Sample records for coding sequence showed

  1. Is a Genome a Codeword of an Error-Correcting Code?

    PubMed Central

    Kleinschmidt, João H.; Silva-Filho, Márcio C.; Bim, Edson; Herai, Roberto H.; Yamagishi, Michel E. B.; Palazzo, Reginaldo

    2012-01-01

    Since a genome is a discrete sequence, the elements of which belong to a set of four letters, the question as to whether or not there is an error-correcting code underlying DNA sequences is unavoidable. The most common approach to answering this question is to propose a methodology to verify the existence of such a code. However, none of the methodologies proposed so far, although quite clever, has achieved that goal. In a recent work, we showed that DNA sequences can be identified as codewords in a class of cyclic error-correcting codes known as Hamming codes. In this paper, we show that a complete intron-exon gene, and even a plasmid genome, can be identified as a Hamming code codeword as well. Although this does not constitute a definitive proof that there is an error-correcting code underlying DNA sequences, it is the first evidence in this direction. PMID:22649495

  2. [Transposition errors during learning to reproduce a sequence by the right- and the left-hand movements: simulation of positional and movement coding].

    PubMed

    Liakhovetskiĭ, V A; Bobrova, E V; Skopin, G N

    2012-01-01

    Transposition errors during the reproduction of a hand movement sequence make it possible to receive important information on the internal representation of this sequence in the motor working memory. Analysis of such errors showed that learning to reproduce sequences of the left-hand movements improves the system of positional coding (coding ofpositions), while learning of the right-hand movements improves the system of vector coding (coding of movements). Learning of the right-hand movements after the left-hand performance involved the system of positional coding "imposed" by the left hand. Learning of the left-hand movements after the right-hand performance activated the system of vector coding. Transposition errors during learning to reproduce movement sequences can be explained by neural network using either vector coding or both vector and positional coding.

  3. Statistical properties of DNA sequences

    NASA Technical Reports Server (NTRS)

    Peng, C. K.; Buldyrev, S. V.; Goldberger, A. L.; Havlin, S.; Mantegna, R. N.; Simons, M.; Stanley, H. E.

    1995-01-01

    We review evidence supporting the idea that the DNA sequence in genes containing non-coding regions is correlated, and that the correlation is remarkably long range--indeed, nucleotides thousands of base pairs distant are correlated. We do not find such a long-range correlation in the coding regions of the gene. We resolve the problem of the "non-stationarity" feature of the sequence of base pairs by applying a new algorithm called detrended fluctuation analysis (DFA). We address the claim of Voss that there is no difference in the statistical properties of coding and non-coding regions of DNA by systematically applying the DFA algorithm, as well as standard FFT analysis, to every DNA sequence (33301 coding and 29453 non-coding) in the entire GenBank database. Finally, we describe briefly some recent work showing that the non-coding sequences have certain statistical features in common with natural and artificial languages. Specifically, we adapt to DNA the Zipf approach to analyzing linguistic texts. These statistical properties of non-coding sequences support the possibility that non-coding regions of DNA may carry biological information.

  4. Nucleotide sequence determination of guinea-pig casein B mRNA reveals homology with bovine and rat alpha s1 caseins and conservation of the non-coding regions of the mRNA.

    PubMed Central

    Hall, L; Laird, J E; Craig, R K

    1984-01-01

    Nucleotide sequence analysis of cloned guinea-pig casein B cDNA sequences has identified two casein B variants related to the bovine and rat alpha s1 caseins. Amino acid homology was largely confined to the known bovine or predicted rat phosphorylation sites and within the 'signal' precursor sequence. Comparison of the deduced nucleotide sequence of the guinea-pig and rat alpha s1 casein mRNA species showed greater sequence conservation in the non-coding than in the coding regions, suggesting a functional and possibly regulatory role for the non-coding regions of casein mRNA. The results provide insight into the evolution of the casein genes, and raise questions as to the role of conserved nucleotide sequences within the non-coding regions of mRNA species. Images Fig. 1. PMID:6548375

  5. CSTminer: a web tool for the identification of coding and noncoding conserved sequence tags through cross-species genome comparison

    PubMed Central

    Castrignanò, Tiziana; Canali, Alessandro; Grillo, Giorgio; Liuni, Sabino; Mignone, Flavio; Pesole, Graziano

    2004-01-01

    The identification and characterization of genome tracts that are highly conserved across species during evolution may contribute significantly to the functional annotation of whole-genome sequences. Indeed, such sequences are likely to correspond to known or unknown coding exons or regulatory motifs. Here, we present a web server implementing a previously developed algorithm that, by comparing user-submitted genome sequences, is able to identify statistically significant conserved blocks and assess their coding or noncoding nature through the measure of a coding potential score. The web tool, available at http://www.caspur.it/CSTminer/, is dynamically interconnected with the Ensembl genome resources and produces a graphical output showing a map of detected conserved sequences and annotated gene features. PMID:15215464

  6. Effective Identification of Similar Patients Through Sequential Matching over ICD Code Embedding.

    PubMed

    Nguyen, Dang; Luo, Wei; Venkatesh, Svetha; Phung, Dinh

    2018-04-11

    Evidence-based medicine often involves the identification of patients with similar conditions, which are often captured in ICD (International Classification of Diseases (World Health Organization 2013)) code sequences. With no satisfying prior solutions for matching ICD-10 code sequences, this paper presents a method which effectively captures the clinical similarity among routine patients who have multiple comorbidities and complex care needs. Our method leverages the recent progress in representation learning of individual ICD-10 codes, and it explicitly uses the sequential order of codes for matching. Empirical evaluation on a state-wide cancer data collection shows that our proposed method achieves significantly higher matching performance compared with state-of-the-art methods ignoring the sequential order. Our method better identifies similar patients in a number of clinical outcomes including readmission and mortality outlook. Although this paper focuses on ICD-10 diagnosis code sequences, our method can be adapted to work with other codified sequence data.

  7. Streamlined Genome Sequence Compression using Distributed Source Coding

    PubMed Central

    Wang, Shuang; Jiang, Xiaoqian; Chen, Feng; Cui, Lijuan; Cheng, Samuel

    2014-01-01

    We aim at developing a streamlined genome sequence compression algorithm to support alternative miniaturized sequencing devices, which have limited communication, storage, and computation power. Existing techniques that require heavy client (encoder side) cannot be applied. To tackle this challenge, we carefully examined distributed source coding theory and developed a customized reference-based genome compression protocol to meet the low-complexity need at the client side. Based on the variation between source and reference, our protocol will pick adaptively either syndrome coding or hash coding to compress subsequences of changing code length. Our experimental results showed promising performance of the proposed method when compared with the state-of-the-art algorithm (GRS). PMID:25520552

  8. Automated conserved non-coding sequence (CNS) discovery reveals differences in gene content and promoter evolution among grasses

    PubMed Central

    Turco, Gina; Schnable, James C.; Pedersen, Brent; Freeling, Michael

    2013-01-01

    Conserved non-coding sequences (CNS) are islands of non-coding sequence that, like protein coding exons, show less divergence in sequence between related species than functionless DNA. Several CNSs have been demonstrated experimentally to function as cis-regulatory regions. However, the specific functions of most CNSs remain unknown. Previous searches for CNS in plants have either anchored on exons and only identified nearby sequences or required years of painstaking manual annotation. Here we present an open source tool that can accurately identify CNSs between any two related species with sequenced genomes, including both those immediately adjacent to exons and distal sequences separated by >12 kb of non-coding sequence. We have used this tool to characterize new motifs, associate CNSs with additional functions, and identify previously undetected genes encoding RNA and protein in the genomes of five grass species. We provide a list of 15,363 orthologous CNSs conserved across all grasses tested. We were also able to identify regulatory sequences present in the common ancestor of grasses that have been lost in one or more extant grass lineages. Lists of orthologous gene pairs and associated CNSs are provided for reference inbred lines of arabidopsis, Japonica rice, foxtail millet, sorghum, brachypodium, and maize. PMID:23874343

  9. A DS-UWB Cognitive Radio System Based on Bridge Function Smart Codes

    NASA Astrophysics Data System (ADS)

    Xu, Yafei; Hong, Sheng; Zhao, Guodong; Zhang, Fengyuan; di, Jinshan; Zhang, Qishan

    This paper proposes a direct-sequence UWB Gaussian pulse of cognitive radio systems based on bridge function smart sequence matrix and the Gaussian pulse. As the system uses the spreading sequence code, that is the bridge function smart code sequence, the zero correlation zones (ZCZs) which the bridge function sequences' auto-correlation functions had, could reduce multipath fading of the pulse interference. The Modulated channel signal was sent into the IEEE 802.15.3a UWB channel. We analysis the ZCZs's inhibition to the interference multipath interference (MPI), as one of the main system sources interferences. The simulation in SIMULINK/MATLAB is described in detail. The result shows the system has better performance by comparison with that employing Walsh sequence square matrix, and it was verified by the formula in principle.

  10. Circular codes revisited: a statistical approach.

    PubMed

    Gonzalez, D L; Giannerini, S; Rosa, R

    2011-04-21

    In 1996 Arquès and Michel [1996. A complementary circular code in the protein coding genes. J. Theor. Biol. 182, 45-58] discovered the existence of a common circular code in eukaryote and prokaryote genomes. Since then, circular code theory has provoked great interest and underwent a rapid development. In this paper we discuss some theoretical issues related to the synchronization properties of coding sequences and circular codes with particular emphasis on the problem of retrieval and maintenance of the reading frame. Motivated by the theoretical discussion, we adopt a rigorous statistical approach in order to try to answer different questions. First, we investigate the covering capability of the whole class of 216 self-complementary, C(3) maximal codes with respect to a large set of coding sequences. The results indicate that, on average, the code proposed by Arquès and Michel has the best covering capability but, still, there exists a great variability among sequences. Second, we focus on such code and explore the role played by the proportion of the bases by means of a hierarchy of permutation tests. The results show the existence of a sort of optimization mechanism such that coding sequences are tailored as to maximize or minimize the coverage of circular codes on specific reading frames. Such optimization clearly relates the function of circular codes with reading frame synchronization. Copyright © 2011 Elsevier Ltd. All rights reserved.

  11. Systematic analysis of coding and noncoding DNA sequences using methods of statistical linguistics

    NASA Technical Reports Server (NTRS)

    Mantegna, R. N.; Buldyrev, S. V.; Goldberger, A. L.; Havlin, S.; Peng, C. K.; Simons, M.; Stanley, H. E.

    1995-01-01

    We compare the statistical properties of coding and noncoding regions in eukaryotic and viral DNA sequences by adapting two tests developed for the analysis of natural languages and symbolic sequences. The data set comprises all 30 sequences of length above 50 000 base pairs in GenBank Release No. 81.0, as well as the recently published sequences of C. elegans chromosome III (2.2 Mbp) and yeast chromosome XI (661 Kbp). We find that for the three chromosomes we studied the statistical properties of noncoding regions appear to be closer to those observed in natural languages than those of coding regions. In particular, (i) a n-tuple Zipf analysis of noncoding regions reveals a regime close to power-law behavior while the coding regions show logarithmic behavior over a wide interval, while (ii) an n-gram entropy measurement shows that the noncoding regions have a lower n-gram entropy (and hence a larger "n-gram redundancy") than the coding regions. In contrast to the three chromosomes, we find that for vertebrates such as primates and rodents and for viral DNA, the difference between the statistical properties of coding and noncoding regions is not pronounced and therefore the results of the analyses of the investigated sequences are less conclusive. After noting the intrinsic limitations of the n-gram redundancy analysis, we also briefly discuss the failure of the zeroth- and first-order Markovian models or simple nucleotide repeats to account fully for these "linguistic" features of DNA. Finally, we emphasize that our results by no means prove the existence of a "language" in noncoding DNA.

  12. Cloning and sequence determination of the gene coding for the pyruvate phosphate dikinase of Entamoeba histolytica.

    PubMed

    Saavedra-Lira, E; Pérez-Montfort, R

    1994-05-16

    We isolated three overlapping clones from a DNA genomic library of Entamoeba histolytica strain HM1:IMSS, whose translated nucleotide (nt) sequence shows similarities of 51, 48 and 47% with the amino acid (aa) sequences reported for the pyruvate phosphate dikinases from Bacteroides symbiosus, maize and Flaveria trinervia, respectively. The reading frame determined codes for a protein of 886 aa.

  13. RY-Coding and Non-Homogeneous Models Can Ameliorate the Maximum-Likelihood Inferences From Nucleotide Sequence Data with Parallel Compositional Heterogeneity.

    PubMed

    Ishikawa, Sohta A; Inagaki, Yuji; Hashimoto, Tetsuo

    2012-01-01

    In phylogenetic analyses of nucleotide sequences, 'homogeneous' substitution models, which assume the stationarity of base composition across a tree, are widely used, albeit individual sequences may bear distinctive base frequencies. In the worst-case scenario, a homogeneous model-based analysis can yield an artifactual union of two distantly related sequences that achieved similar base frequencies in parallel. Such potential difficulty can be countered by two approaches, 'RY-coding' and 'non-homogeneous' models. The former approach converts four bases into purine and pyrimidine to normalize base frequencies across a tree, while the heterogeneity in base frequency is explicitly incorporated in the latter approach. The two approaches have been applied to real-world sequence data; however, their basic properties have not been fully examined by pioneering simulation studies. Here, we assessed the performances of the maximum-likelihood analyses incorporating RY-coding and a non-homogeneous model (RY-coding and non-homogeneous analyses) on simulated data with parallel convergence to similar base composition. Both RY-coding and non-homogeneous analyses showed superior performances compared with homogeneous model-based analyses. Curiously, the performance of RY-coding analysis appeared to be significantly affected by a setting of the substitution process for sequence simulation relative to that of non-homogeneous analysis. The performance of a non-homogeneous analysis was also validated by analyzing a real-world sequence data set with significant base heterogeneity.

  14. BASiNET-BiologicAl Sequences NETwork: a case study on coding and non-coding RNAs identification.

    PubMed

    Ito, Eric Augusto; Katahira, Isaque; Vicente, Fábio Fernandes da Rocha; Pereira, Luiz Filipe Protasio; Lopes, Fabrício Martins

    2018-06-05

    With the emergence of Next Generation Sequencing (NGS) technologies, a large volume of sequence data in particular de novo sequencing was rapidly produced at relatively low costs. In this context, computational tools are increasingly important to assist in the identification of relevant information to understand the functioning of organisms. This work introduces BASiNET, an alignment-free tool for classifying biological sequences based on the feature extraction from complex network measurements. The method initially transform the sequences and represents them as complex networks. Then it extracts topological measures and constructs a feature vector that is used to classify the sequences. The method was evaluated in the classification of coding and non-coding RNAs of 13 species and compared to the CNCI, PLEK and CPC2 methods. BASiNET outperformed all compared methods in all adopted organisms and datasets. BASiNET have classified sequences in all organisms with high accuracy and low standard deviation, showing that the method is robust and non-biased by the organism. The proposed methodology is implemented in open source in R language and freely available for download at https://cran.r-project.org/package=BASiNET.

  15. Code-modulated visual evoked potentials using fast stimulus presentation and spatiotemporal beamformer decoding.

    PubMed

    Wittevrongel, Benjamin; Van Wolputte, Elia; Van Hulle, Marc M

    2017-11-08

    When encoding visual targets using various lagged versions of a pseudorandom binary sequence of luminance changes, the EEG signal recorded over the viewer's occipital pole exhibits so-called code-modulated visual evoked potentials (cVEPs), the phase lags of which can be tied to these targets. The cVEP paradigm has enjoyed interest in the brain-computer interfacing (BCI) community for the reported high information transfer rates (ITR, in bits/min). In this study, we introduce a novel decoding algorithm based on spatiotemporal beamforming, and show that this algorithm is able to accurately identify the gazed target. Especially for a small number of repetitions of the coding sequence, our beamforming approach significantly outperforms an optimised support vector machine (SVM)-based classifier, which is considered state-of-the-art in cVEP-based BCI. In addition to the traditional 60 Hz stimulus presentation rate for the coding sequence, we also explore the 120 Hz rate, and show that the latter enables faster communication, with a maximal median ITR of 172.87 bits/min. Finally, we also report on a transition effect in the EEG signal following the onset of the stimulus sequence, and recommend to exclude the first 150 ms of the trials from decoding when relying on a single presentation of the stimulus sequence.

  16. Detecting the borders between coding and non-coding DNA regions in prokaryotes based on recursive segmentation and nucleotide doublets statistics

    PubMed Central

    2012-01-01

    Background Detecting the borders between coding and non-coding regions is an essential step in the genome annotation. And information entropy measures are useful for describing the signals in genome sequence. However, the accuracies of previous methods of finding borders based on entropy segmentation method still need to be improved. Methods In this study, we first applied a new recursive entropic segmentation method on DNA sequences to get preliminary significant cuts. A 22-symbol alphabet is used to capture the differential composition of nucleotide doublets and stop codon patterns along three phases in both DNA strands. This process requires no prior training datasets. Results Comparing with the previous segmentation methods, the experimental results on three bacteria genomes, Rickettsia prowazekii, Borrelia burgdorferi and E.coli, show that our approach improves the accuracy for finding the borders between coding and non-coding regions in DNA sequences. Conclusions This paper presents a new segmentation method in prokaryotes based on Jensen-Rényi divergence with a 22-symbol alphabet. For three bacteria genomes, comparing to A12_JR method, our method raised the accuracy of finding the borders between protein coding and non-coding regions in DNA sequences. PMID:23282225

  17. Genetic code, hamming distance and stochastic matrices.

    PubMed

    He, Matthew X; Petoukhov, Sergei V; Ricci, Paolo E

    2004-09-01

    In this paper we use the Gray code representation of the genetic code C=00, U=10, G=11 and A=01 (C pairs with G, A pairs with U) to generate a sequence of genetic code-based matrices. In connection with these code-based matrices, we use the Hamming distance to generate a sequence of numerical matrices. We then further investigate the properties of the numerical matrices and show that they are doubly stochastic and symmetric. We determine the frequency distributions of the Hamming distances, building blocks of the matrices, decomposition and iterations of matrices. We present an explicit decomposition formula for the genetic code-based matrix in terms of permutation matrices, which provides a hypercube representation of the genetic code. It is also observed that there is a Hamiltonian cycle in a genetic code-based hypercube.

  18. Applications of statistical physics and information theory to the analysis of DNA sequences

    NASA Astrophysics Data System (ADS)

    Grosse, Ivo

    2000-10-01

    DNA carries the genetic information of most living organisms, and the of genome projects is to uncover that genetic information. One basic task in the analysis of DNA sequences is the recognition of protein coding genes. Powerful computer programs for gene recognition have been developed, but most of them are based on statistical patterns that vary from species to species. In this thesis I address the question if there exist universal statistical patterns that are different in coding and noncoding DNA of all living species, regardless of their phylogenetic origin. In search for such species-independent patterns I study the mutual information function of genomic DNA sequences, and find that it shows persistent period-three oscillations. To understand the biological origin of the observed period-three oscillations, I compare the mutual information function of genomic DNA sequences to the mutual information function of stochastic model sequences. I find that the pseudo-exon model is able to reproduce the mutual information function of genomic DNA sequences. Moreover, I find that a generalization of the pseudo-exon model can connect the existence and the functional form of long-range correlations to the presence and the length distributions of coding and noncoding regions. Based on these theoretical studies I am able to find an information-theoretical quantity, the average mutual information (AMI), whose probability distributions are significantly different in coding and noncoding DNA, while they are almost identical in all studied species. These findings show that there exist universal statistical patterns that are different in coding and noncoding DNA of all studied species, and they suggest that the AMI may be used to identify genes in different living species, irrespective of their taxonomic origin.

  19. Complete Mitochondrial Genome of Echinostoma hortense (Digenea: Echinostomatidae).

    PubMed

    Liu, Ze-Xuan; Zhang, Yan; Liu, Yu-Ting; Chang, Qiao-Cheng; Su, Xin; Fu, Xue; Yue, Dong-Mei; Gao, Yuan; Wang, Chun-Ren

    2016-04-01

    Echinostoma hortense (Digenea: Echinostomatidae) is one of the intestinal flukes with medical importance in humans. However, the mitochondrial (mt) genome of this fluke has not been known yet. The present study has determined the complete mt genome sequences of E. hortense and assessed the phylogenetic relationships with other digenean species for which the complete mt genome sequences are available in GenBank using concatenated amino acid sequences inferred from 12 protein-coding genes. The mt genome of E. hortense contained 12 protein-coding genes, 22 transfer RNA genes, 2 ribosomal RNA genes, and 1 non-coding region. The length of the mt genome of E. hortense was 14,994 bp, which was somewhat smaller than those of other trematode species. Phylogenetic analyses based on concatenated nucleotide sequence datasets for all 12 protein-coding genes using maximum parsimony (MP) method showed that E. hortense and Hypoderaeum conoideum gathered together, and they were closer to each other than to Fasciolidae and other echinostomatid trematodes. The availability of the complete mt genome sequences of E. hortense provides important genetic markers for diagnostics, population genetics, and evolutionary studies of digeneans.

  20. Complete Mitochondrial Genome of Echinostoma hortense (Digenea: Echinostomatidae)

    PubMed Central

    Liu, Ze-Xuan; Zhang, Yan; Liu, Yu-Ting; Chang, Qiao-Cheng; Su, Xin; Fu, Xue; Yue, Dong-Mei; Gao, Yuan; Wang, Chun-Ren

    2016-01-01

    Echinostoma hortense (Digenea: Echinostomatidae) is one of the intestinal flukes with medical importance in humans. However, the mitochondrial (mt) genome of this fluke has not been known yet. The present study has determined the complete mt genome sequences of E. hortense and assessed the phylogenetic relationships with other digenean species for which the complete mt genome sequences are available in GenBank using concatenated amino acid sequences inferred from 12 protein-coding genes. The mt genome of E. hortense contained 12 protein-coding genes, 22 transfer RNA genes, 2 ribosomal RNA genes, and 1 non-coding region. The length of the mt genome of E. hortense was 14,994 bp, which was somewhat smaller than those of other trematode species. Phylogenetic analyses based on concatenated nucleotide sequence datasets for all 12 protein-coding genes using maximum parsimony (MP) method showed that E. hortense and Hypoderaeum conoideum gathered together, and they were closer to each other than to Fasciolidae and other echinostomatid trematodes. The availability of the complete mt genome sequences of E. hortense provides important genetic markers for diagnostics, population genetics, and evolutionary studies of digeneans. PMID:27180575

  1. Evolution of the alternative AQP2 gene: Acquisition of a novel protein-coding sequence in dolphins.

    PubMed

    Kishida, Takushi; Suzuki, Miwa; Takayama, Asuka

    2018-01-01

    Taxon-specific de novo protein-coding sequences are thought to be important for taxon-specific environmental adaptation. A recent study revealed that bottlenose dolphins acquired a novel isoform of aquaporin 2 generated by alternative splicing (alternative AQP2), which helps dolphins to live in hyperosmotic seawater. The AQP2 gene consists of four exons, but the alternative AQP2 gene lacks the fourth exon and instead has a longer third exon that includes the original third exon and a part of the original third intron. Here, we show that the latter half of the third exon of the alternative AQP2 arose from a non-protein-coding sequence. Intact ORF of this de novo sequence is shared not by all cetaceans, but only by delphinoids. However, this sequence is conservative in all modern cetaceans, implying that this de novo sequence potentially plays important roles for marine adaptation in cetaceans. Copyright © 2017 Elsevier Inc. All rights reserved.

  2. Discrete Ramanujan transform for distinguishing the protein coding regions from other regions.

    PubMed

    Hua, Wei; Wang, Jiasong; Zhao, Jian

    2014-01-01

    Based on the study of Ramanujan sum and Ramanujan coefficient, this paper suggests the concepts of discrete Ramanujan transform and spectrum. Using Voss numerical representation, one maps a symbolic DNA strand as a numerical DNA sequence, and deduces the discrete Ramanujan spectrum of the numerical DNA sequence. It is well known that of discrete Fourier power spectrum of protein coding sequence has an important feature of 3-base periodicity, which is widely used for DNA sequence analysis by the technique of discrete Fourier transform. It is performed by testing the signal-to-noise ratio at frequency N/3 as a criterion for the analysis, where N is the length of the sequence. The results presented in this paper show that the property of 3-base periodicity can be only identified as a prominent spike of the discrete Ramanujan spectrum at period 3 for the protein coding regions. The signal-to-noise ratio for discrete Ramanujan spectrum is defined for numerical measurement. Therefore, the discrete Ramanujan spectrum and the signal-to-noise ratio of a DNA sequence can be used for distinguishing the protein coding regions from the noncoding regions. All the exon and intron sequences in whole chromosomes 1, 2, 3 and 4 of Caenorhabditis elegans have been tested and the histograms and tables from the computational results illustrate the reliability of our method. In addition, we have analyzed theoretically and gotten the conclusion that the algorithm for calculating discrete Ramanujan spectrum owns the lower computational complexity and higher computational accuracy. The computational experiments show that the technique by using discrete Ramanujan spectrum for classifying different DNA sequences is a fast and effective method. Copyright © 2014 Elsevier Ltd. All rights reserved.

  3. Ancient DNA sequence revealed by error-correcting codes.

    PubMed

    Brandão, Marcelo M; Spoladore, Larissa; Faria, Luzinete C B; Rocha, Andréa S L; Silva-Filho, Marcio C; Palazzo, Reginaldo

    2015-07-10

    A previously described DNA sequence generator algorithm (DNA-SGA) using error-correcting codes has been employed as a computational tool to address the evolutionary pathway of the genetic code. The code-generated sequence alignment demonstrated that a residue mutation revealed by the code can be found in the same position in sequences of distantly related taxa. Furthermore, the code-generated sequences do not promote amino acid changes in the deviant genomes through codon reassignment. A Bayesian evolutionary analysis of both code-generated and homologous sequences of the Arabidopsis thaliana malate dehydrogenase gene indicates an approximately 1 MYA divergence time from the MDH code-generated sequence node to its paralogous sequences. The DNA-SGA helps to determine the plesiomorphic state of DNA sequences because a single nucleotide alteration often occurs in distantly related taxa and can be found in the alternative codon patterns of noncanonical genetic codes. As a consequence, the algorithm may reveal an earlier stage of the evolution of the standard code.

  4. Ancient DNA sequence revealed by error-correcting codes

    PubMed Central

    Brandão, Marcelo M.; Spoladore, Larissa; Faria, Luzinete C. B.; Rocha, Andréa S. L.; Silva-Filho, Marcio C.; Palazzo, Reginaldo

    2015-01-01

    A previously described DNA sequence generator algorithm (DNA-SGA) using error-correcting codes has been employed as a computational tool to address the evolutionary pathway of the genetic code. The code-generated sequence alignment demonstrated that a residue mutation revealed by the code can be found in the same position in sequences of distantly related taxa. Furthermore, the code-generated sequences do not promote amino acid changes in the deviant genomes through codon reassignment. A Bayesian evolutionary analysis of both code-generated and homologous sequences of the Arabidopsis thaliana malate dehydrogenase gene indicates an approximately 1 MYA divergence time from the MDH code-generated sequence node to its paralogous sequences. The DNA-SGA helps to determine the plesiomorphic state of DNA sequences because a single nucleotide alteration often occurs in distantly related taxa and can be found in the alternative codon patterns of noncanonical genetic codes. As a consequence, the algorithm may reveal an earlier stage of the evolution of the standard code. PMID:26159228

  5. Two-terminal video coding.

    PubMed

    Yang, Yang; Stanković, Vladimir; Xiong, Zixiang; Zhao, Wei

    2009-03-01

    Following recent works on the rate region of the quadratic Gaussian two-terminal source coding problem and limit-approaching code designs, this paper examines multiterminal source coding of two correlated, i.e., stereo, video sequences to save the sum rate over independent coding of both sequences. Two multiterminal video coding schemes are proposed. In the first scheme, the left sequence of the stereo pair is coded by H.264/AVC and used at the joint decoder to facilitate Wyner-Ziv coding of the right video sequence. The first I-frame of the right sequence is successively coded by H.264/AVC Intracoding and Wyner-Ziv coding. An efficient stereo matching algorithm based on loopy belief propagation is then adopted at the decoder to produce pixel-level disparity maps between the corresponding frames of the two decoded video sequences on the fly. Based on the disparity maps, side information for both motion vectors and motion-compensated residual frames of the right sequence are generated at the decoder before Wyner-Ziv encoding. In the second scheme, source splitting is employed on top of classic and Wyner-Ziv coding for compression of both I-frames to allow flexible rate allocation between the two sequences. Experiments with both schemes on stereo video sequences using H.264/AVC, LDPC codes for Slepian-Wolf coding of the motion vectors, and scalar quantization in conjunction with LDPC codes for Wyner-Ziv coding of the residual coefficients give a slightly lower sum rate than separate H.264/AVC coding of both sequences at the same video quality.

  6. Identification of two allelic IgG1 C(H) coding regions (Cgamma1) of cat.

    PubMed

    Kanai, T H; Ueda, S; Nakamura, T

    2000-01-31

    Two types of cDNA encoding IgG1 heavy chain (gamma1) were isolated from a single domestic short-hair cat. Sequence analysis indicated a higher level of similarity of these Cgamma1 sequences to human Cgamma1 sequence (76.9 and 77.0%) than to mouse sequence (70.0 and 69.7%) at the nucleotide level. Predicted primary structures of both the feline Cgamma1 genes, designated as Cgamma1a and Cgamma1b, were similar to that of human Cgamma1 gene, for instance, as to the size of constant domains, the presence of six conserved cysteine residues involved in formation of the domain structure, and the location of a conserved N-linked glycosylation site. Sequence comparison between the two alleles showed that 7 out of 10 nucleotide differences were within the C(H)3 domain coding region, all leading to nonsynonymous changes in amino acid residues. Partial sequence analysis of genomic clones showed three nucleotide substitutions between the two Cgamma1 alleles in the intron between the CH2 and C(H)3 domain coding regions. In 12 domestic short-hair cats used in this study, the frequency of Cgamma1a allele (62.5%) was higher than that of the Cgamma1b allele (37.5%).

  7. The influence of viral coding sequences on pestivirus IRES activity reveals further parallels with translation initiation in prokaryotes.

    PubMed Central

    Fletcher, Simon P; Ali, Iraj K; Kaminski, Ann; Digard, Paul; Jackson, Richard J

    2002-01-01

    Classical swine fever virus (CSFV) is a member of the pestivirus family, which shares many features in common with hepatitis C virus (HCV). It is shown here that CSFV has an exceptionally efficient cis-acting internal ribosome entry segment (IRES), which, like that of HCV, is strongly influenced by the sequences immediately downstream of the initiation codon, and is optimal with viral coding sequences in this position. Constructs that retained 17 or more codons of viral coding sequence exhibited full IRES activity, but with only 12 codons, activity was approximately 66% of maximum in vitro (though close to maximum in transfected BHK cells), whereas with just 3 codons or fewer, the activity was only approximately 15% of maximum. The minimal coding region elements required for high activity were exchanged between HCV and CSFV. Although maximum activity was observed in each case with the homologous combination of coding region and 5' UTR, the heterologous combinations were sufficiently active to rule out a highly specific functional interplay between the 5' UTR and coding sequences. On the other hand, inversion of the coding sequences resulted in low IRES activity, particularly with the HCV coding sequences. RNA structure probing showed that the efficiency of internal initiation of these chimeric constructs correlated most closely with the degree of single-strandedness of the region around and immediately downstream of the initiation codon. The low activity IRESs could not be rescued by addition of supplementary eIF4A (the initiation factor with ATP-dependent RNA helicase activity). The extreme sensitivity to secondary structure around the initiation codon is likely to be due to the fact that the eIF4F complex (which has eIF4A as one of its subunits) is not required for and does not participate in initiation on these IRESs. PMID:12515388

  8. Coordination analysis of players' distribution in football using cross-correlation and vector coding techniques.

    PubMed

    Moura, Felipe Arruda; van Emmerik, Richard E A; Santana, Juliana Exel; Martins, Luiz Eduardo Barreto; Barros, Ricardo Machado Leite de; Cunha, Sergio Augusto

    2016-12-01

    The purpose of this study was to investigate the coordination between teams spread during football matches using cross-correlation and vector coding techniques. Using a video-based tracking system, we obtained the trajectories of 257 players during 10 matches. Team spread was calculated as functions of time. For a general coordination description, we calculated the cross-correlation between the signals. Vector coding was used to identify the coordination patterns between teams during offensive sequences that ended in shots on goal or defensive tackles. Cross-correlation showed that opponent teams have a tendency to present in-phase coordination, with a short time lag. During offensive sequences, vector coding results showed that, although in-phase coordination dominated, other patterns were observed. We verified that during the early stages, offensive sequences ending in shots on goal present greater anti-phase and attacking team phase periods, compared to sequences ending in tackles. Results suggest that the attacking team may seek to present a contrary behaviour of its opponent (or may lead the adversary behaviour) in the beginning of the attacking play, regarding to the distribution strategy, to increase the chances of a shot on goal. The techniques allowed detecting the coordination patterns between teams, providing additional information about football dynamics and players' interaction.

  9. The Use and Effectiveness of Triple Multiplex System for Coding Region Single Nucleotide Polymorphism in Mitochondrial DNA Typing of Archaeologically Obtained Human Skeletons from Premodern Joseon Tombs of Korea

    PubMed Central

    Oh, Chang Seok; Lee, Soong Deok; Kim, Yi-Suk; Shin, Dong Hoon

    2015-01-01

    Previous study showed that East Asian mtDNA haplogroups, especially those of Koreans, could be successfully assigned by the coupled use of analyses on coding region SNP markers and control region mutation motifs. In this study, we tried to see if the same triple multiplex analysis for coding regions SNPs could be also applicable to ancient samples from East Asia as the complementation for sequence analysis of mtDNA control region. By the study on Joseon skeleton samples, we know that mtDNA haplogroup determined by coding region SNP markers successfully falls within the same haplogroup that sequence analysis on control region can assign. Considering that ancient samples in previous studies make no small number of errors in control region mtDNA sequencing, coding region SNP analysis can be used as good complimentary to the conventional haplogroup determination, especially of archaeological human bone samples buried underground over long periods. PMID:26345190

  10. DNA-based watermarks using the DNA-Crypt algorithm.

    PubMed

    Heider, Dominik; Barnekow, Angelika

    2007-05-29

    The aim of this paper is to demonstrate the application of watermarks based on DNA sequences to identify the unauthorized use of genetically modified organisms (GMOs) protected by patents. Predicted mutations in the genome can be corrected by the DNA-Crypt program leaving the encrypted information intact. Existing DNA cryptographic and steganographic algorithms use synthetic DNA sequences to store binary information however, although these sequences can be used for authentication, they may change the target DNA sequence when introduced into living organisms. The DNA-Crypt algorithm and image steganography are based on the same watermark-hiding principle, namely using the least significant base in case of DNA-Crypt and the least significant bit in case of the image steganography. It can be combined with binary encryption algorithms like AES, RSA or Blowfish. DNA-Crypt is able to correct mutations in the target DNA with several mutation correction codes such as the Hamming-code or the WDH-code. Mutations which can occur infrequently may destroy the encrypted information, however an integrated fuzzy controller decides on a set of heuristics based on three input dimensions, and recommends whether or not to use a correction code. These three input dimensions are the length of the sequence, the individual mutation rate and the stability over time, which is represented by the number of generations. In silico experiments using the Ypt7 in Saccharomyces cerevisiae shows that the DNA watermarks produced by DNA-Crypt do not alter the translation of mRNA into protein. The program is able to store watermarks in living organisms and can maintain the original information by correcting mutations itself. Pairwise or multiple sequence alignments show that DNA-Crypt produces few mismatches between the sequences similar to all steganographic algorithms.

  11. DNA-based watermarks using the DNA-Crypt algorithm

    PubMed Central

    Heider, Dominik; Barnekow, Angelika

    2007-01-01

    Background The aim of this paper is to demonstrate the application of watermarks based on DNA sequences to identify the unauthorized use of genetically modified organisms (GMOs) protected by patents. Predicted mutations in the genome can be corrected by the DNA-Crypt program leaving the encrypted information intact. Existing DNA cryptographic and steganographic algorithms use synthetic DNA sequences to store binary information however, although these sequences can be used for authentication, they may change the target DNA sequence when introduced into living organisms. Results The DNA-Crypt algorithm and image steganography are based on the same watermark-hiding principle, namely using the least significant base in case of DNA-Crypt and the least significant bit in case of the image steganography. It can be combined with binary encryption algorithms like AES, RSA or Blowfish. DNA-Crypt is able to correct mutations in the target DNA with several mutation correction codes such as the Hamming-code or the WDH-code. Mutations which can occur infrequently may destroy the encrypted information, however an integrated fuzzy controller decides on a set of heuristics based on three input dimensions, and recommends whether or not to use a correction code. These three input dimensions are the length of the sequence, the individual mutation rate and the stability over time, which is represented by the number of generations. In silico experiments using the Ypt7 in Saccharomyces cerevisiae shows that the DNA watermarks produced by DNA-Crypt do not alter the translation of mRNA into protein. Conclusion The program is able to store watermarks in living organisms and can maintain the original information by correcting mutations itself. Pairwise or multiple sequence alignments show that DNA-Crypt produces few mismatches between the sequences similar to all steganographic algorithms. PMID:17535434

  12. Long-range correlation properties of coding and noncoding DNA sequences: GenBank analysis.

    PubMed

    Buldyrev, S V; Goldberger, A L; Havlin, S; Mantegna, R N; Matsa, M E; Peng, C K; Simons, M; Stanley, H E

    1995-05-01

    An open question in computational molecular biology is whether long-range correlations are present in both coding and noncoding DNA or only in the latter. To answer this question, we consider all 33301 coding and all 29453 noncoding eukaryotic sequences--each of length larger than 512 base pairs (bp)--in the present release of the GenBank to dtermine whether there is any statistically significant distinction in their long-range correlation properties. Standard fast Fourier transform (FFT) analysis indicates that coding sequences have practically no correlations in the range from 10 bp to 100 bp (spectral exponent beta=0.00 +/- 0.04, where the uncertainty is two standard deviations). In contrast, for noncoding sequences, the average value of the spectral exponent beta is positive (0.16 +/- 0.05) which unambiguously shows the presence of long-range correlations. We also separately analyze the 874 coding and the 1157 noncoding sequences that have more than 4096 bp and find a larger region of power-law behavior. We calculate the probability that these two data sets (coding and noncoding) were drawn from the same distribution and we find that it is less than 10(-10). We obtain independent confirmation of these findings using the method of detrended fluctuation analysis (DFA), which is designed to treat sequences with statistical heterogeneity, such as DNA's known mosaic structure ("patchiness") arising from the nonstationarity of nucleotide concentration. The near-perfect agreement between the two independent analysis methods, FFT and DFA, increases the confidence in the reliability of our conclusion.

  13. Long-range correlation properties of coding and noncoding DNA sequences: GenBank analysis

    NASA Technical Reports Server (NTRS)

    Buldyrev, S. V.; Goldberger, A. L.; Havlin, S.; Mantegna, R. N.; Matsa, M. E.; Peng, C. K.; Simons, M.; Stanley, H. E.

    1995-01-01

    An open question in computational molecular biology is whether long-range correlations are present in both coding and noncoding DNA or only in the latter. To answer this question, we consider all 33301 coding and all 29453 noncoding eukaryotic sequences--each of length larger than 512 base pairs (bp)--in the present release of the GenBank to dtermine whether there is any statistically significant distinction in their long-range correlation properties. Standard fast Fourier transform (FFT) analysis indicates that coding sequences have practically no correlations in the range from 10 bp to 100 bp (spectral exponent beta=0.00 +/- 0.04, where the uncertainty is two standard deviations). In contrast, for noncoding sequences, the average value of the spectral exponent beta is positive (0.16 +/- 0.05) which unambiguously shows the presence of long-range correlations. We also separately analyze the 874 coding and the 1157 noncoding sequences that have more than 4096 bp and find a larger region of power-law behavior. We calculate the probability that these two data sets (coding and noncoding) were drawn from the same distribution and we find that it is less than 10(-10). We obtain independent confirmation of these findings using the method of detrended fluctuation analysis (DFA), which is designed to treat sequences with statistical heterogeneity, such as DNA's known mosaic structure ("patchiness") arising from the nonstationarity of nucleotide concentration. The near-perfect agreement between the two independent analysis methods, FFT and DFA, increases the confidence in the reliability of our conclusion.

  14. Evolution and Diversity of the Human Hepatitis D Virus Genome

    PubMed Central

    Huang, Chi-Ruei; Lo, Szecheng J.

    2010-01-01

    Human hepatitis delta virus (HDV) is the smallest RNA virus in genome. HDV genome is divided into a viroid-like sequence and a protein-coding sequence which could have originated from different resources and the HDV genome was eventually constituted through RNA recombination. The genome subsequently diversified through accumulation of mutations selected by interactions between the mutated RNA and proteins with host factors to successfully form the infectious virions. Therefore, we propose that the conservation of HDV nucleotide sequence is highly related with its functionality. Genome analysis of known HDV isolates shows that the C-terminal coding sequences of large delta antigen (LDAg) are the highest diversity than other regions of protein-coding sequences but they still retain biological functionality to interact with the heavy chain of clathrin can be selected and maintained. Since viruses interact with many host factors, including escaping the host immune response, how to design a program to predict RNA genome evolution is a great challenging work. PMID:20204073

  15. Exome sequencing-driven discovery of coding polymorphisms associated with common metabolic phenotypes.

    PubMed

    Albrechtsen, A; Grarup, N; Li, Y; Sparsø, T; Tian, G; Cao, H; Jiang, T; Kim, S Y; Korneliussen, T; Li, Q; Nie, C; Wu, R; Skotte, L; Morris, A P; Ladenvall, C; Cauchi, S; Stančáková, A; Andersen, G; Astrup, A; Banasik, K; Bennett, A J; Bolund, L; Charpentier, G; Chen, Y; Dekker, J M; Doney, A S F; Dorkhan, M; Forsen, T; Frayling, T M; Groves, C J; Gui, Y; Hallmans, G; Hattersley, A T; He, K; Hitman, G A; Holmkvist, J; Huang, S; Jiang, H; Jin, X; Justesen, J M; Kristiansen, K; Kuusisto, J; Lajer, M; Lantieri, O; Li, W; Liang, H; Liao, Q; Liu, X; Ma, T; Ma, X; Manijak, M P; Marre, M; Mokrosiński, J; Morris, A D; Mu, B; Nielsen, A A; Nijpels, G; Nilsson, P; Palmer, C N A; Rayner, N W; Renström, F; Ribel-Madsen, R; Robertson, N; Rolandsson, O; Rossing, P; Schwartz, T W; Slagboom, P E; Sterner, M; Tang, M; Tarnow, L; Tuomi, T; van't Riet, E; van Leeuwen, N; Varga, T V; Vestmar, M A; Walker, M; Wang, B; Wang, Y; Wu, H; Xi, F; Yengo, L; Yu, C; Zhang, X; Zhang, J; Zhang, Q; Zhang, W; Zheng, H; Zhou, Y; Altshuler, D; 't Hart, L M; Franks, P W; Balkau, B; Froguel, P; McCarthy, M I; Laakso, M; Groop, L; Christensen, C; Brandslund, I; Lauritzen, T; Witte, D R; Linneberg, A; Jørgensen, T; Hansen, T; Wang, J; Nielsen, R; Pedersen, O

    2013-02-01

    Human complex metabolic traits are in part regulated by genetic determinants. Here we applied exome sequencing to identify novel associations of coding polymorphisms at minor allele frequencies (MAFs) >1% with common metabolic phenotypes. The study comprised three stages. We performed medium-depth (8×) whole exome sequencing in 1,000 cases with type 2 diabetes, BMI >27.5 kg/m(2) and hypertension and in 1,000 controls (stage 1). We selected 16,192 polymorphisms nominally associated (p < 0.05) with case-control status, from four selected annotation categories or from loci reported to associate with metabolic traits. These variants were genotyped in 15,989 Danes to search for association with 12 metabolic phenotypes (stage 2). In stage 3, polymorphisms showing potential associations were genotyped in a further 63,896 Europeans. Exome sequencing identified 70,182 polymorphisms with MAF >1%. In stage 2 we identified 51 potential associations with one or more of eight metabolic phenotypes covered by 45 unique polymorphisms. In meta-analyses of stage 2 and stage 3 results, we demonstrated robust associations for coding polymorphisms in CD300LG (fasting HDL-cholesterol: MAF 3.5%, p = 8.5 × 10(-14)), COBLL1 (type 2 diabetes: MAF 12.5%, OR 0.88, p = 1.2 × 10(-11)) and MACF1 (type 2 diabetes: MAF 23.4%, OR 1.10, p = 8.2 × 10(-10)). We applied exome sequencing as a basis for finding genetic determinants of metabolic traits and show the existence of low-frequency and common coding polymorphisms with impact on common metabolic traits. Based on our study, coding polymorphisms with MAF above 1% do not seem to have particularly high effect sizes on the measured metabolic traits.

  16. The kinetoplast DNA of the Australian trypanosome, Trypanosoma copemani, shares features with Trypanosoma cruzi and Trypanosoma lewisi.

    PubMed

    Botero, Adriana; Kapeller, Irit; Cooper, Crystal; Clode, Peta L; Shlomai, Joseph; Thompson, R C Andrew

    2018-05-17

    Kinetoplast DNA (kDNA) is the mitochondrial genome of trypanosomatids. It consists of a few dozen maxicircles and several thousand minicircles, all catenated topologically to form a two-dimensional DNA network. Minicircles are heterogeneous in size and sequence among species. They present one or several conserved regions that contain three highly conserved sequence blocks. CSB-1 (10 bp sequence) and CSB-2 (8 bp sequence) present lower interspecies homology, while CSB-3 (12 bp sequence) or the Universal Minicircle Sequence is conserved within most trypanosomatids. The Universal Minicircle Sequence is located at the replication origin of the minicircles, and is the binding site for the UMS binding protein, a protein involved in trypanosomatid survival and virulence. Here, we describe the structure and organisation of the kDNA of Trypanosoma copemani, a parasite that has been shown to infect mammalian cells and has been associated with the drastic decline of the endangered Australian marsupial, the woylie (Bettongia penicillata). Deep genomic sequencing showed that T. copemani presents two classes of minicircles that share sequence identity and organisation in the conserved sequence blocks with those of Trypanosoma cruzi and Trypanosoma lewisi. A 19,257 bp partial region of the maxicircle of T. copemani that contained the entire coding region was obtained. Comparative analysis of the T. copemani entire maxicircle coding region with the coding regions of T. cruzi and T. lewisi showed they share 71.05% and 71.28% identity, respectively. The shared features in the maxicircle/minicircle organisation and sequence between T. copemani and T. cruzi/T. lewisi suggest similarities in their process of kDNA replication, and are of significance in understanding the evolution of Australian trypanosomes. Copyright © 2018 The Authors. Published by Elsevier Ltd.. All rights reserved.

  17. Nonspatial Sequence Coding in CA1 Neurons

    PubMed Central

    Allen, Timothy A.; Salz, Daniel M.; McKenzie, Sam

    2016-01-01

    The hippocampus is critical to the memory for sequences of events, a defining feature of episodic memory. However, the fundamental neuronal mechanisms underlying this capacity remain elusive. While considerable research indicates hippocampal neurons can represent sequences of locations, direct evidence of coding for the memory of sequential relationships among nonspatial events remains lacking. To address this important issue, we recorded neural activity in CA1 as rats performed a hippocampus-dependent sequence-memory task. Briefly, the task involves the presentation of repeated sequences of odors at a single port and requires rats to identify each item as “in sequence” or “out of sequence”. We report that, while the animals' location and behavior remained constant, hippocampal activity differed depending on the temporal context of items—in this case, whether they were presented in or out of sequence. Some neurons showed this effect across items or sequence positions (general sequence cells), while others exhibited selectivity for specific conjunctions of item and sequence position information (conjunctive sequence cells) or for specific probe types (probe-specific sequence cells). We also found that the temporal context of individual trials could be accurately decoded from the activity of neuronal ensembles, that sequence coding at the single-cell and ensemble level was linked to sequence memory performance, and that slow-gamma oscillations (20–40 Hz) were more strongly modulated by temporal context and performance than theta oscillations (4–12 Hz). These findings provide compelling evidence that sequence coding extends beyond the domain of spatial trajectories and is thus a fundamental function of the hippocampus. SIGNIFICANCE STATEMENT The ability to remember the order of life events depends on the hippocampus, but the underlying neural mechanisms remain poorly understood. Here we addressed this issue by recording neural activity in hippocampal region CA1 while rats performed a nonspatial sequence memory task. We found that hippocampal neurons code for the temporal context of items (whether odors were presented in the correct or incorrect sequential position) and that this activity is linked with memory performance. The discovery of this novel form of temporal coding in hippocampal neurons advances our fundamental understanding of the neurobiology of episodic memory and will serve as a foundation for our cross-species, multitechnique approach aimed at elucidating the neural mechanisms underlying memory impairments in aging and dementia. PMID:26843637

  18. Reduced TCOF1 mRNA level in a rhesus macaque with Treacher Collins-like syndrome: further evidence for haploinsufficiency of treacle as the cause of disease.

    PubMed

    Shows, Kathryn H; Ward, Christy; Summers, Laura; Li, Lin; Ziegler, Gregory R; Hendrickx, Andrew G; Shiang, Rita

    2006-02-01

    Mutations in the human gene TCOF1 cause a mandibulofacial dysostosis known as Treacher Collins syndrome (TCS). An infant rhesus macaque (Macaca mulatta) that displayed the TCS phenotype was identified at the California National Primate Research Center. The TCOF1 coding region was cloned from a normal rhesus macaque and sequenced. The rhesus macaque homolog of TCOF1 is 91.6% identical in cDNA sequence and 93.8% identical in translated protein sequence compared to human TCOF1. Sequencing of TCOF1 in the TCS-affected rhesus macaque showed no mutations within the coding region or splice sites; however, real-time quantitative PCR showed an 87% reduction of spleen TCOF1 mRNA level in the TCS affected macaque when compared with normal macaque spleen.

  19. Cloning and sequence analysis of a cDNA clone coding for the mouse GM2 activator protein.

    PubMed Central

    Bellachioma, G; Stirling, J L; Orlacchio, A; Beccari, T

    1993-01-01

    A cDNA (1.1 kb) containing the complete coding sequence for the mouse GM2 activator protein was isolated from a mouse macrophage library using a cDNA for the human protein as a probe. There was a single ATG located 12 bp from the 5' end of the cDNA clone followed by an open reading frame of 579 bp. Northern blot analysis of mouse macrophage RNA showed that there was a single band with a mobility corresponding to a size of 2.3 kb. We deduce from this that the mouse mRNA, in common with the mRNA for the human GM2 activator protein, has a long 3' untranslated sequence of approx. 1.7 kb. Alignment of the mouse and human deduced amino acid sequences showed 68% identity overall and 75% identity for the sequence on the C-terminal side of the first 31 residues, which in the human GM2 activator protein contains the signal peptide. Hydropathicity plots showed great similarity between the mouse and human sequences even in regions of low sequence similarity. There is a single N-glycosylation site in the mouse GM2 activator protein sequence (Asn151-Phe-Thr) which differs in its location from the single site reported in the human GM2 activator protein sequence (Asn63-Val-Thr). Images Figure 1 PMID:7689829

  20. Complex alternative splicing of acetylcholinesterase transcripts in Torpedo electric organ; primary structure of the precursor of the glycolipid-anchored dimeric form.

    PubMed Central

    Sikorav, J L; Duval, N; Anselmet, A; Bon, S; Krejci, E; Legay, C; Osterlund, M; Reimund, B; Massoulié, J

    1988-01-01

    In this paper, we show the existence of alternative splicing in the 3' region of the coding sequence of Torpedo acetylcholinesterase (AChE). We describe two cDNA structures which both diverge from the previously described coding sequence of the catalytic subunit of asymmetric (A) forms (Schumacher et al., 1986; Sikorav et al., 1987). They both contain a coding sequence followed by a non-coding sequence and a poly(A) stretch. Both of these structures were shown to exist in poly(A)+ RNAs, by S1 mapping experiments. The divergent region encoded by the first sequence corresponds to the precursor of the globular dimeric form (G2a), since it contains the expected C-terminal amino acids, Ala-Cys. These amino acids are followed by a 29 amino acid extension which contains a hydrophobic segment and must be replaced by a glycolipid in the mature protein. Analyses of intact G2a AChE showed that the common domain of the protein contains intersubunit disulphide bonds. The divergent region of the second type of cDNA consists of an adjacent genomic sequence, which is removed as an intron in A and Ga mRNAs, but may encode a distinct, less abundant catalytic subunit. The structures of the cDNA clones indicate that they are derived from minor mRNAs, shorter than the three major transcripts which have been described previously (14.5, 10.5 and 5.5 kb). Oligonucleotide probes specific for the asymmetric and globular terminal regions hybridize with the three major transcripts, indicating that their size is determined by 3'-untranslated regions which are not related to the differential splicing leading to A and Ga forms. Images PMID:3181125

  1. File compression and encryption based on LLS and arithmetic coding

    NASA Astrophysics Data System (ADS)

    Yu, Changzhi; Li, Hengjian; Wang, Xiyu

    2018-03-01

    e propose a file compression model based on arithmetic coding. Firstly, the original symbols, to be encoded, are input to the encoder one by one, we produce a set of chaotic sequences by using the Logistic and sine chaos system(LLS), and the values of this chaotic sequences are randomly modified the Upper and lower limits of current symbols probability. In order to achieve the purpose of encryption, we modify the upper and lower limits of all character probabilities when encoding each symbols. Experimental results show that the proposed model can achieve the purpose of data encryption while achieving almost the same compression efficiency as the arithmetic coding.

  2. Different evolutionary patterns of SNPs between domains and unassigned regions in human protein-coding sequences.

    PubMed

    Pang, Erli; Wu, Xiaomei; Lin, Kui

    2016-06-01

    Protein evolution plays an important role in the evolution of each genome. Because of their functional nature, in general, most of their parts or sites are differently constrained selectively, particularly by purifying selection. Most previous studies on protein evolution considered individual proteins in their entirety or compared protein-coding sequences with non-coding sequences. Less attention has been paid to the evolution of different parts within each protein of a given genome. To this end, based on PfamA annotation of all human proteins, each protein sequence can be split into two parts: domains or unassigned regions. Using this rationale, single nucleotide polymorphisms (SNPs) in protein-coding sequences from the 1000 Genomes Project were mapped according to two classifications: SNPs occurring within protein domains and those within unassigned regions. With these classifications, we found: the density of synonymous SNPs within domains is significantly greater than that of synonymous SNPs within unassigned regions; however, the density of non-synonymous SNPs shows the opposite pattern. We also found there are signatures of purifying selection on both the domain and unassigned regions. Furthermore, the selective strength on domains is significantly greater than that on unassigned regions. In addition, among all of the human protein sequences, there are 117 PfamA domains in which no SNPs are found. Our results highlight an important aspect of protein domains and may contribute to our understanding of protein evolution.

  3. Translational resistivity/conductivity of coding sequences during exponential growth of Escherichia coli.

    PubMed

    Takai, Kazuyuki

    2017-01-21

    Codon adaptation index (CAI) has been widely used for prediction of expression of recombinant genes in Escherichia coli and other organisms. However, CAI has no mechanistic basis that rationalizes its application to estimation of translational efficiency. Here, I propose a model based on which we could consider how codon usage is related to the level of expression during exponential growth of bacteria. In this model, translation of a gene is considered as an analog of electric current, and an analog of electric resistance corresponding to each gene is considered. "Translational resistance" is dependent on the steady-state concentration and the sequence of the mRNA species, and "translational resistivity" is dependent only on the mRNA sequence. The latter is the sum of two parts: one is the resistivity for the elongation reaction (coding sequence resistivity), and the other comes from all of the other steps of the decoding reaction. This electric circuit model clearly shows that some conditions should be met for codon composition of a coding sequence to correlate well with its expression level. On the other hand, I calculated relative frequency of each of the 61 sense codon triplets translated during exponential growth of E. coli from a proteomic dataset covering over 2600 proteins. A tentative method for estimating relative coding sequence resistivity based on the data is presented. Copyright © 2016. Published by Elsevier Ltd.

  4. The complete mitochondrial genome of Papilio glaucus and its phylogenetic implications.

    PubMed

    Shen, Jinhui; Cong, Qian; Grishin, Nick V

    2015-09-01

    Due to the intriguing morphology, lifecycle, and diversity of butterflies and moths, Lepidoptera are emerging as model organisms for the study of genetics, evolution and speciation. The progress of these studies relies on decoding Lepidoptera genomes, both nuclear and mitochondrial. Here we describe a protocol to obtain mitogenomes from Next Generation Sequencing reads performed for whole-genome sequencing and report the complete mitogenome of Papilio (Pterourus) glaucus. The circular mitogenome is 15,306 bp in length and rich in A and T. It contains 13 protein-coding genes (PCGs), 22 transfer-RNA-coding genes (tRNA), and 2 ribosomal-RNA-coding genes (rRNA), with a gene order typical for mitogenomes of Lepidoptera. We performed phylogenetic analyses based on PCG and RNA-coding genes or protein sequences using Bayesian Inference and Maximum Likelihood methods. The phylogenetic trees consistently show that among species with available mitogenomes Papilio glaucus is the closest to Papilio (Agehana) maraho from Asia.

  5. Full-Genome Sequence of Infectious Laryngotracheitis Virus (Gallid Alphaherpesvirus 1) Strain VFAR-043, Isolated in Peru

    PubMed Central

    Bendezu Eguis, Jorge; Montesinos, Ricardo; Fernández-Díaz, Manolo

    2018-01-01

    ABSTRACT We report here the first genome sequence of infectious laryngotracheitis virus isolated in Peru from tracheal tissues of layer chickens. The genome showed 99.98% identity to the J2 strain genome sequence. Single nucleotide polymorphisms were detected in five gene-coding sequences related to vaccine development, virus attachment, and viral immune evasion. PMID:29519822

  6. Cloning and expression of a cDNA coding for a human monocyte-derived plasminogen activator inhibitor.

    PubMed

    Antalis, T M; Clark, M A; Barnes, T; Lehrbach, P R; Devine, P L; Schevzov, G; Goss, N H; Stephens, R W; Tolstoshev, P

    1988-02-01

    Human monocyte-derived plasminogen activator inhibitor (mPAI-2) was purified to homogeneity from the U937 cell line and partially sequenced. Oligonucleotide probes derived from this sequence were used to screen a cDNA library prepared from U937 cells. One positive clone was sequenced and contained most of the coding sequence as well as a long incomplete 3' untranslated region (1112 base pairs). This cDNA sequence was shown to encode mPAI-2 by hybrid-select translation. A cDNA clone encoding the remainder of the mPAI-2 mRNA was obtained by primer extension of U937 poly(A)+ RNA using a probe complementary to the mPAI-2 coding region. The coding sequence for mPAI-2 was placed under the control of the lambda PL promoter, and the protein expressed in Escherichia coli formed a complex with urokinase that could be detected immunologically. By nucleotide sequence analysis, mPAI-2 cDNA encodes a protein containing 415 amino acids with a predicted unglycosylated Mr of 46,543. The predicted amino acid sequence of mPAI-2 is very similar to placental PAI-2 (3 amino acid differences) and shows extensive homology with members of the serine protease inhibitor (serpin) superfamily. mPAI-2 was found to be more homologous to ovalbumin (37%) than the endothelial plasminogen activator inhibitor, PAI-1 (26%). Like ovalbumin, mPAI-2 appears to have no typical amino-terminal signal sequence. The 3' untranslated region of the mPAI-2 cDNA contains a putative regulatory sequence that has been associated with the inflammatory mediators.

  7. Cloning and expression of a cDNA coding for a human monocyte-derived plasminogen activator inhibitor.

    PubMed Central

    Antalis, T M; Clark, M A; Barnes, T; Lehrbach, P R; Devine, P L; Schevzov, G; Goss, N H; Stephens, R W; Tolstoshev, P

    1988-01-01

    Human monocyte-derived plasminogen activator inhibitor (mPAI-2) was purified to homogeneity from the U937 cell line and partially sequenced. Oligonucleotide probes derived from this sequence were used to screen a cDNA library prepared from U937 cells. One positive clone was sequenced and contained most of the coding sequence as well as a long incomplete 3' untranslated region (1112 base pairs). This cDNA sequence was shown to encode mPAI-2 by hybrid-select translation. A cDNA clone encoding the remainder of the mPAI-2 mRNA was obtained by primer extension of U937 poly(A)+ RNA using a probe complementary to the mPAI-2 coding region. The coding sequence for mPAI-2 was placed under the control of the lambda PL promoter, and the protein expressed in Escherichia coli formed a complex with urokinase that could be detected immunologically. By nucleotide sequence analysis, mPAI-2 cDNA encodes a protein containing 415 amino acids with a predicted unglycosylated Mr of 46,543. The predicted amino acid sequence of mPAI-2 is very similar to placental PAI-2 (3 amino acid differences) and shows extensive homology with members of the serine protease inhibitor (serpin) superfamily. mPAI-2 was found to be more homologous to ovalbumin (37%) than the endothelial plasminogen activator inhibitor, PAI-1 (26%). Like ovalbumin, mPAI-2 appears to have no typical amino-terminal signal sequence. The 3' untranslated region of the mPAI-2 cDNA contains a putative regulatory sequence that has been associated with the inflammatory mediators. Images PMID:3257578

  8. A specific indel marker for the Philippines Schistosoma japonicum revealed by analysis of mitochondrial genome sequences.

    PubMed

    Li, Juan; Chen, Fen; Sugiyama, Hiromu; Blair, David; Lin, Rui-Qing; Zhu, Xing-Quan

    2015-07-01

    In the present study, near-complete mitochondrial (mt) genome sequences for Schistosoma japonicum from different regions in the Philippines and Japan were amplified and sequenced. Comparisons among S. japonicum from the Philippines, Japan, and China revealed a geographically based length difference in mt genomes, but the mt genomic organization and gene arrangement were the same. Sequence differences among samples from the Philippines and all samples from the three endemic areas were 0.57-2.12 and 0.76-3.85 %, respectively. The most variable part of the mt genome was the non-coding region. In the coding portion of the genome, protein-coding genes varied more than rRNA genes and tRNAs. The near-complete mt genome sequences for Philippine specimens were identical in length (14,091 bp) which was 4 bp longer than those of S. japonicum samples from Japan and China. This indel provides a unique genetic marker for S. japonicum samples from the Philippines. Phylogenetic analyses based on the concatenated amino acids of 12 protein-coding genes showed that samples of S. japonicum clustered according to their geographical origins. The identified mitochondrial indel marker will be useful for tracing the source of S. japonicum infection in humans and animals in Southeast Asia.

  9. Sequence and RT-PCR expression analysis of two peroxidases from Arabidopsis thaliana belonging to a novel evolutionary branch of plant peroxidases.

    PubMed

    Kjaersgård, I V; Jespersen, H M; Rasmussen, S K; Welinder, K G

    1997-03-01

    cDNA clones encoding two new Arabidopsis thaliana peroxidases, ATP 1a and ATP 2a, have been identified by searching the Arabidopsis database of expressed sequence tags (dbEST). They represent a novel branch of hitherto uncharacterized plant peroxidases which is only 35% identical in amino acid sequence to the well characterized group of basic plant peroxidases represented by the horseradish (Armoracia rusticana) isoperoxidases HRP C, HRP E5 and the similar Arabidopsis isoperoxidases ATP Ca, ATP Cb, and ATP Ea. However ATP 1a is 87% identical in amino acid sequence to a peroxidase encoded by an mRNA isolated from cotton (Gossypium hirsutum). As cotton and Arabidopsis belong to rather diverse families (Malvaceae and Crucifereae, respectively), in contrast with Arabidopsis and horseradish (both Crucifereae), the high degree of sequence identity indicates that this novel type of peroxidase, albeit of unknown function, is likely to be widespread in plant species. The atp 1 and atp 2 types of cDNA sequences were the most redundant among the 28 different isoperoxidases identified among about 200 peroxidase encoding ESTs. Interestingly, 8 out of totally 38 EST sequences coding for ATP 1 showed three identical nucleotide substitutions. This variant form is designated ATP 1b. Similarly, six out of totally 16 EST sequences coding for ATP 2 showed a number of deletions and nucleotide changes. This variant form is designated ATP 2b. The selected EST clones are full-length and contain coding regions of 993 nucleotides for atp 1a, and 984 nucleotides for atp 2a. These regions show 61% DNA sequence identity. The predicted mature proteins ATP 1a, and ATP 2a are 57% identical in sequence and contain the structurally and functionally important residues, characteristic of the plant peroxidase superfamily. However, they do show two differences of importance to peroxidase catalysis: (1) the asparagine residue linked with the active site distal histidine via hydrogen bonding is absent; (2) an N-glycosylation site is located right at the entrance to the heme channel. The reverse transcriptase polymerase chain reaction (RT-PCR) was used to identify mRNAs coding for ATP 1a/b and ATP 2a/b in germinating seeds, seedlings, roots, leaves, stems, flowers and cell suspension culture using elongation factor 1alpha (EF-1alpha) for the first time as a positive control. Both mRNAs were transcribed at levels comparable to EF-1alpha in all plant tissues investigated which were more than two days old, and in cell suspension culture. In addition, the mRNA coding for ATP 1a/b was found in two day old germinating seeds. The abundant transcription of ATP 1a/b and ATP 2a/b is in line with their many entries in dbEST, and indicates essential roles for these novel peroxidases.

  10. A Sabin 2-related poliovirus recombinant contains a homologous sequence of human enterovirus species C in the viral polymerase coding region.

    PubMed

    Zhang, Yong; Zhang, Fan; Zhu, Shuangli; Chen, Li; Yan, Dongmei; Wang, Dongyan; Tang, Ruiyan; Zhu, Hui; Hou, Xiaohui; An, Hongqiu; Zhang, Hong; Xu, Wenbo

    2010-02-01

    A type 2 vaccine-related poliovirus (strain CHN3024), differing from the Sabin 2 strain by 0.44% in the VP1 coding region was isolated from a patient with vaccine-associated paralytic poliomyelitis. Sequences downstream of nucleotide position 6735 (3D(pol) coding region) were derived from an unidentified sequence; no close match for a potential parent was found, but it could be classified into a non-polio human enteroviruses species C (HEV-C) phylogeny. The virus differed antigenically from the parental Sabin strain, having an amino acid substitution in the neutralizing antigenic site 1. The similarity between CHN3024 and Sabin 2 sequences suggests that the recombination was recent; this is supported by the estimation that the initiating OPV dose was given only 36-75 days before sampling. The patient's clinical manifestations, intratypic differentiation examination, and whole-genome sequencing showed that this recombinant exhibited characteristics of neurovirulent vaccine-derived polioviruses (VDPV), which may, thus, pose a potential threat to a polio-free world.

  11. Improving performance of DS-CDMA systems using chaotic complex Bernoulli spreading codes

    NASA Astrophysics Data System (ADS)

    Farzan Sabahi, Mohammad; Dehghanfard, Ali

    2014-12-01

    The most important goal of spreading spectrum communication system is to protect communication signals against interference and exploitation of information by unintended listeners. In fact, low probability of detection and low probability of intercept are two important parameters to increase the performance of the system. In Direct Sequence Code Division Multiple Access (DS-CDMA) systems, these properties are achieved by multiplying the data information in spreading sequences. Chaotic sequences, with their particular properties, have numerous applications in constructing spreading codes. Using one-dimensional Bernoulli chaotic sequence as spreading code is proposed in literature previously. The main feature of this sequence is its negative auto-correlation at lag of 1, which with proper design, leads to increase in efficiency of the communication system based on these codes. On the other hand, employing the complex chaotic sequences as spreading sequence also has been discussed in several papers. In this paper, use of two-dimensional Bernoulli chaotic sequences is proposed as spreading codes. The performance of a multi-user synchronous and asynchronous DS-CDMA system will be evaluated by applying these sequences under Additive White Gaussian Noise (AWGN) and fading channel. Simulation results indicate improvement of the performance in comparison with conventional spreading codes like Gold codes as well as similar complex chaotic spreading sequences. Similar to one-dimensional Bernoulli chaotic sequences, the proposed sequences also have negative auto-correlation. Besides, construction of complex sequences with lower average cross-correlation is possible with the proposed method.

  12. Cloning and sequencing of a laccase gene from the lignin-degrading basidiomycete Pleurotus ostreatus.

    PubMed Central

    Giardina, P; Cannio, R; Martirani, L; Marzullo, L; Palmieri, G; Sannia, G

    1995-01-01

    The gene (pox1) encoding a phenol oxidase from Pleurotus ostreatus, a lignin-degrading basidiomycete, was cloned and sequenced, and the corresponding pox1 cDNA was also synthesized and sequenced. The isolated gene consists of 2,592 bp, with the coding sequence being interrupted by 19 introns and flanked by an upstream region in which putative CAAT and TATA consensus sequences could be identified at positions -174 and -84, respectively. The isolation of a second cDNA (pox2 cDNA), showing 84% similarity, and of the corresponding truncated genomic clones demonstrated the existence of a multigene family coding for isoforms of laccase in P. ostreatus. PCR amplifications of specific regions on the DNA of isolated monokaryons proved that the two genes are not allelic forms. The POX1 amino acid sequence deduced was compared with those of other known laccases from different fungi. PMID:7793961

  13. Application of 2D graphic representation of protein sequence based on Huffman tree method.

    PubMed

    Qi, Zhao-Hui; Feng, Jun; Qi, Xiao-Qin; Li, Ling

    2012-05-01

    Based on Huffman tree method, we propose a new 2D graphic representation of protein sequence. This representation can completely avoid loss of information in the transfer of data from a protein sequence to its graphic representation. The method consists of two parts. One is about the 0-1 codes of 20 amino acids by Huffman tree with amino acid frequency. The amino acid frequency is defined as the statistical number of an amino acid in the analyzed protein sequences. The other is about the 2D graphic representation of protein sequence based on the 0-1 codes. Then the applications of the method on ten ND5 genes and seven Escherichia coli strains are presented in detail. The results show that the proposed model may provide us with some new sights to understand the evolution patterns determined from protein sequences and complete genomes. Copyright © 2012 Elsevier Ltd. All rights reserved.

  14. Complete nucleotide sequence of the freshwater unicellular cyanobacterium Synechococcus elongatus PCC 6301 chromosome: gene content and organization.

    PubMed

    Sugita, Chieko; Ogata, Koretsugu; Shikata, Masamitsu; Jikuya, Hiroyuki; Takano, Jun; Furumichi, Miho; Kanehisa, Minoru; Omata, Tatsuo; Sugiura, Masahiro; Sugita, Mamoru

    2007-01-01

    The entire genome of the unicellular cyanobacterium Synechococcus elongatus PCC 6301 (formerly Anacystis nidulans Berkeley strain 6301) was sequenced. The genome consisted of a circular chromosome 2,696,255 bp long. A total of 2,525 potential protein-coding genes, two sets of rRNA genes, 45 tRNA genes representing 42 tRNA species, and several genes for small stable RNAs were assigned to the chromosome by similarity searches and computer predictions. The translated products of 56% of the potential protein-coding genes showed sequence similarities to experimentally identified and predicted proteins of known function, and the products of 35% of the genes showed sequence similarities to the translated products of hypothetical genes. The remaining 9% of genes lacked significant similarities to genes for predicted proteins in the public DNA databases. Some 139 genes coding for photosynthesis-related components were identified. Thirty-seven genes for two-component signal transduction systems were also identified. This is the smallest number of such genes identified in cyanobacteria, except for marine cyanobacteria, suggesting that only simple signal transduction systems are found in this strain. The gene arrangement and nucleotide sequence of Synechococcus elongatus PCC 6301 were nearly identical to those of a closely related strain Synechococcus elongatus PCC 7942, except for the presence of a 188.6 kb inversion. The sequences as well as the gene information shown in this paper are available in the Web database, CYORF (http://www.cyano.genome.jp/).

  15. Representation of DNA sequences in genetic codon context with applications in exon and intron prediction.

    PubMed

    Yin, Changchuan

    2015-04-01

    To apply digital signal processing (DSP) methods to analyze DNA sequences, the sequences first must be specially mapped into numerical sequences. Thus, effective numerical mappings of DNA sequences play key roles in the effectiveness of DSP-based methods such as exon prediction. Despite numerous mappings of symbolic DNA sequences to numerical series, the existing mapping methods do not include the genetic coding features of DNA sequences. We present a novel numerical representation of DNA sequences using genetic codon context (GCC) in which the numerical values are optimized by simulation annealing to maximize the 3-periodicity signal to noise ratio (SNR). The optimized GCC representation is then applied in exon and intron prediction by Short-Time Fourier Transform (STFT) approach. The results show the GCC method enhances the SNR values of exon sequences and thus increases the accuracy of predicting protein coding regions in genomes compared with the commonly used 4D binary representation. In addition, this study offers a novel way to reveal specific features of DNA sequences by optimizing numerical mappings of symbolic DNA sequences.

  16. Iterative Code-Aided ML Phase Estimation and Phase Ambiguity Resolution

    NASA Astrophysics Data System (ADS)

    Wymeersch, Henk; Moeneclaey, Marc

    2005-12-01

    As many coded systems operate at very low signal-to-noise ratios, synchronization becomes a very difficult task. In many cases, conventional algorithms will either require long training sequences or result in large BER degradations. By exploiting code properties, these problems can be avoided. In this contribution, we present several iterative maximum-likelihood (ML) algorithms for joint carrier phase estimation and ambiguity resolution. These algorithms operate on coded signals by accepting soft information from the MAP decoder. Issues of convergence and initialization are addressed in detail. Simulation results are presented for turbo codes, and are compared to performance results of conventional algorithms. Performance comparisons are carried out in terms of BER performance and mean square estimation error (MSEE). We show that the proposed algorithm reduces the MSEE and, more importantly, the BER degradation. Additionally, phase ambiguity resolution can be performed without resorting to a pilot sequence, thus improving the spectral efficiency.

  17. Informational structure of genetic sequences and nature of gene splicing

    NASA Astrophysics Data System (ADS)

    Trifonov, E. N.

    1991-10-01

    Only about 1/20 of DNA of higher organisms codes for proteins, by means of classical triplet code. The rest of DNA sequences is largely silent, with unclear functions, if any. The triplet code is not the only code (message) carried by the sequences. There are three levels of molecular communication, where the same sequence ``talks'' to various bimolecules, while having, respectively, three different appearances: DNA, RNA and protein. Since the molecular structures and, hence, sequence specific preferences of these are substantially different, the original DNA sequence has to carry simultaneously three types of sequence patterns (codes, messages), thus, being a composite structure in which one had the same letter (nucleotide) is frequently involved in several overlapping codes of different nature. This multiplicity and overlapping of the codes is a unique feature of the Gnomic, language of genetic sequences. The coexisting codes have to be degenerate in various degrees to allow an optimal and concerted performance of all the encoded functions. There is an obvious conflict between the best possible performance of a given function and necessity to compromise the quality of a given sequence pattern in favor of other patterns. It appears that the major role of various changes in the sequences on their ``ontogenetic'' way from DNA to RNA to protein, like RNA editing and splicing, or protein post-translational modifications is to resolve such conflicts. New data are presented strongly indicating that the gene splicing is such a device to resolve the conflict between the code of DNA folding in chromatin and the triplet code for protein synthesis.

  18. Genetic Code Analysis Toolkit: A novel tool to explore the coding properties of the genetic code and DNA sequences

    NASA Astrophysics Data System (ADS)

    Kraljić, K.; Strüngmann, L.; Fimmel, E.; Gumbel, M.

    2018-01-01

    The genetic code is degenerated and it is assumed that redundancy provides error detection and correction mechanisms in the translation process. However, the biological meaning of the code's structure is still under current research. This paper presents a Genetic Code Analysis Toolkit (GCAT) which provides workflows and algorithms for the analysis of the structure of nucleotide sequences. In particular, sets or sequences of codons can be transformed and tested for circularity, comma-freeness, dichotomic partitions and others. GCAT comes with a fertile editor custom-built to work with the genetic code and a batch mode for multi-sequence processing. With the ability to read FASTA files or load sequences from GenBank, the tool can be used for the mathematical and statistical analysis of existing sequence data. GCAT is Java-based and provides a plug-in concept for extensibility. Availability: Open source Homepage:http://www.gcat.bio/

  19. Noncoding sequence classification based on wavelet transform analysis: part II

    NASA Astrophysics Data System (ADS)

    Paredes, O.; Strojnik, M.; Romo-Vázquez, R.; Vélez-Pérez, H.; Ranta, R.; Garcia-Torales, G.; Scholl, M. K.; Morales, J. A.

    2017-09-01

    DNA sequences in human genome can be divided into the coding and noncoding ones. We hypothesize that the characteristic periodicities of the noncoding sequences are related to their function. We describe the procedure to identify these characteristic periodicities using the wavelet analysis. Our results show that three groups of noncoding sequences, each one with different biological function, may be differentiated by their wavelet coefficients within specific frequency range.

  20. SEQassembly: A Practical Tools Program for Coding Sequences Splicing

    NASA Astrophysics Data System (ADS)

    Lee, Hongbin; Yang, Hang; Fu, Lei; Qin, Long; Li, Huili; He, Feng; Wang, Bo; Wu, Xiaoming

    CDS (Coding Sequences) is a portion of mRNA sequences, which are composed by a number of exon sequence segments. The construction of CDS sequence is important for profound genetic analysis such as genotyping. A program in MATLAB environment is presented, which can process batch of samples sequences into code segments under the guide of reference exon models, and splice these code segments of same sample source into CDS according to the exon order in queue file. This program is useful in transcriptional polymorphism detection and gene function study.

  1. Correlation approach to identify coding regions in DNA sequences

    NASA Technical Reports Server (NTRS)

    Ossadnik, S. M.; Buldyrev, S. V.; Goldberger, A. L.; Havlin, S.; Mantegna, R. N.; Peng, C. K.; Simons, M.; Stanley, H. E.

    1994-01-01

    Recently, it was observed that noncoding regions of DNA sequences possess long-range power-law correlations, whereas coding regions typically display only short-range correlations. We develop an algorithm based on this finding that enables investigators to perform a statistical analysis on long DNA sequences to locate possible coding regions. The algorithm is particularly successful in predicting the location of lengthy coding regions. For example, for the complete genome of yeast chromosome III (315,344 nucleotides), at least 82% of the predictions correspond to putative coding regions; the algorithm correctly identified all coding regions larger than 3000 nucleotides, 92% of coding regions between 2000 and 3000 nucleotides long, and 79% of coding regions between 1000 and 2000 nucleotides. The predictive ability of this new algorithm supports the claim that there is a fundamental difference in the correlation property between coding and noncoding sequences. This algorithm, which is not species-dependent, can be implemented with other techniques for rapidly and accurately locating relatively long coding regions in genomic sequences.

  2. Temporal Code-Driven Stimulation: Definition and Application to Electric Fish Signaling

    PubMed Central

    Lareo, Angel; Forlim, Caroline G.; Pinto, Reynaldo D.; Varona, Pablo; Rodriguez, Francisco de Borja

    2016-01-01

    Closed-loop activity-dependent stimulation is a powerful methodology to assess information processing in biological systems. In this context, the development of novel protocols, their implementation in bioinformatics toolboxes and their application to different description levels open up a wide range of possibilities in the study of biological systems. We developed a methodology for studying biological signals representing them as temporal sequences of binary events. A specific sequence of these events (code) is chosen to deliver a predefined stimulation in a closed-loop manner. The response to this code-driven stimulation can be used to characterize the system. This methodology was implemented in a real time toolbox and tested in the context of electric fish signaling. We show that while there are codes that evoke a response that cannot be distinguished from a control recording without stimulation, other codes evoke a characteristic distinct response. We also compare the code-driven response to open-loop stimulation. The discussed experiments validate the proposed methodology and the software toolbox. PMID:27766078

  3. Temporal Code-Driven Stimulation: Definition and Application to Electric Fish Signaling.

    PubMed

    Lareo, Angel; Forlim, Caroline G; Pinto, Reynaldo D; Varona, Pablo; Rodriguez, Francisco de Borja

    2016-01-01

    Closed-loop activity-dependent stimulation is a powerful methodology to assess information processing in biological systems. In this context, the development of novel protocols, their implementation in bioinformatics toolboxes and their application to different description levels open up a wide range of possibilities in the study of biological systems. We developed a methodology for studying biological signals representing them as temporal sequences of binary events. A specific sequence of these events (code) is chosen to deliver a predefined stimulation in a closed-loop manner. The response to this code-driven stimulation can be used to characterize the system. This methodology was implemented in a real time toolbox and tested in the context of electric fish signaling. We show that while there are codes that evoke a response that cannot be distinguished from a control recording without stimulation, other codes evoke a characteristic distinct response. We also compare the code-driven response to open-loop stimulation. The discussed experiments validate the proposed methodology and the software toolbox.

  4. Compression of computer generated phase-shifting hologram sequence using AVC and HEVC

    NASA Astrophysics Data System (ADS)

    Xing, Yafei; Pesquet-Popescu, Béatrice; Dufaux, Frederic

    2013-09-01

    With the capability of achieving twice the compression ratio of Advanced Video Coding (AVC) with similar reconstruction quality, High Efficiency Video Coding (HEVC) is expected to become the newleading technique of video coding. In order to reduce the storage and transmission burden of digital holograms, in this paper we propose to use HEVC for compressing the phase-shifting digital hologram sequences (PSDHS). By simulating phase-shifting digital holography (PSDH) interferometry, interference patterns between illuminated three dimensional( 3D) virtual objects and the stepwise phase changed reference wave are generated as digital holograms. The hologram sequences are obtained by the movement of the virtual objects and compressed by AVC and HEVC. The experimental results show that AVC and HEVC are efficient to compress PSDHS, with HEVC giving better performance. Good compression rate and reconstruction quality can be obtained with bitrate above 15000kbps.

  5. Cellulases and coding sequences

    DOEpatents

    Li, Xin-Liang; Ljungdahl, Lars G.; Chen, Huizhong

    2001-02-20

    The present invention provides three fungal cellulases, their coding sequences, recombinant DNA molecules comprising the cellulase coding sequences, recombinant host cells and methods for producing same. The present cellulases are from Orpinomyces PC-2.

  6. Cellulases and coding sequences

    DOEpatents

    Li, Xin-Liang; Ljungdahl, Lars G.; Chen, Huizhong

    2001-01-01

    The present invention provides three fungal cellulases, their coding sequences, recombinant DNA molecules comprising the cellulase coding sequences, recombinant host cells and methods for producing same. The present cellulases are from Orpinomyces PC-2.

  7. Statistical Evaluation of the Rodin–Ohno Hypothesis: Sense/Antisense Coding of Ancestral Class I and II Aminoacyl-tRNA Synthetases

    PubMed Central

    Chandrasekaran, Srinivas Niranj; Yardimci, Galip Gürkan; Erdogan, Ozgün; Roach, Jeffrey; Carter, Charles W.

    2013-01-01

    We tested the idea that ancestral class I and II aminoacyl-tRNA synthetases arose on opposite strands of the same gene. We assembled excerpted 94-residue Urgenes for class I tryptophanyl-tRNA synthetase (TrpRS) and class II Histidyl-tRNA synthetase (HisRS) from a diverse group of species, by identifying and catenating three blocks coding for secondary structures that position the most highly conserved, active-site residues. The codon middle-base pairing frequency was 0.35 ± 0.0002 in all-by-all sense/antisense alignments for 211 TrpRS and 207 HisRS sequences, compared with frequencies between 0.22 ± 0.0009 and 0.27 ± 0.0005 for eight different representations of the null hypothesis. Clustering algorithms demonstrate further that profiles of middle-base pairing in the synthetase antisense alignments are correlated along the sequences from one species-pair to another, whereas this is not the case for similar operations on sets representing the null hypothesis. Most probable reconstructed sequences for ancestral nodes of maximum likelihood trees show that middle-base pairing frequency increases to approximately 0.42 ± 0.002 as bacterial trees approach their roots; ancestral nodes from trees including archaeal sequences show a less pronounced increase. Thus, contemporary and reconstructed sequences all validate important bioinformatic predictions based on descent from opposite strands of the same ancestral gene. They further provide novel evidence for the hypothesis that bacteria lie closer than archaea to the origin of translation. Moreover, the inverse polarity of genetic coding, together with a priori α-helix propensities suggest that in-frame coding on opposite strands leads to similar secondary structures with opposite polarity, as observed in TrpRS and HisRS crystal structures. PMID:23576570

  8. Abstract feature codes: The building blocks of the implicit learning system.

    PubMed

    Eberhardt, Katharina; Esser, Sarah; Haider, Hilde

    2017-07-01

    According to the Theory of Event Coding (TEC; Hommel, Müsseler, Aschersleben, & Prinz, 2001), action and perception are represented in a shared format in the cognitive system by means of feature codes. In implicit sequence learning research, it is still common to make a conceptual difference between independent motor and perceptual sequences. This supposedly independent learning takes place in encapsulated modules (Keele, Ivry, Mayr, Hazeltine, & Heuer 2003) that process information along single dimensions. These dimensions have remained underspecified so far. It is especially not clear whether stimulus and response characteristics are processed in separate modules. Here, we suggest that feature dimensions as they are described in the TEC should be viewed as the basic content of modules of implicit learning. This means that the modules process all stimulus and response information related to certain feature dimensions of the perceptual environment. In 3 experiments, we investigated by means of a serial reaction time task the nature of the basic units of implicit learning. As a test case, we used stimulus location sequence learning. The results show that a stimulus location sequence and a response location sequence cannot be learned without interference (Experiment 2) unless one of the sequences can be coded via an alternative, nonspatial dimension (Experiment 3). These results support the notion that spatial location is one module of the implicit learning system and, consequently, that there are no separate processing units for stimulus versus response locations. (PsycINFO Database Record (c) 2017 APA, all rights reserved).

  9. Whole mitochondrial genome sequence for an osteoarthritis model of Guinea pig (Caviidae; Cavia).

    PubMed

    Cui, Xin-Gang; Liu, Cheng-Yao; Wei, Bo; Zhao, Wen-Jian; Zhang, Wen-Feng

    2016-11-01

    Animal models played an important role in osteoarthritis studies. Here, the complete mitochondrial genome sequence of the Guinea pig was reported for the first time. The total length of the mitogenome was 16,797 bp. It contained the typical structure, including two ribosomal RNA genes, 13 protein-coding genes, 22 transfer RNA genes and one non-coding control region (D-loop region). The overall composition of the mitogenome was estimated to be 34.9% for A, 26.1% for T, 26.0% for C and 13.0% for G showing an A-T (61.0%)-rich feature. This mitochondrial genome sequence will provide new genetic resource into osteoarthritis disease.

  10. Statistical and linguistic features of DNA sequences

    NASA Technical Reports Server (NTRS)

    Havlin, S.; Buldyrev, S. V.; Goldberger, A. L.; Mantegna, R. N.; Peng, C. K.; Simons, M.; Stanley, H. E.

    1995-01-01

    We present evidence supporting the idea that the DNA sequence in genes containing noncoding regions is correlated, and that the correlation is remarkably long range--indeed, base pairs thousands of base pairs distant are correlated. We do not find such a long-range correlation in the coding regions of the gene. We resolve the problem of the "non-stationary" feature of the sequence of base pairs by applying a new algorithm called Detrended Fluctuation Analysis (DFA). We address the claim of Voss that there is no difference in the statistical properties of coding and noncoding regions of DNA by systematically applying the DFA algorithm, as well as standard FFT analysis, to all eukaryotic DNA sequences (33 301 coding and 29 453 noncoding) in the entire GenBank database. We describe a simple model to account for the presence of long-range power-law correlations which is based upon a generalization of the classic Levy walk. Finally, we describe briefly some recent work showing that the noncoding sequences have certain statistical features in common with natural languages. Specifically, we adapt to DNA the Zipf approach to analyzing linguistic texts, and the Shannon approach to quantifying the "redundancy" of a linguistic text in terms of a measurable entropy function. We suggest that noncoding regions in plants and invertebrates may display a smaller entropy and larger redundancy than coding regions, further supporting the possibility that noncoding regions of DNA may carry biological information.

  11. Reliable Wireless Broadcast with Linear Network Coding for Multipoint-to-Multipoint Real-Time Communications

    NASA Astrophysics Data System (ADS)

    Kondo, Yoshihisa; Yomo, Hiroyuki; Yamaguchi, Shinji; Davis, Peter; Miura, Ryu; Obana, Sadao; Sampei, Seiichi

    This paper proposes multipoint-to-multipoint (MPtoMP) real-time broadcast transmission using network coding for ad-hoc networks like video game networks. We aim to achieve highly reliable MPtoMP broadcasting using IEEE 802.11 media access control (MAC) that does not include a retransmission mechanism. When each node detects packets from the other nodes in a sequence, the correctly detected packets are network-encoded, and the encoded packet is broadcasted in the next sequence as a piggy-back for its native packet. To prevent increase of overhead in each packet due to piggy-back packet transmission, network coding vector for each node is exchanged between all nodes in the negotiation phase. Each user keeps using the same coding vector generated in the negotiation phase, and only coding information that represents which user signal is included in the network coding process is transmitted along with the piggy-back packet. Our simulation results show that the proposed method can provide higher reliability than other schemes using multi point relay (MPR) or redundant transmissions such as forward error correction (FEC). We also implement the proposed method in a wireless testbed, and show that the proposed method achieves high reliability in a real-world environment with a practical degree of complexity when installed on current wireless devices.

  12. A Bioinformatics-Based Alternative mRNA Splicing Code that May Explain Some Disease Mutations Is Conserved in Animals.

    PubMed

    Qu, Wen; Cingolani, Pablo; Zeeberg, Barry R; Ruden, Douglas M

    2017-01-01

    Deep sequencing of cDNAs made from spliced mRNAs indicates that most coding genes in many animals and plants have pre-mRNA transcripts that are alternatively spliced. In pre-mRNAs, in addition to invariant exons that are present in almost all mature mRNA products, there are at least 6 additional types of exons, such as exons from alternative promoters or with alternative polyA sites, mutually exclusive exons, skipped exons, or exons with alternative 5' or 3' splice sites. Our bioinformatics-based hypothesis is that, in analogy to the genetic code, there is an "alternative-splicing code" in introns and flanking exon sequences, analogous to the genetic code, that directs alternative splicing of many of the 36 types of introns. In humans, we identified 42 different consensus sequences that are each present in at least 100 human introns. 37 of the 42 top consensus sequences are significantly enriched or depleted in at least one of the 36 types of introns. We further supported our hypothesis by showing that 96 out of 96 analyzed human disease mutations that affect RNA splicing, and change alternative splicing from one class to another, can be partially explained by a mutation altering a consensus sequence from one type of intron to that of another type of intron. Some of the alternative splicing consensus sequences, and presumably their small-RNA or protein targets, are evolutionarily conserved from 50 plant to animal species. We also noticed the set of introns within a gene usually share the same splicing codes, thus arguing that one sub-type of splicesosome might process all (or most) of the introns in a given gene. Our work sheds new light on a possible mechanism for generating the tremendous diversity in protein structure by alternative splicing of pre-mRNAs.

  13. Prevalence of transcription promoters within archaeal operons and coding sequences

    PubMed Central

    Koide, Tie; Reiss, David J; Bare, J Christopher; Pang, Wyming Lee; Facciotti, Marc T; Schmid, Amy K; Pan, Min; Marzolf, Bruz; Van, Phu T; Lo, Fang-Yin; Pratap, Abhishek; Deutsch, Eric W; Peterson, Amelia; Martin, Dan; Baliga, Nitin S

    2009-01-01

    Despite the knowledge of complex prokaryotic-transcription mechanisms, generalized rules, such as the simplified organization of genes into operons with well-defined promoters and terminators, have had a significant role in systems analysis of regulatory logic in both bacteria and archaea. Here, we have investigated the prevalence of alternate regulatory mechanisms through genome-wide characterization of transcript structures of ∼64% of all genes, including putative non-coding RNAs in Halobacterium salinarum NRC-1. Our integrative analysis of transcriptome dynamics and protein–DNA interaction data sets showed widespread environment-dependent modulation of operon architectures, transcription initiation and termination inside coding sequences, and extensive overlap in 3′ ends of transcripts for many convergently transcribed genes. A significant fraction of these alternate transcriptional events correlate to binding locations of 11 transcription factors and regulators (TFs) inside operons and annotated genes—events usually considered spurious or non-functional. Using experimental validation, we illustrate the prevalence of overlapping genomic signals in archaeal transcription, casting doubt on the general perception of rigid boundaries between coding sequences and regulatory elements. PMID:19536208

  14. Prevalence of transcription promoters within archaeal operons and coding sequences.

    PubMed

    Koide, Tie; Reiss, David J; Bare, J Christopher; Pang, Wyming Lee; Facciotti, Marc T; Schmid, Amy K; Pan, Min; Marzolf, Bruz; Van, Phu T; Lo, Fang-Yin; Pratap, Abhishek; Deutsch, Eric W; Peterson, Amelia; Martin, Dan; Baliga, Nitin S

    2009-01-01

    Despite the knowledge of complex prokaryotic-transcription mechanisms, generalized rules, such as the simplified organization of genes into operons with well-defined promoters and terminators, have had a significant role in systems analysis of regulatory logic in both bacteria and archaea. Here, we have investigated the prevalence of alternate regulatory mechanisms through genome-wide characterization of transcript structures of approximately 64% of all genes, including putative non-coding RNAs in Halobacterium salinarum NRC-1. Our integrative analysis of transcriptome dynamics and protein-DNA interaction data sets showed widespread environment-dependent modulation of operon architectures, transcription initiation and termination inside coding sequences, and extensive overlap in 3' ends of transcripts for many convergently transcribed genes. A significant fraction of these alternate transcriptional events correlate to binding locations of 11 transcription factors and regulators (TFs) inside operons and annotated genes-events usually considered spurious or non-functional. Using experimental validation, we illustrate the prevalence of overlapping genomic signals in archaeal transcription, casting doubt on the general perception of rigid boundaries between coding sequences and regulatory elements.

  15. MIMO Radar System for Respiratory Monitoring Using Tx and Rx Modulation with M-Sequence Codes

    NASA Astrophysics Data System (ADS)

    Miwa, Takashi; Ogiwara, Shun; Yamakoshi, Yoshiki

    The importance of respiratory monitoring systems during sleep have increased due to early diagnosis of sleep apnea syndrome (SAS) in the home. This paper presents a simple respiratory monitoring system suitable for home use having 3D ranging of targets. The range resolution and azimuth resolution are obtained by a stepped frequency transmitting signal and MIMO arrays with preferred pair M-sequence codes doubly modulating in transmission and reception, respectively. Due to the use of these codes, Gold sequence codes corresponding to all the antenna combinations are equivalently modulated in receiver. The signal to interchannel interference ratio of the reconstructed image is evaluated by numerical simulations. The results of experiments on a developed prototype 3D-MIMO radar system show that this system can extract only the motion of respiration of a human subject 2m apart from a metallic rotatable reflector. Moreover, it is found that this system can successfully measure the respiration information of sleeping human subjects for 96.6 percent of the whole measurement time except for instances of large posture change.

  16. Optimized and secure technique for multiplexing QR code images of single characters: application to noiseless messages retrieval

    NASA Astrophysics Data System (ADS)

    Trejos, Sorayda; Fredy Barrera, John; Torroba, Roberto

    2015-08-01

    We present for the first time an optical encrypting-decrypting protocol for recovering messages without speckle noise. This is a digital holographic technique using a 2f scheme to process QR codes entries. In the procedure, letters used to compose eventual messages are individually converted into a QR code, and then each QR code is divided into portions. Through a holographic technique, we store each processed portion. After filtering and repositioning, we add all processed data to create a single pack, thus simplifying the handling and recovery of multiple QR code images, representing the first multiplexing procedure applied to processed QR codes. All QR codes are recovered in a single step and in the same plane, showing neither cross-talk nor noise problems as in other methods. Experiments have been conducted using an interferometric configuration and comparisons between unprocessed and recovered QR codes have been performed, showing differences between them due to the involved processing. Recovered QR codes can be successfully scanned, thanks to their noise tolerance. Finally, the appropriate sequence in the scanning of the recovered QR codes brings a noiseless retrieved message. Additionally, to procure maximum security, the multiplexed pack could be multiplied by a digital diffuser as to encrypt it. The encrypted pack is easily decoded by multiplying the multiplexing with the complex conjugate of the diffuser. As it is a digital operation, no noise is added. Therefore, this technique is threefold robust, involving multiplexing, encryption, and the need of a sequence to retrieve the outcome.

  17. Chromatin accessibility prediction via a hybrid deep convolutional neural network.

    PubMed

    Liu, Qiao; Xia, Fei; Yin, Qijin; Jiang, Rui

    2018-03-01

    A majority of known genetic variants associated with human-inherited diseases lie in non-coding regions that lack adequate interpretation, making it indispensable to systematically discover functional sites at the whole genome level and precisely decipher their implications in a comprehensive manner. Although computational approaches have been complementing high-throughput biological experiments towards the annotation of the human genome, it still remains a big challenge to accurately annotate regulatory elements in the context of a specific cell type via automatic learning of the DNA sequence code from large-scale sequencing data. Indeed, the development of an accurate and interpretable model to learn the DNA sequence signature and further enable the identification of causative genetic variants has become essential in both genomic and genetic studies. We proposed Deopen, a hybrid framework mainly based on a deep convolutional neural network, to automatically learn the regulatory code of DNA sequences and predict chromatin accessibility. In a series of comparison with existing methods, we show the superior performance of our model in not only the classification of accessible regions against background sequences sampled at random, but also the regression of DNase-seq signals. Besides, we further visualize the convolutional kernels and show the match of identified sequence signatures and known motifs. We finally demonstrate the sensitivity of our model in finding causative noncoding variants in the analysis of a breast cancer dataset. We expect to see wide applications of Deopen with either public or in-house chromatin accessibility data in the annotation of the human genome and the identification of non-coding variants associated with diseases. Deopen is freely available at https://github.com/kimmo1019/Deopen. ruijiang@tsinghua.edu.cn. Supplementary data are available at Bioinformatics online. © The Author (2017). Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com

  18. Images Multiplexing By Code Division Technique

    NASA Astrophysics Data System (ADS)

    Kuo, Chung Jung; Rigas, Harriett B.

    1990-01-01

    Spread Spectrum System (SSS) or Code Division Multiple Access System (CDMAS) has been studied for a long time, but most of the attention was focused on the transmission problems. In this paper, we study the results when the code division technique is applied to the image at the source stage. The idea is to convolve the N different images with the corresponding m-sequence to obtain the encrypted image. The superimposed image (summation of the encrypted images) is then stored or transmitted. The benefit of this is that no one knows what is stored or transmitted unless the m-sequence is known. The recovery of the original image is recovered by correlating the superimposed image with corresponding m-sequence. Two cases are studied in this paper. First, the 2-D image is treated as a long 1-D vector and the m-sequence is employed to obtained the results. Secondly, the 2-D quasi m-array is proposed and used for the code division multiplexing. It is showed that quasi m-array is faster when the image size is 256x256. The important features of the proposed technique are not only the image security but also the data compactness. The compression ratio depends on how many images are superimposed.

  19. The Complete Sequence of a Human Parainfluenzavirus 4 Genome

    PubMed Central

    Yea, Carmen; Cheung, Rose; Collins, Carol; Adachi, Dena; Nishikawa, John; Tellier, Raymond

    2009-01-01

    Although the human parainfluenza virus 4 (HPIV4) has been known for a long time, its genome, alone among the human paramyxoviruses, has not been completely sequenced to date. In this study we obtained the first complete genomic sequence of HPIV4 from a clinical isolate named SKPIV4 obtained at the Hospital for Sick Children in Toronto (Ontario, Canada). The coding regions for the N, P/V, M, F and HN proteins show very high identities (95% to 97%) with previously available partial sequences for HPIV4B. The sequence for the L protein and the non-coding regions represent new information. A surprising feature of the genome is its length, more than 17 kb, making it the longest genome within the genus Rubulavirus, although the length is well within the known range of 15 kb to 19 kb for the subfamily Paramyxovirinae. The availability of a complete genomic sequence will facilitate investigations on a respiratory virus that is still not completely characterized. PMID:21994536

  20. Cloning and sequence analysis of Hemonchus contortus HC58cDNA.

    PubMed

    Muleke, Charles I; Ruofeng, Yan; Lixin, Xu; Xinwen, Bo; Xiangrui, Li

    2007-06-01

    The complete coding sequence of Hemonchus contortus HC58cDNA was generated by rapid amplification of cDNA ends and polymerase chain reaction using primers based on the 5' and 3' ends of the parasite mRNA, accession no. AF305964. The HC58cDNA gene was 851 bp long, with open reading frame of 717 bp, precursors to 239 amino acids coding for approximately 27 kDa protein. Analysis of amino acid sequence revealed conserved residues of cysteine, histidine, asparagine, occluding loop pattern, hemoglobinase motif and glutamine of the oxyanion hole characteristic of cathepsin B like proteases (CBL). Comparison of the predicted amino acid sequences showed the protein shared 33.5-58.7% identity to cathepsin B homologues in the papain clan CA family (family C1). Phylogenetic analysis revealed close evolutionary proximity of the protein sequence to counterpart sequences in the CBL, suggesting that HC58cDNA was a member of the papain family.

  1. Efficient burst image compression using H.265/HEVC

    NASA Astrophysics Data System (ADS)

    Roodaki-Lavasani, Hoda; Lainema, Jani

    2014-02-01

    New imaging use cases are emerging as more powerful camera hardware is entering consumer markets. One family of such use cases is based on capturing multiple pictures instead of just one when taking a photograph. That kind of a camera operation allows e.g. selecting the most successful shot from a sequence of images, showing what happened right before or after the shot was taken or combining the shots by computational means to improve either visible characteristics of the picture (such as dynamic range or focus) or the artistic aspects of the photo (e.g. by superimposing pictures on top of each other). Considering that photographic images are typically of high resolution and quality and the fact that these kind of image bursts can consist of at least tens of individual pictures, an efficient compression algorithm is desired. However, traditional video coding approaches fail to provide the random access properties these use cases require to achieve near-instantaneous access to the pictures in the coded sequence. That feature is critical to allow users to browse the pictures in an arbitrary order or imaging algorithms to extract desired pictures from the sequence quickly. This paper proposes coding structures that provide such random access properties while achieving coding efficiency superior to existing image coders. The results indicate that using HEVC video codec with a single reference picture fixed for the whole sequence can achieve nearly as good compression as traditional IPPP coding structures. It is also shown that the selection of the reference frame can further improve the coding efficiency.

  2. Amino- and carboxyl-terminal amino acid sequences of proteins coded by gag gene of murine leukemia virus

    PubMed Central

    Oroszlan, Stephen; Henderson, Louis E.; Stephenson, John R.; Copeland, Terry D.; Long, Cedric W.; Ihle, James N.; Gilden, Raymond V.

    1978-01-01

    The amino- and carboxyl-terminal amino acid sequences of proteins (p10, p12, p15, and p30) coded by the gag gene of Rauscher and AKR murine leukemia viruses were determined. Among these proteins, p15 from both viruses appears to have a blocked amino end. Proline was found to be the common NH2 terminus of both p30s and both p12s, and alanine of both p10s. The amino-terminal sequences of p30s are identical, as are those of p10s, while the p12 sequences are clearly distinctive but also show substantial homology. The carboxyl-terminal amino acids of both viral p30s and p12s are leucine and phenylalanine, respectively. Rauscher leukemia virus p15 has tyrosine as the carboxyl terminus while AKR virus p15 has phenylalanine in this position. The compositional and sequence data provide definite chemical criteria for the identification of analogous gag gene products and for the comparison of viral proteins isolated in different laboratories. On the basis of amino acid sequences and the previously proposed H-p15-p12-p30-p10-COOH peptide sequence in the precursor polyprotein, a model for cleavage sites involved in the post-translational processing of the precursor coded for by the gag gene is proposed. PMID:206897

  3. Recent horizontal transfer of mellifera subfamily mariner transposons into insect lineages representing four different orders shows that selection acts only during horizontal transfer.

    PubMed

    Lampe, David J; Witherspoon, David J; Soto-Adames, Felipe N; Robertson, Hugh M

    2003-04-01

    We report the isolation and sequencing of genomic copies of mariner transposons involved in recent horizontal transfers into the genomes of the European earwig, Forficula auricularia; the European honey bee, Apis mellifera; the Mediterranean fruit fly, Ceratitis capitata; and a blister beetle, Epicauta funebris, insects from four different orders. These elements are in the mellifera subfamily and are the second documented example of full-length mariner elements involved in this kind of phenomenon. We applied maximum likelihood methods to the coding sequences and determined that the copies in each genome were evolving neutrally, whereas reconstructed ancestral coding sequences appeared to be under selection, which strengthens our previous hypothesis that the primary selective constraint on mariner sequence evolution is the act of horizontal transfer between genomes.

  4. DNA barcode goes two-dimensions: DNA QR code web server.

    PubMed

    Liu, Chang; Shi, Linchun; Xu, Xiaolan; Li, Huan; Xing, Hang; Liang, Dong; Jiang, Kun; Pang, Xiaohui; Song, Jingyuan; Chen, Shilin

    2012-01-01

    The DNA barcoding technology uses a standard region of DNA sequence for species identification and discovery. At present, "DNA barcode" actually refers to DNA sequences, which are not amenable to information storage, recognition, and retrieval. Our aim is to identify the best symbology that can represent DNA barcode sequences in practical applications. A comprehensive set of sequences for five DNA barcode markers ITS2, rbcL, matK, psbA-trnH, and CO1 was used as the test data. Fifty-three different types of one-dimensional and ten two-dimensional barcode symbologies were compared based on different criteria, such as coding capacity, compression efficiency, and error detection ability. The quick response (QR) code was found to have the largest coding capacity and relatively high compression ratio. To facilitate the further usage of QR code-based DNA barcodes, a web server was developed and is accessible at http://qrfordna.dnsalias.org. The web server allows users to retrieve the QR code for a species of interests, convert a DNA sequence to and from a QR code, and perform species identification based on local and global sequence similarities. In summary, the first comprehensive evaluation of various barcode symbologies has been carried out. The QR code has been found to be the most appropriate symbology for DNA barcode sequences. A web server has also been constructed to allow biologists to utilize QR codes in practical DNA barcoding applications.

  5. Lichenase and coding sequences

    DOEpatents

    Li, Xin-Liang; Ljungdahl, Lars G.; Chen, Huizhong

    2000-08-15

    The present invention provides a fungal lichenase, i.e., an endo-1,3-1,4-.beta.-D-glucanohydrolase, its coding sequence, recombinant DNA molecules comprising the lichenase coding sequences, recombinant host cells and methods for producing same. The present lichenase is from Orpinomyces PC-2.

  6. Simultaneous chromatic dispersion and PMD compensation by using coded-OFDM and girth-10 LDPC codes.

    PubMed

    Djordjevic, Ivan B; Xu, Lei; Wang, Ting

    2008-07-07

    Low-density parity-check (LDPC)-coded orthogonal frequency division multiplexing (OFDM) is studied as an efficient coded modulation scheme suitable for simultaneous chromatic dispersion and polarization mode dispersion (PMD) compensation. We show that, for aggregate rate of 10 Gb/s, accumulated dispersion over 6500 km of SMF and differential group delay of 100 ps can be simultaneously compensated with penalty within 1.5 dB (with respect to the back-to-back configuration) when training sequence based channel estimation and girth-10 LDPC codes of rate 0.8 are employed.

  7. FRAGS: estimation of coding sequence substitution rates from fragmentary data

    PubMed Central

    Swart, Estienne C; Hide, Winston A; Seoighe, Cathal

    2004-01-01

    Background Rates of substitution in protein-coding sequences can provide important insights into evolutionary processes that are of biomedical and theoretical interest. Increased availability of coding sequence data has enabled researchers to estimate more accurately the coding sequence divergence of pairs of organisms. However the use of different data sources, alignment protocols and methods to estimate substitution rates leads to widely varying estimates of key parameters that define the coding sequence divergence of orthologous genes. Although complete genome sequence data are not available for all organisms, fragmentary sequence data can provide accurate estimates of substitution rates provided that an appropriate and consistent methodology is used and that differences in the estimates obtainable from different data sources are taken into account. Results We have developed FRAGS, an application framework that uses existing, freely available software components to construct in-frame alignments and estimate coding substitution rates from fragmentary sequence data. Coding sequence substitution estimates for human and chimpanzee sequences, generated by FRAGS, reveal that methodological differences can give rise to significantly different estimates of important substitution parameters. The estimated substitution rates were also used to infer upper-bounds on the amount of sequencing error in the datasets that we have analysed. Conclusion We have developed a system that performs robust estimation of substitution rates for orthologous sequences from a pair of organisms. Our system can be used when fragmentary genomic or transcript data is available from one of the organisms and the other is a completely sequenced genome within the Ensembl database. As well as estimating substitution statistics our system enables the user to manage and query alignment and substitution data. PMID:15005802

  8. Visual pattern image sequence coding

    NASA Technical Reports Server (NTRS)

    Silsbee, Peter; Bovik, Alan C.; Chen, Dapang

    1990-01-01

    The visual pattern image coding (VPIC) configurable digital image-coding process is capable of coding with visual fidelity comparable to the best available techniques, at compressions which (at 30-40:1) exceed all other technologies. These capabilities are associated with unprecedented coding efficiencies; coding and decoding operations are entirely linear with respect to image size and entail a complexity that is 1-2 orders of magnitude faster than any previous high-compression technique. The visual pattern image sequence coding to which attention is presently given exploits all the advantages of the static VPIC in the reduction of information from an additional, temporal dimension, to achieve unprecedented image sequence coding performance.

  9. Informatic and genomic analysis of melanocyte cDNA libraries as a resource for the study of melanocyte development and function.

    PubMed

    Baxter, Laura L; Hsu, Benjamin J; Umayam, Lowell; Wolfsberg, Tyra G; Larson, Denise M; Frith, Martin C; Kawai, Jun; Hayashizaki, Yoshihide; Carninci, Piero; Pavan, William J

    2007-06-01

    As part of the RIKEN mouse encyclopedia project, two cDNA libraries were prepared from melanocyte-derived cell lines, using techniques of full-length clone selection and subtraction/normalization to enrich for rare transcripts. End sequencing showed that these libraries display over 83% complete coding sequence at the 5' end and 96-97% complete coding sequence at the 3' end. Evaluation of the libraries, derived from B16F10Y tumor cells and melan-c cells, revealed that they contain clones for a majority of the genes previously demonstrated to function in melanocyte biology. Analysis of genomic locations for transcripts revealed that the distribution of melanocyte genes is non-random throughout the genome. Three genomic regions identified that showed significant clustering of melanocyte-expressed genes contain one or more genes previously shown to regulate melanocyte development or function. A catalog of genes expressed in these libraries is presented, providing a valuable resource of cDNA clones and sequence information that can be used for identification of new genes important for melanocyte development, function, and disease.

  10. Both coding exons of the c-myc gene contribute to its posttranscriptional regulation in the quiescent liver and regenerating liver and after protein synthesis inhibition.

    PubMed Central

    Lavenu, A; Pistoi, S; Pournin, S; Babinet, C; Morello, D

    1995-01-01

    In vivo, the steady-state level of c-myc mRNA is mainly controlled by posttranscriptional mechanisms. Using a panel of transgenic mice in which various versions of the human c-myc proto-oncogene were under the control of major histocompatibility complex H-2Kb class I regulatory sequences, we have shown that the 5' and the 3' noncoding sequences are dispensable for obtaining a regulated expression of the transgene in adult quiescent tissues, at the start of liver regeneration, and after inhibition of protein synthesis. These results indicated that the coding sequences were sufficient to ensure a regulated c-myc expression. In the present study, we have pursued this analysis with transgenes containing one or the other of the two c-myc coding exons either alone or in association with the c-myc 3' untranslated region. We demonstrate that each of the exons contains determinants which control c-myc mRNA expression. Moreover, we show that in the liver, c-myc exon 2 sequences are able to down-regulate an otherwise stable H-2K mRNA when embedded within it and to induce its transient accumulation after cycloheximide treatment and soon after liver ablation. Finally, the use of transgenes with different coding capacities has allowed us to postulate that the primary mRNA sequence itself and not c-Myc peptides is an important component of c-myc posttranscriptional regulation. PMID:7623834

  11. DNA Barcoding through Quaternary LDPC Codes

    PubMed Central

    Tapia, Elizabeth; Spetale, Flavio; Krsticevic, Flavia; Angelone, Laura; Bulacio, Pilar

    2015-01-01

    For many parallel applications of Next-Generation Sequencing (NGS) technologies short barcodes able to accurately multiplex a large number of samples are demanded. To address these competitive requirements, the use of error-correcting codes is advised. Current barcoding systems are mostly built from short random error-correcting codes, a feature that strongly limits their multiplexing accuracy and experimental scalability. To overcome these problems on sequencing systems impaired by mismatch errors, the alternative use of binary BCH and pseudo-quaternary Hamming codes has been proposed. However, these codes either fail to provide a fine-scale with regard to size of barcodes (BCH) or have intrinsic poor error correcting abilities (Hamming). Here, the design of barcodes from shortened binary BCH codes and quaternary Low Density Parity Check (LDPC) codes is introduced. Simulation results show that although accurate barcoding systems of high multiplexing capacity can be obtained with any of these codes, using quaternary LDPC codes may be particularly advantageous due to the lower rates of read losses and undetected sample misidentification errors. Even at mismatch error rates of 10−2 per base, 24-nt LDPC barcodes can be used to multiplex roughly 2000 samples with a sample misidentification error rate in the order of 10−9 at the expense of a rate of read losses just in the order of 10−6. PMID:26492348

  12. DNA Barcoding through Quaternary LDPC Codes.

    PubMed

    Tapia, Elizabeth; Spetale, Flavio; Krsticevic, Flavia; Angelone, Laura; Bulacio, Pilar

    2015-01-01

    For many parallel applications of Next-Generation Sequencing (NGS) technologies short barcodes able to accurately multiplex a large number of samples are demanded. To address these competitive requirements, the use of error-correcting codes is advised. Current barcoding systems are mostly built from short random error-correcting codes, a feature that strongly limits their multiplexing accuracy and experimental scalability. To overcome these problems on sequencing systems impaired by mismatch errors, the alternative use of binary BCH and pseudo-quaternary Hamming codes has been proposed. However, these codes either fail to provide a fine-scale with regard to size of barcodes (BCH) or have intrinsic poor error correcting abilities (Hamming). Here, the design of barcodes from shortened binary BCH codes and quaternary Low Density Parity Check (LDPC) codes is introduced. Simulation results show that although accurate barcoding systems of high multiplexing capacity can be obtained with any of these codes, using quaternary LDPC codes may be particularly advantageous due to the lower rates of read losses and undetected sample misidentification errors. Even at mismatch error rates of 10(-2) per base, 24-nt LDPC barcodes can be used to multiplex roughly 2000 samples with a sample misidentification error rate in the order of 10(-9) at the expense of a rate of read losses just in the order of 10(-6).

  13. [Influence of "prehistory" of sequential movements of the right and the left hand on reproduction: coding of positions, movements and sequence structure].

    PubMed

    Bobrova, E V; Liakhovetskiĭ, V A; Borshchevskaia, E R

    2011-01-01

    The dependence of errors during reproduction of a sequence of hand movements without visual feedback on the previous right- and left-hand performance ("prehistory") and on positions in space of sequence elements (random or ordered by the explicit rule) was analyzed. It was shown that the preceding information about the ordered positions of the sequence elements was used during right-hand movements, whereas left-hand movements were performed with involvement of the information about the random sequence. The data testify to a central mechanism of the analysis of spatial structure of sequence elements. This mechanism activates movement coding specific for the left hemisphere (vector coding) in case of an ordered sequence structure and positional coding specific for the right hemisphere in case of a random sequence structure.

  14. Discrete Cosine Transform Image Coding With Sliding Block Codes

    NASA Astrophysics Data System (ADS)

    Divakaran, Ajay; Pearlman, William A.

    1989-11-01

    A transform trellis coding scheme for images is presented. A two dimensional discrete cosine transform is applied to the image followed by a search on a trellis structured code. This code is a sliding block code that utilizes a constrained size reproduction alphabet. The image is divided into blocks by the transform coding. The non-stationarity of the image is counteracted by grouping these blocks in clusters through a clustering algorithm, and then encoding the clusters separately. Mandela ordered sequences are formed from each cluster i.e identically indexed coefficients from each block are grouped together to form one dimensional sequences. A separate search ensues on each of these Mandela ordered sequences. Padding sequences are used to improve the trellis search fidelity. The padding sequences absorb the error caused by the building up of the trellis to full size. The simulations were carried out on a 256x256 image ('LENA'). The results are comparable to any existing scheme. The visual quality of the image is enhanced considerably by the padding and clustering.

  15. DNA Barcode Goes Two-Dimensions: DNA QR Code Web Server

    PubMed Central

    Li, Huan; Xing, Hang; Liang, Dong; Jiang, Kun; Pang, Xiaohui; Song, Jingyuan; Chen, Shilin

    2012-01-01

    The DNA barcoding technology uses a standard region of DNA sequence for species identification and discovery. At present, “DNA barcode” actually refers to DNA sequences, which are not amenable to information storage, recognition, and retrieval. Our aim is to identify the best symbology that can represent DNA barcode sequences in practical applications. A comprehensive set of sequences for five DNA barcode markers ITS2, rbcL, matK, psbA-trnH, and CO1 was used as the test data. Fifty-three different types of one-dimensional and ten two-dimensional barcode symbologies were compared based on different criteria, such as coding capacity, compression efficiency, and error detection ability. The quick response (QR) code was found to have the largest coding capacity and relatively high compression ratio. To facilitate the further usage of QR code-based DNA barcodes, a web server was developed and is accessible at http://qrfordna.dnsalias.org. The web server allows users to retrieve the QR code for a species of interests, convert a DNA sequence to and from a QR code, and perform species identification based on local and global sequence similarities. In summary, the first comprehensive evaluation of various barcode symbologies has been carried out. The QR code has been found to be the most appropriate symbology for DNA barcode sequences. A web server has also been constructed to allow biologists to utilize QR codes in practical DNA barcoding applications. PMID:22574113

  16. Cloning of human prourokinase cDNA without the signal peptide and expression in Escherichia coli.

    PubMed

    Hu, B; Li, J; Yu, W; Fang, J

    1993-01-01

    Human prourokinase (pro-UK) cDNA without the signal peptide was obtained using synthetic oligonucleotide and DNA recombination techniques and was successfully expressed in E. coli. The plasmid pMMUK which contained pro-UK cDNA (including both the entire coding sequence and the sequence for signal peptide) was digested with Hind III and PstI, so that the N-terminal 371-bp fragment could be recovered. A 304-bp fragment was collected from the 371-bp fragment after partial digestion with Fnu4HI in order to remove the signal peptide sequence. An intermediate plasmid was formed after this 304-bp fragment and the synthetic oligonucleotide was ligated with pUC18. Correctness of the ligation was confirmed by enzyme digestion and sequencing. By joining the PstI-PstI fragment of pro-UK to the plasmid we obtained the final plasmid which contained the entire coding sequence of pro-UK without the signal peptide. The coding sequence with correct orientation was inserted into pBV220 under the control of the temperature-induced promoter PRPL, and mature pro-UK was expressed in E. coli at 42 degrees C. Both sonicated supernatant and inclusion bodies of the bacterial host JM101 showed positive results by ELISA and FAPA assays. After renaturation, the biological activity of the expressed product was increased from 500-1000IU/L to about 60,000IU/L. The bacterial pro-UK showed a molecular weight of about 47,000 daltons by Western blot analysis. It can be completely inhibited by UK antiserum but not by t-PA antiserum nor by normal rabbit serum.

  17. Long-term excretion of vaccine-derived poliovirus by a healthy child.

    PubMed

    Martín, Javier; Odoom, Kofi; Tuite, Gráinne; Dunn, Glynis; Hopewell, Nicola; Cooper, Gill; Fitzharris, Catherine; Butler, Karina; Hall, William W; Minor, Philip D

    2004-12-01

    A child was found to be excreting type 1 vaccine-derived poliovirus (VDPV) with a 1.1% sequence drift from Sabin type 1 vaccine strain in the VP1 coding region 6 months after he was immunized with oral live polio vaccine. Seventeen type 1 poliovirus isolates were recovered from stools taken from this child during the following 4 months. Contrary to expectation, the child was not deficient in humoral immunity and showed high levels of serum neutralization against poliovirus. Selected virus isolates were characterized in terms of their antigenic properties, virulence in transgenic mice, sensitivity for growth at high temperatures, and differences in nucleotide sequence from the Sabin type 1 strain. The VDPV isolates showed mutations at key nucleotide positions that correlated with the observed reversion to biological properties typical of wild polioviruses. A number of capsid mutations mapped at known antigenic sites leading to changes in the viral antigenic structure. Estimates of sequence evolution based on the accumulation of nucleotide changes in the VP1 coding region detected a "defective" molecular clock running at an apparent faster speed of 2.05% nucleotide changes per year versus 1% shown in previous studies. Remarkably, when compared to several type 1 VDPV strains of different origins, isolates from this child showed a much higher proportion of nonsynonymous versus synonymous nucleotide changes in the capsid coding region. This anomaly could explain the high VP1 sequence drift found and the ability of these virus strains to replicate in the gut for a longer period than expected.

  18. CRITICA: coding region identification tool invoking comparative analysis

    NASA Technical Reports Server (NTRS)

    Badger, J. H.; Olsen, G. J.; Woese, C. R. (Principal Investigator)

    1999-01-01

    Gene recognition is essential to understanding existing and future DNA sequence data. CRITICA (Coding Region Identification Tool Invoking Comparative Analysis) is a suite of programs for identifying likely protein-coding sequences in DNA by combining comparative analysis of DNA sequences with more common noncomparative methods. In the comparative component of the analysis, regions of DNA are aligned with related sequences from the DNA databases; if the translation of the aligned sequences has greater amino acid identity than expected for the observed percentage nucleotide identity, this is interpreted as evidence for coding. CRITICA also incorporates noncomparative information derived from the relative frequencies of hexanucleotides in coding frames versus other contexts (i.e., dicodon bias). The dicodon usage information is derived by iterative analysis of the data, such that CRITICA is not dependent on the existence or accuracy of coding sequence annotations in the databases. This independence makes the method particularly well suited for the analysis of novel genomes. CRITICA was tested by analyzing the available Salmonella typhimurium DNA sequences. Its predictions were compared with the DNA sequence annotations and with the predictions of GenMark. CRITICA proved to be more accurate than GenMark, and moreover, many of its predictions that would seem to be errors instead reflect problems in the sequence databases. The source code of CRITICA is freely available by anonymous FTP (rdp.life.uiuc.edu in/pub/critica) and on the World Wide Web (http:/(/)rdpwww.life.uiuc.edu).

  19. The complete mitochondrial genome of Conus tulipa (Neogastropoda: Conidae).

    PubMed

    Chen, Po-Wei; Hsiao, Sheng-Tai; Huang, Chih-Wei; Chen, Kao-Sung; Tseng, Chen-Te; Wu, Wen-Lung; Hwang, Deng-Fwu

    2016-07-01

    The complete mitogenome sequence of the cone snail Conus tulipa (Linnaeus, 1758) has been sequenced by next-generation sequencing method. The assembled mitogenome is 16,599 bp in length, including 13 protein-coding genes, 22 transfer RNA genes and 2 ribosomal RNA genes. The overall base composition of C. tulipa is 28.7% A, 15.2% C, 18.4% G and 37.7% T. It shows 81.1% identity to the cone snail C. consors, 78.5% to C. borgesi and 77.5% to C. textile. Using the 13 protein-coding genes and 2 ribosomal RNA genes of C. tulipa in this study, together with 18 other closely species, we constructed the species phylogenetic tree to verify the accuracy and utility of new determined mitogenome sequence. The complete mitogenome of the C. tulipa provides an essential and important DNA molecular data for further phylogeography and evolutionary analysis for cone snail phylogeny.

  20. Flexible manipulation of terahertz wave reflection using polarization insensitive coding metasurfaces.

    PubMed

    Jiu-Sheng, Li; Ze-Jiang, Zhao; Jian-Quan, Yao

    2017-11-27

    In order to extend to 3-bit encoding, we propose notched-wheel structures as polarization insensitive coding metasurfaces to control terahertz wave reflection and suppress backward scattering. By using a coding sequence of "00110011…" along x-axis direction and 16 × 16 random coding sequence, we investigate the polarization insensitive properties of the coding metasurfaces. By designing the coding sequences of the basic coding elements, the terahertz wave reflection can be flexibly manipulated. Additionally, radar cross section (RCS) reduction in the backward direction is less than -10dB in a wide band. The present approach can offer application for novel terahertz manipulation devices.

  1. Noncoding sequence classification based on wavelet transform analysis: part I

    NASA Astrophysics Data System (ADS)

    Paredes, O.; Strojnik, M.; Romo-Vázquez, R.; Vélez Pérez, H.; Ranta, R.; Garcia-Torales, G.; Scholl, M. K.; Morales, J. A.

    2017-09-01

    DNA sequences in human genome can be divided into the coding and noncoding ones. Coding sequences are those that are read during the transcription. The identification of coding sequences has been widely reported in literature due to its much-studied periodicity. Noncoding sequences represent the majority of the human genome. They play an important role in gene regulation and differentiation among the cells. However, noncoding sequences do not exhibit periodicities that correlate to their functions. The ENCODE (Encyclopedia of DNA elements) and Epigenomic Roadmap Project projects have cataloged the human noncoding sequences into specific functions. We study characteristics of noncoding sequences with wavelet analysis of genomic signals.

  2. Converting Panax ginseng DNA and chemical fingerprints into two-dimensional barcode.

    PubMed

    Cai, Yong; Li, Peng; Li, Xi-Wen; Zhao, Jing; Chen, Hai; Yang, Qing; Hu, Hao

    2017-07-01

    In this study, we investigated how to convert the Panax ginseng DNA sequence code and chemical fingerprints into a two-dimensional code. In order to improve the compression efficiency, GATC2Bytes and digital merger compression algorithms are proposed. HPLC chemical fingerprint data of 10 groups of P. ginseng from Northeast China and the internal transcribed spacer 2 (ITS2) sequence code as the DNA sequence code were ready for conversion. In order to convert such data into a two-dimensional code, the following six steps were performed: First, the chemical fingerprint characteristic data sets were obtained through the inflection filtering algorithm. Second, precompression processing of such data sets is undertaken. Third, precompression processing was undertaken with the P. ginseng DNA (ITS2) sequence codes. Fourth, the precompressed chemical fingerprint data and the DNA (ITS2) sequence code were combined in accordance with the set data format. Such combined data can be compressed by Zlib, an open source data compression algorithm. Finally, the compressed data generated a two-dimensional code called a quick response code (QR code). Through the abovementioned converting process, it can be found that the number of bytes needed for storing P. ginseng chemical fingerprints and its DNA (ITS2) sequence code can be greatly reduced. After GTCA2Bytes algorithm processing, the ITS2 compression rate reaches 75% and the chemical fingerprint compression rate exceeds 99.65% via filtration and digital merger compression algorithm processing. Therefore, the overall compression ratio even exceeds 99.36%. The capacity of the formed QR code is around 0.5k, which can easily and successfully be read and identified by any smartphone. P. ginseng chemical fingerprints and its DNA (ITS2) sequence code can form a QR code after data processing, and therefore the QR code can be a perfect carrier of the authenticity and quality of P. ginseng information. This study provides a theoretical basis for the development of a quality traceability system of traditional Chinese medicine based on a two-dimensional code.

  3. Venom gland transcriptomic and venom proteomic analyses of the scorpion Megacormus gertschi Díaz-Najera, 1966 (Scorpiones: Euscorpiidae: Megacorminae).

    PubMed

    Santibáñez-López, Carlos E; Cid-Uribe, Jimena I; Zamudio, Fernando Z; Batista, Cesar V F; Ortiz, Ernesto; Possani, Lourival D

    2017-07-01

    The soluble venom from the Mexican scorpion Megacormus gertschi of the family Euscorpiidae was obtained and its biological effects were tested in several animal models. This venom is not toxic to mice at doses of 100 μg per 20 g of mouse weight, while being lethal to arthropods (insects and crustaceans), at doses of 20 μg (for crickets) and 100 μg (for shrimps) per animal. Samples of the venom were separated by high performance liquid chromatography and circa 80 distinct chromatographic fractions were obtained from which 67 components have had their molecular weights determined by mass spectrometry analysis. The N-terminal amino acid sequence of seven protein/peptides were obtained by Edman degradation and are reported. Among the high molecular weight components there are enzymes with experimentally-confirmed phospholipase activity. A pair of telsons from this scorpion species was dissected, from which total RNA was extracted and used for cDNA library construction. Massive sequencing by the Illumina protocol, followed by de novo assembly, resulted in a total of 110,528 transcripts. From those, we were able to annotate 182, which putatively code for peptides/proteins with sequence similarity to previously-reported venom components available from different protein databases. Transcripts seemingly coding for enzymes showed the richest diversity, with 52 sequences putatively coding for proteases, 20 for phospholipases, 8 for lipases and 5 for hyaluronidases. The number of different transcripts potentially coding for peptides with sequence similarity to those that affect ion channels was 19, for putative antimicrobial peptides 19, and for protease inhibitor-like peptides, 18. Transcripts seemingly coding for other venom components were identified and described. The LC/MS analysis of a trypsin-digested venom aliquot resulted in 23 matches with the translated transcriptome database, which validates the transcriptome. The proteomic and transcriptomic analyses reported here constitute the first approach to study the venom components from a scorpion species belonging to the family Euscorpiidae. The data certainly show that this venom is different from all the ones described thus far in the literature. Copyright © 2017 Elsevier Ltd. All rights reserved.

  4. Barley whole exome capture: a tool for genomic research in the genus Hordeum and beyond

    PubMed Central

    Mascher, Martin; Richmond, Todd A; Gerhardt, Daniel J; Himmelbach, Axel; Clissold, Leah; Sampath, Dharanya; Ayling, Sarah; Steuernagel, Burkhard; Pfeifer, Matthias; D'Ascenzo, Mark; Akhunov, Eduard D; Hedley, Pete E; Gonzales, Ana M; Morrell, Peter L; Kilian, Benjamin; Blattner, Frank R; Scholz, Uwe; Mayer, Klaus FX; Flavell, Andrew J; Muehlbauer, Gary J; Waugh, Robbie; Jeddeloh, Jeffrey A; Stein, Nils

    2013-01-01

    Advanced resources for genome-assisted research in barley (Hordeum vulgare) including a whole-genome shotgun assembly and an integrated physical map have recently become available. These have made possible studies that aim to assess genetic diversity or to isolate single genes by whole-genome resequencing and in silico variant detection. However such an approach remains expensive given the 5 Gb size of the barley genome. Targeted sequencing of the mRNA-coding exome reduces barley genomic complexity more than 50-fold, thus dramatically reducing this heavy sequencing and analysis load. We have developed and employed an in-solution hybridization-based sequence capture platform to selectively enrich for a 61.6 megabase coding sequence target that includes predicted genes from the genome assembly of the cultivar Morex as well as publicly available full-length cDNAs and de novo assembled RNA-Seq consensus sequence contigs. The platform provides a highly specific capture with substantial and reproducible enrichment of targeted exons, both for cultivated barley and related species. We show that this exome capture platform provides a clear path towards a broader and deeper understanding of the natural variation residing in the mRNA-coding part of the barley genome and will thus constitute a valuable resource for applications such as mapping-by-sequencing and genetic diversity analyzes. PMID:23889683

  5. TFIIS-Dependent Non-coding Transcription Regulates Developmental Genome Rearrangements

    PubMed Central

    Maliszewska-Olejniczak, Kamila; Gruchota, Julita; Gromadka, Robert; Denby Wilkes, Cyril; Arnaiz, Olivier; Mathy, Nathalie; Duharcourt, Sandra; Bétermier, Mireille; Nowak, Jacek K.

    2015-01-01

    Because of their nuclear dimorphism, ciliates provide a unique opportunity to study the role of non-coding RNAs (ncRNAs) in the communication between germline and somatic lineages. In these unicellular eukaryotes, a new somatic nucleus develops at each sexual cycle from a copy of the zygotic (germline) nucleus, while the old somatic nucleus degenerates. In the ciliate Paramecium tetraurelia, the genome is massively rearranged during this process through the reproducible elimination of repeated sequences and the precise excision of over 45,000 short, single-copy Internal Eliminated Sequences (IESs). Different types of ncRNAs resulting from genome-wide transcription were shown to be involved in the epigenetic regulation of genome rearrangements. To understand how ncRNAs are produced from the entire genome, we have focused on a homolog of the TFIIS elongation factor, which regulates RNA polymerase II transcriptional pausing. Six TFIIS-paralogs, representing four distinct families, can be found in P. tetraurelia genome. Using RNA interference, we showed that TFIIS4, which encodes a development-specific TFIIS protein, is essential for the formation of a functional somatic genome. Molecular analyses and high-throughput DNA sequencing upon TFIIS4 RNAi demonstrated that TFIIS4 is involved in all kinds of genome rearrangements, including excision of ~48% of IESs. Localization of a GFP-TFIIS4 fusion revealed that TFIIS4 appears specifically in the new somatic nucleus at an early developmental stage, before IES excision. RT-PCR experiments showed that TFIIS4 is necessary for the synthesis of IES-containing non-coding transcripts. We propose that these IES+ transcripts originate from the developing somatic nucleus and serve as pairing substrates for germline-specific short RNAs that target elimination of their homologous sequences. Our study, therefore, connects the onset of zygotic non coding transcription to the control of genome plasticity in Paramecium, and establishes for the first time a specific role of TFIIS in non-coding transcription in eukaryotes. PMID:26177014

  6. Coding and decoding libraries of sequence-defined functional copolymers synthesized via photoligation

    PubMed Central

    Zydziak, Nicolas; Konrad, Waldemar; Feist, Florian; Afonin, Sergii; Weidner, Steffen; Barner-Kowollik, Christopher

    2016-01-01

    Designing artificial macromolecules with absolute sequence order represents a considerable challenge. Here we report an advanced light-induced avenue to monodisperse sequence-defined functional linear macromolecules up to decamers via a unique photochemical approach. The versatility of the synthetic strategy—combining sequential and modular concepts—enables the synthesis of perfect macromolecules varying in chemical constitution and topology. Specific functions are placed at arbitrary positions along the chain via the successive addition of monomer units and blocks, leading to a library of functional homopolymers, alternating copolymers and block copolymers. The in-depth characterization of each sequence-defined chain confirms the precision nature of the macromolecules. Decoding of the functional information contained in the molecular structure is achieved via tandem mass spectrometry without recourse to their synthetic history, showing that the sequence information can be read. We submit that the presented photochemical strategy is a viable and advanced concept for coding individual monomer units along a macromolecular chain. PMID:27901024

  7. Coding and decoding libraries of sequence-defined functional copolymers synthesized via photoligation.

    PubMed

    Zydziak, Nicolas; Konrad, Waldemar; Feist, Florian; Afonin, Sergii; Weidner, Steffen; Barner-Kowollik, Christopher

    2016-11-30

    Designing artificial macromolecules with absolute sequence order represents a considerable challenge. Here we report an advanced light-induced avenue to monodisperse sequence-defined functional linear macromolecules up to decamers via a unique photochemical approach. The versatility of the synthetic strategy-combining sequential and modular concepts-enables the synthesis of perfect macromolecules varying in chemical constitution and topology. Specific functions are placed at arbitrary positions along the chain via the successive addition of monomer units and blocks, leading to a library of functional homopolymers, alternating copolymers and block copolymers. The in-depth characterization of each sequence-defined chain confirms the precision nature of the macromolecules. Decoding of the functional information contained in the molecular structure is achieved via tandem mass spectrometry without recourse to their synthetic history, showing that the sequence information can be read. We submit that the presented photochemical strategy is a viable and advanced concept for coding individual monomer units along a macromolecular chain.

  8. Novel variants of the 5S rRNA genes in Eruca sativa.

    PubMed

    Singh, K; Bhatia, S; Lakshmikumaran, M

    1994-02-01

    The 5S ribosomal RNA (rRNA) genes of Eruca sativa were cloned and characterized. They are organized into clusters of tandemly repeated units. Each repeat unit consists of a 119-bp coding region followed by a noncoding spacer region that separates it from the coding region of the next repeat unit. Our study reports novel gene variants of the 5S rRNA genes in plants. Two families of the 5S rDNA, the 0.5-kb size family and the 1-kb size family, coexist in the E. sativa genome. The 0.5-kb size family consists of the 5S rRNA genes (S4) that have coding regions similar to those of other reported plant 5S rDNA sequences, whereas the 1-kb size family consists of the 5S rRNA gene variants (S1) that exist as 1-kb BamHI tandem repeats. S1 is made up of two variant units (V1 and V2) of 5S rDNA where the BamHI site between the two units is mutated. Sequence heterogeneity among S4, V1, and V2 units exists throughout the sequence and is not limited to the noncoding spacer region only. The coding regions of V1 and V2 show approximately 20% dissimilarity to the coding regions of S4 and other reported plant 5S rDNA sequences. Such a large variation in the coding regions of the 5S rDNA units within the same plant species has been observed for the first time. Restriction site variation is observed between the two size classes of 5S rDNA in E. sativa.(ABSTRACT TRUNCATED AT 250 WORDS)

  9. Genome Sequence of Paenibacillus polymyxa Strain CICC 10580, Isolated from the Fruit of Noni (Morinda citrifolia L.) Grown in the Paracel Islands.

    PubMed

    Xu, Youqiang; Liu, Yang; Yao, Su; Li, Jinxia; Cheng, Chi

    2014-08-28

    Noni is a plant reported to have nutritional and therapeutic properties. Paenibacillus polymyxa CICC 10580 is a strain that was isolated from the fruit of noni and showed comprehensive antagonistic activity against many pathogens. Its genome was sequenced and assembled (6.10 Mb). The coding sequences (CDSs) correlated with antagonistic activity were annotated. Copyright © 2014 Xu et al.

  10. Sequences of 95 human MHC haplotypes reveal extreme coding variation in genes other than highly polymorphic HLA class I and II

    PubMed Central

    Norman, Paul J.; Norberg, Steven J.; Guethlein, Lisbeth A.; Nemat-Gorgani, Neda; Royce, Thomas; Wroblewski, Emily E.; Dunn, Tamsen; Mann, Tobias; Alicata, Claudia; Hollenbach, Jill A.; Chang, Weihua; Shults Won, Melissa; Gunderson, Kevin L.; Abi-Rached, Laurent; Ronaghi, Mostafa; Parham, Peter

    2017-01-01

    The most polymorphic part of the human genome, the MHC, encodes over 160 proteins of diverse function. Half of them, including the HLA class I and II genes, are directly involved in immune responses. Consequently, the MHC region strongly associates with numerous diseases and clinical therapies. Notoriously, the MHC region has been intractable to high-throughput analysis at complete sequence resolution, and current reference haplotypes are inadequate for large-scale studies. To address these challenges, we developed a method that specifically captures and sequences the 4.8-Mbp MHC region from genomic DNA. For 95 MHC homozygous cell lines we assembled, de novo, a set of high-fidelity contigs and a sequence scaffold, representing a mean 98% of the target region. Included are six alternative MHC reference sequences of the human genome that we completed and refined. Characterization of the sequence and structural diversity of the MHC region shows the approach accurately determines the sequences of the highly polymorphic HLA class I and HLA class II genes and the complex structural diversity of complement factor C4A/C4B. It has also uncovered extensive and unexpected diversity in other MHC genes; an example is MUC22, which encodes a lung mucin and exhibits more coding sequence alleles than any HLA class I or II gene studied here. More than 60% of the coding sequence alleles analyzed were previously uncharacterized. We have created a substantial database of robust reference MHC haplotype sequences that will enable future population scale studies of this complicated and clinically important region of the human genome. PMID:28360230

  11. Structure-related statistical singularities along protein sequences: a correlation study.

    PubMed

    Colafranceschi, Mauro; Colosimo, Alfredo; Zbilut, Joseph P; Uversky, Vladimir N; Giuliani, Alessandro

    2005-01-01

    A data set composed of 1141 proteins representative of all eukaryotic protein sequences in the Swiss-Prot Protein Knowledge base was coded by seven physicochemical properties of amino acid residues. The resulting numerical profiles were submitted to correlation analysis after the application of a linear (simple mean) and a nonlinear (Recurrence Quantification Analysis, RQA) filter. The main RQA variables, Recurrence and Determinism, were subsequently analyzed by Principal Component Analysis. The RQA descriptors showed that (i) within protein sequences is embedded specific information neither present in the codes nor in the amino acid composition and (ii) the most sensitive code for detecting ordered recurrent (deterministic) patterns of residues in protein sequences is the Miyazawa-Jernigan hydrophobicity scale. The most deterministic proteins in terms of autocorrelation properties of primary structures were found (i) to be involved in protein-protein and protein-DNA interactions and (ii) to display a significantly higher proportion of structural disorder with respect to the average data set. A study of the scaling behavior of the average determinism with the setting parameters of RQA (embedding dimension and radius) allows for the identification of patterns of minimal length (six residues) as possible markers of zones specifically prone to inter- and intramolecular interactions.

  12. MicroRNA-200c Modulates the Expression of MUC4 and MUC16 by Directly Targeting Their Coding Sequences in Human Pancreatic Cancer

    PubMed Central

    Radhakrishnan, Prakash; Mohr, Ashley M.; Grandgenett, Paul M.; Steele, Maria M.; Batra, Surinder K.; Hollingsworth, Michael A.

    2013-01-01

    Transmembrane mucins, MUC4 and MUC16 are associated with tumor progression and metastatic potential in human pancreatic adenocarcinoma. We discovered that miR-200c interacts with specific sequences within the coding sequence of MUC4 and MUC16 mRNAs, and evaluated the regulatory nature of this association. Pancreatic cancer cell lines S2.028 and T3M-4 transfected with miR-200c showed a 4.18 and 8.50 fold down regulation of MUC4 mRNA, and 4.68 and 4.82 fold down regulation of MUC16 mRNA compared to mock-transfected cells, respectively. A significant reduction of glycoprotein expression was also observed. These results indicate that miR-200c overexpression regulates MUC4 and MUC16 mucins in pancreatic cancer cells by directly targeting the mRNA coding sequence of each, resulting in reduced levels of MUC4 and MUC16 mRNA and protein. These data suggest that, in addition to regulating proteins that modulate EMT, miR-200c influences expression of cell surface mucins in pancreatic cancer. PMID:24204560

  13. MicroRNA-200c modulates the expression of MUC4 and MUC16 by directly targeting their coding sequences in human pancreatic cancer.

    PubMed

    Radhakrishnan, Prakash; Mohr, Ashley M; Grandgenett, Paul M; Steele, Maria M; Batra, Surinder K; Hollingsworth, Michael A

    2013-01-01

    Transmembrane mucins, MUC4 and MUC16 are associated with tumor progression and metastatic potential in human pancreatic adenocarcinoma. We discovered that miR-200c interacts with specific sequences within the coding sequence of MUC4 and MUC16 mRNAs, and evaluated the regulatory nature of this association. Pancreatic cancer cell lines S2.028 and T3M-4 transfected with miR-200c showed a 4.18 and 8.50 fold down regulation of MUC4 mRNA, and 4.68 and 4.82 fold down regulation of MUC16 mRNA compared to mock-transfected cells, respectively. A significant reduction of glycoprotein expression was also observed. These results indicate that miR-200c overexpression regulates MUC4 and MUC16 mucins in pancreatic cancer cells by directly targeting the mRNA coding sequence of each, resulting in reduced levels of MUC4 and MUC16 mRNA and protein. These data suggest that, in addition to regulating proteins that modulate EMT, miR-200c influences expression of cell surface mucins in pancreatic cancer.

  14. An improved and validated RNA HLA class I SBT approach for obtaining full length coding sequences.

    PubMed

    Gerritsen, K E H; Olieslagers, T I; Groeneweg, M; Voorter, C E M; Tilanus, M G J

    2014-11-01

    The functional relevance of human leukocyte antigen (HLA) class I allele polymorphism beyond exons 2 and 3 is difficult to address because more than 70% of the HLA class I alleles are defined by exons 2 and 3 sequences only. For routine application on clinical samples we improved and validated the HLA sequence-based typing (SBT) approach based on RNA templates, using either a single locus-specific or two overlapping group-specific polymerase chain reaction (PCR) amplifications, with three forward and three reverse sequencing reactions for full length sequencing. Locus-specific HLA typing with RNA SBT of a reference panel, representing the major antigen groups, showed identical results compared to DNA SBT typing. Alleles encountered with unknown exons in the IMGT/HLA database and three samples, two with Null and one with a Low expressed allele, have been addressed by the group-specific RNA SBT approach to obtain full length coding sequences. This RNA SBT approach has proven its value in our routine full length definition of alleles. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  15. Comparative Mitogenomics of Plant Bugs (Hemiptera: Miridae): Identifying the AGG Codon Reassignments between Serine and Lysine

    PubMed Central

    Wang, Pei; Song, Fan; Cai, Wanzhi

    2014-01-01

    Insect mitochondrial genomes are very important to understand the molecular evolution as well as for phylogenetic and phylogeographic studies of the insects. The Miridae are the largest family of Heteroptera encompassing more than 11,000 described species and of great economic importance. For better understanding the diversity and the evolution of plant bugs, we sequence five new mitochondrial genomes and present the first comparative analysis of nine mitochondrial genomes of mirids available to date. Our result showed that gene content, gene arrangement, base composition and sequences of mitochondrial transcription termination factor were conserved in plant bugs. Intra-genus species shared more conserved genomic characteristics, such as nucleotide and amino acid composition of protein-coding genes, secondary structure and anticodon mutations of tRNAs, and non-coding sequences. Control region possessed several distinct characteristics, including: variable size, abundant tandem repetitions, and intra-genus conservation; and was useful in evolutionary and population genetic studies. The AGG codon reassignments were investigated between serine and lysine in the genera Adelphocoris and other cimicomorphans. Our analysis revealed correlated evolution between reassignments of the AGG codon and specific point mutations at the antidocons of tRNALys and tRNASer(AGN). Phylogenetic analysis indicated that mitochondrial genome sequences were useful in resolving family level relationship of Cimicomorpha. Comparative evolutionary analysis of plant bug mitochondrial genomes allowed the identification of previously neglected coding genes or non-coding regions as potential molecular markers. The finding of the AGG codon reassignments between serine and lysine indicated the parallel evolution of the genetic code in Hemiptera mitochondrial genomes. PMID:24988409

  16. Identification of coding and non-coding mutational hotspots in cancer genomes.

    PubMed

    Piraino, Scott W; Furney, Simon J

    2017-01-05

    The identification of mutations that play a causal role in tumour development, so called "driver" mutations, is of critical importance for understanding how cancers form and how they might be treated. Several large cancer sequencing projects have identified genes that are recurrently mutated in cancer patients, suggesting a role in tumourigenesis. While the landscape of coding drivers has been extensively studied and many of the most prominent driver genes are well characterised, comparatively less is known about the role of mutations in the non-coding regions of the genome in cancer development. The continuing fall in genome sequencing costs has resulted in a concomitant increase in the number of cancer whole genome sequences being produced, facilitating systematic interrogation of both the coding and non-coding regions of cancer genomes. To examine the mutational landscapes of tumour genomes we have developed a novel method to identify mutational hotspots in tumour genomes using both mutational data and information on evolutionary conservation. We have applied our methodology to over 1300 whole cancer genomes and show that it identifies prominent coding and non-coding regions that are known or highly suspected to play a role in cancer. Importantly, we applied our method to the entire genome, rather than relying on predefined annotations (e.g. promoter regions) and we highlight recurrently mutated regions that may have resulted from increased exposure to mutational processes rather than selection, some of which have been identified previously as targets of selection. Finally, we implicate several pan-cancer and cancer-specific candidate non-coding regions, which could be involved in tumourigenesis. We have developed a framework to identify mutational hotspots in cancer genomes, which is applicable to the entire genome. This framework identifies known and novel coding and non-coding mutional hotspots and can be used to differentiate candidate driver regions from likely passenger regions susceptible to somatic mutation.

  17. Pattern recognition of electronic bit-sequences using a semiconductor mode-locked laser and spatial light modulators

    NASA Astrophysics Data System (ADS)

    Bhooplapur, Sharad; Akbulut, Mehmetkan; Quinlan, Franklyn; Delfyett, Peter J.

    2010-04-01

    A novel scheme for recognition of electronic bit-sequences is demonstrated. Two electronic bit-sequences that are to be compared are each mapped to a unique code from a set of Walsh-Hadamard codes. The codes are then encoded in parallel on the spectral phase of the frequency comb lines from a frequency-stabilized mode-locked semiconductor laser. Phase encoding is achieved by using two independent spatial light modulators based on liquid crystal arrays. Encoded pulses are compared using interferometric pulse detection and differential balanced photodetection. Orthogonal codes eight bits long are compared, and matched codes are successfully distinguished from mismatched codes with very low error rates, of around 10-18. This technique has potential for high-speed, high accuracy recognition of bit-sequences, with applications in keyword searches and internet protocol packet routing.

  18. Two Perspectives on the Origin of the Standard Genetic Code

    NASA Astrophysics Data System (ADS)

    Sengupta, Supratim; Aggarwal, Neha; Bandhu, Ashutosh Vishwa

    2014-12-01

    The origin of a genetic code made it possible to create ordered sequences of amino acids. In this article we provide two perspectives on code origin by carrying out simulations of code-sequence coevolution in finite populations with the aim of examining how the standard genetic code may have evolved from more primitive code(s) encoding a small number of amino acids. We determine the efficacy of the physico-chemical hypothesis of code origin in the absence and presence of horizontal gene transfer (HGT) by allowing a diverse collection of code-sequence sets to compete with each other. We find that in the absence of horizontal gene transfer, natural selection between competing codes distinguished by differences in the degree of physico-chemical optimization is unable to explain the structure of the standard genetic code. However, for certain probabilities of the horizontal transfer events, a universal code emerges having a structure that is consistent with the standard genetic code.

  19. The complete chloroplast genome sequence of strawberry (Fragaria  × ananassa Duch.) and comparison with related species of Rosaceae

    PubMed Central

    Cheng, Hui; Li, Jinfeng; Zhang, Hong; Cai, Binhua; Gao, Zhihong

    2017-01-01

    Compared with other members of the family Rosaceae, the chloroplast genomes of Fragaria species exhibit low variation, and this situation has limited phylogenetic analyses; thus, complete chloroplast genome sequencing of Fragaria species is needed. In this study, we sequenced the complete chloroplast genome of F. × ananassa ‘Benihoppe’ using the Illumina HiSeq 2500-PE150 platform and then performed a combination of de novo assembly and reference-guided mapping of contigs to generate complete chloroplast genome sequences. The chloroplast genome exhibits a typical quadripartite structure with a pair of inverted repeats (IRs, 25,936 bp) separated by large (LSC, 85,531 bp) and small (SSC, 18,146 bp) single-copy (SC) regions. The length of the F. × ananassa ‘Benihoppe’ chloroplast genome is 155,549 bp, representing the smallest Fragaria chloroplast genome observed to date. The genome encodes 112 unique genes, comprising 78 protein-coding genes, 30 tRNA genes and four rRNA genes. Comparative analysis of the overall nucleotide sequence identity among ten complete chloroplast genomes confirmed that for both coding and non-coding regions in Rosaceae, SC regions exhibit higher sequence variation than IRs. The Ka/Ks ratio of most genes was less than 1, suggesting that most genes are under purifying selection. Moreover, the mVISTA results also showed a high degree of conservation in genome structure, gene order and gene content in Fragaria, particularly among three octoploid strawberries which were F. × ananassa ‘Benihoppe’, F. chiloensis (GP33) and F. virginiana (O477). However, when the sequences of the coding and non-coding regions of F. × ananassa ‘Benihoppe’ were compared in detail with those of F. chiloensis (GP33) and F. virginiana (O477), a number of SNPs and InDels were revealed by MEGA 7. Six non-coding regions (trnK-matK, trnS-trnG, atpF-atpH, trnC-petN, trnT-psbD and trnP-psaJ) with a percentage of variable sites greater than 1% and no less than five parsimony-informative sites were identified and may be useful for phylogenetic analysis of the genus Fragaria. PMID:29038765

  20. An algebraic hypothesis about the primeval genetic code architecture.

    PubMed

    Sánchez, Robersy; Grau, Ricardo

    2009-09-01

    A plausible architecture of an ancient genetic code is derived from an extended base triplet vector space over the Galois field of the extended base alphabet {D,A,C,G,U}, where symbol D represents one or more hypothetical bases with unspecific pairings. We hypothesized that the high degeneration of a primeval genetic code with five bases and the gradual origin and improvement of a primeval DNA repair system could make possible the transition from ancient to modern genetic codes. Our results suggest that the Watson-Crick base pairing G identical with C and A=U and the non-specific base pairing of the hypothetical ancestral base D used to define the sum and product operations are enough features to determine the coding constraints of the primeval and the modern genetic code, as well as, the transition from the former to the latter. Geometrical and algebraic properties of this vector space reveal that the present codon assignment of the standard genetic code could be induced from a primeval codon assignment. Besides, the Fourier spectrum of the extended DNA genome sequences derived from the multiple sequence alignment suggests that the called period-3 property of the present coding DNA sequences could also exist in the ancient coding DNA sequences. The phylogenetic analyses achieved with metrics defined in the N-dimensional vector space (B(3))(N) of DNA sequences and with the new evolutionary model presented here also suggest that an ancient DNA coding sequence with five or more bases does not contradict the expected evolutionary history.

  1. The complete chloroplast genome sequence of the medicinal plant Salvia miltiorrhiza.

    PubMed

    Qian, Jun; Song, Jingyuan; Gao, Huanhuan; Zhu, Yingjie; Xu, Jiang; Pang, Xiaohui; Yao, Hui; Sun, Chao; Li, Xian'en; Li, Chuyuan; Liu, Juyan; Xu, Haibin; Chen, Shilin

    2013-01-01

    Salvia miltiorrhiza is an important medicinal plant with great economic and medicinal value. The complete chloroplast (cp) genome sequence of Salvia miltiorrhiza, the first sequenced member of the Lamiaceae family, is reported here. The genome is 151,328 bp in length and exhibits a typical quadripartite structure of the large (LSC, 82,695 bp) and small (SSC, 17,555 bp) single-copy regions, separated by a pair of inverted repeats (IRs, 25,539 bp). It contains 114 unique genes, including 80 protein-coding genes, 30 tRNAs and four rRNAs. The genome structure, gene order, GC content and codon usage are similar to the typical angiosperm cp genomes. Four forward, three inverted and seven tandem repeats were detected in the Salvia miltiorrhiza cp genome. Simple sequence repeat (SSR) analysis among the 30 asterid cp genomes revealed that most SSRs are AT-rich, which contribute to the overall AT richness of these cp genomes. Additionally, fewer SSRs are distributed in the protein-coding sequences compared to the non-coding regions, indicating an uneven distribution of SSRs within the cp genomes. Entire cp genome comparison of Salvia miltiorrhiza and three other Lamiales cp genomes showed a high degree of sequence similarity and a relatively high divergence of intergenic spacers. Sequence divergence analysis discovered the ten most divergent and ten most conserved genes as well as their length variation, which will be helpful for phylogenetic studies in asterids. Our analysis also supports that both regional and functional constraints affect gene sequence evolution. Further, phylogenetic analysis demonstrated a sister relationship between Salvia miltiorrhiza and Sesamum indicum. The complete cp genome sequence of Salvia miltiorrhiza reported in this paper will facilitate population, phylogenetic and cp genetic engineering studies of this medicinal plant.

  2. Application of Quaternion in improving the quality of global sequence alignment scores for an ambiguous sequence target in Streptococcus pneumoniae DNA

    NASA Astrophysics Data System (ADS)

    Lestari, D.; Bustamam, A.; Novianti, T.; Ardaneswari, G.

    2017-07-01

    DNA sequence can be defined as a succession of letters, representing the order of nucleotides within DNA, using a permutation of four DNA base codes including adenine (A), guanine (G), cytosine (C), and thymine (T). The precise code of the sequences is determined using DNA sequencing methods and technologies, which have been developed since the 1970s and currently become highly developed, advanced and highly throughput sequencing technologies. So far, DNA sequencing has greatly accelerated biological and medical research and discovery. However, in some cases DNA sequencing could produce any ambiguous and not clear enough sequencing results that make them quite difficult to be determined whether these codes are A, T, G, or C. To solve these problems, in this study we can introduce other representation of DNA codes namely Quaternion Q = (PA, PT, PG, PC), where PA, PT, PG, PC are the probability of A, T, G, C bases that could appear in Q and PA + PT + PG + PC = 1. Furthermore, using Quaternion representations we are able to construct the improved scoring matrix for global sequence alignment processes, by applying a dot product method. Moreover, this scoring matrix produces better and higher quality of the match and mismatch score between two DNA base codes. In implementation, we applied the Needleman-Wunsch global sequence alignment algorithm using Octave, to analyze our target sequence which contains some ambiguous sequence data. The subject sequences are the DNA sequences of Streptococcus pneumoniae families obtained from the Genebank, meanwhile the target DNA sequence are received from our collaborator database. As the results we found the Quaternion representations improve the quality of the sequence alignment score and we can conclude that DNA sequence target has maximum similarity with Streptococcus pneumoniae.

  3. A novel all-optical label processing for OPS networks based on multiple OOC sequences from multiple-groups OOC

    NASA Astrophysics Data System (ADS)

    Qiu, Kun; Zhang, Chongfu; Ling, Yun; Wang, Yibo

    2007-11-01

    This paper proposes an all-optical label processing scheme using multiple optical orthogonal codes sequences (MOOCS) for optical packet switching (OPS) (MOOCS-OPS) networks, for the first time to the best of our knowledge. In this scheme, the multiple optical orthogonal codes (MOOC) from multiple-groups optical orthogonal codes (MGOOC) are permuted and combined to obtain the MOOCS for the optical labels, which are used to effectively enlarge the capacity of available optical codes for optical labels. The optical label processing (OLP) schemes are reviewed and analyzed, the principles of MOOCS-based optical labels for OPS networks are given, and analyzed, then the MOOCS-OPS topology and the key realization units of the MOOCS-based optical label packets are studied in detail, respectively. The performances of this novel all-optical label processing technology are analyzed, the corresponding simulation is performed. These analysis and results show that the proposed scheme can overcome the lack of available optical orthogonal codes (OOC)-based optical labels due to the limited number of single OOC for optical label with the short code length, and indicate that the MOOCS-OPS scheme is feasible.

  4. Recurrent and functional regulatory mutations in breast cancer.

    PubMed

    Rheinbay, Esther; Parasuraman, Prasanna; Grimsby, Jonna; Tiao, Grace; Engreitz, Jesse M; Kim, Jaegil; Lawrence, Michael S; Taylor-Weiner, Amaro; Rodriguez-Cuevas, Sergio; Rosenberg, Mara; Hess, Julian; Stewart, Chip; Maruvka, Yosef E; Stojanov, Petar; Cortes, Maria L; Seepo, Sara; Cibulskis, Carrie; Tracy, Adam; Pugh, Trevor J; Lee, Jesse; Zheng, Zongli; Ellisen, Leif W; Iafrate, A John; Boehm, Jesse S; Gabriel, Stacey B; Meyerson, Matthew; Golub, Todd R; Baselga, Jose; Hidalgo-Miranda, Alfredo; Shioda, Toshi; Bernards, Andre; Lander, Eric S; Getz, Gad

    2017-07-06

    Genomic analysis of tumours has led to the identification of hundreds of cancer genes on the basis of the presence of mutations in protein-coding regions. By contrast, much less is known about cancer-causing mutations in non-coding regions. Here we perform deep sequencing in 360 primary breast cancers and develop computational methods to identify significantly mutated promoters. Clear signals are found in the promoters of three genes. FOXA1, a known driver of hormone-receptor positive breast cancer, harbours a mutational hotspot in its promoter leading to overexpression through increased E2F binding. RMRP and NEAT1, two non-coding RNA genes, carry mutations that affect protein binding to their promoters and alter expression levels. Our study shows that promoter regions harbour recurrent mutations in cancer with functional consequences and that the mutations occur at similar frequencies as in coding regions. Power analyses indicate that more such regions remain to be discovered through deep sequencing of adequately sized cohorts of patients.

  5. Polyomavirus BK non-coding control region rearrangements in health and disease.

    PubMed

    Sharma, Preety M; Gupta, Gaurav; Vats, Abhay; Shapiro, Ron; Randhawa, Parmjeet S

    2007-08-01

    BK virus is an increasingly recognized pathogen in transplanted patients. DNA sequencing of this virus shows considerable genomic variability. To understand the clinical significance of rearrangements in the non-coding control region (NCCR) of BK virus (BKV), we report a meta-analysis of 507 sequences, including 40 sequences generated in our own laboratory, for associations between rearrangements and disease, tissue tropism, geographic origin, and viral genotype. NCCR rearrangements were less frequent in (a) asymptomatic BKV viruria compared to patients viral nephropathy (1.7% vs. 22.5%), and (b) viral genotype 1 compared to other genotypes (2.4% vs. 11.2%). Rearrangements were commoner in malignancy (78.6%), and Norwegians (45.7%), and less common in East Indians (0%), and Japanese (4.3%). A surprising number of rearranged sequences were reported from mononuclear cells of healthy subjects, whereas most plasma sequences were archetypal. This difference could not be related to potential recombinase activity in lymphocytes, as consensus recombination signal sequences could not be found in the NCCR region. NCCR rearrangements are neither required nor a sufficient condition to produce clinical disease. BKV nephropathy and hemorrhagic cystitis are not associated with any unique NCCR configuration or nucleotide sequence.

  6. The compositional transition of vertebrate genomes: an analysis of the secondary structure of the proteins encoded by human genes.

    PubMed

    D'Onofrio, Giuseppe; Ghosh, Tapash Chandra

    2005-01-17

    Fluctuations and increments of both C(3) and G(3) levels along the human coding sequences were investigated comparing two sets of Xenopus/human orthologous genes. The first set of genes shows minor differences of the GC(3) levels, the second shows considerable increments of the GC(3) levels in the human genes. In both data sets, the fluctuations of C(3) and G(3) levels along the coding sequences correlated with the secondary structures of the encoded proteins. The human genes that underwent the compositional transition showed a different increment of the C(3) and G(3) levels within and among the structural units of the proteins. The relative synonymous codon usage (RSCU) of several amino acids were also affected during the compositional transition, showing that there exists a correlation between RSCU and protein secondary structures in human genes. The importance of natural selection for the formation of isochore organization of the human genome has been discussed on the basis of these results.

  7. A Case-by-Case Evolutionary Analysis of Four Imprinted Retrogenes

    PubMed Central

    McCole, Ruth B; Loughran, Noeleen B; Chahal, Mandeep; Fernandes, Luis P; Roberts, Roland G; Fraternali, Franca; O'Connell, Mary J; Oakey, Rebecca J

    2011-01-01

    Retroposition is a widespread phenomenon resulting in the generation of new genes that are initially related to a parent gene via very high coding sequence similarity. We examine the evolutionary fate of four retrogenes generated by such an event; mouse Inpp5f_v2, Mcts2, Nap1l5, and U2af1-rs1. These genes are all subject to the epigenetic phenomenon of parental imprinting. We first provide new data on the age of these retrogene insertions. Using codon-based models of sequence evolution, we show these retrogenes have diverse evolutionary trajectories, including divergence from the parent coding sequence under positive selection pressure, purifying selection pressure maintaining parent-retrogene similarity, and neutral evolution. Examination of the expression pattern of retrogenes shows an atypical, broad pattern across multiple tissues. Protein 3D structure modeling reveals that a positively selected residue in U2af1-rs1, not shared by its parent, may influence protein conformation. Our case-by-case analysis of the evolution of four imprinted retrogenes reveals that this interesting class of imprinted genes, while similar in regulation and sequence characteristics, follow very varied evolutionary paths. PMID:21166792

  8. Cloning and sequence analysis of a cDNA encoding the alpha-subunit of mouse beta-N-acetylhexosaminidase and comparison with the human enzyme.

    PubMed Central

    Beccari, T; Hoade, J; Orlacchio, A; Stirling, J L

    1992-01-01

    cDNAs encoding the mouse beta-N-acetylhexosaminidase alpha-subunit were isolated from a mouse testis library. The longest of these (1.7 kb) was sequenced and showed 83% similarity with the human alpha-subunit cDNA sequence. The 5' end of the coding sequence was obtained from a genomic DNA clone. Alignment of the human and mouse sequences showed that all three putative N-glycosylation sites are conserved, but that the mouse alpha-subunit has an additional site towards the C-terminus. All eight cysteines in the human sequence are conserved in the mouse. There are an additional two cysteines in the mouse alpha-subunit signal peptide. All amino acids affected in Tay-Sachs-disease mutations are conserved in the mouse. Images Fig. 1. PMID:1379046

  9. Application of representational difference analysis to identify genomic differences between Bradyrhizobium elkanii and B. Japonicum species.

    PubMed

    Soares, René Arderius; Passaglia, Luciane Maria Pereira

    2010-10-01

    Bradyrhizobium elkanii is successfully used in the formulation of commercial inoculants and, together with B. japonicum, it fully supplies the plant nitrogen demands. Despite the similarity between B. japonicum and B. elkanii species, several works demonstrated genetic and physiological differences between them. In this work Representational Difference Analysis (RDA) was used for genomic comparison between B. elkanii SEMIA 587, a crop inoculant strain, and B. japonicum USDA 110, a reference strain. Two hundred sequences were obtained. From these, 46 sequences belonged exclusively to the genome of B. elkanii strain, and 154 showed similarity to sequences from B. japonicum genome. From the 46 sequences with no similarity to sequences from B. japonicum, 39 showed no similarity to sequences in public databases and seven showed similarity to sequences of genes coding for known proteins. These seven sequences were divided in three groups: similar to sequences from other Bradyrhizobium strains, similar to sequences from other nitrogen-fixing bacteria, and similar to sequences from non nitrogen-fixing bacteria. These new sequences could be used as DNA markers in order to investigate the rates of genetic material gain and loss in natural Bradyrhizobium strains.

  10. Semiconductor Whole Exome Sequencing for the Identification of Genetic Variants in Colombian Patients Clinically Diagnosed with Long QT Syndrome.

    PubMed

    Burgos, Mariana; Arenas, Alvaro; Cabrera, Rodrigo

    2016-08-01

    Inherited long QT syndrome (LQTS) is a cardiac channelopathy characterized by a prolongation of QT interval and the risk of syncope, cardiac arrest, and sudden cardiac death. Genetic diagnosis of LQTS is critical in medical practice as results can guide adequate management of patients and distinguish phenocopies such as catecholaminergic polymorphic ventricular tachycardia (CPVT). However, extensive screening of large genomic regions is required in order to reliably identify genetic causes. Semiconductor whole exome sequencing (WES) is a promising approach for the identification of variants in the coding regions of most human genes. DNA samples from 21 Colombian patients clinically diagnosed with LQTS were enriched for coding regions using multiplex polymerase chain reaction (PCR) and subjected to WES using a semiconductor sequencer. Semiconductor WES showed mean coverage of 93.6 % for all coding regions relevant to LQTS at >10× depth with high intra- and inter-assay depth heterogeneity. Fifteen variants were detected in 12 patients in genes associated with LQTS. Three variants were identified in three patients in genes associated with CPVT. Co-segregation analysis was performed when possible. All variants were analyzed with two pathogenicity prediction algorithms. The overall prevalence of LQTS and CPVT variants in our cohort was 71.4 %. All LQTS variants previously identified through commercial genetic testing were identified. Standardized WES assays can be easily implemented, often at a lower cost than sequencing panels. Our results show that WES can identify LQTS-causing mutations and permits differential diagnosis of related conditions in a real-world clinical setting. However, high heterogeneity in sequencing depth and low coverage in the most relevant genes is expected to be associated with reduced analytical sensitivity.

  11. Nucleotide sequence of the L1 ribosomal protein gene of Xenopus laevis: remarkable sequence homology among introns.

    PubMed Central

    Loreni, F; Ruberti, I; Bozzoni, I; Pierandrei-Amaldi, P; Amaldi, F

    1985-01-01

    Ribosomal protein L1 is encoded by two genes in Xenopus laevis. The comparison of two cDNA sequences shows that the two L1 gene copies (L1a and L1b) have diverged in many silent sites and very few substitution sites; moreover a small duplication occurred at the very end of the coding region of the L1b gene which thus codes for a product five amino acids longer than that coded by L1a. Quantitatively the divergence between the two L1 genes confirms that a whole genome duplication took place in Xenopus laevis approximately 30 million years ago. A genomic fragment containing one of the two L1 gene copies (L1a), with its nine introns and flanking regions, has been completely sequenced. The 5' end of this gene has been mapped within a 20-pyridimine stretch as already found for other vertebrate ribosomal protein genes. Four of the nine introns have a 60-nucleotide sequence with 80% homology; within this region some boxes, one of which is 16 nucleotides long, are 100% homologous among the four introns. This feature of L1a gene introns is interesting since we have previously shown that the activity of this gene is regulated at a post-transcriptional level and it involves the block of the normal splicing of some intron sequences. Images Fig. 3. Fig. 5. PMID:3841512

  12. The structure of the coding and 5'-flanking region of the type 1 iodothyronine deiodinase (dio1) gene is normal in a patient with suspected congenital dio1 deficiency.

    PubMed

    Toyoda, N; Kleinhaus, N; Larsen, P R

    1996-06-01

    We analyzed the exon-intron structure of the human type 1 deiodinase gene (dio1) and compared it with that of a patient with suspected congenital type 1 deiodinase (D1) deficiency. The hdio1 gene is identical in exon-intron arrangement to the mouse gene, with coding sequences and a selenocysteine insertion sequence (SECIS) element contained in four exons. There were no mutations in the sequences of exons 1-4 of the patient's genomic DNA. Functional studies by transient expression techniques showed no difference in basal promoter activity or T3 responsiveness between the patient's and the normal dio1 gene. A structural abnormality in the dio1 gene is not a likely explanation for this patient's D1-deficient phenotype.

  13. Second-generation sequencing of entire mitochondrial coding-regions (∼15.4 kb) holds promise for study of the phylogeny and taxonomy of human body lice and head lice.

    PubMed

    Xiong, H; Campelo, D; Pollack, R J; Raoult, D; Shao, R; Alem, M; Ali, J; Bilcha, K; Barker, S C

    2014-08-01

    The Illumina Hiseq platform was used to sequence the entire mitochondrial coding-regions of 20 body lice, Pediculus humanus Linnaeus, and head lice, P. capitis De Geer (Phthiraptera: Pediculidae), from eight towns and cities in five countries: Ethiopia, France, China, Australia and the U.S.A. These data (∼310 kb) were used to see how much more informative entire mitochondrial coding-region sequences were than partial mitochondrial coding-region sequences, and thus to guide the design of future studies of the phylogeny, origin, evolution and taxonomy of body lice and head lice. Phylogenies were compared from entire coding-region sequences (∼15.4 kb), entire cox1 (∼1.5 kb), partial cox1 (∼700 bp) and partial cytb (∼600 bp) sequences. On the one hand, phylogenies from entire mitochondrial coding-region sequences (∼15.4 kb) were much more informative than phylogenies from entire cox1 sequences (∼1.5 kb) and partial gene sequences (∼600 to ∼700 bp). For example, 19 branches had > 95% bootstrap support in our maximum likelihood tree from the entire mitochondrial coding-regions (∼15.4 kb) whereas the tree from 700 bp cox1 had only two branches with bootstrap support > 95%. Yet, by contrast, partial cytb (∼600 bp) and partial cox1 (∼486 bp) sequences were sufficient to genotype lice to Clade A, B or C. The sequences of the mitochondrial genomes of the P. humanus, P. capitis and P. schaeffi Fahrenholz studied are in NCBI GenBank under the accession numbers KC660761-800, KC685631-6330, KC241882-97, EU219988-95, HM241895-8 and JX080388-407. © 2014 The Royal Entomological Society.

  14. Quality of experience enhancement of high efficiency video coding video streaming in wireless packet networks using multiple description coding

    NASA Astrophysics Data System (ADS)

    Boumehrez, Farouk; Brai, Radhia; Doghmane, Noureddine; Mansouri, Khaled

    2018-01-01

    Recently, video streaming has attracted much attention and interest due to its capability to process and transmit large data. We propose a quality of experience (QoE) model relying on high efficiency video coding (HEVC) encoder adaptation scheme, in turn based on the multiple description coding (MDC) for video streaming. The main contributions of the paper are (1) a performance evaluation of the new and emerging video coding standard HEVC/H.265, which is based on the variation of quantization parameter (QP) values depending on different video contents to deduce their influence on the sequence to be transmitted, (2) QoE support multimedia applications in wireless networks are investigated, so we inspect the packet loss impact on the QoE of transmitted video sequences, (3) HEVC encoder parameter adaptation scheme based on MDC is modeled with the encoder parameter and objective QoE model. A comparative study revealed that the proposed MDC approach is effective for improving the transmission with a peak signal-to-noise ratio (PSNR) gain of about 2 to 3 dB. Results show that a good choice of QP value can compensate for transmission channel effects and improve received video quality, although HEVC/H.265 is also sensitive to packet loss. The obtained results show the efficiency of our proposed method in terms of PSNR and mean-opinion-score.

  15. Cloning and expression of a cDNA coding for catalase from zebrafish (Danio rerio).

    PubMed

    Ken, C F; Lin, C T; Wu, J L; Shaw, J F

    2000-06-01

    A full-length complementary DNA (cDNA) clone encoding a catalase was amplified by the rapid amplication of cDNA ends-polymerase chain reaction (RACE-PCR) technique from zebrafish (Danio rerio) mRNA. Nucleotide sequence analysis of this cDNA clone revealed that it comprised a complete open reading frame coding for 526 amino acid residues and that it had a molecular mass of 59 654 Da. The deduced amino acid sequence showed high similarity with the sequences of catalase from swine (86.9%), mouse (85.8%), rat (85%), human (83.7%), fruit fly (75.6%), nematode (71.1%), and yeast (58.6%). The amino acid residues for secondary structures are apparently conserved as they are present in other mammal species. Furthermore, the coding region of zebrafish catalase was introduced into an expression vector, pET-20b(+), and transformed into Escherichia coli expression host BL21(DE3)pLysS. A 60-kDa active catalase protein was expressed and detected by Coomassie blue staining as well as activity staining on polyacrylamide gel followed electrophoresis.

  16. Representation of DNA sequences with virtual potentials and their processing by (SEQREP) Kohonen self-organizing maps.

    PubMed

    Aires-de-Sousa, João; Aires-de-Sousa, Luisa

    2003-01-01

    We propose representing individual positions in DNA sequences by virtual potentials generated by other bases of the same sequence. This is a compact representation of the neighbourhood of a base. The distribution of the virtual potentials over the whole sequence can be used as a representation of the entire sequence (SEQREP code). It is a flexible code, with a length independent of the sequence size, does not require previous alignment, and is convenient for processing by neural networks or statistical techniques. To evaluate its biological significance, the SEQREP code was used for training Kohonen self-organizing maps (SOMs) in two applications: (a) detection of Alu sequences, and (b) classification of sequences encoding for HIV-1 envelope glycoprotein (env) into subtypes A-G. It was demonstrated that SOMs clustered sequences belonging to different classes into distinct regions. For independent test sets, very high rates of correct predictions were obtained (97% in the first application, 91% in the second). Possible areas of application of SEQREP codes include functional genomics, phylogenetic analysis, detection of repetitions, database retrieval, and automatic alignment. Software for representing sequences by SEQREP code, and for training Kohonen SOMs is made freely available from http://www.dq.fct.unl.pt/qoa/jas/seqrep. Supplementary material is available at http://www.dq.fct.unl.pt/qoa/jas/seqrep/bioinf2002

  17. CombAlign: a code for generating a one-to-many sequence alignment from a set of pairwise structure-based sequence alignments.

    PubMed

    Zhou, Carol L Ecale

    2015-01-01

    In order to better define regions of similarity among related protein structures, it is useful to identify the residue-residue correspondences among proteins. Few codes exist for constructing a one-to-many multiple sequence alignment derived from a set of structure or sequence alignments, and a need was evident for creating such a tool for combining pairwise structure alignments that would allow for insertion of gaps in the reference structure. This report describes a new Python code, CombAlign, which takes as input a set of pairwise sequence alignments (which may be structure based) and generates a one-to-many, gapped, multiple structure- or sequence-based sequence alignment (MSSA). The use and utility of CombAlign was demonstrated by generating gapped MSSAs using sets of pairwise structure-based sequence alignments between structure models of the matrix protein (VP40) and pre-small/secreted glycoprotein (sGP) of Reston Ebolavirus and the corresponding proteins of several other filoviruses. The gapped MSSAs revealed structure-based residue-residue correspondences, which enabled identification of structurally similar versus differing regions in the Reston proteins compared to each of the other corresponding proteins. CombAlign is a new Python code that generates a one-to-many, gapped, multiple structure- or sequence-based sequence alignment (MSSA) given a set of pairwise sequence alignments (which may be structure based). CombAlign has utility in assisting the user in distinguishing structurally conserved versus divergent regions on a reference protein structure relative to other closely related proteins. CombAlign was developed in Python 2.6, and the source code is available for download from the GitHub code repository.

  18. Complete Coding Genome Sequence for Mogiana Tick Virus, a Jingmenvirus Isolated from Ticks in Brazil

    DTIC Science & Technology

    2017-05-04

    and capable of infecting a wide range of animal hosts (1–5). Here, we report the complete coding genome sequence (i.e., only missing portions of...segmented nature of the genome was not under- stood. Therefore, only the two genome segments with detectable sequence homolo- gies to flaviviruses were...originally reported (2). We revisited the data set of Maruyama et al. (2) and assembled the complete coding sequences for all four genome segments. We

  19. Quantized phase coding and connected region labeling for absolute phase retrieval.

    PubMed

    Chen, Xiangcheng; Wang, Yuwei; Wang, Yajun; Ma, Mengchao; Zeng, Chunnian

    2016-12-12

    This paper proposes an absolute phase retrieval method for complex object measurement based on quantized phase-coding and connected region labeling. A specific code sequence is embedded into quantized phase of three coded fringes. Connected regions of different codes are labeled and assigned with 3-digit-codes combining the current period and its neighbors. Wrapped phase, more than 36 periods, can be restored with reference to the code sequence. Experimental results verify the capability of the proposed method to measure multiple isolated objects.

  20. Functional interrogation of non-coding DNA through CRISPR genome editing

    PubMed Central

    Canver, Matthew C.; Bauer, Daniel E.; Orkin, Stuart H.

    2017-01-01

    Methodologies to interrogate non-coding regions have lagged behind coding regions despite comprising the vast majority of the genome. However, the rapid evolution of clustered regularly interspaced short palindromic repeats (CRISPR)-based genome editing has provided a multitude of novel techniques for laboratory investigation including significant contributions to the toolbox for studying non-coding DNA. CRISPR-mediated loss-of-function strategies rely on direct disruption of the underlying sequence or repression of transcription without modifying the targeted DNA sequence. CRISPR-mediated gain-of-function approaches similarly benefit from methods to alter the targeted sequence through integration of customized sequence into the genome as well as methods to activate transcription. Here we review CRISPR-based loss- and gain-of-function techniques for the interrogation of non-coding DNA. PMID:28288828

  1. Optimal power allocation and joint source-channel coding for wireless DS-CDMA visual sensor networks

    NASA Astrophysics Data System (ADS)

    Pandremmenou, Katerina; Kondi, Lisimachos P.; Parsopoulos, Konstantinos E.

    2011-01-01

    In this paper, we propose a scheme for the optimal allocation of power, source coding rate, and channel coding rate for each of the nodes of a wireless Direct Sequence Code Division Multiple Access (DS-CDMA) visual sensor network. The optimization is quality-driven, i.e. the received quality of the video that is transmitted by the nodes is optimized. The scheme takes into account the fact that the sensor nodes may be imaging scenes with varying levels of motion. Nodes that image low-motion scenes will require a lower source coding rate, so they will be able to allocate a greater portion of the total available bit rate to channel coding. Stronger channel coding will mean that such nodes will be able to transmit at lower power. This will both increase battery life and reduce interference to other nodes. Two optimization criteria are considered. One that minimizes the average video distortion of the nodes and one that minimizes the maximum distortion among the nodes. The transmission powers are allowed to take continuous values, whereas the source and channel coding rates can assume only discrete values. Thus, the resulting optimization problem lies in the field of mixed-integer optimization tasks and is solved using Particle Swarm Optimization. Our experimental results show the importance of considering the characteristics of the video sequences when determining the transmission power, source coding rate and channel coding rate for the nodes of the visual sensor network.

  2. Memorization of Sequences of Movements of the Right or the Left Hand by Right- and Left-Handers: Vector Coding.

    PubMed

    Bobrova, E V; Bogacheva, I N; Lyakhovetskii, V A; Fabinskaja, A A; Fomina, E V

    2017-01-01

    In order to test the hypothesis of hemisphere specialization for different types of information coding (the right hemisphere, for positional coding; the left one, for vector coding), we analyzed the errors of right and left-handers during a task involving the memorization of sequences of movements by the left or the right hand, which activates vector coding by changing the order of movements in memorized sequences. The task was first performed by the right or the left hand, then by the opposite hand. It was found that both'right- and left-handers use the information about the previous movements of the dominant hand, but not of the non-dom" inant one. After changing the hand, right-handers use the information about previous movements of the second hand, while left-handers do not. We compared our results with the data of previous experiments, in which positional coding was activated, and concluded that both right- and left-handers use vector coding for memorizing the sequences of their dominant hands and positional coding for memorizing the sequences of non-dominant hand. No similar patterns of errors were found between right- and left-handers after changing the hand, which suggests that in right- and left-handersthe skills are transferred in different ways depending on the type of coding.

  3. Parallel evolution of chordate cis-regulatory code for development.

    PubMed

    Doglio, Laura; Goode, Debbie K; Pelleri, Maria C; Pauls, Stefan; Frabetti, Flavia; Shimeld, Sebastian M; Vavouri, Tanya; Elgar, Greg

    2013-11-01

    Urochordates are the closest relatives of vertebrates and at the larval stage, possess a characteristic bilateral chordate body plan. In vertebrates, the genes that orchestrate embryonic patterning are in part regulated by highly conserved non-coding elements (CNEs), yet these elements have not been identified in urochordate genomes. Consequently the evolution of the cis-regulatory code for urochordate development remains largely uncharacterised. Here, we use genome-wide comparisons between C. intestinalis and C. savignyi to identify putative urochordate cis-regulatory sequences. Ciona conserved non-coding elements (ciCNEs) are associated with largely the same key regulatory genes as vertebrate CNEs. Furthermore, some of the tested ciCNEs are able to activate reporter gene expression in both zebrafish and Ciona embryos, in a pattern that at least partially overlaps that of the gene they associate with, despite the absence of sequence identity. We also show that the ability of a ciCNE to up-regulate gene expression in vertebrate embryos can in some cases be localised to short sub-sequences, suggesting that functional cross-talk may be defined by small regions of ancestral regulatory logic, although functional sub-sequences may also be dispersed across the whole element. We conclude that the structure and organisation of cis-regulatory modules is very different between vertebrates and urochordates, reflecting their separate evolutionary histories. However, functional cross-talk still exists because the same repertoire of transcription factors has likely guided their parallel evolution, exploiting similar sets of binding sites but in different combinations.

  4. The complete mitochondrial genome sequence of the maned wolf (Chrysocyon brachyurus).

    PubMed

    Zhao, Chao; Yang, Xiufeng; Zhang, Honghai; Zhang, Jin; Chen, Lei; Sha, Weilai; Liu, Guangshuai

    2016-01-01

    In this study, the complete mitochondrial genome of the maned wolf (Chrysocyon brachyurus), the unique species in Chrysocyon, was sequenced and reported for the first time using blood samples obtained from a female individual in Shanghai Zoo, China. Sequence analysis showed that the genome structure was in accordance with other Canidae species and it contained 12 S rRNA gene, 16 S rRNA gene, 22 tRNA genes, 13 protein-coding genes and 1 control region.

  5. Non-coding stem-bulge RNAs are required for cell proliferation and embryonic development in C. elegans

    PubMed Central

    Kowalski, Madzia P.; Baylis, Howard A.; Krude, Torsten

    2015-01-01

    ABSTRACT Stem bulge RNAs (sbRNAs) are a family of small non-coding stem-loop RNAs present in Caenorhabditis elegans and other nematodes, the function of which is unknown. Here, we report the first functional characterisation of nematode sbRNAs. We demonstrate that sbRNAs from a range of nematode species are able to reconstitute the initiation of chromosomal DNA replication in the presence of replication proteins in vitro, and that conserved nucleotide sequence motifs are essential for this function. By functionally inactivating sbRNAs with antisense morpholino oligonucleotides, we show that sbRNAs are required for S phase progression, early embryonic development and the viability of C. elegans in vivo. Thus, we demonstrate a new and essential role for sbRNAs during the early development of C. elegans. sbRNAs show limited nucleotide sequence similarity to vertebrate Y RNAs, which are also essential for the initiation of DNA replication. Our results therefore establish that the essential function of small non-coding stem-loop RNAs during DNA replication extends beyond vertebrates. PMID:25908866

  6. RNA Editing in Plant Mitochondria

    NASA Astrophysics Data System (ADS)

    Hiesel, Rudolf; Wissinger, Bernd; Schuster, Wolfgang; Brennicke, Axel

    1989-12-01

    Comparative sequence analysis of genomic and complementary DNA clones from several mitochondrial genes in the higher plant Oenothera revealed nucleotide sequence divergences between the genomic and the messenger RNA-derived sequences. These sequence alterations could be most easily explained by specific post-transcriptional nucleotide modifications. Most of the nucleotide exchanges in coding regions lead to altered codons in the mRNA that specify amino acids better conserved in evolution than those encoded by the genomic DNA. Several instances show that the genomic arginine codon CGG is edited in the mRNA to the tryptophan codon TGG in amino acid positions that are highly conserved as tryptophan in the homologous proteins of other species. This editing suggests that the standard genetic code is used in plant mitochondria and resolves the frequent coincidence of CGG codons and tryptophan in different plant species. The apparently frequent and non-species-specific equivalency of CGG and TGG codons in particular suggests that RNA editing is a common feature of all higher plant mitochondria.

  7. Primer development to obtain complete coding sequence of HA and NA genes of influenza A/H3N2 virus.

    PubMed

    Agustiningsih, Agustiningsih; Trimarsanto, Hidayat; Setiawaty, Vivi; Artika, I Made; Muljono, David Handojo

    2016-08-30

    Influenza is an acute respiratory illness and has become a serious public health problem worldwide. The need to study the HA and NA genes in influenza A virus is essential since these genes frequently undergo mutations. This study describes the development of primer sets for RT-PCR to obtain complete coding sequence of Hemagglutinin (HA) and Neuraminidase (NA) genes of influenza A/H3N2 virus from Indonesia. The primers were developed based on influenza A/H3N2 sequence worldwide from Global Initiative on Sharing All Influenza Data (GISAID) and further tested using Indonesian influenza A/H3N2 archived samples of influenza-like illness (ILI) surveillance from 2008 to 2009. An optimum RT-PCR condition was acquired for all HA and NA fragments designed to cover complete coding sequence of HA and NA genes. A total of 71 samples were successfully sequenced for complete coding sequence both of HA and NA genes out of 145 samples of influenza A/H3N2 tested. The developed primer sets were suitable for obtaining complete coding sequences of HA and NA genes of Indonesian samples from 2008 to 2009.

  8. GATA: A graphic alignment tool for comparative sequenceanalysis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Nix, David A.; Eisen, Michael B.

    2005-01-01

    Several problems exist with current methods used to align DNA sequences for comparative sequence analysis. Most dynamic programming algorithms assume that conserved sequence elements are collinear. This assumption appears valid when comparing orthologous protein coding sequences. Functional constraints on proteins provide strong selective pressure against sequence inversions, and minimize sequence duplications and feature shuffling. For non-coding sequences this collinearity assumption is often invalid. For example, enhancers contain clusters of transcription factor binding sites that change in number, orientation, and spacing during evolution yet the enhancer retains its activity. Dotplot analysis is often used to estimate non-coding sequence relatedness. Yet dotmore » plots do not actually align sequences and thus cannot account well for base insertions or deletions. Moreover, they lack an adequate statistical framework for comparing sequence relatedness and are limited to pairwise comparisons. Lastly, dot plots and dynamic programming text outputs fail to provide an intuitive means for visualizing DNA alignments.« less

  9. Phylogenetic Network for European mtDNA

    PubMed Central

    Finnilä, Saara; Lehtonen, Mervi S.; Majamaa, Kari

    2001-01-01

    The sequence in the first hypervariable segment (HVS-I) of the control region has been used as a source of evolutionary information in most phylogenetic analyses of mtDNA. Population genetic inference would benefit from a better understanding of the variation in the mtDNA coding region, but, thus far, complete mtDNA sequences have been rare. We determined the nucleotide sequence in the coding region of mtDNA from 121 Finns, by conformation-sensitive gel electrophoresis and subsequent sequencing and by direct sequencing of the D loop. Furthermore, 71 sequences from our previous reports were included, so that the samples represented all the mtDNA haplogroups present in the Finnish population. We found a total of 297 variable sites in the coding region, which allowed the compilation of unambiguous phylogenetic networks. The D loop harbored 104 variable sites, and, in most cases, these could be localized within the coding-region networks, without discrepancies. Interestingly, many homoplasies were detected in the coding region. Nucleotide variation in the rRNA and tRNA genes was 6%, and that in the third nucleotide positions of structural genes amounted to 22% of that in the HVS-I. The complete networks enabled the relationships between the mtDNA haplogroups to be analyzed. Phylogenetic networks based on the entire coding-region sequence in mtDNA provide a rich source for further population genetic studies, and complete sequences make it easier to differentiate between disease-causing mutations and rare polymorphisms. PMID:11349229

  10. Minimum variance optimal rate allocation for multiplexed H.264/AVC bitstreams.

    PubMed

    Tagliasacchi, Marco; Valenzise, Giuseppe; Tubaro, Stefano

    2008-07-01

    Consider the problem of transmitting multiple video streams to fulfill a constant bandwidth constraint. The available bit budget needs to be distributed across the sequences in order to meet some optimality criteria. For example, one might want to minimize the average distortion or, alternatively, minimize the distortion variance, in order to keep almost constant quality among the encoded sequences. By working in the rho-domain, we propose a low-delay rate allocation scheme that, at each time instant, provides a closed form solution for either the aforementioned problems. We show that minimizing the distortion variance instead of the average distortion leads, for each of the multiplexed sequences, to a coding penalty less than 0.5 dB, in terms of average PSNR. In addition, our analysis provides an explicit relationship between model parameters and this loss. In order to smooth the distortion also along time, we accommodate a shared encoder buffer to compensate for rate fluctuations. Although the proposed scheme is general, and it can be adopted for any video and image coding standard, we provide experimental evidence by transcoding bitstreams encoded using the state-of-the-art H.264/AVC standard. The results of our simulations reveal that is it possible to achieve distortion smoothing both in time and across the sequences, without sacrificing coding efficiency.

  11. Network perturbation by recurrent regulatory variants in cancer

    PubMed Central

    Cho, Ara; Lee, Insuk; Choi, Jung Kyoon

    2017-01-01

    Cancer driving genes have been identified as recurrently affected by variants that alter protein-coding sequences. However, a majority of cancer variants arise in noncoding regions, and some of them are thought to play a critical role through transcriptional perturbation. Here we identified putative transcriptional driver genes based on combinatorial variant recurrence in cis-regulatory regions. The identified genes showed high connectivity in the cancer type-specific transcription regulatory network, with high outdegree and many downstream genes, highlighting their causative role during tumorigenesis. In the protein interactome, the identified transcriptional drivers were not as highly connected as coding driver genes but appeared to form a network module centered on the coding drivers. The coding and regulatory variants associated via these interactions between the coding and transcriptional drivers showed exclusive and complementary occurrence patterns across tumor samples. Transcriptional cancer drivers may act through an extensive perturbation of the regulatory network and by altering protein network modules through interactions with coding driver genes. PMID:28333928

  12. Palindromic repetitive DNA elements with coding potential in Methanocaldococcus jannaschii.

    PubMed

    Suyama, Mikita; Lathe, Warren C; Bork, Peer

    2005-10-10

    We have identified 141 novel palindromic repetitive elements in the genome of euryarchaeon Methanocaldococcus jannaschii. The total length of these elements is 14.3kb, which corresponds to 0.9% of the total genomic sequence and 6.3% of all extragenic regions. The elements can be divided into three groups (MJRE1-3) based on the sequence similarity. The low sequence identity within each of the groups suggests rather old origin of these elements in M. jannaschii. Three MJRE2 elements were located within the protein coding regions without disrupting the coding potential of the host genes, indicating that insertion of repeats might be a widespread mechanism to enhance sequence diversity in coding regions.

  13. Effective gene prediction by high resolution frequency estimator based on least-norm solution technique

    PubMed Central

    2014-01-01

    Linear algebraic concept of subspace plays a significant role in the recent techniques of spectrum estimation. In this article, the authors have utilized the noise subspace concept for finding hidden periodicities in DNA sequence. With the vast growth of genomic sequences, the demand to identify accurately the protein-coding regions in DNA is increasingly rising. Several techniques of DNA feature extraction which involves various cross fields have come up in the recent past, among which application of digital signal processing tools is of prime importance. It is known that coding segments have a 3-base periodicity, while non-coding regions do not have this unique feature. One of the most important spectrum analysis techniques based on the concept of subspace is the least-norm method. The least-norm estimator developed in this paper shows sharp period-3 peaks in coding regions completely eliminating background noise. Comparison of proposed method with existing sliding discrete Fourier transform (SDFT) method popularly known as modified periodogram method has been drawn on several genes from various organisms and the results show that the proposed method has better as well as an effective approach towards gene prediction. Resolution, quality factor, sensitivity, specificity, miss rate, and wrong rate are used to establish superiority of least-norm gene prediction method over existing method. PMID:24386895

  14. External Guide Sequences Targeting the aac(6′)-Ib mRNA Induce Inhibition of Amikacin Resistance▿

    PubMed Central

    Bistué, Alfonso J. C. Soler; Ha, Hongphuc; Sarno, Renee; Don, Michelle; Zorreguieta, Angeles; Tolmasky, Marcelo E.

    2007-01-01

    The dissemination of AAC(6′)-I-type acetyltransferases have rendered amikacin and other aminoglycosides all but useless in some parts of the world. Antisense technologies could be an alternative to extend the life of these antibiotics. External guide sequences are short antisense oligoribonucleotides that induce RNase P-mediated cleavage of a target RNA by forming a precursor tRNA-like complex. Thirteen-nucleotide external guide sequences complementary to locations within five regions accessible for interaction with antisense oligonucleotides in the mRNA that encodes AAC(6′)-Ib were analyzed. While small variations in the location targeted by different external guide sequences resulted in big changes in efficiency of binding to native aac(6′)-Ib mRNA, most of them induced high levels of RNase P-mediated cleavage in vitro. Recombinant plasmids coding for selected external guide sequences were introduced into Escherichia coli harboring aac(6′)-Ib, and the transformant strains were tested to determine their resistance to amikacin. The two external guide sequences that showed the strongest binding efficiency to the mRNA in vitro, EGSC3 and EGSA2, interfered with expression of the resistance phenotype at different degrees. Growth curve experiments showed that E. coli cells harboring a plasmid coding for EGSC3, the external guide sequence with the highest mRNA binding affinity in vitro, did not grow for at least 300 min in the presence of 15 μg of amikacin/ml. EGSA2, which had a lower mRNA-binding affinity in vitro than EGSC3, inhibited the expression of amikacin resistance at a lesser level; growth of E. coli harboring a plasmid coding for EGSA2, in the presence of 15 μg of amikacin/ml was undetectable for 200 min but reached an optical density at 600 nm of 0.5 after 5 h of incubation. Our results indicate that the use of external guide sequences could be a viable strategy to preserve the efficacy of amikacin. PMID:17387154

  15. Analysis of 16S-23S rRNA intergenic spacer regions of Vibrio cholerae and Vibrio mimicus.

    PubMed

    Chun, J; Huq, A; Colwell, R R

    1999-05-01

    Vibrio cholerae identification based on molecular sequence data has been hampered by a lack of sequence variation from the closely related Vibrio mimicus. The two species share many genes coding for proteins, such as ctxAB, and show almost identical 16S DNA coding for rRNA (rDNA) sequences. Primers targeting conserved sequences flanking the 3' end of the 16S and the 5' end of the 23S rDNAs were used to amplify the 16S-23S rRNA intergenic spacer regions of V. cholerae and V. mimicus. Two major (ca. 580 and 500 bp) and one minor (ca. 750 bp) amplicons were consistently generated for both species, and their sequences were determined. The largest fragment contains three tRNA genes (tDNAs) coding for tRNAGlu, tRNALys, and tRNAVal, which has not previously been found in bacteria examined to date. The 580-bp amplicon contained tDNAIle and tDNAAla, whereas the 500-bp fragment had single tDNA coding either tRNAGlu or tRNAAla. Little variation, i.e., 0 to 0.4%, was found among V. cholerae O1 classical, O1 El Tor, and O139 epidemic strains. Slightly more variation was found against the non-O1/non-O139 serotypes (ca. 1% difference) and V. mimicus (2 to 3% difference). A pair of oligonucleotide primers were designed, based on the region differentiating all of V. cholerae strains from V. mimicus. The PCR system developed was subsequently evaluated by using representatives of V. cholerae from environmental and clinical sources, and of other taxa, including V. mimicus. This study provides the first molecular tool for identifying the species V. cholerae.

  16. Complete chloroplast genome sequence of MD-2 pineapple and its comparative analysis among nine other plants from the subclass Commelinidae.

    PubMed

    Redwan, R M; Saidin, A; Kumar, S V

    2015-08-12

    Pineapple (Ananas comosus var. comosus) is known as the king of fruits for its crown and is the third most important tropical fruit after banana and citrus. The plant, which is indigenous to South America, is the most important species in the Bromeliaceae family and is largely traded for fresh fruit consumption. Here, we report the complete chloroplast sequence of the MD-2 pineapple that was sequenced using the PacBio sequencing technology. In this study, the high error rate of PacBio long sequence reads of A. comosus's total genomic DNA were improved by leveraging on the high accuracy but short Illumina reads for error-correction via the latest error correction module from Novocraft. Error corrected long PacBio reads were assembled by using a single tool to produce a contig representing the pineapple chloroplast genome. The genome of 159,636 bp in length is featured with the conserved quadripartite structure of chloroplast containing a large single copy region (LSC) with a size of 87,482 bp, a small single copy region (SSC) with a size of 18,622 bp and two inverted repeat regions (IRA and IRB) each with the size of 26,766 bp. Overall, the genome contained 117 unique coding regions and 30 were repeated in the IR region with its genes contents, structure and arrangement similar to its sister taxon, Typha latifolia. A total of 35 repeats structure were detected in both the coding and non-coding regions with a majority being tandem repeats. In addition, 205 SSRs were detected in the genome with six protein-coding genes contained more than two SSRs. Comparative chloroplast genomes from the subclass Commelinidae revealed a conservative protein coding gene albeit located in a highly divergence region. Analysis of selection pressure on protein-coding genes using Ka/Ks ratio showed significant positive selection exerted on the rps7 gene of the pineapple chloroplast with P less than 0.05. Phylogenetic analysis confirmed the recent taxonomical relation among the member of commelinids which support the monophyly relationship between Arecales and Dasypogonaceae and between Zingiberales to the Poales, which includes the A. comosus. The complete sequence of the chloroplast of pineapple provides insights to the divergence of genic chloroplast sequences from the members of the subclass Commelinidae. The complete pineapple chloroplast will serve as a reference for in-depth taxonomical studies in the Bromeliaceae family when more species under the family are sequenced in the future. The genetic sequence information will also make feasible other molecular applications of the pineapple chloroplast for plant genetic improvement.

  17. The PRC2-binding long non-coding RNAs in human and mouse genomes are associated with predictive sequence features

    NASA Astrophysics Data System (ADS)

    Tu, Shiqi; Yuan, Guo-Cheng; Shao, Zhen

    2017-01-01

    Recently, long non-coding RNAs (lncRNAs) have emerged as an important class of molecules involved in many cellular processes. One of their primary functions is to shape epigenetic landscape through interactions with chromatin modifying proteins. However, mechanisms contributing to the specificity of such interactions remain poorly understood. Here we took the human and mouse lncRNAs that were experimentally determined to have physical interactions with Polycomb repressive complex 2 (PRC2), and systematically investigated the sequence features of these lncRNAs by developing a new computational pipeline for sequences composition analysis, in which each sequence is considered as a series of transitions between adjacent nucleotides. Through that, PRC2-binding lncRNAs were found to be associated with a set of distinctive and evolutionarily conserved sequence features, which can be utilized to distinguish them from the others with considerable accuracy. We further identified fragments of PRC2-binding lncRNAs that are enriched with these sequence features, and found they show strong PRC2-binding signals and are more highly conserved across species than the other parts, implying their functional importance.

  18. Brain cDNA clone for human cholinesterase

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    McTiernan, C.; Adkins, S.; Chatonnet, A.

    1987-10-01

    A cDNA library from human basal ganglia was screened with oligonucleotide probes corresponding to portions of the amino acid sequence of human serum cholinesterase. Five overlapping clones, representing 2.4 kilobases, were isolated. The sequenced cDNA contained 207 base pairs of coding sequence 5' to the amino terminus of the mature protein in which there were four ATG translation start sites in the same reading frame as the protein. Only the ATG coding for Met-(-28) lay within a favorable consensus sequence for functional initiators. There were 1722 base pairs of coding sequence corresponding to the protein found circulating in human serum.more » The amino acid sequence deduced from the cDNA exactly matched the 574 amino acid sequence of human serum cholinesterase, as previously determined by Edman degradation. Therefore, our clones represented cholinesterase rather than acetylcholinesterase. It was concluded that the amino acid sequences of cholinesterase from two different tissues, human brain and human serum, were identical. Hybridization of genomic DNA blots suggested that a single gene, or very few genes coded for cholinesterase.« less

  19. Orthogonal Pilot Channel Using Combination of FDMA and CDMA in Single-Carrier FDMA-Based Evolved UTRA Uplink

    NASA Astrophysics Data System (ADS)

    Kawamura, Teruo; Kishiyama, Yoshihisa; Higuchi, Kenichi; Sawahashi, Mamoru

    In the Evolved UTRA (UMTS Terrestrial Radio Access) uplink, single-carrier frequency division multiple access (SC-FDMA) radio access was adopted owing to its advantageous low peak-to-average power ratio (PAPR) feature, which leads to wide coverage area provisioning with limited peak transmission power of user equipments. This paper proposes orthogonal pilot channel generation using the combination of FDMA and CDMA in the SC-FDMA-based Evolved UTRA uplink. In the proposed method, we employ distributed FDMA transmission for simultaneous accessing users with different transmission bandwidths, and employ CDMA transmission for simultaneous accessing users with identical transmission bandwidth. Moreover, we apply a code sequence with a good auto-correlation property such as a Constant Amplitude Zero Auto-Correlation (CAZAC) sequence employing a cyclic shift to increase the number of sequences. Simulation results show that the average packet error rate performance using an orthogonal pilot channel with the combination of FDMA and CDMA in a six-user environment, i. e., four users each with a 1.25-MHz transmission bandwidth and two users each with a 5-MHz transmission bandwidth, employing turbo coding with the coding r of R=1/2 and QPSK and 16QAM data modulation coincides well with that in a single-user environment with the same transmission bandwidth. We show that the proposed orthogonal pilot channel structure using the combination of distributed FDMA and CDMA transmissions and the application of the CAZAC sequence is effective in the SC-FDMA-based Evolved UTRA uplink.

  20. Functional interrogation of non-coding DNA through CRISPR genome editing.

    PubMed

    Canver, Matthew C; Bauer, Daniel E; Orkin, Stuart H

    2017-05-15

    Methodologies to interrogate non-coding regions have lagged behind coding regions despite comprising the vast majority of the genome. However, the rapid evolution of clustered regularly interspaced short palindromic repeats (CRISPR)-based genome editing has provided a multitude of novel techniques for laboratory investigation including significant contributions to the toolbox for studying non-coding DNA. CRISPR-mediated loss-of-function strategies rely on direct disruption of the underlying sequence or repression of transcription without modifying the targeted DNA sequence. CRISPR-mediated gain-of-function approaches similarly benefit from methods to alter the targeted sequence through integration of customized sequence into the genome as well as methods to activate transcription. Here we review CRISPR-based loss- and gain-of-function techniques for the interrogation of non-coding DNA. Copyright © 2017 Elsevier Inc. All rights reserved.

  1. Molecular cloning and characterization of a novel RING zinc-finger protein gene up-regulated under in vitro salt stress in cassava.

    PubMed

    dos Reis, Sávio Pinho; Tavares, Liliane de Souza Conceição; Costa, Carinne de Nazaré Monteiro; Brígida, Aílton Borges Santa; de Souza, Cláudia Regina Batista

    2012-06-01

    Cassava (Manihot esculenta Crantz) is one of the world's most important food crops. It is cultivated mainly in developing countries of tropics, since its root is a major source of calories for low-income people due to its high productivity and resistance to many abiotic and biotic factors. A previous study has identified a partial cDNA sequence coding for a putative RING zinc finger in cassava storage root. The RING zinc finger protein is a specialized type of zinc finger protein found in many organisms. Here, we isolated the full-length cDNA sequence coding for M. esculenta RZF (MeRZF) protein by a combination of 5' and 3' RACE assays. BLAST analysis showed that its deduced amino acid sequence has a high level of similarity to plant proteins of RZF family. MeRZF protein contains a signature sequence motif for a RING zinc finger at its C-terminal region. In addition, this protein showed a histidine residue at the fifth coordination site, likely belonging to the RING-H2 subgroup, as confirmed by our phylogenetic analysis. There is also a transmembrane domain in its N-terminal region. Finally, semi-quantitative RT-PCR assays showed that MeRZF expression is increased in detached leaves treated with sodium chloride. Here, we report the first evidence of a RING zinc finger gene of cassava showing potential role in response to salt stress.

  2. Complete cDNA sequence and amino acid analysis of a bovine ribonuclease K6 gene.

    PubMed

    Pietrowski, D; Förster, M

    2000-01-01

    The complete cDNA sequence of a ribonuclease k6 gene of Bos Taurus has been determined. It codes for a protein with 154 amino acids and contains the invariant cysteine, histidine and lysine residues as well as the characteristic motifs specific to ribonuclease active sites. The deduced protein sequence is 27 residues longer than other known ribonucleases k6 and shows amino acids exchanges which could reflect a strain specificity or polymorphism within the bovine genome. Based on sequence similarity we have termed the identified gene bovine ribonuclease k6 b (brk6b).

  3. A novel nuclear genetic code alteration in yeasts and the evolution of codon reassignment in eukaryotes

    PubMed Central

    Mühlhausen, Stefanie; Findeisen, Peggy; Plessmann, Uwe; Urlaub, Henning; Kollmar, Martin

    2016-01-01

    The genetic code is the cellular translation table for the conversion of nucleotide sequences into amino acid sequences. Changes to the meaning of sense codons would introduce errors into almost every translated message and are expected to be highly detrimental. However, reassignment of single or multiple codons in mitochondria and nuclear genomes, although extremely rare, demonstrates that the code can evolve. Several models for the mechanism of alteration of nuclear genetic codes have been proposed (including “codon capture,” “genome streamlining,” and “ambiguous intermediate” theories), but with little resolution. Here, we report a novel sense codon reassignment in Pachysolen tannophilus, a yeast related to the Pichiaceae. By generating proteomics data and using tRNA sequence comparisons, we show that Pachysolen translates CUG codons as alanine and not as the more usual leucine. The Pachysolen tRNACAG is an anticodon-mutated tRNAAla containing all major alanine tRNA recognition sites. The polyphyly of the CUG-decoding tRNAs in yeasts is best explained by a tRNA loss driven codon reassignment mechanism. Loss of the CUG-tRNA in the ancient yeast is followed by gradual decrease of respective codons and subsequent codon capture by tRNAs whose anticodon is not part of the aminoacyl-tRNA synthetase recognition region. Our hypothesis applies to all nuclear genetic code alterations and provides several testable predictions. We anticipate more codon reassignments to be uncovered in existing and upcoming genome projects. PMID:27197221

  4. A Code Division Multiple Access Communication System for the Low Frequency Band.

    DTIC Science & Technology

    1983-04-01

    frequency channels spread-spectrum communication / complex sequences, orthogonal codes impulsive noise 20. ABSTRACT (Continue an reverse side It...their transmissions with signature sequences. Our LF/CDMA scheme is different in that each user’s signature sequence set consists of M orthogonal ...signature sequences. Our LF/CDMA scheme is different in that each user’s signature sequence set consists of M orthogonal sequences and thus log 2 M

  5. The effects of different representations on static structure analysis of computer malware signatures.

    PubMed

    Narayanan, Ajit; Chen, Yi; Pang, Shaoning; Tao, Ban

    2013-01-01

    The continuous growth of malware presents a problem for internet computing due to increasingly sophisticated techniques for disguising malicious code through mutation and the time required to identify signatures for use by antiviral software systems (AVS). Malware modelling has focused primarily on semantics due to the intended actions and behaviours of viral and worm code. The aim of this paper is to evaluate a static structure approach to malware modelling using the growing malware signature databases now available. We show that, if malware signatures are represented as artificial protein sequences, it is possible to apply standard sequence alignment techniques in bioinformatics to improve accuracy of distinguishing between worm and virus signatures. Moreover, aligned signature sequences can be mined through traditional data mining techniques to extract metasignatures that help to distinguish between viral and worm signatures. All bioinformatics and data mining analysis were performed on publicly available tools and Weka.

  6. The Effects of Different Representations on Static Structure Analysis of Computer Malware Signatures

    PubMed Central

    Narayanan, Ajit; Chen, Yi; Pang, Shaoning; Tao, Ban

    2013-01-01

    The continuous growth of malware presents a problem for internet computing due to increasingly sophisticated techniques for disguising malicious code through mutation and the time required to identify signatures for use by antiviral software systems (AVS). Malware modelling has focused primarily on semantics due to the intended actions and behaviours of viral and worm code. The aim of this paper is to evaluate a static structure approach to malware modelling using the growing malware signature databases now available. We show that, if malware signatures are represented as artificial protein sequences, it is possible to apply standard sequence alignment techniques in bioinformatics to improve accuracy of distinguishing between worm and virus signatures. Moreover, aligned signature sequences can be mined through traditional data mining techniques to extract metasignatures that help to distinguish between viral and worm signatures. All bioinformatics and data mining analysis were performed on publicly available tools and Weka. PMID:23983644

  7. Complete mitogenome sequencing and phylogenetic analysis of PaLi yak (Bos grunniens).

    PubMed

    Bao, Pengjia; Guo, Xian; Pei, Jie; Liang, Chunnian; Ding, Xuezhi; Min, Chu; Wang, Hongbo; Wu, Xiaoyun; Yan, Ping

    2016-11-01

    PaLi yak is a very important local breed in China; as a year-round grazing animal, it plays a very important role for the economic and native herdsmen. The PaLi yak complete mitochondrial DNA is sequenced in this study, the total length is 16,324 bp, containing 13 protein-coding genes, 22 tRNA genes, 2 rRNA genes and a non-coding control region (D-loop region). The order and composition are similar to most of the other vertebrates. The base contents are: 33.72% A, 25.80% C, 13.21% G and 27.27% T; A + T (60.99%) was higher than G + C (39.01%). The phylogenetic relationships were analyzed using the complete mitogenome sequence, results showed that the genetic relationship between yak and cattle is distinct. These information provides useful data for further study on protection of genetic resources and the taxonomy of Bovinae.

  8. Performance Analysis of Direct-Sequence Code-Division Multiple-Access Communications with Asymmetric Quadrature Phase-Shift-Keying Modulation

    NASA Technical Reports Server (NTRS)

    Wang, C.-W.; Stark, W.

    2005-01-01

    This article considers a quaternary direct-sequence code-division multiple-access (DS-CDMA) communication system with asymmetric quadrature phase-shift-keying (AQPSK) modulation for unequal error protection (UEP) capability. Both time synchronous and asynchronous cases are investigated. An expression for the probability distribution of the multiple-access interference is derived. The exact bit-error performance and the approximate performance using a Gaussian approximation and random signature sequences are evaluated by extending the techniques used for uniform quadrature phase-shift-keying (QPSK) and binary phase-shift-keying (BPSK) DS-CDMA systems. Finally, a general system model with unequal user power and the near-far problem is considered and analyzed. The results show that, for a system with UEP capability, the less protected data bits are more sensitive to the near-far effect that occurs in a multiple-access environment than are the more protected bits.

  9. The complete mitochondrial genome of the cryptic "lineage B" big-fin reef squid, Sepioteuthis lessoniana (Cephalopoda: Loliginidae) in Indo-West Pacific.

    PubMed

    Shen, Kang-Ning; Yen, Ta-Chi; Chen, Ching-Hung; Ye, Jeng-Jia; Hsiao, Chung-Der

    2016-05-01

    In this study, the complete mitogenome sequence of the cryptic "lineage B" big-fin reef squid, Sepioteuthis lessoniana (Cephalopoda: Loliginidae) has been sequenced by next-generation sequencing method. The assembled mitogenome consisting of 16,694 bp, includes 13 protein coding genes, 25 transfer RNAs, 2 ribosomal RNAs genes. The overall base composition of "lineage B" S. lessoniana is 36.7% for A, 18.9 % for C, 34.5 % for T and 9.8 % for G and show 90% identities to "lineage C" S. lessoniana. It is also exhibits high T + A content (71.2%), two non-coding regions with TA tandem repeats. The complete mitogenome of the cryptic "lineage B" S. lessoniana provides essential and important DNA molecular data for further phylogeography and evolutionary analysis for big-fin reef squid species complex.

  10. The complete mitochondrial genome of the cryptic "lineage A" big-fin reef squid, Sepioteuthis lessoniana (Cephalopoda: Loliginidae) in Indo-West Pacific.

    PubMed

    Hsiao, Chung-Der; Shen, Kang-Ning; Ching, Tzu-Yun; Wang, Ya-Hsien; Ye, Jeng-Jia; Tsai, Shiou-Yi; Wu, Shan-Chun; Chen, Ching-Hung; Wang, Chia-Hui

    2016-07-01

    In this study, the complete mitogenome sequence of the cryptic "lineage A" big-fin reef squid, Sepioteuthis lessoniana (Cephalopoda: Loliginidae) has been sequenced by the next-generation sequencing method. The assembled mitogenome consists of 16,605 bp, which includes 13 protein-coding genes, 22 transfer RNAs, and 2 ribosomal RNAs genes. The overall base composition of "lineage A" S. lessoniana is 37.5% for A, 17.4% for C, 9.1% for G, and 35.9% for T and shows 87% identities to "lineage C" S. lessoniana. It is also noticed by its high T + A content (73.4%), two non-coding regions with TA tandem repeats. The complete mitogenome of the cryptic "lineage A" S. lessoniana provides essential and important DNA molecular data for further phylogeography and evolutionary analysis for big-fin reef squid species complex.

  11. A two-locus global DNA barcode for land plants: the coding rbcL gene complements the non-coding trnH-psbA spacer region.

    PubMed

    Kress, W John; Erickson, David L

    2007-06-06

    A useful DNA barcode requires sufficient sequence variation to distinguish between species and ease of application across a broad range of taxa. Discovery of a DNA barcode for land plants has been limited by intrinsically lower rates of sequence evolution in plant genomes than that observed in animals. This low rate has complicated the trade-off in finding a locus that is universal and readily sequenced and has sufficiently high sequence divergence at the species-level. Here, a global plant DNA barcode system is evaluated by comparing universal application and degree of sequence divergence for nine putative barcode loci, including coding and non-coding regions, singly and in pairs across a phylogenetically diverse set of 48 genera (two species per genus). No single locus could discriminate among species in a pair in more than 79% of genera, whereas discrimination increased to nearly 88% when the non-coding trnH-psbA spacer was paired with one of three coding loci, including rbcL. In silico trials were conducted in which DNA sequences from GenBank were used to further evaluate the discriminatory power of a subset of these loci. These trials supported the earlier observation that trnH-psbA coupled with rbcL can correctly identify and discriminate among related species. A combination of the non-coding trnH-psbA spacer region and a portion of the coding rbcL gene is recommended as a two-locus global land plant barcode that provides the necessary universality and species discrimination.

  12. De Novo ORFs in Drosophila Are Important to Organismal Fitness and Evolved Rapidly from Previously Non-coding Sequences

    PubMed Central

    Reinhardt, Josephine A.; Wanjiru, Betty M.; Brant, Alicia T.; Saelao, Perot; Begun, David J.; Jones, Corbin D.

    2013-01-01

    How non-coding DNA gives rise to new protein-coding genes (de novo genes) is not well understood. Recent work has revealed the origins and functions of a few de novo genes, but common principles governing the evolution or biological roles of these genes are unknown. To better define these principles, we performed a parallel analysis of the evolution and function of six putatively protein-coding de novo genes described in Drosophila melanogaster. Reconstruction of the transcriptional history of de novo genes shows that two de novo genes emerged from novel long non-coding RNAs that arose at least 5 MY prior to evolution of an open reading frame. In contrast, four other de novo genes evolved a translated open reading frame and transcription within the same evolutionary interval suggesting that nascent open reading frames (proto-ORFs), while not required, can contribute to the emergence of a new de novo gene. However, none of the genes arose from proto-ORFs that existed long before expression evolved. Sequence and structural evolution of de novo genes was rapid compared to nearby genes and the structural complexity of de novo genes steadily increases over evolutionary time. Despite the fact that these genes are transcribed at a higher level in males than females, and are most strongly expressed in testes, RNAi experiments show that most of these genes are essential in both sexes during metamorphosis. This lethality suggests that protein coding de novo genes in Drosophila quickly become functionally important. PMID:24146629

  13. Application of grammar-based codes for lossless compression of digital mammograms

    NASA Astrophysics Data System (ADS)

    Li, Xiaoli; Krishnan, Srithar; Ma, Ngok-Wah

    2006-01-01

    A newly developed grammar-based lossless source coding theory and its implementation was proposed in 1999 and 2000, respectively, by Yang and Kieffer. The code first transforms the original data sequence into an irreducible context-free grammar, which is then compressed using arithmetic coding. In the study of grammar-based coding for mammography applications, we encountered two issues: processing time and limited number of single-character grammar G variables. For the first issue, we discover a feature that can simplify the matching subsequence search in the irreducible grammar transform process. Using this discovery, an extended grammar code technique is proposed and the processing time of the grammar code can be significantly reduced. For the second issue, we propose to use double-character symbols to increase the number of grammar variables. Under the condition that all the G variables have the same probability of being used, our analysis shows that the double- and single-character approaches have the same compression rates. By using the methods proposed, we show that the grammar code can outperform three other schemes: Lempel-Ziv-Welch (LZW), arithmetic, and Huffman on compression ratio, and has similar error tolerance capabilities as LZW coding under similar circumstances.

  14. DCT based interpolation filter for motion compensation in HEVC

    NASA Astrophysics Data System (ADS)

    Alshin, Alexander; Alshina, Elena; Park, Jeong Hoon; Han, Woo-Jin

    2012-10-01

    High Efficiency Video Coding (HEVC) draft standard has a challenging goal to improve coding efficiency twice compare to H.264/AVC. Many aspects of the traditional hybrid coding framework were improved during new standard development. Motion compensated prediction, in particular the interpolation filter, is one area that was improved significantly over H.264/AVC. This paper presents the details of the interpolation filter design of the draft HEVC standard. The coding efficiency improvements over H.264/AVC interpolation filter is studied and experimental results are presented, which show a 4.0% average bitrate reduction for Luma component and 11.3% average bitrate reduction for Chroma component. The coding efficiency gains are significant for some video sequences and can reach up 21.7%.

  15. Sequence-dependent modelling of local DNA bending phenomena: curvature prediction and vibrational analysis.

    PubMed

    Vlahovicek, K; Munteanu, M G; Pongor, S

    1999-01-01

    Bending is a local conformational micropolymorphism of DNA in which the original B-DNA structure is only distorted but not extensively modified. Bending can be predicted by simple static geometry models as well as by a recently developed elastic model that incorporate sequence dependent anisotropic bendability (SDAB). The SDAB model qualitatively explains phenomena including affinity of protein binding, kinking, as well as sequence-dependent vibrational properties of DNA. The vibrational properties of DNA segments can be studied by finite element analysis of a model subjected to an initial bending moment. The frequency spectrum is obtained by applying Fourier analysis to the displacement values in the time domain. This analysis shows that the spectrum of the bending vibrations quite sensitively depends on the sequence, for example the spectrum of a curved sequence is characteristically different from the spectrum of straight sequence motifs of identical basepair composition. Curvature distributions are genome-specific, and pronounced differences are found between protein-coding and regulatory regions, respectively, that is, sites of extreme curvature and/or bendability are less frequent in protein-coding regions. A WWW server is set up for the prediction of curvature and generation of 3D models from DNA sequences (http:@www.icgeb.trieste.it/dna).

  16. Lineage-Specific Biology Revealed by a Finished Genome Assembly of the Mouse

    PubMed Central

    Hillier, LaDeana W.; Zody, Michael C.; Goldstein, Steve; She, Xinwe; Bult, Carol J.; Agarwala, Richa; Cherry, Joshua L.; DiCuccio, Michael; Hlavina, Wratko; Kapustin, Yuri; Meric, Peter; Maglott, Donna; Birtle, Zoë; Marques, Ana C.; Graves, Tina; Zhou, Shiguo; Teague, Brian; Potamousis, Konstantinos; Churas, Christopher; Place, Michael; Herschleb, Jill; Runnheim, Ron; Forrest, Daniel; Amos-Landgraf, James; Schwartz, David C.; Cheng, Ze; Lindblad-Toh, Kerstin; Eichler, Evan E.; Ponting, Chris P.

    2009-01-01

    The mouse (Mus musculus) is the premier animal model for understanding human disease and development. Here we show that a comprehensive understanding of mouse biology is only possible with the availability of a finished, high-quality genome assembly. The finished clone-based assembly of the mouse strain C57BL/6J reported here has over 175,000 fewer gaps and over 139 Mb more of novel sequence, compared with the earlier MGSCv3 draft genome assembly. In a comprehensive analysis of this revised genome sequence, we are now able to define 20,210 protein-coding genes, over a thousand more than predicted in the human genome (19,042 genes). In addition, we identified 439 long, non–protein-coding RNAs with evidence for transcribed orthologs in human. We analyzed the complex and repetitive landscape of 267 Mb of sequence that was missing or misassembled in the previously published assembly, and we provide insights into the reasons for its resistance to sequencing and assembly by whole-genome shotgun approaches. Duplicated regions within newly assembled sequence tend to be of more recent ancestry than duplicates in the published draft, correcting our initial understanding of recent evolution on the mouse lineage. These duplicates appear to be largely composed of sequence regions containing transposable elements and duplicated protein-coding genes; of these, some may be fixed in the mouse population, but at least 40% of segmentally duplicated sequences are copy number variable even among laboratory mouse strains. Mouse lineage-specific regions contain 3,767 genes drawn mainly from rapidly-changing gene families associated with reproductive functions. The finished mouse genome assembly, therefore, greatly improves our understanding of rodent-specific biology and allows the delineation of ancestral biological functions that are shared with human from derived functions that are not. PMID:19468303

  17. Position specific variation in the rate of evolution in transcription factor binding sites

    PubMed Central

    Moses, Alan M; Chiang, Derek Y; Kellis, Manolis; Lander, Eric S; Eisen, Michael B

    2003-01-01

    Background The binding sites of sequence specific transcription factors are an important and relatively well-understood class of functional non-coding DNAs. Although a wide variety of experimental and computational methods have been developed to characterize transcription factor binding sites, they remain difficult to identify. Comparison of non-coding DNA from related species has shown considerable promise in identifying these functional non-coding sequences, even though relatively little is known about their evolution. Results Here we analyse the genome sequences of the budding yeasts Saccharomyces cerevisiae, S. bayanus, S. paradoxus and S. mikatae to study the evolution of transcription factor binding sites. As expected, we find that both experimentally characterized and computationally predicted binding sites evolve slower than surrounding sequence, consistent with the hypothesis that they are under purifying selection. We also observe position-specific variation in the rate of evolution within binding sites. We find that the position-specific rate of evolution is positively correlated with degeneracy among binding sites within S. cerevisiae. We test theoretical predictions for the rate of evolution at positions where the base frequencies deviate from background due to purifying selection and find reasonable agreement with the observed rates of evolution. Finally, we show how the evolutionary characteristics of real binding motifs can be used to distinguish them from artefacts of computational motif finding algorithms. Conclusion As has been observed for protein sequences, the rate of evolution in transcription factor binding sites varies with position, suggesting that some regions are under stronger functional constraint than others. This variation likely reflects the varying importance of different positions in the formation of the protein-DNA complex. The characterization of the pattern of evolution in known binding sites will likely contribute to the effective use of comparative sequence data in the identification of transcription factor binding sites and is an important step toward understanding the evolution of functional non-coding DNA. PMID:12946282

  18. Broadband transmission-type coding metamaterial for wavefront manipulation for airborne sound

    NASA Astrophysics Data System (ADS)

    Li, Kun; Liang, Bin; Yang, Jing; Yang, Jun; Cheng, Jian-chun

    2018-07-01

    The recent advent of coding metamaterials, as a new class of acoustic metamaterials, substantially reduces the complexity in the design and fabrication of acoustic functional devices capable of manipulating sound waves in exotic manners by arranging coding elements with discrete phase states in specific sequences. It is therefore intriguing, both physically and practically, to pursue a mechanism for realizing broadband acoustic coding metamaterials that control transmitted waves with a fine resolution of the phase profile. Here, we propose the design of a transmission-type acoustic coding device and demonstrate its metamaterial-based implementation. The mechanism is that, instead of relying on resonant coding elements that are necessarily narrow-band, we build weak-resonant coding elements with a helical-like metamaterial with a continuously varying pitch that effectively expands the working bandwidth while maintaining the sub-wavelength resolution of the phase profile that is vital for the production of complicated wave fields. The effectiveness of our proposed scheme is numerically verified via the demonstration of three distinctive examples of acoustic focusing, anomalous refraction, and vortex beam generation in the prescribed frequency band on the basis of 1- and 2-bit coding sequences. Simulation results agree well with theoretical predictions, showing that the designed coding devices with discrete phase profiles are efficient in engineering the wavefront of outcoming waves to form the desired spatial pattern. We anticipate the realization of coding metamaterials with broadband functionality and design flexibility to open up possibilities for novel acoustic functional devices for the special manipulation of transmitted waves and underpin diverse applications ranging from medical ultrasound imaging to acoustic detections.

  19. Determination of the melon chloroplast and mitochondrial genome sequences reveals that the largest reported mitochondrial genome in plants contains a significant amount of DNA having a nuclear origin

    PubMed Central

    2011-01-01

    Background The melon belongs to the Cucurbitaceae family, whose economic importance among vegetable crops is second only to Solanaceae. The melon has a small genome size (454 Mb), which makes it suitable for molecular and genetic studies. Despite similar nuclear and chloroplast genome sizes, cucurbits show great variation when their mitochondrial genomes are compared. The melon possesses the largest plant mitochondrial genome, as much as eight times larger than that of other cucurbits. Results The nucleotide sequences of the melon chloroplast and mitochondrial genomes were determined. The chloroplast genome (156,017 bp) included 132 genes, with 98 single-copy genes dispersed between the small (SSC) and large (LSC) single-copy regions and 17 duplicated genes in the inverted repeat regions (IRa and IRb). A comparison of the cucumber and melon chloroplast genomes showed differences in only approximately 5% of nucleotides, mainly due to short indels and SNPs. Additionally, 2.74 Mb of mitochondrial sequence, accounting for 95% of the estimated mitochondrial genome size, were assembled into five scaffolds and four additional unscaffolded contigs. An 84% of the mitochondrial genome is contained in a single scaffold. The gene-coding region accounted for 1.7% (45,926 bp) of the total sequence, including 51 protein-coding genes, 4 conserved ORFs, 3 rRNA genes and 24 tRNA genes. Despite the differences observed in the mitochondrial genome sizes of cucurbit species, Citrullus lanatus (379 kb), Cucurbita pepo (983 kb) and Cucumis melo (2,740 kb) share 120 kb of sequence, including the predicted protein-coding regions. Nevertheless, melon contained a high number of repetitive sequences and a high content of DNA of nuclear origin, which represented 42% and 47% of the total sequence, respectively. Conclusions Whereas the size and gene organisation of chloroplast genomes are similar among the cucurbit species, mitochondrial genomes show a wide variety of sizes, with a non-conserved structure both in gene number and organisation, as well as in the features of the noncoding DNA. The transfer of nuclear DNA to the melon mitochondrial genome and the high proportion of repetitive DNA appear to explain the size of the largest mitochondrial genome reported so far. PMID:21854637

  20. Successful Recovery of Nuclear Protein-Coding Genes from Small Insects in Museums Using Illumina Sequencing.

    PubMed

    Kanda, Kojun; Pflug, James M; Sproul, John S; Dasenko, Mark A; Maddison, David R

    2015-01-01

    In this paper we explore high-throughput Illumina sequencing of nuclear protein-coding, ribosomal, and mitochondrial genes in small, dried insects stored in natural history collections. We sequenced one tenebrionid beetle and 12 carabid beetles ranging in size from 3.7 to 9.7 mm in length that have been stored in various museums for 4 to 84 years. Although we chose a number of old, small specimens for which we expected low sequence recovery, we successfully recovered at least some low-copy nuclear protein-coding genes from all specimens. For example, in one 56-year-old beetle, 4.4 mm in length, our de novo assembly recovered about 63% of approximately 41,900 nucleotides in a target suite of 67 nuclear protein-coding gene fragments, and 70% using a reference-based assembly. Even in the least successfully sequenced carabid specimen, reference-based assembly yielded fragments that were at least 50% of the target length for 34 of 67 nuclear protein-coding gene fragments. Exploration of alternative references for reference-based assembly revealed few signs of bias created by the reference. For all specimens we recovered almost complete copies of ribosomal and mitochondrial genes. We verified the general accuracy of the sequences through comparisons with sequences obtained from PCR and Sanger sequencing, including of conspecific, fresh specimens, and through phylogenetic analysis that tested the placement of sequences in predicted regions. A few possible inaccuracies in the sequences were detected, but these rarely affected the phylogenetic placement of the samples. Although our sample sizes are low, an exploratory regression study suggests that the dominant factor in predicting success at recovering nuclear protein-coding genes is a high number of Illumina reads, with success at PCR of COI and killing by immersion in ethanol being secondary factors; in analyses of only high-read samples, the primary significant explanatory variable was body length, with small beetles being more successfully sequenced.

  1. Successful Recovery of Nuclear Protein-Coding Genes from Small Insects in Museums Using Illumina Sequencing

    PubMed Central

    Dasenko, Mark A.

    2015-01-01

    In this paper we explore high-throughput Illumina sequencing of nuclear protein-coding, ribosomal, and mitochondrial genes in small, dried insects stored in natural history collections. We sequenced one tenebrionid beetle and 12 carabid beetles ranging in size from 3.7 to 9.7 mm in length that have been stored in various museums for 4 to 84 years. Although we chose a number of old, small specimens for which we expected low sequence recovery, we successfully recovered at least some low-copy nuclear protein-coding genes from all specimens. For example, in one 56-year-old beetle, 4.4 mm in length, our de novo assembly recovered about 63% of approximately 41,900 nucleotides in a target suite of 67 nuclear protein-coding gene fragments, and 70% using a reference-based assembly. Even in the least successfully sequenced carabid specimen, reference-based assembly yielded fragments that were at least 50% of the target length for 34 of 67 nuclear protein-coding gene fragments. Exploration of alternative references for reference-based assembly revealed few signs of bias created by the reference. For all specimens we recovered almost complete copies of ribosomal and mitochondrial genes. We verified the general accuracy of the sequences through comparisons with sequences obtained from PCR and Sanger sequencing, including of conspecific, fresh specimens, and through phylogenetic analysis that tested the placement of sequences in predicted regions. A few possible inaccuracies in the sequences were detected, but these rarely affected the phylogenetic placement of the samples. Although our sample sizes are low, an exploratory regression study suggests that the dominant factor in predicting success at recovering nuclear protein-coding genes is a high number of Illumina reads, with success at PCR of COI and killing by immersion in ethanol being secondary factors; in analyses of only high-read samples, the primary significant explanatory variable was body length, with small beetles being more successfully sequenced. PMID:26716693

  2. The Mitochondrial Cytochrome Oxidase Subunit I Gene Occurs on a Minichromosome with Extensive Heteroplasmy in Two Species of Chewing Lice, Geomydoecus aurei and Thomomydoecus minor

    PubMed Central

    Pietan, Lucas L.; Spradling, Theresa A.

    2016-01-01

    In animals, mitochondrial DNA (mtDNA) typically occurs as a single circular chromosome with 13 protein-coding genes and 22 tRNA genes. The various species of lice examined previously, however, have shown mitochondrial genome rearrangements with a range of chromosome sizes and numbers. Our research demonstrates that the mitochondrial genomes of two species of chewing lice found on pocket gophers, Geomydoecus aurei and Thomomydoecus minor, are fragmented with the 1,536 base-pair (bp) cytochrome-oxidase subunit I (cox1) gene occurring as the only protein-coding gene on a 1,916–1,964 bp minicircular chromosome in the two species, respectively. The cox1 gene of T. minor begins with an atypical start codon, while that of G. aurei does not. Components of the non-protein coding sequence of G. aurei and T. minor include a tRNA (isoleucine) gene, inverted repeat sequences consistent with origins of replication, and an additional non-coding region that is smaller than the non-coding sequence of other lice with such fragmented mitochondrial genomes. Sequences of cox1 minichromosome clones for each species reveal extensive length and sequence heteroplasmy in both coding and noncoding regions. The highly variable non-gene regions of G. aurei and T. minor have little sequence similarity with one another except for a 19-bp region of phylogenetically conserved sequence with unknown function. PMID:27589589

  3. Sequence and comparative analysis of the chicken genome provide unique perspectives on vertebrate evolution.

    PubMed

    2004-12-09

    We present here a draft genome sequence of the red jungle fowl, Gallus gallus. Because the chicken is a modern descendant of the dinosaurs and the first non-mammalian amniote to have its genome sequenced, the draft sequence of its genome--composed of approximately one billion base pairs of sequence and an estimated 20,000-23,000 genes--provides a new perspective on vertebrate genome evolution, while also improving the annotation of mammalian genomes. For example, the evolutionary distance between chicken and human provides high specificity in detecting functional elements, both non-coding and coding. Notably, many conserved non-coding sequences are far from genes and cannot be assigned to defined functional classes. In coding regions the evolutionary dynamics of protein domains and orthologous groups illustrate processes that distinguish the lineages leading to birds and mammals. The distinctive properties of avian microchromosomes, together with the inferred patterns of conserved synteny, provide additional insights into vertebrate chromosome architecture.

  4. Complete genome sequence of Corynebacterium glutamicum CP, a Chinese l-leucine producing strain.

    PubMed

    Gui, Yongli; Ma, Yuechao; Xu, Qingyang; Zhang, Chenglin; Xie, Xixian; Chen, Ning

    2016-02-20

    Here, we report the complete genome sequence of Corynebacterium glutamicum CP, an industrial l-leucine producing strain in China. The whole genome consists of a circular chromosome and a plasmid. The comparative genomics analysis shows that there are many mutations in the key enzyme coding genes relevant to l-leucine biosynthesis compared to C. glutamicum ATCC 13032. Copyright © 2016 Elsevier B.V. All rights reserved.

  5. Sequence-based heuristics for faster annotation of non-coding RNA families.

    PubMed

    Weinberg, Zasha; Ruzzo, Walter L

    2006-01-01

    Non-coding RNAs (ncRNAs) are functional RNA molecules that do not code for proteins. Covariance Models (CMs) are a useful statistical tool to find new members of an ncRNA gene family in a large genome database, using both sequence and, importantly, RNA secondary structure information. Unfortunately, CM searches are extremely slow. Previously, we created rigorous filters, which provably sacrifice none of a CM's accuracy, while making searches significantly faster for virtually all ncRNA families. However, these rigorous filters make searches slower than heuristics could be. In this paper we introduce profile HMM-based heuristic filters. We show that their accuracy is usually superior to heuristics based on BLAST. Moreover, we compared our heuristics with those used in tRNAscan-SE, whose heuristics incorporate a significant amount of work specific to tRNAs, where our heuristics are generic to any ncRNA. Performance was roughly comparable, so we expect that our heuristics provide a high-quality solution that--unlike family-specific solutions--can scale to hundreds of ncRNA families. The source code is available under GNU Public License at the supplementary web site.

  6. Avoidance of truncated proteins from unintended ribosome binding sites within heterologous protein coding sequences.

    PubMed

    Whitaker, Weston R; Lee, Hanson; Arkin, Adam P; Dueber, John E

    2015-03-20

    Genetic sequences ported into non-native hosts for synthetic biology applications can gain unexpected properties. In this study, we explored sequences functioning as ribosome binding sites (RBSs) within protein coding DNA sequences (CDSs) that cause internal translation, resulting in truncated proteins. Genome-wide prediction of bacterial RBSs, based on biophysical calculations employed by the RBS calculator, suggests a selection against internal RBSs within CDSs in Escherichia coli, but not those in Saccharomyces cerevisiae. Based on these calculations, silent mutations aimed at removing internal RBSs can effectively reduce truncation products from internal translation. However, a solution for complete elimination of internal translation initiation is not always feasible due to constraints of available coding sequences. Fluorescence assays and Western blot analysis showed that in genes with internal RBSs, increasing the strength of the intended upstream RBS had little influence on the internal translation strength. Another strategy to minimize truncated products from an internal RBS is to increase the relative strength of the upstream RBS with a concomitant reduction in promoter strength to achieve the same protein expression level. Unfortunately, lower transcription levels result in increased noise at the single cell level due to stochasticity in gene expression. At the low expression regimes desired for many synthetic biology applications, this problem becomes particularly pronounced. We found that balancing promoter strengths and upstream RBS strengths to intermediate levels can achieve the target protein concentration while avoiding both excessive noise and truncated protein.

  7. The complete nucleotide sequence of the domestic dog (Canis familiaris) mitochondrial genome.

    PubMed

    Kim, K S; Lee, S E; Jeong, H W; Ha, J H

    1998-10-01

    The complete nucleotide sequence of the mitochondrial genome of the domestic dog, Canis familiaris, was determined. The length of the sequence was 16,728 bp; however, the length was not absolute due to the variation (heteroplasmy) caused by differing numbers of the repetitive motif, 5'-GTACACGT(A/G)C-3', in the control region. The genome organization, gene contents, and codon usage conformed to those of other mammalian mitochondrial genomes. Although its features were unknown, the "CTAGA" duplication event which followed the translational stop codon of the COII gene was not observed in other mammalian mitochondrial genomes. In order to determine the possible differences between mtDNAs in carnivores, two rRNA and 13 protein-coding genes from the cat, dog, and seal were compared. The combined molecular differences, in two rRNA genes as well as in the inferred amino acid sequences of the mitochondrial 13 protein-coding genes, suggested that there is a closer relationship between the dog and the seal than there is between either of these species and the cat. Based on the molecular differences of the mtDNA, the evolutionary divergence between the cat, the dog, and the seal was dated to approximately 50 +/- 4 million years ago. The degree of difference between carnivore mtDNAs varied according to the individual protein-coding gene applied, showing that the evolutionary relationships of distantly related species should be presented in an extended study based on ample sequence data like complete mtDNA molecules. Copyright 1998 Academic Press.

  8. Comparative analysis of mitochondrial genomes between a wheat K-type cytoplasmic male sterility (CMS) line and its maintainer line.

    PubMed

    Liu, Huitao; Cui, Peng; Zhan, Kehui; Lin, Qiang; Zhuo, Guoyin; Guo, Xiaoli; Ding, Feng; Yang, Wenlong; Liu, Dongcheng; Hu, Songnian; Yu, Jun; Zhang, Aimin

    2011-03-29

    Plant mitochondria, semiautonomous organelles that function as manufacturers of cellular ATP, have their own genome that has a slow rate of evolution and rapid rearrangement. Cytoplasmic male sterility (CMS), a common phenotype in higher plants, is closely associated with rearrangements in mitochondrial DNA (mtDNA), and is widely used to produce F1 hybrid seeds in a variety of valuable crop species. Novel chimeric genes deduced from mtDNA rearrangements causing CMS have been identified in several plants, such as rice, sunflower, pepper, and rapeseed, but there are very few reports about mtDNA rearrangements in wheat. In the present work, we describe the mitochondrial genome of a wheat K-type CMS line and compare it with its maintainer line. The complete mtDNA sequence of a wheat K-type (with cytoplasm of Aegilops kotschyi) CMS line, Ks3, was assembled into a master circle (MC) molecule of 647,559 bp and found to harbor 34 known protein-coding genes, three rRNAs (18 S, 26 S, and 5 S rRNAs), and 16 different tRNAs. Compared to our previously published sequence of a K-type maintainer line, Km3, we detected Ks3-specific mtDNA (> 100 bp, 11.38%) and repeats (> 100 bp, 29 units) as well as genes that are unique to each line: rpl5 was missing in Ks3 and trnH was absent from Km3. We also defined 32 single nucleotide polymorphisms (SNPs) in 13 protein-coding, albeit functionally irrelevant, genes, and predicted 22 unique ORFs in Ks3, representing potential candidates for K-type CMS. All these sequence variations are candidates for involvement in CMS. A comparative analysis of the mtDNA of several angiosperms, including those from Ks3, Km3, rice, maize, Arabidopsis thaliana, and rapeseed, showed that non-coding sequences of higher plants had mostly divergent multiple reorganizations during the mtDNA evolution of higher plants. The complete mitochondrial genome of the wheat K-type CMS line Ks3 is very different from that of its maintainer line Km3, especially in non-coding sequences. Sequence rearrangement has produced novel chimeric ORFs, which may be candidate genes for CMS. Comparative analysis of several angiosperm mtDNAs indicated that non-coding sequences are the most frequently reorganized during mtDNA evolution in higher plants.

  9. Investigation of a Quadruplex-Forming Repeat Sequence Highly Enriched in Xanthomonas and Nostoc sp.

    PubMed

    Rehm, Charlotte; Wurmthaler, Lena A; Li, Yuanhao; Frickey, Tancred; Hartig, Jörg S

    2015-01-01

    In prokaryotes simple sequence repeats (SSRs) with unit sizes of 1-5 nucleotides (nt) are causative for phase and antigenic variation. Although an increased abundance of heptameric repeats was noticed in bacteria, reports about SSRs of 6-9 nt are rare. In particular G-rich repeat sequences with the propensity to fold into G-quadruplex (G4) structures have received little attention. In silico analysis of prokaryotic genomes show putative G4 forming sequences to be abundant. This report focuses on a surprisingly enriched G-rich repeat of the type GGGNATC in Xanthomonas and cyanobacteria such as Nostoc. We studied in detail the genomes of Xanthomonas campestris pv. campestris ATCC 33913 (Xcc), Xanthomonas axonopodis pv. citri str. 306 (Xac), and Nostoc sp. strain PCC7120 (Ana). In all three organisms repeats are spread all over the genome with an over-representation in non-coding regions. Extensive variation of the number of repetitive units was observed with repeat numbers ranging from two up to 26 units. However a clear preference for four units was detected. The strong bias for four units coincides with the requirement of four consecutive G-tracts for G4 formation. Evidence for G4 formation of the consensus repeat sequences was found in biophysical studies utilizing CD spectroscopy. The G-rich repeats are preferably located between aligned open reading frames (ORFs) and are under-represented in coding regions or between divergent ORFs. The G-rich repeats are preferentially located within a distance of 50 bp upstream of an ORF on the anti-sense strand or within 50 bp from the stop codon on the sense strand. Analysis of whole transcriptome sequence data showed that the majority of repeat sequences are transcribed. The genetic loci in the vicinity of repeat regions show increased genomic stability. In conclusion, we introduce and characterize a special class of highly abundant and wide-spread quadruplex-forming repeat sequences in bacteria.

  10. Investigation of a Quadruplex-Forming Repeat Sequence Highly Enriched in Xanthomonas and Nostoc sp.

    PubMed Central

    Rehm, Charlotte; Wurmthaler, Lena A.; Li, Yuanhao; Frickey, Tancred; Hartig, Jörg S.

    2015-01-01

    In prokaryotes simple sequence repeats (SSRs) with unit sizes of 1–5 nucleotides (nt) are causative for phase and antigenic variation. Although an increased abundance of heptameric repeats was noticed in bacteria, reports about SSRs of 6–9 nt are rare. In particular G-rich repeat sequences with the propensity to fold into G-quadruplex (G4) structures have received little attention. In silico analysis of prokaryotic genomes show putative G4 forming sequences to be abundant. This report focuses on a surprisingly enriched G-rich repeat of the type GGGNATC in Xanthomonas and cyanobacteria such as Nostoc. We studied in detail the genomes of Xanthomonas campestris pv. campestris ATCC 33913 (Xcc), Xanthomonas axonopodis pv. citri str. 306 (Xac), and Nostoc sp. strain PCC7120 (Ana). In all three organisms repeats are spread all over the genome with an over-representation in non-coding regions. Extensive variation of the number of repetitive units was observed with repeat numbers ranging from two up to 26 units. However a clear preference for four units was detected. The strong bias for four units coincides with the requirement of four consecutive G-tracts for G4 formation. Evidence for G4 formation of the consensus repeat sequences was found in biophysical studies utilizing CD spectroscopy. The G-rich repeats are preferably located between aligned open reading frames (ORFs) and are under-represented in coding regions or between divergent ORFs. The G-rich repeats are preferentially located within a distance of 50 bp upstream of an ORF on the anti-sense strand or within 50 bp from the stop codon on the sense strand. Analysis of whole transcriptome sequence data showed that the majority of repeat sequences are transcribed. The genetic loci in the vicinity of repeat regions show increased genomic stability. In conclusion, we introduce and characterize a special class of highly abundant and wide-spread quadruplex-forming repeat sequences in bacteria. PMID:26695179

  11. A Partial Least Squares Based Procedure for Upstream Sequence Classification in Prokaryotes.

    PubMed

    Mehmood, Tahir; Bohlin, Jon; Snipen, Lars

    2015-01-01

    The upstream region of coding genes is important for several reasons, for instance locating transcription factor, binding sites, and start site initiation in genomic DNA. Motivated by a recently conducted study, where multivariate approach was successfully applied to coding sequence modeling, we have introduced a partial least squares (PLS) based procedure for the classification of true upstream prokaryotic sequence from background upstream sequence. The upstream sequences of conserved coding genes over genomes were considered in analysis, where conserved coding genes were found by using pan-genomics concept for each considered prokaryotic species. PLS uses position specific scoring matrix (PSSM) to study the characteristics of upstream region. Results obtained by PLS based method were compared with Gini importance of random forest (RF) and support vector machine (SVM), which is much used method for sequence classification. The upstream sequence classification performance was evaluated by using cross validation, and suggested approach identifies prokaryotic upstream region significantly better to RF (p-value < 0.01) and SVM (p-value < 0.01). Further, the proposed method also produced results that concurred with known biological characteristics of the upstream region.

  12. Golay sequences coded coherent optical OFDM for long-haul transmission

    NASA Astrophysics Data System (ADS)

    Qin, Cui; Ma, Xiangrong; Hua, Tao; Zhao, Jing; Yu, Huilong; Zhang, Jian

    2017-09-01

    We propose to use binary Golay sequences in coherent optical orthogonal frequency division multiplexing (CO-OFDM) to improve the long-haul transmission performance. The Golay sequences are generated by binary Reed-Muller codes, which have low peak-to-average power ratio and certain error correction capability. A low-complexity decoding algorithm for the Golay sequences is then proposed to recover the signal. Under same spectral efficiency, the QPSK modulated OFDM with binary Golay sequences coding with and without discrete Fourier transform (DFT) spreading (DFTS-QPSK-GOFDM and QPSK-GOFDM) are compared with the normal BPSK modulated OFDM with and without DFT spreading (DFTS-BPSK-OFDM and BPSK-OFDM) after long-haul transmission. At a 7% forward error correction code threshold (Q2 factor of 8.5 dB), it is shown that DFTS-QPSK-GOFDM outperforms DFTS-BPSK-OFDM by extending the transmission distance by 29% and 18%, in non-dispersion managed and dispersion managed links, respectively.

  13. The detection error of thermal test low-frequency cable based on M sequence correlation algorithm

    NASA Astrophysics Data System (ADS)

    Wu, Dongliang; Ge, Zheyang; Tong, Xin; Du, Chunlin

    2018-04-01

    The problem of low accuracy and low efficiency of off-line detecting on thermal test low-frequency cable faults could be solved by designing a cable fault detection system, based on FPGA export M sequence code(Linear feedback shift register sequence) as pulse signal source. The design principle of SSTDR (Spread spectrum time-domain reflectometry) reflection method and hardware on-line monitoring setup figure is discussed in this paper. Testing data show that, this detection error increases with fault location of thermal test low-frequency cable.

  14. The Number, Organization, and Size of Polymorphic Membrane Protein Coding Sequences as well as the Most Conserved Pmp Protein Differ within and across Chlamydia Species.

    PubMed

    Van Lent, Sarah; Creasy, Heather Huot; Myers, Garry S A; Vanrompay, Daisy

    2016-01-01

    Variation is a central trait of the polymorphic membrane protein (Pmp) family. The number of pmp coding sequences differs between Chlamydia species, but it is unknown whether the number of pmp coding sequences is constant within a Chlamydia species. The level of conservation of the Pmp proteins has previously only been determined for Chlamydia trachomatis. As different Pmp proteins might be indispensible for the pathogenesis of different Chlamydia species, this study investigated the conservation of Pmp proteins both within and across C. trachomatis,C. pneumoniae,C. abortus, and C. psittaci. The pmp coding sequences were annotated in 16 C. trachomatis, 6 C. pneumoniae, 2 C. abortus, and 16 C. psittaci genomes. The number and organization of polymorphic membrane coding sequences differed within and across the analyzed Chlamydia species. The length of coding sequences of pmpA,pmpB, and pmpH was conserved among all analyzed genomes, while the length of pmpE/F and pmpG, and remarkably also of the subtype pmpD, differed among the analyzed genomes. PmpD, PmpA, PmpH, and PmpA were the most conserved Pmp in C. trachomatis,C. pneumoniae,C. abortus, and C. psittaci, respectively. PmpB was the most conserved Pmp across the 4 analyzed Chlamydia species. © 2016 S. Karger AG, Basel.

  15. Abundance and distribution of the highly iterated palindrome 1 (HIP1) among prokaryotes

    PubMed Central

    Moya, Andrés

    2011-01-01

    We have studied the abundance and phylogenetic distribution of the Highly Iterated Palindrome 1 (HIP1) among sequenced prokaryotic genomes. We show that an overrepresentation of HIP1 is exclusive of some lineages of cyanobacteria, and that this abundance was gained only once during evolution and was subsequently lost in the lineage leading to marine pico-cyanobacteria. We show that among cyanobacterial protein sequences with annotated Pfam domains, only OpcA (glucose 6-phosphate dehydrogenase assembly protein) has a phylogenetic distribution fully matching HIP1 abundance, suggesting a functional relationship; we also show that DAM methylase (an enzyme that has the four central nucleotides of HIP1 as is site of action) is present in all cyanobacterial genomes (independently of their HIP1 content) with the exception of marine pico-cyanobacteria whom might have lost this enzyme during the process of genome reduction. Our analyses also show that in some prokaryotic lineages (particularly in those species with large genomes), HIP1 is unevenly distributed between coding and non-coding DNA (being more common in coding regions; with the exception of Cyanobacteria Yellowstone B' and Synechococcus elongates where the reverse pattern is true). Finally, we explore the hypothesis that the HIP1 can be used as a molecular “water-mark” to identify horizontally transferred genes from cyanobacteria to other species. PMID:22312590

  16. Abundance and distribution of the highly iterated palindrome 1 (HIP1) among prokaryotes.

    PubMed

    Delaye, Luis; Moya, Andrés

    2011-09-01

    We have studied the abundance and phylogenetic distribution of the Highly Iterated Palindrome 1 (HIP1) among sequenced prokaryotic genomes. We show that an overrepresentation of HIP1 is exclusive of some lineages of cyanobacteria, and that this abundance was gained only once during evolution and was subsequently lost in the lineage leading to marine pico-cyanobacteria. We show that among cyanobacterial protein sequences with annotated Pfam domains, only OpcA (glucose 6-phosphate dehydrogenase assembly protein) has a phylogenetic distribution fully matching HIP1 abundance, suggesting a functional relationship; we also show that DAM methylase (an enzyme that has the four central nucleotides of HIP1 as is site of action) is present in all cyanobacterial genomes (independently of their HIP1 content) with the exception of marine pico-cyanobacteria whom might have lost this enzyme during the process of genome reduction. Our analyses also show that in some prokaryotic lineages (particularly in those species with large genomes), HIP1 is unevenly distributed between coding and non-coding DNA (being more common in coding regions; with the exception of Cyanobacteria Yellowstone B' and Synechococcus elongates where the reverse pattern is true). Finally, we explore the hypothesis that the HIP1 can be used as a molecular "water-mark" to identify horizontally transferred genes from cyanobacteria to other species.

  17. High-capacity quantum secure direct communication using hyper-entanglement of photonic qubits

    NASA Astrophysics Data System (ADS)

    Cai, Jiarui; Pan, Ziwen; Wang, Tie-Jun; Wang, Sihai; Wang, Chuan

    2016-11-01

    Hyper-entanglement is a system constituted by photons entangled in multiple degrees of freedom (DOF), being considered as a promising way of increasing channel capacity and guaranteeing powerful eavesdropping safeguard. In this work, we propose a coding scheme based on a 3-particle hyper-entanglement of polarization and orbital angular momentum (OAM) system and its application as a quantum secure direct communication (QSDC) protocol. The OAM values are specially encoded by Fibonacci sequence and the polarization carries information by defined unitary operations. The internal relations of the secret message enhances security due to principle of quantum mechanics and Fibonacci sequence. We also discuss the coding capacity and security property along with some simulation results to show its superiority and extensibility.

  18. Second generation DNA sequencing of the mitogenome of the Chinstrap penguin and comparative genomics of Antarctic penguins.

    PubMed

    Subramanian, Sankar; Lingala, Syamala Gowri; Swaminathan, Siva; Huynen, Leon; Lambert, David

    2014-08-01

    The complete mitochondrial genome of the Chinstrap penguin (Pygoscelis antarcticus) was sequenced and compared with other penguin mitogenomes. The genome is 15,972 bp in length with the number and order of protein coding genes and RNAs being very similar to that of other known penguin mitogenomes. Comparative nucleotide analysis showed the Chinstrap mitogenome shares 94% homology with the mitogenome of its sister species, Pygoscelis adelie (Adélie penguin). Divergence at nonsynonymous nucleotide positions was found to be up to 23 times less than that observed in synonymous positions of protein coding genes, suggesting high selection constraints. The complete mitogenome data will be useful for genetic and evolutionary studies of penguins.

  19. Complete sequence and gene organization of the mitochondrial genome of Asio flammeus (Strigiformes, strigidae).

    PubMed

    Zhang, Yanan; Song, Tao; Pan, Tao; Sun, Xiaonan; Sun, Zhonglou; Qian, Lifu; Zhang, Baowei

    2016-07-01

    The complete sequence of the mitochondrial genome was determined for Asio flammeus, which is distributed widely in geography. The length of the complete mitochondrial genome was 18,966 bp, containing 2 rRNA genes, 22 tRNA genes, 13 protein-coding genes (PCGs), and 1 non-coding region (D-loop). All the genes were distributed on the H-strand, except for the ND6 subunit gene and eight tRNA genes which were encoded on the L-strand. The D-loop of A. flammeus contained many tandem repeats of varying lengths and repeat numbers. The molecular-based phylogeny showed that our species acted as the sister group to A. capensis and the supported Asio was the monophyletic group.

  20. Spliced RNA of woodchuck hepatitis virus.

    PubMed

    Ogston, C W; Razman, D G

    1992-07-01

    Polymerase chain reaction was used to investigate RNA splicing in liver of woodchucks infected with woodchuck hepatitis virus (WHV). Two spliced species were detected, and the splice junctions were sequenced. The larger spliced RNA has an intron of 1300 nucleotides, and the smaller spliced sequence shows an additional downstream intron of 1104 nucleotides. We did not detect singly spliced sequences from which the smaller intron alone was removed. Control experiments showed that spliced sequences are present in both RNA and DNA in infected liver, showing that the viral reverse transcriptase can use spliced RNA as template. Spliced sequences were detected also in virion DNA prepared from serum. The upstream intron produces a reading frame that fuses the core to the polymerase polypeptide, while the downstream intron causes an inframe deletion in the polymerase open reading frame. Whereas the splicing patterns in WHV are superficially similar to those reported recently in hepatitis B virus, we detected no obvious homology in the coding capacity of spliced RNAs from these two viruses.

  1. Computational prediction of over-annotated protein-coding genes in the genome of Agrobacterium tumefaciens strain C58

    NASA Astrophysics Data System (ADS)

    Yu, Jia-Feng; Sui, Tian-Xiang; Wang, Hong-Mei; Wang, Chun-Ling; Jing, Li; Wang, Ji-Hua

    2015-12-01

    Agrobacterium tumefaciens strain C58 is a type of pathogen that can cause tumors in some dicotyledonous plants. Ever since the genome of A. tumefaciens strain C58 was sequenced, the quality of annotation of its protein-coding genes has been queried continually, because the annotation varies greatly among different databases. In this paper, the questionable hypothetical genes were re-predicted by integrating the TN curve and Z curve methods. As a result, 30 genes originally annotated as “hypothetical” were discriminated as being non-coding sequences. By testing the re-prediction program 10 times on data sets composed of the function-known genes, the mean accuracy of 99.99% and mean Matthews correlation coefficient value of 0.9999 were obtained. Further sequence analysis and COG analysis showed that the re-annotation results were very reliable. This work can provide an efficient tool and data resources for future studies of A. tumefaciens strain C58. Project supported by the National Natural Science Foundation of China (Grant Nos. 61302186 and 61271378) and the Funding from the State Key Laboratory of Bioelectronics of Southeast University.

  2. The genomic substrate for adaptive radiation in African cichlid fish.

    PubMed

    Brawand, David; Wagner, Catherine E; Li, Yang I; Malinsky, Milan; Keller, Irene; Fan, Shaohua; Simakov, Oleg; Ng, Alvin Y; Lim, Zhi Wei; Bezault, Etienne; Turner-Maier, Jason; Johnson, Jeremy; Alcazar, Rosa; Noh, Hyun Ji; Russell, Pamela; Aken, Bronwen; Alföldi, Jessica; Amemiya, Chris; Azzouzi, Naoual; Baroiller, Jean-François; Barloy-Hubler, Frederique; Berlin, Aaron; Bloomquist, Ryan; Carleton, Karen L; Conte, Matthew A; D'Cotta, Helena; Eshel, Orly; Gaffney, Leslie; Galibert, Francis; Gante, Hugo F; Gnerre, Sante; Greuter, Lucie; Guyon, Richard; Haddad, Natalie S; Haerty, Wilfried; Harris, Rayna M; Hofmann, Hans A; Hourlier, Thibaut; Hulata, Gideon; Jaffe, David B; Lara, Marcia; Lee, Alison P; MacCallum, Iain; Mwaiko, Salome; Nikaido, Masato; Nishihara, Hidenori; Ozouf-Costaz, Catherine; Penman, David J; Przybylski, Dariusz; Rakotomanga, Michaelle; Renn, Suzy C P; Ribeiro, Filipe J; Ron, Micha; Salzburger, Walter; Sanchez-Pulido, Luis; Santos, M Emilia; Searle, Steve; Sharpe, Ted; Swofford, Ross; Tan, Frederick J; Williams, Louise; Young, Sarah; Yin, Shuangye; Okada, Norihiro; Kocher, Thomas D; Miska, Eric A; Lander, Eric S; Venkatesh, Byrappa; Fernald, Russell D; Meyer, Axel; Ponting, Chris P; Streelman, J Todd; Lindblad-Toh, Kerstin; Seehausen, Ole; Di Palma, Federica

    2014-09-18

    Cichlid fishes are famous for large, diverse and replicated adaptive radiations in the Great Lakes of East Africa. To understand the molecular mechanisms underlying cichlid phenotypic diversity, we sequenced the genomes and transcriptomes of five lineages of African cichlids: the Nile tilapia (Oreochromis niloticus), an ancestral lineage with low diversity; and four members of the East African lineage: Neolamprologus brichardi/pulcher (older radiation, Lake Tanganyika), Metriaclima zebra (recent radiation, Lake Malawi), Pundamilia nyererei (very recent radiation, Lake Victoria), and Astatotilapia burtoni (riverine species around Lake Tanganyika). We found an excess of gene duplications in the East African lineage compared to tilapia and other teleosts, an abundance of non-coding element divergence, accelerated coding sequence evolution, expression divergence associated with transposable element insertions, and regulation by novel microRNAs. In addition, we analysed sequence data from sixty individuals representing six closely related species from Lake Victoria, and show genome-wide diversifying selection on coding and regulatory variants, some of which were recruited from ancient polymorphisms. We conclude that a number of molecular mechanisms shaped East African cichlid genomes, and that amassing of standing variation during periods of relaxed purifying selection may have been important in facilitating subsequent evolutionary diversification.

  3. The gene coding for small ribosomal subunit RNA in the basidiomycete Ustilago maydis contains a group I intron.

    PubMed Central

    De Wachter, R; Neefs, J M; Goris, A; Van de Peer, Y

    1992-01-01

    The nucleotide sequence of the gene coding for small ribosomal subunit RNA in the basidiomycete Ustilago maydis was determined. It revealed the presence of a group I intron with a length of 411 nucleotides. This is the third occurrence of such an intron discovered in a small subunit rRNA gene encoded by a eukaryotic nuclear genome. The other two occurrences are in Pneumocystis carinii, a fungus of uncertain taxonomic status, and Ankistrodesmus stipitatus, a green alga. The nucleotides of the conserved core structure of 101 group I intron sequences present in different genes and genome types were aligned and their evolutionary relatedness was examined. This revealed a cluster including all group I introns hitherto found in eukaryotic nuclear genes coding for small and large subunit rRNAs. A secondary structure model was designed for the area of the Ustilago maydis small ribosomal subunit RNA precursor where the intron is situated. It shows that the internal guide sequence pairing with the intron boundaries fits between two helices of the small subunit rRNA, and that minimal rearrangement of base pairs suffices to achieve the definitive secondary structure of the 18S rRNA upon splicing. PMID:1561081

  4. The genomic substrate for adaptive radiation in African cichlid fish

    PubMed Central

    Malinsky, Milan; Keller, Irene; Fan, Shaohua; Simakov, Oleg; Ng, Alvin Y.; Lim, Zhi Wei; Bezault, Etienne; Turner-Maier, Jason; Johnson, Jeremy; Alcazar, Rosa; Noh, Hyun Ji; Russell, Pamela; Aken, Bronwen; Alföldi, Jessica; Amemiya, Chris; Azzouzi, Naoual; Baroiller, Jean-François; Barloy-Hubler, Frederique; Berlin, Aaron; Bloomquist, Ryan; Carleton, Karen L.; Conte, Matthew A.; D'Cotta, Helena; Eshel, Orly; Gaffney, Leslie; Galibert, Francis; Gante, Hugo F.; Gnerre, Sante; Greuter, Lucie; Guyon, Richard; Haddad, Natalie S.; Haerty, Wilfried; Harris, Rayna M.; Hofmann, Hans A.; Hourlier, Thibaut; Hulata, Gideon; Jaffe, David B.; Lara, Marcia; Lee, Alison P.; MacCallum, Iain; Mwaiko, Salome; Nikaido, Masato; Nishihara, Hidenori; Ozouf-Costaz, Catherine; Penman, David J.; Przybylski, Dariusz; Rakotomanga, Michaelle; Renn, Suzy C. P.; Ribeiro, Filipe J.; Ron, Micha; Salzburger, Walter; Sanchez-Pulido, Luis; Santos, M. Emilia; Searle, Steve; Sharpe, Ted; Swofford, Ross; Tan, Frederick J.; Williams, Louise; Young, Sarah; Yin, Shuangye; Okada, Norihiro; Kocher, Thomas D.; Miska, Eric A.; Lander, Eric S.; Venkatesh, Byrappa; Fernald, Russell D.; Meyer, Axel; Ponting, Chris P.; Streelman, J. Todd; Lindblad-Toh, Kerstin; Seehausen, Ole; Di Palma, Federica

    2015-01-01

    Cichlid fishes are famous for large, diverse and replicated adaptive radiations in the Great Lakes of East Africa. To understand the molecular mechanisms underlying cichlid phenotypic diversity, we sequenced the genomes and transcriptomes of five lineages of African cichlids: the Nile tilapia (Oreochromis niloticus), an ancestral lineage with low diversity; and four members of the East African lineage: Neolamprologus brichardi/pulcher (older radiation, Lake Tanganyika), Metriaclima zebra (recent radiation, Lake Malawi), Pundamilia nyererei (very recent radiation, Lake Victoria), and Astatotilapia burtoni (riverine species around Lake Tanganyika). We found an excess of gene duplications in the East African lineage compared to tilapia and other teleosts, an abundance of non-coding element divergence, accelerated coding sequence evolution, expression divergence associated with transposable element insertions, and regulation by novel microRNAs. In addition, we analysed sequence data from sixty individuals representing six closely related species from Lake Victoria, and show genome-wide diversifying selection on coding and regulatory variants, some of which were recruited from ancient polymorphisms. We conclude that a number of molecular mechanisms shaped East African cichlid genomes, and that amassing of standing variation during periods of relaxed purifying selection may have been important in facilitating subsequent evolutionary diversification. PMID:25186727

  5. Amino-terminal domain of the v-fms oncogene product includes a functional signal peptide that directs synthesis of a transforming glycoprotein in the absence of feline leukemia virus gag sequences

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wheeler, E.F.; Roussel, M.F.; Hampe, A.

    1986-08-01

    The nucleotide sequence of a 5' segment of the human genomic c-fms proto-oncogene suggested that recombination between feline leukemia virus and feline c-fms sequences might have occurred in a region encoding the 5' untranslated portion of c-fms mRNA. The polyprotein precursor gP180/sup gag-fms/ encoded by the McDonough strain of feline sarcoma virus was therefore predicted to contain 34 v-fms-coded amino acids derived from sequences of the c-fms gene that are not ordinarily translated from the proto-oncogene mRNA. The (gP180/sup gag-fms/) polyprotein was cotranslationally cleaved near the gag-fms junction to remove its gag gene-coded portion. Determination of the amino-terminal sequence ofmore » the resulting v-fms-coded glycoprotein, gp120/sup v-fms/, showed that the site of proteolysis corresponded to a predicted signal peptidase cleavage site within the c-fms gene product. Together, these analyses suggested that the linked gag sequences may not be necessary for expression of a biologically active v-fms gene product. The gag-fms sequences of feline sarcoma virus strain McDonough and the v-fms sequences alone were inserted into a murine retroviral vector containing a neomycin resistance gene. The authors conclude that a cryptic hydrophobic signal peptide sequence in v-fms was unmasked by gag deletion, thereby allowing the correct orientation and transport of the v-fms was unmasked by gag deletion, thereby allowing the correct orientation and transport of the v-fms gene product within membranous organelles. It seems likely that the proteolytic cleavage of gP180/gag-fms/ is mediated by signal peptidase and that the amino termini of gp140/sup v-fms/ and the c-fms gene product are identical.« less

  6. PIPI: PTM-Invariant Peptide Identification Using Coding Method.

    PubMed

    Yu, Fengchao; Li, Ning; Yu, Weichuan

    2016-12-02

    In computational proteomics, the identification of peptides with an unlimited number of post-translational modification (PTM) types is a challenging task. The computational cost associated with database search increases exponentially with respect to the number of modified amino acids and linearly with respect to the number of potential PTM types at each amino acid. The problem becomes intractable very quickly if we want to enumerate all possible PTM patterns. To address this issue, one group of methods named restricted tools (including Mascot, Comet, and MS-GF+) only allow a small number of PTM types in database search process. Alternatively, the other group of methods named unrestricted tools (including MS-Alignment, ProteinProspector, and MODa) avoids enumerating PTM patterns with an alignment-based approach to localizing and characterizing modified amino acids. However, because of the large search space and PTM localization issue, the sensitivity of these unrestricted tools is low. This paper proposes a novel method named PIPI to achieve PTM-invariant peptide identification. PIPI belongs to the category of unrestricted tools. It first codes peptide sequences into Boolean vectors and codes experimental spectra into real-valued vectors. For each coded spectrum, it then searches the coded sequence database to find the top scored peptide sequences as candidates. After that, PIPI uses dynamic programming to localize and characterize modified amino acids in each candidate. We used simulation experiments and real data experiments to evaluate the performance in comparison with restricted tools (i.e., Mascot, Comet, and MS-GF+) and unrestricted tools (i.e., Mascot with error tolerant search, MS-Alignment, ProteinProspector, and MODa). Comparison with restricted tools shows that PIPI has a close sensitivity and running speed. Comparison with unrestricted tools shows that PIPI has the highest sensitivity except for Mascot with error tolerant search and ProteinProspector. These two tools simplify the task by only considering up to one modified amino acid in each peptide, which results in a higher sensitivity but has difficulty in dealing with multiple modified amino acids. The simulation experiments also show that PIPI has the lowest false discovery proportion, the highest PTM characterization accuracy, and the shortest running time among the unrestricted tools.

  7. A Two-Locus Global DNA Barcode for Land Plants: The Coding rbcL Gene Complements the Non-Coding trnH-psbA Spacer Region

    PubMed Central

    Kress, W. John; Erickson, David L.

    2007-01-01

    Background A useful DNA barcode requires sufficient sequence variation to distinguish between species and ease of application across a broad range of taxa. Discovery of a DNA barcode for land plants has been limited by intrinsically lower rates of sequence evolution in plant genomes than that observed in animals. This low rate has complicated the trade-off in finding a locus that is universal and readily sequenced and has sufficiently high sequence divergence at the species-level. Methodology/Principal Findings Here, a global plant DNA barcode system is evaluated by comparing universal application and degree of sequence divergence for nine putative barcode loci, including coding and non-coding regions, singly and in pairs across a phylogenetically diverse set of 48 genera (two species per genus). No single locus could discriminate among species in a pair in more than 79% of genera, whereas discrimination increased to nearly 88% when the non-coding trnH-psbA spacer was paired with one of three coding loci, including rbcL. In silico trials were conducted in which DNA sequences from GenBank were used to further evaluate the discriminatory power of a subset of these loci. These trials supported the earlier observation that trnH-psbA coupled with rbcL can correctly identify and discriminate among related species. Conclusions/Significance A combination of the non-coding trnH-psbA spacer region and a portion of the coding rbcL gene is recommended as a two-locus global land plant barcode that provides the necessary universality and species discrimination. PMID:17551588

  8. A common class of transcripts with 5'-intron depletion, distinct early coding sequence features, and N1-methyladenosine modification.

    PubMed

    Cenik, Can; Chua, Hon Nian; Singh, Guramrit; Akef, Abdalla; Snyder, Michael P; Palazzo, Alexander F; Moore, Melissa J; Roth, Frederick P

    2017-03-01

    Introns are found in 5' untranslated regions (5'UTRs) for 35% of all human transcripts. These 5'UTR introns are not randomly distributed: Genes that encode secreted, membrane-bound and mitochondrial proteins are less likely to have them. Curiously, transcripts lacking 5'UTR introns tend to harbor specific RNA sequence elements in their early coding regions. To model and understand the connection between coding-region sequence and 5'UTR intron status, we developed a classifier that can predict 5'UTR intron status with >80% accuracy using only sequence features in the early coding region. Thus, the classifier identifies transcripts with 5 ' proximal- i ntron- m inus-like-coding regions ("5IM" transcripts). Unexpectedly, we found that the early coding sequence features defining 5IM transcripts are widespread, appearing in 21% of all human RefSeq transcripts. The 5IM class of transcripts is enriched for non-AUG start codons, more extensive secondary structure both preceding the start codon and near the 5' cap, greater dependence on eIF4E for translation, and association with ER-proximal ribosomes. 5IM transcripts are bound by the exon junction complex (EJC) at noncanonical 5' proximal positions. Finally, N 1 -methyladenosines are specifically enriched in the early coding regions of 5IM transcripts. Taken together, our analyses point to the existence of a distinct 5IM class comprising ∼20% of human transcripts. This class is defined by depletion of 5' proximal introns, presence of specific RNA sequence features associated with low translation efficiency, N 1 -methyladenosines in the early coding region, and enrichment for noncanonical binding by the EJC. © 2017 Cenik et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

  9. Chromosomal localization and sequence analysis of a human episomal sequence with in vitro differentiating activity

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Boccaccio, C.; Deshatrette, J.; Meunier-Rotival, M.

    1994-05-01

    The genomic fragment carrying the human activator of liver function, previously described as an episome capable of inducing differentiation upon transfection into a dedifferentiated rat hepatoma cell line, was mapped on human chromosome 12q24.2-12q24.3. This chromosomal location was indistinguishable by in situ hybridization from that of the gene coding for the hepatic transcription factor HNF1. The sequence of the integrated form of the episome as well as its flanking sequences show that it is rich in retroposons. It contains a human ribosomal protein L21 processed pseudogene, one truncated L1Hs sequence, and 10 Alu repeats, which belong to different subfamilies.

  10. The ura5 gene of the ascomycete Sordaria macrospora: molecular cloning, characterization and expression in Escherichia coli.

    PubMed

    Le Chevanton, L; Leblon, G

    1989-04-15

    We cloned the ura5 gene coding for the orotate phosphoribosyl transferase from the ascomycete Sordaria macrospora by heterologous probing of a Sordaria genomic DNA library with the corresponding Podospora anserina sequence. The Sordaria gene was expressed in an Escherichia coli pyrE mutant strain defective for the same enzyme, and expression was shown to be promoted by plasmid sequences. The nucleotide sequence of the 1246-bp DNA fragment encompassing the region of homology with the Podospora gene has been determined. This sequence contains an open reading frame of 699 nucleotides. The deduced amino acid sequence shows 72% similarity with the corresponding Podospora protein.

  11. Mitochondrial comparative genomics and phylogenetic signal assessment of mtDNA among arbuscular mycorrhizal fungi.

    PubMed

    Nadimi, Maryam; Daubois, Laurence; Hijri, Mohamed

    2016-05-01

    Mitochondrial (mt) genes, such as cytochrome C oxidase genes (cox), have been widely used for barcoding in many groups of organisms, although this approach has been less powerful in the fungal kingdom due to the rapid evolution of their mt genomes. The use of mt genes in phylogenetic studies of Dikarya has been met with success, while early diverging fungal lineages remain less studied, particularly the arbuscular mycorrhizal fungi (AMF). Advances in next-generation sequencing have substantially increased the number of publically available mtDNA sequences for the Glomeromycota. As a result, comparison of mtDNA across key AMF taxa can now be applied to assess the phylogenetic signal of individual mt coding genes, as well as concatenated subsets of coding genes. Here we show comparative analyses of publically available mt genomes of Glomeromycota, augmented with two mtDNA genomes that were newly sequenced for this study (Rhizophagus irregularis DAOM240159 and Glomus aggregatum DAOM240163), resulting in 16 complete mtDNA datasets. R. irregularis isolate DAOM240159 and G. aggregatum isolate DAOM240163 showed mt genomes measuring 72,293bp and 69,505bp with G+C contents of 37.1% and 37.3%, respectively. We assessed the phylogenies inferred from single mt genes and complete sets of coding genes, which are referred to as "supergenes" (16 concatenated coding genes), using Shimodaira-Hasegawa tests, in order to identify genes that best described AMF phylogeny. We found that rnl, nad5, cox1, and nad2 genes, as well as concatenated subset of these genes, provided phylogenies that were similar to the supergene set. This mitochondrial genomic analysis was also combined with principal coordinate and partitioning analyses, which helped to unravel certain evolutionary relationships in the Rhizophagus genus and for G. aggregatum within the Glomeromycota. We showed evidence to support the position of G. aggregatum within the R. irregularis 'species complex'. Copyright © 2016 Elsevier Inc. All rights reserved.

  12. Sulfonamide Resistance in Clinical Isolates of Campylobacter jejuni: Mutational Changes in the Chromosomal Dihydropteroate Synthase

    PubMed Central

    Gibreel, Amera; Sköld, Ola

    1999-01-01

    The characterization of the genetic basis of sulfonamide resistance in Campylobacter jejuni was attempted. The resistance determinant from a sulfonamide-resistant strain of C. jejuni was cloned and was found to show 42% identity with the folP gene (which codes for dihydropteroate synthase, the target of sulfonamides) of the related bacterium Helicobacter pylori. The sequences of the areas surrounding the folP gene in C. jejuni showed similarity to those of the areas surrounding the corresponding gene in H. pylori. The folP gene of C. jejuni, which mediates the resistance, was observed to show particular features when it was compared to other known folP genes. One of these features is the presence of two pairs of direct repeats (15 and 27 bp) within the coding sequence of the gene. Comparison of the C. jejuni folP genes that mediate susceptibility and resistance revealed the occurrence of mutations that changed four amino acid residues. Resistance of C. jejuni to sulfonamides could be associated with one or several of these four mutational substitutions, which all occurred in the five different resistant isolates studied. The codon for one of these changed amino acids was found to be located in the second direct repeat within the coding sequence of the gene. The change made the repeat perfect. The transformation of both the resistance and the susceptibility variants of the gene into an Escherichia coli folP knockout mutant was found to complement the dihydropteroate synthase deficiency, confirming that the characterized sulfonamide resistance determinant codes for the C. jejuni dihydropteroate synthase enzyme. Kinetic measurements established different affinities of sulfonamide for the dihydropteroate synthase enzyme isolated from the resistant and susceptible strains. In conclusion, sulfonamide resistance in C. jejuni was shown to be associated with mutational changes in the chromosomally located gene for dihydropteroate synthase, the target of sulfonamides. PMID:10471557

  13. Simultaneous mutation and copy number variation (CNV) detection by multiplex PCR-based GS-FLX sequencing.

    PubMed

    Goossens, Dirk; Moens, Lotte N; Nelis, Eva; Lenaerts, An-Sofie; Glassee, Wim; Kalbe, Andreas; Frey, Bruno; Kopal, Guido; De Jonghe, Peter; De Rijk, Peter; Del-Favero, Jurgen

    2009-03-01

    We evaluated multiplex PCR amplification as a front-end for high-throughput sequencing, to widen the applicability of massive parallel sequencers for the detailed analysis of complex genomes. Using multiplex PCR reactions, we sequenced the complete coding regions of seven genes implicated in peripheral neuropathies in 40 individuals on a GS-FLX genome sequencer (Roche). The resulting dataset showed highly specific and uniform amplification. Comparison of the GS-FLX sequencing data with the dataset generated by Sanger sequencing confirmed the detection of all variants present and proved the sensitivity of the method for mutation detection. In addition, we showed that we could exploit the multiplexed PCR amplicons to determine individual copy number variation (CNV), increasing the spectrum of detected variations to both genetic and genomic variants. We conclude that our straightforward procedure substantially expands the applicability of the massive parallel sequencers for sequencing projects of a moderate number of amplicons (50-500) with typical applications in resequencing exons in positional or functional candidate regions and molecular genetic diagnostics. 2008 Wiley-Liss, Inc.

  14. Highly conserved elements discovered in vertebrates are present in non-syntenic loci of tunicates, act as enhancers and can be transcribed during development

    PubMed Central

    Sanges, Remo; Hadzhiev, Yavor; Gueroult-Bellone, Marion; Roure, Agnes; Ferg, Marco; Meola, Nicola; Amore, Gabriele; Basu, Swaraj; Brown, Euan R.; De Simone, Marco; Petrera, Francesca; Licastro, Danilo; Strähle, Uwe; Banfi, Sandro; Lemaire, Patrick; Birney, Ewan; Müller, Ferenc; Stupka, Elia

    2013-01-01

    Co-option of cis-regulatory modules has been suggested as a mechanism for the evolution of expression sites during development. However, the extent and mechanisms involved in mobilization of cis-regulatory modules remains elusive. To trace the history of non-coding elements, which may represent candidate ancestral cis-regulatory modules affirmed during chordate evolution, we have searched for conserved elements in tunicate and vertebrate (Olfactores) genomes. We identified, for the first time, 183 non-coding sequences that are highly conserved between the two groups. Our results show that all but one element are conserved in non-syntenic regions between vertebrate and tunicate genomes, while being syntenic among vertebrates. Nevertheless, in all the groups, they are significantly associated with transcription factors showing specific functions fundamental to animal development, such as multicellular organism development and sequence-specific DNA binding. The majority of these regions map onto ultraconserved elements and we demonstrate that they can act as functional enhancers within the organism of origin, as well as in cross-transgenesis experiments, and that they are transcribed in extant species of Olfactores. We refer to the elements as ‘Olfactores conserved non-coding elements’. PMID:23393190

  15. Isolation and characterization of the promoter sequence of a cassava gene coding for Pt2L4, a glutamic acid-rich protein differentially expressed in storage roots.

    PubMed

    de Souza, C R; Aragão, F J; Moreira, E C O; Costa, C N M; Nascimento, S B; Carvalho, L J

    2009-03-24

    Cassava is one of the most important tropical food crops for more than 600 million people worldwide. Transgenic technologies can be useful for increasing its nutritional value and its resistance to viral diseases and insect pests. However, tissue-specific promoters that guarantee correct expression of transgenes would be necessary. We used inverse polymerase chain reaction to isolate a promoter sequence of the Mec1 gene coding for Pt2L4, a glutamic acid-rich protein differentially expressed in cassava storage roots. In silico analysis revealed putative cis-acting regulatory elements within this promoter sequence, including root-specific elements that may be required for its expression in vascular tissues. Transient expression experiments showed that the Mec1 promoter is functional, since this sequence was able to drive GUS expression in bean embryonic axes. Results from our computational analysis can serve as a guide for functional experiments to identify regions with tissue-specific Mec1 promoter activity. The DNA sequence that we identified is a new promoter that could be a candidate for genetic engineering of cassava roots.

  16. PIMMS (Pragmatic Insertional Mutation Mapping System) Laboratory Methodology a Readily Accessible Tool for Identification of Essential Genes in Streptococcus

    PubMed Central

    Blanchard, Adam M.; Egan, Sharon A.; Emes, Richard D.; Warry, Andrew; Leigh, James A.

    2016-01-01

    The Pragmatic Insertional Mutation Mapping (PIMMS) laboratory protocol was developed alongside various bioinformatics packages (Blanchard et al., 2015) to enable detection of essential and conditionally essential genes in Streptococcus and related bacteria. This extended the methodology commonly used to locate insertional mutations in individual mutants to the analysis of mutations in populations of bacteria. In Streptococcus uberis, a pyogenic Streptococcus associated with intramammary infection and mastitis in ruminants, the mutagen pGhost9:ISS1 was shown to integrate across the entire genome. Analysis of >80,000 mutations revealed 196 coding sequences, which were not be mutated and a further 67 where mutation only occurred beyond the 90th percentile of the coding sequence. These sequences showed good concordance with sequences within the database of essential genes and typically matched sequences known to be associated with basic cellular functions. Due to the broad utility of this mutagen and the simplicity of the methodology it is anticipated that PIMMS will be of value to a wide range of laboratories in functional genomic analysis of a wide range of Gram positive bacteria (Streptococcus, Enterococcus, and Lactococcus) of medical, veterinary, and industrial significance. PMID:27826289

  17. Assessing the 5S ribosomal RNA heterogeneity in Arabidopsis thaliana using short RNA next generation sequencing data.

    PubMed

    Szymanski, Maciej; Karlowski, Wojciech M

    2016-01-01

    In eukaryotes, ribosomal 5S rRNAs are products of multigene families organized within clusters of tandemly repeated units. Accumulation of genomic data obtained from a variety of organisms demonstrated that the potential 5S rRNA coding sequences show a large number of variants, often incompatible with folding into a correct secondary structure. Here, we present results of an analysis of a large set of short RNA sequences generated by the next generation sequencing techniques, to address the problem of heterogeneity of the 5S rRNA transcripts in Arabidopsis and identification of potentially functional rRNA-derived fragments.

  18. Low Diversity in the Mitogenome of Sperm Whales Revealed by Next-Generation Sequencing

    PubMed Central

    Alexander, Alana; Steel, Debbie; Slikas, Beth; Hoekzema, Kendra; Carraher, Colm; Parks, Matthew; Cronn, Richard; Baker, C. Scott

    2013-01-01

    Large population sizes and global distributions generally associate with high mitochondrial DNA control region (CR) diversity. The sperm whale (Physeter macrocephalus) is an exception, showing low CR diversity relative to other cetaceans; however, diversity levels throughout the remainder of the sperm whale mitogenome are unknown. We sequenced 20 mitogenomes from 17 sperm whales representative of worldwide diversity using Next Generation Sequencing (NGS) technologies (Illumina GAIIx, Roche 454 GS Junior). Resequencing of three individuals with both NGS platforms and partial Sanger sequencing showed low discrepancy rates (454-Illumina: 0.0071%; Sanger-Illumina: 0.0034%; and Sanger-454: 0.0023%) confirming suitability of both NGS platforms for investigating low mitogenomic diversity. Using the 17 sperm whale mitogenomes in a phylogenetic reconstruction with 41 other species, including 11 new dolphin mitogenomes, we tested two hypotheses for the low CR diversity. First, the hypothesis that CR-specific constraints have reduced diversity solely in the CR was rejected as diversity was low throughout the mitogenome, not just in the CR (overall diversity π = 0.096%; protein-coding 3rd codon = 0.22%; CR = 0.35%), and CR phylogenetic signal was congruent with protein-coding regions. Second, the hypothesis that slow substitution rates reduced diversity throughout the sperm whale mitogenome was rejected as sperm whales had significantly higher rates of CR evolution and no evidence of slow coding region evolution relative to other cetaceans. The estimated time to most recent common ancestor for sperm whale mitogenomes was 72,800 to 137,400 years ago (95% highest probability density interval), consistent with previous hypotheses of a bottleneck or selective sweep as likely causes of low mitogenome diversity. PMID:23254394

  19. microRNA-122 target sites in the hepatitis C virus RNA NS5B coding region and 3' untranslated region: function in replication and influence of RNA secondary structure.

    PubMed

    Gerresheim, Gesche K; Dünnes, Nadia; Nieder-Röhrmann, Anika; Shalamova, Lyudmila A; Fricke, Markus; Hofacker, Ivo; Höner Zu Siederdissen, Christian; Marz, Manja; Niepmann, Michael

    2017-02-01

    We have analyzed the binding of the liver-specific microRNA-122 (miR-122) to three conserved target sites of hepatitis C virus (HCV) RNA, two in the non-structural protein 5B (NS5B) coding region and one in the 3' untranslated region (3'UTR). miR-122 binding efficiency strongly depends on target site accessibility under conditions when the range of flanking sequences available for the formation of local RNA secondary structures changes. Our results indicate that the particular sequence feature that contributes most to the correlation between target site accessibility and binding strength varies between different target sites. This suggests that the dynamics of miRNA/Ago2 binding not only depends on the target site itself but also on flanking sequence context to a considerable extent, in particular in a small viral genome in which strong selection constraints act on coding sequence and overlapping cis-signals and model the accessibility of cis-signals. In full-length genomes, single and combination mutations in the miR-122 target sites reveal that site 5B.2 is positively involved in regulating overall genome replication efficiency, whereas mutation of site 5B.3 showed a weaker effect. Mutation of the 3'UTR site and double or triple mutants showed no significant overall effect on genome replication, whereas in a translation reporter RNA, the 3'UTR target site inhibits translation directed by the HCV 5'UTR. Thus, the miR-122 target sites in the 3'-region of the HCV genome are involved in a complex interplay in regulating different steps of the HCV replication cycle.

  20. Low diversity in the mitogenome of sperm whales revealed by next-generation sequencing.

    PubMed

    Alexander, Alana; Steel, Debbie; Slikas, Beth; Hoekzema, Kendra; Carraher, Colm; Parks, Matthew; Cronn, Richard; Baker, C Scott

    2013-01-01

    Large population sizes and global distributions generally associate with high mitochondrial DNA control region (CR) diversity. The sperm whale (Physeter macrocephalus) is an exception, showing low CR diversity relative to other cetaceans; however, diversity levels throughout the remainder of the sperm whale mitogenome are unknown. We sequenced 20 mitogenomes from 17 sperm whales representative of worldwide diversity using Next Generation Sequencing (NGS) technologies (Illumina GAIIx, Roche 454 GS Junior). Resequencing of three individuals with both NGS platforms and partial Sanger sequencing showed low discrepancy rates (454-Illumina: 0.0071%; Sanger-Illumina: 0.0034%; and Sanger-454: 0.0023%) confirming suitability of both NGS platforms for investigating low mitogenomic diversity. Using the 17 sperm whale mitogenomes in a phylogenetic reconstruction with 41 other species, including 11 new dolphin mitogenomes, we tested two hypotheses for the low CR diversity. First, the hypothesis that CR-specific constraints have reduced diversity solely in the CR was rejected as diversity was low throughout the mitogenome, not just in the CR (overall diversity π = 0.096%; protein-coding 3rd codon = 0.22%; CR = 0.35%), and CR phylogenetic signal was congruent with protein-coding regions. Second, the hypothesis that slow substitution rates reduced diversity throughout the sperm whale mitogenome was rejected as sperm whales had significantly higher rates of CR evolution and no evidence of slow coding region evolution relative to other cetaceans. The estimated time to most recent common ancestor for sperm whale mitogenomes was 72,800 to 137,400 years ago (95% highest probability density interval), consistent with previous hypotheses of a bottleneck or selective sweep as likely causes of low mitogenome diversity.

  1. DROP: Detecting Return-Oriented Programming Malicious Code

    NASA Astrophysics Data System (ADS)

    Chen, Ping; Xiao, Hai; Shen, Xiaobin; Yin, Xinchun; Mao, Bing; Xie, Li

    Return-Oriented Programming (ROP) is a new technique that helps the attacker construct malicious code mounted on x86/SPARC executables without any function call at all. Such technique makes the ROP malicious code contain no instruction, which is different from existing attacks. Moreover, it hides the malicious code in benign code. Thus, it circumvents the approaches that prevent control flow diversion outside legitimate regions (such as W ⊕ X ) and most malicious code scanning techniques (such as anti-virus scanners). However, ROP has its own intrinsic feature which is different from normal program design: (1) uses short instruction sequence ending in "ret", which is called gadget, and (2) executes the gadgets contiguously in specific memory space, such as standard GNU libc. Based on the features of the ROP malicious code, in this paper, we present a tool DROP, which is focused on dynamically detecting ROP malicious code. Preliminary experimental results show that DROP can efficiently detect ROP malicious code, and have no false positives and negatives.

  2. Can mutational GC-pressure create new linear B-cell epitopes in herpes simplex virus type 1 glycoprotein B?

    PubMed

    Khrustalev, Vladislav Victorovich

    2009-01-01

    We showed that GC-content of nucleotide sequences coding for linear B-cell epitopes of herpes simplex virus type 1 (HSV1) glycoprotein B (gB) is higher than GC-content of sequences coding for epitope-free regions of this glycoprotein (G + C = 73 and 64%, respectively). Linear B-cell epitopes have been predicted in HSV1 gB by BepiPred algorithm ( www.cbs.dtu.dk/services/BepiPred ). Proline is an acrophilic amino acid residue (it is usually situated on the surface of protein globules, and so included in linear B-cell epitopes). Indeed, the level of proline is much higher in predicted epitopes of gB than in epitope-free regions (17.8% versus 1.8%). This amino acid is coded by GC-rich codons (CCX) that can be produced due to nucleotide substitutions caused by mutational GC-pressure. GC-pressure will also lead to disappearance of acrophobic phenylalanine, isoleucine, methionine and tyrosine coded by GC-poor codons. Results of our "in-silico directed mutagenesis" showed that single nonsynonymous substitutions in AT to GC direction in two long epitope-free regions of gB will cause formation of new linear epitopes or elongation of previously existing epitopes flanking these regions in 25% of 539 possible cases. The calculations of GC-content and amino acid content have been performed by CodonChanges algorithm ( www.barkovsky.hotmail.ru ).

  3. Repeats of base oligomers as the primordial coding sequences of the primeval earth and their vestiges in modern genes.

    PubMed

    Ohno, S

    1984-01-01

    Three outstanding properties uniquely qualify repeats of base oligomers as the primordial coding sequences of all polypeptide chains. First, when compared with randomly generated base sequences in general, they are more likely to have long open reading frames. Second, periodical polypeptide chains specified by such repeats are more likely to assume either alpha-helical or beta-sheet secondary structures than are polypeptide chains of random sequence. Third, provided that the number of bases in the oligomeric unit is not a multiple of 3, these internally repetitious coding sequences are impervious to randomly sustained base substitutions, deletions, and insertions. This is because the recurring periodicity of their polypeptide chains is given by three consecutive copies of the oligomeric unit translated in three different reading frames. Accordingly, when one reading frame is open, the other two are automatically open as well, all three being capable of coding for polypeptide chains of identical periodicity. Under this circumstance, a frame shift due to the deletion or insertion of a number of bases that is not a multiple of 3 fails to alter the down-stream amino acid sequence, and even a base change causing premature chain-termination can silence only one of the three potential coding units. Newly arisen coding sequences in modern organisms are oligomeric repeats, and most of the older genes retain various vestiges of their original internal repetitions. Some of the genes (e.g., oncogenes) have even inherited the property of being impervious to randomly sustained base changes.

  4. The flaA locus of Bacillus subtilis is part of a large operon coding for flagellar structures, motility functions, and an ATPase-like polypeptide.

    PubMed Central

    Albertini, A M; Caramori, T; Crabb, W D; Scoffone, F; Galizzi, A

    1991-01-01

    We cloned and sequenced 8.3 kb of Bacillus subtilis DNA corresponding to the flaA locus involved in flagellar biosynthesis, motility, and chemotaxis. The DNA sequence revealed the presence of 10 complete and 2 incomplete open reading frames. Comparison of the deduced amino acid sequences to data banks showed similarities of nine of the deduced products to a number of proteins of Escherichia coli and Salmonella typhimurium for which a role in flagellar functioning has been directly demonstrated. In particular, the sequence data suggest that the flaA operon codes for the M-ring protein, components of the motor switch, and the distal part of the basal-body rod. The gene order is remarkably similar to that described for region III of the enterobacterial flagellar regulon. One of the open reading frames was translated into a protein with 48% amino acid identity to S. typhimurium FliI and 29% identity to the beta subunit of E. coli ATP synthase. PMID:1828465

  5. Comprehensive analysis of single molecule sequencing-derived complete genome and whole transcriptome of Hyposidra talaca nuclear polyhedrosis virus.

    PubMed

    Nguyen, Thong T; Suryamohan, Kushal; Kuriakose, Boney; Janakiraman, Vasantharajan; Reichelt, Mike; Chaudhuri, Subhra; Guillory, Joseph; Divakaran, Neethu; Rabins, P E; Goel, Ridhi; Deka, Bhabesh; Sarkar, Suman; Ekka, Preety; Tsai, Yu-Chih; Vargas, Derek; Santhosh, Sam; Mohan, Sangeetha; Chin, Chen-Shan; Korlach, Jonas; Thomas, George; Babu, Azariah; Seshagiri, Somasekar

    2018-06-12

    We sequenced the Hyposidra talaca NPV (HytaNPV) double stranded circular DNA genome using PacBio single molecule sequencing technology. We found that the HytaNPV genome is 139,089 bp long with a GC content of 39.6%. It encodes 141 open reading frames (ORFs) including the 37 baculovirus core genes, 25 genes conserved among lepidopteran baculoviruses, 72 genes known in baculovirus, and 7 genes unique to the HytaNPV genome. It is a group II alphabaculovirus that codes for the F protein and lacks the gp64 gene found in group I alphabaculovirus viruses. Using RNA-seq, we confirmed the expression of the ORFs identified in the HytaNPV genome. Phylogenetic analysis showed HytaNPV to be closest to BusuNPV, SujuNPV and EcobNPV that infect other tea pests, Buzura suppressaria, Sucra jujuba, and Ectropis oblique, respectively. We identified repeat elements and a conserved non-coding baculovirus element in the genome. Analysis of the putative promoter sequences identified motif consistent with the temporal expression of the genes observed in the RNA-seq data.

  6. A novel nuclear genetic code alteration in yeasts and the evolution of codon reassignment in eukaryotes.

    PubMed

    Mühlhausen, Stefanie; Findeisen, Peggy; Plessmann, Uwe; Urlaub, Henning; Kollmar, Martin

    2016-07-01

    The genetic code is the cellular translation table for the conversion of nucleotide sequences into amino acid sequences. Changes to the meaning of sense codons would introduce errors into almost every translated message and are expected to be highly detrimental. However, reassignment of single or multiple codons in mitochondria and nuclear genomes, although extremely rare, demonstrates that the code can evolve. Several models for the mechanism of alteration of nuclear genetic codes have been proposed (including "codon capture," "genome streamlining," and "ambiguous intermediate" theories), but with little resolution. Here, we report a novel sense codon reassignment in Pachysolen tannophilus, a yeast related to the Pichiaceae. By generating proteomics data and using tRNA sequence comparisons, we show that Pachysolen translates CUG codons as alanine and not as the more usual leucine. The Pachysolen tRNACAG is an anticodon-mutated tRNA(Ala) containing all major alanine tRNA recognition sites. The polyphyly of the CUG-decoding tRNAs in yeasts is best explained by a tRNA loss driven codon reassignment mechanism. Loss of the CUG-tRNA in the ancient yeast is followed by gradual decrease of respective codons and subsequent codon capture by tRNAs whose anticodon is not part of the aminoacyl-tRNA synthetase recognition region. Our hypothesis applies to all nuclear genetic code alterations and provides several testable predictions. We anticipate more codon reassignments to be uncovered in existing and upcoming genome projects. © 2016 Mühlhausen et al.; Published by Cold Spring Harbor Laboratory Press.

  7. Does the Genetic Code Have A Eukaryotic Origin?

    PubMed Central

    Zhang, Zhang; Yu, Jun

    2013-01-01

    In the RNA world, RNA is assumed to be the dominant macromolecule performing most, if not all, core “house-keeping” functions. The ribo-cell hypothesis suggests that the genetic code and the translation machinery may both be born of the RNA world, and the introduction of DNA to ribo-cells may take over the informational role of RNA gradually, such as a mature set of genetic code and mechanism enabling stable inheritance of sequence and its variation. In this context, we modeled the genetic code in two content variables—GC and purine contents—of protein-coding sequences and measured the purine content sensitivities for each codon when the sensitivity (% usage) is plotted as a function of GC content variation. The analysis leads to a new pattern—the symmetric pattern—where the sensitivity of purine content variation shows diagonally symmetry in the codon table more significantly in the two GC content invariable quarters in addition to the two existing patterns where the table is divided into either four GC content sensitivity quarters or two amino acid diversity halves. The most insensitive codon sets are GUN (valine) and CAN (CAR for asparagine and CAY for aspartic acid) and the most biased amino acid is valine (always over-estimated) followed by alanine (always under-estimated). The unique position of valine and its codons suggests its key roles in the final recruitment of the complete codon set of the canonical table. The distinct choice may only be attributable to sequence signatures or signals of splice sites for spliceosomal introns shared by all extant eukaryotes. PMID:23402863

  8. Sequence similarity is more relevant than species specificity in probabilistic backtranslation.

    PubMed

    Ferro, Alfredo; Giugno, Rosalba; Pigola, Giuseppe; Pulvirenti, Alfredo; Di Pietro, Cinzia; Purrello, Michele; Ragusa, Marco

    2007-02-21

    Backtranslation is the process of decoding a sequence of amino acids into the corresponding codons. All synthetic gene design systems include a backtranslation module. The degeneracy of the genetic code makes backtranslation potentially ambiguous since most amino acids are encoded by multiple codons. The common approach to overcome this difficulty is based on imitation of codon usage within the target species. This paper describes EasyBack, a new parameter-free, fully-automated software for backtranslation using Hidden Markov Models. EasyBack is not based on imitation of codon usage within the target species, but instead uses a sequence-similarity criterion. The model is trained with a set of proteins with known cDNA coding sequences, constructed from the input protein by querying the NCBI databases with BLAST. Unlike existing software, the proposed method allows the quality of prediction to be estimated. When tested on a group of proteins that show different degrees of sequence conservation, EasyBack outperforms other published methods in terms of precision. The prediction quality of a protein backtranslation methis markedly increased by replacing the criterion of most used codon in the same species with a Hidden Markov Model trained with a set of most similar sequences from all species. Moreover, the proposed method allows the quality of prediction to be estimated probabilistically.

  9. On the Evolution of the Standard Genetic Code: Vestiges of Critical Scale Invariance from the RNA World in Current Prokaryote Genomes

    PubMed Central

    José, Marco V.; Govezensky, Tzipe; García, José A.; Bobadilla, Juan R.

    2009-01-01

    Herein two genetic codes from which the primeval RNA code could have originated the standard genetic code (SGC) are derived. One of them, called extended RNA code type I, consists of all codons of the type RNY (purine-any base-pyrimidine) plus codons obtained by considering the RNA code but in the second (NYR type) and third (YRN type) reading frames. The extended RNA code type II, comprises all codons of the type RNY plus codons that arise from transversions of the RNA code in the first (YNY type) and third (RNR) nucleotide bases. In order to test if putative nucleotide sequences in the RNA World and in both extended RNA codes, share the same scaling and statistical properties to those encountered in current prokaryotes, we used the genomes of four Eubacteria and three Archaeas. For each prokaryote, we obtained their respective genomes obeying the RNA code or the extended RNA codes types I and II. In each case, we estimated the scaling properties of triplet sequences via a renormalization group approach, and we calculated the frequency distributions of distances for each codon. Remarkably, the scaling properties of the distance series of some codons from the RNA code and most codons from both extended RNA codes turned out to be identical or very close to the scaling properties of codons of the SGC. To test for the robustness of these results, we show, via computer simulation experiments, that random mutations of current genomes, at the rates of 10−10 per site per year during three billions of years, were not enough for destroying the observed patterns. Therefore, we conclude that most current prokaryotes may still contain relics of the primeval RNA World and that both extended RNA codes may well represent two plausible evolutionary paths between the RNA code and the current SGC. PMID:19183813

  10. The application of coded excitation technology in medical ultrasonic Doppler imaging

    NASA Astrophysics Data System (ADS)

    Li, Weifeng; Chen, Xiaodong; Bao, Jing; Yu, Daoyin

    2008-03-01

    Medical ultrasonic Doppler imaging is one of the most important domains of modern medical imaging technology. The application of coded excitation technology in medical ultrasonic Doppler imaging system has the potential of higher SNR and deeper penetration depth than conventional pulse-echo imaging system, it also improves the image quality, and enhances the sensitivity of feeble signal, furthermore, proper coded excitation is beneficial to received spectrum of Doppler signal. Firstly, this paper analyzes the application of coded excitation technology in medical ultrasonic Doppler imaging system abstractly, showing the advantage and bright future of coded excitation technology, then introduces the principle and the theory of coded excitation. Secondly, we compare some coded serials (including Chirp and fake Chirp signal, Barker codes, Golay's complementary serial, M-sequence, etc). Considering Mainlobe Width, Range Sidelobe Level, Signal-to-Noise Ratio and sensitivity of Doppler signal, we choose Barker codes as coded serial. At last, we design the coded excitation circuit. The result in B-mode imaging and Doppler flow measurement coincided with our expectation, which incarnated the advantage of application of coded excitation technology in Digital Medical Ultrasonic Doppler Endoscope Imaging System.

  11. Complete genomic sequence of an infectious pancreatic necrosis virus isolated from rainbow trout (Oncorhynchus mykiss) in China.

    PubMed

    Ji, Feng; Zhao, Jing-Zhuang; Liu, Miao; Lu, Tong-Yan; Liu, Hong-Bai; Yin, Jiasheng; Xu, Li-Ming

    2017-04-01

    Infectious pancreatic necrosis (IPN) is a significant disease of farmed salmonids resulting in direct economic losses due to high mortality in China. However, no gene sequence of any Chinese infectious pancreatic necrosis virus (IPNV) isolates was available. In the study, moribund rainbow trout fry samples were collected during an outbreak of IPN in Yunnan province of southwest China in 2013. An IPNV was isolated and tentatively named ChRtm213. We determined the full genome sequence of the IPNV ChRtm213 and compared it with previously identified IPNV sequences worldwide. The sequences of different structural and non-structural protein genes were compared to those of other aquatic birnaviruses sequenced to date. The results indicated that the complete genome sequence of ChRtm213 strain contains a segment A (3099 nucleotides) coding a polyprotein VP2-VP4-VP3, and a segment B (2789 nucleotides) coding a RNA-dependent RNA polymerase VP1. The phylogenetic analyses showed that ChRtm213 strain fell within genogroup 1, serotype A9 (Jasper), having similarities of 96.3% (segment A) and 97.3% (segment B) with the IPNV strain AM98 from Japan. The results suggest that the Chinese IPNV isolate has relative closer relationship with Japanese IPNV strains. The sequence of ChRtm213 was the first gene sequence of IPNV isolates in China. This study provided a robust reference for diagnosis and/or control of IPNV prevalent in China.

  12. Comparison of simple sequence repeats in 19 Archaea.

    PubMed

    Trivedi, S

    2006-12-05

    All organisms that have been studied until now have been found to have differential distribution of simple sequence repeats (SSRs), with more SSRs in intergenic than in coding sequences. SSR distribution was investigated in Archaea genomes where complete chromosome sequences of 19 Archaea were analyzed with the program SPUTNIK to find di- to penta-nucleotide repeats. The number of repeats was determined for the complete chromosome sequences and for the coding and non-coding sequences. Different from what has been found for other groups of organisms, there is an abundance of SSRs in coding regions of the genome of some Archaea. Dinucleotide repeats were rare and CG repeats were found in only two Archaea. In general, trinucleotide repeats are the most abundant SSR motifs; however, pentanucleotide repeats are abundant in some Archaea. Some of the tetranucleotide and pentanucleotide repeat motifs are organism specific. In general, repeats are short and CG-rich repeats are present in Archaea having a CG-rich genome. Among the 19 Archaea, SSR density was not correlated with genome size or with optimum growth temperature. Pentanucleotide density had an inverse correlation with the CG content of the genome.

  13. Association of Amine-Receptor DNA Sequence Variants with Associative Learning in the Honeybee.

    PubMed

    Lagisz, Malgorzata; Mercer, Alison R; de Mouzon, Charlotte; Santos, Luana L S; Nakagawa, Shinichi

    2016-03-01

    Octopamine- and dopamine-based neuromodulatory systems play a critical role in learning and learning-related behaviour in insects. To further our understanding of these systems and resulting phenotypes, we quantified DNA sequence variations at six loci coding octopamine-and dopamine-receptors and their association with aversive and appetitive learning traits in a population of honeybees. We identified 79 polymorphic sequence markers (mostly SNPs and a few insertions/deletions) located within or close to six candidate genes. Intriguingly, we found that levels of sequence variation in the protein-coding regions studied were low, indicating that sequence variation in the coding regions of receptor genes critical to learning and memory is strongly selected against. Non-coding and upstream regions of the same genes, however, were less conserved and sequence variations in these regions were weakly associated with between-individual differences in learning-related traits. While these associations do not directly imply a specific molecular mechanism, they suggest that the cross-talk between dopamine and octopamine signalling pathways may influence olfactory learning and memory in the honeybee.

  14. Coherent direct sequence optical code multiple access encoding-decoding efficiency versus wavelength detuning.

    PubMed

    Pastor, D; Amaya, W; García-Olcina, R; Sales, S

    2007-07-01

    We present a simple theoretical model of and the experimental verification for vanishing of the autocorrelation peak due to wavelength detuning on the coding-decoding process of coherent direct sequence optical code multiple access systems based on a superstructured fiber Bragg grating. Moreover, the detuning vanishing effect has been explored to take advantage of this effect and to provide an additional degree of multiplexing and/or optical code tuning.

  15. FOURTH SEMINAR TO THE MEMORY OF D.N. KLYSHKO: Algebraic solution of the synthesis problem for coded sequences

    NASA Astrophysics Data System (ADS)

    Leukhin, Anatolii N.

    2005-08-01

    The algebraic solution of a 'complex' problem of synthesis of phase-coded (PC) sequences with the zero level of side lobes of the cyclic autocorrelation function (ACF) is proposed. It is shown that the solution of the synthesis problem is connected with the existence of difference sets for a given code dimension. The problem of estimating the number of possible code combinations for a given code dimension is solved. It is pointed out that the problem of synthesis of PC sequences is related to the fundamental problems of discrete mathematics and, first of all, to a number of combinatorial problems, which can be solved, as the number factorisation problem, by algebraic methods by using the theory of Galois fields and groups.

  16. Capturing the Temporal Sequence of Interaction in Young Siblings

    PubMed Central

    Steele, Fiona; Jenkins, Jennifer

    2015-01-01

    We explored whether young children exhibit subtypes of behavioral sequences during sibling interaction. Ten-minute, free-play observations of over 300 sibling dyads were coded for positivity, negativity and disengagement. The data were analyzed using growth mixture modeling (GMM). Younger (18-month-old) children’s temporal behavioral sequences showed a harmonious (53%) and a casual (47%) class. Older (approximately four-year-old) children’s behavior was more differentiated revealing a harmonious (25%), a deteriorating (31%), a recovery (22%) and a casual (22%) class. A more positive maternal affective climate was associated with more positive patterns. Siblings’ sequential behavioral patterns tended to be complementary rather than reciprocal in nature. The study illustrates a novel use of GMM and makes a theoretical contribution by showing that young children exhibit distinct types of temporal behavioral sequences that are related to parenting processes. PMID:25996957

  17. Evaluating the protein coding potential of exonized transposable element sequences

    PubMed Central

    Piriyapongsa, Jittima; Rutledge, Mark T; Patel, Sanil; Borodovsky, Mark; Jordan, I King

    2007-01-01

    Background Transposable element (TE) sequences, once thought to be merely selfish or parasitic members of the genomic community, have been shown to contribute a wide variety of functional sequences to their host genomes. Analysis of complete genome sequences have turned up numerous cases where TE sequences have been incorporated as exons into mRNAs, and it is widely assumed that such 'exonized' TEs encode protein sequences. However, the extent to which TE-derived sequences actually encode proteins is unknown and a matter of some controversy. We have tried to address this outstanding issue from two perspectives: i-by evaluating ascertainment biases related to the search methods used to uncover TE-derived protein coding sequences (CDS) and ii-through a probabilistic codon-frequency based analysis of the protein coding potential of TE-derived exons. Results We compared the ability of three classes of sequence similarity search methods to detect TE-derived sequences among data sets of experimentally characterized proteins: 1-a profile-based hidden Markov model (HMM) approach, 2-BLAST methods and 3-RepeatMasker. Profile based methods are more sensitive and more selective than the other methods evaluated. However, the application of profile-based search methods to the detection of TE-derived sequences among well-curated experimentally characterized protein data sets did not turn up many more cases than had been previously detected and nowhere near as many cases as recent genome-wide searches have. We observed that the different search methods used were complementary in the sense that they yielded largely non-overlapping sets of hits and differed in their ability to recover known cases of TE-derived CDS. The probabilistic analysis of TE-derived exon sequences indicates that these sequences have low protein coding potential on average. In particular, non-autonomous TEs that do not encode protein sequences, such as Alu elements, are frequently exonized but unlikely to encode protein sequences. Conclusion The exaptation of the numerous TE sequences found in exons as bona fide protein coding sequences may prove to be far less common than has been suggested by the analysis of complete genomes. We hypothesize that many exonized TE sequences actually function as post-transcriptional regulators of gene expression, rather than coding sequences, which may act through a variety of double stranded RNA related regulatory pathways. Indeed, their relatively high copy numbers and similarity to sequences dispersed throughout the genome suggests that exonized TE sequences could serve as master regulators with a wide scope of regulatory influence. Reviewers: This article was reviewed by Itai Yanai, Kateryna D. Makova, Melissa Wilson (nominated by Kateryna D. Makova) and Cedric Feschotte (nominated by John M. Logsdon Jr.). PMID:18036258

  18. RAMICS: trainable, high-speed and biologically relevant alignment of high-throughput sequencing reads to coding DNA

    PubMed Central

    Wright, Imogen A.; Travers, Simon A.

    2014-01-01

    The challenge presented by high-throughput sequencing necessitates the development of novel tools for accurate alignment of reads to reference sequences. Current approaches focus on using heuristics to map reads quickly to large genomes, rather than generating highly accurate alignments in coding regions. Such approaches are, thus, unsuited for applications such as amplicon-based analysis and the realignment phase of exome sequencing and RNA-seq, where accurate and biologically relevant alignment of coding regions is critical. To facilitate such analyses, we have developed a novel tool, RAMICS, that is tailored to mapping large numbers of sequence reads to short lengths (<10 000 bp) of coding DNA. RAMICS utilizes profile hidden Markov models to discover the open reading frame of each sequence and aligns to the reference sequence in a biologically relevant manner, distinguishing between genuine codon-sized indels and frameshift mutations. This approach facilitates the generation of highly accurate alignments, accounting for the error biases of the sequencing machine used to generate reads, particularly at homopolymer regions. Performance improvements are gained through the use of graphics processing units, which increase the speed of mapping through parallelization. RAMICS substantially outperforms all other mapping approaches tested in terms of alignment quality while maintaining highly competitive speed performance. PMID:24861618

  19. Genome-Wide Discovery of Long Non-Coding RNAs in Rainbow Trout.

    PubMed

    Al-Tobasei, Rafet; Paneru, Bam; Salem, Mohamed

    2016-01-01

    The ENCODE project revealed that ~70% of the human genome is transcribed. While only 1-2% of the RNAs encode for proteins, the rest are non-coding RNAs. Long non-coding RNAs (lncRNAs) form a diverse class of non-coding RNAs that are longer than 200 nt. Emerging evidence indicates that lncRNAs play critical roles in various cellular processes including regulation of gene expression. LncRNAs show low levels of gene expression and sequence conservation, which make their computational identification in genomes difficult. In this study, more than two billion Illumina sequence reads were mapped to the genome reference using the TopHat and Cufflinks software. Transcripts shorter than 200 nt, with more than 83-100 amino acids ORF, or with significant homologies to the NCBI nr-protein database were removed. In addition, a computational pipeline was used to filter the remaining transcripts based on a protein-coding-score test. Depending on the filtering stringency conditions, between 31,195 and 54,503 lncRNAs were identified, with only 421 matching known lncRNAs in other species. A digital gene expression atlas revealed 2,935 tissue-specific and 3,269 ubiquitously-expressed lncRNAs. This study annotates the lncRNA rainbow trout genome and provides a valuable resource for functional genomics research in salmonids.

  20. A genome-wide survey of maternal and embryonic transcripts during Xenopus tropicalis development.

    PubMed

    Paranjpe, Sarita S; Jacobi, Ulrike G; van Heeringen, Simon J; Veenstra, Gert Jan C

    2013-11-06

    Dynamics of polyadenylation vs. deadenylation determine the fate of several developmentally regulated genes. Decay of a subset of maternal mRNAs and new transcription define the maternal-to-zygotic transition, but the full complement of polyadenylated and deadenylated coding and non-coding transcripts has not yet been assessed in Xenopus embryos. To analyze the dynamics and diversity of coding and non-coding transcripts during development, both polyadenylated mRNA and ribosomal RNA-depleted total RNA were harvested across six developmental stages and subjected to high throughput sequencing. The maternally loaded transcriptome is highly diverse and consists of both polyadenylated and deadenylated transcripts. Many maternal genes show peak expression in the oocyte and include genes which are known to be the key regulators of events like oocyte maturation and fertilization. Of all the transcripts that increase in abundance between early blastula and larval stages, about 30% of the embryonic genes are induced by fourfold or more by the late blastula stage and another 35% by late gastrulation. Using a gene model validation and discovery pipeline, we identified novel transcripts and putative long non-coding RNAs (lncRNA). These lncRNA transcripts were stringently selected as spliced transcripts generated from independent promoters, with limited coding potential and a codon bias characteristic of noncoding sequences. Many lncRNAs are conserved and expressed in a developmental stage-specific fashion. These data reveal dynamics of transcriptome polyadenylation and abundance and provides a high-confidence catalogue of novel and long non-coding RNAs.

  1. Genomic Sequence around Butterfly Wing Development Genes: Annotation and Comparative Analysis

    PubMed Central

    Conceição, Inês C.; Long, Anthony D.; Gruber, Jonathan D.; Beldade, Patrícia

    2011-01-01

    Background Analysis of genomic sequence allows characterization of genome content and organization, and access beyond gene-coding regions for identification of functional elements. BAC libraries, where relatively large genomic regions are made readily available, are especially useful for species without a fully sequenced genome and can increase genomic coverage of phylogenetic and biological diversity. For example, no butterfly genome is yet available despite the unique genetic and biological properties of this group, such as diversified wing color patterns. The evolution and development of these patterns is being studied in a few target species, including Bicyclus anynana, where a whole-genome BAC library allows targeted access to large genomic regions. Methodology/Principal Findings We characterize ∼1.3 Mb of genomic sequence around 11 selected genes expressed in B. anynana developing wings. Extensive manual curation of in silico predictions, also making use of a large dataset of expressed genes for this species, identified repetitive elements and protein coding sequence, and highlighted an expansion of Alcohol dehydrogenase genes. Comparative analysis with orthologous regions of the lepidopteran reference genome allowed assessment of conservation of fine-scale synteny (with detection of new inversions and translocations) and of DNA sequence (with detection of high levels of conservation of non-coding regions around some, but not all, developmental genes). Conclusions The general properties and organization of the available B. anynana genomic sequence are similar to the lepidopteran reference, despite the more than 140 MY divergence. Our results lay the groundwork for further studies of new interesting findings in relation to both coding and non-coding sequence: 1) the Alcohol dehydrogenase expansion with higher similarity between the five tandemly-repeated B. anynana paralogs than with the corresponding B. mori orthologs, and 2) the high conservation of non-coding sequence around the genes wingless and Ecdysone receptor, both involved in multiple developmental processes including wing pattern formation. PMID:21909358

  2. Speech processing using conditional observable maximum likelihood continuity mapping

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hogden, John; Nix, David

    A computer implemented method enables the recognition of speech and speech characteristics. Parameters are initialized of first probability density functions that map between the symbols in the vocabulary of one or more sequences of speech codes that represent speech sounds and a continuity map. Parameters are also initialized of second probability density functions that map between the elements in the vocabulary of one or more desired sequences of speech transcription symbols and the continuity map. The parameters of the probability density functions are then trained to maximize the probabilities of the desired sequences of speech-transcription symbols. A new sequence ofmore » speech codes is then input to the continuity map having the trained first and second probability function parameters. A smooth path is identified on the continuity map that has the maximum probability for the new sequence of speech codes. The probability of each speech transcription symbol for each input speech code can then be output.« less

  3. Evolution of coding and non-coding genes in HOX clusters of a marsupial.

    PubMed

    Yu, Hongshi; Lindsay, James; Feng, Zhi-Ping; Frankenberg, Stephen; Hu, Yanqiu; Carone, Dawn; Shaw, Geoff; Pask, Andrew J; O'Neill, Rachel; Papenfuss, Anthony T; Renfree, Marilyn B

    2012-06-18

    The HOX gene clusters are thought to be highly conserved amongst mammals and other vertebrates, but the long non-coding RNAs have only been studied in detail in human and mouse. The sequencing of the kangaroo genome provides an opportunity to use comparative analyses to compare the HOX clusters of a mammal with a distinct body plan to those of other mammals. Here we report a comparative analysis of HOX gene clusters between an Australian marsupial of the kangaroo family and the eutherians. There was a strikingly high level of conservation of HOX gene sequence and structure and non-protein coding genes including the microRNAs miR-196a, miR-196b, miR-10a and miR-10b and the long non-coding RNAs HOTAIR, HOTAIRM1 and HOXA11AS that play critical roles in regulating gene expression and controlling development. By microRNA deep sequencing and comparative genomic analyses, two conserved microRNAs (miR-10a and miR-10b) were identified and one new candidate microRNA with typical hairpin precursor structure that is expressed in both fibroblasts and testes was found. The prediction of microRNA target analysis showed that several known microRNA targets, such as miR-10, miR-414 and miR-464, were found in the tammar HOX clusters. In addition, several novel and putative miRNAs were identified that originated from elsewhere in the tammar genome and that target the tammar HOXB and HOXD clusters. This study confirms that the emergence of known long non-coding RNAs in the HOX clusters clearly predate the marsupial-eutherian divergence 160 Ma ago. It also identified a new potentially functional microRNA as well as conserved miRNAs. These non-coding RNAs may participate in the regulation of HOX genes to influence the body plan of this marsupial.

  4. Evolution of coding and non-coding genes in HOX clusters of a marsupial

    PubMed Central

    2012-01-01

    Background The HOX gene clusters are thought to be highly conserved amongst mammals and other vertebrates, but the long non-coding RNAs have only been studied in detail in human and mouse. The sequencing of the kangaroo genome provides an opportunity to use comparative analyses to compare the HOX clusters of a mammal with a distinct body plan to those of other mammals. Results Here we report a comparative analysis of HOX gene clusters between an Australian marsupial of the kangaroo family and the eutherians. There was a strikingly high level of conservation of HOX gene sequence and structure and non-protein coding genes including the microRNAs miR-196a, miR-196b, miR-10a and miR-10b and the long non-coding RNAs HOTAIR, HOTAIRM1 and HOXA11AS that play critical roles in regulating gene expression and controlling development. By microRNA deep sequencing and comparative genomic analyses, two conserved microRNAs (miR-10a and miR-10b) were identified and one new candidate microRNA with typical hairpin precursor structure that is expressed in both fibroblasts and testes was found. The prediction of microRNA target analysis showed that several known microRNA targets, such as miR-10, miR-414 and miR-464, were found in the tammar HOX clusters. In addition, several novel and putative miRNAs were identified that originated from elsewhere in the tammar genome and that target the tammar HOXB and HOXD clusters. Conclusions This study confirms that the emergence of known long non-coding RNAs in the HOX clusters clearly predate the marsupial-eutherian divergence 160 Ma ago. It also identified a new potentially functional microRNA as well as conserved miRNAs. These non-coding RNAs may participate in the regulation of HOX genes to influence the body plan of this marsupial. PMID:22708672

  5. SequenceL: Automated Parallel Algorithms Derived from CSP-NT Computational Laws

    NASA Technical Reports Server (NTRS)

    Cooke, Daniel; Rushton, Nelson

    2013-01-01

    With the introduction of new parallel architectures like the cell and multicore chips from IBM, Intel, AMD, and ARM, as well as the petascale processing available for highend computing, a larger number of programmers will need to write parallel codes. Adding the parallel control structure to the sequence, selection, and iterative control constructs increases the complexity of code development, which often results in increased development costs and decreased reliability. SequenceL is a high-level programming language that is, a programming language that is closer to a human s way of thinking than to a machine s. Historically, high-level languages have resulted in decreased development costs and increased reliability, at the expense of performance. In recent applications at JSC and in industry, SequenceL has demonstrated the usual advantages of high-level programming in terms of low cost and high reliability. SequenceL programs, however, have run at speeds typically comparable with, and in many cases faster than, their counterparts written in C and C++ when run on single-core processors. Moreover, SequenceL is able to generate parallel executables automatically for multicore hardware, gaining parallel speedups without any extra effort from the programmer beyond what is required to write the sequen tial/singlecore code. A SequenceL-to-C++ translator has been developed that automatically renders readable multithreaded C++ from a combination of a SequenceL program and sample data input. The SequenceL language is based on two fundamental computational laws, Consume-Simplify- Produce (CSP) and Normalize-Trans - pose (NT), which enable it to automate the creation of parallel algorithms from high-level code that has no annotations of parallelism whatsoever. In our anecdotal experience, SequenceL development has been in every case less costly than development of the same algorithm in sequential (that is, single-core, single process) C or C++, and an order of magnitude less costly than development of comparable parallel code. Moreover, SequenceL not only automatically parallelizes the code, but since it is based on CSP-NT, it is provably race free, thus eliminating the largest quality challenge the parallelized software developer faces.

  6. ANN modeling of DNA sequences: new strategies using DNA shape code.

    PubMed

    Parbhane, R V; Tambe, S S; Kulkarni, B D

    2000-09-01

    Two new encoding strategies, namely, wedge and twist codes, which are based on the DNA helical parameters, are introduced to represent DNA sequences in artificial neural network (ANN)-based modeling of biological systems. The performance of the new coding strategies has been evaluated by conducting three case studies involving mapping (modeling) and classification applications of ANNs. The proposed coding schemes have been compared rigorously and shown to outperform the existing coding strategies especially in situations wherein limited data are available for building the ANN models.

  7. The primitive code and repeats of base oligomers as the primordial protein-encoding sequence.

    PubMed Central

    Ohno, S; Epplen, J T

    1983-01-01

    Even if the prebiotic self-replication of nucleic acids and the subsequent emergence of primitive, enzyme-independent tRNAs are accepted as plausible, the origin of life by spontaneous generation still appears improbable. This is because the just-emerged primitive translational machinery had to cope with base sequences that were not preselected for their coding potentials. Particularly if the primitive mitochondria-like code with four chain-terminating base triplets preceded the universal code, the translation of long, randomly generated, base sequences at this critical stage would have merely resulted in the production of short oligopeptides instead of long polypeptide chains. We present the base sequence of a mouse transcript containing tetranucleotide repeats conserved during evolution. Even if translated in accordance with the primitive mitochondria-like code, this transcript in its three reading frames can yield 245-, 246-, and 251-residue-long tetrapeptidic periodical polypeptides that are already acquiring longer periodicities. We contend that the first set of base sequences translated at the beginning of life were such oligonucleotide repeats. By quickly acquiring longer periodicities, their products must have soon gained characteristic secondary structures--alpha-helical or beta-sheet or both. PMID:6574491

  8. Distribution of cold adaptation proteins in microbial mats in Lake Joyce, Antarctica: Analysis of metagenomic data by using two bioinformatics tools.

    PubMed

    Koo, Hyunmin; Hakim, Joseph A; Fisher, Phillip R E; Grueneberg, Alexander; Andersen, Dale T; Bej, Asim K

    2016-01-01

    In this study, we report the distribution and abundance of cold-adaptation proteins in microbial mat communities in the perennially ice-covered Lake Joyce, located in the McMurdo Dry Valleys, Antarctica. We have used MG-RAST and R code bioinformatics tools on Illumina HiSeq2000 shotgun metagenomic data and compared the filtering efficacy of these two methods on cold-adaptation proteins. Overall, the abundance of cold-shock DEAD-box protein A (CSDA), antifreeze proteins (AFPs), fatty acid desaturase (FAD), trehalose synthase (TS), and cold-shock family of proteins (CSPs) were present in all mat samples at high, moderate, or low levels, whereas the ice nucleation protein (INP) was present only in the ice and bulbous mat samples at insignificant levels. Considering the near homogeneous temperature profile of Lake Joyce (0.08-0.29 °C), the distribution and abundance of these proteins across various mat samples predictively correlated with known functional attributes necessary for microbial communities to thrive in this ecosystem. The comparison of the MG-RAST and the R code methods showed dissimilar occurrences of the cold-adaptation protein sequences, though with insignificant ANOSIM (R = 0.357; p-value = 0.012), ADONIS (R(2) = 0.274; p-value = 0.03) and STAMP (p-values = 0.521-0.984) statistical analyses. Furthermore, filtering targeted sequences using the R code accounted for taxonomic groups by avoiding sequence redundancies, whereas the MG-RAST provided total counts resulting in a higher sequence output. The results from this study revealed for the first time the distribution of cold-adaptation proteins in six different types of microbial mats in Lake Joyce, while suggesting a simpler and more manageable user-defined method of R code, as compared to a web-based MG-RAST pipeline.

  9. A Golay complementary TS-based symbol synchronization scheme in variable rate LDPC-coded MB-OFDM UWBoF system

    NASA Astrophysics Data System (ADS)

    He, Jing; Wen, Xuejie; Chen, Ming; Chen, Lin

    2015-09-01

    In this paper, a Golay complementary training sequence (TS)-based symbol synchronization scheme is proposed and experimentally demonstrated in multiband orthogonal frequency division multiplexing (MB-OFDM) ultra-wideband over fiber (UWBoF) system with a variable rate low-density parity-check (LDPC) code. Meanwhile, the coding gain and spectral efficiency in the variable rate LDPC-coded MB-OFDM UWBoF system are investigated. By utilizing the non-periodic auto-correlation property of the Golay complementary pair, the start point of LDPC-coded MB-OFDM UWB signal can be estimated accurately. After 100 km standard single-mode fiber (SSMF) transmission, at the bit error rate of 1×10-3, the experimental results show that the short block length 64QAM-LDPC coding provides a coding gain of 4.5 dB, 3.8 dB and 2.9 dB for a code rate of 62.5%, 75% and 87.5%, respectively.

  10. Cloning and sequence analysis of the invertase gene INV 1 from the yeast Pichia anomala.

    PubMed

    Pérez, J A; Rodríguez, J; Rodríguez, L; Ruiz, T

    1996-02-01

    A genomic library from the yeast Pichia anomala has been constructed and employed to clone the gene encoding the sucrose-hydrolysing enzyme invertase by complementation of a sucrose non-fermenting mutant of Saccharomyces cerevisiae. The cloned gene, INV1, was sequenced and found to encode a polypeptide of 550 amino acids which contained a 22 amino-acid signal sequence and ten potential glycosylation sites. The amino-acid sequence shows significant identity with other yeast invertases and also with Kluyveromyces marxianus inulinase, a yeast beta-fructofuranosidase which has a different substrate specificity. The nucleotide sequences of the 5' and 3' non-coding regions were found to contain several consensus motifs probably involved in the initiation and termination of gene transcription.

  11. Experimental demonstration of tunable multiple optical orthogonal codes sequences-based optical label for optical packets switching

    NASA Astrophysics Data System (ADS)

    Zhang, Chongfu; Qiu, Kun; Zhou, Heng; Ling, Yun; Wang, Yawei; Xu, Bo

    2010-03-01

    In this paper, the tunable multiple optical orthogonal codes sequences (MOOCS)-based optical label for optical packet switching (OPS) (MOOCS-OPS) is experimentally demonstrated for the first time. The tunable MOOCS-based optical label is performed by using fiber Bragg grating (FBG)-based optical en/decoders group and optical switches configured by using Field Programmable Gate Array (FPGA), and the optical label is erased by using Semiconductor Optical Amplifier (SOA). Some waveforms of the MOOCS-based optical label, optical packet including the MOOCS-based optical label and the payloads are obtained, the switching control mechanism and the switching matrix are discussed, the bit error rate (BER) performance of this system is also studied. These experimental results show that the tunable MOOCS-OPS scheme is effective.

  12. A Novel Motion Compensation Method for Random Stepped Frequency Radar with M-sequence

    NASA Astrophysics Data System (ADS)

    Liao, Zhikun; Hu, Jiemin; Lu, Dawei; Zhang, Jun

    2018-01-01

    The random stepped frequency radar is a new kind of synthetic wideband radar. In the research, it has been found that it possesses a thumbtack-like ambiguity function which is considered to be the ideal one. This also means that only a precise motion compensation could result in the correct high resolution range profile. In this paper, we will introduce the random stepped frequency radar coded by M-sequence firstly and briefly analyse the effect of relative motion between target and radar on the distance imaging, which is called defocusing problem. Then, a novel motion compensation method, named complementary code cancellation, will be put forward to solve this problem. Finally, the simulated experiments will demonstrate its validity and the computational analysis will show up its efficiency.

  13. The emerging High Efficiency Video Coding standard (HEVC)

    NASA Astrophysics Data System (ADS)

    Raja, Gulistan; Khan, Awais

    2013-12-01

    High definition video (HDV) is becoming popular day by day. This paper describes the performance analysis of latest upcoming video standard known as High Efficiency Video Coding (HEVC). HEVC is designed to fulfil all the requirements for future high definition videos. In this paper, three configurations (intra only, low delay and random access) of HEVC are analyzed using various 480p, 720p and 1080p high definition test video sequences. Simulation results show the superior objective and subjective quality of HEVC.

  14. Genomics dataset of unidentified disclosed isolates.

    PubMed

    Rekadwad, Bhagwan N

    2016-09-01

    Analysis of DNA sequences is necessary for higher hierarchical classification of the organisms. It gives clues about the characteristics of organisms and their taxonomic position. This dataset is chosen to find complexities in the unidentified DNA in the disclosed patents. A total of 17 unidentified DNA sequences were thoroughly analyzed. The quick response codes were generated. AT/GC content of the DNA sequences analysis was carried out. The QR is helpful for quick identification of isolates. AT/GC content is helpful for studying their stability at different temperatures. Additionally, a dataset on cleavage code and enzyme code studied under the restriction digestion study, which helpful for performing studies using short DNA sequences was reported. The dataset disclosed here is the new revelatory data for exploration of unique DNA sequences for evaluation, identification, comparison and analysis.

  15. CDSbank: taxonomy-aware extraction, selection, renaming and formatting of protein-coding DNA or amino acid sequences.

    PubMed

    Hazes, Bart

    2014-02-28

    Protein-coding DNA sequences and their corresponding amino acid sequences are routinely used to study relationships between sequence, structure, function, and evolution. The rapidly growing size of sequence databases increases the power of such comparative analyses but it makes it more challenging to prepare high quality sequence data sets with control over redundancy, quality, completeness, formatting, and labeling. Software tools for some individual steps in this process exist but manual intervention remains a common and time consuming necessity. CDSbank is a database that stores both the protein-coding DNA sequence (CDS) and amino acid sequence for each protein annotated in Genbank. CDSbank also stores Genbank feature annotation, a flag to indicate incomplete 5' and 3' ends, full taxonomic data, and a heuristic to rank the scientific interest of each species. This rich information allows fully automated data set preparation with a level of sophistication that aims to meet or exceed manual processing. Defaults ensure ease of use for typical scenarios while allowing great flexibility when needed. Access is via a free web server at http://hazeslab.med.ualberta.ca/CDSbank/. CDSbank presents a user-friendly web server to download, filter, format, and name large sequence data sets. Common usage scenarios can be accessed via pre-programmed default choices, while optional sections give full control over the processing pipeline. Particular strengths are: extract protein-coding DNA sequences just as easily as amino acid sequences, full access to taxonomy for labeling and filtering, awareness of incomplete sequences, and the ability to take one protein sequence and extract all synonymous CDS or identical protein sequences in other species. Finally, CDSbank can also create labeled property files to, for instance, annotate or re-label phylogenetic trees.

  16. Parallel evolution of the glycogen synthase 1 (muscle) gene Gys1 between Old World and New World fruit bats (Order: Chiroptera).

    PubMed

    Fang, Lu; Shen, Bin; Irwin, David M; Zhang, Shuyi

    2014-10-01

    Glycogen synthase, which catalyzes the synthesis of glycogen, is especially important for Old World (Pteropodidae) and New World (Phyllostomidae) fruit bats that ingest high-carbohydrate diets. Glycogen synthase 1, encoded by the Gys1 gene, is the glycogen synthase isozyme that functions in muscles. To determine whether Gys1 has undergone adaptive evolution in bats with carbohydrate-rich diets, in comparison to insect-eating sister bat taxa, we sequenced the coding region of the Gys1 gene from 10 species of bats, including two Old World fruit bats (Pteropodidae) and a New World fruit bat (Phyllostomidae). Our results show no evidence for positive selection in the Gys1 coding sequence on the ancestral Old World and the New World Artibeus lituratus branches. Tests for convergent evolution indicated convergence of the sequences and one parallel amino acid substitution (T395A) was detected on these branches, which was likely driven by natural selection.

  17. COOLAIR Antisense RNAs Form Evolutionarily Conserved Elaborate Secondary Structures

    DOE PAGES

    Hawkes, Emily J.; Hennelly, Scott P.; Novikova, Irina V.; ...

    2016-09-20

    There is considerable debate about the functionality of long non-coding RNAs (lncRNAs). Lack of sequence conservation has been used to argue against functional relevance. Here, we investigated antisense lncRNAs, called COOLAIR, at the A. thaliana FLC locus and experimentally determined their secondary structure. The major COOLAIR variants are highly structured, organized by exon. The distally polyadenylated transcript has a complex multi-domain structure, altered by a single non-coding SNP defining a functionally distinct A. thaliana FLC haplotype. The A. thaliana COOLAIR secondary structure was used to predict COOLAIR exons in evolutionarily divergent Brassicaceae species. These predictions were validated through chemical probingmore » and cloning. Despite the relatively low nucleotide sequence identity, the structures, including multi-helix junctions, show remarkable evolutionary conservation. In a number of places, the structure is conserved through covariation of a non-contiguous DNA sequence. This structural conservation supports a functional role for COOLAIR transcripts rather than, or in addition to, antisense transcription.« less

  18. Haplotype block structure study of the CFTR gene. Most variants are associated with the M470 allele in several European populations.

    PubMed

    Pompei, Fiorenza; Ciminelli, Bianca Maria; Bombieri, Cristina; Ciccacci, Cinzia; Koudova, Monika; Giorgi, Silvia; Belpinati, Francesca; Begnini, Angela; Cerny, Milos; Des Georges, Marie; Claustres, Mireille; Ferec, Claude; Macek, Milan; Modiano, Guido; Pignatti, Pier Franco

    2006-01-01

    An average of about 1700 CFTR (cystic fibrosis transmembrane conductance regulator) alleles from normal individuals from different European populations were extensively screened for DNA sequence variation. A total of 80 variants were observed: 61 coding SNSs (results already published), 13 noncoding SNSs, three STRs, two short deletions, and one nucleotide insertion. Eight DNA variants were classified as non-CF causing due to their high frequency of occurrence. Through this survey the CFTR has become the most exhaustively studied gene for its coding sequence variability and, though to a lesser extent, for its noncoding sequence variability as well. Interestingly, most variation was associated with the M470 allele, while the V470 allele showed an 'extended haplotype homozygosity' (EHH). These findings make us suggest a role for selection acting either on the M470V itself or through an hitchhiking mechanism involving a second site. The possible ancient origin of the V allele in an 'out of Africa' time frame is discussed.

  19. Molecular cloning, structural analysis, and expression in Escherichia coli of a chitinase gene from Enterobacter agglomerans.

    PubMed Central

    Chernin, L S; De la Fuente, L; Sobolev, V; Haran, S; Vorgias, C E; Oppenheim, A B; Chet, I

    1997-01-01

    The gene chiA, which codes for endochitinase, was cloned from a soilborne Enterobacter agglomerans. Its complete sequence was determined, and the deduced amino acid sequence of the enzyme designated Chia_Entag yielded an open reading frame coding for 562 amino acids of a 61-kDa precursor protein with a putative leader peptide at its N terminus. The nucleotide and polypeptide sequences of Chia_Entag showed 86.8 and 87.7% identity with the corresponding gene and enzyme, Chia_Serma, of Serratia marcescens, respectively. Homology modeling of Chia_Entag's three-dimensional structure demonstrated that most amino acid substitutions are at solvent-accessible sites. Escherichia coli JM109 carrying the E. agglomerans chiA gene produced and secreted Chia_Entag. The antifungal activity of the secreted endochitinase was demonstrated in vitro by inhibition of Fusarium oxysporum spore germination. The transformed strain inhibited Rhizoctonia solani growth on plates and the root rot disease caused by this fungus in cotton seedlings under greenhouse conditions. PMID:9055404

  20. COOLAIR Antisense RNAs Form Evolutionarily Conserved Elaborate Secondary Structures

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hawkes, Emily J.; Hennelly, Scott P.; Novikova, Irina V.

    There is considerable debate about the functionality of long non-coding RNAs (lncRNAs). Lack of sequence conservation has been used to argue against functional relevance. Here, we investigated antisense lncRNAs, called COOLAIR, at the A. thaliana FLC locus and experimentally determined their secondary structure. The major COOLAIR variants are highly structured, organized by exon. The distally polyadenylated transcript has a complex multi-domain structure, altered by a single non-coding SNP defining a functionally distinct A. thaliana FLC haplotype. The A. thaliana COOLAIR secondary structure was used to predict COOLAIR exons in evolutionarily divergent Brassicaceae species. These predictions were validated through chemical probingmore » and cloning. Despite the relatively low nucleotide sequence identity, the structures, including multi-helix junctions, show remarkable evolutionary conservation. In a number of places, the structure is conserved through covariation of a non-contiguous DNA sequence. This structural conservation supports a functional role for COOLAIR transcripts rather than, or in addition to, antisense transcription.« less

  1. SIBIS: a Bayesian model for inconsistent protein sequence estimation.

    PubMed

    Khenoussi, Walyd; Vanhoutrève, Renaud; Poch, Olivier; Thompson, Julie D

    2014-09-01

    The prediction of protein coding genes is a major challenge that depends on the quality of genome sequencing, the accuracy of the model used to elucidate the exonic structure of the genes and the complexity of the gene splicing process leading to different protein variants. As a consequence, today's protein databases contain a huge amount of inconsistency, due to both natural variants and sequence prediction errors. We have developed a new method, called SIBIS, to detect such inconsistencies based on the evolutionary information in multiple sequence alignments. A Bayesian framework, combined with Dirichlet mixture models, is used to estimate the probability of observing specific amino acids and to detect inconsistent or erroneous sequence segments. We evaluated the performance of SIBIS on a reference set of protein sequences with experimentally validated errors and showed that the sensitivity is significantly higher than previous methods, with only a small loss of specificity. We also assessed a large set of human sequences from the UniProt database and found evidence of inconsistency in 48% of the previously uncharacterized sequences. We conclude that the integration of quality control methods like SIBIS in automatic analysis pipelines will be critical for the robust inference of structural, functional and phylogenetic information from these sequences. Source code, implemented in C on a linux system, and the datasets of protein sequences are freely available for download at http://www.lbgi.fr/∼julie/SIBIS. © The Author 2014. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  2. Synthetic versions of firefly luciferase and Renilla luciferase reporter genes that resist transgene silencing in sugarcane

    PubMed Central

    2014-01-01

    Background Down-regulation or silencing of transgene expression can be a major hurdle to both molecular studies and biotechnology applications in many plant species. Sugarcane is particularly effective at silencing introduced transgenes, including reporter genes such as the firefly luciferase gene. Synthesizing transgene coding sequences optimized for usage in the host plant is one method of enhancing transgene expression and stability. Using specified design rules we have synthesised new coding sequences for both the firefly luciferase and Renilla luciferase reporter genes. We have tested these optimized versions for enhanced levels of luciferase activity and for increased steady state luciferase mRNA levels in sugarcane. Results The synthetic firefly luciferase (luc*) and Renilla luciferase (Renluc*) coding sequences have elevated G + C contents in line with sugarcane codon usage, but maintain 75% identity to the native firefly or Renilla luciferase nucleotide sequences and 100% identity to the protein coding sequences. Under the control of the maize pUbi promoter, the synthetic luc* and Renluc* genes yielded 60x and 15x higher luciferase activity respectively, over the native firefly and Renilla luciferase genes in transient assays on sugarcane suspension cell cultures. Using a novel transient assay in sugarcane suspension cells combining co-bombardment and qRT-PCR, we showed that synthetic luc* and Renluc* genes generate increased transcript levels compared to the native firefly and Renilla luciferase genes. In stable transgenic lines, the luc* transgene generated significantly higher levels of expression than the native firefly luciferase transgene. The fold difference in expression was highest in the youngest tissues. Conclusions We developed synthetic versions of both the firefly and Renilla luciferase reporter genes that resist transgene silencing in sugarcane. These transgenes will be particularly useful for evaluating the expression patterns conferred by existing and newly isolated promoters in sugarcane tissues. The strategies used to design the synthetic luciferase transgenes could be applied to other transgenes that are aggressively silenced in sugarcane. PMID:24708613

  3. Synthetic versions of firefly luciferase and Renilla luciferase reporter genes that resist transgene silencing in sugarcane.

    PubMed

    Chou, Ting-Chun; Moyle, Richard L

    2014-04-08

    Down-regulation or silencing of transgene expression can be a major hurdle to both molecular studies and biotechnology applications in many plant species. Sugarcane is particularly effective at silencing introduced transgenes, including reporter genes such as the firefly luciferase gene.Synthesizing transgene coding sequences optimized for usage in the host plant is one method of enhancing transgene expression and stability. Using specified design rules we have synthesised new coding sequences for both the firefly luciferase and Renilla luciferase reporter genes. We have tested these optimized versions for enhanced levels of luciferase activity and for increased steady state luciferase mRNA levels in sugarcane. The synthetic firefly luciferase (luc*) and Renilla luciferase (Renluc*) coding sequences have elevated G + C contents in line with sugarcane codon usage, but maintain 75% identity to the native firefly or Renilla luciferase nucleotide sequences and 100% identity to the protein coding sequences.Under the control of the maize pUbi promoter, the synthetic luc* and Renluc* genes yielded 60x and 15x higher luciferase activity respectively, over the native firefly and Renilla luciferase genes in transient assays on sugarcane suspension cell cultures.Using a novel transient assay in sugarcane suspension cells combining co-bombardment and qRT-PCR, we showed that synthetic luc* and Renluc* genes generate increased transcript levels compared to the native firefly and Renilla luciferase genes.In stable transgenic lines, the luc* transgene generated significantly higher levels of expression than the native firefly luciferase transgene. The fold difference in expression was highest in the youngest tissues. We developed synthetic versions of both the firefly and Renilla luciferase reporter genes that resist transgene silencing in sugarcane. These transgenes will be particularly useful for evaluating the expression patterns conferred by existing and newly isolated promoters in sugarcane tissues. The strategies used to design the synthetic luciferase transgenes could be applied to other transgenes that are aggressively silenced in sugarcane.

  4. Molecular Cloning, Characterization, and Differential Expression of a Glucoamylase Gene from the Basidiomycetous Fungus Lentinula edodes

    PubMed Central

    Zhao, J.; Chen, Y. H.; Kwan, H. S.

    2000-01-01

    The complete nucleotide sequence of putative glucoamylase gene gla1 from the basidiomycetous fungus Lentinula edodes strain L54 is reported. The coding region of the genomic glucoamylase sequence, which is preceded by eukaryotic promoter elements CAAT and TATA, spans 2,076 bp. The gla1 gene sequence codes for a putative polypeptide of 571 amino acids and is interrupted by seven introns. The open reading frame sequence of the gla1 gene shows strong homology with those of other fungal glucoamylase genes and encodes a protein with an N-terminal catalytic domain and a C-terminal starch-binding domain. The similarity between the Gla1 protein and other fungal glucoamylases is from 45 to 61%, with the region of highest conservation found in catalytic domains and starch-binding domains. We compared the kinetics of glucoamylase activity and levels of gene expression in L. edodes strain L54 grown on different carbon sources (glucose, starch, cellulose, and potato extract) and in various developmental stages (mycelium growth, primordium appearance, and fruiting body formation). Quantitative reverse transcription PCR utilizing pairs of primers specific for gla1 gene expression shows that expression of gla1 was induced by starch and increased during the process of fruiting body formation, which indicates that glucoamylases may play an important role in the morphogenesis of the basidiomycetous fungus. PMID:10831434

  5. Pseudoscorpion mitochondria show rearranged genes and genome-wide reductions of RNA gene sizes and inferred structures, yet typical nucleotide composition bias

    PubMed Central

    2012-01-01

    Background Pseudoscorpions are chelicerates and have historically been viewed as being most closely related to solifuges, harvestmen, and scorpions. No mitochondrial genomes of pseudoscorpions have been published, but the mitochondrial genomes of some lineages of Chelicerata possess unusual features, including short rRNA genes and tRNA genes that lack sequence to encode arms of the canonical cloverleaf-shaped tRNA. Additionally, some chelicerates possess an atypical guanine-thymine nucleotide bias on the major coding strand of their mitochondrial genomes. Results We sequenced the mitochondrial genomes of two divergent taxa from the chelicerate order Pseudoscorpiones. We find that these genomes possess unusually short tRNA genes that do not encode cloverleaf-shaped tRNA structures. Indeed, in one genome, all 22 tRNA genes lack sequence to encode canonical cloverleaf structures. We also find that the large ribosomal RNA genes are substantially shorter than those of most arthropods. We inferred secondary structures of the LSU rRNAs from both pseudoscorpions, and find that they have lost multiple helices. Based on comparisons with the crystal structure of the bacterial ribosome, two of these helices were likely contact points with tRNA T-arms or D-arms as they pass through the ribosome during protein synthesis. The mitochondrial gene arrangements of both pseudoscorpions differ from the ancestral chelicerate gene arrangement. One genome is rearranged with respect to the location of protein-coding genes, the small rRNA gene, and at least 8 tRNA genes. The other genome contains 6 tRNA genes in novel locations. Most chelicerates with rearranged mitochondrial genes show a genome-wide reversal of the CA nucleotide bias typical for arthropods on their major coding strand, and instead possess a GT bias. Yet despite their extensive rearrangement, these pseudoscorpion mitochondrial genomes possess a CA bias on the major coding strand. Phylogenetic analyses of all 13 mitochondrial protein-coding gene sequences consistently yield trees that place pseudoscorpions as sister to acariform mites. Conclusion The well-supported phylogenetic placement of pseudoscorpions as sister to Acariformes differs from some previous analyses based on morphology. However, these two lineages share multiple molecular evolutionary traits, including substantial mitochondrial genome rearrangements, extensive nucleotide substitution, and loss of helices in their inferred tRNA and rRNA structures. PMID:22409411

  6. Nucleic and Amino Acid Sequences Support Structure-Based Viral Classification.

    PubMed

    Sinclair, Robert M; Ravantti, Janne J; Bamford, Dennis H

    2017-04-15

    Viral capsids ensure viral genome integrity by protecting the enclosed nucleic acids. Interactions between the genome and capsid and between individual capsid proteins (i.e., capsid architecture) are intimate and are expected to be characterized by strong evolutionary conservation. For this reason, a capsid structure-based viral classification has been proposed as a way to bring order to the viral universe. The seeming lack of sufficient sequence similarity to reproduce this classification has made it difficult to reject structural convergence as the basis for the classification. We reinvestigate whether the structure-based classification for viral coat proteins making icosahedral virus capsids is in fact supported by previously undetected sequence similarity. Since codon choices can influence nascent protein folding cotranslationally, we searched for both amino acid and nucleotide sequence similarity. To demonstrate the sensitivity of the approach, we identify a candidate gene for the pandoravirus capsid protein. We show that the structure-based classification is strongly supported by amino acid and also nucleotide sequence similarities, suggesting that the similarities are due to common descent. The correspondence between structure-based and sequence-based analyses of the same proteins shown here allow them to be used in future analyses of the relationship between linear sequence information and macromolecular function, as well as between linear sequence and protein folds. IMPORTANCE Viral capsids protect nucleic acid genomes, which in turn encode capsid proteins. This tight coupling of protein shell and nucleic acids, together with strong functional constraints on capsid protein folding and architecture, leads to the hypothesis that capsid protein-coding nucleotide sequences may retain signatures of ancient viral evolution. We have been able to show that this is indeed the case, using the major capsid proteins of viruses forming icosahedral capsids. Importantly, we detected similarity at the nucleotide level between capsid protein-coding regions from viruses infecting cells belonging to all three domains of life, reproducing a previously established structure-based classification of icosahedral viral capsids. Copyright © 2017 Sinclair et al.

  7. Nucleic and Amino Acid Sequences Support Structure-Based Viral Classification

    PubMed Central

    Sinclair, Robert M.; Ravantti, Janne J.

    2017-01-01

    ABSTRACT Viral capsids ensure viral genome integrity by protecting the enclosed nucleic acids. Interactions between the genome and capsid and between individual capsid proteins (i.e., capsid architecture) are intimate and are expected to be characterized by strong evolutionary conservation. For this reason, a capsid structure-based viral classification has been proposed as a way to bring order to the viral universe. The seeming lack of sufficient sequence similarity to reproduce this classification has made it difficult to reject structural convergence as the basis for the classification. We reinvestigate whether the structure-based classification for viral coat proteins making icosahedral virus capsids is in fact supported by previously undetected sequence similarity. Since codon choices can influence nascent protein folding cotranslationally, we searched for both amino acid and nucleotide sequence similarity. To demonstrate the sensitivity of the approach, we identify a candidate gene for the pandoravirus capsid protein. We show that the structure-based classification is strongly supported by amino acid and also nucleotide sequence similarities, suggesting that the similarities are due to common descent. The correspondence between structure-based and sequence-based analyses of the same proteins shown here allow them to be used in future analyses of the relationship between linear sequence information and macromolecular function, as well as between linear sequence and protein folds. IMPORTANCE Viral capsids protect nucleic acid genomes, which in turn encode capsid proteins. This tight coupling of protein shell and nucleic acids, together with strong functional constraints on capsid protein folding and architecture, leads to the hypothesis that capsid protein-coding nucleotide sequences may retain signatures of ancient viral evolution. We have been able to show that this is indeed the case, using the major capsid proteins of viruses forming icosahedral capsids. Importantly, we detected similarity at the nucleotide level between capsid protein-coding regions from viruses infecting cells belonging to all three domains of life, reproducing a previously established structure-based classification of icosahedral viral capsids. PMID:28122979

  8. Variability and transmission by Aphis glycines of North American and Asian Soybean mosaic virus isolates.

    PubMed

    Domier, L L; Latorre, I J; Steinlage, T A; McCoppin, N; Hartman, G L

    2003-10-01

    The variability of North American and Asian strains and isolates of Soybean mosaic virus was investigated. First, polymerase chain reaction (PCR) products representing the coat protein (CP)-coding regions of 38 SMVs were analyzed for restriction fragment length polymorphisms (RFLP). Second, the nucleotide and predicted amino acid sequence variability of the P1-coding region of 18 SMVs and the helper component/protease (HC/Pro) and CP-coding regions of 25 SMVs were assessed. The CP nucleotide and predicted amino acid sequences were the most similar and predicted phylogenetic relationships similar to those obtained from RFLP analysis. Neither RFLP nor sequence analyses of the CP-coding regions grouped the SMVs by geographical origin. The P1 and HC/Pro sequences were more variable and separated the North American and Asian SMV isolates into two groups similar to previously reported differences in pathogenic diversity of the two sets of SMV isolates. The P1 region was the most informative of the three regions analyzed. To assess the biological relevance of the sequence differences in the HC/Pro and CP coding regions, the transmissibility of 14 SMV isolates by Aphis glycines was tested. All field isolates of SMV were transmitted efficiently by A. glycines, but the laboratory isolates analyzed were transmitted poorly. The amino acid sequences from most, but not all, of the poorly transmitted isolates contained mutations in the aphid transmission-associated DAG and/or KLSC amino acid sequence motifs of CP and HC/Pro, respectively.

  9. Closed Genome Sequence of Chryseobacterium piperi Strain CTMT/ATCC BAA-1782, a Gram-Negative Bacterium with Clostridial Neurotoxin-Like Coding Sequences

    PubMed Central

    Wentz, Travis G.; Muruvanda, Tim; Thirunavukkarasu, Nagarajan; Hoffmann, Maria; Allard, Marc W.; Hodge, David R.; Pillai, Segaran P.; Hammack, Thomas S.; Brown, Eric W.

    2017-01-01

    ABSTRACT Clostridial neurotoxins, including botulinum and tetanus neurotoxins, are among the deadliest known bacterial toxins. Until recently, the horizontal mobility of this toxin gene family appeared to be limited to the genus Clostridium. We report here the closed genome sequence of Chryseobacterium piperi, a Gram-negative bacterium containing coding sequences with homology to clostridial neurotoxin family proteins. PMID:29192076

  10. Improving the genome annotation of the acarbose producer Actinoplanes sp. SE50/110 by sequencing enriched 5'-ends of primary transcripts.

    PubMed

    Schwientek, Patrick; Neshat, Armin; Kalinowski, Jörn; Klein, Andreas; Rückert, Christian; Schneiker-Bekel, Susanne; Wendler, Sergej; Stoye, Jens; Pühler, Alfred

    2014-11-20

    Actinoplanes sp. SE50/110 is the producer of the alpha-glucosidase inhibitor acarbose, which is an economically relevant and potent drug in the treatment of type-2 diabetes mellitus. In this study, we present the detection of transcription start sites on this genome by sequencing enriched 5'-ends of primary transcripts. Altogether, 1427 putative transcription start sites were initially identified. With help of the annotated genome sequence, 661 transcription start sites were found to belong to the leader region of protein-coding genes with the surprising result that roughly 20% of these genes rank among the class of leaderless transcripts. Next, conserved promoter motifs were identified for protein-coding genes with and without leader sequences. The mapped transcription start sites were finally used to improve the annotation of the Actinoplanes sp. SE50/110 genome sequence. Concerning protein-coding genes, 41 translation start sites were corrected and 9 novel protein-coding genes could be identified. In addition to this, 122 previously undetermined non-coding RNA (ncRNA) genes of Actinoplanes sp. SE50/110 were defined. Focusing on antisense transcription start sites located within coding genes or their leader sequences, it was discovered that 96 of those ncRNA genes belong to the class of antisense RNA (asRNA) genes. The remaining 26 ncRNA genes were found outside of known protein-coding genes. Four chosen examples of prominent ncRNA genes, namely the transfer messenger RNA gene ssrA, the ribonuclease P class A RNA gene rnpB, the cobalamin riboswitch RNA gene cobRS, and the selenocysteine-specific tRNA gene selC, are presented in more detail. This study demonstrates that sequencing of enriched 5'-ends of primary transcripts and the identification of transcription start sites are valuable tools for advanced genome annotation of Actinoplanes sp. SE50/110 and most probably also for other bacteria. Copyright © 2014 Elsevier B.V. All rights reserved.

  11. Complete mitochondrial genome sequence from an endangered Indian snake, Python molurus molurus (Serpentes, Pythonidae).

    PubMed

    Dubey, Bhawna; Meganathan, P R; Haque, Ikramul

    2012-07-01

    This paper reports the complete mitochondrial genome sequence of an endangered Indian snake, Python molurus molurus (Indian Rock Python). A typical snake mitochondrial (mt) genome of 17258 bp length comprising of 37 genes including the 13 protein coding genes, 22 tRNA genes, and 2 ribosomal RNA genes along with duplicate control regions is described herein. The P. molurus molurus mt. genome is relatively similar to other snake mt. genomes with respect to gene arrangement, composition, tRNA structures and skews of AT/GC bases. The nucleotide composition of the genome shows that there are more A-C % than T-G% on the positive strand as revealed by positive AT and CG skews. Comparison of individual protein coding genes, with other snake genomes suggests that ATP8 and NADH3 genes have high divergence rates. Codon usage analysis reveals a preference of NNC codons over NNG codons in the mt. genome of P. molurus. Also, the synonymous and non-synonymous substitution rates (ka/ks) suggest that most of the protein coding genes are under purifying selection pressure. The phylogenetic analyses involving the concatenated 13 protein coding genes of P. molurus molurus conformed to the previously established snake phylogeny.

  12. Synthetic phytochelatin surface display in Cupriavidus metallidurans CH34 for enhanced metals bioremediation.

    PubMed

    Biondo, Ronaldo; da Silva, Felipe Almeida; Vicente, Elisabete José; Souza Sarkis, Jorge Eduardo; Schenberg, Ana Clara Guerrini

    2012-08-07

    This work describes the effects of the cell surface display of a synthetic phytochelatin in the highly metal tolerant bacterium Cupriavidus metallidurans CH34. The EC20sp synthetic phytochelatin gene was fused between the coding sequences of the signal peptide (SS) and of the autotransporter β-domain of the Neisseria gonorrhoeae IgA protease precursor (IgAβ), which successfully targeted the hybrid protein toward the C. metallidurans outer membrane. The expression of the SS-EC20sp-IgAβ gene fusion was driven by a modified version of the Bacillus subtilis mrgA promoter showing high level basal gene expression that is further enhanced by metal presence in C. metallidurans. The recombinant strain showed increased ability to immobilize Pb(2+), Zn(2+), Cu(2+), Cd(2+), Mn(2+), and Ni(2+) ions from the external medium when compared to the control strain. To ensure plasmid stability and biological containment, the MOB region of the plasmid was replaced by the E. coli hok/sok coding sequence.

  13. Evaluation of non-coding variation in GLUT1 deficiency.

    PubMed

    Liu, Yu-Chi; Lee, Jia Wei Audrey; Bellows, Susannah T; Damiano, John A; Mullen, Saul A; Berkovic, Samuel F; Bahlo, Melanie; Scheffer, Ingrid E; Hildebrand, Michael S

    2016-12-01

    Loss-of-function mutations in SLC2A1, encoding glucose transporter-1 (GLUT-1), lead to dysfunction of glucose transport across the blood-brain barrier. Ten percent of cases with hypoglycorrhachia (fasting cerebrospinal fluid [CSF] glucose <2.2mmol/L) do not have mutations. We hypothesized that GLUT1 deficiency could be due to non-coding SLC2A1 variants. We performed whole exome sequencing of one proband with a GLUT1 phenotype and hypoglycorrhachia negative for SLC2A1 sequencing and copy number variants. We studied a further 55 patients with different epilepsies and low CSF glucose who did not have exonic mutations or copy number variants. We sequenced non-coding promoter and intronic regions. We performed mRNA studies for the recurrent intronic variant. The proband had a de novo splice site mutation five base pairs from the intron-exon boundary. Three of 55 patients had deep intronic SLC2A1 variants, including a recurrent variant in two. The recurrent variant produced less SLC2A1 mRNA transcript. Fasting CSF glucose levels show an age-dependent correlation, which makes the definition of hypoglycorrhachia challenging. Low CSF glucose levels may be associated with pathogenic SLC2A1 mutations including deep intronic SLC2A1 variants. Extending genetic screening to non-coding regions will enable diagnosis of more patients with GLUT1 deficiency, allowing implementation of the ketogenic diet to improve outcomes. © 2016 Mac Keith Press.

  14. COME: a robust coding potential calculation tool for lncRNA identification and characterization based on multiple features.

    PubMed

    Hu, Long; Xu, Zhiyu; Hu, Boqin; Lu, Zhi John

    2017-01-09

    Recent genomic studies suggest that novel long non-coding RNAs (lncRNAs) are specifically expressed and far outnumber annotated lncRNA sequences. To identify and characterize novel lncRNAs in RNA sequencing data from new samples, we have developed COME, a coding potential calculation tool based on multiple features. It integrates multiple sequence-derived and experiment-based features using a decompose-compose method, which makes it more accurate and robust than other well-known tools. We also showed that COME was able to substantially improve the consistency of predication results from other coding potential calculators. Moreover, COME annotates and characterizes each predicted lncRNA transcript with multiple lines of supporting evidence, which are not provided by other tools. Remarkably, we found that one subgroup of lncRNAs classified by such supporting features (i.e. conserved local RNA secondary structure) was highly enriched in a well-validated database (lncRNAdb). We further found that the conserved structural domains on lncRNAs had better chance than other RNA regions to interact with RNA binding proteins, based on the recent eCLIP-seq data in human, indicating their potential regulatory roles. Overall, we present COME as an accurate, robust and multiple-feature supported method for the identification and characterization of novel lncRNAs. The software implementation is available at https://github.com/lulab/COME. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  15. Motion Detection in Ultrasound Image-Sequences Using Tensor Voting

    NASA Astrophysics Data System (ADS)

    Inba, Masafumi; Yanagida, Hirotaka; Tamura, Yasutaka

    2008-05-01

    Motion detection in ultrasound image sequences using tensor voting is described. We have been developing an ultrasound imaging system adopting a combination of coded excitation and synthetic aperture focusing techniques. In our method, frame rate of the system at distance of 150 mm reaches 5000 frame/s. Sparse array and short duration coded ultrasound signals are used for high-speed data acquisition. However, many artifacts appear in the reconstructed image sequences because of the incompleteness of the transmitted code. To reduce the artifacts, we have examined the application of tensor voting to the imaging method which adopts both coded excitation and synthetic aperture techniques. In this study, the basis of applying tensor voting and the motion detection method to ultrasound images is derived. It was confirmed that velocity detection and feature enhancement are possible using tensor voting in the time and space of simulated ultrasound three-dimensional image sequences.

  16. SeqCompress: an algorithm for biological sequence compression.

    PubMed

    Sardaraz, Muhammad; Tahir, Muhammad; Ikram, Ataul Aziz; Bajwa, Hassan

    2014-10-01

    The growth of Next Generation Sequencing technologies presents significant research challenges, specifically to design bioinformatics tools that handle massive amount of data efficiently. Biological sequence data storage cost has become a noticeable proportion of total cost in the generation and analysis. Particularly increase in DNA sequencing rate is significantly outstripping the rate of increase in disk storage capacity, which may go beyond the limit of storage capacity. It is essential to develop algorithms that handle large data sets via better memory management. This article presents a DNA sequence compression algorithm SeqCompress that copes with the space complexity of biological sequences. The algorithm is based on lossless data compression and uses statistical model as well as arithmetic coding to compress DNA sequences. The proposed algorithm is compared with recent specialized compression tools for biological sequences. Experimental results show that proposed algorithm has better compression gain as compared to other existing algorithms. Copyright © 2014 Elsevier Inc. All rights reserved.

  17. The primary structure of the Saccharomyces cerevisiae gene for 3-phosphoglycerate kinase.

    PubMed Central

    Hitzeman, R A; Hagie, F E; Hayflick, J S; Chen, C Y; Seeburg, P H; Derynck, R

    1982-01-01

    The DNA sequence of the gene for the yeast glycolytic enzyme, 3-phosphoglycerate kinase (PGK), has been obtained by sequencing part of a 3.1 kbp HindIII fragment obtained from the yeast genome. The structural gene sequence corresponds to a reading frame of 1251 bp coding for 416 amino acids with no intervening DNA sequences. The amino acid sequence is approximately 65 percent homologous with human and horse PGK protein sequences and is in general agreement with the published protein sequence for yeast PGK. As for other highly expressed structural genes in yeast, the coding sequence is highly codon biased with 95 percent of the amino acids coded for by a select 25 codons (out of 61 possible). Besides structural DNA sequence, 291 bp of 5'-flanking sequence and 286 bp of 3'-flanking sequence were determined. Transcription starts 36 nucleotides upstream from the translational start and stops 86-93 nucleotides downstream from the translational stop. These results suggest a non-polyadenylated mRNA length of 1373 to 1380 nucleotides, which is consistent with the observed length of 1500 nucleotides for polyadenylated PGK mRNA. A sequence TATATATAAA is found at 145 nucleotides upstream from the translational start. This sequence resembles the TATAAA box that is possibly associated with RNA polymerase II binding. Images PMID:6296791

  18. Codes in the codons: construction of a codon/amino acid periodic table and a study of the nature of specific nucleic acid-protein interactions.

    PubMed

    Benyo, B; Biro, J C; Benyo, Z

    2004-01-01

    The theory of "codon-amino acid coevolution" was first proposed by Woese in 1967. It suggests that there is a stereochemical matching - that is, affinity - between amino acids and certain of the base triplet sequences that code for those amino acids. We have constructed a common periodic table of codons and amino acids, where the nucleic acid table showed perfect axial symmetry for codons and the corresponding amino acid table also displayed periodicity regarding the biochemical properties (charge and hydrophobicity) of the 20 amino acids and the position of the stop signals. The table indicates that the middle (2/sup nd/) amino acid in the codon has a prominent role in determining some of the structural features of the amino acids. The possibility that physical contact between codons and amino acids might exist was tested on restriction enzymes. Many recognition site-like sequences were found in the coding sequences of these enzymes and as many as 73 examples of codon-amino acid co-location were observed in the 7 known 3D structures (December 2003) of endonuclease-nucleic acid complexes. These results indicate that the smallest possible units of specific nucleic acid-protein interaction are indeed the stereochemically compatible codons and amino acids.

  19. Genome Analysis Reveals Interplay between 5′UTR Introns and Nuclear mRNA Export for Secretory and Mitochondrial Genes

    PubMed Central

    Cenik, Can; Chua, Hon Nian; Zhang, Hui; Tarnawsky, Stefan P.; Akef, Abdalla; Derti, Adnan; Tasan, Murat; Moore, Melissa J.; Palazzo, Alexander F.; Roth, Frederick P.

    2011-01-01

    In higher eukaryotes, messenger RNAs (mRNAs) are exported from the nucleus to the cytoplasm via factors deposited near the 5′ end of the transcript during splicing. The signal sequence coding region (SSCR) can support an alternative mRNA export (ALREX) pathway that does not require splicing. However, most SSCR–containing genes also have introns, so the interplay between these export mechanisms remains unclear. Here we support a model in which the furthest upstream element in a given transcript, be it an intron or an ALREX–promoting SSCR, dictates the mRNA export pathway used. We also experimentally demonstrate that nuclear-encoded mitochondrial genes can use the ALREX pathway. Thus, ALREX can also be supported by nucleotide signals within mitochondrial-targeting sequence coding regions (MSCRs). Finally, we identified and experimentally verified novel motifs associated with the ALREX pathway that are shared by both SSCRs and MSCRs. Our results show strong correlation between 5′ untranslated region (5′UTR) intron presence/absence and sequence features at the beginning of the coding region. They also suggest that genes encoding secretory and mitochondrial proteins share a common regulatory mechanism at the level of mRNA export. PMID:21533221

  20. Sequence data and association statistics from 12,940 type 2 diabetes cases and controls.

    PubMed

    Flannick, Jason; Fuchsberger, Christian; Mahajan, Anubha; Teslovich, Tanya M; Agarwala, Vineeta; Gaulton, Kyle J; Caulkins, Lizz; Koesterer, Ryan; Ma, Clement; Moutsianas, Loukas; McCarthy, Davis J; Rivas, Manuel A; Perry, John R B; Sim, Xueling; Blackwell, Thomas W; Robertson, Neil R; Rayner, N William; Cingolani, Pablo; Locke, Adam E; Tajes, Juan Fernandez; Highland, Heather M; Dupuis, Josee; Chines, Peter S; Lindgren, Cecilia M; Hartl, Christopher; Jackson, Anne U; Chen, Han; Huyghe, Jeroen R; van de Bunt, Martijn; Pearson, Richard D; Kumar, Ashish; Müller-Nurasyid, Martina; Grarup, Niels; Stringham, Heather M; Gamazon, Eric R; Lee, Jaehoon; Chen, Yuhui; Scott, Robert A; Below, Jennifer E; Chen, Peng; Huang, Jinyan; Go, Min Jin; Stitzel, Michael L; Pasko, Dorota; Parker, Stephen C J; Varga, Tibor V; Green, Todd; Beer, Nicola L; Day-Williams, Aaron G; Ferreira, Teresa; Fingerlin, Tasha; Horikoshi, Momoko; Hu, Cheng; Huh, Iksoo; Ikram, Mohammad Kamran; Kim, Bong-Jo; Kim, Yongkang; Kim, Young Jin; Kwon, Min-Seok; Lee, Juyoung; Lee, Selyeong; Lin, Keng-Han; Maxwell, Taylor J; Nagai, Yoshihiko; Wang, Xu; Welch, Ryan P; Yoon, Joon; Zhang, Weihua; Barzilai, Nir; Voight, Benjamin F; Han, Bok-Ghee; Jenkinson, Christopher P; Kuulasmaa, Teemu; Kuusisto, Johanna; Manning, Alisa; Ng, Maggie C Y; Palmer, Nicholette D; Balkau, Beverley; Stančáková, Alena; Abboud, Hanna E; Boeing, Heiner; Giedraitis, Vilmantas; Prabhakaran, Dorairaj; Gottesman, Omri; Scott, James; Carey, Jason; Kwan, Phoenix; Grant, George; Smith, Joshua D; Neale, Benjamin M; Purcell, Shaun; Butterworth, Adam S; Howson, Joanna M M; Lee, Heung Man; Lu, Yingchang; Kwak, Soo-Heon; Zhao, Wei; Danesh, John; Lam, Vincent K L; Park, Kyong Soo; Saleheen, Danish; So, Wing Yee; Tam, Claudia H T; Afzal, Uzma; Aguilar, David; Arya, Rector; Aung, Tin; Chan, Edmund; Navarro, Carmen; Cheng, Ching-Yu; Palli, Domenico; Correa, Adolfo; Curran, Joanne E; Rybin, Dennis; Farook, Vidya S; Fowler, Sharon P; Freedman, Barry I; Griswold, Michael; Hale, Daniel Esten; Hicks, Pamela J; Khor, Chiea-Chuen; Kumar, Satish; Lehne, Benjamin; Thuillier, Dorothée; Lim, Wei Yen; Liu, Jianjun; Loh, Marie; Musani, Solomon K; Puppala, Sobha; Scott, William R; Yengo, Loïc; Tan, Sian-Tsung; Taylor, Herman A; Thameem, Farook; Wilson, Gregory; Wong, Tien Yin; Njølstad, Pål Rasmus; Levy, Jonathan C; Mangino, Massimo; Bonnycastle, Lori L; Schwarzmayr, Thomas; Fadista, João; Surdulescu, Gabriela L; Herder, Christian; Groves, Christopher J; Wieland, Thomas; Bork-Jensen, Jette; Brandslund, Ivan; Christensen, Cramer; Koistinen, Heikki A; Doney, Alex S F; Kinnunen, Leena; Esko, Tõnu; Farmer, Andrew J; Hakaste, Liisa; Hodgkiss, Dylan; Kravic, Jasmina; Lyssenko, Valeri; Hollensted, Mette; Jørgensen, Marit E; Jørgensen, Torben; Ladenvall, Claes; Justesen, Johanne Marie; Käräjämäki, Annemari; Kriebel, Jennifer; Rathmann, Wolfgang; Lannfelt, Lars; Lauritzen, Torsten; Narisu, Narisu; Linneberg, Allan; Melander, Olle; Milani, Lili; Neville, Matt; Orho-Melander, Marju; Qi, Lu; Qi, Qibin; Roden, Michael; Rolandsson, Olov; Swift, Amy; Rosengren, Anders H; Stirrups, Kathleen; Wood, Andrew R; Mihailov, Evelin; Blancher, Christine; Carneiro, Mauricio O; Maguire, Jared; Poplin, Ryan; Shakir, Khalid; Fennell, Timothy; DePristo, Mark; de Angelis, Martin Hrabé; Deloukas, Panos; Gjesing, Anette P; Jun, Goo; Nilsson, Peter; Murphy, Jacquelyn; Onofrio, Robert; Thorand, Barbara; Hansen, Torben; Meisinger, Christa; Hu, Frank B; Isomaa, Bo; Karpe, Fredrik; Liang, Liming; Peters, Annette; Huth, Cornelia; O'Rahilly, Stephen P; Palmer, Colin N A; Pedersen, Oluf; Rauramaa, Rainer; Tuomilehto, Jaakko; Salomaa, Veikko; Watanabe, Richard M; Syvänen, Ann-Christine; Bergman, Richard N; Bharadwaj, Dwaipayan; Bottinger, Erwin P; Cho, Yoon Shin; Chandak, Giriraj R; Chan, Juliana Cn; Chia, Kee Seng; Daly, Mark J; Ebrahim, Shah B; Langenberg, Claudia; Elliott, Paul; Jablonski, Kathleen A; Lehman, Donna M; Jia, Weiping; Ma, Ronald C W; Pollin, Toni I; Sandhu, Manjinder; Tandon, Nikhil; Froguel, Philippe; Barroso, Inês; Teo, Yik Ying; Zeggini, Eleftheria; Loos, Ruth J F; Small, Kerrin S; Ried, Janina S; DeFronzo, Ralph A; Grallert, Harald; Glaser, Benjamin; Metspalu, Andres; Wareham, Nicholas J; Walker, Mark; Banks, Eric; Gieger, Christian; Ingelsson, Erik; Im, Hae Kyung; Illig, Thomas; Franks, Paul W; Buck, Gemma; Trakalo, Joseph; Buck, David; Prokopenko, Inga; Mägi, Reedik; Lind, Lars; Farjoun, Yossi; Owen, Katharine R; Gloyn, Anna L; Strauch, Konstantin; Tuomi, Tiinamaija; Kooner, Jaspal Singh; Lee, Jong-Young; Park, Taesung; Donnelly, Peter; Morris, Andrew D; Hattersley, Andrew T; Bowden, Donald W; Collins, Francis S; Atzmon, Gil; Chambers, John C; Spector, Timothy D; Laakso, Markku; Strom, Tim M; Bell, Graeme I; Blangero, John; Duggirala, Ravindranath; Tai, E Shyong; McVean, Gilean; Hanis, Craig L; Wilson, James G; Seielstad, Mark; Frayling, Timothy M; Meigs, James B; Cox, Nancy J; Sladek, Rob; Lander, Eric S; Gabriel, Stacey; Mohlke, Karen L; Meitinger, Thomas; Groop, Leif; Abecasis, Goncalo; Scott, Laura J; Morris, Andrew P; Kang, Hyun Min; Altshuler, David; Burtt, Noël P; Florez, Jose C; Boehnke, Michael; McCarthy, Mark I

    2017-12-19

    To investigate the genetic basis of type 2 diabetes (T2D) to high resolution, the GoT2D and T2D-GENES consortia catalogued variation from whole-genome sequencing of 2,657 European individuals and exome sequencing of 12,940 individuals of multiple ancestries. Over 27M SNPs, indels, and structural variants were identified, including 99% of low-frequency (minor allele frequency [MAF] 0.1-5%) non-coding variants in the whole-genome sequenced individuals and 99.7% of low-frequency coding variants in the whole-exome sequenced individuals. Each variant was tested for association with T2D in the sequenced individuals, and, to increase power, most were tested in larger numbers of individuals (>80% of low-frequency coding variants in ~82 K Europeans via the exome chip, and ~90% of low-frequency non-coding variants in ~44 K Europeans via genotype imputation). The variants, genotypes, and association statistics from these analyses provide the largest reference to date of human genetic information relevant to T2D, for use in activities such as T2D-focused genotype imputation, functional characterization of variants or genes, and other novel analyses to detect associations between sequence variation and T2D.

  1. Sequence data and association statistics from 12,940 type 2 diabetes cases and controls

    PubMed Central

    Jason, Flannick; Fuchsberger, Christian; Mahajan, Anubha; Teslovich, Tanya M.; Agarwala, Vineeta; Gaulton, Kyle J.; Caulkins, Lizz; Koesterer, Ryan; Ma, Clement; Moutsianas, Loukas; McCarthy, Davis J.; Rivas, Manuel A.; Perry, John R. B.; Sim, Xueling; Blackwell, Thomas W.; Robertson, Neil R.; Rayner, N William; Cingolani, Pablo; Locke, Adam E.; Tajes, Juan Fernandez; Highland, Heather M.; Dupuis, Josee; Chines, Peter S.; Lindgren, Cecilia M.; Hartl, Christopher; Jackson, Anne U.; Chen, Han; Huyghe, Jeroen R.; van de Bunt, Martijn; Pearson, Richard D.; Kumar, Ashish; Müller-Nurasyid, Martina; Grarup, Niels; Stringham, Heather M.; Gamazon, Eric R.; Lee, Jaehoon; Chen, Yuhui; Scott, Robert A.; Below, Jennifer E.; Chen, Peng; Huang, Jinyan; Go, Min Jin; Stitzel, Michael L.; Pasko, Dorota; Parker, Stephen C. J.; Varga, Tibor V.; Green, Todd; Beer, Nicola L.; Day-Williams, Aaron G.; Ferreira, Teresa; Fingerlin, Tasha; Horikoshi, Momoko; Hu, Cheng; Huh, Iksoo; Ikram, Mohammad Kamran; Kim, Bong-Jo; Kim, Yongkang; Kim, Young Jin; Kwon, Min-Seok; Lee, Juyoung; Lee, Selyeong; Lin, Keng-Han; Maxwell, Taylor J.; Nagai, Yoshihiko; Wang, Xu; Welch, Ryan P.; Yoon, Joon; Zhang, Weihua; Barzilai, Nir; Voight, Benjamin F.; Han, Bok-Ghee; Jenkinson, Christopher P.; Kuulasmaa, Teemu; Kuusisto, Johanna; Manning, Alisa; Ng, Maggie C. Y.; Palmer, Nicholette D.; Balkau, Beverley; Stančáková, Alena; Abboud, Hanna E.; Boeing, Heiner; Giedraitis, Vilmantas; Prabhakaran, Dorairaj; Gottesman, Omri; Scott, James; Carey, Jason; Kwan, Phoenix; Grant, George; Smith, Joshua D.; Neale, Benjamin M.; Purcell, Shaun; Butterworth, Adam S.; Howson, Joanna M. M.; Lee, Heung Man; Lu, Yingchang; Kwak, Soo-Heon; Zhao, Wei; Danesh, John; Lam, Vincent K. L.; Park, Kyong Soo; Saleheen, Danish; So, Wing Yee; Tam, Claudia H. T.; Afzal, Uzma; Aguilar, David; Arya, Rector; Aung, Tin; Chan, Edmund; Navarro, Carmen; Cheng, Ching-Yu; Palli, Domenico; Correa, Adolfo; Curran, Joanne E.; Rybin, Dennis; Farook, Vidya S.; Fowler, Sharon P.; Freedman, Barry I.; Griswold, Michael; Hale, Daniel Esten; Hicks, Pamela J.; Khor, Chiea-Chuen; Kumar, Satish; Lehne, Benjamin; Thuillier, Dorothée; Lim, Wei Yen; Liu, Jianjun; Loh, Marie; Musani, Solomon K.; Puppala, Sobha; Scott, William R.; Yengo, Loïc; Tan, Sian-Tsung; Taylor, Herman A.; Thameem, Farook; Wilson, Gregory; Wong, Tien Yin; Njølstad, Pål Rasmus; Levy, Jonathan C.; Mangino, Massimo; Bonnycastle, Lori L.; Schwarzmayr, Thomas; Fadista, João; Surdulescu, Gabriela L.; Herder, Christian; Groves, Christopher J.; Wieland, Thomas; Bork-Jensen, Jette; Brandslund, Ivan; Christensen, Cramer; Koistinen, Heikki A.; Doney, Alex S. F.; Kinnunen, Leena; Esko, Tõnu; Farmer, Andrew J.; Hakaste, Liisa; Hodgkiss, Dylan; Kravic, Jasmina; Lyssenko, Valeri; Hollensted, Mette; Jørgensen, Marit E.; Jørgensen, Torben; Ladenvall, Claes; Justesen, Johanne Marie; Käräjämäki, Annemari; Kriebel, Jennifer; Rathmann, Wolfgang; Lannfelt, Lars; Lauritzen, Torsten; Narisu, Narisu; Linneberg, Allan; Melander, Olle; Milani, Lili; Neville, Matt; Orho-Melander, Marju; Qi, Lu; Qi, Qibin; Roden, Michael; Rolandsson, Olov; Swift, Amy; Rosengren, Anders H.; Stirrups, Kathleen; Wood, Andrew R.; Mihailov, Evelin; Blancher, Christine; Carneiro, Mauricio O.; Maguire, Jared; Poplin, Ryan; Shakir, Khalid; Fennell, Timothy; DePristo, Mark; de Angelis, Martin Hrabé; Deloukas, Panos; Gjesing, Anette P.; Jun, Goo; Nilsson, Peter; Murphy, Jacquelyn; Onofrio, Robert; Thorand, Barbara; Hansen, Torben; Meisinger, Christa; Hu, Frank B.; Isomaa, Bo; Karpe, Fredrik; Liang, Liming; Peters, Annette; Huth, Cornelia; O'Rahilly, Stephen P; Palmer, Colin N. A.; Pedersen, Oluf; Rauramaa, Rainer; Tuomilehto, Jaakko; Salomaa, Veikko; Watanabe, Richard M.; Syvänen, Ann-Christine; Bergman, Richard N.; Bharadwaj, Dwaipayan; Bottinger, Erwin P.; Cho, Yoon Shin; Chandak, Giriraj R.; Chan, Juliana CN; Chia, Kee Seng; Daly, Mark J.; Ebrahim, Shah B.; Langenberg, Claudia; Elliott, Paul; Jablonski, Kathleen A.; Lehman, Donna M.; Jia, Weiping; Ma, Ronald C. W.; Pollin, Toni I.; Sandhu, Manjinder; Tandon, Nikhil; Froguel, Philippe; Barroso, Inês; Teo, Yik Ying; Zeggini, Eleftheria; Loos, Ruth J. F.; Small, Kerrin S.; Ried, Janina S.; DeFronzo, Ralph A.; Grallert, Harald; Glaser, Benjamin; Metspalu, Andres; Wareham, Nicholas J.; Walker, Mark; Banks, Eric; Gieger, Christian; Ingelsson, Erik; Im, Hae Kyung; Illig, Thomas; Franks, Paul W.; Buck, Gemma; Trakalo, Joseph; Buck, David; Prokopenko, Inga; Mägi, Reedik; Lind, Lars; Farjoun, Yossi; Owen, Katharine R.; Gloyn, Anna L.; Strauch, Konstantin; Tuomi, Tiinamaija; Kooner, Jaspal Singh; Lee, Jong-Young; Park, Taesung; Donnelly, Peter; Morris, Andrew D.; Hattersley, Andrew T.; Bowden, Donald W.; Collins, Francis S.; Atzmon, Gil; Chambers, John C.; Spector, Timothy D.; Laakso, Markku; Strom, Tim M.; Bell, Graeme I.; Blangero, John; Duggirala, Ravindranath; Tai, E. Shyong; McVean, Gilean; Hanis, Craig L.; Wilson, James G.; Seielstad, Mark; Frayling, Timothy M.; Meigs, James B.; Cox, Nancy J.; Sladek, Rob; Lander, Eric S.; Gabriel, Stacey; Mohlke, Karen L.; Meitinger, Thomas; Groop, Leif; Abecasis, Goncalo; Scott, Laura J.; Morris, Andrew P.; Kang, Hyun Min; Altshuler, David; Burtt, Noël P.; Florez, Jose C.; Boehnke, Michael; McCarthy, Mark I.

    2017-01-01

    To investigate the genetic basis of type 2 diabetes (T2D) to high resolution, the GoT2D and T2D-GENES consortia catalogued variation from whole-genome sequencing of 2,657 European individuals and exome sequencing of 12,940 individuals of multiple ancestries. Over 27M SNPs, indels, and structural variants were identified, including 99% of low-frequency (minor allele frequency [MAF] 0.1–5%) non-coding variants in the whole-genome sequenced individuals and 99.7% of low-frequency coding variants in the whole-exome sequenced individuals. Each variant was tested for association with T2D in the sequenced individuals, and, to increase power, most were tested in larger numbers of individuals (>80% of low-frequency coding variants in ~82 K Europeans via the exome chip, and ~90% of low-frequency non-coding variants in ~44 K Europeans via genotype imputation). The variants, genotypes, and association statistics from these analyses provide the largest reference to date of human genetic information relevant to T2D, for use in activities such as T2D-focused genotype imputation, functional characterization of variants or genes, and other novel analyses to detect associations between sequence variation and T2D. PMID:29257133

  2. HAlign-II: efficient ultra-large multiple sequence alignment and phylogenetic tree reconstruction with distributed and parallel computing.

    PubMed

    Wan, Shixiang; Zou, Quan

    2017-01-01

    Multiple sequence alignment (MSA) plays a key role in biological sequence analyses, especially in phylogenetic tree construction. Extreme increase in next-generation sequencing results in shortage of efficient ultra-large biological sequence alignment approaches for coping with different sequence types. Distributed and parallel computing represents a crucial technique for accelerating ultra-large (e.g. files more than 1 GB) sequence analyses. Based on HAlign and Spark distributed computing system, we implement a highly cost-efficient and time-efficient HAlign-II tool to address ultra-large multiple biological sequence alignment and phylogenetic tree construction. The experiments in the DNA and protein large scale data sets, which are more than 1GB files, showed that HAlign II could save time and space. It outperformed the current software tools. HAlign-II can efficiently carry out MSA and construct phylogenetic trees with ultra-large numbers of biological sequences. HAlign-II shows extremely high memory efficiency and scales well with increases in computing resource. THAlign-II provides a user-friendly web server based on our distributed computing infrastructure. HAlign-II with open-source codes and datasets was established at http://lab.malab.cn/soft/halign.

  3. Cloning and High-Level Expression of α-Galactosidase cDNA from Penicillium purpurogenum

    PubMed Central

    Shibuya, Hajime; Nagasaki, Hiroaki; Kaneko, Satoshi; Yoshida, Shigeki; Park, Gwi Gun; Kusakabe, Isao; Kobayashi, Hideyuki

    1998-01-01

    The cDNA coding for Penicillium purpurogenum α-galactosidase (αGal) was cloned and sequenced. The deduced amino acid sequence of the α-Gal cDNA showed that the mature enzyme consisted of 419 amino acid residues with a molecular mass of 46,334 Da. The derived amino acid sequence of the enzyme showed similarity to eukaryotic αGals from plants, animals, yeasts, and filamentous fungi. The highest similarity observed (57% identity) was to Trichoderma reesei AGLI. The cDNA was expressed in Saccharomyces cerevisiae under the control of the yeast GAL10 promoter. Almost all of the enzyme produced was secreted into the culture medium, and the expression level reached was approximately 0.2 g/liter. The recombinant enzyme purified to homogeneity was highly glycosylated, showed slightly higher specific activity, and exhibited properties almost identical to those of the native enzyme from P. purpurogenum in terms of the N-terminal amino acid sequence, thermoactivity, pH profile, and mode of action on galacto-oligosaccharides. PMID:9797312

  4. Genome-guided exploration of metabolic features of Streptomyces peucetius ATCC 27952: past, current, and prospect.

    PubMed

    Thuan, Nguyen Huy; Dhakal, Dipesh; Pokhrel, Anaya Raj; Chu, Luan Luong; Van Pham, Thi Thuy; Shrestha, Anil; Sohng, Jae Kyung

    2018-05-01

    Streptomyces peucetius ATCC 27952 produces two major anthracyclines, doxorubicin (DXR) and daunorubicin (DNR), which are potent chemotherapeutic agents for the treatment of several cancers. In order to gain detailed insight on genetics and biochemistry of the strain, the complete genome was determined and analyzed. The result showed that its complete sequence contains 7187 protein coding genes in a total of 8,023,114 bp, whereas 87% of the genome contributed to the protein coding region. The genomic sequence included 18 rRNA, 66 tRNAs, and 3 non-coding RNAs. In silico studies predicted ~ 68 biosynthetic gene clusters (BCGs) encoding diverse classes of secondary metabolites, including non-ribosomal polyketide synthase (NRPS), polyketide synthase (PKS I, II, and III), terpenes, and others. Detailed analysis of the genome sequence revealed versatile biocatalytic enzymes such as cytochrome P450 (CYP), electron transfer systems (ETS) genes, methyltransferase (MT), glycosyltransferase (GT). In addition, numerous functional genes (transporter gene, SOD, etc.) and regulatory genes (afsR-sp, metK-sp, etc.) involved in the regulation of secondary metabolites were found. This minireview summarizes the genome-based genome mining (GM) of diverse BCGs and genome exploration (GE) of versatile biocatalytic enzymes, and other enzymes involved in maintenance and regulation of metabolism of S. peucetius. The detailed analysis of genome sequence provides critically important knowledge useful in the bioengineering of the strain or harboring catalytically efficient enzymes for biotechnological applications.

  5. Not All Order Memory Is Equal: Test Demands Reveal Dissociations in Memory for Sequence Information

    ERIC Educational Resources Information Center

    Jonker, Tanya R.; MacLeod, Colin M.

    2017-01-01

    Remembering the order of a sequence of events is a fundamental feature of episodic memory. Indeed, a number of formal models represent temporal context as part of the memory system, and memory for order has been researched extensively. Yet, the nature of the code(s) underlying sequence memory is still relatively unknown. Across 4 experiments that…

  6. Complete mitochondrial genome sequence of the heart failure model of cardiomyopathic Syrian hamster (Mesocricetus auratus).

    PubMed

    Hu, Bo; Liu, Dong-Xing; Zhang, Yu-Qing; Song, Jian-Tao; Ji, Xian-Fei; Hou, Zhi-Qiang; Zhang, Zhen-Hai

    2016-05-01

    In this study we sequenced the complete mitochondrial genome sequencing of a heart failure model of cardiomyopathic Syrian hamster (Mesocricetus auratus) for the first time. The total length of the mitogenome was 16,267 bp. It harbored 13 protein-coding genes, 2 ribosomal RNA genes, 22 transfer RNA genes and 1 non-coding control region.

  7. Code-Switching to Know a TL Equivalent of an L1 Word: Request-Provision-Acknowledgement (RPA) Sequence

    ERIC Educational Resources Information Center

    Lucero, Edgar

    2011-01-01

    This article focuses on the learner's use of Code-switching to learn the TL (Target Language) equivalent of an L1 word. The interactional pattern that this situation creates defines the Request-Provision-Acknowledgement (RPA) sequence. The article explains each of the turns of the sequence under the combination of the Ethnomethodological…

  8. Quantitative analysis of the anti-noise performance of an m-sequence in an electromagnetic method

    NASA Astrophysics Data System (ADS)

    Yuan, Zhe; Zhang, Yiming; Zheng, Qijia

    2018-02-01

    An electromagnetic method with a transmitted waveform coded by an m-sequence achieved better anti-noise performance compared to the conventional manner with a square-wave. The anti-noise performance of the m-sequence varied with multiple coding parameters; hence, a quantitative analysis of the anti-noise performance for m-sequences with different coding parameters was required to optimize them. This paper proposes the concept of an identification system, with the identified Earth impulse response obtained by measuring the system output with the input of the voltage response. A quantitative analysis of the anti-noise performance of the m-sequence was achieved by analyzing the amplitude-frequency response of the corresponding identification system. The effects of the coding parameters on the anti-noise performance are summarized by numerical simulation, and their optimization is further discussed in our conclusions; the validity of the conclusions is further verified by field experiment. The quantitative analysis method proposed in this paper provides a new insight into the anti-noise mechanism of the m-sequence, and could be used to evaluate the anti-noise performance of artificial sources in other time-domain exploration methods, such as the seismic method.

  9. RAMICS: trainable, high-speed and biologically relevant alignment of high-throughput sequencing reads to coding DNA.

    PubMed

    Wright, Imogen A; Travers, Simon A

    2014-07-01

    The challenge presented by high-throughput sequencing necessitates the development of novel tools for accurate alignment of reads to reference sequences. Current approaches focus on using heuristics to map reads quickly to large genomes, rather than generating highly accurate alignments in coding regions. Such approaches are, thus, unsuited for applications such as amplicon-based analysis and the realignment phase of exome sequencing and RNA-seq, where accurate and biologically relevant alignment of coding regions is critical. To facilitate such analyses, we have developed a novel tool, RAMICS, that is tailored to mapping large numbers of sequence reads to short lengths (<10 000 bp) of coding DNA. RAMICS utilizes profile hidden Markov models to discover the open reading frame of each sequence and aligns to the reference sequence in a biologically relevant manner, distinguishing between genuine codon-sized indels and frameshift mutations. This approach facilitates the generation of highly accurate alignments, accounting for the error biases of the sequencing machine used to generate reads, particularly at homopolymer regions. Performance improvements are gained through the use of graphics processing units, which increase the speed of mapping through parallelization. RAMICS substantially outperforms all other mapping approaches tested in terms of alignment quality while maintaining highly competitive speed performance. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  10. Genomics dataset on unclassified published organism (patent US 7547531).

    PubMed

    Khan Shawan, Mohammad Mahfuz Ali; Hasan, Md Ashraful; Hossain, Md Mozammel; Hasan, Md Mahmudul; Parvin, Afroza; Akter, Salina; Uddin, Kazi Rasel; Banik, Subrata; Morshed, Mahbubul; Rahman, Md Nazibur; Rahman, S M Badier

    2016-12-01

    Nucleotide (DNA) sequence analysis provides important clues regarding the characteristics and taxonomic position of an organism. With the intention that, DNA sequence analysis is very crucial to learn about hierarchical classification of that particular organism. This dataset (patent US 7547531) is chosen to simplify all the complex raw data buried in undisclosed DNA sequences which help to open doors for new collaborations. In this data, a total of 48 unidentified DNA sequences from patent US 7547531 were selected and their complete sequences were retrieved from NCBI BioSample database. Quick response (QR) code of those DNA sequences was constructed by DNA BarID tool. QR code is useful for the identification and comparison of isolates with other organisms. AT/GC content of the DNA sequences was determined using ENDMEMO GC Content Calculator, which indicates their stability at different temperature. The highest GC content was observed in GP445188 (62.5%) which was followed by GP445198 (61.8%) and GP445189 (59.44%), while lowest was in GP445178 (24.39%). In addition, New England BioLabs (NEB) database was used to identify cleavage code indicating the 5, 3 and blunt end and enzyme code indicating the methylation site of the DNA sequences was also shown. These data will be helpful for the construction of the organisms' hierarchical classification, determination of their phylogenetic and taxonomic position and revelation of their molecular characteristics.

  11. Beta-keratins of differentiating epidermis of snake comprise glycine-proline-serine-rich proteins with an avian-like gene organization.

    PubMed

    Dalla Valle, Luisa; Nardi, Alessia; Belvedere, Paola; Toni, Mattia; Alibardi, Lorenzo

    2007-07-01

    Beta-keratins of reptilian scales have been recently cloned and characterized in some lizards. Here we report for the first time the sequence of some beta-keratins from the snake Elaphe guttata. Five different cDNAs were obtained using 5'- and 3'-RACE analyses. Four sequences differ by only few nucleotides in the coding region, whereas the last cDNA shows, in this region, only 84% of identity. The gene corresponding to one of the cDNA sequences has a single intron present in the 5'-untranslated region. This genomic organization is similar to that of birds' beta-keratins. Cloning and Southern blotting analysis suggest that snake beta-keratins belong to a family of high-related genes as for geckos. PCR analysis suggests a head-to-tail orientation of genes in the same chromosome. In situ hybridization detected beta-keratin transcripts almost exclusively in differentiating oberhautchen and beta-cells of the snake epidermis in renewal phase. This is confirmed by Northern blotting that showed, in this phase, a high expression of two different transcripts whereas only the longer transcript is expressed at a much lower level in resting skin. The cDNA coding sequences encoded putative glycine-proline-serine rich proteins containing 137-139 amino acids, with apparent isoelectric point at 7.5 and 8.2. A central region, rich in proline, shows over 50% homology with avian scale, claw, and feather keratins. The prediction of secondary structure shows mainly a random coil conformation and few beta-strand regions in the central region, likely involved in the formation of a fibrous framework of beta-keratins. This region was possibly present in basic reptiles that originated reptiles and birds. Copyright 2007 Wiley-Liss, Inc.

  12. RNAcode: Robust discrimination of coding and noncoding regions in comparative sequence data

    PubMed Central

    Washietl, Stefan; Findeiß, Sven; Müller, Stephan A.; Kalkhof, Stefan; von Bergen, Martin; Hofacker, Ivo L.; Stadler, Peter F.; Goldman, Nick

    2011-01-01

    With the availability of genome-wide transcription data and massive comparative sequencing, the discrimination of coding from noncoding RNAs and the assessment of coding potential in evolutionarily conserved regions arose as a core analysis task. Here we present RNAcode, a program to detect coding regions in multiple sequence alignments that is optimized for emerging applications not covered by current protein gene-finding software. Our algorithm combines information from nucleotide substitution and gap patterns in a unified framework and also deals with real-life issues such as alignment and sequencing errors. It uses an explicit statistical model with no machine learning component and can therefore be applied “out of the box,” without any training, to data from all domains of life. We describe the RNAcode method and apply it in combination with mass spectrometry experiments to predict and confirm seven novel short peptides in Escherichia coli and to analyze the coding potential of RNAs previously annotated as “noncoding.” RNAcode is open source software and available for all major platforms at http://wash.github.com/rnacode. PMID:21357752

  13. RNAcode: robust discrimination of coding and noncoding regions in comparative sequence data.

    PubMed

    Washietl, Stefan; Findeiss, Sven; Müller, Stephan A; Kalkhof, Stefan; von Bergen, Martin; Hofacker, Ivo L; Stadler, Peter F; Goldman, Nick

    2011-04-01

    With the availability of genome-wide transcription data and massive comparative sequencing, the discrimination of coding from noncoding RNAs and the assessment of coding potential in evolutionarily conserved regions arose as a core analysis task. Here we present RNAcode, a program to detect coding regions in multiple sequence alignments that is optimized for emerging applications not covered by current protein gene-finding software. Our algorithm combines information from nucleotide substitution and gap patterns in a unified framework and also deals with real-life issues such as alignment and sequencing errors. It uses an explicit statistical model with no machine learning component and can therefore be applied "out of the box," without any training, to data from all domains of life. We describe the RNAcode method and apply it in combination with mass spectrometry experiments to predict and confirm seven novel short peptides in Escherichia coli and to analyze the coding potential of RNAs previously annotated as "noncoding." RNAcode is open source software and available for all major platforms at http://wash.github.com/rnacode.

  14. High compression image and image sequence coding

    NASA Technical Reports Server (NTRS)

    Kunt, Murat

    1989-01-01

    The digital representation of an image requires a very large number of bits. This number is even larger for an image sequence. The goal of image coding is to reduce this number, as much as possible, and reconstruct a faithful duplicate of the original picture or image sequence. Early efforts in image coding, solely guided by information theory, led to a plethora of methods. The compression ratio reached a plateau around 10:1 a couple of years ago. Recent progress in the study of the brain mechanism of vision and scene analysis has opened new vistas in picture coding. Directional sensitivity of the neurones in the visual pathway combined with the separate processing of contours and textures has led to a new class of coding methods capable of achieving compression ratios as high as 100:1 for images and around 300:1 for image sequences. Recent progress on some of the main avenues of object-based methods is presented. These second generation techniques make use of contour-texture modeling, new results in neurophysiology and psychophysics and scene analysis.

  15. Polymorphism and selection in the major histocompatibility complex DRA and DQA genes in the family Equidae.

    PubMed

    Janova, Eva; Matiasovic, Jan; Vahala, Jiri; Vodicka, Roman; Van Dyk, Enette; Horin, Petr

    2009-07-01

    The major histocompatibility complex genes coding for antigen binding and presenting molecules are the most polymorphic genes in the vertebrate genome. We studied the DRA and DQA gene polymorphism of the family Equidae. In addition to 11 previously reported DRA and 24 DQA alleles, six new DRA sequences and 13 new DQA alleles were identified in the genus Equus. Phylogenetic analysis of both DRA and DQA sequences provided evidence for trans-species polymorphism in the family Equidae. The phylogenetic trees differed from species relationships defined by standard taxonomy of Equidae and from trees based on mitochondrial or neutral gene sequence data. Analysis of selection showed differences between the less variable DRA and more variable DQA genes. DRA alleles were more often shared by more species. The DQA sequences analysed showed strong amongst-species positive selection; the selected amino acid positions mostly corresponded to selected positions in rodent and human DQA genes.

  16. Fast H.264/AVC FRExt intra coding using belief propagation.

    PubMed

    Milani, Simone

    2011-01-01

    In the H.264/AVC FRExt coder, the coding performance of Intra coding significantly overcomes the previous still image coding standards, like JPEG2000, thanks to a massive use of spatial prediction. Unfortunately, the adoption of an extensive set of predictors induces a significant increase of the computational complexity required by the rate-distortion optimization routine. The paper presents a complexity reduction strategy that aims at reducing the computational load of the Intra coding with a small loss in the compression performance. The proposed algorithm relies on selecting a reduced set of prediction modes according to their probabilities, which are estimated adopting a belief-propagation procedure. Experimental results show that the proposed method permits saving up to 60 % of the coding time required by an exhaustive rate-distortion optimization method with a negligible loss in performance. Moreover, it permits an accurate control of the computational complexity unlike other methods where the computational complexity depends upon the coded sequence.

  17. Unexpected allelic heterogeneity and spectrum of mutations in Fowler syndrome revealed by next-generation exome sequencing.

    PubMed

    Lalonde, Emilie; Albrecht, Steffen; Ha, Kevin C H; Jacob, Karine; Bolduc, Nathalie; Polychronakos, Constantin; Dechelotte, Pierre; Majewski, Jacek; Jabado, Nada

    2010-08-01

    Protein coding genes constitute approximately 1% of the human genome but harbor 85% of the mutations with large effects on disease-related traits. Therefore, efficient strategies for selectively sequencing complete coding regions (i.e., "whole exome") have the potential to contribute our understanding of human diseases. We used a method for whole-exome sequencing coupling Agilent whole-exome capture to the Illumina DNA-sequencing platform, and investigated two unrelated fetuses from nonconsanguineous families with Fowler Syndrome (FS), a stereotyped phenotype lethal disease. We report novel germline mutations in feline leukemia virus subgroup C cellular-receptor-family member 2, FLVCR2, which has recently been shown to cause FS. Using this technology, we identified three types of genetic abnormalities: point-mutations, insertions-deletions, and intronic splice-site changes (first pathogenic report using this technology), in the fetuses who both were compound heterozygotes for the disease. Although revealing a high level of allelic heterogeneity and mutational spectrum in FS, this study further illustrates the successful application of whole-exome sequencing to uncover genetic defects in rare Mendelian disorders. Of importance, we show that we can identify genes underlying rare, monogenic and recessive diseases using a limited number of patients (n=2), in the absence of shared genetic heritage and in the presence of allelic heterogeneity.

  18. Mutant type glutathione S-transferase theta 1 gene homologue to mTOR in myelodysplastic syndrome: possible clinical application of rapamycin.

    PubMed

    Maeda, Yasuhiro; Yamaguchi, Terufumi; Ueda, Satomi; Matsuo, Koki; Morita, Yasuyoshi; Naiki, Yoshito; Miyazato, Hajime; Shimada, Takahiro; Miyatake, Jun-Ichi; Matsuda, Mitsuhiro; Kanamaru, Akihisa

    2003-07-01

    In this study, we observed the expression of the GSTT-1 gene in patients with myelodysplastic syndrome (MDS) at the messenger RNA level. Reverse transcription-polymerase chain reaction (RT-PCR) for GSTT-1 was performed with a pair of primers complementary to the 5' coding section and the 3' coding section of the GSTT-1 cDNA for amplifying the 623-bp band. Among 20 patients with MDS, 8 patients showed the expected 623-bp band on RT-PCR, and 12 patients showed a 500-bp band on RT-PCR, indicating that a 123-bp sequence was deleted as a mutant of the GSTT-1 gene. Furthermore, a BLAST DNA search showed that the deletion of a 123 bp sequence creates a sequence that is 63% homologous to human FKBP-rapamycin associated protein (FRAP); this protein has been termed a mammalian target of rapamycin (mTOR). We respectively transfected the wild type and the mutant type GSTT-1 gene in an expression vector to two cell lines (K562 and HL-60). The stable transformants for the wild type and the mutant type GSTT-1 genes were made by G418 selection. Interestingly, rapamycin could induce significant growth inhibition of the stable transformants for mutant type GSTT-1, which was indicative of apoptosis, but not that of those for wild type GSTT-1. These results suggest that rapamycin could be included in the therapeutic modality for the patients with MDS who have the mTOR sequences in GSTT-1 gene.

  19. Next-Generation Sequencing of Protein-Coding and Long Non-protein-Coding RNAs in Two Types of Exosomes Derived from Human Whole Saliva.

    PubMed

    Ogawa, Yuko; Tsujimoto, Masafumi; Yanoshita, Ryohei

    2016-01-01

    Exosomes are small extracellular vesicles containing microRNAs and mRNAs that are produced by various types of cells. We previously used ultrafiltration and size-exclusion chromatography to isolate two types of human salivary exosomes (exosomes I, II) that are different in size and proteomes. We showed that salivary exosomes contain large repertoires of small RNAs. However, precise information regarding long RNAs in salivary exosomes has not been fully determined. In this study, we investigated the compositions of protein-coding RNAs (pcRNAs) and long non-protein-coding RNAs (lncRNAs) of exosome I, exosome II and whole saliva (WS) by next-generation sequencing technology. Although 11% of all RNAs were commonly detected among the three samples, the compositions of reads mapping to known RNAs were similar. The most abundant pcRNA is ribosomal RNA protein, and pcRNAs of some salivary proteins such as S100 calcium-binding protein A8 (protein S100-A8) were present in salivary exosomes. Interestingly, lncRNAs of pseudogenes (presumably, processed pseudogenes) were abundant in exosome I, exosome II and WS. Translationally controlled tumor protein gene, which plays an important role in cell proliferation, cell death and immune responses, was highly expressed as pcRNA and pseudogenes in salivary exosomes. Our results show that salivary exosomes contain various types of RNAs such as pseudogenes and small RNAs, and may mediate intercellular communication by transferring these RNAs to target cells as gene expression regulators.

  20. Shaping electromagnetic waves using software-automatically-designed metasurfaces.

    PubMed

    Zhang, Qian; Wan, Xiang; Liu, Shuo; Yuan Yin, Jia; Zhang, Lei; Jun Cui, Tie

    2017-06-15

    We present a fully digital procedure of designing reflective coding metasurfaces to shape reflected electromagnetic waves. The design procedure is completely automatic, controlled by a personal computer. In details, the macro coding units of metasurface are automatically divided into several types (e.g. two types for 1-bit coding, four types for 2-bit coding, etc.), and each type of the macro coding units is formed by discretely random arrangement of micro coding units. By combining an optimization algorithm and commercial electromagnetic software, the digital patterns of the macro coding units are optimized to possess constant phase difference for the reflected waves. The apertures of the designed reflective metasurfaces are formed by arranging the macro coding units with certain coding sequence. To experimentally verify the performance, a coding metasurface is fabricated by automatically designing two digital 1-bit unit cells, which are arranged in array to constitute a periodic coding metasurface to generate the required four-beam radiations with specific directions. Two complicated functional metasurfaces with circularly- and elliptically-shaped radiation beams are realized by automatically designing 4-bit macro coding units, showing excellent performance of the automatic designs by software. The proposed method provides a smart tool to realize various functional devices and systems automatically.

  1. Alignment-based and alignment-free methods converge with experimental data on amino acids coded by stop codons at split between nuclear and mitochondrial genetic codes.

    PubMed

    Seligmann, Hervé

    2018-05-01

    Genetic codes mainly evolve by reassigning punctuation codons, starts and stops. Previous analyses assuming that undefined amino acids translate stops showed greater divergence between nuclear and mitochondrial genetic codes. Here, three independent methods converge on which amino acids translated stops at split between nuclear and mitochondrial genetic codes: (a) alignment-free genetic code comparisons inserting different amino acids at stops; (b) alignment-based blast analyses of hypothetical peptides translated from non-coding mitochondrial sequences, inserting different amino acids at stops; (c) biases in amino acid insertions at stops in proteomic data. Hence short-term protein evolution models reconstruct long-term genetic code evolution. Mitochondria reassign stops to amino acids otherwise inserted at stops by codon-anticodon mismatches (near-cognate tRNAs). Hence dual function (translation termination and translation by codon-anticodon mismatch) precedes mitochondrial reassignments of stops to amino acids. Stop ambiguity increases coded information, compensates endocellular mitogenome reduction. Mitochondrial codon reassignments might prevent viral infections. Copyright © 2018 Elsevier B.V. All rights reserved.

  2. Sexual selection drives evolution and rapid turnover of male gene expression.

    PubMed

    Harrison, Peter W; Wright, Alison E; Zimmer, Fabian; Dean, Rebecca; Montgomery, Stephen H; Pointer, Marie A; Mank, Judith E

    2015-04-07

    The profound and pervasive differences in gene expression observed between males and females, and the unique evolutionary properties of these genes in many species, have led to the widespread assumption that they are the product of sexual selection and sexual conflict. However, we still lack a clear understanding of the connection between sexual selection and transcriptional dimorphism, often termed sex-biased gene expression. Moreover, the relative contribution of sexual selection vs. drift in shaping broad patterns of expression, divergence, and polymorphism remains unknown. To assess the role of sexual selection in shaping these patterns, we assembled transcriptomes from an avian clade representing the full range of sexual dimorphism and sexual selection. We use these species to test the links between sexual selection and sex-biased gene expression evolution in a comparative framework. Through ancestral reconstruction of sex bias, we demonstrate a rapid turnover of sex bias across this clade driven by sexual selection and show it to be primarily the result of expression changes in males. We use phylogenetically controlled comparative methods to demonstrate that phenotypic measures of sexual selection predict the proportion of male-biased but not female-biased gene expression. Although male-biased genes show elevated rates of coding sequence evolution, consistent with previous reports in a range of taxa, there is no association between sexual selection and rates of coding sequence evolution, suggesting that expression changes may be more important than coding sequence in sexual selection. Taken together, our results highlight the power of sexual selection to act on gene expression differences and shape genome evolution.

  3. Implications of natural selection in shaping 99.4% nonsynonymous DNA identity between humans and chimpanzees: Enlarging genus Homo

    PubMed Central

    Wildman, Derek E.; Uddin, Monica; Liu, Guozhen; Grossman, Lawrence I.; Goodman, Morris

    2003-01-01

    What do functionally important DNA sites, those scrutinized and shaped by natural selection, tell us about the place of humans in evolution? Here we compare ≈90 kb of coding DNA nucleotide sequence from 97 human genes to their sequenced chimpanzee counterparts and to available sequenced gorilla, orangutan, and Old World monkey counterparts, and, on a more limited basis, to mouse. The nonsynonymous changes (functionally important), like synonymous changes (functionally much less important), show chimpanzees and humans to be most closely related, sharing 99.4% identity at nonsynonymous sites and 98.4% at synonymous sites. On a time scale, the coding DNA divergencies separate the human–chimpanzee clade from the gorilla clade at between 6 and 7 million years ago and place the most recent common ancestor of humans and chimpanzees at between 5 and 6 million years ago. The evolutionary rate of coding DNA in the catarrhine clade (Old World monkey and ape, including human) is much slower than in the lineage to mouse. Among the genes examined, 30 show evidence of positive selection during descent of catarrhines. Nonsynonymous substitutions by themselves, in this subset of positively selected genes, group humans and chimpanzees closest to each other and have chimpanzees diverge about as much from the common human–chimpanzee ancestor as humans do. This functional DNA evidence supports two previously offered taxonomic proposals: family Hominidae should include all extant apes; and genus Homo should include three extant species and two subgenera, Homo (Homo) sapiens (humankind), Homo (Pan) troglodytes (common chimpanzee), and Homo (Pan) paniscus (bonobo chimpanzee). PMID:12766228

  4. Implications of natural selection in shaping 99.4% nonsynonymous DNA identity between humans and chimpanzees: enlarging genus Homo.

    PubMed

    Wildman, Derek E; Uddin, Monica; Liu, Guozhen; Grossman, Lawrence I; Goodman, Morris

    2003-06-10

    What do functionally important DNA sites, those scrutinized and shaped by natural selection, tell us about the place of humans in evolution? Here we compare approximately 90 kb of coding DNA nucleotide sequence from 97 human genes to their sequenced chimpanzee counterparts and to available sequenced gorilla, orangutan, and Old World monkey counterparts, and, on a more limited basis, to mouse. The nonsynonymous changes (functionally important), like synonymous changes (functionally much less important), show chimpanzees and humans to be most closely related, sharing 99.4% identity at nonsynonymous sites and 98.4% at synonymous sites. On a time scale, the coding DNA divergencies separate the human-chimpanzee clade from the gorilla clade at between 6 and 7 million years ago and place the most recent common ancestor of humans and chimpanzees at between 5 and 6 million years ago. The evolutionary rate of coding DNA in the catarrhine clade (Old World monkey and ape, including human) is much slower than in the lineage to mouse. Among the genes examined, 30 show evidence of positive selection during descent of catarrhines. Nonsynonymous substitutions by themselves, in this subset of positively selected genes, group humans and chimpanzees closest to each other and have chimpanzees diverge about as much from the common human-chimpanzee ancestor as humans do. This functional DNA evidence supports two previously offered taxonomic proposals: family Hominidae should include all extant apes; and genus Homo should include three extant species and two subgenera, Homo (Homo) sapiens (humankind), Homo (Pan) troglodytes (common chimpanzee), and Homo (Pan) paniscus (bonobo chimpanzee).

  5. Draft Genome Sequence of Pantoea ananatis Strain 1.38, a Bacterium Isolated from the Rhizosphere of Oryza sativa var. Puntal That Shows Biotechnological Potential as an Inoculant

    PubMed Central

    Megías, Esaú; dos Reis Junior, Fábio Bueno; Ribeiro, Renan Augusto; Ollero, Francisco Javier; Megías, Manuel

    2018-01-01

    ABSTRACT Pantoea ananatis 1.38 is a strain isolated from the rhizosphere of irrigated rice in southern Spain. Its genome was estimated at 4,869,281 bp, with 4,644 coding sequences (CDSs). The genome encompasses several CDSs related to plant growth promotion, such as that for siderophore metabolism, and virulence genes characteristic of pathogenic Pantoea spp. are absent. PMID:29371365

  6. Lossless Video Sequence Compression Using Adaptive Prediction

    NASA Technical Reports Server (NTRS)

    Li, Ying; Sayood, Khalid

    2007-01-01

    We present an adaptive lossless video compression algorithm based on predictive coding. The proposed algorithm exploits temporal, spatial, and spectral redundancies in a backward adaptive fashion with extremely low side information. The computational complexity is further reduced by using a caching strategy. We also study the relationship between the operational domain for the coder (wavelet or spatial) and the amount of temporal and spatial redundancy in the sequence being encoded. Experimental results show that the proposed scheme provides significant improvements in compression efficiencies.

  7. Mitochondrial genome diversity in dagger and needle nematodes (Nematoda: Longidoridae).

    PubMed

    Palomares-Rius, J E; Cantalapiedra-Navarrete, C; Archidona-Yuste, A; Blok, V C; Castillo, P

    2017-02-02

    Dagger and needle nematodes included in the family Longidoridae (viz. Longidorus, Paralongidorus, and Xiphinema) are highly polyphagous plant-parasitic nematodes in wild and cultivated plants and some of them are plant-virus vectors (nepovirus). The mitochondrial (mt) genomes of the dagger and needle nematodes, Xiphinema rivesi, Xiphinema pachtaicum, Longidorus vineacola and Paralongidorus litoralis were sequenced in this study. The four circular mt genomes have an estimated size of 12.6, 12.5, 13.5 and 12.7 kb, respectively. Up to date, the mt genome of X. pachtaicum is the smallest genome found in Nematoda. The four mt genomes contain 12 protein-coding genes (viz. cox1-3, nad1-6, nad4L, atp6 and cob) and two ribosomal RNA genes (rrnL and rrnS), but the atp8 gene was not detected. These mt genomes showed a gene arrangement very different within the Longidoridae species sequenced, with the exception of very closely related species (X. americanum and X. rivesi). The sizes of non-coding regions in the Longidoridae nematodes were very small and were present in a few places in the mt genome. Phylogenetic analysis of all coding genes showed a closer relationship between Longidorus and Paralongidorus and different phylogenetic possibilities for the three Xiphinema species.

  8. Mitochondrial genome diversity in dagger and needle nematodes (Nematoda: Longidoridae)

    PubMed Central

    Palomares-Rius, J. E.; Cantalapiedra-Navarrete, C.; Archidona-Yuste, A.; Blok, V. C.; Castillo, P.

    2017-01-01

    Dagger and needle nematodes included in the family Longidoridae (viz. Longidorus, Paralongidorus, and Xiphinema) are highly polyphagous plant-parasitic nematodes in wild and cultivated plants and some of them are plant-virus vectors (nepovirus). The mitochondrial (mt) genomes of the dagger and needle nematodes, Xiphinema rivesi, Xiphinema pachtaicum, Longidorus vineacola and Paralongidorus litoralis were sequenced in this study. The four circular mt genomes have an estimated size of 12.6, 12.5, 13.5 and 12.7 kb, respectively. Up to date, the mt genome of X. pachtaicum is the smallest genome found in Nematoda. The four mt genomes contain 12 protein-coding genes (viz. cox1-3, nad1-6, nad4L, atp6 and cob) and two ribosomal RNA genes (rrnL and rrnS), but the atp8 gene was not detected. These mt genomes showed a gene arrangement very different within the Longidoridae species sequenced, with the exception of very closely related species (X. americanum and X. rivesi). The sizes of non-coding regions in the Longidoridae nematodes were very small and were present in a few places in the mt genome. Phylogenetic analysis of all coding genes showed a closer relationship between Longidorus and Paralongidorus and different phylogenetic possibilities for the three Xiphinema species. PMID:28150734

  9. SHARAKU: an algorithm for aligning and clustering read mapping profiles of deep sequencing in non-coding RNA processing.

    PubMed

    Tsuchiya, Mariko; Amano, Kojiro; Abe, Masaya; Seki, Misato; Hase, Sumitaka; Sato, Kengo; Sakakibara, Yasubumi

    2016-06-15

    Deep sequencing of the transcripts of regulatory non-coding RNA generates footprints of post-transcriptional processes. After obtaining sequence reads, the short reads are mapped to a reference genome, and specific mapping patterns can be detected called read mapping profiles, which are distinct from random non-functional degradation patterns. These patterns reflect the maturation processes that lead to the production of shorter RNA sequences. Recent next-generation sequencing studies have revealed not only the typical maturation process of miRNAs but also the various processing mechanisms of small RNAs derived from tRNAs and snoRNAs. We developed an algorithm termed SHARAKU to align two read mapping profiles of next-generation sequencing outputs for non-coding RNAs. In contrast with previous work, SHARAKU incorporates the primary and secondary sequence structures into an alignment of read mapping profiles to allow for the detection of common processing patterns. Using a benchmark simulated dataset, SHARAKU exhibited superior performance to previous methods for correctly clustering the read mapping profiles with respect to 5'-end processing and 3'-end processing from degradation patterns and in detecting similar processing patterns in deriving the shorter RNAs. Further, using experimental data of small RNA sequencing for the common marmoset brain, SHARAKU succeeded in identifying the significant clusters of read mapping profiles for similar processing patterns of small derived RNA families expressed in the brain. The source code of our program SHARAKU is available at http://www.dna.bio.keio.ac.jp/sharaku/, and the simulated dataset used in this work is available at the same link. Accession code: The sequence data from the whole RNA transcripts in the hippocampus of the left brain used in this work is available from the DNA DataBank of Japan (DDBJ) Sequence Read Archive (DRA) under the accession number DRA004502. yasu@bio.keio.ac.jp Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press.

  10. Mechanisms of haplotype divergence at the RGA08 nucleotide-binding leucine-rich repeat gene locus in wild banana (Musa balbisiana).

    PubMed

    Baurens, Franc-Christophe; Bocs, Stéphanie; Rouard, Mathieu; Matsumoto, Takashi; Miller, Robert N G; Rodier-Goud, Marguerite; MBéguié-A-MBéguié, Didier; Yahiaoui, Nabila

    2010-07-16

    Comparative sequence analysis of complex loci such as resistance gene analog clusters allows estimating the degree of sequence conservation and mechanisms of divergence at the intraspecies level. In banana (Musa sp.), two diploid wild species Musa acuminata (A genome) and Musa balbisiana (B genome) contribute to the polyploid genome of many cultivars. The M. balbisiana species is associated with vigour and tolerance to pests and disease and little is known on the genome structure and haplotype diversity within this species. Here, we compare two genomic sequences of 253 and 223 kb corresponding to two haplotypes of the RGA08 resistance gene analog locus in M. balbisiana "Pisang Klutuk Wulung" (PKW). Sequence comparison revealed two regions of contrasting features. The first is a highly colinear gene-rich region where the two haplotypes diverge only by single nucleotide polymorphisms and two repetitive element insertions. The second corresponds to a large cluster of RGA08 genes, with 13 and 18 predicted RGA genes and pseudogenes spread over 131 and 152 kb respectively on each haplotype. The RGA08 cluster is enriched in repetitive element insertions, in duplicated non-coding intergenic sequences including low complexity regions and shows structural variations between haplotypes. Although some allelic relationships are retained, a large diversity of RGA08 genes occurs in this single M. balbisiana genotype, with several RGA08 paralogs specific to each haplotype. The RGA08 gene family has evolved by mechanisms of unequal recombination, intragenic sequence exchange and diversifying selection. An unequal recombination event taking place between duplicated non-coding intergenic sequences resulted in a different RGA08 gene content between haplotypes pointing out the role of such duplicated regions in the evolution of RGA clusters. Based on the synonymous substitution rate in coding sequences, we estimated a 1 million year divergence time for these M. balbisiana haplotypes. A large RGA08 gene cluster identified in wild banana corresponds to a highly variable genomic region between haplotypes surrounded by conserved flanking regions. High level of sequence identity (70 to 99%) of the genic and intergenic regions suggests a recent and rapid evolution of this cluster in M. balbisiana.

  11. Intervening sequences in a plant gene-comparison of the partial sequence of cDNA and genomic DNA of French bean phaseolin

    NASA Astrophysics Data System (ADS)

    Sun, S. M.; Slightom, J. L.; Hall, T. C.

    1981-01-01

    A plant gene coding for the major storage protein (phaseolin, G1-globulin) of the French bean was isolated from a genomic library constructed in the phage vector Charon 24A. Comparison of the nucleotide sequence of part of the gene with that of the cloned messenger RNA (cDNA) revealed the presence of three intervening sequences, all beginning with GTand ending with AG. The 5' and 3' boundaries of intervening sequences TVS-A (88 base pairs) and IVS-B (124 base pairs) are similar to those described for animal and viral genes, but the 3' boundary of IVS-C (129 base pairs) shows some differences. A sequence of 185 amino acids deduced from the cloned DMAs represents about 40% of a phaseolin polypeptide.

  12. Efficient analysis of mouse genome sequences reveal many nonsense variants

    PubMed Central

    Steeland, Sophie; Timmermans, Steven; Van Ryckeghem, Sara; Hulpiau, Paco; Saeys, Yvan; Van Montagu, Marc; Vandenbroucke, Roosmarijn E.; Libert, Claude

    2016-01-01

    Genetic polymorphisms in coding genes play an important role when using mouse inbred strains as research models. They have been shown to influence research results, explain phenotypical differences between inbred strains, and increase the amount of interesting gene variants present in the many available inbred lines. SPRET/Ei is an inbred strain derived from Mus spretus that has ∼1% sequence difference with the C57BL/6J reference genome. We obtained a listing of all SNPs and insertions/deletions (indels) present in SPRET/Ei from the Mouse Genomes Project (Wellcome Trust Sanger Institute) and processed these data to obtain an overview of all transcripts having nonsynonymous coding sequence variants. We identified 8,883 unique variants affecting 10,096 different transcripts from 6,328 protein-coding genes, which is about 28% of all coding genes. Because only a subset of these variants results in drastic changes in proteins, we focused on variations that are nonsense mutations that ultimately resulted in a gain of a stop codon. These genes were identified by in silico changing the C57BL/6J coding sequences to the SPRET/Ei sequences, converting them to amino acid (AA) sequences, and comparing the AA sequences. All variants and transcripts affected were also stored in a database, which can be browsed using a SPRET/Ei M. spretus variants web tool (www.spretus.org), including a manual. We validated the tool by demonstrating the loss of function of three proteins predicted to be severely truncated, namely Fas, IRAK2, and IFNγR1. PMID:27147605

  13. Anticipatory activity in primary motor cortex codes memorized movement sequences.

    PubMed

    Lu, Xiaofeng; Ashe, James

    2005-03-24

    Movement sequences, defined both by the component movements and by the serial order in which they are produced, are fundamental building blocks of motor behavior. The serial order of sequence production is strongly encoded in medial motor areas. It is not known to what extent sequences are further elaborated or encoded in primary motor cortex. Here, we describe cells in the primary motor cortex of the monkey that show anticipatory activity exclusively related to a specific memorized sequence of upcoming movements. In addition, the injection of muscimol, a GABA agonist, into motor cortex resulted in an increase in the error rate during sequence production, without concomitant effects on nonsequenced motor performance. Our results challenge the role of medial motor areas in the control of well-practiced movement sequences and suggest that motor cortex contains a complete apparatus for the planning and production of this complex behavior.

  14. Cost-effective sequencing of full-length cDNA clones powered by a de novo-reference hybrid assembly.

    PubMed

    Kuroshu, Reginaldo M; Watanabe, Junichi; Sugano, Sumio; Morishita, Shinichi; Suzuki, Yutaka; Kasahara, Masahiro

    2010-05-07

    Sequencing full-length cDNA clones is important to determine gene structures including alternative splice forms, and provides valuable resources for experimental analyses to reveal the biological functions of coded proteins. However, previous approaches for sequencing cDNA clones were expensive or time-consuming, and therefore, a fast and efficient sequencing approach was demanded. We developed a program, MuSICA 2, that assembles millions of short (36-nucleotide) reads collected from a single flow cell lane of Illumina Genome Analyzer to shotgun-sequence approximately 800 human full-length cDNA clones. MuSICA 2 performs a hybrid assembly in which an external de novo assembler is run first and the result is then improved by reference alignment of shotgun reads. We compared the MuSICA 2 assembly with 200 pooled full-length cDNA clones finished independently by the conventional primer-walking using Sanger sequencers. The exon-intron structure of the coding sequence was correct for more than 95% of the clones with coding sequence annotation when we excluded cDNA clones insufficiently represented in the shotgun library due to PCR failure (42 out of 200 clones excluded), and the nucleotide-level accuracy of coding sequences of those correct clones was over 99.99%. We also applied MuSICA 2 to full-length cDNA clones from Toxoplasma gondii, to confirm that its ability was competent even for non-human species. The entire sequencing and shotgun assembly takes less than 1 week and the consumables cost only approximately US$3 per clone, demonstrating a significant advantage over previous approaches.

  15. VaDiR: an integrated approach to Variant Detection in RNA.

    PubMed

    Neums, Lisa; Suenaga, Seiji; Beyerlein, Peter; Anders, Sara; Koestler, Devin; Mariani, Andrea; Chien, Jeremy

    2018-02-01

    Advances in next-generation DNA sequencing technologies are now enabling detailed characterization of sequence variations in cancer genomes. With whole-genome sequencing, variations in coding and non-coding sequences can be discovered. But the cost associated with it is currently limiting its general use in research. Whole-exome sequencing is used to characterize sequence variations in coding regions, but the cost associated with capture reagents and biases in capture rate limit its full use in research. Additional limitations include uncertainty in assigning the functional significance of the mutations when these mutations are observed in the non-coding region or in genes that are not expressed in cancer tissue. We investigated the feasibility of uncovering mutations from expressed genes using RNA sequencing datasets with a method called Variant Detection in RNA(VaDiR) that integrates 3 variant callers, namely: SNPiR, RVBoost, and MuTect2. The combination of all 3 methods, which we called Tier 1 variants, produced the highest precision with true positive mutations from RNA-seq that could be validated at the DNA level. We also found that the integration of Tier 1 variants with those called by MuTect2 and SNPiR produced the highest recall with acceptable precision. Finally, we observed a higher rate of mutation discovery in genes that are expressed at higher levels. Our method, VaDiR, provides a possibility of uncovering mutations from RNA sequencing datasets that could be useful in further functional analysis. In addition, our approach allows orthogonal validation of DNA-based mutation discovery by providing complementary sequence variation analysis from paired RNA/DNA sequencing datasets.

  16. An FPGA Implementation to Detect Selective Cationic Antibacterial Peptides

    PubMed Central

    Polanco González, Carlos; Nuño Maganda, Marco Aurelio; Arias-Estrada, Miguel; del Rio, Gabriel

    2011-01-01

    Exhaustive prediction of physicochemical properties of peptide sequences is used in different areas of biological research. One example is the identification of selective cationic antibacterial peptides (SCAPs), which may be used in the treatment of different diseases. Due to the discrete nature of peptide sequences, the physicochemical properties calculation is considered a high-performance computing problem. A competitive solution for this class of problems is to embed algorithms into dedicated hardware. In the present work we present the adaptation, design and implementation of an algorithm for SCAPs prediction into a Field Programmable Gate Array (FPGA) platform. Four physicochemical properties codes useful in the identification of peptide sequences with potential selective antibacterial activity were implemented into an FPGA board. The speed-up gained in a single-copy implementation was up to 108 times compared with a single Intel processor cycle for cycle. The inherent scalability of our design allows for replication of this code into multiple FPGA cards and consequently improvements in speed are possible. Our results show the first embedded SCAPs prediction solution described and constitutes the grounds to efficiently perform the exhaustive analysis of the sequence-physicochemical properties relationship of peptides. PMID:21738652

  17. Preparation of highly multiplexed small RNA sequencing libraries.

    PubMed

    Persson, Helena; Søkilde, Rolf; Pirona, Anna Chiara; Rovira, Carlos

    2017-08-01

    MicroRNAs (miRNAs) are ~22-nucleotide-long small non-coding RNAs that regulate the expression of protein-coding genes by base pairing to partially complementary target sites, preferentially located in the 3´ untranslated region (UTR) of target mRNAs. The expression and function of miRNAs have been extensively studied in human disease, as well as the possibility of using these molecules as biomarkers for prognostication and treatment guidance. To identify and validate miRNAs as biomarkers, their expression must be screened in large collections of patient samples. Here, we develop a scalable protocol for the rapid and economical preparation of a large number of small RNA sequencing libraries using dual indexing for multiplexing. Combined with the use of off-the-shelf reagents, more samples can be sequenced simultaneously on large-scale sequencing platforms at a considerably lower cost per sample. Sample preparation is simplified by pooling libraries prior to gel purification, which allows for the selection of a narrow size range while minimizing sample variation. A comparison with publicly available data from benchmarking of miRNA analysis platforms showed that this method captures absolute and differential expression as effectively as commercially available alternatives.

  18. Programmable DNA-binding proteins from Burkholderia provide a fresh perspective on the TALE-like repeat domain

    PubMed Central

    de Lange, Orlando; Wolf, Christina; Dietze, Jörn; Elsaesser, Janett; Morbitzer, Robert; Lahaye, Thomas

    2014-01-01

    The tandem repeats of transcription activator like effectors (TALEs) mediate sequence-specific DNA binding using a simple code. Naturally, TALEs are injected by Xanthomonas bacteria into plant cells to manipulate the host transcriptome. In the laboratory TALE DNA binding domains are reprogrammed and used to target a fused functional domain to a genomic locus of choice. Research into the natural diversity of TALE-like proteins may provide resources for the further improvement of current TALE technology. Here we describe TALE-like proteins from the endosymbiotic bacterium Burkholderia rhizoxinica, termed Bat proteins. Bat repeat domains mediate sequence-specific DNA binding with the same code as TALEs, despite less than 40% sequence identity. We show that Bat proteins can be adapted for use as transcription factors and nucleases and that sequence preferences can be reprogrammed. Unlike TALEs, the core repeats of each Bat protein are highly polymorphic. This feature allowed us to explore alternative strategies for the design of custom Bat repeat arrays, providing novel insights into the functional relevance of non-RVD residues. The Bat proteins offer fertile grounds for research into the creation of improved programmable DNA-binding proteins and comparative insights into TALE-like evolution. PMID:24792163

  19. Genomic Structure of the Luciferase Gene from the Bioluminescent Beetle, Nyctophila cf. Caucasica

    PubMed Central

    Day, John C.; Chaichi, Mohammad J.; Najafil, Iraj; Whiteley, Andrew S.

    2006-01-01

    The gene coding for beetle luciferase, the enzyme responsible for bioluminescence in over two thousand coleopteran species has, to date, only been characterized from one Palearctic species of Lampyridae. Here we report the characterization of the luciferase gene from a female beetle of an Iranian lampyrid species, Nyctophila cf. caucasica (Coleoptera:Lampyridae). The luciferase gene was composed of seven exons, coding for 547 amino acids, separated by six introns spanning 1976 bp of genomic DNA. The deduced amino acid sequences of the luciferase gene of N. caucasica showed 98.9% homology to that of the Palearctic species Lampyris noctiluca. Analysis of the 810 bp upstream region of the luciferase gene revealed three TATA boxes and several other consensus transcriptional factor recognition sequences presenting evidence for a putative core promoter region conserved in Lampyrinae from -190 through to -155 upstream of the luciferase start codon. Along with the core promoter region the luciferase gene was compared with orthologous sequences from other lampyrid species and found to have greatest identity to Lampyris turkistanicus and Lampyris noctiluca. The significant sequence identity to the former is discussed in relation to taxonomic issues of Iranian lampyrids. PMID:20298115

  20. Aggregating and Predicting Sequence Labels from Crowd Annotations

    PubMed Central

    Nguyen, An T.; Wallace, Byron C.; Li, Junyi Jessy; Nenkova, Ani; Lease, Matthew

    2017-01-01

    Despite sequences being core to NLP, scant work has considered how to handle noisy sequence labels from multiple annotators for the same text. Given such annotations, we consider two complementary tasks: (1) aggregating sequential crowd labels to infer a best single set of consensus annotations; and (2) using crowd annotations as training data for a model that can predict sequences in unannotated text. For aggregation, we propose a novel Hidden Markov Model variant. To predict sequences in unannotated text, we propose a neural approach using Long Short Term Memory. We evaluate a suite of methods across two different applications and text genres: Named-Entity Recognition in news articles and Information Extraction from biomedical abstracts. Results show improvement over strong baselines. Our source code and data are available online1. PMID:29093611

  1. Draft Genome Sequence of Cellulolytic and Xylanolytic Paenibacillus sp. A59, Isolated from Decaying Forest Soil from Patagonia, Argentina

    PubMed Central

    Ghio, Silvina; Martinez Cáceres, Alfredo I.; Talia, Paola; Grasso, Daniel H.

    2015-01-01

    Paenibacillus sp. A59 was isolated from decaying forest soil in Argentina and characterized as a xylanolytic strain. We report the draft genome sequence of this isolate, with an estimated genome size of 7 Mb which harbor 6,424 coding sequences. Genes coding for hydrolytic enzymes involved in lignocellulose deconstruction were predicted. PMID:26494679

  2. Complete mitochondrial genome of Xingguo red carp (Cyprinus carpio var. singuonensis) and purse red carp (Cyprinus carpio var. wuyuanensis).

    PubMed

    Hu, Guang-Fu; Liu, Xiang-Jiang; Li, Zhong; Liang, Hong-Wei; Hu, Shao-Na; Zou, Gui-Wei

    2016-01-01

    The complete mitochondrial genomes of Xingguo red carp (Cyprinus carpio var. singuonensis) and purse red carp (Cyprinus carpio var. wuyuanensis) were sequenced. Comparison of these two mitochondrial genomes revealed that the mtDNAs of these two common carp varieties were remarkably similar in genome length, gene order and content, and AT content. However, size variation between these two mitochondrial genomes presented here showed 39 site differences in overall length. About 2 site differences were located in rRNAs, 3 in tRNAs, 3 in the control region, 31 in protein-coding genes. Thirty-one variable bases in the protein-coding regions between the two varieties mitochondrial sequences led to three variable amino acids, which were mainly located in the protein ND5 and ND4.

  3. Gene Identification Algorithms Using Exploratory Statistical Analysis of Periodicity

    NASA Astrophysics Data System (ADS)

    Mukherjee, Shashi Bajaj; Sen, Pradip Kumar

    2010-10-01

    Studying periodic pattern is expected as a standard line of attack for recognizing DNA sequence in identification of gene and similar problems. But peculiarly very little significant work is done in this direction. This paper studies statistical properties of DNA sequences of complete genome using a new technique. A DNA sequence is converted to a numeric sequence using various types of mappings and standard Fourier technique is applied to study the periodicity. Distinct statistical behaviour of periodicity parameters is found in coding and non-coding sequences, which can be used to distinguish between these parts. Here DNA sequences of Drosophila melanogaster were analyzed with significant accuracy.

  4. SSMART: Sequence-structure motif identification for RNA-binding proteins.

    PubMed

    Munteanu, Alina; Mukherjee, Neelanjan; Ohler, Uwe

    2018-06-11

    RNA-binding proteins (RBPs) regulate every aspect of RNA metabolism and function. There are hundreds of RBPs encoded in the eukaryotic genomes, and each recognize its RNA targets through a specific mixture of RNA sequence and structure properties. For most RBPs, however, only a primary sequence motif has been determined, while the structure of the binding sites is uncharacterized. We developed SSMART, an RNA motif finder that simultaneously models the primary sequence and the structural properties of the RNA targets sites. The sequence-structure motifs are represented as consensus strings over a degenerate alphabet, extending the IUPAC codes for nucleotides to account for secondary structure preferences. Evaluation on synthetic data showed that SSMART is able to recover both sequence and structure motifs implanted into 3'UTR-like sequences, for various degrees of structured/unstructured binding sites. In addition, we successfully used SSMART on high-throughput in vivo and in vitro data, showing that we not only recover the known sequence motif, but also gain insight into the structural preferences of the RBP. Availability: SSMART is freely available at https://ohlerlab.mdc-berlin.de/software/SSMART_137/. Supplementary data are available at Bioinformatics online.

  5. Tau mRNA 3'UTR-to-CDS ratio is increased in Alzheimer disease.

    PubMed

    García-Escudero, Vega; Gargini, Ricardo; Martín-Maestro, Patricia; García, Esther; García-Escudero, Ramón; Avila, Jesús

    2017-08-10

    Neurons frequently show an imbalance in expression of the 3' untranslated region (3'UTR) relative to the coding DNA sequence (CDS) region of mature messenger RNAs (mRNA). The ratio varies among different cells or parts of the brain. The Map2 protein levels per cell depend on the 3'UTR-to-CDS ratio rather than the total mRNA amount, which suggests powerful regulation of protein expression by 3'UTR sequences. Here we found that MAPT (the microtubule-associated protein tau gene) 3'UTR levels are particularly high with respect to other genes; indeed, the 3'UTR-to-CDS ratio of MAPT is balanced in healthy brain in mouse and human. The tau protein accumulates in Alzheimer diseased brain. We nonetheless observed that the levels of RNA encoding MAPT/tau were diminished in these patients' brains. To explain this apparently contradictory result, we studied MAPT mRNA stoichiometry in coding and non-coding regions, and found that the 3'UTR-to-CDS ratio was higher in the hippocampus of Alzheimer disease patients, with higher tau protein but lower total mRNA levels. Our data indicate that changes in the 3'UTR-to-CDS ratio have a regulatory role in the disease. Future research should thus consider not only mRNA levels, but also the ratios between coding and non-coding regions. Copyright © 2017 Elsevier B.V. All rights reserved.

  6. Channel coding for underwater acoustic single-carrier CDMA communication system

    NASA Astrophysics Data System (ADS)

    Liu, Lanjun; Zhang, Yonglei; Zhang, Pengcheng; Zhou, Lin; Niu, Jiong

    2017-01-01

    CDMA is an effective multiple access protocol for underwater acoustic networks, and channel coding can effectively reduce the bit error rate (BER) of the underwater acoustic communication system. For the requirements of underwater acoustic mobile networks based on CDMA, an underwater acoustic single-carrier CDMA communication system (UWA/SCCDMA) based on the direct-sequence spread spectrum is proposed, and its channel coding scheme is studied based on convolution, RA, Turbo and LDPC coding respectively. The implementation steps of the Viterbi algorithm of convolutional coding, BP and minimum sum algorithms of RA coding, Log-MAP and SOVA algorithms of Turbo coding, and sum-product algorithm of LDPC coding are given. An UWA/SCCDMA simulation system based on Matlab is designed. Simulation results show that the UWA/SCCDMA based on RA, Turbo and LDPC coding have good performance such that the communication BER is all less than 10-6 in the underwater acoustic channel with low signal to noise ratio (SNR) from -12 dB to -10dB, which is about 2 orders of magnitude lower than that of the convolutional coding. The system based on Turbo coding with Log-MAP algorithm has the best performance.

  7. Outbreak of poliomyelitis in Finland in 1984-85 - Re-analysis of viral sequences using the current standard approach.

    PubMed

    Simonen, Marja-Leena; Roivainen, Merja; Iber, Jane; Burns, Cara; Hovi, Tapani

    2010-01-01

    In 1984, a wild type 3 poliovirus (PV3/FIN84) spread all over Finland causing nine cases of paralytic poliomyelitis and one case of aseptic meningitis. The outbreak was ended in 1985 with an intensive vaccination campaign. By limited sequence comparison with previously isolated PV3 strains, closest relatives of PV3/FIN84 were found among strains circulating in the Mediterranean region. Now we wanted to reanalyse the relationships using approaches currently exploited in poliovirus surveillance. Cell lysates of 22 strains isolated during the outbreak and stored frozen were subjected to RT-PCR amplification in three genomic regions without prior subculture. Sequences of the entire VP1 coding region, 150 nucleotides in the VP1-2A junction, most of the 5' non-coding region, partial sequences of the 3D RNA polymerase coding region and partial 3' non-coding region were compared within the outbreak and with sequences available in data banks. In addition, complete nucleotide sequences were obtained for 2 strains isolated from two different cases of disease during the outbreak. The results confirmed the previously described wide intraepidemic variation of the strains, including amino acid substitutions in antigenic sites, as well as the likely Mediterranean region origin of the strains. Simplot and bootscanning analyses of the complete genomes indicated complicated evolutionary history of the non-capsid coding regions of the genome suggesting several recombinations with different HEV-C viruses in the past.

  8. Mitochondrial genomes of the jungle crow Corvus macrorhynchos (Passeriformes: Corvidae) from shed feathers and a phylogenetic analysis of genus Corvus using mitochondrial protein-coding genes.

    PubMed

    Krzeminska, Urszula; Wilson, Robyn; Rahman, Sadequr; Song, Beng Kah; Seneviratne, Sampath; Gan, Han Ming; Austin, Christopher M

    2016-07-01

    The complete mitochondrial genomes of two jungle crows (Corvus macrorhynchos) were sequenced. DNA was extracted from tissue samples obtained from shed feathers collected in the field in Sri Lanka and sequenced using the Illumina MiSeq Personal Sequencer. Jungle crow mitogenomes have a structural organization typical of the genus Corvus and are 16,927 bp and 17,066 bp in length, both comprising 13 protein-coding genes, 22 transfer RNA genes, 2 ribosomal subunit genes, and a non-coding control region. In addition, we complement already available house crow (Corvus spelendens) mitogenome resources by sequencing an individual from Singapore. A phylogenetic tree constructed from Corvidae family mitogenome sequences available on GenBank is presented. We confirm the monophyly of the genus Corvus and propose to use complete mitogenome resources for further intra- and interspecies genetic studies.

  9. A compositional segmentation of the human mitochondrial genome is related to heterogeneities in the guanine mutation rate

    PubMed Central

    Samuels, David C.; Boys, Richard J.; Henderson, Daniel A.; Chinnery, Patrick F.

    2003-01-01

    We applied a hidden Markov model segmentation method to the human mitochondrial genome to identify patterns in the sequence, to compare these patterns to the gene structure of mtDNA and to see whether these patterns reveal additional characteristics important for our understanding of genome evolution, structure and function. Our analysis identified three segmentation categories based upon the sequence transition probabilities. Category 2 segments corresponded to the tRNA and rRNA genes, with a greater strand-symmetry in these segments. Category 1 and 3 segments covered the protein- coding genes and almost all of the non-coding D-loop. Compared to category 1, the mtDNA segments assigned to category 3 had much lower guanine abundance. A comparison to two independent databases of mitochondrial mutations and polymorphisms showed that the high substitution rate of guanine in human mtDNA is largest in the category 3 segments. Analysis of synonymous mutations showed the same pattern. This suggests that this heterogeneity in the mutation rate is partly independent of respiratory chain function and is a direct property of the genome sequence itself. This has important implications for our understanding of mtDNA evolution and its use as a ‘molecular clock’ to determine the rate of population and species divergence. PMID:14530452

  10. Melanin production by Rhizobium meliloti GR4 is linked to nonsymbiotic plasmid pRmeGR4b: cloning, sequencing, and expression of the tyrosinase gene mepA.

    PubMed Central

    Mercado-Blanco, J; García, F; Fernández-López, M; Olivares, J

    1993-01-01

    Melanin production by Rhizobium meliloti GR4 is linked to nonsymbiotic plasmid pRmeGR4b (140 MDa). Transfer of this plasmid to GR4-cured derivatives or to Agrobacterium tumefaciens enables these bacteria to produce melanin. Sequence analysis of a 3.5-kb PstI fragment of plasmid pRmeGR4b has revealed the presence of a open reading frame 1,481-bp that codes for a protein whose sequence shows strong homology to two conserved regions involved in copper binding in tyrosinases and hemocyanins. In vitro-coupled transcription-translation experiments showed that this open reading frame codes for a 55-kDa polypeptide. Melanin production in GR4 is not under the control of the RpoN-NifA regulatory system, unlike that in R. leguminosarum bv. phaseoli 8002. The GR4 tyrosinase gene could be expressed in Escherichia coli under the control of the lacZ promoter. For avoiding confusion with mel genes (for melibiose), a change of the name of the previously reported mel genes of R. leguminosarum bv. phaseoli and other organisms to mep genes (for melanin production) is proposed. Images PMID:8366027

  11. The complete mitochondrial genome sequence of the Tibetan red fox (Vulpes vulpes montana).

    PubMed

    Zhang, Jin; Zhang, Honghai; Zhao, Chao; Chen, Lei; Sha, Weilai; Liu, Guangshuai

    2015-01-01

    In this study, the complete mitochondrial genome of the Tibetan red fox (Vulpes Vulpes montana) was sequenced for the first time using blood samples obtained from a wild female red fox captured from Lhasa in Tibet, China. Qinghai--Tibet Plateau is the highest plateau in the world with an average elevation above 3500 m. Sequence analysis showed it contains 12S rRNA gene, 16S rRNA gene, 22 tRNA genes, 13 protein-coding genes and 1 control region (CR). The variable tandem repeats in CR is the main reason of the length variability of mitochondrial genome among canide animals.

  12. Draft genome sequence of Enterococcus faecium strain LMG 8148.

    PubMed

    Michiels, Joran E; Van den Bergh, Bram; Fauvart, Maarten; Michiels, Jan

    2016-01-01

    Enterococcus faecium, traditionally considered a harmless gut commensal, is emerging as an important nosocomial pathogen showing increasing rates of multidrug resistance. We report the draft genome sequence of E. faecium strain LMG 8148, isolated in 1968 from a human in Gothenburg, Sweden. The draft genome has a total length of 2,697,490 bp, a GC-content of 38.3 %, and 2,402 predicted protein-coding sequences. The isolation of this strain predates the emergence of E. faecium as a nosocomial pathogen. Consequently, its genome can be useful in comparative genomic studies investigating the evolution of E. faecium as a pathogen.

  13. Transcriptome sequences resolve deep relationships of the grape family.

    PubMed

    Wen, Jun; Xiong, Zhiqiang; Nie, Ze-Long; Mao, Likai; Zhu, Yabing; Kan, Xian-Zhao; Ickert-Bond, Stefanie M; Gerrath, Jean; Zimmer, Elizabeth A; Fang, Xiao-Dong

    2013-01-01

    Previous phylogenetic studies of the grape family (Vitaceae) yielded poorly resolved deep relationships, thus impeding our understanding of the evolution of the family. Next-generation sequencing now offers access to protein coding sequences very easily, quickly and cost-effectively. To improve upon earlier work, we extracted 417 orthologous single-copy nuclear genes from the transcriptomes of 15 species of the Vitaceae, covering its phylogenetic diversity. The resulting transcriptome phylogeny provides robust support for the deep relationships, showing the phylogenetic utility of transcriptome data for plants over a time scale at least since the mid-Cretaceous. The pros and cons of transcriptome data for phylogenetic inference in plants are also evaluated.

  14. A method for partitioning the information contained in a protein sequence between its structure and function.

    PubMed

    Possenti, Andrea; Vendruscolo, Michele; Camilloni, Carlo; Tiana, Guido

    2018-05-23

    Proteins employ the information stored in the genetic code and translated into their sequences to carry out well-defined functions in the cellular environment. The possibility to encode for such functions is controlled by the balance between the amount of information supplied by the sequence and that left after that the protein has folded into its structure. We study the amount of information necessary to specify the protein structure, providing an estimate that keeps into account the thermodynamic properties of protein folding. We thus show that the information remaining in the protein sequence after encoding for its structure (the 'information gap') is very close to what needed to encode for its function and interactions. Then, by predicting the information gap directly from the protein sequence, we show that it may be possible to use these insights from information theory to discriminate between ordered and disordered proteins, to identify unknown functions, and to optimize artificially-designed protein sequences. This article is protected by copyright. All rights reserved. © 2018 Wiley Periodicals, Inc.

  15. Complete genome sequencing of the luminescent bacterium, Vibrio qinghaiensis sp. Q67 using PacBio technology

    NASA Astrophysics Data System (ADS)

    Gong, Liang; Wu, Yu; Jian, Qijie; Yin, Chunxiao; Li, Taotao; Gupta, Vijai Kumar; Duan, Xuewu; Jiang, Yueming

    2018-01-01

    Vibrio qinghaiensis sp.-Q67 (Vqin-Q67) is a freshwater luminescent bacterium that continuously emits blue-green light (485 nm). The bacterium has been widely used for detecting toxic contaminants. Here, we report the complete genome sequence of Vqin-Q67, obtained using third-generation PacBio sequencing technology. Continuous long reads were attained from three PacBio sequencing runs and reads >500 bp with a quality value of >0.75 were merged together into a single dataset. This resultant highly-contiguous de novo assembly has no genome gaps, and comprises two chromosomes with substantial genetic information, including protein-coding genes, non-coding RNA, transposon and gene islands. Our dataset can be useful as a comparative genome for evolution and speciation studies, as well as for the analysis of protein-coding gene families, the pathogenicity of different Vibrio species in fish, the evolution of non-coding RNA and transposon, and the regulation of gene expression in relation to the bioluminescence of Vqin-Q67.

  16. Deep neural models for ICD-10 coding of death certificates and autopsy reports in free-text.

    PubMed

    Duarte, Francisco; Martins, Bruno; Pinto, Cátia Sousa; Silva, Mário J

    2018-04-01

    We address the assignment of ICD-10 codes for causes of death by analyzing free-text descriptions in death certificates, together with the associated autopsy reports and clinical bulletins, from the Portuguese Ministry of Health. We leverage a deep neural network that combines word embeddings, recurrent units, and neural attention, for the generation of intermediate representations of the textual contents. The neural network also explores the hierarchical nature of the input data, by building representations from the sequences of words within individual fields, which are then combined according to the sequences of fields that compose the inputs. Moreover, we explore innovative mechanisms for initializing the weights of the final nodes of the network, leveraging co-occurrences between classes together with the hierarchical structure of ICD-10. Experimental results attest to the contribution of the different neural network components. Our best model achieves accuracy scores over 89%, 81%, and 76%, respectively for ICD-10 chapters, blocks, and full-codes. Through examples, we also show that our method can produce interpretable results, useful for public health surveillance. Copyright © 2018 Elsevier Inc. All rights reserved.

  17. Weight distributions for turbo codes using random and nonrandom permutations

    NASA Technical Reports Server (NTRS)

    Dolinar, S.; Divsalar, D.

    1995-01-01

    This article takes a preliminary look at the weight distributions achievable for turbo codes using random, nonrandom, and semirandom permutations. Due to the recursiveness of the encoders, it is important to distinguish between self-terminating and non-self-terminating input sequences. The non-self-terminating sequences have little effect on decoder performance, because they accumulate high encoded weight until they are artificially terminated at the end of the block. From probabilistic arguments based on selecting the permutations randomly, it is concluded that the self-terminating weight-2 data sequences are the most important consideration in the design of constituent codes; higher-weight self-terminating sequences have successively decreasing importance. Also, increasing the number of codes and, correspondingly, the number of permutations makes it more and more likely that the bad input sequences will be broken up by one or more of the permuters. It is possible to design nonrandom permutations that ensure that the minimum distance due to weight-2 input sequences grows roughly as the square root of (2N), where N is the block length. However, these nonrandom permutations amplify the bad effects of higher-weight inputs, and as a result they are inferior in performance to randomly selected permutations. But there are 'semirandom' permutations that perform nearly as well as the designed nonrandom permutations with respect to weight-2 input sequences and are not as susceptible to being foiled by higher-weight inputs.

  18. An automatic and efficient pipeline for disease gene identification through utilizing family-based sequencing data.

    PubMed

    Song, Dandan; Li, Ning; Liao, Lejian

    2015-01-01

    Due to the generation of enormous amounts of data at both lower costs as well as in shorter times, whole-exome sequencing technologies provide dramatic opportunities for identifying disease genes implicated in Mendelian disorders. Since upwards of thousands genomic variants can be sequenced in each exome, it is challenging to filter pathogenic variants in protein coding regions and reduce the number of missing true variants. Therefore, an automatic and efficient pipeline for finding disease variants in Mendelian disorders is designed by exploiting a combination of variants filtering steps to analyze the family-based exome sequencing approach. Recent studies on the Freeman-Sheldon disease are revisited and show that the proposed method outperforms other existing candidate gene identification methods.

  19. Next-generation sequencing of the Trichinella murrelli mitochondrial genome allows comprehensive comparison of its divergence from the principal agent of human trichinellosis, Trichinella spiralis.

    PubMed

    Webb, Kristen M; Rosenthal, Benjamin M

    2011-01-01

    The mitochondrial genome's non-recombinant mode of inheritance and relatively rapid rate of evolution has promoted its use as a marker for studying the biogeographic history and evolutionary interrelationships among many metazoan species. A modest portion of the mitochondrial genome has been defined for 12 species and genotypes of parasites in the genus Trichinella, but its adequacy in representing the mitochondrial genome as a whole remains unclear, as the complete coding sequence has been characterized only for Trichinella spiralis. Here, we sought to comprehensively describe the extent and nature of divergence between the mitochondrial genomes of T. spiralis (which poses the most appreciable zoonotic risk owing to its capacity to establish persistent infections in domestic pigs) and Trichinella murrelli (which is the most prevalent species in North American wildlife hosts, but which poses relatively little risk to the safety of pork). Next generation sequencing methodologies and scaffold and de novo assembly strategies were employed. The entire protein-coding region was sequenced (13,917 bp), along with a portion of the highly repetitive non-coding region (1524 bp) of the mitochondrial genome of T. murrelli with a combined average read depth of 250 reads. The accuracy of base calling, estimated from coding region sequence was found to exceed 99.3%. Genome content and gene order was not found to be significantly different from that of T. spiralis. An overall inter-species sequence divergence of 9.5% was estimated. Significant variation was identified when the amount of variation between species at each gene is compared to the average amount of variation between species across the coding region. Next generation sequencing is a highly effective means to obtain previously unknown mitochondrial genome sequence. Particular to parasites, the extremely deep coverage achieved through this method allows for the detection of sequence heterogeneity between the multiple individuals that necessarily comprise such templates. Copyright © 2010 Elsevier B.V. All rights reserved.

  20. Draft Genome Sequence of Cellulolytic and Xylanolytic Paenibacillus sp. A59, Isolated from Decaying Forest Soil from Patagonia, Argentina.

    PubMed

    Ghio, Silvina; Martinez Cáceres, Alfredo I; Talia, Paola; Grasso, Daniel H; Campos, Eleonora

    2015-10-22

    Paenibacillus sp. A59 was isolated from decaying forest soil in Argentina and characterized as a xylanolytic strain. We report the draft genome sequence of this isolate, with an estimated genome size of 7 Mb which harbor 6,424 coding sequences. Genes coding for hydrolytic enzymes involved in lignocellulose deconstruction were predicted. Copyright © 2015 Ghio et al.

  1. Comparisons between Arabidopsis thaliana and Drosophila melanogaster in relation to Coding and Noncoding Sequence Length and Gene Expression

    PubMed Central

    Caldwell, Rachel; Lin, Yan-Xia; Zhang, Ren

    2015-01-01

    There is a continuing interest in the analysis of gene architecture and gene expression to determine the relationship that may exist. Advances in high-quality sequencing technologies and large-scale resource datasets have increased the understanding of relationships and cross-referencing of expression data to the large genome data. Although a negative correlation between expression level and gene (especially transcript) length has been generally accepted, there have been some conflicting results arising from the literature concerning the impacts of different regions of genes, and the underlying reason is not well understood. The research aims to apply quantile regression techniques for statistical analysis of coding and noncoding sequence length and gene expression data in the plant, Arabidopsis thaliana, and fruit fly, Drosophila melanogaster, to determine if a relationship exists and if there is any variation or similarities between these species. The quantile regression analysis found that the coding sequence length and gene expression correlations varied, and similarities emerged for the noncoding sequence length (5′ and 3′ UTRs) between animal and plant species. In conclusion, the information described in this study provides the basis for further exploration into gene regulation with regard to coding and noncoding sequence length. PMID:26114098

  2. The mitochondrial genomes of the acoelomorph worms Paratomella rubra, Isodiametra pulchra and Archaphanostoma ylvae.

    PubMed

    Robertson, Helen E; Lapraz, François; Egger, Bernhard; Telford, Maximilian J; Schiffer, Philipp H

    2017-05-12

    Acoels are small, ubiquitous - but understudied - marine worms with a very simple body plan. Their internal phylogeny is still not fully resolved, and the position of their proposed phylum Xenacoelomorpha remains debated. Here we describe mitochondrial genome sequences from the acoels Paratomella rubra and Isodiametra pulchra, and the complete mitochondrial genome of the acoel Archaphanostoma ylvae. The P. rubra and A. ylvae sequences are typical for metazoans in size and gene content. The larger I. pulchra  mitochondrial genome contains both ribosomal genes, 21 tRNAs, but only 11 protein-coding genes. We find evidence suggesting a duplicated sequence in the I. pulchra mitochondrial genome. The P. rubra, I. pulchra and A. ylvae mitochondria have a unique genome organisation in comparison to other metazoan mitochondrial genomes. We found a large degree of protein-coding gene and tRNA overlap with little non-coding sequence in the compact P. rubra genome. Conversely, the A. ylvae and I. pulchra genomes have many long non-coding sequences between genes, likely driving genome size expansion in the latter. Phylogenetic trees inferred from mitochondrial genes retrieve Xenacoelomorpha as an early branching taxon in the deuterostomes. Sequence divergence analysis between P. rubra sampled in England and Spain indicates cryptic diversity.

  3. Metal resistance sequences and transgenic plants

    DOEpatents

    Meagher, Richard Brian; Summers, Anne O.; Rugh, Clayton L.

    1999-10-12

    The present invention provides nucleic acid sequences encoding a metal ion resistance protein, which are expressible in plant cells. The metal resistance protein provides for the enzymatic reduction of metal ions including but not limited to divalent Cu, divalent mercury, trivalent gold, divalent cadmium, lead ions and monovalent silver ions. Transgenic plants which express these coding sequences exhibit increased resistance to metal ions in the environment as compared with plants which have not been so genetically modified. Transgenic plants with improved resistance to organometals including alkylmercury compounds, among others, are provided by the further inclusion of plant-expressible organometal lyase coding sequences, as specifically exemplified by the plant-expressible merB coding sequence. Furthermore, these transgenic plants which have been genetically modified to express the metal resistance coding sequences of the present invention can participate in the bioremediation of metal contamination via the enzymatic reduction of metal ions. Transgenic plants resistant to organometals can further mediate remediation of organic metal compounds, for example, alkylmetal compounds including but not limited to methyl mercury, methyl lead compounds, methyl cadmium and methyl arsenic compounds, in the environment by causing the freeing of mercuric or other metal ions and the reduction of the ionic mercury or other metal ions to the less toxic elemental mercury or other metals.

  4. Comparative and Evolutionary Analyses of Meloidogyne spp. Based on Mitochondrial Genome Sequences

    PubMed Central

    García, Laura Evangelina; Sánchez-Puerta, M. Virginia

    2015-01-01

    Molecular taxonomy and evolution of nematodes have been recently the focus of several studies. Mitochondrial sequences were proposed as an alternative for precise identification of Meloidogyne species, to study intraspecific variability and to follow maternal lineages. We characterized the mitochondrial genomes (mtDNAs) of the root knot nematodes M. floridensis, M. hapla and M. incognita. These were AT rich (81–83%) and highly compact, encoding 12 proteins, 2 rRNAs, and 22 tRNAs. Comparisons with published mtDNAs of M. chitwoodi, M. incognita (another strain) and M. graminicola revealed that they share protein and rRNA gene order but differ in the order of tRNAs. The mtDNAs of M. floridensis and M. incognita were strikingly similar (97–100% identity for all coding regions). In contrast, M. floridensis, M. chitwoodi, M. hapla and M. graminicola showed 65–84% nucleotide identity for coding regions. Variable mitochondrial sequences are potentially useful for evolutionary and taxonomic studies. We developed a molecular taxonomic marker by sequencing a highly-variable ~2 kb mitochondrial region, nad5-cox1, from 36 populations of root-knot nematodes to elucidate relationships within the genus Meloidogyne. Isolates of five species formed monophyletic groups and showed little intraspecific variability. We also present a thorough analysis of the mitochondrial region cox2-rrnS. Phylogenies based on either mitochondrial region had good discrimination power but could not discriminate between M. arenaria, M. incognita and M. floridensis. PMID:25799071

  5. Characterization of a Novel Polerovirus Infecting Maize in China

    PubMed Central

    Chen, Sha; Jiang, Guangzhuang; Wu, Jianxiang; Liu, Yong; Qian, Yajuan; Zhou, Xueping

    2016-01-01

    A novel virus, tentatively named Maize Yellow Mosaic Virus (MaYMV), was identified from the field-grown maize plants showing yellow mosaic symptoms on the leaves collected from the Yunnan Province of China by the deep sequencing of small RNAs. The complete 5642 nucleotide (nt)-long genome of the MaYMV shared the highest nucleotide sequence identity (73%) to Maize Yellow Dwarf Virus-RMV. Sequence comparisons and phylogenetic analyses suggested that MaYMV represents a new member of the genus Polerovirus in the family Luteoviridae. Furthermore, the P0 protein encoded by MaYMV was demonstrated to inhibit both local and systemic RNA silencing by co-infiltration assays using transgenic Nicotiana benthamiana line 16c carrying the GFP reporter gene, which further supported the identification of a new polerovirus. The biologically-active cDNA clone of MaYMV was generated by inserting the full-length cDNA of MaYMV into the binary vector pCB301. RT-PCR and Northern blot analyses showed that this clone was systemically infectious upon agro-inoculation into N. benthamiana. Subsequently, 13 different isolates of MaYMV from field-grown maize plants in different geographical locations of Yunnan and Guizhou provinces of China were sequenced. Analyses of their molecular variation indicate that the 3′ half of P3–P5 read-through protein coding region was the most variable, whereas the coat protein- (CP-) and movement protein- (MP-)coding regions were the most conserved. PMID:27136578

  6. Characterization of a Novel Polerovirus Infecting Maize in China.

    PubMed

    Chen, Sha; Jiang, Guangzhuang; Wu, Jianxiang; Liu, Yong; Qian, Yajuan; Zhou, Xueping

    2016-04-28

    A novel virus, tentatively named Maize Yellow Mosaic Virus (MaYMV), was identified from the field-grown maize plants showing yellow mosaic symptoms on the leaves collected from the Yunnan Province of China by the deep sequencing of small RNAs. The complete 5642 nucleotide (nt)-long genome of the MaYMV shared the highest nucleotide sequence identity (73%) to Maize Yellow Dwarf Virus-RMV. Sequence comparisons and phylogenetic analyses suggested that MaYMV represents a new member of the genus Polerovirus in the family Luteoviridae. Furthermore, the P0 protein encoded by MaYMV was demonstrated to inhibit both local and systemic RNA silencing by co-infiltration assays using transgenic Nicotiana benthamiana line 16c carrying the GFP reporter gene, which further supported the identification of a new polerovirus. The biologically-active cDNA clone of MaYMV was generated by inserting the full-length cDNA of MaYMV into the binary vector pCB301. RT-PCR and Northern blot analyses showed that this clone was systemically infectious upon agro-inoculation into N. benthamiana. Subsequently, 13 different isolates of MaYMV from field-grown maize plants in different geographical locations of Yunnan and Guizhou provinces of China were sequenced. Analyses of their molecular variation indicate that the 3' half of P3-P5 read-through protein coding region was the most variable, whereas the coat protein- (CP-) and movement protein- (MP-)coding regions were the most conserved.

  7. Complete mitochondrial genome of the whiter-spotted flower chafer, Protaetia brevitarsis (Coleoptera: Scarabaeidae).

    PubMed

    Kim, Min Jee; Im, Hyun Hwak; Lee, Kwang Youll; Han, Yeon Soo; Kim, Iksoo

    2014-06-01

    Abstract The complete nucleotide sequences of the mitochondrial genome from the whiter-spotted flower chafer, Protaetia brevitarsis (Coleoptera: Scarabaeidae), was determined. The 20,319-bp long circular genome is the longest among completely sequenced Coleoptera. As is typical in animals, the P. brevitarsis genome consisted of two ribosomal RNAs, 22 transfer RNAs, 13 protein-coding genes and one A + T-rich region. Although the size of the coding genes was typical, the non-coding A + T-rich region was 5654 bp, which is the longest in insects. The extraordinary length of this region was composed of 28,117-bp tandem repeats and 782-bp tandem repeats. These repeat sequences were encompassed by three non-repeat sequences constituting 1804 bp.

  8. Chromosome-level genome assembly and transcriptome of the green alga Chromochloris zofingiensis illuminates astaxanthin production.

    PubMed

    Roth, Melissa S; Cokus, Shawn J; Gallaher, Sean D; Walter, Andreas; Lopez, David; Erickson, Erika; Endelman, Benjamin; Westcott, Daniel; Larabell, Carolyn A; Merchant, Sabeeha S; Pellegrini, Matteo; Niyogi, Krishna K

    2017-05-23

    Microalgae have potential to help meet energy and food demands without exacerbating environmental problems. There is interest in the unicellular green alga Chromochloris zofingiensis , because it produces lipids for biofuels and a highly valuable carotenoid nutraceutical, astaxanthin. To advance understanding of its biology and facilitate commercial development, we present a C. zofingiensis chromosome-level nuclear genome, organelle genomes, and transcriptome from diverse growth conditions. The assembly, derived from a combination of short- and long-read sequencing in conjunction with optical mapping, revealed a compact genome of ∼58 Mbp distributed over 19 chromosomes containing 15,274 predicted protein-coding genes. The genome has uniform gene density over chromosomes, low repetitive sequence content (∼6%), and a high fraction of protein-coding sequence (∼39%) with relatively long coding exons and few coding introns. Functional annotation of gene models identified orthologous families for the majority (∼73%) of genes. Synteny analysis uncovered localized but scrambled blocks of genes in putative orthologous relationships with other green algae. Two genes encoding beta-ketolase ( BKT ), the key enzyme synthesizing astaxanthin, were found in the genome, and both were up-regulated by high light. Isolation and molecular analysis of astaxanthin-deficient mutants showed that BKT1 is required for the production of astaxanthin. Moreover, the transcriptome under high light exposure revealed candidate genes that could be involved in critical yet missing steps of astaxanthin biosynthesis, including ABC transporters, cytochrome P450 enzymes, and an acyltransferase. The high-quality genome and transcriptome provide insight into the green algal lineage and carotenoid production.

  9. Chromosome-level genome assembly and transcriptome of the green alga Chromochloris zofingiensis illuminates astaxanthin production

    DOE PAGES

    Roth, Melissa S.; Cokus, Shawn J.; Gallaher, Sean D.; ...

    2017-05-08

    Microalgae have potential to help meet energy and food demands without exacerbating environmental problems. There is interest in the unicellular green alga Chromochloris zofingiensis, because it produces lipids for biofuels and a highly valuable carotenoid nutraceutical, astaxanthin. Here, to advance understanding of its biology and facilitate commercial development, we present a C. zofingiensis chromosome-level nuclear genome, organelle genomes, and transcriptome from diverse growth conditions. The assembly, derived from a combination of short- and long-read sequencing in conjunction with optical mapping, revealed a compact genome of ~58 Mbp distributed over 19 chromosomes containing 15,274 predicted protein-coding genes. The genome has uniformmore » gene density over chromosomes, low repetitive sequence content (~6%), and a high fraction of protein-coding sequence (~39%) with relatively long coding exons and few coding introns. Functional annotation of gene models identified orthologous families for the majority (~73%) of genes. Synteny analysis uncovered localized but scrambled blocks of genes in putative orthologous relationships with other green algae. Two genes encoding beta-ketolase (BKT), the key enzyme synthesizing astaxanthin, were found in the genome, and both were up-regulated by high light. Isolation and molecular analysis of astaxanthin-deficient mutants showed that BKT1 is required for the production of astaxanthin. Moreover, the transcriptome under high light exposure revealed candidate genes that could be involved in critical yet missing steps of astaxanthin biosynthesis, including ABC transporters, cytochrome P450 enzymes, and an acyltransferase. Finally, the high-quality genome and transcriptome provide insight into the green algal lineage and carotenoid production.« less

  10. Chromosome-level genome assembly and transcriptome of the green alga Chromochloris zofingiensis illuminates astaxanthin production

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Roth, Melissa S.; Cokus, Shawn J.; Gallaher, Sean D.

    Microalgae have potential to help meet energy and food demands without exacerbating environmental problems. There is interest in the unicellular green alga Chromochloris zofingiensis, because it produces lipids for biofuels and a highly valuable carotenoid nutraceutical, astaxanthin. Here, to advance understanding of its biology and facilitate commercial development, we present a C. zofingiensis chromosome-level nuclear genome, organelle genomes, and transcriptome from diverse growth conditions. The assembly, derived from a combination of short- and long-read sequencing in conjunction with optical mapping, revealed a compact genome of ~58 Mbp distributed over 19 chromosomes containing 15,274 predicted protein-coding genes. The genome has uniformmore » gene density over chromosomes, low repetitive sequence content (~6%), and a high fraction of protein-coding sequence (~39%) with relatively long coding exons and few coding introns. Functional annotation of gene models identified orthologous families for the majority (~73%) of genes. Synteny analysis uncovered localized but scrambled blocks of genes in putative orthologous relationships with other green algae. Two genes encoding beta-ketolase (BKT), the key enzyme synthesizing astaxanthin, were found in the genome, and both were up-regulated by high light. Isolation and molecular analysis of astaxanthin-deficient mutants showed that BKT1 is required for the production of astaxanthin. Moreover, the transcriptome under high light exposure revealed candidate genes that could be involved in critical yet missing steps of astaxanthin biosynthesis, including ABC transporters, cytochrome P450 enzymes, and an acyltransferase. Finally, the high-quality genome and transcriptome provide insight into the green algal lineage and carotenoid production.« less

  11. Chromosome-level genome assembly and transcriptome of the green alga Chromochloris zofingiensis illuminates astaxanthin production

    PubMed Central

    Roth, Melissa S.; Cokus, Shawn J.; Gallaher, Sean D.; Walter, Andreas; Lopez, David; Erickson, Erika; Endelman, Benjamin; Westcott, Daniel; Larabell, Carolyn A.; Merchant, Sabeeha S.; Pellegrini, Matteo

    2017-01-01

    Microalgae have potential to help meet energy and food demands without exacerbating environmental problems. There is interest in the unicellular green alga Chromochloris zofingiensis, because it produces lipids for biofuels and a highly valuable carotenoid nutraceutical, astaxanthin. To advance understanding of its biology and facilitate commercial development, we present a C. zofingiensis chromosome-level nuclear genome, organelle genomes, and transcriptome from diverse growth conditions. The assembly, derived from a combination of short- and long-read sequencing in conjunction with optical mapping, revealed a compact genome of ∼58 Mbp distributed over 19 chromosomes containing 15,274 predicted protein-coding genes. The genome has uniform gene density over chromosomes, low repetitive sequence content (∼6%), and a high fraction of protein-coding sequence (∼39%) with relatively long coding exons and few coding introns. Functional annotation of gene models identified orthologous families for the majority (∼73%) of genes. Synteny analysis uncovered localized but scrambled blocks of genes in putative orthologous relationships with other green algae. Two genes encoding beta-ketolase (BKT), the key enzyme synthesizing astaxanthin, were found in the genome, and both were up-regulated by high light. Isolation and molecular analysis of astaxanthin-deficient mutants showed that BKT1 is required for the production of astaxanthin. Moreover, the transcriptome under high light exposure revealed candidate genes that could be involved in critical yet missing steps of astaxanthin biosynthesis, including ABC transporters, cytochrome P450 enzymes, and an acyltransferase. The high-quality genome and transcriptome provide insight into the green algal lineage and carotenoid production. PMID:28484037

  12. EDGE 2017 R&D 100 Entry with Appendix

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chain, Patrick Sam Guy; Davenport, Karen Walston; Li, Po-E

    Diabetes, infertility, cancer, and Alzheimer’s disease—the key to one day preventing or even curing such afflictions and diseases (both infectious and genetically driven) may be locked in our own genetic code and the code of microorganisms that inhabit our bodies. The study of this code, known as genomics, has recently become much more promising as a result of two things: (1) vast improvements in high-throughput, nextgeneration sequencing (NSG), and (2) an exponential decrease in the cost of such sequencing. For example, it originally cost approximately $3 billion to sequence the human genome; today, this genome could be resequenced for lessmore » than $1,000.« less

  13. Determining coding CpG islands by identifying regions significant for pattern statistics on Markov chains.

    PubMed

    Singer, Meromit; Engström, Alexander; Schönhuth, Alexander; Pachter, Lior

    2011-09-23

    Recent experimental and computational work confirms that CpGs can be unmethylated inside coding exons, thereby showing that codons may be subjected to both genomic and epigenomic constraint. It is therefore of interest to identify coding CpG islands (CCGIs) that are regions inside exons enriched for CpGs. The difficulty in identifying such islands is that coding exons exhibit sequence biases determined by codon usage and constraints that must be taken into account. We present a method for finding CCGIs that showcases a novel approach we have developed for identifying regions of interest that are significant (with respect to a Markov chain) for the counts of any pattern. Our method begins with the exact computation of tail probabilities for the number of CpGs in all regions contained in coding exons, and then applies a greedy algorithm for selecting islands from among the regions. We show that the greedy algorithm provably optimizes a biologically motivated criterion for selecting islands while controlling the false discovery rate. We applied this approach to the human genome (hg18) and annotated CpG islands in coding exons. The statistical criterion we apply to evaluating islands reduces the number of false positives in existing annotations, while our approach to defining islands reveals significant numbers of undiscovered CCGIs in coding exons. Many of these appear to be examples of functional epigenetic specialization in coding exons.

  14. Scaling features of noncoding DNA

    NASA Technical Reports Server (NTRS)

    Stanley, H. E.; Buldyrev, S. V.; Goldberger, A. L.; Havlin, S.; Peng, C. K.; Simons, M.

    1999-01-01

    We review evidence supporting the idea that the DNA sequence in genes containing noncoding regions is correlated, and that the correlation is remarkably long range--indeed, base pairs thousands of base pairs distant are correlated. We do not find such a long-range correlation in the coding regions of the gene, and utilize this fact to build a Coding Sequence Finder Algorithm, which uses statistical ideas to locate the coding regions of an unknown DNA sequence. Finally, we describe briefly some recent work adapting to DNA the Zipf approach to analyzing linguistic texts, and the Shannon approach to quantifying the "redundancy" of a linguistic text in terms of a measurable entropy function, and reporting that noncoding regions in eukaryotes display a larger redundancy than coding regions. Specifically, we consider the possibility that this result is solely a consequence of nucleotide concentration differences as first noted by Bonhoeffer and his collaborators. We find that cytosine-guanine (CG) concentration does have a strong "background" effect on redundancy. However, we find that for the purine-pyrimidine binary mapping rule, which is not affected by the difference in CG concentration, the Shannon redundancy for the set of analyzed sequences is larger for noncoding regions compared to coding regions.

  15. Phylogenetic distribution and expression of a penicillin-binding protein homologue, Ear and its significance in virulence of Staphylococcus aureus.

    PubMed

    Singh, Vineet K; Ring, Robert P; Aswani, Vijay; Stemper, Mary E; Kislow, Jennifer; Ye, Zhan; Shukla, Sanjay K

    2017-12-01

    Staphylococcus aureus is an opportunistic human pathogen that can cause serious infections in humans. A plethora of known and putative virulence factors are produced by staphylococci that collectively orchestrate pathogenesis. Ear protein (Escherichia coli ampicillin resistance) in S. aureus is an exoprotein in COL strain, predicted to be a superantigen, and speculated to play roles in antibiotic resistance and virulence. The goal of this study was to determine if expression of ear is modulated by single nucleotide polymorphisms in its promoter and coding sequences and whether this gene plays roles in antibiotic resistance and virulence. Promoter, coding sequences and expression of the ear gene in clinical and carriage S. aureus strains with distinct genetic backgrounds were analysed. The JE2 strain and its isogenic ear mutant were used in a systemic infection mouse model to determine the competiveness of the ear mutant.Results/Key findings. The ear gene showed a variable expression, with USA300FPR3757 showing a high-level expression compared to many of the other strains tested including some showing negligible expression. Higher expression was associated with agr type 1 but not correlated with phylogenetic relatedness of the ear gene based upon single nucleotide polymorphisms in the promoter or coding regions suggesting a complex regulation. An isogenic JE2 (USA300 background) ear mutant showed no significant difference in its growth, antibiotic susceptibility or virulence in a mouse model. Our data suggests that despite being highly expressed in a USA300 genetic background, Ear is not a significant contributor to virulence in that strain.

  16. Cost-Effective Sequencing of Full-Length cDNA Clones Powered by a De Novo-Reference Hybrid Assembly

    PubMed Central

    Sugano, Sumio; Morishita, Shinichi; Suzuki, Yutaka

    2010-01-01

    Background Sequencing full-length cDNA clones is important to determine gene structures including alternative splice forms, and provides valuable resources for experimental analyses to reveal the biological functions of coded proteins. However, previous approaches for sequencing cDNA clones were expensive or time-consuming, and therefore, a fast and efficient sequencing approach was demanded. Methodology We developed a program, MuSICA 2, that assembles millions of short (36-nucleotide) reads collected from a single flow cell lane of Illumina Genome Analyzer to shotgun-sequence ∼800 human full-length cDNA clones. MuSICA 2 performs a hybrid assembly in which an external de novo assembler is run first and the result is then improved by reference alignment of shotgun reads. We compared the MuSICA 2 assembly with 200 pooled full-length cDNA clones finished independently by the conventional primer-walking using Sanger sequencers. The exon-intron structure of the coding sequence was correct for more than 95% of the clones with coding sequence annotation when we excluded cDNA clones insufficiently represented in the shotgun library due to PCR failure (42 out of 200 clones excluded), and the nucleotide-level accuracy of coding sequences of those correct clones was over 99.99%. We also applied MuSICA 2 to full-length cDNA clones from Toxoplasma gondii, to confirm that its ability was competent even for non-human species. Conclusions The entire sequencing and shotgun assembly takes less than 1 week and the consumables cost only ∼US$3 per clone, demonstrating a significant advantage over previous approaches. PMID:20479877

  17. Genomic DNA sequence and cytosine methylation changes of adult rice leaves after seeds space flight

    NASA Astrophysics Data System (ADS)

    Shi, Jinming

    In this study, cytosine methylation on CCGG site and genomic DNA sequence changes of adult leaves of rice after seeds space flight were detected by methylation-sensitive amplification polymorphism (MSAP) and Amplified fragment length polymorphism (AFLP) technique respectively. Rice seeds were planted in the trial field after 4 days space flight on the shenzhou-6 Spaceship of China. Adult leaves of space-treated rice including 8 plants chosen randomly and 2 plants with phenotypic mutation were used for AFLP and MSAP analysis. Polymorphism of both DNA sequence and cytosine methylation were detected. For MSAP analysis, the average polymorphic frequency of the on-ground controls, space-treated plants and mutants are 1.3%, 3.1% and 11% respectively. For AFLP analysis, the average polymorphic frequencies are 1.4%, 2.9%and 8%respectively. Total 27 and 22 polymorphic fragments were cloned sequenced from MSAP and AFLP analysis respectively. Nine of the 27 fragments from MSAP analysis show homology to coding sequence. For the 22 polymorphic fragments from AFLP analysis, no one shows homology to mRNA sequence and eight fragments show homology to repeat region or retrotransposon sequence. These results suggest that although both genomic DNA sequence and cytosine methylation status can be effected by space flight, the genomic region homology to the fragments from genome DNA and cytosine methylation analysis were different.

  18. [Learning and Repetive Reproduction of Memorized Sequences by the Right and the Left Hand].

    PubMed

    Bobrova, E V; Lyakhovetskii, V A; Bogacheva, I N

    2015-01-01

    An important stage of learning a new skill is repetitive reproduction of one and the same sequence of movements, which plays a significant role in forming of the movement stereotypes. Two groups of right-handers repeatedly memorized (6-10 repetitions) the sequences of their hand transitions by experimenter in 6 positions, firstly by the right hand (RH), and then--by the left hand (LH) or vice versa. Random sequences previously unknown to the volunteers were reproduced in the 11 series. Modified sequences were tested in the 2nd and 3rd series, where the same elements' positions were presented in different order. The processes of repetitive sequence reproduction were similar for RH and LH. However, the learning of the modified sequences differed: Information about elements' position disregarding the reproduction order was used only when LH initiated task performing. This information was not used when LH followed RH and when RH performed the task. Consequently, the type of information coding activated by LH helped learn the positions of sequence elements, while the type of information coding activated by RH prevented learning. It is supposedly connected with the predominant role of right hemisphere in the processes of positional coding and motor learning.

  19. Sequence Polishing Library (SPL) v10.0

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Oberortner, Ernst

    The Sequence Polishing Library (SPL) is a suite of software tools in order to automate "Design for Synthesis and Assembly" workflows. Specifically: The SPL "Converter" tool converts files among the following sequence data exchange formats: CSV, FASTA, GenBank, and Synthetic Biology Open Language (SBOL); The SPL "Juggler" tool optimizes the codon usages of DNA coding sequences according to an optimization strategy, a user-specific codon usage table and genetic code. In addition, the SPL "Juggler" can translate amino acid sequences into DNA sequences.:The SPL "Polisher" verifies NA sequences against DNA synthesis constraints, such as GC content, repeating k-mers, and restriction sites.more » In case of violations, the "Polisher" reports the violations in a comprehensive manner. The "Polisher" tool can also modify the violating regions according to an optimization strategy, a user-specific codon usage table and genetic code;The SPL "Partitioner" decomposes large DNA sequences into smaller building blocks with partial overlaps that enable an efficient assembly. The "Partitioner" enables the user to configure the characteristics of the overlaps, which are mostly determined by the utilized assembly protocol, such as length, GC content, or melting temperature.« less

  20. Multiple Access Interference Reduction Using Received Response Code Sequence for DS-CDMA UWB System

    NASA Astrophysics Data System (ADS)

    Toh, Keat Beng; Tachikawa, Shin'ichi

    This paper proposes a combination of novel Received Response (RR) sequence at the transmitter and a Matched Filter-RAKE (MF-RAKE) combining scheme receiver system for the Direct Sequence-Code Division Multiple Access Ultra Wideband (DS-CDMA UWB) multipath channel model. This paper also demonstrates the effectiveness of the RR sequence in Multiple Access Interference (MAI) reduction for the DS-CDMA UWB system. It suggests that by using conventional binary code sequence such as the M sequence or the Gold sequence, there is a possibility of generating extra MAI in the UWB system. Therefore, it is quite difficult to collect the energy efficiently although the RAKE reception method is applied at the receiver. The main purpose of the proposed system is to overcome the performance degradation for UWB transmission due to the occurrence of MAI during multiple accessing in the DS-CDMA UWB system. The proposed system improves the system performance by improving the RAKE reception performance using the RR sequence which can reduce the MAI effect significantly. Simulation results verify that significant improvement can be obtained by the proposed system in the UWB multipath channel models.

  1. Viewing multiple sequence alignments with the JavaScript Sequence Alignment Viewer (JSAV)

    PubMed Central

    Martin, Andrew C. R.

    2014-01-01

    The JavaScript Sequence Alignment Viewer (JSAV) is designed as a simple-to-use JavaScript component for displaying sequence alignments on web pages. The display of sequences is highly configurable with options to allow alternative coloring schemes, sorting of sequences and ’dotifying’ repeated amino acids. An option is also available to submit selected sequences to another web site, or to other JavaScript code. JSAV is implemented purely in JavaScript making use of the JQuery and JQuery-UI libraries. It does not use any HTML5-specific options to help with browser compatibility. The code is documented using JSDOC and is available from http://www.bioinf.org.uk/software/jsav/. PMID:25653836

  2. Viewing multiple sequence alignments with the JavaScript Sequence Alignment Viewer (JSAV).

    PubMed

    Martin, Andrew C R

    2014-01-01

    The JavaScript Sequence Alignment Viewer (JSAV) is designed as a simple-to-use JavaScript component for displaying sequence alignments on web pages. The display of sequences is highly configurable with options to allow alternative coloring schemes, sorting of sequences and 'dotifying' repeated amino acids. An option is also available to submit selected sequences to another web site, or to other JavaScript code. JSAV is implemented purely in JavaScript making use of the JQuery and JQuery-UI libraries. It does not use any HTML5-specific options to help with browser compatibility. The code is documented using JSDOC and is available from http://www.bioinf.org.uk/software/jsav/.

  3. Comparative sequence analysis of acid sensitive/resistance proteins in Escherichia coli and Shigella flexneri

    PubMed Central

    Manikandan, Selvaraj; Balaji, Seetharaaman; Kumar, Anil; Kumar, Rita

    2007-01-01

    The molecular basis for the survival of bacteria under extreme conditions in which growth is inhibited is a question of great current interest. A preliminary study was carried out to determine residue pattern conservation among the antiporters of enteric bacteria, responsible for extreme acid sensitivity especially in Escherichia coli and Shigella flexneri. Here we found the molecular evidence that proved the relationship between E. coli and S. flexneri. Multiple sequence alignment of the gadC coded acid sensitive antiporter showed many conserved residue patterns at regular intervals at the N-terminal region. It was observed that as the alignment approaches towards the C-terminal, the number of conserved residues decreases, indicating that the N-terminal region of this protein has much active role when compared to the carboxyl terminal. The motif, FHLVFFLLLGG, is well conserved within the entire gadC coded protein at the amino terminal. The motif is also partially conserved among other antiporters (which are not coded by gadC) but involved in acid sensitive/resistance mechanism. Phylogenetic cluster analysis proves the relationship of Escherichia coli and Shigella flexneri. The gadC coded proteins are converged as a clade and diverged from other antiporters belongs to the amino acid-polyamine-organocation (APC) superfamily. PMID:21670792

  4. Identification of a novel bovine enterovirus possessing highly divergent amino acid sequences in capsid protein.

    PubMed

    Tsuchiaka, Shinobu; Rahpaya, Sayed Samim; Otomaru, Konosuke; Aoki, Hiroshi; Kishimoto, Mai; Naoi, Yuki; Omatsu, Tsutomu; Sano, Kaori; Okazaki-Terashima, Sachiko; Katayama, Yukie; Oba, Mami; Nagai, Makoto; Mizutani, Tetsuya

    2017-01-17

    Bovine enterovirus (BEV) belongs to the species Enterovirus E or F, genus Enterovirus and family Picornaviridae. Although numerous studies have identified BEVs in the feces of cattle with diarrhea, the pathogenicity of BEVs remains unclear. Previously, we reported the detection of novel kobu-like virus in calf feces, by metagenomics analysis. In the present study, we identified a novel BEV in diarrheal feces collected for that survey. Complete genome sequences were determined by deep sequencing in feces. Secondary RNA structure analysis of the 5' untranslated region (UTR), phylogenetic tree construction and pairwise identity analysis were conducted. The complete genome sequences of BEV were genetically distant from other EVs and the VP1 coding region contained novel and unique amino acid sequences. We named this strain as BEV AN12/Bos taurus/JPN/2014 (referred to as BEV-AN12). According to genome analysis, the genome length of this virus is 7414 nucleotides excluding the poly (A) tail and its genome consists of a 5'UTR, open reading frame encoding a single polyprotein, and 3'UTR. The results of secondary RNA structure analysis showed that in the 5'UTR, BEV-AN12 had an additional clover leaf structure and small stem loop structure, similarly to other BEVs. In pairwise identity analysis, BEV-AN12 showed high amino acid (aa) identities to Enterovirus F in the polyprotein, P2 and P3 regions (aa identity ≥82.4%). Therefore, BEV-AN12 is closely related to Enterovirus F. However, aa sequences in the capsid protein regions, particularly the VP1 encoding region, showed significantly low aa identity to other viruses in genus Enterovirus (VP1 aa identity ≤58.6%). In addition, BEV-AN12 branched separately from Enterovirus E and F in phylogenetic trees based on the aa sequences of P1 and VP1, although it clustered with Enterovirus F in trees based on sequences in the P2 and P3 genome region. We identified novel BEV possessing highly divergent aa sequences in the VP1 coding region in Japan. According to species definition, we proposed naming this strain as "Enterovirus K", which is a novel species within genus Enterovirus. Further genomic studies are needed to understand the pathogenicity of BEVs.

  5. Sequence-based analysis of pQBR103; a representative of a unique, transfer-proficient mega plasmid resident in the microbial community of sugar beet

    PubMed Central

    Tett, Adrian; Spiers, Andrew J; Crossman, Lisa C; Ager, Duane; Ciric, Lena; Dow, J Maxwell; Fry, John C; Harris, David; Lilley, Andrew; Oliver, Anna; Parkhill, Julian; Quail, Michael A; Rainey, Paul B; Saunders, Nigel J; Seeger, Kathy; Snyder, Lori AS; Squares, Rob; Thomas, Christopher M; Turner, Sarah L; Zhang, Xue-Xian; Field, Dawn; Bailey, Mark J

    2009-01-01

    The plasmid pQBR103 was found within Pseudomonas populations colonizing the leaf and root surfaces of sugar beet plants growing at Wytham, Oxfordshire, UK. At 425 kb it is the largest self-transmissible plasmid yet sequenced from the phytosphere. It is known to enhance the competitive fitness of its host, and parts of the plasmid are known to be actively transcribed in the plant environment. Analysis of the complete sequence of this plasmid predicts a coding sequence (CDS)-rich genome containing 478 CDSs and an exceptional degree of genetic novelty; 80% of predicted coding sequences cannot be ascribed a function and 60% are orphans. Of those to which function could be assigned, 40% bore greatest similarity to sequences from Pseudomonas spp, and the majority of the remainder showed similarity to other c-proteobacterial genera and plasmids. pQBR103 has identifiable regions presumed responsible for replication and partitioning, but despite being tra+ lacks the full complement of any previously described conjugal transfer functions. The DNA sequence provided few insights into the functional significance of plant-induced transcriptional regions, but suggests that 14% of CDSs may be expressed (11 CDSs with functional annotation and 54 without), further highlighting the ecological importance of these novel CDSs. Comparative analysis indicates that pQBR103 shares significant regions of sequence with other plasmids isolated from sugar beet plants grown at the same geographic location. These plasmid sequences indicate there is more novelty in the mobile DNA pool accessible to phytosphere pseudomonas than is currently appreciated or understood. PMID:18043644

  6. A novel peptide from the ACEI/BPP-CNP precursor in the venom of Crotalus durissus collilineatus.

    PubMed

    Higuchi, Shigesada; Murayama, Nobuhiro; Saguchi, Ken-ichi; Ohi, Hiroaki; Fujita, Yoshiaki; da Silva, Nelson Jorge; de Siqueira, Rodrigo José Bezerra; Lahlou, Saad; Aird, Steven D

    2006-10-01

    In crotaline venoms, angiotensin-converting enzyme inhibitors [ACEIs, also known as bradykinin potentiating peptides (BPPs)], are products of a gene coding for an ACEI/BPP-C-type natriuretic peptide (CNP) precursor. In the genes from Bothrops jararaca and Gloydius blomhoffii, ACEI/BPP sequences are repeated. Sequencing of a cDNA clone from venom glands of Crotalus durissus collilineatus showed that two ACEIs/BPPs are located together at the N-terminus, but without repeats. An additional sequence for CNP was unexpectedly found at the C-terminus. Homologous genes for the ACEI/BPP-CNP precursor suggest that most crotaline venoms contain both ACEIs/BPPs and CNP. The sequence of ACEIs/BPPs is separated from the CNP sequence by a long spacer sequence. Previously, there was no evidence that this spacer actually coded any expressed peptides. Aird and Kaiser (1986, unpublished) previously isolated and sequenced a peptide of 11 residues (TPPAGPDVGPR) from Crotalus viridis viridis venom. In the present study, analysis of the cDNA clone from C. d. collilineatus revealed a nearly identical sequence in the ACEI/BPP-CNP spacer. Fractionation of the crude venom by reverse phase HPLC (C(18)), and analysis of the fractions by mass spectrometry (MS) indicated a component of 1020.5 Da. Amino acid sequencing by MS/MS confirmed that C. d. collilineatus venom contains the peptide TPPAGPDGGPR. Its high proline content and paired proline residues are typical of venom hypotensive peptides, although it lacks the usual N-terminal pyroglutamate. It has no demonstrable hypotensive activity when injected intravenously in rats; however, its occurrence in the venoms of dissimilar species suggests that its presence is not accidental. Evidence suggests that these novel toxins probably activate anaphylatoxin C3a receptors.

  7. Use of wavelet-packet transforms to develop an engineering model for multifractal characterization of mutation dynamics in pathological and nonpathological gene sequences

    NASA Astrophysics Data System (ADS)

    Walker, David Lee

    1999-12-01

    This study uses dynamical analysis to examine in a quantitative fashion the information coding mechanism in DNA sequences. This exceeds the simple dichotomy of either modeling the mechanism by comparing DNA sequence walks as Fractal Brownian Motion (fbm) processes. The 2-D mappings of the DNA sequences for this research are from Iterated Function System (IFS) (Also known as the ``Chaos Game Representation'' (CGR)) mappings of the DNA sequences. This technique converts a 1-D sequence into a 2-D representation that preserves subsequence structure and provides a visual representation. The second step of this analysis involves the application of Wavelet Packet Transforms, a recently developed technique from the field of signal processing. A multi-fractal model is built by using wavelet transforms to estimate the Hurst exponent, H. The Hurst exponent is a non-parametric measurement of the dynamism of a system. This procedure is used to evaluate gene- coding events in the DNA sequence of cystic fibrosis mutations. The H exponent is calculated for various mutation sites in this gene. The results of this study indicate the presence of anti-persistent, random walks and persistent ``sub-periods'' in the sequence. This indicates the hypothesis of a multi-fractal model of DNA information encoding warrants further consideration. This work examines the model's behavior in both pathological (mutations) and non-pathological (healthy) base pair sequences of the cystic fibrosis gene. These mutations both natural and synthetic were introduced by computer manipulation of the original base pair text files. The results show that disease severity and system ``information dynamics'' correlate. These results have implications for genetic engineering as well as in mathematical biology. They suggest that there is scope for more multi-fractal models to be developed.

  8. RNAcentral: an international database of ncRNA sequences

    DOE PAGES

    Williams, Kelly Porter

    2014-10-28

    The field of non-coding RNA biology has been hampered by the lack of availability of a comprehensive, up-to-date collection of accessioned RNA sequences. Here we present the first release of RNAcentral, a database that collates and integrates information from an international consortium of established RNA sequence databases. The initial release contains over 8.1 million sequences, including representatives of all major functional classes. A web portal (http://rnacentral.org) provides free access to data, search functionality, cross-references, source code and an integrated genome browser for selected species.

  9. The complete validated mitochondrial genome of the silver gemfish Rexea solandri (Cuvier, 1832) (Perciformes, Gempylidae).

    PubMed

    Bustamante, Carlos; Ovenden, Jennifer R

    2016-01-01

    The silver gemfish Rexea solandri is an important economic resource but Vulnerable to overfishing in Australian waters. The complete mitochondrial genome sequence is described from 1.6 million reads obtained via next generation sequencing. The total length of the mitogenome is 16,350 bp comprising 2 rRNA, 13 protein-coding genes, 22 tRNA and 2 non-coding regions. The mitogenome sequence was validated against sequences of PCR fragments and BLAST queries of Genbank. Gene order was equivalent to that found in marine fishes.

  10. Spontaneous Mutation Rate in the Smallest Photosynthetic Eukaryotes

    PubMed Central

    Krasovec, Marc; Eyre-Walker, Adam; Sanchez-Ferandin, Sophie

    2017-01-01

    Abstract Mutation is the ultimate source of genetic variation, and knowledge of mutation rates is fundamental for our understanding of all evolutionary processes. High throughput sequencing of mutation accumulation lines has provided genome wide spontaneous mutation rates in a dozen model species, but estimates from nonmodel organisms from much of the diversity of life are very limited. Here, we report mutation rates in four haploid marine bacterial-sized photosynthetic eukaryotic algae; Bathycoccus prasinos, Ostreococcus tauri, Ostreococcus mediterraneus, and Micromonas pusilla. The spontaneous mutation rate between species varies from μ = 4.4 × 10−10 to 9.8 × 10−10 mutations per nucleotide per generation. Within genomes, there is a two-fold increase of the mutation rate in intergenic regions, consistent with an optimization of mismatch and transcription-coupled DNA repair in coding sequences. Additionally, we show that deviation from the equilibrium GC content increases the mutation rate by ∼2% to ∼12% because of a GC bias in coding sequences. More generally, the difference between the observed and equilibrium GC content of genomes explains some of the inter-specific variation in mutation rates. PMID:28379581

  11. MouSensor: A Versatile Genetic Platform to Create Super Sniffer Mice for Studying Human Odor Coding.

    PubMed

    D'Hulst, Charlotte; Mina, Raena B; Gershon, Zachary; Jamet, Sophie; Cerullo, Antonio; Tomoiaga, Delia; Bai, Li; Belluscio, Leonardo; Rogers, Matthew E; Sirotin, Yevgeniy; Feinstein, Paul

    2016-07-26

    Typically, ∼0.1% of the total number of olfactory sensory neurons (OSNs) in the main olfactory epithelium express the same odorant receptor (OR) in a singular fashion and their axons coalesce into homotypic glomeruli in the olfactory bulb. Here, we have dramatically increased the total number of OSNs expressing specific cloned OR coding sequences by multimerizing a 21-bp sequence encompassing the predicted homeodomain binding site sequence, TAATGA, known to be essential in OR gene choice. Singular gene choice is maintained in these "MouSensors." In vivo synaptopHluorin imaging of odor-induced responses by known M71 ligands shows functional glomerular activation in an M71 MouSensor. Moreover, a behavioral avoidance task demonstrates that specific odor detection thresholds are significantly decreased in multiple transgenic lines, expressing mouse or human ORs. We have developed a versatile platform to study gene choice and axon identity, to create biosensors with great translational potential, and to finally decode human olfaction. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

  12. Xuhuai goat H-FABP gene clone, subcellular localization of expression products and the preparation of transgenic mice.

    PubMed

    Yin, Yan-hui; Li, Bi-chun; Wei, Guang-hui; Zhu, Cai-ye; Li, Wei; Zhang, Ya-ni; Du, Li-xin; Cao, Wen-guang

    2012-05-01

    The aim of this study was to clone the heart-type fatty acid binding protein (H-FABP) gene of Xuhuai goat, to explore it bioinformatically, and analyze the subcellular localization using enhanced green fluorescent protein (EGFP). The results showed that the coding sequence (CDS) length of Xuhuai goat H-FABP gene was 402 bp, encoding 133 amino acids (GenBank accession number AY466498.1). The H-FABP cDNA coding sequence was compared with the corresponding region of human, chicken, brown rat, cow, wild boar, donkey, and zebrafish. The similarity were 89%, 76%, 85%, 84%, 93%, 91%, 70%, respectively. For the corresponding amino acid sequences, the similarity were 90%, 79%, 88%, 97%, 95%, 94%, 72%, respectively. This study did not find the signal peptide region in the H-FABP protein; it revealed that H-FABP protein might be a nonsecreted protein. H-FABP expression was detected in vitro by reverse transcription-polymerase chain reaction (RT-PCR), and the EGFP-H-FABP fusion protein was localized to the cytoplasm. The gene could also be transiently and permanently expressed in mice.

  13. Structural organization and classification of cytochrome P450 genes in flax (Linum usitatissimum L.).

    PubMed

    Babu, Peram Ravindra; Rao, Khareedu Venkateswara; Reddy, Vudem Dashavantha

    2013-01-15

    Flax CYPome analysis resulted in the identification of 334 putative cytochrome P450 (CYP450) genes in the cultivated flax genome. Classification of flax CYP450 genes based on the sequence similarity with Arabidopsis orthologs and CYP450 nomenclature, revealed 10 clans representing 44 families and 98 subfamilies. CYP80, CYP83, CYP92, CYP702, CYP705, CYP708, CYP728, CYP729, CYP733 and CYP736 families are absent in the flax genome. The subfamily members exhibited conserved sequences, length of exons and phasing of introns. Similarity search of the genomic resources of wild flax species Linum bienne with CYP450 coding sequences of the cultivated flax, revealed the presence of 127 CYP450 gene orthologs, indicating amplification of novel CYP450 genes in the cultivated flax. Seven families CYP73, 74, 75, 76, 77, 84 and 709, coding for enzymes associated with phenylpropanoid/fatty acid metabolism, showed extensive gene amplification in the flax. About 59% of the flax CYP450 genes were present in the EST libraries. Copyright © 2012 Elsevier B.V. All rights reserved.

  14. Arthropod phylogenetics in light of three novel millipede (myriapoda: diplopoda) mitochondrial genomes with comments on the appropriateness of mitochondrial genome sequence data for inferring deep level relationships.

    PubMed

    Brewer, Michael S; Swafford, Lynn; Spruill, Chad L; Bond, Jason E

    2013-01-01

    Arthropods are the most diverse group of eukaryotic organisms, but their phylogenetic relationships are poorly understood. Herein, we describe three mitochondrial genomes representing orders of millipedes for which complete genomes had not been characterized. Newly sequenced genomes are combined with existing data to characterize the protein coding regions of myriapods and to attempt to reconstruct the evolutionary relationships within the Myriapoda and Arthropoda. The newly sequenced genomes are similar to previously characterized millipede sequences in terms of synteny and length. Unique translocations occurred within the newly sequenced taxa, including one half of the Appalachioria falcifera genome, which is inverted with respect to other millipede genomes. Across myriapods, amino acid conservation levels are highly dependent on the gene region. Additionally, individual loci varied in the level of amino acid conservation. Overall, most gene regions showed low levels of conservation at many sites. Attempts to reconstruct the evolutionary relationships suffered from questionable relationships and low support values. Analyses of phylogenetic informativeness show the lack of signal deep in the trees (i.e., genes evolve too quickly). As a result, the myriapod tree resembles previously published results but lacks convincing support, and, within the arthropod tree, well established groups were recovered as polyphyletic. The novel genome sequences described herein provide useful genomic information concerning millipede groups that had not been investigated. Taken together with existing sequences, the variety of compositions and evolution of myriapod mitochondrial genomes are shown to be more complex than previously thought. Unfortunately, the use of mitochondrial protein-coding regions in deep arthropod phylogenetics appears problematic, a result consistent with previously published studies. Lack of phylogenetic signal renders the resulting tree topologies as suspect. As such, these data are likely inappropriate for investigating such ancient relationships.

  15. Complete genome sequence of a coxsackievirus B3 recombinant isolated from an aseptic meningitis outbreak in eastern China.

    PubMed

    Zhang, Wenqiang; Lin, Xiaojuan; Jiang, Ping; Tao, Zexin; Liu, Xiaolin; Ji, Feng; Wang, Tongzhan; Wang, Suting; Lv, Hui; Xu, Aiqiang; Wang, Haiyan

    2016-08-01

    Coxsackievirus B3 (CV-B3) has frequently been associated with aseptic meningitis outbreaks in China. To identify sequence motifs related to aseptic meningitis and to construct an infectious clone, the genome sequence of 08TC170, a representative strain isolated from cerebrospinal fluid (CSF) samples from an outbreak in Shandong in 2008, was determined, and the coding regions for P1-P3 and VP1 were aligned. The first 21 and last 20 residues were "TTAAAACAGCCTGTGGGTTGT" and "ATTCTCCGCATTCGGTGCGG", respectively. The whole genome consisted of 7401 nucleotides, sharing 80.8 % identity with the prototype strain Nancy and low sequence similarity with members of clusters A-C. In contrast, 08TC170 showed high sequence similarity to members of cluster D. An especially high level of sequence identity (≥97.7 %) was found within a branch constituted by 08TC170 and four Chinese strains that clustered together in all of the P1-P3 phylogenic trees. In addition, 08TC170 also possessed a close relationship to the Hong Kong strain 26362/08 in VP1. Similarity plot analysis showed that 08TC170 was most similar to the Chinese CV-B3 strain SSM in P1 and the partial P2 coding region but to the CV-B5 or E-6 strain in 2C and following regions. A T277A mutation was found in 08TC170 and other strains isolated in 2008-2010, but not in strains isolated before 2008, which had high sequence similarity and formed the cluster A277. The results suggested that 08TC170 was the product of both intertypic recombination and point mutation, whose effects on viral neurovirulence will be investigated in a further study. The high homology between 08TC170 and other strains revealed their co-circulation in mainland China and Hong Kong and indicates that further surveillance is needed.

  16. High rate concatenated coding systems using bandwidth efficient trellis inner codes

    NASA Technical Reports Server (NTRS)

    Deng, Robert H.; Costello, Daniel J., Jr.

    1989-01-01

    High-rate concatenated coding systems with bandwidth-efficient trellis inner codes and Reed-Solomon (RS) outer codes are investigated for application in high-speed satellite communication systems. Two concatenated coding schemes are proposed. In one the inner code is decoded with soft-decision Viterbi decoding, and the outer RS code performs error-correction-only decoding (decoding without side information). In the other, the inner code is decoded with a modified Viterbi algorithm, which produces reliability information along with the decoded output. In this algorithm, path metrics are used to estimate the entire information sequence, whereas branch metrics are used to provide reliability information on the decoded sequence. This information is used to erase unreliable bits in the decoded output. An errors-and-erasures RS decoder is then used for the outer code. The two schemes have been proposed for high-speed data communication on NASA satellite channels. The rates considered are at least double those used in current NASA systems, and the results indicate that high system reliability can still be achieved.

  17. An ultra-sparse code underliesthe generation of neural sequences in a songbird

    NASA Astrophysics Data System (ADS)

    Hahnloser, Richard H. R.; Kozhevnikov, Alexay A.; Fee, Michale S.

    2002-09-01

    Sequences of motor activity are encoded in many vertebrate brains by complex spatio-temporal patterns of neural activity; however, the neural circuit mechanisms underlying the generation of these pre-motor patterns are poorly understood. In songbirds, one prominent site of pre-motor activity is the forebrain robust nucleus of the archistriatum (RA), which generates stereotyped sequences of spike bursts during song and recapitulates these sequences during sleep. We show that the stereotyped sequences in RA are driven from nucleus HVC (high vocal centre), the principal pre-motor input to RA. Recordings of identified HVC neurons in sleeping and singing birds show that individual HVC neurons projecting onto RA neurons produce bursts sparsely, at a single, precise time during the RA sequence. These HVC neurons burst sequentially with respect to one another. We suggest that at each time in the RA sequence, the ensemble of active RA neurons is driven by a subpopulation of RA-projecting HVC neurons that is active only at that time. As a population, these HVC neurons may form an explicit representation of time in the sequence. Such a sparse representation, a temporal analogue of the `grandmother cell' concept for object recognition, eliminates the problem of temporal interference during sequence generation and learning attributed to more distributed representations.

  18. Exploration of sequence space as the basis of viral RNA genome segmentation.

    PubMed

    Moreno, Elena; Ojosnegros, Samuel; García-Arriaza, Juan; Escarmís, Cristina; Domingo, Esteban; Perales, Celia

    2014-05-06

    The mechanisms of viral RNA genome segmentation are unknown. On extensive passage of foot-and-mouth disease virus in baby hamster kidney-21 cells, the virus accumulated multiple point mutations and underwent a transition akin to genome segmentation. The standard single RNA genome molecule was replaced by genomes harboring internal in-frame deletions affecting the L- or capsid-coding region. These genomes were infectious and killed cells by complementation. Here we show that the point mutations in the nonstructural protein-coding region (P2, P3) that accumulated in the standard genome before segmentation increased the relative fitness of the segmented version relative to the standard genome. Fitness increase was documented by intracellular expression of virus-coded proteins and infectious progeny production by RNAs with the internal deletions placed in the sequence context of the parental and evolved genome. The complementation activity involved several viral proteins, one of them being the leader proteinase L. Thus, a history of genetic drift with accumulation of point mutations was needed to allow a major variation in the structure of a viral genome. Thus, exploration of sequence space by a viral genome (in this case an unsegmented RNA) can reach a point of the space in which a totally different genome structure (in this case, a segmented RNA) is favored over the form that performed the exploration.

  19. Intact coding region of the serotonin transporter gene in obsessive-compulsive disorder

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Altemus, M.; Murphy, D.L.; Greenberg, B.

    1996-07-26

    Epidemiologic studies indicate that obsessive-compulsive disorder is genetically transmitted in some families, although no genetic abnormalities have been identified in individuals with this disorder. The selective response of obsessive-compulsive disorder to treatment with agents which block serotonin reuptake suggests the gene coding for the serotonin transporter as a candidate gene. The primary structure of the serotonin-transporter coding region was sequenced in 22 patients with obsessive-compulsive disorder, using direct PCR sequencing of cDNA synthesized from platelet serotonin-transporter mRNA. No variations in amino acid sequence were found among the obsessive-compulsive disorder patients or healthy controls. These results do not support a rolemore » for alteration in the primary structure of the coding region of the serotonin-transporter gene in the pathogenesis of obsessive-compulsive disorder. 27 refs.« less

  20. Novel coding, translation, and gene expression of a replicating covalently closed circular RNA of 220 nt.

    PubMed

    AbouHaidar, Mounir Georges; Venkataraman, Srividhya; Golshani, Ashkan; Liu, Bolin; Ahmad, Tauqeer

    2014-10-07

    The highly structured (64% GC) covalently closed circular (CCC) RNA (220 nt) of the virusoid associated with rice yellow mottle virus codes for a 16-kDa highly basic protein using novel modalities for coding, translation, and gene expression. This CCC RNA is the smallest among all known viroids and virusoids and the only one that codes proteins. Its sequence possesses an internal ribosome entry site and is directly translated through two (or three) completely overlapping ORFs (shifting to a new reading frame at the end of each round). The initiation and termination codons overlap UGAUGA (underline highlights the initiation codon AUG within the combined initiation-termination sequence). Termination codons can be ignored to obtain larger read-through proteins. This circular RNA with no noncoding sequences is a unique natural supercompact "nanogenome."

  1. Cis-encoded non-coding antisense RNAs in streptococci and other low GC Gram (+) bacterial pathogens

    PubMed Central

    Cho, Kyu Hong; Kim, Jeong-Ho

    2015-01-01

    Due to recent advances of bioinformatics and high throughput sequencing technology, discovery of regulatory non-coding RNAs in bacteria has been increased to a great extent. Based on this bandwagon, many studies searching for trans-acting small non-coding RNAs in streptococci have been performed intensively, especially in the important human pathogen, group A and B streptococci. However, studies for cis-encoded non-coding antisense RNAs in streptococci have been scarce. A recent study shows antisense RNAs are involved in virulence gene regulation in group B streptococcus, S. agalactiae. This suggests antisense RNAs could have important roles in the pathogenesis of streptococcal pathogens. In this review, we describe recent discoveries of chromosomal cis-encoded antisense RNAs in streptococcal pathogens and other low GC Gram (+) bacteria to provide a guide for future studies. PMID:25859258

  2. Sequencing proteins with transverse ionic transport in nanochannels.

    PubMed

    Boynton, Paul; Di Ventra, Massimiliano

    2016-05-03

    De novo protein sequencing is essential for understanding cellular processes that govern the function of living organisms and all sequence modifications that occur after a protein has been constructed from its corresponding DNA code. By obtaining the order of the amino acids that compose a given protein one can then determine both its secondary and tertiary structures through structure prediction, which is used to create models for protein aggregation diseases such as Alzheimer's Disease. Here, we propose a new technique for de novo protein sequencing that involves translocating a polypeptide through a synthetic nanochannel and measuring the ionic current of each amino acid through an intersecting perpendicular nanochannel. We find that the distribution of ionic currents for each of the 20 proteinogenic amino acids encoded by eukaryotic genes is statistically distinct, showing this technique's potential for de novo protein sequencing.

  3. Introgression from Domestic Goat Generated Variation at the Major Histocompatibility Complex of Alpine Ibex

    PubMed Central

    Grossen, Christine; Keller, Lukas; Biebach, Iris; Croll, Daniel

    2014-01-01

    The major histocompatibility complex (MHC) is a crucial component of the vertebrate immune system and shows extremely high levels of genetic polymorphism. The extraordinary genetic variation is thought to be ancient polymorphisms maintained by balancing selection. However, introgression from related species was recently proposed as an additional mechanism. Here we provide evidence for introgression at the MHC in Alpine ibex (Capra ibex ibex). At a usually very polymorphic MHC exon involved in pathogen recognition (DRB exon 2), Alpine ibex carried only two alleles. We found that one of these DRB alleles is identical to a DRB allele of domestic goats (Capra aegagrus hircus). We sequenced 2489 bp of the coding and non-coding regions of the DRB gene and found that Alpine ibex homozygous for the goat-type DRB exon 2 allele showed nearly identical sequences (99.8%) to a breed of domestic goats. Using Sanger and RAD sequencing, microsatellite and SNP chip data, we show that the chromosomal region containing the goat-type DRB allele has a signature of recent introgression in Alpine ibex. A region of approximately 750 kb including the DRB locus showed high rates of heterozygosity in individuals carrying one copy of the goat-type DRB allele. These individuals shared SNP alleles both with domestic goats and other Alpine ibex. In a survey of four Alpine ibex populations, we found that the region surrounding the DRB allele shows strong linkage disequilibria, strong sequence clustering and low diversity among haplotypes carrying the goat-type allele. Introgression at the MHC is likely adaptive and introgression critically increased MHC DRB diversity in the genetically impoverished Alpine ibex. Our finding contradicts the long-standing view that genetic variability at the MHC is solely a consequence of ancient trans-species polymorphism. Introgression is likely an underappreciated source of genetic diversity at the MHC and other loci under balancing selection. PMID:24945814

  4. Gene and genon concept: coding versus regulation

    PubMed Central

    2007-01-01

    We analyse here the definition of the gene in order to distinguish, on the basis of modern insight in molecular biology, what the gene is coding for, namely a specific polypeptide, and how its expression is realized and controlled. Before the coding role of the DNA was discovered, a gene was identified with a specific phenotypic trait, from Mendel through Morgan up to Benzer. Subsequently, however, molecular biologists ventured to define a gene at the level of the DNA sequence in terms of coding. As is becoming ever more evident, the relations between information stored at DNA level and functional products are very intricate, and the regulatory aspects are as important and essential as the information coding for products. This approach led, thus, to a conceptual hybrid that confused coding, regulation and functional aspects. In this essay, we develop a definition of the gene that once again starts from the functional aspect. A cellular function can be represented by a polypeptide or an RNA. In the case of the polypeptide, its biochemical identity is determined by the mRNA prior to translation, and that is where we locate the gene. The steps from specific, but possibly separated sequence fragments at DNA level to that final mRNA then can be analysed in terms of regulation. For that purpose, we coin the new term “genon”. In that manner, we can clearly separate product and regulative information while keeping the fundamental relation between coding and function without the need to introduce a conceptual hybrid. In mRNA, the program regulating the expression of a gene is superimposed onto and added to the coding sequence in cis - we call it the genon. The complementary external control of a given mRNA by trans-acting factors is incorporated in its transgenon. A consequence of this definition is that, in eukaryotes, the gene is, in most cases, not yet present at DNA level. Rather, it is assembled by RNA processing, including differential splicing, from various pieces, as steered by the genon. It emerges finally as an uninterrupted nucleic acid sequence at mRNA level just prior to translation, in faithful correspondence with the amino acid sequence to be produced as a polypeptide. After translation, the genon has fulfilled its role and expires. The distinction between the protein coding information as materialised in the final polypeptide and the processing information represented by the genon allows us to set up a new information theoretic scheme. The standard sequence information determined by the genetic code expresses the relation between coding sequence and product. Backward analysis asks from which coding region in the DNA a given polypeptide originates. The (more interesting) forward analysis asks in how many polypeptides of how many different types a given DNA segment is expressed. This concerns the control of the expression process for which we have introduced the genon concept. Thus, the information theoretic analysis can capture the complementary aspects of coding and regulation, of gene and genon. PMID:18087760

  5. Flexible and polarization-controllable diffusion metasurface with optical transparency

    NASA Astrophysics Data System (ADS)

    Zhuang, Yaqiang; Wang, Guangming; Liang, Jiangang; Cai, Tong; Guo, Wenlong; Zhang, Qingfeng

    2017-11-01

    In this paper, a novel coding metasurface is proposed to realize polarization-controllable diffusion scattering. The anisotropic Jerusalem-cross unit cell is employed as the basic coding element due to its polarization-dependent phase response. The isotropic random coding sequence is firstly designed to obtain diffusion scattering, and the anisotropic random coding sequence is subsequently realized by adding different periodic coding sequences to the original isotropic one along different directions. For demonstration, we designed and fabricated a flexible polarization-controllable diffusion metasurface (PCDM) with both chessboard diffusion and hedge diffusion under different polarizations. The specular scattering reduction performance of the anisotropic metasurface is better than the isotropic one because the scattered energies are redirected away from the specular reflection direction. For potential applications, the flexible PCDM wrapped around a cylinder structure is investigated and tested for polarization-controllable diffusion scattering. The numerical and experimental results coincide well, indicating anisotropic low scatterings with comparable performances. This paper provides an alternative approach for designing high-performance, flexible, low-scattering platforms.

  6. Genome variability of foot-and-mouth disease virus during the short period of the 2010 epidemic in Japan.

    PubMed

    Nishi, Tatsuya; Yamada, Manabu; Fukai, Katsuhiko; Shimada, Nobuaki; Morioka, Kazuki; Yoshida, Kazuo; Sakamoto, Kenichi; Kanno, Toru; Yamakawa, Makoto

    2017-02-01

    Foot-and-mouth disease virus (FMDV) is highly contagious and has a high mutation rate, leading to extensive genetic variation. To investigate how FMDV genetically evolves over a short period of an epidemic after initial introduction into an FMD-free area, whole L-fragment sequences of 104 FMDVs isolated from the 2010 epidemic in Japan, which continued for less than three months were determined and phylogenetically and comparatively analyzed. Phylogenetic analysis of whole L-fragment sequences showed that these isolates were classified into a single group, indicating that FMDV was introduced into Japan in the epidemic via a single introduction. Nucleotide sequences of 104 virus isolates showed more than 99.56% pairwise identity rates without any genetic deletion or insertion, although no sequences were completely identical with each other. These results indicate that genetic substitutions of FMDV occurred gradually and constantly during the epidemic and generation of an extensive mutant virus could have been prevented by rapid eradication strategy. From comparative analysis of variability of each FMDV protein coding region, VP4 and 2C regions showed the highest average identity rates and invariant rates, and were confirmed as highly conserved. In contrast, the protein coding regions VP2 and VP1 were confirmed to be highly variable regions with the lowest average identity rates and invariant rates, respectively. Our data demonstrate the importance of rapid eradication strategy in an FMD epidemic and provide valuable information on the genome variability of FMDV during the short period of an epidemic. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.

  7. Multistability in auditory stream segregation: a predictive coding view

    PubMed Central

    Winkler, István; Denham, Susan; Mill, Robert; Bőhm, Tamás M.; Bendixen, Alexandra

    2012-01-01

    Auditory stream segregation involves linking temporally separate acoustic events into one or more coherent sequences. For any non-trivial sequence of sounds, many alternative descriptions can be formed, only one or very few of which emerge in awareness at any time. Evidence from studies showing bi-/multistability in auditory streaming suggest that some, perhaps many of the alternative descriptions are represented in the brain in parallel and that they continuously vie for conscious perception. Here, based on a predictive coding view, we consider the nature of these sound representations and how they compete with each other. Predictive processing helps to maintain perceptual stability by signalling the continuation of previously established patterns as well as the emergence of new sound sources. It also provides a measure of how well each of the competing representations describes the current acoustic scene. This account of auditory stream segregation has been tested on perceptual data obtained in the auditory streaming paradigm. PMID:22371621

  8. Secure multiple access for indoor optical wireless communications with time-slot coding and chaotic phase.

    PubMed

    Liang, Tian; Wang, Ke; Lim, Christina; Wong, Elaine; Song, Tingting; Nirmalathas, Ampalavanapillai

    2017-09-04

    In this paper, we report a novel mechanism to simultaneously provide secure connections for multiple users in indoor optical wireless communication systems by employing the time-slot coding scheme together with chaotic phase sequence. The chaotic phase sequence is generated according to the logistic map and applied to each symbol to secure the transmission. Proof-of-concept experiments are carried out for multiple system capacities based on both 4-QAM and 16-QAM modulation formats, i.e. 1.25 Gb/s, 2 Gb/s and 2.5 Gb/s for 4-QAM, and 2.5 Gb/s, 3.33 Gb/s and 4 Gb/s for 16-QAM. Experimental results show that in all cases the added chaotic phase does not degrade the legitimate user's signal quality while the illegal user cannot detect the signal without the key.

  9. The Diversity Present in 5140 Human Mitochondrial Genomes

    PubMed Central

    Pereira, Luísa; Freitas, Fernando; Fernandes, Verónica; Pereira, Joana B.; Costa, Marta D.; Costa, Stephanie; Máximo, Valdemar; Macaulay, Vincent; Rocha, Ricardo; Samuels, David C.

    2009-01-01

    We analyzed the current status (as of the end of August 2008) of human mitochondrial genomes deposited in GenBank, amounting to 5140 complete or coding-region sequences, in order to present an overall picture of the diversity present in the mitochondrial DNA of the global human population. To perform this task, we developed mtDNA-GeneSyn, a computer tool that identifies and exhaustedly classifies the diversity present in large genetic data sets. The diversity observed in the 5140 human mitochondrial genomes was compared with all possible transitions and transversions from the standard human mitochondrial reference genome. This comparison showed that tRNA and rRNA secondary structures have a large effect in limiting the diversity of the human mitochondrial sequences, whereas for the protein-coding genes there is a bias toward less variation at the second codon positions. The analysis of the observed amino acid variations showed a tolerance of variations that convert between the amino acids V, I, A, M, and T. This defines a group of amino acids with similar chemical properties that can interconvert by a single transition. PMID:19426953

  10. Identification of a new genotype H wild-type mumps virus strain and its molecular relatedness to other virulent and attenuated strains.

    PubMed

    Amexis, Georgios; Rubin, Steven; Chatterjee, Nando; Carbone, Kathryn; Chumakov, Kostantin

    2003-06-01

    A single clinical isolate of mumps virus designated 88-1961 was obtained from a patient hospitalized with a clinical history of upper respiratory tract infection, parotitis, severe headache, fever and lymphadenopathy. We have sequenced the full-length genome of 88-1961 and compared it against all available full-length sequences of mumps virus. Based upon its nucleotide sequence of the SH gene 88-1961 was identified as a genotype H mumps strain. The overall extent of nucleotide and amino acid differences between each individual gene and protein of 88-1961 and the full-length mumps samples showed that the missense to silent ratios were unevenly distributed. Upon evaluation of the consensus sequence of 88-1961, four positions were found to be clearly heterogeneous at the nucleotide level (NP 315C/T, NP 318C/T, F 271A/C, and HN 855C/T). Sequence analysis revealed that the amino acid sequences for the NP, M, and the L protein were the most conserved, whereas the SH protein exhibited the highest variability among the compared mumps genotypes A, B, and G. No identifying molecular patterns in the non-coding (intergenic) or coding regions of 88-1961 were found when we compared it against relatively virulent (Urabe AM9 B, Glouc1/UK96, 87-1004 and 87-1005) and non-virulent mumps strains (Jeryl Lynn and all Urabe Am9 A substrains). Copyright 2003 Wiley-Liss, Inc.

  11. In silico search, characterization and validation of new EST-SSR markers in the genus Prunus.

    PubMed

    Sorkheh, Karim; Prudencio, Angela S; Ghebinejad, Azim; Dehkordi, Mehrana Kohei; Erogul, Deniz; Rubio, Manuel; Martínez-Gómez, Pedro

    2016-07-07

    Simple sequence repeats (SSRs) are defined as sequence repeat units between 1 and 6 bp that occur in both coding and non-coding regions abundant in eukaryotic genomes, which may affect the expression of genes. In this study, expressed sequence tags (ESTs) of eight Prunus species were analyzed for in silico mining of EST-SSRs, protein annotation, and open reading frames (ORFs), and the identification of codon repetitions. A total of 316 SSRs were identified using MISA software. Dinucleotide SSR motifs (26.31 %) were found to be the most abundant type of repeats, followed by tri- (14.58 %), tetra- (0.53 %), and penta- (0.27 %) nucleotide motifs. An attempt was made to design primer pairs for 316 identified SSRs but these were successful for only 175 SSR sequences. The positions of SSRs with respect to ORFs were detected, and annotation of sequences containing SSRs was performed to assign function to each sequence. SSRs were also characterized (in terms of position in the reference genome and associated gene) using the two available Prunus reference genomes (mei and peach). Finally, 38 SSR markers were validated across peach, almond, plum, and apricot genotypes. This validation showed a higher transferability level of EST-SSR developed in P. mume (mei) in comparison with the rest of species analyzed. Findings will aid analysis of functionally important molecular markers and facilitate the analysis of genetic diversity.

  12. groHMM: a computational tool for identifying unannotated and cell type-specific transcription units from global run-on sequencing data.

    PubMed

    Chae, Minho; Danko, Charles G; Kraus, W Lee

    2015-07-16

    Global run-on coupled with deep sequencing (GRO-seq) provides extensive information on the location and function of coding and non-coding transcripts, including primary microRNAs (miRNAs), long non-coding RNAs (lncRNAs), and enhancer RNAs (eRNAs), as well as yet undiscovered classes of transcripts. However, few computational tools tailored toward this new type of sequencing data are available, limiting the applicability of GRO-seq data for identifying novel transcription units. Here, we present groHMM, a computational tool in R, which defines the boundaries of transcription units de novo using a two state hidden-Markov model (HMM). A systematic comparison of the performance between groHMM and two existing peak-calling methods tuned to identify broad regions (SICER and HOMER) favorably supports our approach on existing GRO-seq data from MCF-7 breast cancer cells. To demonstrate the broader utility of our approach, we have used groHMM to annotate a diverse array of transcription units (i.e., primary transcripts) from four GRO-seq data sets derived from cells representing a variety of different human tissue types, including non-transformed cells (cardiomyocytes and lung fibroblasts) and transformed cells (LNCaP and MCF-7 cancer cells), as well as non-mammalian cells (from flies and worms). As an example of the utility of groHMM and its application to questions about the transcriptome, we show how groHMM can be used to analyze cell type-specific enhancers as defined by newly annotated enhancer transcripts. Our results show that groHMM can reveal new insights into cell type-specific transcription by identifying novel transcription units, and serve as a complete and useful tool for evaluating functional genomic elements in cells.

  13. Phylogenomic Resolution of the Phylogeny of Laurasiatherian Mammals: Exploring Phylogenetic Signals within Coding and Noncoding Sequences.

    PubMed

    Chen, Meng-Yun; Liang, Dan; Zhang, Peng

    2017-08-01

    The interordinal relationships of Laurasiatherian mammals are currently one of the most controversial questions in mammalian phylogenetics. Previous studies mainly relied on coding sequences (CDS) and seldom used noncoding sequences. Here, by data mining public genome data, we compiled an intron data set of 3,638 genes (all introns from a protein-coding gene are considered as a gene) (19,055,073 bp) and a CDS data set of 10,259 genes (20,994,285 bp), covering all major lineages of Laurasiatheria (except Pholidota). We found that the intron data contained stronger and more congruent phylogenetic signals than the CDS data. In agreement with this observation, concatenation and species-tree analyses of the intron data set yielded well-resolved and identical phylogenies, whereas the CDS data set produced weakly supported and incongruent results. Further analyses showed that the phylogeny inferred from the intron data is highly robust to data subsampling and change in outgroup, but the CDS data produced unstable results under the same conditions. Interestingly, gene tree statistical results showed that the most frequently observed gene tree topologies for the CDS and intron data are identical, suggesting that the major phylogenetic signal within the CDS data is actually congruent with that within the intron data. Our final result of Laurasiatheria phylogeny is (Eulipotyphla,((Chiroptera, Perissodactyla),(Carnivora, Cetartiodactyla))), favoring a close relationship between Chiroptera and Perissodactyla. Our study 1) provides a well-supported phylogenetic framework for Laurasiatheria, representing a step towards ending the long-standing "hard" polytomy and 2) argues that intron within genome data is a promising data resource for resolving rapid radiation events across the tree of life. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  14. Molecular homogeneity of heat-stable enterotoxins produced by bovine enterotoxigenic Escherichia coli.

    PubMed Central

    Saeed, A M; Magnuson, N S; Sriranganathan, N; Burger, D; Cosand, W

    1984-01-01

    Heat-stable enterotoxins (STs) from four strains of bovine enterotoxigenic Escherichia coli representing four serogroups were purified to homogeneity by utilizing previously published purification schemata. Biochemical characterization of the purified STs showed that they met the basic criteria for the heat-stable enterotoxins of E. coli. Amino acid analysis of the purified STs revealed that they were peptides of identical amino acid composition. This composition consisted of 18 residues of 10 different amino acids, 6 of which were cysteine. The amino acid composition of the four ST peptides was identical to that reported for the STs of human and porcine E. coli. In addition, complete sequence analysis of two of the ST peptides and partial sequencing of several others revealed strong homology to the sequences of STs from human and porcine E. coli and to the sequence predicted from the last 18 codons of the transposon Tn1681. There was also substantial homology to the sequence predicted from the ST-coding genetic element of human E. coli, which may indicate the existence of identical bioactive configuration among ST peptides of E. coli strains of various host origins. These data support the hypothesis that STs produced by human, bovine, and porcine E. coli are coded by a closely related genetic element which may have originated from a single, widely disseminated transposon. Images PMID:6376355

  15. Compound heterozygous mutations in the SRD5A2 gene exon 4 in a male pseudohermaphrodite patient of Chinese origin.

    PubMed

    Fernández-Cancio, Mónica; Nistal, Manuel; Gracia, Ricardo; Molina, M Antonia; Tovar, Juan Antonio; Esteban, Cristina; Carrascosa, Antonio; Audí, Laura

    2004-01-01

    The goal of this study was to perform 5-alpha-reductase type 2 gene (SRD5A2) analysis in a male pseudohermaphrodite (MPH) patient with normal testosterone (T) production and normal androgen receptor (AR) gene coding sequences. A patient of Chinese origin with ambiguous genitalia at 14 months, a 46,XY karyotype, and normal T secretion under human chorionic gonadotropin (hCG) stimulation underwent a gonadectomy at 20 months. Exons 1-8 of the AR gene and exons 1-5 of the SRD5A2 gene were sequenced from peripheral blood DNA. AR gene coding sequences were normal. SRD5A2 gene analysis revealed 2 consecutive mutations in exon 4, each located in a different allele: 1) a T nucleotide deletion, which predicts a frameshift mutation from codon 219, and 2) a missense mutation at codon 227, where the substitution of guanine (CGA) by adenine (CAA) predicts a glutamine replacement of arginine (R227Q). Testes located in the inguinal canal showed a normal morphology for age. The patient was a compound heterozygote for SRD5A2 mutations, carrying 2 mutations in exon 4. The patient showed an R227Q mutation that has been described in an Asian population and MPH patients, along with a novel frameshift mutation, Tdel219. Testis morphology showed that, during early infancy, the 5-alpha-reductase enzyme deficiency may not have affected interstitial or tubular development.

  16. Nucleotide sequence and structural organization of the human vasopressin pituitary receptor (V3) gene.

    PubMed

    René, P; Lenne, F; Ventura, M A; Bertagna, X; de Keyzer, Y

    2000-01-04

    In the pituitary, vasopressin triggers ACTH release through a specific receptor subtype, termed V3 or V1b. We cloned the V3 cDNA and showed that its expression was almost exclusive to pituitary corticotrophs and some corticotroph tumors. To study the determinants of this tissue specificity, we have now cloned the gene for the human (h) V3 receptor and characterized its structure. It is composed of two exons, spanning 10kb, with the coding region interrupted between transmembrane domains 6 and 7. We established that the transcription initiation site is located 498 nucleotides upstream of the initiator codon and showed that two polyadenylation sites may be used, while the most frequent is the most downstream. Sequence analysis of the promoter region showed no TATA box but identified consensus binding motifs for Sp1, CREB, and half sites of the estrogen receptor binding site. However comparison with another corticotroph-specific gene, proopiomelanocortin, did not identify common regulatory elements in the two promoters except for a short GC-rich region. Unexpectedly, hV3 gene analysis revealed that a formerly cloned 'artifactual' hV3 cDNA indeed corresponded to a spliced antisense transcript, overlapping the 5' part of the coding sequence in exon 1 and the promoter region. This transcript, hV3rev, was detected in normal pituitary and in many corticotroph tumors expressing hV3 sense mRNA and may therefore play a role in hV3 gene expression.

  17. Characterization of a species-specific repetitive DNA from a highly endangered wild animal, Rhinoceros unicornis, and assessment of genetic polymorphism by microsatellite associated sequence amplification (MASA).

    PubMed

    Ali, S; Azfer, M A; Bashamboo, A; Mathur, P K; Malik, P K; Mathur, V B; Raha, A K; Ansari, S

    1999-03-04

    We have cloned and sequenced a 906bp EcoRI repeat DNA fraction from Rhinoceros unicornis genome. The contig pSS(R)2 is AT rich with 340 A (37.53%), 187 C (20.64%), 173 G (19.09%) and 206 T (22.74%). The sequence contains MALT box, NF-E1, Poly-A signal, lariat consensus sequences, TATA box, translational initiation sequences and several stop codons. Translation of the contig showed seven different types of protein motifs, among which, EGF-like domain cysteine pattern signatures and Bowman-Birk serine protease inhibitor family signatures were prominent. The presence of eukaryotic transcriptional elements, protein signatures and analysis of subset sequences in the 5' region from 1 to 165nt indicating coding potential (test code value=0.97) suggest possible regulatory and/or functional role(s) of these sequences in the rhino genome. Translation of the complementary strand from 906 to 706nt and 190 to 2nt showed proteins of more than 7kDa rich in non-polar residues. This suggests that pSS(R)2 is either a part of, or adjacent to, a functional gene. The contig contains mostly non-consecutive simple repeat units from 2 to 17nt with varying frequencies, of which four base motifs were found to be predominant. Zoo-blot hybridization revealed that pSS(R)2 sequences are unique to R. unicornis genome because they do not cross-hybridize, even with the genomic DNA of South African black rhino Diceros bicornis. Southern blot analysis of R. unicornis genomic DNA with pSS(R)2 and other synthetic oligo probes revealed a high level of genetic homogeneity, which was also substantiated by microsatellite associated sequence amplification (MASA). Owing to its uniqueness, the pSS(R)2 probe has a potential application in the area of conservation biology for unequivocal identification of horn or other body tissues of R. unicornis. The evolutionary aspect of this repeat fraction in the context of comparative genome analysis is discussed.

  18. Sequence space coverage, entropy of genomes and the potential to detect non-human DNA in human samples

    PubMed Central

    Liu, Zhandong; Venkatesh, Santosh S; Maley, Carlo C

    2008-01-01

    Background Genomes store information for building and maintaining organisms. Complete sequencing of many genomes provides the opportunity to study and compare global information properties of those genomes. Results We have analyzed aspects of the information content of Homo sapiens, Mus musculus, Drosophila melanogaster, Caenorhabditis elegans, Arabidopsis thaliana, Saccharomyces cerevisiae, and Escherichia coli (K-12) genomes. Virtually all possible (> 98%) 12 bp oligomers appear in vertebrate genomes while < 2% of 19 bp oligomers are present. Other species showed different ranges of > 98% to < 2% of possible oligomers in D. melanogaster (12–17 bp), C. elegans (11–17 bp), A. thaliana (11–17 bp), S. cerevisiae (10–16 bp) and E. coli (9–15 bp). Frequencies of unique oligomers in the genomes follow similar patterns. We identified a set of 2.6 M 15-mers that are more than 1 nucleotide different from all 15-mers in the human genome and so could be used as probes to detect microbes in human samples. In a human sample, these probes would detect 100% of the 433 currently fully sequenced prokaryotes and 75% of the 3065 fully sequenced viruses. The human genome is significantly more compact in sequence space than a random genome. We identified the most frequent 5- to 20-mers in the human genome, which may prove useful as PCR primers. We also identified a bacterium, Anaeromyxobacter dehalogenans, which has an exceptionally low diversity of oligomers given the size of its genome and its GC content. The entropy of coding regions in the human genome is significantly higher than non-coding regions and chromosomes. However chromosomes 1, 2, 9, 12 and 14 have a relatively high proportion of coding DNA without high entropy, and chromosome 20 is the opposite with a low frequency of coding regions but relatively high entropy. Conclusion Measures of the frequency of oligomers are useful for designing PCR assays and for identifying chromosomes and organisms with hidden structure that had not been previously recognized. This information may be used to detect novel microbes in human tissues. PMID:18973670

  19. Sequence space coverage, entropy of genomes and the potential to detect non-human DNA in human samples.

    PubMed

    Liu, Zhandong; Venkatesh, Santosh S; Maley, Carlo C

    2008-10-30

    Genomes store information for building and maintaining organisms. Complete sequencing of many genomes provides the opportunity to study and compare global information properties of those genomes. We have analyzed aspects of the information content of Homo sapiens, Mus musculus, Drosophila melanogaster, Caenorhabditis elegans, Arabidopsis thaliana, Saccharomyces cerevisiae, and Escherichia coli (K-12) genomes. Virtually all possible (> 98%) 12 bp oligomers appear in vertebrate genomes while < 2% of 19 bp oligomers are present. Other species showed different ranges of > 98% to < 2% of possible oligomers in D. melanogaster (12-17 bp), C. elegans (11-17 bp), A. thaliana (11-17 bp), S. cerevisiae (10-16 bp) and E. coli (9-15 bp). Frequencies of unique oligomers in the genomes follow similar patterns. We identified a set of 2.6 M 15-mers that are more than 1 nucleotide different from all 15-mers in the human genome and so could be used as probes to detect microbes in human samples. In a human sample, these probes would detect 100% of the 433 currently fully sequenced prokaryotes and 75% of the 3065 fully sequenced viruses. The human genome is significantly more compact in sequence space than a random genome. We identified the most frequent 5- to 20-mers in the human genome, which may prove useful as PCR primers. We also identified a bacterium, Anaeromyxobacter dehalogenans, which has an exceptionally low diversity of oligomers given the size of its genome and its GC content. The entropy of coding regions in the human genome is significantly higher than non-coding regions and chromosomes. However chromosomes 1, 2, 9, 12 and 14 have a relatively high proportion of coding DNA without high entropy, and chromosome 20 is the opposite with a low frequency of coding regions but relatively high entropy. Measures of the frequency of oligomers are useful for designing PCR assays and for identifying chromosomes and organisms with hidden structure that had not been previously recognized. This information may be used to detect novel microbes in human tissues.

  20. Multiple copies of a bile acid-inducible gene in Eubacterium sp. strain VPI 12708.

    PubMed Central

    Gopal-Srivastava, R; Mallonee, D H; White, W B; Hylemon, P B

    1990-01-01

    Eubacterium sp. strain VPI 12708 is an anaerobic intestinal bacterium which possesses inducible bile acid 7-dehydroxylation activity. Several new polypeptides are produced in this strain following induction with cholic acid. Genes coding for two copies of a bile acid-inducible 27,000-dalton polypeptide (baiA1 and baiA2) have been previously cloned and sequenced. We now report on a gene coding for a third copy of this 27,000-dalton polypeptide (baiA3). The baiA3 gene has been cloned in lambda DASH on an 11.2-kilobase DNA fragment from a partial Sau3A digest of the Eubacterium DNA. DNA sequence analysis of the baiA3 gene revealed 100% homology with the baiA1 gene within the coding region of the 27,000-dalton polypeptides. The baiA2 gene shares 81% sequence identity with the other two genes at the nucleotide level. The flanking nucleotide sequences associated with the baiA1 and baiA3 genes are identical for 930 bases in the 5' direction from the initiation codon and for at least 325 bases in the 3' direction from the stop codon, including the putative promoter regions for the genes. An additional open reading frame (occupying from 621 to 648 bases, depending on the correct start codon) was found in the identical 5' regions associated with the baiA1 and baiA3 clones. The 5' sequence 930 bases upstream from the baiA1 and baiA3 genes was totally divergent. The baiA2 gene, which is part of a large bile acid-inducible operon, showed no homology with the other two genes either in the 5' or 3' direction from the polypeptide coding region, except for a 15-base-pair presumed ribosome-binding site in the 5' region. These studies strongly suggest that a gene duplication (baiA1 and baiA3) has occurred and is stably maintained in this bacterium. Images PMID:2376563

  1. Draft genome sequence of a thermostable, alkaliphilic α-amylase and protease producing Bacillus amyloliquefaciens strain KCP2.

    PubMed

    Prajapati, Vimalkumar S; Ray, Sanket; Narayan, Jitendra; Joshi, Chaitanya C; Patel, Kamlesh C; Trivedi, Ujjval B; Patel, R M

    2017-12-01

    Bacillus amyloliquefaciens strain KCP2 was isolated from municipal food waste samples collected in Vallabh Vidyanagar, Gujarat, India. Strain KCP2 is noteworthy due to its ability to produce a thermostable, alkaliphilic α-amylase and a protease. These enzymes have importance in several industrial processes including bread making, brewing, starch processing, pharmacy, and textile industries. Whole genome sequencing of strain KCP2 showed that the estimated genome size was 3.9 Mb, the G + C content was 46%, and it coded for 4113 genes.

  2. Training alignment parameters for arbitrary sequencers with LAST-TRAIN.

    PubMed

    Hamada, Michiaki; Ono, Yukiteru; Asai, Kiyoshi; Frith, Martin C

    2017-03-15

    LAST-TRAIN improves sequence alignment accuracy by inferring substitution and gap scores that fit the frequencies of substitutions, insertions, and deletions in a given dataset. We have applied it to mapping DNA reads from IonTorrent and PacBio RS, and we show that it reduces reference bias for Oxford Nanopore reads. the source code is freely available at http://last.cbrc.jp/. mhamada@waseda.jp or mcfrith@edu.k.u-tokyo.ac.jp. Supplementary data are available at Bioinformatics online. © The Author 2016. Published by Oxford University Press.

  3. Molecular cloning of a Candida albicans gene (SSB1) coding for a protein related to the Hsp70 family.

    PubMed

    Maneu, V; Cervera, A M; Martinez, J P; Gozalbo, D

    1997-06-15

    We have cloned and sequenced a Candida albicans gene (SSB1) encoding a potential member of the heat-shock protein seventy (hsp70) family. The protein encoded by this gene contains 613 amino acids and shows a high degree (85%) of sequence identity to the ssb subfamily (ssb1 and ssb2) of the Saccharomyces cerevisiae hsp70 family. The transcribed mRNA (2.1 kb) is present in similar amounts both in yeast and germ tube cells of C. albicans.

  4. Molecular evidence of undescribed Ceratonova sp. (Cnidaria: Myxosporea) in the freshwater polychaete, Manayunkia speciosa, from western Lake Erie

    USGS Publications Warehouse

    Malakauskas, David M.; Snipes, Robert Benjamin; Thompson, Ann M.; Schloesser, Donald W.

    2016-01-01

    We used PCR to screen pooled individuals of Manayunkia speciosa from western Lake Erie, Michigan, USA for myxosporean parasites. Amplicons from positive PCRs were sequenced and showed a Ceratonova species in an estimated 1.1% (95% CI = 0.46%, 1.8%) of M. speciosa individuals. We sequenced 18S, ITS1, 5.8S, ITS2 and most of the 28S rDNA regions of this Ceratonova sp., and part of the protein-coding EF2 gene. Phylogenetic analyses of ribosomal and EF2 sequences showed the Lake Erie Ceratonova sp. is most similar to, but genetically distinct from, Ceratonova shasta. Marked interspecific polymorphism in all genes examined, including the ITS barcoding genes, along with geographic location suggests this is an undescribed Ceratonova species. COI sequences showed M. speciosa individuals in Michigan and California are the same species. These findings represent a third parasite in the genus Ceratonovapotentially hosted by M. speciosa.

  5. Coding visual features extracted from video sequences.

    PubMed

    Baroffio, Luca; Cesana, Matteo; Redondi, Alessandro; Tagliasacchi, Marco; Tubaro, Stefano

    2014-05-01

    Visual features are successfully exploited in several applications (e.g., visual search, object recognition and tracking, etc.) due to their ability to efficiently represent image content. Several visual analysis tasks require features to be transmitted over a bandwidth-limited network, thus calling for coding techniques to reduce the required bit budget, while attaining a target level of efficiency. In this paper, we propose, for the first time, a coding architecture designed for local features (e.g., SIFT, SURF) extracted from video sequences. To achieve high coding efficiency, we exploit both spatial and temporal redundancy by means of intraframe and interframe coding modes. In addition, we propose a coding mode decision based on rate-distortion optimization. The proposed coding scheme can be conveniently adopted to implement the analyze-then-compress (ATC) paradigm in the context of visual sensor networks. That is, sets of visual features are extracted from video frames, encoded at remote nodes, and finally transmitted to a central controller that performs visual analysis. This is in contrast to the traditional compress-then-analyze (CTA) paradigm, in which video sequences acquired at a node are compressed and then sent to a central unit for further processing. In this paper, we compare these coding paradigms using metrics that are routinely adopted to evaluate the suitability of visual features in the context of content-based retrieval, object recognition, and tracking. Experimental results demonstrate that, thanks to the significant coding gains achieved by the proposed coding scheme, ATC outperforms CTA with respect to all evaluation metrics.

  6. Non-codingRNA sequence variations in human chronic lymphocytic leukemia and colorectal cancer.

    PubMed

    Wojcik, Sylwia E; Rossi, Simona; Shimizu, Masayoshi; Nicoloso, Milena S; Cimmino, Amelia; Alder, Hansjuerg; Herlea, Vlad; Rassenti, Laura Z; Rai, Kanti R; Kipps, Thomas J; Keating, Michael J; Croce, Carlo M; Calin, George A

    2010-02-01

    Cancer is a genetic disease in which the interplay between alterations in protein-coding genes and non-coding RNAs (ncRNAs) plays a fundamental role. In recent years, the full coding component of the human genome was sequenced in various cancers, whereas such attempts related to ncRNAs are still fragmentary. We screened genomic DNAs for sequence variations in 148 microRNAs (miRNAs) and ultraconserved regions (UCRs) loci in patients with chronic lymphocytic leukemia (CLL) or colorectal cancer (CRC) by Sanger technique and further tried to elucidate the functional consequences of some of these variations. We found sequence variations in miRNAs in both sporadic and familial CLL cases, mutations of UCRs in CLLs and CRCs and, in certain instances, detected functional effects of these variations. Furthermore, by integrating our data with previously published data on miRNA sequence variations, we have created a catalog of DNA sequence variations in miRNAs/ultraconserved genes in human cancers. These findings argue that ncRNAs are targeted by both germ line and somatic mutations as well as by single-nucleotide polymorphisms with functional significance for human tumorigenesis. Sequence variations in ncRNA loci are frequent and some have functional and biological significance. Such information can be exploited to further investigate on a genome-wide scale the frequency of genetic variations in ncRNAs and their functional meaning, as well as for the development of new diagnostic and prognostic markers for leukemias and carcinomas.

  7. Non-codingRNA sequence variations in human chronic lymphocytic leukemia and colorectal cancer

    PubMed Central

    Wojcik, Sylwia E.; Rossi, Simona; Shimizu, Masayoshi; Nicoloso, Milena S.; Cimmino, Amelia; Alder, Hansjuerg; Herlea, Vlad; Rassenti, Laura Z.; Rai, Kanti R.; Kipps, Thomas J.; Keating, Michael J.

    2010-01-01

    Cancer is a genetic disease in which the interplay between alterations in protein-coding genes and non-coding RNAs (ncRNAs) plays a fundamental role. In recent years, the full coding component of the human genome was sequenced in various cancers, whereas such attempts related to ncRNAs are still fragmentary. We screened genomic DNAs for sequence variations in 148 microRNAs (miRNAs) and ultraconserved regions (UCRs) loci in patients with chronic lymphocytic leukemia (CLL) or colorectal cancer (CRC) by Sanger technique and further tried to elucidate the functional consequences of some of these variations. We found sequence variations in miRNAs in both sporadic and familial CLL cases, mutations of UCRs in CLLs and CRCs and, in certain instances, detected functional effects of these variations. Furthermore, by integrating our data with previously published data on miRNA sequence variations, we have created a catalog of DNA sequence variations in miRNAs/ultraconserved genes in human cancers. These findings argue that ncRNAs are targeted by both germ line and somatic mutations as well as by single-nucleotide polymorphisms with functional significance for human tumorigenesis. Sequence variations in ncRNA loci are frequent and some have functional and biological significance. Such information can be exploited to further investigate on a genome-wide scale the frequency of genetic variations in ncRNAs and their functional meaning, as well as for the development of new diagnostic and prognostic markers for leukemias and carcinomas. PMID:19926640

  8. A Dual Origin of the Xist Gene from a Protein-Coding Gene and a Set of Transposable Elements

    PubMed Central

    Elisaphenko, Eugeny A.; Kolesnikov, Nikolay N.; Shevchenko, Alexander I.; Rogozin, Igor B.; Nesterova, Tatyana B.; Brockdorff, Neil; Zakian, Suren M.

    2008-01-01

    X-chromosome inactivation, which occurs in female eutherian mammals is controlled by a complex X-linked locus termed the X-inactivation center (XIC). Previously it was proposed that genes of the XIC evolved, at least in part, as a result of pseudogenization of protein-coding genes. In this study we show that the key XIC gene Xist, which displays fragmentary homology to a protein-coding gene Lnx3, emerged de novo in early eutherians by integration of mobile elements which gave rise to simple tandem repeats. The Xist gene promoter region and four out of ten exons found in eutherians retain homology to exons of the Lnx3 gene. The remaining six Xist exons including those with simple tandem repeats detectable in their structure have similarity to different transposable elements. Integration of mobile elements into Xist accompanies the overall evolution of the gene and presumably continues in contemporary eutherian species. Additionally we showed that the combination of remnants of protein-coding sequences and mobile elements is not unique to the Xist gene and is found in other XIC genes producing non-coding nuclear RNA. PMID:18575625

  9. Probability of coding of a DNA sequence: an algorithm to predict translated reading frames from their thermodynamic characteristics.

    PubMed Central

    Tramontano, A; Macchiato, M F

    1986-01-01

    An algorithm to determine the probability that a reading frame codifies for a protein is presented. It is based on the results of our previous studies on the thermodynamic characteristics of a translated reading frame. We also develop a prediction procedure to distinguish between coding and non-coding reading frames. The procedure is based on the characteristics of the putative product of the DNA sequence and not on periodicity characteristics of the sequence, so the prediction is not biased by the presence of overlapping translated reading frames or by the presence of translated reading frames on the complementary DNA strand. PMID:3753761

  10. Metastable neural dynamics mediates expectation

    NASA Astrophysics Data System (ADS)

    Mazzucato, Luca; La Camera, Giancarlo; Fontanini, Alfredo

    Sensory stimuli are processed faster when their presentation is expected compared to when they come as a surprise. We previously showed that, in multiple single-unit recordings from alert rat gustatory cortex, taste stimuli can be decoded faster from neural activity if preceded by a stimulus-predicting cue. However, the specific computational process mediating this anticipatory neural activity is unknown. Here, we propose a biologically plausible model based on a recurrent network of spiking neurons with clustered architecture. In the absence of stimulation, the model neural activity unfolds through sequences of metastable states, each state being a population vector of firing rates. We modeled taste stimuli and cue (the same for all stimuli) as two inputs targeting subsets of excitatory neurons. As observed in experiment, stimuli evoked specific state sequences, characterized in terms of `coding states', i.e., states occurring significantly more often for a particular stimulus. When stimulus presentation is preceded by a cue, coding states show a faster and more reliable onset, and expected stimuli can be decoded more quickly than unexpected ones. This anticipatory effect is unrelated to changes of firing rates in stimulus-selective neurons and is absent in homogeneous balanced networks, suggesting that a clustered organization is necessary to mediate the expectation of relevant events. Our results demonstrate a novel mechanism for speeding up sensory coding in cortical circuits. NIDCD K25-DC013557 (LM); NIDCD R01-DC010389 (AF); NSF IIS-1161852 (GL).

  11. mPUMA: a computational approach to microbiota analysis by de novo assembly of operational taxonomic units based on protein-coding barcode sequences.

    PubMed

    Links, Matthew G; Chaban, Bonnie; Hemmingsen, Sean M; Muirhead, Kevin; Hill, Janet E

    2013-08-15

    Formation of operational taxonomic units (OTU) is a common approach to data aggregation in microbial ecology studies based on amplification and sequencing of individual gene targets. The de novo assembly of OTU sequences has been recently demonstrated as an alternative to widely used clustering methods, providing robust information from experimental data alone, without any reliance on an external reference database. Here we introduce mPUMA (microbial Profiling Using Metagenomic Assembly, http://mpuma.sourceforge.net), a software package for identification and analysis of protein-coding barcode sequence data. It was developed originally for Cpn60 universal target sequences (also known as GroEL or Hsp60). Using an unattended process that is independent of external reference sequences, mPUMA forms OTUs by DNA sequence assembly and is capable of tracking OTU abundance. mPUMA processes microbial profiles both in terms of the direct DNA sequence as well as in the translated amino acid sequence for protein coding barcodes. By forming OTUs and calculating abundance through an assembly approach, mPUMA is capable of generating inputs for several popular microbiota analysis tools. Using SFF data from sequencing of a synthetic community of Cpn60 sequences derived from the human vaginal microbiome, we demonstrate that mPUMA can faithfully reconstruct all expected OTU sequences and produce compositional profiles consistent with actual community structure. mPUMA enables analysis of microbial communities while empowering the discovery of novel organisms through OTU assembly.

  12. Recurrence time statistics: versatile tools for genomic DNA sequence analysis.

    PubMed

    Cao, Yinhe; Tung, Wen-Wen; Gao, J B

    2004-01-01

    With the completion of the human and a few model organisms' genomes, and the genomes of many other organisms waiting to be sequenced, it has become increasingly important to develop faster computational tools which are capable of easily identifying the structures and extracting features from DNA sequences. One of the more important structures in a DNA sequence is repeat-related. Often they have to be masked before protein coding regions along a DNA sequence are to be identified or redundant expressed sequence tags (ESTs) are to be sequenced. Here we report a novel recurrence time based method for sequence analysis. The method can conveniently study all kinds of periodicity and exhaustively find all repeat-related features from a genomic DNA sequence. An efficient codon index is also derived from the recurrence time statistics, which has the salient features of being largely species-independent and working well on very short sequences. Efficient codon indices are key elements of successful gene finding algorithms, and are particularly useful for determining whether a suspected EST belongs to a coding or non-coding region. We illustrate the power of the method by studying the genomes of E. coli, the yeast S. cervisivae, the nematode worm C. elegans, and the human, Homo sapiens. Computationally, our method is very efficient. It allows us to carry out analysis of genomes on the whole genomic scale by a PC.

  13. A candidate gene for choanal atresia in alpaca.

    PubMed

    Reed, Kent M; Bauer, Miranda M; Mendoza, Kristelle M; Armién, Aníbal G

    2010-03-01

    Choanal atresia (CA) is a common nasal craniofacial malformation in New World domestic camelids (alpaca and llama). CA results from abnormal development of the nasal passages and is especially debilitating to newborn crias. CA in camelids shares many of the clinical manifestations of a similar condition in humans (CHARGE syndrome). Herein we report on the regulatory gene CHD7 of alpaca, whose homologue in humans is most frequently associated with CHARGE. Sequence of the CHD7 coding region was obtained from a non-affected cria. The complete coding region was 9003 bp, corresponding to a translated amino acid sequence of 3000 aa. Additional genomic sequences corresponding to a significant portion of the CHD7 gene were identified and assembled from the 2x alpaca whole genome sequence, providing confirmatory sequence for much of the CHD7 coding region. The alpaca CHD7 mRNA sequence was 97.9% similar to the human sequence, with the greatest sequence difference being an insertion in exon 38 that results in a polyalanine repeat (A12). Polymorphism in this repeat was tested for association with CA in alpaca by cloning and sequencing the repeat from both affected and non-affected individuals. Variation in length of the poly-A repeat was not associated with CA. Complete sequencing of the CHD7 gene will be necessary to determine whether other mutations in CHD7 are the cause of CA in camelids.

  14. Origins of Genes: "Big Bang" or Continuous Creation?

    NASA Astrophysics Data System (ADS)

    Kesse, Paul K.; Gibbs, Adrian

    1992-10-01

    Many protein families are common to all cellular organisms, indicating that many genes have ancient origins. Genetic variation is mostly attributed to processes such as mutation, duplication, and rearrangement of ancient modules. Thus it is widely assumed that much of present-day genetic diversity can be traced by common ancestry to a molecular "big bang." A rarely considered alternative is that proteins may arise continuously de novo. One mechanism of generating different coding sequences is by "overprinting," in which an existing nucleotide sequence is translated de novo in a different reading frame or from noncoding open reading frames. The clearest evidence for overprinting is provided when the original gene function is retained, as in overlapping genes. Analysis of their phylogenies indicates which are the original genes and which are their informationally novel partners. We report here the phylogenetic relationships of overlapping coding sequences from steroid-related receptor genes and from tymovirus, luteovirus, and lentivirus genomes. For each pair of overlapping coding sequences, one is confined to a single lineage, whereas the other is more widespread. This suggests that the phylogenetically restricted coding sequence arose only in the progenitor of that lineage by translating an out-of-frame sequence to yield the new polypeptide. The production of novel exons by alternative splicing in thyroid receptor and lentivirus genes suggests that introns can be a valuable evolutionary source for overprinting. New genes and their products may drive major evolutionary changes.

  15. Protein structure and the sequential structure of mRNA: alpha-helix and beta-sheet signals at the nucleotide level.

    PubMed

    Brunak, S; Engelbrecht, J

    1996-06-01

    A direct comparison of experimentally determined protein structures and their corresponding protein coding mRNA sequences has been performed. We examine whether real world data support the hypothesis that clusters of rare codons correlate with the location of structural units in the resulting protein. The degeneracy of the genetic code allows for a biased selection of codons which may control the translational rate of the ribosome, and may thus in vivo have a catalyzing effect on the folding of the polypeptide chain. A complete search for GenBank nucleotide sequences coding for structural entries in the Brookhaven Protein Data Bank produced 719 protein chains with matching mRNA sequence, amino acid sequence, and secondary structure assignment. By neural network analysis, we found strong signals in mRNA sequence regions surrounding helices and sheets. These signals do not originate from the clustering of rare codons, but from the similarity of codons coding for very abundant amino acid residues at the N- and C-termini of helices and sheets. No correlation between the positioning of rare codons and the location of structural units was found. The mRNA signals were also compared with conserved nucleotide features of 16S-like ribosomal RNA sequences and related to mechanisms for maintaining the correct reading frame by the ribosome.

  16. Porcine MYF6 gene: sequence, homology analysis, and variation in the promoter region.

    PubMed

    Wyszyńska-Koko, J; Kurył, J

    2004-01-01

    MYF6 gene codes for the bHLH transcription factor belonging to MyoD family. Its expression accompanies the processes of differentiation and maturation of myotubes during embriogenesis and continues on a relatively high level after birth, affecting the muscle phenotype. The porcine MYF6 gene was amplified and sequenced and compared with MYF6 gene sequences of other species. The amino acid sequence was deduced and an interspecies homology analysis was performed. Myf-6 protein shows a high conservation among species of 99 and 97% identity when comparing pig with cow and human, respectively, and of 93% when comparing pig with mouse and rat. The single nucleotide polymorphism (SNP) was revealed within the promoter region, which appeared to be T --> C transition recognized by a MspI restriction enzyme.

  17. The complete mitochondrial genome of the big-belly seahorse, Hippocampus abdominalis (Lesson 1827).

    PubMed

    Wang, Lei; Chen, Zaizhong; Leng, Xiangjun; Gao, Jianzhong; Chen, Xiaowu; Li, Zhongpu; Sun, Peiying; Zhao, Yuming

    2016-11-01

    In this study, the complete mitogenome sequence of the big-belly seahorse, Hippocampus abdominalis (Lesson, 1827) (Syngnathiformes: Syngnathidae), has been sequenced by the next-generation sequencing method. The assembled mitogenome is 16 521 bp in length which includes 13 protein-coding genes, 22 transfer RNAs, and 2 ribosomal RNAs genes. The overall base composition of the seahorse is 31.1% for A, 23.6% for C, 16.0% for G, 29.3% for T and shows 87% identities similar to tiger tail seahorse, Hippocampus comes. The complete mitogenome of the big-belly seahorse provides essential and important DNA molecular data for further phylogeography and evolutionary analysis for seahorse family.

  18. The complete chloroplast genomes of two Wisteria species, W. floribunda and W. sinensis (Fabaceae).

    PubMed

    Kim, Na-Rae; Kim, Kyunghee; Lee, Sang-Choon; Lee, Jung-Hoon; Cho, Seong-Hyun; Yu, Yeisoo; Kim, Young-Dong; Yang, Tae-Jin

    2016-11-01

    Wisteria floribunda and Wisteria sinensis are ornamental woody vines in the Fabaceae. The complete chloroplast genome sequences of the two species were generated by de novo assembly using whole genome next generation sequences. The chloroplast genomes of W. floribunda and W. sinensis were 130 960 bp and 130 561 bp long, respectively, and showed inverted repeat (IR)-lacking structures as those reported in IRLC in the Fabaceae. The chloroplast genomes of both species contained same number of protein-coding sequences (77), tRNA genes (30), and rRNA genes (4). The phylogenetic analysis with the reported chloroplast genomes confirmed close taxonomical relationship of W. floribunda and W. sinensis.

  19. Transcriptome Sequences Resolve Deep Relationships of the Grape Family

    PubMed Central

    Wen, Jun; Xiong, Zhiqiang; Nie, Ze-Long; Mao, Likai; Zhu, Yabing; Kan, Xian-Zhao; Ickert-Bond, Stefanie M.; Gerrath, Jean; Zimmer, Elizabeth A.; Fang, Xiao-Dong

    2013-01-01

    Previous phylogenetic studies of the grape family (Vitaceae) yielded poorly resolved deep relationships, thus impeding our understanding of the evolution of the family. Next-generation sequencing now offers access to protein coding sequences very easily, quickly and cost-effectively. To improve upon earlier work, we extracted 417 orthologous single-copy nuclear genes from the transcriptomes of 15 species of the Vitaceae, covering its phylogenetic diversity. The resulting transcriptome phylogeny provides robust support for the deep relationships, showing the phylogenetic utility of transcriptome data for plants over a time scale at least since the mid-Cretaceous. The pros and cons of transcriptome data for phylogenetic inference in plants are also evaluated. PMID:24069307

  20. Novel methodologies for spectral classification of exon and intron sequences

    NASA Astrophysics Data System (ADS)

    Kwan, Hon Keung; Kwan, Benjamin Y. M.; Kwan, Jennifer Y. Y.

    2012-12-01

    Digital processing of a nucleotide sequence requires it to be mapped to a numerical sequence in which the choice of nucleotide to numeric mapping affects how well its biological properties can be preserved and reflected from nucleotide domain to numerical domain. Digital spectral analysis of nucleotide sequences unfolds a period-3 power spectral value which is more prominent in an exon sequence as compared to that of an intron sequence. The success of a period-3 based exon and intron classification depends on the choice of a threshold value. The main purposes of this article are to introduce novel codes for 1-sequence numerical representations for spectral analysis and compare them to existing codes to determine appropriate representation, and to introduce novel thresholding methods for more accurate period-3 based exon and intron classification of an unknown sequence. The main findings of this study are summarized as follows: Among sixteen 1-sequence numerical representations, the K-Quaternary Code I offers an attractive performance. A windowed 1-sequence numerical representation (with window length of 9, 15, and 24 bases) offers a possible speed gain over non-windowed 4-sequence Voss representation which increases as sequence length increases. A winner threshold value (chosen from the best among two defined threshold values and one other threshold value) offers a top precision for classifying an unknown sequence of specified fixed lengths. An interpolated winner threshold value applicable to an unknown and arbitrary length sequence can be estimated from the winner threshold values of fixed length sequences with a comparable performance. In general, precision increases as sequence length increases. The study contributes an effective spectral analysis of nucleotide sequences to better reveal embedded properties, and has potential applications in improved genome annotation.

  1. Phylodynamic and Phylogeographic Patterns of the HIV Type 1 Subtype F1 Parenteral Epidemic in Romania

    PubMed Central

    Hué, Stéphane; Buckton, Andrew J.; Myers, Richard E.; Duiculescu, Dan; Ene, Luminita; Oprea, Cristiana; Tardei, Gratiela; Rugina, Sorin; Mardarescu, Mariana; Floch, Corinne; Notheis, Gundula; Zöhrer, Bettina; Cane, Patricia A.; Pillay, Deenan

    2012-01-01

    Abstract In the late 1980s an HIV-1 epidemic emerged in Romania that was dominated by subtype F1. The main route of infection is believed to be parenteral transmission in children. We sequenced partial pol coding regions of 70 subtype F1 samples from children and adolescents from the PENTA-EPPICC network of which 67 were from Romania. Phylogenetic reconstruction using the sequences and other publically available global subtype F sequences showed that 79% of Romanian F1 sequences formed a statistically robust monophyletic cluster. The monophyletic cluster was epidemiologically linked to parenteral transmission in children. Coalescent-based analysis dated the origins of the parenteral epidemic to 1983 [1981–1987; 95% HPD]. The analysis also shows that the epidemic's effective population size has remained fairly constant since the early 1990s suggesting limited onward spread of the virus within the population. Furthermore, phylogeographic analysis suggests that the root location of the parenteral epidemic was Bucharest. PMID:22251065

  2. DNA sequences of three beta-1,4-endoglucanase genes from Thermomonospora fusca.

    PubMed Central

    Lao, G; Ghangas, G S; Jung, E D; Wilson, D B

    1991-01-01

    The DNA sequences of the Thermomonospora fusca genes encoding cellulases E2 and E5 and the N-terminal end of E4 were determined. Each sequence contains an identical 14-bp inverted repeat upstream of the initiation codon. There were no significant homologies between the coding regions of the three genes. The E2 gene is 73% identical to the celA gene from Microbispora bispora, but this was the only homology found with other cellulase genes. E2 belongs to a family of cellulases that includes celA from M. bispora, cenA from Cellulomonas fimi, casA from an alkalophilic Streptomyces strain, and cellobiohydrolase II from Trichoderma reesei. E4 shows 44% identity to an avocado cellulase, while E5 belongs to the Bacillus cellulase family. There were strong similarities between the amino acid sequences of the E2 and E5 cellulose binding domains, and these regions also showed homology with C. fimi and Pseudomonas fluorescens cellulose binding domains. PMID:1904434

  3. Negligible impact of rare autoimmune-locus coding-region variants on missing heritability.

    PubMed

    Hunt, Karen A; Mistry, Vanisha; Bockett, Nicholas A; Ahmad, Tariq; Ban, Maria; Barker, Jonathan N; Barrett, Jeffrey C; Blackburn, Hannah; Brand, Oliver; Burren, Oliver; Capon, Francesca; Compston, Alastair; Gough, Stephen C L; Jostins, Luke; Kong, Yong; Lee, James C; Lek, Monkol; MacArthur, Daniel G; Mansfield, John C; Mathew, Christopher G; Mein, Charles A; Mirza, Muddassar; Nutland, Sarah; Onengut-Gumuscu, Suna; Papouli, Efterpi; Parkes, Miles; Rich, Stephen S; Sawcer, Steven; Satsangi, Jack; Simmonds, Matthew J; Trembath, Richard C; Walker, Neil M; Wozniak, Eva; Todd, John A; Simpson, Michael A; Plagnol, Vincent; van Heel, David A

    2013-06-13

    Genome-wide association studies (GWAS) have identified common variants of modest-effect size at hundreds of loci for common autoimmune diseases; however, a substantial fraction of heritability remains unexplained, to which rare variants may contribute. To discover rare variants and test them for association with a phenotype, most studies re-sequence a small initial sample size and then genotype the discovered variants in a larger sample set. This approach fails to analyse a large fraction of the rare variants present in the entire sample set. Here we perform simultaneous amplicon-sequencing-based variant discovery and genotyping for coding exons of 25 GWAS risk genes in 41,911 UK residents of white European origin, comprising 24,892 subjects with six autoimmune disease phenotypes and 17,019 controls, and show that rare coding-region variants at known loci have a negligible role in common autoimmune disease susceptibility. These results do not support the rare-variant synthetic genome-wide-association hypothesis (in which unobserved rare causal variants lead to association detected at common tag variants). Many known autoimmune disease risk loci contain multiple, independently associated, common and low-frequency variants, and so genes at these loci are a priori stronger candidates for harbouring rare coding-region variants than other genes. Our data indicate that the missing heritability for common autoimmune diseases may not be attributable to the rare coding-region variant portion of the allelic spectrum, but perhaps, as others have proposed, may be a result of many common-variant loci of weak effect.

  4. Random digital encryption secure communication system

    NASA Technical Reports Server (NTRS)

    Doland, G. D. (Inventor)

    1982-01-01

    The design of a secure communication system is described. A product code, formed from two pseudorandom sequences of digital bits, is used to encipher or scramble data prior to transmission. The two pseudorandom sequences are periodically changed at intervals before they have had time to repeat. One of the two sequences is transmitted continuously with the scrambled data for synchronization. In the receiver portion of the system, the incoming signal is compared with one of two locally generated pseudorandom sequences until correspondence between the sequences is obtained. At this time, the two locally generated sequences are formed into a product code which deciphers the data from the incoming signal. Provision is made to ensure synchronization of the transmitting and receiving portions of the system.

  5. Expressed gene sequence of the IFN-gamma-response chemokine CXCL9 of cattle, horses, and swine

    USDA-ARS?s Scientific Manuscript database

    This report describes the cloning and characterization of expressed gene sequences of bovine, equine, and swine CXCL9 from RNA obtained from peripheral blood mononuclear cell (PBMC) or other tissues. The bovine coding region was 378 nucleotides in length, while the equine and swine coding regions w...

  6. Hermes Transposon Distribution and Structure in Musca domestica

    PubMed Central

    Subramanian, Ramanand A.; Cathcart, Laura A.; Krafsur, Elliot S.; Atkinson, Peter W.

    2009-01-01

    Hermes are hAT transposons from Musca domestica that are very closely related to the hobo transposons from Drosophila melanogaster and are useful as gene vectors in a wide variety of organisms including insects, planaria, and yeast. hobo elements show distinct length variations in a rapidly evolving region of the transposase-coding region as a result of expansions and contractions of a simple repeat sequence encoding 3 amino acids threonine, proline, and glutamic acid (TPE). These variations in length may influence the function of the protein and the movement of hobo transposons in natural populations. Here, we determine the distribution of Hermes in populations of M. domestica as well as whether Hermes transposase has undergone similar sequence expansions and contractions during its evolution in this species. Hermes transposons were found in all M. domestica individuals sampled from 14 populations collected from 4 continents. All individuals with Hermes transposons had evidence for the presence of intact transposase open reading frames, and little sequence variation was observed among Hermes elements. A systematic analysis of the TPE-homologous region of the Hermes transposase-coding region revealed no evidence for length variation. The simple sequence repeat found in hobo elements is a feature of this transposon that evolved since the divergence of hobo and Hermes. PMID:19366812

  7. Protein and gene structure of a blue laccase from Pleurotus ostreatus1.

    PubMed Central

    Giardina, P; Palmieri, G; Scaloni, A; Fontanella, B; Faraco, V; Cennamo, G; Sannia, G

    1999-01-01

    A new laccase isoenzyme (POXA1b, where POX is phenol oxidase), produced by Pleurotus ostreatus in cultures supplemented with copper sulphate, has been purified and fully characterized. The main characteristics of this protein (molecular mass in native and denaturing conditions, pI and catalytic properties) are almost identical to the previously studied laccase POXA1w. However, POXA1b contains four copper atoms per molecule instead of one copper, two zinc and one iron atom per molecule of POXA1w. Furthermore, POXA1b shows an unusually high stability at alkaline pH. The gene and cDNA coding for POXA1b have been cloned and sequenced. The gene coding sequence contains 1599 bp, interrupted by 15 introns. Comparison of the structure of the poxa1b gene with the two previously studied P. ostreatus laccase genes (pox1 and poxc) suggests that these genes belong to two different subfamilies. The amino acid sequence of POXA1b deduced from the cDNA sequence has been almost completely verified by means of matrix-assisted laser desorption ionization MS. It has been demonstrated that three out of six putative glycosylation sites are post-translationally modified and the structure of the bound glycosidic moieties has been determined, whereas two other putative glycosylation sites are unmodified. PMID:10417329

  8. A Tandemly Arranged Pattern of Two 5S rDNA Arrays in Amolops mantzorum (Anura, Ranidae).

    PubMed

    Liu, Ting; Song, Menghuan; Xia, Yun; Zeng, Xiaomao

    2017-01-01

    In an attempt to extend the knowledge of the 5S rDNA organization in anurans, the 5S rDNA sequences of Amolops mantzorum were isolated, characterized, and mapped by FISH. Two forms of 5S rDNA, type I (209 bp) and type II (about 870 bp), were found in specimens investigated from various populations. Both of them contained a 118-bp coding sequence, readily differentiated by their non-transcribed spacer (NTS) sizes and compositions. Four probes (the 5S rDNA coding sequences, the type I NTS, the type II NTS, and the entire type II 5S rDNA sequences) were respectively labeled with TAMRA or digoxigenin to hybridize with mitotic chromosomes for samples of all localities. It turned out that all probes showed the same signals that appeared in every centromeric region and in the telomeric regions of chromosome 5, without differences within or between populations. Obviously, both type I and type II of the 5S rDNA arrays arranged in tandem, which was contrasting with other frogs or fishes recorded to date. More interestingly, all the probes detected centromeric regions in all karyotypes, suggesting the presence of a satellite DNA family derived from 5S rDNA. © 2017 S. Karger AG, Basel.

  9. Programmable DNA-binding proteins from Burkholderia provide a fresh perspective on the TALE-like repeat domain.

    PubMed

    de Lange, Orlando; Wolf, Christina; Dietze, Jörn; Elsaesser, Janett; Morbitzer, Robert; Lahaye, Thomas

    2014-06-01

    The tandem repeats of transcription activator like effectors (TALEs) mediate sequence-specific DNA binding using a simple code. Naturally, TALEs are injected by Xanthomonas bacteria into plant cells to manipulate the host transcriptome. In the laboratory TALE DNA binding domains are reprogrammed and used to target a fused functional domain to a genomic locus of choice. Research into the natural diversity of TALE-like proteins may provide resources for the further improvement of current TALE technology. Here we describe TALE-like proteins from the endosymbiotic bacterium Burkholderia rhizoxinica, termed Bat proteins. Bat repeat domains mediate sequence-specific DNA binding with the same code as TALEs, despite less than 40% sequence identity. We show that Bat proteins can be adapted for use as transcription factors and nucleases and that sequence preferences can be reprogrammed. Unlike TALEs, the core repeats of each Bat protein are highly polymorphic. This feature allowed us to explore alternative strategies for the design of custom Bat repeat arrays, providing novel insights into the functional relevance of non-RVD residues. The Bat proteins offer fertile grounds for research into the creation of improved programmable DNA-binding proteins and comparative insights into TALE-like evolution. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

  10. Characterization of petunia flower mottle virus (PetFMV), a new potyvirus infecting Petunia x hybrida.

    PubMed

    Feldhoff, A; Wetzel, T; Peters, D; Kellner, R; Krczal, G

    1998-01-01

    With the introduction of cutting-grown Petunia x hybrida plants on the European market, a new potyvirus which showed no serological reaction with antisera against any other potyviruses infecting petunias was discovered. Infected leaves contained flexuous rod-shaped virus particles of 750-800 nm in length and inclusion bodies (pinwheel structures) typical for potyviruses in ultrathin leaf sections. The purified coat protein with a Mr of approximately 36 kDa could be detected in Western immunoblots with a specific antibody to the coat protein of the petunia-infecting virus. The 3' end of the viral genome encompassing the 3' non-coding region, the coat protein gene, and part of the NIb gene was amplified from infected leaf material by IC/PCR using degenerate and specific primers. Sequences of PCR-generated cDNA clones were compared to other known sequences of potyviruses. Maximum homology of 56% was found in the 3' non-coding region between the petunia isolate and other potyviruses. A maximum homology of 69% was found between the amino acid sequence of the coat protein of the petunia isolate and corresponding sequences of other potyviruses. These data indicate that the petunia-infecting virus is a previously undescribed potyvirus and the name petunia flower mottle virus (PetFMV) is suggested.

  11. Antisense Transcription Is Pervasive but Rarely Conserved in Enteric Bacteria

    PubMed Central

    Raghavan, Rahul; Sloan, Daniel B.; Ochman, Howard

    2012-01-01

    ABSTRACT Noncoding RNAs, including antisense RNAs (asRNAs) that originate from the complementary strand of protein-coding genes, are involved in the regulation of gene expression in all domains of life. Recent application of deep-sequencing technologies has revealed that the transcription of asRNAs occurs genome-wide in bacteria. Although the role of the vast majority of asRNAs remains unknown, it is often assumed that their presence implies important regulatory functions, similar to those of other noncoding RNAs. Alternatively, many antisense transcripts may be produced by chance transcription events from promoter-like sequences that result from the degenerate nature of bacterial transcription factor binding sites. To investigate the biological relevance of antisense transcripts, we compared genome-wide patterns of asRNA expression in closely related enteric bacteria, Escherichia coli and Salmonella enterica serovar Typhimurium, by performing strand-specific transcriptome sequencing. Although antisense transcripts are abundant in both species, less than 3% of asRNAs are expressed at high levels in both species, and only about 14% appear to be conserved among species. And unlike the promoters of protein-coding genes, asRNA promoters show no evidence of sequence conservation between, or even within, species. Our findings suggest that many or even most bacterial asRNAs are nonadaptive by-products of the cell’s transcription machinery. PMID:22872780

  12. Insights into hominid evolution from the gorilla genome sequence

    PubMed Central

    Scally, Aylwyn; Dutheil, Julien Y.; Hillier, LaDeana W.; Jordan, Greg E.; Goodhead, Ian; Herrero, Javier; Hobolth, Asger; Lappalainen, Tuuli; Mailund, Thomas; Marques-Bonet, Tomas; McCarthy, Shane; Montgomery, Stephen H.; Schwalie, Petra C.; Tang, Y. Amy; Ward, Michelle C.; Xue, Yali; Yngvadottir, Bryndis; Alkan, Can; Andersen, Lars N.; Ayub, Qasim; Ball, Edward V.; Beal, Kathryn; Bradley, Brenda J.; Chen, Yuan; Clee, Chris M.; Fitzgerald, Stephen; Graves, Tina A.; Gu, Yong; Heath, Paul; Heger, Andreas; Karakoc, Emre; Kolb-Kokocinski, Anja; Laird, Gavin K.; Lunter, Gerton; Meader, Stephen; Mort, Matthew; Mullikin, James C.; Munch, Kasper; O’Connor, Timothy D.; Phillips, Andrew D.; Prado-Martinez, Javier; Rogers, Anthony S.; Sajjadian, Saba; Schmidt, Dominic; Shaw, Katy; Simpson, Jared T.; Stenson, Peter D.; Turner, Daniel J.; Vigilant, Linda; Vilella, Albert J.; Whitener, Weldon; Zhu, Baoli; Cooper, David N.; de Jong, Pieter; Dermitzakis, Emmanouil T.; Eichler, Evan E.; Flicek, Paul; Goldman, Nick; Mundy, Nicholas I.; Ning, Zemin; Odom, Duncan T.; Ponting, Chris P.; Quail, Michael A.; Ryder, Oliver A.; Searle, Stephen M.; Warren, Wesley C.; Wilson, Richard K.; Schierup, Mikkel H.; Rogers, Jane; Tyler-Smith, Chris; Durbin, Richard

    2012-01-01

    Summary Gorillas are humans’ closest living relatives after chimpanzees, and are of comparable importance for the study of human origins and evolution. Here we present the assembly and analysis of a genome sequence for the western lowland gorilla, and compare the whole genomes of all extant great ape genera. We propose a synthesis of genetic and fossil evidence consistent with placing the human-chimpanzee and human-chimpanzee-gorilla speciation events at approximately 6 and 10 million years ago (Mya). In 30% of the genome, gorilla is closer to human or chimpanzee than the latter are to each other; this is rarer around coding genes, indicating pervasive selection throughout great ape evolution, and has functional consequences in gene expression. A comparison of protein coding genes reveals approximately 500 genes showing accelerated evolution on each of the gorilla, human and chimpanzee lineages, and evidence for parallel acceleration, particularly of genes involved in hearing. We also compare the western and eastern gorilla species, estimating an average sequence divergence time 1.75 million years ago, but with evidence for more recent genetic exchange and a population bottleneck in the eastern species. The use of the genome sequence in these and future analyses will promote a deeper understanding of great ape biology and evolution. PMID:22398555

  13. ISSYS: An integrated synergistic Synthesis System

    NASA Technical Reports Server (NTRS)

    Dovi, A. R.

    1980-01-01

    Integrated Synergistic Synthesis System (ISSYS), an integrated system of computer codes in which the sequence of program execution and data flow is controlled by the user, is discussed. The commands available to exert such control, the ISSYS major function and rules, and the computer codes currently available in the system are described. Computational sequences frequently used in the aircraft structural analysis and synthesis are defined. External computer codes utilized by the ISSYS system are documented. A bibliography on the programs is included.

  14. Long interspersed repeated DNA (LINE) causes polymorphism at the rat insulin 1 locus.

    PubMed

    Lakshmikumaran, M S; D'Ambrosio, E; Laimins, L A; Lin, D T; Furano, A V

    1985-09-01

    The insulin 1, but not the insulin 2, locus is polymorphic (i.e., exhibits allelic variation) in rats. Restriction enzyme analysis and hybridization studies showed that the polymorphic region is 2.2 kilobases upstream of the insulin 1 coding region and is due to the presence or absence of an approximately 2.7-kilobase repeated DNA element. DNA sequence determination showed that this DNA element is a member of a long interspersed repeated DNA family (LINE) that is highly repeated (greater than 50,000 copies) and highly transcribed in the rat. Although the presence or absence of LINE sequences at the insulin 1 locus occurs in both the homozygous and heterozygous states, LINE-containing insulin 1 alleles are more prevalent in the rat population than are alleles without LINEs. Restriction enzyme analysis of the LINE-containing alleles indicated that at least two versions of the LINE sequence may be present at the insulin 1 locus in different rats. Either repeated transposition of LINE sequences or gene conversion between the resident insulin 1 LINE and other sequences in the genome are possible explanations for this.

  15. Discovery and Complete Genome Sequence of a Bacteriophage from an Obligate Intracellular Symbiont of a Cellulolytic Protist in the Termite Gut

    PubMed Central

    Pramono, Ajeng K.; Kuwahara, Hirokazu; Itoh, Takehiko; Toyoda, Atsushi; Yamada, Akinori; Hongoh, Yuichi

    2017-01-01

    Termites depend nutritionally on their gut microbes, and protistan, bacterial, and archaeal gut communities have been extensively studied. However, limited information is available on viruses in the termite gut. We herein report the complete genome sequence (99,517 bp) of a phage obtained during a genome analysis of “Candidatus Azobacteroides pseudotrichonymphae” phylotype ProJPt-1, which is an obligate intracellular symbiont of the cellulolytic protist Pseudotrichonympha sp. in the gut of the termite Prorhinotermes japonicus. The genome of the phage, designated ProJPt-Bp1, was circular or circularly permuted, and was not integrated into the two circular chromosomes or five circular plasmids composing the host ProJPt-1 genome. The phage was putatively affiliated with the order Caudovirales based on sequence similarities with several phage-related genes; however, most of the 52 protein-coding sequences had no significant homology to sequences in the databases. The phage genome contained a tRNA-Gln (CAG) gene, which showed the highest sequence similarity to the tRNA-Gln (CAA) gene of the host “Ca. A. pseudotrichonymphae” phylotype ProJPt-1. Since the host genome lacked a tRNA-Gln (CAG) gene, the phage tRNA gene may compensate for differences in codon usage bias between the phage and host genomes. The phage genome also contained a non-coding region with high nucleotide sequence similarity to a region in one of the host plasmids. No other phage-related sequences were found in the host ProJPt-1 genome. To the best of our knowledge, this is the first report of a phage from an obligate, mutualistic endosymbiont permanently associated with eukaryotic cells. PMID:28321010

  16. Connection anonymity analysis in coded-WDM PONs

    NASA Astrophysics Data System (ADS)

    Sue, Chuan-Ching

    2008-04-01

    A coded wavelength division multiplexing passive optical network (WDM PON) is presented for fiber to the home (FTTH) systems to protect against eavesdropping. The proposed scheme applies spectral amplitude coding (SAC) with a unipolar maximal-length sequence (M-sequence) code matrix to generate a specific signature address (coding) and to retrieve its matching address codeword (decoding) by exploiting the cyclic properties inherent in array waveguide grating (AWG) routers. In addition to ensuring the confidentiality of user data, the proposed coded-WDM scheme is also a suitable candidate for the physical layer with connection anonymity. Under the assumption that the eavesdropper applies a photo-detection strategy, it is shown that the coded WDM PON outperforms the conventional TDM PON and WDM PON schemes in terms of a higher degree of connection anonymity. Additionally, the proposed scheme allows the system operator to partition the optical network units (ONUs) into appropriate groups so as to achieve a better degree of anonymity.

  17. Novel coding, translation, and gene expression of a replicating covalently closed circular RNA of 220 nt

    PubMed Central

    AbouHaidar, Mounir Georges; Venkataraman, Srividhya; Golshani, Ashkan; Liu, Bolin; Ahmad, Tauqeer

    2014-01-01

    The highly structured (64% GC) covalently closed circular (CCC) RNA (220 nt) of the virusoid associated with rice yellow mottle virus codes for a 16-kDa highly basic protein using novel modalities for coding, translation, and gene expression. This CCC RNA is the smallest among all known viroids and virusoids and the only one that codes proteins. Its sequence possesses an internal ribosome entry site and is directly translated through two (or three) completely overlapping ORFs (shifting to a new reading frame at the end of each round). The initiation and termination codons overlap UGAUGA (underline highlights the initiation codon AUG within the combined initiation-termination sequence). Termination codons can be ignored to obtain larger read-through proteins. This circular RNA with no noncoding sequences is a unique natural supercompact “nanogenome.” PMID:25253891

  18. Trellises and Trellis-Based Decoding Algorithms for Linear Block Codes. Part 3; The Map and Related Decoding Algirithms

    NASA Technical Reports Server (NTRS)

    Lin, Shu; Fossorier, Marc

    1998-01-01

    In a coded communication system with equiprobable signaling, MLD minimizes the word error probability and delivers the most likely codeword associated with the corresponding received sequence. This decoding has two drawbacks. First, minimization of the word error probability is not equivalent to minimization of the bit error probability. Therefore, MLD becomes suboptimum with respect to the bit error probability. Second, MLD delivers a hard-decision estimate of the received sequence, so that information is lost between the input and output of the ML decoder. This information is important in coded schemes where the decoded sequence is further processed, such as concatenated coding schemes, multi-stage and iterative decoding schemes. In this chapter, we first present a decoding algorithm which both minimizes bit error probability, and provides the corresponding soft information at the output of the decoder. This algorithm is referred to as the MAP (maximum aposteriori probability) decoding algorithm.

  19. Automatic vehicle location system

    NASA Technical Reports Server (NTRS)

    Hansen, G. R., Jr. (Inventor)

    1973-01-01

    An automatic vehicle detection system is disclosed, in which each vehicle whose location is to be detected carries active means which interact with passive elements at each location to be identified. The passive elements comprise a plurality of passive loops arranged in a sequence along the travel direction. Each of the loops is tuned to a chosen frequency so that the sequence of the frequencies defines the location code. As the vehicle traverses the sequence of the loops as it passes over each loop, signals only at the frequency of the loop being passed over are coupled from a vehicle transmitter to a vehicle receiver. The frequencies of the received signals in the receiver produce outputs which together represent a code of the traversed location. The code location is defined by a painted pattern which reflects light to a vehicle carried detector whose output is used to derive the code defined by the pattern.

  20. Digital data for quick response (QR) codes of alkalophilic Bacillus pumilus to identify and to compare bacilli isolated from Lonar Crator Lake, India.

    PubMed

    Rekadwad, Bhagwan N; Khobragade, Chandrahasya N

    2016-06-01

    Microbiologists are routinely engaged isolation, identification and comparison of isolated bacteria for their novelty. 16S rRNA sequences of Bacillus pumilus were retrieved from NCBI repository and generated QR codes for sequences (FASTA format and full Gene Bank information). 16SrRNA were used to generate quick response (QR) codes of Bacillus pumilus isolated from Lonar Crator Lake (19° 58' N; 76° 31' E), India. Bacillus pumilus 16S rRNA gene sequences were used to generate CGR, FCGR and PCA. These can be used for visual comparison and evaluation respectively. The hyperlinked QR codes, CGR, FCGR and PCA of all the isolates are made available to the users on a portal https://sites.google.com/site/bhagwanrekadwad/. This generated digital data helps to evaluate and compare any Bacillus pumilus strain, minimizes laboratory efforts and avoid misinterpretation of the species.

  1. Sequence differences in the diagnostic region of the cysteine protease 8 gene of Tritrichomonas foetus parasites of cats and cattle.

    PubMed

    Sun, Zichen; Stack, Colin; Šlapeta, Jan

    2012-05-25

    In order to investigate the genetic variation between Tritrichomonas foetus from bovine and feline origins, cysteine protease 8 (CP8) coding sequence was selected as the polymorphic DNA marker. Direct sequencing of CP8 coding sequence of T. foetus from four feline isolates and two bovine isolates with polymerase chain reaction successfully revealed conserved nucleotide polymorphisms between feline and bovine isolates. These results provide useful information for CP8-based molecular differentiation of T. foetus genotypes. Copyright © 2011 Elsevier B.V. All rights reserved.

  2. EUGENE'HOM: A generic similarity-based gene finder using multiple homologous sequences.

    PubMed

    Foissac, Sylvain; Bardou, Philippe; Moisan, Annick; Cros, Marie-Josée; Schiex, Thomas

    2003-07-01

    EUGENE'HOM is a gene prediction software for eukaryotic organisms based on comparative analysis. EUGENE'HOM is able to take into account multiple homologous sequences from more or less closely related organisms. It integrates the results of TBLASTX analysis, splice site and start codon prediction and a robust coding/non-coding probabilistic model which allows EUGENE'HOM to handle sequences from a variety of organisms. The current target of EUGENE'HOM is plant sequences. The EUGENE'HOM web site is available at http://genopole.toulouse.inra.fr/bioinfo/eugene/EuGeneHom/cgi-bin/EuGeneHom.pl.

  3. Assessing the utility of the Oxford Nanopore MinION for snake venom gland cDNA sequencing.

    PubMed

    Hargreaves, Adam D; Mulley, John F

    2015-01-01

    Portable DNA sequencers such as the Oxford Nanopore MinION device have the potential to be truly disruptive technologies, facilitating new approaches and analyses and, in some cases, taking sequencing out of the lab and into the field. However, the capabilities of these technologies are still being revealed. Here we show that single-molecule cDNA sequencing using the MinION accurately characterises venom toxin-encoding genes in the painted saw-scaled viper, Echis coloratus. We find the raw sequencing error rate to be around 12%, improved to 0-2% with hybrid error correction and 3% with de novo error correction. Our corrected data provides full coding sequences and 5' and 3' UTRs for 29 of 33 candidate venom toxins detected, far superior to Illumina data (13/40 complete) and Sanger-based ESTs (15/29). We suggest that, should the current pace of improvement continue, the MinION will become the default approach for cDNA sequencing in a variety of species.

  4. Assessing the utility of the Oxford Nanopore MinION for snake venom gland cDNA sequencing

    PubMed Central

    Hargreaves, Adam D.

    2015-01-01

    Portable DNA sequencers such as the Oxford Nanopore MinION device have the potential to be truly disruptive technologies, facilitating new approaches and analyses and, in some cases, taking sequencing out of the lab and into the field. However, the capabilities of these technologies are still being revealed. Here we show that single-molecule cDNA sequencing using the MinION accurately characterises venom toxin-encoding genes in the painted saw-scaled viper, Echis coloratus. We find the raw sequencing error rate to be around 12%, improved to 0–2% with hybrid error correction and 3% with de novo error correction. Our corrected data provides full coding sequences and 5′ and 3′ UTRs for 29 of 33 candidate venom toxins detected, far superior to Illumina data (13/40 complete) and Sanger-based ESTs (15/29). We suggest that, should the current pace of improvement continue, the MinION will become the default approach for cDNA sequencing in a variety of species. PMID:26623194

  5. A deep learning method for lincRNA detection using auto-encoder algorithm.

    PubMed

    Yu, Ning; Yu, Zeng; Pan, Yi

    2017-12-06

    RNA sequencing technique (RNA-seq) enables scientists to develop novel data-driven methods for discovering more unidentified lincRNAs. Meantime, knowledge-based technologies are experiencing a potential revolution ignited by the new deep learning methods. By scanning the newly found data set from RNA-seq, scientists have found that: (1) the expression of lincRNAs appears to be regulated, that is, the relevance exists along the DNA sequences; (2) lincRNAs contain some conversed patterns/motifs tethered together by non-conserved regions. The two evidences give the reasoning for adopting knowledge-based deep learning methods in lincRNA detection. Similar to coding region transcription, non-coding regions are split at transcriptional sites. However, regulatory RNAs rather than message RNAs are generated. That is, the transcribed RNAs participate the biological process as regulatory units instead of generating proteins. Identifying these transcriptional regions from non-coding regions is the first step towards lincRNA recognition. The auto-encoder method achieves 100% and 92.4% prediction accuracy on transcription sites over the putative data sets. The experimental results also show the excellent performance of predictive deep neural network on the lincRNA data sets compared with support vector machine and traditional neural network. In addition, it is validated through the newly discovered lincRNA data set and one unreported transcription site is found by feeding the whole annotated sequences through the deep learning machine, which indicates that deep learning method has the extensive ability for lincRNA prediction. The transcriptional sequences of lincRNAs are collected from the annotated human DNA genome data. Subsequently, a two-layer deep neural network is developed for the lincRNA detection, which adopts the auto-encoder algorithm and utilizes different encoding schemes to obtain the best performance over intergenic DNA sequence data. Driven by those newly annotated lincRNA data, deep learning methods based on auto-encoder algorithm can exert their capability in knowledge learning in order to capture the useful features and the information correlation along DNA genome sequences for lincRNA detection. As our knowledge, this is the first application to adopt the deep learning techniques for identifying lincRNA transcription sequences.

  6. Synthetic oligonucleotide probes deduced from amino acid sequence data. Theoretical and practical considerations.

    PubMed

    Lathe, R

    1985-05-05

    Synthetic probes deduced from amino acid sequence data are widely used to detect cognate coding sequences in libraries of cloned DNA segments. The redundancy of the genetic code dictates that a choice must be made between (1) a mixture of probes reflecting all codon combinations, and (2) a single longer "optimal" probe. The second strategy is examined in detail. The frequency of sequences matching a given probe by chance alone can be determined and also the frequency of sequences closely resembling the probe and contributing to the hybridization background. Gene banks cannot be treated as random associations of the four nucleotides, and probe sequences deduced from amino acid sequence data occur more often than predicted by chance alone. Probe lengths must be increased to confer the necessary specificity. Examination of hybrids formed between unique homologous probes and their cognate targets reveals that short stretches of perfect homology occurring by chance make a significant contribution to the hybridization background. Statistical methods for improving homology are examined, taking human coding sequences as an example, and considerations of codon utilization and dinucleotide frequencies yield an overall homology of greater than 82%. Recommendations for probe design and hybridization are presented, and the choice between using multiple probes reflecting all codon possibilities and a unique optimal probe is discussed.

  7. Tenebrio molitor antifreeze protein gene identification and regulation.

    PubMed

    Qin, Wensheng; Walker, Virginia K

    2006-02-15

    The yellow mealworm, Tenebrio molitor, is a freeze susceptible, stored product pest. Its winter survival is facilitated by the accumulation of antifreeze proteins (AFPs), encoded by a small gene family. We have now isolated 11 different AFP genomic clones from 3 genomic libraries. All the clones had a single coding sequence, with no evidence of intervening sequences. Three genomic clones were further characterized. All have putative TATA box sequences upstream of the coding regions and multiple potential poly(A) signal sequences downstream of the coding regions. A TmAFP regulatory region, B1037, conferred transcriptional activity when ligated to a luciferase reporter sequence and after transfection into an insect cell line. A 143 bp core promoter including a TATA box sequence was identified. Its promoter activity was increased 4.4 times by inserting an exotic 245 bp intron into the construct, similar to the enhancement of transgenic expression seen in several other systems. The addition of a duplication of the first 120 bp sequence from the 143 bp core promoter decreased promoter activity by half. Although putative hormonal response sequences were identified, none of the five hormones tested enhanced reporter activity. These studies on the mechanisms of AFP transcriptional control are important for the consideration of any transfer of freeze-resistance phenotypes to beneficial hosts.

  8. What Information is Stored in DNA: Does it Contain Digital Error Correcting Codes?

    NASA Astrophysics Data System (ADS)

    Liebovitch, Larry

    1998-03-01

    The longest term correlations in living systems are the information stored in DNA which reflects the evolutionary history of an organism. The 4 bases (A,T,G,C) encode sequences of amino acids as well as locations of binding sites for proteins that regulate DNA. The fidelity of this important information is maintained by ANALOG error check mechanisms. When a single strand of DNA is replicated the complementary base is inserted in the new strand. Sometimes the wrong base is inserted that sticks out disrupting the phosphate backbone. The new base is not yet methylated, so repair enzymes, that slide along the DNA, can tear out the wrong base and replace it with the right one. The bases in DNA form a sequence of 4 different symbols and so the information is encoded in a DIGITAL form. All the digital codes in our society (ISBN book numbers, UPC product codes, bank account numbers, airline ticket numbers) use error checking code, where some digits are functions of other digits to maintain the fidelity of transmitted informaiton. Does DNA also utitlize a DIGITAL error chekcing code to maintain the fidelity of its information and increase the accuracy of replication? That is, are some bases in DNA functions of other bases upstream or downstream? This raises the interesting mathematical problem: How does one determine whether some symbols in a sequence of symbols are a function of other symbols. It also bears on the issue of determining algorithmic complexity: What is the function that generates the shortest algorithm for reproducing the symbol sequence. The error checking codes most used in our technology are linear block codes. We developed an efficient method to test for the presence of such codes in DNA. We coded the 4 bases as (0,1,2,3) and used Gaussian elimination, modified for modulus 4, to test if some bases are linear combinations of other bases. We used this method to analyze the base sequence in the genes from the lac operon and cytochrome C. We did not find evidence for such error correcting codes in these genes. However, we analyzed only a small amount of DNA and if digitial error correcting schemes are present in DNA, they may be more subtle than such simple linear block codes. The basic issue we raise here, is how information is stored in DNA and an appreciation that digital symbol sequences, such as DNA, admit of interesting schemes to store and protect the fidelity of their information content. Liebovitch, Tao, Todorov, Levine. 1996. Biophys. J. 71:1539-1544. Supported by NIH grant EY6234.

  9. Mechanisms of haplotype divergence at the RGA08 nucleotide-binding leucine-rich repeat gene locus in wild banana (Musa balbisiana)

    PubMed Central

    2010-01-01

    Background Comparative sequence analysis of complex loci such as resistance gene analog clusters allows estimating the degree of sequence conservation and mechanisms of divergence at the intraspecies level. In banana (Musa sp.), two diploid wild species Musa acuminata (A genome) and Musa balbisiana (B genome) contribute to the polyploid genome of many cultivars. The M. balbisiana species is associated with vigour and tolerance to pests and disease and little is known on the genome structure and haplotype diversity within this species. Here, we compare two genomic sequences of 253 and 223 kb corresponding to two haplotypes of the RGA08 resistance gene analog locus in M. balbisiana "Pisang Klutuk Wulung" (PKW). Results Sequence comparison revealed two regions of contrasting features. The first is a highly colinear gene-rich region where the two haplotypes diverge only by single nucleotide polymorphisms and two repetitive element insertions. The second corresponds to a large cluster of RGA08 genes, with 13 and 18 predicted RGA genes and pseudogenes spread over 131 and 152 kb respectively on each haplotype. The RGA08 cluster is enriched in repetitive element insertions, in duplicated non-coding intergenic sequences including low complexity regions and shows structural variations between haplotypes. Although some allelic relationships are retained, a large diversity of RGA08 genes occurs in this single M. balbisiana genotype, with several RGA08 paralogs specific to each haplotype. The RGA08 gene family has evolved by mechanisms of unequal recombination, intragenic sequence exchange and diversifying selection. An unequal recombination event taking place between duplicated non-coding intergenic sequences resulted in a different RGA08 gene content between haplotypes pointing out the role of such duplicated regions in the evolution of RGA clusters. Based on the synonymous substitution rate in coding sequences, we estimated a 1 million year divergence time for these M. balbisiana haplotypes. Conclusions A large RGA08 gene cluster identified in wild banana corresponds to a highly variable genomic region between haplotypes surrounded by conserved flanking regions. High level of sequence identity (70 to 99%) of the genic and intergenic regions suggests a recent and rapid evolution of this cluster in M. balbisiana. PMID:20637079

  10. Evolutionary Dynamics of Microsatellite Distribution in Plants: Insight from the Comparison of Sequenced Brassica, Arabidopsis and Other Angiosperm Species

    PubMed Central

    Shi, Jiaqin; Huang, Shunmou; Fu, Donghui; Yu, Jinyin; Wang, Xinfa; Hua, Wei; Liu, Shengyi; Liu, Guihua; Wang, Hanzhong

    2013-01-01

    Despite their ubiquity and functional importance, microsatellites have been largely ignored in comparative genomics, mostly due to the lack of genomic information. In the current study, microsatellite distribution was characterized and compared in the whole genomes and both the coding and non-coding DNA sequences of the sequenced Brassica, Arabidopsis and other angiosperm species to investigate their evolutionary dynamics in plants. The variation in the microsatellite frequencies of these angiosperm species was much smaller than those for their microsatellite numbers and genome sizes, suggesting that microsatellite frequency may be relatively stable in plants. The microsatellite frequencies of these angiosperm species were significantly negatively correlated with both their genome sizes and transposable elements contents. The pattern of microsatellite distribution may differ according to the different genomic regions (such as coding and non-coding sequences). The observed differences in many important microsatellite characteristics (especially the distribution with respect to motif length, type and repeat number) of these angiosperm species were generally accordant with their phylogenetic distance, which suggested that the evolutionary dynamics of microsatellite distribution may be generally consistent with plant divergence/evolution. Importantly, by comparing these microsatellite characteristics (especially the distribution with respect to motif type) the angiosperm species (aside from a few species) all clustered into two obviously different groups that were largely represented by monocots and dicots, suggesting a complex and generally dichotomous evolutionary pattern of microsatellite distribution in angiosperms. Polyploidy may lead to a slight increase in microsatellite frequency in the coding sequences and a significant decrease in microsatellite frequency in the whole genome/non-coding sequences, but have little effect on the microsatellite distribution with respect to motif length, type and repeat number. Interestingly, several microsatellite characteristics seemed to be constant in plant evolution, which can be well explained by the general biological rules. PMID:23555856

  11. A Novel Subgenomic Murine Leukemia Virus RNA Transcript Results from Alternative Splicing

    PubMed Central

    Déjardin, Jérôme; Bompard-Maréchal, Guillaume; Audit, Muriel; Hope, Thomas J.; Sitbon, Marc; Mougel, Marylène

    2000-01-01

    Here we show the existence of a novel subgenomic 4.4-kb RNA in cells infected with the prototypic replication-competent Friend or Moloney murine leukemia viruses (MuLV). This RNA derives by splicing from an alternative donor site (SD′) within the capsid-coding region to the canonical envelope splice acceptor site. The position and the sequence of SD′ was highly conserved among mammalian type C and D oncoviruses. Point mutations used to inactivate SD′ without changing the capsid-coding ability affected viral RNA splicing and reduced viral replication in infected cells. PMID:10729146

  12. Rapid quantification of mutant fitness in diverse bacteria by sequencing randomly bar-coded transposons

    DOE PAGES

    Wetmore, Kelly M.; Price, Morgan N.; Waters, Robert J.; ...

    2015-05-12

    Transposon mutagenesis with next-generation sequencing (TnSeq) is a powerful approach to annotate gene function in bacteria, but existing protocols for TnSeq require laborious preparation of every sample before sequencing. Thus, the existing protocols are not amenable to the throughput necessary to identify phenotypes and functions for the majority of genes in diverse bacteria. Here, we present a method, random bar code transposon-site sequencing (RB-TnSeq), which increases the throughput of mutant fitness profiling by incorporating random DNA bar codes into Tn5 and mariner transposons and by using bar code sequencing (BarSeq) to assay mutant fitness. RB-TnSeq can be used with anymore » transposon, and TnSeq is performed once per organism instead of once per sample. Each BarSeq assay requires only a simple PCR, and 48 to 96 samples can be sequenced on one lane of an Illumina HiSeq system. We demonstrate the reproducibility and biological significance of RB-TnSeq with Escherichia coli, Phaeobacter inhibens, Pseudomonas stutzeri, Shewanella amazonensis, and Shewanella oneidensis. To demonstrate the increased throughput of RB-TnSeq, we performed 387 successful genome-wide mutant fitness assays representing 130 different bacterium-carbon source combinations and identified 5,196 genes with significant phenotypes across the five bacteria. In P. inhibens, we used our mutant fitness data to identify genes important for the utilization of diverse carbon substrates, including a putative D-mannose isomerase that is required for mannitol catabolism. RB-TnSeq will enable the cost-effective functional annotation of diverse bacteria using mutant fitness profiling. A large challenge in microbiology is the functional assessment of the millions of uncharacterized genes identified by genome sequencing. Transposon mutagenesis coupled to next-generation sequencing (TnSeq) is a powerful approach to assign phenotypes and functions to genes. However, the current strategies for TnSeq are too laborious to be applied to hundreds of experimental conditions across multiple bacteria. Here, we describe an approach, random bar code transposon-site sequencing (RB-TnSeq), which greatly simplifies the measurement of gene fitness by using bar code sequencing (BarSeq) to monitor the abundance of mutants. We performed 387 genome-wide fitness assays across five bacteria and identified phenotypes for over 5,000 genes. RB-TnSeq can be applied to diverse bacteria and is a powerful tool to annotate uncharacterized genes using phenotype data.« less

  13. Rapid quantification of mutant fitness in diverse bacteria by sequencing randomly bar-coded transposons

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wetmore, Kelly M.; Price, Morgan N.; Waters, Robert J.

    Transposon mutagenesis with next-generation sequencing (TnSeq) is a powerful approach to annotate gene function in bacteria, but existing protocols for TnSeq require laborious preparation of every sample before sequencing. Thus, the existing protocols are not amenable to the throughput necessary to identify phenotypes and functions for the majority of genes in diverse bacteria. Here, we present a method, random bar code transposon-site sequencing (RB-TnSeq), which increases the throughput of mutant fitness profiling by incorporating random DNA bar codes into Tn5 and mariner transposons and by using bar code sequencing (BarSeq) to assay mutant fitness. RB-TnSeq can be used with anymore » transposon, and TnSeq is performed once per organism instead of once per sample. Each BarSeq assay requires only a simple PCR, and 48 to 96 samples can be sequenced on one lane of an Illumina HiSeq system. We demonstrate the reproducibility and biological significance of RB-TnSeq with Escherichia coli, Phaeobacter inhibens, Pseudomonas stutzeri, Shewanella amazonensis, and Shewanella oneidensis. To demonstrate the increased throughput of RB-TnSeq, we performed 387 successful genome-wide mutant fitness assays representing 130 different bacterium-carbon source combinations and identified 5,196 genes with significant phenotypes across the five bacteria. In P. inhibens, we used our mutant fitness data to identify genes important for the utilization of diverse carbon substrates, including a putative D-mannose isomerase that is required for mannitol catabolism. RB-TnSeq will enable the cost-effective functional annotation of diverse bacteria using mutant fitness profiling. A large challenge in microbiology is the functional assessment of the millions of uncharacterized genes identified by genome sequencing. Transposon mutagenesis coupled to next-generation sequencing (TnSeq) is a powerful approach to assign phenotypes and functions to genes. However, the current strategies for TnSeq are too laborious to be applied to hundreds of experimental conditions across multiple bacteria. Here, we describe an approach, random bar code transposon-site sequencing (RB-TnSeq), which greatly simplifies the measurement of gene fitness by using bar code sequencing (BarSeq) to monitor the abundance of mutants. We performed 387 genome-wide fitness assays across five bacteria and identified phenotypes for over 5,000 genes. RB-TnSeq can be applied to diverse bacteria and is a powerful tool to annotate uncharacterized genes using phenotype data.« less

  14. Nucleotide sequence of the gag gene and gag-pol junction of feline leukemia virus.

    PubMed Central

    Laprevotte, I; Hampe, A; Sherr, C J; Galibert, F

    1984-01-01

    The nucleotide sequence of the gag gene of feline leukemia virus and its flanking sequences were determined and compared with the corresponding sequences of two strains of feline sarcoma virus and with that of the Moloney strain of murine leukemia virus. A high degree of nucleotide sequence homology between the feline leukemia virus and murine leukemia virus gag genes was observed, suggesting that retroviruses of domestic cats and laboratory mice have a common, proximal evolutionary progenitor. The predicted structure of the complete feline leukemia virus gag gene precursor suggests that the translation of nonglycosylated and glycosylated gag gene polypeptides is initiated at two different AUG codons. These initiator codons fall in the same reading frame and are separated by a 222-base-pair segment which encodes an amino terminal signal peptide. The nucleotide sequence predicts the order of amino acids in each of the individual gag-coded proteins (p15, p12, p30, p10), all of which derive from the gag gene precursor. Stable stem-and-loop secondary structures are proposed for two regions of viral RNA. The first falls within sequences at the 5' end of the viral genome, together with adjacent palindromic sequences which may play a role in dimer linkage of RNA subunits. The second includes coding sequences at the gag-pol junction and is proposed to be involved in translation of the pol gene product. Sequence analysis of the latter region shows that the gag and pol genes are translated in different reading frames. Classical consensus splice donor and acceptor sequences could not be localized to regions which would permit synthesis of the expected gag-pol precursor protein. Alternatively, we suggest that the pol gene product (RNA-dependent DNA polymerase) could be translated by a frameshift suppressing mechanism which could involve cleavage modification of stems and loops in a manner similar to that observed in tRNA processing. PMID:6328019

  15. NullSeq: A Tool for Generating Random Coding Sequences with Desired Amino Acid and GC Contents.

    PubMed

    Liu, Sophia S; Hockenberry, Adam J; Lancichinetti, Andrea; Jewett, Michael C; Amaral, Luís A N

    2016-11-01

    The existence of over- and under-represented sequence motifs in genomes provides evidence of selective evolutionary pressures on biological mechanisms such as transcription, translation, ligand-substrate binding, and host immunity. In order to accurately identify motifs and other genome-scale patterns of interest, it is essential to be able to generate accurate null models that are appropriate for the sequences under study. While many tools have been developed to create random nucleotide sequences, protein coding sequences are subject to a unique set of constraints that complicates the process of generating appropriate null models. There are currently no tools available that allow users to create random coding sequences with specified amino acid composition and GC content for the purpose of hypothesis testing. Using the principle of maximum entropy, we developed a method that generates unbiased random sequences with pre-specified amino acid and GC content, which we have developed into a python package. Our method is the simplest way to obtain maximally unbiased random sequences that are subject to GC usage and primary amino acid sequence constraints. Furthermore, this approach can easily be expanded to create unbiased random sequences that incorporate more complicated constraints such as individual nucleotide usage or even di-nucleotide frequencies. The ability to generate correctly specified null models will allow researchers to accurately identify sequence motifs which will lead to a better understanding of biological processes as well as more effective engineering of biological systems.

  16. RNAcentral: A comprehensive database of non-coding RNA sequences

    DOE PAGES

    Williams, Kelly Porter; Lau, Britney Yan

    2016-10-28

    RNAcentral is a database of non-coding RNA (ncRNA) sequences that aggregates data from specialised ncRNA resources and provides a single entry point for accessing ncRNA sequences of all ncRNA types from all organisms. Since its launch in 2014, RNAcentral has integrated twelve new resources, taking the total number of collaborating database to 22, and began importing new types of data, such as modified nucleotides from MODOMICS and PDB. We created new species-specific identifiers that refer to unique RNA sequences within a context of single species. Furthermore, the website has been subject to continuous improvements focusing on text and sequence similaritymore » searches as well as genome browsing functionality.« less

  17. RNAcentral: A comprehensive database of non-coding RNA sequences

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Williams, Kelly Porter; Lau, Britney Yan

    RNAcentral is a database of non-coding RNA (ncRNA) sequences that aggregates data from specialised ncRNA resources and provides a single entry point for accessing ncRNA sequences of all ncRNA types from all organisms. Since its launch in 2014, RNAcentral has integrated twelve new resources, taking the total number of collaborating database to 22, and began importing new types of data, such as modified nucleotides from MODOMICS and PDB. We created new species-specific identifiers that refer to unique RNA sequences within a context of single species. Furthermore, the website has been subject to continuous improvements focusing on text and sequence similaritymore » searches as well as genome browsing functionality.« less

  18. Performance Analysis of a New Coded TH-CDMA Scheme in Dispersive Infrared Channel with Additive Gaussian Noise

    NASA Astrophysics Data System (ADS)

    Hamdi, Mazda; Kenari, Masoumeh Nasiri

    2013-06-01

    We consider a time-hopping based multiple access scheme introduced in [1] for communication over dispersive infrared links, and evaluate its performance for correlator and matched filter receivers. In the investigated time-hopping code division multiple access (TH-CDMA) method, the transmitter benefits a low rate convolutional encoder. In this method, the bit interval is divided into Nc chips and the output of the encoder along with a PN sequence assigned to the user determines the position of the chip in which the optical pulse is transmitted. We evaluate the multiple access performance of the system for correlation receiver considering background noise which is modeled as White Gaussian noise due to its large intensity. For the correlation receiver, the results show that for a fixed processing gain, at high transmit power, where the multiple access interference has the dominant effect, the performance improves by the coding gain. But at low transmit power, in which the increase of coding gain leads to the decrease of the chip time, and consequently, to more corruption due to the channel dispersion, there exists an optimum value for the coding gain. However, for the matched filter, the performance always improves by the coding gain. The results show that the matched filter receiver outperforms the correlation receiver in the considered cases. Our results show that, for the same bandwidth and bit rate, the proposed system excels other multiple access techniques, like conventional CDMA and time hopping scheme.

  19. Integrative structural annotation of de novo RNA-Seq provides an accurate reference gene set of the enormous genome of the onion (Allium cepa L.)

    PubMed Central

    Kim, Seungill; Kim, Myung-Shin; Kim, Yong-Min; Yeom, Seon-In; Cheong, Kyeongchae; Kim, Ki-Tae; Jeon, Jongbum; Kim, Sunggil; Kim, Do-Sun; Sohn, Seong-Han; Lee, Yong-Hwan; Choi, Doil

    2015-01-01

    The onion (Allium cepa L.) is one of the most widely cultivated and consumed vegetable crops in the world. Although a considerable amount of onion transcriptome data has been deposited into public databases, the sequences of the protein-coding genes are not accurate enough to be used, owing to non-coding sequences intermixed with the coding sequences. We generated a high-quality, annotated onion transcriptome from de novo sequence assembly and intensive structural annotation using the integrated structural gene annotation pipeline (ISGAP), which identified 54,165 protein-coding genes among 165,179 assembled transcripts totalling 203.0 Mb by eliminating the intron sequences. ISGAP performed reliable annotation, recognizing accurate gene structures based on reference proteins, and ab initio gene models of the assembled transcripts. Integrative functional annotation and gene-based SNP analysis revealed a whole biological repertoire of genes and transcriptomic variation in the onion. The method developed in this study provides a powerful tool for the construction of reference gene sets for organisms based solely on de novo transcriptome data. Furthermore, the reference genes and their variation described here for the onion represent essential tools for molecular breeding and gene cloning in Allium spp. PMID:25362073

  20. Analysis of the cytochrome c oxidase subunit II (COX2) gene in giant panda, Ailuropoda melanoleuca.

    PubMed

    Ling, S S; Zhu, Y; Lan, D; Li, D S; Pang, H Z; Wang, Y; Li, D Y; Wei, R P; Zhang, H M; Wang, C D; Hu, Y D

    2017-01-23

    The giant panda, Ailuropoda melanoleuca (Ursidae), has a unique bamboo-based diet; however, this low-energy intake has been sufficient to maintain the metabolic processes of this species since the fourth ice age. As mitochondria are the main sites for energy metabolism in animals, the protein-coding genes involved in mitochondrial respiratory chains, particularly cytochrome c oxidase subunit II (COX2), which is the rate-limiting enzyme in electron transfer, could play an important role in giant panda metabolism. Therefore, the present study aimed to isolate, sequence, and analyze the COX2 DNA from individuals kept at the Giant Panda Protection and Research Center, China, and compare these sequences with those of the other Ursidae family members. Multiple sequence alignment showed that the COX2 gene had three point mutations that defined three haplotypes, with 60% of the sequences corresponding to haplotype I. The neutrality tests revealed that the COX2 gene was conserved throughout evolution, and the maximum likelihood phylogenetic analysis, using homologous sequences from other Ursidae species, showed clustering of the COX2 sequences of giant pandas, suggesting that this gene evolved differently in them.

  1. Exome sequencing and arrayCGH detection of gene sequence and copy number variation between ILS and ISS mouse strains.

    PubMed

    Dumas, Laura; Dickens, C Michael; Anderson, Nathan; Davis, Jonathan; Bennett, Beth; Radcliffe, Richard A; Sikela, James M

    2014-06-01

    It has been well documented that genetic factors can influence predisposition to develop alcoholism. While the underlying genomic changes may be of several types, two of the most common and disease associated are copy number variations (CNVs) and sequence alterations of protein coding regions. The goal of this study was to identify CNVs and single-nucleotide polymorphisms that occur in gene coding regions that may play a role in influencing the risk of an individual developing alcoholism. Toward this end, two mouse strains were used that have been selectively bred based on their differential sensitivity to alcohol: the Inbred long sleep (ILS) and Inbred short sleep (ISS) mouse strains. Differences in initial response to alcohol have been linked to risk for alcoholism, and the ILS/ISS strains are used to investigate the genetics of initial sensitivity to alcohol. Array comparative genomic hybridization (arrayCGH) and exome sequencing were conducted to identify CNVs and gene coding sequence differences, respectively, between ILS and ISS mice. Mouse arrayCGH was performed using catalog Agilent 1 × 244 k mouse arrays. Subsequently, exome sequencing was carried out using an Illumina HiSeq 2000 instrument. ArrayCGH detected 74 CNVs that were strain-specific (38 ILS/36 ISS), including several ISS-specific deletions that contained genes implicated in brain function and neurotransmitter release. Among several interesting coding variations detected by exome sequencing was the gain of a premature stop codon in the alpha-amylase 2B (AMY2B) gene specifically in the ILS strain. In total, exome sequencing detected 2,597 and 1,768 strain-specific exonic gene variants in the ILS and ISS mice, respectively. This study represents the most comprehensive and detailed genomic comparison of ILS and ISS mouse strains to date. The two complementary genome-wide approaches identified strain-specific CNVs and gene coding sequence variations that should provide strong candidates to contribute to the alcohol-related phenotypic differences associated with these strains.

  2. Identification of Putative Nuclear Receptors and Steroidogenic Enzymes in Murray-Darling Rainbowfish (Melanotaenia fluviatilis) Using RNA-Seq and De Novo Transcriptome Assembly.

    PubMed

    Bain, Peter A; Papanicolaou, Alexie; Kumar, Anupama

    2015-01-01

    Murray-Darling rainbowfish (Melanotaenia fluviatilis [Castelnau, 1878]; Atheriniformes: Melanotaeniidae) is a small-bodied teleost currently under development in Australasia as a test species for aquatic toxicological studies. To date, efforts towards the development of molecular biomarkers of contaminant exposure have been hindered by the lack of available sequence data. To address this, we sequenced messenger RNA from brain, liver and gonads of mature male and female fish and generated a high-quality draft transcriptome using a de novo assembly approach. 149,742 clusters of putative transcripts were obtained, encompassing 43,841 non-redundant protein-coding regions. Deduced amino acid sequences were annotated by functional inference based on similarity with sequences from manually curated protein sequence databases. The draft assembly contained protein-coding regions homologous to 95.7% of the complete cohort of predicted proteins from the taxonomically related species, Oryzias latipes (Japanese medaka). The mean length of rainbowfish protein-coding sequences relative to their medaka homologues was 92.1%, indicating that despite the limited number of tissues sampled a large proportion of the total expected number of protein-coding genes was captured in the study. Because of our interest in the effects of environmental contaminants on endocrine pathways, we manually curated subsets of coding regions for putative nuclear receptors and steroidogenic enzymes in the rainbowfish transcriptome, revealing 61 candidate nuclear receptors encompassing all known subfamilies, and 41 putative steroidogenic enzymes representing all major steroidogenic enzymes occurring in teleosts. The transcriptome presented here will be a valuable resource for researchers interested in biomarker development, protein structure and function, and contaminant-response genomics in Murray-Darling rainbowfish.

  3. Partial sequence homogenization in the 5S multigene families may generate sequence chimeras and spurious results in phylogenetic reconstructions.

    PubMed

    Galián, José A; Rosato, Marcela; Rosselló, Josep A

    2014-03-01

    Multigene families have provided opportunities for evolutionary biologists to assess molecular evolution processes and phylogenetic reconstructions at deep and shallow systematic levels. However, the use of these markers is not free of technical and analytical challenges. Many evolutionary studies that used the nuclear 5S rDNA gene family rarely used contiguous 5S coding sequences due to the routine use of head-to-tail polymerase chain reaction primers that are anchored to the coding region. Moreover, the 5S coding sequences have been concatenated with independent, adjacent gene units in many studies, creating simulated chimeric genes as the raw data for evolutionary analysis. This practice is based on the tacitly assumed, but rarely tested, hypothesis that strict intra-locus concerted evolution processes are operating in 5S rDNA genes, without any empirical evidence as to whether it holds for the recovered data. The potential pitfalls of analysing the patterns of molecular evolution and reconstructing phylogenies based on these chimeric genes have not been assessed to date. Here, we compared the sequence integrity and phylogenetic behavior of entire versus concatenated 5S coding regions from a real data set obtained from closely related plant species (Medicago, Fabaceae). Our results suggest that within arrays sequence homogenization is partially operating in the 5S coding region, which is traditionally assumed to be highly conserved. Consequently, concatenating 5S genes increases haplotype diversity, generating novel chimeric genotypes that most likely do not exist within the genome. In addition, the patterns of gene evolution are distorted, leading to incorrect haplotype relationships in some evolutionary reconstructions.

  4. Shared prefetching to reduce execution skew in multi-threaded systems

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Eichenberger, Alexandre E; Gunnels, John A

    Mechanisms are provided for optimizing code to perform prefetching of data into a shared memory of a computing device that is shared by a plurality of threads that execute on the computing device. A memory stream of a portion of code that is shared by the plurality of threads is identified. A set of prefetch instructions is distributed across the plurality of threads. Prefetch instructions are inserted into the instruction sequences of the plurality of threads such that each instruction sequence has a separate sub-portion of the set of prefetch instructions, thereby generating optimized code. Executable code is generated basedmore » on the optimized code and stored in a storage device. The executable code, when executed, performs the prefetches associated with the distributed set of prefetch instructions in a shared manner across the plurality of threads.« less

  5. FB-NOF is a non-autonomous transposable element, expressed in Drosophila melanogaster and present only in the melanogaster group.

    PubMed

    Badal, Martí; Xamena, Noel; Cabré, Oriol

    2013-09-10

    Most foldback elements are defective due to the lack of coding sequences but some are associated with coding sequences and may represent the entire element. This is the case of the NOF sequences found in the FB of Drosophila melanogaster, formerly considered as an autonomous TE and currently proposed as part of the so-called FB-NOF element, the transposon that would be complete and fully functional. NOF is always associated with FB and never seen apart from the FB inverted repeats (IR). This is the reason why the FB-NOF composite element can be considered the complete element. At least one of its ORFs encodes a protein that has always been considered its transposase, but no detailed studies have been carried out to verify this. In this work we test the hypothesis that FB-NOF is an active transposon nowadays. We search for its expression product, obtaining its cDNA, and propose the ORF and the sequence of its potential protein. We found that the NOF protein is not a transposase as it lacks any of the motifs of known transposases and also shows structural homology with hydrolases, therefore FB-NOF cannot belong to the superfamily MuDR/foldback, as up to now it has been classified, and can be considered as a non-autonomous transposable element. The alignment with the published genomes of 12 Drosophila species shows that NOF presence is restricted only to the 6 Drosophila species belonging to the melanogaster group. Copyright © 2013 Elsevier B.V. All rights reserved.

  6. Integrating alignment-based and alignment-free sequence similarity measures for biological sequence classification.

    PubMed

    Borozan, Ivan; Watt, Stuart; Ferretti, Vincent

    2015-05-01

    Alignment-based sequence similarity searches, while accurate for some type of sequences, can produce incorrect results when used on more divergent but functionally related sequences that have undergone the sequence rearrangements observed in many bacterial and viral genomes. Here, we propose a classification model that exploits the complementary nature of alignment-based and alignment-free similarity measures with the aim to improve the accuracy with which DNA and protein sequences are characterized. Our model classifies sequences using a combined sequence similarity score calculated by adaptively weighting the contribution of different sequence similarity measures. Weights are determined independently for each sequence in the test set and reflect the discriminatory ability of individual similarity measures in the training set. Because the similarity between some sequences is determined more accurately with one type of measure rather than another, our classifier allows different sets of weights to be associated with different sequences. Using five different similarity measures, we show that our model significantly improves the classification accuracy over the current composition- and alignment-based models, when predicting the taxonomic lineage for both short viral sequence fragments and complete viral sequences. We also show that our model can be used effectively for the classification of reads from a real metagenome dataset as well as protein sequences. All the datasets and the code used in this study are freely available at https://collaborators.oicr.on.ca/vferretti/borozan_csss/csss.html. ivan.borozan@gmail.com Supplementary data are available at Bioinformatics online. © The Author 2015. Published by Oxford University Press.

  7. Integrating alignment-based and alignment-free sequence similarity measures for biological sequence classification

    PubMed Central

    Borozan, Ivan; Watt, Stuart; Ferretti, Vincent

    2015-01-01

    Motivation: Alignment-based sequence similarity searches, while accurate for some type of sequences, can produce incorrect results when used on more divergent but functionally related sequences that have undergone the sequence rearrangements observed in many bacterial and viral genomes. Here, we propose a classification model that exploits the complementary nature of alignment-based and alignment-free similarity measures with the aim to improve the accuracy with which DNA and protein sequences are characterized. Results: Our model classifies sequences using a combined sequence similarity score calculated by adaptively weighting the contribution of different sequence similarity measures. Weights are determined independently for each sequence in the test set and reflect the discriminatory ability of individual similarity measures in the training set. Because the similarity between some sequences is determined more accurately with one type of measure rather than another, our classifier allows different sets of weights to be associated with different sequences. Using five different similarity measures, we show that our model significantly improves the classification accuracy over the current composition- and alignment-based models, when predicting the taxonomic lineage for both short viral sequence fragments and complete viral sequences. We also show that our model can be used effectively for the classification of reads from a real metagenome dataset as well as protein sequences. Availability and implementation: All the datasets and the code used in this study are freely available at https://collaborators.oicr.on.ca/vferretti/borozan_csss/csss.html. Contact: ivan.borozan@gmail.com Supplementary information: Supplementary data are available at Bioinformatics online. PMID:25573913

  8. Draft Genome Sequence of Bacillus cereus CITVM-11.1, a Strain Exhibiting Interesting Antifungal Activities.

    PubMed

    Caballero, Javier; Peralta, Cecilia; Molla, Antonella; Del Valle, Eleodoro E; Caballero, Primitivo; Berry, Colin; Felipe, Verónica; Yaryura, Pablo; Palma, Leopoldo

    2018-01-01

    Bacillus cereus is a gram-positive, spore-forming bacterium possessing an important and historical record as a human-pathogenic bacterium. However, several strains of this species exhibit interesting potential to be used as plant growth-promoting rhizobacteria. Here, we report the draft genome sequence of B. cereus strain CITVM-11.1, which consists of 37 contig sequences, accounting for 5,746,486 bp (with a GC content of 34.8%) and 5,752 predicted protein-coding sequences. Several of them could potentially be involved in plant-bacterium interactions and may contribute to the strong antagonistic activity shown by this strain against the charcoal root rot fungus, Macrophomina phaseolina. This genomic sequence also showed a number of genes that may confer this strain resistance against several polluting heavy metals and for the bioconversion of mycotoxins. © 2018 S. Karger AG, Basel.

  9. Spatiotemporal coding of inputs for a system of globally coupled phase oscillators

    NASA Astrophysics Data System (ADS)

    Wordsworth, John; Ashwin, Peter

    2008-12-01

    We investigate the spatiotemporal coding of low amplitude inputs to a simple system of globally coupled phase oscillators with coupling function g(ϕ)=-sin(ϕ+α)+rsin(2ϕ+β) that has robust heteroclinic cycles (slow switching between cluster states). The inputs correspond to detuning of the oscillators. It was recently noted that globally coupled phase oscillators can encode their frequencies in the form of spatiotemporal codes of a sequence of cluster states [P. Ashwin, G. Orosz, J. Wordsworth, and S. Townley, SIAM J. Appl. Dyn. Syst. 6, 728 (2007)]. Concentrating on the case of N=5 oscillators we show in detail how the spatiotemporal coding can be used to resolve all of the information that relates the individual inputs to each other, providing that a long enough time series is considered. We investigate robustness to the addition of noise and find a remarkable stability, especially of the temporal coding, to the addition of noise even for noise of a comparable magnitude to the inputs.

  10. The evolution of transcriptional regulation in eukaryotes

    NASA Technical Reports Server (NTRS)

    Wray, Gregory A.; Hahn, Matthew W.; Abouheif, Ehab; Balhoff, James P.; Pizer, Margaret; Rockman, Matthew V.; Romano, Laura A.

    2003-01-01

    Gene expression is central to the genotype-phenotype relationship in all organisms, and it is an important component of the genetic basis for evolutionary change in diverse aspects of phenotype. However, the evolution of transcriptional regulation remains understudied and poorly understood. Here we review the evolutionary dynamics of promoter, or cis-regulatory, sequences and the evolutionary mechanisms that shape them. Existing evidence indicates that populations harbor extensive genetic variation in promoter sequences, that a substantial fraction of this variation has consequences for both biochemical and organismal phenotype, and that some of this functional variation is sorted by selection. As with protein-coding sequences, rates and patterns of promoter sequence evolution differ considerably among loci and among clades for reasons that are not well understood. Studying the evolution of transcriptional regulation poses empirical and conceptual challenges beyond those typically encountered in analyses of coding sequence evolution: promoter organization is much less regular than that of coding sequences, and sequences required for the transcription of each locus reside at multiple other loci in the genome. Because of the strong context-dependence of transcriptional regulation, sequence inspection alone provides limited information about promoter function. Understanding the functional consequences of sequence differences among promoters generally requires biochemical and in vivo functional assays. Despite these challenges, important insights have already been gained into the evolution of transcriptional regulation, and the pace of discovery is accelerating.

  11. Archaebacterial rhodopsin sequences: Implications for evolution

    NASA Technical Reports Server (NTRS)

    Lanyi, J. K.

    1991-01-01

    It was proposed over 10 years ago that the archaebacteria represent a separate kingdom which diverged very early from the eubacteria and eukaryotes. It follows that investigations of archaebacterial characteristics might reveal features of early evolution. So far, two genes, one for bacteriorhodopsin and another for halorhodopsin, both from Halobacterium halobium, have been sequenced. We cloned and sequenced the gene coding for the polypeptide of another one of these rhodopsins, a halorhodopsin in Natronobacterium pharaonis. Peptide sequencing of cyanogen bromide fragments, and immuno-reactions of the protein and synthetic peptides derived from the C-terminal gene sequence, confirmed that the open reading frame was the structural gene for the pharaonis halorhodopsin polypeptide. The flanking DNA sequences of this gene, as well as those of other bacterial rhodopsins, were compared to previously proposed archaebacterial consensus sequences. In pairwise comparisons of the open reading frame with DNA sequences for bacterio-opsin and halo-opsin from Halobacterium halobium, silent divergences were calculated. These indicate very considerable evolutionary distance between each pair of genes, even in the dame organism. In spite of this, three protein sequences show extensive similarities, indicating strong selective pressures.

  12. Convolutional encoding of self-dual codes

    NASA Technical Reports Server (NTRS)

    Solomon, G.

    1994-01-01

    There exist almost complete convolutional encodings of self-dual codes, i.e., block codes of rate 1/2 with weights w, w = 0 mod 4. The codes are of length 8m with the convolutional portion of length 8m-2 and the nonsystematic information of length 4m-1. The last two bits are parity checks on the two (4m-1) length parity sequences. The final information bit complements one of the extended parity sequences of length 4m. Solomon and van Tilborg have developed algorithms to generate these for the Quadratic Residue (QR) Codes of lengths 48 and beyond. For these codes and reasonable constraint lengths, there are sequential decodings for both hard and soft decisions. There are also possible Viterbi-type decodings that may be simple, as in a convolutional encoding/decoding of the extended Golay Code. In addition, the previously found constraint length K = 9 for the QR (48, 24;12) Code is lowered here to K = 8.

  13. Gene and translation initiation site prediction in metagenomic sequences

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hyatt, Philip Douglas; LoCascio, Philip F; Hauser, Loren John

    2012-01-01

    Gene prediction in metagenomic sequences remains a difficult problem. Current sequencing technologies do not achieve sufficient coverage to assemble the individual genomes in a typical sample; consequently, sequencing runs produce a large number of short sequences whose exact origin is unknown. Since these sequences are usually smaller than the average length of a gene, algorithms must make predictions based on very little data. We present MetaProdigal, a metagenomic version of the gene prediction program Prodigal, that can identify genes in short, anonymous coding sequences with a high degree of accuracy. The novel value of the method consists of enhanced translationmore » initiation site identification, ability to identify sequences that use alternate genetic codes and confidence values for each gene call. We compare the results of MetaProdigal with other methods and conclude with a discussion of future improvements.« less

  14. The Evolution of Bony Vertebrate Enhancers at Odds with Their Coding Sequence Landscape.

    PubMed

    Yousaf, Aisha; Sohail Raza, Muhammad; Ali Abbasi, Amir

    2015-08-06

    Enhancers lie at the heart of transcriptional and developmental gene regulation. Therefore, changes in enhancer sequences usually disrupt the target gene expression and result in disease phenotypes. Despite the well-established role of enhancers in development and disease, evolutionary sequence studies are lacking. The current study attempts to unravel the puzzle of bony vertebrates' conserved noncoding elements (CNE) enhancer evolution. Bayesian phylogenetics of enhancer sequences spotlights promising interordinal relationships among placental mammals, proposing a closer relationship between humans and laurasiatherians while placing rodents at the basal position. Clock-based estimates of enhancer evolution provided a dynamic picture of interspecific rate changes across the bony vertebrate lineage. Moreover, coelacanth in the study augmented our appreciation of the vertebrate cis-regulatory evolution during water-land transition. Intriguingly, we observed a pronounced upsurge in enhancer evolution in land-dwelling vertebrates. These novel findings triggered us to further investigate the evolutionary trend of coding as well as CNE nonenhancer repertoires, to highlight the relative evolutionary dynamics of diverse genomic landscapes. Surprisingly, the evolutionary rates of enhancer sequences were clearly at odds with those of the coding and the CNE nonenhancer sequences during vertebrate adaptation to land, with land vertebrates exhibiting significantly reduced rates of coding sequence evolution in comparison to their fast evolving regulatory landscape. The observed variation in tetrapod cis-regulatory elements caused the fine-tuning of associated gene regulatory networks. Therefore, the increased evolutionary rate of tetrapods' enhancer sequences might be responsible for the variation in developmental regulatory circuits during the process of vertebrate adaptation to land. © The Author(s) 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  15. Single nucleotide polymorphisms in common bean: their discovery and genotyping using a multiplex detection system

    USDA-ARS?s Scientific Manuscript database

    Single-nucleotide Polymorphism (SNP) markers are by far the most common form of DNA polymorphism in a genome. The objectives of this study were to discover SNPs in common bean comparing sequences from coding and non-coding regions obtained from Genbank and genomic DNA and to compare sequencing resu...

  16. Predictive coding in autism spectrum disorder and attention deficit hyperactivity disorder.

    PubMed

    Gonzalez-Gadea, Maria Luz; Chennu, Srivas; Bekinschtein, Tristan A; Rattazzi, Alexia; Beraudi, Ana; Tripicchio, Paula; Moyano, Beatriz; Soffita, Yamila; Steinberg, Laura; Adolfi, Federico; Sigman, Mariano; Marino, Julian; Manes, Facundo; Ibanez, Agustin

    2015-11-01

    Predictive coding has been proposed as a framework to understand neural processes in neuropsychiatric disorders. We used this approach to describe mechanisms responsible for attentional abnormalities in autism spectrum disorder (ASD) and attention deficit hyperactivity disorder (ADHD). We monitored brain dynamics of 59 children (8-15 yr old) who had ASD or ADHD or who were control participants via high-density electroencephalography. We performed analysis at the scalp and source-space levels while participants listened to standard and deviant tone sequences. Through task instructions, we manipulated top-down expectation by presenting expected and unexpected deviant sequences. Children with ASD showed reduced superior frontal cortex (FC) responses to unexpected events but increased dorsolateral prefrontal cortex (PFC) activation to expected events. In contrast, children with ADHD exhibited reduced cortical responses in superior FC to expected events but strong PFC activation to unexpected events. Moreover, neural abnormalities were associated with specific control mechanisms, namely, inhibitory control in ASD and set-shifting in ADHD. Based on the predictive coding account, top-down expectation abnormalities could be attributed to a disproportionate reliance (precision) allocated to prior beliefs in ASD and to sensory input in ADHD. Copyright © 2015 the American Physiological Society.

  17. Predictive coding in autism spectrum disorder and attention deficit hyperactivity disorder

    PubMed Central

    Gonzalez-Gadea, Maria Luz; Chennu, Srivas; Bekinschtein, Tristan A.; Rattazzi, Alexia; Beraudi, Ana; Tripicchio, Paula; Moyano, Beatriz; Soffita, Yamila; Steinberg, Laura; Adolfi, Federico; Sigman, Mariano; Marino, Julian; Manes, Facundo

    2015-01-01

    Predictive coding has been proposed as a framework to understand neural processes in neuropsychiatric disorders. We used this approach to describe mechanisms responsible for attentional abnormalities in autism spectrum disorder (ASD) and attention deficit hyperactivity disorder (ADHD). We monitored brain dynamics of 59 children (8–15 yr old) who had ASD or ADHD or who were control participants via high-density electroencephalography. We performed analysis at the scalp and source-space levels while participants listened to standard and deviant tone sequences. Through task instructions, we manipulated top-down expectation by presenting expected and unexpected deviant sequences. Children with ASD showed reduced superior frontal cortex (FC) responses to unexpected events but increased dorsolateral prefrontal cortex (PFC) activation to expected events. In contrast, children with ADHD exhibited reduced cortical responses in superior FC to expected events but strong PFC activation to unexpected events. Moreover, neural abnormalities were associated with specific control mechanisms, namely, inhibitory control in ASD and set-shifting in ADHD. Based on the predictive coding account, top-down expectation abnormalities could be attributed to a disproportionate reliance (precision) allocated to prior beliefs in ASD and to sensory input in ADHD. PMID:26311184

  18. LSB-based Steganography Using Reflected Gray Code for Color Quantum Images

    NASA Astrophysics Data System (ADS)

    Li, Panchi; Lu, Aiping

    2018-02-01

    At present, the classical least-significant-bit (LSB) based image steganography has been extended to quantum image processing. For the existing LSB-based quantum image steganography schemes, the embedding capacity is no more than 3 bits per pixel. Therefore, it is meaningful to study how to improve the embedding capacity of quantum image steganography. This work presents a novel LSB-based steganography using reflected Gray code for colored quantum images, and the embedding capacity of this scheme is up to 4 bits per pixel. In proposed scheme, the secret qubit sequence is considered as a sequence of 4-bit segments. For the four bits in each segment, the first bit is embedded in the second LSB of B channel of the cover image, and and the remaining three bits are embedded in LSB of RGB channels of each color pixel simultaneously using reflected-Gray code to determine the embedded bit from secret information. Following the transforming rule, the LSB of stego-image are not always same as the secret bits and the differences are up to almost 50%. Experimental results confirm that the proposed scheme shows good performance and outperforms the previous ones currently found in the literature in terms of embedding capacity.

  19. Cloning, sequence analysis, and expression in Escherichia coli of a gene coding for a. beta. -mannanase from the extremely thermophilic bacterium Caldocellum saccharolyticum

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Luethi, E.; Jasmat, N.B.; Grayling, R.A.

    1991-03-01

    A {lambda} recombinant phage expressing {beta}-mannanase activity in Escherichia coli has been isolated from a genomic library of the extremely thermophilic anaerobe Caldocellum saccharolyticum. The gene was cloned into pBR322 on a 5-kb BamHI fragment, and its location was obtained by deletion analysis. The sequence of a 2.1-kb fragment containing the mannanase gene has been determined. One open reading frame was found which could code for a protein of M{sub r} 38,904. The mannanase gene (manA) was overexpressed in E. coli by cloning the gene downstream from the lacZ promoter of pUC18. The enzyme was most active at pH 6more » and 80 C and degraded locust bean gum, guar gum, Pinus radiata glucomannan, and konjak glucomannan. The noncoding region downstream from the mannanase gene showed strong homology to celB, a gene coding for a cellulase from the same organism, suggesting that the manA gene might have been inserted into its present position on the C. saccharolyticum genome by homologous recombination.« less

  20. Molecular cloning and functional analysis of MRLC2 in Tianfu, Boer, and Chengdu Ma goats.

    PubMed

    Xu, H G; Xu, G Y; Wan, L; Ma, J

    2013-03-15

    To determine the molecular basis of heterosis in goats, fluorescence quantitative polymerase chain reaction (PCR) was performed to investigate myosin-regulatory light chain 2 (MRLC2) gene expression in the longissimus dorsi muscle tissues of the Tianfu goat and its parents, the Boer and Chengdu Ma goats. The goat MRLC2 gene was differentially expressed in the crossbreed, and the purebred mRNA were isolated and identified using fluorescence quantitative reverse transcription-PCR (RT-PCR). The complete coding sequence of MRLC2 was obtained using the cDNA method, and the full-length coding sequence consisted of 513 bp encoding 172 amino acids. The EF-hand superfamily domain of the MRLC2 protein is well conserved in caprine and other animals. The deduced amino acid sequence of MRLC2 shared significant identity with MRLC2 from other mammals. Phylogenetic tree analysis revealed that the MRLC2 protein was closely related to MRLC2 in other mammals. Several predicted miRNA target sites were found in the coding sequence of caprine MRLC2 mRNA. Analysis by RT-PCR showed that MRLC2 mRNA was present in the heart, stomach, liver, spleen, lung, small intestine, kidney, leg muscle, abdominal muscle, and longissimus dorsi muscles. In particular, the high expression of MRLC2 mRNA was detected in the longissimus dorsi, leg muscle, abdominal muscle, stomach, and heart, but low levels of expression were also observed in the liver, spleen, lung, small intestine, and kidney. The expression of the MRLC2 gene was upregulated in the longissimus dorsi muscle of Boer and Tianfu goats, and it was moderately upregulated in Chengdu Ma goats.

  1. Detection of hyper-conserved regions in hepatitis B virus X gene potentially useful for gene therapy.

    PubMed

    González, Carolina; Tabernero, David; Cortese, Maria Francesca; Gregori, Josep; Casillas, Rosario; Riveiro-Barciela, Mar; Godoy, Cristina; Sopena, Sara; Rando, Ariadna; Yll, Marçal; Lopez-Martinez, Rosa; Quer, Josep; Esteban, Rafael; Buti, Maria; Rodríguez-Frías, Francisco

    2018-05-21

    To detect hyper-conserved regions in the hepatitis B virus (HBV) X gene ( HBX ) 5' region that could be candidates for gene therapy. The study included 27 chronic hepatitis B treatment-naive patients in various clinical stages (from chronic infection to cirrhosis and hepatocellular carcinoma, both HBeAg-negative and HBeAg-positive), and infected with HBV genotypes A-F and H. In a serum sample from each patient with viremia > 3.5 log IU/mL, the HBX 5' end region [nucleotide (nt) 1255-1611] was PCR-amplified and submitted to next-generation sequencing (NGS). We assessed genotype variants by phylogenetic analysis, and evaluated conservation of this region by calculating the information content of each nucleotide position in a multiple alignment of all unique sequences (haplotypes) obtained by NGS. Conservation at the HBx protein amino acid (aa) level was also analyzed. NGS yielded 1333069 sequences from the 27 samples, with a median of 4578 sequences/sample (2487-9279, IQR 2817). In 14/27 patients (51.8%), phylogenetic analysis of viral nucleotide haplotypes showed a complex mixture of genotypic variants. Analysis of the information content in the haplotype multiple alignments detected 2 hyper-conserved nucleotide regions, one in the HBX upstream non-coding region (nt 1255-1286) and the other in the 5' end coding region (nt 1519-1603). This last region coded for a conserved amino acid region (aa 63-76) that partially overlaps a Kunitz-like domain. Two hyper-conserved regions detected in the HBX 5' end may be of value for targeted gene therapy, regardless of the patients' clinical stage or HBV genotype.

  2. Complete mitochondrial genomes of the ‘intermediate form’ of Fasciola and Fasciola gigantica, and their comparison with F. hepatica

    PubMed Central

    2014-01-01

    Background Fascioliasis is an important and neglected disease of humans and other mammals, caused by trematodes of the genus Fasciola. Fasciola hepatica and F. gigantica are valid species that infect humans and animals, but the specific status of Fasciola sp. (‘intermediate form’) is unclear. Methods Single specimens inferred to represent Fasciola sp. (‘intermediate form’; Heilongjiang) and F. gigantica (Guangxi) from China were genetically identified and characterized using PCR-based sequencing of the first and second internal transcribed spacer regions of nuclear ribosomal DNA. The complete mitochondrial (mt) genomes of these representative specimens were then sequenced. The relationships of these specimens with selected members of the Trematoda were assessed by phylogenetic analysis of concatenated amino acid sequence datasets by Bayesian inference (BI). Results The complete mt genomes of representatives of Fasciola sp. and F. gigantica were 14,453 bp and 14,478 bp in size, respectively. Both mt genomes contain 12 protein-coding genes, 22 transfer RNA genes and two ribosomal RNA genes, but lack an atp8 gene. All protein-coding genes are transcribed in the same direction, and the gene order in both mt genomes is the same as that published for F. hepatica. Phylogenetic analysis of the concatenated amino acid sequence data for all 12 protein-coding genes showed that the specimen of Fasciola sp. was more closely related to F. gigantica than to F. hepatica. Conclusions The mt genomes characterized here provide a rich source of markers, which can be used in combination with nuclear markers and imaging techniques, for future comparative studies of the biology of Fasciola sp. from China and other countries. PMID:24685294

  3. Complete mitochondrial genomes of the 'intermediate form' of Fasciola and Fasciola gigantica, and their comparison with F. hepatica.

    PubMed

    Liu, Guo-Hua; Gasser, Robin B; Young, Neil D; Song, Hui-Qun; Ai, Lin; Zhu, Xing-Quan

    2014-03-31

    Fascioliasis is an important and neglected disease of humans and other mammals, caused by trematodes of the genus Fasciola. Fasciola hepatica and F. gigantica are valid species that infect humans and animals, but the specific status of Fasciola sp. ('intermediate form') is unclear. Single specimens inferred to represent Fasciola sp. ('intermediate form'; Heilongjiang) and F. gigantica (Guangxi) from China were genetically identified and characterized using PCR-based sequencing of the first and second internal transcribed spacer regions of nuclear ribosomal DNA. The complete mitochondrial (mt) genomes of these representative specimens were then sequenced. The relationships of these specimens with selected members of the Trematoda were assessed by phylogenetic analysis of concatenated amino acid sequence datasets by Bayesian inference (BI). The complete mt genomes of representatives of Fasciola sp. and F. gigantica were 14,453 bp and 14,478 bp in size, respectively. Both mt genomes contain 12 protein-coding genes, 22 transfer RNA genes and two ribosomal RNA genes, but lack an atp8 gene. All protein-coding genes are transcribed in the same direction, and the gene order in both mt genomes is the same as that published for F. hepatica. Phylogenetic analysis of the concatenated amino acid sequence data for all 12 protein-coding genes showed that the specimen of Fasciola sp. was more closely related to F. gigantica than to F. hepatica. The mt genomes characterized here provide a rich source of markers, which can be used in combination with nuclear markers and imaging techniques, for future comparative studies of the biology of Fasciola sp. from China and other countries.

  4. Regulatory versus coding signatures of natural selection in a candidate gene involved in the adaptive divergence of whitefish species pairs (Coregonus spp.)

    PubMed Central

    Jeukens, Julie; Bernatchez, Louis

    2012-01-01

    While gene expression divergence is known to be involved in adaptive phenotypic divergence and speciation, the relative importance of regulatory and structural evolution of genes is poorly understood. A recent next-generation sequencing experiment allowed identifying candidate genes potentially involved in the ongoing speciation of sympatric dwarf and normal lake whitefish (Coregonus clupeaformis), such as cytosolic malate dehydrogenase (MDH1), which showed both significant expression and sequence divergence. The main goal of this study was to investigate into more details the signatures of natural selection in the regulatory and coding sequences of MDH1 in lake whitefish and test for parallelism of these signatures with other coregonine species. Sequencing of the two regions in 118 fish from four sympatric pairs of whitefish and two cisco species revealed a total of 35 single nucleotide polymorphisms (SNPs), with more genetic diversity in European compared to North American coregonine species. While the coding region was found to be under purifying selection, an SNP in the proximal promoter exhibited significant allele frequency divergence in a parallel manner among independent sympatric pairs of North American lake whitefish and European whitefish (C. lavaretus). According to transcription factor binding simulation for 22 regulatory haplotypes of MDH1, putative binding profiles were fairly conserved among species, except for the region around this SNP. Moreover, we found evidence for the role of this SNP in the regulation of MDH1 expression level. Overall, these results provide further evidence for the role of natural selection in gene regulation evolution among whitefish species pairs and suggest its possible link with patterns of phenotypic diversity observed in coregonine species. PMID:22408741

  5. Regulatory versus coding signatures of natural selection in a candidate gene involved in the adaptive divergence of whitefish species pairs (Coregonus spp.).

    PubMed

    Jeukens, Julie; Bernatchez, Louis

    2012-01-01

    While gene expression divergence is known to be involved in adaptive phenotypic divergence and speciation, the relative importance of regulatory and structural evolution of genes is poorly understood. A recent next-generation sequencing experiment allowed identifying candidate genes potentially involved in the ongoing speciation of sympatric dwarf and normal lake whitefish (Coregonus clupeaformis), such as cytosolic malate dehydrogenase (MDH1), which showed both significant expression and sequence divergence. The main goal of this study was to investigate into more details the signatures of natural selection in the regulatory and coding sequences of MDH1 in lake whitefish and test for parallelism of these signatures with other coregonine species. Sequencing of the two regions in 118 fish from four sympatric pairs of whitefish and two cisco species revealed a total of 35 single nucleotide polymorphisms (SNPs), with more genetic diversity in European compared to North American coregonine species. While the coding region was found to be under purifying selection, an SNP in the proximal promoter exhibited significant allele frequency divergence in a parallel manner among independent sympatric pairs of North American lake whitefish and European whitefish (C. lavaretus). According to transcription factor binding simulation for 22 regulatory haplotypes of MDH1, putative binding profiles were fairly conserved among species, except for the region around this SNP. Moreover, we found evidence for the role of this SNP in the regulation of MDH1 expression level. Overall, these results provide further evidence for the role of natural selection in gene regulation evolution among whitefish species pairs and suggest its possible link with patterns of phenotypic diversity observed in coregonine species.

  6. Specific and Modular Binding Code for Cytosine Recognition in Pumilio/FBF (PUF) RNA-binding Domains

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Dong, Shuyun; Wang, Yang; Cassidy-Amstutz, Caleb

    2011-10-28

    Pumilio/fem-3 mRNA-binding factor (PUF) proteins possess a recognition code for bases A, U, and G, allowing designed RNA sequence specificity of their modular Pumilio (PUM) repeats. However, recognition side chains in a PUM repeat for cytosine are unknown. Here we report identification of a cytosine-recognition code by screening random amino acid combinations at conserved RNA recognition positions using a yeast three-hybrid system. This C-recognition code is specific and modular as specificity can be transferred to different positions in the RNA recognition sequence. A crystal structure of a modified PUF domain reveals specific contacts between an arginine side chain and themore » cytosine base. We applied the C-recognition code to design PUF domains that recognize targets with multiple cytosines and to generate engineered splicing factors that modulate alternative splicing. Finally, we identified a divergent yeast PUF protein, Nop9p, that may recognize natural target RNAs with cytosine. This work deepens our understanding of natural PUF protein target recognition and expands the ability to engineer PUF domains to recognize any RNA sequence.« less

  7. Novel numerical and graphical representation of DNA sequences and proteins.

    PubMed

    Randić, M; Novic, M; Vikić-Topić, D; Plavsić, D

    2006-12-01

    We have introduced novel numerical and graphical representations of DNA, which offer a simple and unique characterization of DNA sequences. The numerical representation of a DNA sequence is given as a sequence of real numbers derived from a unique graphical representation of the standard genetic code. There is no loss of information on the primary structure of a DNA sequence associated with this numerical representation. The novel representations are illustrated with the coding sequences of the first exon of beta-globin gene of half a dozen species in addition to human. The method can be extended to proteins as is exemplified by humanin, a 24-aa peptide that has recently been identified as a specific inhibitor of neuronal cell death induced by familial Alzheimer's disease mutant genes.

  8. Ovine mitochondrial DNA sequence variation and its association with production and reproduction traits within an Afec-Assaf flock.

    PubMed

    Reicher, S; Seroussi, E; Weller, J I; Rosov, A; Gootwine, E

    2012-07-01

    Polymorphisms in mitochondrial DNA (mtDNA) protein- and tRNA-coding genes were shown to be associated with various diseases in humans as well as with production and reproduction traits in livestock. Alignment of full length mitochondria sequences from the 5 known ovine haplogroups: HA (n = 3), HB (n = 5), HC (n = 3), HD (n = 2), and HE (n = 2; GenBank accession nos. HE577847-50 and 11 published complete ovine mitochondria sequences) revealed sequence variation in 10 out of the 13 protein coding mtDNA sequences. Twenty-six of the 245 variable sites found in the protein coding sequences represent non-synonymous mutations. Sequence variation was observed also in 8 out of the 22 tRNA mtDNA sequences. On the basis of the mtDNA control region and cytochrome b partial sequences along with information on maternal lineages within an Afec-Assaf flock, 1,126 Afec-Assaf ewes were assigned to mitochondrial haplogroups HA, HB, and HC, with frequencies of 0.43, 0.43, and 0.14, respectively. Analysis of birth weight and growth rate records of lamb (n = 1286) and productivity from 4,993 lambing records revealed no association between mitochondrial haplogroup affiliation and female longevity, lambs perinatal survival rate, birth weight, and daily growth rate of lambs up to 150 d that averaged 1,664 d, 88.3%, 4.5 kg, and 320 g/d, respectively. However, significant (P < 0.0001) differences among the haplogroups were found for prolificacy of ewes, with prolificacies (mean ± SE) of 2.14 ± 0.04, 2.25 ± 0.04, and 2.30 ± 0.06 lamb born/ewe lambing for the HA, HB, and the HC haplogroups, respectively. Our results highlight the ovine mitogenome genetic variation in protein- and tRNA coding genes and suggest that sequence variation in ovine mtDNA is associated with variation in ewe prolificacy.

  9. Exogean: a framework for annotating protein-coding genes in eukaryotic genomic DNA

    PubMed Central

    Djebali, Sarah; Delaplace, Franck; Crollius, Hugues Roest

    2006-01-01

    Background Accurate and automatic gene identification in eukaryotic genomic DNA is more than ever of crucial importance to efficiently exploit the large volume of assembled genome sequences available to the community. Automatic methods have always been considered less reliable than human expertise. This is illustrated in the EGASP project, where reference annotations against which all automatic methods are measured are generated by human annotators and experimentally verified. We hypothesized that replicating the accuracy of human annotators in an automatic method could be achieved by formalizing the rules and decisions that they use, in a mathematical formalism. Results We have developed Exogean, a flexible framework based on directed acyclic colored multigraphs (DACMs) that can represent biological objects (for example, mRNA, ESTs, protein alignments, exons) and relationships between them. Graphs are analyzed to process the information according to rules that replicate those used by human annotators. Simple individual starting objects given as input to Exogean are thus combined and synthesized into complex objects such as protein coding transcripts. Conclusion We show here, in the context of the EGASP project, that Exogean is currently the method that best reproduces protein coding gene annotations from human experts, in terms of identifying at least one exact coding sequence per gene. We discuss current limitations of the method and several avenues for improvement. PMID:16925841

  10. Sense-antisense (complementary) peptide interactions and the proteomic code; potential opportunities in biology and pharmaceutical science.

    PubMed

    Miller, Andrew D

    2015-02-01

    A sense peptide can be defined as a peptide whose sequence is coded by the nucleotide sequence (read 5' → 3') of the sense (positive) strand of DNA. Conversely, an antisense (complementary) peptide is coded by the corresponding nucleotide sequence (read 5' → 3') of the antisense (negative) strand of DNA. Research has been accumulating steadily to suggest that sense peptides are capable of specific interactions with their corresponding antisense peptides. Unfortunately, although more and more examples of specific sense-antisense peptide interactions are emerging, the very idea of such interactions does not conform to standard biology dogma and so there remains a sizeable challenge to lift this concept from being perceived as a peripheral phenomenon if not worse, into becoming part of the scientific mainstream. Specific interactions have now been exploited for the inhibition of number of widely different protein-protein and protein-receptor interactions in vitro and in vivo. Further, antisense peptides have also been used to induce the production of antibodies targeted to specific receptors or else the production of anti-idiotypic antibodies targeted against auto-antibodies. Such illustrations of utility would seem to suggest that observed sense-antisense peptide interactions are not just the consequence of a sequence of coincidental 'lucky-hits'. Indeed, at the very least, one might conclude that sense-antisense peptide interactions represent a potentially new and different source of leads for drug discovery. But could there be more to come from studies in this area? Studies on the potential mechanism of sense-antisense peptide interactions suggest that interactions may be driven by amino acid residue interactions specified from the genetic code. If so, such specified amino acid residue interactions could form the basis for an even wider amino acid residue interaction code (proteomic code) that links gene sequences to actual protein structure and function, even entire genomes to entire proteomes. The possibility that such a proteomic code should exist is discussed. So too the potential implications for biology and pharmaceutical science are also discussed were such a code to exist.

  11. DNA-binding proteins from marine bacteria expand the known sequence diversity of TALE-like repeats

    PubMed Central

    de Lange, Orlando; Wolf, Christina; Thiel, Philipp; Krüger, Jens; Kleusch, Christian; Kohlbacher, Oliver; Lahaye, Thomas

    2015-01-01

    Transcription Activator-Like Effectors (TALEs) of Xanthomonas bacteria are programmable DNA binding proteins with unprecedented target specificity. Comparative studies into TALE repeat structure and function are hindered by the limited sequence variation among TALE repeats. More sequence-diverse TALE-like proteins are known from Ralstonia solanacearum (RipTALs) and Burkholderia rhizoxinica (Bats), but RipTAL and Bat repeats are conserved with those of TALEs around the DNA-binding residue. We study two novel marine-organism TALE-like proteins (MOrTL1 and MOrTL2), the first to date of non-terrestrial origin. We have assessed their DNA-binding properties and modelled repeat structures. We found that repeats from these proteins mediate sequence specific DNA binding conforming to the TALE code, despite low sequence similarity to TALE repeats, and with novel residues around the BSR. However, MOrTL1 repeats show greater sequence discriminating power than MOrTL2 repeats. Sequence alignments show that there are only three residues conserved between repeats of all TALE-like proteins including the two new additions. This conserved motif could prove useful as an identifier for future TALE-likes. Additionally, comparing MOrTL repeats with those of other TALE-likes suggests a common evolutionary origin for the TALEs, RipTALs and Bats. PMID:26481363

  12. Complete mitochondrial genome from South American catfish Pseudoplatystoma reticulatum (Eigenmann & Eigenmann) and its impact in Siluriformes phylogenetic tree.

    PubMed

    Villela, Luciana Cristine Vasques; Alves, Anderson Luis; Varela, Eduardo Sousa; Yamagishi, Michel Eduardo Beleza; Giachetto, Poliana Fernanda; da Silva, Naiara Milagres Augusto; Ponzetto, Josi Margarete; Paiva, Samuel Rezende; Caetano, Alexandre Rodrigues

    2017-02-01

    The cachara (Pseudoplatystoma reticulatum) is a Neotropical freshwater catfish from family Pimelodidae (Siluriformes) native to Brazil. The species is of relative economic importance for local aquaculture production and basic biological information is under development to help boost efforts to domesticate and raise the species in commercial systems. The complete cachara mitochondrial genome was obtained by assembling Illumina RNA-seq data from pooled samples. The full mitogenome was found to be 16,576 bp in length, showing the same basic structure, order, and genetic organization observed in other Pimelodidae, with 13 protein-coding genes, 2 rNA genes, 22 trNAs, and a control region. Observed base composition was 24.63% T, 28.47% C, 31.45% A, and 15.44% G. With the exception of NAD6 and eight tRNAs, all of the observed mitochondrial genes were found to be coded on the H strand. A total of 107 SNPs were identified in P. reticulatum mtDNA, 67 of which were located in coding regions. Of these SNPs, 10 result in amino acid changes. Analysis of the obtained sequence with 94 publicly available full Siluriformes mitogenomes resulted in a phylogenetic tree that generally agreed with available phylogenetic proposals for the order. The first report of the complete Pseudoplatystoma reticulatum mitochondrial genome sequence revealed general gene organization, structure, content, and order similar to most vertebrates. Specific sequence and content features were observed and may have functional attributes which are now available for further investigation.

  13. Origins of genes: "big bang" or continuous creation?

    PubMed Central

    Keese, P K; Gibbs, A

    1992-01-01

    Many protein families are common to all cellular organisms, indicating that many genes have ancient origins. Genetic variation is mostly attributed to processes such as mutation, duplication, and rearrangement of ancient modules. Thus it is widely assumed that much of present-day genetic diversity can be traced by common ancestry to a molecular "big bang." A rarely considered alternative is that proteins may arise continuously de novo. One mechanism of generating different coding sequences is by "overprinting," in which an existing nucleotide sequence is translated de novo in a different reading frame or from noncoding open reading frames. The clearest evidence for overprinting is provided when the original gene function is retained, as in overlapping genes. Analysis of their phylogenies indicates which are the original genes and which are their informationally novel partners. We report here the phylogenetic relationships of overlapping coding sequences from steroid-related receptor genes and from tymovirus, luteovirus, and lentivirus genomes. For each pair of overlapping coding sequences, one is confined to a single lineage, whereas the other is more widespread. This suggests that the phylogenetically restricted coding sequence arose only in the progenitor of that lineage by translating an out-of-frame sequence to yield the new polypeptide. The production of novel exons by alternative splicing in thyroid receptor and lentivirus genes suggests that introns can be a valuable evolutionary source for overprinting. New genes and their products may drive major evolutionary changes. PMID:1329098

  14. Sequence of interleukin-2 isolated from human placental poly A+ RNA: possible role in maintenance of fetal allograft.

    PubMed

    Chernicky, C L; Tan, H; Burfeind, P; Ilan, J; Ilan, J

    1996-02-01

    There are several cell types within the placenta that produce cytokines which can contribute to the regulatory mechanisms that ensure normal pregnancy. The immunological milieu at the maternofetal interface is considered to be crucial for survival of the fetus. Interleukin-2 (IL-2) is expressed by the syncytiotrophoblast, the cell layer between the mother and the fetus. IL-2 appears to be a key factor in maintenance of pregnancy. Therefore, it was important to determine the sequence of human placental interleukin-2. Direct sequencing of human placental IL-2 cDNA was determined for the coding region. Subclone sequencing was carried out for the 5'- and 3'-untranslated regions (5'-UTR and 3'-UTR). The 5'-UTR for human placental IL-2 cDNA is 294 bp, which is 247 nucleotides longer than that reported for cDNA IL-2 derived from T cells. The sequence of the coding region is identical to that reported for T cell IL-2, while sequence analysis of the polymerase chain reaction (PCR) product showed that the cDNA from the 3' end was the same as that reported for cDNA from T cells. Human placental IL-2 cDNA is 1,028 base pairs (excluding the poly A tail), which is 247 bp longer at the 5' end than that reported for IL-2 T cell cDNA. Therefore, the extended 5'-UTR of the placental IL-2 cDNA may be a consequence of alternative promoter utilization in the placenta.

  15. Unraveling patterns of site-to-site synonymous rates variation and associated gene properties of protein domains and families.

    PubMed

    Dimitrieva, Slavica; Anisimova, Maria

    2014-01-01

    In protein-coding genes, synonymous mutations are often thought not to affect fitness and therefore are not subject to natural selection. Yet increasingly, cases of non-neutral evolution at certain synonymous sites were reported over the last decade. To evaluate the extent and the nature of site-specific selection on synonymous codons, we computed the site-to-site synonymous rate variation (SRV) and identified gene properties that make SRV more likely in a large database of protein-coding gene families and protein domains. To our knowledge, this is the first study that explores the determinants and patterns of the SRV in real data. We show that the SRV is widespread in the evolution of protein-coding sequences, putting in doubt the validity of the synonymous rate as a standard neutral proxy. While protein domains rarely undergo adaptive evolution, the SRV appears to play important role in optimizing the domain function at the level of DNA. In contrast, protein families are more likely to evolve by positive selection, but are less likely to exhibit SRV. Stronger SRV was detected in genes with stronger codon bias and tRNA reusage, those coding for proteins with larger number of interactions or forming larger number of structures, located in intracellular components and those involved in typically conserved complex processes and functions. Genes with extreme SRV show higher expression levels in nearly all tissues. This indicates that codon bias in a gene, which often correlates with gene expression, may often be a site-specific phenomenon regulating the speed of translation along the sequence, consistent with the co-translational folding hypothesis. Strikingly, genes with SRV were strongly overrepresented for metabolic pathways and those associated with several genetic diseases, particularly cancers and diabetes.

  16. Capturing the Biofuel Wellhead and Powerhouse: The Chloroplast and Mitochondrial Genomes of the Leguminous Feedstock Tree Pongamia pinnata

    PubMed Central

    Kazakoff, Stephen H.; Imelfort, Michael; Edwards, David; Koehorst, Jasper; Biswas, Bandana; Batley, Jacqueline; Scott, Paul T.; Gresshoff, Peter M.

    2012-01-01

    Pongamia pinnata (syn. Millettia pinnata) is a novel, fast-growing arboreal legume that bears prolific quantities of oil-rich seeds suitable for the production of biodiesel and aviation biofuel. Here, we have used Illumina® ‘Second Generation DNA Sequencing (2GS)’ and a new short-read de novo assembler, SaSSY, to assemble and annotate the Pongamia chloroplast (152,968 bp; cpDNA) and mitochondrial (425,718 bp; mtDNA) genomes. We also show that SaSSY can be used to accurately assemble 2GS data, by re-assembling the Lotus japonicus cpDNA and in the process assemble its mtDNA (380,861 bp). The Pongamia cpDNA contains 77 unique protein-coding genes and is almost 60% gene-dense. It contains a 50 kb inversion common to other legumes, as well as a novel 6.5 kb inversion that is responsible for the non-disruptive, re-orientation of five protein-coding genes. Additionally, two copies of an inverted repeat firmly place the species outside the subclade of the Fabaceae lacking the inverted repeat. The Pongamia and L. japonicus mtDNA contain just 33 and 31 unique protein-coding genes, respectively, and like other angiosperm mtDNA, have expanded intergenic and multiple repeat regions. Through comparative analysis with Vigna radiata we measured the average synonymous and non-synonymous divergence of all three legume mitochondrial (1.59% and 2.40%, respectively) and chloroplast (8.37% and 8.99%, respectively) protein-coding genes. Finally, we explored the relatedness of Pongamia within the Fabaceae and showed the utility of the organellar genome sequences by mapping transcriptomic data to identify up- and down-regulated stress-responsive gene candidates and confirm in silico predicted RNA editing sites. PMID:23272141

  17. Capturing the biofuel wellhead and powerhouse: the chloroplast and mitochondrial genomes of the leguminous feedstock tree Pongamia pinnata.

    PubMed

    Kazakoff, Stephen H; Imelfort, Michael; Edwards, David; Koehorst, Jasper; Biswas, Bandana; Batley, Jacqueline; Scott, Paul T; Gresshoff, Peter M

    2012-01-01

    Pongamia pinnata (syn. Millettia pinnata) is a novel, fast-growing arboreal legume that bears prolific quantities of oil-rich seeds suitable for the production of biodiesel and aviation biofuel. Here, we have used Illumina® 'Second Generation DNA Sequencing (2GS)' and a new short-read de novo assembler, SaSSY, to assemble and annotate the Pongamia chloroplast (152,968 bp; cpDNA) and mitochondrial (425,718 bp; mtDNA) genomes. We also show that SaSSY can be used to accurately assemble 2GS data, by re-assembling the Lotus japonicus cpDNA and in the process assemble its mtDNA (380,861 bp). The Pongamia cpDNA contains 77 unique protein-coding genes and is almost 60% gene-dense. It contains a 50 kb inversion common to other legumes, as well as a novel 6.5 kb inversion that is responsible for the non-disruptive, re-orientation of five protein-coding genes. Additionally, two copies of an inverted repeat firmly place the species outside the subclade of the Fabaceae lacking the inverted repeat. The Pongamia and L. japonicus mtDNA contain just 33 and 31 unique protein-coding genes, respectively, and like other angiosperm mtDNA, have expanded intergenic and multiple repeat regions. Through comparative analysis with Vigna radiata we measured the average synonymous and non-synonymous divergence of all three legume mitochondrial (1.59% and 2.40%, respectively) and chloroplast (8.37% and 8.99%, respectively) protein-coding genes. Finally, we explored the relatedness of Pongamia within the Fabaceae and showed the utility of the organellar genome sequences by mapping transcriptomic data to identify up- and down-regulated stress-responsive gene candidates and confirm in silico predicted RNA editing sites.

  18. Adaptive decoding of convolutional codes

    NASA Astrophysics Data System (ADS)

    Hueske, K.; Geldmacher, J.; Götze, J.

    2007-06-01

    Convolutional codes, which are frequently used as error correction codes in digital transmission systems, are generally decoded using the Viterbi Decoder. On the one hand the Viterbi Decoder is an optimum maximum likelihood decoder, i.e. the most probable transmitted code sequence is obtained. On the other hand the mathematical complexity of the algorithm only depends on the used code, not on the number of transmission errors. To reduce the complexity of the decoding process for good transmission conditions, an alternative syndrome based decoder is presented. The reduction of complexity is realized by two different approaches, the syndrome zero sequence deactivation and the path metric equalization. The two approaches enable an easy adaptation of the decoding complexity for different transmission conditions, which results in a trade-off between decoding complexity and error correction performance.

  19. Selective forces and mutational biases drive stop codon usage in the human genome: a comparison with sense codon usage.

    PubMed

    Trotta, Edoardo

    2016-05-17

    The three stop codons UAA, UAG, and UGA signal the termination of mRNA translation. As a result of a mechanism that is not adequately understood, they are normally used with unequal frequencies. In this work, we showed that selective forces and mutational biases drive stop codon usage in the human genome. We found that, in respect to sense codons, stop codon usage was affected by stronger selective forces but was less influenced by neutral mutational biases. UGA is the most frequent termination codon in human genome. However, UAA was the preferred stop codon in genes with high breadth of expression, high level of expression, AT-rich coding sequences, housekeeping functions, and in gene ontology categories with the largest deviation from expected stop codon usage. Selective forces associated with the breadth and the level of expression favoured AT-rich sequences in the mRNA region including the stop site and its proximal 3'-UTR, but acted with scarce effects on sense codons, generating two regions, upstream and downstream of the stop codon, with strongly different base composition. By favouring low levels of GC-content, selection promoted labile local secondary structures at the stop site and its proximal 3'-UTR. The compositional and structural context favoured by selection was surprisingly emphasized in the class of ribosomal proteins and was consistent with sequence elements that increase the efficiency of translational termination. Stop codons were also heterogeneously distributed among chromosomes by a mechanism that was strongly correlated with the GC-content of coding sequences. In human genome, the nucleotide composition and the thermodynamic stability of stop codon site and its proximal 3'-UTR are correlated with the GC-content of coding sequences and with the breadth and the level of gene expression. In highly expressed genes stop codon usage is compositionally and structurally consistent with highly efficient translation termination signals.

  20. Bioinformatic analysis suggests that the Orbivirus VP6 cistron encodes an overlapping gene

    PubMed Central

    Firth, Andrew E

    2008-01-01

    Background The genus Orbivirus includes several species that infect livestock – including Bluetongue virus (BTV) and African horse sickness virus (AHSV). These viruses have linear dsRNA genomes divided into ten segments, all of which have previously been assumed to be monocistronic. Results Bioinformatic evidence is presented for a short overlapping coding sequence (CDS) in the Orbivirus genome segment 9, overlapping the VP6 cistron in the +1 reading frame. In BTV, a 77–79 codon AUG-initiated open reading frame (hereafter ORFX) is present in all 48 segment 9 sequences analysed. The pattern of base variations across the 48-sequence alignment indicates that ORFX is subject to functional constraints at the amino acid level (even when the constraints due to coding in the overlapping VP6 reading frame are taken into account; MLOGD software). In fact the translated ORFX shows greater amino acid conservation than the overlapping region of VP6. The ORFX AUG codon has a strong Kozak context in all 48 sequences. Each has only one or two upstream AUG codons, always in the VP6 reading frame, and (with a single exception) always with weak or medium Kozak context. Thus, in BTV, ORFX may be translated via leaky scanning. A long (83–169 codon) ORF is present in a corresponding location and reading frame in all other Orbivirus species analysed except Saint Croix River virus (SCRV; the most divergent). Again, the pattern of base variations across sequence alignments indicates multiple coding in the VP6 and ORFX reading frames. Conclusion At ~9.5 kDa, the putative ORFX product in BTV is too small to appear on most published protein gels. Nonetheless, a review of past literature reveals a number of possible detections. We hope that presentation of this bioinformatic analysis will stimulate an attempt to experimentally verify the expression and functional role of ORFX, and hence lead to a greater understanding of the molecular biology of these important pathogens. PMID:18489030

Top