Loss-of-function mutations in APOC3, triglycerides, and coronary disease.

PubMed

Crosby, Jacy; Peloso, Gina M; Auer, Paul L; Crosslin, David R; Stitziel, Nathan O; Lange, Leslie A; Lu, Yingchang; Tang, Zheng-zheng; Zhang, He; Hindy, George; Masca, Nicholas; Stirrups, Kathleen; Kanoni, Stavroula; Do, Ron; Jun, Goo; Hu, Youna; Kang, Hyun Min; Xue, Chenyi; Goel, Anuj; Farrall, Martin; Duga, Stefano; Merlini, Pier Angelica; Asselta, Rosanna; Girelli, Domenico; Olivieri, Oliviero; Martinelli, Nicola; Yin, Wu; Reilly, Dermot; Speliotes, Elizabeth; Fox, Caroline S; Hveem, Kristian; Holmen, Oddgeir L; Nikpay, Majid; Farlow, Deborah N; Assimes, Themistocles L; Franceschini, Nora; Robinson, Jennifer; North, Kari E; Martin, Lisa W; DePristo, Mark; Gupta, Namrata; Escher, Stefan A; Jansson, Jan-Håkan; Van Zuydam, Natalie; Palmer, Colin N A; Wareham, Nicholas; Koch, Werner; Meitinger, Thomas; Peters, Annette; Lieb, Wolfgang; Erbel, Raimund; Konig, Inke R; Kruppa, Jochen; Degenhardt, Franziska; Gottesman, Omri; Bottinger, Erwin P; O'Donnell, Christopher J; Psaty, Bruce M; Ballantyne, Christie M; Abecasis, Goncalo; Ordovas, Jose M; Melander, Olle; Watkins, Hugh; Orho-Melander, Marju; Ardissino, Diego; Loos, Ruth J F; McPherson, Ruth; Willer, Cristen J; Erdmann, Jeanette; Hall, Alistair S; Samani, Nilesh J; Deloukas, Panos; Schunkert, Heribert; Wilson, James G; Kooperberg, Charles; Rich, Stephen S; Tracy, Russell P; Lin, Dan-Yu; Altshuler, David; Gabriel, Stacey; Nickerson, Deborah A; Jarvik, Gail P; Cupples, L Adrienne; Reiner, Alex P; Boerwinkle, Eric; Kathiresan, Sekar

2014-07-03

Plasma triglyceride levels are heritable and are correlated with the risk of coronary heart disease. Sequencing of the protein-coding regions of the human genome (the exome) has the potential to identify rare mutations that have a large effect on phenotype. We sequenced the protein-coding regions of 18,666 genes in each of 3734 participants of European or African ancestry in the Exome Sequencing Project. We conducted tests to determine whether rare mutations in coding sequence, individually or in aggregate within a gene, were associated with plasma triglyceride levels. For mutations associated with triglyceride levels, we subsequently evaluated their association with the risk of coronary heart disease in 110,970 persons. An aggregate of rare mutations in the gene encoding apolipoprotein C3 (APOC3) was associated with lower plasma triglyceride levels. Among the four mutations that drove this result, three were loss-of-function mutations: a nonsense mutation (R19X) and two splice-site mutations (IVS2+1G→A and IVS3+1G→T). The fourth was a missense mutation (A43T). Approximately 1 in 150 persons in the study was a heterozygous carrier of at least one of these four mutations. Triglyceride levels in the carriers were 39% lower than levels in noncarriers (P<1×10(-20)), and circulating levels of APOC3 in carriers were 46% lower than levels in noncarriers (P=8×10(-10)). The risk of coronary heart disease among 498 carriers of any rare APOC3 mutation was 40% lower than the risk among 110,472 noncarriers (odds ratio, 0.60; 95% confidence interval, 0.47 to 0.75; P=4×10(-6)). Rare mutations that disrupt APOC3 function were associated with lower levels of plasma triglycerides and APOC3. Carriers of these mutations were found to have a reduced risk of coronary heart disease. (Funded by the National Heart, Lung, and Blood Institute and others.).

Loss-of-Function Mutations in APOC3, Triglycerides, and Coronary Disease

PubMed Central

2014-01-01

Background Plasma triglyceride levels are heritable and are correlated with the risk of coronary heart disease. Sequencing of the protein-coding regions of the human genome (the exome) has the potential to identify rare mutations that have a large effect on phenotype. Methods We sequenced the protein-coding regions of 18,666 genes in each of 3734 participants of European or African ancestry in the Exome Sequencing Project. We conducted tests to determine whether rare mutations in coding sequence, individually or in aggregate within a gene, were associated with plasma triglyceride levels. For mutations associated with triglyceride levels, we subsequently evaluated their association with the risk of coronary heart disease in 110,970 persons. Results An aggregate of rare mutations in the gene encoding apolipoprotein C3 (APOC3) was associated with lower plasma triglyceride levels. Among the four mutations that drove this result, three were loss-of-function mutations: a nonsense mutation (R19X) and two splice-site mutations (IVS2+1G→A and IVS3+1G→T). The fourth was a missense mutation (A43T). Approximately 1 in 150 persons in the study was a heterozygous carrier of at least one of these four mutations. Triglyceride levels in the carriers were 39% lower than levels in noncarriers (P<1×10−20), and circulating levels of APOC3 in carriers were 46% lower than levels in noncarriers (P = 8×10−10). The risk of coronary heart disease among 498 carriers of any rare APOC3 mutation was 40% lower than the risk among 110,472 noncarriers (odds ratio, 0.60; 95% confidence interval, 0.47 to 0.75; P = 4×10−6). Conclusions Rare mutations that disrupt APOC3 function were associated with lower levels of plasma triglycerides and APOC3. Carriers of these mutations were found to have a reduced risk of coronary heart disease. (Funded by the National Heart, Lung, and Blood Institute and others.) PMID:24941081

SIGMAR1 mutation associated with autosomal recessive Silver-like syndrome

PubMed Central

Horga, Alejandro; Tomaselli, Pedro J.; Gonzalez, Michael A.; Laurà, Matilde; Muntoni, Francesco; Manzur, Adnan Y.; Hanna, Michael G.; Blake, Julian C.; Houlden, Henry; Züchner, Stephan

2016-01-01

Objective: To describe the genetic and clinical features of a simplex patient with distal hereditary motor neuropathy (dHMN) and lower limb spasticity (Silver-like syndrome) due to a mutation in the sigma nonopioid intracellular receptor–1 gene (SIGMAR1) and review the phenotypic spectrum of mutations in this gene. Methods: We used whole-exome sequencing to investigate the proband. The variants of interest were investigated for segregation in the family using Sanger sequencing. Subsequently, a larger cohort of 16 unrelated dHMN patients was specifically screened for SIGMAR1 mutations. Results: In the proband, we identified a homozygous missense variant (c.194T>A, p.Leu65Gln) in exon 2 of SIGMAR1 as the probable causative mutation. Pathogenicity is supported by evolutionary conservation, in silico analyses, and the strong phenotypic similarities with previously reported cases carrying coding sequence mutations in SIGMAR1. No other mutations were identified in 16 additional patients with dHMN. Conclusions: We suggest that coding sequence mutations in SIGMAR1 present clinically with a combination of dHMN and pyramidal tract signs, with or without spasticity, in the lower limbs. Preferential involvement of extensor muscles of the upper limbs may be a distinctive feature of the disease. These observations should be confirmed in future studies. PMID:27629094

SIGMAR1 mutation associated with autosomal recessive Silver-like syndrome.

PubMed

Horga, Alejandro; Tomaselli, Pedro J; Gonzalez, Michael A; Laurà, Matilde; Muntoni, Francesco; Manzur, Adnan Y; Hanna, Michael G; Blake, Julian C; Houlden, Henry; Züchner, Stephan; Reilly, Mary M

2016-10-11

To describe the genetic and clinical features of a simplex patient with distal hereditary motor neuropathy (dHMN) and lower limb spasticity (Silver-like syndrome) due to a mutation in the sigma nonopioid intracellular receptor-1 gene (SIGMAR1) and review the phenotypic spectrum of mutations in this gene. We used whole-exome sequencing to investigate the proband. The variants of interest were investigated for segregation in the family using Sanger sequencing. Subsequently, a larger cohort of 16 unrelated dHMN patients was specifically screened for SIGMAR1 mutations. In the proband, we identified a homozygous missense variant (c.194T>A, p.Leu65Gln) in exon 2 of SIGMAR1 as the probable causative mutation. Pathogenicity is supported by evolutionary conservation, in silico analyses, and the strong phenotypic similarities with previously reported cases carrying coding sequence mutations in SIGMAR1. No other mutations were identified in 16 additional patients with dHMN. We suggest that coding sequence mutations in SIGMAR1 present clinically with a combination of dHMN and pyramidal tract signs, with or without spasticity, in the lower limbs. Preferential involvement of extensor muscles of the upper limbs may be a distinctive feature of the disease. These observations should be confirmed in future studies. © 2016 American Academy of Neurology.

[Detection of gene mutation in glucose-6-phosphate dehydrogenase deficiency by RT-PCR sequencing].

PubMed

Lyu, Rong-Yu; Chen, Xiao-Wen; Zhang, Min; Chen, Yun-Sheng; Yu, Jie; Wen, Fei-Qiu

2016-07-01

Since glucose-6-phosphate dehydrogenase (G6PD) deficiency is the most common hereditary hemolytic erythrocyte enzyme deficiency, most cases have single nucleotide mutations in the coding region, and current test methods for gene mutation have some missed detections, this study aimed to investigate the feasibility of RT-PCR sequencing in the detection of gene mutation in G6PD deficiency. According to the G6PD/6GPD ratio, 195 children with anemia of unknown cause or who underwent physical examination between August 2013 and July 2014 were classified into G6PD-deficiency group with 130 children (G6PD/6GPD ratio <1.00) and control group with 65 children (G6PD/6GPD ratio≥1.00). The primer design and PCR amplification conditions were optimized, and RT-PCR sequencing was used to analyze the complete coding sequence and verify the genomic DNA sequence in the two groups. In the G6PD-deficiency group, the detection rate of gene mutation was 100% and 13 missense mutations were detected, including one new mutation. In the control group, no missense mutation was detected in 28 boys; 13 heterozygous missense mutations, 1 homozygous same-sense mutation (C1191T) which had not been reported in China and abroad, and 14 single nucleotide polymorphisms of C1311T were detected in 37 girls. The control group showed a high rate of missed detection of G6PD deficiency (carriers) in the specimens from girls (35%, 13/37). RT-PCR sequencing has a high detection rate of G6PD gene mutation and a certain value in clinical diagnosis of G6PD deficiency.

Novel mutations of CHST6 in Iranian patients with macular corneal dystrophy

PubMed Central

Salehi, Zivar; Houshmand, Masoud; Mohamadi, Mohamad Javad; Promehr, Leila Azizade; Mozafarzadeh, Zahra

2009-01-01

Purpose To characterize mutations within the carbohydrate sulfotransferase 6 (CHST6) gene in Iranian subjects from 12 families with macular corneal dystrophy (MCD). Methods Genomic DNA was extracted from peripheral blood of 20 affected patients and 60 healthy volunteers followed by polymerase chain reaction (PCR) and direct sequencing of the CHST6 coding region. The observed nucleotide sequences were then compared with those found by investigators in other populations with MCD and in the controls. Results Analysis of CHST6 revealed 11 different mutations. These mutations were comprised of six novel missense mutations (p.F55L, p.P132L, p.S136G, p.C149Y, p.D203Y, and p.H249R), one novel nonsense mutation (p.S48X), one novel frame shift (after P297), and three previously reported missense mutations (p.P31L, p.C165Y, and p.R127C). The majority of the detected MCD mutations are located in the binding sites or the binding pocket, except the p.P31L and p.H249R mutations. Conclusions Nucleotide changes within the coding region of CHST6 are predicted to significantly alter the encoded sulfotransferase within the evolutionary conserved sequences. Our findings show that CHST6 mutations are responsible for the pathogenesis of MCD in Iranian patients. Moreover, the observation that some cases of MCD cannot be explained by mutations in the coding region of CHST6 suggests that MCD may result from possible upstream rearrangements in the CHST6 genomic region. PMID:19223992

Novel mutations of CHST6 in Iranian patients with macular corneal dystrophy.

PubMed

Birgani, Shiva Akbari; Salehi, Zivar; Houshmand, Masoud; Mohamadi, Mohamad Javad; Promehr, Leila Azizade; Mozafarzadeh, Zahra

2009-01-01

To characterize mutations within the carbohydrate sulfotransferase 6 (CHST6) gene in Iranian subjects from 12 families with macular corneal dystrophy (MCD). Genomic DNA was extracted from peripheral blood of 20 affected patients and 60 healthy volunteers followed by polymerase chain reaction (PCR) and direct sequencing of the CHST6 coding region. The observed nucleotide sequences were then compared with those found by investigators in other populations with MCD and in the controls. Analysis of CHST6 revealed 11 different mutations. These mutations were comprised of six novel missense mutations (p.F55L, p.P132L, p.S136G, p.C149Y, p.D203Y, and p.H249R), one novel nonsense mutation (p.S48X), one novel frame shift (after P297), and three previously reported missense mutations (p.P31L, p.C165Y, and p.R127C). The majority of the detected MCD mutations are located in the binding sites or the binding pocket, except the p.P31L and p.H249R mutations. Nucleotide changes within the coding region of CHST6 are predicted to significantly alter the encoded sulfotransferase within the evolutionary conserved sequences. Our findings show that CHST6 mutations are responsible for the pathogenesis of MCD in Iranian patients. Moreover, the observation that some cases of MCD cannot be explained by mutations in the coding region of CHST6 suggests that MCD may result from possible upstream rearrangements in the CHST6 genomic region.

Mutation detection in the human HSP70B′ gene by denaturing high-performance liquid chromatography

PubMed Central

Hecker, Karl H.; Asea, Alexzander; Kobayashi, Kaoru; Green, Stacy; Tang, Dan; Calderwood, Stuart K.

2000-01-01

Variances, particularly single nucleotide polymorphisms (SNP), in the genomic sequence of individuals are the primary key to understanding gene function as it relates to differences in the susceptibility to disease, environmental influences, and therapy. In this report, the HSP70B′ gene is the target sequence for mutation detection in biopsy samples from human prostate cancer patients undergoing combined hyperthermia and radiation therapy at the Dana-Farber Cancer Institute, using temperature-modulated heteroduplex analysis (TMHA). The underlying principles of TMHA for mutation detection using DHPLC technology are discussed. The procedures involved in amplicon design for mutation analysis by DHPLC are detailed. The melting behavior of the complete coding sequence of the target gene is characterized using WAVEMAKERTM software. Four overlapping amplicons, which span the complete coding region of the HSP70B′ gene, amenable to mutation detection by DHPLC were identified based on the software-predicted melting profile of the target sequence. TMHA was performed on PCR products of individual amplicons of the HSP70B′ gene on the WAVE® Nucleic Acid Fragment Analysis System. The criteria for mutation calling by comparing wild-type and mutant chromatographic patterns are discussed. PMID:11189446

Mutation detection in the human HSP7OB' gene by denaturing high-performance liquid chromatography.

PubMed

Hecker, K H; Asea, A; Kobayashi, K; Green, S; Tang, D; Calderwood, S K

2000-11-01

Variances, particularly single nucleotide polymorphisms (SNP), in the genomic sequence of individuals are the primary key to understanding gene function as it relates to differences in the susceptibility to disease, environmental influences, and therapy. In this report, the HSP70B' gene is the target sequence for mutation detection in biopsy samples from human prostate cancer patients undergoing combined hyperthermia and radiation therapy at the Dana-Farber Cancer Institute, using temperature-modulated heteroduplex analysis (TMHA). The underlying principles of TMHA for mutation detection using DHPLC technology are discussed. The procedures involved in amplicon design for mutation analysis by DHPLC are detailed. The melting behavior of the complete coding sequence of the target gene is characterized using WAVEMAKER software. Four overlapping amplicons, which span the complete coding region of the HSP70B' gene, amenable to mutation detection by DHPLC were identified based on the software-predicted melting profile of the target sequence. TMHA was performed on PCR products of individual amplicons of the HSP70B' gene on the WAVE Nucleic Acid Fragment Analysis System. The criteria for mutation calling by comparing wild-type and mutant chromatographic patterns are discussed.

Ancient DNA sequence revealed by error-correcting codes.

PubMed

Brandão, Marcelo M; Spoladore, Larissa; Faria, Luzinete C B; Rocha, Andréa S L; Silva-Filho, Marcio C; Palazzo, Reginaldo

2015-07-10

A previously described DNA sequence generator algorithm (DNA-SGA) using error-correcting codes has been employed as a computational tool to address the evolutionary pathway of the genetic code. The code-generated sequence alignment demonstrated that a residue mutation revealed by the code can be found in the same position in sequences of distantly related taxa. Furthermore, the code-generated sequences do not promote amino acid changes in the deviant genomes through codon reassignment. A Bayesian evolutionary analysis of both code-generated and homologous sequences of the Arabidopsis thaliana malate dehydrogenase gene indicates an approximately 1 MYA divergence time from the MDH code-generated sequence node to its paralogous sequences. The DNA-SGA helps to determine the plesiomorphic state of DNA sequences because a single nucleotide alteration often occurs in distantly related taxa and can be found in the alternative codon patterns of noncanonical genetic codes. As a consequence, the algorithm may reveal an earlier stage of the evolution of the standard code.

Ancient DNA sequence revealed by error-correcting codes

PubMed Central

Brandão, Marcelo M.; Spoladore, Larissa; Faria, Luzinete C. B.; Rocha, Andréa S. L.; Silva-Filho, Marcio C.; Palazzo, Reginaldo

2015-01-01

A previously described DNA sequence generator algorithm (DNA-SGA) using error-correcting codes has been employed as a computational tool to address the evolutionary pathway of the genetic code. The code-generated sequence alignment demonstrated that a residue mutation revealed by the code can be found in the same position in sequences of distantly related taxa. Furthermore, the code-generated sequences do not promote amino acid changes in the deviant genomes through codon reassignment. A Bayesian evolutionary analysis of both code-generated and homologous sequences of the Arabidopsis thaliana malate dehydrogenase gene indicates an approximately 1 MYA divergence time from the MDH code-generated sequence node to its paralogous sequences. The DNA-SGA helps to determine the plesiomorphic state of DNA sequences because a single nucleotide alteration often occurs in distantly related taxa and can be found in the alternative codon patterns of noncanonical genetic codes. As a consequence, the algorithm may reveal an earlier stage of the evolution of the standard code. PMID:26159228

Random oligonucleotide mutagenesis: application to a large protein coding sequence of a major histocompatibility complex class I gene, H-2DP.

PubMed Central

Murray, R; Pederson, K; Prosser, H; Muller, D; Hutchison, C A; Frelinger, J A

1988-01-01

We have used random oligonucleotide mutagenesis (or saturation mutagenesis) to create a library of point mutations in the alpha 1 protein domain of a Major Histocompatibility Complex (MHC) molecule. This protein domain is critical for T cell and B cell recognition. We altered the MHC class I H-2DP gene sequence such that synthetic mutant alpha 1 exons (270 bp of coding sequence), which contain mutations identified by sequence analysis, can replace the wild type alpha 1 exon. The synthetic exons were constructed from twelve overlapping oligonucleotides which contained an average of 1.3 random point mutations per intact exon. DNA sequence analysis of mutant alpha 1 exons has shown a point mutant distribution that fits a Poisson distribution, and thus emphasizes the utility of this mutagenesis technique to "scan" a large protein sequence for important mutations. We report our use of saturation mutagenesis to scan an entire exon of the H-2DP gene, a cassette strategy to replace the wild type alpha 1 exon with individual mutant alpha 1 exons, and analysis of mutant molecules expressed on the surface of transfected mouse L cells. Images PMID:2903482

Increasing the yield in targeted next-generation sequencing by implicating CNV analysis, non-coding exons and the overall variant load: the example of retinal dystrophies.

PubMed

Eisenberger, Tobias; Neuhaus, Christine; Khan, Arif O; Decker, Christian; Preising, Markus N; Friedburg, Christoph; Bieg, Anika; Gliem, Martin; Charbel Issa, Peter; Holz, Frank G; Baig, Shahid M; Hellenbroich, Yorck; Galvez, Alberto; Platzer, Konrad; Wollnik, Bernd; Laddach, Nadja; Ghaffari, Saeed Reza; Rafati, Maryam; Botzenhart, Elke; Tinschert, Sigrid; Börger, Doris; Bohring, Axel; Schreml, Julia; Körtge-Jung, Stefani; Schell-Apacik, Chayim; Bakur, Khadijah; Al-Aama, Jumana Y; Neuhann, Teresa; Herkenrath, Peter; Nürnberg, Gudrun; Nürnberg, Peter; Davis, John S; Gal, Andreas; Bergmann, Carsten; Lorenz, Birgit; Bolz, Hanno J

2013-01-01

Retinitis pigmentosa (RP) and Leber congenital amaurosis (LCA) are major causes of blindness. They result from mutations in many genes which has long hampered comprehensive genetic analysis. Recently, targeted next-generation sequencing (NGS) has proven useful to overcome this limitation. To uncover "hidden mutations" such as copy number variations (CNVs) and mutations in non-coding regions, we extended the use of NGS data by quantitative readout for the exons of 55 RP and LCA genes in 126 patients, and by including non-coding 5' exons. We detected several causative CNVs which were key to the diagnosis in hitherto unsolved constellations, e.g. hemizygous point mutations in consanguineous families, and CNVs complemented apparently monoallelic recessive alleles. Mutations of non-coding exon 1 of EYS revealed its contribution to disease. In view of the high carrier frequency for retinal disease gene mutations in the general population, we considered the overall variant load in each patient to assess if a mutation was causative or reflected accidental carriership in patients with mutations in several genes or with single recessive alleles. For example, truncating mutations in RP1, a gene implicated in both recessive and dominant RP, were causative in biallelic constellations, unrelated to disease when heterozygous on a biallelic mutation background of another gene, or even non-pathogenic if close to the C-terminus. Patients with mutations in several loci were common, but without evidence for di- or oligogenic inheritance. Although the number of targeted genes was low compared to previous studies, the mutation detection rate was highest (70%) which likely results from completeness and depth of coverage, and quantitative data analysis. CNV analysis should routinely be applied in targeted NGS, and mutations in non-coding exons give reason to systematically include 5'-UTRs in disease gene or exome panels. Consideration of all variants is indispensable because even truncating mutations may be misleading.

Neutropenia-associated ELANE mutations disrupting translation initiation produce novel neutrophil elastase isoforms

PubMed Central

Tidwell, Timothy; Wechsler, Jeremy; Nayak, Ramesh C.; Trump, Lisa; Salipante, Stephen J.; Cheng, Jerry C.; Donadieu, Jean; Glaubach, Taly; Corey, Seth J.; Grimes, H. Leighton; Lutzko, Carolyn; Cancelas, Jose A.

2014-01-01

Hereditary neutropenia is usually caused by heterozygous germline mutations in the ELANE gene encoding neutrophil elastase (NE). How mutations cause disease remains uncertain, but two hypotheses have been proposed. In one, ELANE mutations lead to mislocalization of NE. In the other, ELANE mutations disturb protein folding, inducing an unfolded protein response in the endoplasmic reticulum (ER). In this study, we describe new types of mutations that disrupt the translational start site. At first glance, they should block translation and are incompatible with either the mislocalization or misfolding hypotheses, which require mutant protein for pathogenicity. We find that start-site mutations, instead, force translation from downstream in-frame initiation codons, yielding amino-terminally truncated isoforms lacking ER-localizing (pre) and zymogen-maintaining (pro) sequences, yet retain essential catalytic residues. Patient-derived induced pluripotent stem cells recapitulate hematopoietic and molecular phenotypes. Expression of the amino-terminally deleted isoforms in vitro reduces myeloid cell clonogenic capacity. We define an internal ribosome entry site (IRES) within ELANE and demonstrate that adjacent mutations modulate IRES activity, independently of protein-coding sequence alterations. Some ELANE mutations, therefore, appear to cause neutropenia via the production of amino-terminally deleted NE isoforms rather than by altering the coding sequence of the full-length protein. PMID:24184683

Simulation of gene evolution under directional mutational pressure

NASA Astrophysics Data System (ADS)

Dudkiewicz, Małgorzata; Mackiewicz, Paweł; Kowalczuk, Maria; Mackiewicz, Dorota; Nowicka, Aleksandra; Polak, Natalia; Smolarczyk, Kamila; Banaszak, Joanna; R. Dudek, Mirosław; Cebrat, Stanisław

2004-05-01

The two main mechanisms generating the genetic diversity, mutation and recombination, have random character but they are biased which has an effect on the generation of asymmetry in the bacterial chromosome structure and in the protein coding sequences. Thus, like in a case of two chiral molecules-the two possible orientations of a gene in relation to the topology of a chromosome are not equivalent. Assuming that the sequence of a gene may oscillate only between certain limits of its structural composition means that the gene could be forced out of these limits by the directional mutation pressure, in the course of evolution. The probability of the event depends on the time the gene stays under the same mutation pressure. Inversion of the gene changes the directional mutational pressure to the reciprocal one and hence it changes the distance of the gene to its lower and upper bound of the structural tolerance. Using Monte Carlo methods we were able to simulate the evolution of genes under experimentally found mutational pressure, assuming simple mechanisms of selection. We found that the mutation and recombination should work in accordance to lower their negative effects on the function of the products of coding sequences.

Increasing the Yield in Targeted Next-Generation Sequencing by Implicating CNV Analysis, Non-Coding Exons and the Overall Variant Load: The Example of Retinal Dystrophies

PubMed Central

Eisenberger, Tobias; Neuhaus, Christine; Khan, Arif O.; Decker, Christian; Preising, Markus N.; Friedburg, Christoph; Bieg, Anika; Gliem, Martin; Issa, Peter Charbel; Holz, Frank G.; Baig, Shahid M.; Hellenbroich, Yorck; Galvez, Alberto; Platzer, Konrad; Wollnik, Bernd; Laddach, Nadja; Ghaffari, Saeed Reza; Rafati, Maryam; Botzenhart, Elke; Tinschert, Sigrid; Börger, Doris; Bohring, Axel; Schreml, Julia; Körtge-Jung, Stefani; Schell-Apacik, Chayim; Bakur, Khadijah; Al-Aama, Jumana Y.; Neuhann, Teresa; Herkenrath, Peter; Nürnberg, Gudrun; Nürnberg, Peter; Davis, John S.; Gal, Andreas; Bergmann, Carsten; Lorenz, Birgit; Bolz, Hanno J.

2013-01-01

Retinitis pigmentosa (RP) and Leber congenital amaurosis (LCA) are major causes of blindness. They result from mutations in many genes which has long hampered comprehensive genetic analysis. Recently, targeted next-generation sequencing (NGS) has proven useful to overcome this limitation. To uncover “hidden mutations” such as copy number variations (CNVs) and mutations in non-coding regions, we extended the use of NGS data by quantitative readout for the exons of 55 RP and LCA genes in 126 patients, and by including non-coding 5′ exons. We detected several causative CNVs which were key to the diagnosis in hitherto unsolved constellations, e.g. hemizygous point mutations in consanguineous families, and CNVs complemented apparently monoallelic recessive alleles. Mutations of non-coding exon 1 of EYS revealed its contribution to disease. In view of the high carrier frequency for retinal disease gene mutations in the general population, we considered the overall variant load in each patient to assess if a mutation was causative or reflected accidental carriership in patients with mutations in several genes or with single recessive alleles. For example, truncating mutations in RP1, a gene implicated in both recessive and dominant RP, were causative in biallelic constellations, unrelated to disease when heterozygous on a biallelic mutation background of another gene, or even non-pathogenic if close to the C-terminus. Patients with mutations in several loci were common, but without evidence for di- or oligogenic inheritance. Although the number of targeted genes was low compared to previous studies, the mutation detection rate was highest (70%) which likely results from completeness and depth of coverage, and quantitative data analysis. CNV analysis should routinely be applied in targeted NGS, and mutations in non-coding exons give reason to systematically include 5′-UTRs in disease gene or exome panels. Consideration of all variants is indispensable because even truncating mutations may be misleading. PMID:24265693

Highly sensitive detection of mutations in CHO cell recombinant DNA using multi-parallel single molecule real-time DNA sequencing.

PubMed

Cartwright, Joseph F; Anderson, Karin; Longworth, Joseph; Lobb, Philip; James, David C

2018-06-01

High-fidelity replication of biologic-encoding recombinant DNA sequences by engineered mammalian cell cultures is an essential pre-requisite for the development of stable cell lines for the production of biotherapeutics. However, immortalized mammalian cells characteristically exhibit an increased point mutation frequency compared to mammalian cells in vivo, both across their genomes and at specific loci (hotspots). Thus unforeseen mutations in recombinant DNA sequences can arise and be maintained within producer cell populations. These may affect both the stability of recombinant gene expression and give rise to protein sequence variants with variable bioactivity and immunogenicity. Rigorous quantitative assessment of recombinant DNA integrity should therefore form part of the cell line development process and be an essential quality assurance metric for instances where synthetic/multi-component assemblies are utilized to engineer mammalian cells, such as the assessment of recombinant DNA fidelity or the mutability of single-site integration target loci. Based on Pacific Biosciences (Menlo Park, CA) single molecule real-time (SMRT™) circular consensus sequencing (CCS) technology we developed a rDNA sequence analysis tool to process the multi-parallel sequencing of ∼40,000 single recombinant DNA molecules. After statistical filtering of raw sequencing data, we show that this analytical method is capable of detecting single point mutations in rDNA to a minimum single mutation frequency of 0.0042% (<1/24,000 bases). Using a stable CHO transfectant pool harboring a randomly integrated 5 kB plasmid construct encoding GFP we found that 28% of recombinant plasmid copies contained at least one low frequency (<0.3%) point mutation. These mutations were predominantly found in GC base pairs (85%) and that there was no positional bias in mutation across the plasmid sequence. There was no discernable difference between the mutation frequencies of coding and non-coding DNA. The putative ratio of non-synonymous and synonymous changes within the open reading frames (ORFs) in the plasmid sequence indicates that natural selection does not impact upon the prevalence of these mutations. Here we have demonstrated the abundance of mutations that fall outside of the reported range of detection of next generation sequencing (NGS) and second generation sequencing (SGS) platforms, providing a methodology capable of being utilized in cell line development platforms to identify the fidelity of recombinant genes throughout the production process. © 2018 Wiley Periodicals, Inc.

Unexpected allelic heterogeneity and spectrum of mutations in Fowler syndrome revealed by next-generation exome sequencing.

PubMed

Lalonde, Emilie; Albrecht, Steffen; Ha, Kevin C H; Jacob, Karine; Bolduc, Nathalie; Polychronakos, Constantin; Dechelotte, Pierre; Majewski, Jacek; Jabado, Nada

2010-08-01

Protein coding genes constitute approximately 1% of the human genome but harbor 85% of the mutations with large effects on disease-related traits. Therefore, efficient strategies for selectively sequencing complete coding regions (i.e., "whole exome") have the potential to contribute our understanding of human diseases. We used a method for whole-exome sequencing coupling Agilent whole-exome capture to the Illumina DNA-sequencing platform, and investigated two unrelated fetuses from nonconsanguineous families with Fowler Syndrome (FS), a stereotyped phenotype lethal disease. We report novel germline mutations in feline leukemia virus subgroup C cellular-receptor-family member 2, FLVCR2, which has recently been shown to cause FS. Using this technology, we identified three types of genetic abnormalities: point-mutations, insertions-deletions, and intronic splice-site changes (first pathogenic report using this technology), in the fetuses who both were compound heterozygotes for the disease. Although revealing a high level of allelic heterogeneity and mutational spectrum in FS, this study further illustrates the successful application of whole-exome sequencing to uncover genetic defects in rare Mendelian disorders. Of importance, we show that we can identify genes underlying rare, monogenic and recessive diseases using a limited number of patients (n=2), in the absence of shared genetic heritage and in the presence of allelic heterogeneity.

Evaluation of non-coding variation in GLUT1 deficiency.

PubMed

Liu, Yu-Chi; Lee, Jia Wei Audrey; Bellows, Susannah T; Damiano, John A; Mullen, Saul A; Berkovic, Samuel F; Bahlo, Melanie; Scheffer, Ingrid E; Hildebrand, Michael S

2016-12-01

Loss-of-function mutations in SLC2A1, encoding glucose transporter-1 (GLUT-1), lead to dysfunction of glucose transport across the blood-brain barrier. Ten percent of cases with hypoglycorrhachia (fasting cerebrospinal fluid [CSF] glucose <2.2mmol/L) do not have mutations. We hypothesized that GLUT1 deficiency could be due to non-coding SLC2A1 variants. We performed whole exome sequencing of one proband with a GLUT1 phenotype and hypoglycorrhachia negative for SLC2A1 sequencing and copy number variants. We studied a further 55 patients with different epilepsies and low CSF glucose who did not have exonic mutations or copy number variants. We sequenced non-coding promoter and intronic regions. We performed mRNA studies for the recurrent intronic variant. The proband had a de novo splice site mutation five base pairs from the intron-exon boundary. Three of 55 patients had deep intronic SLC2A1 variants, including a recurrent variant in two. The recurrent variant produced less SLC2A1 mRNA transcript. Fasting CSF glucose levels show an age-dependent correlation, which makes the definition of hypoglycorrhachia challenging. Low CSF glucose levels may be associated with pathogenic SLC2A1 mutations including deep intronic SLC2A1 variants. Extending genetic screening to non-coding regions will enable diagnosis of more patients with GLUT1 deficiency, allowing implementation of the ketogenic diet to improve outcomes. © 2016 Mac Keith Press.

Non-coding variants contribute to the clinical heterogeneity of TTR amyloidosis.

PubMed

Iorio, Andrea; De Lillo, Antonella; De Angelis, Flavio; Di Girolamo, Marco; Luigetti, Marco; Sabatelli, Mario; Pradotto, Luca; Mauro, Alessandro; Mazzeo, Anna; Stancanelli, Claudia; Perfetto, Federico; Frusconi, Sabrina; My, Filomena; Manfellotto, Dario; Fuciarelli, Maria; Polimanti, Renato

2017-09-01

Coding mutations in TTR gene cause a rare hereditary form of systemic amyloidosis, which has a complex genotype-phenotype correlation. We investigated the role of non-coding variants in regulating TTR gene expression and consequently amyloidosis symptoms. We evaluated the genotype-phenotype correlation considering the clinical information of 129 Italian patients with TTR amyloidosis. Then, we conducted a re-sequencing of TTR gene to investigate how non-coding variants affect TTR expression and, consequently, phenotypic presentation in carriers of amyloidogenic mutations. Polygenic scores for genetically determined TTR expression were constructed using data from our re-sequencing analysis and the GTEx (Genotype-Tissue Expression) project. We confirmed a strong phenotypic heterogeneity across coding mutations causing TTR amyloidosis. Considering the effects of non-coding variants on TTR expression, we identified three patient clusters with specific expression patterns associated with certain phenotypic presentations, including late onset, autonomic neurological involvement, and gastrointestinal symptoms. This study provides novel data regarding the role of non-coding variation and the gene expression profiles in patients affected by TTR amyloidosis, also putting forth an approach that could be used to investigate the mechanisms at the basis of the genotype-phenotype correlation of the disease.

Evolution and Diversity of the Human Hepatitis D Virus Genome

PubMed Central

Huang, Chi-Ruei; Lo, Szecheng J.

2010-01-01

Human hepatitis delta virus (HDV) is the smallest RNA virus in genome. HDV genome is divided into a viroid-like sequence and a protein-coding sequence which could have originated from different resources and the HDV genome was eventually constituted through RNA recombination. The genome subsequently diversified through accumulation of mutations selected by interactions between the mutated RNA and proteins with host factors to successfully form the infectious virions. Therefore, we propose that the conservation of HDV nucleotide sequence is highly related with its functionality. Genome analysis of known HDV isolates shows that the C-terminal coding sequences of large delta antigen (LDAg) are the highest diversity than other regions of protein-coding sequences but they still retain biological functionality to interact with the heavy chain of clathrin can be selected and maintained. Since viruses interact with many host factors, including escaping the host immune response, how to design a program to predict RNA genome evolution is a great challenging work. PMID:20204073

A KCNH2 branch point mutation causing aberrant splicing contributes to an explanation of genotype-negative long QT syndrome.

PubMed

Crotti, Lia; Lewandowska, Marzena A; Schwartz, Peter J; Insolia, Roberto; Pedrazzini, Matteo; Bussani, Erica; Dagradi, Federica; George, Alfred L; Pagani, Franco

2009-02-01

Genetic screening of long QT syndrome (LQTS) fails to identify disease-causing mutations in about 30% of patients. So far, molecular screening has focused mainly on coding sequence mutations or on substitutions at canonical splice sites. The purpose of this study was to explore the possibility that intronic variants not at canonical splice sites might affect splicing regulatory elements, lead to aberrant transcripts, and cause LQTS. Molecular screening was performed through DHPLC and sequence analysis. The role of the intronic mutation identified was assessed with a hybrid minigene splicing assay. A three-generation LQTS family was investigated. Molecular screening failed to identify an obvious disease-causing mutation in the coding sequences of the major LQTS genes but revealed an intronic A-to-G substitution in KCNH2 (IVS9-28A/G) cosegregating with the clinical phenotype in family members. In vitro analysis proved that the mutation disrupts the acceptor splice site definition by affecting the branch point (BP) sequence and promoting intron retention. We further demonstrated a tight functional relationship between the BP and the polypyrimidine tract, whose weakness is responsible for the pathological effect of the IVS9-28A/G mutation. We identified a novel BP mutation in KCNH2 that disrupts the intron 9 acceptor splice site definition and causes LQT2. The present finding demonstrates that intronic mutations affecting pre-mRNA processing may contribute to the failure of traditional molecular screening in identifying disease-causing mutations in LQTS subjects and offers a rationale strategy for the reduction of genotype-negative cases.

Systematic screening for mutations in the promoter and the coding region of the 5-HT{sub 1A} gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Erdmann, J.; Shimron-Abarbanell, D.; Cichon, S.

1995-10-09

In the present study we sought to identify genetic variation in the 5-HT{sub 1A} receptor gene which through alteration of protein function or level of expression might contribute to the genetic predisposition to neuropsychiatric diseases. Genomic DNA samples from 159 unrelated subjects (including 45 schizophrenic, 46 bipolar affective, and 43 patients with Tourette`s syndrome, as well as 25 healthy controls) were investigated by single-strand conformation analysis. Overlapping PCR (polymerase chain reaction) fragments covered the whole coding sequence as well as the 5{prime} untranslated region of the 5-HT{sub 1A} gene. The region upstream to the coding sequence we investigated contains amore » functional promoter. We found two rare nucleotide sequence variants. Both mutations are located in the coding region of the gene: a coding mutation (A{yields}G) in nucleotide position 82 which leads to an amino acid exchange (Ile{yields}Val) in position 28 of the receptor protein and a silent mutation (C{yields}T) in nucleotide position 549. The occurrence of the Ile-28-Val substitution was studied in an extended sample of patients (n = 352) and controls (n = 210) but was found in similar frequencies in all groups. Thus, this mutation is unlikely to play a significant role in the genetic predisposition to the diseases investigated. In conclusion, our study does not provide evidence that the 5-HT{sub 1A} gene plays either a major or a minor role in the genetic predisposition to schizophrenia, bipolar affective disorder, or Tourette`s syndrome. 29 refs., 4 figs., 1 tab.« less

Detection of novel mutations that cause autosomal dominant retinitis pigmentosa in candidate genes by long-range PCR amplification and next-generation sequencing

PubMed Central

Dias, Miguel de Sousa; Hernan, Imma; Pascual, Beatriz; Borràs, Emma; Mañé, Begoña; Gamundi, Maria José

2013-01-01

Purpose To devise an effective method for detecting mutations in 12 genes (CA4, CRX, IMPDH1, NR2E3, RP9, PRPF3, PRPF8, PRPF31, PRPH2, RHO, RP1, and TOPORS) commonly associated with autosomal dominant retinitis pigmentosa (adRP) that account for more than 95% of known mutations. Methods We used long-range PCR (LR-PCR) amplification and next-generation sequencing (NGS) performed in a GS Junior 454 benchtop sequencing platform. Twenty LR-PCR fragments, between 3,000 and 10,000 bp, containing all coding exons and flanking regions of the 12 genes, were obtained from DNA samples of patients with adRP. Sequencing libraries were prepared with an enzymatic (Fragmentase technology) method. Results Complete coverage of the coding and flanking sequences of the 12 genes assayed was obtained with NGS, with an average sequence depth of 380× (ranging from 128× to 1,077×). Five previous known mutations in the adRP genes were detected with a sequence variation percentage between 35% and 65%. We also performed a parallel sequence analysis of four samples, three of them new patients with index adRP, in which two novel mutations were detected in RHO (p.Asn73del) and PRPF31 (p.Ile109del). Conclusions The results demonstrate that genomic LR-PCR amplification together with NGS is an effective method for analyzing individual patient samples for mutations in a monogenic heterogeneous disease such as adRP. This approach proved effective for the parallel analysis of adRP and has been introduced as routine. Additionally, this approach could be extended to other heterogeneous genetic diseases. PMID:23559859

Whole Genome Sequencing Identifies a 78 kb Insertion from Chromosome 8 as the Cause of Charcot-Marie-Tooth Neuropathy CMTX3

PubMed Central

Brewer, Megan H.; Chaudhry, Rabia; Qi, Jessica; Kidambi, Aditi; Drew, Alexander P.; Ryan, Monique M.; Subramanian, Gopinath M.; Young, Helen K.; Zuchner, Stephan; Reddel, Stephen W.; Nicholson, Garth A.; Kennerson, Marina L.

2016-01-01

With the advent of whole exome sequencing, cases where no pathogenic coding mutations can be found are increasingly being observed in many diseases. In two large, distantly-related families that mapped to the Charcot-Marie-Tooth neuropathy CMTX3 locus at chromosome Xq26.3-q27.3, all coding mutations were excluded. Using whole genome sequencing we found a large DNA interchromosomal insertion within the CMTX3 locus. The 78 kb insertion originates from chromosome 8q24.3, segregates fully with the disease in the two families, and is absent from the general population as well as 627 neurologically normal chromosomes from in-house controls. Large insertions into chromosome Xq27.1 are known to cause a range of diseases and this is the first neuropathy phenotype caused by an interchromosomal insertion at this locus. The CMTX3 insertion represents an understudied pathogenic structural variation mechanism for inherited peripheral neuropathies. Our finding highlights the importance of considering all structural variation types when studying unsolved inherited peripheral neuropathy cases with no pathogenic coding mutations. PMID:27438001

Detection of 98. 5% of the mutations in 200 Belgian cystic fibrosis alleles by reverse dot-blot and sequencing of the complete coding region and exon/intron junctions of the CFTR gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cuppens, H.; Marynen, P.; Cassiman, J.J.

1993-12-01

The authors have previously shown that about 85% of the mutations in 194 Belgian cystic fibrosis alleles could be detected by a reverse dot-blot assay. In the present study, 50 Belgian chromosomes were analyzed for mutations in the cystic fibrosis transmembrane conductance regulator gene by means of direct solid phase automatic sequencing of PCR products of individual exons. Twenty-six disease mutations and 14 polymorphisms were found. Twelve of these mutations and 3 polymorphisms were not described before. With the exception of one mutant allele carrying two mutations, these mutations were the only mutations found in the complete coding region andmore » their exon/intron boundaries. The total sensitivity of mutant CF alleles that could be identified was 98.5%. Given the heterogeneity of these mutations, most of them very rare, CFTR mutation screening still remains rather complex in the population, and population screening, whether desirable or not, does not appear to be technically feasible with the methods currently available. 24 refs., 1 fig., 2 tabs.« less

A Bioinformatics-Based Alternative mRNA Splicing Code that May Explain Some Disease Mutations Is Conserved in Animals.

PubMed

Qu, Wen; Cingolani, Pablo; Zeeberg, Barry R; Ruden, Douglas M

2017-01-01

Deep sequencing of cDNAs made from spliced mRNAs indicates that most coding genes in many animals and plants have pre-mRNA transcripts that are alternatively spliced. In pre-mRNAs, in addition to invariant exons that are present in almost all mature mRNA products, there are at least 6 additional types of exons, such as exons from alternative promoters or with alternative polyA sites, mutually exclusive exons, skipped exons, or exons with alternative 5' or 3' splice sites. Our bioinformatics-based hypothesis is that, in analogy to the genetic code, there is an "alternative-splicing code" in introns and flanking exon sequences, analogous to the genetic code, that directs alternative splicing of many of the 36 types of introns. In humans, we identified 42 different consensus sequences that are each present in at least 100 human introns. 37 of the 42 top consensus sequences are significantly enriched or depleted in at least one of the 36 types of introns. We further supported our hypothesis by showing that 96 out of 96 analyzed human disease mutations that affect RNA splicing, and change alternative splicing from one class to another, can be partially explained by a mutation altering a consensus sequence from one type of intron to that of another type of intron. Some of the alternative splicing consensus sequences, and presumably their small-RNA or protein targets, are evolutionarily conserved from 50 plant to animal species. We also noticed the set of introns within a gene usually share the same splicing codes, thus arguing that one sub-type of splicesosome might process all (or most) of the introns in a given gene. Our work sheds new light on a possible mechanism for generating the tremendous diversity in protein structure by alternative splicing of pre-mRNAs.

Identification of the Bovine Arachnomelia Mutation by Massively Parallel Sequencing Implicates Sulfite Oxidase (SUOX) in Bone Development

PubMed Central

Drögemüller, Cord; Tetens, Jens; Sigurdsson, Snaevar; Gentile, Arcangelo; Testoni, Stefania; Lindblad-Toh, Kerstin; Leeb, Tosso

2010-01-01

Arachnomelia is a monogenic recessive defect of skeletal development in cattle. The causative mutation was previously mapped to a ∼7 Mb interval on chromosome 5. Here we show that array-based sequence capture and massively parallel sequencing technology, combined with the typical family structure in livestock populations, facilitates the identification of the causative mutation. We re-sequenced the entire critical interval in a healthy partially inbred cow carrying one copy of the critical chromosome segment in its ancestral state and one copy of the same segment with the arachnomelia mutation, and we detected a single heterozygous position. The genetic makeup of several partially inbred cattle provides extremely strong support for the causality of this mutation. The mutation represents a single base insertion leading to a premature stop codon in the coding sequence of the SUOX gene and is perfectly associated with the arachnomelia phenotype. Our findings suggest an important role for sulfite oxidase in bone development. PMID:20865119

Use of wavelet-packet transforms to develop an engineering model for multifractal characterization of mutation dynamics in pathological and nonpathological gene sequences

NASA Astrophysics Data System (ADS)

Walker, David Lee

1999-12-01

This study uses dynamical analysis to examine in a quantitative fashion the information coding mechanism in DNA sequences. This exceeds the simple dichotomy of either modeling the mechanism by comparing DNA sequence walks as Fractal Brownian Motion (fbm) processes. The 2-D mappings of the DNA sequences for this research are from Iterated Function System (IFS) (Also known as the ``Chaos Game Representation'' (CGR)) mappings of the DNA sequences. This technique converts a 1-D sequence into a 2-D representation that preserves subsequence structure and provides a visual representation. The second step of this analysis involves the application of Wavelet Packet Transforms, a recently developed technique from the field of signal processing. A multi-fractal model is built by using wavelet transforms to estimate the Hurst exponent, H. The Hurst exponent is a non-parametric measurement of the dynamism of a system. This procedure is used to evaluate gene- coding events in the DNA sequence of cystic fibrosis mutations. The H exponent is calculated for various mutation sites in this gene. The results of this study indicate the presence of anti-persistent, random walks and persistent ``sub-periods'' in the sequence. This indicates the hypothesis of a multi-fractal model of DNA information encoding warrants further consideration. This work examines the model's behavior in both pathological (mutations) and non-pathological (healthy) base pair sequences of the cystic fibrosis gene. These mutations both natural and synthetic were introduced by computer manipulation of the original base pair text files. The results show that disease severity and system ``information dynamics'' correlate. These results have implications for genetic engineering as well as in mathematical biology. They suggest that there is scope for more multi-fractal models to be developed.

Single nucleotide primer extension to detect genetic diseases: Experimental application to hemophilia B (factor IX) and cystic fibrosis genes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kuppuswamy, M.N.; Hoffmann, J.W.; Spitzer, S.G.

1991-02-15

In this report, the authors describe an approach to detect the presence of abnormal alleles in those genetic diseases in which frequency of occurrence of the same mutation is high (e.g., hemophilia B). Initially, from each subject, the DNA fragment containing the putative mutation site is amplified by the polymerase chain reaction. For each fragment two reaction mixtures are then prepared. Each contains the amplified fragment, a primer (18-mer or longer) whose sequence is identical to the coding sequence of the normal gene immediately flanking the 5{prime} end of the mutation site, and either an {alpha}-{sup 32}P-labeled nucleotide corresponding tomore » the normal coding sequence at the mutation site or an {alpha}-{sup 32}P-labeled nucleotide corresponding to the mutant sequence. An essential feature of the present methodology is that the base immediately 3{prime} to the template-bound primer is one of those altered in the mutant, since in this way an extension of the primer by a single base will give an extended molecule characteristic of either the mutant or the wild type. The method is rapid and should be useful in carrier detection and prenatal diagnosis of every genetic disease with a known sequence variation.« less

Identification of significantly mutated regions across cancer types highlights a rich landscape of functional molecular alterations

PubMed Central

Araya, Carlos L.; Cenik, Can; Reuter, Jason A.; Kiss, Gert; Pande, Vijay S.; Snyder, Michael P.; Greenleaf, William J.

2015-01-01

Cancer sequencing studies have primarily identified cancer-driver genes by the accumulation of protein-altering mutations. An improved method would be annotation-independent, sensitive to unknown distributions of functions within proteins, and inclusive of non-coding drivers. We employed density-based clustering methods in 21 tumor types to detect variably-sized significantly mutated regions (SMRs). SMRs reveal recurrent alterations across a spectrum of coding and non-coding elements, including transcription factor binding sites and untranslated regions mutated in up to ∼15% of specific tumor types. SMRs reveal spatial clustering of mutations at molecular domains and interfaces, often with associated changes in signaling. Mutation frequencies in SMRs demonstrate that distinct protein regions are differentially mutated among tumor types, as exemplified by a linker region of PIK3CA in which biophysical simulations suggest mutations affect regulatory interactions. The functional diversity of SMRs underscores both the varied mechanisms of oncogenic misregulation and the advantage of functionally-agnostic driver identification. PMID:26691984

Deleterious ABCA7 mutations and transcript rescue mechanisms in early onset Alzheimer's disease.

PubMed

De Roeck, Arne; Van den Bossche, Tobi; van der Zee, Julie; Verheijen, Jan; De Coster, Wouter; Van Dongen, Jasper; Dillen, Lubina; Baradaran-Heravi, Yalda; Heeman, Bavo; Sanchez-Valle, Raquel; Lladó, Albert; Nacmias, Benedetta; Sorbi, Sandro; Gelpi, Ellen; Grau-Rivera, Oriol; Gómez-Tortosa, Estrella; Pastor, Pau; Ortega-Cubero, Sara; Pastor, Maria A; Graff, Caroline; Thonberg, Håkan; Benussi, Luisa; Ghidoni, Roberta; Binetti, Giuliano; de Mendonça, Alexandre; Martins, Madalena; Borroni, Barbara; Padovani, Alessandro; Almeida, Maria Rosário; Santana, Isabel; Diehl-Schmid, Janine; Alexopoulos, Panagiotis; Clarimon, Jordi; Lleó, Alberto; Fortea, Juan; Tsolaki, Magda; Koutroumani, Maria; Matěj, Radoslav; Rohan, Zdenek; De Deyn, Peter; Engelborghs, Sebastiaan; Cras, Patrick; Van Broeckhoven, Christine; Sleegers, Kristel

2017-09-01

Premature termination codon (PTC) mutations in the ATP-Binding Cassette, Sub-Family A, Member 7 gene (ABCA7) have recently been identified as intermediate-to-high penetrant risk factor for late-onset Alzheimer's disease (LOAD). High variability, however, is observed in downstream ABCA7 mRNA and protein expression, disease penetrance, and onset age, indicative of unknown modifying factors. Here, we investigated the prevalence and disease penetrance of ABCA7 PTC mutations in a large early onset AD (EOAD)-control cohort, and examined the effect on transcript level with comprehensive third-generation long-read sequencing. We characterized the ABCA7 coding sequence with next-generation sequencing in 928 EOAD patients and 980 matched control individuals. With MetaSKAT rare variant association analysis, we observed a fivefold enrichment (p = 0.0004) of PTC mutations in EOAD patients (3%) versus controls (0.6%). Ten novel PTC mutations were only observed in patients, and PTC mutation carriers in general had an increased familial AD load. In addition, we observed nominal risk reducing trends for three common coding variants. Seven PTC mutations were further analyzed using targeted long-read cDNA sequencing on an Oxford Nanopore MinION platform. PTC-containing transcripts for each investigated PTC mutation were observed at varying proportion (5-41% of the total read count), implying incomplete nonsense-mediated mRNA decay (NMD). Furthermore, we distinguished and phased several previously unknown alternative splicing events (up to 30% of transcripts). In conjunction with PTC mutations, several of these novel ABCA7 isoforms have the potential to rescue deleterious PTC effects. In conclusion, ABCA7 PTC mutations play a substantial role in EOAD, warranting genetic screening of ABCA7 in genetically unexplained patients. Long-read cDNA sequencing revealed both varying degrees of NMD and transcript-modifying events, which may influence ABCA7 dosage, disease severity, and may create opportunities for therapeutic interventions in AD.

Using information content and base frequencies to distinguish mutations from genetic polymorphisms in splice junction recognition sites.

PubMed

Rogan, P K; Schneider, T D

1995-01-01

Predicting the effects of nucleotide substitutions in human splice sites has been based on analysis of consensus sequences. We used a graphic representation of sequence conservation and base frequency, the sequence logo, to demonstrate that a change in a splice acceptor of hMSH2 (a gene associated with familial nonpolyposis colon cancer) probably does not reduce splicing efficiency. This confirms a population genetic study that suggested that this substitution is a genetic polymorphism. The information theory-based sequence logo is quantitative and more sensitive than the corresponding splice acceptor consensus sequence for detection of true mutations. Information analysis may potentially be used to distinguish polymorphisms from mutations in other types of transcriptional, translational, or protein-coding motifs.

Molecular genetics of cystinuria: Identification of four new mutations and seven polymorphisms, and evidence for genetic heterogeneity

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gasparini, P.; Bisceglia, L.; Notarangelo, A.

A cystinuria disease gene (rBAT) has been recently identified, and some mutations causing the disease have been described. The frequency of these mutations has been investigated in a large sample of 51 Italian and Spanish cystinuric patients. In addition, to identify new mutated alleles, genomic DNA has been analyzed by an accurate and sensitive method able to detect nucleotide changes. Because of the lack of information available on the genomic structure of rBAT gene, the study was carried out using the sequence data so far obtained by us. More than 70% of the entire coding sequence and 8 intron-exon boundariesmore » have been analyzed. Four new mutations and seven intragenic polymorphisms have been detected. All mutations so far identified in rBAT belong only to cystinuria type I alleles, accounting for {approximately} 44% of all type I cystinuric chromosomes. Mutation M467T is the most common mutated allele in the Italian and Spanish populations. After analysis of 70% of the rBAT coding region, we have detected normal sequences in cystinuria type II and type III chromosomes. The presence of rBAT mutated alleles only in type I chromosomes of homozygous (type I/I) and heterozygous (type I/III) patients provides evidence for genetic heterogeneity where rBAT would be responsible only for type I cystinuria and suggests a complementation mechanism to explain the intermediate type I/type III phenotype. 25 refs., 1 fig., 3 tabs.« less

Mutation Analysis in Classical Phenylketonuria Patients Followed by Detecting Haplotypes Linked to Some PAH Mutations.

PubMed

Dehghanian, Fatemeh; Silawi, Mohammad; Tabei, Seyed M B

2017-02-01

Deficiency of phenylalanine hydroxylase (PAH) enzyme and elevation of phenylalanine in body fluids cause phenylketonuria (PKU). The gold standard for confirming PKU and PAH deficiency is detecting causal mutations by direct sequencing of the coding exons and splicing involved sequences of the PAH gene. Furthermore, haplotype analysis could be considered as an auxiliary approach for detecting PKU causative mutations before direct sequencing of the PAH gene by making comparisons between prior detected mutation linked-haplotypes and new PKU case haplotypes with undetermined mutations. In this study, 13 unrelated classical PKU patients took part in the study detecting causative mutations. Mutations were identified by polymerase chain reaction (PCR) and direct sequencing in all patients. After that, haplotype analysis was performed by studying VNTR and PAHSTR markers (linked genetic markers of the PAH gene) through application of PCR and capillary electrophoresis (CE). Mutation analysis was performed successfully and the detected mutations were as follows: c.782G>A, c.754C>T, c.842C>G, c.113-115delTCT, c.688G>A, and c.696A>G. Additionally, PAHSTR/VNTR haplotypes were detected to discover haplotypes linked to each mutation. Mutation detection is the best approach for confirming PAH enzyme deficiency in PKU patients. Due to the relatively large size of the PAH gene and high cost of the direct sequencing in developing countries, haplotype analysis could be used before DNA sequencing and mutation detection for a faster and cheaper way via identifying probable mutated exons.

Genetic diagnosis of Duchenne and Becker muscular dystrophy using next-generation sequencing technology: comprehensive mutational search in a single platform.

PubMed

Lim, Byung Chan; Lee, Seungbok; Shin, Jong-Yeon; Kim, Jong-Il; Hwang, Hee; Kim, Ki Joong; Hwang, Yong Seung; Seo, Jeong-Sun; Chae, Jong Hee

2011-11-01

Duchenne muscular dystrophy or Becker muscular dystrophy might be a suitable candidate disease for application of next-generation sequencing in the genetic diagnosis because the complex mutational spectrum and the large size of the dystrophin gene require two or more analytical methods and have a high cost. The authors tested whether large deletions/duplications or small mutations, such as point mutations or short insertions/deletions of the dystrophin gene, could be predicted accurately in a single platform using next-generation sequencing technology. A custom solution-based target enrichment kit was designed to capture whole genomic regions of the dystrophin gene and other muscular-dystrophy-related genes. A multiplexing strategy, wherein four differently bar-coded samples were captured and sequenced together in a single lane of the Illumina Genome Analyser, was applied. The study subjects were 25 16 with deficient dystrophin expression without a large deletion/duplication and 9 with a known large deletion/duplication. Nearly 100% of the exonic region of the dystrophin gene was covered by at least eight reads with a mean read depth of 107. Pathogenic small mutations were identified in 15 of the 16 patients without a large deletion/duplication. Using these 16 patients as the standard, the authors' method accurately predicted the deleted or duplicated exons in the 9 patients with known mutations. Inclusion of non-coding regions and paired-end sequence analysis enabled accurate identification by increasing the read depth and providing information about the breakpoint junction. The current method has an advantage for the genetic diagnosis of Duchenne muscular dystrophy and Becker muscular dystrophy wherein a comprehensive mutational search may be feasible using a single platform.

Genome-Wide Linkage, Exome Sequencing and Functional Analyses Identify ABCB6 as the Pathogenic Gene of Dyschromatosis Universalis Hereditaria

PubMed Central

Wang, Na; Wang, Chuan; Chen, Xuechao; Sheng, Donglai; Fu, Xi’an; See, Kelvin; Foo, Jia Nee; Low, Huiqi; Liany, Herty; Irwan, Ishak Darryl; Liu, Jian; Yang, Baoqi; Chen, Mingfei; Yu, Yongxiang; Yu, Gongqi; Niu, Guiye; You, Jiabao; Zhou, Yan; Ma, Shanshan; Wang, Ting; Yan, Xiaoxiao; Goh, Boon Kee; Common, John E. A.; Lane, Birgitte E.; Sun, Yonghu; Zhou, Guizhi; Lu, Xianmei; Wang, Zhenhua; Tian, Hongqing; Cao, Yuanhua; Chen, Shumin; Liu, Qiji; Liu, Jianjun; Zhang, Furen

2014-01-01

Background As a genetic disorder of abnormal pigmentation, the molecular basis of dyschromatosis universalis hereditaria (DUH) had remained unclear until recently when ABCB6 was reported as a causative gene of DUH. Methodology We performed genome-wide linkage scan using Illumina Human 660W-Quad BeadChip and exome sequencing analyses using Agilent SureSelect Human All Exon Kits in a multiplex Chinese DUH family to identify the pathogenic mutations and verified the candidate mutations using Sanger sequencing. Quantitative RT-PCR and Immunohistochemistry was performed to verify the expression of the pathogenic gene, Zebrafish was also used to confirm the functional role of ABCB6 in melanocytes and pigmentation. Results Genome-wide linkage (assuming autosomal dominant inheritance mode) and exome sequencing analyses identified ABCB6 as the disease candidate gene by discovering a coding mutation (c.1358C>T; p.Ala453Val) that co-segregates with the disease phenotype. Further mutation analysis of ABCB6 in four other DUH families and two sporadic cases by Sanger sequencing confirmed the mutation (c.1358C>T; p.Ala453Val) and discovered a second, co-segregating coding mutation (c.964A>C; p.Ser322Lys) in one of the four families. Both mutations were heterozygous in DUH patients and not present in the 1000 Genome Project and dbSNP database as well as 1,516 unrelated Chinese healthy controls. Expression analysis in human skin and mutagenesis interrogation in zebrafish confirmed the functional role of ABCB6 in melanocytes and pigmentation. Given the involvement of ABCB6 mutations in coloboma, we performed ophthalmological examination of the DUH carriers of ABCB6 mutations and found ocular abnormalities in them. Conclusion Our study has advanced our understanding of DUH pathogenesis and revealed the shared pathological mechanism between pigmentary DUH and ocular coloboma. PMID:24498303

High-throughput sequencing of the entire genomic regions of CCM1/KRIT1, CCM2 and CCM3/PDCD10 to search for pathogenic deep-intronic splice mutations in cerebral cavernous malformations.

PubMed

Rath, Matthias; Jenssen, Sönke E; Schwefel, Konrad; Spiegler, Stefanie; Kleimeier, Dana; Sperling, Christian; Kaderali, Lars; Felbor, Ute

2017-09-01

Cerebral cavernous malformations (CCM) are vascular lesions of the central nervous system that can cause headaches, seizures and hemorrhagic stroke. Disease-associated mutations have been identified in three genes: CCM1/KRIT1, CCM2 and CCM3/PDCD10. The precise proportion of deep-intronic variants in these genes and their clinical relevance is yet unknown. Here, a long-range PCR (LR-PCR) approach for target enrichment of the entire genomic regions of the three genes was combined with next generation sequencing (NGS) to screen for coding and non-coding variants. NGS detected all six CCM1/KRIT1, two CCM2 and four CCM3/PDCD10 mutations that had previously been identified by Sanger sequencing. Two of the pathogenic variants presented here are novel. Additionally, 20 stringently selected CCM index cases that had remained mutation-negative after conventional sequencing and exclusion of copy number variations were screened for deep-intronic mutations. The combination of bioinformatics filtering and transcript analyses did not reveal any deep-intronic splice mutations in these cases. Our results demonstrate that target enrichment by LR-PCR combined with NGS can be used for a comprehensive analysis of the entire genomic regions of the CCM genes in a research context. However, its clinical utility is limited as deep-intronic splice mutations in CCM1/KRIT1, CCM2 and CCM3/PDCD10 seem to be rather rare. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

Myelin protein zero gene sequencing diagnoses Charcot-Marie-Tooth Type 1B disease

DOE Office of Scientific and Technical Information (OSTI.GOV)

Su, Y.; Zhang, H.; Madrid, R.

1994-09-01

Charcot-Marie-Tooth disease (CMT), the most common genetic neuropathy, affects about 1 in 2600 people in Norway and is found worldwide. CMT Type 1 (CMT1) has slow nerve conduction with demyelinated Schwann cells. Autosomal dominant CMT Type 1B (CMT1B) results from mutations in the myelin protein zero gene which directs the synthesis of more than half of all Schwann cell protein. This gene was mapped to the chromosome 1q22-1q23.1 borderline by fluorescence in situ hybridization. The first 7 of 7 reported CMT1B mutations are unique. Thus the most effective means to identify CMT1B mutations in at-risk family members and fetuses ismore » to sequence the entire coding sequence in dominant or sporadic CMT patients without the CMT1A duplication. Of the 19 primers used in 16 pars to uniquely amplify the entire MPZ coding sequence, 6 primer pairs were used to amplify and sequence the 6 exons. The DyeDeoxy Terminator cycle sequencing method used with four different color fluorescent lables was superior to manual sequencing because it sequences more bases unambiguously from extracted genomic DNA samples within 24 hours. This protocol was used to test 28 CMT and Dejerine-Sottas patients without CMT1A gene duplication. Sequencing MPZ gene-specific amplified fragments identified 9 polymorphic sites within the 6 exons that encode the 248 amino acid MPZ protein. The large number of major CMT1B mutations identified by single strand sequencing are being verified by reverse strand sequencing and when possible, by restriction enzyme analysis. This protocol can be used to distringuish CMT1B patients from othre CMT phenotypes and to determine the CMT1B status of relatives both presymptomatically and prenatally.« less

Compound heterozygous mutations in the SRD5A2 gene exon 4 in a male pseudohermaphrodite patient of Chinese origin.

PubMed

Fernández-Cancio, Mónica; Nistal, Manuel; Gracia, Ricardo; Molina, M Antonia; Tovar, Juan Antonio; Esteban, Cristina; Carrascosa, Antonio; Audí, Laura

2004-01-01

The goal of this study was to perform 5-alpha-reductase type 2 gene (SRD5A2) analysis in a male pseudohermaphrodite (MPH) patient with normal testosterone (T) production and normal androgen receptor (AR) gene coding sequences. A patient of Chinese origin with ambiguous genitalia at 14 months, a 46,XY karyotype, and normal T secretion under human chorionic gonadotropin (hCG) stimulation underwent a gonadectomy at 20 months. Exons 1-8 of the AR gene and exons 1-5 of the SRD5A2 gene were sequenced from peripheral blood DNA. AR gene coding sequences were normal. SRD5A2 gene analysis revealed 2 consecutive mutations in exon 4, each located in a different allele: 1) a T nucleotide deletion, which predicts a frameshift mutation from codon 219, and 2) a missense mutation at codon 227, where the substitution of guanine (CGA) by adenine (CAA) predicts a glutamine replacement of arginine (R227Q). Testes located in the inguinal canal showed a normal morphology for age. The patient was a compound heterozygote for SRD5A2 mutations, carrying 2 mutations in exon 4. The patient showed an R227Q mutation that has been described in an Asian population and MPH patients, along with a novel frameshift mutation, Tdel219. Testis morphology showed that, during early infancy, the 5-alpha-reductase enzyme deficiency may not have affected interstitial or tubular development.

CHEK2 contribution to hereditary breast cancer in non-BRCA families.

PubMed

Desrichard, Alexis; Bidet, Yannick; Uhrhammer, Nancy; Bignon, Yves-Jean

2011-01-01

Mutations in the BRCA1 and BRCA2 genes are responsible for only a part of hereditary breast cancer (HBC). The origins of "non-BRCA" HBC in families may be attributed in part to rare mutations in genes conferring moderate risk, such as CHEK2, which encodes for an upstream regulator of BRCA1. Previous studies have demonstrated an association between CHEK2 founder mutations and non-BRCA HBC. However, very few data on the entire coding sequence of this gene are available. We investigated the contribution of CHEK2 mutations to non-BRCA HBC by direct sequencing of its whole coding sequence in 507 non-BRCA HBC cases and 513 controls. We observed 16 mutations in cases and 4 in controls, including 9 missense variants of uncertain consequence. Using both in silico tools and an in vitro kinase activity test, the majority of the variants were found likely to be deleterious for protein function. One variant present in both cases and controls was proposed to be neutral. Removing this variant from the pool of potentially deleterious variants gave a mutation frequency of 1.48% for cases and 0.29% for controls (P = 0.0040). The odds ratio of breast cancer in the presence of a deleterious CHEK2 mutation was 5.18. Our work indicates that a variety of deleterious CHEK2 alleles make an appreciable contribution to breast cancer susceptibility, and their identification could help in the clinical management of patients carrying a CHEK2 mutation.

Emerging patterns of somatic mutations in cancer

PubMed Central

Watson, Ian R.; Takahashi, Koichi; Futreal, P. Andrew; Chin, Lynda

2014-01-01

The advance in technological tools for massively parallel, high-throughput sequencing of DNA has enabled the comprehensive characterization of somatic mutations in large number of tumor samples. Here, we review recent cancer genomic studies that have assembled emerging views of the landscapes of somatic mutations through deep sequencing analyses of the coding exomes and whole genomes in various cancer types. We discuss the comparative genomics of different cancers, including mutation rates, spectrums, and roles of environmental insults that influence these processes. We highlight the developing statistical approaches used to identify significantly mutated genes, and discuss the emerging biological and clinical insights from such analyses as well as the challenges ahead translating these genomic data into clinical impacts. PMID:24022702

Reduced TCOF1 mRNA level in a rhesus macaque with Treacher Collins-like syndrome: further evidence for haploinsufficiency of treacle as the cause of disease.

PubMed

Shows, Kathryn H; Ward, Christy; Summers, Laura; Li, Lin; Ziegler, Gregory R; Hendrickx, Andrew G; Shiang, Rita

2006-02-01

Mutations in the human gene TCOF1 cause a mandibulofacial dysostosis known as Treacher Collins syndrome (TCS). An infant rhesus macaque (Macaca mulatta) that displayed the TCS phenotype was identified at the California National Primate Research Center. The TCOF1 coding region was cloned from a normal rhesus macaque and sequenced. The rhesus macaque homolog of TCOF1 is 91.6% identical in cDNA sequence and 93.8% identical in translated protein sequence compared to human TCOF1. Sequencing of TCOF1 in the TCS-affected rhesus macaque showed no mutations within the coding region or splice sites; however, real-time quantitative PCR showed an 87% reduction of spleen TCOF1 mRNA level in the TCS affected macaque when compared with normal macaque spleen.

Nucleotide sequencing analysis of a LEU gene of Candida maltosa which complements leuB mutation of Escherichia coli and leu2 mutation of Saccharomyces cerevisiae.

PubMed

Takagi, M; Kobayashi, N; Sugimoto, M; Fujii, T; Watari, J; Yano, K

1987-01-01

The expression of a LEU gene from Candida maltosa (designated as C-LEU2) isolated previously (Kawamura et al. 1983) was shown to be regulated, when transferred into Saccharomyces cerevisiae, by leucine and threonine in the medium, as in the case of LEU2 gene of S. cerevisiae. The coding region together with the regulatory region was subcloned and the nucleotide sequence was determined. When the sequence of the coding region was compared with that of LEU2, the homology was 72% for base pairs and 76% for deduced amino acids. Comparison of the regulatory region of C-LEU2 with those of LEU1 and LEU2 suggested a few short consensus sequences which are involved in regulation of gene expression by leucine and threonine in the medium.

Non-codingRNA sequence variations in human chronic lymphocytic leukemia and colorectal cancer.

PubMed

Wojcik, Sylwia E; Rossi, Simona; Shimizu, Masayoshi; Nicoloso, Milena S; Cimmino, Amelia; Alder, Hansjuerg; Herlea, Vlad; Rassenti, Laura Z; Rai, Kanti R; Kipps, Thomas J; Keating, Michael J; Croce, Carlo M; Calin, George A

2010-02-01

Cancer is a genetic disease in which the interplay between alterations in protein-coding genes and non-coding RNAs (ncRNAs) plays a fundamental role. In recent years, the full coding component of the human genome was sequenced in various cancers, whereas such attempts related to ncRNAs are still fragmentary. We screened genomic DNAs for sequence variations in 148 microRNAs (miRNAs) and ultraconserved regions (UCRs) loci in patients with chronic lymphocytic leukemia (CLL) or colorectal cancer (CRC) by Sanger technique and further tried to elucidate the functional consequences of some of these variations. We found sequence variations in miRNAs in both sporadic and familial CLL cases, mutations of UCRs in CLLs and CRCs and, in certain instances, detected functional effects of these variations. Furthermore, by integrating our data with previously published data on miRNA sequence variations, we have created a catalog of DNA sequence variations in miRNAs/ultraconserved genes in human cancers. These findings argue that ncRNAs are targeted by both germ line and somatic mutations as well as by single-nucleotide polymorphisms with functional significance for human tumorigenesis. Sequence variations in ncRNA loci are frequent and some have functional and biological significance. Such information can be exploited to further investigate on a genome-wide scale the frequency of genetic variations in ncRNAs and their functional meaning, as well as for the development of new diagnostic and prognostic markers for leukemias and carcinomas.

Non-codingRNA sequence variations in human chronic lymphocytic leukemia and colorectal cancer

PubMed Central

Wojcik, Sylwia E.; Rossi, Simona; Shimizu, Masayoshi; Nicoloso, Milena S.; Cimmino, Amelia; Alder, Hansjuerg; Herlea, Vlad; Rassenti, Laura Z.; Rai, Kanti R.; Kipps, Thomas J.; Keating, Michael J.

2010-01-01

Cancer is a genetic disease in which the interplay between alterations in protein-coding genes and non-coding RNAs (ncRNAs) plays a fundamental role. In recent years, the full coding component of the human genome was sequenced in various cancers, whereas such attempts related to ncRNAs are still fragmentary. We screened genomic DNAs for sequence variations in 148 microRNAs (miRNAs) and ultraconserved regions (UCRs) loci in patients with chronic lymphocytic leukemia (CLL) or colorectal cancer (CRC) by Sanger technique and further tried to elucidate the functional consequences of some of these variations. We found sequence variations in miRNAs in both sporadic and familial CLL cases, mutations of UCRs in CLLs and CRCs and, in certain instances, detected functional effects of these variations. Furthermore, by integrating our data with previously published data on miRNA sequence variations, we have created a catalog of DNA sequence variations in miRNAs/ultraconserved genes in human cancers. These findings argue that ncRNAs are targeted by both germ line and somatic mutations as well as by single-nucleotide polymorphisms with functional significance for human tumorigenesis. Sequence variations in ncRNA loci are frequent and some have functional and biological significance. Such information can be exploited to further investigate on a genome-wide scale the frequency of genetic variations in ncRNAs and their functional meaning, as well as for the development of new diagnostic and prognostic markers for leukemias and carcinomas. PMID:19926640

Analysis of protein-coding genetic variation in 60,706 humans.

PubMed

Lek, Monkol; Karczewski, Konrad J; Minikel, Eric V; Samocha, Kaitlin E; Banks, Eric; Fennell, Timothy; O'Donnell-Luria, Anne H; Ware, James S; Hill, Andrew J; Cummings, Beryl B; Tukiainen, Taru; Birnbaum, Daniel P; Kosmicki, Jack A; Duncan, Laramie E; Estrada, Karol; Zhao, Fengmei; Zou, James; Pierce-Hoffman, Emma; Berghout, Joanne; Cooper, David N; Deflaux, Nicole; DePristo, Mark; Do, Ron; Flannick, Jason; Fromer, Menachem; Gauthier, Laura; Goldstein, Jackie; Gupta, Namrata; Howrigan, Daniel; Kiezun, Adam; Kurki, Mitja I; Moonshine, Ami Levy; Natarajan, Pradeep; Orozco, Lorena; Peloso, Gina M; Poplin, Ryan; Rivas, Manuel A; Ruano-Rubio, Valentin; Rose, Samuel A; Ruderfer, Douglas M; Shakir, Khalid; Stenson, Peter D; Stevens, Christine; Thomas, Brett P; Tiao, Grace; Tusie-Luna, Maria T; Weisburd, Ben; Won, Hong-Hee; Yu, Dongmei; Altshuler, David M; Ardissino, Diego; Boehnke, Michael; Danesh, John; Donnelly, Stacey; Elosua, Roberto; Florez, Jose C; Gabriel, Stacey B; Getz, Gad; Glatt, Stephen J; Hultman, Christina M; Kathiresan, Sekar; Laakso, Markku; McCarroll, Steven; McCarthy, Mark I; McGovern, Dermot; McPherson, Ruth; Neale, Benjamin M; Palotie, Aarno; Purcell, Shaun M; Saleheen, Danish; Scharf, Jeremiah M; Sklar, Pamela; Sullivan, Patrick F; Tuomilehto, Jaakko; Tsuang, Ming T; Watkins, Hugh C; Wilson, James G; Daly, Mark J; MacArthur, Daniel G

2016-08-18

Large-scale reference data sets of human genetic variation are critical for the medical and functional interpretation of DNA sequence changes. Here we describe the aggregation and analysis of high-quality exome (protein-coding region) DNA sequence data for 60,706 individuals of diverse ancestries generated as part of the Exome Aggregation Consortium (ExAC). This catalogue of human genetic diversity contains an average of one variant every eight bases of the exome, and provides direct evidence for the presence of widespread mutational recurrence. We have used this catalogue to calculate objective metrics of pathogenicity for sequence variants, and to identify genes subject to strong selection against various classes of mutation; identifying 3,230 genes with near-complete depletion of predicted protein-truncating variants, with 72% of these genes having no currently established human disease phenotype. Finally, we demonstrate that these data can be used for the efficient filtering of candidate disease-causing variants, and for the discovery of human 'knockout' variants in protein-coding genes.

Clinical features of X linked juvenile retinoschisis associated with new mutations in the XLRS1 gene in Italian families.

PubMed

Simonelli, F; Cennamo, G; Ziviello, C; Testa, F; de Crecchio, G; Nesti, A; Manitto, M P; Ciccodicola, A; Banfi, S; Brancato, R; Rinaldi, E

2003-09-01

To describe the clinical phenotype of X linked juvenile retinoschisis in eight Italian families with six different mutations in the XLRS1 gene. Complete ophthalmic examinations, electroretinography and A and B-scan standardised echography were performed in 18 affected males. The coding sequences of the XLRS1 gene were amplified by polymerase chain reaction and directly sequenced on an automated sequencer. Six different XLRS1 mutations were identified; two of these mutations Ile81Asn and the Trp122Cys, have not been previously described. The affected males showed an electronegative response to the standard white scotopic stimulus and a prolonged implicit time of the 30 Hz flicker. In the families with Trp112Cys and Trp122Cys mutations we observed a more severe retinoschisis (RS) clinical picture compared with the other genotypes. The severe RS phenotypes associated with Trp112Cys and to Trp122Cys mutations suggest that these mutations determine a notable alteration in the function of the retinoschisin protein.

mRNA-based detection of rare CFTR mutations improves genetic diagnosis of cystic fibrosis in populations with high genetic heterogeneity.

PubMed

Felício, V; Ramalho, A S; Igreja, S; Amaral, M D

2017-03-01

Even with advent of next generation sequencing complete sequencing of large disease-associated genes and intronic regions is economically not feasible. This is the case of cystic fibrosis transmembrane conductance regulator (CFTR), the gene responsible for cystic fibrosis (CF). Yet, to confirm a CF diagnosis, proof of CFTR dysfunction needs to be obtained, namely by the identification of two disease-causing mutations. Moreover, with the advent of mutation-based therapies, genotyping is an essential tool for CF disease management. There is, however, still an unmet need to genotype CF patients by fast, comprehensive and cost-effective approaches, especially in populations with high genetic heterogeneity (and low p.F508del incidence), where CF is now emerging with new diagnosis dilemmas (Brazil, Asia, etc). Herein, we report an innovative mRNA-based approach to identify CFTR mutations in the complete coding and intronic regions. We applied this protocol to genotype individuals with a suspicion of CF and only one or no CFTR mutations identified by routine methods. It successfully detected multiple intronic mutations unlikely to be detected by CFTR exon sequencing. We conclude that this is a rapid, robust and inexpensive method to detect any CFTR coding/intronic mutation (including rare ones) that can be easily used either as primary approach or after routine DNA analysis. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Development of positive control materials for DNA-based detection of cystic fibrosis: Cloning and sequencing of 31 mutations

DOE Office of Scientific and Technical Information (OSTI.GOV)

Iovannisci, D.; Brown, C.; Winn-Deen, E.

1994-09-01

The cloning and sequencing of the gene associated with cystic fibrosis (CF) now provides the opportunity for earlier detection and carrier screening through DNA-based detection schemes. To date, over 300 mutations have been reported to the CF Consortium; however, only 30 mutations have been observed frequently enough world-wide to warrant routine screening. Many of these mutations are not available as cloned material or as established tissue culture cell lines to aid in the development of DNA-based detection assays. We have therefore cloned the 30 most frequently reported mutations, plus the mutation R347H due to its association with male infertility (31more » mutations, total). Two approaches were employed: direct PCR amplification, where mutations were available from patient sources, and site-directed PCR mutagenesis of normal genomic DNA to generate the remaining mutations. After amplification, products were cloned into a sequencing vector, bacterial transformants were screened by a novel method (PCR/oligonucleotide litigation assay/sequence-coded separation), and plamid DNA sequences determined by automated fluorescent methods on the Applied Biosystems 373A. Mixing of the clones allows the construction of artificial genotypes useful as positive control material for assay validation. A second round of mutagenesis, resulting in the construction of plasmids bearing multiple mutations, will be evaluated for their utility as reagent control materials in kit development.« less

Somatic frameshift mutations in the Bloom syndrome BLM gene are frequent in sporadic gastric carcinomas with microsatellite mutator phenotype

PubMed Central

Calin, George; Ranzani, Guglielmina N; Amadori, Dino; Herlea, Vlad; Matei, Irina; Barbanti-Brodano, Giuseppe; Negrini, Massimo

2001-01-01

Background Genomic instability has been reported at microsatellite tracts in few coding sequences. We have shown that the Bloom syndrome BLM gene may be a target of microsatelliteinstability (MSI) in a short poly-adenine repeat located in its coding region. To further characterize the involvement of BLM in tumorigenesis, we have investigated mutations in nine genes containing coding microsatellites in microsatellite mutator phenotype (MMP) positive and negative gastric carcinomas (GCs). Methods We analyzed 50 gastric carcinomas (GCs) for mutations in the BLM poly(A) tract aswell as in the coding microsatellites of the TGFβ1-RII, IGFIIR, hMSH3, hMSH6, BAX, WRN, RECQL and CBL genes. Results BLM mutations were found in 27% of MMP+ GCs (4/15 cases) but not in any of the MMP negative GCs (0/35 cases). The frequency of mutations in the other eight coding regions microsatellite was the following: TGFβ1-RII (60 %), BAX (27%), hMSH6 (20%),hMSH3 (13%), CBL (13%), IGFIIR (7%), RECQL (0%) and WRN (0%). Mutations in BLM appear to be more frequently associated with frameshifts in BAX and in hMSH6and/or hMSH3. Tumors with BLM alterations present a higher frequency of unstable mono- and trinucleotide repeats located in coding regions as compared with mutator phenotype tumors without BLM frameshifts. Conclusions BLM frameshifts are frequent alterations in GCs specifically associated with MMP+tumors. We suggest that BLM loss of function by MSI may increase the genetic instability of a pre-existent unstable genotype in gastric tumors. PMID:11532193

Combined sequence and sequence-structure-based methods for analyzing RAAS gene SNPs: a computational approach.

PubMed

Singh, Kh Dhanachandra; Karthikeyan, Muthusamy

2014-12-01

The renin-angiotensin-aldosterone system (RAAS) plays a key role in the regulation of blood pressure (BP). Mutations on the genes that encode components of the RAAS have played a significant role in genetic susceptibility to hypertension and have been intensively scrutinized. The identification of such probably causal mutations not only provides insight into the RAAS but may also serve as antihypertensive therapeutic targets and diagnostic markers. The methods for analyzing the SNPs from the huge dataset of SNPs, containing both functional and neutral SNPs is challenging by the experimental approach on every SNPs to determine their biological significance. To explore the functional significance of genetic mutation (SNPs), we adopted combined sequence and sequence-structure-based SNP analysis algorithm. Out of 3864 SNPs reported in dbSNP, we found 108 missense SNPs in the coding region and remaining in the non-coding region. In this study, we are reporting only those SNPs in coding region to be deleterious when three or more tools are predicted to be deleterious and which have high RMSD from the native structure. Based on these analyses, we have identified two SNPs of REN gene, eight SNPs of AGT gene, three SNPs of ACE gene, two SNPs of AT1R gene, three SNPs of CYP11B2 gene and three SNPs of CMA1 gene in the coding region were found to be deleterious. Further this type of study will be helpful in reducing the cost and time for identification of potential SNP and also helpful in selecting potential SNP for experimental study out of SNP pool.

Novel ANKH Amino Terminus Mutation (Pro5Ser) Associated With Early-Onset Calcium Pyrophosphate Disease With Associated Phosphaturia

PubMed Central

Gruber, Barry L.; Couto, Ana Rita; Armas, Jácome Bruges; Brown, Matthew A.; Finzel, Kathleen; Terkeltaub, Robert A.

2015-01-01

This report describes a 32-year-old woman presenting since childhood with progressive calcium pyrophosphate disease (CPPD), characterized by severe arthropathy and chondrocalcinosis involving multiple peripheral joints and intervertebral disks. Because ANKH mutations have been previously described in familial CPPD, the proband’s DNA was assessed at this locus by direct sequencing of promoter and coding regions and revealed 3 sequence variants in ANKH. Sequences of exon 1 revealed a novel isolated nonsynonymous mutation (c.13 C>T), altering amino acid in codon 5 from proline to serine (CCG>TCG). Sequencing of parental DNA revealed an identical mutation in the proband’s father but not the mother. Subsequent clinical evaluation demonstrated extensive chondrocalcinosis and degenerative arthropathy in the proband’s father. In summary, we report a novel mutation, not previously described, in ANKH exon 1, wherein serine replaces proline, in a case of early-onset severe CPPD associated with metabolic abnormalities, with similar findings in the proband’s father. PMID:22647861

Novel ANKH amino terminus mutation (Pro5Ser) associated with early-onset calcium pyrophosphate disease with associated phosphaturia.

PubMed

Gruber, Barry L; Couto, Ana Rita; Armas, Jácome Bruges; Brown, Matthew A; Finzel, Kathleen; Terkeltaub, Robert A

2012-06-01

This report describes a 32-year-old woman presenting since childhood with progressive calcium pyrophosphate disease (CPPD), characterized by severe arthropathy and chondrocalcinosis involving multiple peripheral joints and intervertebral disks. Because ANKH mutations have been previously described in familial CPPD, the proband's DNA was assessed at this locus by direct sequencing of promoter and coding regions and revealed 3 sequence variants in ANKH. Sequences of exon 1 revealed a novel isolated nonsynonymous mutation (c.13 C>T), altering amino acid in codon 5 from proline to serine (CCG>TCG). Sequencing of parental DNA revealed an identical mutation in the proband's father but not the mother. Subsequent clinical evaluation demonstrated extensive chondrocalcinosis and degenerative arthropathy in the proband's father. In summary, we report a novel mutation, not previously described, in ANKH exon 1, wherein serine replaces proline, in a case of early-onset severe CPPD associated with metabolic abnormalities, with similar findings in the proband's father.

Human pluripotent stem cells recurrently acquire and expand dominant negative P53 mutations

PubMed Central

Kamitaki, Nolan; Mitchell, Jana; Avior, Yishai; Mello, Curtis; Kashin, Seva; Mekhoubad, Shila; Ilic, Dusko; Charlton, Maura; Saphier, Genevieve; Handsaker, Robert E.; Genovese, Giulio; Bar, Shiran; Benvenisty, Nissim; McCarroll, Steven A.; Eggan, Kevin

2017-01-01

Human pluripotent stem cells (hPSCs) can self-renew indefinitely, making them an attractive source for regenerative therapies. This expansion potential has been linked with acquisition of large copy number variants (CNVs) that provide mutant cells with a growth advantage in culture1–3. However, the nature, extent, and functional impact of other acquired genome sequence mutations in cultured hPSCs is not known. Here, we sequenced the protein-coding genes (exomes) of 140 independent human embryonic stem cell (hESC) lines, including 26 lines prepared for potential clinical use4. We then applied computational strategies for identifying mutations present in a subset of cells5. Though such mosaic mutations were generally rare, we identified five unrelated hESC lines that carried six mutations in the TP53 gene that encodes the tumor suppressor P53. Notably, the TP53 mutations we observed are dominant negative and are the mutations most commonly seen in human cancers. We used droplet digital PCR to demonstrate that the TP53 mutant allelic fraction increased with passage number under standard culture conditions, suggesting that P53 mutation confers selective advantage. When we then mined published RNA sequencing data from 117 hPSC lines, we observed another nine TP53 mutations, all resulting in coding changes in the DNA binding domain of P53. Strikingly, in three lines, the allelic fraction exceeded 50%, suggesting additional selective advantage resulting from loss of heterozygosity at the TP53 locus. As the acquisition and favored expansion of cancer-associated mutations in hPSCs may go unnoticed during most applications, we suggest that careful genetic characterization of hPSCs and their differentiated derivatives should be carried out prior to clinical use. PMID:28445466

Kangaroo – A pattern-matching program for biological sequences

PubMed Central

2002-01-01

Background Biologists are often interested in performing a simple database search to identify proteins or genes that contain a well-defined sequence pattern. Many databases do not provide straightforward or readily available query tools to perform simple searches, such as identifying transcription binding sites, protein motifs, or repetitive DNA sequences. However, in many cases simple pattern-matching searches can reveal a wealth of information. We present in this paper a regular expression pattern-matching tool that was used to identify short repetitive DNA sequences in human coding regions for the purpose of identifying potential mutation sites in mismatch repair deficient cells. Results Kangaroo is a web-based regular expression pattern-matching program that can search for patterns in DNA, protein, or coding region sequences in ten different organisms. The program is implemented to facilitate a wide range of queries with no restriction on the length or complexity of the query expression. The program is accessible on the web at http://bioinfo.mshri.on.ca/kangaroo/ and the source code is freely distributed at http://sourceforge.net/projects/slritools/. Conclusion A low-level simple pattern-matching application can prove to be a useful tool in many research settings. For example, Kangaroo was used to identify potential genetic targets in a human colorectal cancer variant that is characterized by a high frequency of mutations in coding regions containing mononucleotide repeats. PMID:12150718

Novel mutation of GATA4 gene in Kurdish population of Iran with nonsyndromic congenital heart septals defects.

PubMed

Soheili, Fariborz; Jalili, Zahra; Rahbar, Mahtab; Khatooni, Zahed; Mashayekhi, Amir; Jafari, Hossein

2018-03-01

The mutations in GATA4 gene induce inherited atrial and ventricular septation defects, which is the most frequent forms of congenital heart defects (CHDs) constituting about half of all cases. We have performed High resolution melting (HRM) mutation scanning of GATA4 coding exons of nonsyndrome 100 patients as a case group including 39 atrial septal defects (ASD), 57 ventricular septal defects (VSD) and four patients with both above defects and 50 healthy individuals as a control group. Our samples are categorized according to their HRM graph. The genome sequencing has been done for 15 control samples and 25 samples of patients whose HRM analysis were similar to healthy subjects for each exon. The PolyPhen-2 and MUpro have been used to determine the causative possibility and structural stability prediction of GATA4 sequence variation. The HRM curve analysis exhibit that 21 patients and 3 normal samples have deviated curves for GATA4 coding exons. Sequencing analysis has revealed 12 nonsynonymous mutations while all of them resulted in stability structure of protein 10 of them are pathogenic and 2 of them are benign. Also we found two nucleotide deletions which one of them was novel and one new indel mutation resulting in frame shift mutation, and 4 synonymous variations or polymorphism in 6 of patients and 3 of normal individuals. Six or about 50% of these nonsynonymous mutations have not been previously reported. Our results show that there is a spectrum of GATA4 mutations resulting in septal defects. © 2018 Wiley Periodicals, Inc.

Identification of the structural mutation responsible for the dibucaine-resistant (atypical) variant form of human serum cholinesterase.

PubMed Central

McGuire, M C; Nogueira, C P; Bartels, C F; Lightstone, H; Hajra, A; Van der Spek, A F; Lockridge, O; La Du, B N

1989-01-01

A point mutation in the gene for human serum cholinesterase was identified that changes Asp-70 to Gly in the atypical form of serum cholinesterase. The mutation in nucleotide 209, which changes codon 70 from GAT to GGT, was found by sequencing a genomic clone and sequencing selected regions of DNA amplified by the polymerase chain reaction. The entire coding sequences for usual and atypical cholinesterases were compared, and no other consistent base differences were found. A polymorphic site near the C terminus of the coded region was detected, but neither allele at this locus segregated consistently with the atypical trait. The nucleotide-209 mutation was detected in all five atypical cholinesterase families examined. There was complete concordance between this mutation and serum cholinesterase phenotypes for all 14 heterozygous and 6 homozygous atypical subjects tested. The mutation causes the loss of a Sau3A1 restriction site; the resulting DNA fragment length polymorphism was verified by electrophoresis of 32P-labeled DNA restriction fragments from usual and atypical subjects. Dot-blot hybridization analysis with a 19-mer allele-specific probe to the DNA amplified by the polymerase chain reaction distinguished between the usual and atypical genotypes. We conclude that the Asp-70----Gly mutation (acidic to neutral amino acid substitution) accounts for reduced affinity of atypical cholinesterase for choline esters and that Asp-70 must be an important component of the anionic site. Heterogeneity in atypical alleles may exist, but the Asp-70 point mutation may represent an appreciable portion of the atypical gene pool. Images PMID:2915989

CHEK2 contribution to hereditary breast cancer in non-BRCA families

PubMed Central

2011-01-01

Background Mutations in the BRCA1 and BRCA2 genes are responsible for only a part of hereditary breast cancer (HBC). The origins of "non-BRCA" HBC in families may be attributed in part to rare mutations in genes conferring moderate risk, such as CHEK2, which encodes for an upstream regulator of BRCA1. Previous studies have demonstrated an association between CHEK2 founder mutations and non-BRCA HBC. However, very few data on the entire coding sequence of this gene are available. Methods We investigated the contribution of CHEK2 mutations to non-BRCA HBC by direct sequencing of its whole coding sequence in 507 non-BRCA HBC cases and 513 controls. Results We observed 16 mutations in cases and 4 in controls, including 9 missense variants of uncertain consequence. Using both in silico tools and an in vitro kinase activity test, the majority of the variants were found likely to be deleterious for protein function. One variant present in both cases and controls was proposed to be neutral. Removing this variant from the pool of potentially deleterious variants gave a mutation frequency of 1.48% for cases and 0.29% for controls (P = 0.0040). The odds ratio of breast cancer in the presence of a deleterious CHEK2 mutation was 5.18. Conclusions Our work indicates that a variety of deleterious CHEK2 alleles make an appreciable contribution to breast cancer susceptibility, and their identification could help in the clinical management of patients carrying a CHEK2 mutation. PMID:22114986

Pan-cancer transcriptomic analysis associates long non-coding RNAs with key mutational driver events

PubMed Central

Ashouri, Arghavan; Sayin, Volkan I.; Van den Eynden, Jimmy; Singh, Simranjit X.; Papagiannakopoulos, Thales; Larsson, Erik

2016-01-01

Thousands of long non-coding RNAs (lncRNAs) lie interspersed with coding genes across the genome, and a small subset has been implicated as downstream effectors in oncogenic pathways. Here we make use of transcriptome and exome sequencing data from thousands of tumours across 19 cancer types, to identify lncRNAs that are induced or repressed in relation to somatic mutations in key oncogenic driver genes. Our screen confirms known coding and non-coding effectors and also associates many new lncRNAs to relevant pathways. The associations are often highly reproducible across cancer types, and while many lncRNAs are co-expressed with their protein-coding hosts or neighbours, some are intergenic and independent. We highlight lncRNAs with possible functions downstream of the tumour suppressor TP53 and the master antioxidant transcription factor NFE2L2. Our study provides a comprehensive overview of lncRNA transcriptional alterations in relation to key driver mutational events in human cancers. PMID:28959951

Cis-regulatory somatic mutations and gene-expression alteration in B-cell lymphomas.

PubMed

Mathelier, Anthony; Lefebvre, Calvin; Zhang, Allen W; Arenillas, David J; Ding, Jiarui; Wasserman, Wyeth W; Shah, Sohrab P

2015-04-23

With the rapid increase of whole-genome sequencing of human cancers, an important opportunity to analyze and characterize somatic mutations lying within cis-regulatory regions has emerged. A focus on protein-coding regions to identify nonsense or missense mutations disruptive to protein structure and/or function has led to important insights; however, the impact on gene expression of mutations lying within cis-regulatory regions remains under-explored. We analyzed somatic mutations from 84 matched tumor-normal whole genomes from B-cell lymphomas with accompanying gene expression measurements to elucidate the extent to which these cancers are disrupted by cis-regulatory mutations. We characterize mutations overlapping a high quality set of well-annotated transcription factor binding sites (TFBSs), covering a similar portion of the genome as protein-coding exons. Our results indicate that cis-regulatory mutations overlapping predicted TFBSs are enriched in promoter regions of genes involved in apoptosis or growth/proliferation. By integrating gene expression data with mutation data, our computational approach culminates with identification of cis-regulatory mutations most likely to participate in dysregulation of the gene expression program. The impact can be measured along with protein-coding mutations to highlight key mutations disrupting gene expression and pathways in cancer. Our study yields specific genes with disrupted expression triggered by genomic mutations in either the coding or the regulatory space. It implies that mutated regulatory components of the genome contribute substantially to cancer pathways. Our analyses demonstrate that identifying genomically altered cis-regulatory elements coupled with analysis of gene expression data will augment biological interpretation of mutational landscapes of cancers.

Novel folliculin (FLCN) mutation and familial spontaneous pneumothorax.

PubMed

Zhu, J-F; Shen, X-Q; Zhu, F; Tian, L

2017-01-01

Familial spontaneous pneumothorax is one of the characteristics of Birt-Hogg-Dubé syndrome (BHDS), which is an autosomal dominant disease caused by the mutation of folliculin (FLCN). To investigate the mutation of FLCN gene in a familial spontaneous pneumothorax. Prospective case study. Clinical and genetic data of a Chinese family with four patients who presented spontaneous pneumothorax in the absence of skin lesions or renal tumors were collected. CT scan of patient's lung was applied for observation of pneumothorax. DNA sequencing of the coding exons (4-14 exons) of FLCN was performed for all 11 members of the family and 100 unrelated healthy controls. CT scan of patient's lung showed spontaneous pneumothorax. A mutation (c. 510C > G) that leads to a premature stop codon (p. Y170X) was found in the proband using DNA sequencing of coding exons (4-14 exons) of FLCN. This mutation was also observed in the other affected members of the family. A nonsense mutation of FLCN was found in a spontaneous pneumothorax family. Our results expand the mutational spectrum of FLCN in patients with BHDS. © The Author 2016. Published by Oxford University Press on behalf of the Association of Physicians. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Detection of mitochondrial DNA mutations in primary breast cancer and fine-needle aspirates.

PubMed

Parrella, P; Xiao, Y; Fliss, M; Sanchez-Cespedes, M; Mazzarelli, P; Rinaldi, M; Nicol, T; Gabrielson, E; Cuomo, C; Cohen, D; Pandit, S; Spencer, M; Rabitti, C; Fazio, V M; Sidransky, D

2001-10-15

To determine the frequency and distribution of mitochondrial DNA mutations in breast cancer, 18 primary breast tumors were analyzed by direct sequencing. Twelve somatic mutations not present in matched lymphocytes and normal breast tissues were detected in 11 of the tumors screened (61%). Of these mutations, five (42%) were deletions or insertions in a homopolymeric C-stretch between nucleotides 303-315 (D310) within the D-loop. The remaining seven mutations (58%) were single-base substitutions in the coding (ND1, ND4, ND5, and cytochrome b genes) or noncoding regions (D-loop) of the mitochondrial genome. In three cases (25%), the mutations detected in coding regions led to amino acid substitutions in the protein sequence. We then screened an additional 46 primary breast tumors with a rapid PCR-based assay to identify poly-C alterations in D310, and we found seven more cancers with alterations. Using D310 mutations as clonal marker, we detected identical changes in five of five matched fine-needle aspirates and in four of four metastases-positive lymph nodes. The high frequency of D310 alterations in primary breast cancer combined with the high sensitivity of the PCR-based assays provides a new molecular tool for cancer detection.

Identification of three novel NHS mutations in families with Nance-Horan syndrome.

PubMed

Huang, Kristen M; Wu, Junhua; Brooks, Simon P; Hardcastle, Alison J; Lewis, Richard Alan; Stambolian, Dwight

2007-03-27

Nance-Horan Syndrome (NHS) is an infrequent and often overlooked X-linked disorder characterized by dense congenital cataracts, microphthalmia, and dental abnormalities. The syndrome is caused by mutations in the NHS gene, whose function is not known. The purpose of this study was to identify the frequency and distribution of NHS gene mutations and compare genotype with Nance-Horan phenotype in five North American NHS families. Genomic DNA was isolated from white blood cells from NHS patients and family members. The NHS gene coding region and its splice site donor and acceptor regions were amplified from genomic DNA by PCR, and the amplicons were sequenced directly. We identified three unique NHS coding region mutations in these NHS families. This report extends the number of unique identified NHS mutations to 14.

Mutation allele burden remains unchanged in chronic myelomonocytic leukaemia responding to hypomethylating agents

DOE PAGES

Merlevede, Jane; Droin, Nathalie; Qin, Tingting; ...

2016-02-24

The cytidine analogues azacytidine and 5-aza-2’-deoxycytidine (decitabine) are commonly used to treat myelodysplastic syndromes, with or without a myeloproliferative component. It remains unclear whether the response to these hypomethylating agents results from a cytotoxic or an epigenetic effect. In this study, we address this question in chronic myelomonocytic leukaemia. We describe a comprehensive analysis of the mutational landscape of these tumours, combining whole-exome and whole-genome sequencing. We identify an average of 14 ± 5 somatic mutations in coding sequences of sorted monocyte DNA and the signatures of three mutational processes. Serial sequencing demonstrates that the response to hypomethylating agents ismore » associated with changes in DNA methylation and gene expression, without any decrease in the mutation allele burden, nor prevention of new genetic alteration occurence. Lastly, our findings indicate that cytosine analogues restore a balanced haematopoiesis without decreasing the size of the mutated clone, arguing for a predominantly epigenetic effect.« less

[Deregulation of pre-messenger RNA splicing and rare diseases].

PubMed

de la Grange, Pierre

2016-12-01

Most of protein-coding human genes are subjected to alternative pre-mRNA splicing. This mechanism is highly regulated to precisely modulate detection of specific splice sites. This regulation is under control of the spliceosome and several splicing factors are also required to modulate the alternative usage of splice sites. Splicing factors and spliceosome components recognize splicing signals and regulatory sequences of the pre-mRNAs. These splicing sequences make splicing susceptible to polymorphisms and mutations. Examples of associations between human rare diseases and defects in pre-messenger RNA splicing are accumulating. Although many alterations are caused by mutations in splicing sequence (i.e., cis acting mutations), recent studies described the disruptive impact of mutations within spliceosome components or splicing factors (i.e., trans acting mutations). Following growing of knowledge regarding splicing regulation, several approaches have been developed to compensate for the effect of deleterious mutations and to restore sufficient amounts of functional protein. © 2016 médecine/sciences – Inserm.

Mutation allele burden remains unchanged in chronic myelomonocytic leukaemia responding to hypomethylating agents

PubMed Central

Merlevede, Jane; Droin, Nathalie; Qin, Tingting; Meldi, Kristen; Yoshida, Kenichi; Morabito, Margot; Chautard, Emilie; Auboeuf, Didier; Fenaux, Pierre; Braun, Thorsten; Itzykson, Raphael; de Botton, Stéphane; Quesnel, Bruno; Commes, Thérèse; Jourdan, Eric; Vainchenker, William; Bernard, Olivier; Pata-Merci, Noemie; Solier, Stéphanie; Gayevskiy, Velimir; Dinger, Marcel E.; Cowley, Mark J.; Selimoglu-Buet, Dorothée; Meyer, Vincent; Artiguenave, François; Deleuze, Jean-François; Preudhomme, Claude; Stratton, Michael R.; Alexandrov, Ludmil B.; Padron, Eric; Ogawa, Seishi; Koscielny, Serge; Figueroa, Maria; Solary, Eric

2016-01-01

The cytidine analogues azacytidine and 5-aza-2'-deoxycytidine (decitabine) are commonly used to treat myelodysplastic syndromes, with or without a myeloproliferative component. It remains unclear whether the response to these hypomethylating agents results from a cytotoxic or an epigenetic effect. In this study, we address this question in chronic myelomonocytic leukaemia. We describe a comprehensive analysis of the mutational landscape of these tumours, combining whole-exome and whole-genome sequencing. We identify an average of 14±5 somatic mutations in coding sequences of sorted monocyte DNA and the signatures of three mutational processes. Serial sequencing demonstrates that the response to hypomethylating agents is associated with changes in DNA methylation and gene expression, without any decrease in the mutation allele burden, nor prevention of new genetic alteration occurence. Our findings indicate that cytosine analogues restore a balanced haematopoiesis without decreasing the size of the mutated clone, arguing for a predominantly epigenetic effect. PMID:26908133

A new compound heterozygous CFTR mutation in a Chinese family with cystic fibrosis.

PubMed

Xie, Yingjun; Huang, Xueqiong; Liang, Yujian; Xu, Lingling; Pei, Yuxin; Cheng, Yucai; Zhang, Lidan; Tang, Wen

2017-11-01

Cystic fibrosis (CF) is the most common autosomal recessive disease among Caucasians but is rarer in the Chinese population, because mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene. To elucidate the causative role of a novel compound heterozygous mutation of CF. In this study, clinical samples were obtained from two siblings with recurrent airway infections, clubbed fingers, salt-sweat and failure to gain weight in a non-consanguineous Chinese family. Next-generation sequencing was performed on the 27 coding exons of CFTR in both children, with confirmation by Sanger sequencing. Next-generation sequencing showed the same compound heterozygous CFTR mutation (c.865A>T p.Arg289X and c.3651_3652insAAAT p.Tyr1219X) in both children. As this mutation is consistent with the clinical manifestations of CF and no other mutations were detected after scanning the gene sequence, we suggest that the CF phenotype is caused by compound heterozygosity for c.865A>T and c.3651_3652insAAAT. As c865A>T is not currently listed in the "Cystic Fibrosis Mutation Database", this information about CF in a Chinese population is of interest. © 2015 John Wiley & Sons Ltd.

Novel Mutations in pncA Gene of Pyrazinamide Resistant Clinical Isolates of Mycobacterium tuberculosis.

PubMed

Kahbazi, Manijeh; Sarmadian, Hossein; Ahmadi, Azam; Didgar, Farshideh; Sadrnia, Maryam; Poolad, Toktam; Arjomandzadegan, Mohammad

2018-04-16

In clinical isolates of Mycobacterium tuberculosis (MTB), resistance to pyrazinamide occurs by mutations in any positions of the pncA gene (NC_000962.3) especially in nucleotides 359 and 374. In this study we examined the pncA gene sequence in clinical isolates of MTB. Genomic DNA of 33 clinical isolates of MTB was extracted by the Chelex100 method. The polymerase chain reactions (PCR) were performed using specific primers for amplification of 744 bp amplicon comprising the coding sequences (CDS) of the pncA gene. PCR products were sequenced by an automated sequencing Bioscience system. Additionally, semi Nested-allele specific (sNASP) and polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) methods were carried out for verification of probable mutations in nucleotides 359 and 374. Sequencing results showed that from 33 MTB clinical isolates, nine pyrazinamide-resistant isolates have mutations. Furthermore, no mutation was detected in 24 susceptible strains in the entire 561 bp of the pncA gene. Moreover, new mutations of G→A at position 3 of the pncA gene were identified in some of the resistant isolates. Results showed that the sNASP method could detect mutations in nucleotide 359 and 374 of the pncA gene, but the PCR-RFLP method by the SacII enzyme could not detect these mutations. In conclusion, the identification of new mutations in the pncA gene confirmed the probable occurrence of mutations in any nucleotides of the pncA gene sequence in resistant isolates of MTB.

Differentiating Alström from Bardet-Biedl syndrome (BBS) using systematic ciliopathy genes sequencing.

PubMed

Aliferis, K; Hellé, S; Gyapay, G; Duchatelet, S; Stoetzel, C; Mandel, J L; Dollfus, H

2012-03-01

Early onset retinal degeneration associated with obesity can present a diagnostic challenge in paediatric ophthalmology practice. Clinical overlap between Bardet-Biedl syndrome (BBS) and Alström syndrome has been described, although the two entities are genetically distinct. To date, 16 genes are known to be associated with BBS (BBS1-16) and only one gene has been identified for Alström syndrome (ALMS1). In collaboration with the French National Center for Sequencing (CNS, Evry), all coding exons and flanking introns were sequenced for 27 ciliopathy genes (BBS1-12, MGC1203, TTC21b, AHI1, NPHP2-8 (NPHP6=BBS14), MKS1(BBS13), MKS3, C2ORF86, SDCCAG8, ALMS1) in 96 patients referred with a clinical diagnosis of BBS. ALMS1 gene analysis included sequencing of all coding exons. BBS known gene mutations were found in 44 patients (36 with two mutations and 8 heterozygous). ALMS1 mutations were found in four cases. The rate of ALMS1 mutations among patients suspected of having BBS was 4.2%. Clinically, all four patients presented early-onset severe retinal degeneration with congenital nystagmus associated with obesity. The difficult early differential diagnosis between the two syndromes is outlined. One mutation had already been reported (c.11310delAGAG/p.R3770fsX) and three were novel (c.2293C > T/p.Q765X, c.6823insA/p.R2275fsX, c.9046delA/p.N3016fsX). Ciliopathy genes sequencing can be very helpful in providing a timely diagnosis in this group of patients, hence appropriate genetic counselling for families and adequate medical follow-up for affected children.

Identification of novel mutations in X-linked retinitis pigmentosa families and implications for diagnostic testing

PubMed Central

Glaus, Esther; Lorenz, Birgit; Netzer, Christian; Li, Yün; Schambeck, Maria; Wittmer, Mariana; Feil, Silke; Kirschner-Schwabe, Renate; Rosenberg, Thomas; Cremers, Frans P.M.; Bergen, Arthur A.B.; Barthelmes, Daniel; Baraki, Husnia; Schmid, Fabian; Tanner, Gaby; Fleischhauer, Johannes; Orth, Ulrike; Becker, Christian; Wegscheider, Erika; Nürnberg, Gudrun; Nürnberg, Peter; Bolz, Hanno Jörn; Gal, Andreas; Berger, Wolfgang

2008-01-01

Purpose The goal of this study was to identify mutations in X-chromosomal genes associated with retinitis pigmentosa (RP) in patients from Germany, The Netherlands, Denmark, and Switzerland. Methods In addition to all coding exons of RP2, exons 1 through 15, 9a, ORF15, 15a and 15b of RPGR were screened for mutations. PCR products were amplified from genomic DNA extracted from blood samples and analyzed by direct sequencing. In one family with apparently dominant inheritance of RP, linkage analysis identified an interval on the X chromosome containing RPGR, and mutation screening revealed a pathogenic variant in this gene. Patients of this family were examined clinically and by X-inactivation studies. Results This study included 141 RP families with possible X-chromosomal inheritance. In total, we identified 46 families with pathogenic sequence alterations in RPGR and RP2, of which 17 mutations have not been described previously. Two of the novel mutations represent the most 3’-terminal pathogenic sequence variants in RPGR and RP2 reported to date. In exon ORF15 of RPGR, we found eight novel and 14 known mutations. All lead to a disruption of open reading frame. Of the families with suggested X-chromosomal inheritance, 35% showed mutations in ORF15. In addition, we found five novel mutations in other exons of RPGR and four in RP2. Deletions in ORF15 of RPGR were identified in three families in which female carriers showed variable manifestation of the phenotype. Furthermore, an ORF15 mutation was found in an RP patient who additionally carries a 6.4 kbp deletion downstream of the coding region of exon ORF15. We did not identify mutations in 39 sporadic male cases from Switzerland. Conclusions RPGR mutations were confirmed to be the most frequent cause of RP in families with an X-chromosomal inheritance pattern. We propose a screening strategy to provide molecular diagnostics in these families. PMID:18552978

Chemical and UV Mutagenesis.

PubMed

Bose, Jeffrey L

2016-01-01

The ability to create mutations is an important step towards understanding bacterial physiology and virulence. While targeted approaches are invaluable, the ability to produce genome-wide random mutations can lead to crucial discoveries. Transposon mutagenesis is a useful approach, but many interesting mutations can be missed by these insertions that interrupt coding and noncoding sequences due to the integration of an entire transposon. Chemical mutagenesis and UV-based random mutagenesis are alternate approaches to isolate mutations of interest with the potential of only single nucleotide changes. Once a standard method, difficulty in identifying mutation sites had decreased the popularity of this technique. However, thanks to the recent emergence of economical whole-genome sequencing, this approach to making mutations can once again become a viable option. Therefore, this chapter provides an overview protocol for random mutagenesis using UV light or DNA-damaging chemicals.

Target gene analyses of 39 amelogenesis imperfecta kindreds

PubMed Central

Chan, Hui-Chen; Estrella, Ninna M. R. P.; Milkovich, Rachel N.; Kim, Jung-Wook; Simmer, James P.; Hu, Jan C-C.

2012-01-01

Previously, mutational analyses identified six disease-causing mutations in 24 amelogenesis imperfecta (AI) kindreds. We have since expanded the number of AI kindreds to 39, and performed mutation analyses covering the coding exons and adjoining intron sequences for the six proven AI candidate genes [amelogenin (AMELX), enamelin (ENAM), family with sequence similarity 83, member H (FAM83H), WD repeat containing domain 72 (WDR72), enamelysin (MMP20), and kallikrein-related peptidase 4 (KLK4)] and for ameloblastin (AMBN) (a suspected candidate gene). All four of the X-linked AI families (100%) had disease-causing mutations in AMELX, suggesting that AMELX is the only gene involved in the aetiology of X-linked AI. Eighteen families showed an autosomal-dominant pattern of inheritance. Disease-causing mutations were identified in 12 (67%): eight in FAM83H, and four in ENAM. No FAM83H coding-region or splice-junction mutations were identified in three probands with autosomal-dominant hypocalcification AI (ADHCAI), suggesting that a second gene may contribute to the aetiology of ADHCAI. Six families showed an autosomal-recessive pattern of inheritance, and disease-causing mutations were identified in three (50%): two in MMP20, and one in WDR72. No disease-causing mutations were found in 11 families with only one affected member. We conclude that mutation analyses of the current candidate genes for AI have about a 50% chance of identifying the disease-causing mutation in a given kindred. PMID:22243262

Clinical features of X linked juvenile retinoschisis associated with new mutations in the XLRS1 gene in Italian families

PubMed Central

Simonelli, F; Cennamo, G; Ziviello, C; Testa, F; de Crecchio, G; Nesti, A; Manitto, M P; Ciccodicola, A; Banfi, S; Brancato, R; Rinaldi, E

2003-01-01

Aims: To describe the clinical phenotype of X linked juvenile retinoschisis in eight Italian families with six different mutations in the XLRS1 gene. Methods: Complete ophthalmic examinations, electroretinography and A and B-scan standardised echography were performed in 18 affected males. The coding sequences of the XLRS1 gene were amplified by polymerase chain reaction and directly sequenced on an automated sequencer. Results: Six different XLRS1 mutations were identified; two of these mutations Ile81Asn and the Trp122Cys, have not been previously described. The affected males showed an electronegative response to the standard white scotopic stimulus and a prolonged implicit time of the 30 Hz flicker. In the families with Trp112Cys and Trp122Cys mutations we observed a more severe retinoschisis (RS) clinical picture compared with the other genotypes. Conclusion: The severe RS phenotypes associated with Trp112Cys and to Trp122Cys mutations suggest that these mutations determine a notable alteration in the function of the retinoschisin protein. PMID:12928282

Validation of high-resolution DNA melting analysis for mutation scanning of the CDKL5 gene: identification of novel mutations.

PubMed

Raymond, Laure; Diebold, Bertrand; Leroux, Céline; Maurey, Hélène; Drouin-Garraud, Valérie; Delahaye, Andre; Dulac, Olivier; Metreau, Julia; Melikishvili, Gia; Toutain, Annick; Rivier, François; Bahi-Buisson, Nadia; Bienvenu, Thierry

2013-01-01

Mutations in the cyclin-dependent kinase-like 5 gene (CDKL5) have been predominantly described in epileptic encephalopathies of female, including infantile spasms with Rett-like features. Up to now, detection of mutations in this gene was made by laborious, expensive and/or time consuming methods. Here, we decided to validate high-resolution melting analysis (HRMA) for mutation scanning of the CDKL5 gene. Firstly, using a large DNA bank consisting to 34 samples carrying different mutations and polymorphisms, we validated our analytical conditions to analyse the different exons and flanking intronic sequences of the CDKL5 gene by HRMA. Secondly, we screened CDKL5 by both HRMA and denaturing high performance liquid chromatography (dHPLC) in a cohort of 135 patients with early-onset seizures. Our results showed that point mutations and small insertions and deletions can be reliably detected by HRMA. Compared to dHPLC, HRMA profiles are more discriminated, thereby decreasing unnecessary sequencing. In this study, we identified eleven novel sequence variations including four pathogenic mutations (2.96% prevalence). HRMA appears cost-effective, easy to set up, highly sensitive, non-toxic and rapid for mutation screening, ideally suited for large genes with heterogeneous mutations located along the whole coding sequence, such as the CDKL5 gene. Copyright © 2012 Elsevier B.V. All rights reserved.

A compositional segmentation of the human mitochondrial genome is related to heterogeneities in the guanine mutation rate

PubMed Central

Samuels, David C.; Boys, Richard J.; Henderson, Daniel A.; Chinnery, Patrick F.

2003-01-01

We applied a hidden Markov model segmentation method to the human mitochondrial genome to identify patterns in the sequence, to compare these patterns to the gene structure of mtDNA and to see whether these patterns reveal additional characteristics important for our understanding of genome evolution, structure and function. Our analysis identified three segmentation categories based upon the sequence transition probabilities. Category 2 segments corresponded to the tRNA and rRNA genes, with a greater strand-symmetry in these segments. Category 1 and 3 segments covered the protein- coding genes and almost all of the non-coding D-loop. Compared to category 1, the mtDNA segments assigned to category 3 had much lower guanine abundance. A comparison to two independent databases of mitochondrial mutations and polymorphisms showed that the high substitution rate of guanine in human mtDNA is largest in the category 3 segments. Analysis of synonymous mutations showed the same pattern. This suggests that this heterogeneity in the mutation rate is partly independent of respiratory chain function and is a direct property of the genome sequence itself. This has important implications for our understanding of mtDNA evolution and its use as a ‘molecular clock’ to determine the rate of population and species divergence. PMID:14530452

Genomic Characterization of Non–Small-Cell Lung Cancer in African Americans by Targeted Massively Parallel Sequencing

PubMed Central

Araujo, Luiz H.; Timmers, Cynthia; Bell, Erica Hlavin; Shilo, Konstantin; Lammers, Philip E.; Zhao, Weiqiang; Natarajan, Thanemozhi G.; Miller, Clinton J.; Zhang, Jianying; Yilmaz, Ayse S.; Liu, Tom; Coombes, Kevin; Amann, Joseph; Carbone, David P.

2015-01-01

Purpose Technologic advances have enabled the comprehensive analysis of genetic perturbations in non–small-cell lung cancer (NSCLC); however, African Americans have often been underrepresented in these studies. This ethnic group has higher lung cancer incidence and mortality rates, and some studies have suggested a lower incidence of epidermal growth factor receptor mutations. Herein, we report the most in-depth molecular profile of NSCLC in African Americans to date. Methods A custom panel was designed to cover the coding regions of 81 NSCLC-related genes and 40 ancestry-informative markers. Clinical samples were sequenced on a massively parallel sequencing instrument, and anaplastic lymphoma kinase translocation was evaluated by fluorescent in situ hybridization. Results The study cohort included 99 patients (61% males, 94% smokers) comprising 31 squamous and 68 nonsquamous cell carcinomas. We detected 227 nonsilent variants in the coding sequence, including 24 samples with nonoverlapping, classic driver alterations. The frequency of driver mutations was not significantly different from that of whites, and no association was found between genetic ancestry and the presence of somatic mutations. Copy number alteration analysis disclosed distinguishable amplifications in the 3q chromosome arm in squamous cell carcinomas and pointed toward a handful of targetable alterations. We also found frequent SMARCA4 mutations and protein loss, mostly in driver-negative tumors. Conclusion Our data suggest that African American ancestry may not be significantly different from European/white background for the presence of somatic driver mutations in NSCLC. Furthermore, we demonstrated that using a comprehensive genotyping approach could identify numerous targetable alterations, with potential impact on therapeutic decisions. PMID:25918285

The Intolerance of Regulatory Sequence to Genetic Variation Predicts Gene Dosage Sensitivity

PubMed Central

Wang, Quanli; Halvorsen, Matt; Han, Yujun; Weir, William H.; Allen, Andrew S.; Goldstein, David B.

2015-01-01

Noncoding sequence contains pathogenic mutations. Yet, compared with mutations in protein-coding sequence, pathogenic regulatory mutations are notoriously difficult to recognize. Most fundamentally, we are not yet adept at recognizing the sequence stretches in the human genome that are most important in regulating the expression of genes. For this reason, it is difficult to apply to the regulatory regions the same kinds of analytical paradigms that are being successfully applied to identify mutations among protein-coding regions that influence risk. To determine whether dosage sensitive genes have distinct patterns among their noncoding sequence, we present two primary approaches that focus solely on a gene’s proximal noncoding regulatory sequence. The first approach is a regulatory sequence analogue of the recently introduced residual variation intolerance score (RVIS), termed noncoding RVIS, or ncRVIS. The ncRVIS compares observed and predicted levels of standing variation in the regulatory sequence of human genes. The second approach, termed ncGERP, reflects the phylogenetic conservation of a gene’s regulatory sequence using GERP++. We assess how well these two approaches correlate with four gene lists that use different ways to identify genes known or likely to cause disease through changes in expression: 1) genes that are known to cause disease through haploinsufficiency, 2) genes curated as dosage sensitive in ClinGen’s Genome Dosage Map, 3) genes judged likely to be under purifying selection for mutations that change expression levels because they are statistically depleted of loss-of-function variants in the general population, and 4) genes judged unlikely to cause disease based on the presence of copy number variants in the general population. We find that both noncoding scores are highly predictive of dosage sensitivity using any of these criteria. In a similar way to ncGERP, we assess two ensemble-based predictors of regional noncoding importance, ncCADD and ncGWAVA, and find both scores are significantly predictive of human dosage sensitive genes and appear to carry information beyond conservation, as assessed by ncGERP. These results highlight that the intolerance of noncoding sequence stretches in the human genome can provide a critical complementary tool to other genome annotation approaches to help identify the parts of the human genome increasingly likely to harbor mutations that influence risk of disease. PMID:26332131

Identification of a deep intronic mutation in the COL6A2 gene by a novel custom oligonucleotide CGH array designed to explore allelic and genetic heterogeneity in collagen VI-related myopathies

PubMed Central

2010-01-01

Background Molecular characterization of collagen-VI related myopathies currently relies on standard sequencing, which yields a detection rate approximating 75-79% in Ullrich congenital muscular dystrophy (UCMD) and 60-65% in Bethlem myopathy (BM) patients as PCR-based techniques tend to miss gross genomic rearrangements as well as copy number variations (CNVs) in both the coding sequence and intronic regions. Methods We have designed a custom oligonucleotide CGH array in order to investigate the presence of CNVs in the coding and non-coding regions of COL6A1, A2, A3, A5 and A6 genes and a group of genes functionally related to collagen VI. A cohort of 12 patients with UCMD/BM negative at sequencing analysis and 2 subjects carrying a single COL6 mutation whose clinical phenotype was not explicable by inheritance were selected and the occurrence of allelic and genetic heterogeneity explored. Results A deletion within intron 1A of the COL6A2 gene, occurring in compound heterozygosity with a small deletion in exon 28, previously detected by routine sequencing, was identified in a BM patient. RNA studies showed monoallelic transcription of the COL6A2 gene, thus elucidating the functional effect of the intronic deletion. No pathogenic mutations were identified in the remaining analyzed patients, either within COL6A genes, or in genes functionally related to collagen VI. Conclusions Our custom CGH array may represent a useful complementary diagnostic tool, especially in recessive forms of the disease, when only one mutant allele is detected by standard sequencing. The intronic deletion we identified represents the first example of a pure intronic mutation in COL6A genes. PMID:20302629

Identification of three novel NHS mutations in families with Nance-Horan syndrome

PubMed Central

Wu, Junhua; Brooks, Simon P.; Hardcastle, Alison J.; Lewis, Richard Alan; Stambolian, Dwight

2007-01-01

Purpose Nance-Horan Syndrome (NHS) is an infrequent and often overlooked X-linked disorder characterized by dense congenital cataracts, microphthalmia, and dental abnormalities. The syndrome is caused by mutations in the NHS gene, whose function is not known. The purpose of this study was to identify the frequency and distribution of NHS gene mutations and compare genotype with Nance-Horan phenotype in five North American NHS families. Methods Genomic DNA was isolated from white blood cells from NHS patients and family members. The NHS gene coding region and its splice site donor and acceptor regions were amplified from genomic DNA by PCR, and the amplicons were sequenced directly. Results We identified three unique NHS coding region mutations in these NHS families. Conclusions This report extends the number of unique identified NHS mutations to 14. PMID:17417607

HRAS mutations in Costello syndrome: detection of constitutional activating mutations in codon 12 and 13 and loss of wild-type allele in malignancy.

PubMed

Estep, Anne L; Tidyman, William E; Teitell, Michael A; Cotter, Philip D; Rauen, Katherine A

2006-01-01

Costello syndrome (CS) is a complex developmental disorder involving characteristic craniofacial features, failure to thrive, developmental delay, cardiac and skeletal anomalies, and a predisposition to develop neoplasia. Based on similarities with other cancer syndromes, we previously hypothesized that CS is likely due to activation of signal transduction through the Ras/MAPK pathway [Tartaglia et al., 2003]. In this study, the HRAS coding region was sequenced for mutations in a large, well-characterized cohort of 36 CS patients. Heterogeneous missense point mutations predicting an amino acid substitution were identified in 33/36 (92%) patients. The majority (91%) had a 34G --> A transition in codon 12. Less frequent mutations included 35G --> C (codon 12) and 37G --> T (codon 13). Parental samples did not have an HRAS mutation supporting the hypothesis of de novo heterogeneous mutations. There is phenotypic variability among patients with a 34G --> A transition. The most consistent features included characteristic facies and skin, failure to thrive, developmental delay, musculoskeletal abnormalities, visual impairment, cardiac abnormalities, and generalized hyperpigmentation. The two patients with 35G --> C had cardiac arrhythmias whereas one patient with a 37G --> T transversion had an enlarged aortic root. Of the patients with a clinical diagnosis of CS, neoplasia was the most consistent phenotypic feature for predicating an HRAS mutation. To gain an understanding of the relationship between constitutional HRAS mutations and malignancy, HRAS was sequenced in an advanced biphasic rhabdomyosarcoma/fibrosarcoma from an individual with a 34G --> A mutation. Loss of the wild-type HRAS allele was observed, suggesting tumorigenesis in CS patients is accompanied by additional somatic changes affecting HRAS. Finally, due to phenotypic overlap between CS and cardio-facio-cutaneous (CFC) syndromes, the HRAS coding region was sequenced in a well-characterized CFC cohort. No mutations were found which support a distinct genetic etiology between CS and CFC syndromes. (c) 2005 Wiley-Liss, Inc.

[Novel nonsense mutation (p.Y113X) in the human growth hormone receptor gene in a Brazilian patient with Laron syndrome].

PubMed

Diniz, Erik Trovão; Jorge, Alexander A L; Arnhold, Ivo J P; Rosenbloom, Arlan L; Bandeira, Francisco

2008-11-01

To date, about sixty different mutations within GH receptor (GHR) gene have been described in patients with GH insensitivity syndrome (GHI). In this report, we described a novel nonsense mutation of GHR. The patient was evaluated at the age of 6 yr, for short stature associated to clinical phenotype of GHI. GH, IGF-1, and GHBP levels were determined. The PCR products from exons 2-10 were sequenced. The patient had high GH (26 microg/L), low IGF-1 (22.5 ng/ml) and undetectable GHBP levels. The sequencing of GHR exon 5 disclosed adenine duplication at nucleotide 338 of GHR coding sequence (c.338dupA) in homozygous state. We described a novel mutation that causes a truncated GHR and a loss of receptor function due to the lack of amino acids comprising the transmembrane and intracellular regions of GHR protein, leading to GHI.

Accumulation of multiple mutations in linezolid-resistant Staphylococcus epidermidis causing bloodstream infections; in silico analysis of L3 amino acid substitutions that might confer high-level linezolid resistance.

PubMed

Ikonomidis, Alexandros; Grapsa, Anastasia; Pavlioglou, Charikleia; Demiri, Antonia; Batarli, Alexandra; Panopoulou, Maria

2016-12-01

Fifty-six Staphylococcus epidermidis clinical isolates, showing high-level linezolid resistance and causing bacteremia in critically ill patients, were studied. All isolates belonged to ST22 clone and carried the T2504A and C2534T mutations in gene coding for 23SrRNA as well as the C189A, G208A, C209T and G384C missense mutations in L3 protein which resulted in Asp159Tyr, Gly152Asp and Leu94Val substitutions. Other silent mutations were also detected in genes coding for ribosomal proteins L3 and L22. In silico analysis of missense mutations showed that although L3 protein retained the sequence of secondary motifs, the tertiary structure was influenced. The observed alteration in L3 protein folding provides an indication on the putative role of L3-coding gene mutations in high-level linezolid resistance. Furthermore, linezolid pressure in health care settings where linezolid consumption is of high rates might lead to the selection of resistant mutants possessing L3 mutations that might confer high-level linezolid resistance.

Rapid evolution of cis-regulatory sequences via local point mutations

NASA Technical Reports Server (NTRS)

Stone, J. R.; Wray, G. A.

2001-01-01

Although the evolution of protein-coding sequences within genomes is well understood, the same cannot be said of the cis-regulatory regions that control transcription. Yet, changes in gene expression are likely to constitute an important component of phenotypic evolution. We simulated the evolution of new transcription factor binding sites via local point mutations. The results indicate that new binding sites appear and become fixed within populations on microevolutionary timescales under an assumption of neutral evolution. Even combinations of two new binding sites evolve very quickly. We predict that local point mutations continually generate considerable genetic variation that is capable of altering gene expression.

A case report and literature review of Fanconi Anemia (FA) diagnosed by genetic testing.

PubMed

Solomon, Ponnumony John; Margaret, Priya; Rajendran, Ramya; Ramalingam, Revathy; Menezes, Godfred A; Shirley, Alph S; Lee, Seung Jun; Seong, Moon-Woo; Park, Sung Sup; Seol, Dodam; Seo, Soo Hyun

2015-05-08

Fanconi anemia (FA) is a genetically heterogeneous rare autosomal recessive disorder characterized by congenital malformations, hematological problems and predisposition to malignancies. The genes that have been found to be mutated in FA patients are called FANC. To date 16 distinct FANC genes have been reported. Among these, mutations in FANCA are the most frequent among FA patients worldwide which account for 60- 65%. In this study, a nine years old male child was brought to our hospital one year ago for opinion and advice. He was the third child born to consanguineous parents. The mutation analyses were performed for proband, parents, elder sibling and the relatives [maternal aunt and maternal aunt's son (cousin)]. Molecular genetic testing [targeted next-generation sequencing (MiSeq, Illumina method)] was performed by mutation analysis in 15 genes involved. Entire coding exons and their flanking regions of the genes were analysed. Sanger sequencing [(ABI 3730 analyzer by Applied Biosystems)] was performed using primers specific for 43 coding exons of the FANCA gene. A novel splice site mutation, c.3066 + 1G > T, (IVS31 + 1G > T), homozygote was detected by sequencing in the patient. The above sequence variant was identified in heterozygous state in his parents. Further, the above sequence variant was not identified in other family members (elder sibling, maternal aunt and cousin). It is concluded that genetic study should be done if possible in all the cases of suspected FA, including siblings, parents and close blood relatives. It will help us to plan appropriate treatment and also to select suitable donor for hematopoietic stem cell transplantation and to plan for genetic counseling. In addition to the case report, the main focus of this manuscript was to review literature on role of FANCA gene in FA since large number of FANCA mutations and polymorphisms have been identified.

Sequencing the GRHL3 Coding Region Reveals Rare Truncating Mutations and a Common Susceptibility Variant for Nonsyndromic Cleft Palate

PubMed Central

Mangold, Elisabeth; Böhmer, Anne C.; Ishorst, Nina; Hoebel, Ann-Kathrin; Gültepe, Pinar; Schuenke, Hannah; Klamt, Johanna; Hofmann, Andrea; Gölz, Lina; Raff, Ruth; Tessmann, Peter; Nowak, Stefanie; Reutter, Heiko; Hemprich, Alexander; Kreusch, Thomas; Kramer, Franz-Josef; Braumann, Bert; Reich, Rudolf; Schmidt, Gül; Jäger, Andreas; Reiter, Rudolf; Brosch, Sibylle; Stavusis, Janis; Ishida, Miho; Seselgyte, Rimante; Moore, Gudrun E.; Nöthen, Markus M.; Borck, Guntram; Aldhorae, Khalid A.; Lace, Baiba; Stanier, Philip; Knapp, Michael; Ludwig, Kerstin U.

2016-01-01

Nonsyndromic cleft lip with/without cleft palate (nsCL/P) and nonsyndromic cleft palate only (nsCPO) are the most frequent subphenotypes of orofacial clefts. A common syndromic form of orofacial clefting is Van der Woude syndrome (VWS) where individuals have CL/P or CPO, often but not always associated with lower lip pits. Recently, ∼5% of VWS-affected individuals were identified with mutations in the grainy head-like 3 gene (GRHL3). To investigate GRHL3 in nonsyndromic clefting, we sequenced its coding region in 576 Europeans with nsCL/P and 96 with nsCPO. Most strikingly, nsCPO-affected individuals had a higher minor allele frequency for rs41268753 (0.099) than control subjects (0.049; p = 1.24 × 10−2). This association was replicated in nsCPO/control cohorts from Latvia, Yemen, and the UK (pcombined = 2.63 × 10−5; ORallelic = 2.46 [95% CI 1.6–3.7]) and reached genome-wide significance in combination with imputed data from a GWAS in nsCPO triads (p = 2.73 × 10−9). Notably, rs41268753 is not associated with nsCL/P (p = 0.45). rs41268753 encodes the highly conserved p.Thr454Met (c.1361C>T) (GERP = 5.3), which prediction programs denote as deleterious, has a CADD score of 29.6, and increases protein binding capacity in silico. Sequencing also revealed four novel truncating GRHL3 mutations including two that were de novo in four families, where all nine individuals harboring mutations had nsCPO. This is important for genetic counseling: given that VWS is rare compared to nsCPO, our data suggest that dominant GRHL3 mutations are more likely to cause nonsyndromic than syndromic CPO. Thus, with rare dominant mutations and a common risk variant in the coding region, we have identified an important contribution for GRHL3 in nsCPO. PMID:27018475

Exploration of sequence space as the basis of viral RNA genome segmentation.

PubMed

Moreno, Elena; Ojosnegros, Samuel; García-Arriaza, Juan; Escarmís, Cristina; Domingo, Esteban; Perales, Celia

2014-05-06

The mechanisms of viral RNA genome segmentation are unknown. On extensive passage of foot-and-mouth disease virus in baby hamster kidney-21 cells, the virus accumulated multiple point mutations and underwent a transition akin to genome segmentation. The standard single RNA genome molecule was replaced by genomes harboring internal in-frame deletions affecting the L- or capsid-coding region. These genomes were infectious and killed cells by complementation. Here we show that the point mutations in the nonstructural protein-coding region (P2, P3) that accumulated in the standard genome before segmentation increased the relative fitness of the segmented version relative to the standard genome. Fitness increase was documented by intracellular expression of virus-coded proteins and infectious progeny production by RNAs with the internal deletions placed in the sequence context of the parental and evolved genome. The complementation activity involved several viral proteins, one of them being the leader proteinase L. Thus, a history of genetic drift with accumulation of point mutations was needed to allow a major variation in the structure of a viral genome. Thus, exploration of sequence space by a viral genome (in this case an unsegmented RNA) can reach a point of the space in which a totally different genome structure (in this case, a segmented RNA) is favored over the form that performed the exploration.

Short communication: novel truncating mutations in the CFTR gene causing a severe form of cystic fibrosis in Italian patients.

PubMed

Lenarduzzi, S; Morgutti, M; Crovella, S; Coiana, A; Rosatelli, M C

2014-11-14

Cystic fibrosis (CF) is a common recessive genetic disease caused by mutations in the gene encoding for the cystic fibrosis transmembrane conductance regulator (CFTR) protein. More than 1800 different mutations have been described to date. Here, we report 3 novel mutations in CFTR in 3 Italian CF patients. To detect and identify 36 frequent mutations in Caucasians, we used the INNO-LiPA CFTR19 and INNO-LiPA CFTR17+Tn Update kits (Innogenetics; Ghent, Belgium). Our first analysis did not reveal both of the responsible mutations; thus, direct sequencing of the CFTR gene coding region was performed. The 3 patients were compound heterozygous. In one allele, the F508del (c.1521_1523delCTT, p.PHE508del) mutation in exon 11 was observed in each case. For the second allele, in patient No.1, direct sequencing revealed an 11-base pair deletion (GAGGCGATACT) in exon 14 (c.2236_2246del; pGlu746Alafs*29). In patient No. 2, direct sequencing revealed a nonsense mutation at nucleotide 3892 (c.3892G>T) in exon 24. In patient No. 3, direct sequencing revealed a deletion of cytosine in exon 27 (c.4296delC; p.Asn1432Lysfs*16). These 3 novel mutations indicate the production of a truncated protein, which consequently results in a non-functional polypeptide.

Promoter mutation is a common variant in GJC2-associated Pelizaeus-Merzbacher-like disease.

PubMed

Meyer, E; Kurian, M A; Morgan, N V; McNeill, A; Pasha, S; Tee, L; Younis, R; Norman, A; van der Knaap, M S; Wassmer, E; Trembath, R C; Brueton, L; Maher, E R

2011-12-01

Pelizaeus-Merzbacher-like disease (PMLD) is a clinically and genetically heterogeneous neurological disorder of cerebral hypomyelination. It is clinically characterised by early onset (usually infantile) nystagmus, impaired motor development, ataxia, choreoathetoid movements, dysarthria and progressive limb spasticity. We undertook autozygosity mapping studies in a large consanguineous family of Pakistani origin in which affected children had progressive lower limb spasticity and features of cerebral hypomyelination on MR brain imaging. SNP microarray and microsatellite marker analysis demonstrated linkage to chromosome 1q42.13-1q42.2. Direct sequencing of the gap junction protein gamma-2 gene, GJC2, identified a promoter region mutation (c.-167A>G) in the non-coding exon 1. The c.-167A>G promoter mutation was identified in a further 4 individuals from two families (who were also of Pakistani origin) with clinical and radiological features of PMLD in whom previous routine diagnostic screening of GJC2 had been reported as negative. A common haplotype was identified at the GJC2 locus in the three mutation-positive families, consistent with a common origin for the mutation and likely founder effect. This promoter mutation has only recently been reported in GJC2-PMLD but it has been postulated to affect the binding of the transcription factor SOX10 and appears to be a prevalent mutation, accounting for ~29% of reported patients with GJC2-PMLD. We propose that diagnostic screening of GJC2 should include sequence analysis of the non-coding exon 1, as well as the coding regions to avoid misdiagnosis or diagnostic delay in suspected PMLD. Copyright © 2011 Elsevier Inc. All rights reserved.

The Near Naked Hairless (HrN) Mutation Disrupts Hair Formation but is not Due to a Mutation in the Hairless Coding Region

DOE Office of Scientific and Technical Information (OSTI.GOV)

Liu, Yutao; Das, Suchita; Olszewski, Robert Edward

Near naked hairless (HrN) is a semi-dominant mutation that arose spontaneously and was suggested by allelism testing to be an allele of mouse Hairless (Hr). HrN mice differ from other Hr mutants in that hair loss appears as the postnatal coat begins to emerge, as opposed to failure to initiate the first postnatal hair cycle, and that the mutation displays semi-dominant inheritance. We sequenced the Hr cDNA in HrN/HrN mice and characterized the pathological and molecular phenotypes to identify the basis for hair loss in this model. HrN/HrN mice exhibit dystrophic hairs that are unable to consistently emerge from themore » hair follicle, while HrN/+ mice display a sparse coat of hair and a milder degree of follicular dystrophy than their homozygous littermates. DNA microarray analysis of cutaneous gene expression demonstrates that numerous genes are downregulated in HrN/HrN mice, primarily genes important for hair structure. By contrast, Hr expression is significantly increased. Sequencing the Hr coding region, intron-exon boundaries, 5'- and 3'- UTR and immediate upstream region did not reveal the underlying mutation. Therefore HrN does not appear to be an allele of Hr but may result from a mutation in a closely linked gene or from a regulatory mutation in Hr.« less

Primer development to obtain complete coding sequence of HA and NA genes of influenza A/H3N2 virus.

PubMed

Agustiningsih, Agustiningsih; Trimarsanto, Hidayat; Setiawaty, Vivi; Artika, I Made; Muljono, David Handojo

2016-08-30

Influenza is an acute respiratory illness and has become a serious public health problem worldwide. The need to study the HA and NA genes in influenza A virus is essential since these genes frequently undergo mutations. This study describes the development of primer sets for RT-PCR to obtain complete coding sequence of Hemagglutinin (HA) and Neuraminidase (NA) genes of influenza A/H3N2 virus from Indonesia. The primers were developed based on influenza A/H3N2 sequence worldwide from Global Initiative on Sharing All Influenza Data (GISAID) and further tested using Indonesian influenza A/H3N2 archived samples of influenza-like illness (ILI) surveillance from 2008 to 2009. An optimum RT-PCR condition was acquired for all HA and NA fragments designed to cover complete coding sequence of HA and NA genes. A total of 71 samples were successfully sequenced for complete coding sequence both of HA and NA genes out of 145 samples of influenza A/H3N2 tested. The developed primer sets were suitable for obtaining complete coding sequences of HA and NA genes of Indonesian samples from 2008 to 2009.

Phenotype/genotype correlation in a case series of Stargardt's patients identifies novel mutations in the ABCA4 gene.

PubMed

Gemenetzi, M; Lotery, A J

2013-11-01

To investigate phenotypic variability in terms of best-corrected visual acuity (BCVA) in patients with Stargardt disease (STGD) and confirmed ABCA4 mutations. Entire coding region analysis of the ABCA4 gene by direct sequencing of seven patients with clinical findings of STGD seen in the Retina Clinics of Southampton Eye Unit between 2002 and 2011.Phenotypic variables recorded were BCVA, fluorescein angiographic appearance, electrophysiology, and visual fields. All patients had heterozygous amino acid-changing variants (missense mutations) in the ABCA4 gene. A splice sequence change was found in a 30-year-old patient with severly affected vision. Two novel sequence changes were identified: a missense mutation in a mildly affected 44-year-old patient and a frameshift mutation in a severly affected 34-year-old patient. The identified ABCA4 mutations were compatible with the resulting phenotypes in terms of BCVA. Higher BCVAs were recorded in patients with missense mutations. Sequence changes, predicted to have more deleterious effect on protein function, resulted in a more severe phenotype. This case series of STGD patients demonstrates novel genotype/phenotype correlations, which may be useful to counselling of patients. This information may prove useful in selection of candidates for clinical trials in ABCA4 disease.

A novel dysfunctional germline P53 mutation identified in a family with Li-Fraumeni syndrome.

PubMed

Ji, Min; Wang, Lin; Shao, Yuguo; Cao, Wei; Xu, Ting; Chen, Shujie; Wang, Zhiwei; He, Qi; Yang, Kuo

2018-01-01

Li-Fraumeni Syndrome (LFS), which is a rare dominantly inherited cancer predisposition syndrome, is associated with germline P53 mutations. Mutations of the tumor suppressor protein P53 are associated with more than 50% of human cancers; however, almost 30% of P53 mutations occur rarely and this has raised questions about their significance. It therefore appeared of particular interest that we identified a novel mutation in a patient suffering from breast cancer and fulfilling the diagnostic criteria of LFS. In this study, a patient with remarkable family history developed breast cancer and was diagnosed with LFS. By performing next-generation sequencing on the patient and subsequent verification by Sanger sequencing among other family members, a new germ-line P53 replication error, a trinucleotide repeat mutation in the coding region, was identified in two generations of this Li-Fraumeni family.

Evaluation of 10 genes encoding cardiac proteins in Doberman Pinschers with dilated cardiomyopathy.

PubMed

O'Sullivan, M Lynne; O'Grady, Michael R; Pyle, W Glen; Dawson, John F

2011-07-01

To identify a causative mutation for dilated cardiomyopathy (DCM) in Doberman Pinschers by sequencing the coding regions of 10 cardiac genes known to be associated with familial DCM in humans. 5 Doberman Pinschers with DCM and congestive heart failure and 5 control mixed-breed dogs that were euthanized or died. RNA was extracted from frozen ventricular myocardial samples from each dog, and first-strand cDNA was synthesized via reverse transcription, followed by PCR amplification with gene-specific primers. Ten cardiac genes were analyzed: cardiac actin, α-actinin, α-tropomyosin, β-myosin heavy chain, metavinculin, muscle LIM protein, myosinbinding protein C, tafazzin, titin-cap (telethonin), and troponin T. Sequences for DCM-affected and control dogs and the published canine genome were compared. None of the coding sequences yielded a common causative mutation among all Doberman Pinscher samples. However, 3 variants were identified in the α-actinin gene in the DCM-affected Doberman Pinschers. One of these variants, identified in 2 of the 5 Doberman Pinschers, resulted in an amino acid change in the rod-forming triple coiled-coil domain. Mutations in the coding regions of several genes associated with DCM in humans did not appear to consistently account for DCM in Doberman Pinschers. However, an α-actinin variant was detected in some Doberman Pinschers that may contribute to the development of DCM given its potential effect on the structure of this protein. Investigation of additional candidate gene coding and noncoding regions and further evaluation of the role of α-actinin in development of DCM in Doberman Pinschers are warranted.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mebarki, F.; Forest, M.G.; Josso, N.

The androgen insensivity syndrome (AIS) is a recessive X-linked disorder resulting from a deficient function of the androgen receptor (AR). The human AR gene has 3 functional domains: N-terminal encoded by exon 1, DNA-binding domain encoded by exons 2 and 3, and androgen-binding domain encoded by exons 4 to 8. In order to characterize the molecular defects of the AR gene in AIS, the entire coding regions and the intronic bording sequences of the AR gene were amplified by PCR before automatic direct sequencing in 45 patients. Twenty seven different point mutations were found in 32 unrelated AIS patients: 18more » with a complete form (CAIS), 14 with a partial form (PAIS); 18 of these mutations are novel mutations, not published to date. Only 3 mutations were repeatedly found: R804H in 3 families; M780I in 3 families and R774C in 2 families. For 26 patients out of the 32 found to have a mutation, maternal DNA was collected and sequenced: 6 de novo mutations were detected (i.e. 23% of the cases). Finally, no mutation was detected in 13 patients (29%): 7 with CAIS and 6 familial severe PAIS. The latter all presented with perineal hypospadias, micropenis, 4 out of 6 being raised as girl. Diagnosis of AIS in these 13 families in whom no mutation was detected is supported by the following criteria: clinical data, familial history (2 or 3 index cases in the same family), familial segregation of the polymorphic CAG repeat of the AR gene. Mutations in intronic regions or the promoter of the AR gene could not explain all cases of AIS without mutations in the AR coding regions, because AR binding (performed in 9 out of 13) was normal in 6, suggesting the synthesis of an AR protein. This situation led us to speculate that another X-linked factor associated with the AR could be implicated in some cases of AIS.« less

Coherent Somatic Mutation in Autoimmune Disease

PubMed Central

Ross, Kenneth Andrew

2014-01-01

Background Many aspects of autoimmune disease are not well understood, including the specificities of autoimmune targets, and patterns of co-morbidity and cross-heritability across diseases. Prior work has provided evidence that somatic mutation caused by gene conversion and deletion at segmentally duplicated loci is relevant to several diseases. Simple tandem repeat (STR) sequence is highly mutable, both somatically and in the germ-line, and somatic STR mutations are observed under inflammation. Results Protein-coding genes spanning STRs having markers of mutability, including germ-line variability, high total length, repeat count and/or repeat similarity, are evaluated in the context of autoimmunity. For the initiation of autoimmune disease, antigens whose autoantibodies are the first observed in a disease, termed primary autoantigens, are informative. Three primary autoantigens, thyroid peroxidase (TPO), phogrin (PTPRN2) and filaggrin (FLG), include STRs that are among the eleven longest STRs spanned by protein-coding genes. This association of primary autoantigens with long STR sequence is highly significant (). Long STRs occur within twenty genes that are associated with sixteen common autoimmune diseases and atherosclerosis. The repeat within the TTC34 gene is an outlier in terms of length and a link with systemic lupus erythematosus is proposed. Conclusions The results support the hypothesis that many autoimmune diseases are triggered by immune responses to proteins whose DNA sequence mutates somatically in a coherent, consistent fashion. Other autoimmune diseases may be caused by coherent somatic mutations in immune cells. The coherent somatic mutation hypothesis has the potential to be a comprehensive explanation for the initiation of many autoimmune diseases. PMID:24988487

TCOF1 gene encodes a putative nucleolar phosphoprotein that exhibits mutations in Treacher Collins Syndrome throughout its coding region.

PubMed

Wise, C A; Chiang, L C; Paznekas, W A; Sharma, M; Musy, M M; Ashley, J A; Lovett, M; Jabs, E W

1997-04-01

Treacher Collins Syndrome (TCS) is the most common of the human mandibulofacial dysostosis disorders. Recently, a partial TCOF1 cDNA was identified and shown to contain mutations in TCS families. Here we present the entire exon/intron genomic structure and the complete coding sequence of TCOF1. TCOF1 encodes a low complexity protein of 1,411 amino acids, whose predicted protein structure reveals repeated motifs that mirror the organization of its exons. These motifs are shared with nucleolar trafficking proteins in other species and are predicted to be highly phosphorylated by casein kinase. Consistent with this, the full-length TCOF1 protein sequence also contains putative nuclear and nucleolar localization signals. Throughout the open reading frame, we detected an additional eight mutations in TCS families and several polymorphisms. We postulate that TCS results from defects in a nucleolar trafficking protein that is critically required during human craniofacial development.

A mutation in yeast mitochondrial DNA results in a precise excision of the terminal intron of the cytochrome b gene.

PubMed

Hill, J; McGraw, P; Tzagoloff, A

1985-03-25

The yeast nuclear gene CBP2 was previously proposed to code for a protein necessary for processing of the terminal intron in the cytochrome b pre-mRNA (McGraw, P., and Tzagoloff, A. (1983) J. Biol. Chem. 258, 9459-9468). In the present study we describe a mitochondrial mutation capable of suppressing the respiratory deficiency of cbp2 mutants. The mitochondrial suppressor mutation has been shown to be the result of a precise excision of the last intervening sequence from the cytochrome b gene. Strains with the altered mitochondrial DNA have normal levels of mature cytochrome b mRNA and of cytochrome b and exhibit wild type growth on glycerol. These results confirm that CBP2 codes for a protein specifically required for splicing of the cytochrome b intron and further suggest that absence of the intervening sequence does not noticeably affect the expression of respiratory function in mitochondria.

High mutation detection rate in TCOF1 among Treacher Collins syndrome patients reveals clustering of mutations and 16 novel pathogenic changes.

PubMed

Splendore, A; Silva, E O; Alonso, L G; Richieri-Costa, A; Alonso, N; Rosa, A; Carakushanky, G; Cavalcanti, D P; Brunoni, D; Passos-Bueno, M R

2000-10-01

Twenty-eight families with a clinical diagnosis of Treacher Collins syndrome were screened for mutations in the 25 coding exons of TCOF1 and their adjacent splice junctions through SSCP and direct sequencing. Pathogenic mutations were detected in 26 patients, yielding the highest detection rate reported so far for this disease (93%) and bringing the number of known disease-causing mutations from 35 to 51. This is the first report to describe clustering of pathogenic mutations. Thirteen novel polymorphic alterations were characterized, confirming previous reports that TCOF1 has an unusually high rate of single-nucleotide polymorphisms (SNPs) within its coding region. We suggest a possible different mechanism leading to TCS or genetic heterogeneity for this condition, as we identified two families with no apparent pathogenic mutation in the gene. Furthermore, our data confirm the absence of genotype-phenotype correlation and reinforce that the apparent anticipation often observed in TCS families is due to ascertainment bias. Copyright 2000 Wiley-Liss, Inc.

Identification of a Novel GJA8 (Cx50) Point Mutation Causes Human Dominant Congenital Cataracts

NASA Astrophysics Data System (ADS)

Ge, Xiang-Lian; Zhang, Yilan; Wu, Yaming; Lv, Jineng; Zhang, Wei; Jin, Zi-Bing; Qu, Jia; Gu, Feng

2014-02-01

Hereditary cataracts are clinically and genetically heterogeneous lens diseases that cause a significant proportion of visual impairment and blindness in children. Human cataracts have been linked with mutations in two genes, GJA3 and GJA8, respectively. To identify the causative mutation in a family with hereditary cataracts, family members were screened for mutations by PCR for both genes. Sequencing the coding regions of GJA8, coding for connexin 50, revealed a C > A transversion at nucleotide 264, which caused p.P88T mutation. To dissect the molecular consequences of this mutation, plasmids carrying wild-type and mutant mouse ORFs of Gja8 were generated and ectopically expressed in HEK293 cells and human lens epithelial cells, respectively. The recombinant proteins were assessed by confocal microscopy and Western blotting. The results demonstrate that the molecular consequences of the p.P88T mutation in GJA8 include changes in connexin 50 protein localization patterns, accumulation of mutant protein, and increased cell growth.

Diagnostic screening identifies a wide range of mutations involving the SHOX gene, including a common 47.5 kb deletion 160 kb downstream with a variable phenotypic effect.

PubMed

Bunyan, David J; Baker, Kevin R; Harvey, John F; Thomas, N Simon

2013-06-01

Léri-Weill dyschondrosteosis (LWD) results from heterozygous mutations of the SHOX gene, with homozygosity or compound heterozygosity resulting in the more severe form, Langer mesomelic dysplasia (LMD). These mutations typically take the form of whole or partial gene deletions, point mutations within the coding sequence, or large (>100 kb) 3' deletions of downstream regulatory elements. We have analyzed the coding sequence of the SHOX gene and its downstream regulatory regions in a cohort of 377 individuals referred with symptoms of LWD, LMD or short stature. A causative mutation was identified in 68% of the probands with LWD or LMD (91/134). In addition, a 47.5 kb deletion was found 160 kb downstream of the SHOX gene in 17 of the 377 patients (12% of the LWD referrals, 4.5% of all referrals). In 14 of these 17 patients, this was the only potentially causative abnormality detected (13 had symptoms consistent with LWD and one had short stature only), but the other three 47.5 kb deletions were found in patients with an additional causative SHOX mutation (with symptoms of LWD rather than LMD). Parental samples were available on 14/17 of these families, and analysis of these showed a more variable phenotype ranging from apparently unaffected to LWD. Breakpoint sequence analysis has shown that the 47.5 kb deletion is identical in all 17 patients, most likely due to an ancient founder mutation rather than recurrence. This deletion was not seen in 471 normal controls (P<0.0001), providing further evidence for a phenotypic effect, albeit one with variable penetration. Copyright © 2013 Wiley Periodicals, Inc.

New genetic variants of LATS1 detected in urinary bladder and colon cancer.

PubMed

Saadeldin, Mona K; Shawer, Heba; Mostafa, Ahmed; Kassem, Neemat M; Amleh, Asma; Siam, Rania

2014-01-01

LATS1, the large tumor suppressor 1 gene, encodes for a serine/threonine kinase protein and is implicated in cell cycle progression. LATS1 is down-regulated in various human cancers, such as breast cancer, and astrocytoma. Point mutations in LATS1 were reported in human sarcomas. Additionally, loss of heterozygosity of LATS1 chromosomal region predisposes to breast, ovarian, and cervical tumors. In the current study, we investigated LATS1 genetic variations including single nucleotide polymorphisms (SNPs), in 28 Egyptian patients with either urinary bladder or colon cancers. The LATS1 gene was amplified and sequenced and the expression of LATS1 at the RNA level was assessed in 12 urinary bladder cancer samples. We report, the identification of a total of 29 variants including previously identified SNPs within LATS1 coding and non-coding sequences. A total of 18 variants were novel. Majority of the novel variants, 13, were mapped to intronic sequences and un-translated regions of the gene. Four of the five novel variants located in the coding region of the gene, represented missense mutations within the serine/threonine kinase catalytic domain. Interestingly, LATS1 RNA steady state levels was lost in urinary bladder cancerous tissue harboring four specific SNPs (16045 + 41736 + 34614 + 56177) positioned in the 5'UTR, intron 6, and two silent mutations within exon 4 and exon 8, respectively. This study identifies novel single-base-sequence alterations in the LATS1 gene. These newly identified variants could potentially be used as novel diagnostic or prognostic tools in cancer.

p53 in pure epithelioid PEComa: an immunohistochemistry study and gene mutation analysis.

PubMed

Bing, Zhanyong; Yao, Yuan; Pasha, Theresa; Tomaszewski, John E; Zhang, Paul J

2012-04-01

Pure epithelioid PEComa (PEP; so-called epithelioid angiomyolipoma) is rare and is more often associated with aggressive behaviors. The pathogenesis of PEP has been poorly understood. The authors studied p53 expression and gene mutation in PEPs by immunohistochemistry, single-strand conformation polymorphism, and direct sequencing in paraffin material from 8 PEPs. A group of classic angiomyolipomas (AMLs) were also analyzed for comparison. Five PEPs were from kidneys and 1 each from the heart, the liver, and the uterus. PEPs showed much stronger p53 nuclear staining (Allred score 6.4 ± 2.5) than the classic AML (2.3 ± 2.9) (P < .01). There was no p53 single-strand conformation polymorphism identified in either the PEPs or the 8 classic AMLs. p53 mutation analyses by direct sequencing of exons 5 to 9 showed 4 mutations in 3 of 8 PEPs but none in any of the 8 classic AMLs. The mutations included 2 missense mutations in a hepatic PEComa and 2 silent mutations in 2 renal PEPs. Both the missense mutations in the hepatic PEComa involved the exon 5, one involving codon 165, with change from CAG to CAC (coding amino acid changed from glutamine to histidine), and the other involving codon 182, with change from TGC to TAC (coding amino acid changed from cysteine to tyrosine). The finding of stronger p53 expression and mutations in epithelioid angiomyolipomas might have contributed to their less predictable behavior. However, the abnormal p53 expression cannot be entirely explained by p53 mutations in the exons examined in the PEPs.

Genotype-phenotype correlation of xeroderma pigmentosum in a Chinese Han population.

PubMed

Sun, Z; Zhang, J; Guo, Y; Ni, C; Liang, J; Cheng, R; Li, M; Yao, Z

2015-04-01

Xeroderma pigmentosum (XP) is a rare autosomal recessive disorder characterized by extreme sensitivity to sunlight, freckle-like pigmentation and a greatly increased incidence of skin cancers. Genetic mutation detection and genotype-phenotype analysis of XP are rarely reported in the Chinese Han population. To investigate the mutational spectrum of XP in a Chinese Han population, to discover any genotype-phenotype correlation and, consequently, to propose a simple and effective tool for the molecular diagnosis of XP. This study was carried out on 12 unrelated Chinese families that included 13 patients with clinically suspected XP. Genomic DNA was extracted from peripheral blood samples. Mutation screening was performed by direct sequencing of exons and flanking intron-exon boundaries for the entire coding region of eight XP genes. In 12 patients, direct sequencing of the whole coding region of eight XP genes revealed pathogenic mutations, including seven compound heterozygous mutations, three homozygous mutations and a Japanese founder mutation. Thirteen mutations have not been previously identified. This cohort was composed of four patients with XP-C (XPC), two with XP-G (ERCC5), three with XP-A (XPA) and three with XP-V (POLH). This study identified 13 novel mutations and extended the mutation spectrum of XP in the Chinese Han population. In this cohort, we found that patients with XP-G have no neurological symptoms, and patients with XP-A and XP-V have a high incidence of malignancy. Furthermore, lack of stringent protection against sunlight, late diagnosis and long duration of disease play an important role. © 2014 British Association of Dermatologists.

Mutational spectrum of Xeroderma pigmentosum group A in Egyptian patients.

PubMed

Amr, Khalda; Messaoud, Olfa; El Darouti, Mohamad; Abdelhak, Sonia; El-Kamah, Ghada

2014-01-01

Xeroderma pigmentosum (XP) is a rare autosomal recessive hereditary disease characterized by hyperphotosensitivity, DNA repair defects and a predisposition to skin cancers. The most frequently occurring type worldwide is the XP group A (XPA). There is a close relationship between the clinical features that ranged from severe to mild form and the mutational site in XPA gene. The aim of this study is to carry out the mutational analysis in Egyptian patients with XP-A. This study was carried out on four unrelated Egyptian XP-A families. Clinical features were examined and direct sequencing of the coding region of XPA gene was performed in patients and their parents. Direct sequencing of the whole coding region of the XPA gene revealed the identification of two homozygous nonsense mutations: (c.553C >T; p.(Gln185)) and (c.331G>T; p.(Glu111)), which create premature, stop codon and a homodeletion (c.374delC: p.Thr125Ilefs 15) that leads to frameshift and premature translation termination. We report the identification of one novel XPA gene mutation and two known mutations in four unrelated Egyptian families with Xermoderma pigmentosum. All explored patients presented severe neurological abnormalities and have mutations located in the DNA binding domain. This report gives insight on the mutation spectrum of XP-A in Egypt. This would provide a valuable tool for early diagnosis of this severe disease. © 2013 Elsevier B.V. All rights reserved.

A single base substitution in the coding region for neurophysin II associated with familial central diabetes insipidus.

PubMed Central

Ito, M; Mori, Y; Oiso, Y; Saito, H

1991-01-01

To elucidate the molecular mechanism of familial central diabetes insipidus (FDI), we sequenced the arginine vasopressin-neurophysin II (AVP-NPII) gene in 2 patients belonging to a pedigree that is consistent with an autosomal dominant mode of inheritance. 10 patients with idiopathic central diabetes insipidus (IDI) and 5 normals were also studied. The AVP-NPII gene, locating on chromosome 20, consists of three exons that encode putative signal peptide, AVP, NPII, and glycoprotein. Using polymerase chain reaction, fragments including the promoter region and all coding regions were amplified from genomic DNA and subjected to direct sequencing. Sequences of 10 patients with IDI were identical with those of normals, while in 2 patients with FDI, a single base substitution was detected in one of two alleles of the AVP-NPII gene, indicating they were heterozygotes for this mutation. It was a G----A transition at nucleotide position 1859 in the second exon, resulting in a substitution of Gly for Ser at amino acid position 57 in the NPII moiety. It was speculated that the mutated AVP-NPII precursor or the mutated NPII molecule, through their conformational changes, might be responsible for AVP deficiency. Images PMID:1840604

CFTR gene mutations in isolated chronic obstructive pulmonary disease

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pignatti, P.F.; Bombien, C.; Marigo, C.

1994-09-01

In order to identify a possible hereditary predisposition to the development of chronic obstructive pulmonary disease (COPD), we have looked for the presence of cystic fibrosis transmembrane regulator (CFTR) gene DNA sequence modifications in 28 unrelated patients with no signs of cystic fibrosis. The known mutations in Italian CF patients, as well as the most frequent worldwide CF mutations, were investigated. In addition, a denaturing gradient gel electrophoresis analysis of about half of the coding sequence of the gene in 56 chromosomes from the patients and in 102 chromosomes from control individuals affected by other pulmonary diseases and from normalmore » controls was performed. Nine different CFTR gene mutations and polymorphisms were found in seven patients, a highly significant increase over controls. Two of the patients were compound heterozygotes. Two frequent CF mutations were detected: deletion F508 and R117H; two rare CF mutations: R1066C and 3667ins4; and five CF sequence variants: R75Q (which was also described as a disease-causing mutation in male sterility cases due to the absence of the vasa deferentia), G576A, 2736 A{r_arrow}G, L997F, and 3271+18C{r_arrow}T. Seven (78%) of the mutations are localized in transmembrane domains. Six (86%) of the patients with defined mutations and polymorphisms had bronchiectasis. These results indicate that CFTR gene mutations and sequence alterations may be involved in the etiopathogenesis of some cases of COPD.« less

De novo mutations in regulatory elements in neurodevelopmental disorders

PubMed Central

Short, Patrick J.; McRae, Jeremy F.; Gallone, Giuseppe; Sifrim, Alejandro; Won, Hyejung; Geschwind, Daniel H.; Wright, Caroline F.; Firth, Helen V; FitzPatrick, David R.; Barrett, Jeffrey C.; Hurles, Matthew E.

2018-01-01

We previously estimated that 42% of patients with severe developmental disorders carry pathogenic de novo mutations in coding sequences. The role of de novo mutations in regulatory elements affecting genes associated with developmental disorders, or other genes, has been essentially unexplored. We identified de novo mutations in three classes of putative regulatory elements in almost 8,000 patients with developmental disorders. Here we show that de novo mutations in highly evolutionarily conserved fetal brain-active elements are significantly and specifically enriched in neurodevelopmental disorders. We identified a significant twofold enrichment of recurrently mutated elements. We estimate that, genome-wide, 1-3% of patients without a diagnostic coding variant carry pathogenic de novo mutations in fetal brain-active regulatory elements and that only 0.15% of all possible mutations within highly conserved fetal brain-active elements cause neurodevelopmental disorders with a dominant mechanism. Our findings represent a robust estimate of the contribution of de novo mutations in regulatory elements to this genetically heterogeneous set of disorders, and emphasize the importance of combining functional and evolutionary evidence to identify regulatory causes of genetic disorders. PMID:29562236

Comparative Mitogenomics of Plant Bugs (Hemiptera: Miridae): Identifying the AGG Codon Reassignments between Serine and Lysine

PubMed Central

Wang, Pei; Song, Fan; Cai, Wanzhi

2014-01-01

Insect mitochondrial genomes are very important to understand the molecular evolution as well as for phylogenetic and phylogeographic studies of the insects. The Miridae are the largest family of Heteroptera encompassing more than 11,000 described species and of great economic importance. For better understanding the diversity and the evolution of plant bugs, we sequence five new mitochondrial genomes and present the first comparative analysis of nine mitochondrial genomes of mirids available to date. Our result showed that gene content, gene arrangement, base composition and sequences of mitochondrial transcription termination factor were conserved in plant bugs. Intra-genus species shared more conserved genomic characteristics, such as nucleotide and amino acid composition of protein-coding genes, secondary structure and anticodon mutations of tRNAs, and non-coding sequences. Control region possessed several distinct characteristics, including: variable size, abundant tandem repetitions, and intra-genus conservation; and was useful in evolutionary and population genetic studies. The AGG codon reassignments were investigated between serine and lysine in the genera Adelphocoris and other cimicomorphans. Our analysis revealed correlated evolution between reassignments of the AGG codon and specific point mutations at the antidocons of tRNALys and tRNASer(AGN). Phylogenetic analysis indicated that mitochondrial genome sequences were useful in resolving family level relationship of Cimicomorpha. Comparative evolutionary analysis of plant bug mitochondrial genomes allowed the identification of previously neglected coding genes or non-coding regions as potential molecular markers. The finding of the AGG codon reassignments between serine and lysine indicated the parallel evolution of the genetic code in Hemiptera mitochondrial genomes. PMID:24988409

Detecting very low allele fraction variants using targeted DNA sequencing and a novel molecular barcode-aware variant caller.

PubMed

Xu, Chang; Nezami Ranjbar, Mohammad R; Wu, Zhong; DiCarlo, John; Wang, Yexun

2017-01-03

Detection of DNA mutations at very low allele fractions with high accuracy will significantly improve the effectiveness of precision medicine for cancer patients. To achieve this goal through next generation sequencing, researchers need a detection method that 1) captures rare mutation-containing DNA fragments efficiently in the mix of abundant wild-type DNA; 2) sequences the DNA library extensively to deep coverage; and 3) distinguishes low level true variants from amplification and sequencing errors with high accuracy. Targeted enrichment using PCR primers provides researchers with a convenient way to achieve deep sequencing for a small, yet most relevant region using benchtop sequencers. Molecular barcoding (or indexing) provides a unique solution for reducing sequencing artifacts analytically. Although different molecular barcoding schemes have been reported in recent literature, most variant calling has been done on limited targets, using simple custom scripts. The analytical performance of barcode-aware variant calling can be significantly improved by incorporating advanced statistical models. We present here a highly efficient, simple and scalable enrichment protocol that integrates molecular barcodes in multiplex PCR amplification. In addition, we developed smCounter, an open source, generic, barcode-aware variant caller based on a Bayesian probabilistic model. smCounter was optimized and benchmarked on two independent read sets with SNVs and indels at 5 and 1% allele fractions. Variants were called with very good sensitivity and specificity within coding regions. We demonstrated that we can accurately detect somatic mutations with allele fractions as low as 1% in coding regions using our enrichment protocol and variant caller.

Identification of 13 new mutations in the vasopressin-neurophysin II gene in 17 kindreds with familial autosomal dominant neurohypophyseal diabetes insipidus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rittig, S.; Siggaard, C.; Pedersen, E.B.

1996-01-01

Familial neurohypophyseal diabetes insipidus (FNDI) is an autosomal dominant disorder characterized by progressive postnatal deficiency of arginine vasopressin as a result of mutation in the gene that encodes the hormone. To determine the extent of mutations in the coding region that produce the phenotype, we studied members of 17 unrelated kindreds with the disorder. We sequenced all 3 exons of the gene by using a rapid, direct dye-terminator method and found the causative mutation in each kindred. In four kindreds, the mutations were each identical to mutations described in other affected families. In the other 13 kindreds each mutation wasmore » unique. There were two missense mutations that altered the cleavage region of the signal peptide, seven missense mutations in exon 2, which codes for the conserved portion of the protein, one nonsense mutation in exon 2, and three nonsense mutations in exon 3. These findings, together with the clinical features of FNDI, suggest that each of the mutations exerts an effect by directing the production of a pre-prohormone that cannot be folded, processed, or degraded properly and eventually destroys vasopressinergic neurons. 63 refs., 5 figs., 6 tabs.« less

Identification of 13 new mutations in the vasopressin-neurophysin II gene in 17 kindreds with familial autosomal dominant neurohypophyseal diabetes insipidus.

PubMed Central

Rittig, S.; Robertson, G. L.; Siggaard, C.; Kovács, L.; Gregersen, N.; Nyborg, J.; Pedersen, E. B.

1996-01-01

Familial neurohypophyseal diabetes insipidus (FNDI) is an autosomal dominant disorder characterized by progressive postnatal deficiency of arginine vasopressin as a result of mutation in the gene that encodes the hormone. To determine the extent of mutations in the coding region that produce the phenotype, we studied members of 17 unrelated kindreds with the disorder. We sequenced all 3 exons of the gene by using a rapid, direct dye-terminator method and found the causative mutation in each kindred. In four kindreds, the mutations were each identical to mutations described in other affected families. In the other 13 kindreds each mutation was unique. There were two missense mutations that altered the cleavage region of the signal peptide, seven missense mutations in exon 2, which codes for the conserved portion of the protein, one nonsense mutation in exon 2, and three nonsense mutations in exon 3. These findings, together with the clinical features of FNDI, suggest that each of the mutations exerts an effect by directing the production of a pre-prohormone that cannot be folded, processed, or degraded properly and eventually destroys vasopressinergic neurons. Images Figure 3 PMID:8554046

Different rates of spontaneous mutation of chloroplastic and nuclear viroids as determined by high-fidelity ultra-deep sequencing.

PubMed

López-Carrasco, Amparo; Ballesteros, Cristina; Sentandreu, Vicente; Delgado, Sonia; Gago-Zachert, Selma; Flores, Ricardo; Sanjuán, Rafael

2017-09-01

Mutation rates vary by orders of magnitude across biological systems, being higher for simpler genomes. The simplest known genomes correspond to viroids, subviral plant replicons constituted by circular non-coding RNAs of few hundred bases. Previous work has revealed an extremely high mutation rate for chrysanthemum chlorotic mottle viroid, a chloroplast-replicating viroid. However, whether this is a general feature of viroids remains unclear. Here, we have used high-fidelity ultra-deep sequencing to determine the mutation rate in a common host (eggplant) of two viroids, each representative of one family: the chloroplastic eggplant latent viroid (ELVd, Avsunviroidae) and the nuclear potato spindle tuber viroid (PSTVd, Pospiviroidae). This revealed higher mutation frequencies in ELVd than in PSTVd, as well as marked differences in the types of mutations produced. Rates of spontaneous mutation, quantified in vivo using the lethal mutation method, ranged from 1/1000 to 1/800 for ELVd and from 1/7000 to 1/3800 for PSTVd depending on sequencing run. These results suggest that extremely high mutability is a common feature of chloroplastic viroids, whereas the mutation rates of PSTVd and potentially other nuclear viroids appear significantly lower and closer to those of some RNA viruses.

Different rates of spontaneous mutation of chloroplastic and nuclear viroids as determined by high-fidelity ultra-deep sequencing

PubMed Central

Ballesteros, Cristina; Sentandreu, Vicente; Gago-Zachert, Selma

2017-01-01

Mutation rates vary by orders of magnitude across biological systems, being higher for simpler genomes. The simplest known genomes correspond to viroids, subviral plant replicons constituted by circular non-coding RNAs of few hundred bases. Previous work has revealed an extremely high mutation rate for chrysanthemum chlorotic mottle viroid, a chloroplast-replicating viroid. However, whether this is a general feature of viroids remains unclear. Here, we have used high-fidelity ultra-deep sequencing to determine the mutation rate in a common host (eggplant) of two viroids, each representative of one family: the chloroplastic eggplant latent viroid (ELVd, Avsunviroidae) and the nuclear potato spindle tuber viroid (PSTVd, Pospiviroidae). This revealed higher mutation frequencies in ELVd than in PSTVd, as well as marked differences in the types of mutations produced. Rates of spontaneous mutation, quantified in vivo using the lethal mutation method, ranged from 1/1000 to 1/800 for ELVd and from 1/7000 to 1/3800 for PSTVd depending on sequencing run. These results suggest that extremely high mutability is a common feature of chloroplastic viroids, whereas the mutation rates of PSTVd and potentially other nuclear viroids appear significantly lower and closer to those of some RNA viruses. PMID:28910391

High-resolution melting analysis (HRM) for mutational screening of Dnajc17 gene in patients affected by thyroid dysgenesis.

PubMed

Nettore, I C; Desiderio, S; De Nisco, E; Cacace, V; Albano, L; Improda, N; Ungaro, P; Salerno, M; Colao, A; Macchia, P E

2018-06-01

Congenital hypothyroidism is a frequent disease occurring with an incidence of about 1/1500 newborns/year. In about 75% of the cases, CH is caused by alterations in thyroid morphogenesis, defined "thyroid dysgenesis" (TD). TD is generally a sporadic disease but in about 5% of the cases a genetic origin has been demonstrated. Previous studies indicate that Dnajc17 as a candidate modifier gene for hypothyroidism, since it is expressed in the thyroid bud, interacts with NKX2.1 and PAX8 and it has been associated to the hypothyroid phenotype in mice carrying a single Nkx2.1 and Pax8 genes (double heterozygous knock-out). The work evaluates the possible involvement of DNAJC17 in the pathogenesis of TD. High-resolution DNA melting analysis (HRM) and direct sequencing have been used to screen for mutations in the DNAJC17 coding sequence in 89 patients with TD. Two mutations have been identified in the coding sequence of DNAJC17 gene, one in exon 5 (c.350A>C; rs79709714) and one in exon 9 (c.610G>C; rs117485355). The last one is a rare variant, while the rs79709714 is a polymorphism. Both are present in databases and the frequency of the alleles is not different between TD patients and controls. DNAJC17 mutations are not frequently present in patients with TD.

Sulfonamide Resistance in Clinical Isolates of Campylobacter jejuni: Mutational Changes in the Chromosomal Dihydropteroate Synthase

PubMed Central

Gibreel, Amera; Sköld, Ola

1999-01-01

The characterization of the genetic basis of sulfonamide resistance in Campylobacter jejuni was attempted. The resistance determinant from a sulfonamide-resistant strain of C. jejuni was cloned and was found to show 42% identity with the folP gene (which codes for dihydropteroate synthase, the target of sulfonamides) of the related bacterium Helicobacter pylori. The sequences of the areas surrounding the folP gene in C. jejuni showed similarity to those of the areas surrounding the corresponding gene in H. pylori. The folP gene of C. jejuni, which mediates the resistance, was observed to show particular features when it was compared to other known folP genes. One of these features is the presence of two pairs of direct repeats (15 and 27 bp) within the coding sequence of the gene. Comparison of the C. jejuni folP genes that mediate susceptibility and resistance revealed the occurrence of mutations that changed four amino acid residues. Resistance of C. jejuni to sulfonamides could be associated with one or several of these four mutational substitutions, which all occurred in the five different resistant isolates studied. The codon for one of these changed amino acids was found to be located in the second direct repeat within the coding sequence of the gene. The change made the repeat perfect. The transformation of both the resistance and the susceptibility variants of the gene into an Escherichia coli folP knockout mutant was found to complement the dihydropteroate synthase deficiency, confirming that the characterized sulfonamide resistance determinant codes for the C. jejuni dihydropteroate synthase enzyme. Kinetic measurements established different affinities of sulfonamide for the dihydropteroate synthase enzyme isolated from the resistant and susceptible strains. In conclusion, sulfonamide resistance in C. jejuni was shown to be associated with mutational changes in the chromosomally located gene for dihydropteroate synthase, the target of sulfonamides. PMID:10471557

DNA copy number changes define spatial patterns of heterogeneity in colorectal cancer

PubMed Central

Mamlouk, Soulafa; Childs, Liam Harold; Aust, Daniela; Heim, Daniel; Melching, Friederike; Oliveira, Cristiano; Wolf, Thomas; Durek, Pawel; Schumacher, Dirk; Bläker, Hendrik; von Winterfeld, Moritz; Gastl, Bastian; Möhr, Kerstin; Menne, Andrea; Zeugner, Silke; Redmer, Torben; Lenze, Dido; Tierling, Sascha; Möbs, Markus; Weichert, Wilko; Folprecht, Gunnar; Blanc, Eric; Beule, Dieter; Schäfer, Reinhold; Morkel, Markus; Klauschen, Frederick; Leser, Ulf; Sers, Christine

2017-01-01

Genetic heterogeneity between and within tumours is a major factor determining cancer progression and therapy response. Here we examined DNA sequence and DNA copy-number heterogeneity in colorectal cancer (CRC) by targeted high-depth sequencing of 100 most frequently altered genes. In 97 samples, with primary tumours and matched metastases from 27 patients, we observe inter-tumour concordance for coding mutations; in contrast, gene copy numbers are highly discordant between primary tumours and metastases as validated by fluorescent in situ hybridization. To further investigate intra-tumour heterogeneity, we dissected a single tumour into 68 spatially defined samples and sequenced them separately. We identify evenly distributed coding mutations in APC and TP53 in all tumour areas, yet highly variable gene copy numbers in numerous genes. 3D morpho-molecular reconstruction reveals two clusters with divergent copy number aberrations along the proximal–distal axis indicating that DNA copy number variations are a major source of tumour heterogeneity in CRC. PMID:28120820

[Cystic fibrosis gene mutations in the West of France: clinical application].

PubMed

Verlingue, C; Travert, G; Le Roux, M G; Laroche, D; Audrézet, M P; Mercier, B; Moisan, J P; Férec, C

1994-01-01

The cystic fibrosis transmembrane conductance regulator (CFTR) gene, responsible for the cystic fibrosis phenotype when both alleles are mutated, was cloned and sequenced in 1989. Since then, more than 400 mutations have been reported in the gene, although most of these are rare. We have systematically analysed the entire coding sequence of the CFTR gene in a cohort of patients originating from the West of France (Caen, Brest and Nantes). More than 450 CF children, 914 chromosomes in all, have been exhaustively studied in the three centers. We have been able to characterize more than 90% of the mutations, respectively 93.5%, 99% and 95.8%. Despite the large diversity in the CFTR mutations occurring in CF patients from this area, these results can help to improve genetic counselling, prenatal diagnosis as well as our understanding of the molecular basis of the pathophysiology of cystic fibrosis.

High frequency of ribosomal protein gene deletions in Italian Diamond-Blackfan anemia patients detected by multiplex ligation-dependent probe amplification assay

PubMed Central

Quarello, Paola; Garelli, Emanuela; Brusco, Alfredo; Carando, Adriana; Mancini, Cecilia; Pappi, Patrizia; Vinti, Luciana; Svahn, Johanna; Dianzani, Irma; Ramenghi, Ugo

2012-01-01

Diamond-Blackfan anemia is an autosomal dominant disease due to mutations in nine ribosomal protein encoding genes. Because most mutations are loss of function and detected by direct sequencing of coding exons, we reasoned that part of the approximately 50% mutation negative patients may have carried a copy number variant of ribosomal protein genes. As a proof of concept, we designed a multiplex ligation-dependent probe amplification assay targeted to screen the six genes that are most frequently mutated in Diamond-Blackfan anemia patients: RPS17, RPS19, RPS26, RPL5, RPL11, and RPL35A. Using this assay we showed that deletions represent approximately 20% of all mutations. The combination of sequencing and multiplex ligation-dependent probe amplification analysis of these six genes allows the genetic characterization of approximately 65% of patients, showing that Diamond-Blackfan anemia is indisputably a ribosomopathy. PMID:22689679

[Clinical classification and genetic mutation study of two pedigrees with type II Waardenburg syndrome].

PubMed

Chen, Yong; Yang, Fuwei; Zheng, Hexin; Zhu, Ganghua; Hu, Peng; Wu, Weijing

2015-12-01

To explore the molecular etiology of two pedigrees affected with type II Waardenburg syndrome (WS2) and to provide genetic diagnosis and counseling. Blood samples were collected from the proband and his family members. Following extraction of genomic DNA, the coding sequences of PAX3, MITF, SOX10 and SNAI2 genes were amplified with PCR and subjected to DNA sequencing to detect potential mutations. A heterozygous deletional mutation c.649_651delAGA in exon 7 of the MITF gene has been identified in all patients from the first family, while no mutation was found in the other WS2 related genes including PAX3, MITF, SOX10 and SNAI2. The heterozygous deletion mutation c.649_651delAGA in exon 7 of the MITF gene probably underlies the disease in the first family. It is expected that other genes may also underlie WS2.

[Detection of pathogenic mutations in Marfan syndrome by targeted next-generation semiconductor sequencing].

PubMed

Lu, Chaoxia; Wu, Wei; Xiao, Jifang; Meng, Yan; Zhang, Shuyang; Zhang, Xue

2013-06-01

To detect pathogenic mutations in Marfan syndrome (MFS) using an Ion Torrent Personal Genome Machine (PGM) and to validate the result of targeted next-generation semiconductor sequencing for the diagnosis of genetic disorders. Peripheral blood samples were collected from three MFS patients and a normal control with informed consent. Genomic DNA was isolated by standard method and then subjected to targeted sequencing using an Ion Ampliseq(TM) Inherited Disease Panel. Three multiplex PCR reactions were carried out to amplify the coding exons of 328 genes including FBN1, TGFBR1 and TGFBR2. DNA fragments from different samples were ligated with barcoded sequencing adaptors. Template preparation and emulsion PCR, and Ion Sphere Particles enrichment were carried out using an Ion One Touch system. The ion sphere particles were sequenced on a 318 chip using the PGM platform. Data from the PGM runs were processed using an Ion Torrent Suite 3.2 software to generate sequence reads. After sequence alignment and extraction of SNPs and indels, all the variants were filtered against dbSNP137. DNA sequences were visualized with an Integrated Genomics Viewer. The most likely disease-causing variants were analyzed by Sanger sequencing. The PGM sequencing has yielded an output of 855.80 Mb, with a > 100 × median sequencing depth and a coverage of > 98% for the targeted regions in all the four samples. After data analysis and database filtering, one known missense mutation (p.E1811K) and two novel premature termination mutations (p.E2264X and p.L871FfsX23) in the FBN1 gene were identified in the three MFS patients. All mutations were verified by conventional Sanger sequencing. Pathogenic FBN1 mutations have been identified in all patients with MFS, indicating that the targeted next-generation sequencing on the PGM sequencers can be applied for accurate and high-throughput testing of genetic disorders.

Solving Mendelian Mysteries: The Non-coding Genome May Hold the Key.

PubMed

Valente, Enza Maria; Bhatia, Kailash P

2018-02-22

Despite revolutionary advances in sequencing approaches, many mendelian disorders have remained unexplained. In this issue of Cell, Aneichyk et al. combine genomic and cell-type-specific transcriptomic data to causally link a non-coding mutation in the ubiquitous TAF1 gene to X-linked dystonia-parkinsonism. Copyright © 2018 Elsevier Inc. All rights reserved.

Molecular characterization demonstrates that the Zea mays gene sugary2 codes for the starch synthase isoform SSIIa.

PubMed

Zhang, Xiaoli; Colleoni, Christophe; Ratushna, Vlada; Sirghie-Colleoni, Mirella; James, Martha G; Myers, Alan M

2004-04-01

Mutations in the maize gene sugary2 ( su2 ) affect starch structure and its resultant physiochemical properties in useful ways, although the gene has not been characterized previously at the molecular level. This study tested the hypothesis that su2 codes for starch synthase IIa (SSIIa). Two independent mutations of the su2 locus, su2-2279 and su2-5178 , were identified in a Mutator -active maize population. The nucleotide sequence of the genomic locus that codes for SSIIa was compared between wild type plants and those homozygous for either novel mutation. Plants bearing su2-2279 invariably contained a Mutator transposon in exon 3 of the SSIIa gene, and su2-5178 mutants always contained a small retrotransposon-like insertion in exon 10. Six allelic su2 (-) mutations conditioned loss or reduction in abundance of the SSIIa protein detected by immunoblot. These data indicate that su2 codes for SSIIa and that deficiency in this isoform is ultimately responsible for the altered physiochemical properties of su2 (-) mutant starches. A specific starch synthase isoform among several identified in soluble endosperm extracts was absent in su2-2279 or su2-5178 mutants, indicating that SSIIa is active in the soluble phase during kernel development. The immediate structural effect of the su2 (-) mutations was shown to be increased abundance of short glucan chains in amylopectin and a proportional decrease in intermediate length chains, similar to the effects of SSII deficiency in other species.

SF3B1 mutations constitute a novel therapeutic target in breast cancer

PubMed Central

Maguire, Sarah L; Leonidou, Andri; Wai, Patty; Marchiò, Caterina; Ng, Charlotte KY; Sapino, Anna; Salomon, Anne-Vincent; Reis-Filho, Jorge S; Weigelt, Britta; Natrajan, Rachael C

2015-01-01

Mutations in genes encoding proteins involved in RNA splicing have been found to occur at relatively high frequencies in several tumour types including myelodysplastic syndromes, chronic lymphocytic leukaemia, uveal melanoma, and pancreatic cancer, and at lower frequencies in breast cancer. To investigate whether dysfunction in RNA splicing is implicated in the pathogenesis of breast cancer, we performed a re-analysis of published exome and whole genome sequencing data. This analysis revealed that mutations in spliceosomal component genes occurred in 5.6% of unselected breast cancers, including hotspot mutations in the SF3B1 gene, which were found in 1.8% of unselected breast cancers. SF3B1 mutations were significantly associated with ER-positive disease, AKT1 mutations, and distinct copy number alterations. Additional profiling of hotspot mutations in a panel of special histological subtypes of breast cancer showed that 16% and 6% of papillary and mucinous carcinomas of the breast harboured the SF3B1 K700E mutation. RNA sequencing identified differentially spliced events expressed in tumours with SF3B1 mutations including the protein coding genes TMEM14C, RPL31, DYNL11, UQCC, and ABCC5, and the long non-coding RNA CRNDE. Moreover, SF3B1 mutant cell lines were found to be sensitive to the SF3b complex inhibitor spliceostatin A and treatment resulted in perturbation of the splicing signature. Albeit rare, SF3B1 mutations result in alternative splicing events, and may constitute drivers and a novel therapeutic target in a subset of breast cancers. © 2014 The Authors. The Journal of Pathology published by John Wiley & Sons Ltd on behalf of Pathological Society of Great Britain and Ireland. PMID:25424858

Muscle RAS oncogene homolog (MRAS) recurrent mutation in Borrmann type IV gastric cancer.

PubMed

Yasumoto, Makiko; Sakamoto, Etsuko; Ogasawara, Sachiko; Isobe, Taro; Kizaki, Junya; Sumi, Akiko; Kusano, Hironori; Akiba, Jun; Torimura, Takuji; Akagi, Yoshito; Itadani, Hiraku; Kobayashi, Tsutomu; Hasako, Shinichi; Kumazaki, Masafumi; Mizuarai, Shinji; Oie, Shinji; Yano, Hirohisa

2017-01-01

The prognosis of patients with Borrmann type IV gastric cancer (Type IV) is extremely poor. Thus, there is an urgent need to elucidate the molecular mechanisms underlying the oncogenesis of Type IV and to identify new therapeutic targets. Although previous studies using whole-exome and whole-genome sequencing have elucidated genomic alterations in gastric cancer, none has focused on comprehensive genetic analysis of Type IV. To discover cancer-relevant genes in Type IV, we performed whole-exome sequencing and genome-wide copy number analysis on 13 patients with Type IV. Exome sequencing identified 178 somatic mutations in protein-coding sequences or at splice sites. Among the mutations, we found a mutation in muscle RAS oncogene homolog (MRAS), which is predicted to cause molecular dysfunction. MRAS belongs to the Ras subgroup of small G proteins, which includes the prototypic RAS oncogenes. We analyzed an additional 46 Type IV samples to investigate the frequency of MRAS mutation. There were eight nonsynonymous mutations (mutation frequency, 17%), showing that MRAS is recurrently mutated in Type IV. Copy number analysis identified six focal amplifications and one homozygous deletion, including insulin-like growth factor 1 receptor (IGF1R) amplification. The samples with IGF1R amplification had remarkably higher IGF1R mRNA and protein expression levels compared with the other samples. This is the first report of MRAS recurrent mutation in human tumor samples. Our results suggest that MRAS mutation and IGF1R amplification could drive tumorigenesis of Type IV and could be new therapeutic targets. © 2016 The Authors. Cancer Medicine published by John Wiley & Sons Ltd.

microRNA-122 target sites in the hepatitis C virus RNA NS5B coding region and 3' untranslated region: function in replication and influence of RNA secondary structure.

PubMed

Gerresheim, Gesche K; Dünnes, Nadia; Nieder-Röhrmann, Anika; Shalamova, Lyudmila A; Fricke, Markus; Hofacker, Ivo; Höner Zu Siederdissen, Christian; Marz, Manja; Niepmann, Michael

2017-02-01

We have analyzed the binding of the liver-specific microRNA-122 (miR-122) to three conserved target sites of hepatitis C virus (HCV) RNA, two in the non-structural protein 5B (NS5B) coding region and one in the 3' untranslated region (3'UTR). miR-122 binding efficiency strongly depends on target site accessibility under conditions when the range of flanking sequences available for the formation of local RNA secondary structures changes. Our results indicate that the particular sequence feature that contributes most to the correlation between target site accessibility and binding strength varies between different target sites. This suggests that the dynamics of miRNA/Ago2 binding not only depends on the target site itself but also on flanking sequence context to a considerable extent, in particular in a small viral genome in which strong selection constraints act on coding sequence and overlapping cis-signals and model the accessibility of cis-signals. In full-length genomes, single and combination mutations in the miR-122 target sites reveal that site 5B.2 is positively involved in regulating overall genome replication efficiency, whereas mutation of site 5B.3 showed a weaker effect. Mutation of the 3'UTR site and double or triple mutants showed no significant overall effect on genome replication, whereas in a translation reporter RNA, the 3'UTR target site inhibits translation directed by the HCV 5'UTR. Thus, the miR-122 target sites in the 3'-region of the HCV genome are involved in a complex interplay in regulating different steps of the HCV replication cycle.

Mutation Scanning in Wheat by Exon Capture and Next-Generation Sequencing.

PubMed

King, Robert; Bird, Nicholas; Ramirez-Gonzalez, Ricardo; Coghill, Jane A; Patil, Archana; Hassani-Pak, Keywan; Uauy, Cristobal; Phillips, Andrew L

2015-01-01

Targeted Induced Local Lesions in Genomes (TILLING) is a reverse genetics approach to identify novel sequence variation in genomes, with the aims of investigating gene function and/or developing useful alleles for breeding. Despite recent advances in wheat genomics, most current TILLING methods are low to medium in throughput, being based on PCR amplification of the target genes. We performed a pilot-scale evaluation of TILLING in wheat by next-generation sequencing through exon capture. An oligonucleotide-based enrichment array covering ~2 Mbp of wheat coding sequence was used to carry out exon capture and sequencing on three mutagenised lines of wheat containing previously-identified mutations in the TaGA20ox1 homoeologous genes. After testing different mapping algorithms and settings, candidate SNPs were identified by mapping to the IWGSC wheat Chromosome Survey Sequences. Where sequence data for all three homoeologues were found in the reference, mutant calls were unambiguous; however, where the reference lacked one or two of the homoeologues, captured reads from these genes were mis-mapped to other homoeologues, resulting either in dilution of the variant allele frequency or assignment of mutations to the wrong homoeologue. Competitive PCR assays were used to validate the putative SNPs and estimate cut-off levels for SNP filtering. At least 464 high-confidence SNPs were detected across the three mutagenized lines, including the three known alleles in TaGA20ox1, indicating a mutation rate of ~35 SNPs per Mb, similar to that estimated by PCR-based TILLING. This demonstrates the feasibility of using exon capture for genome re-sequencing as a method of mutation detection in polyploid wheat, but accurate mutation calling will require an improved genomic reference with more comprehensive coverage of homoeologues.

Combining Structural Modeling with Ensemble Machine Learning to Accurately Predict Protein Fold Stability and Binding Affinity Effects upon Mutation

PubMed Central

Garcia Lopez, Sebastian; Kim, Philip M.

2014-01-01

Advances in sequencing have led to a rapid accumulation of mutations, some of which are associated with diseases. However, to draw mechanistic conclusions, a biochemical understanding of these mutations is necessary. For coding mutations, accurate prediction of significant changes in either the stability of proteins or their affinity to their binding partners is required. Traditional methods have used semi-empirical force fields, while newer methods employ machine learning of sequence and structural features. Here, we show how combining both of these approaches leads to a marked boost in accuracy. We introduce ELASPIC, a novel ensemble machine learning approach that is able to predict stability effects upon mutation in both, domain cores and domain-domain interfaces. We combine semi-empirical energy terms, sequence conservation, and a wide variety of molecular details with a Stochastic Gradient Boosting of Decision Trees (SGB-DT) algorithm. The accuracy of our predictions surpasses existing methods by a considerable margin, achieving correlation coefficients of 0.77 for stability, and 0.75 for affinity predictions. Notably, we integrated homology modeling to enable proteome-wide prediction and show that accurate prediction on modeled structures is possible. Lastly, ELASPIC showed significant differences between various types of disease-associated mutations, as well as between disease and common neutral mutations. Unlike pure sequence-based prediction methods that try to predict phenotypic effects of mutations, our predictions unravel the molecular details governing the protein instability, and help us better understand the molecular causes of diseases. PMID:25243403

Mutations Affecting Expression of the rosy Locus in Drosophila melanogaster

PubMed Central

Lee, Chong Sung; Curtis, Daniel; McCarron, Margaret; Love, Carol; Gray, Mark; Bender, Welcome; Chovnick, Arthur

1987-01-01

The rosy locus in Drosophila melanogaster codes for the enzyme xanthine dehydrogenase (XDH). Previous studies defined a "control element" near the 5' end of the gene, where variant sites affected the amount of rosy mRNA and protein produced. We have determined the DNA sequence of this region from both genomic and cDNA clones, and from the ry+10 underproducer strain. This variant strain had many sequence differences, so that the site of the regulatory change could not be fixed. A mutagenesis was also undertaken to isolate new regulatory mutations. We induced 376 new mutations with 1-ethyl-1-nitrosourea (ENU) and screened them to isolate those that reduced the amount of XDH protein produced, but did not change the properties of the enzyme. Genetic mapping was used to find mutations located near the 5' end of the gene. DNA from each of seven mutants was cloned and sequenced through the 5' region. Mutant base changes were identified in all seven; they appear to affect splicing and translation of the rosy mRNA. In a related study (T. P. Keith et al. 1987), the genomic and cDNA sequences are extended through the 3' end of the gene; the combined sequences define the processing pattern of the rosy transcript and predict the amino acid sequence of XDH. PMID:3036645

A Novel Missense Mutation of Doublecortin: Mutation Analysis of Korean Patients with Subcortical Band Heterotopia

PubMed Central

Kim, Myeong-Kyu; Park, Man-Seok; Kim, Byeong-Chae; Cho, Ki-Hyun; Kim, Young-Seon; Kim, Jin-Hee; Heo, Tag; Kim, Eun-Young

2005-01-01

The neuronal migration disorders, X-linked lissencephaly syndrome (XLIS) and subcortical band heterotopia (SBH), also called "double cortex", have been linked to missense, nonsense, aberrant splicing, deletion, and insertion mutations in doublecortin (DCX) in families and sporadic cases. Most DCX mutations identified to date are located in two evolutionarily conserved domains. We performed mutation analysis of DCX in two Korean patients with SBH. The SBH patients had mild to moderate developmental delays, drug-resistant generalized seizures, and diffuse thick SBH upon brain MRI. Sequence analysis of the DCX coding region in Patient 1 revealed a c.386 C>T change in exon 3. The sequence variation results in a serine to leucine amino acid change at position 129 (S129L), which has not been found in other family members of Patient 1 or in a large panel of 120 control X-chromosomes. We report here a novel c.386 C>T mutation of DCX that is responsible for SBH. PMID:16100463

No evidence of radiation effect on mutation rates at hypervariable minisatellite loci in the germ cells of atomic bomb survivors.

PubMed

Kodaira, Mieko; Izumi, Shizue; Takahashi, Norio; Nakamura, Nori

2004-10-01

Human minisatellites consist of tandem arrays of short repeat sequences, and some are highly polymorphic in numbers of repeats among individuals. Since these loci mutate much more frequently than coding sequences, they make attractive markers for screening populations for genetic effects of mutagenic agents. Here we report the results of our analysis of mutations at eight hypervariable minisatellite loci in the offspring (61 from exposed families in 60 of which only one parent was exposed, and 58 from unexposed parents) of atomic bomb survivors with mean doses of >1 Sv. We found 44 mutations in paternal alleles and eight mutations in maternal alleles with no indication that the high doses of acutely applied radiation had caused significant genetic effects. Our finding contrasts with those of some other studies in which much lower radiation doses, applied chronically, caused significantly increased mutation rates. Possible reasons for this discrepancy are discussed.

Identification of novel mutations in the α-galactosidase A gene in patients with Fabry disease: pitfalls of mutation analyses in patients with low α-galactosidase A activity.

PubMed

Yoshimitsu, Makoto; Higuchi, Koji; Miyata, Masaaki; Devine, Sean; Mattman, Andre; Sirrs, Sandra; Medin, Jeffrey A; Tei, Chuwa; Takenaka, Toshihiro

2011-05-01

Fabry disease is an X-linked lysosomal storage disorder caused by mutations of the α-galactosidase A (GLA) gene, and the disease is a relatively prevalent cause of left ventricular hypertrophy followed by conduction abnormalities and arrhythmias. Mutation analysis of the GLA gene is a valuable tool for accurate diagnosis of affected families. In this study, we carried out molecular studies of 10 unrelated families diagnosed with Fabry disease. Genetic analysis of the GLA gene using conventional genomic sequencing was performed in 9 hemizygous males and 6 heterozygous females. In patients with no mutations in coding DNA sequence, multiplex ligation-dependent probe amplification (MLPA) and/or cDNA sequencing were performed. We identified a novel exon 2 deletion (IVS1_IVS2) in a heterozygous female by MLPA, which was undetectable by conventional sequencing methods. In addition, the g.9331G>A mutation that has previously been found only in patients with cardiac Fabry disease was found in 3 unrelated, newly-diagnosed, cardiac Fabry patients by sequencing GLA genomic DNA and cDNA. Two other novel mutations, g.8319A>G and 832delA were also found in addition to 4 previously reported mutations (R112C, C142Y, M296I, and G373D) in 6 other families. We could identify GLA gene mutations in all hemizygotes and heterozygotes from 10 families with Fabry disease. Mutations in 4 out of 10 families could not be identified by classical genomic analysis, which focuses on exons and the flanking region. Instead, these data suggest that MLPA analysis and cDNA sequence should be considered in genetic testing surveys of patients with Fabry disease. Copyright © 2011 Japanese College of Cardiology. Published by Elsevier Ltd. All rights reserved.

The contribution of de novo coding mutations to autism spectrum disorder

PubMed Central

Iossifov, Ivan; O’Roak, Brian J.; Sanders, Stephan J.; Ronemus, Michael; Krumm, Niklas; Levy, Dan; Stessman, Holly A.; Witherspoon, Kali; Vives, Laura; Patterson, Karynne E.; Smith, Joshua D.; Paeper, Bryan; Nickerson, Deborah A.; Dea, Jeanselle; Dong, Shan; Gonzalez, Luis E.; Mandell, Jefferey D.; Mane, Shrikant M.; Murtha, Michael T.; Sullivan, Catherine A.; Walker, Michael F.; Waqar, Zainulabedin; Wei, Liping; Willsey, A. Jeremy; Yamrom, Boris; Lee, Yoon-ha; Grabowska, Ewa; Dalkic, Ertugrul; Wang, Zihua; Marks, Steven; Andrews, Peter; Leotta, Anthony; Kendall, Jude; Hakker, Inessa; Rosenbaum, Julie; Ma, Beicong; Rodgers, Linda; Troge, Jennifer; Narzisi, Giuseppe; Yoon, Seungtai; Schatz, Michael C.; Ye, Kenny; McCombie, W. Richard; Shendure, Jay; Eichler, Evan E.; State, Matthew W.; Wigler, Michael

2015-01-01

We sequenced exomes from more than 2,500 simplex families each having a child with an autistic spectrum disorder (ASD). By comparing affected to unaffected siblings, we estimate that 13% of de novo (DN) missense mutations and 42% of DN likely gene-disrupting (LGD) mutations contribute to 12% and 9% of diagnoses, respectively. Including copy number variants, coding DN mutations contribute to about 30% of all simplex and 45% of female diagnoses. Virtually all LGD mutations occur opposite wild-type alleles. LGD targets in affected females significantly overlap the targets in males of lower IQ, but neither overlaps significantly with targets in males of higher IQ. We estimate that LGD mutation in about 400 genes can contribute to the joint class of affected females and males of lower IQ, with an overlapping and similar number of genes vulnerable to causative missense mutation. LGD targets in the joint class overlap with published targets for intellectual disability and schizophrenia, and are enriched for chromatin modifiers, FMRP-associated genes and embryonically expressed genes. Virtually all significance for the latter comes from affected females. PMID:25363768

Novel mutations in the CHST6 gene associated with macular corneal dystrophy in southern India.

PubMed

Warren, John F; Aldave, Anthony J; Srinivasan, M; Thonar, Eugene J; Kumar, Abha B; Cevallos, Vicky; Whitcher, John P; Margolis, Todd P

2003-11-01

To further characterize the role of the carbohydrate sulfotransferase (CHST6) gene in macular corneal dystrophy (MCD) through identification of causative mutations in a cohort of affected patients from southern India. Genomic DNA was extracted from buccal epithelium of 75 patients (51 families) with MCD, 33 unaffected relatives, and 48 healthy volunteers. The coding region of the CHST6 gene was evaluated by means of polymerase chain reaction amplification and direct sequencing. Subtyping of MCD into types I and II was performed by measuring serum levels of antigenic keratan sulfate. Seventy patients were classified as having type I MCD, and 5 patients as having type II MCD. Analysis of the CHST6 coding region in patients with type I MCD identified 11 homozygous missense mutations (Leu22Arg, His42Tyr, Arg50Cys, Arg50Leu, Ser53Leu, Arg97Pro, Cys102Tyr, Arg127Cys, Arg205Gln, His249Pro, and Glu274Lys), 2 compound heterozygous missense mutations (Arg93His and Ala206Thr), 5 homozygous deletion mutations (delCG707-708, delC890, delA1237, del1748-1770, and delORF), and 2 homozygous replacement mutations (ACCTAC 1273 GGT, and GCG 1304 AT). One patient with type II MCD was heterozygous for the C890 deletion mutation, whereas 4 possessed no CHST6 coding region mutations. A variety of previously unreported mutations in the coding region of the CHST6 gene are associated with type I MCD in a cohort of patients in southern India. An improved understanding of the genetic basis of MCD allows for earlier, more accurate diagnosis of affected individuals, and may provide the foundation for the development of novel disease treatments.

The Use and Effectiveness of Triple Multiplex System for Coding Region Single Nucleotide Polymorphism in Mitochondrial DNA Typing of Archaeologically Obtained Human Skeletons from Premodern Joseon Tombs of Korea

PubMed Central

Oh, Chang Seok; Lee, Soong Deok; Kim, Yi-Suk; Shin, Dong Hoon

2015-01-01

Previous study showed that East Asian mtDNA haplogroups, especially those of Koreans, could be successfully assigned by the coupled use of analyses on coding region SNP markers and control region mutation motifs. In this study, we tried to see if the same triple multiplex analysis for coding regions SNPs could be also applicable to ancient samples from East Asia as the complementation for sequence analysis of mtDNA control region. By the study on Joseon skeleton samples, we know that mtDNA haplogroup determined by coding region SNP markers successfully falls within the same haplogroup that sequence analysis on control region can assign. Considering that ancient samples in previous studies make no small number of errors in control region mtDNA sequencing, coding region SNP analysis can be used as good complimentary to the conventional haplogroup determination, especially of archaeological human bone samples buried underground over long periods. PMID:26345190

Multiple origins of resistance-conferring mutations in Plasmodium vivax dihydrofolate reductase

PubMed Central

Hawkins, Vivian N; Auliff, Alyson; Prajapati, Surendra Kumar; Rungsihirunrat, Kanchana; Hapuarachchi, Hapuarachchige C; Maestre, Amanda; O'Neil, Michael T; Cheng, Qin; Joshi, Hema; Na-Bangchang, Kesara; Sibley, Carol Hopkins

2008-01-01

Background In order to maximize the useful therapeutic life of antimalarial drugs, it is crucial to understand the mechanisms by which parasites resistant to antimalarial drugs are selected and spread in natural populations. Recent work has demonstrated that pyrimethamine-resistance conferring mutations in Plasmodium falciparum dihydrofolate reductase (dhfr) have arisen rarely de novo, but spread widely in Asia and Africa. The origin and spread of mutations in Plasmodium vivax dhfr were assessed by constructing haplotypes based on sequencing dhfr and its flanking regions. Methods The P. vivax dhfr coding region, 792 bp upstream and 683 bp downstream were amplified and sequenced from 137 contemporary patient isolates from Colombia, India, Indonesia, Papua New Guinea, Sri Lanka, Thailand, and Vanuatu. A repeat motif located 2.6 kb upstream of dhfr was also sequenced from 75 of 137 patient isolates, and mutational relationships among the haplotypes were visualized using the programme Network. Results Synonymous and non-synonymous single nucleotide polymorphisms (SNPs) within the dhfr coding region were identified, as was the well-documented in-frame insertion/deletion (indel). SNPs were also identified upstream and downstream of dhfr, with an indel and a highly polymorphic repeat region identified upstream of dhfr. The regions flanking dhfr were highly variable. The double mutant (58R/117N) dhfr allele has evolved from several origins, because the 58R is encoded by at least 3 different codons. The triple (58R/61M/117T) and quadruple (57L/61M/117T/173F, 57I/58R/61M/117T and 57L/58R/61M/117T) mutant alleles had at least three independent origins in Thailand, Indonesia, and Papua New Guinea/Vanuatu. Conclusion It was found that the P. vivax dhfr coding region and its flanking intergenic regions are highly polymorphic and that mutations in P. vivax dhfr that confer antifolate resistance have arisen several times in the Asian region. This contrasts sharply with the selective sweep of rare antifolate resistant alleles observed in the P. falciparum populations in Asia and Africa. The finding of multiple origins of resistance-conferring mutations has important implications for drug policy. PMID:18442404

Multiple origins of resistance-conferring mutations in Plasmodium vivax dihydrofolate reductase.

PubMed

Hawkins, Vivian N; Auliff, Alyson; Prajapati, Surendra Kumar; Rungsihirunrat, Kanchana; Hapuarachchi, Hapuarachchige C; Maestre, Amanda; O'Neil, Michael T; Cheng, Qin; Joshi, Hema; Na-Bangchang, Kesara; Sibley, Carol Hopkins

2008-04-28

In order to maximize the useful therapeutic life of antimalarial drugs, it is crucial to understand the mechanisms by which parasites resistant to antimalarial drugs are selected and spread in natural populations. Recent work has demonstrated that pyrimethamine-resistance conferring mutations in Plasmodium falciparum dihydrofolate reductase (dhfr) have arisen rarely de novo, but spread widely in Asia and Africa. The origin and spread of mutations in Plasmodium vivax dhfr were assessed by constructing haplotypes based on sequencing dhfr and its flanking regions. The P. vivax dhfr coding region, 792 bp upstream and 683 bp downstream were amplified and sequenced from 137 contemporary patient isolates from Colombia, India, Indonesia, Papua New Guinea, Sri Lanka, Thailand, and Vanuatu. A repeat motif located 2.6 kb upstream of dhfr was also sequenced from 75 of 137 patient isolates, and mutational relationships among the haplotypes were visualized using the programme Network. Synonymous and non-synonymous single nucleotide polymorphisms (SNPs) within the dhfr coding region were identified, as was the well-documented in-frame insertion/deletion (indel). SNPs were also identified upstream and downstream of dhfr, with an indel and a highly polymorphic repeat region identified upstream of dhfr. The regions flanking dhfr were highly variable. The double mutant (58R/117N) dhfr allele has evolved from several origins, because the 58R is encoded by at least 3 different codons. The triple (58R/61M/117T) and quadruple (57L/61M/117T/173F, 57I/58R/61M/117T and 57L/58R/61M/117T) mutant alleles had at least three independent origins in Thailand, Indonesia, and Papua New Guinea/Vanuatu. It was found that the P. vivax dhfr coding region and its flanking intergenic regions are highly polymorphic and that mutations in P. vivax dhfr that confer antifolate resistance have arisen several times in the Asian region. This contrasts sharply with the selective sweep of rare antifolate resistant alleles observed in the P. falciparum populations in Asia and Africa. The finding of multiple origins of resistance-conferring mutations has important implications for drug policy.

Phylogenetic Network for European mtDNA

PubMed Central

Finnilä, Saara; Lehtonen, Mervi S.; Majamaa, Kari

2001-01-01

The sequence in the first hypervariable segment (HVS-I) of the control region has been used as a source of evolutionary information in most phylogenetic analyses of mtDNA. Population genetic inference would benefit from a better understanding of the variation in the mtDNA coding region, but, thus far, complete mtDNA sequences have been rare. We determined the nucleotide sequence in the coding region of mtDNA from 121 Finns, by conformation-sensitive gel electrophoresis and subsequent sequencing and by direct sequencing of the D loop. Furthermore, 71 sequences from our previous reports were included, so that the samples represented all the mtDNA haplogroups present in the Finnish population. We found a total of 297 variable sites in the coding region, which allowed the compilation of unambiguous phylogenetic networks. The D loop harbored 104 variable sites, and, in most cases, these could be localized within the coding-region networks, without discrepancies. Interestingly, many homoplasies were detected in the coding region. Nucleotide variation in the rRNA and tRNA genes was 6%, and that in the third nucleotide positions of structural genes amounted to 22% of that in the HVS-I. The complete networks enabled the relationships between the mtDNA haplogroups to be analyzed. Phylogenetic networks based on the entire coding-region sequence in mtDNA provide a rich source for further population genetic studies, and complete sequences make it easier to differentiate between disease-causing mutations and rare polymorphisms. PMID:11349229

Comparison of space flight and heavy ion radiation induced genomic/epigenomic mutations in rice (Oryza sativa)

NASA Astrophysics Data System (ADS)

Shi, Jinming; Lu, Weihong; Sun, Yeqing

2014-04-01

Rice seeds, after space flight and low dose heavy ion radiation treatment were cultured on ground. Leaves of the mature plants were obtained for examination of genomic/epigenomic mutations by using amplified fragment length polymorphism (AFLP) and methylation sensitive amplification polymorphism (MSAP) method, respectively. The mutation sites were identified by fragment recovery and sequencing. The heritability of the mutations was detected in the next generation. Results showed that both space flight and low dose heavy ion radiation can induce significant alterations on rice genome and epigenome (P < 0.05). For both genetic and epigenetic assays, while there was no significant difference in mutation rates and their ability to be inherited to the next generation, the site of mutations differed between the space flight and radiation treated groups. More than 50% of the mutation sites were shared by two radiation treated groups, radiated with different LET value and dose, while only about 20% of the mutation sites were shared by space flight group and radiation treated group. Moreover, in space flight group, we found that DNA methylation changes were more prone to occur on CNG sequence than CG sequence. Sequencing results proved that both space flight and heavy ion radiation induced mutations were widely spread on rice genome including coding region and repeated region. Our study described and compared the characters of space flight and low dose heavy ion radiation induced genomic/epigenomic mutations. Our data revealed the mechanisms of application of space environment for mutagenesis and crop breeding. Furthermore, this work implicated that the nature of mutations induced under space flight conditions may involve factors beyond ion radiation.

Allelic heterogeneity of FGF5 mutations causes the long-hair phenotype in dogs.

PubMed

Dierks, C; Mömke, S; Philipp, U; Distl, O

2013-08-01

Hitherto, the only known mutant gene leading to the long-hair phenotype in mammals is the fibroblast growth factor 5 (FGF5). In many dog breeds, the previously discovered FGF5:p.Cys95Phe mutation appeared completely concordant with the long-hair phenotype, but for some breeds, the long-hair phenotype could not be resolved. First, we studied the role of the FGF5:p.Cys95Phe and FGF5:g.145_150dupACCAGC mutations in 268 dogs descending from 27 breeds and seven wolves. As these mutations did not explain all the long-hair phenotypes, all exons and their neighbouring regions of FGF5 were re-sequenced. We detected three novel mutations in the coding sequence and one novel non-coding splice-site mutation in FGF5 associated with the long-hair phenotype. The FGF5:p.Ala193Val polymorphism was perfectly consistent with long hair in Akitas and probably in Siberian huskies, too. Dogs of the long-hair breed Samoyed were either homozygous or compound heterozygous for the FGF5:p.Ala193Val or the FGF5:p.Cys95Phe polymorphisms respectively. The two newly detected polymorphisms FGF5:c.559_560dupGG and FGF5:g.8193T>A and the known mutation FGF5:p.Cys95Phe explained the long-hair phenotype of all Afghan hounds analysed. An FGF5:c.556_571del16 mutation was found in one longhaired Eurasier. All long-hair-associated mutations follow a recessive mode of inheritance, and allelic heterogeneity was a common finding in breeds other than Akita. © 2013 The Authors, Animal Genetics © 2013 Stichting International Foundation for Animal Genetics.

Rapid-Onset Obesity with Hypothalamic Dysfunction, Hypoventilation, and Autonomic Dysregulation (ROHHAD): exome sequencing of trios, monozygotic twins and tumours.

PubMed

Barclay, Sarah F; Rand, Casey M; Borch, Lauren A; Nguyen, Lisa; Gray, Paul A; Gibson, William T; Wilson, Richard J A; Gordon, Paul M K; Aung, Zaw; Berry-Kravis, Elizabeth M; Ize-Ludlow, Diego; Weese-Mayer, Debra E; Bech-Hansen, N Torben

2015-08-25

Rapid-onset Obesity with Hypothalamic Dysfunction, Hypoventilation, and Autonomic Dysregulation (ROHHAD) is thought to be a genetic disease caused by de novo mutations, though causative mutations have yet to be identified. We searched for de novo coding mutations among a carefully-diagnosed and clinically homogeneous cohort of 35 ROHHAD patients. We sequenced the exomes of seven ROHHAD trios, plus tumours from four of these patients and the unaffected monozygotic (MZ) twin of one (discovery cohort), to identify constitutional and somatic de novo sequence variants. We further analyzed this exome data to search for candidate genes under autosomal dominant and recessive models, and to identify structural variations. Candidate genes were tested by exome or Sanger sequencing in a replication cohort of 28 ROHHAD singletons. The analysis of the trio-based exomes found 13 de novo variants. However, no two patients had de novo variants in the same gene, and additional patient exomes and mutation analysis in the replication cohort did not provide strong genetic evidence to implicate any of these sequence variants in ROHHAD. Somatic comparisons revealed no coding differences between any blood and tumour samples, or between the two discordant MZ twins. Neither autosomal dominant nor recessive analysis yielded candidate genes for ROHHAD, and we did not identify any potentially causative structural variations. Clinical exome sequencing is highly unlikely to be a useful diagnostic test in patients with true ROHHAD. As ROHHAD has a high risk for fatality if not properly managed, it remains imperative to expand the search for non-exomic genetic risk factors, as well as to investigate other possible mechanisms of disease. In so doing, we will be able to confirm objectively the ROHHAD diagnosis and to contribute to our understanding of obesity, respiratory control, hypothalamic function, and autonomic regulation.

East Asian mtDNA haplogroup determination in Koreans: haplogroup-level coding region SNP analysis and subhaplogroup-level control region sequence analysis.

PubMed

Lee, Hwan Young; Yoo, Ji-Eun; Park, Myung Jin; Chung, Ukhee; Kim, Chong-Youl; Shin, Kyoung-Jin

2006-11-01

The present study analyzed 21 coding region SNP markers and one deletion motif for the determination of East Asian mitochondrial DNA (mtDNA) haplogroups by designing three multiplex systems which apply single base extension methods. Using two multiplex systems, all 593 Korean mtDNAs were allocated into 15 haplogroups: M, D, D4, D5, G, M7, M8, M9, M10, M11, R, R9, B, A, and N9. As the D4 haplotypes occurred most frequently in Koreans, the third multiplex system was used to further define D4 subhaplogroups: D4a, D4b, D4e, D4g, D4h, and D4j. This method allowed the complementation of coding region information with control region mutation motifs and the resultant findings also suggest reliable control region mutation motifs for the assignment of East Asian mtDNA haplogroups. These three multiplex systems produce good results in degraded samples as they contain small PCR products (101-154 bp) for single base extension reactions. SNP scoring was performed in 101 old skeletal remains using these three systems to prove their utility in degraded samples. The sequence analysis of mtDNA control region with high incidence of haplogroup-specific mutations and the selective scoring of highly informative coding region SNPs using the three multiplex systems are useful tools for most applications involving East Asian mtDNA haplogroup determination and haplogroup-directed stringent quality control.

Deep Sequencing Reveals Spatially Distributed Distinct Hot Spot Mutations in DICER1-Related Multinodular Goiter.

PubMed

de Kock, Leanne; Bah, Ismaël; Revil, Timothée; Bérubé, Pierre; Wu, Mona K; Sabbaghian, Nelly; Priest, John R; Ragoussis, Jiannis; Foulkes, William D

2016-10-01

Nontoxic multinodular goiter (MNG) occurs frequently, but its genetic etiology is not well established. Familial MNG and MNG occurring with ovarian Sertoli-Leydig cell tumor are associated with germline DICER1 mutations. We recently identified second somatic DICER1 ribonuclease (RNase) IIIb mutations in two MNGs. The objective of the study was to investigate the occurrence of somatic DICER1 mutations and mutational clonality in MNG. MNGs from 15 patients (10 with and five without germline DICER1 mutations) were selected based on tissue availability. Core biopsies/scrapings (n = 70) were obtained, sampling areas of follicular hyperplasia, hyperplasia within colloid pools, unremarkable thyroid parenchyma, and areas of thyroid parenchyma, not classified. After capture with a Fluidigm access array, the coding sequence of DICER1 was deep sequenced using DNA from each core/scraping. All germline DICER1-mutated cases were found to harbor at least one RNase III mutation. Specifically, we identified 12 individually distinct DICER1 RNase IIIb hot spot mutations in 32 of the follicular hyperplasia or hyperplasia within colloid pools cores/scrapings. These mutations are predicted to affect the metal-ion binding residues at positions p.Glu1705, p.Asp1709, p.Gly1809, p.Asp1810, and p.Glu1813. Somatic RNase IIIb mutations were identified in the 10 DICER1 germline mutated MNGs as follows: two cases contained one somatic mutation, five cases contained two mutations, and three cases contained three distinct somatic hot spot mutations. No RNase IIIb mutations were identified in the MNGs from individuals without germline DICER1 mutations. This study demonstrates that nodules within MNG occurring in DICER1 syndrome are associated with spatially distributed somatic DICER1 RNase IIIb mutations.

RAMICS: trainable, high-speed and biologically relevant alignment of high-throughput sequencing reads to coding DNA

PubMed Central

Wright, Imogen A.; Travers, Simon A.

2014-01-01

The challenge presented by high-throughput sequencing necessitates the development of novel tools for accurate alignment of reads to reference sequences. Current approaches focus on using heuristics to map reads quickly to large genomes, rather than generating highly accurate alignments in coding regions. Such approaches are, thus, unsuited for applications such as amplicon-based analysis and the realignment phase of exome sequencing and RNA-seq, where accurate and biologically relevant alignment of coding regions is critical. To facilitate such analyses, we have developed a novel tool, RAMICS, that is tailored to mapping large numbers of sequence reads to short lengths (<10 000 bp) of coding DNA. RAMICS utilizes profile hidden Markov models to discover the open reading frame of each sequence and aligns to the reference sequence in a biologically relevant manner, distinguishing between genuine codon-sized indels and frameshift mutations. This approach facilitates the generation of highly accurate alignments, accounting for the error biases of the sequencing machine used to generate reads, particularly at homopolymer regions. Performance improvements are gained through the use of graphics processing units, which increase the speed of mapping through parallelization. RAMICS substantially outperforms all other mapping approaches tested in terms of alignment quality while maintaining highly competitive speed performance. PMID:24861618

The clonal and mutational evolution spectrum of primary triple-negative breast cancers.

PubMed

Shah, Sohrab P; Roth, Andrew; Goya, Rodrigo; Oloumi, Arusha; Ha, Gavin; Zhao, Yongjun; Turashvili, Gulisa; Ding, Jiarui; Tse, Kane; Haffari, Gholamreza; Bashashati, Ali; Prentice, Leah M; Khattra, Jaswinder; Burleigh, Angela; Yap, Damian; Bernard, Virginie; McPherson, Andrew; Shumansky, Karey; Crisan, Anamaria; Giuliany, Ryan; Heravi-Moussavi, Alireza; Rosner, Jamie; Lai, Daniel; Birol, Inanc; Varhol, Richard; Tam, Angela; Dhalla, Noreen; Zeng, Thomas; Ma, Kevin; Chan, Simon K; Griffith, Malachi; Moradian, Annie; Cheng, S-W Grace; Morin, Gregg B; Watson, Peter; Gelmon, Karen; Chia, Stephen; Chin, Suet-Feung; Curtis, Christina; Rueda, Oscar M; Pharoah, Paul D; Damaraju, Sambasivarao; Mackey, John; Hoon, Kelly; Harkins, Timothy; Tadigotla, Vasisht; Sigaroudinia, Mahvash; Gascard, Philippe; Tlsty, Thea; Costello, Joseph F; Meyer, Irmtraud M; Eaves, Connie J; Wasserman, Wyeth W; Jones, Steven; Huntsman, David; Hirst, Martin; Caldas, Carlos; Marra, Marco A; Aparicio, Samuel

2012-04-04

Primary triple-negative breast cancers (TNBCs), a tumour type defined by lack of oestrogen receptor, progesterone receptor and ERBB2 gene amplification, represent approximately 16% of all breast cancers. Here we show in 104 TNBC cases that at the time of diagnosis these cancers exhibit a wide and continuous spectrum of genomic evolution, with some having only a handful of coding somatic aberrations in a few pathways, whereas others contain hundreds of coding somatic mutations. High-throughput RNA sequencing (RNA-seq) revealed that only approximately 36% of mutations are expressed. Using deep re-sequencing measurements of allelic abundance for 2,414 somatic mutations, we determine for the first time-to our knowledge-in an epithelial tumour subtype, the relative abundance of clonal frequencies among cases representative of the population. We show that TNBCs vary widely in their clonal frequencies at the time of diagnosis, with the basal subtype of TNBC showing more variation than non-basal TNBC. Although p53 (also known as TP53), PIK3CA and PTEN somatic mutations seem to be clonally dominant compared to other genes, in some tumours their clonal frequencies are incompatible with founder status. Mutations in cytoskeletal, cell shape and motility proteins occurred at lower clonal frequencies, suggesting that they occurred later during tumour progression. Taken together, our results show that understanding the biology and therapeutic responses of patients with TNBC will require the determination of individual tumour clonal genotypes.

A Noncoding, Regulatory Mutation Implicates HCFC1 in Nonsyndromic Intellectual Disability

PubMed Central

Huang, Lingli; Jolly, Lachlan A.; Willis-Owen, Saffron; Gardner, Alison; Kumar, Raman; Douglas, Evelyn; Shoubridge, Cheryl; Wieczorek, Dagmar; Tzschach, Andreas; Cohen, Monika; Hackett, Anna; Field, Michael; Froyen, Guy; Hu, Hao; Haas, Stefan A.; Ropers, Hans-Hilger; Kalscheuer, Vera M.; Corbett, Mark A.; Gecz, Jozef

2012-01-01

The discovery of mutations causing human disease has so far been biased toward protein-coding regions. Having excluded all annotated coding regions, we performed targeted massively parallel resequencing of the nonrepetitive genomic linkage interval at Xq28 of family MRX3. We identified in the binding site of transcription factor YY1 a regulatory mutation that leads to overexpression of the chromatin-associated transcriptional regulator HCFC1. When tested on embryonic murine neural stem cells and embryonic hippocampal neurons, HCFC1 overexpression led to a significant increase of the production of astrocytes and a considerable reduction in neurite growth. Two other nonsynonymous, potentially deleterious changes have been identified by X-exome sequencing in individuals with intellectual disability, implicating HCFC1 in normal brain function. PMID:23000143

Mutation of I176R in the E coding region weakens Japanese encephalitis virus neurovirulence, but not its growth rate in BHK-21 cells.

PubMed

Zhou, Yuyong; Wu, Rui; Zhao, Qin; Chang, Yung-Fu; Wen, Xintian; Feng, Yao; Huang, Xiaobo; Wen, Yiping; Yan, Qigui; Huang, Yong; Ma, Xiaoping; Han, Xinfeng; Cao, Sanjie

2018-05-01

Previously, we isolated the Japanese encephalitis virus (JEV) strain SCYA201201. In this study, we passed the SCYA201201 strain in Syrian baby hamster kidney (BHK-21) cells 120 times to obtain the SCYA201201-0901 strain, which exhibited an attenuated phenotype in mice. Comparison of SCYA201201-0901 amino acid sequences with those of other JEV strains revealed a single mutation, I176R, in the E coding region. Using reverse genetic technology, we provide evidence that this single E-I176R mutation does not affect virus growth in BHK-21 cells but significantly decreases JEV neurovirulence in mice. This study provides critical information for understanding the molecular mechanism of JEV attenuation.

Selective forces and mutational biases drive stop codon usage in the human genome: a comparison with sense codon usage.

PubMed

Trotta, Edoardo

2016-05-17

The three stop codons UAA, UAG, and UGA signal the termination of mRNA translation. As a result of a mechanism that is not adequately understood, they are normally used with unequal frequencies. In this work, we showed that selective forces and mutational biases drive stop codon usage in the human genome. We found that, in respect to sense codons, stop codon usage was affected by stronger selective forces but was less influenced by neutral mutational biases. UGA is the most frequent termination codon in human genome. However, UAA was the preferred stop codon in genes with high breadth of expression, high level of expression, AT-rich coding sequences, housekeeping functions, and in gene ontology categories with the largest deviation from expected stop codon usage. Selective forces associated with the breadth and the level of expression favoured AT-rich sequences in the mRNA region including the stop site and its proximal 3'-UTR, but acted with scarce effects on sense codons, generating two regions, upstream and downstream of the stop codon, with strongly different base composition. By favouring low levels of GC-content, selection promoted labile local secondary structures at the stop site and its proximal 3'-UTR. The compositional and structural context favoured by selection was surprisingly emphasized in the class of ribosomal proteins and was consistent with sequence elements that increase the efficiency of translational termination. Stop codons were also heterogeneously distributed among chromosomes by a mechanism that was strongly correlated with the GC-content of coding sequences. In human genome, the nucleotide composition and the thermodynamic stability of stop codon site and its proximal 3'-UTR are correlated with the GC-content of coding sequences and with the breadth and the level of gene expression. In highly expressed genes stop codon usage is compositionally and structurally consistent with highly efficient translation termination signals.

Screening for NDP mutations in 44 unrelated patients with familial exudative vitreoretinopathy or Norrie disease.

PubMed

Yang, Huiqin; Li, Shiqiang; Xiao, Xueshan; Guo, Xiangming; Zhang, Qingjiong

2012-08-01

To screen mutations in the norrin (NDP) gene in 44 unrelated Chinese patients with familial exudative vitreoretinopathy (FEVR, 38 cases) or Norrie disease (6 cases) and to describe the associated phenotypes. Of the 44 patients, mutation in FZD4, LRP5, and TSPAN12 was excluded in 38 patients with FEVR in previous study. Sanger sequencing was used to analyze the 2 coding exons and their adjacent regions of NDP in the 44 patients. Clinical data were presented for patients with mutation. NDP variants in 5 of the 6 patients with Norrie disease were identified, including a novel missense mutation (c.164G>A, p.Cys55Phe) in one patient, two known missense mutations (c.122G>A, p.Arg41Lys; c.220C>T, p.Arg74Cys) in two patients, and a gross deletion encompassing the two coding exons in two patients. Of the 5 patients, 3 had a family history and 2 were singleton cases. No mutation in NDP was detected in the 38 patients with FEVR. NDP mutations are common cause of Norrie disease but might be rare cause for FEVR in Chinese.

Uncovering hidden variation in polyploid wheat.

PubMed

Krasileva, Ksenia V; Vasquez-Gross, Hans A; Howell, Tyson; Bailey, Paul; Paraiso, Francine; Clissold, Leah; Simmonds, James; Ramirez-Gonzalez, Ricardo H; Wang, Xiaodong; Borrill, Philippa; Fosker, Christine; Ayling, Sarah; Phillips, Andrew L; Uauy, Cristobal; Dubcovsky, Jorge

2017-02-07

Comprehensive reverse genetic resources, which have been key to understanding gene function in diploid model organisms, are missing in many polyploid crops. Young polyploid species such as wheat, which was domesticated less than 10,000 y ago, have high levels of sequence identity among subgenomes that mask the effects of recessive alleles. Such redundancy reduces the probability of selection of favorable mutations during natural or human selection, but also allows wheat to tolerate high densities of induced mutations. Here we exploited this property to sequence and catalog more than 10 million mutations in the protein-coding regions of 2,735 mutant lines of tetraploid and hexaploid wheat. We detected, on average, 2,705 and 5,351 mutations per tetraploid and hexaploid line, respectively, which resulted in 35-40 mutations per kb in each population. With these mutation densities, we identified an average of 23-24 missense and truncation alleles per gene, with at least one truncation or deleterious missense mutation in more than 90% of the captured wheat genes per population. This public collection of mutant seed stocks and sequence data enables rapid identification of mutations in the different copies of the wheat genes, which can be combined to uncover previously hidden variation. Polyploidy is a central phenomenon in plant evolution, and many crop species have undergone recent genome duplication events. Therefore, the general strategy and methods developed herein can benefit other polyploid crops.

Restriction digest screening facilitates efficient detection of site-directed mutations introduced by CRISPR in C. albicans UME6.

PubMed

Evans, Ben A; Smith, Olivia L; Pickerill, Ethan S; York, Mary K; Buenconsejo, Kristen J P; Chambers, Antonio E; Bernstein, Douglas A

2018-01-01

Introduction of point mutations to a gene of interest is a powerful tool when determining protein function. CRISPR-mediated genome editing allows for more efficient transfer of a desired mutation into a wide range of model organisms. Traditionally, PCR amplification and DNA sequencing is used to determine if isolates contain the intended mutation. However, mutation efficiency is highly variable, potentially making sequencing costly and time consuming. To more efficiently screen for correct transformants, we have identified restriction enzymes sites that encode for two identical amino acids or one or two stop codons. We used CRISPR to introduce these restriction sites directly upstream of the Candida albicans UME6 Zn 2+ -binding domain, a known regulator of C. albicans filamentation. While repair templates coding for different restriction sites were not equally successful at introducing mutations, restriction digest screening enabled us to rapidly identify isolates with the intended mutation in a cost-efficient manner. In addition, mutated isolates have clear defects in filamentation and virulence compared to wild type C. albicans . Our data suggest restriction digestion screening efficiently identifies point mutations introduced by CRISPR and streamlines the process of identifying residues important for a phenotype of interest.

[Pro731Ser mutation in the β-myosin heavy chain and hypertrophic cardiomyopathy in a Chinese pedigree].

PubMed

Zhao, Xintao; Wu, Yajie; Chen, Yi; Feng, Xinxing; Song, Ying; Wang, Yilu; Zou, Yubao; Wang, Jizheng; Shao, Yibing; Hui, Rutai; Song, Lei; Wang, Xu

2014-07-01

To identify the casual mutation of a Chinese pedigree with hypertrophic cardiomyopathy (HCM), and to analyze the genotype-phenotype relationship. The coding exons of 26 reported disease genes were sequenced by targeted resequencing in the proband and the identified mutation were detected with bi-directional Sanger sequencing in all family members and 307 healthy controls. The genotype-phenotype correlation was analyzed in the family. A missense mutation (c.2191C > T, p. Pro731Ser) in the 20th exon of MYH7 gene was identified. This mutation was absent in 307 healthy controls and predicted to be pathogenic by PolyPhen-HCM. Totally 13 family members carried this mutation, including 10 patients with HCM and 3 asymptomatic mutation carriers. The proband manifested severe congestive heart failure and 8 patients expressed various clinical manifestations of heart failure, including dyspnea, palpitations, chest pain, amaurosis or syncope. Five patients were diagnosed as HCM at the age of 16 or younger. One family member suffered sudden cardiac death. The Pro731Ser of MYH7 gene mutation is a causal and malignant mutation linked with familiar HCM.

A novel mutation in SCN9A in a child with congenital insensitivity to pain.

PubMed

Shorer, Zamir; Wajsbrot, Einav; Liran, Tamir-Hostovsky; Levy, Jacov; Parvari, Ruti

2014-01-01

[corrected] Congenital insensitivity to pain (CIP) is a rare condition in which patients have no pain perception and anosmia but are otherwise essentially normal (OMIM 243000). The recent discovery of the genetic defects underlying 3 monogenic pain disorders has provided additional and important insights about some components of human pain. Genetic studies in families demonstrating recessively inherited channelopathy-associated insensitivity to pain have identified nonsense mutations that result in truncation of the voltage-gated sodium channel type IX subunit (SCN9A), a 113.5-kb gene comprising coding 26 exons. Here we describe a patient with CIP with a new mutation in SCN9A not described yet. All exons were sequenced. All 26 coding exons were sequenced and two changes were identified in homozygosity in exon 10: c.1126 A > C causing K376Q and c.1124delG causing p.G375Afs* frame shift. We report a novel, loss-of-function mutation in homozygosity that causes congenital insensitivity to pain and provide a comprehensive clinical description of the patient. This contributes to the clinical and neurophysiological characteristic of the sodium channel Nav1.7 channelopathy and expand our genetic knowledge which might provide more accurate and comprehensive clinical electrophysiological and genetic information. Copyright © 2014 Elsevier Inc. All rights reserved.

Late-onset spastic paraplegia: Aberrant SPG11 transcripts generated by a novel splice site donor mutation.

PubMed

Kawarai, Toshitaka; Miyamoto, Ryosuke; Mori, Atsuko; Oki, Ryosuke; Tsukamoto-Miyashiro, Ai; Matsui, Naoko; Miyazaki, Yoshimichi; Orlacchio, Antonio; Izumi, Yuishin; Nishida, Yoshihiko; Kaji, Ryuji

2015-12-15

We identified a novel homozygous mutation in the splice site donor (SSD) of intron 30 (c.5866+1G>A) in consanguineous Japanese SPG11 siblings showing late-onset spastic paraplegia using the whole-exome sequencing. Phenotypic variability was observed, including age-at-onset, dysarthria and pes cavus. Coding DNA sequencing revealed that the mutation affected the recognition of the constitutive SSD of intron 30, splicing upstream onto a nearby cryptic SSD in exon 30. The use of constitutive splice sites of intron 29 was confirmed by sequencing. The mutant transcripts are mostly subject to degradation by the nonsense-mediated mRNA decay system. SPG11 transcripts, escaping from the nonsense-mediated mRNA decay pathway, would generate a truncated protein (p.Tyr1900Phefs5X) containing the first 1899 amino acids and followed by 4 aberrant amino acids. This study showed a successful clinical application of whole-exome sequencing in spastic paraplegia and demonstrated a further evidence of allelic heterogeneity in SPG11. The confirmation of aberrant transcript by splice site mutation is a prerequisite for a more precise molecular diagnosis. Copyright © 2015 Elsevier B.V. All rights reserved.

The Causality of Evolution on Different Fitness Landscapes

NASA Astrophysics Data System (ADS)

Vyawahare, Saurabh; Austin, Robert; Zhang, Qiucen; Kim, Hyunsung; Bestoso, John

2013-03-01

Evolution of antibiotic resistance is a growing problem. One major reason why most antibiotics fail is because of mutations on drug targets (e.g. essential enzymes). Sequencing of clinically resistant isolates have shown that multiple mutational-hotspots exist in coding regions, which could potentially prohibit the binding of drugs. However, it is not clear whether the appearance of each mutation is random or influenced by other factors. In this paper, we compare evolution of resistance to ciprofloxacin from two distinct but well characterized genetic backgrounds. By combining our recently developed evolution reactor and deep whole-genome sequencing, we show different alleles of σs factor lead to fixation of different mutations in gyrA gene that confer ciprofloxacin resistance to bacteria Escherichia coli. Such causality of evolution in different genes provides an opportunity to control the evolution of antibiotic resistance. Sponsored by the NCI/NIH Physical Sciences Oncology Centers

HIV1 V3 loop hypermutability is enhanced by the guanine usage bias in the part of env gene coding for it.

PubMed

Khrustalev, Vladislav Victorovich

2009-01-01

Guanine is the most mutable nucleotide in HIV genes because of frequently occurring G to A transitions, which are caused by cytosine deamination in viral DNA minus strands catalyzed by APOBEC enzymes. Distribution of guanine between three codon positions should influence the probability for G to A mutation to be nonsynonymous (to occur in first or second codon position). We discovered that nucleotide sequences of env genes coding for third variable regions (V3 loops) of gp120 from HIV1 and HIV2 have different kinds of guanine usage biases. In the HIV1 reference strain and 100 additionally analyzed HIV1 strains the guanine usage bias in V3 loop coding regions (2G>1G>3G) should lead to elevated nonsynonymous G to A transitions occurrence rates. In the HIV2 reference strain and 100 other HIV2 strains guanine usage bias in V3 loop coding regions (3G>2G>1G) should protect V3 loops from hypermutability. According to the HIV1 and HIV2 V3 alignment, insertion of the sequence enriched with 2G (21 codons in length) occurred during the evolution of HIV1 predecessor, while insertion of the different sequence enriched with 3G (19 codons in length) occurred during the evolution of HIV2 predecessor. The higher is the level of 3G in the V3 coding region, the lower should be the immune escaping mutation occurrence rates. This hypothesis was tested in this study by comparing the guanine usage in V3 loop coding regions from HIV1 fast and slow progressors. All calculations have been performed by our algorithms "VVK In length", "VVK Dinucleotides" and "VVK Consensus" (www.barkovsky.hotmail.ru).

Whole-genome sequencing reveals a coding non-pathogenic variant tagging a non-coding pathogenic hexanucleotide repeat expansion in C9orf72 as cause of amyotrophic lateral sclerosis.

PubMed

Herdewyn, Sarah; Zhao, Hui; Moisse, Matthieu; Race, Valérie; Matthijs, Gert; Reumers, Joke; Kusters, Benno; Schelhaas, Helenius J; van den Berg, Leonard H; Goris, An; Robberecht, Wim; Lambrechts, Diether; Van Damme, Philip

2012-06-01

Motor neuron degeneration in amyotrophic lateral sclerosis (ALS) has a familial cause in 10% of patients. Despite significant advances in the genetics of the disease, many families remain unexplained. We performed whole-genome sequencing in five family members from a pedigree with autosomal-dominant classical ALS. A family-based elimination approach was used to identify novel coding variants segregating with the disease. This list of variants was effectively shortened by genotyping these variants in 2 additional unaffected family members and 1500 unrelated population-specific controls. A novel rare coding variant in SPAG8 on chromosome 9p13.3 segregated with the disease and was not observed in controls. Mutations in SPAG8 were not encountered in 34 other unexplained ALS pedigrees, including 1 with linkage to chromosome 9p13.2-23.3. The shared haplotype containing the SPAG8 variant in this small pedigree was 22.7 Mb and overlapped with the core 9p21 linkage locus for ALS and frontotemporal dementia. Based on differences in coverage depth of known variable tandem repeat regions between affected and non-affected family members, the shared haplotype was found to contain an expanded hexanucleotide (GGGGCC)(n) repeat in C9orf72 in the affected members. Our results demonstrate that rare coding variants identified by whole-genome sequencing can tag a shared haplotype containing a non-coding pathogenic mutation and that changes in coverage depth can be used to reveal tandem repeat expansions. It also confirms (GGGGCC)n repeat expansions in C9orf72 as a cause of familial ALS.

Organization and annotation of the Xcat critical region: elimination of seven positional candidate genes.

PubMed

Huang, Kristen M; Geunes-Boyer, Scarlett; Wu, Sufen; Dutra, Amalia; Favor, Jack; Stambolian, Dwight

2004-05-01

Xcat mice display X-linked congenital cataracts and are a mouse model for the human X-linked cataract disease Nance Horan syndrome (NHS). The genetic defect in Xcat mice and NHS patients is not known. We isolated and sequenced a BAC contig representing a portion of the Xcat critical region. We combined our sequencing data with the most recent mouse sequence assemblies from both Celera and public databases. The sequence of the 2.2-Mb Xcat critical region was then analyzed for potential Xcat candidate genes. The coding regions of the seven known genes within this area (Rai2, Rbbp7, Ctps2, Calb3, Grpr, Reps2, and Syap1) were sequenced in Xcat mice and no mutations were detected. The expression of Rai2 was quantitatively identical in wild-type and Xcat mutant eyes. These results indicate that the Xcat mutation is within a novel, undiscovered gene.

Next generation sequencing in women affected by nonsyndromic premature ovarian failure displays new potential causative genes and mutations.

PubMed

Fonseca, Dora Janeth; Patiño, Liliana Catherine; Suárez, Yohjana Carolina; de Jesús Rodríguez, Asid; Mateus, Heidi Eliana; Jiménez, Karen Marcela; Ortega-Recalde, Oscar; Díaz-Yamal, Ivonne; Laissue, Paul

2015-07-01

To identify new molecular actors involved in nonsyndromic premature ovarian failure (POF) etiology. This is a retrospective case-control cohort study. University research group and IVF medical center. Twelve women affected by nonsyndromic POF. The control group included 176 women whose menopause had occurred after age 50 and had no antecedents regarding gynecological disease. A further 345 women from the same ethnic origin (general population group) were also recruited to assess allele frequency for potentially deleterious sequence variants. Next generation sequencing (NGS), Sanger sequencing, and bioinformatics analysis. The complete coding regions of 70 candidate genes were massively sequenced, via NGS, in POF patients. Bioinformatics and genetics were used to confirm NGS results and to identify potential sequence variants related to the disease pathogenesis. We have identified mutations in two novel genes, ADAMTS19 and BMPR2, that are potentially related to POF origin. LHCGR mutations, which might have contributed to the phenotype, were also detected. We thus recommend NGS as a powerful tool for identifying new molecular actors in POF and for future diagnostic/prognostic purposes. Copyright © 2015 American Society for Reproductive Medicine. Published by Elsevier Inc. All rights reserved.

SMARCB1/INI1 germline mutations contribute to 10% of sporadic schwannomatosis.

PubMed

Rousseau, Guillaume; Noguchi, Tetsuro; Bourdon, Violaine; Sobol, Hagay; Olschwang, Sylviane

2011-01-24

Schwannomatosis is a disease characterized by multiple non-vestibular schwannomas. Although biallelic NF2 mutations are found in schwannomas, no germ line event is detected in schwannomatosis patients. In contrast, germline mutations of the SMARCB1 (INI1) tumor suppressor gene were described in familial and sporadic schwannomatosis patients. To delineate the SMARCB1 gene contribution, the nine coding exons were sequenced in a series of 56 patients affected with a variable number of non-vestibular schwannomas. Nine variants scattered along the sequence of SMARCB1 were identified. Five of them were classified as deleterious. All five patients carrying a SMARCB1 mutation had more multiple schwannomas, corresponding to 10.2% of patients with schwannomatosis. They were also diagnosed before 35 years of age. These results suggest that patients with schwannomas have a significant probability of carrying a SMARCB1 mutation. Combined with data available from other studies, they confirm the clinical indications for genetic screening of the SMARCB1 gene.

SMARCB1/INI1 germline mutations contribute to 10% of sporadic schwannomatosis

PubMed Central

2011-01-01

Background Schwannomatosis is a disease characterized by multiple non-vestibular schwannomas. Although biallelic NF2 mutations are found in schwannomas, no germ line event is detected in schwannomatosis patients. In contrast, germline mutations of the SMARCB1 (INI1) tumor suppressor gene were described in familial and sporadic schwannomatosis patients. Methods To delineate the SMARCB1 gene contribution, the nine coding exons were sequenced in a series of 56 patients affected with a variable number of non-vestibular schwannomas. Results Nine variants scattered along the sequence of SMARCB1 were identified. Five of them were classified as deleterious. All five patients carrying a SMARCB1 mutation had more multiple schwannomas, corresponding to 10.2% of patients with schwannomatosis. They were also diagnosed before 35 years of age. Conclusions These results suggest that patients with schwannomas have a significant probability of carrying a SMARCB1 mutation. Combined with data available from other studies, they confirm the clinical indications for genetic screening of the SMARCB1 gene. PMID:21255467

Microsatellites in the Eukaryotic DNA Mismatch Repair Genes as Modulators of Evolutionary Mutation Rate

NASA Technical Reports Server (NTRS)

Chang, Dong Kyung; Metzgar, David; Wills, Christopher; Boland, C. Richard

2003-01-01

All "minor" components of the human DNA mismatch repair (MMR) system-MSH3, MSH6, PMS2, and the recently discovered MLH3-contain mononucleotide microsatellites in their coding sequences. This intriguing finding contrasts with the situation found in the major components of the DNA MMR system-MSH2 and MLH1-and, in fact, most human genes. Although eukaryotic genomes are rich in microsatellites, non-triplet microsatellites are rare in coding regions. The recurring presence of exonal mononucleotide repeat sequences within a single family of human genes would therefore be considered exceptional.

Spectrum of mutations in leiomyosarcomas identified by clinical targeted next-generation sequencing.

PubMed

Lee, Paul J; Yoo, Naomi S; Hagemann, Ian S; Pfeifer, John D; Cottrell, Catherine E; Abel, Haley J; Duncavage, Eric J

2017-02-01

Recurrent genomic mutations in uterine and non-uterine leiomyosarcomas have not been well established. Using a next generation sequencing (NGS) panel of common cancer-associated genes, 25 leiomyosarcomas arising from multiple sites were examined to explore genetic alterations, including single nucleotide variants (SNV), small insertions/deletions (indels), and copy number alterations (CNA). Sequencing showed 86 non-synonymous, coding region somatic variants within 151 gene targets in 21 cases, with a mean of 4.1 variants per case; 4 cases had no putative mutations in the panel of genes assayed. The most frequently altered genes were TP53 (36%), ATM and ATRX (16%), and EGFR and RB1 (12%). CNA were identified in 85% of cases, with the most frequent copy number losses observed in chromosomes 10 and 13 including PTEN and RB1; the most frequent gains were seen in chromosomes 7 and 17. Our data show that deletions in canonical cancer-related genes are common in leiomyosarcomas. Further, the spectrum of gene mutations observed shows that defects in DNA repair and chromosomal maintenance are central to the biology of leiomyosarcomas, and that activating mutations observed in other common cancer types are rare in leiomyosarcomas. Copyright © 2017 Elsevier Inc. All rights reserved.

GNE missense mutation in recessive familial amyotrophic lateral sclerosis.

PubMed

Köroğlu, Çiğdem; Yılmaz, Rezzak; Sorgun, Mine Hayriye; Solakoğlu, Seyhun; Şener, Özden

2017-12-01

Amyotrophic lateral sclerosis (ALS) is a motor neuron disease eventually leading to death from respiratory failure. Recessive inheritance is very rare. Here, we describe the clinical findings in a consanguineous family with five men afflicted with recessive ALS and the identification of the homozygous mutation responsible for the disorder. The onset of the disease ranged from 12 to 35 years of age, with variable disease progressions. We performed clinical investigations including metabolic and paraneoplastic screening, cranial and cervical imaging, and electrophysiology. We mapped the disease gene to 9p21.1-p12 with a LOD score of 5.2 via linkage mapping using genotype data for single-nucleotide polymorphism markers and performed exome sequence analysis to identify the disease-causing gene variant. We also Sanger sequenced all coding sequences of SIGMAR1, a gene reported as responsible for juvenile ALS in a family. We did not find any mutation in SIGMAR1. Instead, we identified a novel homozygous missense mutation p.(His705Arg) in GNE which was predicted as damaging by online tools. GNE has been associated with inclusion body myopathy and is expressed in many tissues. We propose that the GNE mutation underlies the pathology in the family.

A new rapid methodological strategy to assess BRCA mutational status.

PubMed

Vuttariello, Emilia; Borra, Marco; Calise, Celeste; Mauriello, Elvira; Greggi, Stefano; Vecchione, Aldo; Biffali, Elio; Chiappetta, Gennaro

2013-07-01

Hereditary cancers account for approximately 10 % of breast and ovarian cancers. Mutations of the BRCA1 and BRCA2 genes, encoding two proteins involved in DNA repair, underlie most cases of such hereditary cancers. Women with BRCA mutations develop breast cancer in 50-80 % of cases and ovarian cancer in 10-40 % of cases. Assessing BRCA mutational status is needed to direct the clinical management of women with predisposition to these hereditary cancers. However, BRCA screening constitutes a bottleneck in terms of costs and time to deliver results. We developed a PCR-based assay using 73 primer pairs covering the entire coding regions of BRCA1 and BRCA2. PCR primers, containing at the 5' end the universal M13 primer sequences, were pre-spotted in 96-well plates. Following PCR, direct sequencing was performed using M13 primers, allowing to standardize the conditions. PCR amplification and sequencing were successful for each amplicon. We tested and validated the assay on 10 known gDNAs from patients with Hereditary breast and ovarian cancer (HBOC). Our strategy is a promising time and cost-effective method to detect BRCA mutations in the clinical setting, which is essential to formulate a personalized therapy for patients with HBOC.

Genome-first approach diagnosed Cabezas syndrome via novel CUL4B mutation detection.

PubMed

Okamoto, Nobuhiko; Watanabe, Miki; Naruto, Takuya; Matsuda, Keiko; Kohmoto, Tomohiro; Saito, Masako; Masuda, Kiyoshi; Imoto, Issei

2017-01-01

Cabezas syndrome is a syndromic form of X-linked intellectual disability primarily characterized by a short stature, hypogonadism and abnormal gait, with other variable features resulting from mutations in the CUL4B gene. Here, we report a clinically undiagnosed 5-year-old male with severe intellectual disability. A genome-first approach using targeted exome sequencing identified a novel nonsense mutation [NM_003588.3:c.2698G>T, p.(Glu900*)] in the last coding exon of CUL4B , thus diagnosing this patient with Cabezas syndrome.

Genome-first approach diagnosed Cabezas syndrome via novel CUL4B mutation detection

PubMed Central

Okamoto, Nobuhiko; Watanabe, Miki; Naruto, Takuya; Matsuda, Keiko; Kohmoto, Tomohiro; Saito, Masako; Masuda, Kiyoshi; Imoto, Issei

2017-01-01

Cabezas syndrome is a syndromic form of X-linked intellectual disability primarily characterized by a short stature, hypogonadism and abnormal gait, with other variable features resulting from mutations in the CUL4B gene. Here, we report a clinically undiagnosed 5-year-old male with severe intellectual disability. A genome-first approach using targeted exome sequencing identified a novel nonsense mutation [NM_003588.3:c.2698G>T, p.(Glu900*)] in the last coding exon of CUL4B, thus diagnosing this patient with Cabezas syndrome. PMID:28144446

Sanger sequencing as a first-line approach for molecular diagnosis of Andersen-Tawil syndrome.

PubMed

Totomoch-Serra, Armando; Marquez, Manlio F; Cervantes-Barragán, David E

2017-01-01

In 1977, Frederick Sanger developed a new method for DNA sequencing based on the chain termination method, now known as the Sanger sequencing method (SSM).  Recently, massive parallel sequencing, better known as next-generation sequencing (NGS),  is replacing the SSM for detecting mutations in cardiovascular diseases with a genetic background. The present opinion article wants to remark that "targeted" SSM is still effective as a first-line approach for the molecular diagnosis of some specific conditions, as is the case for Andersen-Tawil syndrome (ATS). ATS is described as a rare multisystemic autosomal dominant channelopathy syndrome caused mainly by a heterozygous mutation in the KCNJ2 gene . KCJN2 has particular characteristics that make it attractive for "directed" SSM. KCNJ2 has a sequence of 17,510 base pairs (bp), and a short coding region with two exons (exon 1=166 bp and exon 2=5220 bp), half of the mutations are located in the C-terminal cytosolic domain, a mutational hotspot has been described in residue Arg218, and this gene explains the phenotype in 60% of ATS cases that fulfill all the clinical criteria of the disease. In order to increase the diagnosis of ATS we urge cardiologists to search for facial and muscular abnormalities in subjects with frequent ventricular arrhythmias (especially bigeminy) and prominent U waves on the electrocardiogram.

Sanger sequencing as a first-line approach for molecular diagnosis of Andersen-Tawil syndrome

PubMed Central

Totomoch-Serra, Armando; Marquez, Manlio F.; Cervantes-Barragán, David E.

2017-01-01

In 1977, Frederick Sanger developed a new method for DNA sequencing based on the chain termination method, now known as the Sanger sequencing method (SSM).  Recently, massive parallel sequencing, better known as next-generation sequencing (NGS),  is replacing the SSM for detecting mutations in cardiovascular diseases with a genetic background. The present opinion article wants to remark that “targeted” SSM is still effective as a first-line approach for the molecular diagnosis of some specific conditions, as is the case for Andersen-Tawil syndrome (ATS). ATS is described as a rare multisystemic autosomal dominant channelopathy syndrome caused mainly by a heterozygous mutation in the KCNJ2 gene . KCJN2 has particular characteristics that make it attractive for “directed” SSM. KCNJ2 has a sequence of 17,510 base pairs (bp), and a short coding region with two exons (exon 1=166 bp and exon 2=5220 bp), half of the mutations are located in the C-terminal cytosolic domain, a mutational hotspot has been described in residue Arg218, and this gene explains the phenotype in 60% of ATS cases that fulfill all the clinical criteria of the disease. In order to increase the diagnosis of ATS we urge cardiologists to search for facial and muscular abnormalities in subjects with frequent ventricular arrhythmias (especially bigeminy) and prominent U waves on the electrocardiogram. PMID:29093808

Mutation Screening of 1,237 Cancer Genes across Six Model Cell Lines of Basal-Like Breast Cancer.

PubMed

Olsson, Eleonor; Winter, Christof; George, Anthony; Chen, Yilun; Törngren, Therese; Bendahl, Pär-Ola; Borg, Åke; Gruvberger-Saal, Sofia K; Saal, Lao H

2015-01-01

Basal-like breast cancer is an aggressive subtype generally characterized as poor prognosis and lacking the expression of the three most important clinical biomarkers, estrogen receptor, progesterone receptor, and HER2. Cell lines serve as useful model systems to study cancer biology in vitro and in vivo. We performed mutational profiling of six basal-like breast cancer cell lines (HCC38, HCC1143, HCC1187, HCC1395, HCC1954, and HCC1937) and their matched normal lymphocyte DNA using targeted capture and next-generation sequencing of 1,237 cancer-associated genes, including all exons, UTRs and upstream flanking regions. In total, 658 somatic variants were identified, of which 378 were non-silent (average 63 per cell line, range 37-146) and 315 were novel (not present in the Catalogue of Somatic Mutations in Cancer database; COSMIC). 125 novel mutations were confirmed by Sanger sequencing (59 exonic, 48 3'UTR and 10 5'UTR, 1 splicing), with a validation rate of 94% of high confidence variants. Of 36 mutations previously reported for these cell lines but not detected in our exome data, 36% could not be detected by Sanger sequencing. The base replacements C/G>A/T, C/G>G/C, C/G>T/A and A/T>G/C were significantly more frequent in the coding regions compared to the non-coding regions (OR 3.2, 95% CI 2.0-5.3, P<0.0001; OR 4.3, 95% CI 2.9-6.6, P<0.0001; OR 2.4, 95% CI 1.8-3.1, P<0.0001; OR 1.8, 95% CI 1.2-2.7, P = 0.024, respectively). The single nucleotide variants within the context of T[C]T/A[G]A and T[C]A/T[G]A were more frequent in the coding than in the non-coding regions (OR 3.7, 95% CI 2.2-6.1, P<0.0001; OR 3.8, 95% CI 2.0-7.2, P = 0.001, respectively). Copy number estimations were derived from the targeted regions and correlated well to Affymetrix SNP array copy number data (Pearson correlation 0.82 to 0.96 for all compared cell lines; P<0.0001). These mutation calls across 1,237 cancer-associated genes and identification of novel variants will aid in the design and interpretation of biological experiments using these six basal-like breast cancer cell lines.

Complete exon sequencing of all known Usher syndrome genes greatly improves molecular diagnosis.

PubMed

Bonnet, Crystel; Grati, M'hamed; Marlin, Sandrine; Levilliers, Jacqueline; Hardelin, Jean-Pierre; Parodi, Marine; Niasme-Grare, Magali; Zelenika, Diana; Délépine, Marc; Feldmann, Delphine; Jonard, Laurence; El-Amraoui, Aziz; Weil, Dominique; Delobel, Bruno; Vincent, Christophe; Dollfus, Hélène; Eliot, Marie-Madeleine; David, Albert; Calais, Catherine; Vigneron, Jacqueline; Montaut-Verient, Bettina; Bonneau, Dominique; Dubin, Jacques; Thauvin, Christel; Duvillard, Alain; Francannet, Christine; Mom, Thierry; Lacombe, Didier; Duriez, Françoise; Drouin-Garraud, Valérie; Thuillier-Obstoy, Marie-Françoise; Sigaudy, Sabine; Frances, Anne-Marie; Collignon, Patrick; Challe, Georges; Couderc, Rémy; Lathrop, Mark; Sahel, José-Alain; Weissenbach, Jean; Petit, Christine; Denoyelle, Françoise

2011-05-11

Usher syndrome (USH) combines sensorineural deafness with blindness. It is inherited in an autosomal recessive mode. Early diagnosis is critical for adapted educational and patient management choices, and for genetic counseling. To date, nine causative genes have been identified for the three clinical subtypes (USH1, USH2 and USH3). Current diagnostic strategies make use of a genotyping microarray that is based on the previously reported mutations. The purpose of this study was to design a more accurate molecular diagnosis tool. We sequenced the 366 coding exons and flanking regions of the nine known USH genes, in 54 USH patients (27 USH1, 21 USH2 and 6 USH3). Biallelic mutations were detected in 39 patients (72%) and monoallelic mutations in an additional 10 patients (18.5%). In addition to biallelic mutations in one of the USH genes, presumably pathogenic mutations in another USH gene were detected in seven patients (13%), and another patient carried monoallelic mutations in three different USH genes. Notably, none of the USH3 patients carried detectable mutations in the only known USH3 gene, whereas they all carried mutations in USH2 genes. Most importantly, the currently used microarray would have detected only 30 of the 81 different mutations that we found, of which 39 (48%) were novel. Based on these results, complete exon sequencing of the currently known USH genes stands as a definite improvement for molecular diagnosis of this disease, which is of utmost importance in the perspective of gene therapy.

Comparative Analysis of the Complete Plastomes of Apostasia wallichii and Neuwiedia singapureana (Apostasioideae) Reveals Different Evolutionary Dynamics of IR/SSC Boundary among Photosynthetic Orchids.

PubMed

Niu, Zhitao; Pan, Jiajia; Zhu, Shuying; Li, Ludan; Xue, Qingyun; Liu, Wei; Ding, Xiaoyu

2017-01-01

Apostasioideae, consists of only two genera, Apostasia and Neuwiedia , which are mainly distributed in Southeast Asia and northern Australia. The floral structure, taxonomy, biogeography, and genome variation of Apostasioideae have been intensively studied. However, detailed analyses of plastome composition and structure and comparisons with those of other orchid subfamilies have not yet been conducted. Here, the complete plastome sequences of Apostasia wallichii and Neuwiedia singapureana were sequenced and compared with 43 previously published photosynthetic orchid plastomes to characterize the plastome structure and evolution in the orchids. Unlike many orchid plastomes (e.g., Paphiopedilum and Vanilla ), the plastomes of Apostasioideae contain a full set of 11 functional NADH dehydrogenase ( ndh ) genes. The distribution of repeat sequences and simple sequence repeat elements enhanced the view that the mutation rate of non-coding regions was higher than that of coding regions. The 10 loci- ndhA intron, matK-5'trnK , clpP-psbB , rps8-rpl14 , trnT-trnL , 3'trnK-matK , clpP intron , psbK-trnK , trnS-psbC , and ndhF-rpl32 -that had the highest degrees of sequence variability were identified as mutational hotspots for the Apostasia plastome. Furthermore, our results revealed that plastid genes exhibited a variable evolution rate within and among different orchid genus. Considering the diversified evolution of both coding and non-coding regions, we suggested that the plastome-wide evolution of orchid species was disproportional. Additionally, the sequences flanking the inverted repeat/small single copy (IR/SSC) junctions of photosynthetic orchid plastomes were categorized into three types according to the presence/absence of ndh genes. Different evolutionary dynamics for each of the three IR/SSC types of photosynthetic orchid plastomes were also proposed.

Comparative Analysis of the Complete Plastomes of Apostasia wallichii and Neuwiedia singapureana (Apostasioideae) Reveals Different Evolutionary Dynamics of IR/SSC Boundary among Photosynthetic Orchids

PubMed Central

Niu, Zhitao; Pan, Jiajia; Zhu, Shuying; Li, Ludan; Xue, Qingyun; Liu, Wei; Ding, Xiaoyu

2017-01-01

Apostasioideae, consists of only two genera, Apostasia and Neuwiedia, which are mainly distributed in Southeast Asia and northern Australia. The floral structure, taxonomy, biogeography, and genome variation of Apostasioideae have been intensively studied. However, detailed analyses of plastome composition and structure and comparisons with those of other orchid subfamilies have not yet been conducted. Here, the complete plastome sequences of Apostasia wallichii and Neuwiedia singapureana were sequenced and compared with 43 previously published photosynthetic orchid plastomes to characterize the plastome structure and evolution in the orchids. Unlike many orchid plastomes (e.g., Paphiopedilum and Vanilla), the plastomes of Apostasioideae contain a full set of 11 functional NADH dehydrogenase (ndh) genes. The distribution of repeat sequences and simple sequence repeat elements enhanced the view that the mutation rate of non-coding regions was higher than that of coding regions. The 10 loci—ndhA intron, matK-5′trnK, clpP-psbB, rps8-rpl14, trnT-trnL, 3′trnK-matK, clpP intron, psbK-trnK, trnS-psbC, and ndhF-rpl32—that had the highest degrees of sequence variability were identified as mutational hotspots for the Apostasia plastome. Furthermore, our results revealed that plastid genes exhibited a variable evolution rate within and among different orchid genus. Considering the diversified evolution of both coding and non-coding regions, we suggested that the plastome-wide evolution of orchid species was disproportional. Additionally, the sequences flanking the inverted repeat/small single copy (IR/SSC) junctions of photosynthetic orchid plastomes were categorized into three types according to the presence/absence of ndh genes. Different evolutionary dynamics for each of the three IR/SSC types of photosynthetic orchid plastomes were also proposed. PMID:29046685

The complete coding region sequence of river buffalo (Bubalus bubalis) SRY gene.

PubMed

Parma, Pietro; Feligini, Maria; Greppi, Gianfranco; Enne, Giuseppe

2004-02-01

The Y-linked SRY gene is responsible for testis determination in mammals. Mutations in this gene can lead to XY Gonadal Dysgenesis, an abnormal sexual phenotype described in humans, cattle, horses and river buffalo. We report here the complete river buffalo SRY sequence in order to enable the genetic diagnosis of this disease. The SRY sequence was also used to confirm the evolutionary divergence time between cattle and river buffalo 10 million years ago.

Prenatal diagnosis for a Chinese family with a de novo DMD gene mutation

PubMed Central

Li, Tao; Zhang, Zhao-jing; Ma, Xin; Lv, Xue; Xiao, Hai; Guo, Qian-nan; Liu, Hong-yan; Wang, Hong-dan; Wu, Dong; Lou, Gui-yu; Wang, Xin; Zhang, Chao-yang; Liao, Shi-xiu

2017-01-01

Abstract Background: Patients with Duchenne muscular dystrophy (DMD) usually have severe and fatal symptoms. At present, there is no effective treatment for DMD, thus it is very important to avoid the birth of children with DMD by effective prenatal diagnosis. We identified a de novo DMD gene mutation in a Chinese family, and make a prenatal diagnosis. Methods: First, multiplex ligation-dependent probe amplification (MLPA) was applied to analyze DMD gene exon deletion/duplication in all family members. The coding sequences of 79 exons in DMD gene were analyzed by Sanger sequencing in the patient; and then according to DMD gene exon mutation in the patient, DMD gene sequencing was performed in the family members. On the basis of results above, the pathogenic mutation in DMD gene was identified. Results: MLPA showed no DMD gene exon deletion/duplication in all family members. Sanger sequencing revealed c.2767_2767delT [p.Ser923LeufsX26] mutation in DMD gene of the patient. Heterozygous deletion mutation (T/-) at this locus was observed in the pregnant woman and her mother and younger sister. The analyses of amniotic fluid samples indicated negative Y chromosome sex-determining gene, no DMD gene exon deletion/duplication, no mutations at c.2767 locus, and the inherited maternal X chromosome different from that of the patient. Conclusion: The pathogenic mutation in DMD gene, c.2767_2767delT [p.Ser923LeufsX26], identified in this family is a de novo mutation. On the basis of specific conditions, it is necessary to select suitable methods to make prenatal diagnosis more effective, accurate, and economic. PMID:29390271

Novel USH2A compound heterozygous mutations cause RP/USH2 in a Chinese family.

PubMed

Liu, Xiaowen; Tang, Zhaohui; Li, Chang; Yang, Kangjuan; Gan, Guanqi; Zhang, Zibo; Liu, Jingyu; Jiang, Fagang; Wang, Qing; Liu, Mugen

2010-03-17

To identify the disease-causing gene in a four-generation Chinese family affected with retinitis pigmentosa (RP). Linkage analysis was performed with a panel of microsatellite markers flanking the candidate genetic loci of RP. These loci included 38 known RP genes. The complete coding region and exon-intron boundaries of Usher syndrome 2A (USH2A) were sequenced with the proband DNA to screen the disease-causing gene mutation. Restriction fragment length polymorphism (RFLP) analysis and direct DNA sequence analysis were done to demonstrate co-segregation of the USH2A mutations with the family disease. One hundred normal controls were used without the mutations. The disease-causing gene in this Chinese family was linked to the USH2A locus on chromosome 1q41. Direct DNA sequence analysis of USH2A identified two novel mutations in the patients: one missense mutation p.G1734R in exon 26 and a splice site mutation, IVS32+1G>A, which was found in the donor site of intron 32 of USH2A. Neither the p.G1734R nor the IVS32+1G>A mutation was found in the unaffected family members or the 100 normal controls. One patient with a homozygous mutation displayed only RP symptoms until now, while three patients with compound heterozygous mutations in the family of study showed both RP and hearing impairment. This study identified two novel mutations: p.G1734R and IVS32+1G>A of USH2A in a four-generation Chinese RP family. In this study, the heterozygous mutation and the homozygous mutation in USH2A may cause Usher syndrome Type II or RP, respectively. These two mutations expand the mutant spectrum of USH2A.

[Analysis of gene mutation in a Chinese family with Norrie disease].

PubMed

Zhang, Tian-xiao; Zhao, Xiu-li; Hua, Rui; Zhang, Jin-song; Zhang, Xue

2012-09-01

To detect the pathogenic mutation in a Chinese family with Norrie disease. Clinical diagnosis was based on familial history, clinical sign and B ultrasonic examination. Peripheral blood samples were obtained from all available members in a Chinese family with Norrie disease. Genomic DNA was extracted from lymphocytes by the standard SDS-proteinase K-phenol/chloroform method. Two coding exons and all intron-exon boundaries of the NDP gene were PCR amplified using three pairs of primers and subjected to automatic DNA sequence. The causative mutation was confirmed by restriction enzyme analysis and genotyping analysis in all members. Sequence analysis of NDP gene revealed a missense mutation c.220C > T (p.Arg74Cys) in the proband and his mother. Further mutation identification by restriction enzyme analysis and genotyping analysis showed that the proband was homozygote of this mutation. His mother and other four unaffected members (III3, IV4, III5 and II2) were carriers of this mutation. The mutant amino acid located in the C-terminal cystine knot-like domain, which was critical motif for the structure and function of NDP. A NDP missense mutation was identified in a Chinese family with Norrie disease.

A novel mutation of the Keratin 12 gene responsible for a severe phenotype of Meesmann's corneal dystrophy

PubMed Central

Sullivan, Lori S.; Baylin, Eric B.; Font, Ramon; Daiger, Stephen P.; Pepose, Jay S.; Clinch, Thomas E.; Nakamura, Hisashi; Zhao, Xinping C.

2007-01-01

Purpose To determine if a mutation within the coding region of the keratin 12 gene (KRT12) is responsible for a severe form of Meesmann's corneal dystrophy. Methods A family with clinically identified Meesmann's corneal dystrophy was recruited and studied. Electron microscopy was performed on scrapings of corneal epithelial cells from the proband. Mutations in the KRT12 gene were sought using direct genomic sequencing of leukocyte DNA from two affected and two unaffected family members. Subsequently, the observed mutation was screened in all available family members using polymerase chain reaction and direct sequencing. Results A heterozygous missense mutation (Arg430Pro) was found in exon 6 of KRT12 in all 14 affected individuals studied. Unaffected family members and 100 normal controls were negative for this mutation. Conclusions We have identified a novel mutation in the KRT12 gene that is associated with a symptomatic phenotype of Meesmann's corneal dystrophy. This mutation results in a substitution of proline for arginine in the helix termination motif that may disrupt the normal helix, leading to a dramatic structural change of the keratin 12 protein. PMID:17653038

Analysis of full coding sequence of the TP53 gene in invasive vulvar cancers: Implications for therapy.

PubMed

Kashofer, Karl; Regauer, Sigrid

2017-08-01

This study evaluates the frequency and type of TP53 gene mutations and HPV status in 72 consecutively diagnosed primary invasive vulvar squamous cell carcinomas (SCC) during the past 5years. DNA of formalin-fixed and paraffin embedded tumour tissue was analysed for 32 HPV subtypes and the full coding sequence of the TP53 gene, and correlated with results of p53 immunohistochemistry. 13/72 (18%) cancers were HPV-induced squamous cell carcinomas, of which 1/13 (8%) carcinoma harboured a somatic TP53 mutation. Among the 59/72 (82%) HPV-negative cancers, 59/72 (82%) SCC were HPV-negative with wild-type gene in 14/59 (24%) SCC and somatic TP53 mutations in 45/59 (76%) SCC. 28/45 (62%) SCC carried one (n=20) or two (n=8) missense mutations. 11/45 (24%) carcinomas showed a single disruptive mutation (3× frame shift, 7× stop codon, 1× deletion), 3/45 SCC a splice site mutation. 3/45 (7%) carcinomas had 2 or 3 different mutations. 18 different "hot spot" mutations were observed in 22/45 cancers (49%; 5× R273, 3× R282; 2× each Y220, R278, R248). Immunohistochemical p53 over expression was identified in most SCC with missense mutations, but not in SCC with disruptive TP53 mutations or TP53 wild-type. 14/45 (31%) patients with TP53 mutated SCC died of disease within 12months (range 2-24months) versus 0/13 patients with HPV-induced carcinomas and 0/14 patients with HPV-negative, TP53 wild-type carcinomas. 80% of primary invasive vulvar SCC were HPV-negative carcinomas with a high frequency of disruptive mutations and "hot spot" TP53 gene mutations, which have been linked to chemo- and radioresistance. The death rate of patients with p53 mutated vulvar cancers was 31%. Immunohistochemical p53 over expression could not reliably identify SCC with TP53 gene mutation. Pharmacological therapies targeting mutant p53 will be promising strategies for personalized therapy in patients with TP53 mutated vulvar cancers. Copyright © 2017. Published by Elsevier Inc.

Identification of a novel LMF1 nonsense mutation responsible for severe hypertriglyceridemia by targeted next-generation sequencing.

PubMed

Cefalù, Angelo B; Spina, Rossella; Noto, Davide; Ingrassia, Valeria; Valenti, Vincenza; Giammanco, Antonina; Fayer, Francesca; Misiano, Gabriella; Cocorullo, Gianfranco; Scrimali, Chiara; Palesano, Ornella; Altieri, Grazia I; Ganci, Antonina; Barbagallo, Carlo M; Averna, Maurizio R

Severe hypertriglyceridemia (HTG) may result from mutations in genes affecting the intravascular lipolysis of triglyceride (TG)-rich lipoproteins. The aim of this study was to develop a targeted next-generation sequencing panel for the molecular diagnosis of disorders characterized by severe HTG. We developed a targeted customized panel for next-generation sequencing Ion Torrent Personal Genome Machine to capture the coding exons and intron/exon boundaries of 18 genes affecting the main pathways of TG synthesis and metabolism. We sequenced 11 samples of patients with severe HTG (TG>885 mg/dL-10 mmol/L): 4 positive controls in whom pathogenic mutations had previously been identified by Sanger sequencing and 7 patients in whom the molecular defect was still unknown. The customized panel was accurate, and it allowed to confirm genetic variants previously identified in all positive controls with primary severe HTG. Only 1 patient of 7 with HTG was found to be carrier of a homozygous pathogenic mutation of the third novel mutation of LMF1 gene (c.1380C>G-p.Y460X). The clinical and molecular familial cascade screening allowed the identification of 2 additional affected siblings and 7 heterozygous carriers of the mutation. We showed that our targeted resequencing approach for genetic diagnosis of severe HTG appears to be accurate, less time consuming, and more economical compared with traditional Sanger resequencing. The identification of pathogenic mutations in candidate genes remains challenging and clinical resequencing should mainly intended for patients with strong clinical criteria for monogenic severe HTG. Copyright © 2017 National Lipid Association. Published by Elsevier Inc. All rights reserved.

The contribution of de novo coding mutations to autism spectrum disorder.

PubMed

Iossifov, Ivan; O'Roak, Brian J; Sanders, Stephan J; Ronemus, Michael; Krumm, Niklas; Levy, Dan; Stessman, Holly A; Witherspoon, Kali T; Vives, Laura; Patterson, Karynne E; Smith, Joshua D; Paeper, Bryan; Nickerson, Deborah A; Dea, Jeanselle; Dong, Shan; Gonzalez, Luis E; Mandell, Jeffrey D; Mane, Shrikant M; Murtha, Michael T; Sullivan, Catherine A; Walker, Michael F; Waqar, Zainulabedin; Wei, Liping; Willsey, A Jeremy; Yamrom, Boris; Lee, Yoon-ha; Grabowska, Ewa; Dalkic, Ertugrul; Wang, Zihua; Marks, Steven; Andrews, Peter; Leotta, Anthony; Kendall, Jude; Hakker, Inessa; Rosenbaum, Julie; Ma, Beicong; Rodgers, Linda; Troge, Jennifer; Narzisi, Giuseppe; Yoon, Seungtai; Schatz, Michael C; Ye, Kenny; McCombie, W Richard; Shendure, Jay; Eichler, Evan E; State, Matthew W; Wigler, Michael

2014-11-13

Whole exome sequencing has proven to be a powerful tool for understanding the genetic architecture of human disease. Here we apply it to more than 2,500 simplex families, each having a child with an autistic spectrum disorder. By comparing affected to unaffected siblings, we show that 13% of de novo missense mutations and 43% of de novo likely gene-disrupting (LGD) mutations contribute to 12% and 9% of diagnoses, respectively. Including copy number variants, coding de novo mutations contribute to about 30% of all simplex and 45% of female diagnoses. Almost all LGD mutations occur opposite wild-type alleles. LGD targets in affected females significantly overlap the targets in males of lower intelligence quotient (IQ), but neither overlaps significantly with targets in males of higher IQ. We estimate that LGD mutation in about 400 genes can contribute to the joint class of affected females and males of lower IQ, with an overlapping and similar number of genes vulnerable to contributory missense mutation. LGD targets in the joint class overlap with published targets for intellectual disability and schizophrenia, and are enriched for chromatin modifiers, FMRP-associated genes and embryonically expressed genes. Most of the significance for the latter comes from affected females.

An integrative approach to predicting the functional effects of small indels in non-coding regions of the human genome

PubMed Central

Ferlaino, Michael; Rogers, Mark F.; Shihab, Hashem A.; Mort, Matthew; Cooper, David N.; Gaunt, Tom R.; Campbell, Colin

2018-01-01

Background Small insertions and deletions (indels) have a significant influence in human disease and, in terms of frequency, they are second only to single nucleotide variants as pathogenic mutations. As the majority of mutations associated with complex traits are located outside the exome, it is crucial to investigate the potential pathogenic impact of indels in non-coding regions of the human genome. Results We present FATHMM-indel, an integrative approach to predict the functional effect, pathogenic or neutral, of indels in non-coding regions of the human genome. Our method exploits various genomic annotations in addition to sequence data. When validated on benchmark data, FATHMM-indel significantly outperforms CADD and GAVIN, state of the art models in assessing the pathogenic impact of non-coding variants. FATHMM-indel is available via a web server at indels.biocompute.org.uk. Conclusions FATHMM-indel can accurately predict the functional impact and prioritise small indels throughout the whole non-coding genome. PMID:28985712

An integrative approach to predicting the functional effects of small indels in non-coding regions of the human genome.

PubMed

Ferlaino, Michael; Rogers, Mark F; Shihab, Hashem A; Mort, Matthew; Cooper, David N; Gaunt, Tom R; Campbell, Colin

2017-10-06

Small insertions and deletions (indels) have a significant influence in human disease and, in terms of frequency, they are second only to single nucleotide variants as pathogenic mutations. As the majority of mutations associated with complex traits are located outside the exome, it is crucial to investigate the potential pathogenic impact of indels in non-coding regions of the human genome. We present FATHMM-indel, an integrative approach to predict the functional effect, pathogenic or neutral, of indels in non-coding regions of the human genome. Our method exploits various genomic annotations in addition to sequence data. When validated on benchmark data, FATHMM-indel significantly outperforms CADD and GAVIN, state of the art models in assessing the pathogenic impact of non-coding variants. FATHMM-indel is available via a web server at indels.biocompute.org.uk. FATHMM-indel can accurately predict the functional impact and prioritise small indels throughout the whole non-coding genome.

The effects of sex-biased gene expression and X-linkage on rates of sequence evolution in Drosophila.

PubMed

Campos, José Luis; Johnston, Keira; Charlesworth, Brian

2017-12-08

A faster rate of adaptive evolution of X-linked genes compared with autosomal genes (the faster-X effect) can be caused by the fixation of recessive or partially recessive advantageous mutations. This effect should be largest for advantageous mutations that affect only male fitness, and least for mutations that affect only female fitness. We tested these predictions in Drosophila melanogaster by using coding and functionally significant non-coding sequences of genes with different levels of sex-biased expression. Consistent with theory, nonsynonymous substitutions in most male-biased and unbiased genes show faster adaptive evolution on the X. However, genes with very low recombination rates do not show such an effect, possibly as a consequence of Hill-Robertson interference. Contrary to expectation, there was a substantial faster-X effect for female-biased genes. After correcting for recombination rate differences, however, female-biased genes did not show a faster X-effect. Similar analyses of non-coding UTRs and long introns showed a faster-X effect for all groups of genes, other than introns of female-biased genes. Given the strong evidence that deleterious mutations are mostly recessive or partially recessive, we would expect a slower rate of evolution of X-linked genes for slightly deleterious mutations that become fixed by genetic drift. Surprisingly, we found little evidence for this after correcting for recombination rate, implying that weakly deleterious mutations are mostly close to being semidominant. This is consistent with evidence from polymorphism data, which we use to test how models of selection that assume semidominance with no sex-specific fitness effects may bias estimates of purifying selection. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

A novel deletion/insertion mutation in the mRNA transcribed from one {alpha}1(I) collagen allele in a family with dominant type III OI and germline mosaicism

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wang, O.; Masters, C.; Lewis, M.B.

1994-09-01

In an 8-year-old girl and her father, both of whom have severe type III OI, we have previously used RNA/RNA hybrid analysis to demonstrate a mismatch in the region of {alpha}1(I) mRNA coding for aa 558-861. We used SSCP to further localize the abnormality to a subregion coding for aa 579-679. This region was subcloned and sequenced. Each patient`s cDNA has a deletion of the sequences coding for the last residue of exon 34, and all of exons 35 and 36 (aa 604-639), followed by an insertion of 156 nt from the 3{prime}-end of intron 36. PCR amplification of leukocytemore » DNA from the patients and the clinically normal paternal grandmother yielded two fragments: a 1007 bp fragment predicted from normal genomic sequences and a 445 bp fragment. Subcloning and sequencing of the shorter genomic PCR product confirmed the presence of a 565 bp genomic deletion from the end of exon 34 to the middle of intron 36. The abnormal protein is apparently synthesized and incorporated into helix. The inserted nucleotides are in frame with the collagenous sequence and contain no stop codons. They encode a 52 aa non-collagenous region. The fibroblast procollagen of the patients has both normal and electrophoretically delayed pro{alpha}(I) bands. The electrophoretically delayed procollagen is very sensitive to pepsin or trypsin digestion, as predicted by its non-collagenous sequence, and cannot be visualized as collagen. This unique OI collagen mutation is an excellent candidate for molecular targeting to {open_quotes}turn off{close_quotes} a dominant mutant allele.« less

Mutation analysis of SLC26A4 (Pendrin) gene in a Brazilian sample of hearing-impaired subjects.

PubMed

Nonose, Renata Watanabe; Lezirovitz, Karina; de Mello Auricchio, Maria Teresa Balester; Batissoco, Ana Carla; Yamamoto, Guilherme Lopes; Mingroni-Netto, Regina Célia

2018-05-08

Mutations in the SLC26A4 gene are associated with Pendred syndrome and autosomal recessive non-syndromic deafness (DFNB4). Both disorders have similar audiologic characteristics: bilateral hearing loss, often severe or profound, which may be associated with abnormalities of the inner ear, such as dilatation of the vestibular aqueduct or Mondini dysplasia. But, in Pendred syndrome (OMIM #274600), with autosomal recessive inheritance, besides congenital sensorineural deafness, goiter or thyroid dysfunctions are frequently present. The aim of this study was to determine whether mutations in SLC26A4 are a frequent cause of hereditary deafness in Brazilian patients. Microsatellite haplotypes linked to SLC26A4 were investigated in 68 families presenting autosomal recessive non-syndromic deafness. In the probands of the 16 families presenting segregation consistent with linkage to SLC26A4, Sanger sequencing of the 20 coding exons was performed. In an additional sample of 15 individuals with suspected Pendred syndrome, because of the presence of hypothyroidism or cochleovestibular malformations, the SLC26A4 gene coding region was also sequenced. In two of the 16 families with indication of linkage to SLC26A4, the probands were found to be compound heterozygotes for probably pathogenic different mutations: three novel (c.1003 T > G (p. F335 V), c.1553G > A (p.W518X), c.2235 + 2 T > C (IVS19 + 2 T > C), and one already described, c.84C > A (p.S28R). Two of the 15 individuals with suspected Pendred syndrome because of hypothyreoidism or cochleovestibular malformations were monoallelic for likely pathogenic mutations: a splice mutation (IVS7 + 2 T > C) and the previously described c.1246A > C (p.T416P). Pathogenic copy number variations were excluded in the monoallelic cases and in those with normal results after Sanger sequencing. Additional mutations in the SLC26A4 gene or other definite molecular cause for deafness were not identified in the monoallelic patients, after exome sequencing. Biallelic pathogenic mutations in SLC26A4 explained ~ 3% of cases selected because of autosomal recessive deafness. Monoallelic mutations were present in ~ 13% of isolated cases of deafness with cochleovestibular malformations or suspected Pendred syndrome. These data reinforce the importance of mutation screening of SLC26A4 in Brazilian subjects and highlight the elevated frequency of monoallelic patients.

Mutation Spectrum of the ABCA4 Gene in a Greek Cohort with Stargardt Disease: Identification of Novel Mutations and Evidence of Three Prevalent Mutated Alleles

PubMed Central

Vassiliki, Kokkinou; George, Koutsodontis; Polixeni, Stamatiou; Christoforos, Giatzakis; Minas, Aslanides Ioannis; Stavrenia, Koukoula; Ioannis, Datseris

2018-01-01

Aim To evaluate the frequency and pattern of disease-associated mutations of ABCA4 gene among Greek patients with presumed Stargardt disease (STGD1). Materials and Methods A total of 59 patients were analyzed for ABCA4 mutations using the ABCR400 microarray and PCR-based sequencing of all coding exons and flanking intronic regions. MLPA analysis as well as sequencing of two regions in introns 30 and 36 reported earlier to harbor deep intronic disease-associated variants was used in 4 selected cases. Results An overall detection rate of at least one mutant allele was achieved in 52 of the 59 patients (88.1%). Direct sequencing improved significantly the complete characterization rate, that is, identification of two mutations compared to the microarray analysis (93.1% versus 50%). In total, 40 distinct potentially disease-causing variants of the ABCA4 gene were detected, including six previously unreported potentially pathogenic variants. Among the disease-causing variants, in this cohort, the most frequent was c.5714+5G>A representing 16.1%, while p.Gly1961Glu and p.Leu541Pro represented 15.2% and 8.5%, respectively. Conclusions By using a combination of methods, we completely molecularly diagnosed 48 of the 59 patients studied. In addition, we identified six previously unreported, potentially pathogenic ABCA4 mutations. PMID:29854428

DOE Office of Scientific and Technical Information (OSTI.GOV)

Golbus, Jessica R.; Puckelwartz, Megan J.; Dellefave-Castillo, Lisa

Background—Cardiomyopathy is highly heritable but genetically diverse. At present, genetic testing for cardiomyopathy uses targeted sequencing to simultaneously assess the coding regions of more than 50 genes. New genes are routinely added to panels to improve the diagnostic yield. With the anticipated $1000 genome, it is expected that genetic testing will shift towards comprehensive genome sequencing accompanied by targeted gene analysis. Therefore, we assessed the reliability of whole genome sequencing and targeted analysis to identify cardiomyopathy variants in 11 subjects with cardiomyopathy. Methods and Results—Whole genome sequencing with an average of 37× coverage was combined with targeted analysis focused onmore » 204 genes linked to cardiomyopathy. Genetic variants were scored using multiple prediction algorithms combined with frequency data from public databases. This pipeline yielded 1-14 potentially pathogenic variants per individual. Variants were further analyzed using clinical criteria and/or segregation analysis. Three of three previously identified primary mutations were detected by this analysis. In six subjects for whom the primary mutation was previously unknown, we identified mutations that segregated with disease, had clinical correlates, and/or had additional pathological correlation to provide evidence for causality. For two subjects with previously known primary mutations, we identified additional variants that may act as modifiers of disease severity. In total, we identified the likely pathological mutation in 9 of 11 (82%) subjects. We conclude that these pilot data demonstrate that ~30-40× coverage whole genome sequencing combined with targeted analysis is feasible and sensitive to identify rare variants in cardiomyopathy-associated genes.« less

RAMICS: trainable, high-speed and biologically relevant alignment of high-throughput sequencing reads to coding DNA.

PubMed

Wright, Imogen A; Travers, Simon A

2014-07-01

The challenge presented by high-throughput sequencing necessitates the development of novel tools for accurate alignment of reads to reference sequences. Current approaches focus on using heuristics to map reads quickly to large genomes, rather than generating highly accurate alignments in coding regions. Such approaches are, thus, unsuited for applications such as amplicon-based analysis and the realignment phase of exome sequencing and RNA-seq, where accurate and biologically relevant alignment of coding regions is critical. To facilitate such analyses, we have developed a novel tool, RAMICS, that is tailored to mapping large numbers of sequence reads to short lengths (<10 000 bp) of coding DNA. RAMICS utilizes profile hidden Markov models to discover the open reading frame of each sequence and aligns to the reference sequence in a biologically relevant manner, distinguishing between genuine codon-sized indels and frameshift mutations. This approach facilitates the generation of highly accurate alignments, accounting for the error biases of the sequencing machine used to generate reads, particularly at homopolymer regions. Performance improvements are gained through the use of graphics processing units, which increase the speed of mapping through parallelization. RAMICS substantially outperforms all other mapping approaches tested in terms of alignment quality while maintaining highly competitive speed performance. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

Targeted Analysis of Whole Genome Sequence Data to Diagnose Genetic Cardiomyopathy

DOE PAGES

Golbus, Jessica R.; Puckelwartz, Megan J.; Dellefave-Castillo, Lisa; ...

2014-09-01

Background—Cardiomyopathy is highly heritable but genetically diverse. At present, genetic testing for cardiomyopathy uses targeted sequencing to simultaneously assess the coding regions of more than 50 genes. New genes are routinely added to panels to improve the diagnostic yield. With the anticipated $1000 genome, it is expected that genetic testing will shift towards comprehensive genome sequencing accompanied by targeted gene analysis. Therefore, we assessed the reliability of whole genome sequencing and targeted analysis to identify cardiomyopathy variants in 11 subjects with cardiomyopathy. Methods and Results—Whole genome sequencing with an average of 37× coverage was combined with targeted analysis focused onmore » 204 genes linked to cardiomyopathy. Genetic variants were scored using multiple prediction algorithms combined with frequency data from public databases. This pipeline yielded 1-14 potentially pathogenic variants per individual. Variants were further analyzed using clinical criteria and/or segregation analysis. Three of three previously identified primary mutations were detected by this analysis. In six subjects for whom the primary mutation was previously unknown, we identified mutations that segregated with disease, had clinical correlates, and/or had additional pathological correlation to provide evidence for causality. For two subjects with previously known primary mutations, we identified additional variants that may act as modifiers of disease severity. In total, we identified the likely pathological mutation in 9 of 11 (82%) subjects. We conclude that these pilot data demonstrate that ~30-40× coverage whole genome sequencing combined with targeted analysis is feasible and sensitive to identify rare variants in cardiomyopathy-associated genes.« less

Non-exomic and synonymous variants in ABCA4 are an important cause of Stargardt disease

PubMed Central

Braun, Terry A.; Mullins, Robert F.; Wagner, Alex H.; Andorf, Jeaneen L.; Johnston, Rebecca M.; Bakall, Benjamin B.; Deluca, Adam P.; Fishman, Gerald A.; Lam, Byron L.; Weleber, Richard G.; Cideciyan, Artur V.; Jacobson, Samuel G.; Sheffield, Val C.; Tucker, Budd A.; Stone, Edwin M.

2013-01-01

Mutations in ABCA4 cause Stargardt disease and other blinding autosomal recessive retinal disorders. However, sequencing of the complete coding sequence in patients with clinical features of Stargardt disease sometimes fails to detect one or both mutations. For example, among 208 individuals with clear clinical evidence of ABCA4 disease ascertained at a single institution, 28 had only one disease-causing allele identified in the exons and splice junctions of the primary retinal transcript of the gene. Haplotype analysis of these 28 probands revealed 3 haplotypes shared among ten families, suggesting that 18 of the 28 missing alleles were rare enough to be present only once in the cohort. We hypothesized that mutations near rare alternate splice junctions in ABCA4 might cause disease by increasing the probability of mis-splicing at these sites. Next-generation sequencing of RNA extracted from human donor eyes revealed more than a dozen alternate exons that are occasionally incorporated into the ABCA4 transcript in normal human retina. We sequenced the genomic DNA containing 15 of these minor exons in the 28 one-allele subjects and observed five instances of two different variations in the splice signals of exon 36.1 that were not present in normal individuals (P < 10−6). Analysis of RNA obtained from the keratinocytes of patients with these mutations revealed the predicted alternate transcript. This study illustrates the utility of RNA sequence analysis of human donor tissue and patient-derived cell lines to identify mutations that would be undetectable by exome sequencing. PMID:23918662

Mutation analysis of the MECP2 gene in patients of Slavic origin with Rett syndrome: novel mutations and polymorphisms.

PubMed

Zahorakova, Daniela; Rosipal, Robert; Hadac, Jan; Zumrova, Alena; Bzduch, Vladimir; Misovicova, Nadezda; Baxova, Alice; Zeman, Jiri; Martasek, Pavel

2007-01-01

Rett syndrome (RTT), an X-linked dominant neurodevelopmental disorder in females, is caused mainly by de novo mutations in the methyl-CpG-binding protein 2 gene (MECP2). Here we report mutation analysis of the MECP2 gene in 87 patients with RTT from the Czech and Slovak Republics, and Ukraine. The patients, all girls, with classical RTT were investigated for mutations using bi-directional DNA sequencing and conformation sensitive gel electrophoresis analysis of the coding sequence and exon/intron boundaries of the MECP2 gene. Restriction fragment length polymorphism analysis was performed to confirm the mutations that cause the creation or abolition of the restriction site. Mutation-negative cases were subsequently examined by multiple ligation-dependent probe amplification (MLPA) to identify large deletions. Mutation screening revealed 31 different mutations in 68 patients and 12 non-pathogenic polymorphisms. Six mutations have not been previously published: two point mutations (323T>A, 904C>T), three deletions (189_190delGA, 816_832del17, 1069delAGC) and one deletion/inversion (1063_1236del174;1189_1231inv43). MLPA analysis revealed large deletions in two patients. The detection rate was 78.16%. Our results confirm the high frequency of MECP2 mutations in females with RTT and provide data concerning the mutation heterogeneity in the Slavic population.

Double muscling in cattle due to mutations in the myostatin gene

PubMed Central

McPherron, Alexandra C.; Lee, Se-Jin

1997-01-01

Myostatin (GDF-8) is a member of the transforming growth factor β superfamily of secreted growth and differentiation factors that is essential for proper regulation of skeletal muscle mass in mice. Here we report the myostatin sequences of nine other vertebrate species and the identification of mutations in the coding sequence of bovine myostatin in two breeds of double-muscled cattle, Belgian Blue and Piedmontese, which are known to have an increase in muscle mass relative to conventional cattle. The Belgian Blue myostatin sequence contains an 11-nucleotide deletion in the third exon which causes a frameshift that eliminates virtually all of the mature, active region of the molecule. The Piedmontese myostatin sequence contains a missense mutation in exon 3, resulting in a substitution of tyrosine for an invariant cysteine in the mature region of the protein. The similarity in phenotypes of double-muscled cattle and myostatin null mice suggests that myostatin performs the same biological function in these two species and is a potentially useful target for genetic manipulation in other farm animals. PMID:9356471

Evolution of Functional Diversification within Quasispecies

PubMed Central

Colizzi, Enrico Sandro; Hogeweg, Paulien

2014-01-01

According to quasispecies theory, high mutation rates limit the amount of information genomes can store (Eigen’s Paradox), whereas genomes with higher degrees of neutrality may be selected even at the expenses of higher replication rates (the “survival of the flattest” effect). Introducing a complex genotype to phenotype map, such as RNA folding, epitomizes such effect because of the existence of neutral networks and their exploitation by evolution, affecting both population structure and genome composition. We reexamine these classical results in the light of an RNA-based system that can evolve its own ecology. Contrary to expectations, we find that quasispecies evolving at high mutation rates are steep and characterized by one master sequence. Importantly, the analysis of the system and the characterization of the evolved quasispecies reveal the emergence of functionalities as phenotypes of nonreplicating genotypes, whose presence is crucial for the overall viability and stability of the system. In other words, the master sequence codes for the information of the entire ecosystem, whereas the decoding happens, stochastically, through mutations. We show that this solution quickly outcompetes strategies based on genomes with a high degree of neutrality. In conclusion, individually coded but ecosystem-based diversity evolves and persists indefinitely close to the Information Threshold. PMID:25056399

Simultaneous mutation and copy number variation (CNV) detection by multiplex PCR-based GS-FLX sequencing.

PubMed

Goossens, Dirk; Moens, Lotte N; Nelis, Eva; Lenaerts, An-Sofie; Glassee, Wim; Kalbe, Andreas; Frey, Bruno; Kopal, Guido; De Jonghe, Peter; De Rijk, Peter; Del-Favero, Jurgen

2009-03-01

We evaluated multiplex PCR amplification as a front-end for high-throughput sequencing, to widen the applicability of massive parallel sequencers for the detailed analysis of complex genomes. Using multiplex PCR reactions, we sequenced the complete coding regions of seven genes implicated in peripheral neuropathies in 40 individuals on a GS-FLX genome sequencer (Roche). The resulting dataset showed highly specific and uniform amplification. Comparison of the GS-FLX sequencing data with the dataset generated by Sanger sequencing confirmed the detection of all variants present and proved the sensitivity of the method for mutation detection. In addition, we showed that we could exploit the multiplexed PCR amplicons to determine individual copy number variation (CNV), increasing the spectrum of detected variations to both genetic and genomic variants. We conclude that our straightforward procedure substantially expands the applicability of the massive parallel sequencers for sequencing projects of a moderate number of amplicons (50-500) with typical applications in resequencing exons in positional or functional candidate regions and molecular genetic diagnostics. 2008 Wiley-Liss, Inc.

Screening for microsatellite instability target genes in colorectal cancers

PubMed Central

Vilkki, S; Launonen, V; Karhu, A; Sistonen, P; Vastrik, I; Aaltonen, L

2002-01-01

Background: Defects in the DNA repair system lead to genetic instability because replication errors are not corrected. This type of genetic instability is a key event in the malignant progression of HNPCC and a subset of sporadic colon cancers and mutation rates are particularly high at short repetitive sequences. Somatic deletions of coding mononucleotide repeats have been detected, for example, in the TGFßRII and BAX genes, and recently many novel target genes for microsatellite instability (MSI) have been proposed. Novel target genes are likely to be discovered in the future. More data should be created on background mutation rates in MSI tumours to evaluate mutation rates observed in the candidate target genes. Methods: Mutation rates in 14 neutral intronic repeats were evaluated in MSI tumours. Bioinformatic searches combined with keywords related to cancer and tumour suppressor or CRC related gene homology were used to find new candidate MSI target genes. By comparison of mutation frequencies observed in intronic mononucleotide repeats versus exonic coding repeats of potential MSI target genes, the significance of the exonic mutations was estimated. Results: As expected, the length of an intronic mononucleotide repeat correlated positively with the number of slippages for both G/C and A/T repeats (p=0.0020 and p=0.0012, respectively). BRCA1, CtBP1, and Rb1 associated CtIP and other candidates were found in a bioinformatic search combined with keywords related to cancer. Sequencing showed a significantly increased mutation rate in the exonic A9 repeat of CtIP (25/109=22.9%) as compared with similar intronic repeats (p≤0.001). Conclusions: We propose a new candidate MSI target gene CtIP to be evaluated in further studies. PMID:12414815

Estimating Exceptionally Rare Germline and Somatic Mutation Frequencies via Next Generation Sequencing

PubMed Central

Yoon, Song-Ro; Arnheim, Norman; Calabrese, Peter

2016-01-01

We used targeted next generation deep-sequencing (Safe Sequencing System) to measure ultra-rare de novo mutation frequencies in the human male germline by attaching a unique identifier code to each target DNA molecule. Segments from three different human genes (FGFR3, MECP2 and PTPN11) were studied. Regardless of the gene segment, the particular testis donor or the 73 different testis pieces used, the frequencies for any one of the six different mutation types were consistent. Averaging over the C>T/G>A and G>T/C>A mutation types the background mutation frequency was 2.6x10-5 per base pair, while for the four other mutation types the average background frequency was lower at 1.5x10-6 per base pair. These rates far exceed the well documented human genome average frequency per base pair (~10−8) suggesting a non-biological explanation for our data. By computational modeling and a new experimental procedure to distinguish between pre-mutagenic lesion base mismatches and a fully mutated base pair in the original DNA molecule, we argue that most of the base-dependent variation in background frequency is due to a mixture of deamination and oxidation during the first two PCR cycles. Finally, we looked at a previously studied disease mutation in the PTPN11 gene and could easily distinguish true mutations from the SSS background. We also discuss the limits and possibilities of this and other methods to measure exceptionally rare mutation frequencies, and we present calculations for other scientists seeking to design their own such experiments. PMID:27341568

Functional census of mutation sequence spaces: The example of p53 cancer rescue mutants

PubMed Central

Danziger, Samuel A.; Swamidass, S. Joshua; Zeng, Jue; Dearth, Lawrence R.; Lu, Qiang; Chen, Jonathan H.; Cheng, Jainlin; Hoang, Vinh P.; Saigo, Hiroto; Luo, Ray; Baldi, Pierre; Brachmann, Rainer K.; Lathrop, Richard H.

2009-01-01

Many biomedical problems relate to mutant functional properties across a sequence space of interest, e.g., flu, cancer, and HIV. Detailed knowledge of mutant properties and function improves medical treatment and prevention. A functional census of p53 cancer rescue mutants would aid the search for cancer treatments from p53 rescue. We devised a general methodology for conducting a functional census of a mutation sequence space, and conducted a double-blind predictive test on the functional rescue property of 71 novel putative p53 cancer rescue mutants iteratively predicted in sets of 3. Double-blind predictive accuracy (15-point moving window) rose from 47% to 86% over the trial (r = 0.74). Code and data are available upon request1. PMID:17048398

Variability and transmission by Aphis glycines of North American and Asian Soybean mosaic virus isolates.

PubMed

Domier, L L; Latorre, I J; Steinlage, T A; McCoppin, N; Hartman, G L

2003-10-01

The variability of North American and Asian strains and isolates of Soybean mosaic virus was investigated. First, polymerase chain reaction (PCR) products representing the coat protein (CP)-coding regions of 38 SMVs were analyzed for restriction fragment length polymorphisms (RFLP). Second, the nucleotide and predicted amino acid sequence variability of the P1-coding region of 18 SMVs and the helper component/protease (HC/Pro) and CP-coding regions of 25 SMVs were assessed. The CP nucleotide and predicted amino acid sequences were the most similar and predicted phylogenetic relationships similar to those obtained from RFLP analysis. Neither RFLP nor sequence analyses of the CP-coding regions grouped the SMVs by geographical origin. The P1 and HC/Pro sequences were more variable and separated the North American and Asian SMV isolates into two groups similar to previously reported differences in pathogenic diversity of the two sets of SMV isolates. The P1 region was the most informative of the three regions analyzed. To assess the biological relevance of the sequence differences in the HC/Pro and CP coding regions, the transmissibility of 14 SMV isolates by Aphis glycines was tested. All field isolates of SMV were transmitted efficiently by A. glycines, but the laboratory isolates analyzed were transmitted poorly. The amino acid sequences from most, but not all, of the poorly transmitted isolates contained mutations in the aphid transmission-associated DAG and/or KLSC amino acid sequence motifs of CP and HC/Pro, respectively.

Phenotypic spectrum associated with mutations of the mitochondrial polymerase gamma gene.

PubMed

Horvath, Rita; Hudson, Gavin; Ferrari, Gianfrancesco; Fütterer, Nancy; Ahola, Sofia; Lamantea, Eleonora; Prokisch, Holger; Lochmüller, Hanns; McFarland, Robert; Ramesh, V; Klopstock, Thomas; Freisinger, Peter; Salvi, Fabrizio; Mayr, Johannes A; Santer, Rene; Tesarova, Marketa; Zeman, Jiri; Udd, Bjarne; Taylor, Robert W; Turnbull, Douglass; Hanna, Michael; Fialho, Doreen; Suomalainen, Anu; Zeviani, Massimo; Chinnery, Patrick F

2006-07-01

Mutations in the gene coding for the catalytic subunit of the mitochondrial DNA (mtDNA) polymerase gamma (POLG1) have recently been described in patients with diverse clinical presentations, revealing a complex relationship between genotype and phenotype in patients and their families. POLG1 was sequenced in patients from different European diagnostic and research centres to define the phenotypic spectrum and advance understanding of the recurrence risks. Mutations were identified in 38 cases, with the majority being sporadic compound heterozygotes. Eighty-nine DNA sequence changes were identified, including 2 predicted to alter a splice site, 1 predicted to cause a premature stop codon and 13 predicted to cause novel amino acid substitutions. The majority of children had a mutation in the linker region, often 1399G-->A (A467T), and a mutation affecting the polymerase domain. Others had mutations throughout the gene, and 11 had 3 or more substitutions. The clinical presentation ranged from the neonatal period to late adult life, with an overlapping phenotypic spectrum from severe encephalopathy and liver failure to late-onset external ophthalmoplegia, ataxia, myopathy and isolated muscle pain or epilepsy. There was a strong gender bias in children, with evidence of an environmental interaction with sodium valproate. POLG1 mutations cause an overlapping clinical spectrum of disease with both dominant and recessive modes of inheritance. 1399G-->A (A467T) is common in children, but complete POLG1 sequencing is required to identify multiple mutations that can have complex implications for genetic counselling.

Identification of the structural mutation responsible for the dibucaine-resistant (atypical) variant form of human serum cholinesterase

DOE Office of Scientific and Technical Information (OSTI.GOV)

McGuire, M.C.; Nogueira, C.P.; Bartels, C.F.

1989-02-01

A point mutation in the gene for human serum cholinesterase was identified that changes Asp-70 to Gly in the atypical form of serum cholinesterase. The mutation in nucleotide 209, which changes codon 70 from GAT to GGT, was found by sequencing a genomic clone and sequencing selected regions of DNA amplified by the polymerase chain reaction. The entire coding sequences for usual and atypical cholinesterases were compared, and no other consistent base differences were found. The nucleotide-209 mutation was detected in all five atypical cholinesterase families examined. There was complete concordance between this mutation and serum cholinesterase phenotypes for allmore » 14 heterozygous and 6 homozygous atypical subjects tested. The mutation causes the loss of a Sau3A1 restriction site; the resulting DNA fragment length polymorphism was verified by electrophoresis of {sup 32}P-labeled DNA restriction fragments from usual and atypical subjects. Dot-blot hybridization analysis with a 19-mer allele-specific probe to the DNA amplified by the polymerase chain reaction distinguished between the usual and atypical genotypes. The authors conclude that the Asp-70 {yields} Gly mutation accounts for reduced affinity of atypical cholinesterase for choline esters and that Asp-70 must be an important component of the anionic site. Heterogeneity in atypical alleles may exist, but the Asp-70 point mutation may represent an appreciable portion of the atypical gene pool.« less

THE GENOMIC LANDSCAPE OF PEDIATRIC AND YOUNG ADULT T-LINEAGE ACUTE LYMPHOBLASTIC LEUKEMIA

PubMed Central

Liu, Yu; Easton, John; Shao, Ying; Maciaszek, Jamie; Wang, Zhaoming; Wilkinson, Mark R.; McCastlain, Kelly; Edmonson, Michael; Pounds, Stanley B.; Shi, Lei; Zhou, Xin; Ma, Xiaotu; Sioson, Edgar; Li, Yongjin; Rusch, Michael; Gupta, Pankaj; Pei, Deqing; Cheng, Cheng; Smith, Malcolm A.; Auvil, Jaime Guidry; Gerhard, Daniela S.; Relling, Mary V.; Winick, Naomi J.; Carroll, Andrew J.; Heerema, Nyla A.; Raetz, Elizabeth; Devidas, Meenakshi; Willman, Cheryl L.; Harvey, Richard C.; Carroll, William L.; Dunsmore, Kimberly P.; Winter, Stuart S.; Wood, Brent L; Sorrentino, Brian P.; Downing, James R.; Loh, Mignon L.; Hunger, Stephen P; Zhang, Jinghui; Mullighan, Charles G.

2017-01-01

Genetic alterations activating NOTCH1 signaling and T cell transcription factors, coupled with inactivation of the INK4/ARF tumor suppressors are hallmarks of T-ALL, but detailed genome-wide sequencing of large T-ALL cohorts has not been performed. Using integrated genomic analysis of 264 T-ALL cases, we identify 106 putative driver genes, half of which were not previously described in childhood T-ALL (e.g. CCND3, CTCF, MYB, SMARCA4, ZFP36L2 and MYCN). We described new mechanisms of coding and non-coding alteration, and identify 10 recurrently altered pathways, with associations between mutated genes and pathways, and stage or subtype of T-ALL. For example, NRAS/FLT3 mutations were associated with immature T-ALL, JAK3/STAT5B mutations in HOX1 deregulated ALL, PTPN2 mutations in TLX1 T-ALL, and PIK3R1/PTEN mutations in TAL1 ALL, suggesting that different signaling pathways have distinct roles according to maturational stage. This genomic landscape provides a logical framework for the development of faithful genetic models and new therapeutic approaches. PMID:28671688

Homozygous Mutation G539R in the Gene for P450 Oxidoreductase in a Family Previously Diagnosed as Having 17,20-Lyase Deficiency

PubMed Central

Hershkovitz, Eli; Parvari, Ruthi; Wudy, Stefan A.; Hartmann, Michaela F.; Gomes, Larissa G.; Loewental, Neta; Miller, Walter L.

2008-01-01

Context: Very few patients have been described with isolated 17,20-lyase deficiency who have had their mutations in P450c17 (17α-hydroxylase/17,20-lyase) proven by DNA sequencing and in vitro characterization of the mutations. Most patients with 17,20-lyase deficiency have mutations in the domain of P450c17 that interact with the electron-donating redox partner, P450 oxidoreductase (POR). Objective: Our objective was to clarify the genetic and functional basis of isolated 17,20-lyase deficiency in familial cases who were previously reported as having 17,20-lyase deficiency. Patients: Four undervirilized males of an extended Bedouin family were investigated. One of these has previously been reported to carry mutations in the CYP17A1 gene encoding P450c17 causing isolated 17,20-lyase deficiency. Methods: Serum hormones were evaluated before and after stimulation with ACTH. Urinary steroid metabolites were profiled by gas chromatography-mass spectrometry. Exons 1 and 8 of CYP17A1 previously reported to harbor mutations in one of these patients and all 15 coding exons of POR were sequenced. Results: Gas chromatography-mass spectrometry (GC-MS) urinary steroid profiling and serum steroid measurements showed combined deficiencies of 17,20-lyase and 21-hydroxylase. Sequencing of exons 1 and 8 of CYP17A1 in two different laboratories showed no mutations. Sequencing of POR showed that all four patients were homozygous for G539R, a previously studied mutation that retains 46% of normal capacity to support the 17α-hydroxylase activity but only 8% of the 17,20-lyase activity of P450c17. Conclusion: POR deficiency can masquerade clinically as isolated 17,20-lyase deficiency. PMID:18559916

Homozygous mutation G539R in the gene for P450 oxidoreductase in a family previously diagnosed as having 17,20-lyase deficiency.

PubMed

Hershkovitz, Eli; Parvari, Ruthi; Wudy, Stefan A; Hartmann, Michaela F; Gomes, Larissa G; Loewental, Neta; Miller, Walter L

2008-09-01

Very few patients have been described with isolated 17,20-lyase deficiency who have had their mutations in P450c17 (17alpha-hydroxylase/17,20-lyase) proven by DNA sequencing and in vitro characterization of the mutations. Most patients with 17,20-lyase deficiency have mutations in the domain of P450c17 that interact with the electron-donating redox partner, P450 oxidoreductase (POR). Our objective was to clarify the genetic and functional basis of isolated 17,20-lyase deficiency in familial cases who were previously reported as having 17,20-lyase deficiency. Four undervirilized males of an extended Bedouin family were investigated. One of these has previously been reported to carry mutations in the CYP17A1 gene encoding P450c17 causing isolated 17,20-lyase deficiency. Serum hormones were evaluated before and after stimulation with ACTH. Urinary steroid metabolites were profiled by gas chromatography-mass spectrometry. Exons 1 and 8 of CYP17A1 previously reported to harbor mutations in one of these patients and all 15 coding exons of POR were sequenced. Gas chromatography-mass spectrometry (GC-MS) urinary steroid profiling and serum steroid measurements showed combined deficiencies of 17,20-lyase and 21-hydroxylase. Sequencing of exons 1 and 8 of CYP17A1 in two different laboratories showed no mutations. Sequencing of POR showed that all four patients were homozygous for G539R, a previously studied mutation that retains 46% of normal capacity to support the 17alpha-hydroxylase activity but only 8% of the 17,20-lyase activity of P450c17. POR deficiency can masquerade clinically as isolated 17,20-lyase deficiency.

Mitochondrial genetic codes evolve to match amino acid requirements of proteins.

PubMed

Swire, Jonathan; Judson, Olivia P; Burt, Austin

2005-01-01

Mitochondria often use genetic codes different from the standard genetic code. Now that many mitochondrial genomes have been sequenced, these variant codes provide the first opportunity to examine empirically the processes that produce new genetic codes. The key question is: Are codon reassignments the sole result of mutation and genetic drift? Or are they the result of natural selection? Here we present an analysis of 24 phylogenetically independent codon reassignments in mitochondria. Although the mutation-drift hypothesis can explain reassignments from stop to an amino acid, we found that it cannot explain reassignments from one amino acid to another. In particular--and contrary to the predictions of the mutation-drift hypothesis--the codon involved in such a reassignment was not rare in the ancestral genome. Instead, such reassignments appear to take place while the codon is in use at an appreciable frequency. Moreover, the comparison of inferred amino acid usage in the ancestral genome with the neutral expectation shows that the amino acid gaining the codon was selectively favored over the amino acid losing the codon. These results are consistent with a simple model of weak selection on the amino acid composition of proteins in which codon reassignments are selected because they compensate for multiple slightly deleterious mutations throughout the mitochondrial genome. We propose that the selection pressure is for reduced protein synthesis cost: most reassignments give amino acids that are less expensive to synthesize. Taken together, our results strongly suggest that mitochondrial genetic codes evolve to match the amino acid requirements of proteins.

[Identification of novel compound heterozygous mutations of USH2A gene in a family with Usher syndrome type II].

PubMed

Jiang, Haiou; Ge, Chuanqin; Wang, Yiwang; Tang, Genyun; Quan, Qingli

2015-06-01

To identify potential mutations in a Chinese family with Usher syndrome type II. Genomic DNA was obtained from two affected and four unaffected members of the family and subjected to amplification of the entire coding sequence and splicing sites of USH2A gene. Mutation detection was conducted by direct sequencing of the PCR products. A total of 100 normal unrelated individuals were used as controls. The patients were identified to be a compound heterozygote for two mutations: c.8272G>T (p.E2758X) in exon 42 from his mother and c.12376-12378ACT>TAA(p.T4126X) in exon 63 of the USH2A gene from his father. Both mutations were not found in either of the two unaffected family members or 100 unrelated controls, and had completely co-segregated with the disease phenotype in the family. Neither mutation has been reported in the HGMD database. The novel compound heterozygous mutations c.8272G>T and c.12376-12378ACT>TAA within the USH2A gene may be responsible for the disease. This result may provide new clues for molecular diagnosis of this disease.

Identification a nonsense mutation of APC gene in Chinese patients with familial adenomatous polyposis.

PubMed

Li, Haishan; Zhang, Lingling; Jiang, Quan; Shi, Zhenwang; Tong, Hanxing

2017-04-01

Familial adenomatous polyposis (FAP; Mendelian of Inherintance in Man ID, 175100) is a rare autosomal dominant disorder characterized by the development of numerous adenomatous polyps throughout the colon and rectum associated with an increased risk of colorectal cancer. FAP is at time accompanied with certain extraintestinal manifestations such as congenital hypertrophy of the retinal pigment epithelium, dental disorders and desmoid tumors. It is caused by mutations in the adenomatous polyposis coli ( APC ) gene. The present study reported on a Chinese family with FAP. Polymerase chain reaction and direct sequencing of the full coding sequence of the APC gene were performed to identify the mutation in this family. A nonsense mutation of the APC gene was identified in this pedigree. It is a heterozygous G>T substitution at position 2,971 in exon 15 of the APC gene, which formed a premature stop codon at amino acid residue 991 (p.Glu991*). The resulting truncated protein lacked 1,853 amino acids. The present study expanded the database on APC gene mutations in FAP and enriched the spectrum of known germline mutations of the APC gene. Prophylactic proctocolectomy may be considered as a possible treatment for carriers of the mutation.

Novel RS1 mutations associated with X-linked juvenile retinoschisis

PubMed Central

YI, JUNHUI; LI, SHIQIANG; JIA, XIAOYUN; XIAO, XUESHAN; WANG, PANFENG; GUO, XIANGMING; ZHANG, QINGJIONG

2012-01-01

To identify mutations in the retinoschisin (RS1) gene in families with X-linked retinoschisis (XLRS). Twenty families with XLRS were enrolled in this study. All six coding exons and adjacent intronic regions of RS1 were amplified by polymerase chain reaction (PCR). The nucleotide sequences of the amplicons were determined by Sanger sequencing. Ten hemizygous mutations in RS1 were detected in patients from 14 of the 20 families. Four of the ten mutations were novel, including c:176G>A (p:Cys59Tyr) in exon 3, c:531T>G (p:Tyr177X), c:607C>G (p:Pro203Ala) and c:668G>A (p:Cys223Tyr) in exon 6. These four novel mutations were not present in 176 normal individuals. The remaining six were recurrent mutations, including c:214G>A (p:Glu72Lys), c:304C>T (p:Arg102Trp), c:436G>A (p:Glu146Lys), c:544C>T (p:Arg182Cys), c:599G>A (p:Arg200His) and c:644A>T (p:Glu215Val). Our study expanded the mutation spectrum of RS1 and enriches our understanding of the molecular basis of XLRS. PMID:22245991

Novel RS1 mutations associated with X-linked juvenile retinoschisis.

PubMed

Yi, Junhui; Li, Shiqiang; Jia, Xiaoyun; Xiao, Xueshan; Wang, Panfeng; Guo, Xiangming; Zhang, Qingjiong

2012-04-01

To identify mutations in the retinoschisin (RS1) gene in families with X-linked retinoschisis (XLRS). Twenty families with XLRS were enrolled in this study. All six coding exons and adjacent intronic regions of RS1 were amplified by polymerase chain reaction (PCR). The nucleotide sequences of the amplicons were determined by Sanger sequencing. Ten hemizygous mutations in RS1 were detected in patients from 14 of the 20 families. Four of the ten mutations were novel, including c:176G>A (p:Cys59Tyr) in exon 3, c:531T>G (p:Tyr177X), c:607C>G (p:Pro203Ala) and c:668G>A (p:Cys223Tyr) in exon 6. These four novel mutations were not present in 176 normal individuals. The remaining six were recurrent mutations, including c:214G>A (p:Glu72Lys), c:304C>T (p:Arg102Trp), c:436G>A (p:Glu146Lys), c:544C>T (p:Arg182Cys), c:599G>A (p:Arg200His) and c:644A>T (p:Glu215Val). Our study expanded the mutation spectrum of RS1 and enriches our understanding of the molecular basis of XLRS.

Restriction digest screening facilitates efficient detection of site-directed mutations introduced by CRISPR in C. albicans UME6

PubMed Central

Evans, Ben A.; Smith, Olivia L.; Pickerill, Ethan S.; York, Mary K.; Buenconsejo, Kristen J.P.; Chambers, Antonio E.

2018-01-01

Introduction of point mutations to a gene of interest is a powerful tool when determining protein function. CRISPR-mediated genome editing allows for more efficient transfer of a desired mutation into a wide range of model organisms. Traditionally, PCR amplification and DNA sequencing is used to determine if isolates contain the intended mutation. However, mutation efficiency is highly variable, potentially making sequencing costly and time consuming. To more efficiently screen for correct transformants, we have identified restriction enzymes sites that encode for two identical amino acids or one or two stop codons. We used CRISPR to introduce these restriction sites directly upstream of the Candida albicans UME6 Zn2+-binding domain, a known regulator of C. albicans filamentation. While repair templates coding for different restriction sites were not equally successful at introducing mutations, restriction digest screening enabled us to rapidly identify isolates with the intended mutation in a cost-efficient manner. In addition, mutated isolates have clear defects in filamentation and virulence compared to wild type C. albicans. Our data suggest restriction digestion screening efficiently identifies point mutations introduced by CRISPR and streamlines the process of identifying residues important for a phenotype of interest. PMID:29892505

Gene expression of galectin-9/ecalectin, a potent eosinophil chemoattractant, and/or the insertional isoform in human colorectal carcinoma cell lines and detection of frame-shift mutations for protein sequence truncations in the second functional lectin domain.

PubMed

Lahm, H; Hoeflich, A; Andre, S; Sordat, B; Kaltner, H; Wolf, E; Gabius, H J

2000-09-01

The family of Ca2+-independent galactoside-binding lectins with the beta-strand topology of the jelly-roll, referred to as galectins, is known to mediate and modulate a variety of cellular activities. Their functional versatility explains the current interest in monitoring their expression in cancer research, so far primarily focused on galectin-1 and -3. Tandem-repeat-type galectin-9 and its (most probably) allelic variant ecalectin, a potent eosinophil chemoattractant, are known to be human leukocyte products. We show by RT-PCR with primers specific for both that their mRNA is expressed in 17 of 21 human colorectal cancer lines. As also indicated by restriction analysis, in addition to the expected transcript of 571 bp an otherwise identical isoform coding for a 32-amino acid extension of the link peptide was detected. Positive cell lines differentially expressed either one (7 lines) or both transcripts (10 lines). Sequence analysis of RT-PCR products, performed in four cases, allowed to assign the standard transcript to ecalectin in the case of SW480 cells and detected two point mutations in the insert of the link peptide-coding sequence in WiDr and Colo205. Furthermore, this analysis identified the insertion of a single nucleotide into the coding sequence generating a frame-shift mutation, an event which has so far not been reported for any galectin. This alteration encountered in both transcripts of the WiDr line and the isoform transcript of Colo205 cells will most likely truncate the protein part within the second (C-terminal) carbohydrate recognition domain. Our results thus reveal the presence of mRNA for a galectin-9-isoform or a potent eosinophil chemoattractant (ecalectin) or a truncated version thereof with preserved N-terminal carbohydrate recognition domain in established human colon cancer cell lines.

Single-tube, non-isotopic, multiplex PCR/OLA assay and sequence-coded separation for simultaneous screening of 31 cystic fibrosis mutations

DOE Office of Scientific and Technical Information (OSTI.GOV)

Brinson, E.C.; Adriano, T.; Bloch, W.

1994-09-01

We have developed a rapid, single-tube, non-isotopic assay that screens a patient sample for the presence of 31 cystic fibrosis (CF) mutations. This assay can identify these mutations in a single reaction tube and a single electrophoresis run. Sample preparation is a simple, boil-and-go procedure, completed in less than an hour. The assay is composed of a 15-plex PCR, followed by a 61-plex oligonucleotide ligation assay (OLA), and incorporates a novel detection scheme, Sequence Coded Separation. Initially, the multiplex PCR amplifies 15 relevant segments of the CFTR gene, simultaneously. These PCR amplicons serve as templates for the multiplex OLA, whichmore » detects the normal or mutant allele at all loci, simultaneously. Each polymorphic site is interrogated by three oligonucleotide probes, a common probe and two allele-specific probes. Each common probe is tagged with a fluorescent dye, and the competing normal and mutant allelic probes incorporate different, non-nucleotide, mobility modifiers. These modifiers are composed of hexaethylene oxide (HEO) units, incorporated as HEO phosphoramidite monomers during automated DNA synthesis. The OLA is based on both probe hybridization and the ability of DNA ligase to discriminate single base mismatches at the junction between paired probes. Each single tube assay is electrophoresed in a single gel lane of a 4-color fluorescent DNA sequencer (Applied Biosystems, Model 373A). Each of the ligation products is identified by its unique combination of electrophoretic mobility and one of three colors. The fourth color is reserved for the in-lane size standard, used by GENESCAN{sup TM} software (Applied Biosystems) to size the OLA electrophoresis products. The Genotyper{sub TM} software (Applied Biosystems) decodes these Sequence-Coded-Separation data to create a patient summary report for all loci tested.« less

Large-scale whole-genome sequencing of the Icelandic population.

PubMed

Gudbjartsson, Daniel F; Helgason, Hannes; Gudjonsson, Sigurjon A; Zink, Florian; Oddson, Asmundur; Gylfason, Arnaldur; Besenbacher, Soren; Magnusson, Gisli; Halldorsson, Bjarni V; Hjartarson, Eirikur; Sigurdsson, Gunnar Th; Stacey, Simon N; Frigge, Michael L; Holm, Hilma; Saemundsdottir, Jona; Helgadottir, Hafdis Th; Johannsdottir, Hrefna; Sigfusson, Gunnlaugur; Thorgeirsson, Gudmundur; Sverrisson, Jon Th; Gretarsdottir, Solveig; Walters, G Bragi; Rafnar, Thorunn; Thjodleifsson, Bjarni; Bjornsson, Einar S; Olafsson, Sigurdur; Thorarinsdottir, Hildur; Steingrimsdottir, Thora; Gudmundsdottir, Thora S; Theodors, Asgeir; Jonasson, Jon G; Sigurdsson, Asgeir; Bjornsdottir, Gyda; Jonsson, Jon J; Thorarensen, Olafur; Ludvigsson, Petur; Gudbjartsson, Hakon; Eyjolfsson, Gudmundur I; Sigurdardottir, Olof; Olafsson, Isleifur; Arnar, David O; Magnusson, Olafur Th; Kong, Augustine; Masson, Gisli; Thorsteinsdottir, Unnur; Helgason, Agnar; Sulem, Patrick; Stefansson, Kari

2015-05-01

Here we describe the insights gained from sequencing the whole genomes of 2,636 Icelanders to a median depth of 20×. We found 20 million SNPs and 1.5 million insertions-deletions (indels). We describe the density and frequency spectra of sequence variants in relation to their functional annotation, gene position, pathway and conservation score. We demonstrate an excess of homozygosity and rare protein-coding variants in Iceland. We imputed these variants into 104,220 individuals down to a minor allele frequency of 0.1% and found a recessive frameshift mutation in MYL4 that causes early-onset atrial fibrillation, several mutations in ABCB4 that increase risk of liver diseases and an intronic variant in GNAS associating with increased thyroid-stimulating hormone levels when maternally inherited. These data provide a study design that can be used to determine how variation in the sequence of the human genome gives rise to human diversity.

Somatic mutations in the transcriptional corepressor gene BCORL1 in adult acute myelogenous leukemia.

PubMed

Li, Meng; Collins, Roxane; Jiao, Yuchen; Ouillette, Peter; Bixby, Dale; Erba, Harry; Vogelstein, Bert; Kinzler, Kenneth W; Papadopoulos, Nickolas; Malek, Sami N

2011-11-24

To further our understanding of the genetic basis of acute myelogenous leukemia (AML), we determined the coding exon sequences of ∼ 18 000 protein-encoding genes in 8 patients with secondary AML. Here we report the discovery of novel somatic mutations in the transcriptional corepressor gene BCORL1 that is located on the X-chromosome. Analysis of BCORL1 in an unselected cohort of 173 AML patients identified a total of 10 mutated cases (6%) with BCORL1 mutations, whereas analysis of 19 AML cell lines uncovered 4 (21%) BCORL1 mutated cell lines. The majority (87%) of the mutations in BCORL1 were predicted to inactivate the gene product as a result of nonsense mutations, splice site mutation, or out-of-frame insertions or deletions. These results indicate that BCORL1 by genetic criteria is a novel candidate tumor suppressor gene, joining the growing list of genes recurrently mutated in AML.

Clinical evaluation of panel testing by next-generation sequencing (NGS) for gene mutations in myeloid neoplasms.

PubMed

Au, Chun Hang; Wa, Anna; Ho, Dona N; Chan, Tsun Leung; Ma, Edmond S K

2016-01-22

Genomic techniques in recent years have allowed the identification of many mutated genes important in the pathogenesis of acute myeloid leukemia (AML). Together with cytogenetic aberrations, these gene mutations are powerful prognostic markers in AML and can be used to guide patient management, for example selection of optimal post-remission therapy. The mutated genes also hold promise as therapeutic targets themselves. We evaluated the applicability of a gene panel for the detection of AML mutations in a diagnostic molecular pathology laboratory. Fifty patient samples comprising 46 AML and 4 other myeloid neoplasms were accrued for the study. They consisted of 19 males and 31 females at a median age of 60 years (range: 18-88 years). A total of 54 genes (full coding exons of 15 genes and exonic hotspots of 39 genes) were targeted by 568 amplicons that ranged from 225 to 275 bp. The combined coverage was 141 kb in sequence length. Amplicon libraries were prepared by TruSight myeloid sequencing panel (Illumina, CA) and paired-end sequencing runs were performed on a MiSeq (Illumina) genome sequencer. Sequences obtained were analyzed by in-house bioinformatics pipeline, namely BWA-MEM, Samtools, GATK, Pindel, Ensembl Variant Effect Predictor and a novel algorithm ITDseek. The mean count of sequencing reads obtained per sample was 3.81 million and the mean sequencing depth was over 3000X. Seventy-seven mutations in 24 genes were detected in 37 of 50 samples (74 %). On average, 2 mutations (range 1-5) were detected per positive sample. TP53 gene mutations were found in 3 out of 4 patients with complex and unfavorable cytogenetics. Comparing NGS results with that of conventional molecular testing showed a concordance rate of 95.5 %. After further resolution and application of a novel bioinformatics algorithm ITDseek to aid the detection of FLT3 internal tandem duplication (ITD), the concordance rate was revised to 98.2 %. Gene panel testing by NGS approach was applicable for sensitive and accurate detection of actionable AML gene mutations in the clinical laboratory to individualize patient management. A novel algorithm ITDseek was presented that improved the detection of FLT3-ITD of varying length, position and at low allelic burden.

Disease-Causing 7.4 kb Cis-Regulatory Deletion Disrupting Conserved Non-Coding Sequences and Their Interaction with the FOXL2 Promotor: Implications for Mutation Screening

PubMed Central

Dostie, Josée; Lemire, Edmond; Bouchard, Philippe; Field, Michael; Jones, Kristie; Lorenz, Birgit; Menten, Björn; Buysse, Karen; Pattyn, Filip; Friedli, Marc; Ucla, Catherine; Rossier, Colette; Wyss, Carine; Speleman, Frank; De Paepe, Anne; Dekker, Job; Antonarakis, Stylianos E.; De Baere, Elfride

2009-01-01

To date, the contribution of disrupted potentially cis-regulatory conserved non-coding sequences (CNCs) to human disease is most likely underestimated, as no systematic screens for putative deleterious variations in CNCs have been conducted. As a model for monogenic disease we studied the involvement of genetic changes of CNCs in the cis-regulatory domain of FOXL2 in blepharophimosis syndrome (BPES). Fifty-seven molecularly unsolved BPES patients underwent high-resolution copy number screening and targeted sequencing of CNCs. Apart from three larger distant deletions, a de novo deletion as small as 7.4 kb was found at 283 kb 5′ to FOXL2. The deletion appeared to be triggered by an H-DNA-induced double-stranded break (DSB). In addition, it disrupts a novel long non-coding RNA (ncRNA) PISRT1 and 8 CNCs. The regulatory potential of the deleted CNCs was substantiated by in vitro luciferase assays. Interestingly, Chromosome Conformation Capture (3C) of a 625 kb region surrounding FOXL2 in expressing cellular systems revealed physical interactions of three upstream fragments and the FOXL2 core promoter. Importantly, one of these contains the 7.4 kb deleted fragment. Overall, this study revealed the smallest distant deletion causing monogenic disease and impacts upon the concept of mutation screening in human disease and developmental disorders in particular. PMID:19543368

The 253-kb inversion and deep intronic mutations in UNC13D are present in North American patients with familial hemophagocytic lymphohistiocytosis 3.

PubMed

Qian, Yaping; Johnson, Judith A; Connor, Jessica A; Valencia, C Alexander; Barasa, Nathaniel; Schubert, Jeffery; Husami, Ammar; Kissell, Diane; Zhang, Ge; Weirauch, Matthew T; Filipovich, Alexandra H; Zhang, Kejian

2014-06-01

The mutations in UNC13D are responsible for familial hemophagocytic lymphohistiocytosis (FHL) type 3. A 253-kb inversion and two deep intronic mutations, c.118-308C > T and c.118-307G > A, in UNC13D were recently reported in European and Asian FHL3 patients. We sought to determine the prevalence of these three non-coding mutations in North American FHL patients and evaluate the significance of examining these new mutations in genetic testing. We performed DNA sequencing of UNC13D and targeted analysis of these three mutations in 1,709 North American patients with a suspected clinical diagnosis of hemophagocytic lymphohistiocytosis (HLH). The 253-kb inversion, intronic mutations c.118-308C > T and c.118-307G > A were found in 11, 15, and 4 patients, respectively, in which the genetic basis (bi-allelic mutations) explained 25 additional patients. Taken together with previously diagnosed FHL3 patients in our HLH patient registry, these three non-coding mutations were found in 31.6% (25/79) of the FHL3 patients. The 253-kb inversion, c.118-308C > T and c.118-307G > A accounted for 7.0%, 8.9%, and 1.3% of mutant alleles, respectively. Significantly, eight novel mutations in UNC13D are being reported in this study. To further evaluate the expression level of the newly reported intronic mutation c.118-307G > A, reverse transcription PCR and Western blot analysis revealed a significant reduction of both RNA and protein levels suggesting that the c.118-307G > A mutation affects transcription. These specified non-coding mutations were found in a significant number of North American patients and inclusion of them in mutation analysis will improve the molecular diagnosis of FHL3. © 2014 Wiley Periodicals, Inc.

Complete genome sequence of Corynebacterium glutamicum CP, a Chinese l-leucine producing strain.

PubMed

Gui, Yongli; Ma, Yuechao; Xu, Qingyang; Zhang, Chenglin; Xie, Xixian; Chen, Ning

2016-02-20

Here, we report the complete genome sequence of Corynebacterium glutamicum CP, an industrial l-leucine producing strain in China. The whole genome consists of a circular chromosome and a plasmid. The comparative genomics analysis shows that there are many mutations in the key enzyme coding genes relevant to l-leucine biosynthesis compared to C. glutamicum ATCC 13032. Copyright © 2016 Elsevier B.V. All rights reserved.

Wide Distribution of Mitochondrial Genome Rearrangements in Wild Strains of the Cultivated Basidiomycete Agrocybe aegerita

PubMed Central

Barroso, G.; Blesa, S.; Labarere, J.

1995-01-01

We used restriction fragment length polymorphisms to examine mitochondrial genome rearrangements in 36 wild strains of the cultivated basidiomycete Agrocybe aegerita, collected from widely distributed locations in Europe. We identified two polymorphic regions within the mitochondrial DNA which varied independently: one carrying the Cox II coding sequence and the other carrying the Cox I, ATP6, and ATP8 coding sequences. Two types of mutations were responsible for the restriction fragment length polymorphisms that we observed and, accordingly, were involved in the A. aegerita mitochondrial genome evolution: (i) point mutations, which resulted in strain-specific mitochondrial markers, and (ii) length mutations due to genome rearrangements, such as deletions, insertions, or duplications. Within each polymorphic region, the length differences defined only two mitochondrial types, suggesting that these length mutations were not randomly generated but resulted from a precise rearrangement mechanism. For each of the two polymorphic regions, the two molecular types were distributed among the 36 strains without obvious correlation with their geographic origin. On the basis of these two polymorphisms, it is possible to define four mitochondrial haplotypes. The four mitochondrial haplotypes could be the result of intermolecular recombination between allelic forms present in the population long enough to reach linkage equilibrium. All of the 36 dikaryotic strains contained only a single mitochondrial type, confirming the previously described mitochondrial sorting out after cytoplasmic mixing in basidiomycetes. PMID:16534984

The alpaca melanocortin 1 receptor: gene mutations, transcripts, and relative levels of expression in ventral skin biopsies.

PubMed

Chandramohan, Bathrachalam; Renieri, Carlo; La Manna, Vincenzo; La Terza, Antonietta

2015-01-01

The objectives of the present study were to characterize the MC1R gene, its transcripts and the single nucleotide polymorphisms (SNPs) associated with coat color in alpaca. Full length cDNA amplification revealed the presence of two transcripts, named as F1 and F2, differing only in the length of their 5'-terminal untranslated region (UTR) sequences and presenting a color specific expression. Whereas the F1 transcript was common to white and colored (black and brown) alpaca phenotypes, the shorter F2 transcript was specific to white alpaca. Further sequencing of the MC1R gene in white and colored alpaca identified a total of twelve SNPs; among those nine (four silent mutations (c.126C>A, c.354T>C, c.618G>A, and c.933G>A); five missense mutations (c.82A>G, c.92C>T, c.259A>G, c.376A>G, and c.901C>T)) were observed in coding region and three in the 3'UTR. A 4 bp deletion (c.224 227del) was also identified in the coding region. Molecular segregation analysis uncovered that the combinatory mutations in the MC1R locus could cause eumelanin and pheomelanin synthesis in alpaca. Overall, our data refine what is known about the MC1R gene and provides additional information on its role in alpaca pigmentation.

A Novel Loss-of-Sclerostin Function Mutation in a First Egyptian Family with Sclerosteosis

PubMed Central

Fayez, Alaaeldin; Aglan, Mona; Esmaiel, Nora; El Zanaty, Taher; Abdel Kader, Mohamed; El Ruby, Mona

2015-01-01

Sclerosteosis is a rare autosomal recessive condition characterized by increased bone density. Mutations in SOST gene coding for sclerostin are linked to sclerosteosis. Two Egyptian brothers with sclerosteosis and their apparently normal consanguineous parents were included in this study. Clinical evaluation and genomic sequencing of the SOST gene were performed followed by in silico analysis of the resulting variation. A novel homozygous frameshift mutation in the SOST gene, characterized as one nucleotide cytosine insertion that led to premature stop codon and loss of functional sclerostin, was identified in the two affected brothers. Their parents were heterozygous for the same mutation. To our knowledge this is the first Egyptian study of sclerosteosis and SOST gene causing mutation. PMID:25984533

Domestic animals as models for biomedical research.

PubMed

Andersson, Leif

2016-01-01

Domestic animals are unique models for biomedical research due to their long history (thousands of years) of strong phenotypic selection. This process has enriched for novel mutations that have contributed to phenotype evolution in domestic animals. The characterization of such mutations provides insights in gene function and biological mechanisms. This review summarizes genetic dissection of about 50 genetic variants affecting pigmentation, behaviour, metabolic regulation, and the pattern of locomotion. The variants are controlled by mutations in about 30 different genes, and for 10 of these our group was the first to report an association between the gene and a phenotype. Almost half of the reported mutations occur in non-coding sequences, suggesting that this is the most common type of polymorphism underlying phenotypic variation since this is a biased list where the proportion of coding mutations are inflated as they are easier to find. The review documents that structural changes (duplications, deletions, and inversions) have contributed significantly to the evolution of phenotypic diversity in domestic animals. Finally, we describe five examples of evolution of alleles, which means that alleles have evolved by the accumulation of several consecutive mutations affecting the function of the same gene.

Domestic animals as models for biomedical research

PubMed Central

Andersson, Leif

2016-01-01

Domestic animals are unique models for biomedical research due to their long history (thousands of years) of strong phenotypic selection. This process has enriched for novel mutations that have contributed to phenotype evolution in domestic animals. The characterization of such mutations provides insights in gene function and biological mechanisms. This review summarizes genetic dissection of about 50 genetic variants affecting pigmentation, behaviour, metabolic regulation, and the pattern of locomotion. The variants are controlled by mutations in about 30 different genes, and for 10 of these our group was the first to report an association between the gene and a phenotype. Almost half of the reported mutations occur in non-coding sequences, suggesting that this is the most common type of polymorphism underlying phenotypic variation since this is a biased list where the proportion of coding mutations are inflated as they are easier to find. The review documents that structural changes (duplications, deletions, and inversions) have contributed significantly to the evolution of phenotypic diversity in domestic animals. Finally, we describe five examples of evolution of alleles, which means that alleles have evolved by the accumulation of several consecutive mutations affecting the function of the same gene. PMID:26479863

Electron holes appear to trigger cancer-implicated mutations

NASA Astrophysics Data System (ADS)

Miller, John; Villagran, Martha

Malignant tumors are caused by mutations, which also affect their subsequent growth and evolution. We use a novel approach, computational DNA hole spectroscopy [M.Y. Suarez-Villagran & J.H. Miller, Sci. Rep. 5, 13571 (2015)], to compute spectra of enhanced hole probability based on actual sequence data. A hole is a mobile site of positive charge created when an electron is removed, for example by radiation or contact with a mutagenic agent. Peaks in the hole spectrum depict sites where holes tend to localize and potentially trigger a base pair mismatch during replication. Our studies of reveal a correlation between hole spectrum peaks and spikes in human mutation frequencies. Importantly, we also find that hole peak positions that do not coincide with large variant frequencies often coincide with cancer-implicated mutations and/or (for coding DNA) encoded conserved amino acids. This enables combining hole spectra with variant data to identify critical base pairs and potential cancer `driver' mutations. Such integration of DNA hole and variance spectra could also prove invaluable for pinpointing critical regions, and sites of driver mutations, in the vast non-protein-coding genome. Supported by the State of Texas through the Texas Ctr. for Superconductivity.

A mechanism for exon skipping caused by nonsense or missense mutations in BRCA1 and other genes.

PubMed

Liu, H X; Cartegni, L; Zhang, M Q; Krainer, A R

2001-01-01

Point mutations can generate defective and sometimes harmful proteins. The nonsense-mediated mRNA decay (NMD) pathway minimizes the potential damage caused by nonsense mutations. In-frame nonsense codons located at a minimum distance upstream of the last exon-exon junction are recognized as premature termination codons (PTCs), targeting the mRNA for degradation. Some nonsense mutations cause skipping of one or more exons, presumably during pre-mRNA splicing in the nucleus; this phenomenon is termed nonsense-mediated altered splicing (NAS), and its underlying mechanism is unclear. By analyzing NAS in BRCA1, we show here that inappropriate exon skipping can be reproduced in vitro, and results from disruption of a splicing enhancer in the coding sequence. Enhancers can be disrupted by single nonsense, missense and translationally silent point mutations, without recognition of an open reading frame as such. These results argue against a nuclear reading-frame scanning mechanism for NAS. Coding-region single-nucleotide polymorphisms (cSNPs) within exonic splicing enhancers or silencers may affect the patterns or efficiency of mRNA splicing, which may in turn cause phenotypic variability and variable penetrance of mutations elsewhere in a gene.

A double mutation in exon 6 of the [beta]-hexosaminidase [alpha] subunit in a patient with the B1 variant of Tay-Sachs disease

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ainsworth, P.J.; Coulter-Mackie, M.B.

1992-10-01

The B1 variant form of Tay-Sachs disease is enzymologically unique in that the causative mutation(s) appear to affect the active site in the [alpha] subunit of [beta]-hexosaminidase A without altering its ability to associate with the [beta] subunit. Most previously reported B1 variant mutations were found in exon 5 within codon 178. The coding sequence of the [alpha] subunit gene of a patient with the B1 variant form was examined with a combination of reverse transcription of mRNA to cDNA, PCR, and dideoxy sequencing. A double mutation in exon 6 has been identified: a G[sub 574][yields]C transversion causing a val[submore » 192][yields]leu change and a G[sub 598][yields] A transition resulting in a val[sub 200][yields]met alteration. The amplified cDNAs were otherwise normal throughout their sequence. The 574 and 598 alterations have been confirmed by amplification directly from genomic DNA from the patient and her mother. Transient-expression studies of the two exon 6 mutations (singly or together) in COS-1 cells show that the G[sub 574][yields]C change is sufficient to cause the loss of enzyme activity. The biochemical phenotype of the 574 alteration in transfection studies is consistent with that expected for a B1 variant mutation. As such, this mutation differs from previously reported B1 variant mutations, all of which occur in exon 5. 31 refs., 2 figs., 2 tabs.« less

Intragenic SNP haplotypes associated with 84dup18 mutation in TNFRSF11A in four FEO pedigrees suggest three independent origins for this mutation.

PubMed

Elahi, Elahe; Shafaghati, Yousef; Asadi, Sareh; Absalan, Farnaz; Goodarzi, Hani; Gharaii, Nava; Karimi-Nejad, Mohammad Hassan; Shahram, Farhad; Hughes, Anne E

2007-01-01

Familial expansile osteolysis (FEO) is a rare disorder causing bone dysplasia. The clinical features of FEO include early-onset hearing loss, tooth destruction, and progressive lytic expansion within limb bones causing pain, fracture, and deformity. An 18-bp duplication in the first exon of the TNFRSF11A gene encoding RANK has been previously identified in four FEO pedigrees. Despite having the identical mutation, phenotypic variations among affected individuals of the same and different pedigrees were noted. Another 18-bp duplication, one base proximal to the duplication previously reported, was subsequently found in two unrelated FEO patients. Finally, mutations overlapping with the mutations found in the FEO pedigrees have been found in ESH and early-onset PDB pedigrees. An Iranian FEO pedigree that contains six affected individuals dispersed in three generations has previously been introduced; here, the clinical features of the proband are reported in greater detail, and the genetic defect of the pedigree is presented. Direct sequencing of the entire coding region and upstream and downstream noncoding regions of TNFRSF11A in her DNA revealed the same 18-bp duplication mutation as previously found in the four FEO pedigrees. Additionally, eight sequence variations as compared to the TNFRSF11A reference sequence were identified, and a haplotype linked to the mutation based on these variations was defined. Although the mutation in the Iranian and four of the previously described FEO pedigrees was the same, haplotypes based on the intragenic SNPs suggest that the mutations do not share a common descent.

Novel compound heterozygous mutations in MYO7A in a Chinese family with Usher syndrome type 1.

PubMed

Liu, Fei; Li, Pengcheng; Liu, Ying; Li, Weirong; Wong, Fulton; Du, Rong; Wang, Lei; Li, Chang; Jiang, Fagang; Tang, Zhaohui; Liu, Mugen

2013-01-01

To identify the disease-causing mutation(s) in a Chinese family with autosomal recessive Usher syndrome type 1 (USH1). An ophthalmic examination and an audiometric test were conducted to ascertain the phenotype of two affected siblings. The microsatellite marker D11S937, which is close to the candidate gene MYO7A (USH1B locus), was selected for genotyping. From the DNA of the proband, all coding exons and exon-intron boundaries of MYO7A were sequenced to identify the disease-causing mutation(s). Restriction fragment length polymorphism (RFLP) analysis was performed to exclude the alternative conclusion that the mutations are non-pathogenic rare polymorphisms. Based on severe hearing impairment, unintelligible speech, and retinitis pigmentosa, a clinical diagnosis of Usher syndrome type 1 was made. The genotyping results did not exclude the USH1B locus, which suggested that the MYO7A gene was likely the gene associated with the disease-causing mutation(s) in the family. With direct DNA sequencing of MYO7A, two novel compound heterozygous mutations (c.3742G>A and c.6051+1G>A) of MYO7A were identified in the proband. DNA sequence analysis and RFLP analysis of other family members showed that the mutations cosegregated with the disease. Unaffected members, including the parents, uncle, and sister of the proband, carry only one of the two mutations. The mutations were not present in the controls (100 normal Chinese subjects=200 chromosomes) according to the RFLP analysis. In this study, we identified two novel mutations, c.3742G>A (p.E1248K) and c.6051+1G>A (donor splice site mutation in intron 44), of MYO7A in a Chinese non-consanguineous family with USH1. The mutations cosegregated with the disease and most likely cause the phenotype in the two affected siblings who carry these mutations compound heterozygously. Our finding expands the mutational spectrum of MYO7A.

X-linked Charcot-Marie-Tooth (CMT) neuropathies (CMTX1, CMTX2, CMTX3) show different clinical phenotype and molecular genetics

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ionasescu, V.V.; Searby, C.C.; Ionasescu, R.

1994-09-01

The purpose of this study was to compare the X-linked dominant type CMTX1 (20 families) with X-linked recessive types CMTX2 and CMTX3 (2 families). The clinical phenotype was consistent with CMT peripheral neuropathy in all cases including distal weakness, atrophy and sensory loss, pes cavus and areflexia. Additional clinicial involvement of the central nervous system was present in one family with CMTX2 (mental retardation) and one family with CMTX3 (spastic paraparesis). Tight genetic linkage to Xq13.1 was present in 20 families with CMTX1 (Z=34.07 at {theta}=0) for the marker DXS453. Fifteen of the CMTX1 families showed point mutations of themore » connexin 32 coding region (5 nonsense mutations, 8 missense mutations, 2 deletions). Five CMTX1 neuropathy families showed no evidence of point mutations of the CX32 coding sequence. These findings suggest that the CMTX1 neuropathy genotype in these families may be the result of promoter mutations, 3{prime}-untranslated region mutations or exon/intron splice site mutations or a mutation with a different type of connexin but which has close structural similarities to CX32. No mutations of the CX32 coding region were found in the CMTX2 or CMTX3 families. Linkage to Xq13.1 was excluded in both families. Genetic linkage to Xp22.2 was present in the CMTX2 family (Z=3.54 at {theta}=0) for the markers DXS987 and DXS999. Suggestion of linkage to Xq26 (Z=1.81 at {theta}=0) for the marker DXS86 was present in the CMTX3 family.« less

Phenotypic comparison of individuals with homozygous or heterozygous mutation of NOTCH3 in a large CADASIL family.

PubMed

Abou Al-Shaar, Hussam; Qadi, Najeeb; Al-Hamed, Mohamed H; Meyer, Brian F; Bohlega, Saeed

2016-08-15

Cerebral autosomal dominant arteriopathy with subcortical infarcts and leukoencephalopathy (CADASIL) is a hereditary microangiopathy caused by mutations in NOTCH3, very rarely homoallelic. To describe the clinical, radiological, and neuropsychological features in an extended CADASIL family including members with either a homozygous or heterozygous NOTCH3 R1231C mutation. The pedigree included 3 generations of a family with 13 affected individuals. The patients were examined clinically and radiologically. Neuropsychological testing was performed on the proband. Sequencing of the entire coding DNA sequence (CDS) and flanking regions of NOTCH3 was undertaken using PCR amplification and direct Sanger sequencing. Homozygous C3769T mutation, predicting R1231C in exon 22 of NOTCH3 was found in 7 family members. Six other family members harbored the same in the heterozygous state. Homozygous individuals showed a slightly more severe clinical and radiological phenotype of earlier onset compared to their heterozygous counterparts. This study reports the largest number of patients with homozygous NOTCH3 mutation. The phenotype and imaging features of homozygous individuals is within the spectrum of CADASIL, although slightly at the severe end when compared to heterozygotes carrying the same mutation. Both genetic modifiers and environmental factors may play an essential role in modification and alteration of the clinical phenotype and white matter changes among CADASIL patients. Copyright © 2016 Elsevier B.V. All rights reserved.

Neutral lipid-storage disease with myopathy and extended phenotype with novel PNPLA2 mutation.

PubMed

Massa, Roberto; Pozzessere, Simone; Rastelli, Emanuele; Serra, Laura; Terracciano, Chiara; Gibellini, Manuela; Bozzali, Marco; Arca, Marcello

2016-04-01

Neutral lipid-storage disease with myopathy is caused by mutations in PNPLA2, which produce skeletal and cardiac myopathy. We report a man with multiorgan neutral lipid storage and unusual multisystem clinical involvement, including cognitive impairment. Quantitative brain MRI with voxel-based morphometry and extended neuropsychological assessment were performed. In parallel, the coding sequences and intron/exon boundaries of the PNPLA2 gene were screened by direct sequencing. Neuropsychological assessment revealed global cognitive impairment, and brain MRI showed reduced gray matter volume in the temporal lobes. Molecular characterization revealed a novel homozygous mutation in exon 5 of PNPLA2 (c.714C>A), resulting in a premature stop codon (p.Cys238*). Some PNPLA2 mutations, such as the one described here, may present with an extended phenotype, including brain involvement. In these cases, complete neuropsychological testing, combined with quantitative brain MRI, may help to characterize and quantify cognitive impairment. © 2016 Wiley Periodicals, Inc.

Identification of a novel NHS mutation in a Chinese family with Nance-Horan syndrome.

PubMed

Li, Aijun; Li, Bingzhen; Wu, Lemeng; Yang, Liping; Chen, Ningning; Ma, Zhizhong

2015-04-01

To identiy the disease causing mutation in a Chinese family presenting with early-onset cataract and dental anomalies. A specific Hereditary Eye Disease Enrichment Panel (HEDEP) (personalized customization by MyGenostics, Baltimore, MD) based on targeted exome capture technology was used to collect the protein coding regions of 30 early-onset cataract associated genes, and high throughput sequencing was done with Illumina HiSeq 2000 platform. The identified variant was confirmed with Sanger sequencing. A novel deletion in exon 4 (c.852delG) of NHS gene was identified; the identified 1 bp deletion altered the reading frame and was predicted to result in a premature stop codon after the addition of twelve novel amino acid (p.S285PfsX13). This mutation co-segregated in affected males and obligate female carriers, but was absent in 100 matched controls. Our findings broaden the spectrum of NHS mutations causing Nance-Horan syndrome and phenotypic spectrum of the disease in Chinese patients.

A novel de novo mutation in ATP1A3 and childhood-onset schizophrenia

PubMed Central

Smedemark-Margulies, Niklas; Brownstein, Catherine A.; Vargas, Sigella; Tembulkar, Sahil K.; Towne, Meghan C.; Shi, Jiahai; Gonzalez-Cuevas, Elisa; Liu, Kevin X.; Bilguvar, Kaya; Kleiman, Robin J.; Han, Min-Joon; Torres, Alcy; Berry, Gerard T.; Yu, Timothy W.; Beggs, Alan H.; Agrawal, Pankaj B.; Gonzalez-Heydrich, Joseph

2016-01-01

We describe a child with onset of command auditory hallucinations and behavioral regression at 6 yr of age in the context of longer standing selective mutism, aggression, and mild motor delays. His genetic evaluation included chromosomal microarray analysis and whole-exome sequencing. Sequencing revealed a previously unreported heterozygous de novo mutation c.385G>A in ATP1A3, predicted to result in a p.V129M amino acid change. This gene codes for a neuron-specific isoform of the catalytic α-subunit of the ATP-dependent transmembrane sodium–potassium pump. Heterozygous mutations in this gene have been reported as causing both sporadic and inherited forms of alternating hemiplegia of childhood and rapid-onset dystonia parkinsonism. We discuss the literature on phenotypes associated with known variants in ATP1A3, examine past functional studies of the role of ATP1A3 in neuronal function, and describe a novel clinical presentation associated with mutation of this gene. PMID:27626066

Whole-genome sequencing provides new insights into the clonal architecture of Barrett’s esophagus and esophageal adenocarcinoma

PubMed Central

Warren, Andrew; Cheetham, R. Keira; Northen, Helen; O’Donovan, Maria; Malhotra, Shalini; di Pietro, Massimiliano; Ivakhno, Sergii; He, Miao; Weaver, Jamie M.J.; Lynch, Andy G.; Kingsbury, Zoya; Ross, Mark; Humphray, Sean; Bentley, David; Fitzgerald, Rebecca C.

2015-01-01

The molecular genetic relationship between esophageal adenocarcinoma (EAC) and its precursor lesion, Barrett’s esophagus, is poorly understood. Using whole-genome sequencing on 23 paired Barrett’s esophagus and EAC samples, together with one in-depth Barrett’s esophagus case-study sampled over time and space, we have provided new insights on the following aspects: i) Barrett’s esophagus is polyclonal and highly mutated even in the absence of dysplasia; ii) when cancer develops, copy number increases and heterogeneity persists such that the spectrum of mutations often shows surprisingly little overlap between EAC and adjacent Barrett’s esophagus; and iii) despite differences in specific coding mutations the mutational context suggests a common causative insult underlying these two conditions. From a clinical perspective, the histopathological assessment of dysplasia appears to be a poor reflection of the molecular disarray within the Barrett’s epithelium and a molecular Cytosponge™ technique overcomes sampling bias and has capacity to reflect the entire clonal architecture. PMID:26192915

DNA transposon activity is associated with increased mutation rates in genes of rice and other grasses

PubMed Central

Wicker, Thomas; Yu, Yeisoo; Haberer, Georg; Mayer, Klaus F. X.; Marri, Pradeep Reddy; Rounsley, Steve; Chen, Mingsheng; Zuccolo, Andrea; Panaud, Olivier; Wing, Rod A.; Roffler, Stefan

2016-01-01

DNA (class 2) transposons are mobile genetic elements which move within their ‘host' genome through excising and re-inserting elsewhere. Although the rice genome contains tens of thousands of such elements, their actual role in evolution is still unclear. Analysing over 650 transposon polymorphisms in the rice species Oryza sativa and Oryza glaberrima, we find that DNA repair following transposon excisions is associated with an increased number of mutations in the sequences neighbouring the transposon. Indeed, the 3,000 bp flanking the excised transposons can contain over 10 times more mutations than the genome-wide average. Since DNA transposons preferably insert near genes, this is correlated with increases in mutation rates in coding sequences and regulatory regions. Most importantly, we find this phenomenon also in maize, wheat and barley. Thus, these findings suggest that DNA transposon activity is a major evolutionary force in grasses which provide the basis of most food consumed by humankind. PMID:27599761

Further evidence for causal FAM20A mutations and first case of amelogenesis imperfecta and gingival hyperplasia syndrome in Morocco: a case report.

PubMed

Cherkaoui Jaouad, Imane; El Alloussi, Mustapha; Chafai El Alaoui, Siham; Laarabi, Fatima Zahra; Lyahyai, Jaber; Sefiani, Abdelaziz

2015-01-30

Amelogenesis imperfecta represents a group of developmental conditions, clinically and genetically heterogeneous, that affect the structure and clinical appearance of enamel. Amelogenesis imperfecta occurred as an isolated trait or as part of a genetic syndrome. Recently, disease-causing mutations in the FAM20A gene were identified, in families with an autosomal recessive syndrome associating amelogenesis imperfecta and gingival fibromatosis. We report, the first description of a Moroccan patient with amelogenesis imperfecta and gingival fibromatosis, in whom we performed Sanger sequencing of the entire coding sequence of FAM20A and identified a homozygous mutation in the FAM20A gene (c.34_35delCT), already reported in a family with this syndrome. Our finding confirms that the mutations of FAM20A gene are causative for amelogenesis imperfecta and gingival fibromatosis and underlines the recurrent character of the c.34_35delCT in two different ethnic groups.

Characterization of mutations in the FOXE1 gene in a cohort of unrelated Malaysian patients with congenital hypothyroidism and thyroid dysgenesis.

PubMed

Kang, In-Nee; Musa, Maslinda; Harun, Fatimah; Junit, Sarni Mat

2010-02-01

The FOXE1 gene was screened for mutations in a cohort of 34 unrelated patients with congenital hypothyroidism, 14 of whom had thyroid dysgenesis and 18 were normal (the thyroid status for 2 patients was unknown). The entire coding region of the FOXE1 gene was PCR-amplified, then analyzed using single-stranded conformational polymorphism, followed by confirmation by direct DNA sequencing. DNA sequencing analysis revealed a heterozygous A>G transition at nucleotide position 394 in one of the patients. The nucleotide transition changed asparagine to aspartate at codon 132 in the highly conserved region of the forkhead DNA binding domain of the FOXE1 gene. This mutation was not detected in a total of 104 normal healthy individuals screened. The binding ability of the mutant FOXE1 protein to the human thyroperoxidase (TPO) promoter was slightly reduced compared with the wild-type FOXE1. The mutation also caused a 5% loss of TPO transcriptional activity.

Mutations in the C-terminus of CDKL5: proceed with caution.

PubMed

Diebold, Bertrand; Delépine, Chloé; Gataullina, Svetlana; Delahaye, Andrée; Nectoux, Juliette; Bienvenu, Thierry

2014-02-01

Mutations in the cyclin-dependent kinase-like 5 (CDKL5) gene have been described in girls with Rett-like features and early-onset epileptic encephalopathy including infantile spasms. Milder phenotypes have been associated with sequence variations in the 3'-end of the CDKL5 gene. Identification of novel CDKL5 transcripts coding isoforms characterized by an altered C-terminal region strongly questions the eventual pathogenicity of sequence variations located in the 3'-end of the gene. We investigated a group of 30 female patients with a clinically heterogeneous phenotype ranging from nonspecific intellectual disability to a severe neonatal encephalopathy and identified two heterozygous CDKL5 missense mutations, the previously reported p.Val999Met and the novel mutation p.Pro944Thr. However, these mutations have also been detected in their healthy father. Considering our results and all data from the literature, we suggest that genetic variations beyond the codon 938 in human CDKL5115 protein may have minor or no significance. It is probable that screening of exons 19-21 of the CDKL5 gene is not useful in practical molecular diagnosis of atypical Rett syndrome.

Sequence variants of the DFNB31 gene among Usher syndrome patients of diverse origin

PubMed Central

Aller, Elena; Jaijo, Teresa; van Wijk, Erwin; Ebermann, Inga; Kersten, Ferry; García-García, Gema; Voesenek, Krysta; Aparisi, María José; Hoefsloot, Lies; Cremers, Cor; Díaz-Llopis, Manuel; Pennings, Ronald; Bolz, Hanno J.; Kremer, Hannie; Millán, José M.

2010-01-01

Purpose It has been demonstrated that mutations in deafness, autosomal recessive 31 (DFNB31), the gene encoding whirlin, is responsible for nonsyndromic hearing loss (NSHL; DFNB31) and Usher syndrome type II (USH2D). We screened DFNB31 in a large cohort of patients with different clinical subtypes of Usher syndrome (USH) to determine the prevalence of DFNB31 mutations among USH patients. Methods DFNB31 was screened in 149 USH2, 29 USH1, six atypical USH, and 11 unclassified USH patients from diverse ethnic backgrounds. Mutation detection was performed by direct sequencing of all coding exons. Results We identified 38 different variants among 195 patients. Most variants were clearly polymorphic, but at least two out of the 15 nonsynonymous variants (p.R350W and p.R882S) are predicted to impair whirlin structure and function, suggesting eventual pathogenicity. No putatively pathogenic mutation was found in the second allele of patients with these mutations. Conclusions DFNB31 is not a major cause of USH. PMID:20352026

A novel homozygous no-stop mutation in G6PC gene from a Chinese patient with glycogen storage disease type Ia.

PubMed

Gu, Lei-Lei; Li, Xin-Hua; Han, Yue; Zhang, Dong-Hua; Gong, Qi-Ming; Zhang, Xin-Xin

2014-02-25

Glycogen storage disease type Ia (GSD-Ia) is an autosomal recessive genetic disorder resulting in hypoglycemia, hepatomegaly and growth retardation. It is caused by mutations in the G6PC gene encoding Glucose-6-phosphatase. To date, over 80 mutations have been identified in the G6PC gene. Here we reported a novel mutation found in a Chinese patient with abnormal transaminases, hypoglycemia, hepatomegaly and short stature. Direct sequencing of the coding region and splicing-sites in the G6PC gene revealed a novel no-stop mutation, p.*358Yext*43, leading to a 43 amino-acid extension of G6Pase. The expression level of mutant G6Pase transcripts was only 7.8% relative to wild-type transcripts. This mutation was not found in 120 chromosomes from 60 unrelated healthy control subjects using direct sequencing, and was further confirmed by digestion with Rsa I restriction endonuclease. In conclusion, we revealed a novel no-stop mutation in this study which expands the spectrum of mutations in the G6PC gene. The molecular genetic analysis was indispensable to the diagnosis of GSD-Ia for the patient. Copyright © 2013 Elsevier B.V. All rights reserved.

Nagashima-type palmoplantar keratosis in a Chinese Han population

PubMed Central

Zhang, Jia; Zhang, Guolong; Ni, Cheng; Cheng, Ruhong; Liang, Jianying; Li, Ming; Yao, Zhirong

2016-01-01

Nagashima-type palmoplantar keratosis (NPPK) is an autosomal recessive form of palmoplantar keratoderma (PPK), which is caused by mutations in the SERPINB7 gene. NPPK has only been reported in Japanese and Chinese populations. The present study was conducted on 12 unrelated Chinese patients who were clinically predicted to suffer from NPPK. Mutation screening was performed by direct sequencing of the entire coding regions of SERPINB7, SLURP1, AQP5, CSTA, KRT1 and KRT9 genes. Direct sequencing of SERPINB7 revealed five homozygous founder mutations (c.796C>T) and four compound heterozygous mutations in nine patients, including one novel mutation (c.122_127delTGGTCC). Nine out of the 12 patients were diagnosed with NPPK due to SERPINB7 pathogenic mutations, and the results expanded the known mutation spectrum of NPPK. Taking the other seven reported Chinese patients, who had been definitively diagnosed with NPPK by genetic testing, into account, the present study further demonstrated that NPPK is a common entity in Mainland China, and c.796C>T is the most prevalent mutation and exerts a founder effect. Furthermore, the NPPK cases described in the current study presented a consistently mild phenotype, as compared with the degrees of phenotypic variability associated with other types of relatively severe PPK, including Mal de Meleda and Olmsted syndrome. PMID:27666198

Mutational screening of the USH2A gene in Spanish USH patients reveals 23 novel pathogenic mutations

PubMed Central

2011-01-01

Background Usher Syndrome type II (USH2) is an autosomal recessive disorder, characterized by moderate to severe hearing impairment and retinitis pigmentosa (RP). Among the three genes implicated, mutations in the USH2A gene account for 74-90% of the USH2 cases. Methods To identify the genetic cause of the disease and determine the frequency of USH2A mutations in a cohort of 88 unrelated USH Spanish patients, we carried out a mutation screening of the 72 coding exons of this gene by direct sequencing. Moreover, we performed functional minigene studies for those changes that were predicted to affect splicing. Results As a result, a total of 144 DNA sequence variants were identified. Based upon previous studies, allele frequencies, segregation analysis, bioinformatics' predictions and in vitro experiments, 37 variants (23 of them novel) were classified as pathogenic mutations. Conclusions This report provide a wide spectrum of USH2A mutations and clinical features, including atypical Usher syndrome phenotypes resembling Usher syndrome type I. Considering only the patients clearly diagnosed with Usher syndrome type II, and results obtained in this and previous studies, we can state that mutations in USH2A are responsible for 76.1% of USH2 disease in patients of Spanish origin. PMID:22004887

Non-Additive Expression of Homoeologous Genes is Established Upon Polyploidization in Hexaploid Wheat

USDA-ARS?s Scientific Manuscript database

Traditional views on the potential genetic effects of polyploidy in allohexaploid wheat (Triticum aestivum L.) have primarily emphasized aspects of greater coding sequence variation and the enhanced potential to acquire new gene functions through mutation of redundant loci. The extent and significa...

Molecular diagnosis of putative Stargardt disease probands by exome sequencing

PubMed Central

2012-01-01

Background The commonest genetic form of juvenile or early adult onset macular degeneration is Stargardt Disease (STGD) caused by recessive mutations in the gene ABCA4. However, high phenotypic and allelic heterogeneity and a small but non-trivial amount of locus heterogeneity currently impede conclusive molecular diagnosis in a significant proportion of cases. Methods We performed whole exome sequencing (WES) of nine putative Stargardt Disease probands and searched for potentially disease-causing genetic variants in previously identified retinal or macular dystrophy genes. Follow-up dideoxy sequencing was performed for confirmation and to screen for mutations in an additional set of affected individuals lacking a definitive molecular diagnosis. Results Whole exome sequencing revealed seven likely disease-causing variants across four genes, providing a confident genetic diagnosis in six previously uncharacterized participants. We identified four previously missed mutations in ABCA4 across three individuals. Likely disease-causing mutations in RDS/PRPH2, ELOVL, and CRB1 were also identified. Conclusions Our findings highlight the enormous potential of whole exome sequencing in Stargardt Disease molecular diagnosis and research. WES adequately assayed all coding sequences and canonical splice sites of ABCA4 in this study. Additionally, WES enables the identification of disease-related alleles in other genes. This work highlights the importance of collecting parental genetic material for WES testing as the current knowledge of human genome variation limits the determination of causality between identified variants and disease. While larger sample sizes are required to establish the precision and accuracy of this type of testing, this study supports WES for inherited early onset macular degeneration disorders as an alternative to standard mutation screening techniques. PMID:22863181

Simultaneous occurrence of the 11778 (ND4) and the 9438 (COX III) mtDNA mutations in Leber hereditary optic neuropathy: Molecular, biochemical, and clinical findings

DOE Office of Scientific and Technical Information (OSTI.GOV)

Oostra, R.J.; Bleeker-Wagemakers, E.M.; Zwart, R.

1995-10-01

Three mtDNA point mutations at nucleotide position (np) 3460, at np 11778 and at np 14484, are thought to be of primary importance in the pathogenesis of Leber hereditary optic neuropathy (LHON), a maternally inherited disease characterized by subacute central vision loss. These mutations are present in genes coding for subunits of complex I (NADH dehydrogenase) of the respiratory chain, occur exclusively in LHON maternal pedigrees, and have never been reported to occur together. Johns and Neufeld postulated that an mtDNA mutation at np 9438, in the gene coding for one of the subunits (COX III) of complex IV (cytochromemore » c oxidase), was also of primary importance. Johns and Neufeld (1993) found this mutation, which changed a conserved glycine to a serine, in 5 unrelated LHON probands who did not carry one of the presently known primary mutations, but they did not find it in 400 controls. However, the role of this sequence variant has been questioned in the Journal when it has been found to occur in apparently healthy African and Cuban individuals. Subsequently, Johns et al. described this mutation in two Cuban individuals presenting with optic and peripheral neuropathy. 22 refs., 1 fig., 1 tab.« less

Long-term excretion of vaccine-derived poliovirus by a healthy child.

PubMed

Martín, Javier; Odoom, Kofi; Tuite, Gráinne; Dunn, Glynis; Hopewell, Nicola; Cooper, Gill; Fitzharris, Catherine; Butler, Karina; Hall, William W; Minor, Philip D

2004-12-01

A child was found to be excreting type 1 vaccine-derived poliovirus (VDPV) with a 1.1% sequence drift from Sabin type 1 vaccine strain in the VP1 coding region 6 months after he was immunized with oral live polio vaccine. Seventeen type 1 poliovirus isolates were recovered from stools taken from this child during the following 4 months. Contrary to expectation, the child was not deficient in humoral immunity and showed high levels of serum neutralization against poliovirus. Selected virus isolates were characterized in terms of their antigenic properties, virulence in transgenic mice, sensitivity for growth at high temperatures, and differences in nucleotide sequence from the Sabin type 1 strain. The VDPV isolates showed mutations at key nucleotide positions that correlated with the observed reversion to biological properties typical of wild polioviruses. A number of capsid mutations mapped at known antigenic sites leading to changes in the viral antigenic structure. Estimates of sequence evolution based on the accumulation of nucleotide changes in the VP1 coding region detected a "defective" molecular clock running at an apparent faster speed of 2.05% nucleotide changes per year versus 1% shown in previous studies. Remarkably, when compared to several type 1 VDPV strains of different origins, isolates from this child showed a much higher proportion of nonsynonymous versus synonymous nucleotide changes in the capsid coding region. This anomaly could explain the high VP1 sequence drift found and the ability of these virus strains to replicate in the gut for a longer period than expected.

Recessive mutations in the INS gene result in neonatal diabetes through reduced insulin biosynthesis

PubMed Central

Garin, Intza; Edghill, Emma L.; Akerman, Ildem; Rubio-Cabezas, Oscar; Rica, Itxaso; Locke, Jonathan M.; Maestro, Miguel Angel; Alshaikh, Adnan; Bundak, Ruveyde; del Castillo, Gabriel; Deeb, Asma; Deiss, Dorothee; Fernandez, Juan M.; Godbole, Koumudi; Hussain, Khalid; O’Connell, Michele; Klupa, Thomasz; Kolouskova, Stanislava; Mohsin, Fauzia; Perlman, Kusiel; Sumnik, Zdenek; Rial, Jose M.; Ugarte, Estibaliz; Vasanthi, Thiruvengadam; Johnstone, Karen; Flanagan, Sarah E.; Martínez, Rosa; Castaño, Carlos; Patch, Ann-Marie; Fernández-Rebollo, Eduardo; Raile, Klemens; Morgan, Noel; Harries, Lorna W.; Castaño, Luis; Ellard, Sian; Ferrer, Jorge; de Nanclares, Guiomar Perez; Hattersley, Andrew T.

2010-01-01

Heterozygous coding mutations in the INS gene that encodes preproinsulin were recently shown to be an important cause of permanent neonatal diabetes. These dominantly acting mutations prevent normal folding of proinsulin, which leads to beta-cell death through endoplasmic reticulum stress and apoptosis. We now report 10 different recessive INS mutations in 15 probands with neonatal diabetes. Functional studies showed that recessive mutations resulted in diabetes because of decreased insulin biosynthesis through distinct mechanisms, including gene deletion, lack of the translation initiation signal, and altered mRNA stability because of the disruption of a polyadenylation signal. A subset of recessive mutations caused abnormal INS transcription, including the deletion of the C1 and E1 cis regulatory elements, or three different single base-pair substitutions in a CC dinucleotide sequence located between E1 and A1 elements. In keeping with an earlier and more severe beta-cell defect, patients with recessive INS mutations had a lower birth weight (−3.2 SD score vs. −2.0 SD score) and were diagnosed earlier (median 1 week vs. 10 weeks) compared to those with dominant INS mutations. Mutations in the insulin gene can therefore result in neonatal diabetes as a result of two contrasting pathogenic mechanisms. Moreover, the recessively inherited mutations provide a genetic demonstration of the essential role of multiple sequence elements that regulate the biosynthesis of insulin in man. PMID:20133622

Geographic Structuring of the Plasmodium falciparum Sarco(endo)plasmic Reticulum Ca2+ ATPase (PfSERCA) Gene Diversity

PubMed Central

Pinto, João; Gribaldo, Simonetta; Legrand, Eric; Niang, Makhtar; Kim, Nimol; Pharath, Lim; Volnay, Béatrice; Ekala, Marie Therese; Bouchier, Christiane; Fandeur, Thierry; Berzosa, Pedro; Benito, Agustin; Ferreira, Isabel Dinis; Ferreira, Cynthia; Vieira, Pedro Paulo; Alecrim, Maria das Graças; Mercereau-Puijalon, Odile; Cravo, Pedro

2010-01-01

Artemisinin, a thapsigargin-like sesquiterpene has been shown to inhibit the Plasmodium falciparum sarco/endoplasmic reticulum calcium-ATPase PfSERCA. To collect baseline pfserca sequence information before field deployment of Artemisinin-based Combination therapies that may select mutant parasites, we conducted a sequence analysis of 100 isolates from multiple sites in Africa, Asia and South America. Coding sequence diversity was large, with 29 mutated codons, including 32 SNPs (average of one SNP/115 bp), of which 19 were novel mutations. Most SNP detected in this study were clustered within a region in the cytosolic head of the protein. The PfSERCA functional domains were very well conserved, with non synonymous mutations located outside the functional domains, except for the S769N mutation associated in French Guiana with elevated IC50 for artemether. The S769N mutation is located close to the hinge of the headpiece, which in other species modulates calcium affinity and in consequence efficacy of inhibitors, possibly linking calcium homeostasis to drug resistance. Genetic diversity was highest in Senegal, Brazil and French Guiana, and few mutations were identified in Asia. Population genetic analysis was conducted for a partial fragment of the gene encompassing nucleotide coordinates 87-2862 (unambiguous sequence available for 96 isolates). This supported a geographic clustering, with a separation between Old and New World samples and one dominant ancestral haplotype. Genetic drift alone cannot explain the observed polymorphism, suggesting that other evolutionary mechanisms are operating. One possible contributor could be the frequency of haemoglobinopathies that are associated with calcium dysregulation in the erythrocyte. PMID:20195531

Whole-exome sequencing of primary plasma cell leukemia discloses heterogeneous mutational patterns.

PubMed

Cifola, Ingrid; Lionetti, Marta; Pinatel, Eva; Todoerti, Katia; Mangano, Eleonora; Pietrelli, Alessandro; Fabris, Sonia; Mosca, Laura; Simeon, Vittorio; Petrucci, Maria Teresa; Morabito, Fortunato; Offidani, Massimo; Di Raimondo, Francesco; Falcone, Antonietta; Caravita, Tommaso; Battaglia, Cristina; De Bellis, Gianluca; Palumbo, Antonio; Musto, Pellegrino; Neri, Antonino

2015-07-10

Primary plasma cell leukemia (pPCL) is a rare and aggressive form of plasma cell dyscrasia and may represent a valid model for high-risk multiple myeloma (MM). To provide novel information concerning the mutational profile of this disease, we performed the whole-exome sequencing of a prospective series of 12 pPCL cases included in a Phase II multicenter clinical trial and previously characterized at clinical and molecular levels. We identified 1, 928 coding somatic non-silent variants on 1, 643 genes, with a mean of 166 variants per sample, and only few variants and genes recurrent in two or more samples. An excess of C > T transitions and the presence of two main mutational signatures (related to APOBEC over-activity and aging) occurring in different translocation groups were observed. We identified 14 candidate cancer driver genes, mainly involved in cell-matrix adhesion, cell cycle, genome stability, RNA metabolism and protein folding. Furthermore, integration of mutation data with copy number alteration profiles evidenced biallelically disrupted genes with potential tumor suppressor functions. Globally, cadherin/Wnt signaling, extracellular matrix and cell cycle checkpoint resulted the most affected functional pathways. Sequencing results were finally combined with gene expression data to better elucidate the biological relevance of mutated genes. This study represents the first whole-exome sequencing screen of pPCL and evidenced a remarkable genetic heterogeneity of mutational patterns. This may provide a contribution to the comprehension of the pathogenetic mechanisms associated with this aggressive form of PC dyscrasia and potentially with high-risk MM.

Clinical presentations of X-linked retinoschisis in Taiwanese patients confirmed with genetic sequencing

PubMed Central

Liu, Laura; Chen, Ho-Min; Tsai, Shawn; Chang, Tsong-Chi; Tsai, Tzu-Hsun; Yang, Chung-May; Chao, An-Ning; Chen, Kuan-Jen; Kao, Ling-Yuh; Yeung, Ling; Yeh, Lung-Kun; Hwang, Yih-Shiou; Wu, Wei-Chi; Lai, Chi-Chun

2015-01-01

Purpose To investigate the clinical characteristics of X-linked retinoschisis (XLRS) and identify genetic mutations in Taiwanese patients with XLRS. Methods This study included 23 affected males from 16 families with XLRS. Fundus photography, spectral domain optical coherent tomography (SD-OCT), fundus autofluorescence (FAF), and full-field electroretinograms (ERGs) were performed. The coding regions of the RS1 gene that encodes retinoschisin were sequenced. Results The median age at diagnosis was 18 years (range 4–58 years). The best-corrected visual acuity ranged from no light perception to 20/25. The typical spoke-wheel pattern in the macula was present in 61% of the patients (14/23) while peripheral retinoschisis was present in 43% of the patients (10/23). Four eyes presented with vitreous hemorrhage, and two eyes presented with leukocoria that mimics Coats’ disease. Macular schisis was identified with SD-OCT in 82% of the eyes (31/38) while foveal atrophy was present in 18% of the eyes (7/38). Concentric area of high intensity was the most common FAF abnormality observed. Seven out of 12 patients (58%) showed electronegative ERG findings. Sequencing of the RS1 gene identified nine mutations, six of which were novel. The mutations are all located in exons 4–6, including six missense mutations, two nonsense mutations, and one deletion-caused frameshift mutation. Conclusions XLRS is a clinically heterogeneous disease with profound phenotypic inter- and intrafamiliar variability. Genetic sequencing is valuable as it allows a definite diagnosis of XLRS to be made without the classical clinical features and ERG findings. This study showed the variety of clinical features of XLRS and reported novel mutations. PMID:25999676

Genetic and molecular characterization of a gene encoding a wide specificity purine permease of Aspergillus nidulans reveals a novel family of transporters conserved in prokaryotes and eukaryotes.

PubMed

Diallinas, G; Gorfinkiel, L; Arst, H N; Cecchetto, G; Scazzocchio, C

1995-04-14

In Aspergillus nidulans, loss-of-function mutations in the uapA and azgA genes, encoding the major uric acid-xanthine and hypoxanthine-adenine-guanine permeases, respectively, result in impaired utilization of these purines as sole nitrogen sources. The residual growth of the mutant strains is due to the activity of a broad specificity purine permease. We have identified uapC, the gene coding for this third permease through the isolation of both gain-of-function and loss-of-function mutations. Uptake studies with wild-type and mutant strains confirmed the genetic analysis and showed that the UapC protein contributes 30% and 8-10% to uric acid and hypoxanthine transport rates, respectively. The uapC gene was cloned, its expression studied, its sequence and transcript map established, and the sequence of its putative product analyzed. uapC message accumulation is: (i) weakly induced by 2-thiouric acid; (ii) repressed by ammonium; (iii) dependent on functional uaY and areA regulatory gene products (mediating uric acid induction and nitrogen metabolite repression, respectively); (iv) increased by uapC gain-of-function mutations which specifically, but partially, suppress a leucine to valine mutation in the zinc finger of the protein coded by the areA gene. The putative uapC gene product is a highly hydrophobic protein of 580 amino acids (M(r) = 61,251) including 12-14 putative transmembrane segments. The UapC protein is highly similar (58% identity) to the UapA permease and significantly similar (23-34% identity) to a number of bacterial transporters. Comparisons of the sequences and hydropathy profiles of members of this novel family of transporters yield insights into their structure, functionally important residues, and possible evolutionary relationships.

Mutations in the NDP gene: contribution to Norrie disease, familial exudative vitreoretinopathy and retinopathy of prematurity.

PubMed

Dickinson, Joanne L; Sale, Michèle M; Passmore, Abraham; FitzGerald, Liesel M; Wheatley, Catherine M; Burdon, Kathryn P; Craig, Jamie E; Tengtrisorn, Supaporn; Carden, Susan M; Maclean, Hector; Mackey, David A

2006-01-01

To examine the contribution of mutations within the Norrie disease (NDP) gene to the clinically similar retinal diseases Norrie disease, X-linked familial exudative vitreoretinopathy (FEVR), Coat's disease and retinopathy of prematurity (ROP). A dataset comprising 13 Norrie-FEVR, one Coat's disease, 31 ROP patients and 90 ex-premature babies of <32 weeks' gestation underwent an ophthalmologic examination and were screened for mutations within the NDP gene by direct DNA sequencing, denaturing high-performance liquid chromatography or gel electrophoresis. Controls were only screened using denaturing high-performance liquid chromatography and gel electrophoresis. Confirmation of mutations identified was obtained by DNA sequencing. Evidence for two novel mutations in the NDP gene was presented: Leu103Val in one FEVR patient and His43Arg in monozygotic twin Norrie disease patients. Furthermore, a previously described 14-bp deletion located in the 5' unstranslated region of the NDP gene was detected in three cases of regressed ROP. A second heterozygotic 14-bp deletion was detected in an unaffected ex-premature girl. Only two of the 13 Norrie-FEVR index cases had the full features of Norrie disease with deafness and mental retardation. Two novel mutations within the coding region of the NDP gene were found, one associated with a severe disease phenotypes of Norrie disease and the other with FEVR. A deletion within the non-coding region was associated with only mild-regressed ROP, despite the presence of low birthweight, prematurity and exposure to oxygen. In full-term children with retinal detachment only 15% appear to have the full features of Norrie disease and this is important for counselling parents on the possible long-term outcome.

A novel missense mutation in ANO5/TMEM16E is causative for gnathodiaphyseal dyplasia in a large Italian pedigree

PubMed Central

Marconi, Caterina; Brunamonti Binello, Paolo; Badiali, Giovanni; Caci, Emanuela; Cusano, Roberto; Garibaldi, Joseph; Pippucci, Tommaso; Merlini, Alberto; Marchetti, Claudio; Rhoden, Kerry J; Galietta, Luis J V; Lalatta, Faustina; Balbi, Paolo; Seri, Marco

2013-01-01

Gnathodiaphyseal dysplasia (GDD) is an autosomal dominant syndrome characterized by frequent bone fractures at a young age, bowing of tubular bones and cemento-osseus lesions of the jawbones. Anoctamin 5 (ANO5) belongs to the anoctamin protein family that includes calcium-activated chloride channels. However, recent data together with our own experiments reported here add weight to the hypothesis that ANO5 may not function as calcium-activated chloride channel. By sequencing the entire ANO5 gene coding region and untranslated regions in a large Italian GDD family, we found a novel missense mutation causing the p.Thr513Ile substitution. The mutation segregates with the disease in the family and has never been described in any database as a polymorphism. To date, only two mutations on the same cysteine residue at position 356 of ANO5 amino-acid sequence have been described in GDD families. As ANO5 has also been found to be mutated in two different forms of muscular dystrophy, the finding of this third mutation in GDD adds clues to the role of ANO5 in these disorders. PMID:23047743

Clinical application of antenatal genetic diagnosis of osteogenesis imperfecta type IV.

PubMed

Yuan, Jing; Li, Song; Xu, YeYe; Cong, Lin

2015-04-02

Clinical analysis and genetic testing of a family with osteogenesis imperfecta type IV were conducted, aiming to discuss antenatal genetic diagnosis of osteogenesis imperfecta type IV. Preliminary genotyping was performed based on clinical characteristics of the family members and then high-throughput sequencing was applied to rapidly and accurately detect the changes in candidate genes. Genetic testing of the III5 fetus and other family members revealed missense mutation in c.2746G>A, pGly916Arg in COL1A2 gene coding region and missense and synonymous mutation in COL1A1 gene coding region. Application of antenatal genetic diagnosis provides fast and accurate genetic counseling and eugenics suggestions for patients with osteogenesis imperfecta type IV and their families.

Efficient analysis of mouse genome sequences reveal many nonsense variants

PubMed Central

Steeland, Sophie; Timmermans, Steven; Van Ryckeghem, Sara; Hulpiau, Paco; Saeys, Yvan; Van Montagu, Marc; Vandenbroucke, Roosmarijn E.; Libert, Claude

2016-01-01

Genetic polymorphisms in coding genes play an important role when using mouse inbred strains as research models. They have been shown to influence research results, explain phenotypical differences between inbred strains, and increase the amount of interesting gene variants present in the many available inbred lines. SPRET/Ei is an inbred strain derived from Mus spretus that has ∼1% sequence difference with the C57BL/6J reference genome. We obtained a listing of all SNPs and insertions/deletions (indels) present in SPRET/Ei from the Mouse Genomes Project (Wellcome Trust Sanger Institute) and processed these data to obtain an overview of all transcripts having nonsynonymous coding sequence variants. We identified 8,883 unique variants affecting 10,096 different transcripts from 6,328 protein-coding genes, which is about 28% of all coding genes. Because only a subset of these variants results in drastic changes in proteins, we focused on variations that are nonsense mutations that ultimately resulted in a gain of a stop codon. These genes were identified by in silico changing the C57BL/6J coding sequences to the SPRET/Ei sequences, converting them to amino acid (AA) sequences, and comparing the AA sequences. All variants and transcripts affected were also stored in a database, which can be browsed using a SPRET/Ei M. spretus variants web tool (www.spretus.org), including a manual. We validated the tool by demonstrating the loss of function of three proteins predicted to be severely truncated, namely Fas, IRAK2, and IFNγR1. PMID:27147605

A candidate gene for choanal atresia in alpaca.

PubMed

Reed, Kent M; Bauer, Miranda M; Mendoza, Kristelle M; Armién, Aníbal G

2010-03-01

Choanal atresia (CA) is a common nasal craniofacial malformation in New World domestic camelids (alpaca and llama). CA results from abnormal development of the nasal passages and is especially debilitating to newborn crias. CA in camelids shares many of the clinical manifestations of a similar condition in humans (CHARGE syndrome). Herein we report on the regulatory gene CHD7 of alpaca, whose homologue in humans is most frequently associated with CHARGE. Sequence of the CHD7 coding region was obtained from a non-affected cria. The complete coding region was 9003 bp, corresponding to a translated amino acid sequence of 3000 aa. Additional genomic sequences corresponding to a significant portion of the CHD7 gene were identified and assembled from the 2x alpaca whole genome sequence, providing confirmatory sequence for much of the CHD7 coding region. The alpaca CHD7 mRNA sequence was 97.9% similar to the human sequence, with the greatest sequence difference being an insertion in exon 38 that results in a polyalanine repeat (A12). Polymorphism in this repeat was tested for association with CA in alpaca by cloning and sequencing the repeat from both affected and non-affected individuals. Variation in length of the poly-A repeat was not associated with CA. Complete sequencing of the CHD7 gene will be necessary to determine whether other mutations in CHD7 are the cause of CA in camelids.

Origins of Genes: "Big Bang" or Continuous Creation?

NASA Astrophysics Data System (ADS)

Kesse, Paul K.; Gibbs, Adrian

1992-10-01

Many protein families are common to all cellular organisms, indicating that many genes have ancient origins. Genetic variation is mostly attributed to processes such as mutation, duplication, and rearrangement of ancient modules. Thus it is widely assumed that much of present-day genetic diversity can be traced by common ancestry to a molecular "big bang." A rarely considered alternative is that proteins may arise continuously de novo. One mechanism of generating different coding sequences is by "overprinting," in which an existing nucleotide sequence is translated de novo in a different reading frame or from noncoding open reading frames. The clearest evidence for overprinting is provided when the original gene function is retained, as in overlapping genes. Analysis of their phylogenies indicates which are the original genes and which are their informationally novel partners. We report here the phylogenetic relationships of overlapping coding sequences from steroid-related receptor genes and from tymovirus, luteovirus, and lentivirus genomes. For each pair of overlapping coding sequences, one is confined to a single lineage, whereas the other is more widespread. This suggests that the phylogenetically restricted coding sequence arose only in the progenitor of that lineage by translating an out-of-frame sequence to yield the new polypeptide. The production of novel exons by alternative splicing in thyroid receptor and lentivirus genes suggests that introns can be a valuable evolutionary source for overprinting. New genes and their products may drive major evolutionary changes.

Exome sequencing identifies complex I NDUFV2 mutations as a novel cause of Leigh syndrome.

PubMed

Cameron, Jessie M; MacKay, Nevena; Feigenbaum, Annette; Tarnopolsky, Mark; Blaser, Susan; Robinson, Brian H; Schulze, Andreas

2015-09-01

Two siblings with hypertrophic cardiomyopathy and brain atrophy were diagnosed with Complex I deficiency based on low enzyme activity in muscle and high lactate/pyruvate ratio in fibroblasts. Whole exome sequencing results of fibroblast gDNA from one sibling was narrowed down to 190 SNPs or In/Dels in 185 candidate genes by selecting non-synonymous coding sequence base pair changes that were not present in the SNP database. Two compound heterozygous mutations were identified in both siblings in NDUFV2, encoding the 24 kDa subunit of Complex I. The intronic mutation (c.IVS2 + 1delGTAA) is disease causing and has been reported before. The other mutation is novel (c.669_670insG, p.Ser224Valfs*3) and predicted to cause a pathogenic frameshift in the protein. Subsequent investigation of 10 probands with complex I deficiency from different families revealed homozygosity for the intronic c.IVS2 + 1delGTAA mutation in a second, consanguineous family. In this family three of five siblings were affected. Interestingly, they presented with Leigh syndrome but no cardiac involvement. The same genotype had been reported previously in a two families but presenting with hypertrophic cardiomyopathy, trunk hypotonia and encephalopathy. We have identified NDUFV2 mutations in two families with Complex I deficiency, including a novel mutation. The diagnosis of Leigh syndrome expands the clinical phenotypes associated with the c.IVS2 + 1delGTAA mutation in this gene. Copyright © 2015 European Paediatric Neurology Society. Published by Elsevier Ltd. All rights reserved.

Consistency of VDJ Rearrangement and Substitution Parameters Enables Accurate B Cell Receptor Sequence Annotation.

PubMed

Ralph, Duncan K; Matsen, Frederick A

2016-01-01

VDJ rearrangement and somatic hypermutation work together to produce antibody-coding B cell receptor (BCR) sequences for a remarkable diversity of antigens. It is now possible to sequence these BCRs in high throughput; analysis of these sequences is bringing new insight into how antibodies develop, in particular for broadly-neutralizing antibodies against HIV and influenza. A fundamental step in such sequence analysis is to annotate each base as coming from a specific one of the V, D, or J genes, or from an N-addition (a.k.a. non-templated insertion). Previous work has used simple parametric distributions to model transitions from state to state in a hidden Markov model (HMM) of VDJ recombination, and assumed that mutations occur via the same process across sites. However, codon frame and other effects have been observed to violate these parametric assumptions for such coding sequences, suggesting that a non-parametric approach to modeling the recombination process could be useful. In our paper, we find that indeed large modern data sets suggest a model using parameter-rich per-allele categorical distributions for HMM transition probabilities and per-allele-per-position mutation probabilities, and that using such a model for inference leads to significantly improved results. We present an accurate and efficient BCR sequence annotation software package using a novel HMM "factorization" strategy. This package, called partis (https://github.com/psathyrella/partis/), is built on a new general-purpose HMM compiler that can perform efficient inference given a simple text description of an HMM.

Mutational analysis of the myelin protein zero (MPZ) gene associated with Charcot-Marie-Tooth neuropathy type 1B

DOE Office of Scientific and Technical Information (OSTI.GOV)

Roa, B.B.; Warner, L.E.; Lupski, J.R.

1994-09-01

The MPZ gene that maps to chromosome 1q22q23 encodes myelin protein zero, which is the most abundant peripheral nerve myelin protein that functions as a homophilic adhesion molecule in myelin compaction. Association of the MPZ gene with the dysmyelinating peripheral neuropathies Charcot-Marie-Tooth disease type 1B (CMT1B) and the more severe Dejerine-Sottas syndrome (DSS) was previously demonstrated by MPZ mutations identified in CMT1B and in rare DSS patients. In this study, the coding region of the MPZ gene was screened for mutations in a cohort of 74 unrelated patients with either CMT type 1 or DSS who do not carry themore » most common CMT1-associated molecular lesion of a 1.5 Mb DNA duplication on 17p11.2-p12. Heteroduplex analysis detected base mismatches in ten patients that were distributed over three exons of MPZ. Direct sequencing of PCR-amplified genomic DNA identified a de novo MPZ mutation associated with CMT1B that predicts an Ile(135)Thr substitution. This finding further confirms the role of MPZ in the CMT1B disease process. In addition, two polymorphisms were identified within the Gly(200) and Ser(228) codons that do not alter the respective amino acid residues. A fourth base mismatch in MPZ exon 3 detected by heteroduplex analysis is currently being characterized by direct sequence determination. Previously, four unrelated patients in this same cohort were found to have unique point mutations in the coding region of the PMP22 gene. The collective findings on CMT1 point mutations could suggest that regulatory region mutations, and possibly mutations in CMT gene(s) apart from the MPZ, PMP22 and Cx32 genes identified thus far, may prove to be significant for a number of CMT1 cases that do not involve DNA duplication.« less

Can mutational GC-pressure create new linear B-cell epitopes in herpes simplex virus type 1 glycoprotein B?

PubMed

Khrustalev, Vladislav Victorovich

2009-01-01

We showed that GC-content of nucleotide sequences coding for linear B-cell epitopes of herpes simplex virus type 1 (HSV1) glycoprotein B (gB) is higher than GC-content of sequences coding for epitope-free regions of this glycoprotein (G + C = 73 and 64%, respectively). Linear B-cell epitopes have been predicted in HSV1 gB by BepiPred algorithm ( www.cbs.dtu.dk/services/BepiPred ). Proline is an acrophilic amino acid residue (it is usually situated on the surface of protein globules, and so included in linear B-cell epitopes). Indeed, the level of proline is much higher in predicted epitopes of gB than in epitope-free regions (17.8% versus 1.8%). This amino acid is coded by GC-rich codons (CCX) that can be produced due to nucleotide substitutions caused by mutational GC-pressure. GC-pressure will also lead to disappearance of acrophobic phenylalanine, isoleucine, methionine and tyrosine coded by GC-poor codons. Results of our "in-silico directed mutagenesis" showed that single nonsynonymous substitutions in AT to GC direction in two long epitope-free regions of gB will cause formation of new linear epitopes or elongation of previously existing epitopes flanking these regions in 25% of 539 possible cases. The calculations of GC-content and amino acid content have been performed by CodonChanges algorithm ( www.barkovsky.hotmail.ru ).

Comparative genomics and transcriptional profiles of Saccharopolyspora erythraea NRRL 2338 and a classically improved erythromycin over-producing strain

PubMed Central

2012-01-01

Background The molecular mechanisms altered by the traditional mutation and screening approach during the improvement of antibiotic-producing microorganisms are still poorly understood although this information is essential to design rational strategies for industrial strain improvement. In this study, we applied comparative genomics to identify all genetic changes occurring during the development of an erythromycin overproducer obtained using the traditional mutate-and- screen method. Results Compared with the parental Saccharopolyspora erythraea NRRL 2338, the genome of the overproducing strain presents 117 deletion, 78 insertion and 12 transposition sites, with 71 insertion/deletion sites mapping within coding sequences (CDSs) and generating frame-shift mutations. Single nucleotide variations are present in 144 CDSs. Overall, the genomic variations affect 227 proteins of the overproducing strain and a considerable number of mutations alter genes of key enzymes in the central carbon and nitrogen metabolism and in the biosynthesis of secondary metabolites, resulting in the redirection of common precursors toward erythromycin biosynthesis. Interestingly, several mutations inactivate genes coding for proteins that play fundamental roles in basic transcription and translation machineries including the transcription anti-termination factor NusB and the transcription elongation factor Efp. These mutations, along with those affecting genes coding for pleiotropic or pathway-specific regulators, affect global expression profile as demonstrated by a comparative analysis of the parental and overproducer expression profiles. Genomic data, finally, suggest that the mutate-and-screen process might have been accelerated by mutations in DNA repair genes. Conclusions This study helps to clarify the mechanisms underlying antibiotic overproduction providing valuable information about new possible molecular targets for rationale strain improvement. PMID:22401291

Familial neurohypophyseal diabetes insipidus associated with a novel mutation in the vasopressin-neurophysin II gene.

PubMed

Fujii, H; Iida, S; Moriwaki, K

2000-03-01

Familial neurohypophyseal diabetes insipidus (FNDI) is an autosomal dominant disorder of renal water conservation due to deficiency of arginine vasopressin as the result of mutations in the arginine vasopressin-neurophysin II (AVP-NPII) gene that encodes the hormone or its carrier protein. Thirty-one different mutations have been reported. In this study, we evaluated the AVP-NPII gene in a family with FNDI and identified a new mutation (1911Gright curved arrow A) in the coding sequence for NPII in affected family members. This mutation substitutes Tyr for 74 Cys in the NPII moiety. NPII is an intracellular carrier protein for AVP during the axonal transport from the hypothalamus to the posterior pituitary and contains 14 conserved cysteine residues forming 7 disulfide bonds. Because the mutation cosegregates with the phenotype, it is possible that this mutation causes neurohypophyseal diabetes insipidus in this family.

Whole-exome sequencing identifies novel MPL and JAK2 mutations in triple-negative myeloproliferative neoplasms

PubMed Central

Milosevic Feenstra, Jelena D.; Nivarthi, Harini; Gisslinger, Heinz; Leroy, Emilie; Rumi, Elisa; Chachoua, Ilyas; Bagienski, Klaudia; Kubesova, Blanka; Pietra, Daniela; Gisslinger, Bettina; Milanesi, Chiara; Jäger, Roland; Chen, Doris; Berg, Tiina; Schalling, Martin; Schuster, Michael; Bock, Christoph; Constantinescu, Stefan N.; Cazzola, Mario

2016-01-01

Essential thrombocythemia (ET) and primary myelofibrosis (PMF) are chronic diseases characterized by clonal hematopoiesis and hyperproliferation of terminally differentiated myeloid cells. The disease is driven by somatic mutations in exon 9 of CALR or exon 10 of MPL or JAK2-V617F in >90% of the cases, whereas the remaining cases are termed “triple negative.” We aimed to identify the disease-causing mutations in the triple-negative cases of ET and PMF by applying whole-exome sequencing (WES) on paired tumor and control samples from 8 patients. We found evidence of clonal hematopoiesis in 5 of 8 studied cases based on clonality analysis and presence of somatic genetic aberrations. WES identified somatic mutations in 3 of 8 cases. We did not detect any novel recurrent somatic mutations. In 3 patients with clonal hematopoiesis analyzed by WES, we identified a somatic MPL-S204P, a germline MPL-V285E mutation, and a germline JAK2-G571S variant. We performed Sanger sequencing of the entire coding region of MPL in 62, and of JAK2 in 49 additional triple-negative cases of ET or PMF. New somatic (T119I, S204F, E230G, Y591D) and 1 germline (R321W) MPL mutation were detected. All of the identified MPL mutations were gain-of-function when analyzed in functional assays. JAK2 variants were identified in 5 of 57 triple-negative cases analyzed by WES and Sanger sequencing combined. We could demonstrate that JAK2-V625F and JAK2-F556V are gain-of-function mutations. Our results suggest that triple-negative cases of ET and PMF do not represent a homogenous disease entity. Cases with polyclonal hematopoiesis might represent hereditary disorders. PMID:26423830

Whole-exome sequencing identifies novel MPL and JAK2 mutations in triple-negative myeloproliferative neoplasms.

PubMed

Milosevic Feenstra, Jelena D; Nivarthi, Harini; Gisslinger, Heinz; Leroy, Emilie; Rumi, Elisa; Chachoua, Ilyas; Bagienski, Klaudia; Kubesova, Blanka; Pietra, Daniela; Gisslinger, Bettina; Milanesi, Chiara; Jäger, Roland; Chen, Doris; Berg, Tiina; Schalling, Martin; Schuster, Michael; Bock, Christoph; Constantinescu, Stefan N; Cazzola, Mario; Kralovics, Robert

2016-01-21

Essential thrombocythemia (ET) and primary myelofibrosis (PMF) are chronic diseases characterized by clonal hematopoiesis and hyperproliferation of terminally differentiated myeloid cells. The disease is driven by somatic mutations in exon 9 of CALR or exon 10 of MPL or JAK2-V617F in >90% of the cases, whereas the remaining cases are termed "triple negative." We aimed to identify the disease-causing mutations in the triple-negative cases of ET and PMF by applying whole-exome sequencing (WES) on paired tumor and control samples from 8 patients. We found evidence of clonal hematopoiesis in 5 of 8 studied cases based on clonality analysis and presence of somatic genetic aberrations. WES identified somatic mutations in 3 of 8 cases. We did not detect any novel recurrent somatic mutations. In 3 patients with clonal hematopoiesis analyzed by WES, we identified a somatic MPL-S204P, a germline MPL-V285E mutation, and a germline JAK2-G571S variant. We performed Sanger sequencing of the entire coding region of MPL in 62, and of JAK2 in 49 additional triple-negative cases of ET or PMF. New somatic (T119I, S204F, E230G, Y591D) and 1 germline (R321W) MPL mutation were detected. All of the identified MPL mutations were gain-of-function when analyzed in functional assays. JAK2 variants were identified in 5 of 57 triple-negative cases analyzed by WES and Sanger sequencing combined. We could demonstrate that JAK2-V625F and JAK2-F556V are gain-of-function mutations. Our results suggest that triple-negative cases of ET and PMF do not represent a homogenous disease entity. Cases with polyclonal hematopoiesis might represent hereditary disorders. © 2016 by The American Society of Hematology.

Detection of a large duplication mutation in the myosin-binding protein C3 gene in a case of hypertrophic cardiomyopathy.

PubMed

Meyer, Thomas; Pankuweit, Sabine; Richter, Anette; Maisch, Bernhard; Ruppert, Volker

2013-09-15

Hypertrophic cardiomyopathy (HCM) is a cardiovascular disease with autosomal dominant inheritance caused by mutations in genes coding for sarcomeric and/or regulatory proteins expressed in cardiomyocytes. In a small cohort of HCM patients (n=8), we searched for mutations in the two most common genes responsible for HCM and found four missense mutations in the MYH7 gene encoding cardiac β-myosin heavy chain (R204H, M493V, R719W, and R870H) and three mutations in the myosin-binding protein C3 gene (MYBPC3) including one missense (A848V) and two frameshift mutations (c.3713delTG and c.702ins26bp). The c.702ins26bp insertion resulted from the duplication of a 26-bp fragment in a 54-year-old female HCM patient presenting with clinical signs of heart failure due to diastolic dysfunction. Although such large duplications (>10 bp) in the MYBPC3 gene are very rare and have been identified only in 4 families reported so far, the identical duplication mutation was found earlier in a Dutch patient, demonstrating that it may constitute a hitherto unknown founder mutation in central European populations. This observation underscores the significance of insertions into the coding sequence of the MYBPC3 gene for the development and pathogenesis of HCM. © 2013 Elsevier B.V. All rights reserved.

Mutations in the Promoter Region of the Aldolase B Gene that cause Hereditary Fructose Intolerance

PubMed Central

Coffee, Erin M.; Tolan, Dean R.

2010-01-01

SUMMARY Hereditary fructose intolerance (HFI) is a potentially fatal inherited metabolic disease caused by a deficiency of aldolase B activity in the liver and kidney. Over 40 disease-causing mutations are known in the protein-coding region of ALDOB. Mutations upstream of the protein-coding portion of ALDOB are reported here for the first time. DNA sequence analysis of 61 HFI patients revealed single base mutations in the promoter, intronic enhancer, and the first exon, which is entirely untranslated. One mutation, g.–132G>A, is located within the promoter at an evolutionarily conserved nucleotide within a transcription factor-binding site. A second mutation, IVS1+1G>C, is at the donor splice site of the first exon. In vitro electrophoretic mobility shift assays show a decrease in nuclear extract-protein binding at the g.–132G>A mutant site. The promoter mutation results in decreased transcription using luciferase reporter plasmids. Analysis of cDNA from cells transfected with plasmids harboring the IVS1+1G>C mutation results in aberrant splicing leading to complete retention of the first intron (~ 5 kb). The IVS1+1G>C splicing mutation results in loss of luciferase activity from a reporter plasmid. These novel mutations in ALDOB represent 2% of alleles in American HFI patients, with IVS1+1G>C representing a significantly higher allele frequency (6%) among HFI patients of Hispanic and African-American ethnicity. PMID:20882353

Spliced leader RNA of trypanosomes: in vivo mutational analysis reveals extensive and distinct requirements for trans splicing and cap4 formation.

PubMed Central

Lücke, S; Xu, G L; Palfi, Z; Cross, M; Bellofatto, V; Bindereif, A

1996-01-01

In trypanosomes mRNAs are generated through trans splicing. The spliced leader (SL) RNA, which donates the 5'-terminal mini-exon to each of the protein coding exons, plays a central role in the trans splicing process. We have established in vivo assays to study in detail trans splicing, cap4 modification, and RNP assembly of the SL RNA in the trypanosomatid species Leptomonas seymouri. First, we found that extensive sequences within the mini-exon are required for SL RNA function in vivo, although a conserved length of 39 nt is not essential. In contrast, the intron sequence appears to be surprisingly tolerant to mutation; only the stem-loop II structure is indispensable. The asymmetry of the sequence requirements in the stem I region suggests that this domain may exist in different functional conformations. Second, distinct mini-exon sequences outside the modification site are important for efficient cap4 formation. Third, all SL RNA mutations tested allowed core RNP assembly, suggesting flexible requirements for core protein binding. In sum, the results of our mutational analysis provide evidence for a discrete domain structure of the SL RNA and help to explain the strong phylogenetic conservation of the mini-exon sequence and of the overall SL RNA secondary structure; they also suggest that there may be certain differences between trans splicing in nematodes and trypanosomes. This approach provides a basis for studying RNA-RNA interactions in the trans spliceosome. Images PMID:8861965

Novel germline PALB2 truncating mutations in African-American breast cancer patients

PubMed Central

Zheng, Yonglan; Zhang, Jing; Niu, Qun; Huo, Dezheng; Olopade, Olufunmilayo I.

2011-01-01

Background It has been demonstrated that PALB2 acts as a bridging molecule between the BRCA1 and BRCA2 proteins and is responsible for facilitating BRCA2-mediated DNA repair. Truncating mutations in the PALB2 gene have been reported to be enriched in Fanconi anemia and breast cancer patients in various populations. Methods We evaluated the contribution of PALB2 germline mutations in 279 African-American breast cancer patients including 29 patients with a strong family history, 29 patients with a moderate family history, 75 patients with a weak family history, and 146 non-familial or sporadic breast cancer cases. Results After direct sequencing of all the coding exons, exon/intron boundaries, 5′UTR and 3′UTR of PALB2, three (1.08%; 3 in 279) novel monoallelic truncating mutations were identified: c.758dupT (exon4), c.1479delC (exon4) and c.3048delT (exon 10); together with 50 sequence variants, 27 of which are novel. None of the truncating mutations were found in 262 controls from the same population. Conclusions PALB2 mutations are present in both familial and non-familial breast cancer among African-Americans. Rare PALB2 mutations account for a small but substantial proportion of breast cancer patients. PMID:21932393

High prevalence of mutations affecting the splicing process in a Spanish cohort with autosomal dominant retinitis pigmentosa

PubMed Central

Ezquerra-Inchausti, Maitane; Barandika, Olatz; Anasagasti, Ander; Irigoyen, Cristina; López de Munain, Adolfo; Ruiz-Ederra, Javier

2017-01-01

Retinitis pigmentosa is the most frequent group of inherited retinal dystrophies. It is highly heterogeneous, with more than 80 disease-causing genes 27 of which are known to cause autosomal dominant RP (adRP), having been identified. In this study a total of 29 index cases were ascertained based on a family tree compatible with adRP. A custom panel of 31 adRP genes was analysed by targeted next-generation sequencing using the Ion PGM platform in combination with Sanger sequencing. This allowed us to detect putative disease-causing mutations in 14 out of the 29 (48.28%) families analysed. Remarkably, around 38% of all adRP cases analysed showed mutations affecting the splicing process, mainly due to mutations in genes coding for spliceosome factors (SNRNP200 and PRPF8) but also due to splice-site mutations in RHO. Twelve of the 14 mutations found had been reported previously and two were novel mutations found in PRPF8 in two unrelated patients. In conclusion, our results will lead to more accurate genetic counselling and will contribute to a better characterisation of the disease. In addition, they may have a therapeutic impact in the future given the large number of studies currently underway based on targeted RNA splicing for therapeutic purposes. PMID:28045043

Low incidence of SCN1A genetic mutation in patients with hemiconvulsion-hemiplegia-epilepsy syndrome.

PubMed

Kim, Dong Wook; Lim, Byung Chan; Kim, Ki Joong; Chae, Jong Hee; Lee, Ran; Lee, Sang Kun

2013-10-01

Genetic mutations in SCN1A account for more than two-thirds of patients with classic Dravet syndrome. A role for SCN1A genetic mutations in the development of hemiconvulsion-hemiplegia-epilepsy (HHE) syndrome was recently suggested based on the observation that HHE syndrome and classic Dravet syndrome share many clinical features. We previously identified a 2 bp-deletion mutation in SCN1A in a Dravet patient, and we found out the patient also had HHE syndrome upon clinical re-evaluation. We subsequently screened 10 additional HHE patients for SCN1A. Among the 11 patients who were diagnosed with HHE syndrome, six patients had no other etiology with the exception of prolonged febrile illness, therefore classified as idiopathic HHE syndrome, whereas five patients were classified as symptomatic HHE syndrome. Direct sequencing of all coding exons and flanking intronic sequences of the SCN1A gene was performed, but we failed to identify additional mutations in 10 patients. The patient with SCN1A mutation had the earliest onset of febrile convulsion and hemiparesis. Our study suggests that SCN1A genetic mutation is only a rare predisposing cause of HHE syndrome. Copyright © 2013 Elsevier B.V. All rights reserved.

The first case of NSHL by direct impression on EYA1 gene and identification of one novel mutation in MYO7A in the Iranian families.

PubMed

Razmara, Ehsan; Bitarafan, Fatemeh; Esmaeilzadeh-Gharehdaghi, Elika; Almadani, Navid; Garshasbi, Masoud

2018-03-01

Targeted next-generation sequencing (NGS) provides a consequential opportunity to elucidate genetic factors in known diseases, particularly in profoundly heterogeneous disorders such as non-syndromic hearing loss (NSHL). Hearing impairments could be classified into syndromic and non-syndromic types. This study intended to assess the significance of mutations in these genes to the autosomal recessive/dominant non-syndromic genetic load among Iranian families. Two families were involved in this research and two patients were examined by targeted next-generation sequencing. Here we report two novel mutations in the MYO7A and EYA1 genes in two patients detected by targeted NGS. They were confirmed by Sanger sequencing and quantitative real-time PCR techniques. In this investigation, we identified a novel mutation in MYO7A , c.3751G>C, p.A1251P, along with another previously identified mutation (c.1708C>T) in one of the cases. This mutation is located in the MYTH4 protein domain which is a pivotal domain for the myosin function. Another finding in this research was a novel de-novo deletion which deletes the entire EYA1 coding region (EX1-18 DEL). Mutations in EYA1 gene have been found in branchiootorenal (BOR) syndrome. Interestingly the patient with EYA1 deletion did not show any other additional clinical implications apart from HL. This finding might argue for the sole involvement of EYA1 function in the mechanism of hearing. This investigation exhibited that the novel mutations in MYO7A , c.3751G>C, p.A1251P, and EYA1 , EX1-18 DEL, were associated with NSHL. Our research increased the mutation spectrum of hearing loss in the Iranian population.

Automated DNA mutation detection using universal conditions direct sequencing: application to ten muscular dystrophy genes

PubMed Central

2009-01-01

Background One of the most common and efficient methods for detecting mutations in genes is PCR amplification followed by direct sequencing. Until recently, the process of designing PCR assays has been to focus on individual assay parameters rather than concentrating on matching conditions for a set of assays. Primers for each individual assay were selected based on location and sequence concerns. The two primer sequences were then iteratively adjusted to make the individual assays work properly. This generally resulted in groups of assays with different annealing temperatures that required the use of multiple thermal cyclers or multiple passes in a single thermal cycler making diagnostic testing time-consuming, laborious and expensive. These factors have severely hampered diagnostic testing services, leaving many families without an answer for the exact cause of a familial genetic disease. A search of GeneTests for sequencing analysis of the entire coding sequence for genes that are known to cause muscular dystrophies returns only a small list of laboratories that perform comprehensive gene panels. The hypothesis for the study was that a complete set of universal assays can be designed to amplify and sequence any gene or family of genes using computer aided design tools. If true, this would allow automation and optimization of the mutation detection process resulting in reduced cost and increased throughput. Results An automated process has been developed for the detection of deletions, duplications/insertions and point mutations in any gene or family of genes and has been applied to ten genes known to bear mutations that cause muscular dystrophy: DMD; CAV3; CAPN3; FKRP; TRIM32; LMNA; SGCA; SGCB; SGCG; SGCD. Using this process, mutations have been found in five DMD patients and four LGMD patients (one in the FKRP gene, one in the CAV3 gene, and two likely causative heterozygous pairs of variations in the CAPN3 gene of two other patients). Methods and assay sequences are reported in this paper. Conclusion This automated process allows laboratories to discover DNA variations in a short time and at low cost. PMID:19835634

Automated DNA mutation detection using universal conditions direct sequencing: application to ten muscular dystrophy genes.

PubMed

Bennett, Richard R; Schneider, Hal E; Estrella, Elicia; Burgess, Stephanie; Cheng, Andrew S; Barrett, Caitlin; Lip, Va; Lai, Poh San; Shen, Yiping; Wu, Bai-Lin; Darras, Basil T; Beggs, Alan H; Kunkel, Louis M

2009-10-18

One of the most common and efficient methods for detecting mutations in genes is PCR amplification followed by direct sequencing. Until recently, the process of designing PCR assays has been to focus on individual assay parameters rather than concentrating on matching conditions for a set of assays. Primers for each individual assay were selected based on location and sequence concerns. The two primer sequences were then iteratively adjusted to make the individual assays work properly. This generally resulted in groups of assays with different annealing temperatures that required the use of multiple thermal cyclers or multiple passes in a single thermal cycler making diagnostic testing time-consuming, laborious and expensive.These factors have severely hampered diagnostic testing services, leaving many families without an answer for the exact cause of a familial genetic disease. A search of GeneTests for sequencing analysis of the entire coding sequence for genes that are known to cause muscular dystrophies returns only a small list of laboratories that perform comprehensive gene panels.The hypothesis for the study was that a complete set of universal assays can be designed to amplify and sequence any gene or family of genes using computer aided design tools. If true, this would allow automation and optimization of the mutation detection process resulting in reduced cost and increased throughput. An automated process has been developed for the detection of deletions, duplications/insertions and point mutations in any gene or family of genes and has been applied to ten genes known to bear mutations that cause muscular dystrophy: DMD; CAV3; CAPN3; FKRP; TRIM32; LMNA; SGCA; SGCB; SGCG; SGCD. Using this process, mutations have been found in five DMD patients and four LGMD patients (one in the FKRP gene, one in the CAV3 gene, and two likely causative heterozygous pairs of variations in the CAPN3 gene of two other patients). Methods and assay sequences are reported in this paper. This automated process allows laboratories to discover DNA variations in a short time and at low cost.

Influence of Gene Expression on Hardness in Wheat.

PubMed

Nirmal, Ravi C; Furtado, Agnelo; Wrigley, Colin; Henry, Robert J

2016-01-01

Puroindoline (Pina and Pinb) genes control grain texture or hardness in wheat. Wild-type/soft alleles lead to softer grain while a mutation in one or both of these genes results in a hard grain. Variation in hardness in genotypes with identical Pin alleles (wild-type or mutant) is known but the molecular basis of this is not known. We now report the identification of wheat genotypes with hard grain texture and wild-type/soft Pin alleles indicating that hardness in wheat may be controlled by factors other than mutations in the coding region of the Pin genes. RNA-Seq analysis was used to determine the variation in the transcriptome of developing grains of thirty three diverse wheat genotypes including hard (mutant Pin) and soft (wild type) and those that were hard without having Pin mutations. This defined the role of pin gene expression and identified other candidate genes associated with hardness. Pina was not expressed in hard wheat with a mutation in the Pina gene. The ratio of Pina to Pinb expression was generally lower in the hard non mutant genotypes. Hardness may be associated with differences in Pin expression and other factors and is not simply associated with mutations in the PIN protein coding sequences.

Novel autosomal recessive gene mutations in aquaporin-2 in two Chinese congenital nephrogenic diabetes insipidus pedigrees

PubMed Central

Cen, Jing; Nie, Min; Duan, Lian; Gu, Feng

2015-01-01

Recent evidence has linked novel mutations in the arginine vasopressin receptor 2 gene (AVPR2) and aquaporin-2 gene (AQP2) present in Southeast Asian populations to congenital nephrogenic diabetes insipidus (NDI). To investigate mutations in 2 distinct Chinese pedigrees with NDI patients, clinical data, laboratory findings, and genomic DNA sequences from peripheral blood leukocytes were analyzed in two 5.5- and 8-year-old boys (proband 1 and 2, respectively) and their first-degree relatives. Water intake, urinary volume, body weight and medication use were recorded. Mutations in coding regions and intron-exon borders of both AQP2 and AVPR2 gene were sequenced. Three mutations in AQP2 were detected, including previously reported heterozygous frameshift mutation (c.127_128delCA, p.Gln43Aspfs ×63) inherited from the mother, a novel frameshift mutation (c.501_502insC, p.Val168Argfs ×30, inherited from the father) in proband 1 and a novel missense mutation (c. 643G>A, p. G215S), inherited from both parents in proband 2. In family 2 both parents and one sister were heterozygous carriers of the novel missense mutation. Neither pedigree exhibited mutation in the AVPR2 gene. The patient with truncated AQP2 may present with much more severe NDI manifestations. Identification of these novel AQP2 gene mutations expands the AQP2 genotypic spectrum and may contribute to etiological diagnosis and genetic counseling. PMID:26064258

Genetic variations in the hotspot region of RS1 gene in Indian patients with juvenile X-linked retinoschisis.

PubMed

Suganthalakshmi, Balasubbu; Shukla, Dhananjay; Rajendran, Anand; Kim, Ramasamy; Nallathambi, Jeyabalan; Sundaresan, Periasamy

2007-04-19

X-linked juvenile retinoschisis (XLRS) is the leading cause of macular degeneration in males. This condition is caused by mutations in the RS1 gene and is, characterized by schisis within the retina. The purpose of this study was to identify the mutations in the RS1 gene associated with XLRS in an Indian cohort. The coding region of RS1 was analyzed for mutations by polymerase chain reaction-single strand conformational polymorphism (PCR-SSCP) and restriction fragment length polymorphism (RFLP) analysis in six unrelated subjects clinically diagnosed as having XLRS and in their available family members. Direct sequencing was performed for all samples that displayed an electrophoretic mobility shift in SSCP gel. Mutation analysis of RS1 gene revealed five mutations in exon 6 like c.574C>T, c.583A>G, c.608C>T, c.617G>A, and c.637C>T, respectively, among them four missense mutations, one nonsense mutation, and two novel sequence variations. These mutations were found in individuals who exhibited clinical features of bilateral foveal and peripheral retinoschisis consistent with XLRS. The mutations were absent in the 100 age matched control samples analyzed. This is the first report of mutations in RS1 to be associated with XLRS in the Indian population. The identified genetic variations, phenotype and genotype correlations were consistent with other studies. Identification of the causative mutation in patients with XLRS is helpful in confirming the diagnosis and in counseling of family members.

A Rapid, High-Quality, Cost-Effective, Comprehensive and Expandable Targeted Next-Generation Sequencing Assay for Inherited Heart Diseases.

PubMed

Wilson, Kitchener D; Shen, Peidong; Fung, Eula; Karakikes, Ioannis; Zhang, Angela; InanlooRahatloo, Kolsoum; Odegaard, Justin; Sallam, Karim; Davis, Ronald W; Lui, George K; Ashley, Euan A; Scharfe, Curt; Wu, Joseph C

2015-09-11

Thousands of mutations across >50 genes have been implicated in inherited cardiomyopathies. However, options for sequencing this rapidly evolving gene set are limited because many sequencing services and off-the-shelf kits suffer from slow turnaround, inefficient capture of genomic DNA, and high cost. Furthermore, customization of these assays to cover emerging targets that suit individual needs is often expensive and time consuming. We sought to develop a custom high throughput, clinical-grade next-generation sequencing assay for detecting cardiac disease gene mutations with improved accuracy, flexibility, turnaround, and cost. We used double-stranded probes (complementary long padlock probes), an inexpensive and customizable capture technology, to efficiently capture and amplify the entire coding region and flanking intronic and regulatory sequences of 88 genes and 40 microRNAs associated with inherited cardiomyopathies, congenital heart disease, and cardiac development. Multiplexing 11 samples per sequencing run resulted in a mean base pair coverage of 420, of which 97% had >20× coverage and >99% were concordant with known heterozygous single nucleotide polymorphisms. The assay correctly detected germline variants in 24 individuals and revealed several polymorphic regions in miR-499. Total run time was 3 days at an approximate cost of $100 per sample. Accurate, high-throughput detection of mutations across numerous cardiac genes is achievable with complementary long padlock probe technology. Moreover, this format allows facile insertion of additional probes as more cardiomyopathy and congenital heart disease genes are discovered, giving researchers a powerful new tool for DNA mutation detection and discovery. © 2015 American Heart Association, Inc.

Detecting consistent patterns of directional adaptation using differential selection codon models.

PubMed

Parto, Sahar; Lartillot, Nicolas

2017-06-23

Phylogenetic codon models are often used to characterize the selective regimes acting on protein-coding sequences. Recent methodological developments have led to models explicitly accounting for the interplay between mutation and selection, by modeling the amino acid fitness landscape along the sequence. However, thus far, most of these models have assumed that the fitness landscape is constant over time. Fluctuations of the fitness landscape may often be random or depend on complex and unknown factors. However, some organisms may be subject to systematic changes in selective pressure, resulting in reproducible molecular adaptations across independent lineages subject to similar conditions. Here, we introduce a codon-based differential selection model, which aims to detect and quantify the fine-grained consistent patterns of adaptation at the protein-coding level, as a function of external conditions experienced by the organism under investigation. The model parameterizes the global mutational pressure, as well as the site- and condition-specific amino acid selective preferences. This phylogenetic model is implemented in a Bayesian MCMC framework. After validation with simulations, we applied our method to a dataset of HIV sequences from patients with known HLA genetic background. Our differential selection model detects and characterizes differentially selected coding positions specifically associated with two different HLA alleles. Our differential selection model is able to identify consistent molecular adaptations as a function of repeated changes in the environment of the organism. These models can be applied to many other problems, ranging from viral adaptation to evolution of life-history strategies in plants or animals.

Novel genes and mutations in patients affected by recurrent pregnancy loss.

PubMed

Quintero-Ronderos, Paula; Mercier, Eric; Fukuda, Michiko; González, Ronald; Suárez, Carlos Fernando; Patarroyo, Manuel Alfonso; Vaiman, Daniel; Gris, Jean-Christophe; Laissue, Paul

2017-01-01

Recurrent pregnancy loss is a frequently occurring human infertility-related disease affecting ~1% of women. It has been estimated that the cause remains unexplained in >50% cases which strongly suggests that genetic factors may contribute towards the phenotype. Concerning its molecular aetiology numerous studies have had limited success in identifying the disease's genetic causes. This might have been due to the fact that hundreds of genes are involved in each physiological step necessary for guaranteeing reproductive success in mammals. In such scenario, next generation sequencing provides a potentially interesting tool for research into recurrent pregnancy loss causative mutations. The present study involved whole-exome sequencing and an innovative bioinformatics analysis, for the first time, in 49 unrelated women affected by recurrent pregnancy loss. We identified 27 coding variants (22 genes) potentially related to the phenotype (41% of patients). The affected genes, which were enriched by potentially deleterious sequence variants, belonged to distinct molecular cascades playing key roles in implantation/pregnancy biology. Using a quantum chemical approach method we established that mutations in MMP-10 and FGA proteins led to substantial energetic modifications suggesting an impact on their functions and/or stability. The next generation sequencing and bioinformatics approaches presented here represent an efficient way to find mutations, having potentially moderate/strong functional effects, associated with recurrent pregnancy loss aetiology. We consider that some of these variants (and genes) represent probable future biomarkers for recurrent pregnancy loss.

[Comparison of the sensibility and specificity between single-stranded conformation polymorphism and denaturing high-performance liquid chromatography in screening hMSH2 and hMLH1 gene mutations in hereditary non-polyposis colorectal cancer].

PubMed

Wei, Guang-hui; Zhao, Bo; Wang, Zhen-jun

2008-09-01

To compare the sensibility and specificity between single-stranded conformation polymorphism (SSCP) and denaturing high-performance liquid chromatography (DHPLC) in screening hMSH2 and hMLH1 gene mutations for the diagnosis of hereditary non-polyposis colorectal cancer (HNPCC). Seven Chinese HNPCC kindreds were collected. PCR-SSCP and DHPLC were used to screen the coding regions of hMSH2 and hMLH1 genes and the abnormal profiles were sequenced by a 377 DNA sequencer. Seven gene sequence variations of hMSH2 or hMLH1 were found. Among them, 4 variations were not found by SSCP, but by DHPLC. The sensibility of SSCP and DHPLC were 51.6% and 100% respectively, and the specificity were 66.6% and 93.3% respectively. DHPLC has better sensibility and specificity in screening hMSH2 and hMLH1 gene mutation as compared to SSCP. DHPLC is an ideal method in the diagnosis of HNPCC.

The Alpaca Melanocortin 1 Receptor: Gene Mutations, Transcripts, and Relative Levels of Expression in Ventral Skin Biopsies

PubMed Central

Renieri, Carlo; La Terza, Antonietta

2015-01-01

The objectives of the present study were to characterize the MC1R gene, its transcripts and the single nucleotide polymorphisms (SNPs) associated with coat color in alpaca. Full length cDNA amplification revealed the presence of two transcripts, named as F1 and F2, differing only in the length of their 5′-terminal untranslated region (UTR) sequences and presenting a color specific expression. Whereas the F1 transcript was common to white and colored (black and brown) alpaca phenotypes, the shorter F2 transcript was specific to white alpaca. Further sequencing of the MC1R gene in white and colored alpaca identified a total of twelve SNPs; among those nine (four silent mutations (c.126C>A, c.354T>C, c.618G>A, and c.933G>A); five missense mutations (c.82A>G, c.92C>T, c.259A>G, c.376A>G, and c.901C>T)) were observed in coding region and three in the 3′UTR. A 4 bp deletion (c.224 227del) was also identified in the coding region. Molecular segregation analysis uncovered that the combinatory mutations in the MC1R locus could cause eumelanin and pheomelanin synthesis in alpaca. Overall, our data refine what is known about the MC1R gene and provides additional information on its role in alpaca pigmentation. PMID:25685836

Early Clinical Diagnosis of PC1/3 Deficiency in a Patient With a Novel Homozygous PCSK1 Splice-Site Mutation.

PubMed

Härter, Bettina; Fuchs, Irene; Müller, Thomas; Akbulut, Ulas Emre; Cakir, Murat; Janecke, Andreas R

2016-04-01

Autosomal recessive proprotein convertase 1/3 (PC1/3) deficiency, caused by mutations in the PCSK1 gene, is characterized by severe congenital malabsorptive diarrhea, early-onset obesity, and certain endocrine abnormalities. We suspected PC1/3 deficiency in a 4-month-old girl based on the presence of congenital diarrhea and polyuria. Sequencing the whole coding region and splice sites detected a novel homozygous PCSK1 splice-site mutation, c.544-2A>G, in the patient. The mutation resulted in the skipping of exon 5, the generation of a premature termination codon, and nonsense-mediated PCSK1 messenger ribonucleic acid decay, which was demonstrated in complementary DNA derived from fibroblasts.

Integrated DNA/RNA targeted genomic profiling of diffuse large B-cell lymphoma using a clinical assay.

PubMed

Intlekofer, Andrew M; Joffe, Erel; Batlevi, Connie L; Hilden, Patrick; He, Jie; Seshan, Venkatraman E; Zelenetz, Andrew D; Palomba, M Lia; Moskowitz, Craig H; Portlock, Carol; Straus, David J; Noy, Ariela; Horwitz, Steven M; Gerecitano, John F; Moskowitz, Alison; Hamlin, Paul; Matasar, Matthew J; Kumar, Anita; van den Brink, Marcel R; Knapp, Kristina M; Pichardo, Janine D; Nahas, Michelle K; Trabucco, Sally E; Mughal, Tariq; Copeland, Amanda R; Papaemmanuil, Elli; Moarii, Mathai; Levine, Ross L; Dogan, Ahmet; Miller, Vincent A; Younes, Anas

2018-06-12

We sought to define the genomic landscape of diffuse large B-cell lymphoma (DLBCL) by using formalin-fixed paraffin-embedded (FFPE) biopsy specimens. We used targeted sequencing of genes altered in hematologic malignancies, including DNA coding sequence for 405 genes, noncoding sequence for 31 genes, and RNA coding sequence for 265 genes (FoundationOne-Heme). Short variants, rearrangements, and copy number alterations were determined. We studied 198 samples (114 de novo, 58 previously treated, and 26 large-cell transformation from follicular lymphoma). Median number of GAs per case was 6, with 97% of patients harboring at least one alteration. Recurrent GAs were detected in genes with established roles in DLBCL pathogenesis (e.g. MYD88, CREBBP, CD79B, EZH2), as well as notable differences compared to prior studies such as inactivating mutations in TET2 (5%). Less common GAs identified potential targets for approved or investigational therapies, including BRAF, CD274 (PD-L1), IDH2, and JAK1/2. TP53 mutations were more frequently observed in relapsed/refractory DLBCL, and predicted for lack of response to first-line chemotherapy, identifying a subset of patients that could be prioritized for novel therapies. Overall, 90% (n = 169) of the patients harbored a GA which could be explored for therapeutic intervention, with 54% (n = 107) harboring more than one putative target.

CHST6 mutations in North American subjects with macular corneal dystrophy: a comprehensive molecular genetic review.

PubMed

Klintworth, Gordon K; Smith, Clayton F; Bowling, Brandy L

2006-03-10

To evaluate mutations in the carbohydrate sulfotransferase-6 (CHST6) gene in American subjects with macular corneal dystrophy (MCD). We analyzed CHST6 in 57 patients from 31 families with MCD from the United States, 57 carriers (parents or children), and 27 unaffected blood relatives of affected subjects. We compared the observed nucleotide sequences with those found by numerous investigators in other populations with MCD and in controls. In 24 families, the corneal disorder could be explained by mutations in the coding region of CHST6 or in the region upstream of this gene in both the maternal and paternal chromosome. In most instances of MCD a homozygous or heterozygous missense mutation in exon 3 of CHST6 was found. Six cases resulted from a deletion upstream of CHST6. Nucleotide changes within the coding region of CHST6 are predicted to alter the encoded protein significantly within evolutionary conserved parts of the encoded sulfotransferase. Our findings support the hypothesis that CHST6 mutations are cardinal to the pathogenesis of MCD. Moreover, the observation that some cases of MCD cannot be explained by mutations in CHST6 suggests that MCD may result from other subtle changes in CHST6 or from genetic heterogeneity.

Somatic mutations in the transcriptional corepressor gene BCORL1 in adult acute myelogenous leukemia

PubMed Central

Li, Meng; Collins, Roxane; Jiao, Yuchen; Ouillette, Peter; Bixby, Dale; Erba, Harry; Vogelstein, Bert; Kinzler, Kenneth W.

2011-01-01

To further our understanding of the genetic basis of acute myelogenous leukemia (AML), we determined the coding exon sequences of ∼ 18 000 protein-encoding genes in 8 patients with secondary AML. Here we report the discovery of novel somatic mutations in the transcriptional corepressor gene BCORL1 that is located on the X-chromosome. Analysis of BCORL1 in an unselected cohort of 173 AML patients identified a total of 10 mutated cases (6%) with BCORL1 mutations, whereas analysis of 19 AML cell lines uncovered 4 (21%) BCORL1 mutated cell lines. The majority (87%) of the mutations in BCORL1 were predicted to inactivate the gene product as a result of nonsense mutations, splice site mutation, or out-of-frame insertions or deletions. These results indicate that BCORL1 by genetic criteria is a novel candidate tumor suppressor gene, joining the growing list of genes recurrently mutated in AML. PMID:21989985

Neurofibromatosis type 1 molecular diagnosis: what can NGS do for you when you have a large gene with loss of function mutations?

PubMed Central

Pasmant, Eric; Parfait, Béatrice; Luscan, Armelle; Goussard, Philippe; Briand-Suleau, Audrey; Laurendeau, Ingrid; Fouveaut, Corinne; Leroy, Chrystel; Montadert, Annelore; Wolkenstein, Pierre; Vidaud, Michel; Vidaud, Dominique

2015-01-01

Molecular diagnosis of neurofibromatosis type 1 (NF1) is challenging owing to the large size of the tumour suppressor gene NF1, and the lack of mutation hotspots. A somatic alteration of the wild-type NF1 allele is observed in NF1-associated tumours. Genetic heterogeneity in NF1 was confirmed in patients with SPRED1 mutations. Here, we present a targeted next-generation sequencing (NGS) of NF1 and SPRED1 using a multiplex PCR approach (230 amplicons of ∼150 bp) on a PGM sequencer. The chip capacity allowed mixing 48 bar-coded samples in a 4-day workflow. We validated the NGS approach by retrospectively testing 30 NF1-mutated samples, and then prospectively analysed 279 patients in routine diagnosis. On average, 98.5% of all targeted bases were covered by at least 20X and 96% by at least 100X. An NF1 or SPRED1 alteration was found in 246/279 (88%) and 10/279 (4%) patients, respectively. Genotyping throughput was increased over 10 times, as compared with Sanger, with ∼90€ for consumables per sample. Interestingly, our targeted NGS approach also provided quantitative information based on sequencing depth allowing identification of multiexons deletion or duplication. We then addressed the NF1 somatic mutation detection sensitivity in mosaic NF1 patients and tumours. PMID:25074460

The structure of the coding and 5'-flanking region of the type 1 iodothyronine deiodinase (dio1) gene is normal in a patient with suspected congenital dio1 deficiency.

PubMed

Toyoda, N; Kleinhaus, N; Larsen, P R

1996-06-01

We analyzed the exon-intron structure of the human type 1 deiodinase gene (dio1) and compared it with that of a patient with suspected congenital type 1 deiodinase (D1) deficiency. The hdio1 gene is identical in exon-intron arrangement to the mouse gene, with coding sequences and a selenocysteine insertion sequence (SECIS) element contained in four exons. There were no mutations in the sequences of exons 1-4 of the patient's genomic DNA. Functional studies by transient expression techniques showed no difference in basal promoter activity or T3 responsiveness between the patient's and the normal dio1 gene. A structural abnormality in the dio1 gene is not a likely explanation for this patient's D1-deficient phenotype.

Permanent Neonatal Diabetes Caused by Creation of an Ectopic Splice Site within the INS Gene

PubMed Central

Gastaldo, Elena; Harries, Lorna W.; Rubio-Cabezas, Oscar; Castaño, Luis

2012-01-01

Background The aim of this study was to characterize the genetic etiology in a patient who presented with permanent neonatal diabetes at 2 months of age. Methodology/Principal Findings Regulatory elements and coding exons 2 and 3 of the INS gene were amplified and sequenced from genomic and complementary DNA samples. A novel heterozygous INS mutation within the terminal intron of the gene was identified in the proband and her affected father. This mutation introduces an ectopic splice site leading to the insertion of 29 nucleotides from the intronic sequence into the mature mRNA, which results in a longer and abnormal transcript. Conclusions/Significance This study highlights the importance of routinely sequencing the exon-intron boundaries and the need to carry out additional studies to confirm the pathogenicity of any identified intronic genetic variants. PMID:22235272

Sequence variations of the bovine prion protein gene (PRNP) in native Korean Hanwoo cattle

PubMed Central

Choi, Sangho

2012-01-01

Bovine spongiform encephalopathy (BSE) is one of the fatal neurodegenerative diseases known as transmissible spongiform encephalopathies (TSEs) caused by infectious prion proteins. Genetic variations correlated with susceptibility or resistance to TSE in humans and sheep have not been reported for bovine strains including those from Holstein, Jersey, and Japanese Black cattle. Here, we investigated bovine prion protein gene (PRNP) variations in Hanwoo cattle [Bos (B.) taurus coreanae], a native breed in Korea. We identified mutations and polymorphisms in the coding region of PRNP, determined their frequency, and evaluated their significance. We identified four synonymous polymorphisms and two non-synonymous mutations in PRNP, but found no novel polymorphisms. The sequence and number of octapeptide repeats were completely conserved, and the haplotype frequency of the coding region was similar to that of other B. taurus strains. When we examined the 23-bp and 12-bp insertion/deletion (indel) polymorphisms in the non-coding region of PRNP, Hanwoo cattle had a lower deletion allele and 23-bp del/12-bp del haplotype frequency than healthy and BSE-affected animals of other strains. Thus, Hanwoo are seemingly less susceptible to BSE than other strains due to the 23-bp and 12-bp indel polymorphisms. PMID:22705734

Rare Noncoding Mutations Extend the Mutational Spectrum in the PGAP3 Subtype of Hyperphosphatasia with Mental Retardation Syndrome

PubMed Central

Knaus, Alexej; Awaya, Tomonari; Helbig, Ingo; Afawi, Zaid; Pendziwiat, Manuela; Abu‐Rachma, Jubran; Thompson, Miles D.; Cole, David E.; Skinner, Steve; Annese, Fran; Canham, Natalie; Schweiger, Michal R.; Robinson, Peter N.; Mundlos, Stefan; Kinoshita, Taroh; Munnich, Arnold

2016-01-01

ABSTRACT HPMRS or Mabry syndrome is a heterogeneous glycosylphosphatidylinositol (GPI) anchor deficiency that is caused by an impairment of synthesis or maturation of the GPI‐anchor. The expressivity of the clinical features in HPMRS varies from severe syndromic forms with multiple organ malformations to mild nonsyndromic intellectual disability. In about half of the patients with the clinical diagnosis of HPMRS, pathogenic mutations can be identified in the coding region in one of the six genes, one among them is PGAP3. In this work, we describe a screening approach with sequence specific baits for transcripts of genes of the GPI pathway that allows the detection of functionally relevant mutations also including introns and the 5′ and 3′ UTR. By this means, we also identified pathogenic noncoding mutations, which increases the diagnostic yield for HPMRS on the basis of intellectual disability and elevated serum alkaline phosphatase. In eight affected individuals from different ethnicities, we found seven novel pathogenic mutations in PGAP3. Besides five missense mutations, we identified an intronic mutation, c.558‐10G>A, that causes an aberrant splice product and a mutation in the 3′UTR, c.*559C>T, that is associated with substantially lower mRNA levels. We show that our novel screening approach is a useful rapid detection tool for alterations in genes coding for key components of the GPI pathway. PMID:27120253

Whole Exome Sequencing of Pediatric Gastric Adenocarcinoma Reveals an Atypical Presentation of Li-Fraumeni Syndrome

PubMed Central

Chang, Vivian Y.; Federman, Noah; Martinez-Agosto, Julian; Tatishchev, Sergei F.; Nelson, Stanley F.

2014-01-01

Background Gastric adenocarcinoma is a rare diagnosis in childhood. A 14-year old male patient presented with metastatic gastric adenocarcinoma, and a strong family history of colon cancer. Clinical sequencing of CDH1 and APC were negative. Whole exome sequencing was therefore applied to capture the majority of protein-coding regions for the identification of single-nucleotide variants, small insertion/deletions, and copy number abnormalities in the patient’s germline as well as primary tumor. Materials and Methods DNA was extracted from the patient’s blood, primary tumor, and the unaffected mother’s blood. DNA libraries were constructed and sequenced on Illumina HiSeq2000. Data were post-processed using Picard and Samtools, then analyzed with the Genome Analysis Toolkit. Variants were annotated using an in-house Ensembl-based program. Copy number was assessed using ExomeCNV. Results Each sample was sequenced to a mean depth of coverage of greater than 120×. A rare non-synonymous coding SNV in TP53 was identified in the germline. There were 10 somatic cancer protein-damaging variants that were not observed in the unaffected mother genome. ExomeCNV comparing tumor to the patient’s germline, identified abnormal copy number, spanning 6,946 genes. Conclusion We present an unusual case of Li-Fraumeni detected by whole exome sequencing. There were also likely driver somatic mutations in the gastric adenocarcinoma. These results highlight the need for more thorough and broad scale germline and cancer analyses to accurately inform patients of inherited risk to cancer and to identify somatic mutations. PMID:23015295

Homozygosity for a novel missense mutation in the leptin receptor gene (P316T) in two Egyptian cousins with severe early onset obesity.

PubMed

Mazen, I; El-Gammal, M; Abdel-Hamid, M; Farooqi, I S; Amr, K

2011-04-01

Congenital deficiency of the leptin receptor is a very rare cause of severe early-onset obesity. To date, only 9 families have been reported in the literature to have mutations in the leptin receptor gene. The clinical features include severe early onset obesity, severe hyperphagia, hypogonadotropic hypogonadism, and T cell and neuroendocrine/metabolic dysfunction. Here we report two cousins with severe early onset obesity and recurrent respiratory tract infections. Their serum leptin levels were elevated but they were within the range predicted by the elevated fat mass in both cousins. Direct sequencing of the entire coding sequence of the leptin receptor gene revealed a novel homozygous missense mutation in exon 6, P316T. The mutation was found in the homozygous form in both cousins and in the heterozygote state in their parents. This mutation was not found in 200 chromosomes from 100 unrelated normal weight control subjects of Egyptian origin using PCR-RFLP analysis. In conclusion, finding this new mutation in the LEPR beside our previous mutation in the LEP gene implies that monogenic obesity syndromes may be common in the Egyptian population owing to the high rates of consanguineous marriages. Further screening of more families for mutations in LEP, LEPR, and MC4 might confirm this assumption. Copyright © 2010 Elsevier Inc. All rights reserved.

Polycystic Kidney Disease with Hyperinsulinemic Hypoglycemia Caused by a Promoter Mutation in Phosphomannomutase 2.

PubMed

Cabezas, Oscar Rubio; Flanagan, Sarah E; Stanescu, Horia; García-Martínez, Elena; Caswell, Richard; Lango-Allen, Hana; Antón-Gamero, Montserrat; Argente, Jesús; Bussell, Anna-Marie; Brandli, Andre; Cheshire, Chris; Crowne, Elizabeth; Dumitriu, Simona; Drynda, Robert; Hamilton-Shield, Julian P; Hayes, Wesley; Hofherr, Alexis; Iancu, Daniela; Issler, Naomi; Jefferies, Craig; Jones, Peter; Johnson, Matthew; Kesselheim, Anne; Klootwijk, Enriko; Koettgen, Michael; Lewis, Wendy; Martos, José María; Mozere, Monika; Norman, Jill; Patel, Vaksha; Parrish, Andrew; Pérez-Cerdá, Celia; Pozo, Jesús; Rahman, Sofia A; Sebire, Neil; Tekman, Mehmet; Turnpenny, Peter D; Hoff, William Van't; Viering, Daan H H M; Weedon, Michael N; Wilson, Patricia; Guay-Woodford, Lisa; Kleta, Robert; Hussain, Khalid; Ellard, Sian; Bockenhauer, Detlef

2017-08-01

Hyperinsulinemic hypoglycemia (HI) and congenital polycystic kidney disease (PKD) are rare, genetically heterogeneous disorders. The co-occurrence of these disorders (HIPKD) in 17 children from 11 unrelated families suggested an unrecognized genetic disorder. Whole-genome linkage analysis in five informative families identified a single significant locus on chromosome 16p13.2 (logarithm of odds score 6.5). Sequencing of the coding regions of all linked genes failed to identify biallelic mutations. Instead, we found in all patients a promoter mutation (c.-167G>T) in the phosphomannomutase 2 gene ( PMM2 ), either homozygous or in trans with PMM2 coding mutations. PMM2 encodes a key enzyme in N-glycosylation. Abnormal glycosylation has been associated with PKD, and we found that deglycosylation in cultured pancreatic β cells altered insulin secretion. Recessive coding mutations in PMM2 cause congenital disorder of glycosylation type 1a (CDG1A), a devastating multisystem disorder with prominent neurologic involvement. Yet our patients did not exhibit the typical clinical or diagnostic features of CDG1A. In vitro, the PMM2 promoter mutation associated with decreased transcriptional activity in patient kidney cells and impaired binding of the transcription factor ZNF143. In silico analysis suggested an important role of ZNF143 for the formation of a chromatin loop including PMM2 We propose that the PMM2 promoter mutation alters tissue-specific chromatin loop formation, with consequent organ-specific deficiency of PMM2 leading to the restricted phenotype of HIPKD. Our findings extend the spectrum of genetic causes for both HI and PKD and provide insights into gene regulation and PMM2 pleiotropy. Copyright © 2017 by the American Society of Nephrology.

SQSTM1 mutations in French patients with frontotemporal dementia or frontotemporal dementia with amyotrophic lateral sclerosis.

PubMed

Le Ber, Isabelle; Camuzat, Agnès; Guerreiro, Rita; Bouya-Ahmed, Kawtar; Bras, Jose; Nicolas, Gael; Gabelle, Audrey; Didic, Mira; De Septenville, Anne; Millecamps, Stéphanie; Lenglet, Timothée; Latouche, Morwena; Kabashi, Edor; Campion, Dominique; Hannequin, Didier; Hardy, John; Brice, Alexis

2013-11-01

Mutations in the SQSTM1 gene, coding for p62, are a cause of Paget disease of bone and amyotrophic lateral sclerosis (ALS). Recently, SQSTM1 mutations were confirmed in ALS, and mutations were also identified in 3 patients with frontotemporal dementia (FTD), suggesting a role for SQSTM1 in FTD. To evaluate the exact contribution of SQSTM1 to FTD and FTD with ALS (FTD-ALS) in an independent cohort of patients. A SQSTM1 mutation was first identified in a multiplex family with FTD by use of whole-exome sequencing. To evaluate the frequency of SQSTM1 mutations, we sequenced this gene in a cohort of patients with FTD or FTD-ALS, with no mutations in known FTD and ALS genes. Primary care or referral center. An overall cohort of 188 French patients, including 132 probands with FTD and 56 probands with FTD-ALS. Frequency of SQSTM1 mutations in patients with FTD or FTD-ALS; description of associated phenotypes. We identified 4 heterozygous missense mutations in 4 unrelated families with FTD; only 1 family had clinical symptoms of Paget disease of bone, and only 1 family had clinical symptoms of FTD-ALS, possibly owing to the low penetrance of some of the clinical manifestations. Although the frequency of the mutations is low in our series (4 of 188 patients [2%]), our results, similar to those already reported, support a direct pathogenic role of p62 in different types of FTD.

Mitochondrial DNA haplogroup phylogeny of the dog: Proposal for a cladistic nomenclature.

PubMed

Fregel, Rosa; Suárez, Nicolás M; Betancor, Eva; González, Ana M; Cabrera, Vicente M; Pestano, José

2015-05-01

Canis lupus familiaris mitochondrial DNA analysis has increased in recent years, not only for the purpose of deciphering dog domestication but also for forensic genetic studies or breed characterization. The resultant accumulation of data has increased the need for a normalized and phylogenetic-based nomenclature like those provided for human maternal lineages. Although a standardized classification has been proposed, haplotype names within clades have been assigned gradually without considering the evolutionary history of dog mtDNA. Moreover, this classification is based only on the D-loop region, proven to be insufficient for phylogenetic purposes due to its high number of recurrent mutations and the lack of relevant information present in the coding region. In this study, we design 1) a refined mtDNA cladistic nomenclature from a phylogenetic tree based on complete sequences, classifying dog maternal lineages into haplogroups defined by specific diagnostic mutations, and 2) a coding region SNP analysis that allows a more accurate classification into haplogroups when combined with D-loop sequencing, thus improving the phylogenetic information obtained in dog mitochondrial DNA studies. Copyright © 2015 Elsevier B.V. All rights reserved.

[Clinical and genetic analysis of a patient with Treacher Collins syndrome in TCOF1 gene].

PubMed

Li, Hongbo; Zhang, Xu; Li, Zhenyue; Chen, Jing; Lu, Yu; Jia, Jingjie; Yuan, Huijun; Han, Dongyi

2012-05-01

To analyze the clinical and genetic features of a patient with Treacher Collins syndrome (TCS), and identify the mutation in TCOF1 gene. The medical history was taken, and general physical examinations and otological examinations were conducted in this patient. Genomic DNA was extracted from this patient and his parents and complete TCOF1 gene coding exons were amplified by specific PCR primers. Direct sequencing was carried out to identify the mutations. The raw data was analyzed with GeneTool software and molecular biological website. We detected a heterozygous c. 1639 delAG mutation in exon 11 of TCOF1, which resulted in a truncated protein lacking normal function. This mutation is a novel mutation and the second case identified in exon 11 of in TCS. TCS patient reported in this study has unique clinical phenotype. TCOF1 gene mutation is the specific risk factor.

Glutamate receptor mutations in psychiatric and neurodevelopmental disorders

PubMed Central

Soto, David; Altafaj, Xavier; Sindreu, Carlos; Bayés, Àlex

2014-01-01

Alterations in glutamatergic neurotransmission have long been associated with psychiatric and neurodevelopmental disorders (PNDD), but only recent advances in high-throughput DNA sequencing have allowed interrogation of the prevalence of mutations in glutamate receptors (GluR) among afflicted individuals. In this review we discuss recent work describing GluR mutations in the context of PNDDs. Although there are no strict relationships between receptor subunit or type and disease, some interesting preliminary conclusions have arisen. Mutations in genes coding for ionotropic glutamate receptor subunits, which are central to synaptic transmission and plasticity, are mostly associated with intellectual disability and autism spectrum disorders. In contrast, mutations of metabotropic GluRs, having a role on modulating neural transmission, are preferentially associated with psychiatric disorders. Also, the prevalence of mutations among GluRs is highly heterogeneous, suggesting a critical role of certain subunits in PNDD pathophysiology. The emerging bias between GluR subtypes and specific PNDDs may have clinical implications. PMID:24605182

Glutamate receptor mutations in psychiatric and neurodevelopmental disorders.

PubMed

Soto, David; Altafaj, Xavier; Sindreu, Carlos; Bayés, Alex

2014-01-01

Alterations in glutamatergic neurotransmission have long been associated with psychiatric and neurodevelopmental disorders (PNDD), but only recent advances in high-throughput DNA sequencing have allowed interrogation of the prevalence of mutations in glutamate receptors (GluR) among afflicted individuals. In this review we discuss recent work describing GluR mutations in the context of PNDDs. Although there are no strict relationships between receptor subunit or type and disease, some interesting preliminary conclusions have arisen. Mutations in genes coding for ionotropic glutamate receptor subunits, which are central to synaptic transmission and plasticity, are mostly associated with intellectual disability and autism spectrum disorders. In contrast, mutations of metabotropic GluRs, having a role on modulating neural transmission, are preferentially associated with psychiatric disorders. Also, the prevalence of mutations among GluRs is highly heterogeneous, suggesting a critical role of certain subunits in PNDD pathophysiology. The emerging bias between GluR subtypes and specific PNDDs may have clinical implications.

Next generation sequencing and analysis of a conserved transcriptome of New Zealand's kiwi.

PubMed

Subramanian, Sankar; Huynen, Leon; Millar, Craig D; Lambert, David M

2010-12-15

Kiwi is a highly distinctive, flightless and endangered ratite bird endemic to New Zealand. To understand the patterns of molecular evolution of the nuclear protein-coding genes in brown kiwi (Apteryx australis mantelli) and to determine the timescale of avian history we sequenced a transcriptome obtained from a kiwi embryo using next generation sequencing methods. We then assembled the conserved protein-coding regions using the chicken proteome as a scaffold. Using 1,543 conserved protein coding genes we estimated the neutral evolutionary divergence between the kiwi and chicken to be ~45%, which is approximately equal to the divergence computed for the human-mouse pair using the same set of genes. A large fraction of genes was found to be under high selective constraint, as most of the expressed genes appeared to be involved in developmental gene regulation. Our study suggests a significant relationship between gene expression levels and protein evolution. Using sequences from over 700 nuclear genes we estimated the divergence between the two basal avian groups, Palaeognathae and Neognathae to be 132 million years, which is consistent with previous studies using mitochondrial genes. The results of this investigation revealed patterns of mutation and purifying selection in conserved protein coding regions in birds. Furthermore this study suggests a relatively cost-effective way of obtaining a glimpse into the fundamental molecular evolutionary attributes of a genome, particularly when no closely related genomic sequence is available.

Novel compound heterozygous mutations in MYO7A in a Chinese family with Usher syndrome type 1

PubMed Central

Liu, Fei; Li, Pengcheng; Liu, Ying; Li, Weirong; Wong, Fulton; Du, Rong; Wang, Lei; Li, Chang; Jiang, Fagang; Tang, Zhaohui

2013-01-01

Purpose To identify the disease-causing mutation(s) in a Chinese family with autosomal recessive Usher syndrome type 1 (USH1). Methods An ophthalmic examination and an audiometric test were conducted to ascertain the phenotype of two affected siblings. The microsatellite marker D11S937, which is close to the candidate gene MYO7A (USH1B locus), was selected for genotyping. From the DNA of the proband, all coding exons and exon-intron boundaries of MYO7A were sequenced to identify the disease-causing mutation(s). Restriction fragment length polymorphism (RFLP) analysis was performed to exclude the alternative conclusion that the mutations are non-pathogenic rare polymorphisms. Results Based on severe hearing impairment, unintelligible speech, and retinitis pigmentosa, a clinical diagnosis of Usher syndrome type 1 was made. The genotyping results did not exclude the USH1B locus, which suggested that the MYO7A gene was likely the gene associated with the disease-causing mutation(s) in the family. With direct DNA sequencing of MYO7A, two novel compound heterozygous mutations (c.3742G>A and c.6051+1G>A) of MYO7A were identified in the proband. DNA sequence analysis and RFLP analysis of other family members showed that the mutations cosegregated with the disease. Unaffected members, including the parents, uncle, and sister of the proband, carry only one of the two mutations. The mutations were not present in the controls (100 normal Chinese subjects=200 chromosomes) according to the RFLP analysis. Conclusions In this study, we identified two novel mutations, c.3742G>A (p.E1248K) and c.6051+1G>A (donor splice site mutation in intron 44), of MYO7A in a Chinese non-consanguineous family with USH1. The mutations cosegregated with the disease and most likely cause the phenotype in the two affected siblings who carry these mutations compound heterozygously. Our finding expands the mutational spectrum of MYO7A. PMID:23559863

AP1S2 is mutated in X-linked Dandy-Walker malformation with intellectual disability, basal ganglia disease and seizures (Pettigrew syndrome).

PubMed

Cacciagli, Pierre; Desvignes, Jean-Pierre; Girard, Nadine; Delepine, Marc; Zelenika, Diana; Lathrop, Mark; Lévy, Nicolas; Ledbetter, David H; Dobyns, William B; Villard, Laurent

2014-03-01

MRXS5 or Pettigrew syndrome was described 20 years ago in a four generation family including nine affected individuals presenting with facial dysmorphism, intellectual disability, Dandy-Walker malformation and inconstant choreoathetosis. Four individuals had iron deposition in the basal ganglia seen on MRI or at autopsy. The mutation causing Pettigrew has remained elusive since the initial description of the condition. We report the identification of a mutation in the X-linked AP1S2 gene in the original Pettigrew syndrome family using X-chromosome exome sequencing. We report additional phenotype details for several of the affected individuals, allowing us to further refine the phenotype corresponding to this X-linked intellectual disability syndrome. The AP1S2 c.426+1 G>T mutation segregates with the disease in the Pettigrew syndrome family and results in loss of 46 amino acids in the clathrin adaptor complex small chain domain that spans most of the AP1S2 protein sequence. The mutation reported here in AP1S2 is the first mutation that is not predicted to cause a premature termination of the coding sequence or absence of the AP1S2 protein. Although most of the families affected by a mutation in AP1S2 were initially described as having different disorders assigned to at least three different OMIM numbers (MIM 300629, 300630 and 304340), our analysis of the phenotype shows that they are all the same syndrome with recognition complicated by highly variable expressivity that is seen within as well as between families and is probably not explained by differences in mutation severity.

AP1S2 is mutated in X-linked Dandy–Walker malformation with intellectual disability, basal ganglia disease and seizures (Pettigrew syndrome)

PubMed Central

Cacciagli, Pierre; Desvignes, Jean-Pierre; Girard, Nadine; Delepine, Marc; Zelenika, Diana; Lathrop, Mark; Lévy, Nicolas; Ledbetter, David H; Dobyns, William B; Villard, Laurent

2014-01-01

MRXS5 or Pettigrew syndrome was described 20 years ago in a four generation family including nine affected individuals presenting with facial dysmorphism, intellectual disability, Dandy–Walker malformation and inconstant choreoathetosis. Four individuals had iron deposition in the basal ganglia seen on MRI or at autopsy. The mutation causing Pettigrew has remained elusive since the initial description of the condition. We report the identification of a mutation in the X-linked AP1S2 gene in the original Pettigrew syndrome family using X-chromosome exome sequencing. We report additional phenotype details for several of the affected individuals, allowing us to further refine the phenotype corresponding to this X-linked intellectual disability syndrome. The AP1S2 c.426+1 G>T mutation segregates with the disease in the Pettigrew syndrome family and results in loss of 46 amino acids in the clathrin adaptor complex small chain domain that spans most of the AP1S2 protein sequence. The mutation reported here in AP1S2 is the first mutation that is not predicted to cause a premature termination of the coding sequence or absence of the AP1S2 protein. Although most of the families affected by a mutation in AP1S2 were initially described as having different disorders assigned to at least three different OMIM numbers (MIM 300629, 300630 and 304340), our analysis of the phenotype shows that they are all the same syndrome with recognition complicated by highly variable expressivity that is seen within as well as between families and is probably not explained by differences in mutation severity. PMID:23756445

Mutations in the C-terminus of CDKL5: proceed with caution

PubMed Central

Diebold, Bertrand; Delépine, Chloé; Gataullina, Svetlana; Delahaye, Andrée; Nectoux, Juliette; Bienvenu, Thierry

2014-01-01

Mutations in the cyclin-dependent kinase-like 5 (CDKL5) gene have been described in girls with Rett-like features and early-onset epileptic encephalopathy including infantile spasms. Milder phenotypes have been associated with sequence variations in the 3′-end of the CDKL5 gene. Identification of novel CDKL5 transcripts coding isoforms characterized by an altered C-terminal region strongly questions the eventual pathogenicity of sequence variations located in the 3′-end of the gene. We investigated a group of 30 female patients with a clinically heterogeneous phenotype ranging from nonspecific intellectual disability to a severe neonatal encephalopathy and identified two heterozygous CDKL5 missense mutations, the previously reported p.Val999Met and the novel mutation p.Pro944Thr. However, these mutations have also been detected in their healthy father. Considering our results and all data from the literature, we suggest that genetic variations beyond the codon 938 in human CDKL5115 protein may have minor or no significance. It is probable that screening of exons 19–21 of the CDKL5 gene is not useful in practical molecular diagnosis of atypical Rett syndrome. PMID:23756444

PROKR2 and PROK2 mutations cause isolated congenital anosmia without gonadotropic deficiency.

PubMed

Moya-Plana, Antoine; Villanueva, Carine; Laccourreye, Ollivier; Bonfils, Pierre; de Roux, Nicolas

2013-01-01

Isolated congenital anosmia (ICA) is a rare phenotype defined as absent recall of any olfactory sensations since birth and the absence of any disease known to cause anosmia. Although most cases of ICA are sporadic, reports of familial cases suggest a genetic cause. ICA due to olfactory bulb agenesis and associated to hypogonadotropic hypogonadism defines Kallmann syndrome (KS), in which several gene defects have been described. In KS families, the phenotype may be restricted to ICA. We therefore hypothesized that mutations in KS genes cause ICA in patients, even in the absence of family history of reproduction disorders. In 25 patients with ICA and olfactory bulb agenesis, a detailed phenotype analysis was conducted and the coding sequences of KAL1, FGFR1, FGF8, PROKR2, and PROK2 were sequenced. Three PROKR2 mutations previously described in KS and one new PROK2 mutation were found. Investigation of the families showed incomplete penetrance of these mutations. This study is the first to report genetic causes of ICA and indicates that KS genes must be screened in patients with ICA. It also confirms the considerable complexity of GNRH neuron development in humans.

The preferred nucleotide contexts of the AID/APOBEC cytidine deaminases have differential effects when mutating retrotransposon and virus sequences compared to host genes

PubMed Central

Chen, Jeffrey

2017-01-01

The AID / APOBEC genes are a family of cytidine deaminases that have evolved in vertebrates, and particularly mammals, to mutate RNA and DNA at distinct preferred nucleotide contexts (or “hotspots”) on foreign genomes such as viruses and retrotransposons. These enzymes play a pivotal role in intrinsic immunity defense mechanisms, often deleteriously mutating invading retroviruses or retrotransposons and, in the case of AID, changing antibody sequences to drive affinity maturation. We investigate the strength of various hotspots on their known biological targets by evaluating the potential impact of mutations on the DNA coding sequences of these targets, and compare these results to hypothetical hotspots that did not evolve. We find that the existing AID / APOBEC hotspots have a large impact on retrotransposons and non-mammalian viruses while having a much smaller effect on vital mammalian genes, suggesting co-evolution with AID / APOBECs may have had an impact on the genomes of the viruses we analyzed. We determine that GC content appears to be a significant, but not sole, factor in resistance to deaminase activity. We discuss possible mechanisms AID and APOBEC viral targets have adopted to escape the impacts of deamination activity, including changing the GC content of the genome. PMID:28362825

Familial Cortical Myoclonus with a Mutation in NOL3

PubMed Central

Russell, Jonathan F.; Steckley, Jamie L.; Coppola, Giovanni; Hahn, Angelika F.G.; Howard, MacKenzie A.; Kornberg, Zachary; Huang, Alden; Mirsattari, Seyed M.; Merriman, Barry; Klein, Eric; Choi, Murim; Lee, Hsien-Yang; Kirk, Andrew; Nelson-Williams, Carol; Gibson, Gillian; Baraban, Scott C.; Lifton, Richard P.; Geschwind, Daniel H.; Fu, Ying-Hui; Ptáček, Louis J.

2012-01-01

Objective Myoclonus is characterized by sudden, brief involuntary movements and its presence is debilitating. We identified a family suffering from adult-onset, cortical myoclonus without associated seizures. We performed clinical, electrophysiological, and genetic studies to define this phenotype. Methods A large, four-generation family with history of myoclonus underwent careful questioning, examination, and electrophysiological testing. Thirty-five family members donated blood samples for genetic analysis, which included SNP mapping, microsatellite linkage, targeted massively parallel sequencing, and Sanger sequencing. In silico and in vitro experiments were performed to investigate functional significance of the mutation. Results We identified 11 members of a Canadian Mennonite family suffering from adult-onset, slowly progressive, disabling, multifocal myoclonus. Somatosensory evoked potentials indicated a cortical origin of the myoclonus. There were no associated seizures. Some severely affected individuals developed signs of progressive cerebellar ataxia of variable severity late in the course of their illness. The phenotype was inherited in an autosomal dominant fashion. We demonstrated linkage to chromosome 16q21-22.1. We then sequenced all coding sequence in the critical region, identifying only a single co-segregating, novel, nonsynonymous mutation, which resides in the gene NOL3. Furthermore, this mutation was found to alter post-translational modification of NOL3 protein in vitro. Interpretation We propose that Familial Cortical Myoclonus (FCM) is a novel movement disorder that may be caused by mutation in NOL3. Further investigation of the role of NOL3 in neuronal physiology may shed light on neuronal membrane hyperexcitability and pathophysiology of myoclonus and related disorders. PMID:22926851

Mutations in the RNA exosome component gene EXOSC3 cause pontocerebellar hypoplasia and spinal motor neuron degeneration

PubMed Central

Wan, Jijun; Yourshaw, Michael; Mamsa, Hafsa; Rudnik-Schöneborn, Sabine; Menezes, Manoj P.; Hong, Ji Eun; Leong, Derek W.; Senderek, Jan; Salman, Michael S.; Chitayat, David; Seeman, Pavel; von Moers, Arpad; Graul-Neumann, Luitgard; Kornberg, Andrew J.; Castro-Gago, Manuel; Sobrido, María-Jesús; Sanefuji, Masafumi; Shieh, Perry B.; Salamon, Noriko; Kim, Ronald C.; Vinters, Harry V.; Chen, Zugen; Zerres, Klaus; Ryan, Monique M.; Nelson, Stanley F.; Jen, Joanna C.

2012-01-01

RNA exosomes are multi-subunit complexes conserved throughout evolution1 and emerging as the major cellular machinery for processing, surveillance, and turnover of a diverse spectrum of coding and non-coding RNA substrates essential for viability2. By exome sequencing, we discovered recessive mutations in exosome component 3 (EXOSC3) in four siblings with infantile spinal motor neuron disease, cerebellar atrophy, progressive microcephaly, and profound global developmental delay, consistent with pontocerebellar hypoplasia type 1 [PCH1; OMIM 607596]3–6. We identified mutations in EXOSC3 in an additional 8 of 12 families with PCH1. Morpholino knockdown of exosc3 in zebrafish embryos caused embryonic maldevelopment with small brain and poor motility, reminiscent of human clinical features and largely rescued by coinjected wildtype but not mutant exosc3 mRNA. These findings represent the first example of an RNA exosome gene responsible for a human disease and further implicate dysregulation of RNA processing in cerebellar and spinal motor neuron maldevelopment and degeneration. PMID:22544365

Preliminary investigation of bottlenose dolphins (Tursiops truncatus) for hfe gene-related hemochromatosis.

PubMed

Phillips, Brianne E; Venn-Watson, Stephanie; Archer, Linda L; Nollens, Hendrik H; Wellehan, James F X

2014-10-01

Hemochromatosis (iron storage disease) has been reported in diverse mammals including bottlenose dolphins (Tursiops truncatus). The primary cause of excessive iron storage in humans is hereditary hemochromatosis. Most human hereditary hemochromatosis cases (up to 90%) are caused by a point mutation in the hfe gene, resulting in a C282Y substitution leading to iron accumulation. To evaluate the possibility of a hereditary hemochromatosis-like genetic predisposition in dolphins, we sequenced the bottlenose dolphin hfe gene, using reverse transcriptase-PCR and hfe primers designed from the dolphin genome, from liver of affected and healthy control dolphins. Sample size included two case animals and five control animals. Although isotype diversity was evident, no coding differences were identified in the hfe gene between any of the animals examined. Because our sample size was small, we cannot exclude the possibility that hemochromatosis in dolphins is due to a coding mutation in the hfe gene. Other potential causes of hemochromatosis, including mutations in different genes, diet, primary liver disease, and insulin resistance, should be evaluated.

Clonal evolution in relapsed and refractory diffuse large B-cell lymphoma is characterized by high dynamics of subclones.

PubMed

Melchardt, Thomas; Hufnagl, Clemens; Weinstock, David M; Kopp, Nadja; Neureiter, Daniel; Tränkenschuh, Wolfgang; Hackl, Hubert; Weiss, Lukas; Rinnerthaler, Gabriel; Hartmann, Tanja N; Greil, Richard; Weigert, Oliver; Egle, Alexander

2016-08-09

Little information is available about the role of certain mutations for clonal evolution and the clinical outcome during relapse in diffuse large B-cell lymphoma (DLBCL). Therefore, we analyzed formalin-fixed-paraffin-embedded tumor samples from first diagnosis, relapsed or refractory disease from 28 patients using next-generation sequencing of the exons of 104 coding genes. Non-synonymous mutations were present in 74 of the 104 genes tested. Primary tumor samples showed a median of 8 non-synonymous mutations (range: 0-24) with the used gene set. Lower numbers of non-synonymous mutations in the primary tumor were associated with a better median OS compared with higher numbers (28 versus 15 months, p=0.031). We observed three patterns of clonal evolution during relapse of disease: large global change, subclonal selection and no or minimal change possibly suggesting preprogrammed resistance. We conclude that targeted re-sequencing is a feasible and informative approach to characterize the molecular pattern of relapse and it creates novel insights into the role of dynamics of individual genes.

Clinical and genetic investigation of families with type II Waardenburg syndrome.

PubMed

Chen, Yong; Yang, Fuwei; Zheng, Hexin; Zhou, Jianda; Zhu, Ganghua; Hu, Peng; Wu, Weijing

2016-03-01

The present study aimed to investigate the molecular pathology of Waardenburg syndrome type II in three families, in order to provide genetic diagnosis and hereditary counseling for family members. Relevant clinical examinations were conducted on the probands of the three pedigrees. Peripheral blood samples of the probands and related family members were collected and genomic DNA was extracted. The coding sequences of paired box 3 (PAX3), microphthalmia‑associated transcription factor (MITF), sex‑determining region Y‑box 10 (SOX10) and snail family zinc finger 2 (SNAI2) were analyzed by polymerase chain reaction and DNA sequencing. The heterozygous mutation, c.649_651delAGA in exon 7 of the MITF gene was detected in the proband and all patients of pedigree 1; however, no pathological mutation of the relevant genes (MITF, SNAI2, SOX10 or PAX3) was detected in pedigrees 2 and 3. The heterozygous mutation c.649_651delAGA in exon 7 of the MITF gene is therefore considered the disease‑causing mutation in pedigree 1. However, there are novel disease‑causing genes in Waardenburg syndrome type II, which require further research.

Origins of genes: "big bang" or continuous creation?

PubMed Central

Keese, P K; Gibbs, A

1992-01-01

Many protein families are common to all cellular organisms, indicating that many genes have ancient origins. Genetic variation is mostly attributed to processes such as mutation, duplication, and rearrangement of ancient modules. Thus it is widely assumed that much of present-day genetic diversity can be traced by common ancestry to a molecular "big bang." A rarely considered alternative is that proteins may arise continuously de novo. One mechanism of generating different coding sequences is by "overprinting," in which an existing nucleotide sequence is translated de novo in a different reading frame or from noncoding open reading frames. The clearest evidence for overprinting is provided when the original gene function is retained, as in overlapping genes. Analysis of their phylogenies indicates which are the original genes and which are their informationally novel partners. We report here the phylogenetic relationships of overlapping coding sequences from steroid-related receptor genes and from tymovirus, luteovirus, and lentivirus genomes. For each pair of overlapping coding sequences, one is confined to a single lineage, whereas the other is more widespread. This suggests that the phylogenetically restricted coding sequence arose only in the progenitor of that lineage by translating an out-of-frame sequence to yield the new polypeptide. The production of novel exons by alternative splicing in thyroid receptor and lentivirus genes suggests that introns can be a valuable evolutionary source for overprinting. New genes and their products may drive major evolutionary changes. PMID:1329098

SIN3A mutations are rare in men with azoospermia.

PubMed

Miyamoto, T; Koh, E; Tsujimura, A; Miyagawa, Y; Minase, G; Ueda, Y; Namiki, M; Sengoku, K

2015-11-01

A loss of function of the murine Sin3A gene resulted in male infertility with Sertoli cell-only syndrome (SCOS) phenotype in mice. Here, we investigated the relevance of this gene to human male infertility with azoospermia caused by SCOS. Mutation analysis of SIN3A in the coding region was performed on 80 Japanese patients. However, no variants could be detected. This study suggests a lack of association of SIN3A gene sequence variants with azoospermia caused by SCOS in humans. © 2014 Blackwell Verlag GmbH.

Common position of indels that cause deviations from canonical genome organization in different measles virus strains.

PubMed

Ivancic-Jelecki, Jelena; Slovic, Anamarija; Šantak, Maja; Tešović, Goran; Forcic, Dubravko

2016-07-29

The canonical genome organization of measles virus (MV) is characterized by total size of 15 894 nucleotides (nts) and defined length of every genomic region, both coding and non-coding. Only rarely have reports of strains possessing non-canonical genomic properties (possessing indels, with or without the change of total genome length) been published. The observed mutations are mutually compensatory in a sense that the total genome length remains polyhexameric. Although programmed and highly precise pseudo-templated nucleotide additions during transcription are inherent to polymerases of all viruses belonging to family Paramyxoviridae, a similar mechanism that would serve to non-randomly correct genome length, if an indel has occurred during replication, has so far not been described in the context of a complete virus genome. We compiled all complete MV genomic sequences (64 in total) available in open access sequence databases. Multiple sequence comparisons and phylogenetic analyses were performed with the aim of exploring whether non-recombinant and non-evolutionary linked measles strains that show deviations from canonical genome organization possess a common genetic characteristic. In 11 MV sequences we detected deviations from canonical genome organization due to short indels located within homopolymeric stretches or next to them. In nine out of 11 identified non-canonical MV sequences, a common feature was observed: one mutation, either an insertion or a deletion, was located in a 28 nts long region in F gene 5' untranslated region (positions 5051-5078 in genomic cDNA of canonical strains). This segment is composed of five tandemly linked homopolymeric stretches, its consensus sequence is G6-7C7-8A6-7G1-3C5-6. Although none of the mononucleotide repeats within this segment has fixed length, the total number of nts in canonical strains is always 28. These nine non-canonical strains, as well as the tenth (not mutated in 5051-5078 segment), can be grouped in three clusters, based on their passage histories/epidemiological data/genetic similarities. There are no indications that the 3 clusters are evolutionary linked, other than the fact that they all belong to clade D. A common narrow genomic region was found to be mutated in different, non-related, wild type strains suggesting that this region might have a function in non-random genome length corrections occurring during MV replication.

The tRNA(Gly) T10003C mutation in mitochondrial haplogroup M11b in a Chinese family with diabetes decreases the steady-state level of tRNA(Gly), increases aberrant reactive oxygen species production, and reduces mitochondrial membrane potential.

PubMed

Li, Wei; Wen, Chaowei; Li, Weixing; Wang, Hailing; Guan, Xiaomin; Zhang, Wanlin; Ye, Wei; Lu, Jianxin

2015-10-01

Mitochondrial diabetes originates mainly from mutations located in maternally transmitted, mitochondrial tRNA-coding genes. In a genetic screening program of type 2 diabetes conducted with a Chinese Han population, we found one family with suggestive maternally transmitted diabetes. The proband's mitochondrial genome was analyzed using DNA sequencing. Total 42 known nucleoside changes and 1 novel variant were identified, and the entire mitochondrial DNA sequence was assigned to haplogroup M11b. Phylogenetic analysis showed that a homoplasmic mutation, 10003T>C transition, occurred at the highly conserved site in the gene encoding tRNA(Gly). Using a transmitochondrial cybrid cell line harboring this mutation, we observed that the steady-state level of tRNA(Gly) significantly affected and the amount of tRNA(Gly) decreased by 97%, production of reactive oxygen species was enhanced, and mitochondrial membrane potential, mtDNA copy number and cellular oxygen consumption rate were remarkably decreased compared with wild-type cybrid cells. The homoplasmic 10003T>C mutation in the mitochondrial tRNA(Gly) gene suggested to be as a pathogenesis-related mutation which might contribute to the maternal inherited diabetes in the Han Chinese family.

Epidermal Growth Factor Receptor Activation in Glioblastoma through Novel Missense Mutations in the Extracellular Domain

PubMed Central

Lee, Jeffrey C; Vivanco, Igor; Beroukhim, Rameen; Huang, Julie H. Y; Feng, Whei L; DeBiasi, Ralph M; Yoshimoto, Koji; King, Jennifer C; Nghiemphu, Phioanh; Yuza, Yuki; Xu, Qing; Greulich, Heidi; Thomas, Roman K; Paez, J. Guillermo; Peck, Timothy C; Linhart, David J; Glatt, Karen A; Getz, Gad; Onofrio, Robert; Ziaugra, Liuda; Levine, Ross L; Gabriel, Stacey; Kawaguchi, Tomohiro; O'Neill, Keith; Khan, Haumith; Liau, Linda M; Nelson, Stanley F; Rao, P. Nagesh; Mischel, Paul; Pieper, Russell O; Cloughesy, Tim; Leahy, Daniel J; Sellers, William R; Sawyers, Charles L; Meyerson, Matthew; Mellinghoff, Ingo K

2006-01-01

Background Protein tyrosine kinases are important regulators of cellular homeostasis with tightly controlled catalytic activity. Mutations in kinase-encoding genes can relieve the autoinhibitory constraints on kinase activity, can promote malignant transformation, and appear to be a major determinant of response to kinase inhibitor therapy. Missense mutations in the EGFR kinase domain, for example, have recently been identified in patients who showed clinical responses to EGFR kinase inhibitor therapy. Methods and Findings Encouraged by the promising clinical activity of epidermal growth factor receptor (EGFR) kinase inhibitors in treating glioblastoma in humans, we have sequenced the complete EGFR coding sequence in glioma tumor samples and cell lines. We identified novel missense mutations in the extracellular domain of EGFR in 13.6% (18/132) of glioblastomas and 12.5% (1/8) of glioblastoma cell lines. These EGFR mutations were associated with increased EGFR gene dosage and conferred anchorage-independent growth and tumorigenicity to NIH-3T3 cells. Cells transformed by expression of these EGFR mutants were sensitive to small-molecule EGFR kinase inhibitors. Conclusions Our results suggest extracellular missense mutations as a novel mechanism for oncogenic EGFR activation and may help identify patients who can benefit from EGFR kinase inhibitors for treatment of glioblastoma. PMID:17177598

New mutations in non-syndromic primary ovarian insufficiency patients identified via whole-exome sequencing.

PubMed

Patiño, Liliana Catherine; Beau, Isabelle; Carlosama, Carolina; Buitrago, July Constanza; González, Ronald; Suárez, Carlos Fernando; Patarroyo, Manuel Alfonso; Delemer, Brigitte; Young, Jacques; Binart, Nadine; Laissue, Paul

2017-07-01

Is it possible to identify new mutations potentially associated with non-syndromic primary ovarian insufficiency (POI) via whole-exome sequencing (WES)? WES is an efficient tool to study genetic causes of POI as we have identified new mutations, some of which lead to protein destablization potentially contributing to the disease etiology. POI is a frequently occurring complex pathology leading to infertility. Mutations in only few candidate genes, mainly identified by Sanger sequencing, have been definitively related to the pathogenesis of the disease. This is a retrospective cohort study performed on 69 women affected by POI. WES and an innovative bioinformatics analysis were used on non-synonymous sequence variants in a subset of 420 selected POI candidate genes. Mutations in BMPR1B and GREM1 were modeled by using fragment molecular orbital analysis. Fifty-five coding variants in 49 genes potentially related to POI were identified in 33 out of 69 patients (48%). These genes participate in key biological processes in the ovary, such as meiosis, follicular development, granulosa cell differentiation/proliferation and ovulation. The presence of at least two mutations in distinct genes in 42% of the patients argued in favor of a polygenic nature of POI. It is possible that regulatory regions, not analyzed in the present study, carry further variants related to POI. WES and the in silico analyses presented here represent an efficient approach for mapping variants associated with POI etiology. Sequence variants presented here represents potential future genetic biomarkers. This study was supported by the Universidad del Rosario and Colciencias (Grants CS/CIGGUR-ABN062-2016 and 672-2014). Colciencias supported Liliana Catherine Patiño´s work (Fellowship: 617, 2013). The authors declare no conflict of interest. © The Author 2017. Published by Oxford University Press on behalf of the European Society of Human Reproduction and Embryology. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com

A new mutation identified in SPATA16 in two globozoospermic patients.

PubMed

ElInati, Elias; Fossard, Camille; Okutman, Ozlem; Ghédir, Houda; Ibala-Romdhane, Samira; Ray, Pierre F; Saad, Ali; Hennebicq, Sylvianne; Viville, Stéphane

2016-06-01

The aim of this study is to identify potential genes involved in human globozoopsermia. Nineteen globozoospermic patients (previously screened for DPY19L2 mutations with no causative mutation) were recruited in this study and screened for mutations in genes implicated in human globozoospermia SPATA16 and PICK1. Using the candidate gene approach and the determination of Spata16 partners by Glutathione S-transferase (GST) pull-down four genes were also selected and screened for mutations. We identified a novel mutation of SPATA16: deletion of 22.6 Kb encompassing the first coding exon in two unrelated Tunisian patients who presented the same deletion breakpoints. The two patients shared the same haplotype, suggesting a possible ancestral founder effect for this new deletion. Four genes were selected using the candidate gene approach and the GST pull-down (GOPC, PICK1, AGFG1 and IRGC) and were screened for mutation, but no variation was identified. The present study confirms the pathogenicity of the SPATA16 mutations. The fact that no variation was detected in the coding sequence of AFGF1, GOPC, PICK1 and IRGC does not mean that they are not involved in human globozoospermia. A larger globozoospermic cohort must be studied in order to accelerate the process of identifying new genes involved in such phenotypes. Until sufficient numbers of patients have been screened, AFGF1, GOPC, PICK1 and IRGC should still be considered as candidate genes.

Mutation screening of Chinese Treacher Collins syndrome patients identified novel TCOF1 mutations.

PubMed

Chen, Ying; Guo, Luo; Li, Chen-Long; Shan, Jing; Xu, Hai-Song; Li, Jie-Ying; Sun, Shan; Hao, Shao-Juan; Jin, Lei; Chai, Gang; Zhang, Tian-Yu

2018-04-01

Treacher Collins syndrome (TCS) (OMIM 154500) is a rare congenital craniofacial disorder with an autosomal dominant manner of inheritance in most cases. To date, three pathogenic genes (TCOF1, POLR1D and POLR1C) have been identified. In this study, we conducted mutational analysis on Chinese TCS patients to reveal a mutational spectrum of known causative genes and show phenotype-genotype data to provide more information for gene counselling and future studies on the pathogenesis of TCS. Twenty-two TCS patients were recruited from two tertiary referral centres, and Sanger sequencing for the coding exons and exon-intron boundaries of TCOF1, POLR1D and POLR1C was performed. For patients without small variants, further copy number variations (CNVs) analysis was conducted using high-density SNP array platforms. The Sanger sequencing overall mutation detection rate was as high as 86.3% (19/22) for our cohort. Fifteen TCOF1 pathogenic variants, including ten novel mutations, were identified in nineteen patients. No causative mutations in POLR1D and POLR1C genes and no CNVs mutations were detected. A suspected autosomal dominant inheritance case that implies germinal mosaicism was described. Our study confirmed that TCOF1 was the main disease-causing gene for the Chinese TCS population and revealed its mutation spectrum. We also addressed the need for more studies of mosaicism in TCS cases, which could explain the mechanism of autosomal dominant inheritance in TCS cases and benefit the prevention of TCS.

Epidermolysis bullosa with congenital pyloric atresia: novel mutations in the beta 4 integrin gene (ITGB4) and genotype/phenotype correlations.

PubMed

Nakano, A; Pulkkinen, L; Murrell, D; Rico, J; Lucky, A W; Garzon, M; Stevens, C A; Robertson, S; Pfendner, E; Uitto, J

2001-05-01

Epidermolysis bullosa with pyloric atresia (EB-PA: OMIM 226730), also known as Carmi syndrome, is a rare autosomal recessive genodermatosis that manifests with neonatal mucocutaneous fragility associated with congenital pyloric atresia. The disease is frequently lethal within the first year, but nonlethal cases have been reported. Mutations in the genes encoding subunit polypeptides of the alpha 6 beta 4 integrin (ITGA6 and ITGB4) have been demonstrated in EB-PA patients. To extend the repertoire of mutations and to identify genotype-phenotype correlations, we examined seven new EB-PA families, four with lethal and three with nonlethal disease variants. DNA from patients was screened for mutations using heteroduplex analysis followed by nucleotide sequencing of PCR products spanning all beta 4 integrin-coding sequences. Mutation analysis disclosed 12 distinct mutations, 11 of them novel. Four mutations predicted a premature termination codon as a result of nonsense mutations or small out-of-frame insertions or deletions, whereas seven were missense mutations. This brings the total number of distinct ITGB4 mutations to 33. The mutation database indicates that premature termination codons are associated predominantly with the lethal EB-PA variants, whereas missense mutations are more prevalent in nonlethal forms. However, the consequences of the missense mutations are position dependent, and substitutions of highly conserved amino acids may have lethal consequences. In general, indirect immunofluorescence studies of affected skin revealed negative staining for beta 4 integrin in lethal cases and positive, but attenuated, staining in nonlethal cases and correlated with clinical phenotype. The data on specific mutations in EB-PA patients allows prenatal testing and preimplantation genetic diagnosis in families at risk.

Clinical and Biologic Significance of MYC Genetic Mutations in De Novo Diffuse Large B-cell Lymphoma.

PubMed

Xu-Monette, Zijun Y; Deng, Qipan; Manyam, Ganiraju C; Tzankov, Alexander; Li, Ling; Xia, Yi; Wang, Xiao-Xiao; Zou, Dehui; Visco, Carlo; Dybkær, Karen; Li, Jun; Zhang, Li; Liang, Han; Montes-Moreno, Santiago; Chiu, April; Orazi, Attilio; Zu, Youli; Bhagat, Govind; Richards, Kristy L; Hsi, Eric D; Choi, William W L; van Krieken, J Han; Huh, Jooryung; Ponzoni, Maurilio; Ferreri, Andrés J M; Parsons, Ben M; Møller, Michael B; Wang, Sa A; Miranda, Roberto N; Piris, Miguel A; Winter, Jane N; Medeiros, L Jeffrey; Li, Yong; Young, Ken H

2016-07-15

MYC is a critical driver oncogene in many cancers, and its deregulation in the forms of translocation and overexpression has been implicated in lymphomagenesis and progression of diffuse large B-cell lymphoma (DLBCL). The MYC mutational profile and its roles in DLBCL are unknown. This study aims to determine the spectrum of MYC mutations in a large group of patients with DLBCL, and to evaluate the clinical significance of MYC mutations in patients with DLBCL treated with rituximab, cyclophosphamide, doxorubicin, vincristine, and prednisone (R-CHOP) immunochemotherapy. We identified MYC mutations in 750 patients with DLBCL using Sanger sequencing and evaluated the prognostic significance in 602 R-CHOP-treated patients. The frequency of MYC mutations was 33.3% at the DNA level (mutations in either the coding sequence or the untranslated regions) and 16.1% at the protein level (nonsynonymous mutations). Most of the nonsynonymous mutations correlated with better survival outcomes; in contrast, T58 and F138 mutations (which were associated with MYC rearrangements), as well as several mutations occurred at the 3' untranslated region, correlated with significantly worse survival outcomes. However, these mutations occurred infrequently (only in approximately 2% of DLBCL). A germline SNP encoding the Myc-N11S variant (observed in 6.5% of the study cohort) was associated with significantly better patient survival, and resulted in reduced tumorigenecity in mouse xenografts. Various types of MYC gene mutations are present in DLBCL and show different impact on Myc function and clinical outcomes. Unlike MYC gene translocations and overexpression, most MYC gene mutations may not have a role in driving lymphomagenesis. Clin Cancer Res; 22(14); 3593-605. ©2016 AACR. ©2016 American Association for Cancer Research.

Genetic variations in the hotspot region of RS1 gene in Indian patients with juvenile X-linked retinoschisis

PubMed Central

Suganthalakshmi, Balasubbu; Shukla, Dhananjay; Rajendran, Anand; Kim, Ramasamy; Nallathambi, Jeyabalan

2007-01-01

Purpose X-linked juvenile retinoschisis (XLRS) is the leading cause of macular degeneration in males. This condition is caused by mutations in the RS1 gene and is, characterized by schisis within the retina. The purpose of this study was to identify the mutations in the RS1 gene associated with XLRS in an Indian cohort. Methods The coding region of RS1 was analyzed for mutations by polymerase chain reaction-single strand conformational polymorphism (PCR-SSCP) and restriction fragment length polymorphism (RFLP) analysis in six unrelated subjects clinically diagnosed as having XLRS and in their available family members. Direct sequencing was performed for all samples that displayed an electrophoretic mobility shift in SSCP gel. Results Mutation analysis of RS1 gene revealed five mutations in exon 6 like c.574C>T, c.583A>G, c.608C>T, c.617G>A, and c.637C>T, respectively, among them four missense mutations, one nonsense mutation, and two novel sequence variations. These mutations were found in individuals who exhibited clinical features of bilateral foveal and peripheral retinoschisis consistent with XLRS. The mutations were absent in the 100 age matched control samples analyzed. Conclusions This is the first report of mutations in RS1 to be associated with XLRS in the Indian population. The identified genetic variations, phenotype and genotype correlations were consistent with other studies. Identification of the causative mutation in patients with XLRS is helpful in confirming the diagnosis and in counseling of family members. PMID:17515881

Differentiation of the glucocerebrosidase gene from pseudogene by long-template PCR: Implications for Gaucher disease

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tayebi, N.; Cushner, S.; Sidransky, E.

1996-09-01

We describe the use of long-template PCR to differentiate the glucocerebrosidase gene from its pseudogene, which will simplify molecular diagnostic testing and the detection of known and new mutations in patients with Gaucher disease. Gaucher disease results from the inherited deficiency of the lysosomal enzyme, glucocerebrosidase. Sixteen kilobases downstream of the glucocerebrosidase gene is a pseudogene, which is {approximately}2 kb shorter and has >96% identity to the coding regions of the functional gene. Many mutations encountered in Gaucher patients are identical to sequences ordinarily found only in the pseudogene, and some result from recombination between the gene and pseudogene. Thus,more » for diagnostic purposes it is essential to differentiate between sequences from the gene and pseudogene. 9 refs., 1 fig.« less

Evolution of the Iga Heavy Chain Gene in the Genus Mus

PubMed Central

Osborne, B. A.; Golde, T. E.; Schwartz, R. L.; Rudikoff, S.

1988-01-01

To examine questions of immunoglobulin gene evolution, the IgA α heavy chain gene from Mus pahari, an evolutionarily distant relative to Mus musculus domesticus, was cloned and sequenced. The sequence, when compared to the IgA gene of BALB/c or human, demonstrated that the IgA gene is evolving in a mosaic fashion with the hinge region accumulating mutations most rapidly and the third domain at a considerably lower frequency. In spite of this pronounced accumulation of mutations, the hinge region appears to maintain the conformation of a random coil. A marked propensity to accumulate replacement over silent site changes in the coding regions was noted, as was a definite codon bias. The possibility that these two phenomena are interrelated is discussed. PMID:2842228

Human immunodeficiency virus type 1 LTR TATA and TAR region sequences required for transcriptional regulation.

PubMed Central

Garcia, J A; Harrich, D; Soultanakis, E; Wu, F; Mitsuyasu, R; Gaynor, R B

1989-01-01

The human immunodeficiency virus (HIV) type 1 LTR is regulated at the transcriptional level by both cellular and viral proteins. Using HeLa cell extracts, multiple regions of the HIV LTR were found to serve as binding sites for cellular proteins. An untranslated region binding protein UBP-1 has been purified and fractions containing this protein bind to both the TAR and TATA regions. To investigate the role of cellular proteins binding to both the TATA and TAR regions and their potential interaction with other HIV DNA binding proteins, oligonucleotide-directed mutagenesis of both these regions was performed followed by DNase I footprinting and transient expression assays. In the TATA region, two direct repeats TC/AAGC/AT/AGCTGC surround the TATA sequence. Mutagenesis of both of these direct repeats or of the TATA sequence interrupted binding over the TATA region on the coding strand, but only a mutation of the TATA sequence affected in vivo assays for tat-activation. In addition to TAR serving as the site of binding of cellular proteins, RNA transcribed from TAR is capable of forming a stable stem-loop structure. To determine the relative importance of DNA binding proteins as compared to secondary structure, oligonucleotide-directed mutations in the TAR region were studied. Local mutations that disrupted either the stem or loop structure were defective in gene expression. However, compensatory mutations which restored base pairing in the stem resulted in complete tat-activation. This indicated a significant role for the stem-loop structure in HIV gene expression. To determine the role of TAR binding proteins, mutations were constructed which extensively changed the primary structure of the TAR region, yet left stem base pairing, stem energy and the loop sequence intact. These mutations resulted in decreased protein binding to TAR DNA and defects in tat-activation, and revealed factor binding specifically to the loop DNA sequence. Further mutagenesis which inverted this stem and loop mutation relative to the HIV LTR mRNA start site resulted in even larger decreases in tat-activation. This suggests that multiple determinants, including protein binding, the loop sequence, and RNA or DNA secondary structure, are important in tat-activation and suggests that tat may interact with cellular proteins binding to DNA to increase HIV gene expression. Images PMID:2721501

Application of exome sequencing in the search for genetic causes of rare disorders of copper metabolism.

PubMed

Fuchs, Sabine A; Harakalova, Magdalena; van Haaften, Gijs; van Hasselt, Peter M; Cuppen, Edwin; Houwen, Roderick H J

2012-07-01

The genetic defect in a number of rare disorders of metal metabolism remains elusive. The limited number of patients with these disorders impedes the identification of the causative gene through positional cloning, which requires numerous families with multiple affected individuals. However, with next-generation sequencing all coding DNA (exomes) or whole genomes of patients can be sequenced to identify genes that are consistently mutated in patients. With this strategy only a limited number of patients and/or pedigrees is needed, bringing the elucidation of the genetic cause of even very rare diseases within reach. The main challenge associated with whole exome sequencing is the identification of the disease-causing mutation(s) among abundant genetic candidate variants. We describe several strategies to manage this data wealth, including comparison with control databases, increasing the number of patients and controls, and reducing the genomic region under investigation through homozygosity mapping. In this review we introduce a number of rare disorders of copper metabolism, with a suspected but yet unknown monogenetic cause, as an attractive target for this strategy. We anticipate that use of these novel techniques will identify the basic defect in the disorders described in this review, as well as in other genetic disorders of metal metabolism, in the next few years.

Fitness change in relation to mutation number in spontaneous mutation accumulation lines of Chlamydomonas reinhardtii

PubMed Central

Kraemer, Susanne A.; Böndel, Katharina B.; Ness, Robert W.; Keightley, Peter D.; Colegrave, Nick

2017-01-01

Abstract Although all genetic variation ultimately stems from mutations, their properties are difficult to study directly. Here, we used multiple mutation accumulation (MA) lines derived from five genetic backgrounds of the green algae Chlamydomonas reinhardtii that have been previously subjected to whole genome sequencing to investigate the relationship between the number of spontaneous mutations and change in fitness from a nonevolved ancestor. MA lines were on average less fit than their ancestors and we detected a significantly negative correlation between the change in fitness and the total number of accumulated mutations in the genome. Likewise, the number of mutations located within coding regions significantly and negatively impacted MA line fitness. We used the fitness data to parameterize a maximum likelihood model to estimate discrete categories of mutational effects, and found that models containing one to two mutational effect categories (one neutral and one deleterious category) fitted the data best. However, the best‐fitting mutational effects models were highly dependent on the genetic background of the ancestral strain. PMID:28884790

Differentiated evolutionary conservatism and lack of polymorphism of crucial sex determination genes (SRY and SOX9) in four species of the family Canidae.

PubMed

Nowacka-Woszuk, Joanna; Switonski, Marek

2009-01-01

The sex determination process is under the control of several genes of which two (SRY and SOX9), encoding transcription factors, play a crucial role. It is well-known that mutations at these genes may cause the development of an intersexual phenotype. The aim of this study was to conduct a comparative analysis of the coding sequence and 5'-flanking regions of both genes in four species of the family Canidae (the dog, red fox, arctic fox and Chinese raccoon dog). Similarity of the coding sequence of the SOX9 gene among the studied species was higher (99.7-99.9%) than in the case of the SRY gene (96.7-97.3%). Only single nucleotide changes were found in the compared coding sequences, whereas in the 5'-flanking region of both genes nucleotide substitutions, as well as insertions and deletions were observed. None of the changes detected in the 5'-flanking region occurred within the potential consensus sequences for transcription factors. No polymorphism was found for either of these genes in any of the analyzed species.

The effects of different representations on static structure analysis of computer malware signatures.

PubMed

Narayanan, Ajit; Chen, Yi; Pang, Shaoning; Tao, Ban

2013-01-01

The continuous growth of malware presents a problem for internet computing due to increasingly sophisticated techniques for disguising malicious code through mutation and the time required to identify signatures for use by antiviral software systems (AVS). Malware modelling has focused primarily on semantics due to the intended actions and behaviours of viral and worm code. The aim of this paper is to evaluate a static structure approach to malware modelling using the growing malware signature databases now available. We show that, if malware signatures are represented as artificial protein sequences, it is possible to apply standard sequence alignment techniques in bioinformatics to improve accuracy of distinguishing between worm and virus signatures. Moreover, aligned signature sequences can be mined through traditional data mining techniques to extract metasignatures that help to distinguish between viral and worm signatures. All bioinformatics and data mining analysis were performed on publicly available tools and Weka.

The Effects of Different Representations on Static Structure Analysis of Computer Malware Signatures

PubMed Central

Narayanan, Ajit; Chen, Yi; Pang, Shaoning; Tao, Ban

2013-01-01

The continuous growth of malware presents a problem for internet computing due to increasingly sophisticated techniques for disguising malicious code through mutation and the time required to identify signatures for use by antiviral software systems (AVS). Malware modelling has focused primarily on semantics due to the intended actions and behaviours of viral and worm code. The aim of this paper is to evaluate a static structure approach to malware modelling using the growing malware signature databases now available. We show that, if malware signatures are represented as artificial protein sequences, it is possible to apply standard sequence alignment techniques in bioinformatics to improve accuracy of distinguishing between worm and virus signatures. Moreover, aligned signature sequences can be mined through traditional data mining techniques to extract metasignatures that help to distinguish between viral and worm signatures. All bioinformatics and data mining analysis were performed on publicly available tools and Weka. PMID:23983644

Repeated Evolution of the Pyrrolizidine Alkaloid–Mediated Defense System in Separate Angiosperm LineagesW⃞

PubMed Central

Reimann, Andreas; Nurhayati, Niknik; Backenköhler, Anita; Ober, Dietrich

2004-01-01

Species of several unrelated families within the angiosperms are able to constitutively produce pyrrolizidine alkaloids as a defense against herbivores. In pyrrolizidine alkaloid (PA) biosynthesis, homospermidine synthase (HSS) catalyzes the first specific step. HSS was recruited during angiosperm evolution from deoxyhypusine synthase (DHS), an enzyme involved in the posttranslational activation of eukaryotic initiation factor 5A. Phylogenetic analysis of 23 cDNA sequences coding for HSS and DHS of various angiosperm species revealed at least four independent recruitments of HSS from DHS: one within the Boraginaceae, one within the monocots, and two within the Asteraceae family. Furthermore, sequence analyses indicated elevated substitution rates within HSS-coding sequences after each gene duplication, with an increased level of nonsynonymous mutations. However, the contradiction between the polyphyletic origin of the first enzyme in PA biosynthesis and the structural identity of the final biosynthetic PA products needs clarification. PMID:15466410

Exome Sequencing Finds a Novel PCSK1 Mutation in a Child With Generalized Malabsorptive Diarrhea and Diabetes Insipidus

PubMed Central

Yourshaw, Michael; Solorzano-Vargas, R. Sergio; Pickett, Lindsay A.; Lindberg, Iris; Wang, Jiafang; Cortina, Galen; Pawlikowska-Haddal, Anna; Baron, Howard; Venick, Robert S.; Nelson, Stanley F.; Martín, Martín G.

2014-01-01

Objectives Congenital diarrhea disorders are a group of genetically diverse and typically autosomal recessive disorders that have yet to be well characterized phenotypically or molecularly. Diagnostic assessments are generally limited to nutritional challenges and histologic evaluation, and many subjects eventually require a prolonged course of intravenous nutrition. Here we describe next-generation sequencing techniques to investigate a child with perplexing congenital malabsorptive diarrhea and other presumably unrelated clinical problems; this method provides an alternative approach to molecular diagnosis. Methods We screened the diploid genome of an affected individual, using exome sequencing, for uncommon variants that have observed protein-coding consequences. We assessed the functional activity of the mutant protein, as well as its lack of expression using immunohistochemistry. Results Among several rare variants detected was a homozygous nonsense mutation in the catalytic domain of the proprotein convertase subtilisin/kexin type 1 gene. The mutation abolishes prohormone convertase 1/3 endoprotease activity as well as expression in the intestine. These primary genetic findings prompted a careful endocrine reevaluation of the child at 4.5 years of age, and multiple significant problems were subsequently identified consistent with the known phenotypic consequences of proprotein convertase subtilisin/kexin type 1 (PCSK1) gene mutations. Based on the molecular diagnosis, alternate medical and dietary management was implemented for diabetes insipidus, polyphagia, and micropenis. Conclusions Whole-exome sequencing provides a powerful diagnostic tool to clinicians managing rare genetic disorders with multiple perplexing clinical manifestations. PMID:24280991

Exome sequencing finds a novel PCSK1 mutation in a child with generalized malabsorptive diarrhea and diabetes insipidus.

PubMed

Yourshaw, Michael; Solorzano-Vargas, R Sergio; Pickett, Lindsay A; Lindberg, Iris; Wang, Jiafang; Cortina, Galen; Pawlikowska-Haddal, Anna; Baron, Howard; Venick, Robert S; Nelson, Stanley F; Martín, Martín G

2013-12-01

Congenital diarrhea disorders are a group of genetically diverse and typically autosomal recessive disorders that have yet to be well characterized phenotypically or molecularly. Diagnostic assessments are generally limited to nutritional challenges and histologic evaluation, and many subjects eventually require a prolonged course of intravenous nutrition. Here we describe next-generation sequencing techniques to investigate a child with perplexing congenital malabsorptive diarrhea and other presumably unrelated clinical problems; this method provides an alternative approach to molecular diagnosis. We screened the diploid genome of an affected individual, using exome sequencing, for uncommon variants that have observed protein-coding consequences. We assessed the functional activity of the mutant protein, as well as its lack of expression using immunohistochemistry. Among several rare variants detected was a homozygous nonsense mutation in the catalytic domain of the proprotein convertase subtilisin/kexin type 1 gene. The mutation abolishes prohormone convertase 1/3 endoprotease activity as well as expression in the intestine. These primary genetic findings prompted a careful endocrine reevaluation of the child at 4.5 years of age, and multiple significant problems were subsequently identified consistent with the known phenotypic consequences of proprotein convertase subtilisin/kexin type 1 (PCSK1) gene mutations. Based on the molecular diagnosis, alternate medical and dietary management was implemented for diabetes insipidus, polyphagia, and micropenis. Whole-exome sequencing provides a powerful diagnostic tool to clinicians managing rare genetic disorders with multiple perplexing clinical manifestations.

TCOF1 gene encodes a putative nucleolar phosphoprotein that exhibits mutations in Treacher Collins Syndrome throughout its coding region

PubMed Central

Wise, Carol A.; Chiang, Lydia C.; Paznekas, William A.; Sharma, Mridula; Musy, Maurice M.; Ashley, Jennifer A.; Lovett, Michael; Jabs, Ethylin W.

1997-01-01

Treacher Collins Syndrome (TCS) is the most common of the human mandibulofacial dysostosis disorders. Recently, a partial TCOF1 cDNA was identified and shown to contain mutations in TCS families. Here we present the entire exon/intron genomic structure and the complete coding sequence of TCOF1. TCOF1 encodes a low complexity protein of 1,411 amino acids, whose predicted protein structure reveals repeated motifs that mirror the organization of its exons. These motifs are shared with nucleolar trafficking proteins in other species and are predicted to be highly phosphorylated by casein kinase. Consistent with this, the full-length TCOF1 protein sequence also contains putative nuclear and nucleolar localization signals. Throughout the open reading frame, we detected an additional eight mutations in TCS families and several polymorphisms. We postulate that TCS results from defects in a nucleolar trafficking protein that is critically required during human craniofacial development. PMID:9096354

Germline whole exome sequencing and large-scale replication identifies FANCM as a likely high grade serous ovarian cancer susceptibility gene.

PubMed

Dicks, Ed; Song, Honglin; Ramus, Susan J; Oudenhove, Elke Van; Tyrer, Jonathan P; Intermaggio, Maria P; Kar, Siddhartha; Harrington, Patricia; Bowtell, David D; Group, Aocs Study; Cicek, Mine S; Cunningham, Julie M; Fridley, Brooke L; Alsop, Jennifer; Jimenez-Linan, Mercedes; Piskorz, Anna; Goranova, Teodora; Kent, Emma; Siddiqui, Nadeem; Paul, James; Crawford, Robin; Poblete, Samantha; Lele, Shashi; Sucheston-Campbell, Lara; Moysich, Kirsten B; Sieh, Weiva; McGuire, Valerie; Lester, Jenny; Odunsi, Kunle; Whittemore, Alice S; Bogdanova, Natalia; Dürst, Matthias; Hillemanns, Peter; Karlan, Beth Y; Gentry-Maharaj, Aleksandra; Menon, Usha; Tischkowitz, Marc; Levine, Douglas; Brenton, James D; Dörk, Thilo; Goode, Ellen L; Gayther, Simon A; Pharoah, D P Paul

2017-08-01

We analyzed whole exome sequencing data in germline DNA from 412 high grade serous ovarian cancer (HGSOC) cases from The Cancer Genome Atlas Project and identified 5,517 genes harboring a predicted deleterious germline coding mutation in at least one HGSOC case. Gene-set enrichment analysis showed enrichment for genes involved in DNA repair (p = 1.8×10 -3 ). Twelve DNA repair genes - APEX1, APLF, ATX, EME1, FANCL, FANCM, MAD2L2, PARP2, PARP3, POLN, RAD54L and SMUG1 - were prioritized for targeted sequencing in up to 3,107 HGSOC cases, 1,491 cases of other epithelial ovarian cancer (EOC) subtypes and 3,368 unaffected controls of European origin. We estimated mutation prevalence for each gene and tested for associations with disease risk. Mutations were identified in both cases and controls in all genes except MAD2L2 , where we found no evidence of mutations in controls. In FANCM we observed a higher mutation frequency in HGSOC cases compared to controls (29/3,107 cases, 0.96 percent; 13/3,368 controls, 0.38 percent; P=0.008) with little evidence for association with other subtypes (6/1,491, 0.40 percent; P=0.82). The relative risk of HGSOC associated with deleterious FANCM mutations was estimated to be 2.5 (95% CI 1.3 - 5.0; P=0.006). In summary, whole exome sequencing of EOC cases with large-scale replication in case-control studies has identified FANCM as a likely novel susceptibility gene for HGSOC, with mutations associated with a moderate increase in risk. These data may have clinical implications for risk prediction and prevention approaches for high-grade serous ovarian cancer in the future and a significant impact on reducing disease mortality.

Sequencing ASMT identifies rare mutations in Chinese Han patients with autism.

PubMed

Wang, Lifang; Li, Jun; Ruan, Yanyan; Lu, Tianlan; Liu, Chenxing; Jia, Meixiang; Yue, Weihua; Liu, Jing; Bourgeron, Thomas; Zhang, Dai

2013-01-01

Melatonin is involved in the regulation of circadian and seasonal rhythms and immune function. Prior research reported low melatonin levels in autism spectrum disorders (ASD). ASMT located in pseudo-autosomal region 1 encodes the last enzyme of the melatonin biosynthesis pathway. A previous study reported an association between ASD and single nucleotide polymorphisms (SNPs) rs4446909 and rs5989681 located in the promoter of ASMT. Furthermore, rare deleterious mutations were identified in a subset of patients. To investigate the association between ASMT and autism, we sequenced all ASMT exons and its neighboring region in 398 Chinese Han individuals with autism and 437 healthy controls. Although our study did not detect significant differences of genotypic distribution and allele frequencies of the common SNPs in ASMT between patients with autism and healthy controls, we identified new rare coding mutations of ASMT. Among these rare variants, 4 were exclusively detected in patients with autism including a stop mutation (p.R115W, p.V166I, p.V179G, and p.W257X). These four coding variants were observed in 6 of 398 (1.51%) patients with autism and none in 437 controls (Chi-Square test, Continuity Correction p = 0.032, two-sided). Functional prediction of impact of amino acid showed that p.R115W might affect protein function. These results indicate that ASMT might be a susceptibility gene for autism. Further studies in larger samples are needed to better understand the degree of variation in this gene as well as to understand the biochemical and clinical impacts of ASMT/melatonin deficiency.

A novel nonsense mutation in CRYBB1 associated with autosomal dominant congenital cataract

PubMed Central

Yang, Juhua; Zhu, Yihua; Gu, Feng; He, Xiang; Cao, Zongfu; Li, Xuexi; Tong, Yi

2008-01-01

Purpose To identify the molecular defect underlying an autosomal dominant congenital nuclear cataract in a Chinese family. Methods Twenty-two members of a three-generation pedigree were recruited, clinical examinations were performed, and genomic DNA was extracted from peripheral blood leukocytes. All members were genotyped with polymorphic microsatellite markers adjacent to each of the known cataract-related genes. Linkage analysis was performed after genotyping. Candidate genes were screened for mutation using direct sequencing. Individuals were screened for presence of a mutation by restriction fragment length polymorphism (RFLP) analysis. Results Linkage analysis identified a maximum LOD score of 3.31 (recombination fraction [θ]=0.0) with marker D22S1167 on chromosome 22, which flanks the β-crystallin gene cluster (CRYBB3, CRYBB2, CRYBB1, and CRYBA4). Sequencing the coding regions and the flanking intronic sequences of these four candidate genes identified a novel, heterozygous C→T transition in exon 6 of CRYBB1 in the affected individuals of the family. This single nucleotide change introduced a novel BfaI site and was predicted to result in a nonsense mutation at codon 223 that changed a phylogenetically conserved amino acid to a stop codon (p.Q223X). RFLP analysis confirmed that this mutation co-segregated with the disease phenotype in all available family members and was not found in 100 normal unrelated individuals from the same ethnic background. Conclusions This study has identified a novel nonsense mutation in CRYBB1 (p.Q223X) associated with autosomal dominant congenital nuclear cataract. PMID:18432316

Influence of Gene Expression on Hardness in Wheat

PubMed Central

Nirmal, Ravi C.; Wrigley, Colin

2016-01-01

Puroindoline (Pina and Pinb) genes control grain texture or hardness in wheat. Wild-type/soft alleles lead to softer grain while a mutation in one or both of these genes results in a hard grain. Variation in hardness in genotypes with identical Pin alleles (wild-type or mutant) is known but the molecular basis of this is not known. We now report the identification of wheat genotypes with hard grain texture and wild-type/soft Pin alleles indicating that hardness in wheat may be controlled by factors other than mutations in the coding region of the Pin genes. RNA-Seq analysis was used to determine the variation in the transcriptome of developing grains of thirty three diverse wheat genotypes including hard (mutant Pin) and soft (wild type) and those that were hard without having Pin mutations. This defined the role of pin gene expression and identified other candidate genes associated with hardness. Pina was not expressed in hard wheat with a mutation in the Pina gene. The ratio of Pina to Pinb expression was generally lower in the hard non mutant genotypes. Hardness may be associated with differences in Pin expression and other factors and is not simply associated with mutations in the PIN protein coding sequences. PMID:27741295

Evaluation of genetic variations in miRNA-binding sites of BRCA1 and BRCA2 genes as risk factors for the development of early-onset and/or familial breast cancer.

PubMed

Erturk, Elif; Cecener, Gulsah; Polatkan, Volkan; Gokgoz, Sehsuvar; Egeli, Unal; Tunca, Berrin; Tezcan, Gulcin; Demirdogen, Elif; Ak, Secil; Tasdelen, Ismet

2014-01-01

Although genetic markers identifying women at an increased risk of developing breast cancer exist, the majority of inherited risk factors remain elusive. Mutations in the BRCA1/BRCA2 gene confer a substantial increase in breast cancer risk, yet routine clinical genetic screening is limited to the coding regions and intron- exon boundaries, precluding the identification of mutations in noncoding and untranslated regions. Because 3' untranslated region (3'UTR) polymorphisms disrupting microRNA (miRNA) binding can be functional and can act as genetic markers of cancer risk, we aimed to determine genetic variation in the 3'UTR of BRCA1/BRCA2 in familial and early-onset breast cancer patients with and without mutations in the coding regions of BRCA1/ BRCA2 and to identify specific 3'UTR variants that may be risk factors for cancer development. The 3'UTRs of the BRCA1 and BRCA2 genes were screened by heteroduplex analysis and DNA sequencing in 100 patients from 46 BRCA1/2 families, 54 non-BRCA1/2 families, and 47 geographically matched controls. Two polymorphisms were identified. SNPs c.*1287C>T (rs12516) (BRCA1) and c.*105A>C (rs15869) (BRCA2) were identified in 27% and 24% of patients, respectively. These 2 variants were also identified in controls with no family history of cancer (23.4% and 23.4%, respectively). In comparison to variations in the 3'UTR region of the BRCA1/2 genes and the BRCA1/2 mutational status in patients, there was a statistically significant relationship between the BRCA1 gene polymorphism c.*1287C>T (rs12516) and BRCA1 mutations (p=0.035) by Fisher's Exact Test. SNP c.*1287C>T (rs12516) of the BRCA1 gene may have potential use as a genetic marker of an increased risk of developing breast cancer and likely represents a non-coding sequence variation in BRCA1 that impacts BRCA1 function and leads to increased early-onset and/or familial breast cancer risk in the Turkish population.

Clonal Architecture of Secondary Acute Myeloid Leukemia

PubMed Central

Walter, Matthew J.; Shen, Dong; Ding, Li; Shao, Jin; Koboldt, Daniel C.; Chen, Ken; Larson, David E.; McLellan, Michael D.; Dooling, David; Abbott, Rachel; Fulton, Robert; Magrini, Vincent; Schmidt, Heather; Kalicki-Veizer, Joelle; O’Laughlin, Michelle; Fan, Xian; Grillot, Marcus; Witowski, Sarah; Heath, Sharon; Frater, John L.; Eades, William; Tomasson, Michael; Westervelt, Peter; DiPersio, John F.; Link, Daniel C.; Mardis, Elaine R.; Ley, Timothy J.; Wilson, Richard K.; Graubert, Timothy A.

2012-01-01

BACKGROUND The myelodysplastic syndromes are a group of hematologic disorders that often evolve into secondary acute myeloid leukemia (AML). The genetic changes that underlie progression from the myelodysplastic syndromes to secondary AML are not well understood. METHODS We performed whole-genome sequencing of seven paired samples of skin and bone marrow in seven subjects with secondary AML to identify somatic mutations specific to secondary AML. We then genotyped a bone marrow sample obtained during the antecedent myelodysplastic-syndrome stage from each subject to determine the presence or absence of the specific somatic mutations. We identified recurrent mutations in coding genes and defined the clonal architecture of each pair of samples from the myelodysplastic-syndrome stage and the secondary-AML stage, using the allele burden of hundreds of mutations. RESULTS Approximately 85% of bone marrow cells were clonal in the myelodysplastic-syndrome and secondary-AML samples, regardless of the myeloblast count. The secondary-AML samples contained mutations in 11 recurrently mutated genes, including 4 genes that have not been previously implicated in the myelodysplastic syndromes or AML. In every case, progression to acute leukemia was defined by the persistence of an antecedent founding clone containing 182 to 660 somatic mutations and the outgrowth or emergence of at least one subclone, harboring dozens to hundreds of new mutations. All founding clones and subclones contained at least one mutation in a coding gene. CONCLUSIONS Nearly all the bone marrow cells in patients with myelodysplastic syndromes and secondary AML are clonally derived. Genetic evolution of secondary AML is a dynamic process shaped by multiple cycles of mutation acquisition and clonal selection. Recurrent gene mutations are found in both founding clones and daughter subclones. (Funded by the National Institutes of Health and others.) PMID:22417201

Molecular Epidemiology of Mutations in Antimicrobial Resistance Loci of Pseudomonas aeruginosa Isolates from Airways of Cystic Fibrosis Patients.

PubMed

Greipel, Leonie; Fischer, Sebastian; Klockgether, Jens; Dorda, Marie; Mielke, Samira; Wiehlmann, Lutz; Cramer, Nina; Tümmler, Burkhard

2016-11-01

The chronic airway infections with Pseudomonas aeruginosa in people with cystic fibrosis (CF) are treated with aerosolized antibiotics, oral fluoroquinolones, and/or intravenous combination therapy with aminoglycosides and β-lactam antibiotics. An international strain collection of 361 P. aeruginosa isolates from 258 CF patients seen at 30 CF clinics was examined for mutations in 17 antimicrobial susceptibility and resistance loci that had been identified as hot spots of mutation by genome sequencing of serial isolates from a single CF clinic. Combinatorial amplicon sequencing of pooled PCR products identified 1,112 sequence variants that were not present in the genomes of representative strains of the 20 most common clones of the global P. aeruginosa population. A high frequency of singular coding variants was seen in spuE, mexA, gyrA, rpoB, fusA1, mexZ, mexY, oprD, ampD, parR, parS, and envZ (amgS), reflecting the pressure upon P. aeruginosa in lungs of CF patients to generate novel protein variants. The proportion of nonneutral amino acid exchanges was high. Of the 17 loci, mexA, mexZ, and pagL were most frequently affected by independent stop mutations. Private and de novo mutations seem to play a pivotal role in the response of P. aeruginosa populations to the antimicrobial load and the individual CF host. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

SQSTM1 Mutations in French Patients With Frontotemporal Dementia or Frontotemporal Dementia With Amyotrophic Lateral Sclerosis

PubMed Central

Le Ber, Isabelle; Camuzat, Agnès; Guerreiro, Rita; Bouya-Ahmed, Kawtar; Bras, Jose; Nicolas, Gael; Gabelle, Audrey; Didic, Mira; De Septenville, Anne; Millecamps, Stéphanie; Lenglet, Timothée; Latouche, Morwena; Kabashi, Edor; Campion, Dominique; Hannequin, Didier; Hardy, John; Brice, Alexis

2014-01-01

IMPORTANCE Mutations in the SQSTM1 gene, coding for p62, are a cause of Paget disease of bone and amyotrophic lateral sclerosis (ALS). Recently, SQSTM1 mutations were confirmed in ALS, and mutations were also identified in 3 patients with frontotemporal dementia (FTD), suggesting a role for SQSTM1 in FTD. OBJECTIVE To evaluate the exact contribution of SQSTM1 to FTD and FTD with ALS (FTD-ALS) in an independent cohort of patients. DESIGN A SQSTM1 mutation was first identified in a multiplex family with FTD by use of whole-exome sequencing. To evaluate the frequency of SQSTM1 mutations, we sequenced this gene in a cohort of patients with FTD or FTD-ALS, with no mutations in known FTD and ALS genes. SETTING Primary care or referral center. PARTICIPANTS An overall cohort of 188 French patients, including 132 probands with FTD and 56 probands with FTD-ALS. MAIN OUTCOMES AND MEASURES Frequency of SQSTM1 mutations in patients with FTD or FTD-ALS; description of associated phenotypes. RESULTS We identified 4 heterozygous missense mutations in 4 unrelated families with FTD; only 1 family had clinical symptoms of Paget disease of bone, and only 1 family had clinical symptoms of FTD-ALS, possibly owing to the low penetrance of some of the clinical manifestations. CONCLUSIONS AND RELEVANCE Although the frequency of the mutations is low in our series (4 of 188 patients [2%]), our results, similar to those already reported, support a direct pathogenic role of p62 in different types of FTD. PMID:24042580

Missense mutations in SURF1 associated with deficient cytochrome c oxidase assembly in Leigh syndrome patients.

PubMed

Poyau, A; Buchet, K; Bouzidi, M F; Zabot, M T; Echenne, B; Yao, J; Shoubridge, E A; Godinot, C

2000-02-01

We have studied the fibroblasts of three patients suffering from Leigh syndrome associated with cytochrome c oxidase deficiency (LS-COX-). Their mitochondrial DNA was functional and all nuclear COX subunits had a normal sequence. The expression of transcripts encoding mitochondrial and nuclear COX subunits was normal or slightly increased. Similarly, the OXA1 transcript coding for a protein involved in COX assembly was increased. However, several COX-protein subunits were severely depressed, indicating deficient COX assembly. Surf1, a factor involved in COX biogenesis, was recently reported as mutated in LS-COX- patients, all mutations predicting a truncated protein. Sequence analysis of SURF1 gene in our three patients revealed seven heterozygous mutations, six of which were new : an insertion, a nonsense mutation, a splicing mutation of intron 7 in addition to three missense mutations. The mutation G385 A (Gly124-->Glu) changes a Gly that is strictly conserved in Surfl homologs of 12 species. The substitution G618 C (Asp202-->His), changing an Asp that is conserved only in mammals, appears to be a polymorphism. The mutation T751 C changes Ile246 to Thr, a position at which a hydrophobic amino acid is conserved in all eukaryotic and some bacterial species. Replacing Ile246 by Thr disrupts a predicted beta sheet structure present in all higher eukaryotes. COX activity could be restored in fibroblasts of the three patients by complementation with a retroviral vector containing normal SURF1 cDNA. These mutations identify domains essential to Surf1 protein structure and/or function.

Frameshift mutations of TAF1C gene, a core component for transcription by RNA polymerase I, and its regional heterogeneity in gastric and colorectal cancers.

PubMed

Oh, Hye Rim; An, Chang Hyeok; Yoo, Nam Jin; Lee, Sug Hyung

2015-02-01

Initiation of transcription for ribosomal RNA (rRNA) by RNA polymerase I requires TATA-binding protein (TBP) and TBP-associated factors (TAF1A, TAF1B and TAF1C). p53 tumour suppressor inhibits rRNA transcription by blocking TAF1C-UBF interaction, but alterations of TAF1C itself in tumorigenesis remain unknown. The aim of this study was to explore whether TAF1C gene was mutated in gastric (GC) and colorectal cancers (CRC).In a public database, we found that TAF1C gene had a mononucleotide repeat (C8) in the coding sequences that might be a mutation target in the cancers with microsatellite instability (MSI). We analysed 79 GC and 124 CRC by single-strand conformation polymorphism and DNA sequencing analyses. In this study, we found TAF1C frameshift mutations (8.8% of GC and 10.1% of CRC with MSI-H), which were not found in stable MSI/low MSI (MSS/MSI-L) (0/90). In addition, we analysed intratumoural heterogeneity (ITH) of TAF1C frameshift mutations in 16 CRC and found that three CRC (18.8%) harboured regional ITH of the TAF1C frameshift mutations. Our results indicate that TAF1C gene harboured not only somatic frameshift mutations but also the mutational ITH, which together might play a role in tumourigenesis of GC and CRC. Our data also suggest that multi-regional mutation analysis is needed for a better evaluation of the mutation status in CRC.

Four novel germline mutations in the MLH1 and PMS2 mismatch repair genes in patients with hereditary nonpolyposis colorectal cancer.

PubMed

Montazer Haghighi, Mahdi; Radpour, Ramin; Aghajani, Katayoun; Zali, Narges; Molaei, Mahsa; Zali, Mohammad Reza

2009-08-01

Hereditary nonpolyposis colorectal cancer (HNPCC) is the most common cause of early onset hereditary colorectal cancer. In the majority of HNPCC families, microsatellite instability (MSI) and germline mutation in one of the DNA mismatch repair (MMR) genes are found. The entire coding sequence of MMR genes (MLH1, MLH2, MLH6, and PMS2) was analyzed using direct sequencing. Also, tumor tests were done as MSI and immunohistochemistry testing. We were able to find three novel MLH1 and one novel PMS2 germline mutations in three Iranian HNPCC patients. The first was a transversion mutation c.346A>C (T116P) and happened in the highly conserved HATPase-c region of MLH1 protein. The second was a transversion mutation c.736A>T (I246L), which caused an amino acid change of isoleucine to leucine. The third mutation (c.2145,6 delTG) was frameshift and resulted in an immature stop codon in five codons downstream. All of these three mutations were detected in the MLH1 gene. The other mutation was a transition mutation, c.676G>A (G207E), which has been found in exon six of the PMS2 gene and caused an amino acid change of glycine to glutamic acid. MSI assay revealed high instability in microsatellite for two patients and microsatellite stable for one patient. In all patients, an abnormal expression of the MMR proteins in HNPCC was related to the above novel mutations.

Identification of single nucleotide polymorphisms in the agouti signaling protein (ASIP) gene in some goat breeds in tropical and temperate climates.

PubMed

Adefenwa, Mufliat A; Peters, Sunday O; Agaviezor, Brilliant O; Wheto, Matthew; Adekoya, Khalid O; Okpeku, Moses; Oboh, Bola; Williams, Gabriel O; Adebambo, Olufunmilayo A; Singh, Mahipal; Thomas, Bolaji; De Donato, Marcos; Imumorin, Ikhide G

2013-07-01

The agouti-signaling protein (ASIP) plays a major role in mammalian pigmentation as an antagonist to melanocortin-1 receptor gene to stimulate pheomelanin synthesis, a major pigment conferring mammalian coat color. We sequenced a 352 bp fragment of ASIP gene spanning part of exon 2 and part of intron 2 in 215 animals representing six goat breeds from Nigeria and the United States: West African Dwarf, predominantly black; Red Sokoto, mostly red; and Sahel, mostly white from Nigeria; black and white Alpine, brown and white Spanish and white Saanen from the US. Twenty haplotypes from nine mutations representing three intronic, one silent and five missense (p.S19R, p.N35K, p.L36V, p.M42L and p.L45W) mutations were identified in Nigerian goats. Approximately 89 % of Nigerian goats carry haplotype 1 (TGCCATCCG) which seems to be the wild type configuration of mutations in this region of the gene. Although we found no association between these polymorphisms in the ASIP gene and coat color in Nigerian goats, in-silico functional analysis predicts putative deleterious functional impact of the p.L45W mutation on the basic amino-terminal domain of ASIP. In the American goats, two intronic mutations, g.293G>A and g.327C>A, were identified in the Alpine breed, although the g.293G>A mutation is common to American and Nigerian goat populations. All Sannen and Sahel goats in this study belong to haplotypes 1 of both populations which seem to be the wild-type composite ASIP haplotype. Overall, there was no clear association of this portion of the ASIP gene interrogated in this study with coat color variation. Therefore, additional genomic analyses of promoter sequence, the entire coding and non-coding regions of the ASIP gene will be required to obtain a definite conclusion.

Identification of two novel mutations in the SLC45A2 gene in a Hungarian pedigree affected by unusual OCA type 4.

PubMed

Tóth, Lola; Fábos, Beáta; Farkas, Katalin; Sulák, Adrienn; Tripolszki, Kornélia; Széll, Márta; Nagy, Nikoletta

2017-03-15

Oculocutaneous albinism (OCA) is a clinically and genetically heterogenic group of pigmentation abnormalities. OCA type IV (OCA4, OMIM 606574) develops due to homozygous or compound heterozygous mutations in the solute carrier family 45, member 2 (SLC45A2) gene. This gene encodes a membrane-associated transport protein, which regulates tyrosinase activity and, thus, melanin content by changing melanosomal pH and disrupting the incorporation of copper into tyrosinase. Here we report two Hungarian siblings affected by an unusual OCA4 phenotype. After genomic DNA was isolated from peripheral blood of the patients, the coding regions of the SLC45A2 gene were sequenced. In silico tools were applied to identify the functional impact of the newly detected mutations. Direct sequencing of the SLC45A2 gene revealed two novel, heterozygous mutations, one missense (c.1226G > A, p.Gly409Asp) and one nonsense (c.1459C > T, p.Gln437*), which were present in both patients, suggesting the mutations were compound heterozygous. In silico tools suggest that these variations are disease causing mutations. The newly identified mutations may affect the transmembrane domains of the protein, and could impair transport function, resulting in decreases in both melanosomal pH and tyrosinase activity. Our study provides expands on the mutation spectrum of the SLC45A2 gene and the genetic background of OCA4.

PAX3 mutations and clinical characteristics in Chinese patients with Waardenburg syndrome type 1.

PubMed

Wang, Juan; Li, Shiqiang; Xiao, Xueshan; Wang, Panfeng; Guo, Xiangming; Zhang, Qingjiong

2010-06-22

To detect paired box gene 3 (PAX3) mutations and associated phenotypes in Chinese patients with Waardenburg syndrome type 1 (WS1). Five unrelated families with suspected WS1 were selected from our Genomic DNA Repository for Hereditary Eye Diseases. The coding and adjacent intronic regions of PAX3 were amplified by polymerase chain reaction and the amplicons were then analyzed by cycle sequencing. Variations detected were further evaluated in available family members as well as one hundred controls with heteroduplex-single strand conformational polymorphism (heteroduplex-SSCP) analysis and/or clone sequencing. Three novel and two known mutations in PAX3 were detected in five patients, respectively: c.567_586+17del (p.Asp189_Gln505delinsGluGlyGlyAlaLeuAlaGly), c.456_459dupTTCC (p.Ile154PhefsX162), c.795_800delCTGGTT (p.Trp266_Phe267del), c.799T>A (p.Phe267Ile), and c.667C>T (p.Arg223X). Two novel mutations proved to be de novo as their parents did not carry the mutations. All five patients with PAX3 mutations had dystopia canthorum and different iris color and fundi between their two eyes. However, none had white forelock, skin hypopigmentation, and deafness. Our findings expand the frequency and spectrum of PAX3 mutations and ethnic-related phenotypes in Chinese patients with WS1. De novo mutations in PAX3 have not been reported before.

PAX3 mutations and clinical characteristics in Chinese patients with Waardenburg syndrome type 1

PubMed Central

Wang, Juan; Li, Shiqiang; Xiao, Xueshan; Wang, Panfeng; Guo, Xiangming

2010-01-01

Purpose To detect paired box gene 3 (PAX3) mutations and associated phenotypes in Chinese patients with Waardenburg syndrome type 1 (WS1). Methods Five unrelated families with suspected WS1 were selected from our Genomic DNA Repository for Hereditary Eye Diseases. The coding and adjacent intronic regions of PAX3 were amplified by polymerase chain reaction and the amplicons were then analyzed by cycle sequencing. Variations detected were further evaluated in available family members as well as one hundred controls with heteroduplex-single strand conformational polymorphism (heteroduplex-SSCP) analysis and/or clone sequencing. Results Three novel and two known mutations in PAX3 were detected in five patients, respectively: c.567_586+17del (p.Asp189_Gln505delinsGluGlyGlyAlaLeuAlaGly), c.456_459dupTTCC (p.Ile154PhefsX162), c.795_800delCTGGTT (p.Trp266_Phe267del), c.799T>A (p.Phe267Ile), and c.667C>T (p.Arg223X). Two novel mutations proved to be de novo as their parents did not carry the mutations. All five patients with PAX3 mutations had dystopia canthorum and different iris color and fundi between their two eyes. However, none had white forelock, skin hypopigmentation, and deafness. Conclusions Our findings expand the frequency and spectrum of PAX3 mutations and ethnic-related phenotypes in Chinese patients with WS1. De novo mutations in PAX3 have not been reported before. PMID:20664692

Identification of novel mutations and sequence variants in the SOX2 and CHX10 genes in patients with anophthalmia/microphthalmia

PubMed Central

Zhou, Jie; Kherani, Femida; Bardakjian, Tanya M.; Katowitz, James; Hughes, Nkecha; Schimmenti, Lisa A.; Schneider, Adele

2008-01-01

Purpose Mutations in the SOX2 and CHX10 genes have been reported in patients with anophthalmia and/or microphthalmia. In this study, we evaluated 34 anophthalmic/microphthalmic patient DNA samples (two sets of siblings included) for mutations and sequence variants in SOX2 and CHX10. Methods Conformational sensitive gel electrophoresis (CSGE) was used for the initial SOX2 and CHX10 screening of 34 affected individuals (two sets of siblings), five unaffected family members, and 80 healthy controls. Patient samples containing heteroduplexes were selected for sequence analysis. Base pair changes in SOX2 and CHX10 were confirmed by sequencing bidirectionally in patient samples. Results Two novel heterozygous mutations and two sequence variants (one known) in SOX2 were identified in this cohort. Mutation c.310 G>T (p. Glu104X), found in one patient, was in the region encoding the high mobility group (HMG) DNA-binding domain and resulted in a change from glutamic acid to a stop codon. The second mutation, noted in two affected siblings, was a single nucleotide deletion c.549delC (p. Pro184ArgfsX19) in the region encoding the activation domain, resulting in a frameshift and premature termination of the coding sequence. The shortened protein products may result in the loss of function. In addition, a novel nucleotide substitution c.*557G>A was identified in the 3′-untranslated region in one patient. The relationship between the nucleotide change and the protein function is indeterminate. A known single nucleotide polymorphism (c. *469 C>A, SNP rs11915160) was also detected in 2 of the 34 patients. Screening of CHX10 identified two synonymous sequence variants, c.471 C>T (p.Ser157Ser, rs35435463) and c.579 G>A (p. Gln193Gln, novel SNP), and one non-synonymous sequence variant, c.871 G>A (p. Asp291Asn, novel SNP). The non-synonymous polymorphism was also present in healthy controls, suggesting non-causality. Conclusions These results support the role of SOX2 in ocular development. Loss of SOX2 function results in severe eye malformation. CHX10 was not implicated with microphthalmia/anophthalmia in our patient cohort. PMID:18385794

Novel mutations of endothelin-B receptor gene in Pakistani patients with Waardenburg syndrome.

PubMed

Jabeen, Raheela; Babar, Masroor Ellahi; Ahmad, Jamil; Awan, Ali Raza

2012-01-01

Mutations in EDNRB gene have been reported to cause Waardenburg-Shah syndrome (WS4) in humans. We investigated 17 patients with WS4 for identification of mutations in EDNRB gene using PCR and direct sequencing technique. Four genomic mutations were detected in four patients; a G to C transversion in codon 335 (S335C) in exon 5 and a transition of T to C in codon (S361L) in exon 5, a transition of A to G in codon 277 (L277L) in exon 4, a non coding transversion of T to A at -30 nucleotide position of exon 5. None of these mutations were found in controls. One of the patients harbored two novel mutations (S335C, S361L) in exon 5 and one in Intronic region (-30exon5 A>G). All of the mutations were homozygous and novel except the mutation observed in exon 4. In this study, we have identified 3 novel mutations in EDNRB gene associated with WS4 in Pakistani patients.

Association of Germline CHEK2 Gene Variants with Risk and Prognosis of Non-Hodgkin Lymphoma

PubMed Central

Havranek, Ondrej; Kleiblova, Petra; Hojny, Jan; Lhota, Filip; Soucek, Pavel; Trneny, Marek; Kleibl, Zdenek

2015-01-01

The checkpoint kinase 2 gene (CHEK2) codes for the CHK2 protein, an important mediator of the DNA damage response pathway. The CHEK2 gene has been recognized as a multi-cancer susceptibility gene; however, its role in non-Hodgkin lymphoma (NHL) remains unclear. We performed mutation analysis of the entire CHEK2 coding sequence in 340 NHL patients using denaturing high-performance liquid chromatography (DHPLC) and multiplex ligation-dependent probe amplification (MLPA). Identified hereditary variants were genotyped in 445 non-cancer controls. The influence of CHEK2 variants on disease risk was statistically evaluated. Identified CHEK2 germline variants included four truncating mutations (found in five patients and no control; P = 0.02) and nine missense variants (found in 21 patients and 12 controls; P = 0.02). Carriers of non-synonymous variants had an increased risk of NHL development [odds ratio (OR) 2.86; 95% confidence interval (CI) 1.42–5.79] and an unfavorable prognosis [hazard ratio (HR) of progression-free survival (PFS) 2.1; 95% CI 1.12–4.05]. In contrast, the most frequent intronic variant c.319+43dupA (identified in 22% of patients and 31% of controls) was associated with a decreased NHL risk (OR = 0.62; 95% CI 0.45–0.86), but its positive prognostic effect was limited to NHL patients with diffuse large B-cell lymphoma (DLBCL) treated by conventional chemotherapy without rituximab (HR-PFS 0.4; 94% CI 0.17–0.74). Our results show that germ-line CHEK2 mutations affecting protein coding sequence confer a moderately-increased risk of NHL, they are associated with an unfavorable NHL prognosis, and they may represent a valuable predictive biomarker for patients with DLBCL. PMID:26506619

Association of Germline CHEK2 Gene Variants with Risk and Prognosis of Non-Hodgkin Lymphoma.

PubMed

Havranek, Ondrej; Kleiblova, Petra; Hojny, Jan; Lhota, Filip; Soucek, Pavel; Trneny, Marek; Kleibl, Zdenek

2015-01-01

The checkpoint kinase 2 gene (CHEK2) codes for the CHK2 protein, an important mediator of the DNA damage response pathway. The CHEK2 gene has been recognized as a multi-cancer susceptibility gene; however, its role in non-Hodgkin lymphoma (NHL) remains unclear. We performed mutation analysis of the entire CHEK2 coding sequence in 340 NHL patients using denaturing high-performance liquid chromatography (DHPLC) and multiplex ligation-dependent probe amplification (MLPA). Identified hereditary variants were genotyped in 445 non-cancer controls. The influence of CHEK2 variants on disease risk was statistically evaluated. Identified CHEK2 germline variants included four truncating mutations (found in five patients and no control; P = 0.02) and nine missense variants (found in 21 patients and 12 controls; P = 0.02). Carriers of non-synonymous variants had an increased risk of NHL development [odds ratio (OR) 2.86; 95% confidence interval (CI) 1.42-5.79] and an unfavorable prognosis [hazard ratio (HR) of progression-free survival (PFS) 2.1; 95% CI 1.12-4.05]. In contrast, the most frequent intronic variant c.319+43dupA (identified in 22% of patients and 31% of controls) was associated with a decreased NHL risk (OR = 0.62; 95% CI 0.45-0.86), but its positive prognostic effect was limited to NHL patients with diffuse large B-cell lymphoma (DLBCL) treated by conventional chemotherapy without rituximab (HR-PFS 0.4; 94% CI 0.17-0.74). Our results show that germ-line CHEK2 mutations affecting protein coding sequence confer a moderately-increased risk of NHL, they are associated with an unfavorable NHL prognosis, and they may represent a valuable predictive biomarker for patients with DLBCL.

A Dominant Mutation in Hexokinase 1 (HK1) Causes Retinitis Pigmentosa

PubMed Central

Sullivan, Lori S.; Koboldt, Daniel C.; Bowne, Sara J.; Lang, Steven; Blanton, Susan H.; Cadena, Elizabeth; Avery, Cheryl E.; Lewis, Richard A.; Webb-Jones, Kaylie; Wheaton, Dianna H.; Birch, David G.; Coussa, Razck; Ren, Huanan; Lopez, Irma; Chakarova, Christina; Koenekoop, Robert K.; Garcia, Charles A.; Fulton, Robert S.; Wilson, Richard K.; Weinstock, George M.; Daiger, Stephen P.

2014-01-01

Purpose. To identify the cause of retinitis pigmentosa (RP) in UTAD003, a large, six-generation Louisiana family with autosomal dominant retinitis pigmentosa (adRP). Methods. A series of strategies, including candidate gene screening, linkage exclusion, genome-wide linkage mapping, and whole-exome next-generation sequencing, was used to identify a mutation in a novel disease gene on chromosome 10q22.1. Probands from an additional 404 retinal degeneration families were subsequently screened for mutations in this gene. Results. Exome sequencing in UTAD003 led to identification of a single, novel coding variant (c.2539G>A, p.Glu847Lys) in hexokinase 1 (HK1) present in all affected individuals and absent from normal controls. One affected family member carries two copies of the mutation and has an unusually severe form of disease, consistent with homozygosity for this mutation. Screening of additional adRP probands identified four other families (American, Canadian, and Sicilian) with the same mutation and a similar range of phenotypes. The families share a rare 450-kilobase haplotype containing the mutation, suggesting a founder mutation among otherwise unrelated families. Conclusions. We identified an HK1 mutation in five adRP families. Hexokinase 1 catalyzes phosphorylation of glucose to glucose-6-phosphate. HK1 is expressed in retina, with two abundant isoforms expressed at similar levels. The Glu847Lys mutation is located at a highly conserved position in the protein, outside the catalytic domains. We hypothesize that the effect of this mutation is limited to the retina, as no systemic abnormalities in glycolysis were detected. Prevalence of the HK1 mutation in our cohort of RP families is 1%. PMID:25190649

Nephrolithiasis and osteoporosis associated with hypophosphatemia caused by mutations in the type 2a sodium-phosphate cotransporter.

PubMed

Prié, Dominique; Huart, Virginie; Bakouh, Naziha; Planelles, Gabrielle; Dellis, Olivier; Gérard, Bénédicte; Hulin, Philippe; Benqué-Blanchet, François; Silve, Caroline; Grandchamp, Bernard; Friedlander, Gérard

2002-09-26

Epidemiologic studies suggest that genetic factors confer a predisposition to the formation of renal calcium stones or bone demineralization. Low serum phosphate concentrations due to a decrease in renal phosphate reabsorption have been reported in some patients with these conditions, suggesting that genetic factors leading to a decrease in renal phosphate reabsorption may contribute to them. We hypothesized that mutations in the gene coding for the main renal sodium-phosphate cotransporter (NPT2a) may be present in patients with these disorders. We studied 20 patients with urolithiasis or bone demineralization and persistent idiopathic hypophosphatemia associated with a decrease in maximal renal phosphate reabsorption. The coding region of the gene for NPT2a was sequenced in all patients. The functional consequences of the mutations identified were analyzed by expressing the mutated RNA in Xenopus laevis oocytes. Two patients, one with recurrent urolithiasis and one with bone demineralization, were heterozygous for two distinct mutations. One mutation resulted in the substitution of phenylalanine for alanine at position 48, and the other in a substitution of methionine for valine at position 147. Phosphate-induced current and sodium-dependent phosphate uptake were impaired in oocytes expressing the mutant NPT2a. Coinjection of oocytes with wild-type and mutant RNA indicated that the mutant protein had altered function. Heterozygous mutations in the NPT2a gene may be responsible for hypophosphatemia and urinary phosphate loss in persons with urolithiasis or bone demineralization. Copyright 2002 Massachusetts Medical Society

Increasing Nucleosome Occupancy Is Correlated with an Increasing Mutation Rate so Long as DNA Repair Machinery Is Intact

PubMed Central

Taylor, Jared F.; Khattab, Omar S.; Chen, Yu-Han; Chen, Yumay; Jacobsen, Steven E.; Wang, Ping H.

2015-01-01

Deciphering the multitude of epigenomic and genomic factors that influence the mutation rate is an area of great interest in modern biology. Recently, chromatin has been shown to play a part in this process. To elucidate this relationship further, we integrated our own ultra-deep sequenced human nucleosomal DNA data set with a host of published human genomic and cancer genomic data sets. Our results revealed, that differences in nucleosome occupancy are associated with changes in base-specific mutation rates. Increasing nucleosome occupancy is associated with an increasing transition to transversion ratio and an increased germline mutation rate within the human genome. Additionally, cancer single nucleotide variants and microindels are enriched within nucleosomes and both the coding and non-coding cancer mutation rate increases with increasing nucleosome occupancy. There is an enrichment of cancer indels at the theoretical start (74 bp) and end (115 bp) of linker DNA between two nucleosomes. We then hypothesized that increasing nucleosome occupancy decreases access to DNA by DNA repair machinery and could account for the increasing mutation rate. Such a relationship should not exist in DNA repair knockouts, and we thus repeated our analysis in DNA repair machinery knockouts to test our hypothesis. Indeed, our results revealed no correlation between increasing nucleosome occupancy and increasing mutation rate in DNA repair knockouts. Our findings emphasize the linkage of the genome and epigenome through the nucleosome whose properties can affect genome evolution and genetic aberrations such as cancer. PMID:26308346

Novel candidate genes may be possible predisposing factors revealed by whole exome sequencing in familial esophageal squamous cell carcinoma.

PubMed

Forouzanfar, Narjes; Baranova, Ancha; Milanizadeh, Saman; Heravi-Moussavi, Alireza; Jebelli, Amir; Abbaszadegan, Mohammad Reza

2017-05-01

Esophageal squamous cell carcinoma is one of the deadliest of all the cancers. Its metastatic properties portend poor prognosis and high rate of recurrence. A more advanced method to identify new molecular biomarkers predicting disease prognosis can be whole exome sequencing. Here, we report the most effective genetic variants of the Notch signaling pathway in esophageal squamous cell carcinoma susceptibility by whole exome sequencing. We analyzed nine probands in unrelated familial esophageal squamous cell carcinoma pedigrees to identify candidate genes. Genomic DNA was extracted and whole exome sequencing performed to generate information about genetic variants in the coding regions. Bioinformatics software applications were utilized to exploit statistical algorithms to demonstrate protein structure and variants conservation. Polymorphic regions were excluded by false-positive investigations. Gene-gene interactions were analyzed for Notch signaling pathway candidates. We identified novel and damaging variants of the Notch signaling pathway through extensive pathway-oriented filtering and functional predictions, which led to the study of 27 candidate novel mutations in all nine patients. Detection of the trinucleotide repeat containing 6B gene mutation (a slice site alteration) in five of the nine probands, but not in any of the healthy samples, suggested that it may be a susceptibility factor for familial esophageal squamous cell carcinoma. Noticeably, 8 of 27 novel candidate gene mutations (e.g. epidermal growth factor, signal transducer and activator of transcription 3, MET) act in a cascade leading to cell survival and proliferation. Our results suggest that the trinucleotide repeat containing 6B mutation may be a candidate predisposing gene in esophageal squamous cell carcinoma. In addition, some of the Notch signaling pathway genetic mutations may act as key contributors to esophageal squamous cell carcinoma.

Antibiotic Resistance Markers in Burkholderia pseudomallei Strain Bp1651 Identified by Genome Sequence Analysis

PubMed Central

Sue, David; Gee, Jay E.; Elrod, Mindy G.; Hoffmaster, Alex R.; Randall, Linnell B.; Chirakul, Sunisa; Tuanyok, Apichai; Schweizer, Herbert P.; Weigel, Linda M.

2017-01-01

ABSTRACT Burkholderia pseudomallei Bp1651 is resistant to several classes of antibiotics that are usually effective for treatment of melioidosis, including tetracyclines, sulfonamides, and β-lactams such as penicillins (amoxicillin-clavulanic acid), cephalosporins (ceftazidime), and carbapenems (imipenem and meropenem). We sequenced, assembled, and annotated the Bp1651 genome and analyzed the sequence using comparative genomic analyses with susceptible strains, keyword searches of the annotation, publicly available antimicrobial resistance prediction tools, and published reports. More than 100 genes in the Bp1651 sequence were identified as potentially contributing to antimicrobial resistance. Most notably, we identified three previously uncharacterized point mutations in penA, which codes for a class A β-lactamase and was previously implicated in resistance to β-lactam antibiotics. The mutations result in amino acid changes T147A, D240G, and V261I. When individually introduced into select agent-excluded B. pseudomallei strain Bp82, D240G was found to contribute to ceftazidime resistance and T147A contributed to amoxicillin-clavulanic acid and imipenem resistance. This study provides the first evidence that mutations in penA may alter susceptibility to carbapenems in B. pseudomallei. Another mutation of interest was a point mutation affecting the dihydrofolate reductase gene folA, which likely explains the trimethoprim resistance of this strain. Bp1651 was susceptible to aminoglycosides likely because of a frameshift in the amrB gene, the transporter subunit of the AmrAB-OprA efflux pump. These findings expand the role of penA to include resistance to carbapenems and may assist in the development of molecular diagnostics that predict antimicrobial resistance and provide guidance for treatment of melioidosis. PMID:28396541

Sequencing of GJB2 in Cameroonians and Black South Africans and comparison to 1000 Genomes Project Data Support Need to Revise Strategy for Discovery of Nonsyndromic Deafness Genes in Africans.

PubMed

Bosch, Jason; Noubiap, Jean Jacques N; Dandara, Collet; Makubalo, Nomlindo; Wright, Galen; Entfellner, Jean-Baka Domelevo; Tiffin, Nicki; Wonkam, Ambroise

2014-11-01

Mutations in the GJB2 gene, encoding connexin 26, could account for 50% of congenital, nonsyndromic, recessive deafness cases in some Caucasian/Asian populations. There is a scarcity of published data in sub-Saharan Africans. We Sanger sequenced the coding region of the GJB2 gene in 205 Cameroonian and Xhosa South Africans with congenital, nonsyndromic deafness; and performed bioinformatic analysis of variations in the GJB2 gene, incorporating data from the 1000 Genomes Project. Amongst Cameroonian patients, 26.1% were familial. The majority of patients (70%) suffered from sensorineural hearing loss. Ten GJB2 genetic variants were detected by sequencing. A previously reported pathogenic mutation, g.3741_3743delTTC (p.F142del), and a putative pathogenic mutation, g.3816G>A (p.V167M), were identified in single heterozygous samples. Amongst eight the remaining variants, two novel variants, g.3318-41G>A and g.3332G>A, were reported. There were no statistically significant differences in allele frequencies between cases and controls. Principal Components Analyses differentiated between Africans, Asians, and Europeans, but only explained 40% of the variation. The present study is the first to compare African GJB2 sequences with the data from the 1000 Genomes Project and have revealed the low variation between population groups. This finding has emphasized the hypothesis that the prevalence of mutations in GJB2 in nonsyndromic deafness amongst European and Asian populations is due to founder effects arising after these individuals migrated out of Africa, and not to a putative "protective" variant in the genomic structure of GJB2 in Africans. Our results confirm that mutations in GJB2 are not associated with nonsyndromic deafness in Africans.

Novel mutations in the connexin 32 gene associated with X-linked Charcot-Marie-Tooth disease

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tan, C.; Ainsworth, P.

1994-09-01

Charcot-Marie-Tooth disease is a pathologically and genetically hetergenous group of disorders that cause a progressive neuropathy, defined pathologically by degeneration of the myelin (CMT 1) of the axon (CMT 2) of the peripheral nerves. An X-linked type of the demyelinating form of this disorder (CMT X) has recently been linked to mutations in the connexin 32 (Cx32) gene, which codes for a 284 amino acid gap junction protein found in myelinated peripheral nerve. To date some 7 different mutations in this gene have been identified as being responsible for CMT X. The majority of these predict nonconservative amino acid substitutions,more » while one is a frameshift mutation which predicts a premature stop at codon 21. We report the results of molecular studies on three further local CMT X kindreds. The Cx32 gene was amplified by PCR in three overlapping fragments 300-450 bp in length using leukocyte-derived DNA as template. These were either sequenced directly using a deaza dGTP sequencing protocol, or were cloned and sequenced using a TA vector. In two of the kindreds the affected members carried a point mutation which was predicted to effect a non-conservative amino acid change within the first transmembrane domain. Both of these mutations caused a restriction site alteration (the loss of an Nla III and the creation of a Pvu II, respectively), and the former mutation was observed to segregate with the clinicial phenotype in affected family members. Affected members of the third kindred, which was a very large multigenerational family that had been extensively studied previously, were shown to carry a point mutation predicted to cause a premature truncation of the Cx32 gene product in the intracellular carboxy terminus. This mutation obliterated an Rsa I site which allowed a rapid screen of several other family members.« less

Non-coding cancer driver candidates identified with a sample- and position-specific model of the somatic mutation rate

PubMed Central

Juul, Malene; Bertl, Johanna; Guo, Qianyun; Nielsen, Morten Muhlig; Świtnicki, Michał; Hornshøj, Henrik; Madsen, Tobias; Hobolth, Asger; Pedersen, Jakob Skou

2017-01-01

Non-coding mutations may drive cancer development. Statistical detection of non-coding driver regions is challenged by a varying mutation rate and uncertainty of functional impact. Here, we develop a statistically founded non-coding driver-detection method, ncdDetect, which includes sample-specific mutational signatures, long-range mutation rate variation, and position-specific impact measures. Using ncdDetect, we screened non-coding regulatory regions of protein-coding genes across a pan-cancer set of whole-genomes (n = 505), which top-ranked known drivers and identified new candidates. For individual candidates, presence of non-coding mutations associates with altered expression or decreased patient survival across an independent pan-cancer sample set (n = 5454). This includes an antigen-presenting gene (CD1A), where 5’UTR mutations correlate significantly with decreased survival in melanoma. Additionally, mutations in a base-excision-repair gene (SMUG1) correlate with a C-to-T mutational-signature. Overall, we find that a rich model of mutational heterogeneity facilitates non-coding driver identification and integrative analysis points to candidates of potential clinical relevance. DOI: http://dx.doi.org/10.7554/eLife.21778.001 PMID:28362259

Clinical expression of C282Y homozygous HFE haemochromatosis at 14 years of age.

PubMed

Rossi, Enrico; Wallace, Daniel F; Subramaniam, V Nathan; St Pierre, Timothy G; Mews, Catherine; Jeffrey, Gary P

2006-05-01

A 14-year-old boy who presented with debilitating lethargy was shown to have an elevated serum ferritin of 572 microg/L and a C282Y homozygous HFE genotype. Liver iron concentration was measured non-invasively by magnetic resonance imaging, which revealed a liver iron concentration of 59 micromol/g dry weight (children's reference range < 14). The early phenotypic expression was further investigated by screening genomic DNA for the presence of co-inherited mutations in genes responsible for non-HFE haemochromatosis. Coding regions and splice sites in genes encoding hepcidin and haemojuvelin were sequenced and previously described mutations in ferroportin 1 and transferrin receptor 2 genes were screened. Although no mutations were found, the most likely cause for the early expression is the presence of novel mutations or gene(s).

Mutations in PIGY: expanding the phenotype of inherited glycosylphosphatidylinositol deficiencies

PubMed Central

Ilkovski, Biljana; Pagnamenta, Alistair T.; O'Grady, Gina L.; Kinoshita, Taroh; Howard, Malcolm F.; Lek, Monkol; Thomas, Brett; Turner, Anne; Christodoulou, John; Sillence, David; Knight, Samantha J.L.; Popitsch, Niko; Keays, David A.; Anzilotti, Consuelo; Goriely, Anne; Waddell, Leigh B.; Brilot, Fabienne; North, Kathryn N.; Kanzawa, Noriyuki; Macarthur, Daniel G.; Taylor, Jenny C.; Kini, Usha; Murakami, Yoshiko; Clarke, Nigel F.

2015-01-01

Glycosylphosphatidylinositol (GPI)-anchored proteins are ubiquitously expressed in the human body and are important for various functions at the cell surface. Mutations in many GPI biosynthesis genes have been described to date in patients with multi-system disease and together these constitute a subtype of congenital disorders of glycosylation. We used whole exome sequencing in two families to investigate the genetic basis of disease and used RNA and cellular studies to investigate the functional consequences of sequence variants in the PIGY gene. Two families with different phenotypes had homozygous recessive sequence variants in the GPI biosynthesis gene PIGY. Two sisters with c.137T>C (p.Leu46Pro) PIGY variants had multi-system disease including dysmorphism, seizures, severe developmental delay, cataracts and early death. There were significantly reduced levels of GPI-anchored proteins (CD55 and CD59) on the surface of patient-derived skin fibroblasts (∼20–50% compared with controls). In a second, consanguineous family, two siblings had moderate development delay and microcephaly. A homozygous PIGY promoter variant (c.-540G>A) was detected within a 7.7 Mb region of autozygosity. This variant was predicted to disrupt a SP1 consensus binding site and was shown to be associated with reduced gene expression. Mutations in PIGY can occur in coding and non-coding regions of the gene and cause variable phenotypes. This article contributes to understanding of the range of disease phenotypes and disease genes associated with deficiencies of the GPI-anchor biosynthesis pathway and also serves to highlight the potential importance of analysing variants detected in 5′-UTR regions despite their typically low coverage in exome data. PMID:26293662

A model of directional selection applied to the evolution of drug resistance in HIV-1.

PubMed

Seoighe, Cathal; Ketwaroo, Farahnaz; Pillay, Visva; Scheffler, Konrad; Wood, Natasha; Duffet, Rodger; Zvelebil, Marketa; Martinson, Neil; McIntyre, James; Morris, Lynn; Hide, Winston

2007-04-01

Understanding how pathogens acquire resistance to drugs is important for the design of treatment strategies, particularly for rapidly evolving viruses such as HIV-1. Drug treatment can exert strong selective pressures and sites within targeted genes that confer resistance frequently evolve far more rapidly than the neutral rate. Rapid evolution at sites that confer resistance to drugs can be used to help elucidate the mechanisms of evolution of drug resistance and to discover or corroborate novel resistance mutations. We have implemented standard maximum likelihood methods that are used to detect diversifying selection and adapted them for use with serially sampled reverse transcriptase (RT) coding sequences isolated from a group of 300 HIV-1 subtype C-infected women before and after single-dose nevirapine (sdNVP) to prevent mother-to-child transmission. We have also extended the standard models of codon evolution for application to the detection of directional selection. Through simulation, we show that the directional selection model can provide a substantial improvement in sensitivity over models of diversifying selection. Five of the sites within the RT gene that are known to harbor mutations that confer resistance to nevirapine (NVP) strongly supported the directional selection model. There was no evidence that other mutations that are known to confer NVP resistance were selected in this cohort. The directional selection model, applied to serially sampled sequences, also had more power than the diversifying selection model to detect selection resulting from factors other than drug resistance. Because inference of selection from serial samples is unlikely to be adversely affected by recombination, the methods we describe may have general applicability to the analysis of positive selection affecting recombining coding sequences when serially sampled data are available.

Mutations in PIGY: expanding the phenotype of inherited glycosylphosphatidylinositol deficiencies.

PubMed

Ilkovski, Biljana; Pagnamenta, Alistair T; O'Grady, Gina L; Kinoshita, Taroh; Howard, Malcolm F; Lek, Monkol; Thomas, Brett; Turner, Anne; Christodoulou, John; Sillence, David; Knight, Samantha J L; Popitsch, Niko; Keays, David A; Anzilotti, Consuelo; Goriely, Anne; Waddell, Leigh B; Brilot, Fabienne; North, Kathryn N; Kanzawa, Noriyuki; Macarthur, Daniel G; Taylor, Jenny C; Kini, Usha; Murakami, Yoshiko; Clarke, Nigel F

2015-11-01

Glycosylphosphatidylinositol (GPI)-anchored proteins are ubiquitously expressed in the human body and are important for various functions at the cell surface. Mutations in many GPI biosynthesis genes have been described to date in patients with multi-system disease and together these constitute a subtype of congenital disorders of glycosylation. We used whole exome sequencing in two families to investigate the genetic basis of disease and used RNA and cellular studies to investigate the functional consequences of sequence variants in the PIGY gene. Two families with different phenotypes had homozygous recessive sequence variants in the GPI biosynthesis gene PIGY. Two sisters with c.137T>C (p.Leu46Pro) PIGY variants had multi-system disease including dysmorphism, seizures, severe developmental delay, cataracts and early death. There were significantly reduced levels of GPI-anchored proteins (CD55 and CD59) on the surface of patient-derived skin fibroblasts (∼20-50% compared with controls). In a second, consanguineous family, two siblings had moderate development delay and microcephaly. A homozygous PIGY promoter variant (c.-540G>A) was detected within a 7.7 Mb region of autozygosity. This variant was predicted to disrupt a SP1 consensus binding site and was shown to be associated with reduced gene expression. Mutations in PIGY can occur in coding and non-coding regions of the gene and cause variable phenotypes. This article contributes to understanding of the range of disease phenotypes and disease genes associated with deficiencies of the GPI-anchor biosynthesis pathway and also serves to highlight the potential importance of analysing variants detected in 5'-UTR regions despite their typically low coverage in exome data. © The Author 2015. Published by Oxford University Press.

Mutations in the gene for X-linked adrenoleukodystrophy in patients with different clinical phenotypes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Braun, A.; Ambach, H.; Kammerer, S.

Recently, the gene for the most common peroxisomal disorder, X-linked adrenoleukodystrophy (X-ALD), has been described encoding a peroxisomal membrane transporter protein. We analyzed the entire protein-coding sequence of this gene by reverse-transcription PCR, SSCP, and DNA sequencing in five patients with different clinical expressions were cerebral childhood ALD, adrenomyecloneuropathy (AMN), and {open_quotes}Addison disease only{close_quotes} (AD) phenotype. In the three patients exhibiting the classical picture of severe childhood ALD we identified in the 5{prime} portion of the X-ALD gene a 38-bp deletion that causes a frameshift mutation, a 3-bp deletion leading to a deletion of an amino acid in the ATP-bindingmore » domain of the ALD protein, and a missense mutation. In the patient with the clinical phenotype of AMN, a nonsense mutation in codon 212, along with a second site mutation at codon 178, was observed. Analysis of the patient with the ADO phenotype revealed a further missense mutation at a highly conserved position in the ALDP/PMP70 comparison. The disruptive nature of two mutations (i.e., the frameshift and the nonsense mutation) in patients with biochemically proved childhood ALD and AMN further strongly supports the hypothesis that alterations in this gene play a crucial role in the pathogenesis of X-ALD. Since the current biochemical techniques for X-ALD carrier detection in affected families lack sufficient reliability, our procedure described for systematic mutation scanning is also capable of improving genetic counseling and prenatal diagnosis. 19 refs., 6 figs., 3 tabs.« less

Systematic screening for mutations in the human serotonin 1F receptor gene in patients with bipolar affective disorder and schizophrenia

DOE Office of Scientific and Technical Information (OSTI.GOV)

Shimron-Abarbanell, D.; Harms, H.; Erdmann, J.

1996-04-09

Using single strand conformational analysis we screened the complete coding sequence of the serotonin 1F (5-HT{sub 1F}) receptor gene for the presence of DNA sequence variation in a sample of 137 unrelated individuals including 45 schizophrenic patients, 46 bipolar patients, as well as 46 healthy controls. We detected only three rare sequence variants which are characterized by single base pair substitutions, namely a silent T{r_arrow}A transversion in the third position of codon 261 (encoding isoleucine), a silent C{r_arrow}T transition in the third position of codon 176 (encoding histidine), and a C{r_arrow}T transition in position -78 upstream from the start codon.more » The lack of significant mutations in patients suffering from schizophrenia and bipolar affective disorder indicates that the 5-HT{sub 1F} receptor is not commonly involved in the etiology of these diseases. 12 refs., 1 fig., 2 tabs.« less

A gene variation of 14-3-3 zeta isoform in rat hippocampus.

PubMed

Murakami, K; Situ, S Y; Eshete, F

1996-11-14

A variant form of 14-3-3 zeta was isolated from the rat hippocampal cDNA library. The cloned cDNA is 1687 bp in length and it contains an entire ORF (nt = 63-797) with 245 amino acids that is characteristic to 14-3-3 zeta subtype. By comparing with reported sequences of 14-3-3 zeta, we found three nucleotide substitutions within the coding sequence in our clone; C<-->T transition at nt = 325 and G<-->C transversions at nt = 387 and 388. Both are missense mutations, leading ACG (Thr) to ATG (Met) and CGT (Arg) to GCT (Ala) conversions at residue 88 and 109, respectively. Our results show that at least three different genetic variants of 14-3-3 zeta are present in rat species which results in protein variations. Such mutation in the amino acid sequence is an important indication of the diverse functions of this protein and may also contribute to the recent contradictory observations regarding the role of the 14-3-3 zeta subtype.

Simultaneous Detection of Both Single Nucleotide Variations and Copy Number Alterations by Next-Generation Sequencing in Gorlin Syndrome

PubMed Central

Morita, Kei-ichi; Naruto, Takuya; Tanimoto, Kousuke; Yasukawa, Chisato; Oikawa, Yu; Masuda, Kiyoshi; Imoto, Issei; Inazawa, Johji; Omura, Ken; Harada, Hiroyuki

2015-01-01

Gorlin syndrome (GS) is an autosomal dominant disorder that predisposes affected individuals to developmental defects and tumorigenesis, and caused mainly by heterozygous germline PTCH1 mutations. Despite exhaustive analysis, PTCH1 mutations are often unidentifiable in some patients; the failure to detect mutations is presumably because of mutations occurred in other causative genes or outside of analyzed regions of PTCH1, or copy number alterations (CNAs). In this study, we subjected a cohort of GS-affected individuals from six unrelated families to next-generation sequencing (NGS) analysis for the combined screening of causative alterations in Hedgehog signaling pathway-related genes. Specific single nucleotide variations (SNVs) of PTCH1 causing inferred amino acid changes were identified in four families (seven affected individuals), whereas CNAs within or around PTCH1 were found in two families in whom possible causative SNVs were not detected. Through a targeted resequencing of all coding exons, as well as simultaneous evaluation of copy number status using the alignment map files obtained via NGS, we found that GS phenotypes could be explained by PTCH1 mutations or deletions in all affected patients. Because it is advisable to evaluate CNAs of candidate causative genes in point mutation-negative cases, NGS methodology appears to be useful for improving molecular diagnosis through the simultaneous detection of both SNVs and CNAs in the targeted genes/regions. PMID:26544948

Simultaneous Detection of Both Single Nucleotide Variations and Copy Number Alterations by Next-Generation Sequencing in Gorlin Syndrome.

PubMed

Morita, Kei-ichi; Naruto, Takuya; Tanimoto, Kousuke; Yasukawa, Chisato; Oikawa, Yu; Masuda, Kiyoshi; Imoto, Issei; Inazawa, Johji; Omura, Ken; Harada, Hiroyuki

2015-01-01

Gorlin syndrome (GS) is an autosomal dominant disorder that predisposes affected individuals to developmental defects and tumorigenesis, and caused mainly by heterozygous germline PTCH1 mutations. Despite exhaustive analysis, PTCH1 mutations are often unidentifiable in some patients; the failure to detect mutations is presumably because of mutations occurred in other causative genes or outside of analyzed regions of PTCH1, or copy number alterations (CNAs). In this study, we subjected a cohort of GS-affected individuals from six unrelated families to next-generation sequencing (NGS) analysis for the combined screening of causative alterations in Hedgehog signaling pathway-related genes. Specific single nucleotide variations (SNVs) of PTCH1 causing inferred amino acid changes were identified in four families (seven affected individuals), whereas CNAs within or around PTCH1 were found in two families in whom possible causative SNVs were not detected. Through a targeted resequencing of all coding exons, as well as simultaneous evaluation of copy number status using the alignment map files obtained via NGS, we found that GS phenotypes could be explained by PTCH1 mutations or deletions in all affected patients. Because it is advisable to evaluate CNAs of candidate causative genes in point mutation-negative cases, NGS methodology appears to be useful for improving molecular diagnosis through the simultaneous detection of both SNVs and CNAs in the targeted genes/regions.

The genomic landscape of mantle cell lymphoma is related to the epigenetically determined chromatin state of normal B cells

PubMed Central

Zhang, Jenny; Jima, Dereje; Moffitt, Andrea B.; Liu, Qingquan; Czader, Magdalena; Hsi, Eric D.; Fedoriw, Yuri; Dunphy, Cherie H.; Richards, Kristy L.; Gill, Javed I.; Sun, Zhen; Love, Cassandra; Scotland, Paula; Lock, Eric; Levy, Shawn; Hsu, David S.; Dunson, David; Dave, Sandeep S.

2014-01-01

In this study, we define the genetic landscape of mantle cell lymphoma (MCL) through exome sequencing of 56 cases of MCL. We identified recurrent mutations in ATM, CCND1, MLL2, and TP53. We further identified a number of novel genes recurrently mutated in patients with MCL including RB1, WHSC1, POT1, and SMARCA4. We noted that MCLs have a distinct mutational profile compared with lymphomas from other B-cell stages. The ENCODE project has defined the chromatin structure of many cell types. However, a similar characterization of primary human mature B cells has been lacking. We defined, for the first time, the chromatin structure of primary human naïve, germinal center, and memory B cells through chromatin immunoprecipitation and sequencing for H3K4me1, H3K4me3, H3Ac, H3K36me3, H3K27me3, and PolII. We found that somatic mutations that occur more frequently in either MCLs or Burkitt lymphomas were associated with open chromatin in their respective B cells of origin, naïve B cells, and germinal center B cells. Our work thus elucidates the landscape of gene-coding mutations in MCL and the critical interplay between epigenetic alterations associated with B-cell differentiation and the acquisition of somatic mutations in cancer. PMID:24682267

Ultra-sensitive Sequencing Identifies High Prevalence of Clonal Hematopoiesis-Associated Mutations throughout Adult Life.

PubMed

Acuna-Hidalgo, Rocio; Sengul, Hilal; Steehouwer, Marloes; van de Vorst, Maartje; Vermeulen, Sita H; Kiemeney, Lambertus A L M; Veltman, Joris A; Gilissen, Christian; Hoischen, Alexander

2017-07-06

Clonal hematopoiesis results from somatic mutations in hematopoietic stem cells, which give an advantage to mutant cells, driving their clonal expansion and potentially leading to leukemia. The acquisition of clonal hematopoiesis-driver mutations (CHDMs) occurs with normal aging and these mutations have been detected in more than 10% of individuals ≥65 years. We aimed to examine the prevalence and characteristics of CHDMs throughout adult life. We developed a targeted re-sequencing assay combining high-throughput with ultra-high sensitivity based on single-molecule molecular inversion probes (smMIPs). Using smMIPs, we screened more than 100 loci for CHDMs in more than 2,000 blood DNA samples from population controls between 20 and 69 years of age. Loci screened included 40 regions known to drive clonal hematopoiesis when mutated and 64 novel candidate loci. We identified 224 somatic mutations throughout our cohort, of which 216 were coding mutations in known driver genes (DNMT3A, JAK2, GNAS, TET2, and ASXL1), including 196 point mutations and 20 indels. Our assay's improved sensitivity allowed us to detect mutations with variant allele frequencies as low as 0.001. CHDMs were identified in more than 20% of individuals 60 to 69 years of age and in 3% of individuals 20 to 29 years of age, approximately double the previously reported prevalence despite screening a limited set of loci. Our findings support the occurrence of clonal hematopoiesis-associated mutations as a widespread mechanism linked with aging, suggesting that mosaicism as a result of clonal evolution of cells harboring somatic mutations is a universal mechanism occurring at all ages in healthy humans. Copyright © 2017 American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.

Coding Sequence Mutations Identified in MYH7, TNNT2, SCN5A, CSRP3, LBD3, and TCAP from 313 Patients with Familial or Idiopathic Dilated Cardiomyopathy

PubMed Central

Hershberger, Ray E.; Parks, Sharie B.; Kushner, Jessica D.; Li, Duanxiang; Ludwigsen, Susan; Jakobs, Petra; Nauman, Deirdre; Burgess, Donna; Partain, Julie; Litt, Michael

2008-01-01

Abstract Background: More than 20 genes have been reported to cause idiopathic and familial dilated cardiomyopathy (IDC/FDC), but the frequency of genetic causation remains poorly understood. Methods and Results: Blood samples were collected and DNA prepared from 313 patients, 183 with FDC and 130 with IDC. Genomic DNA underwent bidirectional sequencing of six genes, and mutation carriers were followed up by evaluation of additional family members. We identified in 36 probands, 31 unique protein‐altering variants (11.5% overall) that were not identified in 253 control subjects (506 chromosomes). These included 13 probands (4.2%) with 12 β‐myosin heavy chain (MYH7) mutations, nine probands (2.9%) with six different cardiac troponin T (TNNT2) mutations, eight probands (2.6%) carrying seven different cardiac sodium channel (SCN5A) mutations, three probands (1.0%) with three titin‐cap or telethonin (TCAP) mutations, three probands (1.0%) with two LIM domain binding 3 (LDB3) mutations, and one proband (0.3%) with a muscle LIM protein (CSRP3) mutation. Four nucleotide changes did not segregate with phentoype and/or did not alter a conserved amino acid and were therefore considered unlikely to be disease‐causing. Mutations in 11 probands were assessed as likely disease‐causing, and in 21 probands were considered possibly disease‐causing. These 32 probands included 14 of the 130 with IDC (10.8%) and 18 of the 183 with FDC (9.8%) Conclusions: Mutations of these six genes each account for a small fraction of the genetic cause of FDC/IDC. The frequency of possible or likely disease‐causing mutations in these genes is similar for IDC and FDC. PMID:19412328

E2F1 somatic mutation within miRNA target site impairs gene regulation in colorectal cancer.

PubMed

Lopes-Ramos, Camila M; Barros, Bruna P; Koyama, Fernanda C; Carpinetti, Paola A; Pezuk, Julia; Doimo, Nayara T S; Habr-Gama, Angelita; Perez, Rodrigo O; Parmigiani, Raphael B

2017-01-01

Genetic studies have largely concentrated on the impact of somatic mutations found in coding regions, and have neglected mutations outside of these. However, 3' untranslated regions (3' UTR) mutations can also disrupt or create miRNA target sites, and trigger oncogene activation or tumor suppressor inactivation. We used next-generation sequencing to widely screen for genetic alterations within predicted miRNA target sites of oncogenes associated with colorectal cancer, and evaluated the functional impact of a new somatic mutation. Target sequencing of 47 genes was performed for 29 primary colorectal tumor samples. For 71 independent samples, Sanger methodology was used to screen for E2F1 mutations in miRNA predicted target sites, and the functional impact of these mutations was evaluated by luciferase reporter assays. We identified germline and somatic alterations in E2F1. Of the 100 samples evaluated, 3 had germline alterations at the MIR205-5p target site, while one had a somatic mutation at MIR136-5p target site. E2F1 gene expression was similar between normal and tumor tissues bearing the germline alteration; however, expression was increased 4-fold in tumor tissue that harbored a somatic mutation compared to that in normal tissue. Luciferase reporter assays revealed both germline and somatic alterations increased E2F1 activity relative to wild-type E2F1. We demonstrated that somatic mutation within E2F1:MIR136-5p target site impairs miRNA-mediated regulation and leads to increased gene activity. We conclude that somatic mutations that disrupt miRNA target sites have the potential to impact gene regulation, highlighting an important mechanism of oncogene activation.

Two novel de novo mutations of KRT6A and KRT16 genes in two Chinese pachyonychia congenita pedigrees with fissured tongue or diffuse plantar keratoderma.

PubMed

Du, Zhen-Fang; Xu, Chen-Ming; Zhao, Yan; Liu, Wen-Ting; Chen, Xiao-Ling; Chen, Chun-Yue; Fang, Hong; Ke, Hai-Ping; Zhang, Xian-Ning

2012-01-01

Mutations in the KRT6A or KRT16 gene cause pachyonychia congenita type 1 (PC-1), while mutations in KRT16 or KRT6C underlie focal palmoplantar keratoderma (FPPK). A new classification system of PC has been adopted based on the mutated gene. PC rarely presents the symptoms of diffuse plantar keratoderma. Mutation in the tail domain of keratins is rarely reported. PC combined with fissured tongue has never been described. To investigate the genotype-phenotype correlations between clinical features and gene mutational sites in two unrelated southern Chinese PC pedigrees (one family presented with specific fissured tongue, the other with diffuse plantar keratoderma). The whole coding regions of the KRT6A/KRT16/KRT17/KRT6B genes were amplified and directly sequenced to detect the mutation. To confirm the effect of the IVS8-2A>C mutation in KRT6A at the mRNA level, total RNA from the plantar lesion of a patient was extracted and reverse-transcribed to cDNA for sequence analysis. Two novel de novo mutations, a splice acceptor site variant IVS8-2A>C (p.S487FfsX72) in KRT6A and a heterozygous substitution c.AA373_374GG (p.N125G) within exon 1 of KRT16, were found separately in the two PC families. Genotype-phenotype correlations among PC patients with codon-125 mutation in KRT16 were established, while the phenotypes caused by the IVS8-2A>C mutation in KRT6A need further studies to confirm the rare feature of fissured tongue.

Further screening of the rhodopsin gene in patients with autosomal dominant retinitis pigmentosa

DOE Office of Scientific and Technical Information (OSTI.GOV)

Vaithinathan, R.; Berson, E.L.; Dryja, T.P.

Here the authors report 8 novel mutations and 8 previously reported mutations found from further analysis of the rhodopsin gene in a large set of additional patients with autosomal dominant retinitis pigmentosa. Leukocyte DNA was purified from 122 unrelated patients with autosomal dominant retinitis pigmentosa who were not included in previous analyses. The coding region and splice donor and acceptor sites of the rhodopsin gene were screened for mutations using single-strand conformation polymorphism analysis and direct genomic sequencing. They found 29 patients with varient bands that were due to mutations. Sequence analysis showed that 20 cases each had 1 ofmore » 9 previously published mutations: Pro23His, Thr58Arg, Gly89Asp, Pro171Leu, Glu181Lys, Pro347Leu, Phe45Leu, Arg135Trp, and Lys296Glu. In 9 other cases, they found 8 novel mutations. One was a 3-bp deletion (Cys264-del), and the rest were point mutations resulting in an altered amino acid: Gly51Arg (GGC [yields] CGC), Cys110Tyr (TCG [yields] TAC), Gly114Asp (GGC [yields] GAC), Ala164Glu (GCG [yields] GAG), Pro171Ser (CCA [yields] TCA), Val345Leu (GTG [yields] CTG), and Pro347Gln (CCG [yields] CAG). Each of these novel mutations was found in only one family except for Gly51Arg, which was found in two. In every family tested, the mutation cosegregated with the disease. However, in pedigree D865 only one affected member was available for analysis. About two-thirds of the mutations affect amino acids in transmembrane domains, yet only one-half of opsin's residues are in these regions. One-third of the mutations alter residues in the extracellular/intradiscal space, which includes only 25% of the protein.« less

Identification of a novel nonsense mutation and a missense substitution in the AGPAT2 gene causing congenital generalized lipodystrophy type 1

PubMed Central

Haghighi, Amirreza; Razzaghy-Azar, Maryam; Talea, Ali; Sadeghian, Mahnaz; Ellard, Sian; Haghighi, Alireza

2012-01-01

Congenital generalized lipodystrophy (CGL) is an autosomal recessive disease characterized by the generalized scant of adipose tissue. CGL type 1 is caused by mutations in gene encoding 1-acylglycerol-3-phosphate O-acyltransferase-2 (AGPAT2). A clinical and molecular genetic investigation was performed in affected and unaffected members of two families with CGL type 1. The AGPAT2 coding region was sequenced in index cases of the two families. The presence of the identified mutations in relevant parents was tested. We identified a novel nonsense mutation (c.685G>T, p.Glu229*) and a missense substitution (c.514G>A, p.Glu172Lys). The unaffected parents in both families were heterozygous carrier of the relevant mutation. The results expand genotype–phenotype spectrum in CGL1 and will have applications in prenatal and early diagnosis of the disease. This is the first report of Persian families identified with AGPAT2 mutations. PMID:22902344

Hereditary sensory and autonomic neuropathy type I in a Chinese family: British C133W mutation exists in the Chinese.

PubMed

Bi, Hongyan; Gao, Yunying; Yao, Sheng; Dong, Mingrui; Headley, Alexander Peter; Yuan, Yun

2007-10-01

Hereditary sensory and autonomic neuropathy type I (HSAN I) is an autosomal dominant disorder of the peripheral nervous system characterized by marked progressive sensory loss, with variable autonomic and motor involvement. The HSAN I locus maps to chromosome 9q22.1-22.3 and is caused by mutations in the gene coding for serine palmitoyltransferase long chain base subunit 1 (SPTLC1). Sequencing in HSAN I families have previously identified mutations in exons 5, 6 and 13 of this gene. Here we report the clinical, electrophysiological and pathological findings of a proband in a Chinese family with HSAN I. The affected members showed almost typical clinical features. Electrophysiological findings showed an axonal, predominantly sensory, neuropathy with motor and autonomic involvement. Sural nerve biopsy showed loss of myelinated and unmyelinated fibers. SPTLC1 mutational analysis revealed the C133W mutation, a mutation common in British HSAN I families.

Novel mutations of the carbohydrate sulfotransferase-6 (CHST6) gene causing macular corneal dystrophy in India.

PubMed

Sultana, Afia; Sridhar, Mittanamalli S; Jagannathan, Aparna; Balasubramanian, Dorairajan; Kannabiran, Chitra; Klintworth, Gordon K

2003-12-22

Macular corneal dystrophy (MCD) is an autosomal recessive disorder characterized by progressive central haze, confluent punctate opacities and abnormal deposits in the cornea. It is caused by mutations in the carbohydrate sulfotransferase-6 (CHST6) gene, encoding corneal N-acetyl glucosamine-6-O-sulfotransferase (C-GlcNAc-6-ST). We screened the CHST6 gene for mutations in Indian families with MCD, in order to determine the range of pathogenic mutations. Genomic DNA was isolated from peripheral blood leukocytes of patients with MCD and normal controls. The coding regions of the CHST6 gene were amplified using three pairs of primers and amplified products were directly sequenced. We identified 22 (5 nonsense, 5 frameshift, 2 insertion, and 10 missense) mutations in 36 patients from 31 families with MCD, supporting the conclusion that loss of function of this gene is responsible for this corneal disease. Seventeen of these mutations are novel. These data highlight the allelic heterogeneity of macular corneal dystrophy in Indian patients.

Haplotype combination of the bovine INSIG1 gene sequence variants and association with growth traits in Nanyang cattle.

PubMed

Sun, Jiajie; Gao, Yuan; Liu, Dong; Ma, Wei; Xue, Jing; Zhang, Chunlei; Lan, Xianyong; Lei, Chuzhao; Chen, Hong

2012-06-01

The insulin-induced gene 1 (INSIG1) gene encodes a protein that blocks proteolytic activation of sterol regulatory element binding proteins, which are transcription factors that activate genes that regulate cholesterol, fatty acid, and glucose metabolism. However, similar research for the bovine INSIG1 gene is lacking. Therefore, in this study, polymorphisms of the bovine INSIG1 gene were detected in 643 individuals from four cattle breeds by DNA pooling, forced PCR-RFLP, PCR-SSCP, and DNA sequencing methods. Only 10 novel SNPs were identified, which included four mutations in the coding region and the others in the introns. In Nanyang individuals, seven common haplotypes were identified based on four coding region SNPs. The haplotype GACT, with a frequency of 75.4%, was the most prevalent haplotypes and SNPs formed two linkage disequilibrium blocks with strong multi-allelic D' (D' = 1). Additionally, association analysis between mutations of the bovine INSIG1 gene and growth traits in Nanyang cattle at 6, 12, 18, and 24 months old was performed, and the results indicated that the polymorphisms were not significantly associated with body mass.

Core signaling pathways in human pancreatic cancers revealed by global genomic analyses.

PubMed

Jones, Siân; Zhang, Xiaosong; Parsons, D Williams; Lin, Jimmy Cheng-Ho; Leary, Rebecca J; Angenendt, Philipp; Mankoo, Parminder; Carter, Hannah; Kamiyama, Hirohiko; Jimeno, Antonio; Hong, Seung-Mo; Fu, Baojin; Lin, Ming-Tseh; Calhoun, Eric S; Kamiyama, Mihoko; Walter, Kimberly; Nikolskaya, Tatiana; Nikolsky, Yuri; Hartigan, James; Smith, Douglas R; Hidalgo, Manuel; Leach, Steven D; Klein, Alison P; Jaffee, Elizabeth M; Goggins, Michael; Maitra, Anirban; Iacobuzio-Donahue, Christine; Eshleman, James R; Kern, Scott E; Hruban, Ralph H; Karchin, Rachel; Papadopoulos, Nickolas; Parmigiani, Giovanni; Vogelstein, Bert; Velculescu, Victor E; Kinzler, Kenneth W

2008-09-26

There are currently few therapeutic options for patients with pancreatic cancer, and new insights into the pathogenesis of this lethal disease are urgently needed. Toward this end, we performed a comprehensive genetic analysis of 24 pancreatic cancers. We first determined the sequences of 23,219 transcripts, representing 20,661 protein-coding genes, in these samples. Then, we searched for homozygous deletions and amplifications in the tumor DNA by using microarrays containing probes for approximately 10(6) single-nucleotide polymorphisms. We found that pancreatic cancers contain an average of 63 genetic alterations, the majority of which are point mutations. These alterations defined a core set of 12 cellular signaling pathways and processes that were each genetically altered in 67 to 100% of the tumors. Analysis of these tumors' transcriptomes with next-generation sequencing-by-synthesis technologies provided independent evidence for the importance of these pathways and processes. Our data indicate that genetically altered core pathways and regulatory processes only become evident once the coding regions of the genome are analyzed in depth. Dysregulation of these core pathways and processes through mutation can explain the major features of pancreatic tumorigenesis.

Phylogenetic analysis of the complete genome of 11 BKV isolates obtained from allogenic stem cell transplant recipients in Ireland.

PubMed

Drew, Richard John; Walsh, Anne; Laoi, Bairbre Ni; Crowley, Brendan

2012-07-01

BK polyomavirus (family Polyomaviridae) may cause hemorrhagic cystitis (BKV-HC) in hematopoietic stem cell transplant recipients. Eleven complete BKV genomes (GenBank accession numbers: JN192431-JN192441) were sequenced from urine samples of allogenic hematopoietic stem cell transplant recipients and compared to complete BKV genomes in the published literature. Of the 11 isolates, seven (64%) were subgroup Ib-1, three (27%) isolates belonged to subgroup Ib-2 and a single isolate belonged to subtype III. The analysis of single-nucleotide polymorphisms in this study showed that isolates could be subclassified into subtypes I-IV and subgroups Ib-1 and Ib-2 on the basis of VP1 of the first part of the Large T-antigen (LTag). The non-coding control region (NCCR) of the 11 isolates was also sequenced. These sequences showed that there was consistent sequence homology within subgroups Ib-1 and Ib-2. Two new mutations were described in the isolates, G→C at O(84) in isolate SJH-LG-310, and a deletion at R(2-7) in isolate SJH-LG-309. No known transcription factor is thought to be present at the site of either of these mutations. There were no rearrangements seen in isolates and this may be because the patients were not followed up over time. There were five nucleotide positions at which subgroup Ib-1 isolated differed from subgroup Ib-2 isolates in the NCCR sequence, O(41) , P(18) , P(31) , R(4) , and S(18) . The mutation O(41) is present in the promoter granulocyte/macrophage stimulating factor) gene and the P(31) mutation is present in the NF-1 gene. Copyright © 2012 Wiley Periodicals, Inc.

Sequence analysis of the Ras-MAPK pathway genes SOS1, EGFR & GRB2 in silver foxes (Vulpes vulpes): candidate genes for hereditary hyperplastic gingivitis.

PubMed

Clark, Jo-Anna B J; Tully, Sara J; Dawn Marshall, H

2014-12-01

Hereditary hyperplastic gingivitis (HHG) is an autosomal recessive disease that presents with progressive gingival proliferation in farmed silver foxes. Hereditary gingival fibromatosis (HGF) is an analogous condition in humans that is genetically heterogeneous with several known autosomal dominant loci. For one locus the causative mutation is in the Son of sevenless homologue 1 (SOS1) gene. For the remaining loci, the molecular mechanisms are unknown but Ras pathway involvement is suspected. Here we compare sequences for the SOS1 gene, and two adjacent genes in the Ras pathway, growth receptor bound protein 2 (GRB2) and epidermal growth factor receptor (EGFR), between HHG-affected and unaffected foxes. We conclude that the known HGF causative mutation does not cause HHG in foxes, nor do the coding regions or intron-exon boundaries of these three genes contain any candidate mutations for fox gum disease. Patterns of molecular evolution among foxes and other mammals reflect high conservation and strong functional constraints for SOS1 and GRB2 but reveal a lineage-specific pattern of variability in EGFR consistent with mutational rate differences, relaxed functional constraints, and possibly positive selection.

Molecular analysis of abnormal hemoglobins in beta chain in Aegean region of Turkey and first reports of hemoglobin Andrew-Minneapolis and Hb Hinsdale from Turkey.

PubMed

Aykut, Ayça; Onay, Hüseyin; Durmaz, Asude; Karaca, Emin; Vergin, Canan; Aydınok, Yeşim; Özkınay, Ferda

2015-07-01

The Agean is one of the regions in Turkey where thalassemias and abnormal hemoglobins (Hbs) are prevalent. Combined heterozygosity of thalassemia mutations with a variety of structural Hb variants lead to an extremely wide spectrum of clinical and hematological phenotypes which is of importance for prenatal diagnosis. One hundred and seventeen patients and carriers diagnosed by hemoglobin electrophoresis (HPLC), at risk for abnormal hemoglobinopathies were screened for mutational analysis of the beta-globin gene. The full coding the 5' UTR, and the 3' UTR sequences of beta-globin gene (GenBank accession no. U01317) were amplified and sequenced. In this study, a total of 118 (12.24%) structural Hb variant alleles were identified in 1341 mutated beta-chain alleles in Medical Genetics Department of Ege University between January 2006 and November 2013. Here, we report the mutation spectrum of abnormal Hbs associated with the beta-globin gene in Aegean region of Turkey. In the present study, the Hb Hinsdale and Hb Andrew-Minneapolis variants are demonstrated for the first time in the Turkish population.

Rapid screening for nuclear genes mutations in isolated respiratory chain complex I defects.

PubMed

Pagniez-Mammeri, Hélène; Lombes, Anne; Brivet, Michèle; Ogier-de Baulny, Hélène; Landrieu, Pierre; Legrand, Alain; Slama, Abdelhamid

2009-04-01

Complex I or reduced nicotinamide adenine dinucleotide (NADH): ubiquinone oxydoreductase deficiency is the most common cause of respiratory chain defects. Molecular bases of complex I deficiencies are rarely identified because of the dual genetic origin of this multi-enzymatic complex (nuclear DNA and mitochondrial DNA) and the lack of phenotype-genotype correlation. We used a rapid method to screen patients with isolated complex I deficiencies for nuclear genes mutations by Surveyor nuclease digestion of cDNAs. Eight complex I nuclear genes, among the most frequently mutated (NDUFS1, NDUFS2, NDUFS3, NDUFS4, NDUFS7, NDUFS8, NDUFV1 and NDUFV2), were studied in 22 cDNA fragments spanning their coding sequences in 8 patients with a biochemically proved complex I deficiency. Single nucleotide polymorphisms and missense mutations were detected in 18.7% of the cDNA fragments by Surveyor nuclease treatment. Molecular defects were detected in 3 patients. Surveyor nuclease screening is a reliable method for genotyping nuclear complex I deficiencies, easy to interpret, and limits the number of sequence reactions. Its use will enhance the possibility of prenatal diagnosis and help us for a better understanding of complex I molecular defects.

De novo mutations in genes of mediator complex causing syndromic intellectual disability: mediatorpathy or transcriptomopathy?

PubMed

Caro-Llopis, Alfonso; Rosello, Monica; Orellana, Carmen; Oltra, Silvestre; Monfort, Sandra; Mayo, Sonia; Martinez, Francisco

2016-12-01

Mutations in the X-linked gene MED12 cause at least three different, but closely related, entities of syndromic intellectual disability. Recently, a new syndrome caused by MED13L deleterious variants has been described, which shows similar clinical manifestations including intellectual disability, hypotonia, and other congenital anomalies. Genotyping of 1,256 genes related with neurodevelopment was performed by next-generation sequencing in three unrelated patients and their healthy parents. Clinically relevant findings were confirmed by conventional sequencing. Each patient showed one de novo variant not previously reported in the literature or databases. Two different missense variants were found in the MED12 or MED13L genes and one nonsense mutation was found in the MED13L gene. The phenotypic consequences of these mutations are closely related and/or have been previously reported in one or other gene. Additionally, MED12 and MED13L code for two closely related partners of the mediator kinase module. Consequently, we propose the concept of a common MED12/MED13L clinical spectrum, encompassing Opitz-Kaveggia syndrome, Lujan-Fryns syndrome, Ohdo syndrome, MED13L haploinsufficiency syndrome, and others.

Clinical and genetic investigation of families with type II Waardenburg syndrome

PubMed Central

CHEN, YONG; YANG, FUWEI; ZHENG, HEXIN; ZHOU, JIANDA; ZHU, GANGHUA; HU, PENG; WU, WEIJING

2016-01-01

The present study aimed to investigate the molecular pathology of Waardenburg syndrome type II in three families, in order to provide genetic diagnosis and hereditary counseling for family members. Relevant clinical examinations were conducted on the probands of the three pedigrees. Peripheral blood samples of the probands and related family members were collected and genomic DNA was extracted. The coding sequences of paired box 3 (PAX3), microphthalmia-associated transcription factor (MITF), sex-determining region Y-box 10 (SOX10) and snail family zinc finger 2 (SNAI2) were analyzed by polymerase chain reaction and DNA sequencing. The heterozygous mutation, c.649_651delAGA in exon 7 of the MITF gene was detected in the proband and all patients of pedigree 1; however, no pathological mutation of the relevant genes (MITF, SNAI2, SOX10 or PAX3) was detected in pedigrees 2 and 3. The heterozygous mutation c.649_651delAGA in exon 7 of the MITF gene is therefore considered the disease-causing mutation in pedigree 1. However, there are novel disease-causing genes in Waardenburg syndrome type II, which require further research. PMID:26781036

Molecular Analysis of Glucose-6-Phosphate Dehydrogenase Gene Mutations in Bangladeshi Individuals.

PubMed

Sarker, Suprovath Kumar; Islam, Md Tarikul; Eckhoff, Grace; Hossain, Mohammad Amir; Qadri, Syeda Kashfi; Muraduzzaman, A K M; Bhuyan, Golam Sarower; Shahidullah, Mohammod; Mannan, Mohammad Abdul; Tahura, Sarabon; Hussain, Manzoor; Akhter, Shahida; Nahar, Nazmun; Shirin, Tahmina; Qadri, Firdausi; Mannoor, Kaiissar

2016-01-01

Glucose-6-phosphate dehydrogenase (G6PD) deficiency is a common X-linked human enzyme defect of red blood cells (RBCs). Individuals with this gene defect appear normal until exposed to oxidative stress which induces hemolysis. Consumption of certain foods such as fava beans, legumes; infection with bacteria or virus; and use of certain drugs such as primaquine, sulfa drugs etc. may result in lysis of RBCs in G6PD deficient individuals. The genetic defect that causes G6PD deficiency has been identified mostly as single base missense mutations. One hundred and sixty G6PD gene mutations, which lead to amino acid substitutions, have been described worldwide. The purpose of this study was to detect G6PD gene mutations in hospital-based settings in the local population of Dhaka city, Bangladesh. Qualitative fluorescent spot test and quantitative enzyme activity measurement using RANDOX G6PDH kit were performed for analysis of blood specimens and detection of G6PD-deficient participants. For G6PD-deficient samples, PCR was done with six sets of primers specific for G6PD gene. Automated Sanger sequencing of the PCR products was performed to identify the mutations in the gene. Based on fluorescence spot test and quantitative enzyme assay followed by G6PD gene sequencing, 12 specimens (11 males and one female) among 121 clinically suspected patient-specimens were found to be deficient, suggesting a frequency of 9.9% G6PD deficiency. Sequencing of the G6PD-deficient samples revealed c.C131G substitution (exon-3: Ala44Gly) in six samples, c.G487A substitution (exon-6:Gly163Ser) in five samples and c.G949A substitution (exon-9: Glu317Lys) of coding sequence in one sample. These mutations either affect NADP binding or disrupt protein structure. From the study it appears that Ala44Gly and Gly163Ser are the most common G6PD mutations in Dhaka, Bangladesh. This is the first study of G6PD mutations in Bangladesh.

Molecular Analysis of Glucose-6-Phosphate Dehydrogenase Gene Mutations in Bangladeshi Individuals

PubMed Central

Sarker, Suprovath Kumar; Hossain, Mohammad Amir; Qadri, Syeda Kashfi; Muraduzzaman, A. K. M.; Bhuyan, Golam Sarower; Shahidullah, Mohammod; Mannan, Mohammad Abdul; Tahura, Sarabon; Hussain, Manzoor; Akhter, Shahida; Nahar, Nazmun; Shirin, Tahmina; Qadri, Firdausi; Mannoor, Kaiissar

2016-01-01

Glucose-6-phosphate dehydrogenase (G6PD) deficiency is a common X-linked human enzyme defect of red blood cells (RBCs). Individuals with this gene defect appear normal until exposed to oxidative stress which induces hemolysis. Consumption of certain foods such as fava beans, legumes; infection with bacteria or virus; and use of certain drugs such as primaquine, sulfa drugs etc. may result in lysis of RBCs in G6PD deficient individuals. The genetic defect that causes G6PD deficiency has been identified mostly as single base missense mutations. One hundred and sixty G6PD gene mutations, which lead to amino acid substitutions, have been described worldwide. The purpose of this study was to detect G6PD gene mutations in hospital-based settings in the local population of Dhaka city, Bangladesh. Qualitative fluorescent spot test and quantitative enzyme activity measurement using RANDOX G6PDH kit were performed for analysis of blood specimens and detection of G6PD-deficient participants. For G6PD-deficient samples, PCR was done with six sets of primers specific for G6PD gene. Automated Sanger sequencing of the PCR products was performed to identify the mutations in the gene. Based on fluorescence spot test and quantitative enzyme assay followed by G6PD gene sequencing, 12 specimens (11 males and one female) among 121 clinically suspected patient-specimens were found to be deficient, suggesting a frequency of 9.9% G6PD deficiency. Sequencing of the G6PD-deficient samples revealed c.C131G substitution (exon-3: Ala44Gly) in six samples, c.G487A substitution (exon-6:Gly163Ser) in five samples and c.G949A substitution (exon-9: Glu317Lys) of coding sequence in one sample. These mutations either affect NADP binding or disrupt protein structure. From the study it appears that Ala44Gly and Gly163Ser are the most common G6PD mutations in Dhaka, Bangladesh. This is the first study of G6PD mutations in Bangladesh. PMID:27880809

Mutation in cpsf6/CFIm68 (Cleavage and Polyadenylation Specificity Factor Subunit 6) causes short 3'UTRs and disturbs gene expression in developing embryos, as revealed by an analysis of primordial germ cell migration using the medaka mutant naruto.

PubMed

Sasado, Takao; Kondoh, Hisato; Furutani-Seiki, Makoto; Naruse, Kiyoshi

2017-01-01

Our previous studies analyzing medaka mutants defective in primordial germ cell (PGC) migration identified cxcr4b and cxcr7, which are both receptors of the chemokine sdf1/cxcl12, as key regulators of PGC migration. Among PGC migration mutants, naruto (nar) is unique in that the mutant phenotype includes gross morphological abnormalities of embryos, suggesting that the mutation affects a broader range of processes. A fine genetic linkage mapping and genome sequencing showed the nar gene encodes Cleavage and Polyadenylation Specificity Factor subunit 6 (CPSF6/CFIm68). CPSF6 is a component of the Cleavage Factor Im complex (CFIm) which plays a key role in pre-mRNA 3'-cleavage and polyadenylation. 3'RACE of sdf1a/b and cxcr7 transcripts in the mutant embryos indicated shorter 3'UTRs with poly A additions occurring at more upstream positions than wild-type embryos, suggesting CPSF6 functions to prevent premature 3'UTR cleavage. In addition, expression of the coding region sequences of sdf1a/b in nar mutants was more anteriorly extended in somites than wild-type embryos, accounting for the abnormally extended distribution of PGCs in nar mutants. An expected consequence of shortening 3'UTR is the escape from the degradation mechanism mediated by microRNAs interacting with distal 3'UTR sequence. The abnormal expression pattern of sdf1a coding sequence may be at least partially accounted for by this mechanism. Given the pleiotropic effects of nar mutation, further analysis using the nar mutant will reveal processes in which CPSF6 plays essential regulatory roles in poly A site selection and involvement of 3'UTRs in posttranscriptional gene regulation in various genes in vivo.

Mutation in cpsf6/CFIm68 (Cleavage and Polyadenylation Specificity Factor Subunit 6) causes short 3'UTRs and disturbs gene expression in developing embryos, as revealed by an analysis of primordial germ cell migration using the medaka mutant naruto

PubMed Central

Kondoh, Hisato; Furutani-Seiki, Makoto; Naruse, Kiyoshi

2017-01-01

Our previous studies analyzing medaka mutants defective in primordial germ cell (PGC) migration identified cxcr4b and cxcr7, which are both receptors of the chemokine sdf1/cxcl12, as key regulators of PGC migration. Among PGC migration mutants, naruto (nar) is unique in that the mutant phenotype includes gross morphological abnormalities of embryos, suggesting that the mutation affects a broader range of processes. A fine genetic linkage mapping and genome sequencing showed the nar gene encodes Cleavage and Polyadenylation Specificity Factor subunit 6 (CPSF6/CFIm68). CPSF6 is a component of the Cleavage Factor Im complex (CFIm) which plays a key role in pre-mRNA 3'-cleavage and polyadenylation. 3'RACE of sdf1a/b and cxcr7 transcripts in the mutant embryos indicated shorter 3’UTRs with poly A additions occurring at more upstream positions than wild-type embryos, suggesting CPSF6 functions to prevent premature 3’UTR cleavage. In addition, expression of the coding region sequences of sdf1a/b in nar mutants was more anteriorly extended in somites than wild-type embryos, accounting for the abnormally extended distribution of PGCs in nar mutants. An expected consequence of shortening 3'UTR is the escape from the degradation mechanism mediated by microRNAs interacting with distal 3’UTR sequence. The abnormal expression pattern of sdf1a coding sequence may be at least partially accounted for by this mechanism. Given the pleiotropic effects of nar mutation, further analysis using the nar mutant will reveal processes in which CPSF6 plays essential regulatory roles in poly A site selection and involvement of 3'UTRs in posttranscriptional gene regulation in various genes in vivo. PMID:28253363

Computational Tools and Algorithms for Designing Customized Synthetic Genes

PubMed Central

Gould, Nathan; Hendy, Oliver; Papamichail, Dimitris

2014-01-01

Advances in DNA synthesis have enabled the construction of artificial genes, gene circuits, and genomes of bacterial scale. Freedom in de novo design of synthetic constructs provides significant power in studying the impact of mutations in sequence features, and verifying hypotheses on the functional information that is encoded in nucleic and amino acids. To aid this goal, a large number of software tools of variable sophistication have been implemented, enabling the design of synthetic genes for sequence optimization based on rationally defined properties. The first generation of tools dealt predominantly with singular objectives such as codon usage optimization and unique restriction site incorporation. Recent years have seen the emergence of sequence design tools that aim to evolve sequences toward combinations of objectives. The design of optimal protein-coding sequences adhering to multiple objectives is computationally hard, and most tools rely on heuristics to sample the vast sequence design space. In this review, we study some of the algorithmic issues behind gene optimization and the approaches that different tools have adopted to redesign genes and optimize desired coding features. We utilize test cases to demonstrate the efficiency of each approach, as well as identify their strengths and limitations. PMID:25340050

Mutational Analysis of the Rhodopsin Gene in Sector Retinitis Pigmentosa.

PubMed

Napier, Maria L; Durga, Dash; Wolsley, Clive J; Chamney, Sarah; Alexander, Sharon; Brennan, Rosie; Simpson, David A; Silvestri, Giuliana; Willoughby, Colin E

2015-01-01

To determine the role of rhodopsin (RHO) gene mutations in patients with sector retinitis pigmentosa (RP) from Northern Ireland. A case series of sector RP in a tertiary ocular genetics clinic. Four patients with sector RP were recruited from the Royal Victoria Hospital (Belfast, Northern Ireland) and Altnagelvin Hospital (Londonderry, Northern Ireland) following informed consent. The diagnosis of sector RP was based on clinical examination, International Society for Clinical Electrophysiology of Vision (ISCEV) standard electrophysiology, and visual field analysis. DNA was extracted from peripheral blood leucocytes and the coding regions and adjacent flanking intronic sequences of the RHO gene were polymerase chain reaction (PCR) amplified and cycle sequenced. Rhodopsin mutational status. A heterozygous missense mutation in RHO (c.173C > T) resulting in a non-conservative substitution of threonine to methionine (p. Thr58Met) was identified in one patient and was absent from 360 control individuals. This non-conservative substitution (p.Thr58Met) replaces a highly evolutionary conserved polar hydrophilic threonine residue with a non-polar hydrophobic methionine residue at position 58 near the cytoplasmic border of helix A of RHO. The study identified a RHO gene mutation (p.Thr58Met) not previously reported in RP in a patient with sector RP. These findings outline the phenotypic variability associated with RHO mutations. It has been proposed that the regional effects of RHO mutations are likely to result from interplay between mutant alleles and other genetic, epigenetic and environmental factors.

ATM function and its relationship with ATM gene mutations in chronic lymphocytic leukemia with the recurrent deletion (11q22.3-23.2).

PubMed

Jiang, Y; Chen, H-C; Su, X; Thompson, P A; Liu, X; Do, K-A; Wierda, W; Keating, M J; Plunkett, W

2016-09-02

Approximately 10-20% of chronic lymphocytic leukemia (CLL) patients exhibit del(11q22-23) before treatment, this cohort increases to over 40% upon progression following chemoimmunotherapy. The coding sequence of the DNA damage response gene, ataxia-telangiectasia-mutated (ATM), is contained in this deletion. The residual ATM allele is frequently mutated, suggesting a relationship between gene function and clinical response. To investigate this possibility, we sought to develop and validate an assay for the function of ATM protein in these patients. SMC1 (structural maintenance of chromosomes 1) and KAP1 (KRAB-associated protein 1) were found to be unique substrates of ATM kinase by immunoblot detection following ionizing radiation. Using a pool of eight fluorescence in situ hybridization-negative CLL samples as a standard, the phosphorylation of SMC1 and KAP1 from 46 del (11q22-23) samples was analyzed using normal mixture model-based clustering. This identified 13 samples (28%) that were deficient in ATM function. Targeted sequencing of the ATM gene of these samples, with reference to genomic DNA, revealed 12 somatic mutations and 15 germline mutations in these samples. No strong correlation was observed between ATM mutation and function. Therefore, mutation status may not be taken as an indicator of ATM function. Rather, a direct assay of the kinase activity should be used in the development of therapies.

Waardenburg syndrome type II in a Chinese patient caused by a novel nonsense mutation in the SOX10 gene.

PubMed

Ma, Jing; Zhang, Tie-Song; Lin, Ken; Sun, Hao; Jiang, Hong-Chao; Yang, Yan-Li; Low, Fan; Gao, Ying-Qin; Ruan, Biao

2016-06-01

Waardenburg syndrome is a congenital genetic disorder. It is the most common type of syndromic hearing impairment with highly genetic heterogeneity and proved to be related by 6 genes as follows: PAX3, MITF, SNAI2, EDN3, EDNRB and SOX10. This article aims to identify the genetic causes of a Chinese WS child patient. A Chinese WS child was collected for clinical data collection by questionnaire survey. DNA samples of proband and his parents were extracted from peripheral blood samples. Six candidate genes were sequenced by the Trusight One sequencing panel on the illumina NextSeq 500 platform. A novel nonsense heterozygous mutation was found in the coding region of exon 2 in the SOX10 gene of proband. The novel nonsense heterozygous mutation could cause the replacement of the 55th lysine codon by stop codon (484T > C, C142R) and further more possibly cause terminating the protein translation in advance. However, both proband's parents had no mutation of genes above mentioned. The gene mutation of SOX10 [NM_006941.3 c.163A > T] is a novel nonsense mutation. No record of this mutation has been found in dbSNP, HGMD, 1000 Genomes Project, ClinVar and ESP6500 databases. It meets the condition of PS2 of strong evidence in 2015 ACMG Standards and Guidelines. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

Ovine mitochondrial DNA sequence variation and its association with production and reproduction traits within an Afec-Assaf flock.

PubMed

Reicher, S; Seroussi, E; Weller, J I; Rosov, A; Gootwine, E

2012-07-01

Polymorphisms in mitochondrial DNA (mtDNA) protein- and tRNA-coding genes were shown to be associated with various diseases in humans as well as with production and reproduction traits in livestock. Alignment of full length mitochondria sequences from the 5 known ovine haplogroups: HA (n = 3), HB (n = 5), HC (n = 3), HD (n = 2), and HE (n = 2; GenBank accession nos. HE577847-50 and 11 published complete ovine mitochondria sequences) revealed sequence variation in 10 out of the 13 protein coding mtDNA sequences. Twenty-six of the 245 variable sites found in the protein coding sequences represent non-synonymous mutations. Sequence variation was observed also in 8 out of the 22 tRNA mtDNA sequences. On the basis of the mtDNA control region and cytochrome b partial sequences along with information on maternal lineages within an Afec-Assaf flock, 1,126 Afec-Assaf ewes were assigned to mitochondrial haplogroups HA, HB, and HC, with frequencies of 0.43, 0.43, and 0.14, respectively. Analysis of birth weight and growth rate records of lamb (n = 1286) and productivity from 4,993 lambing records revealed no association between mitochondrial haplogroup affiliation and female longevity, lambs perinatal survival rate, birth weight, and daily growth rate of lambs up to 150 d that averaged 1,664 d, 88.3%, 4.5 kg, and 320 g/d, respectively. However, significant (P < 0.0001) differences among the haplogroups were found for prolificacy of ewes, with prolificacies (mean ± SE) of 2.14 ± 0.04, 2.25 ± 0.04, and 2.30 ± 0.06 lamb born/ewe lambing for the HA, HB, and the HC haplogroups, respectively. Our results highlight the ovine mitogenome genetic variation in protein- and tRNA coding genes and suggest that sequence variation in ovine mtDNA is associated with variation in ewe prolificacy.

A Mobile Element in mutS Drives Hypermutation in a Marine Vibrio

PubMed Central

Chu, Nathaniel D.; Clarke, Sean A.; Timberlake, Sonia; Polz, Martin F.; Grossman, Alan D.

2017-01-01

ABSTRACT Bacteria face a trade-off between genetic fidelity, which reduces deleterious mistakes in the genome, and genetic innovation, which allows organisms to adapt. Evidence suggests that many bacteria balance this trade-off by modulating their mutation rates, but few mechanisms have been described for such modulation. Following experimental evolution and whole-genome resequencing of the marine bacterium Vibrio splendidus 12B01, we discovered one such mechanism, which allows this bacterium to switch to an elevated mutation rate. This switch is driven by the excision of a mobile element residing in mutS, which encodes a DNA mismatch repair protein. When integrated within the bacterial genome, the mobile element provides independent promoter and translation start sequences for mutS—different from the bacterium’s original mutS promoter region—which allow the bacterium to make a functional mutS gene product. Excision of this mobile element rejoins the mutS gene with host promoter and translation start sequences but leaves a 2-bp deletion in the mutS sequence, resulting in a frameshift and a hypermutator phenotype. We further identified hundreds of clinical and environmental bacteria across Betaproteobacteria and Gammaproteobacteria that possess putative mobile elements within the same amino acid motif in mutS. In a subset of these bacteria, we detected excision of the element but not a frameshift mutation; the mobile elements leave an intact mutS coding sequence after excision. Our findings reveal a novel mechanism by which one bacterium alters its mutation rate and hint at a possible evolutionary role for mobile elements within mutS in other bacteria. PMID:28174306

Mutations in the LHX2 gene are not a frequent cause of micro/anophthalmia

PubMed Central

Desmaison, Annaïck; Vigouroux, Adeline; Rieubland, Claudine; Peres, Christine; Calvas, Patrick

2010-01-01

Purpose Microphthalmia and anophthalmia are at the severe end of the spectrum of abnormalities in ocular development. A few genes (orthodenticle homeobox 2 [OTX2], retina and anterior neural fold homeobox [RAX], SRY-box 2 [SOX2], CEH10 homeodomain-containing homolog [CHX10], and growth differentiation factor 6 [GDF6]) have been implicated mainly in isolated micro/anophthalmia but causative mutations of these genes explain less than a quarter of these developmental defects. The essential role of the LIM homeobox 2 (LHX2) transcription factor in early eye development has recently been documented. We postulated that mutations in this gene could lead to micro/anophthalmia, and thus performed molecular screening of its sequence in patients having micro/anophthalmia. Methods Seventy patients having non-syndromic forms of colobomatous microphthalmia (n=25), isolated microphthalmia (n=18), or anophthalmia (n=17), and syndromic forms of micro/anophthalmia (n=10) were included in this study after negative molecular screening for OTX2, RAX, SOX2, and CHX10 mutations. Mutation screening of LHX2 was performed by direct sequencing of the coding sequences and intron/exon boundaries. Results Two heterozygous variants of unknown significance (c.128C>G [p.Pro43Arg]; c.776C>A [p.Pro259Gln]) were identified in LHX2 among the 70 patients. These variations were not identified in a panel of 100 control patients of mixed origins. The variation c.776C>A (p.Pro259Gln) was considered as non pathogenic by in silico analysis, while the variation c.128C>G (p.Pro43Arg) considered as deleterious by in silico analysis and was inherited from the asymptomatic father. Conclusions Mutations in LHX2 do not represent a frequent cause of micro/anophthalmia. PMID:21203406

Mutations in the LHX2 gene are not a frequent cause of micro/anophthalmia.

PubMed

Desmaison, Annaïck; Vigouroux, Adeline; Rieubland, Claudine; Peres, Christine; Calvas, Patrick; Chassaing, Nicolas

2010-12-18

Microphthalmia and anophthalmia are at the severe end of the spectrum of abnormalities in ocular development. A few genes (orthodenticle homeobox 2 [OTX2], retina and anterior neural fold homeobox [RAX], SRY-box 2 [SOX2], CEH10 homeodomain-containing homolog [CHX10], and growth differentiation factor 6 [GDF6]) have been implicated mainly in isolated micro/anophthalmia but causative mutations of these genes explain less than a quarter of these developmental defects. The essential role of the LIM homeobox 2 (LHX2) transcription factor in early eye development has recently been documented. We postulated that mutations in this gene could lead to micro/anophthalmia, and thus performed molecular screening of its sequence in patients having micro/anophthalmia. Seventy patients having non-syndromic forms of colobomatous microphthalmia (n=25), isolated microphthalmia (n=18), or anophthalmia (n=17), and syndromic forms of micro/anophthalmia (n=10) were included in this study after negative molecular screening for OTX2, RAX, SOX2, and CHX10 mutations. Mutation screening of LHX2 was performed by direct sequencing of the coding sequences and intron/exon boundaries. Two heterozygous variants of unknown significance (c.128C>G [p.Pro43Arg]; c.776C>A [p.Pro259Gln]) were identified in LHX2 among the 70 patients. These variations were not identified in a panel of 100 control patients of mixed origins. The variation c.776C>A (p.Pro259Gln) was considered as non pathogenic by in silico analysis, while the variation c.128C>G (p.Pro43Arg) considered as deleterious by in silico analysis and was inherited from the asymptomatic father. Mutations in LHX2 do not represent a frequent cause of micro/anophthalmia.

Mutations in the GIGYF2 (TNRC15) Gene at the PARK11 Locus in Familial Parkinson Disease

PubMed Central

Lautier, Corinne; Goldwurm, Stefano; Dürr, Alexandra; Giovannone, Barbara; Tsiaras, William G.; Pezzoli, Gianni; Brice, Alexis; Smith, Robert J.

2008-01-01

The genetic basis for association of the PARK11 region of chromosome 2 with familial Parkinson disease (PD) is unknown. This study examined the GIGYF2 (Grb10-Interacting GYF Protein-2) (TNRC15) gene, which contains the PARK11 microsatellite marker with the highest linkage score (D2S206, LOD 5.14). The 27 coding exons of the GIGYF2 gene were sequenced in 123 Italian and 126 French patients with familial PD, plus 131 Italian and 96 French controls. A total of seven different GIGYF2 missense mutations resulting in single amino acid substitutions were present in 12 unrelated PD index patients (4.8%) and not in controls. Three amino acid insertions or deletions were found in four other index patients and absent in controls. Specific exon sequencing showed that these ten sequence changes were absent from a further 91 controls. In four families with amino acid substitutions in which at least one other PD case was available, the GIGYF2 mutations (Asn56Ser, Thr112Ala, and Asp606Glu) segregated with PD. There were, however, two unaffected carriers in one family, suggesting age-dependent or incomplete penetrance. One index case (PD onset age 33) inherited a GIGYF2 mutation (Ile278Val) from her affected father (PD onset age 66) and a previously described PD-linked mutation in the LRRK2 gene (Ile1371Val) from her affected mother (PD onset age 61). The earlier onset and severe clinical course in the index patient suggest additive effects of the GIGYF2 and LRRK2 mutations. These data strongly support GIGYF2 as a PARK11 gene with a causal role in familial PD. PMID:18358451

A novel COL4A3 mutation causes autosomal-recessive Alport syndrome in a large Turkish family.

PubMed

Uzak, Asli Subasioglu; Tokgoz, Bulent; Dundar, Munis; Tekin, Mustafa

2013-03-01

Alport syndrome (AS) is a genetically heterogeneous disorder that is characterized by hematuria, progressive renal failure typically resulting in end-stage renal disease, sensorineural hearing loss, and variable ocular abnormalities. Only 15% of cases with AS are autosomal recessive and are caused by mutations in the COL4A3 or COL4A4 genes, encoding type IV collagen. Clinical data in a large consanguineous family with four affected members were reviewed, and genomic DNA was extracted. For mapping, 15 microsatellite markers flanking COL4A3, COL4A4, and COL4A5 in 16 family members were typed. For mutation screening, all coding exons of COL4A3 were polymerase chain reaction- amplified and Sanger-sequenced from genomic DNA. The disease locus was mapped to chromosome 2q36.3, where COL4A3 and COL4A4 reside. Sanger sequencing revealed a novel mis-sense mutation (c.2T>C; p.M1T) in exon 1 of COL4A3. The identified nucleotide change was not found in 100 healthy ethnicity-matched controls via Sanger sequencing. We present a large consanguineous Turkish family with AS that was found to have a COL4A3 mutation as the cause of the disease. Although the relationship between the various genotypes and phenotypes in AS has not been fully elucidated, detailed clinical and molecular analyses are helpful for providing data to be used in genetic counseling. It is important to identify new mutations to clarify their clinical importance, to assess the prognosis of the disease, and to avoid renal biopsy for final diagnosis.

Nmf9 Encodes a Highly Conserved Protein Important to Neurological Function in Mice and Flies.

PubMed

Zhang, Shuxiao; Ross, Kevin D; Seidner, Glen A; Gorman, Michael R; Poon, Tiffany H; Wang, Xiaobo; Keithley, Elizabeth M; Lee, Patricia N; Martindale, Mark Q; Joiner, William J; Hamilton, Bruce A

2015-07-01

Many protein-coding genes identified by genome sequencing remain without functional annotation or biological context. Here we define a novel protein-coding gene, Nmf9, based on a forward genetic screen for neurological function. ENU-induced and genome-edited null mutations in mice produce deficits in vestibular function, fear learning and circadian behavior, which correlated with Nmf9 expression in inner ear, amygdala, and suprachiasmatic nuclei. Homologous genes from unicellular organisms and invertebrate animals predict interactions with small GTPases, but the corresponding domains are absent in mammalian Nmf9. Intriguingly, homozygotes for null mutations in the Drosophila homolog, CG45058, show profound locomotor defects and premature death, while heterozygotes show striking effects on sleep and activity phenotypes. These results link a novel gene orthology group to discrete neurological functions, and show conserved requirement across wide phylogenetic distance and domain level structural changes.

Polymorphisms of 20 regulatory proteins between Mycobacterium tuberculosis and Mycobacterium bovis.

PubMed

Bigi, María M; Blanco, Federico Carlos; Araújo, Flabio R; Thacker, Tyler C; Zumárraga, Martín J; Cataldi, Angel A; Soria, Marcelo A; Bigi, Fabiana

2016-08-01

Mycobacterium tuberculosis and Mycobacterium bovis are responsible for tuberculosis in humans and animals, respectively. Both species are closely related and belong to the Mycobacterium tuberculosis complex (MTC). M. tuberculosis is the most ancient species from which M. bovis and other members of the MTC evolved. The genome of M. bovis is over >99.95% identical to that of M. tuberculosis but with seven deletions ranging in size from 1 to 12.7 kb. In addition, 1200 single nucleotide mutations in coding regions distinguish M. bovis from M. tuberculosis. In the present study, we assessed 75 M. tuberculosis genomes and 23 M. bovis genomes to identify non-synonymous mutations in 202 coding sequences of regulatory genes between both species. We identified species-specific variants in 20 regulatory proteins and confirmed differential expression of hypoxia-related genes between M. bovis and M. tuberculosis. © 2016 The Societies and John Wiley & Sons Australia, Ltd.

Prevalence of the AMHR2 mutation in Miniature Schnauzers and genetic investigation of a Belgian Malinois with persistent Müllerian duct syndrome.

PubMed

Smit, M M; Ekenstedt, K J; Minor, K M; Lim, C K; Leegwater, Paj; Furrow, E

2018-04-01

Persistent Müllerian duct syndrome (PMDS) is a sex-limited disorder in which males develop portions of the female reproductive tract. Important consequences of PMDS are cryptorchidism and its sequelae of infertility and increased risk of testicular cancer. Anti-Müllerian hormone (AMH) and its receptor (AMHR2) induce the regression of the Müllerian ducts in male embryos. In Miniature Schnauzer dogs, the genetic basis has been identified as an autosomal recessive nonsense mutation in AMHR2, but the allele frequency of the mutation is unknown. Thus, the primary objective of this study was to estimate the prevalence of the AMHR2 mutation in North American Miniature Schnauzers, in order to ascertain the value of genetic testing in this breed. An additional objective was to determine whether mutations in AMH or AMHR2 were responsible for PMDS in a Belgian Malinois; this would aid development of a genetic test for the Belgian Malinois breed. Genomic DNA from 216 Miniature Schnauzers (including one known PMDS case) was genotyped for the AMHR2 mutation, and DNA from a single PMDS-affected Belgian Malinois was sequenced for all coding exons of AMH and AMHR2. The Miniature Schnauzer cohort had an AMHR2 mutation allele frequency of 0.16 and a carrier genotypic frequency of 0.27. The genetic basis for PMDS in the Belgian Malinois was not determined, as no coding or splicing mutations were identified in either AMH or AMHR2. These findings support a benefit to AMHR2 mutation testing Miniature Schnauzers used for breeding or with cryptorchidism. © 2017 Blackwell Verlag GmbH.

Lack of pathogenic mutations in SOS1 gene in phenytoin-induced gingival overgrowth patients.

PubMed

Margiotti, Katia; Pascolini, Giulia; Consoli, Federica; Guida, Valentina; Di Bonaventura, Carlo; Giallonardo, Anna Teresa; Pizzuti, Antonio; De Luca, Alessandro

2017-08-01

Gingival overgrowth is a side effect associated with some distinct classes of drugs, such as anticonvulsants, immunosuppressants, and calcium channel blockers. One of the main drugs associated with gingival overgrowth is the antiepileptic phenytoin, which affects gingival tissues by altering extracellular matrix metabolism. It has been shown that mutation of human SOS1 gene is responsible for a rare hereditary gingival fibromatosis type 1, a benign gingival overgrowth. The aim of the present study is to evaluate the possible contribution of SOS1 mutation to gingival overgrowth-related phenotype. We selected and screened for mutations a group of 24 epileptic patients who experienced significant gingival overgrowth following phenytoin therapy. Mutation scanning was carried out by denaturing high-performance liquid chromatography analysis of the entire coding region of the SOS1 gene. Novel identified variants were analyzed in-silico by using Alamut Visual mutation interpretation software, and comparison with normal control group was done. Mutation scanning of the entire coding sequence of SOS1 gene identified seven intronic variants and one new exonic substitution (c.138G>A). The seven common intronic variants were not considered to be of pathogenic importance. The exonic substitution c.138G>A was found to be absent in 100 ethnically matched normal control chromosomes, but was not expected to have functional significance based on prediction bioinformatics tools. This study represents the first mutation analysis of the SOS1 gene in phenytoin-induced gingival overgrowth epileptic patients. Present results suggest that obvious pathogenic mutations in the SOS1 gene do not represent a common mechanism underlying phenytoin-induced gingival overgrowth in epileptic patients; other mechanisms are likely to be involved in the pathogenesis of this drug-induced phenotype. Copyright © 2017 Elsevier Ltd. All rights reserved.

Identification of a novel p.R1443W mutation in RP1 gene associated with retinitis pigmentosa sine pigmento.

PubMed

Ma, Li; Sheng, Xun-Lun; Li, Hui-Ping; Zhang, Fang-Xia; Liu, Ya-Ni; Rong, Wei-Ning; Zhang, Jian-Ling

2013-01-01

To screen mutations in the retinitis pigmentosa 1 (RP1) gene and the rhodopsin (RHO) gene in Chinese patients with retinitis pigmentosa sine pigmento (RPSP) and describe the genotype-phenotype relationship of the mutations. Twenty affected, unrelated Chinese individuals with RPSP (4 autosomal dominant RPSP, 12 autosomal recessive RPSP and 4 unknown inheritance pattern) were recruited between 2009 and 2012. The clinical features were determined by complete ophthalmologic examinations. Polymerase chain reaction (PCR) and direct DNA sequencing were used to screen the entire coding region and splice junctions of the RP1 gene and the RHO gene. The cosegregation analysis and population frequency studies were performed for patients with identified mutations. Five variants in the RP1 gene and one in the RHO gene were detected in 20 probands. Four missense changes (rs444772, rs446227, rs414352, rs441800) and one non-coding variant (rs56340615) were common SNPs and none of them showed a significant relationship with RPSP. A missense mutation p.R1443W was identified in the RP1 gene in three affected individuals from a family with autosomal dominant RPSP and was found to cosegregate with the phenotype in this family, suggestive of pathogenic. In addition, population frequency analysis showed the p.R1443W mutation was absent in 300 healthy controls. The identification of p.R1443W mutation cosegregating in a family with autosomal dominant RPSP highlights an atypical phenotype of the RP1 gene mutation, while RHO gene is not associated with the pathogenesis of RPSP in this study. To our knowledge, this is the fist mutation identified to associate with RPSP.

Identification of a novel p.R1443W mutation in RP1 gene associated with retinitis pigmentosa sine pigmento

PubMed Central

Ma, Li; Sheng, Xun-Lun; Li, Hui-Ping; Zhang, Fang-Xia; Liu, Ya-Ni; Rong, Wei-Ning; Zhang, Jian-Ling

2013-01-01

AIM To screen mutations in the retinitis pigmentosa 1 (RP1) gene and the rhodopsin (RHO) gene in Chinese patients with retinitis pigmentosa sine pigmento (RPSP) and describe the genotype-phenotype relationship of the mutations. METHODS Twenty affected, unrelated Chinese individuals with RPSP (4 autosomal dominant RPSP, 12 autosomal recessive RPSP and 4 unknown inheritance pattern) were recruited between 2009 and 2012. The clinical features were determined by complete ophthalmologic examinations. Polymerase chain reaction (PCR) and direct DNA sequencing were used to screen the entire coding region and splice junctions of the RP1 gene and the RHO gene. The cosegregation analysis and population frequency studies were performed for patients with identified mutations. RESULTS Five variants in the RP1 gene and one in the RHO gene were detected in 20 probands. Four missense changes (rs444772, rs446227, rs414352, rs441800) and one non-coding variant (rs56340615) were common SNPs and none of them showed a significant relationship with RPSP. A missense mutation p.R1443W was identified in the RP1 gene in three affected individuals from a family with autosomal dominant RPSP and was found to cosegregate with the phenotype in this family, suggestive of pathogenic. In addition, population frequency analysis showed the p.R1443W mutation was absent in 300 healthy controls. CONCLUSION The identification of p.R1443W mutation cosegregating in a family with autosomal dominant RPSP highlights an atypical phenotype of the RP1 gene mutation, while RHO gene is not associated with the pathogenesis of RPSP in this study. To our knowledge, this is the fist mutation identified to associate with RPSP. PMID:23991373

Novel mutation in forkhead box G1 (FOXG1) gene in an Indian patient with Rett syndrome.

PubMed

Das, Dhanjit Kumar; Jadhav, Vaishali; Ghattargi, Vikas C; Udani, Vrajesh

2014-03-15

Rett syndrome (RTT) is a severe neurodevelopmental disorder characterized by the progressive loss of intellectual functioning, fine and gross motor skills and communicative abilities, deceleration of head growth, and the development of stereotypic hand movements, occurring after a period of normal development. The classic form of RTT involves mutation in MECP2 while the involvement of CDKL5 and FOXG1 genes has been identified in atypical RTT phenotype. FOXG1 gene encodes for a fork-head box protein G1, a transcription factor acting primarily as transcriptional repressor through DNA binding in the embryonic telencephalon as well as a number of other neurodevelopmental processes. In this report we have described the molecular analysis of FOXG1 gene in Indian patients with Rett syndrome. FOXG1 gene mutation analysis was done in a cohort of 34 MECP2/CDKL5 mutation negative RTT patients. We have identified a novel mutation (p. D263VfsX190) in FOXG1 gene in a patient with congenital variant of Rett syndrome. This mutation resulted into a frameshift, thereby causing an alteration in the reading frames of the entire coding sequence downstream of the mutation. The start position of the frameshift (Asp263) and amino acid towards the carboxyl terminal end of the protein was found to be well conserved across species using multiple sequence alignment. Since the mutation is located at forkhead binding domain, the resultant mutation disrupts the secondary structure of the protein making it non-functional. This is the first report from India showing mutation in FOXG1 gene in Rett syndrome. Copyright © 2014 Elsevier B.V. All rights reserved.

Distribution of CFTR mutations in Eastern Hungarians: relevance to genetic testing and to the introduction of newborn screening for cystic fibrosis.

PubMed

Ivady, Gergely; Madar, Laszlo; Nagy, Bela; Gonczi, Ferenc; Ajzner, Eva; Dzsudzsak, Erika; Dvořáková, Lenka; Gombos, Eva; Kappelmayer, Janos; Macek, Milan; Balogh, Istvan

2011-05-01

The aim of this study was characterization of an updated distribution of CFTR mutations in a representative cohort of 40 CF patients with the classical form of the disease drawn from Eastern Hungary. Due to the homogeneity of the Hungarian population our data are generally applicable to other regions of the country, including the sizeable diaspora. We utilized the recommended "cascade" CFTR mutation screening approach, initially using a commercial assay, followed by examination of the common "Slavic" deletion CFTRdele2,3(21kb). Subsequently, the entire CFTR coding region of the CFTR gene was sequenced in patients with yet unidentified mutations. The Elucigene CF29(Tm) v2 assay detected 81.25% of all CF causing mutations. An addition of the CFTRdele2,3(21kb) increased the mutation detection rate to 86.25%. DNA sequencing enabled us to identify mutations on 79/80 CF alleles. Mutations [CFTRdele2,3(21kb), p.Gln685ThrfsX4 (2184insA) were found at an unusually high frequency, each comprising 5.00% of all CF alleles. We have identified common CF causing mutations in the Hungarian population with the most common mutations (p.Phe508del, p.Asn1303Lys, CFTRdele2,3(21kb), 2184insA, p.Gly542X, and p.Leu101X), comprising over 93.75% of all CF alleles. Obtained data are applicable to the improvement of DNA diagnostics in Hungary and beyond, and are the necessary prerequisite for the introduction of a nationwide "two tier" CF newborn screening program. Copyright © 2011 European Cystic Fibrosis Society. Published by Elsevier B.V. All rights reserved.

Mutations in the Norrie disease gene.

PubMed

Schuback, D E; Chen, Z Y; Craig, I W; Breakefield, X O; Sims, K B

1995-01-01

We report our experience to date in mutation identification in the Norrie disease (ND) gene. We carried out mutational analysis in 26 kindreds in an attempt to identify regions presumed critical to protein function and potentially correlated with generation of the disease phenotype. All coding exons, as well as noncoding regions of exons 1 and 2, 636 nucleotides in the noncoding region of exon 3, and 197 nucleotides of 5' flanking sequence, were analyzed for single-strand conformation polymorphisms (SSCP) by polymerase chain reaction (PCR) amplification of genomic DNA. DNA fragments that showed altered SSCP band mobilities were sequenced to locate the specific mutations. In addition to three previously described submicroscopic deletions encompassing the entire ND gene, we have now identified 6 intragenic deletions, 8 missense (seven point mutations, one 9-bp deletion), 6 nonsense (three point mutations, three single bp deletions/frameshift) and one 10-bp insertion, creating an expanded repeat in the 5' noncoding region of exon 1. Thus, mutations have been identified in a total of 24 of 26 (92%) of the kindreds we have studied to date. With the exception of two different mutations, each found in two apparently unrelated kindreds, these mutations are unique and expand the genotype database. Localization of the majority of point mutations at or near cysteine residues, potentially critical in protein tertiary structure, supports a previous protein model for norrin as member of a cystine knot growth factor family (Meitinger et al., 1993). Genotype-phenotype correlations were not evident with the limited clinical data available, except in the cases of larger submicroscopic deletions associated with a more severe neurologic syndrome.(ABSTRACT TRUNCATED AT 250 WORDS)

Identification of five novel mutations in the long isoform of the USH2A gene in Chinese families with Usher syndrome type II.

PubMed

Dai, Hanjun; Zhang, Xiaohui; Zhao, Xin; Deng, Ting; Dong, Bing; Wang, Jingzhao; Li, Yang

2008-01-01

Usher syndrome type II (USH2) is the most common form of Usher syndrome, an autosomal recessive disorder characterized by moderate to severe hearing loss, postpuberal onset of retinitis pigmentosa (RP), and normal vestibular function. Mutations in the USH2A gene have been shown to be responsible for most cases of USH2. To further elucidate the role of USH2A in USH2, mutation screening was undertaken in three Chinese families with USH2. Three unrelated Chinese families, consisting of six patients and 10 unaffected relatives, were examined clinically, and 100 normal Chinese individuals served as controls. Genomic DNA was extracted from the venous blood of all participants. The coding region (exons 2-72), including the intron-exon boundary of USH2A, was amplified by polymerase chain reaction (PCR). The PCR products amplified from the three probands were analyzed using direct sequencing to screen sequence variants. Whenever substitutions were identified in a patient, restriction fragment length polymorphism analysis, or single strand conformation polymorphism analysis was performed on all available family members and the control group. Fundus examination revealed typical fundus features of RP, including narrowing of the vessels, bone-speckle pigmentation, and waxy optic discs. The ERG wave amplitudes of three probands were undetectable. Audiometric tests indicated moderate to severe sensorineural hearing impairment. Vestibular function was normal. Five novel mutations (one small insertion, one small deletion, one nonsense, one missense, and one splice site) were detected in three families after sequence analysis of USH2A. Of the five mutations, four were located in exons 22-72, specific to the long isoform of USH2A. The mutations found in our study broaden the spectrum of USH2A mutations. Our results further indicate that the long isoform of USH2A may harbor even more mutations of the USH2A gene.

A nonsense loss-of-function mutation in PCSK1 contributes to dominantly inherited human obesity.

PubMed

Philippe, J; Stijnen, P; Meyre, D; De Graeve, F; Thuillier, D; Delplanque, J; Gyapay, G; Sand, O; Creemers, J W; Froguel, P; Bonnefond, A

2015-02-01

A significant proportion of severe familial forms of obesity remain genetically elusive. Taking advantage of our unique cohort of multigenerational obese families, we aimed to assess the contribution of rare mutations in 29 common obesity-associated genes to familial obesity, and to evaluate in these families the putative presence of nine known monogenic forms of obesity. Through next-generation sequencing, we sequenced the coding regions of 34 genes involved in polygenic and/or monogenic forms of obesity in 201 participants (75 normal weight individuals, 54 overweight individuals and 72 individuals with obesity class I, II or III) from 13 French families. In vitro functional analyses were performed to investigate the mutation PCSK1-p.Arg80* which was identified in a family. A novel heterozygous nonsense variant in PCSK1 (p.Arg80*), encoding a propeptide truncated to less than two exons (out of 14), was found to co-segregate with obesity in a three-generation family. We demonstrated that this mutation inhibits PCSK1 enzyme activity and that this inhibition most likely does not involve a strong physical interaction. Furthermore, both mutations PCSK1-p.Asn180Ser and POMC-p.Phe144Leu, which had previously been reported to be associated with severe obesity, were also identified in this study, but did not co-segregate with obesity. Finally, we did not identify any rare mutations co-segregating with obesity in common obesity susceptibility genes, except for CADM2 and QPCTL, where we found two novel variants (p.Arg81His and p.Leu98Pro, respectively) in three obese individuals. We showed for the first time that a nonsense mutation in PCSK1 was likely to cause dominantly inherited human obesity, due to the inhibiting properties of the propeptide fragment encoded by the null allele. Furthermore, the present family sequencing design challenged the contribution of previously reported mutations to monogenic or at least severe obesity.

Loss of function mutations in RP1 are responsible for retinitis pigmentosa in consanguineous familial cases

PubMed Central

Kabir, Firoz; Ullah, Inayat; Ali, Shahbaz; Gottsch, Alexander D.H.; Naeem, Muhammad Asif; Assir, Muhammad Zaman; Khan, Shaheen N.; Akram, Javed; Riazuddin, Sheikh; Ayyagari, Radha; Hejtmancik, J. Fielding

2016-01-01

Purpose This study was undertaken to identify causal mutations responsible for autosomal recessive retinitis pigmentosa (arRP) in consanguineous families. Methods Large consanguineous families were ascertained from the Punjab province of Pakistan. An ophthalmic examination consisting of a fundus evaluation and electroretinography (ERG) was completed, and small aliquots of blood were collected from all participating individuals. Genomic DNA was extracted from white blood cells, and a genome-wide linkage or a locus-specific exclusion analysis was completed with polymorphic short tandem repeats (STRs). Two-point logarithm of odds (LOD) scores were calculated, and all coding exons and exon–intron boundaries of RP1 were sequenced to identify the causal mutation. Results The ophthalmic examination showed that affected individuals in all families manifest cardinal symptoms of RP. Genome-wide scans localized the disease phenotype to chromosome 8q, a region harboring RP1, a gene previously implicated in the pathogenesis of RP. Sanger sequencing identified a homozygous single base deletion in exon 4: c.3697delT (p.S1233Pfs22*), a single base substitution in intron 3: c.787+1G>A (p.I263Nfs8*), a 2 bp duplication in exon 2: c.551_552dupTA (p.Q185Yfs4*) and an 11,117 bp deletion that removes all three coding exons of RP1. These variations segregated with the disease phenotype within the respective families and were not present in ethnically matched control samples. Conclusions These results strongly suggest that these mutations in RP1 are responsible for the retinal phenotype in affected individuals of all four consanguineous families. PMID:27307693

High throughput mutagenesis for identification of residues regulating human prostacyclin (hIP) receptor expression and function.

PubMed

Bill, Anke; Rosethorne, Elizabeth M; Kent, Toby C; Fawcett, Lindsay; Burchell, Lynn; van Diepen, Michiel T; Marelli, Anthony; Batalov, Sergey; Miraglia, Loren; Orth, Anthony P; Renaud, Nicole A; Charlton, Steven J; Gosling, Martin; Gaither, L Alex; Groot-Kormelink, Paul J

2014-01-01

The human prostacyclin receptor (hIP receptor) is a seven-transmembrane G protein-coupled receptor (GPCR) that plays a critical role in vascular smooth muscle relaxation and platelet aggregation. hIP receptor dysfunction has been implicated in numerous cardiovascular abnormalities, including myocardial infarction, hypertension, thrombosis and atherosclerosis. Genomic sequencing has discovered several genetic variations in the PTGIR gene coding for hIP receptor, however, its structure-function relationship has not been sufficiently explored. Here we set out to investigate the applicability of high throughput random mutagenesis to study the structure-function relationship of hIP receptor. While chemical mutagenesis was not suitable to generate a mutagenesis library with sufficient coverage, our data demonstrate error-prone PCR (epPCR) mediated mutagenesis as a valuable method for the unbiased screening of residues regulating hIP receptor function and expression. Here we describe the generation and functional characterization of an epPCR derived mutagenesis library compromising >4000 mutants of the hIP receptor. We introduce next generation sequencing as a useful tool to validate the quality of mutagenesis libraries by providing information about the coverage, mutation rate and mutational bias. We identified 18 mutants of the hIP receptor that were expressed at the cell surface, but demonstrated impaired receptor function. A total of 38 non-synonymous mutations were identified within the coding region of the hIP receptor, mapping to 36 distinct residues, including several mutations previously reported to affect the signaling of the hIP receptor. Thus, our data demonstrates epPCR mediated random mutagenesis as a valuable and practical method to study the structure-function relationship of GPCRs.

High Throughput Mutagenesis for Identification of Residues Regulating Human Prostacyclin (hIP) Receptor Expression and Function

PubMed Central

Kent, Toby C.; Fawcett, Lindsay; Burchell, Lynn; van Diepen, Michiel T.; Marelli, Anthony; Batalov, Sergey; Miraglia, Loren; Orth, Anthony P.; Renaud, Nicole A.; Charlton, Steven J.; Gosling, Martin; Gaither, L. Alex; Groot-Kormelink, Paul J.

2014-01-01

The human prostacyclin receptor (hIP receptor) is a seven-transmembrane G protein-coupled receptor (GPCR) that plays a critical role in vascular smooth muscle relaxation and platelet aggregation. hIP receptor dysfunction has been implicated in numerous cardiovascular abnormalities, including myocardial infarction, hypertension, thrombosis and atherosclerosis. Genomic sequencing has discovered several genetic variations in the PTGIR gene coding for hIP receptor, however, its structure-function relationship has not been sufficiently explored. Here we set out to investigate the applicability of high throughput random mutagenesis to study the structure-function relationship of hIP receptor. While chemical mutagenesis was not suitable to generate a mutagenesis library with sufficient coverage, our data demonstrate error-prone PCR (epPCR) mediated mutagenesis as a valuable method for the unbiased screening of residues regulating hIP receptor function and expression. Here we describe the generation and functional characterization of an epPCR derived mutagenesis library compromising >4000 mutants of the hIP receptor. We introduce next generation sequencing as a useful tool to validate the quality of mutagenesis libraries by providing information about the coverage, mutation rate and mutational bias. We identified 18 mutants of the hIP receptor that were expressed at the cell surface, but demonstrated impaired receptor function. A total of 38 non-synonymous mutations were identified within the coding region of the hIP receptor, mapping to 36 distinct residues, including several mutations previously reported to affect the signaling of the hIP receptor. Thus, our data demonstrates epPCR mediated random mutagenesis as a valuable and practical method to study the structure-function relationship of GPCRs. PMID:24886841

The primary transcriptome of the marine diazotroph Trichodesmium erythraeum IMS101

NASA Astrophysics Data System (ADS)

Pfreundt, Ulrike; Kopf, Matthias; Belkin, Natalia; Berman-Frank, Ilana; Hess, Wolfgang R.

2014-08-01

Blooms of the dinitrogen-fixing marine cyanobacterium Trichodesmium considerably contribute to new nitrogen inputs into tropical oceans. Intriguingly, only 60% of the Trichodesmium erythraeum IMS101 genome sequence codes for protein, compared with ~85% in other sequenced cyanobacterial genomes. The extensive non-coding genome fraction suggests space for an unusually high number of unidentified, potentially regulatory non-protein-coding RNAs (ncRNAs). To identify the transcribed fraction of the genome, here we present a genome-wide map of transcriptional start sites (TSS) at single nucleotide resolution, revealing the activity of 6,080 promoters. We demonstrate that T. erythraeum has the highest number of actively splicing group II introns and the highest percentage of TSS yielding ncRNAs of any bacterium examined to date. We identified a highly transcribed retroelement that serves as template repeat for the targeted mutation of at least 12 different genes by mutagenic homing. Our findings explain the non-coding portion of the T. erythraeum genome by the transcription of an unusually high number of non-coding transcripts in addition to the known high incidence of transposable elements. We conclude that riboregulation and RNA maturation-dependent processes constitute a major part of the Trichodesmium regulatory apparatus.

Reduced-median-network analysis of complete mitochondrial DNA coding-region sequences for the major African, Asian, and European haplogroups.

PubMed

Herrnstadt, Corinna; Elson, Joanna L; Fahy, Eoin; Preston, Gwen; Turnbull, Douglass M; Anderson, Christen; Ghosh, Soumitra S; Olefsky, Jerrold M; Beal, M Flint; Davis, Robert E; Howell, Neil

2002-05-01

The evolution of the human mitochondrial genome is characterized by the emergence of ethnically distinct lineages or haplogroups. Nine European, seven Asian (including Native American), and three African mitochondrial DNA (mtDNA) haplogroups have been identified previously on the basis of the presence or absence of a relatively small number of restriction-enzyme recognition sites or on the basis of nucleotide sequences of the D-loop region. We have used reduced-median-network approaches to analyze 560 complete European, Asian, and African mtDNA coding-region sequences from unrelated individuals to develop a more complete understanding of sequence diversity both within and between haplogroups. A total of 497 haplogroup-associated polymorphisms were identified, 323 (65%) of which were associated with one haplogroup and 174 (35%) of which were associated with two or more haplogroups. Approximately one-half of these polymorphisms are reported for the first time here. Our results confirm and substantially extend the phylogenetic relationships among mitochondrial genomes described elsewhere from the major human ethnic groups. Another important result is that there were numerous instances both of parallel mutations at the same site and of reversion (i.e., homoplasy). It is likely that homoplasy in the coding region will confound evolutionary analysis of small sequence sets. By a linkage-disequilibrium approach, additional evidence for the absence of human mtDNA recombination is presented here.

Novel variants of the 5S rRNA genes in Eruca sativa.

PubMed

Singh, K; Bhatia, S; Lakshmikumaran, M

1994-02-01

The 5S ribosomal RNA (rRNA) genes of Eruca sativa were cloned and characterized. They are organized into clusters of tandemly repeated units. Each repeat unit consists of a 119-bp coding region followed by a noncoding spacer region that separates it from the coding region of the next repeat unit. Our study reports novel gene variants of the 5S rRNA genes in plants. Two families of the 5S rDNA, the 0.5-kb size family and the 1-kb size family, coexist in the E. sativa genome. The 0.5-kb size family consists of the 5S rRNA genes (S4) that have coding regions similar to those of other reported plant 5S rDNA sequences, whereas the 1-kb size family consists of the 5S rRNA gene variants (S1) that exist as 1-kb BamHI tandem repeats. S1 is made up of two variant units (V1 and V2) of 5S rDNA where the BamHI site between the two units is mutated. Sequence heterogeneity among S4, V1, and V2 units exists throughout the sequence and is not limited to the noncoding spacer region only. The coding regions of V1 and V2 show approximately 20% dissimilarity to the coding regions of S4 and other reported plant 5S rDNA sequences. Such a large variation in the coding regions of the 5S rDNA units within the same plant species has been observed for the first time. Restriction site variation is observed between the two size classes of 5S rDNA in E. sativa.(ABSTRACT TRUNCATED AT 250 WORDS)

Quantitative PCR analysis reveals a high incidence of large intragenic deletions in the FANCA gene in Spanish Fanconi anemia patients.

PubMed

Callén, E; Tischkowitz, M D; Creus, A; Marcos, R; Bueren, J A; Casado, J A; Mathew, C G; Surrallés, J

2004-01-01

Fanconi anaemia is an autosomal recessive disease characterized by chromosome fragility, multiple congenital abnormalities, progressive bone marrow failure and a high predisposition to develop malignancies. Most of the Fanconi anaemia patients belong to complementation group FA-A due to mutations in the FANCA gene. This gene contains 43 exons along a 4.3-kb coding sequence with a very heterogeneous mutational spectrum that makes the mutation screening of FANCA a difficult task. In addition, as the FANCA gene is rich in Alu sequences, it was reported that Alu-mediated recombination led to large intragenic deletions that cannot be detected in heterozygous state by conventional PCR, SSCP analysis, or DNA sequencing. To overcome this problem, a method based on quantitative fluorescent multiplex PCR was proposed to detect intragenic deletions in FANCA involving the most frequently deleted exons (exons 5, 11, 17, 21 and 31). Here we apply the proposed method to detect intragenic deletions in 25 Spanish FA-A patients previously assigned to complementation group FA-A by FANCA cDNA retroviral transduction. A total of eight heterozygous deletions involving from one to more than 26 exons were detected. Thus, one third of the patients carried a large intragenic deletion that would have not been detected by conventional methods. These results are in agreement with previously published data and indicate that large intragenic deletions are one of the most frequent mutations leading to Fanconi anaemia. Consequently, this technology should be applied in future studies on FANCA to improve the mutation detection rate. Copyright 2003 S. Karger AG, Basel

Combination of retinitis pigmentosa and hearing loss caused by a novel mutation in PRPH2 and a known mutation in GJB2: importance for differential diagnosis of Usher syndrome.

PubMed

Fakin, Ana; Zupan, Andrej; Glavač, Damjan; Hawlina, Marko

2012-12-15

Purpose of this study was to molecularly characterize a family in which two brothers (46 and 36 years) presented with a combination of retinitis pigmentosa (RP) and severe sensorineural hearing loss while father and sister (71 and 41 years) presented with isolated RP. Retinal phenotype was compared with phenotype of 17 patients with Usher syndrome type 1. Ophthalmological examination included assessment of Snellen visual acuity, color vision with Ishihara tables, Goldmann perimetry (targets II/1-4) and microperimetry. Fundus autofluorescence imaging and optical coherence tomography were performed. Direct sequencing of all coding exons and flanking intronic sequences of GJB2 (gap junction protein, beta 2) and PRPH2 (peripherin 2) genes was performed in younger brother. Other family members were analyzed with sequencing (GJB2), high resolution melt analysis (GJB2) or restriction enzymes (PRPH2). Brothers with hearing loss were found to carry a homozygous c.35 delG mutation in GJB2, the most common mutation associated with recessive hearing loss. All patients were found to carry a novel heterozygous mutation c.389T>C (p.Leu130Pro) on PRPH2. Age of onset was higher in PRPH2 than USH1 patients, however with some overlap. Differentiation from retinal phenotype of USH1 could only be made in the oldest patient, who retained good central visual function after more than three decades of disease. Copyright © 2012 Elsevier Ltd. All rights reserved.

High Prevalence of Rare Monogenic Forms of Obesity in Obese Guadeloupean Afro-Caribbean Children.

PubMed

Foucan, Lydia; Larifla, Laurent; Durand, Emmanuelle; Rambhojan, Christine; Armand, Christophe; Michel, Carl-Thony; Billy, Rachel; Dhennin, Véronique; De Graeve, Franck; Rabearivelo, Iandry; Sand, Olivier; Lacorte, Jean-Marc; Froguel, Philippe; Bonnefond, Amélie

2018-02-01

The population of Guadeloupe Island exhibits a high prevalence of obesity. We aimed to investigate whether rare genetic mutations in genes involved in monogenic obesity (or diabetes) might be causal in this population of Afro-Caribbean ancestry. This was a secondary analysis of a study on obesity conducted in schoolchildren from Guadeloupe in 2013 that aimed to assess changes in children's profiles after a lifestyle intervention program. Through next-generation sequencing, we sequenced coding regions of 59 genes involved in monogenic obesity or diabetes in participants from this study. A total of 25 obese schoolchildren from Guadeloupe were screened for rare mutations (nonsynonymous, splice-site, or insertion/deletion) in 59 genes. Correlation between phenotypes and mutations of interest. We detected five rare heterozygous mutations in five different children with obesity: MC4R p.Ile301Thr and SIM1 p.Val326Thrfs*43 mutations that were pathogenic; SIM1 p.Ser343Pro and SH2B1 p.Pro90His mutations that were likely pathogenic; and NTRK2 p.Leu140Phe that was of uncertain significance. In parallel, we identified seven carriers of mutations in ABCC8 (p.Lys1521Asn and p.Ala625Val) or KCNJ11 (p.Val13Met and p.Val151Met) that were of uncertain significance. We were able to detect pathogenic or likely pathogenic mutations linked to severe obesity in >15% of this population, which is much higher than what we observed in Europeans (∼5%). Copyright © 2017 Endocrine Society

Two Novel HOGA1 Splicing Mutations Identified in a Chinese Patient with Primary Hyperoxaluria Type 3.

PubMed

Wang, Xinsheng; Zhao, Xiangzhong; Wang, Xiaoling; Yao, Jian; Zhang, Feifei; Lang, Yanhua; Tuffery-Giraud, Sylvie; Bottillo, Irene; Shao, Leping

2015-01-01

Twenty-six HOGA1 mutations have been reported in primary hyperoxaluria (PH) type 3 (PH3) patients with c.700 + 5G>T accounting for about 50% of the total alleles. However, PH3 has never been described in Asians. A Chinese child with early-onset nephrolithiasis was suspected of having PH. We searched for AGXT, GRHPR and HOGA1 gene mutations in this patient and his parents. All coding regions, including intron-exon boundaries, were analyzed using PCR followed by direct sequence analysis. Two heterozygous mutations not previously described in the literature about HOGA1 were identified (compound heterozygous). One mutation was a successive 2 bp substitution at the last nucleotide of exon 6 and at the first nucleotide of intron 6, respectively (c.834_834 + 1GG>TT), while the other one was a guanine to adenine substitution of the last nucleotide of exon 6 (c.834G>A). Direct sequencing analysis failed to find these mutations in 100 unrelated healthy subjects and the functional role on splicing of both variants found in this study was confirmed by a minigene assay based on the pSPL3 exon trapping vector. In addition, we found a SNP in this family (c.715G>A, p.V239I). There were no mutations detected in AGXT and GRHPR. Two novel HOGA1 mutations were identified in association with PH3. This is the first description and investigation on mutant gene analysis of PH3 in an Asian. © 2015 S. Karger AG, Basel

Mutation Frequency of the Major Frontotemporal Dementia Genes, MAPT, GRN and C9ORF72 in a Turkish Cohort of Dementia Patients.

PubMed

Guven, Gamze; Lohmann, Ebba; Bras, Jose; Gibbs, J Raphael; Gurvit, Hakan; Bilgic, Basar; Hanagasi, Hasmet; Rizzu, Patrizia; Heutink, Peter; Emre, Murat; Erginel-Unaltuna, Nihan; Just, Walter; Hardy, John; Singleton, Andrew; Guerreiro, Rita

2016-01-01

'Microtubule-associated protein tau' (MAPT), 'granulin' (GRN) and 'chromosome 9 open reading frame72' (C9ORF72) gene mutations are the major known genetic causes of frontotemporal dementia (FTD). Recent studies suggest that mutations in these genes may also be associated with other forms of dementia. Therefore we investigated whether MAPT, GRN and C9ORF72 gene mutations are major contributors to dementia in a random, unselected Turkish cohort of dementia patients. A combination of whole-exome sequencing, Sanger sequencing and fragment analysis/Southern blot was performed in order to identify pathogenic mutations and novel variants in these genes as well as other FTD-related genes such as the 'charged multivesicular body protein 2B' (CHMP2B), the 'FUS RNA binding protein' (FUS), the 'TAR DNA binding protein' (TARDBP), the 'sequestosome1' (SQSTM1), and the 'valosin containing protein' (VCP). We determined one pathogenic MAPT mutation (c.1906C>T, p.P636L) and one novel missense variant (c.38A>G, p.D13G). In GRN we identified a probably pathogenic TGAG deletion in the splice donor site of exon 6. Three patients were found to carry the GGGGCC expansions in the non-coding region of the C9ORF72 gene. In summary, a complete screening for mutations in MAPT, GRN and C9ORF72 genes revealed a frequency of 5.4% of pathogenic mutations in a random cohort of 93 Turkish index patients with dementia.

Recurrent mutation in the crystallin alpha A gene associated with inherited paediatric cataract.

PubMed

Javadiyan, Shari; Craig, Jamie E; Souzeau, Emmanuelle; Sharma, Shiwani; Lower, Karen M; Pater, John; Casey, Theresa; Hodson, Trevor; Burdon, Kathryn P

2016-02-11

Cataract is a major cause of childhood blindness worldwide. The purpose of this study was to determine the genetic cause of paediatric cataract in a South Australian family with a bilateral lamellar paediatric cataract displaying variable phenotypes. Fifty-one genes implicated in congenital cataract in human or mouse were sequenced in an affected individual from an Australian (Caucasian) family using a custom Ampliseq library on the Ion Torrent Personal Genome Machine. Reads were mapped against the human genome (hg19) and variants called with the Torrent Suite software. Variants were annotated to dbSNP 137 using Ion Reporter (IR 1.6.2) and were prioritised for validation if they were novel or rare and were predicted to be protein changing. We identified a previously reported oligomerization disrupting mutation, c.62G > A (p.R21Q), in the Crystallin alpha A (CRYAA) gene segregating in this three generation family. No other novel or rare coding mutations were detected in the known cataract genes sequenced. Microsatellite markers were used to compare the haplotypes between the family reported here and a previously published family with the same segregating mutation. Haplotype analysis indicated a potential common ancestry between the two South Australian families with this mutation. The work strengthens the genotype-phenotype correlations between this functional mutation in the crystallin alpha A (CRYAA) gene and paediatric cataract. The p.R21Q mutation is the most likely cause of paediatric cataract in this family. The recurrence of this mutation in paediatric cataract families is likely due to a familial relationship.

Multiplex Amplification Coupled with COLD-PCR and High Resolution Melting Enables Identification of Low-Abundance Mutations in Cancer Samples with Low DNA Content

PubMed Central

Milbury, Coren A.; Chen, Clark C.; Mamon, Harvey; Liu, Pingfang; Santagata, Sandro; Makrigiorgos, G. Mike

2011-01-01

Thorough screening of cancer-specific biomarkers, such as DNA mutations, can require large amounts of genomic material; however, the amount of genomic material obtained from some specimens (such as biopsies, fine-needle aspirations, circulating-DNA or tumor cells, and histological slides) may limit the analyses that can be performed. Furthermore, mutant alleles may be at low-abundance relative to wild-type DNA, reducing detection ability. We present a multiplex-PCR approach tailored to amplify targets of interest from small amounts of precious specimens, for extensive downstream detection of low-abundance alleles. Using 3 ng of DNA (1000 genome-equivalents), we amplified the 1 coding exons (2-11) of TP53 via multiplex-PCR. Following multiplex-PCR, we performed COLD-PCR (co-amplification of major and minor alleles at lower denaturation temperature) to enrich low-abundance variants and high resolution melting (HRM) to screen for aberrant melting profiles. Mutation-positive samples were sequenced. Evaluation of mutation-containing dilutions revealed improved sensitivities after COLD-PCR over conventional-PCR. COLD-PCR improved HRM sensitivity by approximately threefold to sixfold. Similarly, COLD-PCR improved mutation identification in sequence-chromatograms over conventional PCR. In clinical specimens, eight mutations were detected via conventional-PCR-HRM, whereas 12 were detected by COLD-PCR-HRM, yielding a 33% improvement in mutation detection. In summary, we demonstrate an efficient approach to increase screening capabilities from limited DNA material via multiplex-PCR and improve mutation detection sensitivity via COLD-PCR amplification. PMID:21354058

Novel mutations of TCOF1 gene in European patients with treacher Collins syndrome

PubMed Central

2011-01-01

Background Treacher Collins syndrome (TCS) is one of the most severe autosomal dominant congenital disorders of craniofacial development and shows variable phenotypic expression. TCS is extremely rare, occurring with an incidence of 1 in 50.000 live births. The TCS distinguishing characteristics are represented by down slanting palpebral fissures, coloboma of the eyelid, micrognathia, microtia and other deformity of the ears, hypoplastic zygomatic arches, and macrostomia. Conductive hearing loss and cleft palate are often present. TCS results from mutations in the TCOF1 gene located on chromosome 5, which encodes a serine/alanine-rich nucleolar phospho-protein called Treacle. However, alterations in the TCOF1 gene have been implicated in only 81-93% of TCS cases. Methods In this study, the entire coding regions of the TCOF1 gene, including newly described exons 6A and 16A, were sequenced in 46 unrelated subjects suspected of TCS clinical indication. Results Fifteen mutations were reported, including twelve novel and three already described in 14 sporadic patients and in 3 familial cases. Moreover, seven novel polymorphisms were also described. Most of the mutations characterised were microdeletions spanning one or more nucleotides, in addition to an insertion of one nucleotide in exon 18 and a stop mutation. The deletions and the insertion described cause a premature termination of translation, resulting in a truncated protein. Conclusion This study confirms that almost all the TCOF1 pathogenic mutations fall in the coding region and lead to an aberrant protein. PMID:21951868

Novel mutations of TCOF1 gene in European patients with Treacher Collins syndrome.

PubMed

Conte, Chiara; D'Apice, Maria Rosaria; Rinaldi, Fabrizio; Gambardella, Stefano; Sangiuolo, Federica; Novelli, Giuseppe

2011-09-27

Treacher Collins syndrome (TCS) is one of the most severe autosomal dominant congenital disorders of craniofacial development and shows variable phenotypic expression. TCS is extremely rare, occurring with an incidence of 1 in 50.000 live births. The TCS distinguishing characteristics are represented by down slanting palpebral fissures, coloboma of the eyelid, micrognathia, microtia and other deformity of the ears, hypoplastic zygomatic arches, and macrostomia. Conductive hearing loss and cleft palate are often present. TCS results from mutations in the TCOF1 gene located on chromosome 5, which encodes a serine/alanine-rich nucleolar phospho-protein called Treacle. However, alterations in the TCOF1 gene have been implicated in only 81-93% of TCS cases. In this study, the entire coding regions of the TCOF1 gene, including newly described exons 6A and 16A, were sequenced in 46 unrelated subjects suspected of TCS clinical indication. Fifteen mutations were reported, including twelve novel and three already described in 14 sporadic patients and in 3 familial cases. Moreover, seven novel polymorphisms were also described. Most of the mutations characterised were microdeletions spanning one or more nucleotides, in addition to an insertion of one nucleotide in exon 18 and a stop mutation. The deletions and the insertion described cause a premature termination of translation, resulting in a truncated protein. This study confirms that almost all the TCOF1 pathogenic mutations fall in the coding region and lead to an aberrant protein.

Decoding Mechanisms by which Silent Codon Changes Influence Protein Biogenesis and Function

PubMed Central

Bali, Vedrana; Bebok, Zsuzsanna

2015-01-01

Scope Synonymous codon usage has been a focus of investigation since the discovery of the genetic code and its redundancy. The occurrences of synonymous codons vary between species and within genes of the same genome, known as codon usage bias. Today, bioinformatics and experimental data allow us to compose a global view of the mechanisms by which the redundancy of the genetic code contributes to the complexity of biological systems from affecting survival in prokaryotes, to fine tuning the structure and function of proteins in higher eukaryotes. Studies analyzing the consequences of synonymous codon changes in different organisms have revealed that they impact nucleic acid stability, protein levels, structure and function without altering amino acid sequence. As such, synonymous mutations inevitably contribute to the pathogenesis of complex human diseases. Yet, fundamental questions remain unresolved regarding the impact of silent mutations in human disorders. In the present review we describe developments in this area concentrating on mechanisms by which synonymous mutations may affect protein function and human health. Purpose This synopsis illustrates the significance of synonymous mutations in disease pathogenesis. We review the different steps of gene expression affected by silent mutations, and assess the benefits and possible harmful effects of codon optimization applied in the development of therapeutic biologics. Physiological and medical relevance Understanding mechanisms by which synonymous mutations contribute to complex diseases such as cancer, neurodegeneration and genetic disorders, including the limitations of codon-optimized biologics, provides insight concerning interpretation of silent variants and future molecular therapies. PMID:25817479

DOE Office of Scientific and Technical Information (OSTI.GOV)

Vassilevska, Tanya

This is the first code, designed to run on a desktop, which models the intracellular replication and the cell-to-cell infection and demonstrates virus evolution at the molecular level. This code simulates the infection of a population of "idealized biological cells" (represented as objects that do not divide or have metabolism) with "virus" (represented by its genetic sequence), the replication and simultaneous mutation of the virus which leads to evolution of the population of genetically diverse viruses. The code is built to simulate single-stranded RNA viruses. The input for the code is 1. the number of biological cells in the culture,more » 2. the initial composition of the virus population, 3. the reference genome of the RNA virus, 4. the coordinates of the genome regions and their significance and, 5. parameters determining the dynamics of virus replication, such as the mutation rate. The simulation ends when all cells have been infected or when no more infections occurs after a given number of attempts. The code has the ability to simulate the evolution of the virus in serial passage of cell "cultures", i.e. after the end of a simulation, a new one is immediately scheduled with a new culture of infected cells. The code outputs characteristics of the resulting virus population dynamics and genetic composition of the virus population, such as the top dominant genomes, percentage of a genome with specific characteristics.« less

Diverse point mutations in the human gene for polymorphic N-acetyltransferase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Vatsis, K.P.; Martell, K.J.; Weber, W.W.

1991-07-15

Classification of humans as rapid or slow acetylators is based on hereditary differences in rates of N-acetylation of therapeutic and carcinogenic agents, but N-acetylation of certain arylamine drugs displays no genetic variation. Two highly homologous human genes for N-acetyltransferase NAT1 and NAT2, presumably code for the genetically invariant and variant NAT proteins, respectively. In the present investigation, 1.9-kilobase human genomic EcoRI fragments encoding NAT2 were generated by the polymerase chain reaction with liver and leukocyte DNA from seven subjects phenotyped as homozygous and heterozygous acetylators. Direct sequencing revealed multiple point mutations in the coding region of two distinct NAT2 variants.more » One of these was derived from leukocytes of a slow acetylator and was distinguished by a silent mutation (coden 94) and a separate G {r arrow} A transition (position 590) leading to replacement of Arg-197 by Gln; the mutated guanine was part of a CpG dinucleotide and a Taq I site. The second NAT2 variant originated from liver with low N-acetylation activity. It was characterized by three nucleotide transitions giving rise to a silent mutation (codon 161), accompanied by obliteration of the sole Kpn I site, and two amino acid substitutions. The results show conclusively that the genetically variant NAT is encoded by NAT2.« less

Epigenome Aberrations: Emerging Driving Factors of the Clear Cell Renal Cell Carcinoma

PubMed Central

Mehdi, Ali; Riazalhosseini, Yasser

2017-01-01

Clear cell renal cell carcinoma (ccRCC), the most common form of Kidney cancer, is characterized by frequent mutations of the von Hippel-Lindau (VHL) tumor suppressor gene in ~85% of sporadic cases. Loss of pVHL function affects multiple cellular processes, among which the activation of hypoxia inducible factor (HIF) pathway is the best-known function. Constitutive activation of HIF signaling in turn activates hundreds of genes involved in numerous oncogenic pathways, which contribute to the development or progression of ccRCC. Although VHL mutations are considered as drivers of ccRCC, they are not sufficient to cause the disease. Recent genome-wide sequencing studies of ccRCC have revealed that mutations of genes coding for epigenome modifiers and chromatin remodelers, including PBRM1, SETD2 and BAP1, are the most common somatic genetic abnormalities after VHL mutations in these tumors. Moreover, recent research has shed light on the extent of abnormal epigenome alterations in ccRCC tumors, including aberrant DNA methylation patterns, abnormal histone modifications and deregulated expression of non-coding RNAs. In this review, we discuss the epigenetic modifiers that are commonly mutated in ccRCC, and our growing knowledge of the cellular processes that are impacted by them. Furthermore, we explore new avenues for developing therapeutic approaches based on our knowledge of epigenome aberrations of ccRCC. PMID:28812986

Epigenome Aberrations: Emerging Driving Factors of the Clear Cell Renal Cell Carcinoma.

PubMed

Mehdi, Ali; Riazalhosseini, Yasser

2017-08-16

Clear cell renal cell carcinoma (ccRCC), the most common form of Kidney cancer, is characterized by frequent mutations of the von Hippel-Lindau ( VHL ) tumor suppressor gene in ~85% of sporadic cases. Loss of pVHL function affects multiple cellular processes, among which the activation of hypoxia inducible factor (HIF) pathway is the best-known function. Constitutive activation of HIF signaling in turn activates hundreds of genes involved in numerous oncogenic pathways, which contribute to the development or progression of ccRCC. Although VHL mutations are considered as drivers of ccRCC, they are not sufficient to cause the disease. Recent genome-wide sequencing studies of ccRCC have revealed that mutations of genes coding for epigenome modifiers and chromatin remodelers, including PBRM1 , SETD2 and BAP1 , are the most common somatic genetic abnormalities after VHL mutations in these tumors. Moreover, recent research has shed light on the extent of abnormal epigenome alterations in ccRCC tumors, including aberrant DNA methylation patterns, abnormal histone modifications and deregulated expression of non-coding RNAs. In this review, we discuss the epigenetic modifiers that are commonly mutated in ccRCC, and our growing knowledge of the cellular processes that are impacted by them. Furthermore, we explore new avenues for developing therapeutic approaches based on our knowledge of epigenome aberrations of ccRCC.

Absence of Putative Artemisinin Resistance Mutations Among Plasmodium falciparum in Sub-Saharan Africa: A Molecular Epidemiologic Study

PubMed Central

Taylor, Steve M.; Parobek, Christian M.; DeConti, Derrick K.; Kayentao, Kassoum; Coulibaly, Sheick Oumar; Greenwood, Brian M.; Tagbor, Harry; Williams, John; Bojang, Kalifa; Njie, Fanta; Desai, Meghna; Kariuki, Simon; Gutman, Julie; Mathanga, Don P.; Mårtensson, Andreas; Ngasala, Billy; Conrad, Melissa D.; Rosenthal, Philip J.; Tshefu, Antoinette K.; Moormann, Ann M.; Vulule, John M.; Doumbo, Ogobara K.; ter Kuile, Feiko O.; Meshnick, Steven R.; Bailey, Jeffrey A.; Juliano, Jonathan J.

2015-01-01

Plasmodium falciparum parasites that are resistant to artemisinins have been detected in Southeast Asia. Resistance is associated with several polymorphisms in the parasite's K13-propeller gene. The molecular epidemiology of these artemisinin resistance genotypes in African parasite populations is unknown. We developed an assay to quantify rare polymorphisms in parasite populations that uses a pooled deep-sequencing approach to score allele frequencies, validated it by evaluating mixtures of laboratory parasite strains, and then used it to screen P. falciparum parasites from >1100 African infections collected since 2002 from 14 sites across sub-Saharan Africa. We found no mutations in African parasite populations that are associated with artemisinin resistance in Southeast Asian parasites. However, we observed 15 coding mutations, including 12 novel mutations, and limited allele sharing between parasite populations, consistent with a large reservoir of naturally occurring K13-propeller variation. Although polymorphisms associated with artemisinin resistance in P. falciparum in Southeast Asia are not prevalent in sub-Saharan Africa, numerous K13-propeller coding polymorphisms circulate in Africa. Although their distributions do not support a widespread selective sweep for an artemisinin-resistant phenotype, the impact of these mutations on artemisinin susceptibility is unknown and will require further characterization. Rapid, scalable molecular surveillance offers a useful adjunct in tracking and containing artemisinin resistance. PMID:25180240

Shared genetic predisposition in rheumatoid arthritis-interstitial lung disease and familial pulmonary fibrosis.

PubMed

Juge, Pierre-Antoine; Borie, Raphaël; Kannengiesser, Caroline; Gazal, Steven; Revy, Patrick; Wemeau-Stervinou, Lidwine; Debray, Marie-Pierre; Ottaviani, Sébastien; Marchand-Adam, Sylvain; Nathan, Nadia; Thabut, Gabriel; Richez, Christophe; Nunes, Hilario; Callebaut, Isabelle; Justet, Aurélien; Leulliot, Nicolas; Bonnefond, Amélie; Salgado, David; Richette, Pascal; Desvignes, Jean-Pierre; Lioté, Huguette; Froguel, Philippe; Allanore, Yannick; Sand, Olivier; Dromer, Claire; Flipo, René-Marc; Clément, Annick; Béroud, Christophe; Sibilia, Jean; Coustet, Baptiste; Cottin, Vincent; Boissier, Marie-Christophe; Wallaert, Benoit; Schaeverbeke, Thierry; Dastot le Moal, Florence; Frazier, Aline; Ménard, Christelle; Soubrier, Martin; Saidenberg, Nathalie; Valeyre, Dominique; Amselem, Serge; Boileau, Catherine; Crestani, Bruno; Dieudé, Philippe

2017-05-01

Despite its high prevalence and mortality, little is known about the pathogenesis of rheumatoid arthritis-associated interstitial lung disease (RA-ILD). Given that familial pulmonary fibrosis (FPF) and RA-ILD frequently share the usual pattern of interstitial pneumonia and common environmental risk factors, we hypothesised that the two diseases might share additional risk factors, including FPF-linked genes. Our aim was to identify coding mutations of FPF-risk genes associated with RA-ILD.We used whole exome sequencing (WES), followed by restricted analysis of a discrete number of FPF-linked genes and performed a burden test to assess the excess number of mutations in RA-ILD patients compared to controls.Among the 101 RA-ILD patients included, 12 (11.9%) had 13 WES-identified heterozygous mutations in the TERT , RTEL1 , PARN or SFTPC coding regions . The burden test, based on 81 RA-ILD patients and 1010 controls of European ancestry, revealed an excess of TERT , RTEL1 , PARN or SFTPC mutations in RA-ILD patients (OR 3.17, 95% CI 1.53-6.12; p=9.45×10 -4 ). Telomeres were shorter in RA-ILD patients with a TERT , RTEL1 or PARN mutation than in controls (p=2.87×10 -2 ).Our results support the contribution of FPF-linked genes to RA-ILD susceptibility. Copyright ©ERS 2017.

An analytical framework for whole-genome sequence association studies and its implications for autism spectrum disorder.

PubMed

Werling, Donna M; Brand, Harrison; An, Joon-Yong; Stone, Matthew R; Zhu, Lingxue; Glessner, Joseph T; Collins, Ryan L; Dong, Shan; Layer, Ryan M; Markenscoff-Papadimitriou, Eirene; Farrell, Andrew; Schwartz, Grace B; Wang, Harold Z; Currall, Benjamin B; Zhao, Xuefang; Dea, Jeanselle; Duhn, Clif; Erdman, Carolyn A; Gilson, Michael C; Yadav, Rachita; Handsaker, Robert E; Kashin, Seva; Klei, Lambertus; Mandell, Jeffrey D; Nowakowski, Tomasz J; Liu, Yuwen; Pochareddy, Sirisha; Smith, Louw; Walker, Michael F; Waterman, Matthew J; He, Xin; Kriegstein, Arnold R; Rubenstein, John L; Sestan, Nenad; McCarroll, Steven A; Neale, Benjamin M; Coon, Hilary; Willsey, A Jeremy; Buxbaum, Joseph D; Daly, Mark J; State, Matthew W; Quinlan, Aaron R; Marth, Gabor T; Roeder, Kathryn; Devlin, Bernie; Talkowski, Michael E; Sanders, Stephan J

2018-05-01

Genomic association studies of common or rare protein-coding variation have established robust statistical approaches to account for multiple testing. Here we present a comparable framework to evaluate rare and de novo noncoding single-nucleotide variants, insertion/deletions, and all classes of structural variation from whole-genome sequencing (WGS). Integrating genomic annotations at the level of nucleotides, genes, and regulatory regions, we define 51,801 annotation categories. Analyses of 519 autism spectrum disorder families did not identify association with any categories after correction for 4,123 effective tests. Without appropriate correction, biologically plausible associations are observed in both cases and controls. Despite excluding previously identified gene-disrupting mutations, coding regions still exhibited the strongest associations. Thus, in autism, the contribution of de novo noncoding variation is probably modest in comparison to that of de novo coding variants. Robust results from future WGS studies will require large cohorts and comprehensive analytical strategies that consider the substantial multiple-testing burden.

A Bioinformatics Workflow for Variant Peptide Detection in Shotgun Proteomics*

PubMed Central

Li, Jing; Su, Zengliu; Ma, Ze-Qiang; Slebos, Robbert J. C.; Halvey, Patrick; Tabb, David L.; Liebler, Daniel C.; Pao, William; Zhang, Bing

2011-01-01

Shotgun proteomics data analysis usually relies on database search. However, commonly used protein sequence databases do not contain information on protein variants and thus prevent variant peptides and proteins from been identified. Including known coding variations into protein sequence databases could help alleviate this problem. Based on our recently published human Cancer Proteome Variation Database, we have created a protein sequence database that comprehensively annotates thousands of cancer-related coding variants collected in the Cancer Proteome Variation Database as well as noncancer-specific ones from the Single Nucleotide Polymorphism Database (dbSNP). Using this database, we then developed a data analysis workflow for variant peptide identification in shotgun proteomics. The high risk of false positive variant identifications was addressed by a modified false discovery rate estimation method. Analysis of colorectal cancer cell lines SW480, RKO, and HCT-116 revealed a total of 81 peptides that contain either noncancer-specific or cancer-related variations. Twenty-three out of 26 variants randomly selected from the 81 were confirmed by genomic sequencing. We further applied the workflow on data sets from three individual colorectal tumor specimens. A total of 204 distinct variant peptides were detected, and five carried known cancer-related mutations. Each individual showed a specific pattern of cancer-related mutations, suggesting potential use of this type of information for personalized medicine. Compatibility of the workflow has been tested with four popular database search engines including Sequest, Mascot, X!Tandem, and MyriMatch. In summary, we have developed a workflow that effectively uses existing genomic data to enable variant peptide detection in proteomics. PMID:21389108

Adenylosuccinate lyase (ADSL) and infantile autism: Absence of previously reported point mutation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Fon, E.A.; Sarrazin, J.; Rouleau, G.A.

Autism is a heterogeneous neuropsychiatric syndrome of unknown etiology. There is evidence that a deficiency in the enzyme adenylosuccinate lyase (ADSL), essential for de novo purine biosynthesis, could be involved in the pathogenesis of certain cases. A point mutation in the ADSL gene, resulting in a predicted serine-to-proline substitution and conferring structural instability to the mutant enzyme, has been reported previously in 3 affected siblings. In order to determine the prevalence of the mutation, we PCR-amplified the exon spanning the site of this mutation from the genomic DNA of patients fulfilling DSM-III-R criteria for autistic disorder. None of the 119more » patients tested were found to have this mutation. Furthermore, on preliminary screening using single-strand conformation polymorphism (SSCP), no novel mutations were detected in the coding sequence of four ADSL exons, spanning approximately 50% of the cDNA. In light of these findings, it appears that mutations in the ADSL gene represent a distinctly uncommon cause of autism. 12 refs., 2 figs.« less

Role of LRRK2 and SNCA in autosomal dominant Parkinson's disease in Turkey.

PubMed

Kessler, Christoph; Atasu, Burcu; Hanagasi, Hasmet; Simón-Sánchez, Javier; Hauser, Ann-Kathrin; Pak, Meltem; Bilgic, Basar; Erginel-Unaltuna, Nihan; Gurvit, Hakan; Gasser, Thomas; Lohmann, Ebba

2018-03-01

Mutations in the LRRK2 and alpha-synuclein (SNCA) genes are well-established causes of autosomal dominant Parkinson's disease (PD). However, their frequency differs widely between ethnic groups. Only three studies have screened all coding regions of LRRK2 and SNCA in European samples so far. In Turkey, the role of LRRK2 in Parkinson's disease has been studied fragmentarily, and the incidence of SNCA copy number variations is unknown. The purpose of this study is to determine the frequency of LRRK2 and SNCA mutations in autosomal dominant PD in Turkey. We performed Sanger sequencing of all coding LRRK2 and SNCA exons in a sample of 91 patients with Parkinsonism. Copy number variations in SNCA, PRKN, PINK1, DJ1 and ATP13A2 were assessed using the MLPA method. All patients had a positive family history compatible with autosomal dominant inheritance. Known mutations in LRRK2 and SNCA were found in 3.3% of cases: one patient harbored the LRRK2 G2019S mutation, and two patients carried a SNCA gene duplication. Furthermore, we found a heterozygous deletion of PRKN exon 2 in one patient, and four rare coding variants of unknown significance (LRRK2: A211V, R1067Q, T2494I; SNCA: T72T). Genetic testing in one affected family identified the LRRK2 R1067Q variant as a possibly pathogenic substitution. Point mutations in LRRK2 and SNCA are a rare cause of autosomal dominant PD in Turkey. However, copy number variations should be considered. The unclassified variants, especially LRRK2 R1067Q, demand further investigation. Copyright © 2017. Published by Elsevier Ltd.

Reconstitution of wild type viral DNA in simian cells transfected with early and late SV40 defective genomes.

PubMed

O'Neill, F J; Gao, Y; Xu, X

1993-11-01

The DNAs of polyomaviruses ordinarily exist as a single circular molecule of approximately 5000 base pairs. Variants of SV40, BKV and JCV have been described which contain two complementing defective DNA molecules. These defectives, which form a bipartite genome structure, contain either the viral early region or the late region. The defectives have the unique property of being able to tolerate variable sized reiterations of regulatory and terminus region sequences, and portions of the coding region. They can also exchange coding region sequences with other polyomaviruses. It has been suggested that the bipartite genome structure might be a stage in the evolution of polyomaviruses which can uniquely sustain genome and sequence diversity. However, it is not known if the regulatory and terminus region sequences are highly mutable. Also, it is not known if the bipartite genome structure is reversible and what the conditions might be which would favor restoration of the monomolecular genome structure. We addressed the first question by sequencing the reiterated regulatory and terminus regions of E- and L-SV40 DNAs. This revealed a large number of mutations in the regulatory regions of the defective genomes, including deletions, insertions, rearrangements and base substitutions. We also detected insertions and base substitutions in the T-antigen gene. We addressed the second question by introducing into permissive simian cells, E- and L-SV40 genomes which had been engineered to contain only a single regulatory region. Analysis of viral DNA from transfected cells demonstrated recombined genomes containing a wild type monomolecular DNA structure. However, the complete defectives, containing reiterated regulatory regions, could often compete away the wild type genomes. The recombinant monomolecular genomes were isolated, cloned and found to be infectious. All of the DNA alterations identified in one of the regulatory regions of E-SV40 DNA were present in the recombinant monomolecular genomes. These and other findings indicate that the bipartite genome state can sustain many mutations which wtSV40 cannot directly sustain. However, the mutations can later be introduced into the wild type genomes when the E- and L-SV40 DNAs recombine to generate a new monomolecular genome structure.

A Novel Subgenomic Murine Leukemia Virus RNA Transcript Results from Alternative Splicing

PubMed Central

Déjardin, Jérôme; Bompard-Maréchal, Guillaume; Audit, Muriel; Hope, Thomas J.; Sitbon, Marc; Mougel, Marylène

2000-01-01

Here we show the existence of a novel subgenomic 4.4-kb RNA in cells infected with the prototypic replication-competent Friend or Moloney murine leukemia viruses (MuLV). This RNA derives by splicing from an alternative donor site (SD′) within the capsid-coding region to the canonical envelope splice acceptor site. The position and the sequence of SD′ was highly conserved among mammalian type C and D oncoviruses. Point mutations used to inactivate SD′ without changing the capsid-coding ability affected viral RNA splicing and reduced viral replication in infected cells. PMID:10729146

Cloning and sequence analysis of a cDNA encoding the alpha-subunit of mouse beta-N-acetylhexosaminidase and comparison with the human enzyme.

PubMed Central

Beccari, T; Hoade, J; Orlacchio, A; Stirling, J L

1992-01-01

cDNAs encoding the mouse beta-N-acetylhexosaminidase alpha-subunit were isolated from a mouse testis library. The longest of these (1.7 kb) was sequenced and showed 83% similarity with the human alpha-subunit cDNA sequence. The 5' end of the coding sequence was obtained from a genomic DNA clone. Alignment of the human and mouse sequences showed that all three putative N-glycosylation sites are conserved, but that the mouse alpha-subunit has an additional site towards the C-terminus. All eight cysteines in the human sequence are conserved in the mouse. There are an additional two cysteines in the mouse alpha-subunit signal peptide. All amino acids affected in Tay-Sachs-disease mutations are conserved in the mouse. Images Fig. 1. PMID:1379046

Complete genome sequence of a coxsackievirus B3 recombinant isolated from an aseptic meningitis outbreak in eastern China.

PubMed

Zhang, Wenqiang; Lin, Xiaojuan; Jiang, Ping; Tao, Zexin; Liu, Xiaolin; Ji, Feng; Wang, Tongzhan; Wang, Suting; Lv, Hui; Xu, Aiqiang; Wang, Haiyan

2016-08-01

Coxsackievirus B3 (CV-B3) has frequently been associated with aseptic meningitis outbreaks in China. To identify sequence motifs related to aseptic meningitis and to construct an infectious clone, the genome sequence of 08TC170, a representative strain isolated from cerebrospinal fluid (CSF) samples from an outbreak in Shandong in 2008, was determined, and the coding regions for P1-P3 and VP1 were aligned. The first 21 and last 20 residues were "TTAAAACAGCCTGTGGGTTGT" and "ATTCTCCGCATTCGGTGCGG", respectively. The whole genome consisted of 7401 nucleotides, sharing 80.8 % identity with the prototype strain Nancy and low sequence similarity with members of clusters A-C. In contrast, 08TC170 showed high sequence similarity to members of cluster D. An especially high level of sequence identity (≥97.7 %) was found within a branch constituted by 08TC170 and four Chinese strains that clustered together in all of the P1-P3 phylogenic trees. In addition, 08TC170 also possessed a close relationship to the Hong Kong strain 26362/08 in VP1. Similarity plot analysis showed that 08TC170 was most similar to the Chinese CV-B3 strain SSM in P1 and the partial P2 coding region but to the CV-B5 or E-6 strain in 2C and following regions. A T277A mutation was found in 08TC170 and other strains isolated in 2008-2010, but not in strains isolated before 2008, which had high sequence similarity and formed the cluster A277. The results suggested that 08TC170 was the product of both intertypic recombination and point mutation, whose effects on viral neurovirulence will be investigated in a further study. The high homology between 08TC170 and other strains revealed their co-circulation in mainland China and Hong Kong and indicates that further surveillance is needed.

A novel intronic mutation in the DDP1 gene in a family with X-linked dystonia-deafness syndrome.

PubMed

Ezquerra, Mario; Campdelacreu, Jaume; Muñoz, Esteban; Tolosa, Eduardo; Martí, María J

2005-02-01

X-linked dystonia-deafness syndrome (Mohr-Tranebjaerg syndrome) is a rare neurodegenerative disease characterized by hearing loss and dystonia. So far, 7 mutations in the coding region of the DDP1 gene have been described. They consist of frameshift, nonsense, missense mutations or deletions. To investigate the presence of mutations in the DDP1 gene in a family with dystonia-deafness syndrome. Seven members belonging to 2 generations of a family with 2 affected subjects underwent genetic analysis. Mutational screening in the DDP1 gene was made through DNA direct sequencing. We found an intronic mutation in the DDP1 gene. It consists of an A-to-C substitution in the position -23 in reference to the first nucleotide of exon 2 (IVS1-23A>C). The mutation was present in 2 affected men and their respective unaffected mothers, whereas it was absent in the healthy men from this family and in 90 healthy controls. Intronic mutations in the DDP1 gene can also cause X-linked dystonia-deafness syndrome. In our case, the effect of the mutation could be due to a splicing alteration.

Two novel mutations in the homogentisate-1,2-dioxygenase gene identified in Chinese Han Child with Alkaptonuria.

PubMed

Li, Hongying; Zhang, Kaihui; Xu, Qun; Ma, Lixia; Lv, Xin; Sun, Ruopeng

2015-03-01

Alkaptonuria (AKU) is an autosomal recessive disorder of tyrosine metabolism, which is caused by a defect in the enzyme homogentisate 1,2-dioxygenase (HGD) with subsequent accumulation of homogentisic acid. Presently, more than 100 HGD mutations have been identified as the cause of the inborn error of metabolism across different populations worldwide. However, the HGD mutation is very rarely reported in Asia, especially China. In this study, we present mutational analyses of HGD gene in one Chinese Han child with AKU, which had been identified by gas chromatography-mass spectrometry detection of organic acids in urine samples. PCR and DNA sequencing of the entire coding region as well as exon-intron boundaries of HGD have been performed. Two novel mutations were identified in the HGD gene in this AKU case, a frameshift mutation of c.115delG in exon 3 and the splicing mutation of IVS5+3 A>C, a donor splice site of the exon 5 and exon-intron junction. The identification of these mutations in this study further expands the spectrum of known HGD gene mutations and contributes to prenatal molecular diagnosis of AKU.

Autosomal recessive congenital cataract in captive-bred vervet monkeys (Chlorocebus aethiops).

PubMed

Magwebu, Zandisiwe E; Abdul-Rasool, Sahar; Seier, Jürgen V; Chauke, Chesa G

2018-04-01

The aim of the study was to evaluate the genetic predisposition of congenital cataract in a colony of captive-bred vervet monkeys. Four congenital cataract genes: glucosaminyl (N-acetyl) transferase 2 (GCNT2), heat shock transcription factor 4 (HSF4), crystallin alpha A (CRYAA) and lens intrinsic membrane protein-2 (LIM2) were screened, sequenced and analysed for possible genetic variants in 36 monkeys. Gene expression was also evaluated in these genes. Fifteen sequence variants were identified in the coding regions of three genes (GCNT2, HSF4 and CRYAA). Of these variations, only three were missense mutations (M258V, V16I and S24N) and identified in the GCNT2 transcripts A, B and C, respectively, which resulted in a downregulated gene expression. Although the three missense mutations in GCNT2 have a benign effect, a possibility exists that the candidate genes (GCNT2, HSF4 and CRYAA) might harbour mutations that are responsible for total congenital cataract. © 2018 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Impaired riboflavin transport due to missense mutations in SLC52A2 causes Brown-Vialetto-Van Laere syndrome.

PubMed

Haack, Tobias B; Makowski, Christine; Yao, Yoshiaki; Graf, Elisabeth; Hempel, Maja; Wieland, Thomas; Tauer, Ulrike; Ahting, Uwe; Mayr, Johannes A; Freisinger, Peter; Yoshimatsu, Hiroki; Inui, Ken; Strom, Tim M; Meitinger, Thomas; Yonezawa, Atsushi; Prokisch, Holger

2012-11-01

Brown-Vialetto-Van Laere syndrome (BVVLS [MIM 211530]) is a rare neurological disorder characterized by infancy onset sensorineural deafness and ponto-bulbar palsy. Mutations in SLC52A3 (formerly C20orf54), coding for riboflavin transporter 2 (hRFT2), have been identified as the molecular genetic correlate in several individuals with BVVLS. Exome sequencing of just one single case revealed that compound heterozygosity for two pathogenic mutations in the SLC52A2 gene coding for riboflavin transporter 3 (hRFT3), another member of the riboflavin transporter family, is also associated with BVVLS. Overexpression studies confirmed that the gene products of both mutant alleles have reduced riboflavin transport activities. While mutations in SLC52A3 cause decreased plasma riboflavin levels, concordant with a role of SLC52A3 in riboflavin uptake from food, the SLC52A2-mutant individual had normal plasma riboflavin concentrations, a finding in line with a postulated function of SLC52A2 in riboflavin uptake from blood into target cells. Our results contribute to the understanding of human riboflavin metabolism and underscore its role in the pathogenesis of BVVLS, thereby providing a rational basis for a high-dose riboflavin treatment.

Evolution of the Pseudomonas aeruginosa mutational resistome in an international Cystic Fibrosis clone.

PubMed

López-Causapé, Carla; Sommer, Lea Mette; Cabot, Gabriel; Rubio, Rosa; Ocampo-Sosa, Alain A; Johansen, Helle Krogh; Figuerola, Joan; Cantón, Rafael; Kidd, Timothy J; Molin, Soeren; Oliver, Antonio

2017-07-17

Emergence of epidemic clones and antibiotic resistance development compromises the management of Pseudomonas aeruginosa cystic fibrosis (CF) chronic respiratory infections. Whole genome sequencing (WGS) was used to decipher the phylogeny, interpatient dissemination, WGS mutator genotypes (mutome) and resistome of a widespread clone (CC274), in isolates from two highly-distant countries, Australia and Spain, covering an 18-year period. The coexistence of two divergent CC274 clonal lineages was revealed, but without evident geographical barrier; phylogenetic reconstructions and mutational resistome demonstrated the interpatient transmission of mutators. The extraordinary capacity of P. aeruginosa to develop resistance was evidenced by the emergence of mutations in >100 genes related to antibiotic resistance during the evolution of CC274, catalyzed by mutator phenotypes. While the presence of classical mutational resistance mechanisms was confirmed and correlated with resistance phenotypes, results also showed a major role of unexpected mutations. Among them, PBP3 mutations, shaping up β-lactam resistance, were noteworthy. A high selective pressure for mexZ mutations was evidenced, but we showed for the first time that high-level aminoglycoside resistance in CF is likely driven by mutations in fusA1/fusA2, coding for elongation factor G. Altogether, our results provide valuable information for understanding the evolution of the mutational resistome of CF P. aeruginosa.

The complete sequence of mitochondrial genome of polled yak (Bos grunniens).

PubMed

Chu, Min; Wu, Xiaoyun; Liang, Chunnian; Pei, Jie; Ding, Xuezhi; Guo, Xian; Bao, Pengjia; Yan, Ping

2016-05-01

Generally speaking, the hornless trait is also known as polled. Although the POLL locus could be assigned to a 1.36-Mb interval in the centromeric region of BTA1 (Georges et al., 1993; Drögemüller et al., 2005)), and (Liu et al., 2014) reported a 147-kb segment that included three protein-coding genes was the most likely location of the POLL mutation in domestic yaks, the underlying genetic basis for the polled trait is still unknown. In this work, the complete mitochondrial genome sequence of polled yak was determined for the first time. The total length of the mitogenome is 16,324 bp long, with the base composition of 33.72% A, 27.25% T, 25.83% C, and 13.20% G. It contained 13 protein-coding genes, 22 tRNA genes, 2 rRNA genes and 1 non-coding region (D-loop region). The gene order of polled yak mitogenome is identical to that observed in most other vertebrates. The complete mitogenome sequence information of polled yak will provide useful data for further studies on protection of genetic resources and phylogenetic relationships within Bos grunniens.

Hidden Structural Codes in Protein Intrinsic Disorder.

PubMed

Borkosky, Silvia S; Camporeale, Gabriela; Chemes, Lucía B; Risso, Marikena; Noval, María Gabriela; Sánchez, Ignacio E; Alonso, Leonardo G; de Prat Gay, Gonzalo

2017-10-17

Intrinsic disorder is a major structural category in biology, accounting for more than 30% of coding regions across the domains of life, yet consists of conformational ensembles in equilibrium, a major challenge in protein chemistry. Anciently evolved papillomavirus genomes constitute an unparalleled case for sequence to structure-function correlation in cases in which there are no folded structures. E7, the major transforming oncoprotein of human papillomaviruses, is a paradigmatic example among the intrinsically disordered proteins. Analysis of a large number of sequences of the same viral protein allowed for the identification of a handful of residues with absolute conservation, scattered along the sequence of its N-terminal intrinsically disordered domain, which intriguingly are mostly leucine residues. Mutation of these led to a pronounced increase in both α-helix and β-sheet structural content, reflected by drastic effects on equilibrium propensities and oligomerization kinetics, and uncovers the existence of local structural elements that oppose canonical folding. These folding relays suggest the existence of yet undefined hidden structural codes behind intrinsic disorder in this model protein. Thus, evolution pinpoints conformational hot spots that could have not been identified by direct experimental methods for analyzing or perturbing the equilibrium of an intrinsically disordered protein ensemble.

Comprehensive molecular diagnosis of Epstein-Barr virus-associated lymphoproliferative diseases using next-generation sequencing.

PubMed

Ono, Shintaro; Nakayama, Manabu; Kanegane, Hirokazu; Hoshino, Akihiro; Shimodera, Saeko; Shibata, Hirofumi; Fujino, Hisanori; Fujino, Takahiro; Yunomae, Yuta; Okano, Tsubasa; Yamashita, Motoi; Yasumi, Takahiro; Izawa, Kazushi; Takagi, Masatoshi; Imai, Kohsuke; Zhang, Kejian; Marsh, Rebecca; Picard, Capucine; Latour, Sylvain; Ohara, Osamu; Morio, Tomohiro

2018-05-18

Epstein-Barr virus (EBV) is associated with several life-threatening diseases, such as lymphoproliferative disease (LPD), particularly in immunocompromised hosts. Some categories of primary immunodeficiency diseases (PIDs) including X-linked lymphoproliferative syndrome (XLP), are characterized by susceptibility and vulnerability to EBV infection. The number of genetically defined PIDs is rapidly increasing, and clinical genetic testing plays an important role in establishing a definitive diagnosis. Whole-exome sequencing is performed for diagnosing rare genetic diseases, but is both expensive and time-consuming. Low-cost, high-throughput gene analysis systems are thus necessary. We developed a comprehensive molecular diagnostic method using a two-step tailed polymerase chain reaction (PCR) and a next-generation sequencing (NGS) platform to detect mutations in 23 candidate genes responsible for XLP or XLP-like diseases. Samples from 19 patients suspected of having EBV-associated LPD were used in this comprehensive molecular diagnosis. Causative gene mutations (involving PRF1 and SH2D1A) were detected in two of the 19 patients studied. This comprehensive diagnosis method effectively detected mutations in all coding exons of 23 genes with sufficient read numbers for each amplicon. This comprehensive molecular diagnostic method using PCR and NGS provides a rapid, accurate, low-cost diagnosis for patients with XLP or XLP-like diseases.

Clinically actionable mutation profiles in patients with cancer identified by whole-genome sequencing

PubMed Central

Mizani, Tuba; Hamblin, Angela; Parton, Marina; Orosz, Zsolt; Athanasou, Nick; Hassan, Bass; Flanagan, Adrienne M.; Ahmed, Ahmed; Winter, Stuart; Harris, Adrian; Popitsch, Niko; Church, David; Taylor, Jenny C.

2018-01-01

Next-generation sequencing (NGS) efforts have established catalogs of mutations relevant to cancer development. However, the clinical utility of this information remains largely unexplored. Here, we present the results of the first eight patients recruited into a clinical whole-genome sequencing (WGS) program in the United Kingdom. We performed PCR-free WGS of fresh frozen tumors and germline DNA at 75× and 30×, respectively, using the HiSeq2500 HTv4. Subtracted tumor VCFs and paired germlines were subjected to comprehensive analysis of coding and noncoding regions, integration of germline with somatically acquired variants, and global mutation signatures and pathway analyses. Results were classified into tiers and presented to a multidisciplinary tumor board. WGS results helped to clarify an uncertain histopathological diagnosis in one case, led to informed or supported prognosis in two cases, leading to de-escalation of therapy in one, and indicated potential treatments in all eight. Overall 26 different tier 1 potentially clinically actionable findings were identified using WGS compared with six SNVs/indels using routine targeted NGS. These initial results demonstrate the potential of WGS to inform future diagnosis, prognosis, and treatment choice in cancer and justify the systematic evaluation of the clinical utility of WGS in larger cohorts of patients with cancer. PMID:29610388

The Effect of α-Mating Factor Secretion Signal Mutations on Recombinant Protein Expression in Pichia pastoris

PubMed Central

Lin-Cereghino, Geoff P.; Stark, Carolyn M.; Kim, Daniel; Chang, Jennifer; Shaheen, Nadia; Poerwanto, Hansel; Agari, Kimiko; Moua, Pachai; Low, Lauren K.; Tran, Namphuong; Huang, Amy D.; Nattestad, Maria; Oshiro, Kristin T.; Chang, John William; Chavan, Archana; Tsai, Jerry W.; Lin-Cereghino, Joan

2013-01-01

The methylotrophic yeast, Pichia pastoris, has been genetically engineered to produce many heterologous proteins for industrial and research purposes. In order to secrete proteins for easier purification from the extracellular medium, the coding sequence of recombinant proteins are initially fused to the Saccharomyces cerevisiae α-mating factor secretion signal leader. Extensive site-directed mutagenesis of the prepro region of the α-mating factor secretion signal sequence was performed in order to determine the effects of various deletions and substitutions on expression. Though some mutations clearly dampened protein expression, deletion of amino acids 57-70, corresponding to the predicted 3rd alpha helix of α-mating factor secretion signal, increased secretion of reporter proteins horseradish peroxidase and lipase at least 50% in small-scale cultures. These findings raise the possibility that the secretory efficiency of the leader can be further enhanced in the future. PMID:23454485

Mutational spectra of the lacI transgene isolated from Big Blue{reg_sign} mice exposed to three carcinogenic aromatic amines

DOE Office of Scientific and Technical Information (OSTI.GOV)

Staedtler, F.; Locher, F.; Sreenan, G.

1997-10-01

In order to evaluate the in vivo genotoxic potential of three putative genotoxic mouse liver carcinogens, high doses of 4-chloro-o-phenylenediamine, 2-nitro-p-phenylenediamine and 2, 4-diaminotoluene were tested short term in the Big Blue{reg_sign} transgenic mouse mutation assay. Small statistically significant increases in the lacI mutant frequencies in the liver by factors 1.7 to 2.0 were found. A representative number of 347 lacI mutants isolated from liver tissue of male and female animals were analyses by DNA sequencing. The mutational spectra were examined with the Adams-Skopek algorithm. The spontaneous mutational spectra from untreated male and female animals were similar and consistent withmore » spectral Big Blue{reg_sign} control data stored in the lacI database. Most of the background mutations were located in the 5{prime} portion of the coding region of the lacI gene. Single base substitutions were most prominent. G:C to A:T transitions and G:C to T:A transversions occurred predominatly and were preferentially located at CpG sites. Despite the increases observed in the mutant frequencies of the treated animals, the corresponding mutational spectra did not differ from the controls. However, it is possible that certain classes of point mutations were substantially increased but not detected due to the limited number of sequenced mutants. In two animals treated with 2, 4- diaminotoluene unusually high mutant frequencies and the multiple occurrence of certain mutations in the liver was observed. From one of these animals six lacI mutants isolated from colon tissue were all different. Since 2, 4-diaminotoluene was shown to induce liver cell proliferation these results may reflect clonal expansion of single mutated liver cells.« less

Mutations in GNA11 in Uveal Melanoma

PubMed Central

Van Raamsdonk, Catherine D.; Griewank, Klaus G.; Crosby, Michelle B.; Garrido, Maria C.; Vemula, Swapna; Wiesner, Thomas; Obenauf, Anna C.; Wackernagel, Werner; Green, Gary; Bouvier, Nancy; Sozen, M. Mert; Baimukanova, Gail; Roy, Ritu; Heguy, Adriana; Dolgalev, Igor; Khanin, Raya; Busam, Klaus; Speicher, Michael R.; O’Brien, Joan; Bastian, Boris C.

2011-01-01

BACKGROUND Uveal melanoma is the most common intraocular cancer. There are no effective therapies for metastatic disease. Mutations in GNAQ, the gene encoding an alpha subunit of heterotrimeric G proteins, are found in 40% of uveal melanomas. METHODS We sequenced exon 5 of GNAQ and GNA11, a paralogue of GNAQ, in 713 melanocytic neoplasms of different types (186 uveal melanomas, 139 blue nevi, 106 other nevi, and 282 other melanomas). We sequenced exon 4 of GNAQ and GNA11 in 453 of these samples and in all coding exons of GNAQ and GNA11 in 97 uveal melanomas and 45 blue nevi. RESULTS We found somatic mutations in exon 5 (affecting Q209) and in exon 4 (affecting R183) in both GNA11 and GNAQ, in a mutually exclusive pattern. Mutations affecting Q209 in GNA11 were present in 7% of blue nevi, 32% of primary uveal melanomas, and 57% of uveal melanoma metastases. In contrast, we observed Q209 mutations in GNAQ in 55% of blue nevi, 45% of uveal melanomas, and 22% of uveal melanoma metastases. Mutations affecting R183 in either GNAQ or GNA11 were less prevalent (2% of blue nevi and 6% of uveal melanomas) than the Q209 mutations. Mutations in GNA11 induced spontaneously metastasizing tumors in a mouse model and activated the mitogen-activated protein kinase pathway. CONCLUSIONS Of the uveal melanomas we analyzed, 83% had somatic mutations in GNAQ or GNA11. Constitutive activation of the pathway involving these two genes appears to be a major contributor to the development of uveal melanoma. (Funded by the National Institutes of Health and others.) PMID:21083380

Coevolutionary modeling of protein sequences: Predicting structure, function, and mutational landscapes

NASA Astrophysics Data System (ADS)

Weigt, Martin

Over the last years, biological research has been revolutionized by experimental high-throughput techniques, in particular by next-generation sequencing technology. Unprecedented amounts of data are accumulating, and there is a growing request for computational methods unveiling the information hidden in raw data, thereby increasing our understanding of complex biological systems. Statistical-physics models based on the maximum-entropy principle have, in the last few years, played an important role in this context. To give a specific example, proteins and many non-coding RNA show a remarkable degree of structural and functional conservation in the course of evolution, despite a large variability in amino acid sequences. We have developed a statistical-mechanics inspired inference approach - called Direct-Coupling Analysis - to link this sequence variability (easy to observe in sequence alignments, which are available in public sequence databases) to bio-molecular structure and function. In my presentation I will show, how this methodology can be used (i) to infer contacts between residues and thus to guide tertiary and quaternary protein structure prediction and RNA structure prediction, (ii) to discriminate interacting from non-interacting protein families, and thus to infer conserved protein-protein interaction networks, and (iii) to reconstruct mutational landscapes and thus to predict the phenotypic effect of mutations. References [1] M. Figliuzzi, H. Jacquier, A. Schug, O. Tenaillon and M. Weigt ''Coevolutionary landscape inference and the context-dependence of mutations in beta-lactamase TEM-1'', Mol. Biol. Evol. (2015), doi: 10.1093/molbev/msv211 [2] E. De Leonardis, B. Lutz, S. Ratz, S. Cocco, R. Monasson, A. Schug, M. Weigt ''Direct-Coupling Analysis of nucleotide coevolution facilitates RNA secondary and tertiary structure prediction'', Nucleic Acids Research (2015), doi: 10.1093/nar/gkv932 [3] F. Morcos, A. Pagnani, B. Lunt, A. Bertolino, D. Marks, C. Sander, R. Zecchina, J.N. Onuchic, T. Hwa, M. Weigt, ''Direct-coupling analysis of residue co-evolution captures native contacts across many protein families'', Proc. Natl. Acad. Sci. 108, E1293-E1301 (2011).

Using hidden Markov models and observed evolution to annotate viral genomes.

PubMed

McCauley, Stephen; Hein, Jotun

2006-06-01

ssRNA (single stranded) viral genomes are generally constrained in length and utilize overlapping reading frames to maximally exploit the coding potential within the genome length restrictions. This overlapping coding phenomenon leads to complex evolutionary constraints operating on the genome. In regions which code for more than one protein, silent mutations in one reading frame generally have a protein coding effect in another. To maximize coding flexibility in all reading frames, overlapping regions are often compositionally biased towards amino acids which are 6-fold degenerate with respect to the 64 codon alphabet. Previous methodologies have used this fact in an ad hoc manner to look for overlapping genes by motif matching. In this paper differentiated nucleotide compositional patterns in overlapping regions are incorporated into a probabilistic hidden Markov model (HMM) framework which is used to annotate ssRNA viral genomes. This work focuses on single sequence annotation and applies an HMM framework to ssRNA viral annotation. A description of how the HMM is parameterized, whilst annotating within a missing data framework is given. A Phylogenetic HMM (Phylo-HMM) extension, as applied to 14 aligned HIV2 sequences is also presented. This evolutionary extension serves as an illustration of the potential of the Phylo-HMM framework for ssRNA viral genomic annotation. The single sequence annotation procedure (SSA) is applied to 14 different strains of the HIV2 virus. Further results on alternative ssRNA viral genomes are presented to illustrate more generally the performance of the method. The results of the SSA method are encouraging however there is still room for improvement, and since there is overwhelming evidence to indicate that comparative methods can improve coding sequence (CDS) annotation, the SSA method is extended to a Phylo-HMM to incorporate evolutionary information. The Phylo-HMM extension is applied to the same set of 14 HIV2 sequences which are pre-aligned. The performance improvement that results from including the evolutionary information in the analysis is illustrated.

Mutation analysis of BRCA1/2 mutations with special reference to polymorphic SNPs in Indian breast cancer patients.

PubMed

Shah, Nidhi D; Shah, Parth S; Panchal, Yash Y; Katudia, Kalpesh H; Khatri, Nikunj B; Ray, Hari Shankar P; Bhatiya, Upti R; Shah, Sandip C; Shah, Bhavini S; Rao, Mandava V

2018-01-01

Germline mutations BRCA1 and BRCA2 contribute almost equally in the causation of breast cancer (BC). The type of mutations in the Indian population that cause this condition is largely unknown. In this cohort, 79 randomized BC patients were screened for various types of BRCA1 and BRCA2 mutations including frameshift, nonsense, missense, in-frame and splice site types. The purified extracted DNA of each referral patient was subjected to Sanger gene sequencing using Codon Code Analyzer and Mutation Surveyor and next-generation sequencing (NGS) methods with Ion torrent software, after appropriate care. The data revealed that 35 cases were positive for BRCA1 or BRCA2 (35/79: 44.3%). BRCA2 mutations were higher (52.4%) than BRCA1 mutations (47.6%). Five novel mutations detected in this study were p.pro163 frameshift, p.asn997 frameshift, p.ser148 frameshift and two splice site single-nucleotide polymorphisms (SNPs). Additionally, four nonsense and one in-frame deletion were identified, which all seemed to be pathogenic. Polymorphic SNPs contributed the highest percentage of mutations (72/82: 87.8%) and contributed to pathogenic, likely pathogenic, likely benign, benign and variant of unknown significance (VUS). Young age groups (20-60 years) had a high frequency of germline mutations (62/82;75.6%) in the Indian population. This study suggested that polymorphic SNPs contributed a high percentage of mutations along with five novel types. Younger age groups are prone to having BC with a higher mutational rate. Furthermore, the SNPs detected in exons 10, 11 and 16 of BRCA1 and BRCA2 were higher than those in other exons 2, 3 and 9 polymorphic sites in two germline genes. These may be contributory for BC although missense types are known to be susceptible for cancer depending on the type of amino acid replaced in the protein and associated with pathologic events. Accordingly, appropriate counseling and treatment may be suggested.

Analysis of codon usage in beta-tubulin sequences of helminths.

PubMed

von Samson-Himmelstjerna, G; Harder, A; Failing, K; Pape, M; Schnieder, T

2003-07-01

Codon usage bias has been shown to be correlated with gene expression levels in many organisms, including the nematode Caenorhabditis elegans. Here, the codon usage (cu) characteristics for a set of currently available beta-tubulin coding sequences of helminths were assessed by calculating several indices, including the effective codon number (Nc), the intrinsic codon deviation index (ICDI), the P2 value and the mutational response index (MRI). The P2 value gives a measure of translational pressure, which has been shown to be correlated to high gene expression levels in some organisms, but it has not yet been analysed in that respect in helminths. For all but two of the C. elegans beta-tubulin coding sequences investigated, the P2 value was the only index that indicated the presence of codon usage bias. Therefore, we propose that in general the helminth beta-tubulin sequences investigated here are not expressed at high levels. Furthermore, we calculated the correlation coefficients for the cu patterns of the helminth beta-tubulin sequences compared with those of highly expressed genes in organisms such as Escherichia coli and C. elegans. It was found that beta-tubulin cu patterns for all sequences of members of the Strongylida were significantly correlated to those for highly expressed C. elegans genes. This approach provides a new measure for comparing the adaptation of cu of a particular coding sequence with that of highly expressed genes in possible expression systems.Finally, using the cu patterns of the sequences studied, a phylogenetic tree was constructed. The topology of this tree was very much in concordance with that of a phylogeny based on small subunit ribosomal DNA sequence alignments.

A SMAD4 mutation indicative of juvenile polyposis syndrome in a family previously diagnosed with Menetrier's disease.

PubMed

Burmester, James K; Bell, Lauren N; Cross, Deanna; Meyer, Patrick; Yale, Steven H

2016-10-01

Menetrier's disease (MD) is a rare disease with unknown aetiology, characterized by hypertrophic folds within the fundus and body of the stomach. We investigated mutations of the candidate genes SMAD4, BMPR1A, TGF-α, and PDX1 within a family with MD. A large 4-generation family with MD was identified. This family had 5 cases of MD, 1 case of MD and juvenile polyposis syndrome (JPS) and 3 cases of JPS. Participants provided saliva for DNA extraction and completed a health questionnaire designed to assess conditions that may be found in patients with MD. Following pedigree analysis, we sequenced the coding regions of the SMAD4 and BMPR1A genes and the regulatory regions of the TGF-α and PDX1 genes in affected and non-affected family members. No mutations were identified in the sequenced regions of BMPR1A, TGF-α, or PDX1. A dominant 1244_1247delACAG mutation of SMAD4 was identified in each of the subjects with JPS as well as in each of the subjects with MD. Although this mutation segregated with disease, there were also unaffected/undiagnosed carriers. The 1244_1247delACAG mutation of SMAD4 is the cause of JPS and the likely cause of MD in a large family initially diagnosed with MD. Copyright © 2016 Editrice Gastroenterologica Italiana S.r.l. Published by Elsevier Ltd. All rights reserved.

The TP53 gene promoter is not methylated in families suggestive of Li-Fraumeni syndrome with no germline TP53 mutations.

PubMed

Finkova, Alena; Vazna, Alzbeta; Hrachovina, Ondrej; Bendova, Sarka; Prochazkova, Kamila; Sedlacek, Zdenek

2009-08-01

Germline TP53 mutations are found in only 70% of families with the Li-Fraumeni syndrome (LFS), and with an even lower frequency in families suggestive of LFS but not meeting clinical criteria of the syndrome. Despite intense efforts, to date, no other genes have been associated with the disorder in a significant number of TP53 mutation-negative families. A search for defects in TP53 other than heterozygous missense mutations showed that neither intron variants nor sequence variants in the TP53 promoter are frequent in LFS, and multiexon deletions have been found to be responsible for LFS only in several cases. Another cancer predisposition syndrome, hereditary non-polyposis colon cancer, has been associated with epigenetic silencing of one allele of the MLH1 or MSH2 genes. This prompted us to test the methylation of the TP53 gene promoter in a set of 14 families suggestive of LFS using bisulphite sequencing of three DNA fragments from the 5' region of the gene. We found no detectable methylation at any of the CG dinucleotides tested. Thus, epigenetic silencing of the TP53 promoter is not a frequent cause of the disorder in families suggestive of LFS but with no germline mutations in the coding part of the gene.

Prevalence and resistance mutations of non-B HIV-1 subtypes among immigrants in Southern Spain along the decade 2000-2010

PubMed Central

2011-01-01

Background Most of the non-B HIV-1 subtypes are predominant in Sub-Saharan Africa and India although they have been found worldwide. In the last decade, immigration from these areas has increased considerably in Spain. The objective of this study was to evaluate the prevalence of non-B subtypes circulating in a cohort of HIV-1-infected immigrants in Seville, Southern Spain and to identify drug resistance-associated mutations. Methods Complete protease and first 220 codons of the reverse transcriptase coding regions were amplified and sequenced by population sequencing. HIV-1 subtypes were determined using Stanford University Drug Resistance Database, and phylogenetic analysis was performed comparing multiple reported sequences. Drug resistance mutations were defined according to the International AIDS Society-USA. Results From 2000 to 2010 a total of 1,089 newly diagnosed HIV-1-infected patients were enrolled in our cohort. Of these, 121 were immigrants, of which 98 had ethical approval and informed consent to include in our study. Twenty-nine immigrants (29/98, 29.6%) were infected with non-B subtypes, of which 15/29 (51.7%) were CRF02-AG, mostly from Sub-Saharan Africa, and 2/29 (6.9%) were CRF01-AE from Eastern Europe. A, C, F, J and G subtypes from Eastern Europe, Central-South America and Sub-Saharan Africa were also present. Some others harboured recombinant forms CRF02-AG/CRF01-AE, CRF2-AG/G and F/B, B/C, and K/G, in PR and RT-coding regions. Patients infected with non-B subtypes showed a high frequency of minor protease inhibitor resistance mutations, M36I, L63P, and K20R/I. Only one patient, CRF02_AG, showed major resistance mutation L90M. Major RT inhibitor resistance mutations K70R and A98G were present in one patient with subtype G, L100I in one patient with CRF01_AE, and K103N in another patient with CRF01_AE. Three patients had other mutations such as V118I, E138A and V90I. Conclusions The circulation of non-B subtypes has significantly increased in Southern Spain during the last decade, with 29.6% prevalence, in association with demographic changes among immigrants. This could be an issue in the treatment and management of these patients. Resistance mutations have been detected in these patients with a prevalence of 7% among treatment-naïve patients compared with the 21% detected among patients under HAART or during treatment interruption. PMID:21871090

UET: a database of evolutionarily-predicted functional determinants of protein sequences that cluster as functional sites in protein structures.

PubMed

Lua, Rhonald C; Wilson, Stephen J; Konecki, Daniel M; Wilkins, Angela D; Venner, Eric; Morgan, Daniel H; Lichtarge, Olivier

2016-01-04

The structure and function of proteins underlie most aspects of biology and their mutational perturbations often cause disease. To identify the molecular determinants of function as well as targets for drugs, it is central to characterize the important residues and how they cluster to form functional sites. The Evolutionary Trace (ET) achieves this by ranking the functional and structural importance of the protein sequence positions. ET uses evolutionary distances to estimate functional distances and correlates genotype variations with those in the fitness phenotype. Thus, ET ranks are worse for sequence positions that vary among evolutionarily closer homologs but better for positions that vary mostly among distant homologs. This approach identifies functional determinants, predicts function, guides the mutational redesign of functional and allosteric specificity, and interprets the action of coding sequence variations in proteins, people and populations. Now, the UET database offers pre-computed ET analyses for the protein structure databank, and on-the-fly analysis of any protein sequence. A web interface retrieves ET rankings of sequence positions and maps results to a structure to identify functionally important regions. This UET database integrates several ways of viewing the results on the protein sequence or structure and can be found at http://mammoth.bcm.tmc.edu/uet/. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

[Exome sequencing revealed Allan-Herndon-Dudley syndrome underlying multiple disabilities].

PubMed

Arvio, Maria; Philips, Anju K; Ahvenainen, Minna; Somer, Mirja; Kalscheuer, Vera; Järvelä, Irma

2014-01-01

Normal function of the thyroid gland is the cornerstone of a child's mental development and physical growth. We describe a Finnish family, in which the diagnosis of three brothers became clear after investigations that lasted for more than 30 years. Two of the sons have already died. DNA analysis of the third one, a 16-year-old boy, revealed in exome sequencing of the complete X chromosome a mutation in the SLC16A2 gene, i.e. MCT8, coding for a thyroid hormone transport protein. Allan-Herndon-Dudley syndrome was thus shown to be the cause of multiple disabilities.

R3-R4 deletion in the PRNP gene is associated with Creutzfeldt-Jakob disease (CJD)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cervenakova, L.; Brown, P.; Nagle, J.

1994-09-01

There are conflicting reports on the association of deletions in the PRNP gene on chromosome 20 with CJD, a rapidly progressive fatal spongiform encephalopathy. We accumulated data suggesting that a deletion of R3-R4 type (parts of the third and fourth repeats are deleted from the area of four repeating 24 bp sequences in the 5{prime} region of the gene) is causing CJD. Screening of 129 unaffected control individuals demonstrated presence of a deletion of R2 type in four (1.55% of the studied chromosomes), but none of them had the R3-R4 type. Of 181 screened patients with spongiform encephalopathies, two hadmore » a deletion of R3-R4 type with no other mutations in the coding sequence. Both patients had a classical rapidly progressive dementing disease and diffuse spongiform degeneration, and both cases were apparently sporadic. The same R3-R4 type of deletion was detected in three additional neuropathologically confirmed spongiform encephalopathy patients, of which two had other known pathogenic mutations in the PRNP gene: at codon 178 on the methionine allele exhibiting the phenotype of fatal familial insomnia, and codon 200 causing CJD with severe dementia; the third was a patient with iatrogenic CJD who developed the disease after treatment with growth hormone extracted from cadaveric human pituitary glands. In all cases the deletion coincided with a variant sequence at position 129 coding for methionine.« less

Isolated familial somatotropinomas: clinical features and analysis of the MEN1 gene.

PubMed

De Menis, Ernesto; Prezant, Toni R

2002-01-01

Isolated familial somatotropinomas (IFS) rarely occurs in the absence of multiple endocrine neoplasia type I (MEN1) or the Carney complex. In the present study we report two Italian siblings affected by GH-secreting adenomas. There was no history of parental consanguinity. The sister presented at 18 years of age with secondary amenorrhea and acromegalic features and one of her two brothers presented with gigantism at the same age. Endocrinological investigations confirmed GH hypersecretion in both cases. Although a pituitary microadenoma was detected in both patients, transsphenoidal surgery was not successful. The sister received conventional radiotherapy and acromegaly is now considered controlled; the brother is being treated with octreotide LAR 30 mg monthly and the disease is considered clinically active. Patients, their parents and the unaffected brother underwent extensive evaluation, and no features of MEN1 or Carney complex were found. Analysis of polymorphic microsatellite markers from chromosome 11q13 (D11S599, D11S4945, D11S4939, D11S4938 and D11S987) showed that the acromegalic siblings had inherited different maternal chromosomes and shared the paternal chromosome. No pathogenic MEN1 sequence changes were detected by sequencing or dideoxy fingerprinting of the coding sequence (exons 2-10) and exon/intron junctions. Although mutations in the promoter, introns or untranslated regions of the MEN1 gene cannot be excluded, germline mutations within the coding region of this gene do not appear responsible for IFS in this family.

Mutational analysis in a patient with a variant form of Gaucher disease caused by SAP-2 deficiency

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rafi, M.A.; Gala, G. de; Xunling Zhang

1993-01-01

It is now clear that the lysosomal hydrolysis of sphingolipids requires both lysosomal enzymes and so-called sphingolipid activator proteins (SAPs). One gene, called prosaposin, codes for a precursor protein that is proteolytically cut into four putative SAPs. These four SAPs, of about 80 amino acids, share some structural features but differ somewhat in their specificity. Domain 3 of prosaposin mRNA contains the coding region for SAP-2, an activator of glucocerebrosidase. While most patients with Gaucher disease store glucosylceramide due to defects in glucocerebrosidase, a few patients store this lipid in the presence of normal enzyme levels. In this paper themore » authors describe the identification of a point mutation in domain 3 of a patient who died with this variant form of Gaucher disease. Polymerase chain reaction amplification was performed in the small amount of genomic DNA available using primers generated from the intronic sequence surrounding domain 3. The patient was found to have a T-to-G substitution at position 1144 (counting from the A of ATG initiation codon) in half of the M13 recombinant clones. This changes the codon for cysteine[sub 382] to glycine. His father and unaffected brother also had this mutation, but his mother did not. She was found to have half of the normal amount of mRNA for prosaposin in her cultured skin fibroblasts. Therefore, this child inherited a point mutation in domain 3 from his father and a deficiency of all four SAPs coded for by prosaposin from his mother. 29 refs., 3 figs., 1 tab.« less

Sporadic autism exomes reveal a highly interconnected protein network of de novo mutations.

PubMed

O'Roak, Brian J; Vives, Laura; Girirajan, Santhosh; Karakoc, Emre; Krumm, Niklas; Coe, Bradley P; Levy, Roie; Ko, Arthur; Lee, Choli; Smith, Joshua D; Turner, Emily H; Stanaway, Ian B; Vernot, Benjamin; Malig, Maika; Baker, Carl; Reilly, Beau; Akey, Joshua M; Borenstein, Elhanan; Rieder, Mark J; Nickerson, Deborah A; Bernier, Raphael; Shendure, Jay; Eichler, Evan E

2012-04-04

It is well established that autism spectrum disorders (ASD) have a strong genetic component; however, for at least 70% of cases, the underlying genetic cause is unknown. Under the hypothesis that de novo mutations underlie a substantial fraction of the risk for developing ASD in families with no previous history of ASD or related phenotypes--so-called sporadic or simplex families--we sequenced all coding regions of the genome (the exome) for parent-child trios exhibiting sporadic ASD, including 189 new trios and 20 that were previously reported. Additionally, we also sequenced the exomes of 50 unaffected siblings corresponding to these new (n = 31) and previously reported trios (n = 19), for a total of 677 individual exomes from 209 families. Here we show that de novo point mutations are overwhelmingly paternal in origin (4:1 bias) and positively correlated with paternal age, consistent with the modest increased risk for children of older fathers to develop ASD. Moreover, 39% (49 of 126) of the most severe or disruptive de novo mutations map to a highly interconnected β-catenin/chromatin remodelling protein network ranked significantly for autism candidate genes. In proband exomes, recurrent protein-altering mutations were observed in two genes: CHD8 and NTNG1. Mutation screening of six candidate genes in 1,703 ASD probands identified additional de novo, protein-altering mutations in GRIN2B, LAMC3 and SCN1A. Combined with copy number variant (CNV) data, these results indicate extreme locus heterogeneity but also provide a target for future discovery, diagnostics and therapeutics.

In silico analysis of a novel MKRN3 missense mutation in familial central precocious puberty.

PubMed

Neocleous, Vassos; Shammas, Christos; Phelan, Marie M; Nicolaou, Stella; Phylactou, Leonidas A; Skordis, Nicos

2016-01-01

The onset of puberty is influenced by the interplay of stimulating and restraining factors, many of which have a genetic origin. Premature activation of the GnRH secretion in central precocious puberty (CPP) may arise either from gain-of-function mutations of the KISS1 and KISS1R genes or from loss-of-function manner mutations of the MKRN3 gene leading to MKRN3 deficiency. To explore the genetic causes responsible for CPP and the potential role of the RING finger protein 3 (MKRN3) gene. We investigated potential sequence variations in the intronless MKRN3 gene by Sanger sequencing of the entire 507 amino acid coding region of exon 1 in a family with two affected girls presented with CPP at the age of 6 and 5·7 years, respectively. A novel heterozygous g.Gly312Asp missense mutation in the MKRN3 gene was identified in these siblings. The imprinted MKRN3 missense mutation was also identified as expected in the unaffected father and followed as expected an imprinted mode of inheritance. In silico analysis of the altered missense variant using the computational algorithms Polyphen2, SIFT and Mutation Taster predicted a damage and pathogenic alteration causing CPP. The pathogenicity of the alteration at the protein level via an in silico structural model is also explored. A novel mutation in the MKRN3 gene in two sisters with CPP was identified, supporting the fundamental role of this gene in the suppression of the hypothalamic GnRH neurons. © 2015 John Wiley & Sons Ltd.

Genetic Correction and Hepatic Differentiation of Hemophilia B-specific Human Induced Pluripotent Stem Cells.

PubMed

He, Qiong; Wang, Hui-Hui; Cheng, Tao; Yuan, Wei-Ping; Ma, Yu-Po; Jiang, Yong-Ping; Ren, Zhi-Hua

2017-09-27

Objective To genetically correct a disease-causing point mutation in human induced pluripotent stem cells (iPSCs) derived from a hemophilia B patient. Methods First, the disease-causing mutation was detected by sequencing the encoding area of human coagulation factor IX (F IX) gene. Genomic DNA was extracted from the iPSCs, and the primers were designed to amplify the eight exons of F IX. Next, the point mutation in those iPSCs was genetically corrected using CRISPR/Cas9 technology in the presence of a 129-nucleotide homologous repair template that contained two synonymous mutations. Then, top 8 potential off-target sites were subsequently analyzed using Sanger sequencing. Finally, the corrected clones were differentiated into hepatocyte-like cells, and the secretion of F IX was validated by immunocytochemistry and ELISA assay. Results The cell line bore a missense mutation in the 6 th coding exon (c.676 C>T) of F IX gene. Correction of the point mutation was achieved via CRISPR/Cas9 technology in situ with a high efficacy at about 22% (10/45) and no off-target effects detected in the corrected iPSC clones. F IX secretion, which was further visualized by immunocytochemistry and quantified by ELISA in vitro, reached about 6 ng/ml on day 21 of differentiation procedure. Conclusions Mutations in human disease-specific iPSCs could be precisely corrected by CRISPR/Cas9 technology, and corrected cells still maintained hepatic differentiation capability. Our findings might throw a light on iPSC-based personalized therapies in the clinical application, especially for hemophilia B.

Mutations in the AVPR2, AVP-NPII, and AQP2 genes in Turkish patients with diabetes insipidus.

PubMed

Duzenli, Duygu; Saglar, Emel; Deniz, Ferhat; Azal, Omer; Erdem, Beril; Mergen, Hatice

2012-12-01

The aim of this study was to identify mutations in three different genes, the arginine-vasopressin-neurophysin II (AVP-NPII) gene, the arginine-vasopressin receptor 2 (AVPR2) gene, and the vasopressin-sensitive water channel aquaporin-2 (AQP2) gene in Turkish patients affected by central diabetes insipidus or nephrogenic diabetes insipidus. This study included 15 patients from unrelated families. Prospective clinical data were collected for all patients including the patients underwent a water deprivation-desmopressin test. The coding regions of the AVPR2, AQP2, and AVP-NPII genes were amplified by polymerase chain reaction and submitted to direct sequence analysis. Of the 15 patients with diabetes insipidus referred to Gulhane Military Medical Academy, Department of Endocrinology and Metabolism, eight patients have AVPR2 mutations, five patients have AQP2 mutations and two patients have AVP-NPII mutations. Of the patients, which have AVPR2 mutations, one is compound heterozygous for AVPR2 gene. Seven of these mutations are novel. Comparison of the clinical outcomes of these mutations may facilitate in understanding the functions of AVP-NPII, AQP2, and AVPR2 genes in future studies.

Oncogenic mutations in KEAP1 disturbing inhibitory Nrf2-Keap1 interaction: Activation of antioxidative pathway in papillary thyroid carcinoma.

PubMed

Danilovic, Debora Lucia Seguro; de Mello, Evandro Sobroza; Frazzato, Eliana Salgado Turri; Wakamatsu, Alda; de Lima Jorge, Alexander Augusto; Hoff, Ana Oliveira; Marui, Suemi

2018-06-01

Nuclear factor erythroid 2-like 2 (NFE2L2) encodes Nrf2, transcription factor of antioxidative genes. In the presence of reactive oxygen species, Keap1 (Kelch-ECH-associating protein-1) inhibitor complex undergoes conformational changes disrupting Keap1-Nrf2 binding and Nrf2 translocates into nucleus. We evaluated the presence of mutations in NFE2L2 and KEAP1 in papillary thyroid carcinomas (PTCs) and correlated them with clinical presentation. Coding regions of NFE2L2 and KEAP1 were sequenced in 131 patients with PTC. Clinical and histopathological features were analyzed. Immunohistochemical analysis of Nrf2 expression was performed in mutated carcinomas. Although no mutations were found in NFE2L2, missense mutations in KEAP1 were observed in 6 patients with PTC (4.6%). Immunohistochemistry showed increased Nrf2 expression in nuclei of all mutated carcinomas, which presented poor prognostic features in histopathology. We identified mutations in KEAP1 associated with Nrf2 overexpression in PTC. Mutations favored disruption of inhibitory interaction Nrf2-Keap1 to enable increased antioxidant Nrf2 activity, possibly with prognostic consequences. © 2018 Wiley Periodicals, Inc.

A novel nuclear genetic code alteration in yeasts and the evolution of codon reassignment in eukaryotes

PubMed Central

Mühlhausen, Stefanie; Findeisen, Peggy; Plessmann, Uwe; Urlaub, Henning; Kollmar, Martin

2016-01-01

The genetic code is the cellular translation table for the conversion of nucleotide sequences into amino acid sequences. Changes to the meaning of sense codons would introduce errors into almost every translated message and are expected to be highly detrimental. However, reassignment of single or multiple codons in mitochondria and nuclear genomes, although extremely rare, demonstrates that the code can evolve. Several models for the mechanism of alteration of nuclear genetic codes have been proposed (including “codon capture,” “genome streamlining,” and “ambiguous intermediate” theories), but with little resolution. Here, we report a novel sense codon reassignment in Pachysolen tannophilus, a yeast related to the Pichiaceae. By generating proteomics data and using tRNA sequence comparisons, we show that Pachysolen translates CUG codons as alanine and not as the more usual leucine. The Pachysolen tRNACAG is an anticodon-mutated tRNAAla containing all major alanine tRNA recognition sites. The polyphyly of the CUG-decoding tRNAs in yeasts is best explained by a tRNA loss driven codon reassignment mechanism. Loss of the CUG-tRNA in the ancient yeast is followed by gradual decrease of respective codons and subsequent codon capture by tRNAs whose anticodon is not part of the aminoacyl-tRNA synthetase recognition region. Our hypothesis applies to all nuclear genetic code alterations and provides several testable predictions. We anticipate more codon reassignments to be uncovered in existing and upcoming genome projects. PMID:27197221

A mobile element in mutS drives hypermutation in a marine Vibrio

DOE PAGES

Chu, Nathaniel D.; Clarke, Sean A.; Timberlake, Sonia; ...

2017-02-07

Bacteria face a trade-off between genetic fidelity, which reduces deleterious mistakes in the genome, and genetic innovation, which allows organisms to adapt. Evidence suggests that many bacteria balance this trade-off by modulating their mutation rates, but few mechanisms have been described for such modulation. Following experimental evolution and whole-genome resequencing of the marine bacterium Vibrio splendidus 12B01, we discovered one such mechanism, which allows this bacterium to switch to an elevated mutation rate. This switch is driven by the excision of a mobile element residing in mutS, which encodes a DNA mismatch repair protein. When integrated within the bacterial genome,more » the mobile element provides independent promoter and translation start sequences for mutS—different from the bacterium’s original mutS promoter region—which allow the bacterium to make a functional mutS gene product. Excision of this mobile element rejoins the mutS gene with host promoter and translation start sequences but leaves a 2-bp deletion in the mutS sequence, resulting in a frameshift and a hypermutator phenotype. We further identified hundreds of clinical and environmental bacteria across Betaproteobacteria and Gammaproteobacteria that possess putative mobile elements within the same amino acid motif in mutS. In a subset of these bacteria, we detected excision of the element but not a frameshift mutation; the mobile elements leave an intact mutS coding sequence after excision. Finally, our findings reveal a novel mechanism by which one bacterium alters its mutation rate and hint at a possible evolutionary role for mobile elements within mutS in other bacteria.« less

A mobile element in mutS drives hypermutation in a marine Vibrio

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chu, Nathaniel D.; Clarke, Sean A.; Timberlake, Sonia

Bacteria face a trade-off between genetic fidelity, which reduces deleterious mistakes in the genome, and genetic innovation, which allows organisms to adapt. Evidence suggests that many bacteria balance this trade-off by modulating their mutation rates, but few mechanisms have been described for such modulation. Following experimental evolution and whole-genome resequencing of the marine bacterium Vibrio splendidus 12B01, we discovered one such mechanism, which allows this bacterium to switch to an elevated mutation rate. This switch is driven by the excision of a mobile element residing in mutS, which encodes a DNA mismatch repair protein. When integrated within the bacterial genome,more » the mobile element provides independent promoter and translation start sequences for mutS—different from the bacterium’s original mutS promoter region—which allow the bacterium to make a functional mutS gene product. Excision of this mobile element rejoins the mutS gene with host promoter and translation start sequences but leaves a 2-bp deletion in the mutS sequence, resulting in a frameshift and a hypermutator phenotype. We further identified hundreds of clinical and environmental bacteria across Betaproteobacteria and Gammaproteobacteria that possess putative mobile elements within the same amino acid motif in mutS. In a subset of these bacteria, we detected excision of the element but not a frameshift mutation; the mobile elements leave an intact mutS coding sequence after excision. Finally, our findings reveal a novel mechanism by which one bacterium alters its mutation rate and hint at a possible evolutionary role for mobile elements within mutS in other bacteria.« less

Is Mutation Random or Targeted?: No Evidence for Hypermutability in Snail Toxin Genes.

PubMed

Roy, Scott W

2016-10-01

Ever since Luria and Delbruck, the notion that mutation is random with respect to fitness has been foundational to modern biology. However, various studies have claimed striking exceptions to this rule. One influential case involves toxin-encoding genes in snails of the genus Conus, termed conotoxins, a large gene family that undergoes rapid diversification of their protein-coding sequences by positive selection. Previous reconstructions of the sequence evolution of conotoxin genes claimed striking patterns: (1) elevated synonymous change, interpreted as being due to targeted "hypermutation" in this region; (2) elevated transversion-to-transition ratios, interpreted as reflective of the particular mechanism of hypermutation; and (3) much lower rates of synonymous change in the codons encoding several highly conserved cysteine residues, interpreted as strong position-specific codon bias. This work has spawned a variety of studies on the potential mechanisms of hypermutation and on causes for cysteine codon bias, and has inspired hypermutation hypotheses for various other fast-evolving genes. Here, I show that all three findings are likely to be artifacts of statistical reconstruction. First, by simulating nonsynonymous change I show that high rates of dN can lead to overestimation of dS. Second, I show that there is no evidence for any of these three patterns in comparisons of closely related conotoxin sequences, suggesting that the reported findings are due to breakdown of statistical methods at high levels of sequence divergence. The current findings suggest that mutation and codon bias in conotoxin genes may not be atypical, and that random mutation and selection can explain the evolution of even these exceptional loci. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Murine recessive hereditary spherocytosis, sph/sph, is caused by a mutation in the erythroid alpha-spectrin gene.

PubMed

Wandersee, N J; Birkenmeier, C S; Gifford, E J; Mohandas, N; Barker, J E

2000-01-01

Spectrin, a heterodimer of alpha- and beta-subunits, is the major protein component of the red blood cell membrane skeleton. The mouse mutation, sph, causes an alpha-spectrin-deficient hereditary spherocytosis with the severe phenotype typical of recessive hereditary spherocytosis in humans. The sph mutation maps to the erythroid alpha-spectrin locus, Spna1, on Chromosome 1. Scanning electron microscopy, osmotic gradient ektacytometry, cDNA cloning, RT-PCR, nucleic acid sequencing, and Northern blot analyses were used to characterize the wild type and sph alleles of the Spna1 locus. Our results confirm the spherocytic nature of sph/sph red blood cells and document a mild spherocytic transition in the +/sph heterozygotes. Sequencing of the full length coding region of the Spna1 wild type allele from the C57BL/6J strain of mice reveals a 2414 residue deduced amino acid sequence that shows the typical 106-amino-acid repeat structure previously described for other members of the spectrin protein family. Sequence analysis of RT-PCR clones from sph/sph alpha-spectrin mRNA identified a single base deletion in repeat 5 that would cause a frame shift and premature termination of the protein. This deletion was confirmed in sph/sph genomic DNA. Northern blot analyses of the distribution of Spna1 mRNA in non-erythroid tissues detects the expression of 8, 2.5 and 2.0 kb transcripts in adult heart. These results predict the heart as an additional site where alpha-spectrin mutations may produce a phenotype and raise the possibility that a novel functional class of small alpha-spectrin isoforms may exist.

Identification of a Comprehensive Spectrum of Genetic Factors for Hereditary Breast Cancer in a Chinese Population by Next-Generation Sequencing

PubMed Central

Yang, Xiaochen; Wu, Jiong; Lu, Jingsong; Liu, Guangyu; Di, Genhong; Chen, Canming; Hou, Yifeng; Sun, Menghong; Yang, Wentao; Xu, Xiaojing; Zhao, Ying; Hu, Xin; Li, Daqiang; Cao, Zhigang; Zhou, Xiaoyan; Huang, Xiaoyan; Liu, Zhebin; Chen, Huan; Gu, Yanzi; Chi, Yayun; Yan, Xia; Han, Qixia; Shen, Zhenzhou; Shao, Zhimin; Hu, Zhen

2015-01-01

The genetic etiology of hereditary breast cancer has not been fully elucidated. Although germline mutations of high-penetrance genes such as BRCA1/2 are implicated in development of hereditary breast cancers, at least half of all breast cancer families are not linked to these genes. To identify a comprehensive spectrum of genetic factors for hereditary breast cancer in a Chinese population, we performed an analysis of germline mutations in 2,165 coding exons of 152 genes associated with hereditary cancer using next-generation sequencing (NGS) in 99 breast cancer patients from families of cancer patients regardless of cancer types. Forty-two deleterious germline mutations were identified in 21 genes of 34 patients, including 18 (18.2%) BRCA1 or BRCA2 mutations, 3 (3%) TP53 mutations, 5 (5.1%) DNA mismatch repair gene mutations, 1 (1%) CDH1 mutation, 6 (6.1%) Fanconi anemia pathway gene mutations, and 9 (9.1%) mutations in other genes. Of seven patients who carried mutations in more than one gene, 4 were BRCA1/2 mutation carriers, and their average onset age was much younger than patients with only BRCA1/2 mutations. Almost all identified high-penetrance gene mutations in those families fulfill the typical phenotypes of hereditary cancer syndromes listed in the National Comprehensive Cancer Network (NCCN) guidelines, except two TP53 and three mismatch repair gene mutations. Furthermore, functional studies of MSH3 germline mutations confirmed the association between MSH3 mutation and tumorigenesis, and segregation analysis suggested antagonism between BRCA1 and MSH3. We also identified a lot of low-penetrance gene mutations. Although the clinical significance of those newly identified low-penetrance gene mutations has not been fully appreciated yet, these new findings do provide valuable epidemiological information for the future studies. Together, these findings highlight the importance of genetic testing based on NCCN guidelines and a multi-gene analysis using NGS may be a supplement to traditional genetic counseling. PMID:25927356

BRCA1 and BRCA2 mutation analysis of early-onset and familial breast cancer cases in Mexico.

PubMed

Ruiz-Flores, Pablo; Sinilnikova, Olga M; Badzioch, Michael; Calderon-Garcidueñas, A L; Chopin, Sandrine; Fabrice, Odefrey; González-Guerrero, J F; Szabo, Csilla; Lenoir, Gilbert; Goldgar, David E; Barrera-Saldaña, Hugo A

2002-12-01

The entire coding regions of BRCA1 and BRCA2 were screened for mutations by heteroduplex analysis in 51 Mexican breast cancer patients. One BRCA1 and one BRCA2 truncating mutation each was identified in the group of 32 (6%) early-onset breast cancer patients (< or =35 years). Besides these two likely deleterious mutations, eight rare variants of unknown significance, mostly in the BRCA2 gene, were detected in six of 32 (19%) early-onset breast cancer cases and in three of 17 (18%) site-specific breast cancer families, one containing a male breast cancer case. No mutations or rare sequence variants have been identified in two additional families including each an early-onset breast cancer case and an ovarian cancer patient. The two truncating mutations (BRCA1 3857delT; BRCA2 2663-2664insA) and six of the rare variants have never been reported before and may be of country-specific origin. The majority of the alterations appeared to be distinct, with only one of them being observed in more than one family. Copyright 2002 Wiley-Liss, Inc.

Identification of Genetic Defects Underlying FXII Deficiency in Four Unrelated Chinese Patients.

PubMed

Yang, Lihong; Wang, Yingyu; Zhou, Jianpin; Cheng, Xiaoli; Hao, Xiuping; Xie, Haixiao; Jin, Yanhui; Wang, Mingshan

2016-01-01

Congenital factor XII (FXII) dexFB01;ciency is a rare autosomal recessive disorder, characterized by a great variability in its clinical manifestations. In this study, we screened for mutations in the F12 gene of 4 unrelated patients with FXII coagulant activity <10% of that of normal human plasma. To investigate the molecular defects in these FXII-deficient patients, we performed FXII mutation screening. By sequencing all coding exons as well as xFB02;anking intronic regions of the F12 gene, 6 different mutations, including 3 missense mutations (Gly341Arg, Glu502Lys and Gly542 Ser), 1 insertion (7142insertC) and 2 deletions (5741-5742 delCA and 6753-6755delACA), were identixFB01;ed on the F12 gene. Three of them (Gly341Arg, 5741-5742delCA and 6753-6755delACA) are reported here for the first time. Computer-based algorithms predicted these missense mutations to be deleterious. This study has increased our knowledge of the mutational spectrum underlying FXII deficiency. © 2016 S. Karger AG, Basel.

Mutant NDUFS3 subunit of mitochondrial complex I causes Leigh syndrome.

PubMed

Bénit, P; Slama, A; Cartault, F; Giurgea, I; Chretien, D; Lebon, S; Marsac, C; Munnich, A; Rötig, A; Rustin, P

2004-01-01

Respiratory chain complex I deficiency represents a genetically heterogeneous group of diseases resulting from mutations in mitochondrial or nuclear genes. Mutations have been reported in 13 of the 14 subunits encoding the core of complex I (seven mitochondrial and six nuclear genes) and these result in Leigh or Leigh-like syndromes or cardiomyopathy. In this study, a combination of denaturing high performance liquid chromatography and sequence analysis was used to study the NDUFS3 gene in a series of complex I deficient patients. Mutations found in this gene (NADH dehydrogenase iron-sulphur protein 3), coding for the seventh and last subunit of complex I core, were shown to cause late onset Leigh syndrome, optic atrophy, and complex I deficiency. A biochemical diagnosis of complex I deficiency on cultured amniocytes from a later pregnancy was confirmed through the identification of disease causing NDUFS3 mutations in these cells. While mutations in the NDUFS3 gene thus result in Leigh syndrome, a dissimilar clinical phenotype is observed in mutations in the NDUFV2 and NDUFS2 genes, resulting in encephalomyopathy and cardiomyopathy. The reasons for these differences are uncertain.