Luo, Jianxun
2015-07-01
Aim to construct a simple and efficient diagnostic assay for Theileria annulata and Theileria sergenti, a multiplex polymerase chain reaction (PCR) method was developed in this study. Following the alignment of the related sequences, two primer sets were designed specific targeting on T. annulata cytochrome b (COB) gene and T. sergenti internal transcribed spacer (ITS) sequences. It was found that the designed primers could react in one PCR system and generating amplifications of 818 and 393 base pair for T. sergenti and T. annulata, respectively. The standard genomic DNA of both species Theileria was serial tenfold diluted for testing the sensitivity, while specificity test confirmed both primer sets have no cross-reaction with other Theileria and Babesia species. In addition, 378 field samples were used for evaluation of the utility of the multiplex PCR assay for detection of the pathogens infection. The detection results were compared with the other two published PCR methods which targeting on T. annulata COB gene and T. sergenti major piroplasm surface protein (MPSP) gene, respectively. The developed multiplex PCR assay has similar efficient detection with COB and MPSP PCR, which indicates this multiplex PCR may be a valuable assay for the epidemiological studies for T. annulata and T. sergenti.
Ishihara, Satoru; Kotomura, Naoe; Yamamoto, Naoki; Ochiai, Hiroshi
2017-08-15
Ligation-mediated polymerase chain reaction (LM-PCR) is a common technique for amplification of a pool of DNA fragments. Here, a double-stranded oligonucleotide consisting of two primer sequences in back-to-back orientation was designed as an adapter for LM-PCR. When DNA fragments were ligated with this adapter, the fragments were sandwiched between two adapters in random orientations. In the ensuing PCR, ligation products linked at each end to an opposite side of the adapter, i.e. to a distinct primer sequence, were preferentially amplified compared with products linked at each end to an identical primer sequence. The use of this adapter in LM-PCR reduced the impairment of PCR by substrate DNA with a high GC content, compared with the use of traditional LM-PCR adapters. This result suggested that our method has the potential to contribute to reduction of the amplification bias that is caused by an intrinsic property of the sequence context in substrate DNA. A DNA preparation obtained from a chromatin immunoprecipitation assay using pulldown of a specific form of histone H3 was successfully amplified using the modified LM-PCR, and the amplified products could be used as probes in a fluorescence in situ hybridization analysis. Copyright © 2017 Elsevier Inc. All rights reserved.
Drigo, Ilenia; Bacchin, Cosetta; Cocchi, Monia; Bano, Luca; Agnoletti, Fabrizio
2008-10-15
Rabbit diarrhoea caused by toxigenic Clostridium spiroforme is responsible for significant losses in commercial rabbitries but the accurate identification of this micro-organism is difficult due to the absence of both a commercial biochemical panel and biomolecular methods. The aim of this study was therefore to develop PCR protocols for specific detection of C. spiroforme and its binary toxin encoding genes. The C. spiroforme specie-specific primers were designed based on its 16S rDNA published sequences and the specificity of these primers was tested with DNA extracted from closely related Clostridium species. The sa/bs_F and sa/bs _R C. spiroforme binary toxin specific primers were designed to be complementary, respectively, to a sequence of 21 bases on the 3' and of sas gene and on the 5' of the sbs gene. The detection limits of in house developed PCR protocols were 25CFU/ml of bacterial suspension and 1.38x10(4)CFU/g of caecal content for specie-specific primers and 80CFU/ml of bacterial suspension and 2.8x10(4)CFU/g of caecal content in case of sa/bs primers. These results indicated that the described PCR assays enable specific identification of C. spiroforme and its binary toxin genes and can therefore be considered a rapid, reliable tool for the diagnosis of C. spiroforme-related enterotoxaemia.
Use of species-specific PCR for the identification of 10 sea cucumber species
NASA Astrophysics Data System (ADS)
Wen, Jing; Zeng, Ling
2014-11-01
We developed a species-specific PCR method to identify species among dehydrated products of 10 sea cucumber species. Ten reverse species-specific primers designed from the 16S rRNA gene, in combination with one forward universal primer, generated PCR fragments of ca. 270 bp length for each species. The specificity of the PCR assay was tested with DNA of samples of 21 sea cucumber species. Amplification was observed in specific species only. The species-specific PCR method we developed was successfully applied to authenticate species of commercial products of dehydrated sea cucumber, and was proven to be a useful, rapid, and low-cost technique to identify the origin of the sea cucumber product.
Fernandez-Tajes, Juan; Méndez, Josefina
2007-09-05
Polymerase chain reaction (PCR) and restriction fragment length polymorphism (RFLP) analysis of the 5S ribosomal DNA region has been applied to the establishment of DNA-based molecular markers for the identification of five razor clam species: Ensis arcuatus, E. siliqua, E. directus, E. macha, and Solen marginatus. PCR amplifications were carried out using a pair of universal primers from the coding region of 5S rDNA. S. marginatus was simply distinguished by the different size of the amplicons obtained. Species-specific restriction endonuclease patterns were found with the enzymes Hae III for E. arcuatus, E. siliqua, and E. directus, and Acs I for E. macha, and when two enzymes were combined, the four species were also identified. Thus, this work provides a simple, reliable, and rapid protocol for the accurate identification of Ensis and Solen species in fresh and canned products, which is very useful for traceability and to enforce labeling regulations.
Zhang, Xiaoyan; Peng, Yanmei; Wang, Ying; Zhang, Zongying; Li, Dawei; Yu, Jialin; Han, Chenggui
2016-11-22
Brassica yellows virus (BrYV), proposed to be a new polerovirus species, three distinct genotypes (BrYV-A, BrYV-B and BrYV-C) have been described. This study was to develop a simple, rapid, sensitive, cost-effective method for simultaneous detection and differentiation of three genotypes of BrYV. In this study, a multiplex reverse transcription-polymerase chain reaction (mRT-PCR) was developed for simultaneous detection and differentiation of the three genotypes of BrYV. The three genotypes of BrYV and Tunip yellows virus (TuYV) could be differentiated simultaneously using six optimized specific oligonucleotide primers, including one universal primer for detecting BrYV, three BrYV genotype-specific primers, and a pair of primers for specific detection of TuYV. Primers were designed from conserved regions of each virus and their specificity was confirmed by sequencing PCR products. The mRT-PCR products were 278 bp for BrYV-A, 674 bp for BrYV-B, 505 bp for BrYV-C, and 205 bp for TuYV. Amplification of three target genotypes was optimized by increasing the PCR annealing temperatures to 62 °C. One to three fragments specific for the virus genotypes were simultaneously amplified from infected samples and identified by their specific molecular sizes in agarose gel electrophoresis. No specific products could be amplified from cDNAs of other viruses which could infect crucifer crops. Detection limits of the plasmids for multiplex PCR were 100 fg for BrYV-A and BrYV-B, 10 pg for BrYV-C, and 1 pg for TuYV, respectively. The mRT-PCR was applied successfully for detection of three BrYV genotypes from field samples collected in China. The simple, rapid, sensitive, and cost-effective mRT-PCR was developed successfully for detection and differentiation of the three genotypes of BrYV.
Improving molecular tools for global surveillance of measles virus.
Bankamp, Bettina; Byrd-Leotis, Lauren A; Lopareva, Elena N; Woo, Gibson K S; Liu, Chunyu; Jee, Youngmee; Ahmed, Hinda; Lim, Wilina W; Ramamurty, Nalini; Mulders, Mick N; Featherstone, David; Bellini, William J; Rota, Paul A
2013-09-01
The genetic characterization of wild-type measles viruses plays an important role in the description of viral transmission pathways and the verification of measles elimination. The 450 nucleotides that encode the carboxyl-terminus of the nucleoprotein (N-450) are routinely sequenced for genotype analysis. The objectives of this study were to develop improved primers and controls for RT-PCR reactions used for genotyping of measles samples and to develop a method to provide a convenient, safe, and inexpensive means to distribute measles RNA for RT-PCR assays and practice panels. A newly designed, genetically defined synthetic RNA and RNA isolated from cells infected with currently circulating genotypes were used to compare the sensitivity of primer pairs in RT-PCR and nested PCR. FTA® cards loaded with lysates of measles infected cells were tested for their ability to preserve viral RNA and destroy virus infectivity. A new primer pair, MeV216/MeV214, was able to amplify N-450 from viruses representing 10 currently circulating genotypes and a genotype A vaccine strain and demonstrated 100-fold increased sensitivity compared to the previously used primer set. A nested PCR assay further increased the sensitivity of detection from patient samples. A synthetic positive control RNA was developed that produced PCR products that are distinguishable by size from PCR products amplified from clinical samples. FTA® cards completely inactivated measles virus and stabilized RNA for at least six months. These improved molecular tools will advance molecular characterization of circulating measles viruses globally and provide enhanced quality control measures. Published by Elsevier B.V.
Hou, J M; Ma, B C; Zuo, Y H; Guo, L L; Gao, S G; Wang, Y Y; Liu, T
2013-04-01
Curvularia lunata (Wakker) Boed, the causative agent of Curvularia leaf spot in maize, was determined according to conidiophore and conidium morphology in a previous study. In the current study, a sensitive polymerase chain reaction assay was developed for the detection of C. lunata. Two specific forward (ClgD1/ClgD2) and one reverse primers (ClgD3) were designed based on a Ras-related (Clg2p) gene. Eight C. lunata isolates that represent different virulent strains in maize, six other Curvularia spp., and 22 fungal plant pathogens were used to test the specificity of the primers. PCR amplification using ClgD1/ClgD3 as the first-round primers resulted in an 870-bp band from the C. lunata isolates. The detection sensitivity using ClgD1/ClgD3 was 100 pg of genomic DNA. In the second round of PCR, a 1 : 50 dilution of the first-round PCR products was used as a template with the ClgD2/ClgD3 primer pair, which increased the detection sensitivity to 1 fg. This semi-nested PCR procedure could also be used to detect C. lunata from infected maize leaves. The proposed PCR-based assay may be used for diagnosing and monitoring maize Curvularia leaf spot. The semi-nested PCR assay may provide researchers and laboratory technologists a tool to rapidly detect C. lunata, which causes maize Curvularia leaf spot, compared with histological examination. © 2012 The Society for Applied Microbiology.
Improving molecular tools for global surveillance of measles virus⋆
Bankamp, Bettina; Byrd-Leotis, Lauren A.; Lopareva, Elena N.; Woo, Gibson K.S.; Liu, Chunyu; Jee, Youngmee; Ahmed, Hinda; Lim, Wilina W.; Ramamurty, Nalini; Mulders, Mick N.; Featherstone, David; Bellini, William J.; Rota, Paul A.
2017-01-01
Background The genetic characterization of wild-type measles viruses plays an important role in the description of viral transmission pathways and the verification of measles elimination. The 450 nucleotides that encode the carboxyl-terminus of the nucleoprotein (N-450) are routinely sequenced for genotype analysis. Objectives The objectives of this study were to develop improved primers and controls for RT-PCR reactions used for genotyping of measles samples and to develop a method to provide a convenient, safe, and inexpensive means to distribute measles RNA for RT-PCR assays and practice panels. Study design A newly designed, genetically defined synthetic RNA and RNA isolated from cells infected with currently circulating genotypes were used to compare the sensitivity of primer pairs in RT-PCR and nested PCR. FTA® cards loaded with lysates of measles infected cells were tested for their ability to preserve viral RNA and destroy virus infectivity. Results A new primer pair, MeV216/MeV214, was able to amplify N-450 from viruses representing 10 currently circulating genotypes and a genotype A vaccine strain and demonstrated 100-fold increased sensitivity compared to the previously used primer set. A nested PCR assay further increased the sensitivity of detection from patient samples. A synthetic positive control RNA was developed that produced PCR products that are distinguishable by size from PCR products amplified from clinical samples. FTA® cards completely inactivated measles virus and stabilized RNA for at least six months. Conclusions These improved molecular tools will advance molecular characterization of circulating measles viruses globally and provide enhanced quality control measures. PMID:23806666
Fuller, Nicholas J.; Wilson, William H.; Joint, Ian R.; Mann, Nicholas H.
1998-01-01
Viruses are ubiquitous components of marine ecosystems and are known to infect unicellular phycoerythrin-containing cyanobacteria belonging to the genus Synechococcus. A conserved region from the cyanophage genome was identified in three genetically distinct cyanomyoviruses, and a sequence analysis revealed that this region exhibited significant similarity to a gene encoding a capsid assembly protein (gp20) from the enteric coliphage T4. The results of a comparison of gene 20 sequences from three cyanomyoviruses and T4 allowed us to design two degenerate PCR primers, CPS1 and CPS2, which specifically amplified a 165-bp region from the majority of cyanomyoviruses tested. A competitive PCR (cPCR) analysis revealed that cyanomyovirus strains could be accurately enumerated, and it was demonstrated that quantification was log-linear over ca. 3 orders of magnitude. Different calibration curves were obtained for each of the three cyanomyovirus strains tested; consequently, cPCR performed with primers CPS1 and CPS2 could lead to substantial inaccuracies in estimates of phage abundance in natural assemblages. Further sequence analysis of cyanomyovirus gene 20 homologs would be necessary in order to design primers which do not exhibit phage-to-phage variability in priming efficiency. It was demonstrated that PCR products of the correct size could be amplified from seawater samples following 100× concentration and even directly without any prior concentration. Hence, the use of degenerate primers in PCR analyses of cyanophage populations should provide valuable data on the diversity of cyanophages in natural assemblages. Further optimization of procedures may ultimately lead to a sensitive assay which can be used to analyze natural cyanophage populations both quantitatively (by cPCR) and qualitatively following phylogenetic analysis of amplified products. PMID:9603813
Sequence analysis of 16S rRNA gene clone libraries is a popular tool used to describe the composition of natural microbial communities. Commonly, clone libraries are developed by direct cloning of 16S rRNA gene PCR products. Different primers are often employed in the initial amp...
Sequence analysis of 16S rRNA gene clone libraries is a popular tool used to describe the composition of natural microbial communities. Commonly, clone libraries are developed by direct cloning of 16S rRNA gene PCR products. Different primers are often employed in the initial amp...
Cordova, Ivan; Jones, Phil; Harrison, Nigel A; Oropeza, Carlos
2003-03-01
SUMMARY DNA of the lethal yellowing (LY) phytoplasma was detected in 13 of 72 embryos from fruits of four diseased Atlantic tall coconut palms by polymerase chain reaction (PCR) assays employing phytoplasma universal rRNA primer pair P1/P7, nested LY group-specific rRNA primer pair 503f/LY16Sr or LY phytoplasma-specific nonribosomal primer pair LYF1/R1. Phytoplasma distribution in sectioned tissues from six PCR positive embryos was determined by in situ PCR and digoxigenin-11-deoxy-UTP (Dig) labelling of amplification products. Dig-labeled DNA products detected by colourimetric assay were clearly evident on sections from the same three embryos investigated in detail by in situ PCRs employing primer pairs P1/P7 or LYF1/R1. Deposition of blue-green stain on sections as a result of each assay was restricted to areas of the embryos corresponding to the plumule and cells ensheathing it. By comparison, similarly treated embryo sections derived from fruits of a symptomless Atlantic tall coconut palm were consistently devoid of any stain. Presence of phytoplasma DNA in embryo tissues suggests the possible potential for seed transmission which remains to be demonstrated.
Iwase, Tadayuki; Seki, Keiko; Shinji, Hitomi; Mizunoe, Yoshimitsu; Masuda, Shogo
2007-10-01
Staphylococcus capitis, Staphylococcus haemolyticus and Staphylococcus warneri are coagulase-negative staphylococci. Each species has different characteristics, and a difference in pathology is also seen in compromised hosts. Therefore, the development of a species-specific simple detection method for the identification of these staphylococci is important. Here, a species-specific real-time PCR assay is reported that targets the superoxide dismutase A-encoding gene of these bacteria. Primers were designed with a base that was non-complementary with regard to the other bacteria. This base was at the 3' end of the primer (3' mismatch primer) and conferred high specificity. These primers were then evaluated using real-time PCR. They reacted only with the target bacterium. In addition, stable quantitative reactions were observed when experiments were performed using genomic DNA extracted from varying numbers of staphylococci cells (10(1)-10(7) cells). These results indicate that this method is useful for the identification and quantitative analysis of S. capitis, S. haemolyticus and S. warneri.
Authentication of medicinal herbs using PCR-amplified ITS2 with specific primers.
Chiou, Shu-Jiau; Yen, Jui-Hung; Fang, Cheng-Li; Chen, Hui-Ling; Lin, Tsai-Yun
2007-10-01
Different parts of medicinal herbs have long been used as traditional Chinese drugs for treating many diseases, whereas materials of similar morphology and chemical fingerprints are often misidentified. Analyses of sequence variations in the nuclear ribosomal DNA (rDNA) internal transcribed spacer (ITS) have become a valid method for authentication of medicinal herbs at the intergenic and interspecific levels. DNA extracted from processed materials is usually severely degraded or contaminated by microorganisms, thus generates no or unexpected PCR products. The goal of this study is to apply the ITS fragments selectively amplified with two designed primer sets for efficient and precise authentication of medicinal herbs. The designed primers led to an accurate PCR product of the specific region in ITS2, which was confirmed with DNA extracted from 55 processed medicinal herbs belonging to 48 families. Moreover, the selectively amplified ITS2 authenticated five sets of easily confusable Chinese herbal materials. The designed primers were proven to be suitable for a broad application in the authentication of herbal materials.
Beck, Rose C; Kohn, Debra J; Tuohy, Marion J; Prayson, Richard A; Yen-Lieberman, Belinda; Procop, Gary W
2004-03-01
We evaluated 2 methods, a LightCycler PCR assay and pyrosequencing for the detection of the JC polyoma virus (JCV) in fixed brain tissue of 10 patients with and 3 control patients without progressive multifocal leukoencephalopathy (PML). Nucleic acid extraction was performed after deparaffinization and proteinase K digestion. The LightCycler assay differentiates the BK virus (BKV), JCV, and SV40 using melt curve analysis. Conventional PCR was used with the same primers to generate products for pyrosequencing. Two sequencing primers were used that differentiate the polyoma viruses. Seven of 11 biopsies (1 patient had 2 biopsies) with PML were positive for JCV by real-time PCR and/or PCR/pyrosequencing. Three of 4 remaining biopsies were positive by real-time PCR but had melting points between JCV and SV40. The 4 specimens that were negative or atypical by LightCycler PCR were positive by traditional PCR, but 1 had an amplicon of lower molecular weight by gel electrophoresis. These were shown to represent JCV by at least 1 of the 2 pyrosequencing primers. The biopsies from patients without PML were PCR negative. Both the LightCycler and pyrosequencing assays are useful for confirming JCV in brain biopsies from patients with PML, but variant JCVs may require supplementary methods to confirm JCV infection.
Inderbitzin, Patrik; Davis, R. Michael; Bostock, Richard M.; Subbarao, Krishna V.
2013-01-01
Accurate species identification is essential for effective plant disease management, but is challenging in fungi including Verticillium sensu stricto (Ascomycota, Sordariomycetes, Plectosphaerellaceae), a small genus of ten species that includes important plant pathogens. Here we present fifteen PCR assays for the identification of all recognized Verticillium species and the three lineages of the diploid hybrid V. longisporum. The assays were based on DNA sequence data from the ribosomal internal transcribed spacer region, and coding and non-coding regions of actin, elongation factor 1-alpha, glyceraldehyde-3-phosphate dehydrogenase and tryptophan synthase genes. The eleven single target (simplex) PCR assays resulted in amplicons of diagnostic size for V. alfalfae, V. albo-atrum, V. dahliae including V. longisporum lineage A1/D3, V. isaacii, V. klebahnii, V. nonalfalfae, V. nubilum, V. tricorpus, V. zaregamsianum, and Species A1 and Species D1, the two undescribed ancestors of V. longisporum. The four multiple target (multiplex) PCR assays simultaneously differentiated the species or lineages within the following four groups: Verticillium albo-atrum, V. alfalfae and V. nonalfalfae; Verticillium dahliae and V. longisporum lineages A1/D1, A1/D2 and A1/D3; Verticillium dahliae including V. longisporum lineage A1/D3, V. isaacii, V. klebahnii and V. tricorpus; Verticillium isaacii, V. klebahnii and V. tricorpus. Since V. dahliae is a parent of two of the three lineages of the diploid hybrid V. longisporum, no simplex PCR assay is able to differentiate V. dahliae from all V. longisporum lineages. PCR assays were tested with fungal DNA extracts from pure cultures, and were not evaluated for detection and quantification of Verticillium species from plant or soil samples. The DNA sequence alignments are provided and can be used for the design of additional primers. PMID:23823707
Effective PCR-based detection of Naegleria fowleri from cultured sample and PAM-developed mouse.
Kang, Heekyoung; Seong, Gi-Sang; Sohn, Hae-Jin; Kim, Jong-Hyun; Lee, Sang-Eun; Park, Mi Yeoun; Lee, Won-Ja; Shin, Ho-Joon
2015-10-01
Increasing numbers of Primary Amoebic Meningoencephalitis (PAM) cases due to Naegleria fowleri are becoming a serious issue in subtropical and tropical countries as a Neglected Tropical Disease (NTD). To establish a rapid and effective diagnostic tool, a PCR-based detection technique was developed based on previous PCR methods. Four kinds of primer pairs, Nfa1, Nae3, Nf-ITS, and Naegl, were employed in the cultured amoebic trophozoites and a mouse with PAM experimentally developed by N. fowleri inoculation (PAM-mouse). For the extraction of genomic DNA from N. fowleri trophozoites (1×10(6)), simple boiling with 10μl of PBS (pH 7.4) at 100°C for 30min was found to be the most rapid and efficient procedure, allowing amplification of 2.5×10(2) trophozoites using the Nfa-1 primer. The primers Nfa1 and Nae3 amplified only N. fowleri DNA, whereas the ITS primer detected N. fowleri and N. gruberi DNA. Using the PAM-mouse brain tissue, the Nfa1 primer was able to amplify the N. fowleri DNA 4 days post infection with 1ng/μl of genomic DNA being detectable. Using the PAM-mouse CSF, amplification of the N. fowleri DNA with the Nae3 primer was possible 5 days post infection showing a better performance than the Nfa1 primer at day 6. Copyright © 2015 Elsevier GmbH. All rights reserved.
Kim, Choon-Mee; Cho, Min Keun; Yun, Na-Ra; Kim, Seok Won; Jang, Sook Jin; Ahn, Young-Joon; Lim, Donghoon
2015-01-01
We retrospectively evaluated the accuracy of conventional PCR targeting the 16S rRNA gene (16S C-PCR) using the Ot-16sRF1/Ot-16sRR1 primers for diagnosing scrub typhus. The diagnosis of Orientia tsutsugamushi infection by 16S C-PCR presented an increased sensitivity of 87.0% and specificity of 100% compared with those obtained with other targets and is thus a simple and clinically useful method with good diagnostic accuracy. PMID:26491185
Quantitative phenotyping of X-disease resistance in chokecherry using real-time PCR.
Huang, Danqiong; Walla, James A; Dai, Wenhao
2014-03-01
A quantitative real-time SYBR Green PCR (qPCR) assay has been developed to detect and quantify X-disease phytoplasmas in chokecherry. An X-disease phytoplasma-specific and high sensitivity primer pair was designed based on the 16S rRNA gene sequence of X-disease phytoplasmas. This primer pair was specific to the 16SrIII group (X-disease) phytoplasmas. The qPCR method can quantify phytoplasmas from a DNA mix (a mix of both chokecherry and X-disease phytoplasma DNA) at as low as 0.001 ng, 10-fold lower than conventional PCR using the same primer pair. A significant correlation between the copy number of phytoplasmas and visual phenotypic rating scores of X-disease resistance in chokecherry plants was observed. Disease resistant chokecherries had a significantly lower titer of X-disease phytoplasmas than susceptible plants. This suggests that the qPCR assay provides a more objective tool to phenotype phytoplasma disease severity, particularly for early evaluation of host resistance; therefore, this method will facilitate quantitative phenotyping of disease resistance and has great potential in enhancing plant breeding. Copyright © 2013 Elsevier B.V. All rights reserved.
[Iditification of five imported cases of Plasmodium ovale wallikeri infection in Zhejiang Province].
Zhang, Ling-ling; Ruan, Wei; Chen, Hua-liang; Lu, Qiao-yi; Yao, Li-nong
2014-10-01
To identify and analyze Plasmodium ovale wallikeri in 5 imported malaria cases, who were detected positive by microscopy and negative by conventional PCR. Epidemiological information and blood samples were collected from the five patients. The detection was conducted by microscopy, Rapid Diagnostic Test (RDT) and nested PCR with Plasmodium genus-specific, species-specific and Plasmodium ovale wallikeri-specific primers. The amplified products were sequenced and Blast analysis was performed on line in NCBI. The five patients returned from Africa, and all had a history of malaria. They were microscopically positive for Plasmodium sp., and two cases showed Pan positive RDT result. All blood samples were negative for four Plasmodium spp. by conventional nested PCR, but positive by nested PCR with Plasmodium ovale wallikeri-specific primers. Blast analysis showed that the amplified sequences of the five cases had complete homology with P. ovale wallikeri clone RSH10 18S ribosomal RNA gene (Accession No. KF219561.1). The five cases which classified as positive by microscopy while negative by conventional PCR have been confirmed as Plasmodium ovale wallikeri infection by nested PCR with P. ovale wallikeri-specific primers.
Biswas, Chinmay; Dey, Piyali; Gotyal, B S; Satpathy, Subrata
2015-04-01
The fungal entomopathogen Beauveria bassiana is a promising biocontrol agent for many pests. Some B. bassiana strains have been found effective against jute pests. To monitor the survival of field released B. bassiana a rapid and efficient detection technique is essential. Conventional methods such as plating method or direct culture method which are based on cultivation on selective media followed by microscopy are time consuming and not so sensitive. PCR based methods are rapid, sensitive and reliable. A single primer PCR may fail to amplify some of the strains. However, multiplex PCR increases the possibility of detection as it uses multiple primers. Therefore, in the present investigation a multiplex PCR protocol was developed by multiplexing three primers SCA 14, SCA 15 and SCB 9 to detect field released B. bassiana strains from soil as well as foliage of jute field. Using our multiplex PCR protocol all the five B. bassiana strains could be detected from soil and three strains viz., ITCC 6063, ITCC 4563 and ITCC 4796 could be detected even from the crop foliage after 45 days of spray.
Lv, Xu-Cong; Jiang, Ya-Jun; Liu, Jie; Guo, Wei-Ling; Liu, Zhi-Bin; Zhang, Wen; Rao, Ping-Fan; Ni, Li
2017-08-16
Denaturing gradient gel electrophoresis (DGGE) has become a widely used tool to examine microbial community structure. However, when DGGE is applied to evaluate the fungal community of traditional fermentation starters, the choice of hypervariable ribosomal RNA gene regions is still controversial. In the current study, several previously published fungal PCR primer sets were compared and evaluated using PCR-DGGE, with the purpose of screening a suitable primer set to study the fungal community of traditional fermentation starters for Hong Qu glutinous rice wine. Firstly, different primer sets were used to amplify different hypervariable regions from pure fungal cultures. Except NS1/FR1+ and ITS1fGC/ITS4, other primer sets (NL1+/LS2R, NL3A/NL4GC, FF390/FR1+, NS1/GCFung, NS3+/YM951r and ITS1fGC/ITS2r) amplified the target DNA sequences successfully. Secondly, the selected primer sets were further evaluated based on their resolution to distinguish different fungal cultures through DGGE fingerprints. Three primer sets (NL1+/LS2R, NS1/GCFung and ITS1fGC/ITS2r) were finally selected for investigating the fungal community structure of different traditional fermentation starters for Hong Qu glutinous rice wine. The internal transcribed spacer (ITS) region amplified by ITS1fGC/ITS2r, which is more hypervariable than the 18S rRNA gene and 26S rRNA gene, provides an excellent tool to separate amplification products of different fungal species. Results indicated that PCR-DGGE profile using ITS1fGC/ITS2r showed more abundant fungal species than that using NL1+/LS2R and NS1/GCFung. Therefore, ITS1fGC/ITS2r is the most suitable primer set for PCR-DGGE analysis of fungal community structure in traditional fermentation starters for Hong Qu glutinous rice wine. DGGE profiles based on ITS1fGC/ITS2r revealed the presence of twenty-four fungal species in traditional fermentation starter. A significant difference of fungal community can be observed directly from DGGE fingerprints and principal component analysis. The statistical analysis results based on the band intensities of fungal DGGE profile showed that Saccharomyces cerevisiae, Saccharomycopsis fibuligera, Rhizopus oryzae, Monascus purpureus and Aspergillus niger were the dominant fungal species. In conclusion, the comparison of several primer sets for fungal PCR-DGGE would be useful to enrich our knowledge of the fungal community structures associated with traditional fermentation starters, which may facilitate the development of better starter cultures for manufacturing Chinese Hong Qu glutinous rice wine. Copyright © 2017 Elsevier B.V. All rights reserved.
PCR detection of thermophilic spore-forming bacteria involved in canned food spoilage.
Prevost, S; Andre, S; Remize, F
2010-12-01
Thermophilic bacteria that form highly heat-resistant spores constitute an important group of spoilage bacteria of low-acid canned food. A PCR assay was developed in order to rapidly trace these bacteria. Three PCR primer pairs were designed from rRNA gene sequences. These primers were evaluated for the specificity and the sensitivity of detection. Two primer pairs allowed detection at the species level of Geobacillus stearothermophilus and Moorella thermoacetica/thermoautrophica. The other pair allowed group-specific detection of anaerobic thermophilic bacteria of the genera Thermoanaerobacterium, Thermoanaerobacter, Caldanerobium and Caldanaerobacter. After a single enrichment step, these PCR assays allowed the detection of 28 thermophiles from 34 cans of spoiled low-acid food. In addition, 13 ingredients were screened for the presence of these bacteria. This PCR assay serves as a detection method for strains able to spoil low-acid canned food treated at 55°C. It will lead to better reactivity in the canning industry. Raw materials and ingredients might be qualified not only for quantitative spore contamination, but also for qualitative contamination by highly heat-resistant spores.
Identification of Staphylococcus spp. using (GTG)₅-PCR fingerprinting.
Svec, Pavel; Pantůček, Roman; Petráš, Petr; Sedláček, Ivo; Nováková, Dana
2010-12-01
A group of 212 type and reference strains deposited in the Czech Collection of Microorganisms (Brno, Czech Republic) and covering 41 Staphylococcus species comprising 21 subspecies was characterised using rep-PCR fingerprinting with the (GTG)₅ primer in order to evaluate this method for identification of staphylococci. All strains were typeable using the (GTG)₅ primer and generated PCR products ranging from 200 to 4500 bp. Numerical analysis of the obtained fingerprints revealed (sub)species-specific clustering corresponding with the taxonomic position of analysed strains. Taxonomic position of selected strains representing the (sub)species that were distributed over multiple rep-PCR clusters was verified and confirmed by the partial rpoB gene sequencing. Staphylococcus caprae, Staphylococcus equorum, Staphylococcus sciuri, Staphylococcus piscifermentans, Staphylococcus xylosus, and Staphylococcus saprophyticus revealed heterogeneous fingerprints and each (sub)species was distributed over several clusters. However, representatives of the remaining Staphylococcus spp. were clearly separated in single (sub)species-specific clusters. These results showed rep-PCR with the (GTG)₅ primer as a fast and reliable method applicable for differentiation and straightforward identification of majority of Staphylococcus spp. Copyright © 2010 Elsevier GmbH. All rights reserved.
Galkiewicz, Julia P; Kellogg, Christina A
2008-12-01
PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem.
Galkiewicz, Julia P.; Kellogg, Christina A.
2008-01-01
PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem. PMID:18931299
Nakamura, Mikiko; Suzuki, Ayako; Akada, Junko; Yarimizu, Tohru; Iwakiri, Ryo; Hoshida, Hisashi; Akada, Rinji
2015-08-01
Escherichia coli plasmids are commonly used for gene expression experiments in mammalian cells, while PCR-amplified DNAs are rarely used even though PCR is a much faster and easier method to construct recombinant DNAs. One difficulty may be the limited amount of DNA produced by PCR. For direct utilization of PCR-amplified DNA in transfection experiments, efficient transfection with a smaller amount of DNA should be attained. For this purpose, we investigated two enhancer reagents, polyethylene glycol and tRNA, for a chemical transfection method. The addition of the enhancers to a commercial transfection reagent individually and synergistically exhibited higher transfection efficiency applicable for several mammalian cell culture lines in a 96-well plate. By taking advantage of a simple transfection procedure using PCR-amplified DNA, SV40 and rabbit β-globin terminator lengths were minimized. The terminator length is short enough to design in oligonucleotides; thus, terminator primers can be used for the construction and analysis of numerous mutations, deletions, insertions, and tag-fusions at the 3'-terminus of any gene. The PCR-mediated gene manipulation with the terminator primers will transform gene expression by allowing for extremely simple and high-throughput experiments with small-scale, multi-well, and mammalian cell cultures.
Qin, Shaomin; Underwood, Darren; Driver, Luke; Kistler, Carol; Diallo, Ibrahim; Kirkland, Peter D
2018-06-01
We evaluated a fluorogenic probe-based assay for the detection of encephalomyocarditis virus (EMCV) by comparing a set of published primers and probe to a new set of primers and probe. The published reagents failed to amplify a range of Australian isolates and an Italian reference strain of EMCV. In contrast, an assay based on 2 new sets of primers and probes that were run in a duplex reverse-transcription real-time PCR (RT-rtPCR) worked well, with high amplification efficiency. The analytical sensitivity was ~100-fold higher than virus isolation in cell culture. The intra-assay variation was 0.21-4.90%. No cross-reactivity was observed with a range of other porcine viruses. One hundred and twenty-two clinical specimens were tested simultaneously by RT-rtPCR and virus isolation in cell culture; 72 specimens gave positive results by RT-rtPCR, and 63 of these were also positive by virus isolation. Of 245 archived cell culture isolates of EMCV that were tested in the RT-rtPCR, 242 samples were positive. The new duplex RT-rtPCR assay is a reliable tool for the detection of EMCV in clinical specimens and for use in epidemiologic investigations.
Asvapathanagul, P; Olson, B H
2017-01-01
To develop qPCR broad-spectrum primers combined with a Nocardia genus-specific probe for the identification of a broad spectrum of Nocardia spp. and to analyse the effects of using this developed primer and probe set on the ability to quantify Nocardia spp. in mixed DNA. The consequences of using a degenerative primer set and species-specific probe for the genus Nocardia on qPCR assays were examined using DNA extracts of pure cultures and activated sludge. The mixed DNA extracts where the target organism Nocardia flavorosea concentration ranged from 5 × 10 2 to 5 × 10 6 copies per reaction, while the background organism's DNA (Mycobacterium bovis) concentration was held at 5 × 10 6 copies per reaction, only produced comparable cycle threshold florescence levels when N. flavorosea concentration was greater than or equal to the background organism concentration. When concentrations of N. flavorosea were lowered in increments of 1 log, while holding M. bovis concentrations constant at 5 × 10 6 copies per reaction, all assays demonstrated delayed cycle threshold values with a maximum 34·6-fold decrease in cycle threshold at a ratio of 10 6 M. bovis: 10 2 N. flavorosea copies per reaction. The data presented in this study indicated that increasing the ability of a primer set to capture a broad group of organisms can affect the accuracy of quantification even when a highly specific probe is used. This study examined several applications of molecular tools in complex communities such as evaluating the effect of mispriming vs interference. It also elucidates the importance of understanding the community genetic make-up on primer design. Degenerative primers are very useful in amplifying bacterial DNA across genera, but reduce the efficiency of qPCR reactions. Therefore, standards that address closely related background species must be used to obtain accurate qPCR results. © 2016 The Society for Applied Microbiology.
Yamashita, S; Nakagawa, H; Sakaguchi, T; Arima, T-H; Kikoku, Y
2018-01-01
Heat-resistant fungi occur sporadically and are a continuing problem for the food and beverage industry. The genus Talaromyces, as a typical fungus, is capable of producing the heat-resistant ascospores responsible for the spoilage of processed food products. Isocitrate lyase, a signature enzyme of the glyoxylate cycle, is required for the metabolism of non-fermentable carbon compounds, like acetate and ethanol. Here, species-specific primer sets for detection and identification of DNA derived from Talaromyces macrosporus and Talaromyces trachyspermus were designed based on the nucleotide sequences of their isocitrate lyase genes. Polymerase chain reaction (PCR) using a species-specific primer set amplified products specific to T. macrosporus and T. trachyspermus. Other fungal species, such as Byssochlamys fulva and Hamigera striata, which cause food spoilage, were not detected using the Talaromyces-specific primer sets. The detection limit for each species-specific primer set was determined as being 50 pg of template DNA, without using a nested PCR method. The specificity of each species-specific primer set was maintained in the presence of 1,000-fold amounts of genomic DNA from other fungi. The method also detected fungal DNA extracted from blueberry inoculated with T. macrosporus. This PCR method provides a quick, simple, powerful and reliable way to detect T. macrosporus and T. trachyspermus. Polymerase chain reaction (PCR)-based detection is rapid, convenient and sensitive compared with traditional methods of detecting heat-resistant fungi. In this study, a PCR-based method was developed for the detection and identification of amplification products from Talaromyces macrosporus and Talaromyces trachyspermus using primer sets that target the isocitrate lyase gene. This method could be used for the on-site detection of T. macrosporus and T. trachyspermus in the near future, and will be helpful in the safety control of raw materials and in food and beverage production. © 2017 The Authors. Letters in Applied Microbiology published by John Wiley & Sons Ltd on behalf of The Society for Applied Microbiology.
Jaiswal, Sarika; Sheoran, Sonia; Arora, Vasu; Angadi, Ulavappa B; Iquebal, Mir A; Raghav, Nishu; Aneja, Bharti; Kumar, Deepender; Singh, Rajender; Sharma, Pradeep; Singh, G P; Rai, Anil; Tiwari, Ratan; Kumar, Dinesh
2017-01-01
Wheat fulfills 20% of global caloric requirement. World needs 60% more wheat for 9 billion population by 2050 but climate change with increasing temperature is projected to affect wheat productivity adversely. Trait improvement and management of wheat germplasm requires genomic resource. Simple Sequence Repeats (SSRs) being highly polymorphic and ubiquitously distributed in the genome, can be a marker of choice but there is no structured marker database with options to generate primer pairs for genotyping on desired chromosome/physical location. Previously associated markers with different wheat trait are also not available in any database. Limitations of in vitro SSR discovery can be overcome by genome-wide in silico mining of SSR. Triticum aestivum SSR database ( TaSSRDb ) is an integrated online database with three-tier architecture, developed using PHP and MySQL and accessible at http://webtom.cabgrid.res.in/wheatssr/. For genotyping, Primer3 standalone code computes primers on user request. Chromosome-wise SSR calling for all the three sub genomes along with choice of motif types is provided in addition to the primer generation for desired marker. We report here a database of highest number of SSRs (476,169) from complex, hexaploid wheat genome (~17 GB) along with previously reported 268 SSR markers associated with 11 traits. Highest (116.93 SSRs/Mb) and lowest (74.57 SSRs/Mb) SSR densities were found on 2D and 3A chromosome, respectively. To obtain homozygous locus, e-PCR was done. Such 30 loci were randomly selected for PCR validation in panel of 18 wheat Advance Varietal Trial (AVT) lines. TaSSRDb can be a valuable genomic resource tool for linkage mapping, gene/QTL (Quantitative trait locus) discovery, diversity analysis, traceability and variety identification. Varietal specific profiling and differentiation can supplement DUS (Distinctiveness, Uniformity, and Stability) testing, EDV (Essentially Derived Variety)/IV (Initial Variety) disputes, seed purity and hybrid wheat testing. All these are required in germplasm management as well as also in the endeavor of wheat productivity.
Jaiswal, Sarika; Sheoran, Sonia; Arora, Vasu; Angadi, Ulavappa B.; Iquebal, Mir A.; Raghav, Nishu; Aneja, Bharti; Kumar, Deepender; Singh, Rajender; Sharma, Pradeep; Singh, G. P.; Rai, Anil; Tiwari, Ratan; Kumar, Dinesh
2017-01-01
Wheat fulfills 20% of global caloric requirement. World needs 60% more wheat for 9 billion population by 2050 but climate change with increasing temperature is projected to affect wheat productivity adversely. Trait improvement and management of wheat germplasm requires genomic resource. Simple Sequence Repeats (SSRs) being highly polymorphic and ubiquitously distributed in the genome, can be a marker of choice but there is no structured marker database with options to generate primer pairs for genotyping on desired chromosome/physical location. Previously associated markers with different wheat trait are also not available in any database. Limitations of in vitro SSR discovery can be overcome by genome-wide in silico mining of SSR. Triticum aestivum SSR database (TaSSRDb) is an integrated online database with three-tier architecture, developed using PHP and MySQL and accessible at http://webtom.cabgrid.res.in/wheatssr/. For genotyping, Primer3 standalone code computes primers on user request. Chromosome-wise SSR calling for all the three sub genomes along with choice of motif types is provided in addition to the primer generation for desired marker. We report here a database of highest number of SSRs (476,169) from complex, hexaploid wheat genome (~17 GB) along with previously reported 268 SSR markers associated with 11 traits. Highest (116.93 SSRs/Mb) and lowest (74.57 SSRs/Mb) SSR densities were found on 2D and 3A chromosome, respectively. To obtain homozygous locus, e-PCR was done. Such 30 loci were randomly selected for PCR validation in panel of 18 wheat Advance Varietal Trial (AVT) lines. TaSSRDb can be a valuable genomic resource tool for linkage mapping, gene/QTL (Quantitative trait locus) discovery, diversity analysis, traceability and variety identification. Varietal specific profiling and differentiation can supplement DUS (Distinctiveness, Uniformity, and Stability) testing, EDV (Essentially Derived Variety)/IV (Initial Variety) disputes, seed purity and hybrid wheat testing. All these are required in germplasm management as well as also in the endeavor of wheat productivity. PMID:29234333
Yeh, W B; Tseng, M J; Chang, N T; Wu, S Y; Tsai, Y S
2014-10-01
While morphological identification of thrips species has been difficult because of their minute size and a lack of easily recognizable characteristics, molecular identification based on the development of specific molecular markers can be easily and reliably carried out. Among the known molecular markers, the nuclear internal transcribed spacer (ITS) exhibits distinguishable variations among thrips species. In this study, sequences of ITS2 region of 10 agriculturally important thrips were established to design species-specific primers for polymerase chain reaction (PCR). ITS2 sequence variations within these species were far less than those among species, indicating the suitability of this marker for species-specific primers design. These primers, though with one or two sporadically variable positions, showed a good efficacy within species. The specificity of these primers, examined on thrips species belonging to 15 genera, proved satisfactory. Furthermore, a multiplex PCR was used successfully for identifying Frankliniella occidentalis (Pergande), an insect pest monitored for quarantine purpose, and three additional thrips also commonly found in imported agricultural products and field samples, i.e., Thrips tabaci Lindeman, Thrips hawaiiensis (Morgan), and Frankliniella intonsa (Trybom). This study has demonstrated that specific primers and multiplex PCR based on ITS2 are reliable, convenient, and diagnostic tool to discriminate thrips species of quarantine and agricultural importance. © 2014 Entomological Society of America.
Sex identification of four penguin species using locus-specific PCR.
Zhang, Peijun; Han, Jiabo; Liu, Quansheng; Zhang, Junxin; Zhang, Xianfeng
2013-01-01
Traditional methods for sex identification are not applicable to sexually monomorphic species, leading to difficulties in the management of their breeding programs. To identify sex in sexually monomorphic birds, molecular methods have been established. Two established primer pairs (2550F/2718R and p8/p2) amplify the CHD1 gene region from both the Z and W chromosomes. Here, we evaluated the use of these primers for sex identification in four sexually monomorphic penguin species: king penguins (Aptenodytes patagonicus), rockhopper penguins (Eudyptes chrysocome), gentoo penguins (Pygoscelis papua), and Magellanic penguins (Spheniscus magellanicus). For all species except rockhopper penguins, primer pair 2550F/2718R resulted in two distinct CHD1Z and CHD1W PCR bands, allowing for sex identification. For rockhopper penguins, only primer pair p8/p2 yielded different CHD1Z and CHD1W bands, which were faint and similar in size making them difficult to distinguish. As a result, we designed a new primer pair (PL/PR) that efficiently determined the gender of individuals from all four penguin species. Sequencing of the PCR products confirmed that they were from the CHD1 gene region. Primer pair PL/PR can be evaluated for use in sexing other penguin species, which will be crucial for the management of new penguin breeding programs. © 2012 Wiley Periodicals, Inc.
Ulrich, Ricky L; Ulrich, Melanie P; Schell, Mark A; Kim, H Stanley; DeShazer, David
2006-05-01
Burkholderia mallei and Burkholderia pseudomallei, the etiologic agents responsible for glanders and melioidosis, respectively, are genetically and phenotypically similar and are category B biothreat agents. We used an in silico approach to compare the B. mallei ATCC 23344 and B. pseudomallei K96243 genomes to identify nucleotide sequences unique to B. mallei. Five distinct B. mallei DNA sequences and/or genes were identified and evaluated for polymerase chain reaction (PCR) assay development. Genomic DNAs from a collection of 31 B. mallei and 34 B. pseudomallei isolates, obtained from various geographic, clinical, and environmental sources over a 70-year period, were tested with PCR primers targeted for each of the B. mallei ATCC 23344-specific nucleotide sequences. Of the 5 chromosomal targets analyzed, only PCR primers designed to bimA(Bm) were specific for B. mallei. These primers were used to develop a rapid PCR assay for the definitive identification of B. mallei and differentiation from all other bacteria.
Hammond, R W; Crosslin, J M; Pasini, R; Howell, W E; Mink, G I
1999-07-01
Prunus necrotic ringspot ilarvirus (PNRSV) exists as a number of biologically distinct variants which differ in host specificity, serology, and pathology. Previous nucleotide sequence alignment and phylogenetic analysis of cloned reverse transcription-polymerase chain reaction (RT-PCR) products of several biologically distinct sweet cherry isolates revealed correlations between symptom type and the nucleotide and amino acid sequences of the 3a (putative movement protein) and 3b (coat protein) open reading frames. Based upon this analysis, RT-PCR assays have been developed that can identify isolates displaying different symptoms and serotypes. The incorporation of primers in a multiplex PCR protocol permits rapid detection and discrimination among the strains. The results of PCR amplification using type-specific primers that amplify a portion of the coat protein gene demonstrate that the primer-selection procedure developed for PNRSV constitutes a reliable method of viral strain discrimination in cherry for disease control and will also be useful for examining biological diversity within the PNRSV virus group.
do Carmo Teixeira, Diva; Luc Danet, Jean; Eveillard, Sandrine; Cristina Martins, Elaine; de Jesus Junior, Waldir Cintra; Takao Yamamoto, Pedro; Aparecido Lopes, Silvio; Beozzo Bassanezi, Renato; Juliano Ayres, Antonio; Saillard, Colette; Bové, Joseph Marie
2005-06-01
Symptoms of huanglongbing (HLB), one of the most serious diseases of citrus in Asia and Africa, have been noticed in March 2004 in the Araraquara region of São Paulo State, Brazil. HLB has not been reported previously from America. The causal HLB bacteria, Candidatus Liberibacter africanus in Africa and Candidatus Liberibacter asiaticus in Asia, can be detected in symptomatic citrus leaves by PCR amplification of their 16S rDNA with previously described primers. When this technique was applied to 43 symptomatic leaf samples from the Araraquara region, all PCR reactions were negative. This suggested that a new pathogen, not detected by the above primers, could be involved in HLB in the State of São Paulo. Indeed, by using universal primers for amplification of bacterial 16S rDNA, a new liberibacter species, Candidatus Liberibacter americanus, has recently been identified. Specific primers for PCR amplification of the 16S rDNA of Ca. L. americanus have been selected. Using these primers, the new liberibacter could be detected in 214 symptomatic leaf samples tested. The leaves of two additional samples were infected with Candidatus Liberibacter asiaticus, and two further samples contained both Ca. L. americanus and Ca. L. asiaticus. The samples came from 47 farms in 35 municipalities. The psyllid vector of Ca. L. asiaticus, Diaphorina citri, is established in South, Central, and North America (Florida and Texas). Ca. L. americanus could be detected by PCR in several batches of D. citri psyllids collected on symptomatic sweet orange trees infected with Ca. L. americanus, strongly suggesting that D. citri is the vector of Ca. L. americanus. The results reported here confirm the presence of HLB in the State of São Paulo. Ca. L. americanus is the most widely distributed pathogen.
Nasr Esfahani, Bahram; Rezaei Yazdi, Hadi; Moghim, Sharareh; Ghasemian Safaei, Hajieh; Zarkesh Esfahani, Hamid
2012-11-01
Rapid and accurate identification of mycobacteria isolates from primary culture is important due to timely and appropriate antibiotic therapy. Conventional methods for identification of Mycobacterium species based on biochemical tests needs several weeks and may remain inconclusive. In this study, a novel multiplex real-time PCR was developed for rapid identification of Mycobacterium genus, Mycobacterium tuberculosis complex (MTC) and the most common non-tuberculosis mycobacteria species including M. abscessus, M. fortuitum, M. avium complex, M. kansasii, and the M. gordonae in three reaction tubes but under same PCR condition. Genetic targets for primer designing included the 16S rDNA gene, the dnaJ gene, the gyrB gene and internal transcribed spacer (ITS). Multiplex real-time PCR was setup with reference Mycobacterium strains and was subsequently tested with 66 clinical isolates. Results of multiplex real-time PCR were analyzed with melting curves and melting temperature (T (m)) of Mycobacterium genus, MTC, and each of non-tuberculosis Mycobacterium species were determined. Multiplex real-time PCR results were compared with amplification and sequencing of 16S-23S rDNA ITS for identification of Mycobacterium species. Sensitivity and specificity of designed primers were each 100 % for MTC, M. abscessus, M. fortuitum, M. avium complex, M. kansasii, and M. gordonae. Sensitivity and specificity of designed primer for genus Mycobacterium was 96 and 100 %, respectively. According to the obtained results, we conclude that this multiplex real-time PCR with melting curve analysis and these novel primers can be used for rapid and accurate identification of genus Mycobacterium, MTC, and the most common non-tuberculosis Mycobacterium species.
Söderlund-Strand, Anna; Carlson, Joyce; Dillner, Joakim
2009-03-01
Human papillomavirus (HPV) infection is a necessary cause of cervical cancer and cervical dysplasia. Accurate and sensitive genotyping of multiple oncogenic HPVs is essential for a multitude of both clinical and research uses. We developed a modified general primer (MGP) PCR system with five forward and five reverse consensus primers. The MGP system was compared to the classical HPV general primer system GP5+/6+ using a proficiency panel with HPV plasmid dilutions as well as cervical samples from 592 women with low-grade cytological abnormalities. The reference method (GP5+/6+) had the desirable high sensitivity (five copies/PCR) for five oncogenic HPV types (HPV type 16 [HPV-16], HPV-18, HPV-56, HPV-59, and HPV-66). The MGP system was able to detect all 14 oncogenic HPV types at five copies/PCR. In the clinical samples, the MGP system detected a significantly higher proportion of women with more than two concomitant HPV infections than did the GP5+/6+ system (102/592 women compared to 42/592 women). MGP detected a significantly greater number of infections with HPV-16, -18, -31, -33, -35, -39, -42, -43, -45, -51, -52, -56, -58, and -70 than did GP5+/6+. In summary, the MGP system primers allow a more sensitive amplification of most of the HPV types that are established as oncogenic and had an improved ability to detect multiple concomitant HPV infections.
Arif, M.; Aguilar-Moreno, G. S.; Wayadande, A.; Fletcher, J.
2014-01-01
A high consequence pathogen, High plains virus (HPV) causes considerable damage to wheat if the crop is infected during early stages of development. Methods for the early, accurate, and sensitive detection of HPV in plant tissues are needed for the management of disease outbreaks and reservoir hosts. In this study, the effectiveness of five methods—real-time SYBR green and TaqMan reverse transcription-quantitative PCR (RT-qPCR), endpoint RT-PCR, RT-helicase dependent amplification (RT-HDA) and the Razor Ex BioDetection System (Razor Ex)—for the broad-range detection of HPV variants was evaluated. Specific PCR primer sets and probes were designed to target the HPV nucleoprotein gene. Primer set HPV6F and HPV4R, which amplifies a product of 96 bp, was validated in silico against published sequences and in vitro against an inclusivity panel of infected plant samples and an exclusivity panel of near-neighbor viruses. The primers were modified by adding a customized 22 nucleotide long tail at the 5′ terminus, raising the primers' melting temperature (Tm; ca. 10°C) to make them compatible with RT-HDA (required optimal Tm = 68°C), in which the use of primers lacking such tails gave no amplification. All of the methods allowed the detection of as little as 1 fg of either plasmid DNA carrying the target gene sequence or of infected plant samples. The described in vitro and in-field assays are accurate, rapid, sensitive, and useful for pathogen detection and disease diagnosis, microbial quantification, and certification and breeding programs, as well as for biosecurity and microbial forensics applications. PMID:24162574
Ikenaga, Makoto; Tabuchi, Masakazu; Kawauchi, Tomohiro; Sakai, Masao
2016-01-01
The simultaneous extraction of host plant DNA severely limits investigations of the community structures of plant–associated fungi due to the similar homologies of sequences in primer–annealing positions between fungi and host plants. Although fungal-specific primers have been designed, plant DNA continues to be excessively amplified by PCR, resulting in the underestimation of community structures. In order to overcome this limitation, locked nucleic acid (LNA) primers and PCR clamping by LNA oligonucleotides have been applied to enhance the amplification of fungal internal transcribed spacer (ITS) regions. LNA primers were designed by converting DNA into LNA, which is specific to fungi, at the forward primer side. LNA oligonucleotides, the sequences of which are complementary to the host plants, were designed by overlapping a few bases with the annealing position of the reverse primer. Plant-specific DNA was then converted into LNA at the shifted position from the 3′ end of the primer–binding position. PCR using the LNA technique enhanced the amplification of fungal ITS regions, whereas those of the host plants were more likely to be amplified without the LNA technique. A denaturing gradient gel electrophoresis (DGGE) analysis displayed patterns that reached an acceptable level for investigating the community structures of plant–associated fungi using the LNA technique. The sequences of the bands detected using the LNA technique were mostly affiliated with known isolates. However, some sequences showed low similarities, indicating the potential to identify novel fungi. Thus, the application of the LNA technique is considered effective for widening the scope of community analyses of plant–associated fungi. PMID:27600711
DOE Office of Scientific and Technical Information (OSTI.GOV)
Christensen, Geoff A.; Wymore, Ann M.; King, Andrew J.
Two genes, hgcA and hgcB, are essential for microbial mercury (Hg)-methylation. Detection and estimation of their abundance, in conjunction with Hg concentration, bioavailability and biogeochemistry is critical in determining potential hot spots of methylmercury (MeHg) generation in at-risk environments. We developed broad-range degenerate PCR primers spanning known hgcAB genes to determine the presence of both genes in diverse environments. These primers were tested against an extensive set of pure cultures with published genomes, including 13 Deltaproteobacteria, nine Firmicutes, and nine methanogenic Archaea. A distinct PCR product at the expected size was confirmed for all hgcAB+ strains tested via Sanger sequencing.more » Additionally, we developed clade-specific degenerate quantitative primers (qPCR) that targeted hgcA for each of the three dominant Hg-methylating clades. The clade-specific qPCR primers amplified hgcA from 64%, 88% and 86% of tested pure cultures of Deltaproteobacteria, Firmicutes and Archaea, respectively, and were highly specific for each clade. Amplification efficiencies and detection limits were quantified for each organism. Primer sensitivity varied among species based on sequence conservation. Finally, to begin to evaluate the utility of our primer sets in nature, we tested hgcA and hgcAB recovery from pure cultures spiked into sand and soil. These novel quantitative molecular tools designed in this study will allow for more accurate identification and quantification of the individual Hg-methylating groups of microorganisms in the environment. Here, the resulting data will be essential in developing accurate and robust predictive models of Hg-methylation potential, ideally integrating the geochemistry of Hg methylation to the microbiology and genetics of hgcAB.« less
Christensen, Geoff A.; Wymore, Ann M.; King, Andrew J.; ...
2016-07-15
Two genes, hgcA and hgcB, are essential for microbial mercury (Hg)-methylation. Detection and estimation of their abundance, in conjunction with Hg concentration, bioavailability and biogeochemistry is critical in determining potential hot spots of methylmercury (MeHg) generation in at-risk environments. We developed broad-range degenerate PCR primers spanning known hgcAB genes to determine the presence of both genes in diverse environments. These primers were tested against an extensive set of pure cultures with published genomes, including 13 Deltaproteobacteria, nine Firmicutes, and nine methanogenic Archaea. A distinct PCR product at the expected size was confirmed for all hgcAB+ strains tested via Sanger sequencing.more » Additionally, we developed clade-specific degenerate quantitative primers (qPCR) that targeted hgcA for each of the three dominant Hg-methylating clades. The clade-specific qPCR primers amplified hgcA from 64%, 88% and 86% of tested pure cultures of Deltaproteobacteria, Firmicutes and Archaea, respectively, and were highly specific for each clade. Amplification efficiencies and detection limits were quantified for each organism. Primer sensitivity varied among species based on sequence conservation. Finally, to begin to evaluate the utility of our primer sets in nature, we tested hgcA and hgcAB recovery from pure cultures spiked into sand and soil. These novel quantitative molecular tools designed in this study will allow for more accurate identification and quantification of the individual Hg-methylating groups of microorganisms in the environment. Here, the resulting data will be essential in developing accurate and robust predictive models of Hg-methylation potential, ideally integrating the geochemistry of Hg methylation to the microbiology and genetics of hgcAB.« less
Sorensen, Darwin L.; Dupont, R. Ryan
2016-01-01
ABSTRACT The extent of arsenic contamination in drinking water and its potential threat to human health have resulted in considerable research interest in the microbial species responsible for arsenic reduction. The arsenate reductase gene (arrA), an important component of the microbial arsenate reduction system, has been widely used as a biomarker to study arsenate-reducing microorganisms. A new primer pair was designed and evaluated for quantitative PCR (qPCR) and high-throughput sequencing of the arrA gene, because currently available PCR primers are not suitable for these applications. The primers were evaluated in silico and empirically tested for amplification of arrA genes in clones and for amplification and high-throughput sequencing of arrA genes from soil and groundwater samples. In silico, this primer pair matched (≥90% DNA identity) 86% of arrA gene sequences from GenBank. Empirical evaluation showed successful amplification of arrA gene clones of diverse phylogenetic groups, as well as amplification and high-throughput sequencing of independent soil and groundwater samples without preenrichment, suggesting that these primers are highly specific and can amplify a broad diversity of arrA genes. The arrA gene diversity from soil and groundwater samples from the Cache Valley Basin (CVB) in Utah was greater than anticipated. We observed a significant correlation between arrA gene abundance, quantified through qPCR, and reduced arsenic (AsIII) concentrations in the groundwater samples. Furthermore, we demonstrated that these primers can be useful for studying the diversity of arsenate-reducing microbial communities and the ways in which their relative abundance in groundwater may be associated with different groundwater quality parameters. IMPORTANCE Arsenic is a major drinking water contaminant that threatens the health of millions of people worldwide. The extent of arsenic contamination and its potential threat to human health have resulted in considerable interest in the study of microbial species responsible for the reduction of arsenic, i.e., the conversion of AsV to AsIII. In this study, we developed a new primer pair to evaluate the diversity and abundance of arsenate-reducing microorganisms in soil and groundwater samples from the CVB in Utah. We observed significant arrA gene diversity in the CVB soil and groundwater samples, and arrA gene abundance was significantly correlated with the reduced arsenic (AsIII) concentrations in the groundwater samples. We think that these primers are useful for studying the ecology of arsenate-reducing microorganisms in different environments. PMID:27913413
Lee, Chang Soo; Lee, Jiyoung
2010-09-01
A rapid and specific gyrB-based real-time PCR system has been developed for detecting Bacteroides fragilis as a human-specific marker of fecal contamination. Its specificity and sensitivity was evaluated by comparison with other 16S rRNA gene-based primers using closely related Bacteroides and Prevotella. Many studies have used 16S rRNA gene-based method targeting Bacteroides because this genus is relatively abundant in human feces and is useful for microbial source tracking. However, 16S rRNA gene-based primers are evolutionarily too conserved among taxa to discriminate between human-specific species of Bacteroides and other closely related genera, such as Prevotella. Recently, one of the housekeeping genes, gyrB, has been used as an alternative target in multilocus sequence analysis (MLSA) to provide greater phylogenetic resolution. In this study, a new B. fragilis-specific primer set (Bf904F/Bf958R) was designed by alignments of 322 gyrB genes and was compared with the performance of the 16S rRNA gene-based primers in the presence of B. fragilis, Bacteroides ovatus and Prevotella melaninogenica. Amplicons were sequenced and a phylogenetic tree was constructed to confirm the specificity of the primers to B. fragilis. The gyrB-based primers successfully discriminated B. fragilis from B. ovatus and P. melaninogenica. Real-time PCR results showed that the gyrB primer set had a comparable sensitivity in the detection of B. fragilis when compared with the 16S rRNA primer set. The host-specificity of our gyrB-based primer set was validated with human, pig, cow, and dog fecal samples. The gyrB primer system had superior human-specificity. The gyrB-based system can rapidly detect human-specific fecal source and can be used for improved source tracking of human contamination. (c) 2010 Elsevier B.V. All rights reserved.
Diagnosis and molecular characterization of Trichomonas vaginalis in sex workers in the Philippines
Queza, Macario Ireneo P; Rivera, Windell L
2013-01-01
Trichomonas vaginalis is a pathogenic protozoon which causes the sexually transmitted infection, trichomoniasis. The absence or non-specificity of symptoms often leads to misdiagnosis of the infection. In this study, 969 samples consisting of vaginal swabs and urine were collected and screened from social hygiene clinics across the Philippines. Of the 969 samples, 216 were used for the comparative analysis of diagnostic tools such as wet mount microscopy, culture, and PCR utilizing universal trichomonad primers, TFR1/2 and species-specific primers, TVK3/7 and TV1/2. PCR demonstrated higher sensitivity of 100% compared to 77% of the wet mount. PCR primer set TVK3/7 and culture had the same and the best expected average performance [receiver-operating characteristic (ROC): 0.98]. Prevalence of infection in the sample population was 6.8%. PMID:23683368
Development of the polymerase chain reaction for diagnosis of chancroid.
Chui, L; Albritton, W; Paster, B; Maclean, I; Marusyk, R
1993-01-01
The published nucleotide sequences of the 16S rRNA gene of Haemophilus ducreyi were used to develop primer sets and probes for the diagnosis of chancroid by polymerase chain reaction (PCR) DNA amplification. One set of broad specificity primers yielded a 303-bp PCR product from all bacteria tested. Two 16-base probes internal to this sequence were species specific for H. ducreyi when tested with 12 species of the families Pasteurellaceae and Enterobacteriaceae. The two probes in combination with the broad specificity primers were 100% sensitive with 51 strains of H. ducreyi isolated from six continents over a 15-year period. The direct detection of H. ducreyi from 100 clinical specimens by PCR showed a sensitivity of 83 to 98% and a specificity of 51 to 67%, depending on the number of amplification cycles. Images PMID:8458959
Chang, Hsueh-Wei; Cheng, Chun-An; Gu, De-Leung; Chang, Chia-Che; Su, San-Hua; Wen, Cheng-Hao; Chou, Yii-Cheng; Chou, Ta-Ching; Yao, Cheng-Te; Tsai, Chi-Li; Cheng, Chien-Chung
2008-02-12
Combination of CHD (chromo-helicase-DNA binding protein)-specific polymerase chain reaction (PCR) with electrophoresis (PCR/electrophoresis) is the most common avian molecular sexing technique but it is lab-intensive and gel-required. Gender determination often fails when the difference in length between the PCR products of CHD-Z and CHD-W genes is too short to be resolved. Here, we are the first to introduce a PCR-melting curve analysis (PCR/MCA) to identify the gender of birds by genomic DNA, which is gel-free, quick, and inexpensive. Spilornis cheela hoya (S. c. hoya) and Pycnonotus sinensis (P. sinensis) were used to illustrate this novel molecular sexing technique. The difference in the length of CHD genes in S. c. hoya and P. sinensis is 13-, and 52-bp, respectively. Using Griffiths' P2/P8 primers, molecular sexing failed both in PCR/electrophoresis of S. c. hoya and in PCR/MCA of S. c. hoya and P. sinensis. In contrast, we redesigned sex-specific primers to yield 185- and 112-bp PCR products for the CHD-Z and CHD-W genes of S. c. hoya, respectively, using PCR/MCA. Using this specific primer set, at least 13 samples of S. c. hoya were examined simultaneously and the Tm peaks of CHD-Z and CHD-W PCR products were distinguished. In this study, we introduced a high-throughput avian molecular sexing technique and successfully applied it to two species. This new method holds a great potential for use in high throughput sexing of other avian species, as well.
Komaki-Yasuda, Kanako; Vincent, Jeanne Perpétue; Nakatsu, Masami; Kato, Yasuyuki; Ohmagari, Norio; Kano, Shigeyuki
2018-01-01
A microscopy-based diagnosis is the gold standard for the detection and identification of malaria parasites in a patient's blood. However, the detection of cases involving a low number of parasites and the differentiation of species sometimes requires a skilled microscopist. Although PCR-based diagnostic methods are already known to be very powerful tools, the time required to apply such methods is still much longer in comparison to traditional microscopic observation. Thus, improvements to PCR systems are sought to facilitate the more rapid and accurate detection of human malaria parasites Plasmodium falciparum, P. vivax, P. ovale, and P. malariae, as well as P. knowlesi, which is a simian malaria parasite that is currently widely distributed in Southeast Asia. A nested PCR that targets the small subunit ribosomal RNA genes of malaria parasites was performed using a "fast PCR enzyme". In the first PCR, universal primers for all parasite species were used. In the second PCR, inner-specific primers, which targeted sequences from P. falciparum, P. vivax, P. ovale, P. malariae, and P. knowlesi, were used. The PCR reaction time was reduced with the use of the "fast PCR enzyme", with only 65 minutes required to perform the first and second PCRs. The specific primers only reacted with the sequences of their targeted parasite species and never cross-reacted with sequences from other species under the defined PCR conditions. The diagnoses of 36 clinical samples that were obtained using this new PCR system were highly consistent with the microscopic diagnoses.
Komaki-Yasuda, Kanako; Vincent, Jeanne Perpétue; Nakatsu, Masami; Kato, Yasuyuki; Ohmagari, Norio
2018-01-01
A microscopy-based diagnosis is the gold standard for the detection and identification of malaria parasites in a patient’s blood. However, the detection of cases involving a low number of parasites and the differentiation of species sometimes requires a skilled microscopist. Although PCR-based diagnostic methods are already known to be very powerful tools, the time required to apply such methods is still much longer in comparison to traditional microscopic observation. Thus, improvements to PCR systems are sought to facilitate the more rapid and accurate detection of human malaria parasites Plasmodium falciparum, P. vivax, P. ovale, and P. malariae, as well as P. knowlesi, which is a simian malaria parasite that is currently widely distributed in Southeast Asia. A nested PCR that targets the small subunit ribosomal RNA genes of malaria parasites was performed using a “fast PCR enzyme”. In the first PCR, universal primers for all parasite species were used. In the second PCR, inner-specific primers, which targeted sequences from P. falciparum, P. vivax, P. ovale, P. malariae, and P. knowlesi, were used. The PCR reaction time was reduced with the use of the “fast PCR enzyme”, with only 65 minutes required to perform the first and second PCRs. The specific primers only reacted with the sequences of their targeted parasite species and never cross-reacted with sequences from other species under the defined PCR conditions. The diagnoses of 36 clinical samples that were obtained using this new PCR system were highly consistent with the microscopic diagnoses. PMID:29370297
Reid, Scott M; Mioulet, Valerie; Knowles, Nick J; Shirazi, Nazeem; Belsham, Graham J; King, Donald P
2014-10-01
Rapid and accurate diagnosis is essential for effective control of foot-and-mouth disease (FMD). In countries where FMD is endemic, identification of the serotypes of the causative virus strains is important for vaccine selection and tracing the source of outbreaks. In this study, real-time reverse transcription polymerase chain reaction (rRT-PCR) assays using primer/probe sets designed from the VP1 coding region of the virus genomes were developed for the specific detection of serotype O, A and Asia-1 FMD viruses (FMDVs) circulating in the Middle East. These assays were evaluated using representative field samples of serotype O strains belonging exclusively to the PanAsia-2 lineage, serotype A strains of the Iran-05 lineage and serotype Asia-1 viruses from three relevant sub-groups. When RNA extracted from archival and contemporary field strains was tested using one- or two-step rRT-PCR assays, all three primer/probe sets detected the RNA from homotypic viruses and no cross-reactivity was observed with heterotypic viruses. Similar results were obtained using both single- and multiplex assay formats. Using plasmid standards, the minimum detection level of these tests was found to be lower than two copies. The results illustrate the potential of tailored rRT-PCR tools for the detection and categorization of viruses circulating in the Middle East belonging to distinct subgroups of serotypes O, A and Asia-1. These assays can also overcome the problem of serotyping samples which are found positive by the generic rRT-PCR diagnostic assays but negative by virus isolation and antigen-detection ELISA which would otherwise have to be serotyped by nucleotide sequencing. A similar approach could be used to develop serotyping assays for FMDV strains circulating in other regions of the world. Copyright © 2014 The Authors. Published by Elsevier B.V. All rights reserved.
Frisk, A. L.; König, M.; Moritz, A.; Baumgärtner, W.
1999-01-01
Reverse transcription-PCR (RT-PCR) was used to detect canine distemper virus (CDV) nucleoprotein (NP) RNA in serum, whole blood, and cerebrospinal fluid (CSF) samples from 38 dogs with clinically suspected distemper. Results were correlated to clinical findings, anti-CDV neutralizing antibody titers, postmortem findings, and demonstration of CDV NP antigen by immunohistochemistry. The specificity of the RT-PCR was ensured by amplification of RNA from various laboratory CDV strains, restriction enzyme digestion, and Southern blot hybridization. In 29 of 38 dogs, CDV infection was confirmed by postmortem examination and immunohistochemistry. The animals displayed the catarrhal, systemic, and nervous forms of distemper. Seventeen samples (serum, whole blood, or CSF) from dogs with distemper were tested with three sets of primers targeted to different regions of the NP gene of the CDV Onderstepoort strain. Expected amplicons were observed in 82, 53, and 41% of the 17 samples, depending upon the primer pair used. With the most sensitive primer pair (primer pair I), CDV NP RNA was detected in 25 of 29 (86%) serum samples and 14 of 16 (88%) whole blood and CSF samples from dogs with distemper but not in body fluids from immunohistochemically negative dogs. Nucleotide sequence analysis of five RT-PCR amplicons from isolates from the field revealed few silent point mutations. These isolates exhibited greater homology to the Rockborn (97 to 99%) than to the Onderstepoort (95 to 96%) CDV strain. In summary, although the sensitivity of the RT-PCR for detection of CDV is strongly influenced by the location of the selected primers, this nucleic acid detection system represents a highly specific and sensitive method for the antemortem diagnosis of distemper in dogs, regardless of the form of distemper, humoral immune response, and viral antigen distribution. PMID:10523566
Wang, Xiaoyu; Seo, Dong Joo; Lee, Min Hwa
2014-01-01
This study aimed to develop a loop-mediated isothermal amplification (LAMP) method for the rapid detection of Arcobacter species. Specific primers targeting the 23S ribosomal RNA gene were used to detect Arcobacter butzleri, Arcobacter cryaerophilus, and Arcobacter skirrowii. The specificity of the LAMP primer set was assessed using DNA samples from a panel of Arcobacter and Campylobacter species, and the sensitivity was determined using serial dilutions of Arcobacter species cultures. LAMP showed a 10- to 1,000-fold-higher sensitivity than multiplex PCR, with a detection limit of 2 to 20 CFU per reaction in vitro. Whereas multiplex PCR showed cross-reactivity with Campylobacter species, the LAMP method developed in this study was more sensitive and reliable than conventional PCR or multiplex PCR for the detection of Arcobacter species. PMID:24478488
Simplified PCR for detection of Haemophilus ducreyi and diagnosis of chancroid.
West, B; Wilson, S M; Changalucha, J; Patel, S; Mayaud, P; Ballard, R C; Mabey, D
1995-01-01
A simplified PCR was developed for detection of Haemophilus ducreyi in samples from chancroid patients. The strategy included a straightforward chloroform extraction sample preparation method, a one-tube nested PCR to minimize contamination risks, and a colorimetric method for detection of products. Primers were designed from published nucleotide sequences of the 16S rRNA gene of H. ducreyi, with longer outer primers for annealing at a higher temperature and shorter inner primers labelled with biotin and digoxigenin for binding with avidin and colorimetric detection. The PCR technique detected all 35 strains of H. ducreyi tested, from four different geographical regions, and was negative for other, related strains of bacteria and for the common contaminating bacteria tested. Of 25 samples from H. ducreyi culture-positive chancroid patients, 24 were PCR positive and 1 produced a weak reaction. Of 83 samples from clinical cases of chancroid in the Republic of South Africa, 69 were PCR positive. The sensitivity of PCR compared with that of clinical diagnosis was 83%. All 50 negative control samples were negative. Encouraging results were also obtained with a consecutive series of 25 genital ulcer patients in Tanzania, of whom 9 were PCR positive. The adaptations of this simplified PCR strategy, at the sensitivity and specificity levels obtained, mean it will be useful for detection of H. ducreyi in areas where the organism is endemic, particularly where testing by culture is difficult or impossible. PMID:7540625
New primers for the detection Leishmania species by multiplex polymerase chain reaction.
Conter, Carolina Cella; Lonardoni, Maria Valdrinez Campana; Aristides, Sandra Mara Alessi; Cardoso, Rosilene Fressatti; Silveira, Thaís Gomes Verzignassi
2018-02-01
Leishmaniasis is caused by protozoa of the Leishmania genus, which is divided into subgenus Viannia and Leishmania. In humans, the course of infection largely depends on the host-parasite relationship and primarily of the infective species. The objective of the present study was to design specific primers to the identification of Leishmania species using multiplex PCR. Four primers were designed, based on the GenBank sequences of the kDNA minicircle, amplifying 127 bp for subgenus Viannia, 100 bp for L. amazonensis, and 60 bp for Leishmania donovani complex and L. major. None of the primers amplified Trypanosoma cruzi or L. mexicana. The limit of detection of multiplex PCR was 2 × 10 -5 parasites for L. braziliensis, 2 x 10 -3 parasites for L. amazonensis, and 1.4 × 10 -3 parasites for L. infantum. The high sensitivity of multiplex PCR was confirmed by the detection of parasites in different biological samples, including lesion scrapings, spleen imprinting of a hamster, sandflies, and blood. The multiplex PCR that was developed herein presented good performance with regard to detecting and identifying the parasite in different biological samples and may thus be useful for diagnosis, decision making with regard to the proper therapeutic approach, and determining the geographic distribution of Leishmania species.
Dalmastri, Claudia; Pirone, Luisa; Tabacchioni, Silvia; Bevivino, Annamaria; Chiarini, Luigi
2005-05-01
In this study, we evaluated if recA species-specific PCR assays could be successfully applied to identify environmental isolates of the widespread Burkholderia cepacia complex (Bcc) species. A total of 729 Bcc rhizosphere isolates collected in different samplings were assigned to the species B. cepacia genomovar I (61), B. cenocepacia recA lineage IIIB (514), B. ambifaria (124) and B. pyrrocinia (30), by means of recA (RFLP) analysis, and PCR tests were performed to assess sensitivity and specificity of recA species-specific primers pairs. B. cepacia genomovar I specific primers produced the expected amplicon with all isolates of the corresponding species (sensitivity, 100%), and cross-reacted with all B. pyrrocinia isolates. On the contrary, B. cenocepacia IIIB primers did not give the expected amplicon in 164 B. cenocepacia IIIB isolates (sensitivity, 68.1%), and isolates of distinct populations showed different sensitivity. B. ambifaria primers failed to amplify a recA-specific fragment only in a few isolates of this species (sensitivity, 93.5%). The absence of specific amplification in a high number of B. cenocepacia rhizosphere isolates indicates that recA specific PCR assays can lead to an underestimation of environmental microorganisms belonging to this bacterial species.
Real-Time PCR (qPCR) Primer Design Using Free Online Software
ERIC Educational Resources Information Center
Thornton, Brenda; Basu, Chhandak
2011-01-01
Real-time PCR (quantitative PCR or qPCR) has become the preferred method for validating results obtained from assays which measure gene expression profiles. The process uses reverse transcription polymerase chain reaction (RT-PCR), coupled with fluorescent chemistry, to measure variations in transcriptome levels between samples. The four most…
Detection of Food Allergens by Taqman Real-Time PCR Methodology.
García, Aina; Madrid, Raquel; García, Teresa; Martín, Rosario; González, Isabel
2017-01-01
Real-time PCR (polymerase chain reaction) has shown to be a very effective technology for the detection of food allergens. The protocol described herein consists on a real-time PCR assay targeting the plant ITS (Internal Transcribed Spacer) region, using species-specific primers and hydrolysis probes (Taqman) dual labeled with a reporter fluorophore at the 5' end (6-carboxyfluorescein, FAM) and a quencher fluorophore at the 3' end (Blackberry, BBQ). The species-specific real-time PCR systems (primers/probe) described in this work allowed the detection of different nuts (peanut, hazelnut, pistachio, almond, cashew, macadamia, walnut and pecan), common allergens present in commercial food products, with a detection limit of 0.1 mg/kg.
Primer-BLAST: A tool to design target-specific primers for polymerase chain reaction
2012-01-01
Background Choosing appropriate primers is probably the single most important factor affecting the polymerase chain reaction (PCR). Specific amplification of the intended target requires that primers do not have matches to other targets in certain orientations and within certain distances that allow undesired amplification. The process of designing specific primers typically involves two stages. First, the primers flanking regions of interest are generated either manually or using software tools; then they are searched against an appropriate nucleotide sequence database using tools such as BLAST to examine the potential targets. However, the latter is not an easy process as one needs to examine many details between primers and targets, such as the number and the positions of matched bases, the primer orientations and distance between forward and reverse primers. The complexity of such analysis usually makes this a time-consuming and very difficult task for users, especially when the primers have a large number of hits. Furthermore, although the BLAST program has been widely used for primer target detection, it is in fact not an ideal tool for this purpose as BLAST is a local alignment algorithm and does not necessarily return complete match information over the entire primer range. Results We present a new software tool called Primer-BLAST to alleviate the difficulty in designing target-specific primers. This tool combines BLAST with a global alignment algorithm to ensure a full primer-target alignment and is sensitive enough to detect targets that have a significant number of mismatches to primers. Primer-BLAST allows users to design new target-specific primers in one step as well as to check the specificity of pre-existing primers. Primer-BLAST also supports placing primers based on exon/intron locations and excluding single nucleotide polymorphism (SNP) sites in primers. Conclusions We describe a robust and fully implemented general purpose primer design tool that designs target-specific PCR primers. Primer-BLAST offers flexible options to adjust the specificity threshold and other primer properties. This tool is publicly available at http://www.ncbi.nlm.nih.gov/tools/primer-blast. PMID:22708584
Detection of canine distemper virus (CDV) through one step RT-PCR combined with nested PCR.
Kim, Y H; Cho, K W; Youn, H Y; Yoo, H S; Han, H R
2001-04-01
A one step reverse transcription PCR (RT-PCR) combined nested PCR was set up to increase efficiency in the diagnosis of canine distemper virus (CDV) infection after developement of nested PCR. Two PCR primer sets were designed based on the sequence of nucleocapsid gene of CDV Onderstepoort strain. One-step RT-PCR with the outer primer pair was revealed to detect 10(2) PFU/ml. The sensitivity was increased hundredfold using the one-step RT-PCR combined with the nested PCR. Specificity of the PCR was also confirmed using other related canine virus and peripheral blood mononuclear cells (PBMC) and body secretes of healthy dogs. Of the 51 blood samples from dogs clinically suspected of CD, 45 samples were revealed as positive by one-step RT-PCR combined with nested PCR. However, only 15 samples were identified as positive with a single one step RT-PCR. Therefore approximately 60% increase in the efficiency of the diagnosis was observed by the combined method. These results suggested that one step RT-PCR combined with nested PCR could be a sensitive, specific, and practical method for diagnosis of CDV infection.
Dong, Jiajia; Vicente, Natallia; Chintauan-Marquier, Ioana C; Ramadi, Cahyo; Dettai, Agnès; Robillard, Tony
2017-05-15
In the present study, we report the high-coverage complete mitochondrial genome (mitogenome) of the cricket Cardiodactylus muiri Otte, 2007. The mitogenome was sequenced using a long-PCR approach on an Ion Torrent Personal Genome Machine (PGM) for next generation sequencing technology. The total length of the amplified mitogenome is 16,328 bp, representing 13 protein-coding genes, 22 transfer RNA genes, two ribosomal RNA genes and one noncoding region (D-loop region). The new sets of long-PCR primers reported here are invaluable resources for future comparative evolutionary genomic studies in Orthopteran insects. The new mitogenome sequence is compared with published cricket mitogenomes. In the taxonomic part, we present new records for the species and describe life-history traits, habitat and male calling song of the species; based on observation of new material, the species Cardiodactylus buru Gorochov & Robillard, 2014 is synonymized under C. muiri.
Maximizing RNA yield from archival renal tumors and optimizing gene expression analysis.
Glenn, Sean T; Head, Karen L; Teh, Bin T; Gross, Kenneth W; Kim, Hyung L
2010-01-01
Formalin-fixed, paraffin-embedded tissues are widely available for gene expression analysis using TaqMan PCR. Five methods, including 4 commercial kits, for recovering RNA from paraffin-embedded renal tumor tissue were compared. The MasterPure kit from Epicentre produced the highest RNA yield. However, the difference in RNA yield between the kit from Epicenter and Invitrogen's TRIzol method was not significant. Using the top 3 RNA isolation methods, the manufacturers' protocols were modified to include an overnight Proteinase K digestion. Overnight protein digestion resulted in a significant increase in RNA yield. To optimize the reverse transcription reaction, conventional reverse transcription with random oligonucleotide primers was compared to reverse transcription using primers specific for genes of interest. Reverse transcription using gene-specific primers significantly increased the quantity of cDNA detectable by TaqMan PCR. Therefore, expression profiling of formalin-fixed, paraffin-embedded tissue using TaqMan qPCR can be optimized by using the MasterPure RNA isolation kit modified to include an overnight Proteinase K digestion and gene-specific primers during the reverse transcription.
Population diversity of ammonium oxidizers investigated by specific PCR amplification
Ward, B.B.; Voytek, M.A.; Witzel, K.-P.
1997-01-01
The species composition of ammonia-oxidizing bacteria in aquatic environments was investigated using PCR primers for 16S rRNA genes to amplify specific subsets of the total ammonia-oxidizer population. The specificity of the amplification reactions was determined using total genomic DNA from known nitrifying strains and non-nitrifying strains identified as having similar rDNA sequences. Specificity of amplification was determined both for direct amplification, using the nitrifier specific primers, and with nested amplification, in which the nitrifier primers were used to reamplify a fragment obtained from direct amplification with Eubacterial universal primers. The present level of specificity allows the distinction between Nitrosomonas europaea, Nitrosomonas sp. (marine) and the other known ammonia-oxidizers in the beta subclass of the Proteobacteria. Using total DNA extracted from natural samples, we used direct amplification to determine presence/absence of different species groups. Species composition was found to differ among depths in vertical profiles of lake samples and among samples and enrichments from various other aquatic environments. Nested PCR yielded several more positive reactions, which implies that nitrifier DNA was present in most samples, but often at very low levels.
Development of a Multiplex PCR Method to Detect Fungal Pathogens for Quarantine on Exported Cacti
Cho, Hyun ji; Hong, Seong Won; Kim, Hyun-ju; Kwak, Youn-Sig
2016-01-01
Major diseases in grafted cacti have been reported and Fusarium oxysporum, Bipolaris cactivora, Phytophthora spp. and Collectotrichum spp. are known as causal pathogens. These pathogens can lead to plant death after infection. Therefore, some European countries have quarantined imported cacti that are infected with specific fungal pathogens. Consequently, we developed PCR detection methods to identify four quarantined fungal pathogens and reduce export rejection rates of Korean grafted cacti. The pathogen specific primer sets F.oF-F.oR, B.CF-B.CR, P.nF-P.nR, and P.cF-P.CR were tested for F. oxysporum, B. cactivora, P. nicotinae, and P. cactorum, respectively. The F.oF-F.oR primer set was designed from the Fusarium ITS region; the B.CF-B.CR and P.nF-P.nR primers respectively from Bipolaris and Phytophthora ITS1; and the P.cF-P.CR primer set from the Ypt1protein gene region. The quarantine fungal pathogen primer pairs were amplified to the specific number of base pairs in each of the following fungal pathogens: 210-bp (F. oxysporum), 510-bp (B. cactivora), 313-bp (P. nicotinae), and 447-bp (P. cactorum). The detection limit for the mono- and multiplex PCR primer sets was 0.1 ng of template DNA under in vitro conditions. Therefore, each primer set successfully diagnosed contamination of quarantine pathogens in export grafted cacti. Consequently, our methodology is a viable tool to screen contamination of the fungal pathogen in exported grafted cacti. PMID:26889115
Maheshwar, P.K.; Moharram, S. Ahmed; Janardhana, G.R.
2009-01-01
The study reports the occurrence of fumonisin producing Fusarium verticillioides in 90 samples of stored paddy (Oryza sativa L.) collected from different geographical regions of Karnataka, India. Fumonisin producing F. verticillioides was identified based on micromorphological characteristics and PCR using two sets of primers. One set of primers was F. verticillioides species specific, which selectively amplified the intergenic space region of rDNA. The other set of primers was specific to fumonisin producing F. verticillioides. Eight paddy samples were positive for F. verticillioides. Eleven isolates obtained from these samples were capable of producing fumonisin. PMID:24031332
Kelm-Nelson, Cynthia A; Stevenson, Sharon A; Ciucci, Michelle R
2016-09-01
Datasets provided in this article represent the Rattus norvegicus primer design and verification used in Pink1 -/- and wildtype Long Evans brain tissue. Accessible tables include relevant information, accession numbers, sequences, temperatures and product length, describing primer design specific to the transcript amplification use. Additionally, results of Sanger sequencing of qPCR reaction products (FASTA aligned sequences) are presented for genes of interest. Results and further interpretation and discussion can be found in the original research article "Atp13a2 expression in the periaqueductal gray is decreased in the Pink1 -/- rat model of Parkinson disease" [1].
Pandey, Ram Vinay; Pulverer, Walter; Kallmeyer, Rainer; Beikircher, Gabriel; Pabinger, Stephan; Kriegner, Albert; Weinhäusel, Andreas
2016-01-01
Bisulfite (BS) conversion-based and methylation-sensitive restriction enzyme (MSRE)-based PCR methods have been the most commonly used techniques for locus-specific DNA methylation analysis. However, both methods have advantages and limitations. Thus, an integrated approach would be extremely useful to quantify the DNA methylation status successfully with great sensitivity and specificity. Designing specific and optimized primers for target regions is the most critical and challenging step in obtaining the adequate DNA methylation results using PCR-based methods. Currently, no integrated, optimized, and high-throughput methylation-specific primer design software methods are available for both BS- and MSRE-based methods. Therefore an integrated, powerful, and easy-to-use methylation-specific primer design pipeline with great accuracy and success rate will be very useful. We have developed a new web-based pipeline, called MSP-HTPrimer, to design primers pairs for MSP, BSP, pyrosequencing, COBRA, and MSRE assays on both genomic strands. First, our pipeline converts all target sequences into bisulfite-treated templates for both forward and reverse strand and designs all possible primer pairs, followed by filtering for single nucleotide polymorphisms (SNPs) and known repeat regions. Next, each primer pairs are annotated with the upstream and downstream RefSeq genes, CpG island, and cut sites (for COBRA and MSRE). Finally, MSP-HTPrimer selects specific primers from both strands based on custom and user-defined hierarchical selection criteria. MSP-HTPrimer produces a primer pair summary output table in TXT and HTML format for display and UCSC custom tracks for resulting primer pairs in GTF format. MSP-HTPrimer is an integrated, web-based, and high-throughput pipeline and has no limitation on the number and size of target sequences and designs MSP, BSP, pyrosequencing, COBRA, and MSRE assays. It is the only pipeline, which automatically designs primers on both genomic strands to increase the success rate. It is a standalone web-based pipeline, which is fully configured within a virtual machine and thus can be readily used without any configuration. We have experimentally validated primer pairs designed by our pipeline and shown a very high success rate of primer pairs: out of 66 BSP primer pairs, 63 were successfully validated without any further optimization step and using the same qPCR conditions. The MSP-HTPrimer pipeline is freely available from http://sourceforge.net/p/msp-htprimer.
Simbaqueba, Jaime; Sánchez, Pilar; Sanchez, Erika; Núñez Zarantes, Victor Manuel; Chacon, Maria Isabel; Barrero, Luz Stella; Mariño-Ramírez, Leonardo
2011-01-01
Physalis peruviana, commonly known as Cape gooseberry, is an Andean Solanaceae fruit with high nutritional value and interesting medicinal properties. In the present study we report the development and characterization of microsatellite loci from a P. peruviana commercial Colombian genotype. We identified 932 imperfect and 201 perfect Simple Sequence Repeats (SSR) loci in untranslated regions (UTRs) and 304 imperfect and 83 perfect SSR loci in coding regions from the assembled Physalis peruviana leaf transcriptome. The UTR SSR loci were used for the development of 162 primers for amplification. The efficiency of these primers was tested via PCR in a panel of seven P. peruviana accessions including Colombia, Kenya and Ecuador ecotypes and one closely related species Physalis floridana. We obtained an amplification rate of 83% and a polymorphic rate of 22%. Here we report the first P. peruviana specific microsatellite set, a valuable tool for a wide variety of applications, including functional diversity, conservation and improvement of the species. PMID:22039540
Simbaqueba, Jaime; Sánchez, Pilar; Sanchez, Erika; Núñez Zarantes, Victor Manuel; Chacon, Maria Isabel; Barrero, Luz Stella; Mariño-Ramírez, Leonardo
2011-01-01
Physalis peruviana, commonly known as Cape gooseberry, is an Andean Solanaceae fruit with high nutritional value and interesting medicinal properties. In the present study we report the development and characterization of microsatellite loci from a P. peruviana commercial Colombian genotype. We identified 932 imperfect and 201 perfect Simple Sequence Repeats (SSR) loci in untranslated regions (UTRs) and 304 imperfect and 83 perfect SSR loci in coding regions from the assembled Physalis peruviana leaf transcriptome. The UTR SSR loci were used for the development of 162 primers for amplification. The efficiency of these primers was tested via PCR in a panel of seven P. peruviana accessions including Colombia, Kenya and Ecuador ecotypes and one closely related species Physalis floridana. We obtained an amplification rate of 83% and a polymorphic rate of 22%. Here we report the first P. peruviana specific microsatellite set, a valuable tool for a wide variety of applications, including functional diversity, conservation and improvement of the species.
Sequetyping: Serotyping Streptococcus pneumoniae by a Single PCR Sequencing Strategy
Leung, Marcus H.; Bryson, Kevin; Freystatter, Kathrin; Pichon, Bruno; Edwards, Giles; Gillespie, Stephen H.
2012-01-01
The introduction of pneumococcal conjugate vaccines necessitates continued monitoring of circulating strains to assess vaccine efficacy and replacement serotypes. Conventional serological methods are costly, labor-intensive, and prone to misidentification, while current DNA-based methods have limited serotype coverage requiring multiple PCR primers. In this study, a computer algorithm was developed to interrogate the capsulation locus (cps) of vaccine serotypes to locate primer pairs in conserved regions that border variable regions and could differentiate between serotypes. In silico analysis of cps from 92 serotypes indicated that a primer pair spanning the regulatory gene cpsB could putatively amplify 84 serotypes and differentiate 46. This primer set was specific to Streptococcus pneumoniae, with no amplification observed for other species, including S. mitis, S. oralis, and S. pseudopneumoniae. One hundred thirty-eight pneumococcal strains covering 48 serotypes were tested. Of 23 vaccine serotypes included in the study, most (19/22, 86%) were identified correctly at least to the serogroup level, including all of the 13-valent conjugate vaccine and other replacement serotypes. Reproducibility was demonstrated by the correct sequetyping of different strains of a serotype. This novel sequence-based method employing a single PCR primer pair is cost-effective and simple. Furthermore, it has the potential to identify new serotypes that may evolve in the future. PMID:22553238
Comparison between Mt-DNA D-Loop and Cyt B primers for porcine DNA detection in meat products
NASA Astrophysics Data System (ADS)
Hamzah, Azhana; Mutalib, Sahilah Abd.; Babji, Abdul Salam
2013-11-01
This study was conducted to detect the presence of porcine DNA in meat products in the market using conventional polymerase chain reaction (PCR) and commercial PCR-southern hybridization analysis. Porcine DNA detection in meat products was tested due to some issues associated with the adulteration of food products in Malaysia. This is an important issue especially for Halal authentication which is required for some religious practices such as in Islam and Hinduisms. Many techniques have been developed for determining the Halal status of food products. In this paper, mt-DNA D-loop primer and cytochrome (cyt) b were used to detect the presence of porcine DNA in meat products. Positive and negative controls were always present for each batch of extraction. DNA of raw pork meat was used as a positive control while nucleus free water is used as negative control. A pair of oligonucleotide primer was used namely Pork1 and Pork2 which produced amplicon of 531 base pair (bp) in size. While, PCR-southern hybridization was conducted using primers readily supplied by commercial PCR-Southern hybridization and produced amplicon with 276 bp in size. In the present study, demonstrated that none of the samples were contaminated with porcine residuals but selected samples with pork meat were positive. The species-specific PCR amplification yielded excellent results for identification of pork derivatives in food products and it is a potentially reliable and suitable technique in routine food analysis for Halal certification.
Identification of duck plague virus by polymerase chain reaction.
Hansen, W R; Brown, S E; Nashold, S W; Knudson, D L
1999-01-01
A polymerase chain reaction (PCR) assay was developed for detecting duck plague virus. A 765-bp EcoRI fragment cloned from the genome of the duck plague vaccine (DP-VAC) virus was sequenced for PCR primer development. The fragment sequence was found by GenBank alignment searches to be similar to the 3' ends of an undefined open reading frame and the gene for DNA polymerase protein in other herpesviruses. Three of four primers sets were found to be specific for the DP-VAC virus and 100% (7/7) of field isolates but did not amplify DNA from inclusion body disease of cranes virus. The specificity of one primer set was tested with genome templates from other avian herpesviruses, including those from a golden eagle, bald eagle, great horned owl, snowy owl, peregrine falcon, prairie falcon, pigeon, psittacine, and chicken (infectious laryngotracheitis), but amplicons were not produced. Hence, this PCR test is highly specific for duck plague virus DNA. Two primer sets were able to detect 1 fg of DNA from the duck plague vaccine strain, equivalent to five genome copies. In addition, the ratio of tissue culture infectious doses to genome copies of duck plague vaccine virus from infected duck embryo cells was determined to be 1:100, making the PCR assay 20 times more sensitive than tissue culture for detecting duck plague virus. The speed, sensitivity, and specificity of this PCR provide a greatly improved diagnostic and research tool for studying the epizootiology of duck plague.
A method for the further assembly of targeted unigenes in a transcriptome after assembly by Trinity
Xiao, Xinlong; Ma, Jinbiao; Sun, Yufang; Yao, Yinan
2015-01-01
RNA-sequencing has been widely used to obtain high throughput transcriptome sequences in various species, but the assembly of a full set of complete transcripts is still a significant challenge. Judging by the number of expected transcripts and assembled unigenes in a transcriptome library, we believe that some unigenes could be reassembled. In this study, using the nitrate transporter (NRT) gene family and phosphate transporter (PHT) gene family in Salicornia europaea as examples, we introduced an approach to further assemble unigenes found in transcriptome libraries which had been previously generated by Trinity. To find the unigenes of a particular transcript that contained gaps, we respectively selected 16 NRT candidate unigene pairs and 12 PHT candidate unigene pairs for which the two unigenes had the same annotations, the same expression patterns among various RNA-seq samples, and different positions of the proteins coded as mapped to a reference protein. To fill a gap between the two unigenes, PCR was performed using primers that mapped to the two unigenes and the PCR products were sequenced, which demonstrated that 5 unigene pairs of NRT and 3 unigene pairs of PHT could be reassembled when the gaps were filled using the corresponding PCR product sequences. This fast and simple method will reduce the redundancy of targeted unigenes and allow acquisition of complete coding sequences (CDS). PMID:26528307
Novel primers for complete mitochondrial cytochrome b genesequencing in mammals
Naidu, Ashwin; Fitak, Robert R.; Munguia-Vega, Adrian; Culver, Melanie
2011-01-01
Sequence-based species identification relies on the extent and integrity of sequence data available in online databases such as GenBank. When identifying species from a sample of unknown origin, partial DNA sequences obtained from the sample are aligned against existing sequences in databases. When the sequence from the matching species is not present in the database, high-scoring alignments with closely related sequences might produce unreliable results on species identity. For species identification in mammals, the cytochrome b (cyt b) gene has been identified to be highly informative; thus, large amounts of reference sequence data from the cyt b gene are much needed. To enhance availability of cyt b gene sequence data on a large number of mammalian species in GenBank and other such publicly accessible online databases, we identified a primer pair for complete cyt b gene sequencing in mammals. Using this primer pair, we successfully PCR amplified and sequenced the complete cyt b gene from 40 of 44 mammalian species representing 10 orders of mammals. We submitted 40 complete, correctly annotated, cyt b protein coding sequences to GenBank. To our knowledge, this is the first single primer pair to amplify the complete cyt b gene in a broad range of mammalian species. This primer pair can be used for the addition of new cyt b gene sequences and to enhance data available on species represented in GenBank. The availability of novel and complete gene sequences as high-quality reference data can improve the reliability of sequence-based species identification.
A multiplex PCR for detection of six viruses in ducks.
Wang, Yongjuan; Zhu, Shanyuan; Hong, Weiming; Wang, Anping; Zuo, Weiyong
2017-10-01
In this study, six pairs of specific primers that can amplify DNA fragments of different sizes were designed and synthesized according to viral protein gene sequences published in GenBank. Then, a multiplex PCR method was established for rapid detection of duck hepatitis virus 1, duck plague virus, duck Tembusu virus, muscovy duck parvovirus, muscovy duck reovirus, and duck H9N2 avian influenza virus, and achieve simple and rapid detection of viral diseases in ducks. Single PCR was used to confirm primer specificity, and PCR conditions were optimized to construct a multiplex PCR system. Specificity and sensitivity assays were also developed. The multiplex PCR was used to detect duck embryos infected with mixed viruses and those with clinically suspected diseases to verify the feasibility of the multiplex PCR. Results show that the primers can specifically amplify target fragments, without any cross-amplification with other viruses. The multiplex PCR system can amplify six DNA fragments from the pooled viral genomes and specifically detect nucleic acids of the six duck susceptible viruses when the template amount is 10 2 copies/μl. In addition, the system can be used to detect viral nucleic acids in duck embryos infected with the six common viruses. The detection results for clinical samples are consistent with those detected by single PCR. Therefore, the established multiplex PCR method can perform specific, sensitive, and high-throughput detection of six duck-infecting viruses and can be applied to clinical identification and diagnosis of viral infection in ducks. Copyright © 2017. Published by Elsevier B.V.
A polymorphism in the bovine gamma-S-crystallin gene revealed by allele-specific amplification.
Kemp, S J; Maillard, J C; Teale, A J
1993-04-01
A polymorphism was detected in the 3' untranslated region of the bovine gamma-S-crystallin gene by direct sequencing of polymerase chain reaction (PCR) products from genomic DNA of an N'Dama bull and a Boran cow. A set of three PCR primers was designed to detect this difference and thus give allele-specific amplification. The two allele-specific primers differ in length by 20 nucleotides so that the allelic products may be distinguished by simple agarose gel electrophoresis following a single PCR reaction. This provides a simple and rapid assay for this polymorphism.
Kim, Kwang-Pyo; Singh, Atul K; Bai, Xingjian; Leprun, Lena; Bhunia, Arun K
2015-09-08
The goal of this study was to develop the Listeria species-specific PCR assays based on a house-keeping gene (lmo1634) encoding alcohol acetaldehyde dehydrogenase (Aad), previously designated as Listeria adhesion protein (LAP), and compare results with a label-free light scattering sensor, BARDOT (bacterial rapid detection using optical scattering technology). PCR primer sets targeting the lap genes from the species of Listeria sensu stricto were designed and tested with 47 Listeria and 8 non-Listeria strains. The resulting PCR primer sets detected either all species of Listeria sensu stricto or individual L. innocua, L. ivanovii and L. seeligeri, L. welshimeri, and L. marthii without producing any amplified products from other bacteria tested. The PCR assays with Listeria sensu stricto-specific primers also successfully detected all species of Listeria sensu stricto and/or Listeria innocua from mixed culture-inoculated food samples, and each bacterium in food was verified by using the light scattering sensor that generated unique scatter signature for each species of Listeria tested. The PCR assays based on the house-keeping gene aad (lap) can be used for detection of either all species of Listeria sensu stricto or certain individual Listeria species in a mixture from food with a detection limit of about 10⁴ CFU/mL.
Kim, Kwang-Pyo; Singh, Atul K.; Bai, Xingjian; Leprun, Lena; Bhunia, Arun K.
2015-01-01
The goal of this study was to develop the Listeria species-specific PCR assays based on a house-keeping gene (lmo1634) encoding alcohol acetaldehyde dehydrogenase (Aad), previously designated as Listeria adhesion protein (LAP), and compare results with a label-free light scattering sensor, BARDOT (bacterial rapid detection using optical scattering technology). PCR primer sets targeting the lap genes from the species of Listeria sensu stricto were designed and tested with 47 Listeria and 8 non-Listeria strains. The resulting PCR primer sets detected either all species of Listeria sensu stricto or individual L. innocua, L. ivanovii and L. seeligeri, L. welshimeri, and L. marthii without producing any amplified products from other bacteria tested. The PCR assays with Listeria sensu stricto-specific primers also successfully detected all species of Listeria sensu stricto and/or Listeria innocua from mixed culture-inoculated food samples, and each bacterium in food was verified by using the light scattering sensor that generated unique scatter signature for each species of Listeria tested. The PCR assays based on the house-keeping gene aad (lap) can be used for detection of either all species of Listeria sensu stricto or certain individual Listeria species in a mixture from food with a detection limit of about 104 CFU/mL. PMID:26371000
Mehndiratta, Mohit; Palanichamy, Jayanth Kumar; Ramalingam, Pradeep; Pal, Arnab; Das, Prerna; Sinha, Subrata; Chattopadhyay, Parthaprasad
2008-12-01
Quantitative real-time PCR (qPCR) is a standard method used for quantification of specific gene expression. This utilizes either dsDNA binding dyes or probe based chemistry. While dsDNA binding dyes have the advantage of low cost and flexibility, fluorescence due to primer dimers also interferes with the fluorescence of the specific product. Sometimes it is difficult, if not impossible, to standardize conditions and redesign primers in such a way that only specific fluorescence of the products of test and reference genes are acquired. Normally, the fluorescence acquisition in qPCR using dsDNA binding dyes is done during the melting phase of the PCR at a temperature between the melting points of primer dimers and the specific product. We have modified the protocol to acquire fluorescence during the hybridization phase. This significantly increased the signal-to-noise ratio and enabled the use of dsDNA binding dyes for mRNA quantification in situations where it was not possible when measurement was done in the melting phase. We have demonstrated it for three mRNAs, E6, E7, and DNMT1 with beta-actin as the reference gene, and for two miRNAs. This modification broadens the scope of qPCR using dsDNA binding dyes.
A multiplex PCR method of detecting recombinant DNAs from five lines of genetically modified maize.
Matsuoka, T; Kuribara, H; Akiyama, H; Miura, H; Goda, Y; Kusakabe, Y; Isshiki, K; Toyoda, M; Hino, A
2001-02-01
Seven lines of genetically modified (GM) maize have been authorized in Japan as foods and feeds imported from the USA. We improved a multiplex PCR method described in the previous report in order to distinguish the five lines of GM maize. Genomic DNA was extracted from GM maize with a silica spin column kit, which could reduce experimental time and improve safety in the laboratory and potentially in the environment. We sequenced recombinant DNA (r-DNA) introduced into GM maize, and re-designed new primer pairs to increase the specificity of PCR to distinguish five lines of GM maize by multiplex PCR. A primer pair for the maize intrinsic zein gene (Ze1) was also designed to confirm the presence of amplifiable maize DNA. The lengths of PCR products using these six primer pairs were different. The Ze1 and the r-DNAs from the five lines of GM maize were qualitatively detected in one tube. The specific PCR bands were distinguishable from each other on the basis of the expected length. The r-DNA could be detected from maize samples containing 0.5% of each of the five lines of GM maize. The sensitivity would be acceptable to secure the verification of non-GMO materials and to monitor the reliability of the labeling system.
Rodríguez-Martín, Andrea; Acosta, Raquel; Liddell, Susan; Núñez, Félix; Benito, M José; Asensio, Miguel A
2010-04-01
The strain RP42C from Penicillium chrysogenum produces a small protein PgAFP that inhibits the growth of some toxigenic molds. The molecular mass of the protein determined by electrospray ionization mass spectrometry (ESI-MS) was 6 494Da. PgAFP showed a cationic character with an estimated pI value of 9.22. Upon chemical and enzymatic treatments of PgAFP, no evidence for N- or O-glycosylations was obtained. Five partial sequences of PgAFP were obtained by Edman degradation and by ESI-MS/MS after trypsin and chymotrypsin digestions. Using degenerate primers from these peptide sequences, a segment of 70bp was amplified by PCR from pgafp gene. 5'- and 3'-ends of pgafp were obtained by RACE-PCR with gene-specific primers designed from the 70bp segment. The complete pgafp sequence of 404bp was obtained using primers designed from 5'- and 3'-ends. Comparison of genomic and cDNA sequences revealed a 279bp coding region interrupted by two introns of 63 and 62bp. The precursor of the antifungal protein consists of 92 amino acids and appears to be processed to the mature 58 amino acids PgAFP. The deduced amino acid sequence of the mature protein shares 79% identity to the antifungal protein Anafp from Aspergillus niger. PgAFP is a new protein that belongs to the group of small, cysteine-rich, and basic proteins with antifungal activity produced by ascomycetes. Given that P. chrysogenum is regarded as safe mold commonly found in foods, PgAFP may be useful to prevent growth of toxigenic molds in food and agricultural products. Copyright (c) 2009 Elsevier Inc. All rights reserved.
Galkiewicz, J.P.; Kellogg, C.A.
2008-01-01
PCR amplification of pure bacterial DNA is vital to the study of bacterial interactions with corals. Commonly used Bacteria-specific primers 8F and 27F paired with the universal primer 1492R amplify both eukaryotic and prokaryotic rRNA genes. An alternative primer set, 63F/1542R, is suggested to resolve this problem. Copyright ?? 2008, American Society for Microbiology. All Rights Reserved.
Identification of the gene encoding the major capsid protein of fish lymphocystis disease virus.
Schnitzler, P; Darai, G
1993-10-01
The gene encoding the major capsid protein (MCP) of fish lymphocystis disease virus (flounder isolate; FLCDV-f) has been identified by PCR using oligonucleotide primers corresponding to different regions of the MCP of Tipula iridescent virus (TIV), iridescent virus 22 (IV22) and Chilo iridescent virus (CIV). DNA fragments of 0.4 kbp, 0.5 kbp and 0.27 kbp in size were amplified using oligonucleotide primers corresponding to amino acids (aa) 146 to 153 (primer 1) and 274 to 268 (primer 6), or aa 146 to 153 (primer 1) and 313 to 304 (primer 8), or aa 304 to 312 (primer 7) and 385 to 381 (primer 9) of the MCP of TIV, respectively. The PCR products were used as hybridization probes for screening the gene library of FLCDV-f. The MCP gene of FLCDV-f(1377 bp; 459 aa; 51.4K) was identified within the DNA sequence of the EcoRI FLCDV-f DNA fragment C (11.2 kbp; 0.611 to 0.718 map units). A high degree of aa sequence identity/similarity was detected between the MCP of FLCDV-f and TIV (50.3%/33.8%), IV22 (49.1%/34.2%). CIV (53%/29.5%) and African swine fever virus (16%/38.1%).
Farhadi, Atieh; Haniloo, Ali; Fazaeli, Asghar; Moradian, Siamak; Farhadi, Mehdi
2017-01-01
The diagnosis of ocular toxoplasmosis is mainly based on clinical features. However, ocular fluid testing by PCR may be very helpful for approval or rejection of this etiology. In this study, we utilized a nested-PCR technique, targeting the B1 partial sequence to analyze the aqueous and vitreous samples for evaluating the presence of the Toxoplasma DNA. Fifty aqueous or vitreous humor samples were obtained from patients with clinical features of ocular toxoplasmosis admitted to ophthalmology hospitals and clinics in Iran, within 2014. The samples were subsequently subjected to DNA extraction and purification. For nested amplification of the Toxoplasma B1 gene, two primer pairs were used. The outer and inner primers are expected to produce a 193 bp and a 96 bp fragments, respectively. The first-round PCR resulted in the detection of T. gondii in 58% of samples by amplification of the expected 193bp DNA fragment. The nested-PCR using the inner primers, detected 15 additional samples from those with negative amplicons in the first round PCR (overall positivity of 88%). In addition, vitreous samples showed relatively more positive cases than aqueous humor in detection of the infection. The nested-PCR protocol using the B1 gene, with the high detection power, could be a useful complimentary method to clinical diagnose of ocular toxoplasmosis.
Huang, Wen-Chien; Tsai, Hsin-Chi; Tao, Chi-Wei; Chen, Jung-Sheng; Shih, Yi-Jia; Kao, Po-Min; Huang, Tung-Yi; Hsu, Bing-Mu
2017-01-01
In this study, we describe a nested PCR-DGGE strategy to detect Legionella communities from river water samples. The nearly full-length 16S rRNA gene was amplified using bacterial primer in the first step. After, the amplicons were employed as DNA templates in the second PCR using Legionella specific primer. The third round of gene amplification was conducted to gain PCR fragments apposite for DGGE analysis. Then the total numbers of amplified genes were observed in DGGE bands of products gained with primers specific for the diversity of Legionella species. The DGGE patterns are thus potential for a high-throughput preliminary determination of aquatic environmental Legionella species before sequencing. Comparative DNA sequence analysis of excised DGGE unique band patterns showed the identity of the Legionella community members, including a reference profile with two pathogenic species of Legionella strains. In addition, only members of Legionella pneumophila and uncultured Legionella sp. were detected. Development of three step nested PCR-DGGE tactic is seen as a useful method for studying the diversity of Legionella community. The method is rapid and provided sequence information for phylogenetic analysis.
Approach to determine the diversity of Legionella species by nested PCR-DGGE in aquatic environments
Huang, Wen-Chien; Tsai, Hsin-Chi; Tao, Chi-Wei; Chen, Jung-Sheng; Shih, Yi-Jia; Kao, Po-Min; Huang, Tung-Yi; Hsu, Bing-Mu
2017-01-01
In this study, we describe a nested PCR-DGGE strategy to detect Legionella communities from river water samples. The nearly full-length 16S rRNA gene was amplified using bacterial primer in the first step. After, the amplicons were employed as DNA templates in the second PCR using Legionella specific primer. The third round of gene amplification was conducted to gain PCR fragments apposite for DGGE analysis. Then the total numbers of amplified genes were observed in DGGE bands of products gained with primers specific for the diversity of Legionella species. The DGGE patterns are thus potential for a high-throughput preliminary determination of aquatic environmental Legionella species before sequencing. Comparative DNA sequence analysis of excised DGGE unique band patterns showed the identity of the Legionella community members, including a reference profile with two pathogenic species of Legionella strains. In addition, only members of Legionella pneumophila and uncultured Legionella sp. were detected. Development of three step nested PCR-DGGE tactic is seen as a useful method for studying the diversity of Legionella community. The method is rapid and provided sequence information for phylogenetic analysis. PMID:28166249
Lee, Shin-Young; Kim, Mi-Ju; Kim, Hyun-Joong; Jeong, KwangCheol Casey; Kim, Hae-Yeong
2018-02-28
A one-step multiplex reverse transcription PCR (RT-PCR) method comprising six primer sets (for the detection of norovirus GI and GII, hepatitis A virus, rotavirus, and astrovirus) was developed to simultaneously detect four kinds of pathogenic viruses. The size of the PCR products for norovirus GI and GII, hepatitis A virus (VP3/VP1 and P2A regions), rotavirus, and astrovirus were 330, 164, 244, 198, 629, and 449 bp, respectively. The RT-PCR with the six primer sets showed specificity for the pathogenic viruses. The detection limit of the developed multiplex RT-PCR, as evaluated using serially diluted viral RNAs, was comparable to that of one-step single RT-PCR. Moreover, this multiplex RT-PCR was evaluated using food samples such as water, oysters, lettuce, and vegetable product. These food samples were artificially spiked with the four kinds of viruses in diverse combinations, and the spiked viruses in all food samples were detected successfully.
Fredriksson, Nils Johan; Hermansson, Malte; Wilén, Britt-Marie
2013-01-01
Assessments of bacterial community diversity and dynamics are fundamental for the understanding of microbial ecology as well as biotechnological applications. We show that the choice of PCR primers has great impact on the results of analyses of diversity and dynamics using gene libraries and DNA fingerprinting. Two universal primer pairs targeting the 16S rRNA gene, 27F&1492R and 63F&M1387R, were compared and evaluated by analyzing the bacterial community in the activated sludge of a large-scale wastewater treatment plant. The two primer pairs targeted distinct parts of the bacterial community, none encompassing the other, both with similar richness. Had only one primer pair been used, very different conclusions had been drawn regarding dominant phylogenetic and putative functional groups. With 27F&1492R, Betaproteobacteria would have been determined to be the dominating taxa while 63F&M1387R would have described Alphaproteobacteria as the most common taxa. Microscopy and fluorescence in situ hybridization analysis showed that both Alphaproteobacteria and Betaproteobacteria were abundant in the activated sludge, confirming that the two primer pairs target two different fractions of the bacterial community. Furthermore, terminal restriction fragment polymorphism analyses of a series of four activated sludge samples showed that the two primer pairs would have resulted in different conclusions about community stability and the factors contributing to changes in community composition. In conclusion, different PCR primer pairs, although considered universal, target different ranges of bacteria and will thus show the diversity and dynamics of different fractions of the bacterial community in the analyzed sample. We also show that while a database search can serve as an indicator of how universal a primer pair is, an experimental assessment is necessary to evaluate the suitability for a specific environmental sample. PMID:24098498
[Detection of gene mutation in glucose-6-phosphate dehydrogenase deficiency by RT-PCR sequencing].
Lyu, Rong-Yu; Chen, Xiao-Wen; Zhang, Min; Chen, Yun-Sheng; Yu, Jie; Wen, Fei-Qiu
2016-07-01
Since glucose-6-phosphate dehydrogenase (G6PD) deficiency is the most common hereditary hemolytic erythrocyte enzyme deficiency, most cases have single nucleotide mutations in the coding region, and current test methods for gene mutation have some missed detections, this study aimed to investigate the feasibility of RT-PCR sequencing in the detection of gene mutation in G6PD deficiency. According to the G6PD/6GPD ratio, 195 children with anemia of unknown cause or who underwent physical examination between August 2013 and July 2014 were classified into G6PD-deficiency group with 130 children (G6PD/6GPD ratio <1.00) and control group with 65 children (G6PD/6GPD ratio≥1.00). The primer design and PCR amplification conditions were optimized, and RT-PCR sequencing was used to analyze the complete coding sequence and verify the genomic DNA sequence in the two groups. In the G6PD-deficiency group, the detection rate of gene mutation was 100% and 13 missense mutations were detected, including one new mutation. In the control group, no missense mutation was detected in 28 boys; 13 heterozygous missense mutations, 1 homozygous same-sense mutation (C1191T) which had not been reported in China and abroad, and 14 single nucleotide polymorphisms of C1311T were detected in 37 girls. The control group showed a high rate of missed detection of G6PD deficiency (carriers) in the specimens from girls (35%, 13/37). RT-PCR sequencing has a high detection rate of G6PD gene mutation and a certain value in clinical diagnosis of G6PD deficiency.
Jalal Kiani, Seyed; Shatizadeh Malekshahi, Somayeh; Yousefi Ghalejoogh, Zohreh; Ghavvami, Nastaran; Shafiei Jandaghi, Nazanin Zahra; Shahsiah, Reza; Jahanzad, Isa; Yavarian, Jila
2015-01-01
Background: Cervical cancer is the leading cause of death from cancer in under-developed countries. Human papilloma virus (HPV) 16 and 18 are the most prevalent types associated with carcinogenesis in the cervix. Conventional Polymerase Chain Reaction (PCR), type-specific and consensus primer-based PCR followed by sequencing, Restriction Fragment Length Polymorphism (RFLP) or hybridization by specific probes are common methods for HPV detection and typing. In addition, some researchers have developed a multiplex PCR for simultaneous detection and typing of different HPVs. Objectives: The aim of the present study was to investigate the prevalence of HPV infection and its types in cervical Squamous Cell Carcinoma (SCC) using the Nested Multiplex PCR (NMPCR) assay. Patients and Methods: Sixty-six samples with histologically confirmed SCC were evaluated. Total DNA was isolated by phenol–chloroform extraction and ethanol precipitation. Nested multiplex PCR was performed with first-round PCR by GP-E6/E7 consensus primers for amplification of the genomic DNA of all known mucosal HPV genotypes and second-round PCR by type-specific multiplex PCR primer cocktails. Results: Human papilloma virus infection was detected in 78.8% of samples, with the highest prevalence of HPV 16 (60.6%) while concurrent infections with two types was detected in 10.6%. Conclusions: The NMPCR assay is more convenient and easy for analysis of results, which is important for fast diagnosis and patient management, in a type-specific manner. PMID:26865940
Beiter, Thomas; Zimmermann, Martina; Fragasso, Annunziata; Armeanu, Sorin; Lauer, Ulrich M; Bitzer, Michael; Su, Hua; Young, William L; Niess, Andreas M; Simon, Perikles
2008-01-01
So far, the abuse of gene transfer technology in sport, so-called gene doping, is undetectable. However, recent studies in somatic gene therapy indicate that long-term presence of transgenic DNA (tDNA) following various gene transfer protocols can be found in DNA isolated from whole blood using conventional PCR protocols. Application of these protocols for the direct detection of gene doping would require almost complete knowledge about the sequence of the genetic information that has been transferred. Here, we develop and describe the novel single-copy primer-internal intron-spanning PCR (spiPCR) procedure that overcomes this difficulty. Apart from the interesting perspectives that this spiPCR procedure offers in the fight against gene doping, this technology could also be of interest in biodistribution and biosafety studies for gene therapeutic applications.
Han, Joan C.; Elsea, Sarah H.; Pena, Heloísa B.; Pena, Sérgio Danilo Junho
2013-01-01
Detection of human microdeletion and microduplication syndromes poses significant burden on public healthcare systems in developing countries. With genome-wide diagnostic assays frequently inaccessible, targeted low-cost PCR-based approaches are preferred. However, their reproducibility depends on equally efficient amplification using a number of target and control primers. To address this, the recently described technique called Microdeletion/Microduplication Quantitative Fluorescent PCR (MQF-PCR) was shown to reliably detect four human syndromes by quantifying DNA amplification in an internally controlled PCR reaction. Here, we confirm its utility in the detection of eight human microdeletion syndromes, including the more common WAGR, Smith-Magenis, and Potocki-Lupski syndromes with 100% sensitivity and 100% specificity. We present selection, design, and performance evaluation of detection primers using variety of approaches. We conclude that MQF-PCR is an easily adaptable method for detection of human pathological chromosomal aberrations. PMID:24288428
Olmo, Francisco; Escobedo-Orteg, Javier; Palma, Patricia; Sánchez-Moreno, Manuel; Mejía-Jaramillo, Ana; Triana, Omar; Marín, Clotilde
2014-11-01
To classify 21 new isolates of Trypanosoma cruzi (T. cruzi) according to the Discrete Typing Unit (DTU) which they belong to, as well as tune up a new pair of primers designed to detect the parasite in biological samples. Strains were isolated, DNA extracted, and classified by using three Polymerase Chain Reactions (PCR). Subsequently this DNA was used along with other isolates of various biological samples, for a new PCR using primers designed. Finally, the amplified fragments were sequenced. It was observed the predominance of DTU I in Colombia, as well as the specificity of our primers for detection of T. cruzi, while no band was obtained when other species were used. This work reveals the genetic variability of 21 new isolates of T. cruzi in Colombia.Our primers confirmed their specificity for detecting the presence of T. cruzi. Copyright © 2014 Hainan Medical College. Published by Elsevier B.V. All rights reserved.
Molecular diagnosis of group B coltiviruses infections.
Billoir, F; Attoui, H; Simon, S; Gallian, P; de Micco, P; de Lamballerie, X
1999-08-01
The group-B of genus Coltivirus encompasses isolates from humans, ticks or mosquitoes collected in Indonesia and China. Subgroup-B1 includes the strain JKT/dsR-7075 and subgroup-B2 strains JKT/dsR-6423, JKT/dsR-6969, JKT/dsR-7043 and the Banna virus. Data are described for the PCR-based diagnosis of infection by group B coltiviruses. Sets of primers were designed from the sequences of the 7th, 9th and 12th viral segments and RT PCR assays were developed. Consensus primers permitted the detection of all known isolates of subgroup 1 or 2. Viral strains could be characterised further using primers specific for type B2a or B2b, or based on the length of the amplification products. All primers gave negative results when using RNAs from Orbiviruses or Group-A coltiviruses. These primers permitted the detection of Group-B coltiviruses-RNA in infected mouse blood at the acute stage of the disease. Accordingly, they could be used for the diagnosis of infection in humans.
NASA Astrophysics Data System (ADS)
Rozi; Rahayu, K.; Daruti, D. N.
2018-04-01
The goal of this study was to detect of Aeromonas hydrophila carrying the hlyA gene in guramy by PCR assay. A total of 5 A. hydrophila strains were isolated from gouramy with different location and furthermore genotypic of all A. hydrophila strains havedetected by PCR assay for 16S rRNA gene. The primers used in the PCR targeted a 592-bp fragment of the hlyA gene coding for the hemolysin gene. Particularly hlyA genes are responsible for haemolysin toxins production in this genus. After gel electrophoresis, the amplicons from representative strains of the A. hydrophila were purified using extraction kit and were subjected to the DNA sequencing analysis. The results showed that: (i) the 592bp amplicon of the hlyA gene was detected in 5/6 of the A. hydrophila; (ii) the nucleotide blast results of hemolysin gene sequences of the strains of A. hydrophila revealed a high homology of 90-97 % with published sequences, and;(iii) the protein blast showed 95-98 % homology when compared to the published sequences. The PCR clearly identified the haemolysin-producing strains of A. hydrophila by detection in hlyA genes and may have application as a rapid species-specific virulence test.
Sulzinski, Michael A; Wasilewski, Melissa A; Farrell, James C; Glick, David L
2009-07-01
It is an extraordinary challenge to offer an undergraduate laboratory course in virology that teaches hands-on, relevant molecular biology techniques using nonpathogenic models of human virus detection. To our knowledge, there exists no inexpensive kits or reagent sets that are appropriate for demonstrating real-time PCR (RT-PCR) in an undergraduate laboratory course in virology. Here we describe simple procedures for student exercises that demonstrate the PCR detection of an HIV target nucleic acid. Our procedures combine a commercially available kit for conventional PCR with a modification for RT-PCR using the same reagents in the kit, making it possible for an instructor with access to a LightCycler® instrument to implement a relevant student exercise on RT-PCR detection of HIV nucleic acid targets. This combination of techniques is useful for demonstrating and comparing conventional PCR amplification and detection with agarose gel electrophoresis, with real-time PCR over a series of three laboratory periods. The series of laboratory periods also is used to provide the foundation for teaching the concept of PCR primer design, optimization of PCR detection systems, and introduction to nucleic acid queries using NCBI-BLAST to find and identify primers, amplicons, and other potential amplification targets within the HIV viral genome. The techniques were successfully implemented at the Biology 364 undergraduate virology course at the University of Scranton during the Fall 2008 semester. The techniques are particularly targeted to students who intend to pursue either postgraduate technical employment or graduate studies in the molecular life sciences. Copyright © 2009 International Union of Biochemistry and Molecular Biology, Inc.
Llop, Pablo; Bonaterra, Anna; Peñalver, Javier; López, María M.
2000-01-01
A novel method, which involves a nested PCR in a single closed tube, was developed for the sensitive detection of Erwinia amylovora in plant material. The external and internal primer pairs used had different annealing temperatures and directed the amplification of a specific DNA fragment from plasmid pEA29. The procedure involved two consecutive PCRs, the first of which was performed at a higher annealing temperature that allowed amplification only by the external primer pair. Using pure cultures of E. amylovora, the sensitivity of the nested PCR in one tube was similar to that of a standard nested PCR in two tubes. The specificity and sensitivity were greater than those of standard PCR procedures that used a single primer pair. The presence of inhibitors in plant material, very common in E. amylovora hosts, is overcome with this system in combination with a simple DNA extraction protocol because it eliminates many of the inhibitory compounds. In addition, it needs a very small sample volume (1 μl of DNA extracted). With 83 samples of naturally infected material, this method achieved better results than any other PCR technique: standard PCR detected 55% of positive samples, two-tube nested PCR detected 71% of positive samples, and nested PCR in a single closed tube detected 78% of positive samples. When analyzing asymptomatic plant material, the number of positive samples detected by the developed nested PCR was also the highest, compared with the PCR protocols indicated previously (17, 20, and 25% of 251 samples analyzed, respectively). This method is proposed for the detection of endophytic and epiphytic populations of E. amylovora in epidemiological studies and for routine use in quarantine surveys, due to its high sensitivity, specificity, speed, and simplicity. PMID:10788384
Ogaya, Yuko; Nomura, Ryota; Watanabe, Yoshiyuki; Nakano, Kazuhiko
2015-01-01
The oral cavity has been implicated as a source of Helicobacter pylori infection in childhood. Various PCR methods have been used to detect H. pylori DNA in oral specimens with various detection rates reported. Such disparity in detection rates complicates the estimation of the true infection rate of H. pylori in the oral cavity. In the present study, we constructed a novel PCR system for H. pylori detection and used it to analyse oral specimens. Firstly, the nucleotide alignments of genes commonly used for H. pylori detection were compared using the complete genome information for 48 strains registered in the GenBank database. Candidate primer sets with an estimated amplification size of approximately 300-400 bp were selected, and the specificity and sensitivity of the detection system using each primer set were evaluated. Five sets of primers targeting ureA were considered appropriate, of which a single primer set was chosen for inclusion in the PCR system. The sensitivity of the system was considered appropriate and its detection limit established as one to ten cells per reaction. The novel PCR system was used to examine H. pylori distribution in oral specimens (40 inflamed pulp tissues, 40 saliva samples) collected from Japanese children, adolescents and young adults. PCR analysis revealed that the detection rate of H. pylori in inflamed pulp was 15 %, whereas no positive reaction was found in any of the saliva specimens. Taken together, our novel PCR system was found to be reliable for detecting H. pylori. The results obtained showed that H. pylori was detected in inflamed pulp but not saliva specimens, indicating that an infected root canal may be a reservoir for H. pylori. © 2015 The Authors.
PCR analysis of the cryI insecticidal crystal family genes from Bacillus thuringiensis.
Ceron, J; Covarrubias, L; Quintero, R; Ortiz, A; Ortiz, M; Aranda, E; Lina, L; Bravo, A
1994-01-01
A method allowing rapid and accurate identification of different subgroups within the insecticidal crystal CryI protein-producing family of Bacillus thuringiensis strains was established by using PCR technology. Thirteen highly homologous primers specific to regions within genes encoding seven different subgroups of B. thuringiensis CryI proteins were described. Differentiation among these strains was determined on the basis of the electrophoretic patterns of PCR products. B. thuringiensis strains, isolated from soil samples, were analyzed by PCR technology. Small amounts of bacterial lysates were assayed in two reaction mixtures containing six to eight primers. This method can be applied to rapidly detect the subgroups of CryI proteins that correspond with toxicity to various lepidopteran insects. Images PMID:8117089
Chen, J; Chen, J; Adams, M J
2001-01-01
A universal primer (Sprimer: 5'-GGX AAY AAY AGY GGX CAZ CC-3', X = A, G, C or T; Y = T or C; Z = A or G), designed from the consensus sequences that code for the conserved sequence GNNSGQP in the NIb region of members of the family Potyviridae, was used to amplify by RT-PCR the 3'-terminal genome regions from infected plant samples representing 21 different viruses in the family. Sequencing of some of the fragments (c. 1.7 kb) showed that the type strain (ATTC PV-107) of Oat necrotic mottle virus is not a distinct species in the genus Rymovirus, but is synonymous with Brome streak mosaic virus (genus Tritimovirus) and that Celery mosaic virus is a distinct member of the genus Potyvirus not closely related to any other sequenced species. Potyviruses infecting crops in China were also investigated, showing that viruses on cowpea and maize in Hangzhou, Zhejiang province were respectively Bean common mosaic virus and Sugarcane mosaic virus and that one on garlic in Nanjing, Jiangsu province was Onion yellow dwarf virus. Fragments were also sequenced from Chinese isolates of Lettuce mosaic virus and Soybean mosaic virus (from Hangzhou), Turnip mosaic virus (2 different isolates from Zhejiang province) and RNA1 of Wheat yellow mosaic virus (from Rongcheng, Shandong province).
Standorf, Kali; Cortés-Hinojosa, Galaxia; Venn-Watson, Stephanie; Rivera, Rebecca; Archer, Linda L; Wellehan, James F X
2018-01-01
: Adenoviruses are nonenveloped, double-stranded DNA viruses, known to infect members of all tetrapod classes, with a similarity between phylogenies of hosts and viruses observed. We characterized bottlenose dolphin adenovirus 2 (BdAdV-2) found in a bottlenose dolphin ( Tursiops truncatus) with enteritis. Virions were seen by negative staining electron microscopy of feces. Initial sequences obtained using conserved PCR primers were expanded using primer walking techniques, and the complete coding sequence was obtained. Phylogenetic analyses were consistent with coevolution of this virus and its bottlenose dolphin host, placing BdAdV-2 into a monophyletic group with other mastadenoviruses of Cetartiodactyla. When considering the low guanine/cytosine (G/C) content of BdAdV-2 with the phylogenetic data, this virus may represent a host-jumping event from another member of Cetartiodactyla. Analysis of partial polymerase indicated that bottlenose dolphin adenovirus 1, previously identified in Spain, and BdAdV-2 are sister taxa with harbor porpoise adenovirus 1, forming a cetacean clade. Bottlenose dolphin adenovirus 2 includes a highly divergent fiber gene. Two genes homologous to the dUTPase superfamily are also present which could play a role in enabling viral replication in nondividing cells. We used sequence data to develop a probe hybridization quantitative PCR assay specific to BdAdV-2 with a limit of detection of 10 copies.
Salazar, Oscar; Valverde, Aranzazu; Genilloud, Olga
2006-01-01
Real-time PCR (RT-PCR) technology was used for the specific detection and quantification of members of the family Geodermatophilaceae in stone samples. Differences in the nucleotide sequences of the 16S rRNA gene region were used to design a pair of family-specific primers that were used to detect and quantify by RT-PCR DNA from members of this family in stone samples from different geographical origins in Spain. These primers were applied later to identify by PCR-specific amplification new members of the family Geodermatophilaceae isolated from the same stone samples. The diversity and taxonomic position of the wild-type strains identified from ribosomal sequence analysis suggest the presence of a new lineage within the genus Blastococcus. PMID:16391063
Genotyping of beta thalassemia trait by high-resolution DNA melting analysis.
Saetung, Rattika; Ongchai, Siriwan; Charoenkwan, Pimlak; Sanguansermsri, Torpong
2013-11-01
Beta thalassemia is a common hereditary hemalogogical disease in Thailand, with a prevalence of 5-8%. In this study, we evaluated the high resolution DNA melting (HRM) assay to identify beta thalassemia mutation in samples from 143 carriers of the beta thalassemia traits in at risk couples. The DNA was isolated from venous blood samples and tested for mutation under a series of 5 PCR-HRM (A, B, C, D and E primers) protocols. The A primers were for detection of beta thalassemia mutations in the HBB promoter region, the B primers for mutations in exon I, the C primers for exon II, the D primers for exon III and the E primers for the 3.4 kb deletion mutation. The mutations were diagnosed by comparing the complete melting curve profiles of a wild type control with those for each mutant sample. With the PCR-HRM technique, fourteen types of beta thalassemia mutations were detected. Each mutation had a unique and specific melting profile. The mutations included 36.4% (52 cases) codon 41/42-CTTT, 26.6% (38 cases) codon 17 A-T, 11.2% (16 cases) IVS1-1 G-T, 8.4% (12 cases) codon 71/72 +A, 8.4% (12 cases) of the 3.4 kb deletion and 3.5% (5 cases) -28 A-G. The remainder included one instance each of -87 C-A, -31 A-C, codon 27/28 +C, codon 30 G-A, IVS1-5 G-C, codon 35 C-A, codon 41-C and IVSII -654 C-T. Of the total cases, 85.8% of the mutations could be detected by primers B and C. The PCR-HRM method provides a rapid, simple and highly feasible strategy for mutation screening of beta thalassemia traits.
Nuclear Matrix Proteins in Disparity of Prostate Cancer
2011-07-01
using G3PDH 3’ primer and PCR primer 1 followed by two rounds of hybridization. In the first hybridization, the RsaI-digested driver cDNA was mixed...determined using β-actin to confirm the reduced relative abundance of the housekeeping gene after SSH. The SSH nested PCR products were cloned using pCR®2.1...variability of DNA concentration. Additionally, negative and positive controls ( housekeeping genes) from the Ambion™ ArrayControls™ Set were included
Clones identification of Sequoia sempervirens (D. Don) Endl. in Chile by using PCR-RAPDs technique.
Toral Ibañez, Manuel; Caru, Margarita; Herrera, Miguel A; Gonzalez, Luis; Martin, Luis M; Miranda, Jorge; Navarro-Cerrillo, Rafael M
2009-02-01
A protocol of polymerase chain reaction-random amplified polymorphic DNAs (PCR-RAPDs) was established to analyse the gene diversity and genotype identification for clones of Sequoia sempervirens (D. Don) Endl. in Chile. Ten (out of 34) clones from introduction trial located in Voipir-Villarrica, Chile, were studied. The PCR-RAPDs technique and a modified hexadecyltrimethylammonium bromide (CTAB) protocol were used for genomic DNA extraction. The PCR tests were carried out employing 10-mer random primers. The amplification products were detected by electrophoresis in agarose gels. Forty nine polymorphic bands were obtained with the selected primers (BG04, BF07, BF12, BF13, and BF14) and were ordered according to their molecular size. The genetic similarity between samples was calculated by the Jaccard index and a dendrogram was constructed using a cluster analysis of unweighted pair group method using arithmetic averages (UPGMA). Of the primers tested, 5 (out of 60) RAPD primers were selected for their reproducibility and high polymorphism. A total of 49 polymorphic RAPD bands were detected out of 252 bands. The genetic similarity analysis demonstrates an extensive genetic variability between the tested clones and the dendrogram depicts the genetic relationships among the clones, suggesting a geographic relationship. The results indicate that the RAPD markers permitted the identification of the assayed clones, although they are derived from the same geographic origin.
Clones identification of Sequoia sempervirens (D. Don) Endl. in Chile by using PCR-RAPDs technique*
Toral Ibañez, Manuel; Caru, Margarita; Herrera, Miguel A.; Gonzalez, Luis; Martin, Luis M.; Miranda, Jorge; Navarro-Cerrillo, Rafael M.
2009-01-01
A protocol of polymerase chain reaction-random amplified polymorphic DNAs (PCR-RAPDs) was established to analyse the gene diversity and genotype identification for clones of Sequoia sempervirens (D. Don) Endl. in Chile. Ten (out of 34) clones from introduction trial located in Voipir-Villarrica, Chile, were studied. The PCR-RAPDs technique and a modified hexadecyltrimethylammonium bromide (CTAB) protocol were used for genomic DNA extraction. The PCR tests were carried out employing 10-mer random primers. The amplification products were detected by electrophoresis in agarose gels. Forty nine polymorphic bands were obtained with the selected primers (BG04, BF07, BF12, BF13, and BF14) and were ordered according to their molecular size. The genetic similarity between samples was calculated by the Jaccard index and a dendrogram was constructed using a cluster analysis of unweighted pair group method using arithmetic averages (UPGMA). Of the primers tested, 5 (out of 60) RAPD primers were selected for their reproducibility and high polymorphism. A total of 49 polymorphic RAPD bands were detected out of 252 bands. The genetic similarity analysis demonstrates an extensive genetic variability between the tested clones and the dendrogram depicts the genetic relationships among the clones, suggesting a geographic relationship. The results indicate that the RAPD markers permitted the identification of the assayed clones, although they are derived from the same geographic origin. PMID:19235269
Vargas, Diana Y.; Kramer, Fred Russell; Tyagi, Sanjay; Marras, Salvatore A. E.
2016-01-01
We describe the use of “SuperSelective” primers that enable the detection and quantitation of somatic mutations whose presence relates to cancer diagnosis, prognosis, and therapy, in real-time PCR assays that can potentially analyze rare DNA fragments present in blood samples (liquid biopsies). The design of these deoxyribonucleotide primers incorporates both a relatively long “5' anchor sequence” that hybridizes strongly to target DNA fragments, and a very short, physically and functionally separate, “3' foot sequence” that is perfectly complementary to the mutant target sequence, but mismatches the wild-type sequence. As few as ten mutant fragments can reliably be detected in the presence of 1,000,000 wild-type fragments, even when the difference between the mutant and the wild type is only a single nucleotide polymorphism. Multiplex PCR assays employing a set of SuperSelective primers, and a corresponding set of differently colored molecular beacon probes, can be used in situations where the different mutations, though occurring in different cells, are located in the same codon. These non-symmetric real-time multiplex PCR assays contain limited concentrations of each SuperSelective primer, thereby enabling the simultaneous determination of each mutation’s abundance by comparing its threshold value to the threshold value of a reference gene present in the sample. PMID:27244445
Abdulmawjood, A; Roth, S; Bülte, M
2002-10-01
For the detection of food born bacteria by polymerase chain reaction (PCR) in food products, an internal amplification control (IAC) is required in order to prevent false negative results that might be caused by PCR inhibitors. In the present study, two IACs were constructed using two different methods. These IACs were designed in a way that the same primer pair can be used to amplify the target DNA and coamplify the IAC. The first IAC with a size of approximately 200 bp was constructed by deleting a part of the amplicon of the original target DNA (500 bp) between the two primer sites to produce an IAC smaller than the target DNA. The second IAC with a size of approximately 600 bp was synthesized in a one step PCR reaction. The primers used in this reaction possessed 5' over-hanging ends, which were identical to the primers used in the diagnostic reaction, whereas their 3' ends were complementary to the (pUC19) predetermined DNA sequence of defined length and sequence. The concentration of IACs appeared to be critical. Too much IAC DNA template would out-compete the target DNA template, thus giving a false negative result. However the use of an optimal IAC concentration increased the reliability of the PCR assays and appeared to be useful for food diagnostics.
Analysis of 16S-23S rRNA intergenic spacer regions of Vibrio cholerae and Vibrio mimicus.
Chun, J; Huq, A; Colwell, R R
1999-05-01
Vibrio cholerae identification based on molecular sequence data has been hampered by a lack of sequence variation from the closely related Vibrio mimicus. The two species share many genes coding for proteins, such as ctxAB, and show almost identical 16S DNA coding for rRNA (rDNA) sequences. Primers targeting conserved sequences flanking the 3' end of the 16S and the 5' end of the 23S rDNAs were used to amplify the 16S-23S rRNA intergenic spacer regions of V. cholerae and V. mimicus. Two major (ca. 580 and 500 bp) and one minor (ca. 750 bp) amplicons were consistently generated for both species, and their sequences were determined. The largest fragment contains three tRNA genes (tDNAs) coding for tRNAGlu, tRNALys, and tRNAVal, which has not previously been found in bacteria examined to date. The 580-bp amplicon contained tDNAIle and tDNAAla, whereas the 500-bp fragment had single tDNA coding either tRNAGlu or tRNAAla. Little variation, i.e., 0 to 0.4%, was found among V. cholerae O1 classical, O1 El Tor, and O139 epidemic strains. Slightly more variation was found against the non-O1/non-O139 serotypes (ca. 1% difference) and V. mimicus (2 to 3% difference). A pair of oligonucleotide primers were designed, based on the region differentiating all of V. cholerae strains from V. mimicus. The PCR system developed was subsequently evaluated by using representatives of V. cholerae from environmental and clinical sources, and of other taxa, including V. mimicus. This study provides the first molecular tool for identifying the species V. cholerae.
Kurosaki, Yohei; Magassouba, N’Faly; Oloniniyi, Olamide K.; Cherif, Mahamoud S.; Sakabe, Saori; Takada, Ayato; Hirayama, Kenji; Yasuda, Jiro
2016-01-01
Given the current absence of specific drugs or vaccines for Ebola virus disease (EVD), rapid, sensitive, and reliable diagnostic methods are required to stem the transmission chain of the disease. We have developed a rapid detection assay for Zaire ebolavirus based on reverse transcription-loop-mediated isothermal amplification (RT-LAMP) and coupled with a novel portable isothermal amplification and detection platform. The RT-LAMP assay is based on primer sets that target the untranscribed trailer region or nucleoprotein coding region of the viral RNA. The test could specifically detect viral RNAs of Central and West African Ebola virus strains within 15 minutes with no cross-reactivity to other hemorrhagic fever viruses and arboviruses, which cause febrile disease. The assay was evaluated using a total of 100 clinical specimens (serum, n = 44; oral swab, n = 56) collected from suspected EVD cases in Guinea. The specificity of this diagnostic test was 100% for both primer sets, while the sensitivity was 100% and 97.9% for the trailer and nucleoprotein primer sets, respectively, compared with a reference standard RT-PCR test. These observations suggest that our diagnostic assay is useful for identifying EVD cases, especially in the field or in settings with insufficient infrastructure. PMID:26900929
Kurosaki, Yohei; Magassouba, N'Faly; Oloniniyi, Olamide K; Cherif, Mahamoud S; Sakabe, Saori; Takada, Ayato; Hirayama, Kenji; Yasuda, Jiro
2016-02-01
Given the current absence of specific drugs or vaccines for Ebola virus disease (EVD), rapid, sensitive, and reliable diagnostic methods are required to stem the transmission chain of the disease. We have developed a rapid detection assay for Zaire ebolavirus based on reverse transcription-loop-mediated isothermal amplification (RT-LAMP) and coupled with a novel portable isothermal amplification and detection platform. The RT-LAMP assay is based on primer sets that target the untranscribed trailer region or nucleoprotein coding region of the viral RNA. The test could specifically detect viral RNAs of Central and West African Ebola virus strains within 15 minutes with no cross-reactivity to other hemorrhagic fever viruses and arboviruses, which cause febrile disease. The assay was evaluated using a total of 100 clinical specimens (serum, n = 44; oral swab, n = 56) collected from suspected EVD cases in Guinea. The specificity of this diagnostic test was 100% for both primer sets, while the sensitivity was 100% and 97.9% for the trailer and nucleoprotein primer sets, respectively, compared with a reference standard RT-PCR test. These observations suggest that our diagnostic assay is useful for identifying EVD cases, especially in the field or in settings with insufficient infrastructure.
Roh, Ha-Jung; Hilt, Deborah A; Jackwood, Mark W
2014-09-01
Real-time quantitative reverse transcriptase-polymerase chain reaction (qRT-PCR) assays have been used to detect the presence of challenge virus when the efficacy of infectious bronchitis virus (IBV) vaccine against field viruses is being experimentally evaluated. However, federal guidelines for licensing IBV vaccines indicate that challenge-virus detection following vaccination is to be conducted in embryonated eggs. In this study, we examined qRT-PCR data with the use of universal and type-specific primers and probe sets for IBV detection and compared those data with challenge-virus detection in embryonated eggs to determine if the two methods of evaluating vaccine efficacy are comparable. In addition, we tested the qRT-PCR assays on thermocyclers from two different manufacturers. We found the universal IBV primers and probe set to be comparable to challenge-virus detection in embryonated eggs. However, for some IBV types (Mass41 and Conn on the SmartCycler II and Ark, Mass41, Conn, and GA98 on the ABI 7500) the qRT-PCR assay was more sensitive than virus detection in embryonated eggs. This may simply be due to the universal IBV qRT-PCR assay being more sensitive than virus detection in eggs or to the assay detecting nucleic acid from nonviable virus. This finding is important and needs to be considered when evaluating challenge-virus detection for vaccination and challenge studies, because qRT-PCR could potentially identify positive birds that would otherwise be negative by virus detection in embryonated eggs; thus it could lead to a more stringent measure of vaccine efficacy. We also found that the IBV type-specific primers and probe sets designed in this study were in general less sensitive than the universal IBV primers and probe set. Only the Ark-DPI-spedcific assay on the SmartCycler II and the Ark-DPI-, Mass41-, and DE072/GA98- (for detection of GA98 virus only) specific assays on the ABI 7500 were comparable in sensitivity to virus detection in eggs. We found that a number of variables, including the virus type examined, primers and probe efficiency and stability, and assay conditions, including thermocycler platform, can affect the data obtained from qRT-PCR assays. These results indicate that qRT-PCR assays can be used to detect IBV challenge virus, but each assay, including the assay conditions and thermocycler, should be individually evaluated if those data are expected to be comparable to virus detection in embryonated eggs.
Letellier, C; Kerkhofs, P; Wellemans, G; Vanopdenbosch, E
1999-01-01
A reverse-transcription polymerase chain reaction (RT-PCR) was developed to differentiate the bovine diarrhea virus (BVDV) from other pestiviruses, and to determine the genotype of the BVDV isolates. For this purpose, primer pairs were selected in the 5' untranslated region (5'UTR). The primers BE and B2 were located in highly conserved regions and were pestivirus-specific. Two primer pairs named B3B4 and B5B6 were specific of BVDV genotypes I and II, respectively. With this technique, an amplification product of the expected size was obtained with either the B3B4 or the B5B6 primer pairs for the 107 BVDV isolates tested but not for BDV or CSFV. For some isolates that were grouped in the genotype II, sequence analysis of the PCR fragments confirmed their classification into this genotype.
2012-01-01
Background Hawthorn is the common name of all plant species in the genus Crataegus, which belongs to the Rosaceae family. Crataegus are considered useful medicinal plants because of their high content of proanthocyanidins (PAs) and other related compounds. To improve PAs production in Crataegus tissues, the sequences of genes encoding PAs biosynthetic enzymes are required. Findings Different bioinformatics tools, including BLAST, multiple sequence alignment and alignment PCR analysis were used to design primers suitable for the amplification of DNA fragments from 10 candidate genes encoding enzymes involved in PAs biosynthesis in C. aronia. DNA sequencing results proved the utility of the designed primers. The primers were used successfully to amplify DNA fragments of different PAs biosynthesis genes in different Rosaceae plants. Conclusion To the best of our knowledge, this is the first use of the alignment PCR approach to isolate DNA sequences encoding PAs biosynthetic enzymes in Rosaceae plants. PMID:22883984
An expanded nuclear phylogenomic PCR toolkit for Sapindales1
Collins, Elizabeth S.; Gostel, Morgan R.; Weeks, Andrea
2016-01-01
Premise of the study: We tested PCR amplification of 91 low-copy nuclear gene loci in taxa from Sapindales using primers developed for Bursera simaruba (Burseraceae). Methods and Results: Cross-amplification of these markers among 10 taxa tested was related to their phylogenetic distance from B. simaruba. On average, each Sapindalean taxon yielded product for 53 gene regions (range: 16–90). Arabidopsis thaliana (Brassicales), by contrast, yielded product for two. Single representatives of Anacardiaceae and Rutacaeae yielded 34 and 26 products, respectively. Twenty-six primer pairs worked for all Burseraceae species tested if highly divergent Aucoumea klaineana is excluded, and eight of these amplified product in every Sapindalean taxon. Conclusions: Our study demonstrates that customized primers for Bursera can amplify product in a range of Sapindalean taxa. This collection of primer pairs, therefore, is a valuable addition to the toolkit for nuclear phylogenomic analyses of Sapindales and warrants further investigation. PMID:28101434
Zuiter, Afnan Saeid; Sawwan, Jammal; Al Abdallat, Ayed
2012-08-10
Hawthorn is the common name of all plant species in the genus Crataegus, which belongs to the Rosaceae family. Crataegus are considered useful medicinal plants because of their high content of proanthocyanidins (PAs) and other related compounds. To improve PAs production in Crataegus tissues, the sequences of genes encoding PAs biosynthetic enzymes are required. Different bioinformatics tools, including BLAST, multiple sequence alignment and alignment PCR analysis were used to design primers suitable for the amplification of DNA fragments from 10 candidate genes encoding enzymes involved in PAs biosynthesis in C. aronia. DNA sequencing results proved the utility of the designed primers. The primers were used successfully to amplify DNA fragments of different PAs biosynthesis genes in different Rosaceae plants. To the best of our knowledge, this is the first use of the alignment PCR approach to isolate DNA sequences encoding PAs biosynthetic enzymes in Rosaceae plants.
Specific and sensitive detection of the conifer pathogen Gremmeniella abietina by nested PCR
Zeng, Qing-Yin; Hansson, Per; Wang, Xiao-Ru
2005-01-01
Background Gremmeniella abietina (Lagerb.) Morelet is an ascomycete fungus that causes stem canker and shoot dieback in many conifer species. The fungus is widespread and causes severe damage to forest plantations in Europe, North America and Asia. To facilitate early diagnosis and improve measures to control the spread of the disease, rapid, specific and sensitive detection methods for G. abietina in conifer hosts are needed. Results We designed two pairs of specific primers for G. abietina based on the 18S rDNA sequence variation pattern. These primers were validated against a wide range of fungi and 14 potential conifer hosts. Based on these specific primers, two nested PCR systems were developed. The first system employed universal fungal primers to enrich the fungal DNA targets in the first round, followed by a second round selective amplification of the pathogen. The other system employed G. abietina-specific primers in both PCR steps. Both approaches can detect the presence of G. abietina in composite samples with high sensitivity, as little as 7.5 fg G. abietina DNA in the host genomic background. Conclusion The methods described here are rapid and can be applied directly to a wide range of conifer species, without the need for fungal isolation and cultivation. Therefore, it represents a promising alternative to disease inspection in forest nurseries, plantations and quarantine control facilities. PMID:16280082
NASA Astrophysics Data System (ADS)
Tanumihardja, J.; Bela, B.
2017-08-01
Fusion inhibitors have potential for future use in HIV control programs in Indonesia, so the capacity to test resistance to such drugs needs to be developed. Resistance-detection with a genotypic assay began with amplification of the target gene, gp41. Based on the sequence of the two most common HIV subtypes in Indonesia, AE and B, a primer pair was designed. Plasma samples containing both subtypes were extracted to obtain HIV RNA. Using PCR, the primer pair was used to produce the amplification product, the identity of which was checked based on length under electrophoresis. Eleven plasma samples were included in this study. One-step PCR using the primer pair was able to amplify gp41 from 54.5% of the samples, and an unspecific amplification product was seen in 1.1% of the samples. Amplification failed in 36.4% of the samples, which may be due to an inappropriate primer sequence. It was also found that the optimal annealing temperature for producing the single expected band was 57.2 °C. With one-step PCR, the designed primer pair amplified the HIV-1 gp41 gene from subtypes AE and B. However, further research should be done to determine the conditions that will increase the sensitivity and specificity of the amplification process.
Identifying of meat species using polymerase chain reaction (PCR)
NASA Astrophysics Data System (ADS)
Foong, Chow Ming; Sani, Norrakiah Abdullah
2013-11-01
Meat has been widely consumed as an important protein source in daily life of human. Furthermore, with busy and intense urban lifestyle, processed food is now one of the main protein sources of one's diet. Consumers rely on the food labeling to decide if the meat product purchased is safe and reliable. Therefore, it is important to ensure the food labeling is done in a correct manner to avoid consumer fraud. More consumers are now concern about the food quality and safety as compared to before. This study described the meat species identification and detection method using Polymerase Chain Reaction (PCR) in 8 types of meats (cattle, buffalo, goat, sheep, chicken, duck, pork and horse). The objective of this study is to decide on the specificity of oligonucleotide sequences obtained from previous study. There were 5 proposed oligonucleotide primer in this study. The main important finding in this work is the specificity of oligonucleotide primers to raw meats. It if found that the oligonucleotide primers proposed were not specific to the local raw meat species. Therefore, further study is needed to obtain a species-specific oligonucletide primers for PCR, in order to be applied in food product testing.
A multiplex method for detection of glucose-6-phosphate dehydrogenase (G6PD) gene mutations.
Zhang, L; Yang, Y; Liu, R; Li, Q; Yang, F; Ma, L; Liu, H; Chen, X; Yang, Z; Cui, L; He, Y
2015-12-01
Glucose-6-phosphate dehydrogenase (G6PD) deficiency is the most common human enzyme defect caused by G6PD gene mutations. This study aimed to develop a cost-effective, multiplex, genotyping method for detecting common mutations in the G6PD gene. We used a SNaPshot approach to genotype multiple G6PD mutations that are common to human populations in South-East Asia. This assay is based on multiplex PCR coupled with primer extension reactions. Different G6PD gene mutations were determined by peak retention time and colors of the primer extension products. We designed PCR primers for multiplex amplification of the G6PD gene fragments and for primer extension reactions to genotype 11 G6PD mutations. DNA samples from a total of 120 unrelated G6PD-deficient individuals from the China-Myanmar border area were used to establish and validate this method. Direct sequencing of the PCR products demonstrated 100% concordance between the SNaPshot and the sequencing results. The SNaPshot method offers a specific and sensitive alternative for simultaneously interrogating multiple G6PD mutations. © 2015 John Wiley & Sons Ltd.
Cho, Pyo Yun; Na, Byoung-Kuk; Mi Choi, Kyung; Kim, Jin Su; Cho, Shin-Hyeong; Lee, Won-Ja; Lim, Sung-Bin; Cha, Seok Ho; Park, Yun-Kyu; Pak, Jhang Ho; Lee, Hyeong-Woo; Hong, Sung-Jong; Kim, Tong-Soo
2013-01-01
Microscopic examination of eggs of parasitic helminths in stool samples has been the most widely used classical diagnostic method for infections, but tiny and low numbers of eggs in stool samples often hamper diagnosis of helminthic infections with classical microscopic examination. Moreover, it is also difficult to differentiate parasite eggs by the classical method, if they have similar morphological characteristics. In this study, we developed a rapid and sensitive polymerase chain reaction (PCR)-based molecular diagnostic method for detection of Clonorchis sinensis eggs in stool samples. Nine primers were designed based on the long-terminal repeat (LTR) of C. sinensis retrotransposon1 (CsRn1) gene, and seven PCR primer sets were paired. Polymerase chain reaction with each primer pair produced specific amplicons for C. sinensis, but not for other trematodes including Metagonimus yokogawai and Paragonimus westermani. Particularly, three primer sets were able to detect 10 C. sinensis eggs and were applicable to amplify specific amplicons from DNA samples purified from stool of C. sinensis-infected patients. This PCR method could be useful for diagnosis of C. sinensis infections in human stool samples with a high level of specificity and sensitivity. PMID:23916334
Mazumdar-Leighton, S; Babu, C R; Bennett, J
2000-01-01
We have used RT PCR and 3'RACE to identify diverse serine proteinase genes expressed in the midguts of the rice yellow stem borer (Scirpophaga incertulas) and Asian corn borer (Helicoverpa armigera). The RT-PCR primers encoded the conserved regions around the active site histidine57 and serine195 of Drosophila melanogaster alpha trypsin, including aspartate189 of the specificity pocket. These primers amplified three transcripts (SiP1-3) from midguts of S. incertulas, and two transcripts (HaP1-2) from midguts of H. armigera. The five RT PCR products were sequenced to permit design of gene-specific forward primers for use with anchored oligo dT primers in 3'RACE. Sequencing of the 3'RACE products indicated that SiP1, SiP2 and HaP1 encoded trypsin-like serine proteinases, while HaP2 encoded a chymotrypsin-like serine proteinases. The SiP3 transcript proved to be an abundant 960 nt mRNA encoding a trypsin-like protein in which the active site serine195 was replaced by aspartate. The possible functions of this unusual protein are discussed.
Identifying of meat species using polymerase chain reaction (PCR)
DOE Office of Scientific and Technical Information (OSTI.GOV)
Foong, Chow Ming; Sani, Norrakiah Abdullah
Meat has been widely consumed as an important protein source in daily life of human. Furthermore, with busy and intense urban lifestyle, processed food is now one of the main protein sources of one’s diet. Consumers rely on the food labeling to decide if the meat product purchased is safe and reliable. Therefore, it is important to ensure the food labeling is done in a correct manner to avoid consumer fraud. More consumers are now concern about the food quality and safety as compared to before. This study described the meat species identification and detection method using Polymerase Chain Reactionmore » (PCR) in 8 types of meats (cattle, buffalo, goat, sheep, chicken, duck, pork and horse). The objective of this study is to decide on the specificity of oligonucleotide sequences obtained from previous study. There were 5 proposed oligonucleotide primer in this study. The main important finding in this work is the specificity of oligonucleotide primers to raw meats. It if found that the oligonucleotide primers proposed were not specific to the local raw meat species. Therefore, further study is needed to obtain a species-specific oligonucletide primers for PCR, in order to be applied in food product testing.« less
A simple PCR-based strategy for estimating species-specific contributions in chimeras and xenografts
Ealba, Erin L.; Schneider, Richard A.
2013-01-01
Many tissue-engineering approaches for repair and regeneration involve transplants between species. Yet a challenge is distinguishing donor versus host effects on gene expression. This study provides a simple molecular strategy to quantify species-specific contributions in chimeras and xenografts. Species-specific primers for reverse transcription quantitative real-time PCR (RT-qPCR) were designed by identifying silent mutations in quail, duck, chicken, mouse and human ribosomal protein L19 (RPL19). cDNA from different pairs of species was mixed in a dilution series and species-specific RPL19 primers were used to generate standard curves. Then quail cells were transplanted into transgenic-GFP chick and resulting chimeras were analyzed with species-specific primers. Fluorescence-activated cell sorting (FACS) confirmed that donor- and host-specific levels of RPL19 expression represent actual proportions of cells. To apply the RPL19 strategy, we measured Runx2 expression in quail-duck chimeras. Elevated Runx2 levels correlated with higher percentages of donor cells. Finally, RPL19 primers also discriminated mouse from human and chick. Thus, this strategy enables chimeras and/or xenografts to be screened rapidly at the molecular level. PMID:23785056
NASA Astrophysics Data System (ADS)
Carrion, C. N.; Slesinger, E.; Marinovic, B.
2016-02-01
Euphausiids, otherwise known as krill, are an important link between primary producers and higher trophic levels within the central California current upwelling system. Euphausia pacifica and Thysanoessa spinifera, two of the most common euphausiid species along the central California coast, are both broadcast spawners and have some overlap in habitat, e.g. near marine life hotspots like the Monterey Bay and Gulf of Farallones. Species composition of euphausiid egg population within these regions is currently unknown. Distinct morphological differences between their eggs are lost once the egg dies or is preserved via formalin, alcohol, or freezing. In this project we designed genus specific DNA primers (mtCOI) for use in a multiplex PCR to distinguish among spawned euphausiid eggs of Euphausia spp. and Thysanoessa spp. in central California current surface waters. Effective and ineffective application of primers in a multiplex versus single-plex PCR is discussed, with an emphasis on primer design limitations in reference to the available barcoded regions of mitochondrial cytochrome oxidase subunit I (mtCOI) for each species in GenBank. This new protocol expands current monitoring efforts into sampling a non-swimming portion of the population which has the potential to improve euphausiid biomass estimates.
Multiprimer PCR system for differential identification of mycobacteria in clinical samples.
Del Portillo, P; Thomas, M C; Martínez, E; Marañón, C; Valladares, B; Patarroyo, M E; Carlos López, M
1996-01-01
A novel multiprimer PCR method with the potential to identify mycobacteria in clinical samples is presented. The assay relies on the simultaneous amplification of three bacterial DNA genomic fragments by using different sets of oligonucleotide primers. The first set of primers amplifies a 506-bp fragment from the gene for the 32-kDa antigen of Mycobacterium tuberculosis, which is present in most of the species belonging to the genus Mycobacterium. The second set of primers amplifies a 984-bp fragment from the IS6110 insertion sequence of the bacteria belonging to the M. tuberculosis complex. The third set of primers, derived from an M. tuberculosis species-specific sequence named MTP40, amplifies a 396-bp genomic fragment. Thus, while the multiprimer system would render three amplification fragments from the M. tuberculosis genome and two fragments from the Mycobacterium bovis genome, a unique amplification fragment would be obtained from nontuberculous mycobacteria. The results obtained, using reference mycobacterial strains and typed clinical isolates, show that the multiprimer PCR method may be a rapid, sensitive, and specific tool for the differential identification of various mycobacterial strains in a single-step assay. PMID:8789008
Clinician's Primer to ICD-10-CM Coding for Cleft Lip/Palate Care.
Allori, Alexander C; Cragan, Janet D; Della Porta, Gina C; Mulliken, John B; Meara, John G; Bruun, Richard; Shusterman, Stephen; Cassell, Cynthia H; Raynor, Eileen; Santiago, Pedro; Marcus, Jeffrey R
2017-01-01
On October 1, 2015, the United States required use of the Clinical Modification of the International Classification of Diseases, 10th Revision (ICD-10-CM) for diagnostic coding. This primer was written to assist the cleft care community with understanding and use of ICD-10-CM for diagnostic coding related to cleft lip and/or palate (CL/P).
A novel MALDI–TOF based methodology for genotyping single nucleotide polymorphisms
Blondal, Thorarinn; Waage, Benedikt G.; Smarason, Sigurdur V.; Jonsson, Frosti; Fjalldal, Sigridur B.; Stefansson, Kari; Gulcher, Jeffery; Smith, Albert V.
2003-01-01
A new MALDI–TOF based detection assay was developed for analysis of single nucleotide polymorphisms (SNPs). It is a significant modification on the classic three-step minisequencing method, which includes a polymerase chain reaction (PCR), removal of excess nucleotides and primers, followed by primer extension in the presence of dideoxynucleotides using modified thermostable DNA polymerase. The key feature of this novel assay is reliance upon deoxynucleotide mixes, lacking one of the nucleotides at the polymorphic position. During primer extension in the presence of depleted nucleotide mixes, standard thermostable DNA polymerases dissociate from the template at positions requiring a depleted nucleotide; this principal was harnessed to create a genotyping assay. The assay design requires a primer- extension primer having its 3′-end one nucleotide upstream from the interrogated site. The assay further utilizes the same DNA polymerase in both PCR and the primer extension step. This not only simplifies the assay but also greatly reduces the cost per genotype compared to minisequencing methodology. We demonstrate accurate genotyping using this methodology for two SNPs run in both singleplex and duplex reactions. We term this assay nucleotide depletion genotyping (NUDGE). Nucleotide depletion genotyping could be extended to other genotyping assays based on primer extension such as detection by gel or capillary electrophoresis. PMID:14654708
Vuran, Emre; Karaarslan, Aydın; Karasartova, Djursun; Turegun, Buse; Sahin, Fikret
2014-02-01
Despite the fact that a range of molecular methods have been developed as tools for the diagnosis of Malassezia species, there are several drawbacks associated with them, such as inefficiency of differentiating all the species, high cost, and questionable reproducibility. In addition, most of the molecular methods require cultivation to enhance sensitivity. Therefore, alternative methods eliminating cultivation and capable of identifying species with high accuracy and reliability are needed. Herein, a multiplex polymerase chain reaction (PCR)-based method was especially developed for the detection of eleven Malassezia species. The multiplex PCR was standardized by incorporating a consensus forward primer, along with Malassezia species-specific reverse primers considering the sizes of the PCR products. In the method, the multiplex-PCR primer content is divided into three parts to circumvent the problem of increased nonspecific background resulting from the use of a large number of primers. DNA extraction protocol described by Harju and colleagues was modified using liquid nitrogen instead of -80 °C to break down the yeast membrane. By a modified extraction procedure followed by multiplex PCR and electrophoresis, the method enables identification and differentiation of Malassezia species from both of the samples obtained directly from skin and yeast colonies grown in culture. Fifty-five patients who were confirmed with pityriasis versicolor were enrolled in the study. Multiplex PCR detected and differentiated all 55 samples obtained directly from the patients' skin. However, 50 out of 55 samples yielded Malassezia colony in the culture. In addition, eight of 50 colonies were misdiagnosed or not completely differentiated by conventional methods based on the sequence analysis of eight colonies. The method is capable of identifying species with high accuracy and reliability. In addition, it is simple, quick, and cost-effective. More importantly, the method works efficiently for the diagnosis of Malassezia species obtained directly from patient samples.
Wensing, Annette; Zimmermann, Stefan; Geider, Klaus
2010-01-01
Pantoea stewartii subsp. stewartii is the causative agent of Stewart's wilt, a bacterial disease transmitted by the corn flea beetle mainly to sweet corn (Zea mays). In many countries, it is classified as a quarantine organism and must be differentiated from other yellow enteric bacteria frequently occurring with corn. We have created novel primers from the pstS-glmS region of P. stewartii for use in conventional PCR (cPCR) and quantitative PCR (qPCR). To facilitate rapid diagnosis, we applied matrix-assisted laser desorption ionization-time-of-flight mass spectrometry (MALDI-TOF MS) analysis. Using whole-cell protein extracts, profiles were generated with a Bruker microflex machine, and the bacteria classified. P. stewartii strains were clearly distinguished from strains of Pantoea agglomerans, Pantoea dispersa, and Pantoea ananatis. Dendrogram analysis of the protein profiles confirmed the score values and showed the formation of separate clades for each species. The identification achieved by MALDI-TOF MS analysis agrees with the diagnosis by specific PCR primers. The combination of both methods allows a rapid and simple identification of the corn pathogen. P. stewartii subsp. stewartii and P. stewartii subsp. indologenes are highly related and can be distinguished not only by virulence assays and indole tests but also by a characteristic pattern in the nucleotide sequence of recA. PMID:20656863
Development of a PCR protocol to detect aflatoxigenic molds in food products.
Luque, M Isabel; Rodríguez, Alicia; Andrade, María J; Martín, Alberto; Córdoba, Juan J
2012-01-01
Aflatoxins are secondary metabolites produced mainly by Aspergillus species growing in foodstuffs. Because aflatoxins have important health effects, the detection of early contamination of foods by aflatoxigenic molds should be useful. In the present work, a reliable conventional PCR method for detecting aflatoxigenic molds of various species was developed. Fifty-six aflatoxigenic and nonaflatoxigenic strains commonly reported in foodstuffs were tested. Aflatoxin production was first confirmed by micellar electrokinetic capillary electrophoresis or/and high-pressure liquid chromatography-mass spectrometry. Based on the conserved regions of the O-methyltransferase gene (omt-1) involved in the aflatoxin biosynthetic pathway, six primer pairs were designed. With only the designed primer pair AFF1-AFR3, the expected PCR product (381 bp) was obtained in all of the tested aflatoxigenic strains of various species and genera. Amplification products were not obtained with this primer pair for any of the nonaflatoxigenic reference molds. However, an amplicon of 453 bp was obtained for all aflatoxigenic and nonaflatoxigenic mold reference strains with a PCR protocol based on the constitutive fungal β-tubulin gene, which was used as a positive fungal control. The PCR protocol based on omt-1 detected as little as 15 pg of DNA from aflatoxigenic molds and 10(2) to 10(3) CFU/g in contaminated food samples. This PCR protocol should be used as a routine technique to detect aflatoxigenic molds in foods.
Expression of human papillomavirus 6 in inverted papilloma arising in a renal transplant recipient.
Harris, M O; Beck, J C; Terrell, J E; McClatchey, K D; Carey, T E; Bradford, C R
1998-01-01
A 36-year-old renal transplant recipient taking cyclosporin A presented with bilateral nasal polypoid lesions involving the nasal septum and lateral nasal walls. Pathologic findings from surgical excision demonstrated inverted papilloma (IP) with focal atypia and mild dysplasia. DNA extracted from the tissue was tested with the polymerase chain reaction (PCR) using human papillomavirus (HPV) E6 and L1 consensus primers. This revealed amplification of the expected size fragment consistent with the presence of HPV DNA. Hybridization of PCR products with HPV type-specific oligonucleotide probes revealed a strong signal with only HPV 6. This result was confirmed by PCR amplification with HPV 6 type-specific primers. RNA extracted from the tissue was subjected to reverse transcription PCR (RT-PCR) with a primer pair specific for viral E6/E7 transcripts. The HPV early proteins, E6 and E7, are the transforming proteins implicated as critical for tumorigenesis. RT-PCR experiments generated products representing the E1/E4 spliced transcript originating from the E6/E6 promoter and a smaller unclassified fragment. These results provide evidence for HPV 6 E6/E7 expression in IP, lending credence to the concept that HPV may play a role in the origin of this neoplasm. Histologically normal nasal tissue from the same patient contained HPV DNA and similar transcripts to those described in the IP specimen.
Ott, Stephan J; Musfeldt, Meike; Ullmann, Uwe; Hampe, Jochen; Schreiber, Stefan
2004-06-01
The composition of the human intestinal flora is important for the health status of the host. The global composition and the presence of specific pathogens are relevant to the effects of the flora. Therefore, accurate quantification of all major bacterial populations of the enteric flora is needed. A TaqMan real-time PCR-based method for the quantification of 20 dominant bacterial species and groups of the intestinal flora has been established on the basis of 16S ribosomal DNA taxonomy. A PCR with conserved primers was used for all reactions. In each real-time PCR, a universal probe for quantification of total bacteria and a specific probe for the species in question were included. PCR with conserved primers and the universal probe for total bacteria allowed relative and absolute quantification. Minor groove binder probes increased the sensitivity of the assays 10- to 100-fold. The method was evaluated by cross-reaction experiments and quantification of bacteria in complex clinical samples from healthy patients. A sensitivity of 10(1) to 10(3) bacterial cells per sample was achieved. No significant cross-reaction was observed. The real-time PCR assays presented may facilitate understanding of the intestinal bacterial flora through a normalized global estimation of the major contributing species.
Muneta, Yoshihiro; Minagawa, Yu; Kusumoto, Masahiro; Shinkai, Hiroki; Uenishi, Hirohide; Splichal, Igor
2012-05-01
In the present study, we have developed an allele-specific primer-polymerase chain reaction (ASP-PCR) for genotyping a single nucleotide polymorphism (SNP) of swine Toll-like receptor 2 (TLR2) (C406G), which is related to the prevalence of pneumonia caused by Mycoplasma hyopneumoniae. We also compared the allele frequency among several pig breeds of Japan and the Czech Republic. Allele-specific primers were constructed by introducing 1-base mismatch sequence before the SNP site. The swine TLR2 C406G mutation was successfully determined by the ASP-PCR using genomic DNA samples in Japan as previously genotyped by a sequencing method. Using the PCR condition determined, genomic DNA samples from pig blood obtained from 110 pigs from 7 different breeds in the Czech Republic were genotyped by the ASP-PCR. The genotyping results from the ASP-PCR were completely matched with the results from the sequencing method. The allele frequency of the swine TLR2 C406G mutation was 27.5% in the Czech Republic and 3.6% in Japan. The C406G mutation was only found in the Landrace breed in Japan, and was almost exclusively found in the Landrace breed in the Czech Republic as well. These results indicated the usefulness of ASP-PCR for detecting a specific SNP for swine TLR2.
Jaramillo-Correa, J P; Bousquet, J; Beaulieu, J; Isabel, N; Perron, M; Bouillé, M
2003-05-01
Primers previously developed to amplify specific non-coding regions of the mitochondrial genome in Angiosperms, and new primers for additional non-coding mtDNA regions, were tested for their ability to direct DNA amplification in 12 conifer taxa and to detect sequence-tagged-site (STS) polymorphisms within and among eight species in Picea. Out of 12 primer pairs, nine were successful at amplifying mtDNA in most of the taxa surveyed. In conifers, indels and substitutions were observed for several loci, allowing them to distinguish between families, genera and, in some cases, between species within genera. In Picea, interspecific polymorphism was detected for four loci, while intraspecific variation was observed for three of the mtDNA regions studied. One of these (SSU rRNA V1 region) exhibited indel polymorphisms, and the two others ( nad1 intron b/c and nad5 intron1) revealed restriction differences after digestion with Sau3AI (PCR-RFLP). A fourth locus, the nad4L- orf25 intergenic region, showed a multibanding pattern for most of the spruce species, suggesting a possible gene duplication. Maternal inheritance, expected for mtDNA in conifers, was observed for all polymorphic markers except the intergenic region nad4L- orf25. Pooling of the variation observed with the remaining three markers resulted in two to six different mtDNA haplotypes within the different species of Picea. Evidence for intra-genomic recombination was observed in at least two taxa. Thus, these mitotypes are likely to be more informative than single-locus haplotypes. They should be particularly useful for the study of biogeography and the dynamics of hybrid zones.
Cytochrome c oxidase I primers for corbiculate bees: DNA barcode and mini-barcode.
Françoso, E; Arias, M C
2013-09-01
Bees (Apidae), of which there are more than 19 900 species, are extremely important for ecosystem services and economic purposes, so taxon identity is a major concern. The goal of this study was to optimize the DNA barcode technique based on the Cytochrome c oxidase (COI) mitochondrial gene region. This approach has previously been shown to be useful in resolving taxonomic inconsistencies and for species identification when morphological data are poor. Specifically, we designed and tested new primers and standardized PCR conditions to amplify the barcode region for bees, focusing on the corbiculate Apids. In addition, primers were designed to amplify small COI amplicons and tested with pinned specimens. Short barcode sequences were easily obtained for some Bombus century-old museum specimens and shown to be useful as mini-barcodes. The new primers and PCR conditions established in this study proved to be successful for the amplification of the barcode region for all species tested, regardless of the conditions of tissue preservation. We saw no evidence of Wolbachia or numts amplification by these primers, and so we suggest that these new primers are of broad value for corbiculate bee identification through DNA barcode. © 2013 John Wiley & Sons Ltd.
Kim, Seong U; Batule, Bhagwan S; Mun, Hyoyoung; Byun, Ju-Young; Shim, Won-Bo; Kim, Min-Gon
2018-02-07
We have developed a novel strategy for the colorimetric detection of PCR products by utilizing a target-specific primer modified at the 5'-end with an anti-DNAzyme sequence. A single-stranded DNAzyme sequence folds into a G-quadruplex structure with hemin and shows strong peroxidase activity. When the complementary strand binds to the DNAzyme sequence, it blocks the formation of the G-quadraduplex structure and loses its peroxidase activity. In the presence of the target gene, PCR amplification proceeds, and anti-DNAzyme sequence modified primers present in the reaction mixture form a double strand through primer extension. Therefore, it does not block the DNAzyme sequence. Further, a colorimetric signal is generated by the addition of 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonate) (ABTS) and H 2 O 2 at the end of the reaction. We have successfully detected a single copy of the HIV type 1 gag gene in buffer and 10 copies in human serum. The strategy developed could be used to detect DNA and RNA in complex biological samples by simple primer designing that includes DNAzyme and a DNA extended primer.
A PCR-based method for detecting the mycelia of stipitate hydnoid fungi in soil.
van der Linde, Sietse; Alexander, Ian; Anderson, Ian C
2008-09-01
To reduce the reliance on sporocarp records for conservation efforts, information on the below-ground distribution of specific fungal species, such as stipitate hydnoid fungi, is required. Species-specific primers were developed within the internal transcribed spacer (ITS1 and ITS2) regions for 12 hydnoid fungal species including Bankera fuligineoalba, Hydnellum aurantiacum, H. caeruleum, H. concrescens, H. ferrugineum, H. peckii, Phellodon confluens, P. melaleucus, P. niger, P. tomentosus, Sarcodon glaucopus and S. squamosus. The specificity of the primer pairs was tested using BLAST searches and PCR amplifications. All primers amplified DNA only of the target species with the exception of those designed for P. melaleucus. In order to assess the ability of the primers to detect DNA from mycelium in soil, DNA extracted from soil samples taken from around solitary H. peckii sporocarps was amplified with the H. peckii primer 1peck and ITS2. H. peckii DNA was detected in 70% of all soil samples and up to 40 cm away from the base of individual sporocarps. The development of these species-specific primers provides a below-ground alternative for monitoring the distribution of these rare fungi.
Bahkali, Ali H.; Abd-Elsalam, Kamel A.; Guo, Jian-Rong; Khiyami, Mohamed A.; Verreet, Joseph-Alexander
2012-01-01
The goals of this investigation were to identify and evaluate the use of polymorphic microsatellite marker (PMM) analysis for molecular typing of seventeen plant pathogenic fungi. Primers for di-, tri-, and tetranucleotide loci were designed directly from the recently published genomic sequence of Mycospherlla graminicola and Fusarium graminearum. A total of 20 new microsatellite primers as easy-to-score markers were developed. Microsatellite primer PCR (MP-PCR) yielded highly reproducible and complex genomic fingerprints, with several bands ranging in size from 200 to 3000 bp. Of the 20 primers tested, only (TAGG)4, (TCC)5 and (CA)7T produced a high number of polymorphic bands from either F. graminearum or F. culmorum. (ATG)5 led to successful amplifications in M. graminicola isolates collected from Germany. Percentage of polymorphic bands among Fusarium species ranged from 9 to 100%. Cluster analysis of banding patterns of the isolates corresponded well to the established species delineations based on morphology and other methods of phylogenetic analysis. The current research demonstrates that the newly designed microsatellite primers are reliable, sensitive and technically simple tools for assaying genetic variability in plant pathogenic fungi. PMID:22489135
Altınel, Ahmet
2017-01-01
Complex vertebral malformation (CVM) is an inherited, autosomal recessive disorder of Holstein cattle. The aim of this study was to compare sensitivity, specificity, positive and negative predictive values, accuracy, and rapidity of allele-specific polymerase chain reaction (AS-PCR), created restriction-site PCR (CRS-PCR), and PCR with primer-introduced restriction analysis (PCR-PIRA), three methods used in identification of CVM carriers in a Holstein cattle population. In order to screen for the G>T mutation in the solute carrier family 35 member A3 (SLC35A3) gene, DNA sequencing as the gold standard method was used. The prevalence of carriers and the mutant allele frequency were 3.2% and 0.016, respectively, among Holstein cattle in the Thrace region of Turkey. Among the three methods, the fastest but least accurate was AS-PCR. Although the rapidity of CRS-PCR and PCR-PIRA were nearly equal, the accuracy of PCR-PIRA was higher than that of CRS-PCR. Therefore, among the three methods, PCR-PIRA appears to be the most efficacious for screening of mutant alleles when identifying CVM carriers in a Holstein cattle population. PMID:28927256
Sechi, Leonardo A.; Leori, Guido; Lollai, Stefano A.; Duprè, Ilaria; Molicotti, Paola; Fadda, Giovanni; Zanetti, Stefania
1999-01-01
Different genetic markers were used to analyze 22 Mycobacterium bovis strains isolated from cattle in Sardinia and one human isolate. IS6110 DNA fingerprinting differentiated the strains into six patterns, whereas with enterobacterial repetitive consensus sequence primers produced seven clusters. PCR ribotyping followed by digestion with HaeIII and PvuII produced five and seven patterns, respectively. PCR with the (GTG)5 oligonucleotide primer showed the best discriminatory power, generating eight clusters among the strains analyzed. PMID:10103282
Miyajima, Yoshiharu; Satoh, Kazuo; Uchida, Takao; Yamada, Tsuyoshi; Abe, Michiko; Watanabe, Shin-ichi; Makimura, Miho; Makimura, Koichi
2013-03-01
Trichophyton rubrum and Trichophyton mentagrophytes human-type (synonym, Trichophyton interdigitale (anthropophilic)) are major causative pathogens of tinea unguium. For suitable diagnosis and treatment, rapid and accurate identification of etiologic agents in clinical samples using reliable molecular based method is required. For identification of organisms causing tinea unguium, we developed a new real-time polymerase chain reaction (PCR) with a pan-fungal primer set and probe, as well as specific primer sets and probes for T. rubrum and T. mentagrophytes human-type. We designed two sets of primers from the internal transcribed spacer 1 (ITS1) region of fungal ribosomal DNA (rDNA) and three quadruple fluorescent probes, one for detection wide range pathogenic fungi and two for classification of T. rubrum and T. mentagrophytes by specific binding to different sites in the ITS1 region. We investigated the specificity of these primer sets and probes using fungal genomic DNA, and also examined 42 clinical specimens with our real-time PCR. The primers and probes specifically detected T. rubrum, T. mentagrophytes, and a wide range of pathogenic fungi. The causative pathogens were identified in 42 nail and skin samples from 32 patients. The total time required for identification of fungal species in each clinical specimen was about 3h. The copy number of each fungal DNA in the clinical specimens was estimated from the intensity of fluorescence simultaneously. This PCR system is one of the most rapid and sensitive methods available for diagnosing dermatophytosis, including tinea unguium and tinea pedis. Copyright © 2012 Japanese Society for Investigative Dermatology. Published by Elsevier Ireland Ltd. All rights reserved.
Identification of aster yellows phytoplasma in garlic and green onion by PCR-based methods.
Khadhair, A H; Evans, I R; Choban, B
2002-01-01
In the summer of 1999, typical yellows-type symptoms were observed on garlic and green onion plants in a number of gardens and plots around Edmonton, Alberta, Canada. DNA was extracted from leaf tissues of evidently healthy and infected plants. DNA amplifications were conducted on these samples, using two primer pairs, R16F2n/R2 and R16(1)F1/R1, derived from phytoplasma rDNA sequences. DNA samples of aster yellows (AY), lime witches'-broom (LWB) and potato witches'-broom (PWB) phytoplasmas served as controls and were used to determine group relatedness. In a direct polymerase chain reaction (PCR) assay, DNA amplification with universal primer pair R16F2n/R2 gave the expected amplified products of 1.2 kb. Dilution (1/40) of each of the latter products were used as template and nested with specific primer pair R16(1)F1/R1. An expected PCR product of 1.1 kb was obtained from each phytoplasma-infected garlic and green onion samples, LWB and AY phytoplasmas but not from PWB phytoplasma. An aliquot from each amplification product (1.2 kb) with universal primers was subjected to PCR-based restriction fragment length polymorphism (RFLP) to identify phytoplasma isolates, using four restriction endonucleases (AluI, KpnI, MseI and RsaI). DNA amplification with specific primer pair R16(1)F1/R1 and RFLP analysis indicated the presence of AY phytoplasma in the infected garlic and green onion samples. These results suggest that AY phytoplasma in garlic and green onion samples belong to the subgroup 16Sr1-A.
Development of a set of SNP markers present in expressed genes of the apple.
Chagné, David; Gasic, Ksenija; Crowhurst, Ross N; Han, Yuepeng; Bassett, Heather C; Bowatte, Deepa R; Lawrence, Timothy J; Rikkerink, Erik H A; Gardiner, Susan E; Korban, Schuyler S
2008-11-01
Molecular markers associated with gene coding regions are useful tools for bridging functional and structural genomics. Due to their high abundance in plant genomes, single nucleotide polymorphisms (SNPs) are present within virtually all genomic regions, including most coding sequences. The objective of this study was to develop a set of SNPs for the apple by taking advantage of the wealth of genomics resources available for the apple, including a large collection of expressed sequenced tags (ESTs). Using bioinformatics tools, a search for SNPs within an EST database of approximately 350,000 sequences developed from a variety of apple accessions was conducted. This resulted in the identification of a total of 71,482 putative SNPs. As the apple genome is reported to be an ancient polyploid, attempts were made to verify whether those SNPs detected in silico were attributable either to allelic polymorphisms or to gene duplication or paralogous or homeologous sequence variations. To this end, a set of 464 PCR primer pairs was designed, PCR was amplified using two subsets of plants, and the PCR products were sequenced. The SNPs retrieved from these sequences were then mapped onto apple genetic maps, including a newly constructed map of a Royal Gala x A689-24 cross and a Malling 9 x Robusta 5, map using a bin mapping strategy. The SNP genotyping was performed using the high-resolution melting (HRM) technique. A total of 93 new markers containing 210 coding SNPs were successfully mapped. This new set of SNP markers for the apple offers new opportunities for understanding the genetic control of important horticultural traits using quantitative trait loci (QTL) or linkage disequilibrium analysis. These also serve as useful markers for aligning physical and genetic maps, and as potential transferable markers across the Rosaceae family.
Midorikawa, G E O; Pinheiro, M R R; Vidigal, B S; Arruda, M C; Costa, F F; Pappas, G J; Ribeiro, S G; Freire, F; Miller, R N G
2008-07-01
The aim of this study was to determine the genetic variability in Aspergillus flavus populations from Brazil nut and cashew and develop a polymerase chain reaction (PCR) detection method. Chomatography analysis of 48 isolates identified 36 as aflatoxigenic (75%). One hundred and forty-one DNA bands were generated with 11 random amplified polymorphic DNA (RAPD) primers and analysed via unweighted pair group analysis, using arithmetic means (UPGMA). Isolates grouped according to host, with differentiation of those from A. occidentale also according to geographical origin. Aspergillus flavus-specific PCR primers ASPITSF2 and ASPITSR3 were designed from ribosomal DNA internal transcribed spacers (ITS 1 and 2), and an internal amplification control was developed, to prevent false negative results. Specificity to only A. flavus was confirmed against DNA from additional aspergilli and other fungi. RAPD-based characterization differentiated isolates according to plant host. The PCR primer pair developed showed specificity to A. flavus, with a detection limit of 10 fg. Genetic variability observed in A. flavus isolates from two Brazilian agroecosystems suggested reproductive isolation. The PCR detection method developed for A. flavus represents progress towards multiplex PCR detection of aflatoxigenic and nonaflatoxigenic strains in Hazard Analysis Critical Control Point systems.
Harbecke, Ruth; Oxman, Michael N.; Arnold, Beth A.; Ip, Charlotte; Johnson, Gary R.; Levin, Myron J.; Gelb, Lawrence D.; Schmader, Kenneth E.; Straus, Stephen E.; Wang, Hui; Wright, Peter F.; Pachucki, Constance T.; Gershon, Anne A.; Arbeit, Robert D.; Davis, Larry E.; Simberkoff, Michael S.; Weinberg, Adriana; Williams, Heather M.; Cheney, Carol; Petrukhin, Luba; Abraham, Katalin G.; Shaw, Alan; Manoff, Susan; Antonello, Joseph M.; Green, Tina; Wang, Yue; Tan, Charles; Keller, Paul M.
2014-01-01
A real-time PCR assay was developed to identify varicella-zoster virus (VZV) and herpes simplex virus (HSV) DNA in clinical specimens from subjects with suspected herpes zoster (HZ; shingles). Three sets of primers and probes were used in separate PCR reactions to detect and discriminate among wild-type VZV (VZV-WT), Oka vaccine strain VZV (VZV-Oka), and HSV DNA, and the reaction for each virus DNA was multiplexed with primers and probe specific for the human β-globin gene to assess specimen adequacy. Discrimination of all VZV-WT strains, including Japanese isolates and the Oka parent strain, from VZV-Oka was based upon a single nucleotide polymorphism at position 106262 in ORF 62, resulting in preferential amplification by the homologous primer pair. The assay was highly sensitive and specific for the target virus DNA, and no cross-reactions were detected with any other infectious agent. With the PCR assay as the gold standard, the sensitivity of virus culture was 53% for VZV and 77% for HSV. There was 92% agreement between the clinical diagnosis of HZ by the Clinical Evaluation Committee and the PCR assay results. PMID:19475609
[REAL TIME POLYMERASE CHAIN REACTION IN TULAREMIA LABORATORY DIAGNOSTICS].
Kormilitsyna, M I; Mescheryakova, I S; Mikhailova, T V; Dobrovolsky, A A
2015-01-01
Enhancement of tularemia laboratory diagnostics by F. tularensis DNA determination in blood sera of patients using real time polymerase chain reaction (RT-PCR). 39 blood sera of patients obtained during transmissive epidemic outbreak of tularemia in Khanty-Mansiysk in 2013 were studied in agglutination reaction, passive hemagglutination, RT-PCR. Specific primers and fluorescent probes were used: ISFTu2F/R+ISFTu2P, Tu14GF/R+tul4-PR2. Advantages of using RT-PCR for early diagnostics of tularemia, when specific antibodies are not detected using traditional immunologic methods, were established. Use of a combination of primers and ISFTu2F/R+ISFTu2P probe allowed to detect F. tularensis DNA in 100% of sera, whereas Tul4G F/R+tul4-PR2 combination--92% of sera. The data were obtained when DNA was isolated from sera using "Proba Rapid" express method. Clinical-epidemiologic diagnosis oftularemia was confirmed by both immune-serologic and RT-PCR methods when sera were studied 3-4 weeks after the onset of the disease. RT-PCR with ISFTu2F/R primers and fluorescent probe ISFTu2P, having high sensitivity and specificity, allows to determine F. tularensis DNA in blood sera of patients at both the early stage and 3-4 weeks after the onset of the disease.
Species-Specific TT Viruses and Cross-Species Infection in Nonhuman Primates
Okamoto, Hiroaki; Fukuda, Masako; Tawara, Akio; Nishizawa, Tsutomu; Itoh, Yukio; Hayasaka, Ikuo; Tsuda, Fumio; Tanaka, Takeshi; Miyakawa, Yuzo; Mayumi, Makoto
2000-01-01
Viruses resembling human TT virus (TTV) were searched for in sera from nonhuman primates by PCR with primers deduced from well-conserved areas in the untranslated region. TTV DNA was detected in 102 (98%) of 104 chimpanzees, 9 (90%) of 10 Japanese macaques, 4 (100%) of 4 red-bellied tamarins, 5 (83%) of 6 cotton-top tamarins, and 5 (100%) of 5 douroucoulis tested. Analysis of the amplification products of 90 to 106 nucleotides revealed TTV DNA sequences specific for each species, with a decreasing similarity to human TTV in the order of chimpanzee, Japanese macaque, and tamarin/douroucouli TTVs. Full-length viral sequences were amplified by PCR with inverted nested primers deduced from the untranslated region of TTV DNA from each species. All animal TTVs were found to be circular with a genomic length at 3.5 to 3.8 kb, which was comparable to or slightly shorter than human TTV. Sequences closely similar to human TTV were determined by PCR with primers deduced from a coding region (N22 region) and were detected in 49 (47%) of the 104 chimpanzees; they were not found in any animals of the other species. Sequence analysis of the N22 region (222 to 225 nucleotides) of chimpanzee TTV DNAs disclosed four genetic groups that differed by 36.1 to 50.2% from one another; they were 35.0 to 52.8% divergent from any of the 16 genotypes of human TTV. Of the 104 chimpanzees, only 1 was viremic with human TTV of genotype 1a. It was among the 53 chimpanzees which had been used in transmission experiments with human hepatitis viruses. Antibody to TTV of genotype 1a was detected significantly more frequently in the chimpanzees that had been used in transmission experiments than in those that had not (8 of 28 [29%] and 3 of 35 [9%], respectively; P = 0.038). These results indicate that species-specific TTVs are prevalent in nonhuman primates and that human TTV can cross-infect chimpanzees. PMID:10627523
Rapid detection of human fecal Eubacterium species and related genera by nested PCR method.
Kageyama, A; Benno, Y
2001-01-01
PCR procedures based on 16S rDNA gene sequence specific for seven Eubacterium spp. and Eggerthella lenta that predominate in the human intestinal tract were developed, and used for direct detection of these species in seven human feces samples. Three species of Eggerthella lenta, Eubacterium rectale, and Eubacterium eligens were detected from seven fecal samples. Eubacterium biforme was detected from six samples. It was reported that E. rectale, E. eligens, and E. biforme were difficult to detect by traditional culture method, but the nested PCR method is available for the detection of these species. This result shows that the nested PCR method utilizing a universal primer pair, followed by amplification with species-specific primers, would allow rapid detection of Eubacterium species in human feces.
Multiplex PCR assay to identify methicillin-resistant Staphylococcus haemolyticus.
Schuenck, Ricardo P; Pereira, Eliezer M; Iorio, Natalia L P; Dos Santos, Kátia R N
2008-04-01
Staphylococcus haemolyticus is the most frequently coagulase-negative Staphylococcus species associated with antimicrobial resistance isolated from nosocomial infections. We developed an accurate and simple multiplex PCR assay to identify methicillin-resistant S. haemolyticus (MRSH) isolates. We designed species-specific primers of the mvaA gene that encodes a 3-hydroxy-3-methylglutaryl coenzyme A involved in the mevalonate pathway of the microorganism. Simultaneously, mecA gene primers of methicillin resistance were also used. The PCR assay was established using 16 strains of different reference Staphylococcus species and validated with a collection of 147 clinical staphylococcal isolates that were also phenotypically characterized. Reliable results for the detection of MRSH isolates were obtained for 100% of the strains evaluated, showing that this PCR assay can be used for the routine microbiology laboratories. This is the first report using species-specific multiplex PCR to detect a single segment of S. haemolyticus associated with a segment of mecA gene.
Detection of Pseudomonas savastanoi pv. savastanoi in olive plants by enrichment and PCR.
Penyalver, R; García, A; Ferrer, A; Bertolini, E; López, M M
2000-06-01
The sequence of the gene iaaL of Pseudomonas savastanoi EW2009 was used to design primers for PCR amplification. The iaaL-derived primers directed the amplification of a 454-bp fragment from genomic DNA isolated from 70 strains of P. savastanoi, whereas genomic DNA from 93 non-P. savastanoi isolates did not yield this amplified product. A previous bacterial enrichment in the semiselective liquid medium PVF-1 improved the PCR sensitivity level, allowing detection of 10 to 100 CFU/ml of plant extract. P. savastanoi was detected by the developed enrichment-PCR method in knots from different varieties of inoculated and naturally infected olive trees. Moreover, P. savastanoi was detected in symptomless stem tissues from naturally infected olive plants. This enrichment-PCR method is more sensitive and less cumbersome than the conventional isolation methods for detection of P. savastanoi.
Costa, Maria Eduarda S M; Oliveira, Claudio Bruno S; Andrade, Joelma Maria de A; Medeiros, Thatiany A; Neto, Valter F Andrade; Lanza, Daniel C F
2016-07-01
Toxoplasma gondii is a widespread parasite able to infect virtually any nucleated cells of warm-blooded hosts. In some cases, T. gondii detection using already developed PCR primers can be inefficient in routine laboratory tests, especially to detect atypical strains. Here we report a new nested-PCR protocol able to detect virtually all T. gondii isolates. Analyzing 685 sequences available in GenBank, we determine that GRA7 is one of the most conserved genes of T. gondii genome. Based on an alignment of 85 GRA7 sequences new primer sets that anneal in the highly conserved regions of this gene were designed. The new GRA7 nested-PCR assay providing sensitivity and specificity equal to or greater than the gold standard PCR assays for T. gondii detection, that amplify the B1 sequence or the repetitive 529bp element. Copyright © 2016 Elsevier B.V. All rights reserved.
Use of polymerase chain reaction in the diagnosis of toxocariasis: an experimental study.
Rai, S K; Uga, S; Wu, Z; Takahashi, Y; Matsumura, T
1997-09-01
In this paper we report the usefulness of polymerase chain reaction technique in the diagnosis of visceral larva migrans in a mouse model. Liver samples obtained from two set of experimentally infected mice (10, 100, 1,000 and 10,000 embryonated Toxocara canis eggs per mouse) along with the eggs of T. canis, T. cati and Ascaris suum were included in this study. Polymerase chain reaction (PCR) was performed using Toxocara primers (SB12). The first PCR product electrophoresis revealed very thin positive bands or no bands in liver samples. However, on second PCR a clear-cut bands were observed. No positive band was shown by A. suum eggs. Our findings thus indicate the usefulness of PCR technic in the diagnosis of visceral larva migrans (VLM) in liver biopsy materials specifically by means of double PCR using the primer SB12.
[Multiplex real-time PCR method for rapid detection of Marburg virus and Ebola virus].
Yang, Yu; Bai, Lin; Hu, Kong-Xin; Yang, Zhi-Hong; Hu, Jian-Ping; Wang, Jing
2012-08-01
Marburg virus and Ebola virus are acute infections with high case fatality rates. A rapid, sensitive detection method was established to detect Marburg virus and Ebola virus by multiplex real-time fluorescence quantitative PCR. Designing primers and Taqman probes from highly conserved sequences of Marburg virus and Ebola virus through whole genome sequences alignment, Taqman probes labeled by FAM and Texas Red, the sensitivity of the multiplex real-time quantitative PCR assay was optimized by evaluating the different concentrations of primers and Probes. We have developed a real-time PCR method with the sensitivity of 30.5 copies/microl for Marburg virus positive plasmid and 28.6 copies/microl for Ebola virus positive plasmids, Japanese encephalitis virus, Yellow fever virus, Dengue virus were using to examine the specificity. The Multiplex real-time PCR assays provide a sensitive, reliable and efficient method to detect Marburg virus and Ebola virus simultaneously.
Development of touch down-multiplex PCR for the diagnosis of toxoplasmosis.
Hallur, V; Sehgal, R; Khurana, S
2015-01-01
The diagnosis of toxoplasmosis is challenging since conventional methods like culture and immunofluorescence are not universally available. Serology, which is used regularly might be negative during early phase of infection and in immunosuppressed patients or may remain positive for a long time. Several molecular tests have been used for the diagnosis of toxoplasmosis, but none of them have an internal control which would inform us regarding the presence of polymerase chain reaction (PCR) inhibitors thus, undermining the confidence of a laboratory physician. We designed a multiplex PCR containing primers targeting human beta globin gene which would act as internal control and two primers against the B1 gene and 5s gene which aid in sensitive detection of T. gondii. Multiplex PCR had a sensitivity of 83.3% and specificity of 100%. Multiplex PCR may provide a sensitive and specific tool for diagnosis of human toxoplasmosis.
Guo, Longhua; Yang, Huanghao; Qiu, Bin; Xiao, Xueyang; Xue, Linlin; Kim, Donghwan; Chen, Guonan
2009-12-01
A capillary electrophoresis coupled with electrochemiluminescent detection system (CE-ECL) was developed for the detection of polymerase chain reaction (PCR) amplicons. The ECL luminophore, tris(1,10-phenanthroline) ruthenium(II) (Ru(phen)(3)(2+)), was labeled to the PCR primers before amplification. Ru(phen)(3)(2+) was then introduced to PCR amplicons by PCR amplification. Eventually, the PCR amplicons were separated and detected by the homemade CE-ECL system. The detection of a typical genetically modified organism (GMO), Roundup Ready Soy (RRS), was shown as an example to demonstrate the reliability of the proposed approach. Four pairs of primers were amplified by multiple PCR (MPCR) simultaneously, three of which were targeted on the specific sequence of exogenous genes of RRS, and another was targeted on the endogenous reference gene of soybean. Both the conditions for PCR amplification and CE-ECL separation and detection were investigated in detail. Results showed that, under the optimal conditions, the proposed method can accurately identifying RRS. The corresponding limit of detection (LOD) was below 0.01% with 35 PCR cycles.
Fingerprinting and quantification of GMOs in the agro-food sector.
Taverniers, I; Van Bockstaele, E; De Loose, M
2003-01-01
Most strategies for analyzing GMOs in plants and derived food and feed products, are based on the polymerase chain reaction (PCR) technique. In conventional PCR methods, a 'known' sequence between two specific primers is amplified. To the contrary, with the 'anchor PCR' technique, unknown sequences adjacent to a known sequence, can be amplified. Because T-DNA/plant border sequences are being amplified, anchor PCR is the perfect tool for unique identification of transgenes, including non-authorized GMOs. In this work, anchor PCR was applied to characterize the 'transgene locus' and to clarify the complete molecular structure of at least six different commercial transgenic plants. Based on sequences of T-DNA/plant border junctions, obtained by anchor PCR, event specific primers were developed. The junction fragments, together with endogeneous reference gene targets, were cloned in plasmids. The latter were then used as event specific calibrators in real-time PCR, a new technique for the accurate relative quantification of GMOs. We demonstrate here the importance of anchor PCR for identification and the usefulness of plasmid DNA calibrators in quantification strategies for GMOs, throughout the agro-food sector.
Wang, Zi-nian; Li, Mi-jie; Lan, Xian-yong; Li, Ming-xun; Lei, Chu-zhao; Chen, Hong
2014-08-10
Hepatocyte nuclear factor-4α (HNF-4α), a member of the hepatocyte nuclear factor family, plays an important role in regulating the expression of genes involved in the development, differentiation and normal function of liver and pancreatic β cells, as well as the maintenance of glucose homeostasis. Tetra-primer amplification refractory mutation system PCR (T-ARMS-PCR) is a new method offering fast detection and extreme simplicity at a negligible cost for SNP genotyping. In this paper, we characterize the polymorphisms of the bovine HNF-4α gene in three Chinese indigenous cattle breeds (n=660). Six novel SNPs were identified including 1 mutation in the coding region and others in introns. The statistical analyses indicated that 4 SNPs (g.T53729C, g.A53861G, g.A65188C and g.T65444C) affected growth traits markedly (P<0.05) in Qinchuan cattle (2 years after birth). Besides, haplotypes involving these 4 SNP sites in the bovine HNF-4α gene were identified and their effects on growth traits were also analyzed. The results showed that haplotypes 2, 7, 9 and 11 were predominant and accounted for 73.2%, 59.6%, and 67.1% in Qinchuan, Nanyang and Jiaxian cattle breeds, respectively. Hap9 (TAAT) was extremely predominant in all test populations, which suggested that individuals with Hap9 were more adapted to the environment. Furthermore, 4 combined haplotypes were constructed to guarantee the reliability of analysis results in Qinchuan cattle. There were also significant differences in body length (P<0.05). These findings will benefit for the application of DNA marker related to the growth traits on marker-assisted selection (MAS), and improve the performance of beef cattle. Copyright © 2014 Elsevier B.V. All rights reserved.
Real-Time PCR with an Internal Control for Detection of All Known Human Adenovirus Serotypes▿
Damen, Marjolein; Minnaar, René; Glasius, Patricia; van der Ham, Alwin; Koen, Gerrit; Wertheim, Pauline; Beld, Marcel
2008-01-01
The “gold standard” for the diagnosis of adenovirus (AV) infection is virus culture, which is rather time-consuming. Especially for immunocompromised patients, in whom severe infections with AV have been described, rapid diagnosis is important. Therefore, an internally controlled AV real-time PCR assay detecting all known human AV serotypes was developed. Primers were chosen from the hexon region, which is the most conserved region, and in order to cover all known serotypes, degenerate primers were used. The internal control (IC) DNA contained the same primer binding sites as the AV DNA control but had a shuffled probe region compared to the conserved 24-nucleotide consensus AV hexon probe region (the target). The IC DNA was added to the clinical sample in order to monitor extraction and PCR efficiency. The sensitivity and the linearity of the AV PCR were determined. For testing the specificity of this PCR assay for human AVs, a selection of 51 AV prototype strains and 66 patient samples positive for other DNA viruses were tested. Moreover, a comparison of the AV PCR method described herein with culture and antigen (Ag) detection was performed with a selection of 151 clinical samples. All 51 AV serotypes were detected in the selection of AV prototype strains. Concordant results from culture or Ag detection and PCR were found for 139 (92.1%) of 151 samples. In 12 cases (7.9%), PCR was positive while the culture was negative. In conclusion, a sensitive, internally controlled nonnested AV real-time PCR assay which is able to detect all known AV serotypes with higher sensitivity than a culture or Ag detection method was developed. PMID:18923006
[Optimized application of nested PCR method for detection of malaria].
Yao-Guang, Z; Li, J; Zhen-Yu, W; Li, C
2017-04-28
Objective To optimize the application of the nested PCR method for the detection of malaria according to the working practice, so as to improve the efficiency of malaria detection. Methods Premixing solution of PCR, internal primers for further amplification and new designed primers that aimed at two Plasmodium ovale subspecies were employed to optimize the reaction system, reaction condition and specific primers of P . ovale on basis of routine nested PCR. Then the specificity and the sensitivity of the optimized method were analyzed. The positive blood samples and examination samples of malaria were detected by the routine nested PCR and the optimized method simultaneously, and the detection results were compared and analyzed. Results The optimized method showed good specificity, and its sensitivity could reach the pg to fg level. The two methods were used to detect the same positive malarial blood samples simultaneously, the results indicated that the PCR products of the two methods had no significant difference, but the non-specific amplification reduced obviously and the detection rates of P . ovale subspecies improved, as well as the total specificity also increased through the use of the optimized method. The actual detection results of 111 cases of malarial blood samples showed that the sensitivity and specificity of the routine nested PCR were 94.57% and 86.96%, respectively, and those of the optimized method were both 93.48%, and there was no statistically significant difference between the two methods in the sensitivity ( P > 0.05), but there was a statistically significant difference between the two methods in the specificity ( P < 0.05). Conclusion The optimized PCR can improve the specificity without reducing the sensitivity on the basis of the routine nested PCR, it also can save the cost and increase the efficiency of malaria detection as less experiment links.
Tao, Yong; Li, Jian-Long; Liu, Min; Hu, Xue-Yi
2016-01-01
In this study we determined the complete mitochondrial (mt) genome of the yellowtail clownfish Amphiprion clarkii using eight consensus primer pairs with a long PCR technique. The circular mtDNA molecule was 16,976 bp in size and the overall nucleotide composition of the H-strand was 29.15% A, 26.15% T, 15.67% G and 29.03% C, with an A + T bias. The complete mitogenome contained 13 protein-coding genes, 2 rRNAs, 22 tRNAs and 1 control region (D-loop), and the gene order was typical of vertebrate mitogenomes. We determined five complete continuity tandem repeat units and one imperfect tandem repeat, all located downstream in the control region.
NASA Astrophysics Data System (ADS)
Su, Lei; Zhang, Qianqian; Gong, Jun
2017-07-01
Peritrich ciliates are highly diverse and can be important bacterial grazers in aquatic ecosystems. Morphological identifications of peritrich species and assemblages in the environment are time-consuming and expertise-demanding. In this study, two peritrich-specific PCR primers were newly designed to amplify a fragment including the internal transcribed spacer (ITS) region of ribosomal rDNA from environmental samples. The primers showed high specificity in silico, and in tests with peritrich isolates and environmental DNA. Application of these primers in clone library construction and sequencing yielded exclusively sequences of peritrichs for water and sediment samples. We also found the ITS1, ITS2, ITS, D1 region of 28S rDNA, and ITS+D1 region co-varied with, and generally more variable than, the V9 region of 18S rDNA in peritrichs. The newly designed specific primers thus provide additional tools to study the molecular diversity, community composition, and phylogeography of these ecologically important protists in different systems.
S-genotype identification based on allele-specific PCR in Japanese pear
Nashima, Kenji; Terakami, Shingo; Nishio, Sogo; Kunihisa, Miyuki; Nishitani, Chikako; Saito, Toshihiro; Yamamoto, Toshiya
2015-01-01
Gametophytic self-incompatibility in Japanese pear (Pyrus pyrifolia Nakai) is controlled by the single, multi-allelic S-locus. Information about the S-genotypes is important for breeding and the selection of pollen donors for fruit production. Rapid and reliable S-genotype identification system is necessary for efficient breeding of new cultivars in Japanese pear. We designed S allele-specific PCR primer pairs for ten previously reported S-RNase alleles (S1–S9 and Sk) as simple and reliable method. Specific nucleotide sequences were chosen to design the primers to amplify fragments of only the corresponding S alleles. The developed primer pairs were evaluated by using homozygous S-genotypes (S1/S1–S9/S9 and S4sm/S4sm) and 14 major Japanese pear cultivars, and found that S allele-specific primer pairs can identify S-genotypes effectively. The S allele-specific primer pairs developed in this study will be useful for efficient S-genotyping and for marker-assisted selection in Japanese pear breeding programs. PMID:26175617
Simmon, Keith; Karaca, Dilek; Langeland, Nina; Wiker, Harald G.
2012-01-01
Broad-range amplification and sequencing of the bacterial 16S rRNA gene directly from clinical specimens are offered as a diagnostic service in many laboratories. One major pitfall is primer cross-reactivity with human DNA which will result in mixed chromatograms. Mixed chromatograms will complicate subsequent sequence analysis and impede identification. In SYBR green real-time PCR assays, it can also affect crossing threshold values and consequently the status of a specimen as positive or negative. We evaluated two conventional primer pairs in common use and a new primer pair based on the dual priming oligonucleotide (DPO) principle. Cross-reactivity was observed when both conventional primer pairs were used, resulting in interpretation difficulties. No cross-reactivity was observed using the DPOs even in specimens with a high ratio of human to bacterial DNA. In addition to reducing cross-reactivity, the DPO principle also offers a high degree of flexibility in the design of primers and should be considered for any PCR assay intended for detection and identification of pathogens directly from human clinical specimens. PMID:22278843
Multiplex real-time PCR assay for Legionella species.
Kim, Seung Min; Jeong, Yoojung; Sohn, Jang Wook; Kim, Min Ja
2015-12-01
Legionella pneumophila serogroup 1 (sg1) accounts for the majority of infections in humans, but other Legionella species are also associated with human disease. In this study, a new SYBR Green I-based multiplex real-time PCR assay in a single reaction was developed to allow the rapid detection and differentiation of Legionella species by targeting specific gene sequences. Candidate target genes were selected, and primer sets were designed by referring to comparative genomic hybridization data of Legionella species. The Legionella species-specific groES primer set successfully detected all 30 Legionella strains tested. The xcpX and rfbA primers specifically detected L. pneumophila sg1-15 and L. pneumophila sg1, respectively. In addition, this assay was validated by testing clinical samples and isolates. In conclusion, this novel multiplex real-time PCR assay might be a useful diagnostic tool for the rapid detection and differentiation of Legionella species in both clinical and epidemiological studies. Copyright © 2015 Elsevier Ltd. All rights reserved.
PCR tools for the verification of the specific identity of ascaridoid nematodes from dogs and cats.
Li, M W; Lin, R Q; Chen, H H; Sani, R A; Song, H Q; Zhu, X Q
2007-01-01
Based on the sequences of the internal transcribed spacers (ITS-1 and ITS-2) of nuclear ribosomal DNA (rDNA) of Toxocara canis, Toxocara cati, Toxocara malaysiensis and Toxascaris leonina, specific forward primers were designed in the ITS-1 or ITS-2 for each of the four ascaridoid species of dogs and cats. These primers were used individually together with a conserved primer in the large subunit of rDNA to amplify partial ITS-1 and/or ITS-2 of rDNA from 107 DNA samples from ascaridoids from dogs and cats in China, Australia, Malaysia, England and the Netherlands. This approach allowed their specific identification, with no amplicons being amplified from heterogeneous DNA samples, and sequencing confirmed the identity of the sequences amplified. The minimum amounts of DNA detectable using the PCR assays were 0.13-0.54ng. These PCR assays should provide useful tools for the diagnosis and molecular epidemiological investigations of toxocariasis in humans and animals.
Pentaplex PCR as screening assay for jellyfish species identification in food products.
Armani, Andrea; Giusti, Alice; Castigliego, Lorenzo; Rossi, Aurelio; Tinacci, Lara; Gianfaldoni, Daniela; Guidi, Alessandra
2014-12-17
Salted jellyfish, a traditional food in Asian Countries, is nowadays spreading on the Western markets. In this work, we developed a Pentaplex PCR for the identification of five edible species (Nemopilema nomurai, Rhopilema esculentum, Rhizostoma pulmo, Pelagia noctiluca, and Cotylorhiza tuberculata), which cannot be identified by a mere visual inspection in jellyfish products sold as food. A common degenerated forward primer and five specie-specific reverse primers were designed to amplify COI gene regions of different lengths. Another primer pair targeted the 28SrRNA gene and was intended as common positive reaction control. Considering the high level of degradation in the DNA extracted from acidified and salted products, the maximum length of the amplicons was set at 200 bp. The PCR was developed using 66 reference DNA samples. It gave successful amplifications in 85.4% of 48 ready to eat products (REs) and in 60% of 30 classical salted products (CPs) collected on the market.
A TaqMan real-time PCR-based assay for the identification of Fasciola spp.
Alasaad, Samer; Soriguer, Ramón C; Abu-Madi, Marawan; El Behairy, Ahmed; Jowers, Michael J; Baños, Pablo Díez; Píriz, Ana; Fickel, Joerns; Zhu, Xing-Quan
2011-06-30
Real time quantitative PCR (qPCR) is one of the key technologies of the post-genome era, with clear advantages compared to normal end-point PCR. In this paper, we report the first qPCR-based assay for the identification of Fasciola spp. Based on sequences of the second internal transcribed spacers (ITS-2) of the ribosomal rRNA gene, we used a set of genus-specific primers for Fasciola ITS-2 amplification, and we designed species-specific internal TaqMan probes to identify F. hepatica and F. gigantica, as well as the hybrid 'intermediate'Fasciola. These primers and probes were used for the highly specific, sensitive, and simple identification of Fasciola species collected from different animal host from China, Spain, Niger and Egypt. The novel qPCR-based technique for the identification of Fasciola spp. may provide a useful tool for the epidemiological investigation of Fasciola infection, including their intermediate snail hosts. Copyright © 2011 Elsevier B.V. All rights reserved.
Kumar, P V; Sharma, S K; Rishi, N; Ghosh, D K; Baranwal, V K
Management of viral diseases relies on definite and sensitive detection methods. Citrus yellow mosaic virus (CYMV), a double stranded DNA virus of the genus Badnavirus, causes yellow mosaic disease in citrus plants. CYMV is transmitted through budwood and requires a robust and simplified indexing protocol for budwood certification programme. The present study reports development and standardization of an isothermal based recombinase polymerase amplification (RPA) assay for a sensitive, rapid, easy, and cost-effective method for detection and diagnosis of CYMV. Two different oligonucleotide primer sets were designed from ORF III (coding for polyprotein) and ORF II (coding for virion associated protein) regions of CYMV to perform amplification assays. Comparative evaluation of RPA, PCR and immuno-capture recombinase polymerase amplification (IC-RPA) based assays were done using purified DNA and plant crude sap. CYMV infection was efficiently detected from the crude sap in RPA and IC-RPA assays. The primer set used in RPA was specific and did not show any cross-amplification with banana streak MY virus (BSMYV), another Badnavirus species. The results from the present study indicated that RPA assay can be used easily in routine indexing of citrus planting material. To the best of our knowledge, this is the first report on development of a rapid and simplified isothermal detection assay for CYMV and can be utilized as an effective technique in quarantine and budwood certification process.
Anderson, A S; Clark, D J; Gibbons, P H; Sigmund, J M
2002-08-01
The conserved nature of the genes that code for actinomycete secondary metabolite biosynthetic pathways suggests a common evolutionary ancestor and incidences of lateral gene transfer. Resistance genes associated with these biosynthetic pathways also display a high degree of similarity. Actinomycete aminoglycoside phosphotransferase antibiotic resistance enzymes (APH) are coded for by such genes and are therefore good targets for evaluating the bioactive potential of actinomycetes. A set of universal PCR primers for APH encoding genes was used to probe genomic DNA from three collections of actinomycetes to determine the utility of molecular screening. An additional monitoring of populations for the predominance of specific classes of enzymes to predict the potential of environmental sites for providing isolates with interesting metabolic profiles. Approximately one-fifth of all isolates screened gave a positive result by PCR. The PCR products obtained were sequenced and compared to existing APH family members. Sequence analysis resolved the family into nine groups of which six had recognizable phenotypes: 6'-phosphotransferase (APH(6)), 3'-phosphotransferase (APH(3)), hydroxyurea phosphotransferase (HUR), peptide phosphotransferase, hygromycin B phosphotransferase (APH(7")) and oxidoreductase. The actinomycetes screened fell into seven groups, including three novel groups with unknown phenotypes. The strains clustered according to the environmental site from where they were obtained, providing evidence for the movement of these genes within populations. The value of this as a method for obtaining novel compounds and the significance to the ecology of antibiotic biosynthesis are discussed.
Nucleic acid amplification using modular branched primers
Ulanovsky, Levy; Raja, Mugasimangalam C.
2001-01-01
Methods and compositions expand the options for making primers for use in amplifying nucleic acid segments. The invention eliminates the step of custom synthesis of primers for Polymerase Chain Reactions (PCR). Instead of being custom-synthesized, a primer is replaced by a combination of several oligonucleotide modules selected from a pre-synthesized library. A modular combination of just a few oligonucleotides essentially mimics the performance of a conventional, custom-made primer by matching the sequence of the priming site in the template. Each oligonucleotide module has a segment that matches one of the stretches within the priming site.
Detection of Verrucomicrobia in a Pasture Soil by PCR-Mediated Amplification of 16S rRNA Genes
O’Farrell, Katrina A.; Janssen, Peter H.
1999-01-01
Oligonucleotide primers were designed and used to amplify, by PCR, partial 16S rRNA genes of members of the bacterial division Verrucomicrobia in DNA extracted from a pasture soil. By applying most-probable-number theory to the assay, verrucomicrobia appeared to contribute some 0.2% of the soil DNA. Amplified ribosomal DNA restriction analysis of 53 cloned PCR-amplified partial 16S rRNA gene fragments and comparative sequence analysis of 21 nonchimeric partial 16S rRNA genes showed that these primers amplified only 16S rRNA genes of members of the Verrucomicrobia in DNA extracted from the soil. PMID:10473454
Detection of different South American hantaviruses.
Guterres, Alexandro; de Oliveira, Renata Carvalho; Fernandes, Jorlan; Schrago, Carlos Guerra; de Lemos, Elba Regina Sampaio
2015-12-02
Hantaviruses are the etiologic agents of Hemorrhagic Fever with Renal Syndrome (HFRS) in Old World, and Hantavirus Pulmonary Syndrome (HPS)/Hantavirus Cardiopulmonary Syndrome (HCPS), in the New World. Serological methods are the most common approach used for laboratory diagnosis of HCPS, however theses methods do not allow the characterization of viral genotypes. The polymerase chain reaction (PCR) has been extensively used for diagnosis of viral infections, including those caused by hantaviruses, enabling detection of few target sequence copies in the sample. However, most studies proposed methods of PCR with species-specific primers. This study developed a simple and reliable diagnostic system by RT-PCR for different hantavirus detection. Using new primers set, we evaluated human and rodent hantavirus positive samples of various regions from Brazil. Besides, we performed computational analyzes to evaluate the detection of other South American hantaviruses. The diagnostic system by PCR proved to be a sensible and simple assay, allowing amplification of Juquitiba virus, Araraquara virus, Laguna Negra virus, Rio Mamore virus and Jabora virus, beyond of the possibility of the detecting Andes, Anajatuba, Bermejo, Choclo, Cano Delgadito, Lechiguanas, Maciel, Oran, Pergamino and Rio Mearim viruses. The primers sets designed in this study can detect hantaviruses from almost all known genetics lineages in Brazil and from others South America countries and also increases the possibility to detect new hantaviruses. These primers could easily be used both in diagnosis of suspected hantavirus infections in humans and also in studies with animals reservoirs. Copyright © 2015 Elsevier B.V. All rights reserved.
Competitor internal standards for quantitative detection of mycoplasma DNA.
Sidhu, M K; Rashidbaigi, A; Testa, D; Liao, M J
1995-05-01
Homologous internal controls were used as competitor DNA in the polymerase chain reaction for the quantitative detection of mycoplasma DNA. PCR primer sets were designed on the basis of the most conserved nucleotide sequences of the 16S rRNA gene of mycoplasma species. Amplification of this gene was examined in five different mycoplasma species: Mycoplasma orale, M. hyorhinus, M. synoviae, M. gallisepticum and M. pneumoniae. To evaluate the primers, a number of different cell lines were assayed for the detection of mycoplasma infections. All positive cell lines showed a distinct product on agarose gels while uninfected cells showed no DNA amplification. Neither bacterial nor eukaryotic DNA produced any cross-reaction with the primers used, thus confirming their specificity. Internal control DNA to be used for quantitation was constructed by modifying the sizes of the wild-type amplified products and cloning them in plasmid vectors. These controls used the same primer binding sites as the wild-type and the amplified products were differentiated by a size difference. The detection limits for all the mycoplasma species by competitive quantitative PCR were estimated to range from 4 to 60 genome copies per assay as determined by ethidium bromide-stained agarose gels. These internal standards also serve as positive controls in PCR-based detection of mycoplasma DNA, and therefore accidental contamination of test samples with wild-type positive controls can be eliminated. The quantitative PCR method developed will be useful in monitoring the progression and significance of mycoplasma in the disease process.
Kilpatrick, David R; Yang, Chen-Fu; Ching, Karen; Vincent, Annelet; Iber, Jane; Campagnoli, Ray; Mandelbaum, Mark; De, Lina; Yang, Su-Ju; Nix, Allan; Kew, Olen M
2009-06-01
We have adapted our previously described poliovirus diagnostic reverse transcription-PCR (RT-PCR) assays to a real-time RT-PCR (rRT-PCR) format. Our highly specific assays and rRT-PCR reagents are designed for use in the WHO Global Polio Laboratory Network for rapid and large-scale identification of poliovirus field isolates.
Quantitative PCR detection of Batrachochytrium dendrobatidis DNA from sediments and water
Kirshtein, Julie D.; Anderson, Chauncey W.; Wood, J.S.; Longcore, Joyce E.; Voytek, Mary A.
2007-01-01
The fungal pathogen Batrachochytrium dendrobatidis (Bd) causes chytridiomycosis, a disease implicated in amphibian declines on 5 continents. Polymerase chain reaction (PCR) primer sets exist with which amphibians can be tested for this disease, and advances in sampling techniques allow non-invasive testing of animals. We developed filtering and PCR based quantitative methods by modifying existing PCR assays to detect Bd DNA in water and sediments, without the need for testing amphibians; we tested the methods at 4 field sites. The SYBR based assay using Boyle primers (SYBR/Boyle assay) and the Taqman based assay using Wood primers performed similarly with samples generated in the laboratory (Bd spiked filters), but the SYBR/Boyle assay detected Bd DNA in more field samples. We detected Bd DNA in water from 3 of 4 sites tested, including one pond historically negative for chytridiomycosis. Zoospore equivalents in sampled water ranged from 19 to 454 l-1 (nominal detection limit is 10 DNA copies, or about 0.06 zoospore). We did not detect DNA of Bd from sediments collected at any sites. Our filtering and amplification methods provide a new tool to investigate critical aspects of Bd in the environment. ?? Inter-Research 2007.
Use of armored RNA as a standard to construct a calibration curve for real-time RT-PCR.
Donia, D; Divizia, M; Pana', A
2005-06-01
Armored Enterovirus RNA was used to standardize a real-time reverse transcription (RT)-PCR for environmental testing. Armored technology is a system to produce a robust and stable RNA standard, trapped into phage proteins, to be used as internal control. The Armored Enterovirus RNA protected sequence includes 263 bp of highly conserved sequences in 5' UTR region. During these tests, Armored RNA has been used to produce a calibration curve, comparing three different fluorogenic chemistry: TaqMan system, Syber Green I and Lux-primers. The effective evaluation of three amplifying commercial reagent kits, in use to carry out real-time RT-PCR, and several extraction procedures of protected viral RNA have been carried out. The highest Armored RNA recovery was obtained by heat treatment while chemical extraction may decrease the quantity of RNA. The best sensitivity and specificity was obtained using the Syber Green I technique since it is a reproducible test, easy to use and the cheapest one. TaqMan and Lux-primer assays provide good RT-PCR efficiency in relationship to the several extraction methods used, since labelled probe or primer request in these chemistry strategies, increases the cost of testing.
Chen, Jing; Dick, Richard; Lin, Jih-Gaw; Gu, Ji-Dong
2016-12-01
Nitrite-dependent anaerobic methane oxidation (n-damo) process uniquely links microbial nitrogen and carbon cycles. Research on n-damo bacteria progresses quickly with experimental evidences through enrichment cultures. Polymerase chain reaction (PCR)-based methods for detecting them in various natural ecosystems and engineered systems play a very important role in the discovery of their distribution, abundance, and biodiversity in the ecosystems. Important characteristics of n-damo enrichments were obtained and their key significance in microbial nitrogen and carbon cycles was investigated. The molecular methods currently used in detecting n-damo bacteria were comprehensively reviewed and discussed for their strengths and limitations in applications with a wide range of samples. The pmoA gene-based PCR primers for n-damo bacterial detection were evaluated and, in particular, several incorrectly stated PCR primer nucleotide sequences in the published papers were also pointed out to allow correct applications of the PCR primers in current and future investigations. Furthermore, this review also offers the future perspectives of n-damo bacteria based on current information and methods available for a better acquisition of new knowledge about this group of bacteria.
Mishra, Apurva; Pandey, Ramesh K; Manickam, Natesan
2015-01-01
Rapid phylogenetic and functional gene (gtfB) identification of S. mutans from the dental plaque derived from children. Dental plaque collected from fifteen patients of age group 7-12 underwent centrifugation followed by genomic DNA extraction for S. mutans. Genomic DNA was processed with S. mutans specific primers in suitable PCR condtions for phylogenetic and functional gene (gtfB) identification. The yield and results were confirmed by agarose gel electrophoresis. 1% agarose gel electrophoresis depicts the positive PCR amplification at 1,485 bp when compared with standard 1 kbp indicating the presence of S. mutans in the test sample. Another PCR reaction was set using gtfB primers specific for S. mutans for functional gene identification. 1.2% agarose gel electrophoresis was done and a positive amplication was observed at 192 bp when compared to 100 bp standards. With the advancement in molecular biology techniques, PCR based identification and quantification of the bacterial load can be done within hours using species-specific primers and DNA probes. Thus, this technique may reduce the laboratory time spend in conventional culture methods, reduces the possibility of colony identification errors and is more sensitive to culture techniques.
Tsukamoto, Kenji; Panei, Carlos Javier; Javier, Panei Carlos; Shishido, Makiko; Noguchi, Daigo; Pearce, John; Kang, Hyun-Mi; Jeong, Ok Mi; Lee, Youn-Jeong; Nakanishi, Koji; Ashizawa, Takayoshi
2012-01-01
Continuing outbreaks of H5N1 highly pathogenic (HP) avian influenza virus (AIV) infections of wild birds and poultry worldwide emphasize the need for global surveillance of wild birds. To support the future surveillance activities, we developed a SYBR green-based, real-time reverse transcriptase PCR (rRT-PCR) for detecting nucleoprotein (NP) genes and subtyping 16 hemagglutinin (HA) and 9 neuraminidase (NA) genes simultaneously. Primers were improved by focusing on Eurasian or North American lineage genes; the number of mixed-base positions per primer was set to five or fewer, and the concentration of each primer set was optimized empirically. Also, 30 cycles of amplification of 1:10 dilutions of cDNAs from cultured viruses effectively reduced minor cross- or nonspecific reactions. Under these conditions, 346 HA and 345 NA genes of 349 AIVs were detected, with average sensitivities of NP, HA, and NA genes of 10(1.5), 10(2.3), and 10(3.1) 50% egg infective doses, respectively. Utility of rRT-PCR for subtyping AIVs was compared with that of current standard serological tests by using 104 recent migratory duck virus isolates. As a result, all HA genes and 99% of the NA genes were genetically subtyped, while only 45% of HA genes and 74% of NA genes were serologically subtyped. Additionally, direct subtyping of AIVs in fecal samples was possible by 40 cycles of amplification: approximately 70% of HA and NA genes of NP gene-positive samples were successfully subtyped. This validation study indicates that rRT-PCR with optimized primers and reaction conditions is a powerful tool for subtyping varied AIVs in clinical and cultured samples.
Camilo, Lilian Muniz; Pereira-Chioccola, Vera Lucia; Gava, Ricardo; Meira-Strejevitch, Cristina da Silva; Vidal, Jose Ernesto; Brandão de Mattos, Cinara Cássia; Frederico, Fábio Batista; De Mattos, Luiz Carlos; Spegiorin, Lígia Cosentino Junqueira Franco
Symptomatic forms of toxoplasmosis are a serious public health problem and occur in around 10-20% of the infected people. Aiming to improve the molecular diagnosis of symptomatic toxoplasmosis in Brazilian patients, this study evaluated the performance of real time PCR testing two primer sets (B1 and REP-529) in detecting Toxoplasma gondii DNA. The methodology was assayed in 807 clinical samples with known clinical diagnosis, ELISA, and conventional PCR results in a 9-year period. All samples were from patients with clinical suspicion of several features of toxoplasmosis. According to the minimum detection limit curve (in C T ), REP-529 had greater sensitivity to detect T. gondii DNA than B1. Both primer sets were retrospectively evaluated using 515 DNA from different clinical samples. The 122 patients without toxoplasmosis provided high specificity (REP-529, 99.2% and B1, 100%). From the 393 samples with positive ELISA, 146 had clinical diagnosis of toxoplasmosis and positive conventional PCR. REP-529 and B1 sensitivities were 95.9% and 83.6%, respectively. Comparison of REP-529 and B1 performances was further analyzed prospectively in 292 samples. Thus, from a total of 807 DNA analyzed, 217 (26.89%) had positive PCR with, at least one primer set and symptomatic toxoplasmosis confirmed by clinical diagnosis. REP-529 was positive in 97.23%, whereas B1 amplified only 78.80%. After comparing several samples in a Brazilian referral laboratory, this study concluded that REP-529 primer set had better performance than B1 one. These observations were based after using cases with defined clinical diagnosis, ELISA, and conventional PCR. Copyright © 2017 Sociedade Brasileira de Infectologia. Published by Elsevier Editora Ltda. All rights reserved.
USDA-ARS?s Scientific Manuscript database
Quantitative PCR (Q-PCR) utilizing specific primer sequences and a fluorogenic, 5’-exonuclease linear hydrolysis probe is well established as a detection and identification method for Phakopsora pachyrhizi, the soybean rust pathogen. Because of the extreme sensitivity of Q-PCR, the DNA of a single u...
Taniuchi, Mami; Verweij, Jaco J.; Noor, Zannatun; Sobuz, Shihab U.; van Lieshout, Lisette; Petri, William A.; Haque, Rashidul; Houpt, Eric R.
2011-01-01
Polymerase chain reaction (PCR) assays for intestinal parasites are increasingly being used on fecal DNA samples for enhanced specificity and sensitivity of detection. Comparison of these tests against microscopy and copro-antigen detection has been favorable, and substitution of PCR-based assays for the ova and parasite stool examination is a foreseeable goal for the near future. One challenge is the diverse list of protozoan and helminth parasites. Several existing real-time PCR assays for the major intestinal parasites—Cryptosporidium spp., Giardia intestinalis, Entamoeba histolytica, Ancylostoma duodenale, Ascaris lumbricoides, Necator americanus, and Strongyloides stercoralis—were adapted into a high throughput protocol. The assay involves two multiplex PCR reactions, one with specific primers for the protozoa and one with specific primers for the helminths, after which PCR products are hybridized to beads linked to internal oligonucleotide probes and detected on a Luminex platform. When compared with the parent multiplex real-time PCR assays, this multiplex PCR-bead assay afforded between 83% and 100% sensitivity and specificity on a total of 319 clinical specimens. In conclusion, this multiplex PCR-bead protocol provides a sensitive diagnostic screen for a large panel of intestinal parasites. PMID:21292910
USDA-ARS?s Scientific Manuscript database
Identification of populations of Aspergillus section Nigri species in environmental samples using traditional methods is laborious and impractical for large numbers of samples. We developed species-specific primers and probes for quantitative droplet digital PCR (ddPCR) to improve sample throughput ...
Microsatellite primers for red drum (Sciaenops ocellatus)
USDA-ARS?s Scientific Manuscript database
In this note, we document polymerase-chain-reaction (PCR) primer pairs for 101, nuclear-encoded microsatellites designed and developed from a red drum (Sciaenops ocellatus) genomic library. The 101 microsatellites (Genbank Accession Numbers EU015882-EU015982) were amplified successfully and used to...
Luo, Xiao-Feng; Jiao, Jian-Hua; Zhang, Wen-Yue; Pu, Han-Ming; Qu, Bao-Jin; Yang, Bing-Ya; Hou, Min; Ji, Min-Jun
2016-07-07
To investigate clarithromycin resistance positions 2142, 2143 and 2144 of the 23SrRNA gene in Helicobacter pylori (H. pylori) by nested-allele specific primer-polymerase chain reaction (nested-ASP-PCR). The gastric tissue and saliva samples from 99 patients with positive results of the rapid urease test (RUT) were collected. The nested-ASP-PCR method was carried out with the external primers and inner allele-specific primers corresponding to the reference strain and clinical strains. Thirty gastric tissue and saliva samples were tested to determine the sensitivity of nested-ASP-PCR and ASP-PCR methods. Then, clarithromycin resistance was detected for 99 clinical samples by using different methods, including nested-ASP-PCR, bacterial culture and disk diffusion. The nested-ASP-PCR method was successfully established to test the resistance mutation points 2142, 2143 and 2144 of the 23SrRNA gene of H. pylori. Among 30 samples of gastric tissue and saliva, the H. pylori detection rate of nested-ASP-PCR was 90% and 83.33%, while the detection rate of ASP-PCR was just 63% and 56.67%. Especially in the saliva samples, nested-ASP-PCR showed much higher sensitivity in H. pylori detection and resistance mutation rates than ASP-PCR. In the 99 RUT-positive gastric tissue and saliva samples, the H. pylori-positive detection rate by nested-ASP-PCR was 87 (87.88%) and 67 (67.68%), in which there were 30 wild-type and 57 mutated strains in gastric tissue and 22 wild-type and 45 mutated strains in saliva. Genotype analysis showed that three-points mixed mutations were quite common, but different resistant strains were present in gastric mucosa and saliva. Compared to the high sensitivity shown by nested-ASP-PCR, the positive detection of bacterial culture with gastric tissue samples was 50 cases, in which only 26 drug-resistant strains were found through analyzing minimum inhibitory zone of clarithromycin. The nested-ASP-PCR assay showed higher detection sensitivity than ASP-PCR and drug sensitivity testing, which could be performed to evaluate clarithromycin resistance of H. pylori.
Luo, Xiao-Feng; Jiao, Jian-Hua; Zhang, Wen-Yue; Pu, Han-Ming; Qu, Bao-Jin; Yang, Bing-Ya; Hou, Min; Ji, Min-Jun
2016-01-01
AIM: To investigate clarithromycin resistance positions 2142, 2143 and 2144 of the 23SrRNA gene in Helicobacter pylori (H. pylori) by nested-allele specific primer-polymerase chain reaction (nested-ASP-PCR). METHODS: The gastric tissue and saliva samples from 99 patients with positive results of the rapid urease test (RUT) were collected. The nested-ASP-PCR method was carried out with the external primers and inner allele-specific primers corresponding to the reference strain and clinical strains. Thirty gastric tissue and saliva samples were tested to determine the sensitivity of nested-ASP-PCR and ASP-PCR methods. Then, clarithromycin resistance was detected for 99 clinical samples by using different methods, including nested-ASP-PCR, bacterial culture and disk diffusion. RESULTS: The nested-ASP-PCR method was successfully established to test the resistance mutation points 2142, 2143 and 2144 of the 23SrRNA gene of H. pylori. Among 30 samples of gastric tissue and saliva, the H. pylori detection rate of nested-ASP-PCR was 90% and 83.33%, while the detection rate of ASP-PCR was just 63% and 56.67%. Especially in the saliva samples, nested-ASP-PCR showed much higher sensitivity in H. pylori detection and resistance mutation rates than ASP-PCR. In the 99 RUT-positive gastric tissue and saliva samples, the H. pylori-positive detection rate by nested-ASP-PCR was 87 (87.88%) and 67 (67.68%), in which there were 30 wild-type and 57 mutated strains in gastric tissue and 22 wild-type and 45 mutated strains in saliva. Genotype analysis showed that three-points mixed mutations were quite common, but different resistant strains were present in gastric mucosa and saliva. Compared to the high sensitivity shown by nested-ASP-PCR, the positive detection of bacterial culture with gastric tissue samples was 50 cases, in which only 26 drug-resistant strains were found through analyzing minimum inhibitory zone of clarithromycin. CONCLUSION: The nested-ASP-PCR assay showed higher detection sensitivity than ASP-PCR and drug sensitivity testing, which could be performed to evaluate clarithromycin resistance of H. pylori. PMID:27433095
Day, I N; O'Dell, S D; Spanakis, E; Weavind, G P
1999-02-01
Important requirements for molecular genetic epidemiological studies are economy, sample parallelism, convenience of setup and accessibility, goals inadequately met by existent approaches. We invented microplate array diagonal gel electrophoresis (MADGE) to gain simultaneously the advantages of simple setup, 96-well microplate compatibility, horizontal electrophoresis, and the resolution of polyacrylamide. At essentially no equipment cost (one simple plastic gel former), 10-100-fold savings on time for sample coding, liquid transfers, and data documentation, in addition to volume reductions and gel re-use, can be achieved. MADGE is compatible with ARMS, restriction analysis and other pattern analyses. CpG-PCR is a general PCR approach to CpG sites (10-20% of all human single base variation): both primers have 3' T, and are abutted to the CpG, forcing a TaqI restriction site if the CpG is intact. Typically, a 52 bp PCR product is then cut in half. CpG-PCR also illustrates that PAGE-MADGE readily permits analysis of 'ultrashort' PCRs. Melt-MADGE employs real-time-variable-temperature electrophoresis to examine duplex mobility during melting, achieving DGGE-like de novo, mutation scanning, but with the conveniences of arbitrary programmability, MADGE compatibility and short run time. This suite of methods enhances our capability to type or scan thousands of samples simultaneously, by 10-100-fold.
[Three cases of herpes simplex virus type 2 myelitis--detection of HSV2 DNA in cerebrospinal fluid].
Nakajima, H; Furutama, D; Shinoda, K; Ohsawa, N; Nakagawa, T
1993-07-01
Polymerase chain reaction (PCR) technique has been successfully used to detect herpes simplex virus (HSV) from patients with HSV encephalitis. By PCR assay capable of differentiating HSV1 and 2, we detected HSV 2 DNA in cerebrospinal fluid (CSF) from patients with HSV myelitis and discussed the clinical findings. Three cases of HSV myelitis (a 49-year-old female, two 38- and 44-year-old males) were studied. All cases were characterized by transverse myelopathy of the thoracic cord, and two patients had recurrence. In all cases HSV1 antibodies were significantly elevated in serum and CSF. We used 500 microliters of CSF for PCR, and prepared one common upstream primer and two type specific downstream primers for HSV1 and HSV2. Using three primers simultaneously different sizes of PCR products were amplified from HSV1 and HSV2 DNA. PCR products subjected to electrophoresis on 1.2% agarose and stained with ethidium bromide. Still more southern blot hybridization was performed to detect DNA by 35S-end-labelled oligonucleotide prove. HSV2 DNA was amplified from CSF in all cases by PCR, and HSV2 DNA was detected at both first and second episode in two relapsing myelitis. No case of relapsing myelitis by HSV2 has been reported. The PCR technique is useful for diagnosis of HSV1 and 2 myelitis, and its would suggest that some patients of idiopathic myelopathy could be due to HSV2 myelitis and HSV2 myelitis may not be rare.
Villand, P; Aalen, R; Olsen, O A; Lüthi, E; Lönneborg, A; Kleczkowski, L A
1992-06-01
Several cDNAs encoding the small and large subunit of ADP-glucose pyrophosphorylase (AGP) were isolated from total RNA of the starchy endosperm, roots and leaves of barley by polymerase chain reaction (PCR). Sets of degenerate oligonucleotide primers, based on previously published conserved amino acid sequences of plant AGP, were used for synthesis and amplification of the cDNAs. For either the endosperm, roots and leaves, the restriction analysis of PCR products (ca. 550 nucleotides each) has revealed heterogeneity, suggesting presence of three transcripts for AGP in the endosperm and roots, and up to two AGP transcripts in the leaf tissue. Based on the derived amino acid sequences, two clones from the endosperm, beps and bepl, were identified as coding for the small and large subunit of AGP, respectively, while a leaf transcript (blpl) encoded the putative large subunit of AGP. There was about 50% identity between the endosperm clones, and both of them were about 60% identical to the leaf cDNA. Northern blot analysis has indicated that beps and bepl are expressed in both the endosperm and roots, while blpl is detectable only in leaves. Application of the PCR technique in studies on gene structure and gene expression of plant AGP is discussed.
[Application of melting curve to analyze genotype of Duffy blood group antigen Fy-a/b].
Chen, Xue; Zhou, Chang-Hua; Hong, Ying; Gong, Tian-Xiang
2012-12-01
This study was aimed to establish the real-time multiple-PCR with melting curve analysis for Duffy blood group Fy-a/b genotyping. According to the sequence of mRNA coding for β-actin and Fy-a/b, the primers of β-actin and Fy-a/b were synthesized. The real-time multiple-PCR with melting curve analysis for Fy-a/b genotyping was established. The Fy-a/b genotyping of 198 blood donors in Chinese Chengdu area has been investigated by melting curve analysis and PCR-SSP. The results showed that the results of Fy-a/b genotype by melting curve analysis were consistent with PCR-SSP. In all of 198 donors in Chinese Chengdu, 178 were Fy(a) (+) (89.9%), 19 were Fy(a) (+) Fy(b) (+) (9.6%), and 1 was Fy(b) (+) (0.5%). The gene frequency of Fy(a) was 0.947, while that of Fy(b) was 0.053. It is concluded that the genotyping method of Duffy blood group with melting curve analysis is established, which can be used as a high-throughput screening tool for Duffy blood group genotyping; and the Fy(a) genotype is the major of Duffy blood group of donors in Chinese Chengdu area.
Conrad, Cheyenne C; Gilroyed, Brandon H; McAllister, Tim A; Reuter, Tim
2012-10-01
Non-O157 Shiga toxin producing Escherichia coli (STEC) are gaining recognition as human pathogens, but no standardized method exists to identify them. Sequence analysis revealed that STEC can be classified on the base of variable O antigen regions into different O serotypes. Polymerase chain reaction is a powerful technique for thorough screening and complex diagnosis for these pathogens, but requires a positive control to verify qualitative and/or quantitative DNA-fragment amplification. Due to the pathogenic nature of STEC, controls are not readily available and cell culturing of STEC reference strains requires biosafety conditions of level 2 or higher. In order to bypass this limitation, controls of stacked O-type specific DNA-fragments coding for primer recognition sites were designed to screen for nine STEC serotypes frequently associated with human infection. The synthetic controls were amplified by PCR, cloned into a plasmid vector and transferred into bacteria host cells. Plasmids amplified by bacterial expression were purified, serially diluted and tested as standards for real-time PCR using SYBR Green and TaqMan assays. Utility of synthetic DNA controls was demonstrated in conventional and real-time PCR assays and validated with DNA from natural STEC strains. Copyright © 2012 Elsevier B.V. All rights reserved.
Li, Mingzhu; Senda, Masako; Komatsu, Tsutomu; Suga, Haruhisa; Kageyama, Koji
2010-10-20
Pythium intermedium is known to play an important role in the carbon cycling of cool-temperate forest soils. In this study, a fast, precise and effective real-time PCR technique for estimating the population densities of P. intermedium from soils was developed using species-specific primers. Specificity was confirmed both with conventional PCR and real-time PCR. The detection limit (sensitivity) was determined and amplification standard curves were generated using SYBR Green II fluorescent dye. A rapid and accurate assay for quantification of P. intermedium in Takayama forest soils of Japan was developed using a combination of a new DNA extraction method and PCR primers were developed for real-time PCR. And the distribution of P. intermedium in forest soil was investigated with both soil plating method and the developed real-time PCR technique. This new technique will be a useful tool and can be applied to practical use for studying the role of Pythium species in forest and agricultural ecosystems. Copyright © 2009 Elsevier GmbH. All rights reserved.
Molecular analysis of single oocyst of Eimeria by whole genome amplification (WGA) based nested PCR.
Wang, Yunzhou; Tao, Geru; Cui, Yujuan; Lv, Qiyao; Xie, Li; Li, Yuan; Suo, Xun; Qin, Yinghe; Xiao, Lihua; Liu, Xianyong
2014-09-01
PCR-based molecular tools are widely used for the identification and characterization of protozoa. Here we report the molecular analysis of Eimeria species using combined methods of whole genome amplification (WGA) and nested PCR. Single oocyst of Eimeria stiedai or Eimeriamedia was directly used for random amplification of the genomic DNA with either primer extension preamplification (PEP) or multiple displacement amplification (MDA), and then the WGA product was used as template in nested PCR with species-specific primers for ITS-1, 18S rDNA and 23S rDNA of E. stiedai and E. media. WGA-based PCR was successful for the amplification of these genes from single oocyst. For the species identification of single oocyst isolated from mixed E. stiedai or E. media, the results from WGA-based PCR were exactly in accordance with those from morphological identification, suggesting the availability of this method in molecular analysis of eimerian parasites at the single oocyst level. WGA-based PCR method can also be applied for the identification and genetic characterization of other protists. Copyright © 2014 Elsevier Inc. All rights reserved.
Shibuta, K; Abe, M; Suzuki, T
1994-01-01
The K variant of human butyrylcholinesterase is caused by a G/A transition in the butyrylcholinesterase gene, which neither creates nor destroys any restriction site. In an attempt to detect the K variant both simply and rapidly, we developed a two step method of "PCR primer introduced restriction analysis" (PCR-PIRA). The first step was used to introduce a new Fun4HI site into the normal allele for a screening test, while the second step was performed to create a new MaeIII site on the variant allele for a specific test. This method thus enabled us to distinguish clearly the K variant from the normal allele, and also showed that the frequency of the K variant allele is 0.164 in the Japanese population. Images PMID:7966197
Homoeologous cloning of omega-secalin gene family in a wheat 1BL/1RS translocation.
Chai, Jian Fang; Liu, Xu; Jia, Ji Zeng
2005-08-01
Wheat 1BL/1RS translocations are widely planted in China as well as in most of the wheat producing area in the world for their good qualities of disease resistance and high yield. 1BL/1RS translocations are however poor in bread making, partially caused by a family of small monomeric proteins, omega-secalins, which are encoded by genes on 1RS. Based on published sequence of a rye omega-secalin gene we designed a pair of primers to cover the whole mature protein coding sequence. A major band could be amplified from 1BL/1RS translocations but not from euploid wheat. Using this primer set we conducted PCR amplification by using high fidelity Pfu polymerase on the genomic DNAs and cDNAs purified from a 1BL/1RS translocation Lankao 906. Sequencing analysis indicated that this gene family contains several members of 1150 bp, 1076 bp, 1075 bp, 1052 bp and 1004 bp genes, including two pseudogenes and three active genes. The gene transcripts were differentially expressed in developing seeds.
MAJIQ-SPEL: Web-tool to interrogate classical and complex splicing variations from RNA-Seq data.
Green, Christopher J; Gazzara, Matthew R; Barash, Yoseph
2017-09-11
Analysis of RNA sequencing (RNA-Seq) data have highlighted the fact that most genes undergo alternative splicing (AS) and that these patterns are tightly regulated. Many of these events are complex, resulting in numerous possible isoforms that quickly become difficult to visualize, interpret, and experimentally validate. To address these challenges we developed MAJIQ-SPEL, a web-tool that takes as input local splicing variations (LSVs) quantified from RNA-Seq data and provides users with visualization and quantification of gene isoforms associated with those. Importantly, MAJIQ-SPEL is able to handle both classical (binary) and complex, non-binary, splicing variations. Using a matching primer design algorithm it also suggests users possible primers for experimental validation by RT-PCR and displays those, along with the matching protein domains affected by the LSV, on UCSC Genome Browser for further downstream analysis. Program and code will be available at http://majiq.biociphers.org/majiq-spel. Supplementary data are available at Bioinformatics online. © The Author (2017). Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com
Hi-Plex for Simple, Accurate, and Cost-Effective Amplicon-based Targeted DNA Sequencing.
Pope, Bernard J; Hammet, Fleur; Nguyen-Dumont, Tu; Park, Daniel J
2018-01-01
Hi-Plex is a suite of methods to enable simple, accurate, and cost-effective highly multiplex PCR-based targeted sequencing (Nguyen-Dumont et al., Biotechniques 58:33-36, 2015). At its core is the principle of using gene-specific primers (GSPs) to "seed" (or target) the reaction and universal primers to "drive" the majority of the reaction. In this manner, effects on amplification efficiencies across the target amplicons can, to a large extent, be restricted to early seeding cycles. Product sizes are defined within a relatively narrow range to enable high-specificity size selection, replication uniformity across target sites (including in the context of fragmented input DNA such as that derived from fixed tumor specimens (Nguyen-Dumont et al., Biotechniques 55:69-74, 2013; Nguyen-Dumont et al., Anal Biochem 470:48-51, 2015), and application of high-specificity genetic variant calling algorithms (Pope et al., Source Code Biol Med 9:3, 2014; Park et al., BMC Bioinformatics 17:165, 2016). Hi-Plex offers a streamlined workflow that is suitable for testing large numbers of specimens without the need for automation.
Meena, Ram Prasnna; Baranwal, V K
2016-09-01
Citrus trees harbor a large number of viral and bacterial pathogens. Citrus yellow vein clearing virus (CYVCV), Indian citrus ringspot virus (ICRSV), Citrus yellow mosaic virus (CYMV), Citrus tristeza virus (CTV) and a bacterium, Candidatus Liberibacter asiaticus (CLa) associated with huanglongbing (HLB) disease, the most prevalent pathogens in citrus orchards of different regions in India and are responsible for debilitating citriculture. For detection of these viral and bacterial pathogens a quick, sensitive and cost effective detection method is required. With this objective a multiplex polymerase chain reaction (mPCR) assay was developed for simultaneous detection of four viruses and a bacterium in citrus. Several sets of primers were designed for each virus based on the retrieved reference sequences from the GenBank. A primer pair published previously was used for greening bacterium. Each pair of primers was evaluated for their sensitivity and differentiation by simplex and mPCR. The constant amplified products were identified on the basis of molecular size in mPCR and were compared with standard PCR. The amplicons were cloned and results were confirmed with sequencing analysis. The mPCR assay was validated using naturally infected field samples for one or more citrus viruses and the huanglongbing bacterium. The mPCR assay developed here will aid in the production of virus free planting materials and rapid indexing for certification of citrus budwood programme. Copyright © 2016 Elsevier B.V. All rights reserved.
NASA Astrophysics Data System (ADS)
Park, S.; Kim, H.; Kim, M.; Lee, Y.; Han, J.
2011-12-01
The 2010 outbreak of foot and mouth disease (FMD) in South Korea caused about 4,054 carcass burial sites to dispose the carcasses. Potential environmental impacts by leachate of carcass on groundwater have been issued and it still needs to be studied. Therefore, we tried to develop robust and sensitive tool to immediately determine a groundwater contamination by the leachate from carcass burial. For tracking both an agricultural fecal contamination source and the leachate in groundwater, competitive real-time PCR and PCR method were developed using various PCR primer sets designed to detect E. Coli uidA gene and mtDNA(cytochrome B, cytB) of the animal species such as ovine, porcine, caprine, and bovine. The designed methods were applied to tract the animal species in livestock wastewater and leachate of carcass under appropriate PCR or real-time PCR condition. In the result, mtDNA primer sets for individual (Cow or Pig) and multiple (Cow and Pig) amplification, and E. Coli uidA primers for fecal source amplification were specific and sensitive to target genes. To determine contamination source, concentration of amplified mtDNA and uidA was competitively quantified in Livestock wastewater, leachate of carcass, and groundwater. The highest concentration of mtDNA and uidA showed in leachate of carcass and livestock wastewater, respectively. Groundwater samples possibly contaminated by leachate of carcass were analyzed by this assay and it was able to prove contamination source.
Hoy, M.S.; Kelly, K.; Rodriguez, R.J.
2010-01-01
A 3-primer PCR system was developed to discriminate invasive zebra (Dreissena polymorpha) and quagga (Dreissena bugensis) mussel. The system is based on: 1) universal primers that amplifies a region of the nuclear 28s rDNA gene from both species and 2) a species-specific primer complementary to either zebra or quagga mussel. The species-specific primers bind to sequences between the binding sites for the universal primers resulting in the amplification of two products from the target species and one product from the nontarget species. Therefore, nontarget products are positive amplification controls. The 3-primer system accurately discriminated zebra and quagga mussels from seven geographically distinct populations.
One step screening of retroviral producer clones by real time quantitative PCR.
Towers, G J; Stockholm, D; Labrousse-Najburg, V; Carlier, F; Danos, O; Pagès, J C
1999-01-01
Recombinant retroviruses are obtained from either stably or transiently transfected retrovirus producer cells. In the case of stably producing lines, a large number of clones must be screened in order to select the one with the highest titre. The multi-step selection of high titre producing clones is time consuming and expensive. We have taken advantage of retroviral endogenous reverse transcription to develop a quantitative PCR assay on crude supernatant from producing clones. We used Taqman PCR technology, which, by using fluorescence measurement at each cycle of amplification, allows PCR product quantification. Fluorescence results from specific degradation of a probe oligonucleotide by the Taq polymerase 3'-5' exonuclease activity. Primers and probe sequences were chosen to anneal to the viral strong stop species, which is the first DNA molecule synthesised during reverse transcription. The protocol consists of a single real time PCR, using as template filtered viral supernatant without any other pre-treatment. We show that the primers and probe described allow quantitation of serially diluted plasmid to as few as 15 plasmid molecules. We then test 200 GFP-expressing retroviral-producing clones either by FACS analysis of infected cells or by using the quantitative PCR. We confirm that the Taqman protocol allows the detection of virus in supernatant and selection of high titre clones. Furthermore, we can determine infectious titre by quantitative PCR on genomic DNA from infected cells, using an additional set of primers and probe to albumin to normalise for the genomic copy number. We demonstrate that real time quantitative PCR can be used as a powerful and reliable single step, high throughput screen for high titre retroviral producer clones.
Kiss, S; Zsikla, V; Frank, A; Willi, N; Cathomas, G
2016-04-01
Helicobacter-negative gastritis has been increasingly reported. Molecular techniques as the polymerase chain reaction (PCR) may detect bacterial DNA in histologically negative gastritis. To evaluate of Helicobacter PCR in gastric biopsies for the daily diagnostics of Helicobacter-negative gastritis. Over a 5-year period, routine biopsies with chronic gastritis reminiscent of Helicobacter infection, but negative by histology, were tested by using a H. pylori specific PCR. Subsequently, PCR-negative samples were re-evaluated using PCR for other Helicobacter species. Of the 9184 gastric biopsies, 339 (3.7%) with histological-negative gastritis and adequate material were forwarded to PCR analysis for H. pylori and 146 (43.1%) revealed a positive result. In 193 H. pylori DNA-negative biopsies, re-analysis using PCR primers for other Helicobacter species, revealed further 23 (11.9%) positive biopsies, including 4 (2.1%) biopsies with H. heilmannii sensu lato. PCR-positive biopsies showed a higher overall inflammatory score, more lymphoid follicles/aggregates and neutrophils (P < 0.05). No Helicobacter DNA was found in control biopsies of 48 patients with neither primer set (P < 0.0001). In 274 patients with an endoscopic description, detection of H. pylori DNA was associated with ulcers and erosions (P < 0.01). Over all, in 339 histologically-negative gastric biopsies, Helicobacter DNA was detected in 169 (49.9%) samples with at least one primer set. Molecular testing offers a sensitive and specific diagnosis to a selected group of patients, in whom adequate searches for bacteria by conventional histology have resulted in the unsatisfactory diagnosis of H. pylori-negative gastritis. © 2016 John Wiley & Sons Ltd.
Sensitive, microliter PCR with consensus degenerate primers for Epstein Barr virus amplification
Oh, Kyudam; Pak, Nikita; Saunders, D. Curtis; Conrardy, Christina; Landers, James P.; Tong, Suxiang; Forest, Craig R.
2016-01-01
Sensitive identification of the etiology of viral diseases is key to implementing appropriate prevention and treatment. The gold standard for virus identification is the polymerase chain reaction (PCR), a technique that allows for highly specific and sensitive detection of pathogens by exponentially amplifying a specific region of DNA from as little as a single copy through thermocycling a biochemical cocktail. Today, molecular biology laboratories use commercial instruments that operate in 0.5–2 h/analysis using reaction volumes of 5–50 μL contained within polymer tubes or chambers. Towards reducing this volume and maintaining performance, we present a semi-quantitative, systematic experimental study of how PCR yield is affected by tube/chamber substrate, surface-area-to-volume ratio (SA:V), and passivation methods. We perform PCR experiments using traditional PCR tubes as well as using disposable polymer microchips with 1 μL reaction volumes thermocycled using water baths. We report the first oil encapsulation microfluidic PCR method without fluid flow and its application to the first microfluidic amplification of Epstein Barr virus using consensus degenerate primers, a powerful and broad PCR method to screen for both known and novel members of a viral family. The limit of detection is measured as 140 starting copies of DNA from a starting concentration of 3×105 copies/mL, regarded as an accepted sensitivity threshold for diagnostic purposes, and reaction specificity was improved as compared to conventional methods. Also notable, these experiments were conducted with conventional reagent concentrations, rather than commonly spiked enzyme and/or template mixtures. This experimental study of the effects of substrate, SA:V, and passivation, together with sensitive and specific microfluidic PCR with consensus degenerate primers represent advances towards lower cost and higher throughput pathogen screening. PMID:23080522
DOE Office of Scientific and Technical Information (OSTI.GOV)
Oetting, W.S.; Lee, H.K.; Flanders, D.J.
The use of short tandem repeat polymorphisms (STRPs) as marker loci for linkage analysis is becoming increasingly important due to their large numbers in the human genome and their high degree of polymorphism. Fluorescence-based detection of the STRP pattern with an automated DNA sequencer has improved the efficiency of this technique by eliminating the need for radioactivity and producing a digitized autoradiogram-like image that can be used for computer analysis. In an effort to simplify the procedure and to reduce the cost of fluorescence STRP analysis, we have developed a technique known as multiplexing STRPs with tailed primers (MSTP) usingmore » primers that have a 19-bp extension, identical to the sequence of an M13 sequencing primer, on the 5{prime} end of the forward primer in conjunction with multiplexing several primer pairs in a single polymerase chain reaction (PCR) amplification. The banding pattern is detected with the addition of the M13 primer-dye conjugate as the sole primer conjugated to the fluorescent dye, eliminating the need for direct conjugation of the infrared fluorescent dye to the STRP primers. The use of MSTP for linkage analysis greatly reduces the number of PCR reactions. Up to five primer pairs can be multiplexed together in the same reaction. At present, a set of 148 STRP markers spaced at an average genetic distance of 28 cM throughout the autosomal genome can be analyzed in 37 sets of multiplexed amplification reactions. We have automated the analysis of these patterns for linkage using software that both detects the STRP banding pattern and determines their sizes. This information can then be exported in a user-defined format from a database manager for linkage analysis. 15 refs., 2 figs., 4 tabs.« less
Christensen, Geoff A; Wymore, Ann M; King, Andrew J; Podar, Mircea; Hurt, Richard A; Santillan, Eugenio U; Soren, Ally; Brandt, Craig C; Brown, Steven D; Palumbo, Anthony V; Wall, Judy D; Gilmour, Cynthia C; Elias, Dwayne A
2016-10-01
Two genes, hgcA and hgcB, are essential for microbial mercury (Hg) methylation. Detection and estimation of their abundance, in conjunction with Hg concentration, bioavailability, and biogeochemistry, are critical in determining potential hot spots of methylmercury (MeHg) generation in at-risk environments. We developed broad-range degenerate PCR primers spanning known hgcAB genes to determine the presence of both genes in diverse environments. These primers were tested against an extensive set of pure cultures with published genomes, including 13 Deltaproteobacteria, nine Firmicutes, and nine methanogenic Archaea genomes. A distinct PCR product at the expected size was confirmed for all hgcAB(+) strains tested via Sanger sequencing. Additionally, we developed clade-specific degenerate quantitative PCR (qPCR) primers that targeted hgcA for each of the three dominant Hg-methylating clades. The clade-specific qPCR primers amplified hgcA from 64%, 88%, and 86% of tested pure cultures of Deltaproteobacteria, Firmicutes, and Archaea, respectively, and were highly specific for each clade. Amplification efficiencies and detection limits were quantified for each organism. Primer sensitivity varied among species based on sequence conservation. Finally, to begin to evaluate the utility of our primer sets in nature, we tested hgcA and hgcAB recovery from pure cultures spiked into sand and soil. These novel quantitative molecular tools designed in this study will allow for more accurate identification and quantification of the individual Hg-methylating groups of microorganisms in the environment. The resulting data will be essential in developing accurate and robust predictive models of Hg methylation potential, ideally integrating the geochemistry of Hg methylation to the microbiology and genetics of hgcAB IMPORTANCE: The neurotoxin methylmercury (MeHg) poses a serious risk to human health. MeHg production in nature is associated with anaerobic microorganisms. The recent discovery of the Hg-methylating gene pair, hgcA and hgcB, has allowed us to design and optimize molecular probes against these genes within the genomic DNA for microorganisms known to methylate Hg. The protocols designed in this study allow for both qualitative and quantitative assessments of pure-culture or environmental samples. With these protocols in hand, we can begin to study the distribution of Hg-methylating organisms in nature via a cultivation-independent strategy. Copyright © 2016 Christensen et al.
Delaney, Nigel F.; Marx, Christopher J.
2012-01-01
Understanding evolutionary dynamics within microbial populations requires the ability to accurately follow allele frequencies through time. Here we present a rapid, cost-effective method (FREQ-Seq) that leverages Illumina next-generation sequencing for localized, quantitative allele frequency detection. Analogous to RNA-Seq, FREQ-Seq relies upon counts from the >105 reads generated per locus per time-point to determine allele frequencies. Loci of interest are directly amplified from a mixed population via two rounds of PCR using inexpensive, user-designed oligonucleotides and a bar-coded bridging primer system that can be regenerated in-house. The resulting bar-coded PCR products contain the adapters needed for Illumina sequencing, eliminating further library preparation. We demonstrate the utility of FREQ-Seq by determining the order and dynamics of beneficial alleles that arose as a microbial population, founded with an engineered strain of Methylobacterium, evolved to grow on methanol. Quantifying allele frequencies with minimal bias down to 1% abundance allowed effective analysis of SNPs, small in-dels and insertions of transposable elements. Our data reveal large-scale clonal interference during the early stages of adaptation and illustrate the utility of FREQ-Seq as a cost-effective tool for tracking allele frequencies in populations. PMID:23118913
Mas, Sergi; Crescenti, Anna; Gassó, Patricia; Vidal-Taboada, Jose M; Lafuente, Amalia
2007-08-01
As pharmacogenetic studies frequently require establishment of DNA banks containing large cohorts with multi-centric designs, inexpensive methods for collecting and storing high-quality DNA are needed. The aims of this study were two-fold: to compare the amount and quality of DNA obtained from two different DNA cards (IsoCode Cards or FTA Classic Cards, Whatman plc, Brentford, Middlesex, UK); and to evaluate the effects of time and storage temperature, as well as the influence of anticoagulant ethylenediaminetetraacetic acid on the DNA elution procedure. The samples were genotyped by several methods typically used in pharmacogenetic studies: multiplex PCR, PCR-restriction fragment length polymorphism, single nucleotide primer extension, and allelic discrimination assay. In addition, they were amplified by whole genome amplification to increase genomic DNA mass. Time, storage temperature and ethylenediaminetetraacetic acid had no significant effects on either DNA card. This study reveals the importance of drying blood spots prior to isolation to avoid haemoglobin interference. Moreover, our results demonstrate that re-isolation protocols could be applied to increase the amount of DNA recovered. The samples analysed were accurately genotyped with all the methods examined herein. In conclusion, our study shows that both DNA cards, IsoCode Cards and FTA Classic Cards, facilitate genetic and pharmacogenetic testing for routine clinical practice.
Feldhoff, A; Wetzel, T; Peters, D; Kellner, R; Krczal, G
1998-01-01
With the introduction of cutting-grown Petunia x hybrida plants on the European market, a new potyvirus which showed no serological reaction with antisera against any other potyviruses infecting petunias was discovered. Infected leaves contained flexuous rod-shaped virus particles of 750-800 nm in length and inclusion bodies (pinwheel structures) typical for potyviruses in ultrathin leaf sections. The purified coat protein with a Mr of approximately 36 kDa could be detected in Western immunoblots with a specific antibody to the coat protein of the petunia-infecting virus. The 3' end of the viral genome encompassing the 3' non-coding region, the coat protein gene, and part of the NIb gene was amplified from infected leaf material by IC/PCR using degenerate and specific primers. Sequences of PCR-generated cDNA clones were compared to other known sequences of potyviruses. Maximum homology of 56% was found in the 3' non-coding region between the petunia isolate and other potyviruses. A maximum homology of 69% was found between the amino acid sequence of the coat protein of the petunia isolate and corresponding sequences of other potyviruses. These data indicate that the petunia-infecting virus is a previously undescribed potyvirus and the name petunia flower mottle virus (PetFMV) is suggested.
Silva, Felipe Carneiro; Torrezan, Giovana Tardin; Brianese, Rafael Canfield; Stabellini, Raquel; Carraro, Dirce Maria
2017-07-01
Hereditary breast and ovarian cancer is characterized by mutations in BRCA1 or BRCA2 genes and PCR-based screening techniques, such as capillary sequencing and next-generation sequencing (NGS), are considered gold standard methods for detection of pathogenic mutations in these genes. Single-nucleotide polymorphisms (SNPs) constitute a vast source of variation in the human genome and represent a risk for misdiagnosis in genetic testing, since the presence of a SNP in primer-annealing sites may cause false negative results due to allele dropout. However, few reports are available and the frequency of this phenomenon in diagnostic assays remains unknown. In this article, we investigated the causes of a false negative capillary sequencing result in BRCA1 involving a mother-daughter dyad. Using several molecular strategies, including different DNA polymerases, primer redesign, allele-specific PCR and NGS, we established that the initial misdiagnosis was caused by a SNP located in the primer-annealing region, leading to allele dropout of the mutated allele. Assuming that this problem can also occur in any PCR-based method that are widely used in diagnostic settings, the clinical report presented here draws attention for one of the limitations of genetic testing in general, for which medical and laboratory communities need to be aware.
[Development of a universal primers PCR-coupled liquid bead array to detect biothreat bacteria].
Wen, Hai-yan; Wang, Jing; Liu, Heng-chuan; Sun, Xiao-hong; Yang, Yu; Hu, Kong-xin; Shan, Lin-jun
2009-10-01
To develop a fast, high-throughput screening method with suspension array technique for simultaneous detection of biothreat bacteria. 16 S rDNA universal primers for Bacillus anthracis, Francisella tularensis, Yersinia pestis, Brucella spp.and Burkholderia pseudomallei were selected to amplify corresponding regions and the genus-specific or species-specific probes were designed. After amplification of chromosomal DNA by 16 S rDNA primers 341A and 519B, the PCR products were detected by suspension array technique. The sensitivity, specificity, reproducibility and detection power were also analyzed. After PCR amplification by 16 S rDNA primers and specific probe hybridization, the target microorganisms could be identified at genus level, cross reaction was recognized in the same genus. The detection sensitivity of the assay was 1.5 pg/microl (Burkholderia pseudomallei), 20 pg/microl (Brucella spp.), 7 pg/microl (Bacillus anthracis), 0.1 pg/microl (Francisella tularensis), and 1.1 pg/microl (Yersinia pestis), respectively. The coefficient of variation for 15 test of different probes was ranged from 5.18% to 17.88%, it showed good reproducibility. The assay could correctly identify Bacillus anthracis and Yersinia pestis strains in simulated white powder samples. The suspension array technique could be served as an opening screening method for biothreat bacteria rapid detection.
NASA Astrophysics Data System (ADS)
Tsujimura, M.; Akutsu, J.; Zhang, Z.; Sasaki, M.; Tajima, H.; Kawarabayasi, Y.
2004-12-01
The thermostable proteins or enzymes were expected to be capable to be utilized in many areas of industries. Many thermophilic microorganisms, which possess the thermostable proteins or enzymes, were identified from the extreme environment. However, many unidentified and uncultivable microorganisms are still remaining in the environment on the earth. It is generally said that the cultivable microorganisms are less than 1% of entire microorganisms living in the earth, remaining over 99% are still uncultivable. As an approach to the uncultivable microorganisms, the PCR amplification of 16S rDNA region using primer sets designed from the conserved region has been generally utilized for detection and community analysis of microorganism in the environment. However, the facts, that PCR amplification introduces the mutation in the amplified DNA fragment and efficiency of PCR amplification is depend on the sequences of primer sets, indicated that the improving of PCR analysis was necessary for more correct detection of microorganisms. As the result of evaluation for the quality of DNA polymerases, sequences of primers used for amplification and conditions of PCR amplification, the DNA polymerase, the primer set and the conditions for amplification, which did not amplify the DNA fragment from the DNA contaminated within the DNA polymerase itself, were successfully selected. Also the rate of mutation in the DNA fragment amplified was evaluated using this conditions and the genomic DNA from cultivable microbes as a template. The result indicated the rate of mutation introduced by PCR was approximately 0.1% to 0.125%. The improved method using these conditions and error rate calculated was applied for the analysis of microorganisms in the geothermal environment. The result indicated that four kinds of dominant microorganisms, including both of bacteria and archaea, were alive within soil in the hot spring in Tohoku Area. We would like to apply this improved method to detection of microorganisms with important genes from more other environments.
Goldschmidt, Pablo; Degorge, Sandrine; Che Sarria, Patricia; Benallaoua, Djida; Semoun, Oudy; Borderie, Vincent; Laroche, Laurent; Chaumeil, Christine
2012-01-01
The prognosis of people infected with Fungi especially immunocompromised depends on rapid and accurate diagnosis to capitalize on time administration of specific treatments. However, cultures produce false negative results and nucleic-acid amplification techniques require complex post-amplification procedures to differentiate relevant fungal types. The objective of this work was to develop a new diagnostic strategy based on real-time polymerase-chain reaction high-resolution melting analysis (PCR-HRM) that a) detects yeasts and filamentous Fungi, b) differentiates yeasts from filamentous Fungi, and c) discriminates among relevant species of yeasts. PCR-HRM detection limits and specificity were assessed with a) isolated strains; b) human blood samples experimentally infected with Fungi; c) blood experimentally infected with other infectious agents; d) corneal scrapings from patients with suspected fungal keratitis (culture positive and negative) and e) scrapings from patients with suspected bacterial, viral or Acanthamoeba infections. The DNAs were extracted and mixed with primers diluted in the MeltDoctor® HRM Master Mix in 2 tubes, the first for yeasts, containing the forward primer CandUn (5'CATGCCTGTTTGAGCGTC) and the reverse primer FungUn (5'TCCTCCGCTT ATTGATATGCT) and the second for filamentous Fungi, containing the forward primer FilamUn (5'TGCCTGTCCGAGCGTCAT) and FungUn. Molecular probes were not necessary. The yields of DNA extraction and the PCR inhibitors were systematically monitored. PCR-HRM detected 0.1 Colony Forming Units (CFU)/µl of yeasts and filamentous Fungi, differentiated filamentous Fungi from yeasts and discriminated among relevant species of yeasts. PCR-HRM performances were higher than haemoculture and sensitivity and specificity was 100% for culture positive samples, detecting and characterizing Fungi in 7 out 10 culture negative suspected fungal keratitis. PCR-HRM appears as a new, sensitive, specific and inexpensive test that detects Fungi and differentiates filamentous Fungi from yeasts. It allows direct fungal detection from clinical samples and experimentally infected blood in less than 2.30 h after DNA extraction.
There are numerous quantitative real-time PCR (qPCR) methods available to detect and enumerate human fecal pollution in ambient waters. Each assay employs distinct primers and/or probes and many target different genes and microorganisms leading to potential variations in method ...
There are numerous quantitative real-time PCR (qPCR) assays available to detect and enumerate fecal pollution in ambient waters. Each assay employs distinct primers and probes that target different rRNA genes and microorganisms leading to potential variations in concentration es...
Integrating PCR Theory and Bioinformatics into a Research-oriented Primer Design Exercise
ERIC Educational Resources Information Center
Robertson, Amber L.; Phillips, Allison R.
2008-01-01
Polymerase chain reaction (PCR) is a conceptually difficult technique that embodies many fundamental biological processes. Traditionally, students have struggled to analyze PCR results due to an incomplete understanding of the biological concepts (theory) of DNA replication and strand complementarity. Here we describe the design of a novel…
GETPrime 2.0: gene- and transcript-specific qPCR primers for 13 species including polymorphisms
David, Fabrice P.A.; Rougemont, Jacques; Deplancke, Bart
2017-01-01
GETPrime (http://bbcftools.epfl.ch/getprime) is a database with a web frontend providing gene- and transcript-specific, pre-computed qPCR primer pairs. The primers have been optimized for genome-wide specificity and for allowing the selective amplification of one or several splice variants of most known genes. To ease selection, primers have also been ranked according to defined criteria such as genome-wide specificity (with BLAST), amplicon size, and isoform coverage. Here, we report a major upgrade (2.0) of the database: eight new species (yeast, chicken, macaque, chimpanzee, rat, platypus, pufferfish, and Anolis carolinensis) now complement the five already included in the previous version (human, mouse, zebrafish, fly, and worm). Furthermore, the genomic reference has been updated to Ensembl v81 (while keeping earlier versions for backward compatibility) as a result of re-designing the back-end database and automating the import of relevant sections of the Ensembl database in species-independent fashion. This also allowed us to map known polymorphisms to the primers (on average three per primer for human), with the aim of reducing experimental error when targeting specific strains or individuals. Another consequence is that the inclusion of future Ensembl releases and other species has now become a relatively straightforward task. PMID:28053161
Kokosková, B; Mráz, I; Fousek, J
2010-05-01
Detection of Clavibacter michiganensis subsp. michiganensis (Cmm), causing bacterial canker of tomato, was verified using PTA-ELISA and IFAS with PAbs of Neogen Europe Ltd. (UK), and with published and also laboratory-generated PCR primers from the Cmm tomatinase gene. The specificity of this technique was determined with 15 plant-pathogenic and 4 common, saprophytic bacteria. With IFAS, crossreactions were found for Pantoea dispersa, P. agglomerans and Rahnella aquatilis, and with PTA-ELISA for Curtobacterium flaccumfaciens, Pectobacterium atrosepticum and Dickeya sp. Cross-reactions with subspecies other than michiganensis were also found using both methods. Molecular methods were optimized by verification of annealing temperatures and times for both primers. Conditions were finally adjusted to 30 s at 65 degrees C for Dreier's and 10 s at 69 degrees C for our primer set. After this optimization, both primer pairs produced positive reaction only with Cmm. By means of PTA-ELISA and IFAS, Cmm strains were detected at a concentration up to 10(5) CFU/mL and 10(3) CFU/mL, respectively. The PCR test with bacterial cell suspensions reached a sensitivity of 10(3) CFU/mL with our designed primers and 104 CFU/mL with Dreier's primer pair.
Non-lethal sampling for the detection of Myxobolus cerebralis in asymptomatic rainbow trout
Schill, Bane; Waldrop, Thomas; Densmore, Christine; Blazer, Vicki
1999-01-01
We have described in previous reports (Schill et al., 1998) the development of a polymerase chain reaction (PCR) amplification of 18S ribosomal RNA for the detection of Myxozoan parasites. Oligonucleotide primers were developed by multiple alignment of Myxozoan sequence information and analysis by a custom-written computer program (PRIM). Candidate pairs of primer sequences were then analyzed for specificity by BLAST (Basic Local Alignment Search Tool). From these, a set of promising primers (MYXFWD and MYXREV) was chosen for further testing. These were chosen because they should direct detection of a number of Myxozoan species (Table 1). PCR using MXYFWD and MYXREV proved to be robust and relatively free of artifact products. Further, we were able to routinely detect Myxobolus cerebralis in fish tissues (Figure 1).
Yang, Zunyi; McLendon, Chris; Hutter, Daniel; Bradley, Kevin M; Hoshika, Shuichi; Frye, Carole B; Benner, Steven A
2015-06-15
Assays that detect DNA or RNA (xNA) are highly sensitive, as small amounts of xNA can be amplified by PCR. Unfortunately, PCR is inconvenient in low-resource environments, and requires equipment and power that might not be available in these environments. Isothermal procedures, which avoid thermal cycling, are often confounded by primer dimers, off-target priming, and other artifacts. Here, we show how a "self avoiding molecular recognition system" (SAMRS) eliminates these artifacts and gives clean amplicons in a helicase-dependent isothermal amplification (SAMRS-HDA). We also show that incorporating SAMRS into the 3'-ends of primers facilitates the design and screening of primers for HDA assays. Finally, we show that SAMRS-HDA can be twofold multiplexed, difficult to achieve with HDA using standard primers. Thus, SAMRS-HDA is a more versatile approach than standard HDA, with a broader applicability for xNA-targeted diagnostics and research. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Yang, Zunyi; McLendon, Chris; Hutter, Daniel; Bradley, Kevin M.; Hoshika, Shuichi; Frye, Carole; Benner, Steven A.
2015-01-01
Assays that target DNA or RNA (xNA) are highly sensitive, as small amounts of xNA can be amplified by PCR. Unfortunately, PCR is inconvenient in low resource environments, requiring equipment and power that may not be available in these environments. However, isothermal procedures that avoid thermal cycling are often confounded by primer dimers, off-target priming, and other artifacts. Here, we show how a “self avoiding molecular recognition system” (SAMRS) eliminates these artifacts to give clean amplicons in a helicase-dependent isothermal amplification (SAMRS-HDA). We also show that incorporating SAMRS into the 3′-ends of primers facilitates the design and screening of primers for HDA assays. Finally, we show that SAMRS-HDA can be twofold multiplexed, something difficult to achieve with HDA using standard primers. This shows that SAMRS-HDA is a more versatile approach than standard HDA with a broader applicability for xNA-targeted diagnostics and research. PMID:25953623
Jarausch, W; Saillard, C; Dosba, F; Bové, J M
1994-01-01
A 1.8-kb chromosomal DNA fragment of the mycoplasmalike organism (MLO) associated with apple proliferation was sequenced. Three putative open reading frames were observed on this fragment. The protein encoded by open reading frame 2 shows significant homologies with bacterial nitroreductases. From the nucleotide sequence four primer pairs for PCR were chosen to specifically amplify DNA from MLOs associated with European diseases of fruit trees. Primer pairs specific for (i) Malus-affecting MLOs, (ii) Malus- and Prunus-affecting MLOs, and (iii) Malus-, Prunus-, and Pyrus-affecting MLOs were obtained. Restriction enzyme analysis of the amplification products revealed restriction fragment length polymorphisms between Malus-, Prunus, and Pyrus-affecting MLOs as well as between different isolates of the apple proliferation MLO. No amplification with either primer pair could be obtained with DNA from 12 different MLOs experimentally maintained in periwinkle. Images PMID:7916180
Seng, E K; Fang, Q; Lam, T J; Sin, Y M
2004-06-15
A rapid, sensitive and highly specific detection method for Aquareovirus based on reverse-transcription polymerase chain reaction (RT-PCR) was developed. Based on multiple sequence alignment of the cloned sequences of a local isolates, the Threadfin reovirus (TFV) and Guppy reovirus (GPV) with Grass carp reovirus (GCRV), a pair of degenerate primers was selected carefully and synthesized. Using this primer combination, only one specific product, approximately 450 bp in length was obtained when RT-PCR was carried out using the genomic double-stranded RNA (dsRNA) of TFV, GPV and GCRV. Similar results were also obtained when Chum salmon reovirus (CSRV) and Striped bass reovirus (SBRV) dsRNA were used as templates. No products were observed when nucleic acids other than the dsRNA of the aquareoviruses described above were used as RT-PCR templates. This technique could detect not only TFV but also GPV and GCRV in low titer virus-infected cell cultured cells. Furthermore, this method has also been shown to be able to diagnose GPV-infected guppy (Poecilia reticulata) that exhibit clinical symptoms as well as GPV-carrier guppy. Collectively, these results showed that the RT-PCR amplification method using specific degenerate primers described below is very useful for rapid and accurate detection of a variety of aquareovirus strains isolated from different host species and origin.
Dobhal, Shefali; Olson, Jennifer D; Arif, Mohammad; Garcia Suarez, Johnny A; Ochoa-Corona, Francisco M
2016-06-01
Rose rosette disease is a disorder associated with infection by Rose rosette virus (RRV), a pathogen of roses that causes devastating effects on most garden cultivated varieties, and the wild invasive rose especially Rosa multiflora. Reliable and sensitive detection of this disease in early phases is needed to implement proper control measures. This study assesses a single primer-set based detection method for RRV and demonstrates its application in three different chemistries: Endpoint RT-PCR, TaqMan-quantitative RT-PCR (RT-qPCR) and SYBR Green RT-qPCR with High Resolution Melting analyses. A primer set (RRV2F/2R) was designed from consensus sequences of the nucleocapsid protein gene p3 located in the RNA 3 region of RRV. The specificity of primer set RRV2F/2R was validated in silico against published GenBank sequences and in-vitro against infected plant samples and an exclusivity panel of near-neighbor and other viruses that commonly infect Rosa spp. The developed assay is sensitive with a detection limit of 1fg from infected plant tissue. Thirty rose samples from 8 different states of the United States were tested using the developed methods. The developed methods are sensitive and reliable, and can be used by diagnostic laboratories for routine testing and disease management decisions. Copyright © 2016 Elsevier B.V. All rights reserved.
Pereira, Tomás Pellizzaro; do Amaral, Fernanda Plucani; Dall'Asta, Pamela; Brod, Fábio Cristiano Angonesi; Arisi, Ana Carolina Maisonnave
2014-07-01
The plant growth promoting bacteria Herbaspirillum seropedicae SmR1 is an endophytic diazotroph found in several economically important crops. Considering that methods to monitor the plant-bacteria interaction are required, our objective was to develop a real-time PCR method for quantification of PGPB H. seropedicae in the rhizosphere of maize seedlings. Primer pairs were designed, and their specificity was verified using DNA from 12 different bacterial species. Ten standard curves of qPCR assay using HERBAS1 primers and tenfold serial dilutions of H. seropedicae SmR1 DNA were performed, and PCR efficiency of 91 % and correlation coefficient of 0.99 were obtained. H. seropedicae SmR1 limit of detection was 10(1) copies (corresponding to 60.3 fg of bacterial DNA). qPCR assay using HERBAS1 was used to detect and quantify H. seropedicae strain SmR1 in inoculated maize roots, cultivated in vitro and in pots, harvested 1, 4, 7, and 10 days after inoculation. The estimated bacterial DNA copy number per gram of root was in the range 10(7)-10(9) for plants grown in vitro and it was around 10(6) for plants grown in pots. Primer pair HERBAS1 was able to quantify H. seropedicae SmR1, and this assay can be useful for monitoring plant-bacteria interaction.
indCAPS: A tool for designing screening primers for CRISPR/Cas9 mutagenesis events.
Hodgens, Charles; Nimchuk, Zachary L; Kieber, Joseph J
2017-01-01
Genetic manipulation of organisms using CRISPR/Cas9 technology generally produces small insertions/deletions (indels) that can be difficult to detect. Here, we describe a technique to easily and rapidly identify such indels. Sequence-identified mutations that alter a restriction enzyme recognition site can be readily distinguished from wild-type alleles using a cleaved amplified polymorphic sequence (CAPS) technique. If a restriction site is created or altered by the mutation such that only one allele contains the restriction site, a polymerase chain reaction (PCR) followed by a restriction digest can be used to distinguish the two alleles. However, in the case of most CRISPR-induced alleles, no such restriction sites are present in the target sequences. In this case, a derived CAPS (dCAPS) approach can be used in which mismatches are purposefully introduced in the oligonucleotide primers to create a restriction site in one, but not both, of the amplified templates. Web-based tools exist to aid dCAPS primer design, but when supplied sequences that include indels, the current tools often fail to suggest appropriate primers. Here, we report the development of a Python-based, species-agnostic web tool, called indCAPS, suitable for the design of PCR primers used in dCAPS assays that is compatible with indels. This tool should have wide utility for screening editing events following CRISPR/Cas9 mutagenesis as well as for identifying specific editing events in a pool of CRISPR-mediated mutagenesis events. This tool was field-tested in a CRISPR mutagenesis experiment targeting a cytokinin receptor (AHK3) in Arabidopsis thaliana. The tool suggested primers that successfully distinguished between wild-type and edited alleles of a target locus and facilitated the isolation of two novel ahk3 null alleles. Users can access indCAPS and design PCR primers to employ dCAPS to identify CRISPR/Cas9 alleles at http://indcaps.kieber.cloudapps.unc.edu/.
Hua, Ying; Sun, Qi; Wang, Xiangyu; DU, Yanli; Shao, Na; Zhang, Qiwei; Zhao, Wei; Wan, Chengsong
2015-11-01
To construct enterohemorrhagic Escherichia coli (EHEC) O157:H7 strains with delection espF gene and its nucleotide fragment and with espF gene complementation. A pair of homologous arm primers was designed to amplify the gene fragment of kanamycin resistance, which was transformed into EHEC O157:H7 EDL933w strain via the PKD46 plasmid by electroporation. The replacement of the espF gene by kanamycin resistance gene through the PKD46-mediated red recombination system was confirmed by PCR and sequencing. The entire coding region of espF along with its nucleotide fragment was amplified by PCR and cloned into pBAD33 plasmid, which was transformed into a mutant strain to construct the strain with espF complementation. RT-PCR was used to verify the transcription of espF and its nucleotide fragment in the complemented mutant strain. We established EHEC O157:H7 EDL933w strains with espF gene deletion and with espF gene complementation. Both espF and its nucleotide fragment were transcribed in the complemented mutant strain. The two strains provide a basis for further study of the regulatory mechanism of espF.
Quick, Josh; Grubaugh, Nathan D; Pullan, Steven T; Claro, Ingra M; Smith, Andrew D; Gangavarapu, Karthik; Oliveira, Glenn; Robles-Sikisaka, Refugio; Rogers, Thomas F; Beutler, Nathan A; Burton, Dennis R; Lewis-Ximenez, Lia Laura; de Jesus, Jaqueline Goes; Giovanetti, Marta; Hill, Sarah; Black, Allison; Bedford, Trevor; Carroll, Miles W; Nunes, Marcio; Alcantara, Luiz Carlos; Sabino, Ester C; Baylis, Sally A; Faria, Nuno; Loose, Matthew; Simpson, Jared T; Pybus, Oliver G; Andersen, Kristian G; Loman, Nicholas J
2018-01-01
Genome sequencing has become a powerful tool for studying emerging infectious diseases; however, genome sequencing directly from clinical samples without isolation remains challenging for viruses such as Zika, where metagenomic sequencing methods may generate insufficient numbers of viral reads. Here we present a protocol for generating coding-sequence complete genomes comprising an online primer design tool, a novel multiplex PCR enrichment protocol, optimised library preparation methods for the portable MinION sequencer (Oxford Nanopore Technologies) and the Illumina range of instruments, and a bioinformatics pipeline for generating consensus sequences. The MinION protocol does not require an internet connection for analysis, making it suitable for field applications with limited connectivity. Our method relies on multiplex PCR for targeted enrichment of viral genomes from samples containing as few as 50 genome copies per reaction. Viral consensus sequences can be achieved starting with clinical samples in 1-2 days following a simple laboratory workflow. This method has been successfully used by several groups studying Zika virus evolution and is facilitating an understanding of the spread of the virus in the Americas. PMID:28538739
Bhattacharya, D; Steinkötter, J; Melkonian, M
1993-12-01
Centrin (= caltractin) is a ubiquitous, cytoskeletal protein which is a member of the EF-hand superfamily of calcium-binding proteins. A centrin-coding cDNA was isolated and characterized from the prasinophyte green alga Scherffelia dubia. Centrin PCR amplification primers were used to isolate partial, homologous cDNA sequences from the green algae Tetraselmis striata and Spermatozopsis similis. Annealing analyses suggested that centrin is a single-copy-coding region in T. striata and S. similis and other green algae studied. Centrin-coding regions from S. dubia, S. similis and T. striata encode four colinear EF-hand domains which putatively bind calcium. Phylogenetic analyses, including homologous sequences from Chlamydomonas reinhardtii and the land plant Atriplex nummularia, demonstrate that the domains of centrins are congruent and arose from the two-fold duplication of an ancestral EF hand with Domains 1+3 and Domains 2+4 clustering. The domains of centrins are also congruent with those of calmodulins demonstrating that, like calmodulin, centrin is an ancient protein which arose within the ancestor of all eukaryotes via gene duplication. Phylogenetic relationships inferred from centrin-coding region comparisons mirror results of small subunit ribosomal RNA sequence analyses suggesting that centrin-coding regions are useful evolutionary markers within the green algae.
Singh, Chandra K; Ojha, Abhishek; Bhatanagar, Raj K; Kachru, Devendra N
2008-01-01
Vegetative insecticidal protein (Vip), a unique class of insecticidal protein, is now part of transgenic plants for conferring resistance against lepidopteron pests. In order to address the imminent regulatory need for detection and labeling of vip3A carrying genetically modified (GM) products, we have developed a standard single PCR and a multiplex PCR assay. As far as we are aware, this is the first report on PCR-based detection of a vip3A-type gene (vip-s) in transgenic cotton and tobacco. Our assay involves amplification of a 284-bp region of the vip-s gene. This assay can possibly detect as many as 20 natural wild-type isolates bearing a vip3A-like gene and two synthetic genes of vip3A in transgenic plants. The limit of detection as established by our assay for GM trait (vip-s) is 0.1%. Spiking with nontarget DNA originating from diverse plant sources had no inhibitory effect on vip-s detection. Since autoclaving of vip-s bearing GM leaf samples showed no deterioration/interference in detection efficacy, the assay seems to be suitable for processed food products as well. The vip-s amplicon identity was reconfirmed by restriction endonuclease assay. The primer set for vip-s was equally effective in a multiplex PCR assay format (duplex, triplex and quadruplex), used in conjunction with the primer sets for the npt-II selectable marker gene, Cauliflower mosaic virus 35S promoter and nopaline synthetase terminator, enabling concurrent detection of the transgene, regulatory sequences and marker gene. Further, the entire transgene construct was amplified using the forward primer of the promoter and the reverse primer of the terminator. The resultant amplicon served as a template for nested PCR to confirm the construct integrity. The method is suitable for screening any vip3A-carrying GM plant and food. The availability of a reliable PCR assay method prior to commercial release of vip3A-based transgenic crops and food would facilitate rapid and efficient regulatory compliance.
Turan, Tolga; Kalantari, Mina; Cuschieri, Kate; Cubie, Heather A; Skomedal, Hanne; Bernard, Hans-Ulrich
2007-04-25
The L1 gene of human papillomavirus-18 (HPV-18) is consistently hypermethylated in cervical carcinomas, but frequently hypo- or unmethylated in exfoliated cells from asymptomatic patients. In precancerous lesions, L1 is sporadically hypermethylated, correlating with the severity of the neoplasia. In order to explore the potential of using L1 methylation as a workable biomarker for carcinogenic progression of HPV-18 infections in routinely taken samples, our aim was to develop methylation-detection techniques that were sensitive and rapid without being overly complex technically. Therein, we developed a methylation-specific PCR (MSP) through the design of primer sets that specifically amplify either methylated or unmethylated HPV-18 L1 DNA within bisulfite-modified sample DNA. Amplification of unmethylated and in vitro methylated HPV-18 DNA by MSP resulted in 2500 copies of either of the two L1 DNA species being detected, a satisfactory sensitivity considering that bisulfite treatment leads to the fragmentation of about 99% of sample DNA. The primers proved specific and did not generate false positive results at concentrations exceeding the lowest limit of detection by a factor of 400. DNA from carcinomas yielded PCR signals only with the methylation-specific primers, and not with primers specific for unmethylated L1 genes. The inverse result was obtained with DNA from precursor lesions that contained only hypomethylated DNA. High-grade precursor lesions and carcinomas that contained hyper- as well as hypomethylated L1 DNA yielded PCR signals with both primers. By developing a fluorescence based real-time PCR, we quantitatively analyzed samples with in vitro methylated and unmethylated L1 DNA, and could distinguish clinical samples with hyper- and hypomethylated DNA or mixtures of both DNAs. The methylation-specific and real-time PCR techniques permitted efficient HPV-18 L1 methylation analyses and open the door for larger-scale clinical studies where the utility of methylation status to predict the progression of HPV-18 infection and HPV-18 associated lesions is assessed.
Babu, Binoy; Washburn, Brian K; Miller, Steven H; Poduch, Kristina; Sarigul, Tulin; Knox, Gary W; Ochoa-Corona, Francisco M; Paret, Mathews L
2017-02-01
Rose rosette disease caused by Rose rosette virus (RRV; genus Emaravirus) is the most economically relevant disease of Knock Out ® series roses in the U.S. As there are no effective chemical control options for the disease, the most critical disease management strategies include the use of virus free clean plants for propagation and early detection and destruction of infected plants. The current diagnostic techniques for RRV including end-point reverse transcription-polymerase chain reaction (RT-PCR) and real-time PCR (RT-qPCR) are highly sensitive, but limited to diagnostic labs with the equipment and expertise; and is time consuming. To address this limitation, an isothermal reverse transcription-recombinase polymerase amplification (RT-RPA) assay based on multiple gene targets for specific detection of RRV was developed. The assay is highly specific and did not cross react with other viruses belonging to the inclusive and exclusive genus. Dilution assays using the in vitro transcripts showed that the primer sets designed (RPA-267, RPA-131, and RPA-321) are highly sensitive, consistently detecting RRV with a detection limit of 1fg/μL. Testing of the infected plants using the primer sets indicated that the virus could be detected from leaves, stems and petals of roses. The primer pair RPA-267 produced 100% positive detection of the virus from infected leaf tissues, while primer set RPA-131 produced 100% detection from stems and petals. The primer set RPA-321 produced 83%, 87.5% and 75% positive detection from leaves, petals and stem tissues, respectively. In addition, the assay has been efficiently used in the detection of RRV infecting Knock Out ® roses, collected from different states in the U.S. The assay can be completed in 20min as compared to the end-point RT-PCR assay (3-4h) and RT-qPCR (1.5h). The RT-RPA assay is reliable, rapid, highly sensitive, and can be easily used in diagnostic laboratories for detection of RRV with no need for any special equipment. Copyright © 2016 Elsevier B.V. All rights reserved.
Customizable PCR-microplate array for differential identification of multiple pathogens
Woubit, Abdela; Yehualaeshet, Teshome; Roberts, Sherrelle; Graham, Martha; Kim, Moonil; Samuel, Temesgen
2014-01-01
Customizable PCR-microplate arrays were developed for the rapid identification of Francisella tularensis subsp. tularensis, Salmonella Typhi, Shigella dysenteriae, Yersinia pestis, Vibrio cholerae Escherichia coli O157:H7, Salmonella Typhimurium, Salmonella Saintpaul, Francisella tularensis subsp. novicida, Vibrio parahaemolyticus, and Yersinia pseudotuberculosis. Previously, we identified highly specific primers targeting each of the pathogens above. Here, we report the development of customizable PCR-microplate arrays for simultaneous identification of the pathogens using the primers. A mixed aliquot of genomic DNA from 38 different strains was used to validate three PCR-microplate array formats. Identical PCR conditions were used to run all the samples on the three formats. Results show specific amplifications on all the three custom plates. In a preliminary test to evaluate the sensitivity of these assays in laboratory-inoculated samples, detection limits as low as 9 cfu/g/ml S. Typhimurium were obtained from beef hot dog, and 78 cfu/ml from milk. Such microplate arrays could serve as valuable tools for initial identification or secondary confirmation of these pathogens. PMID:24215700