Hunt, C; Morimoto, R I
1985-01-01
We have determined the nucleotide sequence of the human hsp70 gene and 5' flanking region. The hsp70 gene is transcribed as an uninterrupted primary transcript of 2440 nucleotides composed of a 5' noncoding leader sequence of 212 nucleotides, a 3' noncoding region of 242 nucleotides, and a continuous open reading frame of 1986 nucleotides that encodes a protein with predicted molecular mass of 69,800 daltons. Upstream of the 5' terminus are the canonical TATAAA box, the sequence ATTGG that corresponds in the inverted orientation to the CCAAT motif, and the dyad sequence CTGGAAT/ATTCCCG that shares homology in 12 of 14 positions with the consensus transcription regulatory sequence common to Drosophila heat shock genes. Comparison of the predicted amino acid sequences of human hsp70 with the published sequences of Drosophila hsp70 and Escherichia coli dnaK reveals that human hsp70 is 73% identical to Drosophila hsp70 and 47% identical to E. coli dnaK. Surprisingly, the nucleotide sequences of the human and Drosophila genes are 72% identical and human and E. coli genes are 50% identical, which is more highly conserved than necessary given the degeneracy of the genetic code. The lack of accumulated silent nucleotide substitutions leads us to propose that there may be additional information in the nucleotide sequence of the hsp70 gene or the corresponding mRNA that precludes the maximum divergence allowed in the silent codon positions. PMID:3931075
The complete nucleotide sequence of the glnALG operon of Escherichia coli K12.
Miranda-Ríos, J; Sánchez-Pescador, R; Urdea, M; Covarrubias, A A
1987-01-01
The nucleotide sequence of the E. coli glnALG operon has been determined. The glnL (ntrB) and glnG (ntrC) genes present a high homology, at the nucleotide and aminoacid levels, with the corresponding genes of Klebsiella pneumoniae. The predicted aminoacid sequence for glutamine synthetase allowed us to locate some of the enzyme domains. The structure of this operon is discussed. PMID:2882477
Murphy, R C; Gasparich, G E; Bryant, D A; Porter, R D
1990-01-01
The nucleotide sequence and transcript initiation site of the Synechococcus sp. strain PCC 7002 recA gene have been determined. The deduced amino acid sequence of the RecA protein of this cyanobacterium is 56% identical and 73% similar to the Escherichia coli RecA protein. Northern (RNA) blot analysis indicates that the Synechococcus strain PCC 7002 recA gene is transcribed as a monocistronic transcript 1,200 bases in length. The 5' endpoint of the recA mRNA was mapped by primer extension by using synthetic oligonucleotides of 17 and 27 nucleotides as primers. The nucleotide sequence 5' to the mapped endpoint contained sequence motifs bearing a striking resemblance to the heat shock (sigma 32-specific) promoters of E. coli but did not contain sequences similar to the E. coli SOS operator recognized by the LexA repressor. An insertion mutation introduced into the recA locus of Synechococcus strain PCC 7002 via homologous recombination resulted in the formation of diploids carrying both mutant and wild-type recA alleles. A variety of growth regimens and transformation procedures failed to produce a recA Synechococcus strain PCC 7002 mutant. However, introduction into these diploid cells of the E. coli recA gene in trans on a biphasic shuttle vector resulted in segregation of the cyanobacterial recA alleles, indicating that the E. coli recA gene was able to provide a function required for growth of recA Synechococcus strain PCC 7002 cells. This interpretation is supported by the observation that the E. coli recA gene is maintained in these cells when antibiotic selection for the shuttle vector is removed. Images FIG. 3 FIG. 4 FIG. 6 PMID:2105307
Lineage and genogroup-defining single nucleotide polymorphisms of Escherichia coli 0157:H7
USDA-ARS?s Scientific Manuscript database
Escherichia coli O157:H7 is a zoonotic human pathogen for which cattle are an important reservoir host. Using both previously published and new sequencing data, a 48-locus single nucleotide polymorphism (SNP) based typing panel was developed that redundantly identified eleven genogroups that span ...
Le Chevanton, L; Leblon, G
1989-04-15
We cloned the ura5 gene coding for the orotate phosphoribosyl transferase from the ascomycete Sordaria macrospora by heterologous probing of a Sordaria genomic DNA library with the corresponding Podospora anserina sequence. The Sordaria gene was expressed in an Escherichia coli pyrE mutant strain defective for the same enzyme, and expression was shown to be promoted by plasmid sequences. The nucleotide sequence of the 1246-bp DNA fragment encompassing the region of homology with the Podospora gene has been determined. This sequence contains an open reading frame of 699 nucleotides. The deduced amino acid sequence shows 72% similarity with the corresponding Podospora protein.
Gritz, L; Davies, J
1983-11-01
The plasmid-borne gene hph coding for hygromycin B phosphotransferase (HPH) in Escherichia coli has been identified and its nucleotide sequence determined. The hph gene is 1026 nucleotides long, coding for a protein with a predicted Mr of 39 000. The hph gene was placed in a shuttle plasmid vector, downstream from the promoter region of the cyc 1 gene of Saccharomyces cerevisiae, and an hph construction containing a single AUG in the 5' noncoding region allowed direct selection following transformation in yeast and in E. coli. Thus the hph gene can be used in cloning vectors for both pro- and eukaryotes.
Unprecedented high-resolution view of bacterial operon architecture revealed by RNA sequencing.
Conway, Tyrrell; Creecy, James P; Maddox, Scott M; Grissom, Joe E; Conkle, Trevor L; Shadid, Tyler M; Teramoto, Jun; San Miguel, Phillip; Shimada, Tomohiro; Ishihama, Akira; Mori, Hirotada; Wanner, Barry L
2014-07-08
We analyzed the transcriptome of Escherichia coli K-12 by strand-specific RNA sequencing at single-nucleotide resolution during steady-state (logarithmic-phase) growth and upon entry into stationary phase in glucose minimal medium. To generate high-resolution transcriptome maps, we developed an organizational schema which showed that in practice only three features are required to define operon architecture: the promoter, terminator, and deep RNA sequence read coverage. We precisely annotated 2,122 promoters and 1,774 terminators, defining 1,510 operons with an average of 1.98 genes per operon. Our analyses revealed an unprecedented view of E. coli operon architecture. A large proportion (36%) of operons are complex with internal promoters or terminators that generate multiple transcription units. For 43% of operons, we observed differential expression of polycistronic genes, despite being in the same operons, indicating that E. coli operon architecture allows fine-tuning of gene expression. We found that 276 of 370 convergent operons terminate inefficiently, generating complementary 3' transcript ends which overlap on average by 286 nucleotides, and 136 of 388 divergent operons have promoters arranged such that their 5' ends overlap on average by 168 nucleotides. We found 89 antisense transcripts of 397-nucleotide average length, 7 unannotated transcripts within intergenic regions, and 18 sense transcripts that completely overlap operons on the opposite strand. Of 519 overlapping transcripts, 75% correspond to sequences that are highly conserved in E. coli (>50 genomes). Our data extend recent studies showing unexpected transcriptome complexity in several bacteria and suggest that antisense RNA regulation is widespread. Importance: We precisely mapped the 5' and 3' ends of RNA transcripts across the E. coli K-12 genome by using a single-nucleotide analytical approach. Our resulting high-resolution transcriptome maps show that ca. one-third of E. coli operons are complex, with internal promoters and terminators generating multiple transcription units and allowing differential gene expression within these operons. We discovered extensive antisense transcription that results from more than 500 operons, which fully overlap or extensively overlap adjacent divergent or convergent operons. The genomic regions corresponding to these antisense transcripts are highly conserved in E. coli (including Shigella species), although it remains to be proven whether or not they are functional. Our observations of features unearthed by single-nucleotide transcriptome mapping suggest that deeper layers of transcriptional regulation in bacteria are likely to be revealed in the future. Copyright © 2014 Conway et al.
Rule, G S; Pratt, E A; Chin, C C; Wold, F; Ho, C
1985-01-01
Recombinant DNA plasmids containing the gene for the membrane-bound D-lactate dehydrogenase (D-LDH) of Escherichia coli linked to the promoter PL from lambda were constructed. After induction, the levels of D-LDH were elevated 300-fold over that of the wild type and amounted to 35% of the total cellular protein. The nucleotide sequence of the D-LDH gene was determined and shown to agree with the amino acid composition and the amino-terminal sequence of the purified enzyme. Removal of the amino-terminal formyl-Met from D-LDH was not inhibited in cells which contained these high levels of D-LDH. Images PMID:3882663
Nomiyama, H; Kuhara, S; Kukita, T; Otsuka, T; Sakaki, Y
1981-01-01
The 26S ribosomal RNA gene of Physarum polycephalum is interrupted by two introns, and we have previously determined the sequence of one of them (intron 1) (Nomiyama et al. Proc.Natl.Acad.Sci.USA 78, 1376-1380, 1981). In this study we sequenced the second intron (intron 2) of about 0.5 kb length and its flanking regions, and found that one nucleotide at each junction is identical in intron 1 and intron 2, though the junction regions share no other sequence homology. Comparison of the flanking exon sequences to E. coli 23S rRNA sequences shows that conserved sequences are interspersed with tracts having little homology. In particular, the region encompassing the intron 2 interruption site is highly conserved. The E. coli ribosomal protein L1 binding region is also conserved. Images PMID:6171776
De Laurentiis, Evelina Ines; Mercier, Evan; Wieden, Hans-Joachim
2016-10-28
Little is known about the conservation of critical kinetic parameters and the mechanistic strategies of elongation factor (EF) Ts-catalyzed nucleotide exchange in EF-Tu in bacteria and particularly in clinically relevant pathogens. EF-Tu from the clinically relevant pathogen Pseudomonas aeruginosa shares over 84% sequence identity with the corresponding elongation factor from Escherichia coli Interestingly, the functionally closely linked EF-Ts only shares 55% sequence identity. To identify any differences in the nucleotide binding properties, as well as in the EF-Ts-mediated nucleotide exchange reaction, we performed a comparative rapid kinetics and mutagenesis analysis of the nucleotide exchange mechanism for both the E. coli and P. aeruginosa systems, identifying helix 13 of EF-Ts as a previously unnoticed regulatory element in the nucleotide exchange mechanism with species-specific elements. Our findings support the base side-first entry of the nucleotide into the binding pocket of the EF-Tu·EF-Ts binary complex, followed by displacement of helix 13 and rapid binding of the phosphate side of the nucleotide, ultimately leading to the release of EF-Ts. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.
Characterization of a dam Mutant of Serratia marcescens and Nucleotide Sequence of the dam Region
Ostendorf, Tammo; Cherepanov, Peter; de Vries, Johann; Wackernagel, Wilfried
1999-01-01
The DNA of Serratia marcescens has N6-adenine methylation in GATC sequences. Among 2-aminopurine-sensitive mutants isolated from S. marcescens Sr41, one was identified which lacked GATC methylation. The mutant showed up to 30-fold increased spontaneous mutability and enhanced mutability after treatment with 2-aminopurine, ethyl methanesulfonate, or UV light. The gene (dam) coding for the adenine methyltransferase (Dam enzyme) of S. marcescens was identified on a gene bank plasmid which alleviated the 2-aminopurine sensitivity and the higher mutability of a dam-13::Tn9 mutant of Escherichia coli. Nucleotide sequencing revealed that the deduced amino acid sequence of Dam (270 amino acids; molecular mass, 31.3 kDa) has 72% identity to the Dam enzyme of E. coli. The dam gene is located between flanking genes which are similar to those found to the sides of the E. coli dam gene. The results of complementation studies indicated that like Dam of E. coli and unlike Dam of Vibrio cholerae, the Dam enzyme of S. marcescens plays an important role in mutation avoidance by allowing the mismatch repair enzymes to discriminate between the parental and newly synthesized strands during correction of replication errors. PMID:10383952
Focareta, T; Manning, P A
1987-01-01
The gene encoding the extracellular DNase of Vibrio cholerae was cloned into Escherichia coli K-12. A maximal coding region of 1.2 kb and a minimal region of 0.6 kb were determined by transposon mutagenesis and deletion analysis. The nucleotide sequence of this region contained a single open reading frame of 690 bp corresponding to a protein of Mr 26,389 with a typical N-terminal signal sequence of 18 aa which, when removed, would give a mature protein of Mr 24,163. This is in good agreement with the size of 24 kDa, calculated directly by Coomassie blue staining following sodium dodecyl sulphate-polyacrylamide gel electrophoresis and indirectly via a DNA-hydrolysis assay. The protein is located in the periplasmic space of E. coli K-12 unlike in V. cholerae where it is excreted into the extracellular medium. The introduction of the DNase gene into a periplasmic (tolA) leaky mutant of E. coli K-12 facilitates the release of the protein, further confirming the periplasmic location.
Cozens, A L; Walker, J E
1986-01-01
The nucleotide sequence has been determined of a segment of 4680 bases of the pea chloroplast genome. It adjoins a sequence described elsewhere that encodes subunits of the F0 membrane domain of the ATP-synthase complex. The sequence contains a potential gene encoding a protein which is strongly related to the S2 polypeptide of Escherichia coli ribosomes. It also encodes an incomplete protein which contains segments that are homologous to the beta'-subunit of E. coli RNA polymerase and to yeast RNA polymerases II and III. PMID:3530249
USDA-ARS?s Scientific Manuscript database
The PCR-based Escherichia coli O157 (O157) strain typing system, Polymorphic Amplified Typing Sequences (PATS), targets insertions-deletions (Indels) and single nucleotide polymorphisms (SNPs) at the XbaI and AvrII(BlnI) restriction enzyme sites, respectively, besides amplifying four known virulenc...
Banowary, Banya; Dang, Van Tuan; Sarker, Subir; Connolly, Joanne H.; Chenu, Jeremy; Groves, Peter; Ayton, Michelle; Raidal, Shane; Devi, Aruna; Vanniasinkam, Thiru; Ghorashi, Seyed A.
2015-01-01
Campylobacter spp. are important causes of bacterial gastroenteritis in humans in developed countries. Among Campylobacter spp. Campylobacter jejuni (C. jejuni) and C. coli are the most common causes of human infection. In this study, a multiplex PCR (mPCR) and high resolution melt (HRM) curve analysis were optimized for simultaneous detection and differentiation of C. jejuni and C. coli isolates. A segment of the hippuricase gene (hipO) of C. jejuni and putative aspartokinase (asp) gene of C. coli were amplified from 26 Campylobacter isolates and amplicons were subjected to HRM curve analysis. The mPCR-HRM was able to differentiate between C. jejuni and C. coli species. All DNA amplicons generated by mPCR were sequenced. Analysis of the nucleotide sequences from each isolate revealed that the HRM curves were correlated with the nucleotide sequences of the amplicons. Minor variation in melting point temperatures of C. coli or C. jejuni isolates was also observed and enabled some intraspecies differentiation between C. coli and/or C. jejuni isolates. The potential of PCR-HRM curve analysis for the detection and speciation of Campylobacter in additional human clinical specimens and chicken swab samples was also confirmed. The sensitivity and specificity of the test were found to be 100% and 92%, respectively. The results indicated that mPCR followed by HRM curve analysis provides a rapid (8 hours) technique for differentiation between C. jejuni and C. coli isolates. PMID:26394042
Are Escherichia coli Pathotypes Still Relevant in the Era of Whole-Genome Sequencing?
Robins-Browne, Roy M.; Holt, Kathryn E.; Ingle, Danielle J.; Hocking, Dianna M.; Yang, Ji; Tauschek, Marija
2016-01-01
The empirical and pragmatic nature of diagnostic microbiology has given rise to several different schemes to subtype E.coli, including biotyping, serotyping, and pathotyping. These schemes have proved invaluable in identifying and tracking outbreaks, and for prognostication in individual cases of infection, but they are imprecise and potentially misleading due to the malleability and continuous evolution of E. coli. Whole genome sequencing can be used to accurately determine E. coli subtypes that are based on allelic variation or differences in gene content, such as serotyping and pathotyping. Whole genome sequencing also provides information about single nucleotide polymorphisms in the core genome of E. coli, which form the basis of sequence typing, and is more reliable than other systems for tracking the evolution and spread of individual strains. A typing scheme for E. coli based on genome sequences that includes elements of both the core and accessory genomes, should reduce typing anomalies and promote understanding of how different varieties of E. coli spread and cause disease. Such a scheme could also define pathotypes more precisely than current methods. PMID:27917373
Are Escherichia coli Pathotypes Still Relevant in the Era of Whole-Genome Sequencing?
Robins-Browne, Roy M; Holt, Kathryn E; Ingle, Danielle J; Hocking, Dianna M; Yang, Ji; Tauschek, Marija
2016-01-01
The empirical and pragmatic nature of diagnostic microbiology has given rise to several different schemes to subtype E .coli, including biotyping, serotyping, and pathotyping. These schemes have proved invaluable in identifying and tracking outbreaks, and for prognostication in individual cases of infection, but they are imprecise and potentially misleading due to the malleability and continuous evolution of E. coli . Whole genome sequencing can be used to accurately determine E. coli subtypes that are based on allelic variation or differences in gene content, such as serotyping and pathotyping. Whole genome sequencing also provides information about single nucleotide polymorphisms in the core genome of E. coli , which form the basis of sequence typing, and is more reliable than other systems for tracking the evolution and spread of individual strains. A typing scheme for E. coli based on genome sequences that includes elements of both the core and accessory genomes, should reduce typing anomalies and promote understanding of how different varieties of E. coli spread and cause disease. Such a scheme could also define pathotypes more precisely than current methods.
Joshi, S; Chapeville, F; Haenni, A L
1982-01-01
This paper describes the minimum length of the turnip yellow mosaic virus (TYMV) RNA necessary to fulfill the tRNA-like properties of the viral RNA: 50 to 75 nucleotides and 86 nucleotides from the 3' end of TYMV RNA are sufficient for adenylation and valylation respectively by the Escherichia coli system. The size of the tRNA-like fragments obtained in vitro in the presence of an E. coli, a reticulocyte or a chinese cabbage leaf extract has also been determined. Among the major fragments liberated from the 3' end of TYMV RNA by the three systems are fragments of 117 and 112 nucleotides. In addition, the E. coli extract liberates fragments of 139 and 61 nucleotides, and the reticulocyte lysate fragments of 109, 94, 84, 73 and 46 nucleotides. The cleavage of the viral RNA by several systems in vitro to yield RNA fragments encompassing the tRNA-like sequence suggests that such fragments might also be liberated in vivo. Images PMID:6176943
Simple sequence repeats in Escherichia coli: abundance, distribution, composition, and polymorphism.
Gur-Arie, R; Cohen, C J; Eitan, Y; Shelef, L; Hallerman, E M; Kashi, Y
2000-01-01
Computer-based genome-wide screening of the DNA sequence of Escherichia coli strain K12 revealed tens of thousands of tandem simple sequence repeat (SSR) tracts, with motifs ranging from 1 to 6 nucleotides. SSRs were well distributed throughout the genome. Mononucleotide SSRs were over-represented in noncoding regions and under-represented in open reading frames (ORFs). Nucleotide composition of mono- and dinucleotide SSRs, both in ORFs and in noncoding regions, differed from that of the genomic region in which they occurred, with 93% of all mononucleotide SSRs proving to be of A or T. Computer-based analysis of the fine position of every SSR locus in the noncoding portion of the genome relative to downstream ORFs showed SSRs located in areas that could affect gene regulation. DNA sequences at 14 arbitrarily chosen SSR tracts were compared among E. coli strains. Polymorphisms of SSR copy number were observed at four of seven mononucleotide SSR tracts screened, with all polymorphisms occurring in noncoding regions. SSR polymorphism could prove important as a genome-wide source of variation, both for practical applications (including rapid detection, strain identification, and detection of loci affecting key phenotypes) and for evolutionary adaptation of microbes.
Beukers, Alicia G; Hasman, Henrik; Hegstad, Kristin; van Hal, Sebastiaan J
2018-05-29
Mutations associated with linezolid resistance within the V domain of 23S rRNA are annotated using an Escherichia coli numbering system. The 23S rRNA gene varies in length, nucleotide sequence and copy number between bacterial species. Consequently, this numbering system is not intuitive and can lead to confusion when locating mutation sites using whole genome sequencing data. Using the mutation G2576T as an example, we demonstrate the difficulties associated with using the E. coli numbering system. © Crown copyright 2018.
Masters, N; Christie, M; Katouli, M; Stratton, H
2015-06-01
We investigated the usefulness of the β-d-glucuronidase gene variance in Escherichia coli as a microbial source tracking tool using a novel algorithm for comparison of sequences from a prescreened set of host-specific isolates using a high-resolution PhP typing method. A total of 65 common biochemical phenotypes belonging to 318 E. coli strains isolated from humans and domestic and wild animals were analysed for nucleotide variations at 10 loci along a 518 bp fragment of the 1812 bp β-d-glucuronidase gene. Neighbour-joining analysis of loci variations revealed 86 (76.8%) human isolates and 91.2% of animal isolates were correctly identified. Pairwise hierarchical clustering improved assignment; where 92 (82.1%) human and 204 (99%) animal strains were assigned to their respective cluster. Our data show that initial typing of isolates and selection of common types from different hosts prior to analysis of the β-d-glucuronidase gene sequence improves source identification. We also concluded that numerical profiling of the nucleotide variations can be used as a valuable approach to differentiate human from animal E. coli. This study signifies the usefulness of the β-d-glucuronidase gene as a marker for differentiating human faecal pollution from animal sources.
The nucleotide sequence of Beneckea harveyi 5S rRNA. [bioluminescent marine bacterium
NASA Technical Reports Server (NTRS)
Luehrsen, K. R.; Fox, G. E.
1981-01-01
The primary sequence of the 5S ribosomal RNA isolated from the free-living bioluminescent marine bacterium Beneckea harveyi is reported and discussed in regard to indications of phylogenetic relationships with the bacteria Escherichia coli and Photobacterium phosphoreum. Sequences were determined for oligonucleotide products generated by digestion with ribonuclease T1, pancreatic ribonuclease and ribonuclease T2. The presence of heterogeneity is indicated for two sites. The B. harveyi sequence can be arranged into the same four helix secondary structures as E. coli and other prokaryotic 5S rRNAs. Examination of the 5S-RNS sequences of the three bacteria indicates that B. harveyi and P. phosphoreum are specifically related and share a common ancestor which diverged from an ancestor of E. coli at a somewhat earlier time, consistent with previous studies.
Short genome report of cellulose-producing commensal Escherichia coli 1094.
Bernal-Bayard, Joaquin; Gomez-Valero, Laura; Wessel, Aimee; Khanna, Varun; Bouchier, Christiane; Ghigo, Jean-Marc
2018-01-01
Bacterial surface colonization and biofilm formation often rely on the production of an extracellular polymeric matrix that mediates cell-cell and cell-surface contacts. In Escherichia coli and many Betaproteobacteria and Gammaproteobacteria cellulose is often the main component of the extracellular matrix. Here we report the complete genome sequence of the cellulose producing strain E. coli 1094 and compare it with five other closely related genomes within E. coli phylogenetic group A. We present a comparative analysis of the regions encoding genes responsible for cellulose biosynthesis and discuss the changes that could have led to the loss of this important adaptive advantage in several E. coli strains. Data deposition: The annotated genome sequence has been deposited at the European Nucleotide Archive under the accession number PRJEB21000.
Irie, S; Doi, S; Yorifuji, T; Takagi, M; Yano, K
1987-01-01
The nucleotide sequence of the genes from Pseudomonas putida encoding oxidation of benzene to catechol was determined. Five open reading frames were found in the sequence. Four corresponding protein molecules were detected by a DNA-directed in vitro translation system. Escherichia coli cells containing the fragment with the four open reading frames transformed benzene to cis-benzene glycol, which is an intermediate of the oxidation of benzene to catechol. The relation between the product of each cistron and the components of the benzene oxidation enzyme system is discussed. Images PMID:3667527
Simple Sequence Repeats in Escherichia coli: Abundance, Distribution, Composition, and Polymorphism
Gur-Arie, Riva; Cohen, Cyril J.; Eitan, Yuval; Shelef, Leora; Hallerman, Eric M.; Kashi, Yechezkel
2000-01-01
Computer-based genome-wide screening of the DNA sequence of Escherichia coli strain K12 revealed tens of thousands of tandem simple sequence repeat (SSR) tracts, with motifs ranging from 1 to 6 nucleotides. SSRs were well distributed throughout the genome. Mononucleotide SSRs were over-represented in noncoding regions and under-represented in open reading frames (ORFs). Nucleotide composition of mono- and dinucleotide SSRs, both in ORFs and in noncoding regions, differed from that of the genomic region in which they occurred, with 93% of all mononucleotide SSRs proving to be of A or T. Computer-based analysis of the fine position of every SSR locus in the noncoding portion of the genome relative to downstream ORFs showed SSRs located in areas that could affect gene regulation. DNA sequences at 14 arbitrarily chosen SSR tracts were compared among E. coli strains. Polymorphisms of SSR copy number were observed at four of seven mononucleotide SSR tracts screened, with all polymorphisms occurring in noncoding regions. SSR polymorphism could prove important as a genome-wide source of variation, both for practical applications (including rapid detection, strain identification, and detection of loci affecting key phenotypes) and for evolutionary adaptation of microbes.[The sequence data described in this paper have been submitted to the GenBank data library under accession numbers AF209020–209030 and AF209508–209518.] PMID:10645951
Lavrov, K V; Ianenko, A S
2013-10-01
The gene for new Rhodococcus erythropolis TA37 acylamidase, which possesses unique substrate specificity, has been cloned and expressed in E. coli. Substrates for this enzyme are not only simple amides, such as acetamide and propionamide, but also N-substituted amides, such as 4'-nitroacetanilide. The 1431-bp gene was expressed in E. coli BL21 (DE3) cells on pET16b plasmid under the control of a promoter of the φ 10 gene from the T7 phage. The molecular mass of recombinant acylamidase in E. coli was 55 kDa, which corresponded to that of native acylamidase from Rhodococcus erythropolis TA37. Recombinant acylamidase was able to hydrolize N-substituted amides. A search of a nucleotide database and multiple alignment revealed that acylamidase belonged to the Amidase protein family PF01425, but its nucleotide and amino acid sequences differed significantly from those of the described amidases.
Lager, Malin; Mernelius, Sara; Löfgren, Sture; Söderman, Jan
2016-01-01
Healthcare-associated infections caused by Escherichia coli and antibiotic resistance due to extended-spectrum beta-lactamase (ESBL) production constitute a threat against patient safety. To identify, track, and control outbreaks and to detect emerging virulent clones, typing tools of sufficient discriminatory power that generate reproducible and unambiguous data are needed. A probe based real-time PCR method targeting multiple single nucleotide polymorphisms (SNP) was developed. The method was based on the multi locus sequence typing scheme of Institute Pasteur and by adaptation of previously described typing assays. An 8 SNP-panel that reached a Simpson's diversity index of 0.95 was established, based on analysis of sporadic E. coli cases (ESBL n = 27 and non-ESBL n = 53). This multi-SNP assay was used to identify the sequence type 131 (ST131) complex according to the Achtman's multi locus sequence typing scheme. However, it did not fully discriminate within the complex but provided a diagnostic signature that outperformed a previously described detection assay. Pulsed-field gel electrophoresis typing of isolates from a presumed outbreak (n = 22) identified two outbreaks (ST127 and ST131) and three different non-outbreak-related isolates. Multi-SNP typing generated congruent data except for one non-outbreak-related ST131 isolate. We consider multi-SNP real-time PCR typing an accessible primary generic E. coli typing tool for rapid and uniform type identification.
Calva, E; Torres, J; Vázquez, M; Angeles, V; de la Vega, H; Ruíz-Palacios, G M
1989-02-20
Campylobacter jejuni is one of the main etiologic agents of gastrointestinal illness in developing and developed areas throughout the world. Isolation of enterotoxin-producing C. jejuni has been associated with clinical symptoms of a watery-secretory type of diarrhea. Although physiological and immunological relatedness has been demonstrated between the C. jejuni enterotoxin (CJT), the Vibrio cholerae enterotoxin (CT), and the heat-labile cholera-like Escherichia coli enterotoxin (LT), nucleotide sequence similarity between C. jejuni DNA and either the toxA, toxB, eltA or eltB genes remained to be shown. We found that binding to ganglioside GM1 prevented recognition of CJT by monoclonal antibodies directed to either CT or LT. This indicates antigenic similarity between the three enterotoxins in the ganglioside GM1-binding site. Therefore we searched for corresponding similarities at the DNA level and found, by oligodeoxynucleotide hybridization, C. jejuni chromosomal nucleotide sequences similar to the coding region for a postulated ganglioside GM1-binding site on toxB and eltB.
Liu, J; Turnbough, C L
1994-01-01
In Escherichia coli, expression of the pyrC gene is regulated primarily by a translational control mechanism based on nucleotide-sensitive selection of transcriptional start sites at the pyrC promoter. When intracellular levels of CTP are high, pyrC transcripts are initiated predominantly with CTP at a site 7 bases downstream of the Pribnow box. These transcripts form a stable hairpin at their 5' ends that blocks ribosome binding. When the CTP level is low and the GTP level is high, conditions found in pyrimidine-limited cells, transcripts are initiated primarily with GTP at a site 9 bases downstream of the Pribnow box. These shorter transcripts are unable to form a hairpin at their 5' ends and are readily translated. In this study, we examined the effects of nucleotide sequence and position on the selection of transcriptional start sites at the pyrC promoter. We characterized promoter mutations that systematically alter the sequence at position 7 or 9 downstream of the Pribnow box or vary the spacing between the Pribnow box and wild-type transcriptional initiation region. The results reveal preferences for particular initiating nucleotides (ATP > or = GTP > UTP >> CTP) and for starting positions downstream of the Pribnow box (7 >> 6 and 8 > 9 > 10). The results indicate that optimal nucleotide-sensitive start site switching at the wild-type pyrC promoter is the result of competition between the preferred start site (position 7) that uses the poorest initiating nucleotide (CTP) and a weak start site (position 9) that uses a good initiating nucleotide (GTP). The sequence of the pyrC promoter also minimizes the synthesis of untranslatable transcripts and provides for maximum stability of the regulatory transcript hairpin. In addition, the results show that the effects of the mutations on pyrC expression and regulation are consistent with the current model for translational control. Possible effects of preferences for initiating nucleotides and start sites on the expression and regulation of other genes are discussed. Images PMID:7910603
Allen, S P; Polazzi, J O; Gierse, J K; Easton, A M
1992-01-01
In Escherichia coli high-level production of some heterologous proteins (specifically, human prorenin, renin, and bovine insulin-like growth factor 2) resulted in the induction of two new E. coli heat shock proteins, both of which have molecular masses of 16 kDa and are tightly associated with inclusion bodies formed during heterologous protein production. We named these inclusion body-associated proteins IbpA and IbpB. The coding sequences for IbpA and IbpB were identified and isolated from the Kohara E. coli gene bank. The genes for these proteins (ibpA and ibpB) are located at 82.5 min on the chromosome. Nucleotide sequencing of the two genes revealed that they are transcribed in the same direction and are separated by 110 bp. Putative Shine-Dalgarno sequences are located upstream from the initiation codons of both genes. A putative heat shock promoter is located upstream from ibpA, and a putative transcription terminator is located downstream from ibpB. A temperature upshift experiment in which we used a wild-type E. coli strain and an isogenic rpoH mutant strain indicated that a sigma 32-containing RNA polymerase is involved in the regulation of expression of these genes. There is 57.5% identity between the genes at the nucleotide level and 52.2% identity at the amino acid level. A search of the protein data bases showed that both of these 16-kDa proteins exhibit low levels of homology to low-molecular-weight heat shock proteins from eukaryotic species. Images PMID:1356969
Analysis of the regulatory region of the protease III (ptr) gene of Escherichia coli K-12.
Claverie-Martin, F; Diaz-Torres, M R; Kushner, S R
1987-01-01
The ptr gene of Escherichia coli encodes protease III (Mr 110,000) and a 50-kDa polypeptide, both of which are found in the periplasmic space. The gene is physically located between the recC and recB loci on the E. coli chromosome. The nucleotide sequence of a 1167-bp EcoRV-ClaI fragment of chromosomal DNA containing the promoter region and 885 bp of the ptr coding sequence has been determined. S1 nuclease mapping analysis showed that the major 5' end of the ptr mRNA was localized 127 bp upstream from the ATG start codon. The open reading frame (ORF), preceded by a Shine-Dalgarno sequence, extends to the end of the sequenced DNA. Downstream from the -35 and -10 regions is a sequence that strongly fits the consensus sequence of known nitrogen-regulated promoters. A signal peptide of 23 amino acids residues is present at the N terminus of the derived amino acid sequence. The cleavage site as well as the ORF were confirmed by sequencing the N terminus of mature protease III.
Isolation and characterization of the gene coding for Escherichia coli arginyl-tRNA synthetase.
Eriani, G; Dirheimer, G; Gangloff, J
1989-01-01
The gene coding for Escherichia coli arginyl-tRNA synthetase (argS) was isolated as a fragment of 2.4 kb after analysis and subcloning of recombinant plasmids from the Clarke and Carbon library. The clone bearing the gene overproduces arginyl-tRNA synthetase by a factor 100. This means that the enzyme represents more than 20% of the cellular total protein content. Sequencing revealed that the fragment contains a unique open reading frame of 1734 bp flanked at its 5' and 3' ends respectively by 247 bp and 397 bp. The length of the corresponding protein (577 aa) is well consistent with earlier Mr determination (about 70 kd). Primer extension analysis of the ArgRS mRNA by reverse transcriptase, located its 5' end respectively at 8 and 30 nucleotides downstream of a TATA and a TTGAC like element (CTGAC) and 60 nucleotides upstream of the unusual translation initiation codon GUG; nuclease S1 analysis located the 3'-end at 48 bp downstream of the translation termination codon. argS has a codon usage pattern typical for highly expressed E. coli genes. With the exception of the presence of a HVGH sequence similar to the HIGH consensus element, ArgRS has no relevant sequence homologies with other aminoacyl-tRNA synthetases. Images PMID:2668891
Bowen, D; Littlechild, J A; Fothergill, J E; Watson, H C; Hall, L
1988-01-01
Using oligonucleotide probes derived from amino acid sequencing information, the structural gene for phosphoglycerate kinase from the extreme thermophile, Thermus thermophilus, was cloned in Escherichia coli and its complete nucleotide sequence determined. The gene consists of an open reading frame corresponding to a protein of 390 amino acid residues (calculated Mr 41,791) with an extreme bias for G or C (93.1%) in the codon third base position. Comparison of the deduced amino acid sequence with that of the corresponding mesophilic yeast enzyme indicated a number of significant differences. These are discussed in terms of the unusual codon bias and their possible role in enhanced protein thermal stability. Images Fig. 1. PMID:3052437
McKinney, Jeffrey; Guerrier-Takada, Cecilia; Wesolowski, Donna; Altman, Sidney
2001-01-01
Narrow spectrum antimicrobial activity has been designed to reduce the expression of two essential genes, one coding for the protein subunit of RNase P (C5 protein) and one for gyrase (gyrase A). In both cases, external guide sequences (EGS) have been designed to complex with either mRNA. Using the EGS technology, the level of microbial viability is reduced to less than 10% of the wild-type strain. The EGSs are additive when used together and depend on the number of nucleotides paired when attacking gyrase A mRNA. In the case of gyrase A, three nucleotides unpaired out of a 15-mer EGS still favor complete inhibition by the EGS but five unpaired nucleotides do not. PMID:11381134
Zahraei Salehi, Taghi; Derakhshandeh, Abdollah; Tadjbakhsh, Hasan; Karimi, Vahid
2013-02-01
The ISS (increased serum survival) gene and its protein product (ISS) of avian pathogenic Escherichia coli (APEC) are important characteristics of resistance to the complement system. The aims of this study were to clone, sequence and characterize sequence diversity of the ISS gene between two predominant serogroups in Iran and among those previously deposited in Genbank. The ISS gene of 309 bp from the APEC χ1390 strain was amplified by PCR, cloned and sequenced using pTZ57R/T vector. The ISS gene from the χ1390 strain has 100% identity among different serogroups of APEC in different geographical regions throughout the world. Phylogenetic analysis shows two different phylogenic groups among the different strains. Strong association of nucleotide sequences among different E. coli strains suggests that it may be a conserved gene and could be a suitable antigen to control and detect avian pathogenic E. coli, at least in our region. Currently, our group is working on the ISS protein as candidate vaccine in SPF poultry. Copyright © 2012 Elsevier Ltd. All rights reserved.
A fully decompressed synthetic bacteriophage øX174 genome assembled and archived in yeast.
Jaschke, Paul R; Lieberman, Erica K; Rodriguez, Jon; Sierra, Adrian; Endy, Drew
2012-12-20
The 5386 nucleotide bacteriophage øX174 genome has a complicated architecture that encodes 11 gene products via overlapping protein coding sequences spanning multiple reading frames. We designed a 6302 nucleotide synthetic surrogate, øX174.1, that fully separates all primary phage protein coding sequences along with cognate translation control elements. To specify øX174.1f, a decompressed genome the same length as wild type, we truncated the gene F coding sequence. We synthesized DNA encoding fragments of øX174.1f and used a combination of in vitro- and yeast-based assembly to produce yeast vectors encoding natural or designer bacteriophage genomes. We isolated clonal preparations of yeast plasmid DNA and transfected E. coli C strains. We recovered viable øX174 particles containing the øX174.1f genome from E. coli C strains that independently express full-length gene F. We expect that yeast can serve as a genomic 'drydock' within which to maintain and manipulate clonal lineages of other obligate lytic phage. Copyright © 2012 Elsevier Inc. All rights reserved.
Hirotani, M; Kuroda, R; Suzuki, H; Yoshikawa, T
2000-05-01
A cDNA encoding UDP-glucose: baicalein 7-O-glucosyltransferase (UBGT) was isolated from a cDNA library from hairy root cultures of Scutellaria baicalensis Georgi probed with a partial-length cDNA clone of a UDP-glucose: flavonoid 3-O-glucosyltransferase (UFGT) from grape (Vitis vinifera L.). The heterologous probe contained a glucosyltransferase consensus amino acid sequence which was also present in the Scutellaria cDNA clones. The complete nucleotide sequence of the 1688-bp cDNA insert was determined and the deduced amino acid sequences are presented. The nucleotide sequence analysis of UBGT revealed an open reading frame encoding a polypeptide of 476 amino acids with a calculated molecular mass of 53,094 Da. The reaction product for baicalein and UDP-glucose catalyzed by recombinant UBGT in Escherichia coli was identified as authentic baicalein 7-O-glucoside using high-performance liquid chromatography and proton nuclear magnetic resonance spectroscopy. The enzyme activities of recombinant UBGT expressed in E. coli were also detected towards flavonoids such as baicalein, wogonin, apigenin, scutellarein, 7,4'-dihydroxyflavone and kaempferol, and phenolic compounds. The accumulation of UBGT mRNA in hairy roots was in response to wounding or salicylic acid treatments.
Probing genomic diversity and evolution of Escherichia coli O157 by single nucleotide polymorphisms.
Zhang, Wei; Qi, Weihong; Albert, Thomas J; Motiwala, Alifiya S; Alland, David; Hyytia-Trees, Eija K; Ribot, Efrain M; Fields, Patricia I; Whittam, Thomas S; Swaminathan, Bala
2006-06-01
Infections by Shiga toxin-producing Escherichia coli O157:H7 (STEC O157) are the predominant cause of bloody diarrhea and hemolytic uremic syndrome in the United States. In silico comparison of the two complete STEC O157 genomes (Sakai and EDL933) revealed a strikingly high level of sequence identity in orthologous protein-coding genes, limiting the use of nucleotide sequences to study the evolution and epidemiology of this bacterial pathogen. To systematically examine single nucleotide polymorphisms (SNPs) at a genome scale, we designed comparative genome sequencing microarrays and analyzed 1199 chromosomal genes (a total of 1,167,948 bp) and 92,721 bp of the large virulence plasmid (pO157) of eleven outbreak-associated STEC O157 strains. We discovered 906 SNPs in 523 chromosomal genes and observed a high level of DNA polymorphisms among the pO157 plasmids. Based on a uniform rate of synonymous substitution for Escherichia coli and Salmonella enterica (4.7x10(-9) per site per year), we estimate that the most recent common ancestor of the contemporary beta-glucuronidase-negative, non-sorbitolfermenting STEC O157 strains existed ca. 40 thousand years ago. The phylogeny of the STEC O157 strains based on the informative synonymous SNPs was compared to the maximum parsimony trees inferred from pulsed-field gel electrophoresis and multilocus variable numbers of tandem repeats analysis. The topological discrepancies indicate that, in contrast to the synonymous mutations, parts of STEC O157 genomes have evolved through different mechanisms with highly variable divergence rates. The SNP loci reported here will provide useful genetic markers for developing high-throughput methods for fine-resolution genotyping of STEC O157. Functional characterization of nucleotide polymorphisms should shed new insights on the evolution, epidemiology, and pathogenesis of STEC O157 and related pathogens.
Probing genomic diversity and evolution of Escherichia coli O157 by single nucleotide polymorphisms
Zhang, Wei; Qi, Weihong; Albert, Thomas J.; Motiwala, Alifiya S.; Alland, David; Hyytia-Trees, Eija K.; Ribot, Efrain M.; Fields, Patricia I.; Whittam, Thomas S.; Swaminathan, Bala
2006-01-01
Infections by Shiga toxin-producing Escherichia coli O157:H7 (STEC O157) are the predominant cause of bloody diarrhea and hemolytic uremic syndrome in the United States. In silico comparison of the two complete STEC O157 genomes (Sakai and EDL933) revealed a strikingly high level of sequence identity in orthologous protein-coding genes, limiting the use of nucleotide sequences to study the evolution and epidemiology of this bacterial pathogen. To systematically examine single nucleotide polymorphisms (SNPs) at a genome scale, we designed comparative genome sequencing microarrays and analyzed 1199 chromosomal genes (a total of 1,167,948 bp) and 92,721 bp of the large virulence plasmid (pO157) of eleven outbreak-associated STEC O157 strains. We discovered 906 SNPs in 523 chromosomal genes and observed a high level of DNA polymorphisms among the pO157 plasmids. Based on a uniform rate of synonymous substitution for Escherichia coli and Salmonella enterica (4.7 × 10−9 per site per year), we estimate that the most recent common ancestor of the contemporary β-glucuronidase-negative, non-sorbitolfermenting STEC O157 strains existed ca. 40 thousand years ago. The phylogeny of the STEC O157 strains based on the informative synonymous SNPs was compared to the maximum parsimony trees inferred from pulsed-field gel electrophoresis and multilocus variable numbers of tandem repeats analysis. The topological discrepancies indicate that, in contrast to the synonymous mutations, parts of STEC O157 genomes have evolved through different mechanisms with highly variable divergence rates. The SNP loci reported here will provide useful genetic markers for developing high-throughput methods for fine-resolution genotyping of STEC O157. Functional characterization of nucleotide polymorphisms should shed new insights on the evolution, epidemiology, and pathogenesis of STEC O157 and related pathogens. PMID:16606700
Wu, C J; Janssen, G R
1996-10-01
The Streptomyces vinaceus viomycin phosphotransferase (vph) mRNA contains an untranslated leader with a conventional Shine-Dalgarno homology. The vph leader was removed by ligation of the vph coding sequence to the transcriptional start site of a Streptomyces or an Escherichia coli promoter, such that transcription would initiate at the first position of the vph start codon. Analysis of mRNA demonstrated that transcription initiated primarily at the A of the vph AUG translational start codon in both Streptomyces lividans and E. coli; cells expressing the unleadered vph mRNA were resistant to viomycin indicating that the Shine-Dalgarno sequence, or other features contained within the leader, was not necessary for vph translation. Addition of four nucleotides (5'-AUGC-3') onto the 5' end of the unleadered vph mRNA resulted in translation initiation from the vph start codon and the AUG triplet contained within the added sequence. Translational fusions of vph sequence to a Tn5 neo reporter gene indicated that the first 16 codons of vph coding sequence were sufficient to specify the translational start site and reading frame for expression of neomycin resistance in both E. coli and S. lividans.
Johnson, L A; Beacham, I R; MacRae, I C; Free, M L
1992-01-01
Psychrotrophic lipolytic bacteria represent a significant problem in the storage of refrigerated dairy products. A lipase-encoding gene has been cloned and characterized from a highly lipolytic strain of Pseudomonas. The nucleotide sequence of the gene predicts a polypeptide of M(r) 49,905, which was identified when the gene was expressed in Escherichia coli. Images PMID:1622251
Smola, Matthew J.; Rice, Greggory M.; Busan, Steven; Siegfried, Nathan A.; Weeks, Kevin M.
2016-01-01
SHAPE chemistries exploit small electrophilic reagents that react with the 2′-hydroxyl group to interrogate RNA structure at single-nucleotide resolution. Mutational profiling (MaP) identifies modified residues based on the ability of reverse transcriptase to misread a SHAPE-modified nucleotide and then counting the resulting mutations by massively parallel sequencing. The SHAPE-MaP approach measures the structure of large and transcriptome-wide systems as accurately as for simple model RNAs. This protocol describes the experimental steps, implemented over three days, required to perform SHAPE probing and construct multiplexed SHAPE-MaP libraries suitable for deep sequencing. These steps include RNA folding and SHAPE structure probing, mutational profiling by reverse transcription, library construction, and sequencing. Automated processing of MaP sequencing data is accomplished using two software packages. ShapeMapper converts raw sequencing files into mutational profiles, creates SHAPE reactivity plots, and provides useful troubleshooting information, often within an hour. SuperFold uses these data to model RNA secondary structures, identify regions with well-defined structures, and visualize probable and alternative helices, often in under a day. We illustrate these algorithms with the E. coli thiamine pyrophosphate riboswitch, E. coli 16S rRNA, and HIV-1 genomic RNAs. SHAPE-MaP can be used to make nucleotide-resolution biophysical measurements of individual RNA motifs, rare components of complex RNA ensembles, and entire transcriptomes. The straightforward MaP strategy greatly expands the number, length, and complexity of analyzable RNA structures. PMID:26426499
Pi, J; Wookey, P J; Pittard, A J
1991-01-01
The phenylalanine-specific permease gene (pheP) of Escherichia coli has been cloned and sequenced. The gene was isolated on a 6-kb Sau3AI fragment from a chromosomal library, and its presence was verified by complementation of a mutant lacking the functional phenylalanine-specific permease. Subcloning from this fragment localized the pheP gene on a 2.7-kb HindIII-HindII fragment. The nucleotide sequence of this 2.7-kb region was determined. An open reading frame was identified which extends from a putative start point of translation (GTG at position 636) to a termination signal (TAA at position 2010). The assignment of the GTG as the initiation codon was verified by site-directed mutagenesis of the initiation codon and by introducing a chain termination mutation into the pheP-lacZ fusion construct. A single initiation site of transcription 30 bp upstream of the start point of translation was identified by the primer extension analysis. The pheP structural gene consists of 1,374 nucleotides specifying a protein of 458 amino acid residues. The PheP protein is very hydrophobic (71% nonpolar residues). A topological model predicted from the sequence analysis defines 12 transmembrane segments. This protein is highly homologous with the AroP (general aromatic transport) system of E. coli (59.6% identity) and to a lesser extent with the yeast permeases CAN1 (arginine), PUT4 (proline), and HIP1 (histidine) of Saccharomyces cerevisiae. Images PMID:1711024
Kawano, Mitsuoki; Oshima, Taku; Kasai, Hiroaki; Mori, Hirotada
2002-07-01
Genome sequence analyses of Escherichia coli K-12 revealed four copies of long repetitive elements. These sequences are designated as long direct repeat (LDR) sequences. Three of the repeats (LDR-A, -B, -C), each approximately 500 bp in length, are located as tandem repeats at 27.4 min on the genetic map. Another copy (LDR-D), 450 bp in length and nearly identical to LDR-A, -B and -C, is located at 79.7 min, a position that is directly opposite the position of LDR-A, -B and -C. In this study, we demonstrate that LDR-D encodes a 35-amino-acid peptide, LdrD, the overexpression of which causes rapid cell killing and nucleoid condensation of the host cell. Northern blot and primer extension analysis showed constitutive transcription of a stable mRNA (approximately 370 nucleotides) encoding LdrD and an unstable cis-encoded antisense RNA (approximately 60 nucleotides), which functions as a trans-acting regulator of ldrD translation. We propose that LDR encodes a toxin-antitoxin module. LDR-homologous sequences are not pre-sent on any known plasmids but are conserved in Salmonella and other enterobacterial species.
Zhi, Shuai; Li, Qiaozhi; Yasui, Yutaka; Edge, Thomas; Topp, Edward; Neumann, Norman F
2015-11-01
Host specificity in E. coli is widely debated. Herein, we used supervised learning logic-regression-based analysis of intergenic DNA sequence variability in E. coli in an attempt to identify single nucleotide polymorphism (SNP) biomarkers of E. coli that are associated with natural selection and evolution toward host specificity. Seven-hundred and eighty strains of E. coli were isolated from 15 different animal hosts. We utilized logic regression for analyzing DNA sequence data of three intergenic regions (flanked by the genes uspC-flhDC, csgBAC-csgDEFG, and asnS-ompF) to identify genetic biomarkers that could potentially discriminate E. coli based on host sources. Across 15 different animal hosts, logic regression successfully discriminated E. coli based on animal host source with relatively high specificity (i.e., among the samples of the non-target animal host, the proportion that correctly did not have the host-specific marker pattern) and sensitivity (i.e., among the samples from a given animal host, the proportion that correctly had the host-specific marker pattern), even after fivefold cross validation. Permutation tests confirmed that for most animals, host specific intergenic biomarkers identified by logic regression in E. coli were significantly associated with animal host source. The highest level of biomarker sensitivity was observed in deer isolates, with 82% of all deer E. coli isolates displaying a unique SNP pattern that was 98% specific to deer. Fifty-three percent of human isolates displayed a unique biomarker pattern that was 98% specific to humans. Twenty-nine percent of cattle isolates displayed a unique biomarker that was 97% specific to cattle. Interestingly, even within a related host group (i.e., Family: Canidae [domestic dogs and coyotes]), highly specific SNP biomarkers (98% and 99% specificity for dog and coyotes, respectively) were observed, with 21% of dog E. coli isolates displaying a unique dog biomarker and 61% of coyote isolates displaying a unique coyote biomarker. Application of a supervised learning method, such as logic regression, to DNA sequence analysis at certain intergenic regions demonstrates that some E. coli strains may evolve to become host-specific. Copyright © 2015 Elsevier Inc. All rights reserved.
Molecular characterization of a 40 kDa OmpC-like porin from Serratia marcescens.
Hutsul, J A; Worobec, E
1994-02-01
An oligonucleotide that encodes the N-terminal portion of a 41 kDa porin of Serratia marcescens was used to probe S. marcescens UOC-51 genomic DNA. An 11 kb EcoRI fragment which hybridized with the oligonucleotide was subcloned into Escherichia coli, examined for expression, and sequenced. The product expressed by the cloned gene was 40 kDa. The nucleotide sequence has an ORF of 1.13 kb. When the deduced amino acid sequence was aligned and compared to other enterobacterial porins the cloned S. marcescens porin most closely resembled E. coli OmpC. Although we did not detect osmoregulation or thermoregulation of any porins in S. marcescens UOC-51, sequences analogous to the E. coli osmoregulator OmpR-binding regions are seen upstream to the cloned gene. We examined the regulation of the S. marcescens porin in E. coli and found that its expression increased in a high salt environment. A micF gene, whose transcriptional product functions to inhibit synthesis of OmpF by hybridizing with the ompF transcript, was also seen upstream of the S. marcescens ompC. An alignment with the E. coli micF gene revealed that the functional region of the S. marcescens micF gene is conserved. Based on the results obtained we have determined that S. marcescens UOC-51 produces a 40 kDa porin similar to the E. coli OmpC porin.
Dolejska, Monika; Villa, Laura; Minoia, Marco; Guardabassi, Luca; Carattoli, Alessandra
2014-09-01
To determine the structure of two multidrug-resistant IncHI1 plasmids carrying blaCTX-M-1 in Escherichia coli isolates disseminated in an equine clinic in the Czech Republic. A complete nucleotide sequencing of 239 kb IncHI1 (pEQ1) and 287 kb IncHI1/X1 (pEQ2) plasmids was performed using the 454-Genome Sequencer FLX system. The sequences were compared using bioinformatic tools with other sequenced IncHI1 plasmids. A comparative analysis of pEQ1 and pEQ2 identified high nucleotide identity with the IncHI1 type 2 plasmids. A novel 24 kb module containing an operon involved in short-chain fructooligosaccharide uptake and metabolism was found in the pEQ backbones. The role of the pEQ plasmids in the metabolism of short-chain fructooligosaccharides was demonstrated by studying the growth of E. coli cells in the presence of these sugars. The module containing the blaCTX-M-1 gene was formed by a truncated macrolide resistance cluster and flanked by IS26 as previously observed in IncI1 and IncN plasmids. The IncHI1 plasmid changed size and gained the quinolone resistance gene qnrS1 as a result of IS26-mediated fusion with an IncX1 plasmid. Our data highlight the structure and evolution of IncHI1 from equine E. coli. A plasmid-mediated sugar metabolic element could play a key role in strain fitness, contributing to the successful dissemination and maintenance of these plasmids in the intestinal microflora of horses. © The Author 2014. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.
The fuzzy polynucleotide space: basic properties.
Torres, Angela; Nieto, Juan J
2003-03-22
Any triplet codon may be regarded as a 12-dimensional fuzzy code. Sufficient information about a particular sequence may not be available in certain situations. The investigator will be confronted with imprecise sequences, yet want to make comparisons of sequences. Fuzzy polynucleotides can be compared by using geometrical interpretation of fuzzy sets as points in a hypercube. We introduce the space of fuzzy polynucleotides and a means of measuring dissimilitudes between them. We establish mathematical principles to measure dissimilarities between fuzzy polynucleotides and present several examples in this metric space. We calculate the frequencies of the nucleotides at the three base sites of a codon in the coding sequences of Escherichia coli K-12 and Mycobacterium tuberculosis H37Rv, and consider them as points in that fuzzy space. We compute the distance between the genomes of E.coli and M.tuberculosis.
Targeted mutagenesis of dengue virus type 2 replicon RNA by yeast in vivo recombination.
Manzano, Mark; Padmanabhan, Radhakrishnan
2014-01-01
The use of cDNA infectious clones or subgenomic replicons is indispensable in studying flavivirus biology. Mutating nucleotides or amino acid residues gives important clues to their function in the viral life cycle. However, a major challenge to the establishment of a reverse genetics system for flaviviruses is the instability of their nucleotide sequences in Escherichia coli. Thus, direct cloning using conventional restriction enzyme-based procedures usually leads to unwanted rearrangements of the construct. In this chapter, we discuss a cloning strategy that bypasses traditional cloning procedures. We take advantage of the observations from previous studies that (1) unstable sequences in bacteria can be cloned in eukaryotic systems and (2) Saccharomyces cerevisiae has a well-studied genetics system to introduce sequences using homologous recombination. We describe a protocol to perform targeted mutagenesis in a subgenomic dengue virus 2 replicon. Our method makes use of homologous recombination in yeast using a linearized replicon and a PCR product containing the desired mutation. Constructs derived from this method can be propagated in E. coli with improved stability. Thus, yeast in vivo recombination provides an excellent strategy to genetically engineer flavivirus infectious clones or replicons because this system is compatible with inherently unstable sequences of flaviviruses and is not restricted by the limitations of traditional cloning procedures.
Cho, Min Seok; Joh, Kiseong; Ahn, Tae-Young; Park, Dong Suk
2014-09-01
Escherichia coli serotype O157 is still a major global healthcare problem. However, only limited information is now available on the molecular and serological detection of pathogenic bacteria. Therefore, the development of appropriate strategies for their rapid identification and monitoring is still needed. In general, the sequence analysis based on stx, slt, eae, hlyA, rfb, and fliCh7 genes is widely employed for the identification of E. coli serotype O157; but there have been critical defects in the diagnosis and identification of E. coli serotype O157, in that they are also present in other E. coli serogroups. In this study, NCBI-BLAST searches using the nucleotide sequences of the putative regulatory protein gene from E. coli O157:H7 str. Sakai found sequence difference at the serotype level. The specific primers from the putative regulatory protein gene were designed and investigated for their sensitivity and specificity for detecting the pathogen in environment water samples. The specificity of the primer set was evaluated using genomic DNA from 8 isolates of E. coli serotype O157 and 32 other reference strains. In addition, the sensitivity and specificity of this assay were confirmed by successful identification of E. coli serotype O157 in environmental water samples. In conclusion, this study showed that the newly developed quantitative serotype-specific PCR method is a highly specific and efficient tool for the surveillance and rapid detection of high-risk E. coli serotype O157.
Liu, Y; Chatterjee, A; Chatterjee, A K
1994-01-01
Our previous genetic analysis (J. W. Willis, J. K. Engwall, and A. K. Chatterjee, Phytopathology 77:1199-1205, 1987) had revealed a tight linkage between pel-3 (pel, pectate lyase gene) and peh-1 (peh, polygalacturonase gene) within the chromosome of Erwinia carotovora subsp. carotovora 71. Nucleotide sequencing, transcript assays, and expression of enzymatic activities in Escherichia coli have now confirmed that a 3,500-bp segment contains the open reading frames (ORFs) for Pel-3 and Peh-1. The 1,041-bp pel-3 ORF and the 1,206-bp peh-1 ORF are separated by a 579-bp sequence. The genes are transcribed divergently from their own promoters. In E. coli and E. carotovora subsp. carotovora 71, peh-1 is better expressed than pel-3. However, plant signals activate the expression of both the genes in E. carotovora subsp. carotovora. A consensus integration host factor (IHF)-binding sequence upstream of pel-3 appears physiologically significant, since pel-3 promoter activity is higher in an E. coli IHF+ strain than in an IHF- strain. While peh-1 has extensive homology with plant and bacterial peh genes, pel-3 appears not to have significant homology with the pel genes belonging to the pelBC, pelADE, or periplasmic pel families. Pel-3 also is unusual in that it is predicted to contain an ATP- and GTP-binding site motif A (P-loop) not found in the other Pels. Images PMID:8074530
Elkins, Christopher A.; Savage, Dwayne C.
1998-01-01
Cytosolic extracts of Lactobacillus johnsonii 100-100 (previously reported as Lactobacillus sp. strain 100-100) contain four heterotrimeric isozymes composed of two peptides, α and β, with conjugated bile salt hydrolase (BSH) activity. We now report cloning, from the genome of strain 100-100, a 2,977-bp DNA segment that expresses BSH activity in Escherichia coli. The sequencing of this segment showed that it contained one complete and two partial open reading frames (ORFs). The 3′ partial ORF (927 nucleotides) was predicted by BLAST and confirmed with 5′ and 3′ deletions to be a BSH gene. Thermal asymmetric interlaced PCR was used to extend and complete the 948-nucleotide sequence of the BSH gene 3′ of the cloned segment. The predicted amino acid sequence of the 5′ partial ORF (651 nucleotides) was about 80% similar to the C-terminal half of the largest, complete ORF (1,353 nucleotides), and these two putative proteins were similar to several amine, multidrug resistance, and sugar transport proteins of the major facilitator superfamily. E. coli DH5α cells transformed with a construct containing these ORFs, in concert with an extracellular factor produced by strain 100-100, demonstrated levels of uptake of [14C]taurocholic acid that were increased as much as threefold over control levels. [14C]Cholic acid was taken up in similar amounts by strain DH5α pSportI (control) and DH5α p2000 (transport clones). These findings support a hypothesis that the ORFs are conjugated bile salt transport genes which may be arranged in an operon with BSH genes. PMID:9721268
Kuznedelov, Konstantin; Mekler, Vladimir; Lemak, Sofia; ...
2016-10-13
The Escherichia coli type I-E CRISPR-Cas system Cascade effector is a multisubunit complex that binds CRISPR RNA (crRNA). Through its 32-nucleotide spacer sequence, Cascade-bound crRNA recognizes protospacers in foreign DNA, causing its destruction during CRISPR interference or acquisition of additional spacers in CRISPR array during primed CRISPR adaptation. Within Cascade, the crRNA spacer interacts with a hexamer of Cas7 subunits. We show that crRNAs with a spacer length reduced to 14 nucleotides cause primed adaptation, while crRNAs with spacer lengths of more than 20 nucleotides cause both primed adaptation and target interference in vivo. Shortened crRNAs assemble into altered-stoichiometry Cascademore » effector complexes containing less than the normal amount of Cas7 subunits. The results show that Cascade assembly is driven by crRNA and suggest that multi-subunit type I CRISPR effectors may have evolved from much simpler ancestral complexes.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kuznedelov, Konstantin; Mekler, Vladimir; Lemak, Sofia
The Escherichia coli type I-E CRISPR-Cas system Cascade effector is a multisubunit complex that binds CRISPR RNA (crRNA). Through its 32-nucleotide spacer sequence, Cascade-bound crRNA recognizes protospacers in foreign DNA, causing its destruction during CRISPR interference or acquisition of additional spacers in CRISPR array during primed CRISPR adaptation. Within Cascade, the crRNA spacer interacts with a hexamer of Cas7 subunits. We show that crRNAs with a spacer length reduced to 14 nucleotides cause primed adaptation, while crRNAs with spacer lengths of more than 20 nucleotides cause both primed adaptation and target interference in vivo. Shortened crRNAs assemble into altered-stoichiometry Cascademore » effector complexes containing less than the normal amount of Cas7 subunits. The results show that Cascade assembly is driven by crRNA and suggest that multi-subunit type I CRISPR effectors may have evolved from much simpler ancestral complexes.« less
Nishibuchi, M; Murakami, A; Arita, M; Jikuya, H; Takano, J; Honda, T; Miwatani, T
1989-01-01
We examined variations in the genes encoding heat-stable enterotoxin (ST) and heat-labile enterotoxin (LT) in 88 strains of Escherichia coli isolated from individuals with traveler's diarrhea to find suitable sequences for use as oligonucleotide probes. Four oligonucleotide probes of the gene encoding ST of human origin (STIb or STh), one oligonucleotide probe of the gene encoding ST of porcine origin (STIa or STp), and three oligonucleotide probes of the gene encoding LT of human origin (LTIh) were used in DNA colony hybridization tests. In 15 of 22 strains possessing the STh gene and 28 of 42 strains producing LT, the sequences of all regions tested were identical to the published sequences. One region in the STh gene examined with a 18-mer probe was relatively well conserved and was shown to be closely associated with the enterotoxicity of the E. coli strains in suckling mice. This oligonucleotide, however, hybridized with strains of Vibrio cholerae O1, V. parahaemolyticus, and Yersinia enterocolitica that gave negative results in the suckling mouse assay. PMID:2685027
Takagi, M; Kobayashi, N; Sugimoto, M; Fujii, T; Watari, J; Yano, K
1987-01-01
The expression of a LEU gene from Candida maltosa (designated as C-LEU2) isolated previously (Kawamura et al. 1983) was shown to be regulated, when transferred into Saccharomyces cerevisiae, by leucine and threonine in the medium, as in the case of LEU2 gene of S. cerevisiae. The coding region together with the regulatory region was subcloned and the nucleotide sequence was determined. When the sequence of the coding region was compared with that of LEU2, the homology was 72% for base pairs and 76% for deduced amino acids. Comparison of the regulatory region of C-LEU2 with those of LEU1 and LEU2 suggested a few short consensus sequences which are involved in regulation of gene expression by leucine and threonine in the medium.
Stephenson, F H; Ballard, B T; Boyer, H W; Rosenberg, J M; Greene, P J
1989-12-21
The RsrI endonuclease, a type-II restriction endonuclease (ENase) found in Rhodobacter sphaeroides, is an isoschizomer of the EcoRI ENase. A clone containing an 11-kb BamHI fragment was isolated from an R. sphaeroides genomic DNA library by hybridization with synthetic oligodeoxyribonucleotide probes based on the N-terminal amino acid (aa) sequence of RsrI. Extracts of E. coli containing a subclone of the 11-kb fragment display RsrI activity. Nucleotide sequence analysis reveals an 831-bp open reading frame encoding a polypeptide of 277 aa. A 50% identity exists within a 266-aa overlap between the deduced aa sequences of RsrI and EcoRI. Regions of 75-100% aa sequence identity correspond to key structural and functional regions of EcoRI. The type-II ENases have many common properties, and a common origin might have been expected. Nevertheless, this is the first demonstration of aa sequence similarity between ENases produced by different organisms.
Vandenbol, M; Jauniaux, J C; Grenson, M
1989-11-15
The complete nucleotide (nt) sequence of the PUT4 gene, whose product is required for high-affinity proline active transport in the yeast Saccharomyces cerevisiae, is presented. The sequence contains a single long open reading frame of 1881 nt, encoding a polypeptide with a calculated Mr of 68,795. The predicted protein is strongly hydrophobic and exhibits six potential glycosylation sites. Its hydropathy profile suggests the presence of twelve membrane-spanning regions flanked by hydrophilic N- and C-terminal domains. The N terminus does not resemble signal sequences found in secreted proteins. These features are characteristic of integral membrane proteins catalyzing translocation of ligands across cellular membranes. Protein sequence comparisons indicate strong resemblance to the arginine and histidine permeases of S. cerevisiae, but no marked sequence similarity to the proline permease of Escherichia coli or to other known prokaryotic or eukaryotic transport proteins. The strong similarity between the three yeast amino acid permeases suggests a common ancestor for the three proteins.
Sharma, Vijay K; Stanton, Thaddeus B
2008-12-10
Enterohemorrhagic Escherichia coli (EHEC) O157:H7 (strain 86-24) harbors a 3.3-kb plasmid (pSP70) that does not encode a selectable phenotype. A 1.1-kb fragment of DNA encoding kanamycin resistance (Kan(r)) was inserted by in vitro transposon mutagenesis at a random location on pSP70 to construct pSP70-Kan(r) that conferred Kan(r) to the host E. coli strain. Oligonucleotides complementary to 5' and 3' ends of the fragment encoding Kan(r) were used for initiating nucleotide sequencing from the plus and minus strands of pSP70, and thereafter primer walking was used to determine nucleotide sequence of pSP70. Analysis of nucleotide sequence revealed that pSP70 contained 3306 base pairs in its genome and that the genome was almost 100% identical to nucleotide sequences of small plasmids identified in EHEC O157:H7 isolates from Germany and Japan. A DNA cassette encoding a green fluorescent protein (GFP), ampicillin resistance (Amp(r)), and a double transcriptional terminator (DT) was cloned in pSP70 either at the BamHI site (created by deletion of mobA by PCR) or at the NsiI site located downstream of mobA to generate pSP70 DeltamobA-GFP/Amp(r)/DT (pSM431) and pSP70-GFP/Amp(r)/DT (pSM433), respectively. Introduction of pSM431 or pSM433 into EHEC O157:H7 yielded ampicillin-resistant colonies that glowed green under UV illumination. Consecutive subcultures of EHEC O157:H7, carrying pSM431 or pSM433 under conditions simulating the environment of bovine intestine (no selective antibiotic, incubation temperature of 39 degrees C, with or without oxygen), demonstrated that these plasmids were highly stable as greater than 95% of the isolates recovered from these subcultures were positive for green fluorescence. These findings indicate that EHEC O157:H7 carrying pSM431 or pSM433 would be useful for studying persistence and shedding of this important food-borne pathogen in cattle.
van Keulen, H; Gutell, R R; Campbell, S R; Erlandsen, S L; Jarroll, E L
1992-10-01
The total nucleotide sequence of the rDNA of Giardia muris, an intestinal protozoan parasite of rodents, has been determined. The repeat unit is 7668 basepairs (bp) in size and consists of a spacer of 3314 bp, a small-subunit rRNA (SSU-rRNA) gene of 1429, and a large-subunit rRNA (LSU-rRNA) gene of 2698 bp. The spacer contains long direct repeats and is heterogeneous in size. The LSU-rRNA of G. muris was compared to that of the human intestinal parasite Giardia duodenalis, to the bird parasite Giardia ardeae, and to that of Escherichia coli. The LSU-rRNA has a size comparable to the 23S rRNA of E. coli but shows structural features typical for eukaryotes. Some variable regions are typically small and account for the overall smaller size of this rRNA. The structure of the G. muris LSU-rRNA is similar to that of the other Giardia rRNA, but each rRNA has characteristic features residing in a number of variable regions.
Ramesh, M V; Podkovyrov, S M; Lowe, S E; Zeikus, J G
1994-01-01
The amylopullulanase gene (apu) of the thermophilic anaerobic bacterium Thermoanaerobacterium saccharolyticum B6A-RI was cloned into Escherichia coli. The complete nucleotide sequence of the gene was determined. It encoded a protein consisting of 1,288 amino acids with a signal peptide of 35 amino acids. The enzyme purified from E. coli was a monomer with an M(r) of 142,000 +/- 2,000 and had same the catalytic and thermal characteristics as the native glycoprotein from T. saccharolyticum B6A. Linear alignment and the hydrophobic cluster analysis were used to compare this amylopullulanase with other amylolytic enzymes. Both methods revealed strictly conserved amino acid residues among these enzymes, and it is proposed that Asp-594, Asp-700, and Glu-623 are a putative catalytic triad of the T. saccharolyticum B6A-RI amylopullulanase.
Ramesh, M V; Podkovyrov, S M; Lowe, S E; Zeikus, J G
1994-01-01
The amylopullulanase gene (apu) of the thermophilic anaerobic bacterium Thermoanaerobacterium saccharolyticum B6A-RI was cloned into Escherichia coli. The complete nucleotide sequence of the gene was determined. It encoded a protein consisting of 1,288 amino acids with a signal peptide of 35 amino acids. The enzyme purified from E. coli was a monomer with an M(r) of 142,000 +/- 2,000 and had same the catalytic and thermal characteristics as the native glycoprotein from T. saccharolyticum B6A. Linear alignment and the hydrophobic cluster analysis were used to compare this amylopullulanase with other amylolytic enzymes. Both methods revealed strictly conserved amino acid residues among these enzymes, and it is proposed that Asp-594, Asp-700, and Glu-623 are a putative catalytic triad of the T. saccharolyticum B6A-RI amylopullulanase. Images PMID:8117096
Hua, Ying; Sun, Qi; Wang, Xiangyu; DU, Yanli; Shao, Na; Zhang, Qiwei; Zhao, Wei; Wan, Chengsong
2015-11-01
To construct enterohemorrhagic Escherichia coli (EHEC) O157:H7 strains with delection espF gene and its nucleotide fragment and with espF gene complementation. A pair of homologous arm primers was designed to amplify the gene fragment of kanamycin resistance, which was transformed into EHEC O157:H7 EDL933w strain via the PKD46 plasmid by electroporation. The replacement of the espF gene by kanamycin resistance gene through the PKD46-mediated red recombination system was confirmed by PCR and sequencing. The entire coding region of espF along with its nucleotide fragment was amplified by PCR and cloned into pBAD33 plasmid, which was transformed into a mutant strain to construct the strain with espF complementation. RT-PCR was used to verify the transcription of espF and its nucleotide fragment in the complemented mutant strain. We established EHEC O157:H7 EDL933w strains with espF gene deletion and with espF gene complementation. Both espF and its nucleotide fragment were transcribed in the complemented mutant strain. The two strains provide a basis for further study of the regulatory mechanism of espF.
Arif, Amina; Rashid, Naeem; Aslam, Farheen; Mahmood, Nasir; Akhtar, Muhammad
2016-03-01
Human interferon α-2b and Escherichia coli methionine amino peptidase genes were cloned independently as well as bicistronically in expression plasmid pET-21a (+). Production of human interferon α-2b was comparable to that of E. coli methionine amino peptidase when these genes were expressed independently in E. coli BL21-CodonPlus (DE3)-RIL. However, human interferon α-2b was produced in a much less amount whereas there was no difference in the production of methionine amino peptidase when the encoding genes were expressed bicistronically. It is important to note that human interferon α-2b was the first gene in order, after the promoter and E. coli methionine amino peptidase was the next with a linker sequence of 27 nucleotides between them.
Cloning, expression and activation of a truncated 92-kDa gelatinase minienzyme.
Kröger, M; Tschesche, H
1997-09-01
The matrix metalloproteinases (MMPs) are a family of highly homologous zinc-endopeptidases that degrade extracellular matrix components. Human 92-kDa gelatinase (MMP-9) represents one of the MMPs that cleaves native collagen type IV. As a basis for structural investigations, the short form (catalytic domain, amino acid residues 113-450) of the 92-kDa gelatinase cDNA was cloned and expressed in E. coli as a minienzyme. By combination of reverse transcription (RT) and polymerase chain reaction (PCR), the truncated 92-kDa gelatinase-cDNA was amplified from the corresponding mRNA derived from ovarian carcinoma cells. The cDNA fragment obtained was cloned in E. coli and sequenced. With the exception of one nucleotide inversion at position 745 (gt-->tg) the cDNA sequence was identical to the nucleotide sequence of the 92-kDa gelatinase as has been previously reported. The protein was expressed in E. coli using the vector pET-12b. The recombinant protein was stored in inclusion bodies and extracted as a 38 kDa species from the inclusion bodies by solubilization in 8 M urea. The product was purified by affinity chromatography and gel filtration. Amino-terminal sequence analysis confirmed the identity with the catalytic domain of 92-kDa gelatinase. The recombinant protein was refolded in the presence of Ca2+ and Zn2+ and yielded an active minienzyme with gelatinolytic activity. It degrades the native substrate collagen type IV and the synthetic substrate Mca-Pro-Leu-Gly-Leu-Dpa-Ala-Arg-NH2 x AcOH like the full-length 92-kDa gelatinase. The catalytic activity could be inhibited by the specific MMP inhibitors TIMP-1 and TIMP-2.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Peters, J.; Peters, M.; Lottspeich, F.
1987-11-01
The complete nucleotide sequence of the gene encoding the surface (hexagonally packed intermediate (HPI))-layer polypeptide of Deinococcus radiodurans Sark was determined and found to encode a polypeptide of 1036 amino acids. Amino acid sequence analysis of about 30% of the residues revealed that the mature polypeptide consists of at least 978 amino acids. The N terminus was blocked to Edman degradation. The results of proteolytic modification of the HPI layer in situ and M/sub r/ estimations of the HPI polypeptide expressed in Escherichia coli indicated that there is a leader sequence. The N-terminal region contained a very high percentage (29%)more » of threonine and serine, including a cluster of nine consecutive serine or threonine residues, whereas a stretch near the C terminus was extremely rich in aromatic amino acids (29%). The protein contained at least two disulfide bridges, as well as tightly bound reducing sugars and fatty acids.« less
A low molecular weight artificial RNA of unique size with multiple probe target regions
NASA Technical Reports Server (NTRS)
Pitulle, C.; Dsouza, L.; Fox, G. E.
1997-01-01
Artificial RNAs (aRNAs) containing novel sequence segments embedded in a deletion mutant of Vibrio proteolyticus 5S rRNA have previously been shown to be expressed from a plasmid borne growth rate regulated promoter in E. coli. These aRNAs accumulate to high levels and their detection is a promising tool for studies in molecular microbial ecology and in environmental monitoring. Herein a new construct is described which illustrates the versatility of detection that is possible with aRNAs. This 3xPen aRNA construct carries a 72 nucleotide insert with three copies of a unique 17 base probe target sequence. This aRNA is 160 nucleotides in length and again accumulates to high levels in the E. coli cytoplasm without incorporating into ribosomes. The 3xPen aRNA illustrates two improvements in detection. First, by appropriate selection of insert size, we obtained an aRNA which provides a unique and hence, easily quantifiable peak, on a high resolution gel profile of low molecular weight RNAs. Second, the existence of multiple probe targets results in a nearly commensurate increase in signal when detection is by hybridization. These aRNAs are naturally amplified and carry sequence segments that are not found in known rRNA sequences. It thus may be possible to detect them directly. An experimental step involving RT-PCR or PCR amplification of the gene could therefore be avoided.
Robinson, P J; Cranenburgh, R M; Head, I M; Robinson, N J
1997-04-01
The sequence 5'-GCGATCGC-3', designated HIP1, for highly iterated palindrome, was first identified at the borders of a gene-deletion event and subsequently shown to constitute up to 2.5% of the DNA in some cyanobacteria. It is now reported that HIP1 is polyphyletic, occurring in several distinct cyanobacterial lineages and not defining a clade. HIP1 does not introduce gaps into sequence alignments. It aligns with partial HIP1 sites in related sequences showing that it propagates by nucleotide substitutions rather than insertion. Constructs have been created to determine the frequencies at which deletion events occur between palindromes located within the selectable marker neo. Deletion between HIP1 sites was more frequent in Synechococcus PCC 7942 than deletion between control palindromes, 5'-CCGATCGG-3', designated PAL0. However, this is not due to a recombinase that recognises HIP1 and is peculiar to cyanobacteria because similar deletion frequencies were detected in Escherichia coli. Furthermore, the frequency of deletion of DNA flanked asymmetrically by one HIP1 site and one PAL0 site was less than the frequency of deletion of DNA flanked asymmetrically by identical copies of either palindrome. This is consistent with deletion by copy-choice.
Draft genome sequence of non-shiga toxin-producing Escherichia coli O157 NCCP15738.
Kwon, Taesoo; Kim, Jung-Beom; Bak, Young-Seok; Yu, Young-Bin; Kwon, Ki Sung; Kim, Won; Cho, Seung-Hak
2016-01-01
The non-shiga toxin-producing Escherichia coli (non-STEC) O157 is a pathogenic strain that cause diarrhea but does not cause hemolytic-uremic syndrome, or hemorrhagic colitis. Here, we present the 5-Mb draft genome sequence of non-STEC O157 NCCP15738, which was isolated from the feces of a Korean patient with diarrhea, and describe its features and the structural basis for its genome evolution. A total of 565-Mbp paired-end reads were generated using the Illumina-HiSeq 2000 platform. The reads were assembled into 135 scaffolds throughout the de novo assembly. The assembled genome size of NCCP15738 was 5,005,278 bp with an N50 value of 142,450 bp and 50.65 % G+C content. Using Rapid Annotation using Subsystem Technology analysis, we predicted 4780 ORFs and 31 RNA genes. The evolutionary tree was inferred from multiple sequence alignment of 45 E. coli species. The most closely related neighbor of NCCP15738 indicated by whole-genome phylogeny was E. coli UMNK88, but that indicated by multilocus sequence analysis was E. coli DH1(ME8569). A comparison between the NCCP15738 genome and those of reference strains, E. coli K-12 substr. MG1655 and EHEC O157:H7 EDL933 by bioinformatics analyses revealed unique genes in NCCP15738 associated with lysis protein S, two-component signal transduction system, conjugation, the flagellum, nucleotide-binding proteins, and metal-ion binding proteins. Notably, NCCP15738 has a dual flagella system like that in Vibrio parahaemolyticus, Aeromonas spp., and Rhodospirillum centenum. The draft genome sequence and the results of bioinformatics analysis of NCCP15738 provide the basis for understanding the genomic evolution of this strain.
Liu, Yanhong; Yan, Xianghe; DebRoy, Chitrita; Fratamico, Pina M.; Needleman, David S.; Li, Robert W.; Wang, Wei; Losada, Liliana; Brinkac, Lauren; Radune, Diana; Toro, Magaly; Hegde, Narasimha; Meng, Jianghong
2015-01-01
The DNA sequence of the O-antigen gene clusters of Escherichia coli serogroups O62, O68, O131, O140, O142, and O163 was determined, and primers based on the wzx (O-antigen flippase) and/or wzy (O-antigen polymerase) genes within the O-antigen gene clusters were designed and used in PCR assays to identify each serogroup. Specificity was tested with E. coli reference strains, field isolates belonging to the target serogroups, and non-E. coli bacteria. The PCR assays were highly specific for the respective serogroups; however, the PCR assay targeting the O62 wzx gene reacted positively with strains belonging to E. coli O68, which was determined by serotyping. Analysis of the O-antigen gene cluster sequences of serogroups O62 and O68 reference strains showed that they were 94% identical at the nucleotide level, although O62 contained an insertion sequence (IS) element located between the rmlA and rmlC genes within the O-antigen gene cluster. A PCR assay targeting the rmlA and rmlC genes flanking the IS element was used to differentiate O62 and O68 serogroups. The PCR assays developed in this study can be used for the detection and identification of E. coli O62/O68, O131, O140, O142, and O163 strains isolated from different sources. PMID:25664526
Primary structure and mapping of the hupA gene of Salmonella typhimurium.
Higgins, N P; Hillyard, D
1988-01-01
In bacteria, the complex nucleoid structure is folded and maintained by negative superhelical tension and a set of type II DNA-binding proteins, also called histonelike proteins. The most abundant type II DNA-binding protein is HU. Southern blot analysis showed that Salmonella typhimurium contained two HU genes that corresponded to Escherichia coli genes hupA (encoding HU-2 protein) and hupB (encoding HU-1). Salmonella hupA was cloned, and the nucleotide sequence of the gene was determined. Comparison of hupA of E. coli and S. typhimurium revealed that the HU-2 proteins were identical and that there was high conservation of nucleotide sequences outside the coding frames of the genes. A 300-member genomic library of S. typhimurium was constructed by using random transposition of MudP, a specialized chimeric P22-Mu phage that packages chromosomal DNA unidirectionally from its insertion point. Oligonucleotide hybridization against the library identified one MudP insertion that lies within 28 kilobases of hupA; the MudP was 12% linked to purH at 90.5 min on the standard map. Plasmids expressing HU-2 had a surprising phenotype; they caused growth arrest when they were introduced into E. coli strains bearing a himA or hip mutation. These results suggest that IHF and HU have interactive roles in bacteria. Images PMID:3056912
Onishchenko, G G; Dyatlov, I A; Svetoch, E A; Volozhantsev, N V; Bannov, V A; Kartsev, N N; Borzenkov, V N; Fursova, N K; Shemyakin, I G; Bogun, A G; Kislichkina, A A; Popova, A V; Myakinina, V P; Teimurazov, M G; Polosenko, O V; Kaftyreva, L A; Makarova, M A; Matveeva, Z N; Grechaninova, T A; Grigor'eva, N S; Kicha, E V; Zabalueva, G V; Kutasova, T B; Korzhaev, Yu N; Bashketova, N S; Bushmanova, O N; Stalevskaya, A V; Tchinjeria, I G; Zhebrun, F B
2015-01-01
Shiga toxin-producing Escherichia coli (STEC) food-borne infections are reported worldwide and represent a serious problem for public healthcare. In the Russian Federation there is little information on epidemiology and etiology of STEC-infections as well as on molecular-genetic peculiarities of STEC pathogens. Our aim was to describe a food-borne outbreak as hemorrhagic colitis (HC) along with hemolytic uremic syndrome (HUS), enterocolitis, and acute gastroenteritis in children in St. Petersburg in 2013. Epidemiological, microbiological, molecular-genetic and bioinformatic methods were applied. Objects to study were clinical specimens, milk and food samples, as well as STEC strains isolated during the outbreak. The outbreak of food-borne infection was found to be caused by STEC-contaminated raw milk as confirmed by epidemiological analysis, detection of STEC DNA and isolation of relevant pathogens in milk and sick children fecal specimens. The whole-genome sequencing revealed two groups ofpathogens, E. coli O157:H7 and E. coli O101:H33 among collected strains. Group I strains were attributed to the previously known sequence type ST24, while group II strains belonged to the previously non-described sequence type ST145. In strain genomes of both groups there were identified nucleotide sequences of VT2-like prophage carrying stx2c gene, plasmid enterohemolysin gene, and gene of the STEC main adhesion factor intimin. Gene of intimin gamma was identified in E. coli O157:H7 strains and intimin iota 2 in E. coli O101:H33 strains. The latter previously was identified only in enteropathogenic E. coli (EPEC) strains. The additional knowledge of epidemiology and biology of STEC pathogens would assist clinicians and epidemiologists in diagnosing, treating and preventing hemorrhagic colitis.
Hiett, Kelli L; Rothrock, Michael J; Seal, Bruce S
2013-09-01
The complete nucleotide sequence was determined for a cryptic plasmid, pTIW94, recovered from several Campylobacter jejuni isolates from wild birds in the southeastern United States. pTIW94 is a circular molecule of 3860 nucleotides, with a G+C content (31.0%) similar to that of many Campylobacter spp. genomes. A typical origin of replication, with iteron sequences, was identified upstream of DNA sequences that demonstrated similarity to replication initiation proteins. A total of five open reading frames (ORFs) were identified; two of the five ORFs demonstrated significant similarity to plasmid pCC2228-2 found within Campylobacter coli. These two ORFs were similar to essential replication proteins RepA (100%; 26/26 aa identity) and RepB (95%; 327/346 aa identity). A third identified ORF demonstrated significant similarity (99%; 421/424 aa identity) to the MOB protein from C. coli 67-8, originally recovered from swine. The other two identified ORFs were either similar to hypothetical proteins from other Campylobacter spp., or exhibited no significant similarity to any DNA or protein sequence in the GenBank database. Promoter regions (-35 and -10 signal sites), ribosomal binding sites upstream of ORFs, and stem-loop structures were also identified within the plasmid. These results demonstrate that pTIW94 represents a previously un-reported small cryptic plasmid with unique sequences as well as highly similar sequences to other small plasmids found within Campylobacter spp., and that this cryptic plasmid is present among Campylobacter spp. recovered from different genera of wild birds. Copyright © 2013. Published by Elsevier Inc.
Sequence of the chloroplast 16S rRNA gene and its surrounding regions of Chlamydomonas reinhardii.
Dron, M; Rahire, M; Rochaix, J D
1982-01-01
The sequence of a 2 kb DNA fragment containing the chloroplast 16S ribosomal RNA gene from Chlamydomonas reinhardii and its flanking regions has been determined. The algal 16S rRNA sequence (1475 nucleotides) and secondary structure are highly related to those found in bacteria and in the chloroplasts of higher plants. In contrast, the flanking regions are very different. In C. reinhardii the 16S rRNA gene is surrounded by AT rich segments of about 180 bases, which are followed by a long stretch of complementary bases separated from each other by 1833 nucleotides. It is likely that these structures play an important role in the folding and processing of the precursor of 16S rRNA. The primary and secondary structures of the binding sites of two ribosomal proteins in the 16SrRNAs of E. coli and C. reinhardii are considerably related. Images PMID:6296784
Ribosomal protein S14 transcripts are edited in Oenothera mitochondria.
Schuster, W; Unseld, M; Wissinger, B; Brennicke, A
1990-01-01
The gene encoding ribosomal protein S14 (rps14) in Oenothera mitochondria is located upstream of the cytochrome b gene (cob). Sequence analysis of independently derived cDNA clones covering the entire rps14 coding region shows two nucleotides edited from the genomic DNA to the mRNA derived sequences by C to U modifications. A third editing event occurs four nucleotides upstream of the AUG initiation codon and improves a potential ribosome binding site. A CGG codon specifying arginine in a position conserved in evolution between chloroplasts and E. coli as a UGG tryptophan codon is not edited in any of the cDNAs analysed. An inverted repeat 3' of an unidentified open reading frame is located upstream of the rps14 gene. The inverted repeat sequence is highly conserved at analogous regions in other Oenothera mitochondrial loci. Images PMID:2326162
Wylie, J L; Worobec, E A
1994-03-01
OprB is a glucose-selective porin known to be produced by Pseudomonas aeruginosa and Pseudomonas putida. We have cloned and sequenced the oprB gene of P. aeruginosa and obtained expression of OprB in Escherichia coli. The mature protein consists of 423 amino acid residues with a deduced molecular mass of 47597 Da. Several clusters of amino acid residues, potentially involved in the structure or function of the protein, were identified. An area of regional homology with E. coli LamB was also identified. Carbohydrate-inducible proteins, potentially homologous to OprB, were identified in several rRNA homology-group-I pseudomonads by sodium dodecyl sulfate/polyacrylamide gel electrophoresis analysis, Western immunoblotting and N-terminal amino acid sequencing. These species also contained DNA that hybridized to a P. aeruginosa oprB gene probe.
Gallium plasmonic nanoparticles for label-free DNA and single nucleotide polymorphism sensing
NASA Astrophysics Data System (ADS)
Marín, Antonio García; García-Mendiola, Tania; Bernabeu, Cristina Navio; Hernández, María Jesús; Piqueras, Juan; Pau, Jose Luis; Pariente, Félix; Lorenzo, Encarnación
2016-05-01
A label-free DNA and single nucleotide polymorphism (SNP) sensing method is described. It is based on the use of the pseudodielectric function of gallium plasmonic nanoparticles (GaNPs) deposited on Si (100) substrates under reversal of the polarization handedness condition. Under this condition, the pseudodielectric function is extremely sensitive to changes in the surrounding medium of the nanoparticle surface providing an excellent sensing platform competitive to conventional surface plasmon resonance. DNA sensing has been carried out by immobilizing a thiolated capture probe sequence from Helicobacter pylori onto GaNP/Si substrates; complementary target sequences of Helicobacter pylori can be quantified over the range of 10 pM to 3.0 nM with a detection limit of 6.0 pM and a linear correlation coefficient of R2 = 0.990. The selectivity of the device allows the detection of a single nucleotide polymorphism (SNP) in a specific sequence of Helicobacter pylori, without the need for a hybridization suppressor in solution such as formamide. Furthermore, it also allows the detection of this sequence in the presence of other pathogens, such as Escherichia coli in the sample. The broad applicability of the system was demonstrated by the detection of a specific gene mutation directly associated with cystic fibrosis in large genomic DNA isolated from blood cells.A label-free DNA and single nucleotide polymorphism (SNP) sensing method is described. It is based on the use of the pseudodielectric function of gallium plasmonic nanoparticles (GaNPs) deposited on Si (100) substrates under reversal of the polarization handedness condition. Under this condition, the pseudodielectric function is extremely sensitive to changes in the surrounding medium of the nanoparticle surface providing an excellent sensing platform competitive to conventional surface plasmon resonance. DNA sensing has been carried out by immobilizing a thiolated capture probe sequence from Helicobacter pylori onto GaNP/Si substrates; complementary target sequences of Helicobacter pylori can be quantified over the range of 10 pM to 3.0 nM with a detection limit of 6.0 pM and a linear correlation coefficient of R2 = 0.990. The selectivity of the device allows the detection of a single nucleotide polymorphism (SNP) in a specific sequence of Helicobacter pylori, without the need for a hybridization suppressor in solution such as formamide. Furthermore, it also allows the detection of this sequence in the presence of other pathogens, such as Escherichia coli in the sample. The broad applicability of the system was demonstrated by the detection of a specific gene mutation directly associated with cystic fibrosis in large genomic DNA isolated from blood cells. Electronic supplementary information (ESI) available. See DOI: 10.1039/c6nr00926c
CapZyme-Seq Comprehensively Defines Promoter-Sequence Determinants for RNA 5' Capping with NAD.
Vvedenskaya, Irina O; Bird, Jeremy G; Zhang, Yuanchao; Zhang, Yu; Jiao, Xinfu; Barvík, Ivan; Krásný, Libor; Kiledjian, Megerditch; Taylor, Deanne M; Ebright, Richard H; Nickels, Bryce E
2018-05-03
Nucleoside-containing metabolites such as NAD + can be incorporated as 5' caps on RNA by serving as non-canonical initiating nucleotides (NCINs) for transcription initiation by RNA polymerase (RNAP). Here, we report CapZyme-seq, a high-throughput-sequencing method that employs NCIN-decapping enzymes NudC and Rai1 to detect and quantify NCIN-capped RNA. By combining CapZyme-seq with multiplexed transcriptomics, we determine efficiencies of NAD + capping by Escherichia coli RNAP for ∼16,000 promoter sequences. The results define preferred transcription start site (TSS) positions for NAD + capping and define a consensus promoter sequence for NAD + capping: HRRASWW (TSS underlined). By applying CapZyme-seq to E. coli total cellular RNA, we establish that sequence determinants for NCIN capping in vivo match the NAD + -capping consensus defined in vitro, and we identify and quantify NCIN-capped small RNAs (sRNAs). Our findings define the promoter-sequence determinants for NCIN capping with NAD + and provide a general method for analysis of NCIN capping in vitro and in vivo. Copyright © 2018 Elsevier Inc. All rights reserved.
Nishizawa, M; Nishizawa, K
2000-10-01
The tendency for repetitiveness of nucleotides in DNA sequences has been reported for a variety of organisms. We show that the tendency for repetitive use of amino acids is widespread and is observed even for segments conserved between human and Drosophila melanogaster at the level of >50% amino acid identity. This indicates that repetitiveness influences not only the weakly constrained segments but also those sequence segments conserved among phyla. Not only glutamine (Q) but also many of the 20 amino acids show a comparable level of repetitiveness. Repetitiveness in bases at codon position 3 is stronger for human than for D.melanogaster, whereas local repetitiveness in intron sequences is similar between the two organisms. While genes for immune system-specific proteins, but not ancient human genes (i.e. human homologs of Escherichia coli genes), have repetitiveness at codon bases 1 and 2, repetitiveness at codon base 3 for these groups is similar, suggesting that the human genome has at least two mechanisms generating local repetitiveness. Neither amino acid nor nucleotide repetitiveness is observed beyond the exon boundary, denying the possibility that such repetitiveness could mainly stem from natural selection on mRNA or protein sequences. Analyses of mammalian sequence alignments show that while the 'between gene' GC content heterogeneity, which is linked to 'isochores', is a principal factor associated with the bias in substitution patterns in human, 'within gene' heterogeneity in nucleotide composition is also associated with such bias on a more local scale. The relationship amongst the various types of repetitiveness is discussed.
Nishizawa, Manami; Nishizawa, Kazuhisa
2000-01-01
The tendency for repetitiveness of nucleotides in DNA sequences has been reported for a variety of organisms. We show that the tendency for repetitive use of amino acids is widespread and is observed even for segments conserved between human and Drosophila melanogaster at the level of >50% amino acid identity. This indicates that repetitiveness influences not only the weakly constrained segments but also those sequence segments conserved among phyla. Not only glutamine (Q) but also many of the 20 amino acids show a comparable level of repetitiveness. Repetitiveness in bases at codon position 3 is stronger for human than for D.melanogaster, whereas local repetitiveness in intron sequences is similar between the two organisms. While genes for immune system-specific proteins, but not ancient human genes (i.e. human homologs of Escherichia coli genes), have repetitiveness at codon bases 1 and 2, repetitiveness at codon base 3 for these groups is similar, suggesting that the human genome has at least two mechanisms generating local repetitiveness. Neither amino acid nor nucleotide repetitiveness is observed beyond the exon boundary, denying the possibility that such repetitiveness could mainly stem from natural selection on mRNA or protein sequences. Analyses of mammalian sequence alignments show that while the ‘between gene’ GC content heterogeneity, which is linked to ‘isochores’, is a principal factor associated with the bias in substitution patterns in human, ‘within gene’ heterogeneity in nucleotide composition is also associated with such bias on a more local scale. The relationship amongst the various types of repetitiveness is discussed. PMID:11000273
Enterobacteria identification and detection of diarrheagenic Escherichia coli in a Port Complex
Costa, Clarissa Frota Macatrão; Neto, Valério Monteiro; Santos, Bruno Rafael de Carvalho; Costa, Bruno Rafael Rabelo; Azevedo, Alexandre; Serra, Josilene Lima; Mendes, Hermínio Benítez Rabello; Nascimento, Adenilde Ribeiro; Mendes, Mariana Bonfim Pinto; Kuppinger, Oliver
2014-01-01
The Port Complex of Maranhão (PCM) is the second largest port complex in Brazil, receiving ships with large volumes of ballast water. To evaluate the microbiological quality of its waters, physicochemical parameters (pH and salinity), the number of coliforms (thermotolerants and totals), and the presence of enterobacterias and diarrheagenic Escherichia coli strains were analyzed. In order to identify the presence of E. coli virulence genes target regions of the stx, elt, est, aggR, CVD432, ipaH and eae nucleotide sequences were studied. The presence of totals and thermotolerants coliforms were positive. Analyzing the salinity parameter, a significant increase in total coliforms was observed during the rainy season. We identified the species Escherichia coli, Proteus mirabilis, Citrobacter freundii, Proteus vulgaris, Klebsiella pneumoniae, Klebsiella ozaenae, Morganella morganii, Enterobacter cloacae and Edwardsiella tarda. Out of the 51 E. coli isolated, two were positive for the elt gene and one was positive for the CVD432 sequence, features of enterotoxigenic and enteroaggregative strains, respectively. This study reveals that the PCM is contaminated by enterobacteria and diarrheagenic E.coli thus providing evidence regarding the risk of these bacteria being carried by ships to other countries, and draws attention to the input of fecal bacteria brought by ships in the port waters of Maranhão. PMID:25477930
DNA binding site characterization by means of Rényi entropy measures on nucleotide transitions.
Perera, A; Vallverdu, M; Claria, F; Soria, J M; Caminal, P
2008-06-01
In this work, parametric information-theory measures for the characterization of binding sites in DNA are extended with the use of transitional probabilities on the sequence. We propose the use of parametric uncertainty measures such as Rényi entropies obtained from the transition probabilities for the study of the binding sites, in addition to nucleotide frequency-based Rényi measures. Results are reported in this work comparing transition frequencies (i.e., dinucleotides) and base frequencies for Shannon and parametric Rényi entropies for a number of binding sites found in E. Coli, lambda and T7 organisms. We observe that the information provided by both approaches is not redundant. Furthermore, under the presence of noise in the binding site matrix we observe overall improved robustness of nucleotide transition-based algorithms when compared with nucleotide frequency-based method.
Stoesser, N; Sheppard, A E; Moore, C E; Golubchik, T; Parry, C M; Nget, P; Saroeun, M; Day, N P J; Giess, A; Johnson, J R; Peto, T E A; Crook, D W; Walker, A S
2015-07-01
Studies of the transmission epidemiology of antimicrobial-resistant Escherichia coli, such as strains harboring extended-spectrum beta-lactamase (ESBL) genes, frequently use selective culture of rectal surveillance swabs to identify isolates for molecular epidemiological investigation. Typically, only single colonies are evaluated, which risks underestimating species diversity and transmission events. We sequenced the genomes of 16 E. coli colonies from each of eight fecal samples (n = 127 genomes; one failure), taken from different individuals in Cambodia, a region of high ESBL-producing E. coli prevalence. Sequence data were used to characterize both the core chromosomal diversity of E. coli isolates and their resistance/virulence gene content as a proxy measure of accessory genome diversity. The 127 E. coli genomes represented 31 distinct sequence types (STs). Seven (88%) of eight subjects carried ESBL-positive isolates, all containing blaCTX-M variants. Diversity was substantial, with a median of four STs/individual (range, 1 to 10) and wide genetic divergence at the nucleotide level within some STs. In 2/8 (25%) individuals, the same blaCTX-M variant occurred in different clones, and/or different blaCTX-M variants occurred in the same clone. Patterns of other resistance genes and common virulence factors, representing differences in the accessory genome, were also diverse within and between clones. The substantial diversity among intestinally carried ESBL-positive E. coli bacteria suggests that fecal surveillance, particularly if based on single-colony subcultures, will likely underestimate transmission events, especially in high-prevalence settings. Copyright © 2015, Stoesser et al.
Control of total GFP expression by alterations to the 3′ region nucleotide sequence
2013-01-01
Background Previously, we distinguished the Escherichia coli type II cytoplasmic membrane translocation pathways of Tat, Yid, and Sec for unfolded and folded soluble target proteins. The translocation of folded protein to the periplasm for soluble expression via the Tat pathway was controlled by an N-terminal hydrophilic leader sequence. In this study, we investigated the effect of the hydrophilic C-terminal end and its nucleotide sequence on total and soluble protein expression. Results The native hydrophilic C-terminal end of GFP was obtained by deleting the C-terminal peptide LeuGlu-6×His, derived from pET22b(+). The corresponding clones induced total and soluble GFP expression that was either slightly increased or dramatically reduced, apparently through reconstruction of the nucleotide sequence around the stop codon in the 3′ region. In the expression-induced clones, the hydrophilic C-terminus showed increased Tat pathway specificity for soluble expression. However, in the expression-reduced clone, after analyzing the role of the 5′ poly(A) coding sequence with a substituted synonymous codon, we proved that the longer 5′ poly(A) coding sequence interacted with the reconstructed 3′ region nucleotide sequence to create a new mRNA tertiary structure between the 5′ and 3′ regions, which resulted in reduced total GFP expression. Further, to recover the reduced expression by changing the 3′ nucleotide sequence, after replacing selected C-terminal 5′ codons and the stop codon in the ORF with synonymous codons, total GFP expression in most of the clones was recovered to the undeleted control level. The insertion of trinucleotides after the stop codon in the 3′-UTR recovered or reduced total GFP expression. RT-PCR revealed that the level of total protein expression was controlled by changes in translational or transcriptional regulation, which were induced or reduced by the substitution or insertion of 3′ region nucleotides. Conclusions We found that the hydrophilic C-terminal end of GFP increased Tat pathway specificity and that the 3′ nucleotide sequence played an important role in total protein expression through translational and transcriptional regulation. These findings may be useful for efficiently producing recombinant proteins as well as for potentially controlling the expression level of specific genes in the body for therapeutic purposes. PMID:23834827
L'Abée-Lund, Trine M; Jørgensen, Hannah J; O'Sullivan, Kristin; Bohlin, Jon; Ligård, Goro; Granum, Per Einar; Lindbäck, Toril
2012-01-01
In 2006, a severe foodborne EHEC outbreak occured in Norway. Seventeen cases were recorded and the HUS frequency was 60%. The causative strain, Esherichia coli O103:H25, is considered to be particularly virulent. Sequencing of the outbreak strain revealed resemblance to the 2011 German outbreak strain E. coli O104:H4, both in genome and Shiga toxin 2-encoding (Stx2) phage sequence. The nucleotide identity between the Stx2 phages from the Norwegian and German outbreak strains was 90%. During the 2006 outbreak, stx(2)-positive O103:H25 E. coli was isolated from two patients. All the other outbreak associated isolates, including all food isolates, were stx-negative, and carried a different phage replacing the Stx2 phage. This phage was of similar size to the Stx2 phage, but had a distinctive early phage region and no stx gene. The sequence of the early region of this phage was not retrieved from the bacterial host genome, and the origin of the phage is unknown. The contaminated food most likely contained a mixture of E. coli O103:H25 cells with either one of the phages.
L'Abée-Lund, Trine M.; Jørgensen, Hannah J.; O'Sullivan, Kristin; Bohlin, Jon; Ligård, Goro; Granum, Per Einar; Lindbäck, Toril
2012-01-01
In 2006, a severe foodborne EHEC outbreak occured in Norway. Seventeen cases were recorded and the HUS frequency was 60%. The causative strain, Esherichia coli O103:H25, is considered to be particularly virulent. Sequencing of the outbreak strain revealed resemblance to the 2011 German outbreak strain E. coli O104:H4, both in genome and Shiga toxin 2-encoding (Stx2) phage sequence. The nucleotide identity between the Stx2 phages from the Norwegian and German outbreak strains was 90%. During the 2006 outbreak, stx2-positive O103:H25 E. coli was isolated from two patients. All the other outbreak associated isolates, including all food isolates, were stx-negative, and carried a different phage replacing the Stx2 phage. This phage was of similar size to the Stx2 phage, but had a distinctive early phage region and no stx gene. The sequence of the early region of this phage was not retrieved from the bacterial host genome, and the origin of the phage is unknown. The contaminated food most likely contained a mixture of E. coli O103:H25 cells with either one of the phages. PMID:22403614
Bryant, D A; de Lorimier, R; Lambert, D H; Dubbs, J M; Stirewalt, V L; Stevens, S E; Porter, R D; Tam, J; Jay, E
1985-01-01
The genes for the alpha- and beta-subunit apoproteins of allophycocyanin (AP) were isolated from the cyanelle genome of Cyanophora paradoxa and subjected to nucleotide sequence analysis. The AP beta-subunit apoprotein gene was localized to a 7.8-kilobase-pair Pst I restriction fragment from cyanelle DNA by hybridization with a tetradecameric oligonucleotide probe. Sequence analysis using that oligonucleotide and its complement as primers for the dideoxy chain-termination sequencing method confirmed the presence of both AP alpha- and beta-subunit genes on this restriction fragment. Additional oligonucleotide primers were synthesized as sequencing progressed and were used to determine rapidly the nucleotide sequence of a 1336-base-pair region of this cloned fragment. This strategy allowed the sequencing to be completed without a detailed restriction map and without extensive and time-consuming subcloning. The sequenced region contains two open reading frames whose deduced amino acid sequences are 81-85% homologous to cyanobacterial and red algal AP subunits whose amino acid sequences have been determined. The two open reading frames are in the same orientation and are separated by 39 base pairs. AP alpha is 5' to AP beta and both coding sequences are preceded by a polypurine, Shine-Dalgarno-type sequence. Sequences upstream from AP alpha closely resemble the Escherichia coli consensus promoter sequences and also show considerable homology to promoter sequences for several chloroplast-encoded psbA genes. A 56-base-pair palindromic sequence downstream from the AP beta gene could play a role in the termination of transcription or translation. The allophycocyanin apoprotein subunit genes are located on the large single-copy region of the cyanelle genome. PMID:2987916
N6-Methylation Assessment in Escherichia coli 23S rRNA Utilizing a Bulge Loop in an RNA-DNA Hybrid.
Yoshioka, Kyoko; Kurita, Ryoji
2018-06-07
We propose a sequence-selective assay of N6-methyl-adenosine (m6A) in RNA without PCR or reverse transcription, by employing a hybridization assay with a DNA probe designed to form a bulge loop at the position of a target modified nucleotide. The m6A in the bulge in the RNA-DNA hybrid was assumed to be sufficiently mobile to be selectively recognized by an anti-m6A antibody with a high affinity. By employing a surface-plasmon-resonance measurement or using a microtiter-plate immunoassay method, a specific m6A in the Escherichia coli 23S rRNA sequence could be detected at the nanomolar level when synthesized and purified oligo-RNA fragments were used for measurement. We have successfully achieved the first selective detection of m6A 2030 specifically in 23S rRNA from real samples of E. coli total RNA by using our immunochemical approach.
The complete nucleotide sequence of RNA 3 of a peach isolate of Prunus necrotic ringspot virus.
Hammond, R W; Crosslin, J M
1995-04-01
The complete nucleotide sequence of RNA 3 of the PE-5 peach isolate of Prunus necrotic ringspot ilarvirus (PNRSV) was obtained from cloned cDNA. The RNA sequence is 1941 nucleotides and contains two open reading frames (ORFs). ORF 1 consisted of 284 amino acids with a calculated molecular weight of 31,729 Da and ORF 2 contained 224 amino acids with a calculated molecular weight of 25,018 Da. ORF 2 corresponds to the coat protein gene. Expression of ORF 2 engineered into a pTrcHis vector in Escherichia coli results in a fusion polypeptide of approximately 28 kDa which cross-reacts with PNRSV polyclonal antiserum. Analysis of the coat protein amino acid sequence reveals a putative "zinc-finger" domain at the amino-terminal portion of the protein. Two tetranucleotide AUGC motifs occur in the 3'-UTR of the RNA and may function in coat protein binding and genome activation. ORF 1 homologies to other ilarviruses and alfalfa mosaic virus are confined to limited regions of conserved amino acids. The translated amino acid sequence of the coat protein gene shows 92% similarity to one isolate of apple mosaic virus, a closely related member of the ilarvirus group of plant viruses, but only 66% similarity to the amino acid sequence of the coat protein gene of a second isolate. These relationships are also reflected at the nucleotide sequence level. These results in one instance confirm the close similarities observed at the biophysical and serological levels between these two viruses, but on the other hand call into question the nomenclature used to describe these viruses.
Chiu, Chi-Chien; John, Joseph Abraham Christopher; Hseu, Tzong-Hsiung; Chang, Chi-Yao
2002-03-01
The pituitary-specific transcription factor Pit-1 belongs to the family of POU-domain proteins and is known to play an important role in the differentiation of pituitary cells. Here we report the complete nucleotide sequence of cDNA encoding Pit-1 from the brackish water fish, ayu (Plecoglossus altivelis). Nucleotide sequence analysis of 1910 bp of ayu Pit-1 cDNA revealed an open reading frame of 1074 bp that encodes a protein of 358 amino acids containing a POU-specific domain, POU homeodomain, and an STA (Ser/Thr-rich activation) transactivation domain. We inserted the coding region of Pit-1 cDNA, obtained by PCR, into a pET-20b(+) plasmid to produce recombinant Pit-1 in Escherichia coli BL21 (DE3) pLysS cells. Upon induction with isopropyl beta-D-thiogalactopyranoside, Pit-1 was expressed and accumulated as inclusion bodies in E. coli. The protein was then purified in one step by affinity chromatography on a nickel-nitrilotriacetic acid agarose column under denaturing conditions. This method yielded 0.7 mg of highly pure and stable protein per 200 ml of bacterial culture. A band of 40 kDa, resolved as recombinant ayu Pit-1 by sodium dodecyl sulfate-polyacrylamide gel electrophoresis, agrees well with the molecular mass calculated from the translated cDNA sequence. The purified recombinant Pit-1 was confirmed in vitro through Western blot analysis, using its monoclonal antibody. This monoclonal antibody detected Pit-1 in the nuclei of ayu developing pituitary by immunohistochemical reaction. It serves as a good reagent for the detection of ayu Pit-1 in situ. Copyright 2002 Elsevier Science (USA).
Specificity and Evolutionary Conservation of the Escherichia coli RNA Pyrophosphohydrolase RppH*
Foley, Patricia L.; Hsieh, Ping-kun; Luciano, Daniel J.; Belasco, Joel G.
2015-01-01
Bacterial RNA degradation often begins with conversion of the 5′-terminal triphosphate to a monophosphate by the RNA pyrophosphohydrolase RppH, an event that triggers rapid ribonucleolytic attack. Besides its role as the master regulator of 5′-end-dependent mRNA decay, RppH is important for the ability of pathogenic bacteria to invade host cells, yet little is known about how it chooses its targets. Here, we show that Escherichia coli RppH (EcRppH) requires at least two unpaired nucleotides at the RNA 5′ end and prefers three or more such nucleotides. It can tolerate any nucleotide at the first three positions but has a modest preference for A at the 5′ terminus and either a G or A at the second position. Mutational analysis has identified EcRppH residues crucial for substrate recognition or catalysis. The promiscuity of EcRppH differentiates it from its Bacillus subtilis counterpart, which has a strict RNA sequence requirement. EcRppH orthologs likely to share its relaxed sequence specificity are widespread in all classes of Proteobacteria, except Deltaproteobacteria, and in flowering plants. By contrast, the phylogenetic range of recognizable B. subtilis RppH orthologs appears to be restricted to the order Bacillales. These findings help to explain the selective influence of RppH on bacterial mRNA decay and show that RppH-dependent degradation has diversified significantly during the course of evolution. PMID:25657006
Specificity and evolutionary conservation of the Escherichia coli RNA pyrophosphohydrolase RppH.
Foley, Patricia L; Hsieh, Ping-kun; Luciano, Daniel J; Belasco, Joel G
2015-04-10
Bacterial RNA degradation often begins with conversion of the 5'-terminal triphosphate to a monophosphate by the RNA pyrophosphohydrolase RppH, an event that triggers rapid ribonucleolytic attack. Besides its role as the master regulator of 5'-end-dependent mRNA decay, RppH is important for the ability of pathogenic bacteria to invade host cells, yet little is known about how it chooses its targets. Here, we show that Escherichia coli RppH (EcRppH) requires at least two unpaired nucleotides at the RNA 5' end and prefers three or more such nucleotides. It can tolerate any nucleotide at the first three positions but has a modest preference for A at the 5' terminus and either a G or A at the second position. Mutational analysis has identified EcRppH residues crucial for substrate recognition or catalysis. The promiscuity of EcRppH differentiates it from its Bacillus subtilis counterpart, which has a strict RNA sequence requirement. EcRppH orthologs likely to share its relaxed sequence specificity are widespread in all classes of Proteobacteria, except Deltaproteobacteria, and in flowering plants. By contrast, the phylogenetic range of recognizable B. subtilis RppH orthologs appears to be restricted to the order Bacillales. These findings help to explain the selective influence of RppH on bacterial mRNA decay and show that RppH-dependent degradation has diversified significantly during the course of evolution. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.
Unveiling the Hybrid Genome Structure of Escherichia coli RR1 (HB101 RecA+)
Jeong, Haeyoung; Sim, Young Mi; Kim, Hyun Ju; Lee, Sang Jun
2017-01-01
There have been extensive genome sequencing studies for Escherichia coli strains, particularly for pathogenic isolates, because fast determination of pathogenic potential and/or drug resistance and their propagation routes is crucial. For laboratory E. coli strains, however, genome sequence information is limited except for several well-known strains. We determined the complete genome sequence of laboratory E. coli strain RR1 (HB101 RecA+), which has long been used as a general cloning host. A hybrid genome sequence of K-12 MG1655 and B BL21(DE3) was constructed based on the initial mapping of Illumina HiSeq reads to each reference, and iterative rounds of read mapping, variant detection, and consensus extraction were carried out. Finally, PCR and Sanger sequencing-based finishing were applied to resolve non-single nucleotide variant regions with aberrant read depths and breakpoints, most of them resulting from prophages and insertion sequence transpositions that are not present in the reference genome sequence. We found that 96.9% of the RR1 genome is derived from K-12, and identified exact crossover junctions between K-12 and B genomic fragments. However, because RR1 has experienced a series of genetic manipulations since branching from the common ancestor, it has a set of mutations different from those found in K-12 MG1655. As well as identifying all known genotypes of RR1 on the basis of genomic context, we found novel mutations. Our results extend current knowledge of the genotype of RR1 and its relatives, and provide insights into the pedigree, genomic background, and physiology of common laboratory strains. PMID:28421066
Ishii, Y; Ohno, A; Taguchi, H; Imajo, S; Ishiguro, M; Matsuzawa, H
1995-01-01
Escherichia coli TUH12191, which is resistant to piperacillin, cefazolin, cefotiam, ceftizoxime, cefuzonam, and aztreonam but is susceptible to cefoxitin, latamoxef, flomoxef, and imipenem, was isolated from the urine of a patient treated with beta-lactam antibiotics. The beta-lactamase (Toho-1) purified from the bacteria had a pI of 7.8, had a molecular weight of about 29,000, and hydrolyzed beta-lactam antibiotics such as penicillin G, ampicillin, oxacillin, carbenicillin, piperacillin, cephalothin, cefoxitin, cefotaxime, ceftazidime, and aztreonam. Toho-1 was markedly inhibited by beta-lactamase inhibitors such as clavulanic acid and tazobactam. Resistance to beta-lactams, streptomycin, spectinomycin, sulfamethoxazole, and trimethoprim was transferred by conjugational transfer from E. coli TUH12191 to E. coli ML4903, and the transferred plasmid was about 58 kbp, belonging to incompatibility group M. The cefotaxime resistance gene for Toho-1 was subcloned from the 58-kbp plasmid by transformation of E. coli MV1184. The sequence of the gene for Toho-1 was determined, and the open reading frame of the gene consisted of 873 or 876 bases (initial sequence, ATGATG). The nucleotide sequence of the gene (DDBJ accession number D37830) was found to be about 73% homologous to the sequence of the gene encoding a class A beta-lactamase produced by Klebsiella oxytoca E23004. According to the amino acid sequence deduced from the DNA sequence, the precursor consisted of 290 or 291 amino acid residues, which contained amino acid motifs common to class A beta-lactamases (70SXXK, 130SDN, and 234KTG). Toho-1 was about 83% homologous to the beta-lactamase mediated by the chromosome of K. oxytoca D488 and the beta-lactamase mediated by the plasmid of E. coli MEN-1. Therefore, the newly isolated beta-lactamase Toho-1 produced by E. coli TUH12191 is similar to beta-lactamases produced by K. oxytoca D488, K. oxytoca E23004, and E. coli MEN-1 rather than to mutants of TEM or SHV enzymes. Toho-1 has shown the highest degree of similarity to K. oxytoca class A beta-lactamase. Detailed comparison of Toho-1 with other beta-lactamases implied that replacement of Asn-276 by Arg with the concomitant substitution of Thr for Arg-244 is an important mutation in the extension of the substrate specificity. PMID:8619581
Rodas, Claudia; Klena, John D.; Nicklasson, Matilda; Iniguez, Volga; Sjöling, Åsa
2011-01-01
Background Enterotoxigenic Escherichia coli (ETEC) is a major cause of traveller's and infantile diarrhoea in the developing world. ETEC produces two toxins, a heat-stable toxin (known as ST) and a heat-labile toxin (LT) and colonization factors that help the bacteria to attach to epithelial cells. Methodology/Principal Findings In this study, we characterized a subset of ETEC clinical isolates recovered from Bolivian children under 5 years of age using a combination of multilocus sequence typing (MLST) analysis, virulence typing, serotyping and antimicrobial resistance test patterns in order to determine the genetic background of ETEC strains circulating in Bolivia. We found that strains expressing the heat-labile (LT) enterotoxin and colonization factor CS17 were common and belonged to several MLST sequence types but mainly to sequence type-423 and sequence type-443 (Achtman scheme). To further study the LT/CS17 strains we analysed the nucleotide sequence of the CS17 operon and compared the structure to LT/CS17 ETEC isolates from Bangladesh. Sequence analysis confirmed that all sequence type-423 strains from Bolivia had a single nucleotide polymorphism; SNPbol in the CS17 operon that was also found in some other MLST sequence types from Bolivia but not in strains recovered from Bangladeshi children. The dominant ETEC clone in Bolivia (sequence type-423/SNPbol) was found to persist over multiple years and was associated with severe diarrhoea but these strains were variable with respect to antimicrobial resistance patterns. Conclusion/Significance The results showed that although the LT/CS17 phenotype is common among ETEC strains in Bolivia, multiple clones, as determined by unique MLST sequence types, populate this phenotype. Our data also appear to suggest that acquisition and loss of antimicrobial resistance in LT-expressing CS17 ETEC clones is more dynamic than acquisition or loss of virulence factors. PMID:22140423
Rodas, Claudia; Klena, John D; Nicklasson, Matilda; Iniguez, Volga; Sjöling, Asa
2011-01-01
Enterotoxigenic Escherichia coli (ETEC) is a major cause of traveller's and infantile diarrhoea in the developing world. ETEC produces two toxins, a heat-stable toxin (known as ST) and a heat-labile toxin (LT) and colonization factors that help the bacteria to attach to epithelial cells. In this study, we characterized a subset of ETEC clinical isolates recovered from Bolivian children under 5 years of age using a combination of multilocus sequence typing (MLST) analysis, virulence typing, serotyping and antimicrobial resistance test patterns in order to determine the genetic background of ETEC strains circulating in Bolivia. We found that strains expressing the heat-labile (LT) enterotoxin and colonization factor CS17 were common and belonged to several MLST sequence types but mainly to sequence type-423 and sequence type-443 (Achtman scheme). To further study the LT/CS17 strains we analysed the nucleotide sequence of the CS17 operon and compared the structure to LT/CS17 ETEC isolates from Bangladesh. Sequence analysis confirmed that all sequence type-423 strains from Bolivia had a single nucleotide polymorphism; SNP(bol) in the CS17 operon that was also found in some other MLST sequence types from Bolivia but not in strains recovered from Bangladeshi children. The dominant ETEC clone in Bolivia (sequence type-423/SNP(bol)) was found to persist over multiple years and was associated with severe diarrhoea but these strains were variable with respect to antimicrobial resistance patterns. The results showed that although the LT/CS17 phenotype is common among ETEC strains in Bolivia, multiple clones, as determined by unique MLST sequence types, populate this phenotype. Our data also appear to suggest that acquisition and loss of antimicrobial resistance in LT-expressing CS17 ETEC clones is more dynamic than acquisition or loss of virulence factors.
Qiu, T; Lu, R H; Zhang, J; Zhu, Z Y
2001-07-01
The complete nucleotide sequence of M6 gene of grass carp hemorrhage virus (GCHV) was determined. It is 2039 nucleotides in length and contains a single large open reading frame that could encode a protein of 648 amino acids with predicted molecular mass of 68.7 kDa. Amino acid sequence comparison revealed that the protein encoded by GCHV M6 is closely related to the protein mu1 of mammalian reovirus. The M6 gene, encoding the major outer-capsid protein, was expressed using the pET fusion protein vector in Escherichia coli and detected by Western blotting using chicken anti-GCHV immunoglobulin (IgY). The result indicates that the protein encoded by M6 may share a putative Asn-42-Pro-43 proteolytic cleavage site with mu1.
Holmes, Anne; Allison, Lesley; Ward, Melissa; Dallman, Timothy J; Clark, Richard; Fawkes, Angie; Murphy, Lee; Hanson, Mary
2015-11-01
Detailed laboratory characterization of Escherichia coli O157 is essential to inform epidemiological investigations. This study assessed the utility of whole-genome sequencing (WGS) for outbreak detection and epidemiological surveillance of E. coli O157, and the data were used to identify discernible associations between genotypes and clinical outcomes. One hundred five E. coli O157 strains isolated over a 5-year period from human fecal samples in Lothian, Scotland, were sequenced with the Ion Torrent Personal Genome Machine. A total of 8,721 variable sites in the core genome were identified among the 105 isolates; 47% of the single nucleotide polymorphisms (SNPs) were attributable to six "atypical" E. coli O157 strains and included recombinant regions. Phylogenetic analyses showed that WGS correlated well with the epidemiological data. Epidemiological links existed between cases whose isolates differed by three or fewer SNPs. WGS also correlated well with multilocus variable-number tandem repeat analysis (MLVA) typing data, with only three discordant results observed, all among isolates from cases not known to be epidemiologically related. WGS produced a better-supported, higher-resolution phylogeny than MLVA, confirming that the method is more suitable for epidemiological surveillance of E. coli O157. A combination of in silico analyses (VirulenceFinder, ResFinder, and local BLAST searches) were used to determine stx subtypes, multilocus sequence types (15 loci), and the presence of virulence and acquired antimicrobial resistance genes. There was a high level of correlation between the WGS data and our routine typing methods, although some discordant results were observed, mostly related to the limitation of short sequence read assembly. The data were used to identify sublineages and clades of E. coli O157, and when they were correlated with the clinical outcome data, they showed that one clade, Ic3, was significantly associated with severe disease. Together, the results show that WGS data can provide higher resolution of the relationships between E. coli O157 isolates than that provided by MLVA. The method has the potential to streamline the laboratory workflow and provide detailed information for the clinical management of patients and public health interventions. Copyright © 2015, Holmes et al.
Allison, Lesley; Ward, Melissa; Dallman, Timothy J.; Clark, Richard; Fawkes, Angie; Murphy, Lee; Hanson, Mary
2015-01-01
Detailed laboratory characterization of Escherichia coli O157 is essential to inform epidemiological investigations. This study assessed the utility of whole-genome sequencing (WGS) for outbreak detection and epidemiological surveillance of E. coli O157, and the data were used to identify discernible associations between genotypes and clinical outcomes. One hundred five E. coli O157 strains isolated over a 5-year period from human fecal samples in Lothian, Scotland, were sequenced with the Ion Torrent Personal Genome Machine. A total of 8,721 variable sites in the core genome were identified among the 105 isolates; 47% of the single nucleotide polymorphisms (SNPs) were attributable to six “atypical” E. coli O157 strains and included recombinant regions. Phylogenetic analyses showed that WGS correlated well with the epidemiological data. Epidemiological links existed between cases whose isolates differed by three or fewer SNPs. WGS also correlated well with multilocus variable-number tandem repeat analysis (MLVA) typing data, with only three discordant results observed, all among isolates from cases not known to be epidemiologically related. WGS produced a better-supported, higher-resolution phylogeny than MLVA, confirming that the method is more suitable for epidemiological surveillance of E. coli O157. A combination of in silico analyses (VirulenceFinder, ResFinder, and local BLAST searches) were used to determine stx subtypes, multilocus sequence types (15 loci), and the presence of virulence and acquired antimicrobial resistance genes. There was a high level of correlation between the WGS data and our routine typing methods, although some discordant results were observed, mostly related to the limitation of short sequence read assembly. The data were used to identify sublineages and clades of E. coli O157, and when they were correlated with the clinical outcome data, they showed that one clade, Ic3, was significantly associated with severe disease. Together, the results show that WGS data can provide higher resolution of the relationships between E. coli O157 isolates than that provided by MLVA. The method has the potential to streamline the laboratory workflow and provide detailed information for the clinical management of patients and public health interventions. PMID:26354815
Higashi, Koichi; Tobe, Toru; Kanai, Akinori; Uyar, Ebru; Ishikawa, Shu; Suzuki, Yutaka; Ogasawara, Naotake; Kurokawa, Ken; Oshima, Taku
2016-01-01
Bacteria can acquire new traits through horizontal gene transfer. Inappropriate expression of transferred genes, however, can disrupt the physiology of the host bacteria. To reduce this risk, Escherichia coli expresses the nucleoid-associated protein, H-NS, which preferentially binds to horizontally transferred genes to control their expression. Once expression is optimized, the horizontally transferred genes may actually contribute to E. coli survival in new habitats. Therefore, we investigated whether and how H-NS contributes to this optimization process. A comparison of H-NS binding profiles on common chromosomal segments of three E. coli strains belonging to different phylogenetic groups indicated that the positions of H-NS-bound regions have been conserved in E. coli strains. The sequences of the H-NS-bound regions appear to have diverged more so than H-NS-unbound regions only when H-NS-bound regions are located upstream or in coding regions of genes. Because these regions generally contain regulatory elements for gene expression, sequence divergence in these regions may be associated with alteration of gene expression. Indeed, nucleotide substitutions in H-NS-bound regions of the ybdO promoter and coding regions have diversified the potential for H-NS-independent negative regulation among E. coli strains. The ybdO expression in these strains was still negatively regulated by H-NS, which reduced the effect of H-NS-independent regulation under normal growth conditions. Hence, we propose that, during E. coli evolution, the conservation of H-NS binding sites resulted in the diversification of the regulation of horizontally transferred genes, which may have facilitated E. coli adaptation to new ecological niches. PMID:26789284
Higashi, Koichi; Tobe, Toru; Kanai, Akinori; Uyar, Ebru; Ishikawa, Shu; Suzuki, Yutaka; Ogasawara, Naotake; Kurokawa, Ken; Oshima, Taku
2016-01-01
Bacteria can acquire new traits through horizontal gene transfer. Inappropriate expression of transferred genes, however, can disrupt the physiology of the host bacteria. To reduce this risk, Escherichia coli expresses the nucleoid-associated protein, H-NS, which preferentially binds to horizontally transferred genes to control their expression. Once expression is optimized, the horizontally transferred genes may actually contribute to E. coli survival in new habitats. Therefore, we investigated whether and how H-NS contributes to this optimization process. A comparison of H-NS binding profiles on common chromosomal segments of three E. coli strains belonging to different phylogenetic groups indicated that the positions of H-NS-bound regions have been conserved in E. coli strains. The sequences of the H-NS-bound regions appear to have diverged more so than H-NS-unbound regions only when H-NS-bound regions are located upstream or in coding regions of genes. Because these regions generally contain regulatory elements for gene expression, sequence divergence in these regions may be associated with alteration of gene expression. Indeed, nucleotide substitutions in H-NS-bound regions of the ybdO promoter and coding regions have diversified the potential for H-NS-independent negative regulation among E. coli strains. The ybdO expression in these strains was still negatively regulated by H-NS, which reduced the effect of H-NS-independent regulation under normal growth conditions. Hence, we propose that, during E. coli evolution, the conservation of H-NS binding sites resulted in the diversification of the regulation of horizontally transferred genes, which may have facilitated E. coli adaptation to new ecological niches.
Environmental Control Of A Genetic Process
NASA Technical Reports Server (NTRS)
Khosla, Chaitan; Bailey, James E.
1991-01-01
E. coli bacteria altered to contain DNA sequence encoding production of hemoglobin made to produce hemoglobin at rates decreasing with increases in concentration of oxygen in culture media. Represents amplification of part of method described in "Cloned Hemoglobin Genes Enhance Growth Of Cells" (NPO-17517). Manipulation of promoter/regulator DNA sequences opens promising new subfield of recombinant-DNA technology for environmental control of expression of selected DNA sequences. New recombinant-DNA fusion gene products, expression vectors, and nucleotide-base sequences will emerge. Likely applications include such aerobic processes as manufacture of cloned proteins and synthesis of metabolites, production of chemicals by fermentation, enzymatic degradation, treatment of wastes, brewing, and variety of oxidative chemical reactions.
Dixit, Ojas V A; O'Brien, Claire L; Pavli, Paul; Gordon, David M
2018-03-01
When a human host harbors two or more strains of Escherichia coli, the second strain is more likely to be a member of the same phylogroup rather than a different phylogroup. This outcome may be the consequence of a within host evolution event or an independent immigration/establishment event. To determine the relative importance of these two events in determining E. coli diversity in a host, a collection of multiple E. coli isolates recovered from each of 67 patients undergoing colonoscopies was used. Whole genome sequence data were available for one example of every REP-fingerprint type identified in a patient. Sequence type (ST) and single-nucleotide polymorphism (SNP) analyses revealed that 83% of strains observed in the host population were a consequence of immigration/establishment events. Restricting the analysis to hosts harboring two or more strains belonging to the same phylogroup revealed that in about half of these cases, the presence of a second strain belonging to the same phylogroup was the consequence of an independent immigration/establishment event. Thus, the results of this study show that despite hosts being exposed to a diversity of E. coli via their food, factors related to the host also determine what E. coli strains succeed in establishing. © 2017 Society for Applied Microbiology and John Wiley & Sons Ltd.
Chernin, L S; De la Fuente, L; Sobolev, V; Haran, S; Vorgias, C E; Oppenheim, A B; Chet, I
1997-01-01
The gene chiA, which codes for endochitinase, was cloned from a soilborne Enterobacter agglomerans. Its complete sequence was determined, and the deduced amino acid sequence of the enzyme designated Chia_Entag yielded an open reading frame coding for 562 amino acids of a 61-kDa precursor protein with a putative leader peptide at its N terminus. The nucleotide and polypeptide sequences of Chia_Entag showed 86.8 and 87.7% identity with the corresponding gene and enzyme, Chia_Serma, of Serratia marcescens, respectively. Homology modeling of Chia_Entag's three-dimensional structure demonstrated that most amino acid substitutions are at solvent-accessible sites. Escherichia coli JM109 carrying the E. agglomerans chiA gene produced and secreted Chia_Entag. The antifungal activity of the secreted endochitinase was demonstrated in vitro by inhibition of Fusarium oxysporum spore germination. The transformed strain inhibited Rhizoctonia solani growth on plates and the root rot disease caused by this fungus in cotton seedlings under greenhouse conditions. PMID:9055404
Aijuka, Matthew; Santiago, Araceli E; Girón, Jorge A; Nataro, James P; Buys, Elna M
2018-08-02
Diarrheagenic E. coli (DEC) has been implicated in foodborne outbreaks worldwide and have been associated with childhood stunting in the absence of diarrhoea. Infection is extraordinarily common, but the routes of transmission have not been determined. Therefore, determining the most prevalent pathotypes in food and environmental sources may help provide better guidance to various stakeholders in ensuring food safety and public health and advancing understanding of the epidemiology of enteric disease. We characterized 205 E. coli strains previously isolated from producer distributor bulk milk (PDBM)(118), irrigation water (48), irrigated lettuce (29) and street vendor coleslaw (10) in South Africa. Enteropathogenic E. coli (EPEC), enterotoxigenic E. coli (ETEC), enteroaggregative E. coli (EAEC) and diffusely adherent E. coli (DAEC) were sought. We used PCR and partial gene sequencing for all 205 strains while 46 out of 205 that showed poor resolution were subsequently characterized using cell adherence (HeLa cells). PCR and partial gene sequencing of aatA and/or aaiC genes confirmed EAEC (2%, 5 out of 205) as the only pathotype. Phylogenetic analysis of sequenced EAEC strains with E. coli strains in GenBank showing ≥80% nucleotide sequence similarity based on possession of aaiC and aatA generated distinct clusters of strains separated predominantly based on their source of isolation (food source or human stool) suggesting a potential role of virulence genes in source tracking. EAEC 24%, 11 out of 46 strains (PDBM = 15%, irrigation water = 7%, irrigated lettuce = 2%) was similarly the predominant pathotype followed by strains showing invasiveness to HeLa cells, 4%, 2 out of 46 (PDBM = 2%, irrigated lettuce = 2%), among stains characterized using cell adherence. Therefore, EAEC may be the leading cause of DEC associated food and water-borne enteric infection in South Africa. Additionally, solely using molecular based methods targeting virulence gene determinants may underestimate prevalence, especially among heterogeneous pathogens such as EAEC. Copyright © 2018 Elsevier B.V. All rights reserved.
Wide distribution of O157-antigen biosynthesis gene clusters in Escherichia coli.
Iguchi, Atsushi; Shirai, Hiroki; Seto, Kazuko; Ooka, Tadasuke; Ogura, Yoshitoshi; Hayashi, Tetsuya; Osawa, Kayo; Osawa, Ro
2011-01-01
Most Escherichia coli O157-serogroup strains are classified as enterohemorrhagic E. coli (EHEC), which is known as an important food-borne pathogen for humans. They usually produce Shiga toxin (Stx) 1 and/or Stx2, and express H7-flagella antigen (or nonmotile). However, O157 strains that do not produce Stxs and express H antigens different from H7 are sometimes isolated from clinical and other sources. Multilocus sequence analysis revealed that these 21 O157:non-H7 strains tested in this study belong to multiple evolutionary lineages different from that of EHEC O157:H7 strains, suggesting a wide distribution of the gene set encoding the O157-antigen biosynthesis in multiple lineages. To gain insight into the gene organization and the sequence similarity of the O157-antigen biosynthesis gene clusters, we conducted genomic comparisons of the chromosomal regions (about 59 kb in each strain) covering the O-antigen gene cluster and its flanking regions between six O157:H7/non-H7 strains. Gene organization of the O157-antigen gene cluster was identical among O157:H7/non-H7 strains, but was divided into two distinct types at the nucleotide sequence level. Interestingly, distribution of the two types did not clearly follow the evolutionary lineages of the strains, suggesting that horizontal gene transfer of both types of O157-antigen gene clusters has occurred independently among E. coli strains. Additionally, detailed sequence comparison revealed that some positions of the repetitive extragenic palindromic (REP) sequences in the regions flanking the O-antigen gene clusters were coincident with possible recombination points. From these results, we conclude that the horizontal transfer of the O157-antigen gene clusters induced the emergence of multiple O157 lineages within E. coli and speculate that REP sequences may involve one of the driving forces for exchange and evolution of O-antigen loci.
Distinctive acceptor-end structure and other determinants of Escherichia coli tRNAPro identity.
McClain, W H; Schneider, J; Gabriel, K
1994-01-01
The previously uncharacterized determinants of the specificity of tRNAPro for aminoacylation (tRNAPro identity) were defined by a computer comparison of all Escherichia coli tRNA sequences and tested by a functional analysis of amber suppressor tRNAs in vivo. We determined the amino acid specificity of tRNA by sequencing a suppressed protein and the aminoacylation efficiency of tRNA by examining the steady-state level of aminoacyl-tRNA. On substituting nucleotides derived from the acceptor end and variable pocket of tRNAPro for the corresponding nucleotides in a tRNAPhe gene, the identity of the resulting tRNA changed substantially but incompletely to that of tRNAPro. The redesigned tRNAPhe was weakly active and aminoacyl-tRNA was not detected. Ethyl methanesulfonate mutagenesis of the redesigned tRNAPhe gene produced a mutant with a wobble pair in place of a base pair in the end of the acceptor-stem helix of the transcribed tRNA. This mutant exhibited both a tRNAPro identity and substantial aminoacyl-tRNA. The results speak for the importance of a distinctive conformation in the acceptor-stem helix of tRNAPro for aminoacylation by the prolyl-tRNA synthetase. The anticodon also contributes to tRNAPro identity but is not necessary in vivo. Images PMID:8127693
Zurawski, Gerard; Bohnert, Hans J.; Whitfeld, Paul R.; Bottomley, Warwick
1982-01-01
The gene for the so-called Mr 32,000 rapidly labeled photosystem II thylakoid membrane protein (here designated psbA) of spinach (Spinacia oleracea) chloroplasts is located on the chloroplast DNA in the large single-copy region immediately adjacent to one of the inverted repeat sequences. In this paper we show that the size of the mRNA for this protein is ≈ 1.25 kilobases and that the direction of transcription is towards the inverted repeat unit. The nucleotide sequence of the gene and its flanking regions is presented. The only large open reading frame in the sequence codes for a protein of Mr 38,950. The nucleotide sequence of psbA from Nicotiana debneyi also has been determined, and comparison of the sequences from the two species shows them to be highly conserved (>95% homology) throughout the entire reading frame. Conservation of the amino acid sequence is absolute, there being no changes in a total of 353 residues. This leads us to conclude that the primary translation product of psbA must be a protein of Mr 38,950. The protein is characterized by the complete absence of lysine residues and is relatively rich in hydrophobic amino acids, which tend to be clustered. Transcription of spinach psbA starts about 86 base pairs before the first ATG codon. Immediately upstream from this point there is a sequence typical of that found in E. coli promoters. An almost identical sequence occurs in the equivalent region of N. debneyi DNA. Images PMID:16593262
Mateos, L M; Schäfer, A; Kalinowski, J; Martin, J F; Pühler, A
1996-10-01
Conjugative transfer of mobilizable derivatives of the Escherichia coli narrow-host-range plasmids pBR322, pBR325, pACYC177, and pACYC184 from E. coli to species of the gram-positive genera Corynebacterium and Brevibacterium resulted in the integration of the plasmids into the genomes of the recipient bacteria. Transconjugants appeared at low frequencies and reproducibly with a delay of 2 to 3 days compared with matings with replicative vectors. Southern analysis of corynebacterial transconjugants and nucleotide sequences from insertion sites revealed that integration occurs at different locations and that different parts of the vector are involved in the process. Integration is not dependent on indigenous insertion sequence elements but results from recombination between very short homologous DNA segments (8 to 12 bp) present in the vector and in the host DNA. In the majority of the cases (90%), integration led to cointegrate formation, and in some cases, deletions or rearrangements occurred during the recombination event. Insertions were found to be quite stable even in the absence of selective pressure.
Mateos, L M; Schäfer, A; Kalinowski, J; Martin, J F; Pühler, A
1996-01-01
Conjugative transfer of mobilizable derivatives of the Escherichia coli narrow-host-range plasmids pBR322, pBR325, pACYC177, and pACYC184 from E. coli to species of the gram-positive genera Corynebacterium and Brevibacterium resulted in the integration of the plasmids into the genomes of the recipient bacteria. Transconjugants appeared at low frequencies and reproducibly with a delay of 2 to 3 days compared with matings with replicative vectors. Southern analysis of corynebacterial transconjugants and nucleotide sequences from insertion sites revealed that integration occurs at different locations and that different parts of the vector are involved in the process. Integration is not dependent on indigenous insertion sequence elements but results from recombination between very short homologous DNA segments (8 to 12 bp) present in the vector and in the host DNA. In the majority of the cases (90%), integration led to cointegrate formation, and in some cases, deletions or rearrangements occurred during the recombination event. Insertions were found to be quite stable even in the absence of selective pressure. PMID:8824624
Characterization of sams genes of Amoeba proteus and the endosymbiotic X-bacteria.
Jeon, Taeck J; Jeon, Kwang W
2003-01-01
As a result of harboring obligatory bacterial endosymbionts, the xD strain of Amoeba proteus no longer produces its own S-adenosylmethionine synthetase (SAMS). When symbiont-free D amoebae are infected with symbionts (X-bacteria), the amount of amoeba SAMS decreases to a negligible level within four weeks, but about 47% of the SAMS activity, which apparently comes from another source, is still detected. Complete nucleotide sequences of sams genes of D and xD amoebae are presented and show that there are no differences between the two. Long-established xD amoebae contain an intact sams gene and thus the loss of xD amoeba's SAMS is not due to the loss of the gene itself. The open reading frame of the amoeba's sams gene has 1,281 nucleotides, encoding SAMS of 426 amino acids with a mass of 48 kDa and pI of 6.5. The amino acid sequence of amoeba SAMS is longer than the SAMS of other organisms by having an extra internal stretch of 28 amino acids. The 5'-flanking region of amoeba sams contains consensus-binding sites for several transcription factors that are related to the regulation of sams genes in E. coli and yeast. The complete nucleotide sequence of the symbiont's sams gene is also presented. The open reading frame of X-bacteria sams is 1,146 nucleotides long, encoding SAMS of 381 amino acids with a mass of 41 kDa and pI of 6.0. The X-bacteria SAMS has 45% sequence identity with that of A. proteus.
Beutin, Lothar; Delannoy, Sabine; Fach, Patrick
2015-06-15
Enterohemorrhagic Escherichia coli (EHEC) O121:H19 belong to a specific clonal type distinct from other classical EHEC and major enteropathogenic E. coli groups and is regarded as one of the major EHEC serogroups involved in severe infections in humans. Sequencing of the fliC genes associated with the flagellar antigen H19 (fliCH19) revealed the genetic diversity of the fliCH19 gene sequences in E. coli. A cluster analysis of 12 fliCH19 sequences, 4 from O121 and 8 from non-O121 E. coli strains, revealed five different genotypes. All O121:H19 strains fell into one cluster, whereas a second cluster was formed by five non-O121:H19 strains. Cluster 1 and cluster 2 strains differ by 27 single nucleotide exchanges in their fliCH19 genes (98.5% homology). Based on allele discrimination of the fliCH19 genes, a real-time PCR test was designed for specific identification of EHEC O121:H19. The O121 fliCH19 PCR tested negative in 73 E. coli H19 strains that belonged to serogroups other than O121, including 28 different O groups, O-nontypeable H19, and O-rough:H19 strains. The O121 fliCH19 PCR reacted with all 16 tested O121:H19 strains and 1 O-rough:H19 strain which was positive for the O121 wzx gene. A cross-reaction was observed only with E. coli H32 strains which share sequence similarities in the target region of the O121 fliCH19 PCR. The combined use of O-antigen genotyping (O121 wzx) and the detection of O121 fliCH19 allele type contributes to improving the identification and molecular serotyping of EHEC O121:H19 motile and nonmotile strains and variants of these strains lacking stx genes. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
Beutin, Lothar; Delannoy, Sabine
2015-01-01
Enterohemorrhagic Escherichia coli (EHEC) O121:H19 belong to a specific clonal type distinct from other classical EHEC and major enteropathogenic E. coli groups and is regarded as one of the major EHEC serogroups involved in severe infections in humans. Sequencing of the fliC genes associated with the flagellar antigen H19 (fliCH19) revealed the genetic diversity of the fliCH19 gene sequences in E. coli. A cluster analysis of 12 fliCH19 sequences, 4 from O121 and 8 from non-O121 E. coli strains, revealed five different genotypes. All O121:H19 strains fell into one cluster, whereas a second cluster was formed by five non-O121:H19 strains. Cluster 1 and cluster 2 strains differ by 27 single nucleotide exchanges in their fliCH19 genes (98.5% homology). Based on allele discrimination of the fliCH19 genes, a real-time PCR test was designed for specific identification of EHEC O121:H19. The O121 fliCH19 PCR tested negative in 73 E. coli H19 strains that belonged to serogroups other than O121, including 28 different O groups, O-nontypeable H19, and O-rough:H19 strains. The O121 fliCH19 PCR reacted with all 16 tested O121:H19 strains and 1 O-rough:H19 strain which was positive for the O121 wzx gene. A cross-reaction was observed only with E. coli H32 strains which share sequence similarities in the target region of the O121 fliCH19 PCR. The combined use of O-antigen genotyping (O121 wzx) and the detection of O121 fliCH19 allele type contributes to improving the identification and molecular serotyping of EHEC O121:H19 motile and nonmotile strains and variants of these strains lacking stx genes. PMID:25862232
Woksepp, Hanna; Ryberg, Anna; Berglind, Linda; Schön, Thomas; Söderman, Jan
2017-12-01
Enhanced precision of epidemiological typing in clinically suspected nosocomial outbreaks is crucial. Our aim was to investigate whether single nucleotide polymorphism (SNP) analysis and core genome (cg) multilocus sequence typing (MLST) of whole genome sequencing (WGS) data would more reliably identify a nosocomial outbreak, compared to earlier molecular typing methods. Sixteen isolates from a nosocomial outbreak of ESBL E. coli ST-131 in southeastern Sweden and three control strains were subjected to WGS. Sequences were explored by SNP analysis and cgMLST. cgMLST clearly differentiated between the outbreak isolates and the control isolates (>1400 differences). All clinically identified outbreak isolates showed close clustering (≥2 allele differences), except for two isolates (>50 allele differences). These data confirmed that the isolates with >50 differing genes did not belong to the nosocomial outbreak. The number of SNPs within the outbreak was ≤7, whereas the two discrepant isolates had >700 SNPs. Two of the ESBL E. coli ST-131 isolates did not belong to the clinically identified outbreak. Our results illustrate the power of WGS in terms of resolution, which may avoid overestimation of patients belonging to outbreaks as judged from epidemiological data and previously employed molecular methods with lower discriminatory ability. © 2017 APMIS. Published by John Wiley & Sons Ltd.
Runcharoen, Chakkaphan; Raven, Kathy E; Reuter, Sandra; Kallonen, Teemu; Paksanont, Suporn; Thammachote, Jeeranan; Anun, Suthatip; Blane, Beth; Parkhill, Julian; Peacock, Sharon J; Chantratita, Narisara
2017-09-06
Tackling multidrug-resistant Escherichia coli requires evidence from One Health studies that capture numerous potential reservoirs in circumscribed geographic areas. We conducted a survey of extended β-lactamase (ESBL)-producing E. coli isolated from patients, canals and livestock wastewater in eastern Thailand between 2014 and 2015, and analyzed isolates using whole genome sequencing. The bacterial collection of 149 isolates consisted of 84 isolates from a single hospital and 65 from the hospital sewer, canals and farm wastewater within a 20 km radius. E. coli ST131 predominated the clinical collection (28.6%), but was uncommon in the environment. Genome-based comparison of E. coli from infected patients and their immediate environment indicated low genetic similarity overall between the two, although three clinical-environmental isolate pairs differed by ≤ 5 single nucleotide polymorphisms. Thai E. coli isolates were dispersed throughout a phylogenetic tree containing a global E. coli collection. All Thai ESBL-positive E. coli isolates were multidrug resistant, including high rates of resistance to tobramycin (77.2%), gentamicin (77.2%), ciprofloxacin (67.8%) and trimethoprim (68.5%). ESBL was encoded by six different CTX-M elements and SHV-12. Three isolates from clinical samples (n = 2) or a hospital sewer (n = 1) were resistant to the carbapenem drugs (encoded by NDM-1, NDM-5 or GES-5), and three isolates (clinical (n = 1) and canal water (n = 2)) were resistant to colistin (encoded by mcr-1); no isolates were resistant to both carbapenems and colistin. Tackling ESBL-producing E. coli in this setting will be challenging based on widespread distribution, but the low prevalence of resistance to carbapenems and colistin suggests that efforts are now required to prevent these from becoming ubiquitous.
[Characterization of ibeB gene of meningitic Escherichia coli strains in calves from Xinjiang].
Ling, Chen; Jiang, Jianjun; Song, Kang; Zhang, Kun; Shi, Yanxia; Feng, Guangyu; Ni, Hongbin; Zhu, Ling; Wang, Pengyan; Yan, Genqiang
2016-06-04
To understand the molecular biology information of ibeB gene of meningitic Escherichia coli isolates in calves. The strain used was isolated from the brain and liver tissue of calves died from Meningitis. It was identified to be an O161-K99-STa pathogenic Escherichia coli strain and named as bovine-EN and bovine-EG. Based on the sequence of ibeB gene of meningitic Escherichia coli K1 RS218 strain in GenBank, a pair of primers was designed and the ibeB gene was cloned from isolates by PCR. Part molecular biology information of ibeB among different strains was compared. The sequence length of isolates ibeB gene was 1500 bp, containing a 1371 bp open reading frame (ORF) encoding 457 amino acids. Bioinformatics analysis showed that the nucleotide and amino acid homology of ibeB gene of bovine-EN strain shared 90.5% and 96.9% identity with Escherichia coli K1 RS218 ibeB gene, respectively, while bovine-EG strain shared 99.4% and 100.0% identity with Escherichia coli K12 respectively. The ibeB gene of bovine-E strains encoded water-soluble protein whose molecular weight was 50.26 kDa and isoelectric point was 6.05. This protein contained a signal peptide A but no transmembrane domain. Subcellular localization of ibeB belonged to the secreted protein, which secretory signal path site (SP) proportion was 0.939. The ibeB gene was cloned from meningitic E. coli isolates and had higher homology and similar biological characteristics with meningitis E. coli K1 RS218ibeB, which belongs to extraintestinal pathogenic Escherichia coli.
Coque, Teresa M.; Singh, Kavindra V.; Weinstock, George M.; Murray, Barbara E.
1999-01-01
Enterococci are usually susceptible in vitro to trimethoprim; however, high-level resistance (HLR) (MICs, >1,024 μg/ml) has been reported. We studied Enterococcus faecalis DEL, for which the trimethoprim MIC was >1,024 μg/ml. No transfer of resistance was achieved by broth or filter matings. Two different genes that conferred trimethoprim resistance when they were cloned in Escherichia coli (MICs, 128 and >1,024 μg/ml) were studied. One gene that coded for a polypeptide of 165 amino acids (MIC, 128 μg/ml for E. coli) was identical to dfr homologs that we cloned from a trimethoprim-susceptible E. faecalis strain, and it is presumed to be the intrinsic E. faecalis dfr gene (which causes resistance in E. coli when cloned in multiple copies); this gene was designated dfrE. The nucleotide sequence 5′ to this dfr gene showed similarity to thymidylate synthetase genes, suggesting that the dfr and thy genes from E. faecalis are located in tandem. The E. faecalis gene that conferred HLR to trimethoprim in E. coli, designated dfrF, codes for a predicted polypeptide of 165 amino acids with 38 to 64% similarity with other dihydrofolate reductases from gram-positive and gram-negative organisms. The nucleotide sequence 5′ to dfrF did not show similarity to the thy sequences. A DNA probe for dfrF hybridized under high-stringency conditions only to colony lysates of enterococci for which the trimethoprim MIC was >1,024 μg/ml; there was no hybridization to plasmid DNA from the strain of origin. To confirm that this gene causes trimethoprim resistance in enterococci, we cloned it into the integrative vector pAT113 and electroporated it into RH110 (E. faecalis OG1RF::Tn916ΔEm) (trimethoprim MIC, 0.5 μg/ml), which resulted in RH110 derivatives for which the trimethoprim MIC was >1,024 μg/ml. These results indicate that dfrF is an acquired but probably chromosomally located gene which is responsible for in vitro HLR to trimethoprim in E. faecalis. PMID:9869579
Sequence analysis and expression of the M1 and M2 matrix protein genes of hirame rhabdovirus (HIRRV)
Nishizawa, T.; Kurath, G.; Winton, J.R.
1997-01-01
We have cloned and sequenced a 2318 nucleotide region of the genomic RNA of hirame rhabdovirus (HIRRV), an important viral pathogen of Japanese flounder Paralichthys olivaceus. This region comprises approximately two-thirds of the 3' end of the nucleocapsid protein (N) gene and the complete matrix protein (M1 and M2) genes with the associated intergenic regions. The partial N gene sequence was 812 nucleotides in length with an open reading frame (ORF) that encoded the carboxyl-terminal 250 amino acids of the N protein. The M1 and M2 genes were 771 and 700 nucleotides in length, respectively, with ORFs encoding proteins of 227 and 193 amino acids. The M1 gene sequence contained an additional small ORF that could encode a highly basic, arginine-rich protein of 25 amino acids. Comparisons of the N, M1, and M2 gene sequences of HIRRV with the corresponding sequences of the fish rhabdoviruses, infectious hematopoietic necrosis virus (IHNV) or viral hemorrhagic septicemia virus (VHSV) indicated that HIRRV was more closely related to IHNV than to VHSV, but was clearly distinct from either. The putative consensus gene termination sequence for IHNV and VHSV, AGAYAG(A)(7), was present in the N-M1, M1-M2, and M2-G intergenic regions of HIRRV as were the putative transcription initiation sequences YGGCAC and AACA. An Escherichia coli expression system was used to produce recombinant proteins from the M1 and M2 genes of HIRRV. These were the same size as the authentic M1 and M2 proteins and reacted with anti-HIRRV rabbit serum in western blots. These reagents can be used for further study of the fish immune response and to test novel control methods.
The Glyphosate-Based Herbicide Roundup Does not Elevate Genome-Wide Mutagenesis of Escherichia coli.
Tincher, Clayton; Long, Hongan; Behringer, Megan; Walker, Noah; Lynch, Michael
2017-10-05
Mutations induced by pollutants may promote pathogen evolution, for example by accelerating mutations conferring antibiotic resistance. Generally, evaluating the genome-wide mutagenic effects of long-term sublethal pollutant exposure at single-nucleotide resolution is extremely difficult. To overcome this technical barrier, we use the mutation accumulation/whole-genome sequencing (MA/WGS) method as a mutagenicity test, to quantitatively evaluate genome-wide mutagenesis of Escherichia coli after long-term exposure to a wide gradient of the glyphosate-based herbicide (GBH) Roundup Concentrate Plus. The genome-wide mutation rate decreases as GBH concentration increases, suggesting that even long-term GBH exposure does not compromise the genome stability of bacteria. Copyright © 2017 Tincher et al.
Turner, Peter C; Yomano, Lorraine P; Jarboe, Laura R; York, Sean W; Baggett, Christy L; Moritz, Brélan E; Zentz, Emily B; Shanmugam, K T; Ingram, Lonnie O
2012-04-01
Escherichia coli KO11 (ATCC 55124) was engineered in 1990 to produce ethanol by chromosomal insertion of the Zymomonas mobilis pdc and adhB genes into E. coli W (ATCC 9637). KO11FL, our current laboratory version of KO11, and its parent E. coli W were sequenced, and contigs assembled into genomic sequences using optical NcoI restriction maps as templates. E. coli W contained plasmids pRK1 (102.5 kb) and pRK2 (5.4 kb), but KO11FL only contained pRK2. KO11FL optical maps made with AflII and with BamHI showed a tandem repeat region, consisting of at least 20 copies of a 10-kb unit. The repeat region was located at the insertion site for the pdc, adhB, and chloramphenicol-resistance genes. Sequence coverage of these genes was about 25-fold higher than average, consistent with amplification of the foreign genes that were inserted as circularized DNA. Selection for higher levels of chloramphenicol resistance originally produced strains with higher pdc and adhB expression, and hence improved fermentation performance, by increasing the gene copy number. Sequence data for an earlier version of KO11, ATCC 55124, indicated that multiple copies of pdc adhB were present. Comparison of the W and KO11FL genomes showed large inversions and deletions in KO11FL, mostly enabled by IS10, which is absent from W but present at 30 sites in KO11FL. The early KO11 strain ATCC 55124 had no rearrangements, contained only one IS10, and lacked most accumulated single nucleotide polymorphisms (SNPs) present in KO11FL. Despite rearrangements and SNPs in KO11FL, fermentation performance was equal to that of ATCC 55124.
Lindeberg, M; Collmer, A
1992-01-01
Many extracellular proteins produced by Erwinia chrysanthemi require the out gene products for transport across the outer membrane. In a previous report (S. Y. He, M. Lindeberg, A. K. Chatterjee, and A. Collmer, Proc. Natl. Acad. Sci. USA 88:1079-1083, 1991) cosmid pCPP2006, sufficient for secretion of Erwinia chrysanthemi extracellular proteins by Escherichia coli, was partially sequenced, revealing four out genes sharing high homology with pulH through pulK from Klebsiella oxytoca. The nucleotide sequence of eight additional out genes reveals homology with pulC through pulG, pulL, pulM, pulO, and other genes involved in secretion by various gram-negative bacteria. Although signal sequences and hydrophobic regions are generally conserved between Pul and Out proteins, four out genes contain unique inserts, a pulN homolog is not present, and outO appears to be transcribed separately from outC through outM. The sequenced region was subcloned, and an additional 7.6-kb region upstream was identified as being required for secretion in E. coli. out gene homologs were found on Erwinia carotovora cosmid clone pAKC651 but were not detected in E. coli. The outC-through-outM operon is weakly induced by polygalacturonic acid and strongly expressed in the early stationary phase. The out and pul genes are highly similar in sequence, hydropathic properties, and overall arrangement but differ in both transcriptional organization and the nature of their induction. Images PMID:1429461
Human HOXA5 homeodomain enhances protein transduction and its application to vascular inflammation
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lee, Ji Young; Park, Kyoung sook; Cho, Eun Jung
2011-07-01
Highlights: {yields} We have developed an E. coli protein expression vector including human specific gene sequences for protein cellular delivery. {yields} The plasmid was generated by ligation the nucleotides 770-817 of the homeobox A5 mRNA sequence. {yields} HOXA5-APE1/Ref-1 inhibited TNF-alpha-induced monocyte adhesion to endothelial cells. {yields} Human HOXA5-PTD vector provides a powerful research tools for uncovering cellular functions of proteins or for the generation of human PTD-containing proteins. -- Abstract: Cellular protein delivery is an emerging technique by which exogenous recombinant proteins are delivered into mammalian cells across the membrane. We have developed an Escherichia coli expression vector including humanmore » specific gene sequences for protein cellular delivery. The plasmid was generated by ligation the nucleotides 770-817 of the homeobox A5 mRNA sequence which was matched with protein transduction domain (PTD) of homeodomain protein A5 (HOXA5) into pET expression vector. The cellular uptake of HOXA5-PTD-EGFP was detected in 1 min and its transduction reached a maximum at 1 h within cell lysates. The cellular uptake of HOXA5-EGFP at 37 {sup o}C was greater than in 4 {sup o}C. For study for the functional role of human HOXA5-PTD, we purified HOXA5-APE1/Ref-1 and applied it on monocyte adhesion. Pretreatment with HOXA5-APE1/Ref-1 (100 nM) inhibited TNF-{alpha}-induced monocyte adhesion to endothelial cells, compared with HOXA5-EGFP. Taken together, our data suggested that human HOXA5-PTD vector provides a powerful research tools for uncovering cellular functions of proteins or for the generation of human PTD-containing proteins.« less
Jain, Vipin; Hilton, Benjamin; Lin, Bin; Jain, Anshu; MacKerell, Alexander D.; Zou, Yue; Cho, Bongsup P.
2014-01-01
Cluster DNA damage refers to two or more lesions in a single turn of the DNA helix. Such clustering may occur with bulky DNA lesions, which may be responsible for their sequence dependent repair and mutational outcomes. Here we prepared three 16-mer cluster duplexes in which two fluoroacetylaminofluorene adducts (dG-FAAF) are separated by none, one and two nucleotides in the E. coli NarI mutational hot spot (5'-CTCTCG1G2CG3CCATCAC-3'): i.e. 5'-- CG1*G2*CG3CC--3', 5'--CG1G2*CG3*CC--3', and 5'--CG1*G2CG3*CC--3' [G*=dG-FAAF], respectively. We conducted spectroscopic, thermodynamic, and molecular dynamics studies of these di-FAAF duplexes and the results were compared with those of the corresponding mono- FAAF adducts in the same NarI sequence (Nucleic Acids Res. 2012, 3939–3951). Our nucleotide excision repair results showed greater reparability of the di-adducts in comparison to the corresponding mono-adducts. Moreover, we observed dramatic flanking base sequence effects on their repair efficiency in the order of NarI-G2G3 > -G1G3 > -G1G2. The NMR/CD/UV-melting and MD-simulation results revealed that in contrast to the mono-adducts, di-adducts produced synergistic effect on duplex destabilization. In addition, dG-FAAF at G2G3 and G1G3 destack the neighboring bases with greater destabilization occurring with the former. Overall, the results indicate the importance of base stacking and related thermal/thermodynamic destabilization in the repair of bulky cluster arylamine DNA adducts. PMID:23841451
Vapnek, Daniel; Spingler, Elizabeth
1974-01-01
Deoxyribonucleic acid-ribonucleic acid (DNA-RNA) hybridization studies have been performed with R-plasmid DNA (R538-1drd) and in vivo-synthesized RNA. R-plasmid DNA was isolated from Escherichia coli K-12, and the complementary strands were separated in cesium chloride-polyuridylic acid-polyguanylic acid gradients. DNA-RNA hybridization was performed with the separated DNA strands and RNA purified from R-plasmid-carrying cells. The results demonstrated that an asymmetric transcription of the R-plasmid DNA occurs in vivo. Hybridization was only detected with the H strand (denser strand in cesium chloride-polyuridylic acid-polyguanylic acid). By determining the density of the RNA-DNA hybrid in CsCl gradients, it was estimated that greater than 60% of the nucleotide sequences in the R-plasmid DNA are transcribed in logarithmically growing E. coli cells. No R-plasmid-specific RNA was detected in E. coli cells that did not carry the plasmid. PMID:4612013
Berg, E S; Wester, A L; Ahrenfeldt, J; Mo, S S; Slettemeås, J S; Steinbakk, M; Samuelsen, Ø; Grude, N; Simonsen, G S; Løhr, I H; Jørgensen, S B; Tofteland, S; Lund, O; Dahle, U R; Sunde, M
2017-06-01
In 2012 and 2014 the Norwegian monitoring programme for antimicrobial resistance in the veterinary and food production sectors (NORM-VET) showed that 124 of a total of 406 samples (31%) of Norwegian retail chicken meat were contaminated with extended-spectrum cephalosporin-resistant Escherichia coli. The aim of this study was to compare selected cephalosporin-resistant E. coli from humans and poultry to determine their genetic relatedness based on whole genome sequencing (WGS). Escherichia coli representing three prevalent cephalosporin-resistant multi-locus sequence types (STs) isolated from poultry (n=17) were selected from the NORM-VET strain collections. All strains carried an IncK plasmid with a bla CMY-2 gene. Clinical E. coli isolates (n=284) with AmpC-mediated resistance were collected at Norwegian microbiology laboratories from 2010 to 2014. PCR screening showed that 29 of the clinical isolates harboured both IncK and bla CMY-2 . All IncK/bla CMY-2 -positive isolates were analysed with WGS-based bioinformatics tools. Analysis of single nucleotide polymorphisms (SNP) in 2.5 Mbp of shared genome sequences showed close relationship, with fewer than 15 SNP differences between five clinical isolates from urinary tract infections (UTIs) and the ST38 isolates from poultry. Furthermore, all of the 29 clinical isolates harboured IncK/bla CMY-2 plasmid variants highly similar to the IncK/bla CMY-2 plasmid present in the poultry isolates. Our results provide support for the hypothesis that clonal transfer of cephalosporin-resistant E. coli from chicken meat to humans may occur, and may cause difficult-to-treat infections. Furthermore, these E. coli can be a source of AmpC-resistance plasmids for opportunistic pathogens in the human microbiota. Copyright © 2017 European Society of Clinical Microbiology and Infectious Diseases. Published by Elsevier Ltd. All rights reserved.
Sequence of the fhuE outer-membrane receptor gene of Escherichia coli K12 and properties of mutants.
Sauer, M; Hantke, K; Braun, V
1990-03-01
The fhuE gene of Escherichia coli codes for an outer-membrane receptor protein required for the uptake of iron(III) via coprogen, ferrioxamine B and rhodotorulic acid. The amino acid sequence, deduced from the nucleotide sequence, consisted of 729 residues. The mature form, composed of 693 residues, has a calculated molecular weight of 77,453, which agrees with the molecular weight of 76,000 determined by polyacrylamide gel electrophoresis. The FhuE protein contains four regions of homology with other TonB-dependent receptors. A valine to proline exchange in the 'TonB box' abolished transport activity. Phenotypic revertants with substitutions of arginine, glutamine, or leucine at the valine position exhibited increasing iron-coprogen transport rates. Point mutations resulting in the replacement of glycine (127) in the second homology region with either alanine, aspartate, valine, asparagine or histidine exhibited decreased transport rates (listed in descending order). A truncated FhuE protein lacking 24 amino acids at the C-terminal end was exported to the periplasm but failed to be inserted into the outer membrane.
Fu, L; Hou, Y L; Ding, X; Du, Y J; Zhu, H Q; Zhang, N; Hou, W R
2016-08-30
The complementary DNA (cDNA) of the giant panda (Ailuropoda melanoleuca) ferritin light polypeptide (FTL) gene was successfully cloned using reverse transcription-polymerase chain reaction technology. We constructed a recombinant expression vector containing FTL cDNA and overexpressed it in Escherichia coli using pET28a plasmids. The expressed protein was then purified by nickel chelate affinity chromatography. The cloned cDNA fragment was 580 bp long and contained an open reading frame of 525 bp. The deduced protein sequence was composed of 175 amino acids and had an estimated molecular weight of 19.90 kDa, with an isoelectric point of 5.53. Topology prediction revealed one N-glycosylation site, two casein kinase II phosphorylation sites, one N-myristoylation site, two protein kinase C phosphorylation sites, and one cell attachment sequence. Alignment indicated that the nucleotide and deduced amino acid sequences are highly conserved across several mammals, including Homo sapiens, Cavia porcellus, Equus caballus, and Felis catus, among others. The FTL gene was readily expressed in E. coli, which gave rise to the accumulation of a polypeptide of the expected size (25.50 kDa, including an N-terminal polyhistidine tag).
Yagi, Toshihiro; Baroja-Fernández, Edurne; Yamamoto, Ryuji; Muñoz, Francisco José; Akazawa, Takashi; Hong, Kyoung Su; Pozueta-Romero, Javier
2003-01-01
A distinct UDP-glucose (UDPG) pyrophosphatase (UGPPase, EC 3.6.1.45) has been characterized using pig kidney ( Sus scrofa ). This enzyme hydrolyses UDPG, the precursor molecule of numerous glycosylation reactions in animals, to produce glucose 1-phosphate (G1P) and UMP. Sequence analyses of the purified enzyme revealed that, similar to the case of a nucleotide-sugar hydrolase controlling the intracellular levels of ADP-glucose linked to glycogen biosynthesis in Escherichia coli [Moreno-Bruna, Baroja-Fernández, Muñoz, Bastarrica-Berasategui, Zandueta-Criado, Rodri;guez-López, Lasa, Akazawa and Pozueta-Romero (2001) Proc. Natl. Acad. Sci. U.S.A. 98, 8128-8132], UGPPase appears to be a member of the ubiquitously distributed group of nucleotide pyrophosphatases designated Nudix hydrolases. A complete cDNA of the UGPPase-encoding gene, designated UGPP, was isolated from a human thyroid cDNA library and expressed in E. coli. The resulting cells accumulated a protein that showed kinetic properties identical to those of pig UGPPase. PMID:12429023
Yagi, Toshihiro; Baroja-Fernández, Edurne; Yamamoto, Ryuji; Muñoz, Francisco José; Akazawa, Takashi; Hong, Kyoung Su; Pozueta-Romero, Javier
2003-03-01
A distinct UDP-glucose (UDPG) pyrophosphatase (UGPPase, EC 3.6.1.45) has been characterized using pig kidney ( Sus scrofa ). This enzyme hydrolyses UDPG, the precursor molecule of numerous glycosylation reactions in animals, to produce glucose 1-phosphate (G1P) and UMP. Sequence analyses of the purified enzyme revealed that, similar to the case of a nucleotide-sugar hydrolase controlling the intracellular levels of ADP-glucose linked to glycogen biosynthesis in Escherichia coli [Moreno-Bruna, Baroja-Fernández, Muñoz, Bastarrica-Berasategui, Zandueta-Criado, Rodri;guez-López, Lasa, Akazawa and Pozueta-Romero (2001) Proc. Natl. Acad. Sci. U.S.A. 98, 8128-8132], UGPPase appears to be a member of the ubiquitously distributed group of nucleotide pyrophosphatases designated Nudix hydrolases. A complete cDNA of the UGPPase-encoding gene, designated UGPP, was isolated from a human thyroid cDNA library and expressed in E. coli. The resulting cells accumulated a protein that showed kinetic properties identical to those of pig UGPPase.
Janowska, Beata; Komisarski, Marek; Prorok, Paulina; Sokołowska, Beata; Kuśmierek, Jarosław; Janion, Celina; Tudek, Barbara
2009-09-23
One of the major products of lipid peroxidation is trans-4-hydroxy-2-nonenal (HNE). HNE forms highly mutagenic and genotoxic adducts to all DNA bases. Using M13 phage lacZ system, we studied the mutagenesis and repair of HNE treated phage DNA in E. coli wild-type or uvrA, recA, and mutL mutants. These studies revealed that: (i) nucleotide excision and recombination, but not mismatch repair, are engaged in repair of HNE adducts when present in phage DNA replicating in E. coli strains; (ii) in the single uvrA mutant, phage survival was drastically decreased while mutation frequency increased, and recombination events constituted 48% of all mutations; (iii) in the single recA mutant, the survival and mutation frequency of HNE-modified M13 phage was slightly elevated in comparison to that in the wild-type bacteria. The majority of mutations in recA(-) strain were G:C --> T:A transversions, occurring within the sequence which in recA(+) strains underwent RecA-mediated recombination, and the entire sequence was deleted; (iv) in the double uvrA recA mutant, phage survival was the same as in the wild-type although the mutation frequency was higher than in the wild-type and recA single mutant, but lower than in the single uvrA mutant. The majority of mutations found in the latter strain were base substitutions, with G:C --> A:T transitions prevailing. These transitions could have resulted from high reactivity of HNE with G and C, and induction of SOS-independent mutations.
Janowska, Beata; Komisarski, Marek; Prorok, Paulina; Sokołowska, Beata; Kuśmierek, Jarosław; Janion, Celina; Tudek, Barbara
2009-01-01
One of the major products of lipid peroxidation is trans-4-hydroxy-2-nonenal (HNE). HNE forms highly mutagenic and genotoxic adducts to all DNA bases. Using M13 phage lacZ system, we studied the mutagenesis and repair of HNE treated phage DNA in E. coli wild-type or uvrA, recA, and mutL mutants. These studies revealed that: (i) nucleotide excision and recombination, but not mismatch repair, are engaged in repair of HNE adducts when present in phage DNA replicating in E. coli strains; (ii) in the single uvrA mutant, phage survival was drastically decreased while mutation frequency increased, and recombination events constituted 48 % of all mutations; (iii) in the single recA mutant, the survival and mutation frequency of HNE-modified M13 phage was slightly elevated in comparison to that in the wild-type bacteria. The majority of mutations in recA- strain were G:C → T:A transversions, occurring within the sequence which in recA+ strains underwent RecA-mediated recombination, and the entire sequence was deleted; (iv) in the double uvrA recA mutant, phage survival was the same as in the wild-type although the mutation frequency was higher than in the wild-type and recA single mutant, but lower than in the single uvrA mutant. The majority of mutations found in the latter strain were base substitutions, with G:C → A:T transitions prevailing. These transitions could have resulted from high reactivity of HNE with G and C, and induction of SOS-independent mutations. PMID:19834545
The evolution of energy-transducing systems: Studies with archaebacteria
NASA Technical Reports Server (NTRS)
Stan-Lotter, Helga
1993-01-01
N-ethylmaleimide (NEM) inhibits the ATPase of H. saccharovorum in a nucleotide protectable manner. The bulk of 14C-NEM is incorporated into subunit 1. Inhibition kinetics indicated a single binding site. To determine the sequence around this site, cyanogen bromide peptides of NEM-labeled ATPase enzyme were prepared and separated on Tris-Tricine gels. Autoradiography indicated that the NEM binding site is probably located in a fragment of Mr 10-12 K. This result will be confirmed by N-terminal sequencing of the peptide. Since the cysteinyl residue, to which NEM is bound, may be located at the C-terminal end, purification and proteolytic treatment of the 10 K peptide will be required. One inhibitor of V-type ATPases, fluoresceinisothiocyanate (FITC) inhibited also the ATPase of H. saccharovorum. Preliminary results indicated protection against inhibition by nucleotides. Localization of the binding sited to the major subunits is in progress. An extraction procedure for the membrane sector of the ATPase complex of H. saccharovorum yielded a preparation which was enriched in a peptide of Mr 5 500. Experiments to test the immunological crossreaction with subunit c from the Escherichia coli F-type ATPase and the labeling with 14C-DCCD are currently carried out. Polyclonal antiserum to the smaller of the major subunits of the ATPase from H. saccharovorum (subunit ll) reacts in Western blots strongly with the alpha and beta subunits of the F1 ATPase of E. coli, suggesting highly conserved regions on both types of ATPases. To elucidate further the regions of homology, cyanogen bromide peptides of the beta subunits were prepared for sequence analysis.
Guilfoyle, Amy P; Deshpande, Chandrika N; Schenk, Gerhard; Maher, Megan J; Jormakka, Mika
2014-12-12
GDP release from GTPases is usually extremely slow and is in general assisted by external factors, such as association with guanine exchange factors or membrane-embedded GPCRs (G protein-coupled receptors), which accelerate the release of GDP by several orders of magnitude. Intrinsic factors can also play a significant role; a single amino acid substitution in one of the guanine nucleotide recognition motifs, G5, results in a drastically altered GDP release rate, indicating that the sequence composition of this motif plays an important role in spontaneous GDP release. In the present study, we used the GTPase domain from EcNFeoB (Escherichia coli FeoB) as a model and applied biochemical and structural approaches to evaluate the role of all the individual residues in the G5 loop. Our study confirms that several of the residues in the G5 motif have an important role in the intrinsic affinity and release of GDP. In particular, a T151A mutant (third residue of the G5 loop) leads to a reduced nucleotide affinity and provokes a drastically accelerated dissociation of GDP.
DNA binding sites characterization by means of Rényi entropy measures on nucleotide transitions.
Perera, Alexandre; Vallverdu, Montserrat; Claria, Francesc; Soria, José Manuel; Caminal, Pere
2006-01-01
In this work, parametric information-theory measures for the characterization of binding sites in DNA are extended with the use of transitional probabilities on the sequence. We propose the use of parametric uncertainty measure such as Renyi entropies obtained from the transition probabilities for the study of the binding sites, in addition to nucleotide frequency based Renyi measures. Results are reported in this manuscript comparing transition frequencies (i.e. dinucelotides) and base frequencies for Shannon and parametric Renyi for a number of binding sites found in E. Coli, lambda and T7 organisms. We observe that, for the evaluated datasets, the information provided by both approaches is not redundant, as they evolve differently under increasing Renyi orders.
Lescat, Mathilde; Hoede, Claire; Clermont, Olivier; Garry, Louis; Darlu, Pierre; Tuffery, Pierre; Denamur, Erick; Picard, Bertrand
2009-12-29
Previous studies have established a correlation between electrophoretic polymorphism of esterase B, and virulence and phylogeny of Escherichia coli. Strains belonging to the phylogenetic group B2 are more frequently implicated in extraintestinal infections and include esterase B2 variants, whereas phylogenetic groups A, B1 and D contain less virulent strains and include esterase B1 variants. We investigated esterase B as a marker of phylogeny and/or virulence, in a thorough analysis of the esterase B-encoding gene. We identified the gene encoding esterase B as the acetyl-esterase gene (aes) using gene disruption. The analysis of aes nucleotide sequences in a panel of 78 reference strains, including the E. coli reference (ECOR) strains, demonstrated that the gene is under purifying selection. The phylogenetic tree reconstructed from aes sequences showed a strong correlation with the species phylogenetic history, based on multi-locus sequence typing using six housekeeping genes. The unambiguous distinction between variants B1 and B2 by electrophoresis was consistent with Aes amino-acid sequence analysis and protein modelling, which showed that substituted amino acids in the two esterase B variants occurred mostly at different sites on the protein surface. Studies in an experimental mouse model of septicaemia using mutant strains did not reveal a direct link between aes and extraintestinal virulence. Moreover, we did not find any genes in the chromosomal region of aes to be associated with virulence. Our findings suggest that aes does not play a direct role in the virulence of E. coli extraintestinal infection. However, this gene acts as a powerful marker of phylogeny, illustrating the extensive divergence of B2 phylogenetic group strains from the rest of the species.
Kohno, K; Yasuzawa, K; Hirose, M; Kano, Y; Goshima, N; Tanaka, H; Imamoto, F
1994-06-01
The molecular mechanism of autoregulation of expression of the hupA gene in Escherichia coli was examined. The promoter of the gene contains a palindromic sequence with the potential to form a cruciform DNA structure in which the -35 sequence lies at the base of the stem and the -10 sequence forms a single-stranded loop. An artificial promoter lacking the palindrome, which was constructed by replacing a 10 nucleotide repeat for the predicted cruciform arm by a sequence in the opposite orientation, was not subject to HU-repression. DNA relaxation induced by deleting HU proteins and/or inhibiting DNA gyrase in cells results in increased expression from the hupA promoter. We propose that initiation of transcription of the hupA gene is negatively regulated by steric hindrance of the functional promoter domains for formation of the cruciform configuration, which is facilitated at least in part by negative supercoiling of the hupA promoter DNA region. The promoter region of the hupB gene also contains a palindromic sequence that can assume a cruciform configuration. Negative regulation of this gene by HU proteins may occur by a mechanism similar to that operating for the hupA gene.
NASA Technical Reports Server (NTRS)
Pitulle, C.; Hedenstierna, K. O.; Fox, G. E.
1995-01-01
Further improvements in technology for efficient monitoring of genetically engineered microorganisms (GEMs) in the environment are needed. Technology for monitoring rRNA is well established but has not generally been applicable to GEMs because of the lack of unique rRNA target sequences. In the work described herein, it is demonstrated that a deletion mutant of a plasmid-borne Vibrio proteolyticus 5S rRNA gene continues to accumulate to high levels in Escherichia coli although it is no longer incorporated into 70S ribosomes. This deletion construct was subsequently modified by mutagenesis to create a unique recognition site for the restriction endonuclease BstEII, into which new sequences could be readily inserted. Finally, a novel 17-nucleotide identifier sequence from Pennisetum purpureum was embedded into the construct to create an RNA identification cassette. The artificial identifier RNA, expressed from this cassette in vivo, accumulated in E. coli to levels comparable to those of wild-type 5S rRNA without being seriously detrimental to cell survival in laboratory experiments and without entering the ribosomes. These results demonstrate that artificial, stable RNAs containing sequence segments remarkably different from those present in any known rRNA can be designed and that neither the deleted sequence segment nor ribosome incorporation is essential for accumulation of an RNA product.
SuperPhy: predictive genomics for the bacterial pathogen Escherichia coli.
Whiteside, Matthew D; Laing, Chad R; Manji, Akiff; Kruczkiewicz, Peter; Taboada, Eduardo N; Gannon, Victor P J
2016-04-12
Predictive genomics is the translation of raw genome sequence data into a phenotypic assessment of the organism. For bacterial pathogens, these phenotypes can range from environmental survivability, to the severity of human disease. Significant progress has been made in the development of generic tools for genomic analyses that are broadly applicable to all microorganisms; however, a fundamental missing component is the ability to analyze genomic data in the context of organism-specific phenotypic knowledge, which has been accumulated from decades of research and can provide a meaningful interpretation of genome sequence data. In this study, we present SuperPhy, an online predictive genomics platform ( http://lfz.corefacility.ca/superphy/ ) for Escherichia coli. The platform integrates the analytical tools and genome sequence data for all publicly available E. coli genomes and facilitates the upload of new genome sequences from users under public or private settings. SuperPhy provides real-time analyses of thousands of genome sequences with results that are understandable and useful to a wide community, including those in the fields of clinical medicine, epidemiology, ecology, and evolution. SuperPhy includes identification of: 1) virulence and antimicrobial resistance determinants 2) statistical associations between genotypes, biomarkers, geospatial distribution, host, source, and phylogenetic clade; 3) the identification of biomarkers for groups of genomes on the based presence/absence of specific genomic regions and single-nucleotide polymorphisms and 4) in silico Shiga-toxin subtype. SuperPhy is a predictive genomics platform that attempts to provide an essential link between the vast amounts of genome information currently being generated and phenotypic knowledge in an organism-specific context.
Negishi, Tatsuya; Matsumoto, Takehisa; Horiuchi, Kazuki; Kasuga, Eriko; Natori, Tatsuya; Matsuoka, Mina; Ogiwara, Naoko; Sugano, Mitsutoshi; Uehara, Takeshi; Nagano, Noriyuki; Honda, Takayuki
2018-01-01
Thymidine-dependent small-colony variants (TD-SCVs) are difficult to detect or test for antimicrobial susceptibility. We investigated the characteristics of clonal TD-SCVs of Escherichia coli, both with and without blaCTX-M-3, isolated from a patient. Mutation in the thyA gene was analysed by sequencing, and morphological abnormalities in the colonies and cells of the isolates were examined. Additionally, conjugational transfer experiments were performed to prove the horizontal transferability of plasmids harbouring resistance genes. The TD-SCVs contained a single nucleotide substitution in the thyA gene, c.62G>A, corresponding to p.Arg21His. Morphologically, their colonies were more translucent and flattened than those of the wild-type strain. In addition, cells of the TD-SCVs were swollen and elongated, sometimes with abnormal and incomplete divisions; a large amount of cell debris was also observed. Changing c.62G>A back to the wild-type sequence reversed these abnormalities. Conjugational transfer experiments showed that the TD-SCV of E. coli with blaCTX-M-3 failed to transfer blaCTX-M-3 to E. coli CSH2. However, the TD-SCV of E. coli without blaCTX-M-3 experimentally received the plasmid encoding blaSHV-18 from Klebsiella pneumoniae ATCC 700603 and transferred it to E. coli CSH2. Mutation in the thyA gene causes morphological abnormalities in the colonies and cells of E. coli, as well as inducing thymidine auxotrophy. In addition, TD-SCVs horizontally transmit plasmids encoding resistance genes. It is important to detect TD-SCVs based on their characteristics because they serve as reservoirs of transferable antibiotic resistance plasmids.
Progressive genome-wide introgression in agricultural Campylobacter coli
Sheppard, Samuel K; Didelot, Xavier; Jolley, Keith A; Darling, Aaron E; Pascoe, Ben; Meric, Guillaume; Kelly, David J; Cody, Alison; Colles, Frances M; Strachan, Norval J C; Ogden, Iain D; Forbes, Ken; French, Nigel P; Carter, Philip; Miller, William G; McCarthy, Noel D; Owen, Robert; Litrup, Eva; Egholm, Michael; Affourtit, Jason P; Bentley, Stephen D; Parkhill, Julian; Maiden, Martin C J; Falush, Daniel
2013-01-01
Hybridization between distantly related organisms can facilitate rapid adaptation to novel environments, but is potentially constrained by epistatic fitness interactions among cell components. The zoonotic pathogens Campylobacter coli and C. jejuni differ from each other by around 15% at the nucleotide level, corresponding to an average of nearly 40 amino acids per protein-coding gene. Using whole genome sequencing, we show that a single C. coli lineage, which has successfully colonized an agricultural niche, has been progressively accumulating C. jejuni DNA. Members of this lineage belong to two groups, the ST-828 and ST-1150 clonal complexes. The ST-1150 complex is less frequently isolated and has undergone a substantially greater amount of introgression leading to replacement of up to 23% of the C. coli core genome as well as import of novel DNA. By contrast, the more commonly isolated ST-828 complex bacteria have 10–11% introgressed DNA, and C. jejuni and nonagricultural C. coli lineages each have <2%. Thus, the C. coli that colonize agriculture, and consequently cause most human disease, have hybrid origin, but this cross-species exchange has so far not had a substantial impact on the gene pools of either C. jejuni or nonagricultural C. coli. These findings also indicate remarkable interchangeability of basic cellular machinery after a prolonged period of independent evolution. PMID:23279096
Construction of Biologically Functional Bacterial Plasmids In Vitro
Cohen, Stanley N.; Chang, Annie C. Y.; Boyer, Herbert W.; Helling, Robert B.
1973-01-01
The construction of new plasmid DNA species by in vitro joining of restriction endonuclease-generated fragments of separate plasmids is described. Newly constructed plasmids that are inserted into Escherichia coli by transformation are shown to be biologically functional replicons that possess genetic properties and nucleotide base sequences from both of the parent DNA molecules. Functional plasmids can be obtained by reassociation of endonuclease-generated fragments of larger replicons, as well as by joining of plasmid DNA molecules of entirely different origins. Images PMID:4594039
Gurvich, Olga L.; Näsvall, S. Joakim; Baranov, Pavel V.; Björk, Glenn R.; Atkins, John F.
2011-01-01
The bacterial pheL gene encodes the leader peptide for the phenylalanine biosynthetic operon. Translation of pheL mRNA controls transcription attenuation and, consequently, expression of the downstream pheA gene. Fifty-three unique pheL genes have been identified in sequenced genomes of the gamma subdivision. There are two groups of pheL genes, both of which are short and contain a run(s) of phenylalanine codons at an internal position. One group is somewhat diverse and features different termination and 5′-flanking codons. The other group, mostly restricted to Enterobacteria and including Escherichia coli pheL, has a conserved nucleotide sequence that ends with UUC_CCC_UGA. When these three codons in E. coli pheL mRNA are in the ribosomal E-, P- and A-sites, there is an unusually high level, 15%, of +1 ribosomal frameshifting due to features of the nascent peptide sequence that include the penultimate phenylalanine. This level increases to 60% with a natural, heterologous, nascent peptide stimulator. Nevertheless, studies with different tRNAPro mutants in Salmonella enterica suggest that frameshifting at the end of pheL does not influence expression of the downstream pheA. This finding of incidental, rather than utilized, frameshifting is cautionary for other studies of programmed frameshifting. PMID:21177642
Spread of avian pathogenic Escherichia coli ST117 O78:H4 in Nordic broiler production.
Ronco, Troels; Stegger, Marc; Olsen, Rikke Heidemann; Sekse, Camilla; Nordstoga, Anne Bang; Pohjanvirta, Tarja; Lilje, Berit; Lyhs, Ulrike; Andersen, Paal Skytt; Pedersen, Karl
2017-01-03
Escherichia coli infections known as colibacillosis constitute a considerable challenge to poultry farmers worldwide, in terms of decreased animal welfare and production economy. Colibacillosis is caused by avian pathogenic E. coli (APEC). APEC strains are extraintestinal pathogenic E. coli and have in general been characterized as being a genetically diverse population. In the Nordic countries, poultry farmers depend on import of Swedish broiler breeders which are part of a breeding pyramid. During 2014 to 2016, an increased occurrence of colibacillosis on Nordic broiler chicken farms was reported. The aim of this study was to investigate the genetic diversity among E. coli isolates collected on poultry farms with colibacillosis issues, using whole genome sequencing. Hundred and fourteen bacterial isolates from both broilers and broiler breeders were whole genome sequenced. The majority of isolates were collected from poultry with colibacillosis on Nordic farms. Subsequently, comparative genomic analyses were carried out. This included in silico typing (sero- and multi-locus sequence typing), identification of virulence and resistance genes and phylogenetic analyses based on single nucleotide polymorphisms. In general, the characterized poultry isolates constituted a genetically diverse population. However, the phylogenetic analyses revealed a major clade of 47 closely related ST117 O78:H4 isolates. The isolates in this clade were collected from broiler chickens and breeders with colibacillosis in multiple Nordic countries. They clustered together with a human ST117 isolate and all carried virulence genes that previously have been associated with human uropathogenic E. coli. The investigation revealed a lineage of ST117 O78:H4 isolates collected in different Nordic countries from diseased broilers and breeders. The data indicate that the closely related ST117 O78:H4 strains have been transferred vertically through the broiler breeding pyramid into distantly located farms across the Nordic countries.
Molecular Mechanism by Which Retinoids Prevent Breast Cancer Development
2007-06-01
10.11 AFFX-r2-Ec- bioB -M_at E. coli /GEN= bioB /DB_XREF=gb:J04423.1 /NOTE=SIF corresponding to nucleotides 2393-2682 of gb:J04423.1 /DEF=E.coli...7,8-diamino-pelargonic acid (bioA), biotin synthetase ( bioB ), 7-keto-8-amino-pelargonic acid synthetase (bioF), bioC protein, and dethiobiot 9.76...9.42 AFFX- BioB - M_at E. coli /GEN= bioB /DB_XREF=gb:J04423.1 /NOTE=SIF corresponding to nucleotides 2482-2739 of gb:J04423.1 /DEF=E.coli 7,8
Kanamori, Hajime; Parobek, Christian M; Juliano, Jonathan J; Johnson, James R; Johnston, Brian D; Johnson, Timothy J; Weber, David J; Rutala, William A; Anderson, Deverick J
2017-08-01
Escherichia coli sequence type 131 (ST131) predominates globally among multidrug-resistant (MDR) E. coli strains. We used whole-genome sequencing (WGS) to investigate 63 MDR E. coli isolates from 7 North Carolina community hospitals (2010 to 2015). Of these, 39 (62%) represented ST131, including 37 (95%) from the ST131- H 30R subclone: 10 (27%) from its H 30R1 subset and 27 (69%) from its H 30Rx subset. ST131 core genomes differed by a median of 15 (range, 0 to 490) single-nucleotide variants (SNVs) overall versus only 7 within H 30R1 (range, 3 to 12 SNVs) and 11 within H 30Rx (range, 0 to 21). The four isolates with identical core genomes were all H 30Rx. Epidemiological and clinical characteristics did not vary significantly by strain type, but many patients with MDR E. coli or H 30Rx infection were critically ill and had poor outcomes. H 30Rx isolates characteristically exhibited fluoroquinolone resistance and CTX-M-15 production, had a high prevalence of trimethoprim-sulfamethoxazole resistance (89%), sul1 (89%), and dfrA17 (85%), and were enriched for specific virulence traits, and all qualified as extraintestinal pathogenic E. coli The high overall prevalence of CTX-M-15 appeared to be possibly attributable to its association with the ST131- H 30Rx subclone and IncF[F2:A1:B-] plasmids. Some phylogenetically clustered non-ST131 MDR E. coli isolates also had distinctive serotypes/ fimH types, fluoroquinolone mutations, CTX-M variants, and IncF types. Thus, WGS analysis of our community hospital source MDR E. coli isolates suggested ongoing circulation and differentiation of E. coli ST131 subclones, with clonal segregation of CTX-M variants, other resistance genes, Inc-type plasmids, and virulence genes. Copyright © 2017 American Society for Microbiology.
Reconstitution of active mycobacterial binuclear iron monooxygenase complex in Escherichia coli.
Furuya, Toshiki; Hayashi, Mika; Kino, Kuniki
2013-10-01
Bacterial binuclear iron monooxygenases play numerous physiological roles in oxidative metabolism. Monooxygenases of this type found in actinomycetes also catalyze various useful reactions and have attracted much attention as oxidation biocatalysts. However, difficulties in expressing these multicomponent monooxygenases in heterologous hosts, particularly in Escherichia coli, have hampered the development of engineered oxidation biocatalysts. Here, we describe a strategy to functionally express the mycobacterial binuclear iron monooxygenase MimABCD in Escherichia coli. Sodium dodecyl sulfate-polyacrylamide gel electrophoretic analysis of the mimABCD gene expression in E. coli revealed that the oxygenase components MimA and MimC were insoluble. Furthermore, although the reductase MimB was expressed at a low level in the soluble fraction of E. coli cells, a band corresponding to the coupling protein MimD was not evident. This situation rendered the transformed E. coli cells inactive. We found that the following factors are important for functional expression of MimABCD in E. coli: coexpression of the specific chaperonin MimG, which caused MimA and MimC to be soluble in E. coli cells, and the optimization of the mimD nucleotide sequence, which led to efficient expression of this gene product. These two remedies enabled this multicomponent monooxygenase to be actively expressed in E. coli. The strategy described here should be generally applicable to the E. coli expression of other actinomycetous binuclear iron monooxygenases and related enzymes and will accelerate the development of engineered oxidation biocatalysts for industrial processes.
Mfd translocase is necessary and sufficient for transcription-coupled repair in Escherichia coli.
Adebali, Ogun; Sancar, Aziz; Selby, Christopher P
2017-11-10
Nucleotide excision repair in Escherichia coli is stimulated by transcription, specifically in the transcribed strand. Previously, it was shown that this transcription-coupled repair (TCR) is mediated by the Mfd translocase. Recently, it was proposed that in fact the majority of TCR in E. coli is catalyzed by a second pathway ("backtracking-mediated TCR") that is dependent on the UvrD helicase and the guanosine pentaphosphate (ppGpp) alarmone/stringent response regulator. Recently, we reported that as measured by the excision repair-sequencing (XR-seq), UvrD plays no role in TCR genome-wide. Here, we tested the role of ppGpp and UvrD in TCR genome-wide and in the lacZ operon using the XR-seq method, which directly measures repair. We found that the mfd mutation abolishes TCR genome-wide and in the lacZ operon. In contrast, the relA - spoT - mutant deficient in ppGpp synthesis carries out normal TCR. We conclude that UvrD and ppGpp play no role in TCR in E. coli . © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.
Adenosine diphosphate sugar pyrophosphatase prevents glycogen biosynthesis in Escherichia coli
Moreno-Bruna, Beatriz; Baroja-Fernández, Edurne; Muñoz, Francisco José; Bastarrica-Berasategui, Ainara; Zandueta-Criado, Aitor; Rodríguez-López, Milagros; Lasa, Iñigo; Akazawa, Takashi; Pozueta-Romero, Javier
2001-01-01
An adenosine diphosphate sugar pyrophosphatase (ASPPase, EC 3.6.1.21) has been characterized by using Escherichia coli. This enzyme, whose activities in the cell are inversely correlated with the intracellular glycogen content and the glucose concentration in the culture medium, hydrolyzes ADP-glucose, the precursor molecule of glycogen biosynthesis. ASPPase was purified to apparent homogeneity (over 3,000-fold), and sequence analyses revealed that it is a member of the ubiquitously distributed group of nucleotide pyrophosphatases designated as “nudix” hydrolases. Insertional mutagenesis experiments leading to the inactivation of the ASPPase encoding gene, aspP, produced cells with marginally low enzymatic activities and higher glycogen content than wild-type bacteria. aspP was cloned into an expression vector and introduced into E. coli. Transformed cells were shown to contain a dramatically reduced amount of glycogen, as compared with the untransformed bacteria. No pleiotropic changes in the bacterial growth occurred in both the aspP-overexpressing and aspP-deficient strains. The overall results pinpoint the reaction catalyzed by ASPPase as a potential step of regulating glycogen biosynthesis in E. coli. PMID:11416161
Flärdh, K; Axberg, T; Albertson, N H; Kjelleberg, S
1994-01-01
In order to evaluate the role of the stringent response in starvation adaptations of the marine Vibrio sp. strain S14, we have cloned the relA gene and generated relaxed mutants of this organism. The Vibrio relA gene was selected from a chromosomal DNA library by complementation of an Escherichia coli delta relA strain. The nucleotide sequence contains a 743-codon open reading frame that encodes a polypeptide that is identical in length and highly homologous to the E. coli RelA protein. The amino acid sequences are 64% identical, and they share some completely conserved regions. A delta relA::kan allele was generated by replacing 53% of the open reading frame with a kanamycin resistance gene. The Vibrio relA mutants displayed a relaxed control of RNA synthesis and failed to accumulate ppGpp during amino acid limitation. During carbon and energy starvation, a relA-dependent burst of ppGpp synthesis concomitant with carbon source depletion and growth arrest was observed. Also, in the absence of the relA gene, there was an accumulation of ppGpp during carbon starvation, but this was slower and smaller than that which occurred in the stringent strains, and it was preceded by a marked decrease in the [ATP]/[ADP] ratio. In both the wild-type and the relaxed strains, carbon source depletion caused an immediate decrease in the size of the GTP pool and a block of net RNA accumulation. The relA mutation did not affect long-term survival or the development of resistance against heat, ethanol, and oxidative stress during carbon starvation of Vibrio sp. strain S14. PMID:7928955
2012-01-01
Background Detecting the borders between coding and non-coding regions is an essential step in the genome annotation. And information entropy measures are useful for describing the signals in genome sequence. However, the accuracies of previous methods of finding borders based on entropy segmentation method still need to be improved. Methods In this study, we first applied a new recursive entropic segmentation method on DNA sequences to get preliminary significant cuts. A 22-symbol alphabet is used to capture the differential composition of nucleotide doublets and stop codon patterns along three phases in both DNA strands. This process requires no prior training datasets. Results Comparing with the previous segmentation methods, the experimental results on three bacteria genomes, Rickettsia prowazekii, Borrelia burgdorferi and E.coli, show that our approach improves the accuracy for finding the borders between coding and non-coding regions in DNA sequences. Conclusions This paper presents a new segmentation method in prokaryotes based on Jensen-Rényi divergence with a 22-symbol alphabet. For three bacteria genomes, comparing to A12_JR method, our method raised the accuracy of finding the borders between protein coding and non-coding regions in DNA sequences. PMID:23282225
Verhoeven, Esther E. A.; van Kesteren, Marian; Turner, John J.; van der Marel, Gijs A.; van Boom, Jacques H.; Moolenaar, Geri F.; Goosen, Nora
2002-01-01
Nucleotide excision repair in Escherichia coli involves formation of the UvrB–DNA complex and subsequent DNA incisions on either site of the damage by UvrC. In this paper, we studied the incision of substrates with different damages in varying sequence contexts. We show that there is not always a correlation between the incision efficiency and the stability of the UvrB–DNA complex. Both stable and unstable UvrB–DNA complexes can be efficiently incised. However some lesions that give rise to stable UvrB–DNA complexes do result in a very low incision. We present evidence that this poor incision is due to sterical hindrance of the damage itself. In its C-terminal region UvrC contains two helix–hairpin–helix (HhH) motifs. Mutational analysis shows that these motifs constitute one functional unit, probably folded as one structural unit; the (HhH)2 domain. This (HhH)2 domain was previously shown to be important for the 5′ incision on a substrate containing a (cis-Pt)·GG adduct, but not for 3′ incision. Here we show that, mainly depending on the sequence context of the lesion, the (HhH)2 domain can be important for 3′ and/or 5′ incision. We propose that the (HhH)2 domain stabilises specific DNA structures required for the two incisions, thereby contributing to the flexibility of the UvrABC repair system. PMID:12034838
Piddington, C S; Kovacevich, B R; Rambosek, J
1995-01-01
Dibenzothiophene (DBT), a model compound for sulfur-containing organic molecules found in fossil fuels, can be desulfurized to 2-hydroxybiphenyl (2-HBP) by Rhodococcus sp. strain IGTS8. Complementation of a desulfurization (dsz) mutant provided the genes from Rhodococcus sp. strain IGTS8 responsible for desulfurization. A 6.7-kb TaqI fragment cloned in Escherichia coli-Rhodococcus shuttle vector pRR-6 was found to both complement this mutation and confer desulfurization to Rhodococcus fascians, which normally is not able to desulfurize DBT. Expression of this fragment in E. coli also conferred the ability to desulfurize DBT. A molecular analysis of the cloned fragment revealed a single operon containing three open reading frames involved in the conversion of DBT to 2-HBP. The three genes were designated dszA, dszB, and dszC. Neither the nucleotide sequences nor the deduced amino acid sequences of the enzymes exhibited significant similarity to sequences obtained from the GenBank, EMBL, and Swiss-Prot databases, indicating that these enzymes are novel enzymes. Subclone analyses revealed that the gene product of dszC converts DBT directly to DBT-sulfone and that the gene products of dszA and dszB act in concert to convert DBT-sulfone to 2-HBP. PMID:7574582
Zenno, S; Saigo, K; Kanoh, H; Inouye, S
1994-01-01
The gene encoding the major NAD(P)H-flavin oxidoreductase (flavin reductase) of the luminous bacterium Vibrio fischeri ATCC 7744 was isolated by using synthetic oligonucleotide probes corresponding to the N-terminal amino acid sequence of the enzyme. Nucleotide sequence analysis suggested that the major flavin reductase of V. fischeri consisted of 218 amino acids and had a calculated molecular weight of 24,562. Cloned flavin reductase expressed in Escherichia coli was purified virtually to homogeneity, and its basic biochemical properties were examined. As in the major flavin reductase in crude extracts of V. fischeri, cloned flavin reductase showed broad substrate specificity and served well as a catalyst to supply reduced flavin mononucleotide (FMNH2) to the bioluminescence reaction. The major flavin reductase of V. fischeri not only showed significant similarity in amino acid sequence to oxygen-insensitive NAD(P)H nitroreductases of Salmonella typhimurium, Enterobacter cloacae, and E. coli but also was associated with a low level of nitroreductase activity. The major flavin reductase of V. fischeri and the nitroreductases of members of the family Enterobacteriaceae would thus appear closely related in evolution and form a novel protein family. Images PMID:8206830
cDNA encoding a polypeptide including a hevein sequence
Raikhel, Natasha V.; Broekaert, Willem F.; Chua, Nam-Hai; Kush, Anil
1999-05-04
A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74-79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli.
cDNA encoding a polypeptide including a hev ein sequence
Raikhel, Natasha V.; Broekaert, Willem F.; Chua, Nam-Hai; Kush, Anil
2000-07-04
A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74-79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli.
cDNA encoding a polypeptide including a hevein sequence
Raikhel, N.V.; Broekaert, W.F.; Chua, N.H.; Kush, A.
1999-05-04
A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74--79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli. 12 figs.
CDNA encoding a polypeptide including a hevein sequence
Raikhel, Natasha V.; Broekaert, Willem F.; Chua, Nam-Hai; Kush, Anil
1995-03-21
A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74-79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli.
cDNA encoding a polypeptide including a hevein sequence
Raikhel, N.V.; Broekaert, W.F.; Chua, N.H.; Kush, A.
1995-03-21
A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1,018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74--79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli. 11 figures.
Tani, Akio; Sakai, Yasuyoshi; Ishige, Takeru; Kato, Nobuo
2000-01-01
NADPH-dependent alkylaldehyde reducing enzyme, which was greatly induced by n-hexadecane, from Acinetobacter sp. strain M-1 was purified and characterized. The purified enzyme had molecular masses of 40 kDa as determined by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and 160 kDa as determined by gel filtration chromatography. The enzyme, which was shown to be highly thermostable, was most active toward n-heptanal and could use n-alkylaldehydes ranging from C2 to C14 and several substituted benzaldehydes, including the industrially important compounds cinnamyl aldehyde and anisaldehyde, as substrates. The alrA gene coding for this enzyme was cloned, and its nucleotide sequence was determined. The deduced amino acid sequence encoded by the alrA gene exhibited homology to the amino acid sequences of zinc-containing alcohol dehydrogenases from various sources. The gene could be highly expressed in Escherichia coli, and the product was purified to homogeneity by simpler procedures from the recombinant than from the original host. Our results show that this enzyme can be used for industrial bioconversion of useful alcohols and aldehydes. PMID:11097895
Yang, J; Yamamoto, M; Ishibashi, J; Taniai, K; Yamakawa, M
1998-08-01
An antibacterial protein, designated rhinocerosin, was purified to homogeneity from larvae of the coconut rhinoceros beetle, Oryctes rhinoceros immunized with Escherichia coli. Based on the amino acid sequence of the N-terminal region, a degenerate primer was synthesized and reverse-transcriptase PCR was performed to clone rhinocerosin cDNA. As a result, a 279-bp fragment was obtained. The complete nucleotide sequence was determined by sequencing the extended rhinocerosin cDNA clone by 5' rapid amplification of cDNA ends. The deduced amino acid sequence of the mature portion of rhinocerosin was composed of 72 amino acids without cystein residues and was shown to be rich in glycine (11.1%) and proline (11.1%) residues. Comparison of the deduced amino acid sequence of rhinocerosin with those of other antibacterial proteins indicated that it has 77.8% and 44.6% identity with holotricin 2 and coleoptrecin, respectively. Rhinocerosin had strong antibacterial activity against E. coli, Streptococcus pyogenes, Staphylococcus aureus but not against Pseudomonas aeruginosa. Results of reverse-transcriptase PCR analysis of gene expression in different tissues indicated that the rhinocerosin gene is strongly expressed in the fat body and the Malpighian tubule, and weakly expressed in hemocytes and midgut. In addition, gene expression was inducible by bacteria in the fat body, the Malpighian tubule and hemocyte but constitutive expression was observed in the midgut.
Patel, Isha R.; Gangiredla, Jayanthi; Lacher, David W.; Mammel, Mark K.; Jackson, Scott A.; Lampel, Keith A.
2016-01-01
ABSTRACT Most Escherichia coli strains are nonpathogenic. However, for clinical diagnosis and food safety analysis, current identification methods for pathogenic E. coli either are time-consuming and/or provide limited information. Here, we utilized a custom DNA microarray with informative genetic features extracted from 368 sequence sets for rapid and high-throughput pathogen identification. The FDA Escherichia coli Identification (FDA-ECID) platform contains three sets of molecularly informative features that together stratify strain identification and relatedness. First, 53 known flagellin alleles, 103 alleles of wzx and wzy, and 5 alleles of wzm provide molecular serotyping utility. Second, 41,932 probe sets representing the pan-genome of E. coli provide strain-level gene content information. Third, approximately 125,000 single nucleotide polymorphisms (SNPs) of available whole-genome sequences (WGS) were distilled to 9,984 SNPs capable of recapitulating the E. coli phylogeny. We analyzed 103 diverse E. coli strains with available WGS data, including those associated with past foodborne illnesses, to determine robustness and accuracy. The array was able to accurately identify the molecular O and H serotypes, potentially correcting serological failures and providing better resolution for H-nontypeable/nonmotile phenotypes. In addition, molecular risk assessment was possible with key virulence marker identifications. Epidemiologically, each strain had a unique comparative genomic fingerprint that was extended to an additional 507 food and clinical isolates. Finally, a 99.7% phylogenetic concordance was established between microarray analysis and WGS using SNP-level data for advanced genome typing. Our study demonstrates FDA-ECID as a powerful tool for epidemiology and molecular risk assessment with the capacity to profile the global landscape and diversity of E. coli. IMPORTANCE This study describes a robust, state-of-the-art platform developed from available whole-genome sequences of E. coli and Shigella spp. by distilling useful signatures for epidemiology and molecular risk assessment into one assay. The FDA-ECID microarray contains features that enable comprehensive molecular serotyping and virulence profiling along with genome-scale genotyping and SNP analysis. Hence, it is a molecular toolbox that stratifies strain identification and pathogenic potential in the contexts of epidemiology and phylogeny. We applied this tool to strains from food, environmental, and clinical sources, resulting in significantly greater phylogenetic and strain-specific resolution than previously reported for available typing methods. PMID:27037122
McAllister, Lauren J; Bent, Stephen J; Petty, Nicola K; Skippington, Elizabeth; Beatson, Scott A; Paton, James C; Paton, Adrienne W
2016-01-04
Enterohemorrhagic Escherichia coli (EHEC) is an important cause of diarrhea and hemolytic-uremic syndrome (HUS) worldwide. Australia's worst outbreak of HUS occurred in Adelaide in 1995 and was one of the first major HUS outbreaks attributed to a non-O157 Shiga-toxigenic E. coli (STEC) strain. Molecular analyses conducted at the time suggested that the outbreak was caused by an O111:H(-) clone, with strains from later in the outbreak harboring an extra copy of the genes encoding the potent Shiga toxin 2 (Stx2). Two decades later, we have used next-generation sequencing to compare two isolates from early and late in this important outbreak. We analyzed genetic content, single-nucleotide polymorphisms (SNPs), and prophage insertion sites; for the latter, we demonstrate how paired-end sequence data can be leveraged to identify such insertion sites. The two strains are genetically identical except for six SNP differences and the presence of not one but two additional Stx2-converting prophages in the later isolate. Isolates from later in the outbreak were associated with higher levels of morbidity, suggesting that the presence of the additional Stx2-converting prophages is significant in terms of the virulence of this clone. Copyright © 2016, American Society for Microbiology. All Rights Reserved.
The s29x gene of symbiotic bacteria in Amoeba proteus with a novel promoter.
Pak, J W; Jeon, K W
1996-05-24
Gram-symbiotic bacteria (called X-bacteria), present in the xD strain of Amoeba proteus as required cell components, synthesize and export a large amount of a 29-kDa protein, S29x. S29x is exported into the host's cytoplasm across the bacterial membranes and the symbiosome membrane. The complete nucleotide (nt) sequence of the s29x gene of X-bacteria has been determined, and the promoter sequence and tsp have also been identified. The gene has a nonconventional promoter with putative nt sequences different from the known consensus sequences. When Escherichia coli cells are transformed with s29x, the gene is expressed and the product is secreted into the culture medium. Functions of S29x are not fully known, but it is suspected that S29x plays an important role in the symbiotic relationship between amoebae and X-bacteria.
Okada, N; Harada, F; Nishimura, S
1976-01-01
Guanylation of tRNA by a lysate of rabbit reticulocytes was reported previously by Farkas and Singh. This reaction was investigated further using 18 purified E. coli tRNAs as acceptors.Results showed that only tRNATyr, tRNAHis, tRNAAsn and tRNAAsp which contain the modified nucleoside Q in the anticodon acted as acceptors. Analysis of the nucleotide sequences in the guanylated tRNA showed that guanine specifically replaced Q base in these tRNAs. Images PMID:792816
Adaptive Mechanisms Underlying Microbial Resistance to Disinfectants
2016-02-01
dilution]). A clinical surrogate, Escherichia coli , was used in these studies. E. coli cells were grown in the absence or presence of Lysol. The parent... Escherichia coli RTU strength Lysol Single nucleotide polymorphism (SNP...of Escheria coli with control sets of E.coli for physiological, biochemical, and genetic differences in an attempt to understand resistance
Cloning and strong expression of a Bacillus subtilis WL-3 mannanase gene in B. subtilis.
Yoon, Ki-Hong; Lim, Byung-Lak
2007-10-01
A gene encoding the mannanase of Bacillus subtilis WL-3, which had been isolated from Korean soybean paste, was cloned into Escherichia coli and the nucleotide sequence of a 2.7-kb DNA fragment containing the mannanase gene was subsequently determined. The mannanase gene, designated manA, consisted of 1,080 nucleotides encoding polypeptide of 360 amino acid residues. The deduced amino acid sequence was highly homologous to those of mannanases belonging to glycosyl hydrolase family 26. The manA gene was strongly expressed in B. subtilis 168 by cloning the gene downstream of a strong B. subtilis promoter of plasmid pJ27Delta 88U. In flask cultures, the production of mannanase by recombinant B. subtilis 168 reached maximum levels of 300 units/ml and 450 units/ml in LB medium and LB medium containing 0.3% locust bean gum, respectively. Based on the zymogram of the mannanase, it was found that the mannanase produced by recombinant B. subtilis could be maintained stably without proteolytic degradation during the culture time.
De Carli, Silvia; Ikuta, Nilo; Lehmann, Fernanda Kieling Moreira; da Silveira, Vinicius Proença; de Melo Predebon, Gabriela; Fonseca, André Salvador Kazantzi; Lunge, Vagner Ricardo
2015-11-01
Escherichia coli is a commensal bacterium of the bird's intestinal tract, but it can invade different tissues resulting in systemic symptoms (colibacillosis). This disease occurs only when the E. coli infecting strain presents virulence factors (encoded by specific genes) that enable the adhesion and proliferation in the host organism. Thus, it is important to differentiate pathogenic (APEC, avian pathogenic E. coli) and non-pathogenic or fecal (AFEC, avian fecal E. coli) isolates. Previous studies analyzed the occurrence of virulence factors in E. coli strains isolated from birds with colibacillosis, demonstrating a high frequency of the bacterial genes cvaC, iroN, iss, iutA, sitA, tsh, fyuA, irp-2, ompT and hlyF in pathogenic strains. The aim of the present study was to evaluate the occurrence and frequency of these virulence genes in E. coli isolated from poultry flocks in Brazil. A total of 138 isolates of E. coli was obtained from samples of different tissues and/or organs (spleen, liver, kidney, trachea, lungs, skin, ovary, oviduct, intestine, cloaca) and environmental swabs collected from chicken and turkey flocks suspected to have colibacillosis in farms from the main Brazilian producing regions. Total DNA was extracted and the 10 virulence genes were detected by traditional and/or real-time PCR. At least 11 samples of each gene were sequenced and compared to reference strains. All 10 virulence factors were detected in Brazilian E. coli isolates, with frequencies ranging from 39.9% (irp-2) to 68.8% (hlyF and sitA). Moreover, a high nucleotide similarity (over 99%) was observed between gene sequences of Brazilian isolates and reference strains. Seventy-nine isolates were defined as pathogenic (APEC) and 59 as fecal (AFEC) based on previously described criteria. In conclusion, the main virulence genes of the reference E. coli strains are also present in isolates associated with colibacillosis in Brazil. The analysis of this set of virulence factors can be used to differentiate between APEC and AFEC isolates in Brazil. © 2015 Poultry Science Association Inc.
Sokurenko, E V; Courtney, H S; Maslow, J; Siitonen, A; Hasty, D L
1995-01-01
Type 1 fimbriae are heteropolymeric surface organelles responsible for the D-mannose-sensitive (MS) adhesion of Escherichia coli. We recently reported that variation of receptor specificity of type 1 fimbriae can result solely from minor alterations in the structure of the gene for the FimH adhesin subunit. To further study the relationship between allelic variation of the fimH gene and adhesive properties of type 1 fimbriae, the fimH genes from five additional strains were cloned and used to complement the FimH deletion in E. coli KB18. When the parental and recombinant strains were tested for adhesion to immobilized mannan, a wide quantitative range in the ability of bacteria to adhere was noted. The differences in adhesion do not appear to be due to differences in the levels of fimbriation or relative levels of incorporation of FimH, because these parameters were similar in low-adhesion and high-adhesion strains. The nucleotide sequence for each of the fimH genes was determined. Analysis of deduced FimH sequences allowed identification of two sequence homology groups, based on the presence of Asn-70 and Ser-78 or Ser-70 and Asn-78 residues. The consensus sequences for each group conferred very low adhesion activity, and this low-adhesion phenotype predominated among a group of 43 fecal isolates. Strains isolated from a different host niche, the urinary tract, expressed type 1 fimbriae that conferred an increased level of adhesion. The results presented here strongly suggest that the quantitative variations in MS adhesion are due primarily to structural differences in the FimH adhesin. The observed differences in MS adhesion among populations of E. coli isolated from different host niches call attention to the possibility that phenotypic variants of FimH may play a functional role in populations dynamics. PMID:7601831
Escherichia coli ArgR mutants defective in cer/Xer recombination, but not in DNA binding.
Sénéchal, Hélène; Delesques, Jérémy; Szatmari, George
2010-04-01
The Escherichia coli arginine repressor (ArgR) is an L-arginine-dependent DNA-binding protein that controls the expression of the arginine biosynthetic genes and is required as an accessory factor for Xer site-specific recombination at cer and related recombination sites in plasmids. We used the technique of pentapeptide scanning mutagenesis to isolate a series of ArgR mutants that were considerably reduced in cer recombination, but were still able to repress an argA::lacZ fusion. DNA sequence analysis showed that all of the mutants mapped to the same nucleotide, resulting in a five amino acid insertion between residues 149 and 150 of ArgR, corresponding to the end of the alpha6 helix. A truncated ArgR containing a stop codon at residue 150 displayed the same phenotype as the protein with the five amino acid insertion, and both mutants displayed sequence-specific DNA-binding activity that was L-arginine dependent. These results show that the C-terminus of ArgR is more important in cer/Xer site-specific recombination than in DNA binding.
Mainprize, Iain L; Bean, Jordan D; Bouwman, Catrien; Kimber, Matthew S; Whitfield, Chris
2013-08-09
UDP-glucose dehydrogenase (Ugd) generates UDP-glucuronic acid, an important precursor for the production of many hexuronic acid-containing bacterial surface glycostructures. In Escherichia coli K-12, Ugd is important for biosynthesis of the environmentally regulated exopolysaccharide known as colanic acid, whereas in other E. coli isolates, the same enzyme is required for production of the constitutive group 1 capsular polysaccharides, which act as virulence determinants. Recent studies have implicated tyrosine phosphorylation in the activation of Ugd from E. coli K-12, although it is not known if this is a feature shared by bacterial Ugd proteins. The activities of Ugd from E. coli K-12 and from the group 1 capsule prototype (serotype K30) were compared. Surprisingly, for both enzymes, site-directed Tyr → Phe mutants affecting the previously proposed phosphorylation site retained similar kinetic properties to the wild-type protein. Purified Ugd from E. coli K-12 had significant levels of NAD substrate inhibition, which could be alleviated by the addition of ATP and several other nucleotide triphosphates. Mutations in a previously identified UDP-glucuronic acid allosteric binding site decreased the binding affinity of the nucleotide triphosphate. Ugd from E. coli serotype K30 was not inhibited by NAD, but its activity still increased in the presence of ATP.
Mutations That Stimulate flhDC Expression in Escherichia coli K-12.
Fahrner, Karen A; Berg, Howard C
2015-10-01
Motility is a beneficial attribute that enables cells to access and explore new environments and to escape detrimental ones. The organelle of motility in Escherichia coli is the flagellum, and its production is initiated by the activating transcription factors FlhD and FlhC. The expression of these factors by the flhDC operon is highly regulated and influenced by environmental conditions. The flhDC promoter is recognized by σ(70) and is dependent on the transcriptional activator cyclic AMP (cAMP)-cAMP receptor protein complex (cAMP-CRP). A number of K-12 strains exhibit limited motility due to low expression levels of flhDC. We report here a large number of mutations that stimulate flhDC expression in such strains. They include single nucleotide changes in the -10 element of the promoter, in the promoter spacer, and in the cAMP-CRP binding region. In addition, we show that insertion sequence (IS) elements or a kanamycin gene located hundreds of base pairs upstream of the promoter can effectively enhance transcription, suggesting that the topology of a large upstream region plays a significant role in the regulation of flhDC expression. None of the mutations eliminated the requirement for cAMP-CRP for activation. However, several mutations allowed expression in the absence of the nucleoid organizing protein, H-NS, which is normally required for flhDC expression. The flhDC operon of Escherichia coli encodes transcription factors that initiate flagellar synthesis, an energetically costly process that is highly regulated. Few deregulating mutations have been reported thus far. This paper describes new single nucleotide mutations that stimulate flhDC expression, including a number that map to the promoter spacer region. In addition, this work shows that insertion sequence elements or a kanamycin gene located far upstream from the promoter or repressor binding sites also stimulate transcription, indicating a role of regional topology in the regulation of flhDC expression. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
Replacement of RNA hairpins by in vitro selected tetranucleotides.
Dichtl, B; Pan, T; DiRenzo, A B; Uhlenbeck, O C
1993-01-01
An in vitro selection method based on the autolytic cleavage of yeast tRNA(Phe) by Pb2+ was applied to obtain tRNA derivatives with the anticodon hairpin replaced by four single-stranded nucleotides. Based on the rates of the site-specific cleavage by Pb2+ and the presence of a specific UV-induced crosslink, certain tetranucleotide sequences allow proper folding of the rest of the tRNA molecule, whereas others do not. One such successful tetramer sequence was also used to replace the acceptor stem of yeast tRNA(Phe) and the anticodon hairpin of E.coli tRNA(Phe) without disrupting folding. These experiments suggest that certain tetramers may be able to replace structurally nonessential hairpins in any RNA. Images PMID:7680121
Cassels, R; Oliva, B; Knowles, D
1995-01-01
The stringent response in Escherichia coli and many other organisms is regulated by the nucleotides ppGpp and pppGpp. We show here for the first time that at least six staphylococcal species also synthesize ppGpp and pppGpp upon induction of the stringent response by mupirocin. Spots corresponding to ppGpp and pppGpp on thin-layer chromatograms suggest that pppGpp is the principal regulatory nucleotide synthesized by staphylococci in response to mupirocin, rather than ppGpp as in E. coli. PMID:7665499
Combined hairpin-antisense compositions and methods for modulating expression
Shanklin, John; Nguyen, Tam
2014-08-05
A nucleotide construct comprising a nucleotide sequence that forms a stem and a loop, wherein the loop comprises a nucleotide sequence that modulates expression of a target, wherein the stem comprises a nucleotide sequence that modulates expression of a target, and wherein the target modulated by the nucleotide sequence in the loop and the target modulated by the nucleotide sequence in the stem may be the same or different. Vectors, methods of regulating target expression, methods of providing a cell, and methods of treating conditions comprising the nucleotide sequence are also disclosed.
Combined hairpin-antisense compositions and methods for modulating expression
Shanklin, John; Nguyen, Tam Huu
2015-11-24
A nucleotide construct comprising a nucleotide sequence that forms a stem and a loop, wherein the loop comprises a nucleotide sequence that modulates expression of a target, wherein the stem comprises a nucleotide sequence that modulates expression of a target, and wherein the target modulated by the nucleotide sequence in the loop and the target modulated by the nucleotide sequence in the stem may be the same or different. Vectors, methods of regulating target expression, methods of providing a cell, and methods of treating conditions comprising the nucleotide sequence are also disclosed.
Characterization of Clostridium perfringens iota-toxin genes and expression in Escherichia coli.
Perelle, S; Gibert, M; Boquet, P; Popoff, M R
1993-12-01
The iota toxin which is produced by Clostridium perfringens type E, is a binary toxin consisting of two independent polypeptides: Ia, which is an ADP-ribosyltransferase, and Ib, which is involved in the binding and internalization of the toxin into the cell. Two degenerate oligonucleotide probes deduced from partial amino acid sequence of each component of C. spiroforme toxin, which is closely related to the iota toxin, were used to clone three overlapping DNA fragments containing the iota-toxin genes from C. perfringens type E plasmid DNA. Two genes, in the same orientation, coding for Ia (387 amino acids) and Ib (875 amino acids) and separated by 243 noncoding nucleotides were identified. A predicted signal peptide was found for each component, and the secreted Ib displays two domains, the propeptide (172 amino acids) and the mature protein (664 amino acids). The Ia gene has been expressed in Escherichia coli and C. perfringens, under the control of its own promoter. The recombinant polypeptide obtained was recognized by Ia antibodies and ADP-ribosylated actin. The expression of the Ib gene was obtained in E. coli harboring a recombinant plasmid encompassing the putative promoter upstream of the Ia gene and the Ia and Ib genes. Two residues which have been found to be involved in the NAD+ binding site of diphtheria and pseudomonas toxins are conserved in the predicted Ia sequence (Glu-14 and Trp-19). The predicted amino acid Ib sequence shows 33.9% identity with and 54.4% similarity to the protective antigen of the anthrax toxin complex. In particular, the central region of Ib, which contains a predicted transmembrane segment (Leu-292 to Ser-308), presents 45% identity with the corresponding protective antigen sequence which is involved in the translocation of the toxin across the cell membrane.
Functional expression of a human GDP-L-fucose transporter in Escherichia coli.
Förster-Fromme, Karin; Schneider, Sarah; Sprenger, Georg A; Albermann, Christoph
2017-02-01
To investigate the translocation of nucleotide-activated sugars from the cytosol across a membrane into the endoplasmatic reticulum or the Golgi apparatus which is an important step in the synthesis of glycoproteins and glycolipids in eukaryotes. The heterologous expression of the recombinant and codon-adapted human GDP-L-fucose antiporter gene SLC35C1 (encoding an N-terminal OmpA-signal sequence) led to a functional transporter protein located in the cytoplasmic membrane of Escherichia coli. The in vitro transport was investigated using inverted membrane vesicles. SLC35C1 is an antiporter specific for GDP-L-fucose and depending on the concomitant reverse transport of GMP. The recombinant transporter FucT1 exhibited an activity for the transport of 3 H-GDP-L-fucose with a V max of 8 pmol/min mg with a K m of 4 µM. The functional expression of SLC35C1 in GDP-L-fucose overproducing E. coli led to the export of GDP-L-fucose to the culture supernatant. The export of GDP-L-fucose by E. coli provides the opportunity for the engineering of a periplasmatic fucosylation reaction in recombinant bacterial cells.
Pathoadaptive Mutations of Escherichia coli K1 in Experimental Neonatal Systemic Infection
McCarthy, Alex J.; Negus, David; Martin, Patricia; Pechincha, Catarina; Oswald, Eric; Stabler, Richard A.; Taylor, Peter W.
2016-01-01
Although Escherichia coli K1 strains are benign commensals in adults, their acquisition at birth by the newborn may result in life-threatening systemic infections, most commonly sepsis and meningitis. Key features of these infections, including stable gastrointestinal (GI) colonization and age-dependent invasion of the bloodstream, can be replicated in the neonatal rat. We previously increased the capacity of a septicemia isolate of E. coli K1 to elicit systemic infection following colonization of the small intestine by serial passage through two-day-old (P2) rat pups. The passaged strain, A192PP (belonging to sequence type 95), induces lethal infection in all pups fed 2–6 x 106 CFU. Here we use whole-genome sequencing to identify mutations responsible for the threefold increase in lethality between the initial clinical isolate and the passaged derivative. Only four single nucleotide polymorphisms (SNPs), in genes (gloB, yjgV, tdcE) or promoters (thrA) involved in metabolic functions, were found: no changes were detected in genes encoding virulence determinants associated with the invasive potential of E. coli K1. The passaged strain differed in carbon source utilization in comparison to the clinical isolate, most notably its inability to metabolize glucose for growth. Deletion of each of the four genes from the E. coli A192PP chromosome altered the proteome, reduced the number of colonizing bacteria in the small intestine and increased the number of P2 survivors. This work indicates that changes in metabolic potential lead to increased colonization of the neonatal GI tract, increasing the potential for translocation across the GI epithelium into the systemic circulation. PMID:27861552
Pathoadaptive Mutations of Escherichia coli K1 in Experimental Neonatal Systemic Infection.
McCarthy, Alex J; Negus, David; Martin, Patricia; Pechincha, Catarina; Oswald, Eric; Stabler, Richard A; Taylor, Peter W
2016-01-01
Although Escherichia coli K1 strains are benign commensals in adults, their acquisition at birth by the newborn may result in life-threatening systemic infections, most commonly sepsis and meningitis. Key features of these infections, including stable gastrointestinal (GI) colonization and age-dependent invasion of the bloodstream, can be replicated in the neonatal rat. We previously increased the capacity of a septicemia isolate of E. coli K1 to elicit systemic infection following colonization of the small intestine by serial passage through two-day-old (P2) rat pups. The passaged strain, A192PP (belonging to sequence type 95), induces lethal infection in all pups fed 2-6 x 106 CFU. Here we use whole-genome sequencing to identify mutations responsible for the threefold increase in lethality between the initial clinical isolate and the passaged derivative. Only four single nucleotide polymorphisms (SNPs), in genes (gloB, yjgV, tdcE) or promoters (thrA) involved in metabolic functions, were found: no changes were detected in genes encoding virulence determinants associated with the invasive potential of E. coli K1. The passaged strain differed in carbon source utilization in comparison to the clinical isolate, most notably its inability to metabolize glucose for growth. Deletion of each of the four genes from the E. coli A192PP chromosome altered the proteome, reduced the number of colonizing bacteria in the small intestine and increased the number of P2 survivors. This work indicates that changes in metabolic potential lead to increased colonization of the neonatal GI tract, increasing the potential for translocation across the GI epithelium into the systemic circulation.
O'Sullivan, D J; O'Gara, F
1991-08-01
An iron-regulated promoter was cloned on a 2.1 kb Bg/II fragment from Pseudomonas sp. strain M114 and fused to the lacZ reporter gene. Iron-regulated lacZ expression from the resulting construct (pSP1) in strain M114 was mediated via the Fur-like repressor which also regulates siderophore production in this strain. A 390 bp StuI-PstI internal fragment contained the necessary information for iron-regulated promoter expression. This fragment was sequenced and the initiation point for transcription was determined by primer extension analysis. The region directly upstream of the transcription start point contained no significant homology to known promoter consensus sequences. However the -16 to -25 bp region contained homology to four other iron-regulated pseudomonad promoters. Deletion of bases downstream from the transcriptional start did not affect the iron-regulated expression of the promoter. The -37 and -43 bp regions exhibited some homology to the 19 bp Escherichia coli Fur-binding consensus sequence. When expressed in E. coli (via a cloned transacting factor from strain M114) lacZ expression from pSP1 was found to be regulated by iron. A region of greater than 77 bases but less than 131 upstream from the transcriptional start was found to be necessary for promoter activity, further suggesting that a transcriptional activator may be required for expression.
Kyöstiö, S R; Cramer, C L; Lacy, G H
1991-01-01
The prt1 gene encoding extracellular protease from Erwinia carotovora subsp. carotovora EC14 in cosmid pCA7 was subcloned to create plasmid pSK1. The partial nucleotide sequence of the insert in pSK1 (1,878 bp) revealed a 1,041-bp open reading frame (ORF1) that correlated with protease activity in deletion mutants. ORF1 encodes a polypeptide of 347 amino acids with a calculated molecular mass of 38,826 Da. Escherichia coli transformed with pSK1 or pSK23, a subclone of pSK1, produces a protease (Prt1) intracellularly with a molecular mass of 38 kDa and a pI of 4.8. Prt1 activity was inhibited by phenanthroline, suggesting that it is a metalloprotease. The prt1 promoter was localized between 173 and 1,173 bp upstream of ORF1 by constructing transcriptional lacZ fusions. Primer extension identified the prt1 transcription start site 205 bp upstream of ORF1. The deduced amino acid sequence of ORF1 showed significant sequence identity to metalloproteases from Bacillus thermoproteolyticus (thermolysin), B. subtilis (neutral protease), Legionella pneumophila (metalloprotease), and Pseudomonas aeruginosa (elastase). It has less sequence similarity to metalloproteases from Serratia marcescens and Erwinia chrysanthemi. Locations for three zinc ligands and the active site for E. carotovora subsp. carotovora protease were predicted from thermolysin. Images FIG. 2 FIG. 5 FIG. 6 FIG. 8 FIG. 9 PMID:1917878
Thakur, Chandar S.; Brown, Margaret E.; Sama, Jacob N.; Jackson, Melantha E.
2010-01-01
Since RNAs lie at the center of most cellular processes, there is a need for synthesizing large amounts of RNAs made from stable isotope-labeled nucleotides to advance the study of their structure and dynamics by nuclear magnetic resonance (NMR) spectroscopy. A particularly effective means of obtaining labeled nucleotides is to harvest these nucleotides from bacteria grown in defined minimal media supplemented with 15NH4Cl and various carbon sources. Given the high cost of carbon precursors required for labeling nucleic acids for NMR studies, it becomes important to evaluate the optimal growth for commonly used strains under standard minimal media conditions. Such information is lacking. In this study, we characterize the growth for Escherichia coli strains K12, K10zwf, and DL323 in three minimal media with isotopic-labeled carbon sources of acetate, glycerol, and glycerol combined with formate. Of the three media, the LeMaster-Richards and the Studier media outperform the commonly used M9 media and both support optimal growth of E. coli for the production of nucleotides. However, the growth of all three E. coli strains in acetate is reduced almost twofold compared to growth in glycerol. Analysis of the metabolic pathway and previous gene array studies help to explain this differential growth in glycerol and acetate. These studies should benefit efforts to make selective 13C-15N isotopic-labeled nucleotides for synthesizing biologically important RNAs. Electronic supplementary material The online version of this article (doi:10.1007/s00253-010-2813-y) contains supplementary material, which is available to authorized users. PMID:20730533
Differential transcriptional control of the two tRNA(fMet) genes of Escherichia coli K-12.
Nagase, T; Ishii, S; Imamoto, F
1988-07-15
The metZ gene of Escherichia coli, which encodes the tRNA(f1Met), was cloned. Using the nucleotide sequence, in vitro transcription, and S1 nuclease mapping analyses, we identified the promoter region, transcriptional start point, the two tandem tRNA(f1Met) structural genes separated by an intergenic space of 33 bp, and the two Rho-independent transcriptional termination sites, in that order. We compared the promoter region of the metZ gene with that of the metY gene, which encodes the tRNA(f2Met) and is located in the promoter-proximal portion of the nusA operon. A G + C-rich sequence (5'-GCGCATCCAC-3'), similar to the corresponding sequence of the rrn promoters that are under stringent control, was found between the Pribnow box and the transcriptional start point of the metZ promoter, but not in the metY promoter region. We therefore examined the effect of guanosine 3'-diphosphate, 5'-diphosphate (ppGpp), the chemical mediator of stringent control, and found that ppGpp inhibited the transcription of the metZ gene, but not that of the metY gene. These data suggested that the promoters for metZ and metY have different physiological functions and are regulated by different mechanisms.
Bradford, P A; Urban, C; Jaiswal, A; Mariano, N; Rasmussen, B A; Projan, S J; Rahal, J J; Bush, K
1995-01-01
Four ceftazidime-resistant Escherichia coli strains were isolated from elderly nursing home patients in a New York hospital during 1993. Strains MCQ-2, MCQ-3, and MCQ-4 were determined to be identical by pulsed-field gel electrophoresis and plasmid profiles, whereas strain MCQ-1 was unique. Strain MCQ-1 was determined to produce a TEM-10 beta-lactamase. Strains MCQ-2, MCQ-3, and MCQ-4 were also noted to be resistant to cefotaxime. These three strains produced two beta-lactamases with pIs of 5.4 (TEM-1) and 7.6. beta-Lactamase assays revealed that the pI 7.6 enzyme hydrolyzed cefotaxime faster (at a relative hydrolysis rate of 30% compared with that of benzylpenicillin) than either ceftazidime or aztreonam (relative hydrolysis rates of 13 and 3.3%, respectively). Nucleotide sequencing of the gene encoding the pI 7.6 beta-lactamase from strain MCQ-3 revealed a blaSHV-type gene differing from the gene encoding SHV-1 at four nucleotides which resulted in amino acid substitutions: phenylalanine for isoleucine at position 8, serine for arginine at position 43, serine for glycine at position 238, and lysine for glutamate at position 240. This novel SHV-type extended-spectrum beta-lactamase is designated SHV-7. PMID:7785992
Downing, Tim
2015-01-01
High-throughput molecular screening is required to investigate the origin and diffusion of antimicrobial resistance in pathogen outbreaks. The most frequent cause of human infection is Escherichia coli, which is dominated by sequence type 131 (ST131)—a set of rapidly radiating pandemic clones. The highly infectious clades of ST131 originated firstly by a mutation enhancing conjugation and adhesion. Secondly, single-nucleotide polymorphisms occurred enabling fluoroquinolone-resistance, which is near-fixed in all ST131. Thirdly, broader resistance through beta-lactamases has been gained and lost frequently, symptomatic of conflicting environmental selective effects. This flexible approach to gene exchange is worrying and supports the proposition that ST131 will develop an even wider range of plasmid and chromosomal elements promoting antimicrobial resistance. To stop ST131, deep genome sequencing is required to understand the origin, evolution and spread of antimicrobial resistance genes. Phylogenetic methods that decipher past events can predict future patterns of virulence and transmission based on genetic signatures of adaptation and gene exchange. Both the effect of partial antimicrobial exposure and cell dormancy caused by variation in gene expression may accelerate the development of resistance. High-throughput sequencing can decode measurable evolution of cell populations within patients associated with systems-wide changes in gene expression during treatments. A multi-faceted approach can enhance assessment of antimicrobial resistance in E. coli ST131 by examining transmission dynamics between hosts to achieve a goal of pre-empting resistance before it emerges by optimising antimicrobial treatment protocols. PMID:27682088
Dai, Jianjun; Wang, Shaohui; Guerlebeck, Doreen; Laturnus, Claudia; Guenther, Sebastian; Shi, Zhenyu; Lu, Chengping; Ewers, Christa
2010-09-09
Extraintestinal pathogenic E. coli (ExPEC) represent a phylogenetically diverse group of bacteria which are implicated in a large range of infections in humans and animals. Although subgroups of different ExPEC pathotypes, including uropathogenic, newborn meningitis causing, and avian pathogenic E. coli (APEC) share a number of virulence features, there still might be factors specifically contributing to the pathogenesis of a certain subset of strains or a distinct pathotype. Thus, we made use of suppression subtractive hybridization and compared APEC strain IMT5155 (O2:K1:H5; sequence type complex 95) with human uropathogenic E. coli strain CFT073 (O6:K2:H5; sequence type complex 73) to identify factors which may complete the currently existing model of APEC pathogenicity and further elucidate the position of this avian pathotype within the whole ExPEC group. Twenty-eight different genomic loci were identified, which are present in IMT5155 but not in CFT073. One of these loci contained a gene encoding a putative autotransporter adhesin. The open reading frame of the gene spans a 3,498 bp region leading to a putative 124-kDa adhesive protein. A specific antibody was raised against this protein and expression of the adhesin was shown under laboratory conditions. Adherence and adherence inhibition assays demonstrated a role for the corresponding protein in adhesion to DF-1 chicken fibroblasts. Sequence analyses revealed that the flanking regions of the chromosomally located gene contained sequences of mobile genetic elements, indicating a probable spread among different strains by horizontal gene transfer. In accordance with this hypothesis, the adhesin was found to be present not only in different phylogenetic groups of extraintestinal pathogenic but also of commensal E. coli strains, yielding a significant association with strains of avian origin. We identified a chromosomally located autotransporter gene in a highly virulent APEC strain which confers increased adherence of a non-fimbriated E. coli K-12 strain to a chicken fibroblast cell line. Even though flanked by mobile genetic elements and three different genetic regions upstream of the gene, most probably indicating horizontal gene transfer events, the adhesin gene was significantly linked with strains of avian origin. Due to the nucleotide sequence similarity of 98% to a recently published adhesin-related gene, located on plasmid pAPEC-O1-ColBM, the name aatA (APEC autotransporter adhesin A) was adopted from that study.Our data substantiate that AatA might not only be of relevance in APEC pathogenicity but also in facilitating their reservoir life style in the chicken intestine, which might pave the way for future intestinal preventive strategies.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gardner, Shea; Slezak, Tom
With the flood of whole genome finished and draft microbial sequences, we need faster, more scalable bioinformatics tools for sequence comparison. An algorithm is described to find single nucleotide polymorphisms (SNPs) in whole genome data. It scales to hundreds of bacterial or viral genomes, and can be used for finished and/or draft genomes available as unassembled contigs. The method is fast to compute, finding SNPs and building a SNP phylogeny in seconds to hours. We use it to identify thousands of putative SNPs from all publicly available Filoviridae, Poxviridae, foot-and-mouth disease virus, Bacillus, and Escherichia coli genomes and plasmids. Themore » SNP-based trees that result are consistent with known taxonomy and trees determined in other studies. The approach we describe can handle as input hundreds of gigabases of sequence in a single run. The algorithm is based on k-mer analysis using a suffix array, so we call it saSNP.« less
Choury, Danièle; Aubert, Gérald; Szajnert, Marie-France; Azibi, Kemal; Delpech, Marc; Paul, Gérard
1999-01-01
A clinical strain of Vibrio cholerae non-O1 non-O139 isolated in France produced a new β-lactamase with a pI of 5.35. The purified enzyme, with a molecular mass of 33,000 Da, was characterized. Its kinetic constants show it to be a carbenicillin-hydrolyzing enzyme comparable to the five previously reported CARB β-lactamases and to SAR-1, another carbenicillin-hydrolyzing β-lactamase that has a pI of 4.9 and that is produced by a V. cholerae strain from Tanzania. This β-lactamase is designated CARB-6, and the gene for CARB-6 could not be transferred to Escherichia coli K-12 by conjugation. The nucleotide sequence of the structural gene was determined by direct sequencing of PCR-generated fragments from plasmid DNA with four pairs of primers covering the whole sequence of the reference CARB-3 gene. The gene encodes a 288-amino-acid protein that shares 94% homology with the CARB-1, CARB-2, and CARB-3 enzymes, 93% homology with the Proteus mirabilis N29 enzyme, and 86.5% homology with the CARB-4 enzyme. The sequence of CARB-6 differs from those of CARB-3, CARB-2, CARB-1, N29, and CARB-4 at 15, 16, 17, 19, and 37 amino acid positions, respectively. All these mutations are located in the C-terminal region of the sequence and at the surface of the molecule, according to the crystal structure of the Staphylococcus aureus PC-1 β-lactamase. PMID:9925522
Sherry, Norelle L.; Porter, Jessica L.; Seemann, Torsten; Watkins, Andrew; Stinear, Timothy P.
2013-01-01
Next-generation sequencing (NGS) of bacterial genomes has recently become more accessible and is now available to the routine diagnostic microbiology laboratory. However, questions remain regarding its feasibility, particularly with respect to data analysis in nonspecialist centers. To test the applicability of NGS to outbreak investigations, Ion Torrent sequencing was used to investigate a putative multidrug-resistant Escherichia coli outbreak in the neonatal unit of the Mercy Hospital for Women, Melbourne, Australia. Four suspected outbreak strains and a comparator strain were sequenced. Genome-wide single nucleotide polymorphism (SNP) analysis demonstrated that the four neonatal intensive care unit (NICU) strains were identical and easily differentiated from the comparator strain. Genome sequence data also determined that the NICU strains belonged to multilocus sequence type 131 and carried the blaCTX-M-15 extended-spectrum beta-lactamase. Comparison of the outbreak strains to all publicly available complete E. coli genome sequences showed that they clustered with neonatal meningitis and uropathogenic isolates. The turnaround time from a positive culture to the completion of sequencing (prior to data analysis) was 5 days, and the cost was approximately $300 per strain (for the reagents only). The main obstacles to a mainstream adoption of NGS technologies in diagnostic microbiology laboratories are currently cost (although this is decreasing), a paucity of user-friendly and clinically focused bioinformatics platforms, and a lack of genomics expertise outside the research environment. Despite these hurdles, NGS technologies provide unparalleled high-resolution genotyping in a short time frame and are likely to be widely implemented in the field of diagnostic microbiology in the next few years, particularly for epidemiological investigations (replacing current typing methods) and the characterization of resistance determinants. Clinical microbiologists need to familiarize themselves with these technologies and their applications. PMID:23408689
External Guide Sequences Targeting the aac(6′)-Ib mRNA Induce Inhibition of Amikacin Resistance▿
Bistué, Alfonso J. C. Soler; Ha, Hongphuc; Sarno, Renee; Don, Michelle; Zorreguieta, Angeles; Tolmasky, Marcelo E.
2007-01-01
The dissemination of AAC(6′)-I-type acetyltransferases have rendered amikacin and other aminoglycosides all but useless in some parts of the world. Antisense technologies could be an alternative to extend the life of these antibiotics. External guide sequences are short antisense oligoribonucleotides that induce RNase P-mediated cleavage of a target RNA by forming a precursor tRNA-like complex. Thirteen-nucleotide external guide sequences complementary to locations within five regions accessible for interaction with antisense oligonucleotides in the mRNA that encodes AAC(6′)-Ib were analyzed. While small variations in the location targeted by different external guide sequences resulted in big changes in efficiency of binding to native aac(6′)-Ib mRNA, most of them induced high levels of RNase P-mediated cleavage in vitro. Recombinant plasmids coding for selected external guide sequences were introduced into Escherichia coli harboring aac(6′)-Ib, and the transformant strains were tested to determine their resistance to amikacin. The two external guide sequences that showed the strongest binding efficiency to the mRNA in vitro, EGSC3 and EGSA2, interfered with expression of the resistance phenotype at different degrees. Growth curve experiments showed that E. coli cells harboring a plasmid coding for EGSC3, the external guide sequence with the highest mRNA binding affinity in vitro, did not grow for at least 300 min in the presence of 15 μg of amikacin/ml. EGSA2, which had a lower mRNA-binding affinity in vitro than EGSC3, inhibited the expression of amikacin resistance at a lesser level; growth of E. coli harboring a plasmid coding for EGSA2, in the presence of 15 μg of amikacin/ml was undetectable for 200 min but reached an optical density at 600 nm of 0.5 after 5 h of incubation. Our results indicate that the use of external guide sequences could be a viable strategy to preserve the efficacy of amikacin. PMID:17387154
Expression and Bioinformatics Analysis of Pectate Lyase Gene from Bacillus subtilis521
NASA Astrophysics Data System (ADS)
Xiao, Jing; Lu, Fu-Ping; Li, Yu; Li, Jin-Ting
In order to exploit new genetic resources, Pectate lyase(PEL) gene was amplified by PCR using the genome DNA from an alkaline Bacillus subtilis521. The PCR product was inserted into pET22b(+) vector. The recombinant plasmids were cloned in E.coli DH5α and then expressed in E.coli BL21. When cultured in the optimized medium, the positive clones E.coli BL21(pET22b(+)pel)showed intracellular pectate lyase activity of 90.0 U/mL. It was indicated that we had obtained the correct PEL gene. The pel has an open reading frame of 1263 nucleotides and codes for a product of 420 amino acids with a calculated molecular mass of 45.5 kD. Based on computer assisted analysis, a signal peptides and two conserved domains were revealed. The sequence analysis for PEL showed that it shares 26-82% homology with other strains in GenBank. In addition, the advanced structure of PEL were also predicted and analysed. This study will help to the experimental design of PEL fermentation and production purification and enzyme evolution.
Munns, Krysty D.; Zaheer, Rahat; Xu, Yong; Stanford, Kim; Laing, Chad R.; Gannon, Victor P. J.; Selinger, L. Brent; McAllister, Tim A.
2016-01-01
Cattle are the primary reservoir of the foodborne pathogen Escherichia coli O157:H7, with the concentration and frequency of E. coli O157:H7 shedding varying substantially among individual hosts. The term ‘‘super-shedder” has been applied to cattle that shed ≥104 cfu E. coli O157:H7/g of feces. Super-shedders have been reported to be responsible for the majority of E. coli O157:H7 shed into the environment. The objective of this study was to determine if there are phenotypic and/or genotypic differences between E. coli O157:H7 isolates obtained from super-shedder compared to low-shedder cattle. From a total of 784 isolates, four were selected from low-shedder steers and six isolates from super-shedder steers (4.01–8.45 log cfu/g feces) for whole genome sequencing. Isolates were phage and clade typed, screened for substrate utilization, pH sensitivity, virulence gene profiles and Stx bacteriophage insertion (SBI) sites. A range of 89–2473 total single nucleotide polymorphisms (SNPs) were identified when sequenced strains were compared to E. coli O157:H7 strain Sakai. More non-synonymous SNP mutations were observed in low-shedder isolates. Pan-genomic and SNPs comparisons did not identify genetic segregation between super-shedder or low-shedder isolates. All super-shedder isolates and 3 of 4 of low-shedder isolates were typed as phage type 14a, SBI cluster 3 and SNP clade 2. Super-shedder isolates displayed increased utilization of galactitol, thymidine and 3-O-β-D-galactopyranosyl-D-arabinose when compared to low-shedder isolates, but no differences in SNPs were observed in genes encoding for proteins involved in the metabolism of these substrates. While genetic traits specific to super-shedder isolates were not identified in this study, differences in the level of gene expression or genes of unknown function may still contribute to some strains of E. coli O157:H7 reaching high densities within bovine feces. PMID:27018858
Munns, Krysty D; Zaheer, Rahat; Xu, Yong; Stanford, Kim; Laing, Chad R; Gannon, Victor P J; Selinger, L Brent; McAllister, Tim A
2016-01-01
Cattle are the primary reservoir of the foodborne pathogen Escherichia coli O157:H7, with the concentration and frequency of E. coli O157:H7 shedding varying substantially among individual hosts. The term ''super-shedder" has been applied to cattle that shed ≥10(4) cfu E. coli O157:H7/g of feces. Super-shedders have been reported to be responsible for the majority of E. coli O157:H7 shed into the environment. The objective of this study was to determine if there are phenotypic and/or genotypic differences between E. coli O157:H7 isolates obtained from super-shedder compared to low-shedder cattle. From a total of 784 isolates, four were selected from low-shedder steers and six isolates from super-shedder steers (4.01-8.45 log cfu/g feces) for whole genome sequencing. Isolates were phage and clade typed, screened for substrate utilization, pH sensitivity, virulence gene profiles and Stx bacteriophage insertion (SBI) sites. A range of 89-2473 total single nucleotide polymorphisms (SNPs) were identified when sequenced strains were compared to E. coli O157:H7 strain Sakai. More non-synonymous SNP mutations were observed in low-shedder isolates. Pan-genomic and SNPs comparisons did not identify genetic segregation between super-shedder or low-shedder isolates. All super-shedder isolates and 3 of 4 of low-shedder isolates were typed as phage type 14a, SBI cluster 3 and SNP clade 2. Super-shedder isolates displayed increased utilization of galactitol, thymidine and 3-O-β-D-galactopyranosyl-D-arabinose when compared to low-shedder isolates, but no differences in SNPs were observed in genes encoding for proteins involved in the metabolism of these substrates. While genetic traits specific to super-shedder isolates were not identified in this study, differences in the level of gene expression or genes of unknown function may still contribute to some strains of E. coli O157:H7 reaching high densities within bovine feces.
Amino acid sequence of a trypsin inhibitor from a Spirometra (Spirometra erinaceieuropaei).
Sanda, A; Uchida, A; Itagaki, T; Kobayashi, H; Inokuchi, N; Koyama, T; Iwama, M; Ohgi, K; Irie, M
2001-12-01
A trypsin inhibitor that is highly homologous with bovine pancreatic trypsin inhibitor (BPTI) was co-purified along with RNase from Spirometra (Spirometra erinaceieuropaei). The amino acid sequence of this inhibitor (SETI) and the nucleotide sequence of the cDNA encoding this protein were determined by protein chemistry and gene technology. SETI contains 68 amino acid residues and has a molecular mass of 7,798 Da. SETI has 31 amino acid residues that are identical with BPTI's sequence, including 6 half-cystine and 5 aromatic amino acid residues. The active site Lys residue in BPTI is replaced by an Arg residue in SETI. SETI is an effective inhibitor of trypsin and moderately inhibits a-chymotrypsin, but less inhibits elastase or subtilisin. SETI was expressed by E. coli containing a PelB vector carrying the SETI encoding cDNA; an expression yield of 0.68 mg/l was obtained. The phylogenetic relationship of SETI and the other BPTI-like trypsin inhibitors was analyzed using most likelihood inference methods.
Plesiat, P; Grandguillot, M; Harayama, S; Vragar, S; Michel-Briand, Y
1991-01-01
Pseudomonas testosteroni ATCC 17410 is able to grow on testosterone. This strain was mutagenized by Tn5, and 41 mutants defective in the utilization of testosterone were isolated. One of them, called mutant 06, expressed 3-oxosteroid delta 1- and 3-oxosteroid delta 4-5 alpha-dehydrogenases only at low levels. The DNA region around the Tn5 insertion in mutant 06 was cloned into pUC19, and the 1-kbp EcoRI-BamHI segment neighbor to the Tn5 insertion was used to probe DNA from the wild-type strain. The probe hybridized to a 7.8-kbp SalI fragment. Plasmid pTES5, which is a pUC19 derivative containing this 7.8-kbp SalI fragment, was isolated after the screening by the 1-kbp EcoRI-BamHI probe. This plasmid expressed delta 1-dehydrogenase in Escherichia coli cells. The 2.2-kbp KpnI-KpnI segment of pTES5 was subcloned into pUC18, and pTEK21 was constructed. In E. coli containing the lacIq plasmid pRG1 and pTEK21, the expression of delta 1-dehydrogenase was induced by isopropyl-beta-D-thiogalactopyranoside (IPTG). The induced level was about 40 times higher than the induced level in P. testosteroni. Delta 1-Dehydrogenase synthesized in E. coli was localized in the inner membrane fraction. The minicell experiments showed that a 59-kDa polypeptide was synthesized from pTEK21, and this polypeptide was located in the inner membrane fraction. The complete nucleotide sequence of the 2.2-kbp KpnI-KpnI segment of pTEK21 was determined. An open reading frame which encodes a 62.4-kDa polypeptide and which is preceded by a Shine-Dalgarno-like sequence was identified. The first 44 amino acids of the putative product exhibited significant sequence similarity to the N-terminal sequences of lipoamide dehydrogenases. Images FIG. 4 PMID:1657885
DOE Office of Scientific and Technical Information (OSTI.GOV)
Weiss, S.B.
Our laboratory has explored the use of short DNA oligomers as targets for activated polycyclic aromatic hydrocarbons, such as benzo(a)pyrene diol epoxide (BPDE), in order to detect alterations in DNA sequence arrangement. In this model system, oligomers alkylated with (+)-BPDE are ligated into M13 viral DNA and used to transfect Escherichia coli. These cells are plated on agar, incubated at 37/sup 0/C, progeny viral clones are selected, amplified, and the viral DNAs isolated are sequenced at the site of oligomer insertion. We have devised a procedure for the preparation of unique duplex DNA oligomers such that the site of oligomermore » alkylation is specific for a single deoxynucleotide species in the two DNA strands. The procedure for oligomer assembly also allows us to vary the position of the alkylated residue in each of the two strands. Using our model system, the results obtained over the past year can be summarized as follows. When nonalkylated oligomer constructs are ligated into M13 viral DNA and used to transfect E. coli, no modifications in DNA sequence arrangement are detected in progeny viral DNAs. On the other hand, with oligomer constructs containing BP-adducts two major types of modifications in DNA sequence arrangement were observed: (1) large deletions, and (2) nonhomologous (illegitimate) recombinants. Both of these DNA modifications result in the complete removal of the oligomer insert. Transfection of E. coli that are recA/sup -/ does not alter these DNA modifications, therefore, it appears that the deletions and recombinants induced by the alkylated inserts are not under control of the RecA gene. As the distance between the alkylated residues in the duplex strands is increased, the number of recombinant events detected is reduced. In addition to the above types of DNA modifications, restoration of the original nucleotide sequence in the alkylated construct was also observed in progeny viral DNAs. 7 refs., 6 figs., 2 tabs.« less
Gentry-Weeks, C R; Hultsch, A L; Kelly, S M; Keith, J M; Curtiss, R
1992-01-01
Three gene libraries of Bordetella avium 197 DNA were prepared in Escherichia coli LE392 by using the cosmid vectors pCP13 and pYA2329, a derivative of pCP13 specifying spectinomycin resistance. The cosmid libraries were screened with convalescent-phase anti-B. avium turkey sera and polyclonal rabbit antisera against B. avium 197 outer membrane proteins. One E. coli recombinant clone produced a 56-kDa protein which reacted with convalescent-phase serum from a turkey infected with B. avium 197. In addition, five E. coli recombinant clones were identified which produced B. avium outer membrane proteins with molecular masses of 21, 38, 40, 43, and 48 kDa. At least one of these E. coli clones, which encoded the 21-kDa protein, reacted with both convalescent-phase turkey sera and antibody against B. avium 197 outer membrane proteins. The gene for the 21-kDa outer membrane protein was localized by Tn5seq1 mutagenesis, and the nucleotide sequence was determined by dideoxy sequencing. DNA sequence analysis of the 21-kDa protein revealed an open reading frame of 582 bases that resulted in a predicted protein of 194 amino acids. Comparison of the predicted amino acid sequence of the gene encoding the 21-kDa outer membrane protein with protein sequences in the National Biomedical Research Foundation protein sequence data base indicated significant homology to the OmpA proteins of Shigella dysenteriae, Enterobacter aerogenes, E. coli, and Salmonella typhimurium and to Neisseria gonorrhoeae outer membrane protein III, Haemophilus influenzae protein P6, and Pseudomonas aeruginosa porin protein F. The gene (ompA) encoding the B. avium 21-kDa protein hybridized with 4.1-kb DNA fragments from EcoRI-digested, chromosomal DNA of Bordetella pertussis and Bordetella bronchiseptica and with 6.0- and 3.2-kb DNA fragments from EcoRI-digested, chromosomal DNA of B. avium and B. avium-like DNA, respectively. A 6.75-kb DNA fragment encoding the B. avium 21-kDa protein was subcloned into the Asd+ vector pYA292, and the construct was introduced into the avirulent delta cya delta crp delta asd S. typhimurium chi 3987 for oral immunization of birds. The gene encoding the 21-kDa protein was expressed equivalently in B. avium 197, delta asd E. coli chi 6097, and S. typhimurium chi 3987 and was localized primarily in the cytoplasmic membrane and outer membrane. In preliminary studies on oral inoculation of turkey poults with S. typhimurium chi 3987 expressing the gene encoding the B. avium 21-kDa protein, it was determined that a single dose of the recombinant Salmonella vaccine failed to elicit serum antibodies against the 21-kDa protein and challenge with wild-type B. avium 197 resulted in colonization of the trachea and thymus with B. avium 197. Images PMID:1447140
Yamamoto, K; Ichinose, Y; Shinagawa, H; Makino, K; Nakata, A; Iwanaga, M; Honda, T; Miwatani, T
1990-12-01
Vibrio cholerae O1 biotype El Tor produces and secretes a 65-kDa cytolysin/hemolysin into the culture medium. We cloned the structural gene (hlyA) for the cytolysin from the total DNA of a V. cholerae O1 El Tor strain, N86. Nucleotide sequence analysis of hlyA revealed an open reading frame consisting of 2,223 bp which can code for a protein of 741 amino acids with a molecular weight of 81,961. Consistent with this, a 79-kDa protein was identified as the product of hlyA by maxicell analysis in Escherichia coli. N-terminal amino acids of this 79-kDa HlyA protein and those of a 65-kDa El Tor cytolysin purified from V. cholerae were Asn-26 and Asn-158, respectively. The 82- and 79-kDa precursors of the 65-kDa mature cytolysin were found in V. cholerae by pulse-chase labeling and Western blot (immunoblot) analysis of hlyA products. Hemolytic activity of the 79-kDa HlyA protein from E. coli was less than 5% that for the 65-kDa cytolysin from V. cholerae. Our results suggest that in V. cholerae, the 82-kDa preprotoxin synthesized in the cytoplasm is secreted through the membranes into the culture medium as the 79-kDa inactive protoxin after cleavage of the signal peptide and is then further processed into the 65-kDa active cytolysin by release of the N-terminal 15-kDa fragment.
Gulliver, Emily L; Wright, Amy; Lucas, Deanna Deveson; Mégroz, Marianne; Kleifeld, Oded; Schittenhelm, Ralf B; Powell, David R; Seemann, Torsten; Bulitta, Jürgen B; Harper, Marina; Boyce, John D
2018-05-01
Pasteurella multocida is a Gram-negative bacterium responsible for many important animal diseases. While a number of P. multocida virulence factors have been identified, very little is known about how gene expression and protein production is regulated in this organism. Small RNA (sRNA) molecules are critical regulators that act by binding to specific mRNA targets, often in association with the RNA chaperone protein Hfq. In this study, transcriptomic analysis of the P. multocida strain VP161 revealed a putative sRNA with high identity to GcvB from Escherichia coli and Salmonella enterica serovar Typhimurium. High-throughput quantitative liquid proteomics was used to compare the proteomes of the P. multocida VP161 wild-type strain, a gcvB mutant, and a GcvB overexpression strain. These analyses identified 46 proteins that displayed significant differential production after inactivation of gcvB , 36 of which showed increased production. Of the 36 proteins that were repressed by GcvB, 27 were predicted to be involved in amino acid biosynthesis or transport. Bioinformatic analyses of putative P. multocida GcvB target mRNAs identified a strongly conserved 10 nucleotide consensus sequence, 5'-AACACAACAT-3', with the central eight nucleotides identical to the seed binding region present within GcvB mRNA targets in E. coli and S. Typhimurium. Using a defined set of seed region mutants, together with a two-plasmid reporter system that allowed for quantification of sRNA-mRNA interactions, this sequence was confirmed to be critical for the binding of the P. multocida GcvB to the target mRNA, gltA . © 2018 Gulliver et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.
Elkins, C A; Kotewicz, M L; Jackson, S A; Lacher, D W; Abu-Ali, G S; Patel, I R
2013-01-01
Modern risk control and food safety practices involving food-borne bacterial pathogens are benefiting from new genomic technologies for rapid, yet highly specific, strain characterisations. Within the United States Food and Drug Administration (USFDA) Center for Food Safety and Applied Nutrition (CFSAN), optical genome mapping and DNA microarray genotyping have been used for several years to quickly assess genomic architecture and gene content, respectively, for outbreak strain subtyping and to enhance retrospective trace-back analyses. The application and relative utility of each method varies with outbreak scenario and the suspect pathogen, with comparative analytical power enhanced by database scale and depth. Integration of these two technologies allows high-resolution scrutiny of the genomic landscapes of enteric food-borne pathogens with notable examples including Shiga toxin-producing Escherichia coli (STEC) and Salmonella enterica serovars from a variety of food commodities. Moreover, the recent application of whole genome sequencing technologies to food-borne pathogen outbreaks and surveillance has enhanced resolution to the single nucleotide scale. This new wealth of sequence data will support more refined next-generation custom microarray designs, targeted re-sequencing and "genomic signature recognition" approaches involving a combination of genes and single nucleotide polymorphism detection to distil strain-specific fingerprinting to a minimised scale. This paper examines the utility of microarrays and optical mapping in analysing outbreaks, reviews best practices and the limits of these technologies for pathogen differentiation, and it considers future integration with whole genome sequencing efforts.
Structure and regulation of KGD1, the structural gene for yeast alpha-ketoglutarate dehydrogenase.
Repetto, B; Tzagoloff, A
1989-06-01
Nuclear respiratory-defective mutants of Saccharomyces cerevisiae have been screened for lesions in the mitochondrial alpha-ketoglutarate dehydrogenase complex. Strains assigned to complementation group G70 were ascertained to be deficient in enzyme activity due to mutations in the KGD1 gene coding for the alpha-ketoglutarate dehydrogenase component of the complex. The KGD1 gene has been cloned by transformation of a representative kgd1 mutant, C225/U1, with a recombinant plasmid library of wild-type yeast nuclear DNA. Transformants containing the gene on a multicopy plasmid had three- to four-times-higher alpha-ketoglutarate dehydrogenase activity than did wild-type S. cerevisiae. Substitution of the chromosomal copy of KGD1 with a disrupted allele (kgd1::URA3) induced a deficiency in alpha-ketoglutarate dehydrogenase. The sequence of the cloned region of DNA which complements kgd1 mutants was found to have an open reading frame of 3,042 nucleotides capable of coding for a protein of Mw 114,470. The encoded protein had 38% identical residues with the reported sequence of alpha-ketoglutarate dehydrogenase from Escherichia coli. Two lines of evidence indicated that transcription of KGD1 is catabolite repressed. Higher steady-state levels of KGD1 mRNA were detected in wild-type yeast grown on the nonrepressible sugar galactose than in yeast grown on high glucose. Regulation of KGD1 was also studied by fusing different 5'-flanking regions of KGD1 to the lacZ gene of E. coli and measuring the expression of beta-galactosidase in yeast. Transformants harboring a fusion of 693 nucleotides of the 5'-flanking sequence expressed 10 times more beta-galactosidase activity when grown under derepressed conditions. The response to the carbon source was reduced dramatically when the same lacZ fusion was present in a hap2 or hap3 mutant. The promoter element(s) responsible for the regulated expression of KGD1 has been mapped to the -354 to -143 region. This region contained several putative activation sites with sequences matching the core element proposed to be essential for binding of the HAP2 and HAP3 regulatory proteins.
Brunngraber, E F; Chargaff, E
1977-01-01
The action of the nucleotide phosphotransferase of Escherichia coli on nicotinamide riboside and on its 5'-phosphate results in the addition of one phosphate moiety to each of the substrates. Although the proof is not conclusive, it is likely that the phosphate group is transferred to the 3'-hydroxyl of the ribose. This is in contrast to the behavior of the enzyme toward NAD in which only the adenylic acid portion is phosphorylated enzymically. PMID:144913
Adams, C; Dowling, D N; O'Sullivan, D J; O'Gara, F
1994-06-03
An iron-regulated gene, pbsC, required for siderophore production in fluorescent Pseudomonas sp. strain M114 has been identified. A kanamycin-resistance cassette was inserted at specific restriction sites within a 7 kb genomic fragment of M114 DNA and by marker exchange two siderophore-negative mutants, designated M1 and M2, were isolated. The nucleotide sequence of approximately 4 kb of the region flanking the insertion sites was determined and a large open reading frame (ORF) extending for 2409 bp was identified. This gene was designated pbsC (pseudobactin synthesis C) and its putative protein product termed PbsC. PbsC was found to be homologous to a family of enzymes involved in the biosynthesis of secondary metabolites, including EntF of Escherichia coli. These enzymes are believed to act via ATP-dependent binding of AMP to their substrate. Several areas of high sequence homology between these proteins and PbsC were observed, including a conserved AMP-binding domain. The expression of pbsC is iron-regulated as revealed when a DNA fragment containing the upstream region was cloned in a promoter probe vector and conjugated into the wild-type strain, M114. The nucleotide sequence upstream of the putative translational start site contains a region homologous to previously defined -16 to -25 sequences of iron-regulated genes but did not contain an iron-box consensus sequence. It was noted that inactivation of the pbsC gene also affected other iron-regulated phenotypes of Pseudomonas M114.
Tabor, C W; Tabor, H
1987-11-25
We have previously shown that the gene (speD) for S-adenosylmethionine decarboxylase is part of an operon that also contains the gene (speE) for spermidine synthase (Tabor, C. W., Tabor, H., and Xie, Q.-W. (1986) Proc. Natl. Acad. Sci. U. S. A. 83, 6040-6044). We have now determined the nucleotide sequence of this operon and have found that speD codes for a polypeptide of Mr = 30,400, which is considerably greater than the subunit size of the purified enzyme. Our studies show that S-adenosylmethionine decarboxylase is first formed as a Mr = 30,400 polypeptide and that this proenzyme is then cleaved at the Lys111-Ser112 peptide bond to form a Mr = 12,400 subunit and a Mr = 18,000 subunit. The latter subunit contains the pyruvoyl moiety that we previously showed is required for enzymatic activity. Both subunits are present in the purified enzyme. These conclusions are based on (i) pulse-chase experiments with a strain containing a speD+ plasmid which showed a precursor-product relationship between the proenzyme and the enzyme subunits, (ii) the amino acid sequence of the proenzyme form of S-adenosylmethionine decarboxylase (derived from the nucleotide sequence of the speD gene), and (iii) comparison of this sequence of the proenzyme with the N-terminal amino acid sequences of the two subunits of the purified enzyme reported by Anton and Kutny (Anton, D. L., and Kutny, R. (1987) J. Biol. Chem. 262, 2817-2822).
37 CFR 1.822 - Symbols and format to be used for nucleotide and/or amino acid sequence data.
Code of Federal Regulations, 2011 CFR
2011-07-01
... for nucleotide and/or amino acid sequence data. 1.822 Section 1.822 Patents, Trademarks, and... Amino Acid Sequences § 1.822 Symbols and format to be used for nucleotide and/or amino acid sequence data. (a) The symbols and format to be used for nucleotide and/or amino acid sequence data shall...
Kiatpapan, Pornpimon; Kobayashi, Hajime; Sakaguchi, Maki; Ono, Hisayo; Yamashita, Mitsuo; Kaneko, Yoshinobu; Murooka, Yoshikatsu
2001-01-01
Genes for subunits of acetyl coenzyme A carboxylase (ACC), which is the enzyme that catalyzes the first step in the synthesis of fatty acids in Lactobacillus plantarum L137, were cloned and characterized. We identified six potential open reading frames, namely, manB, fabH, accB, accC, accD, and accA, in that order. Nucleotide sequence analysis suggested that fabH encoded β-ketoacyl-acyl carrier protein synthase III, that the accB, accC, accD, and accA genes encoded biotin carboxyl carrier protein, biotin carboxylase, and the β and α subunits of carboxyltransferase, respectively, and that these genes were clustered. The organization of acc genes was different from that reported for Escherichia coli, for Bacillus subtilis, and for Pseudomonas aeruginosa. E. coli accB and accD mutations were complemented by the L. plantarum accB and accD genes, respectively. The predicted products of all five genes were confirmed by using the T7 expression system in E. coli. The gene product of accB was biotinylated in E. coli. Northern and primer extension analyses demonstrated that the five genes in L. plantarum were regulated polycistronically in an acc operon. PMID:11133475
Huiet, L; Feldstein, P A; Tsai, J H; Falk, B W
1993-12-01
Primer extension analyses and a PCR-based cloning strategy were used to identify and characterize 5' nucleotide sequences on the maize stripe virus (MStV) RNA4 mRNA transcripts encoding the major noncapsid protein (NCP). Direct RNA sequence analysis by primer extension showed that the NCP mRNA transcripts had 10-15 nucleotides beyond the 5' terminus of the MStV RNA4 nucleotide sequence. MStV genomic RNAs isolated from ribonucleoprotein particles (RNPs) lacked the additional 5' nucleotides. cDNA clones representing the 5' region of the mRNA transcripts were constructed, and the nucleotide sequences of the 5' regions were determined for 16 clones. Each was found to have a distinct 10-15 nucleotide sequence immediately 5' of the MStV RNA4 sequence. Eleven of 16 clones had the correct MStV RNA4 5' nucleotide sequence, while five showed minor variations at or near the 5' most MStV RNA4 nucleotide. These characteristics show strong similarities to other viral mRNA transcripts which are synthesized by cap snatching.
Benedetti, Michele; Romano, Alessandro; De Castro, Federica; Girelli, Chiara R; Antonucci, Daniela; Migoni, Danilo; Verri, Tiziano; Fanizzi, Francesco P
2016-10-01
In this work, we assessed the capacity of RNA polymerases to use platinated ribonucleotides as substrates for RNA synthesis by testing the incorporation of the model compound [Pt(dien)(N7-5'-GTP)] (dien=diethylenetriamine; GTP=5'-guanosine triphosphate) into a natural RNA sequence. The yield of in vitro transcription operated by T7 RNA polymerase, on the LacZ (Escherichia coli gene encoding for β-galactosidase) sequence, decreases progressively with decreasing the concentration of natural GTP, in favor of the platinated nucleotide, [Pt(dien)(N7-5'-GTP)]. Comparison of the T7 RNA polymerase transcription activities for [Pt(dien)(N7-5'-GTP)] compound incorporation reaction test, with respect to the effect of a decreasing concentration of natural GTP, showed no major differences. A specific inhibitory effect of compound [Pt(dien)(N7-5'-GTP)] (which may pair the complementary base on the DNA strand, without being incorporated in the RNA by the T7 RNA polymerase) was evidenced. Our findings therefore suggest that RNA polymerases, unlike DNA polymerases, are unable to incorporate N7-platinated nucleotides into newly synthesized nucleic acids. In this respect, specifically designed N7-platinated nucleotides based compounds could be used in alternative to the classical platinum based drugs. This approach may offer a possible strategy to target specifically DNA, without affecting RNA, and is potentially able to better modulate pharmacological activity. Copyright © 2016 Elsevier Inc. All rights reserved.
37 CFR 1.821 - Nucleotide and/or amino acid sequence disclosures in patent applications.
Code of Federal Regulations, 2010 CFR
2010-07-01
... 37 Patents, Trademarks, and Copyrights 1 2010-07-01 2010-07-01 false Nucleotide and/or amino acid... Biotechnology Invention Disclosures Application Disclosures Containing Nucleotide And/or Amino Acid Sequences § 1.821 Nucleotide and/or amino acid sequence disclosures in patent applications. (a) Nucleotide and...
37 CFR 1.821 - Nucleotide and/or amino acid sequence disclosures in patent applications.
Code of Federal Regulations, 2011 CFR
2011-07-01
... 37 Patents, Trademarks, and Copyrights 1 2011-07-01 2011-07-01 false Nucleotide and/or amino acid... Biotechnology Invention Disclosures Application Disclosures Containing Nucleotide And/or Amino Acid Sequences § 1.821 Nucleotide and/or amino acid sequence disclosures in patent applications. (a) Nucleotide and...
Selection rhizosphere-competent microbes for development of microbial products as biocontrol agents
NASA Astrophysics Data System (ADS)
Mashinistova, A. V.; Elchin, A. A.; Gorbunova, N. V.; Muratov, V. S.; Kydralieva, K. A.; Khudaibergenova, B. M.; Shabaev, V. P.; Jorobekova, Sh. J.
2009-04-01
Rhizosphere-borne microorganisms reintroduced to the soil-root interface can establish without inducing permanent disturbance in the microbial balance and effectively colonise the rhizosphere due to carbon sources of plant root exudates. A challenge for future development of microbial products for use in agriculture will be selection of rhizosphere-competent microbes that both protect the plant from pathogens and improve crop establishment and persistence. In this study screening, collection, identification and expression of stable and technological microbial strains living in soils and in the rhizosphere of abundant weed - couch-grass Elytrigia repens L. Nevski were conducted. A total of 98 bacteria isolated from the rhizosphere were assessed for biocontrol activity in vitro against phytopathogenic fungi including Fusarium culmorum, Fusarium heterosporum, Fusarium oxysporum, Drechslera teres, Bipolaris sorokiniana, Piricularia oryzae, Botrytis cinerea, Colletothrichum atramentarium and Cladosporium sp., Stagonospora nodorum. Biocontrol activity were performed by the following methods: radial and parallel streaks, "host - pathogen" on the cuts of wheat leaves. A culture collection comprising 64 potential biocontrol agents (BCA) against wheat and barley root diseases has been established. Of these, the most effective were 8 isolates inhibitory to at least 4 out of 5 phytopathogenic fungi tested. The remaining isolates inhibited at least 1 of 5 fungi tested. Growth stimulating activity of proposed rhizobacteria-based preparations was estimated using seedling and vegetative pot techniques. Seeds-inoculation and the tests in laboratory and field conditions were conducted for different agricultural crops - wheat and barley. Intact cells, liquid culture filtrates and crude extracts of the four beneficial bacterial strains isolated from the rhizosphere of weed were studied to stimulate plant growth. As a result, four bacterial strains selected from rhizosphere of weed - couch-grass Elytrigia repens L. Nevski were chosen as a core of collection of 98 pure cultures with high fungicidal and plant growth-stimulating potentials. Partial determination of nucleotide sequence of 16S ribosomes of tested bacteria indicated that Pseudomonas and Bacillus species were the most dominant bacteria exhibiting biocontrol activity. Typing of bacterial strains was performed on the basis of partial determination of nucleotide sequence 16S ribosome of the studying strain. For this purpose polymerase chain reaction (PCR), using specific primers was provided with chromosomal DNA of bacterial strain under study. After determination of nucleotide sequences of the obtained PCR-fragments, the data obtained was compared with the sequences available in the bank of data (GENEBANK: http://www.ncbi.nlm.nih.gov), with the aim to determine close related strain to the organism under study. When the level of homology exceeded the level of 98%, one could conclude that the strain under study was identical to the available in the bank of data. Amplification and sequencing of gene 16S pDNA was performed using universal for the majority of prokaryotes primers. Thermopolimerase Long PCR Enzyme Mix «Fermentas», dNTP -«Fermentas» was used for amplification. While performing PCR, reagent concentrations corresponded to the protocols described in a set Long PCR Enzyme Mix «Fermentas». DNA separation from the sample was performed with DNeasy Plant Mini Kit «QIAGEN». DNA separation from gel was performed with QIAquick Gel Extraction Kit«QIAGEN». Phylogenetic affinity was determined on the basis of the comparison of nucleotide sequence - 400 nucleotides that approximately corresponded to the positions from 500 to 907 nucleotides by nomenclature of E.coli. Primary analysis of the similarity of nucleotide sequences of genes 16S рDNA of the strains under study was performed on the basis of data Genbank. Sequences were aligned according to nucleotide sequences of those bacteria, which had the highest degree of homology with the strains under study, applying the program ClustalX 1.83. Building of rootless phylogenetic trees of the studying bacteria was carried out with the help of the program Njplot. Acknowledgement. This research was supported by the grant of ISTC KR-993.2.
Alpert, Carl-Alfred; Crutz-Le Coq, Anne-Marie; Malleret, Christine; Zagorec, Monique
2003-01-01
The complete nucleotide sequence of the 13-kb plasmid pRV500, isolated from Lactobacillus sakei RV332, was determined. Sequence analysis enabled the identification of genes coding for a putative type I restriction-modification system, two genes coding for putative recombinases of the integrase family, and a region likely involved in replication. The structural features of this region, comprising a putative ori segment containing 11- and 22-bp repeats and a repA gene coding for a putative initiator protein, indicated that pRV500 belongs to the pUCL287 subfamily of theta-type replicons. A 3.7-kb fragment encompassing this region was fused to an Escherichia coli replicon to produce the shuttle vector pRV566 and was observed to be functional in L. sakei for plasmid replication. The L. sakei replicon alone could not support replication in E. coli. Plasmid pRV500 and its derivative pRV566 were determined to be at very low copy numbers in L. sakei. pRV566 was maintained at a reasonable rate over 20 generations in several lactobacilli, such as Lactobacillus curvatus, Lactobacillus casei, and Lactobacillus plantarum, in addition to L. sakei, making it an interesting basis for developing vectors. Sequence relationships with other plasmids are described and discussed. PMID:12957947
Wilson, R L; Stauffer, G V
1994-01-01
The gene encoding GcvA, the trans-acting regulatory protein for the Escherichia coli glycine cleavage enzyme system, has been sequenced. The gcvA locus contains an open reading frame of 930 nucleotides that could encode a protein with a molecular mass of 34.4 kDa, consistent with the results of minicell analysis indicating that GcvA is a polypeptide of approximately 33 kDa. The deduced amino acid sequence of GcvA revealed that this protein shares similarity with the LysR family of activator proteins. The transcription start site was found to be 72 bp upstream of the presumed translation start site. A chromosomal deletion of gcvA resulted in the inability of cells to activate the expression of a gcvT-lacZ gene fusion when grown in the presence of glycine and an inability to repress gcvT-lacZ expression when grown in the presence of inosine. The regulation of gcvA was examined by constructing a gcvA-lacZ gene fusion in which beta-galactosidase synthesis is under the control of the gcvA regulatory region. Although gcvA expression appears to be autogenously regulated over a two- to threefold range, it is neither induced by glycine nor repressed by inosine. Images PMID:8188587
George, Susan; Bhasker, Salini; Madhav, Harish; Nair, Archana; Chinnamma, Mohankumar
2014-02-01
Bromelain (BRM) is a defense protein present in the fruit and stem of pineapple (Ananas comosus) and it is grouped as a cysteine protease enzyme with diversified medicinal uses. Based on its therapeutic applications, bromelain has got sufficient attention in pharmaceutical industries. In the present study, the full coding gene of bromelain in pineapple stem (1,093 bp) was amplified by RT-PCR. The PCR product was cloned, sequenced, and characterized. The sequence analysis of the gene revealed the single nucleotide polymorphism and its phylogenetic relatedness. The peptide sequence deduced from the gene showed the amino acid variations, physicochemical properties and secondary and tertiary structural features of the protein. The full BRM gene was transformed to prokaryotic vector pET32b and expressed in Escherichia coli BL21 DE3pLysS host cells successfully. The identity of the recombinant bromelain (rBRM) protein was confirmed by Western blot analysis using anti-BRM-rabbit IgG antibody. The activity of recombinant bromelain compared with purified native bromelain was determined by protease assay. The inhibitory effect of rBRM compared with native BRM in the growth of Gram-positive and Gram-negative strains of Streptococcus agalactiae and Escherichia coli O111 was evident from the antibacterial sensitivity test. To the best of our knowledge, this is the first report showing the bactericidal property of rBRM expressed in a prokaryotic system.
Sequence and features of the tryptophan operon of Vibrio parahemolyticus.
Crawford, I P; Han, C Y; Silverman, M
1991-01-01
The nucleotide sequence of the trp operon of the marine enteric bacterium Vibrio parahemolyticus is presented. The gene order E, G, D, C(F), B, A is identical to that of other enterics. The structural genes of the operon are preceded by a long leader region encoding a 41-residue peptide containing five tryptophan residues. The organization of the leader region suggests that transcription of the operon is subject to attenuation control. The promoter-operator region of the V. parahemolyticus trp operon is almost identical to the corresponding promoter-operator of E. coli. The similarities suggest that promoter strength and operator function are identical in the two species, and that transcription initiation is regulated by repression. The operon appears to lack the internal promoter within trpD that is common in terrestrial enteric species.
Optimizing complex phenotypes through model-guided multiplex genome engineering
Kuznetsov, Gleb; Goodman, Daniel B.; Filsinger, Gabriel T.; ...
2017-05-25
Here, we present a method for identifying genomic modifications that optimize a complex phenotype through multiplex genome engineering and predictive modeling. We apply our method to identify six single nucleotide mutations that recover 59% of the fitness defect exhibited by the 63-codon E. coli strain C321.ΔA. By introducing targeted combinations of changes in multiplex we generate rich genotypic and phenotypic diversity and characterize clones using whole-genome sequencing and doubling time measurements. Regularized multivariate linear regression accurately quantifies individual allelic effects and overcomes bias from hitchhiking mutations and context-dependence of genome editing efficiency that would confound other strategies.
Optimizing complex phenotypes through model-guided multiplex genome engineering
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kuznetsov, Gleb; Goodman, Daniel B.; Filsinger, Gabriel T.
Here, we present a method for identifying genomic modifications that optimize a complex phenotype through multiplex genome engineering and predictive modeling. We apply our method to identify six single nucleotide mutations that recover 59% of the fitness defect exhibited by the 63-codon E. coli strain C321.ΔA. By introducing targeted combinations of changes in multiplex we generate rich genotypic and phenotypic diversity and characterize clones using whole-genome sequencing and doubling time measurements. Regularized multivariate linear regression accurately quantifies individual allelic effects and overcomes bias from hitchhiking mutations and context-dependence of genome editing efficiency that would confound other strategies.
Haugum, K; Brandal, L T; Løbersli, I; Kapperud, G; Lindstedt, B-A
2011-06-01
To compare 167 Norwegian human and nonhuman Escherichia coli O157:H7/NM (nonmotile) isolates with respect to an A/T single nucleotide polymorphism (SNP) in the tir gene and to detect specific SNPs that differentiate STEC O157 into distinct virulence clades (1-3 and 8). We developed a multiplex PCR followed by single base sequencing for detection of the SNPs, and examined the association among SNP genotype, virulence profile (stx and eae status), multilocus variable number of tandem repeats analysis (MLVA) profile and clinical outcome. We found an over-representation of the T allele among human strains compared to nonhuman strains, including 5/6 haemolytic-uraemic syndrome cases. Fourteen strains belonged to clade 8, followed by two clade 2 strains. No clade 1 nor 3 isolates were observed. stx1 in combination with either stx2(EDL933) or stx2c were frequently observed among human strains, whereas stx2c was dominating in nonhuman strains. MLVA indicated that only single cases or small outbreaks with E. coli O157 have been observed in Norway through the years 1993-2008. We observed that the tir-255 A/T SNP and the stx status were different between human and nonhuman O157 strains. No major outbreaks were observed, and only a few strains were differentiated into the virulence clades 2 and 8. The detection of virulence clade-specific SNPs enables the rapid designation of virulent E. coli O157 strains, especially in outbreak situations. © 2011 The Authors. Journal of Applied Microbiology © 2011 The Society for Applied Microbiology.
Whole Genome Sequencing for Genomics-Guided Investigations of Escherichia coli O157:H7 Outbreaks.
Rusconi, Brigida; Sanjar, Fatemeh; Koenig, Sara S K; Mammel, Mark K; Tarr, Phillip I; Eppinger, Mark
2016-01-01
Multi isolate whole genome sequencing (WGS) and typing for outbreak investigations has become a reality in the post-genomics era. We applied this technology to strains from Escherichia coli O157:H7 outbreaks. These include isolates from seven North America outbreaks, as well as multiple isolates from the same patient and from different infected individuals in the same household. Customized high-resolution bioinformatics sequence typing strategies were developed to assess the core genome and mobilome plasticity. Sequence typing was performed using an in-house single nucleotide polymorphism (SNP) discovery and validation pipeline. Discriminatory power becomes of particular importance for the investigation of isolates from outbreaks in which macrogenomic techniques such as pulse-field gel electrophoresis or multiple locus variable number tandem repeat analysis do not differentiate closely related organisms. We also characterized differences in the phage inventory, allowing us to identify plasticity among outbreak strains that is not detectable at the core genome level. Our comprehensive analysis of the mobilome identified multiple plasmids that have not previously been associated with this lineage. Applied phylogenomics approaches provide strong molecular evidence for exceptionally little heterogeneity of strains within outbreaks and demonstrate the value of intra-cluster comparisons, rather than basing the analysis on archetypal reference strains. Next generation sequencing and whole genome typing strategies provide the technological foundation for genomic epidemiology outbreak investigation utilizing its significantly higher sample throughput, cost efficiency, and phylogenetic relatedness accuracy. These phylogenomics approaches have major public health relevance in translating information from the sequence-based survey to support timely and informed countermeasures. Polymorphisms identified in this work offer robust phylogenetic signals that index both short- and long-term evolution and can complement currently employed typing schemes for outbreak ex- and inclusion, diagnostics, surveillance, and forensic studies.
Whole Genome Sequencing for Genomics-Guided Investigations of Escherichia coli O157:H7 Outbreaks
Rusconi, Brigida; Sanjar, Fatemeh; Koenig, Sara S. K.; Mammel, Mark K.; Tarr, Phillip I.; Eppinger, Mark
2016-01-01
Multi isolate whole genome sequencing (WGS) and typing for outbreak investigations has become a reality in the post-genomics era. We applied this technology to strains from Escherichia coli O157:H7 outbreaks. These include isolates from seven North America outbreaks, as well as multiple isolates from the same patient and from different infected individuals in the same household. Customized high-resolution bioinformatics sequence typing strategies were developed to assess the core genome and mobilome plasticity. Sequence typing was performed using an in-house single nucleotide polymorphism (SNP) discovery and validation pipeline. Discriminatory power becomes of particular importance for the investigation of isolates from outbreaks in which macrogenomic techniques such as pulse-field gel electrophoresis or multiple locus variable number tandem repeat analysis do not differentiate closely related organisms. We also characterized differences in the phage inventory, allowing us to identify plasticity among outbreak strains that is not detectable at the core genome level. Our comprehensive analysis of the mobilome identified multiple plasmids that have not previously been associated with this lineage. Applied phylogenomics approaches provide strong molecular evidence for exceptionally little heterogeneity of strains within outbreaks and demonstrate the value of intra-cluster comparisons, rather than basing the analysis on archetypal reference strains. Next generation sequencing and whole genome typing strategies provide the technological foundation for genomic epidemiology outbreak investigation utilizing its significantly higher sample throughput, cost efficiency, and phylogenetic relatedness accuracy. These phylogenomics approaches have major public health relevance in translating information from the sequence-based survey to support timely and informed countermeasures. Polymorphisms identified in this work offer robust phylogenetic signals that index both short- and long-term evolution and can complement currently employed typing schemes for outbreak ex- and inclusion, diagnostics, surveillance, and forensic studies. PMID:27446025
Wallace, B; Yang, Y J; Hong, J S; Lum, D
1990-01-01
A gene encoding a carrier protein for glutamate and aspartate was cloned into Escherichia coli K-12 strain BK9MDG by using the high-copy-number plasmid pBR322. The gene (designated gltP) is probably identical to a gene recently cloned from E. coli B (Y. Deguchi, I. Yamato, and Y. Anraku, J. Bacteriol. 171:1314-1319). A 1.6-kilobase DNA fragment containing gltP was subcloned into the expression plasmids pT7-5 and pT7-6, and its product was identified by a phage T7 RNA polymerase-T7 promoter coupled system (S. Tabor and C. C. Richardson, Proc. Natl. Acad. Sci. USA 82:1074-1078) as a polypeptide with an apparent mass of 38 kilodaltons. A portion of the gltP polypeptide was associated with the cytoplasmic membrane. The nucleotide sequence of the 1.6-kilobase fragment was determined. It contained an open reading frame capable of encoding a highly hydrophobic polypeptide of 395 amino acids, containing four possible transmembrane segments. Uptake of glutamate and aspartate was increased 5.5- and 4.5-fold, respectively, in strains containing gltP plasmids. Glutamate uptake was insensitive to the concentration of Na+ and was inhibited by L-cysteate and beta-hydroxyaspartate. These results suggest that gltP is a structural gene for a carrier protein of the Na(+)-independent, binding-protein-independent glutamate-aspartate transport system. Images PMID:1971622
Takeuchi, Y; Yoshikawa, M; Takeba, G; Tanaka, K; Shibata, D; Horino, O
1990-06-01
Soybean (Glycine max) beta-1,3-endoglucanase (EC 3.2. 1.39) is involved in one of the earliest plant-pathogen interactions that may lead to active disease resistance by releasing elicitor-active carbohydrates from the cell walls of fungal pathogens. Ethylene induced beta-1,3-endoglucanase activity to 2- to 3-fold higher levels in cotyledons of soybean seedlings. A specific polyclonal antiserum raised against purified soybean beta-1,3-endoglucanase was used to immunoprecipitate in vitro translation products, demonstrating that ethylene induction increased translatable beta-1,3-endoglucanase mRNA. Several cDNA clones for the endoglucanase gene were obtained by antibody screening of a lambda-gt11 expression library prepared from soybean cotyledons. Hybrid-select translation experiments indicated that the cloned cDNA encoded a 36-kilodalton precursor protein product that was specifically immunoprecipitated with beta-1,3-endoglucanase antiserum. Escherichia coli cells expressing the cloned cDNA also synthesized an immunologically positive protein. Nucleotide sequence of three independent clones revealed a single uninterrupted open reading frame of 1041 nucleotides, corresponding to a polypeptide of 347 residue long. The primary amino acid sequence of beta-1,3-endoglucanase as deduced from the nucleotide sequence was confirmed by direct amino acid sequencing of trypsin digests of the glucanase. The soybean beta-1,3-endoglucanase exhibited 53% amino acid homology to a beta-1,3-glucanase cloned from cultured tobacco cells and 48% homology to a beta-(1,3-1,4)-glucanase from barley. Utilizing the largest cloned cDNA (pEG488) as a hybridization probe, it was found that the increase in translatable beta-1,3-endoglucanase mRNA seen upon ethylene treatment of soybean seedlings was due to 50- to 100-fold increase in steady state mRNA levels, indicating that ethylene regulates gene expression of this enzyme important in disease resistance at the level of gene transcription.
Federal Register 2010, 2011, 2012, 2013, 2014
2012-10-29
... DEPARTMENT OF COMMERCE Patent and Trademark Office Requirements for Patent Applications Containing Nucleotide Sequence and/or Amino Acid Sequence Disclosures ACTION: Proposed collection; comment request... Patent applications that contain nucleotide and/or amino acid sequence disclosures must include a copy of...
Characterization of Clostridium perfringens iota-toxin genes and expression in Escherichia coli.
Perelle, S; Gibert, M; Boquet, P; Popoff, M R
1993-01-01
The iota toxin which is produced by Clostridium perfringens type E, is a binary toxin consisting of two independent polypeptides: Ia, which is an ADP-ribosyltransferase, and Ib, which is involved in the binding and internalization of the toxin into the cell. Two degenerate oligonucleotide probes deduced from partial amino acid sequence of each component of C. spiroforme toxin, which is closely related to the iota toxin, were used to clone three overlapping DNA fragments containing the iota-toxin genes from C. perfringens type E plasmid DNA. Two genes, in the same orientation, coding for Ia (387 amino acids) and Ib (875 amino acids) and separated by 243 noncoding nucleotides were identified. A predicted signal peptide was found for each component, and the secreted Ib displays two domains, the propeptide (172 amino acids) and the mature protein (664 amino acids). The Ia gene has been expressed in Escherichia coli and C. perfringens, under the control of its own promoter. The recombinant polypeptide obtained was recognized by Ia antibodies and ADP-ribosylated actin. The expression of the Ib gene was obtained in E. coli harboring a recombinant plasmid encompassing the putative promoter upstream of the Ia gene and the Ia and Ib genes. Two residues which have been found to be involved in the NAD+ binding site of diphtheria and pseudomonas toxins are conserved in the predicted Ia sequence (Glu-14 and Trp-19). The predicted amino acid Ib sequence shows 33.9% identity with and 54.4% similarity to the protective antigen of the anthrax toxin complex. In particular, the central region of Ib, which contains a predicted transmembrane segment (Leu-292 to Ser-308), presents 45% identity with the corresponding protective antigen sequence which is involved in the translocation of the toxin across the cell membrane. Images PMID:8225592
Deng, Peng; Tan, Xiaoqing; Wu, Ying; Bai, Qunhua; Jia, Yan; Xiao, Hong
2015-03-01
The ChrT gene encodes a chromate reductase enzyme which catalyzes the reduction of Cr(VI). The chromate reductase is also known as flavin mononucleotide (FMN) reductase (FMN_red). The aim of the present study was to clone the full-length ChrT DNA from Serratia sp. CQMUS2 and analyze the deduced amino acid sequence and three-dimensional structure. The putative ChrT gene fragment of Serratia sp. CQMUS2 was isolated by polymerase chain reaction (PCR), according to the known FMN_red gene sequence from Serratia sp. AS13. The flanking sequences of the ChrT gene were obtained by high efficiency TAIL-PCR, while the full-length gene of ChrT was cloned in Escherichia coli for subsequent sequencing. The nucleotide sequence of ChrT was submitted onto GenBank under the accession number, KF211434. Sequence analysis of the gene and amino acids was conducted using the Basic Local Alignment Search Tool, and open reading frame (ORF) analysis was performed using ORF Finder software. The ChrT gene was found to be an ORF of 567 bp that encodes a 188-amino acid enzyme with a calculated molecular weight of 20.4 kDa. In addition, the ChrT protein was hypothesized to be an NADPH-dependent FMN_red and a member of the flavodoxin-2 superfamily. The amino acid sequence of ChrT showed high sequence similarity to the FMN reductase genes of Klebsiella pneumonia and Raoultella ornithinolytica , which belong to the flavodoxin-2 superfamily. Furthermore, ChrT was shown to have a 85.6% similarity to the three-dimensional structure of Escherichia coli ChrR, sharing four common enzyme active sites for chromate reduction. Therefore, ChrT gene cloning and protein structure determination demonstrated the ability of the gene for chromate reduction. The results of the present study provide a basis for further studies on ChrT gene expression and protein function.
DENG, PENG; TAN, XIAOQING; WU, YING; BAI, QUNHUA; JIA, YAN; XIAO, HONG
2015-01-01
The ChrT gene encodes a chromate reductase enzyme which catalyzes the reduction of Cr(VI). The chromate reductase is also known as flavin mononucleotide (FMN) reductase (FMN_red). The aim of the present study was to clone the full-length ChrT DNA from Serratia sp. CQMUS2 and analyze the deduced amino acid sequence and three-dimensional structure. The putative ChrT gene fragment of Serratia sp. CQMUS2 was isolated by polymerase chain reaction (PCR), according to the known FMN_red gene sequence from Serratia sp. AS13. The flanking sequences of the ChrT gene were obtained by high efficiency TAIL-PCR, while the full-length gene of ChrT was cloned in Escherichia coli for subsequent sequencing. The nucleotide sequence of ChrT was submitted onto GenBank under the accession number, KF211434. Sequence analysis of the gene and amino acids was conducted using the Basic Local Alignment Search Tool, and open reading frame (ORF) analysis was performed using ORF Finder software. The ChrT gene was found to be an ORF of 567 bp that encodes a 188-amino acid enzyme with a calculated molecular weight of 20.4 kDa. In addition, the ChrT protein was hypothesized to be an NADPH-dependent FMN_red and a member of the flavodoxin-2 superfamily. The amino acid sequence of ChrT showed high sequence similarity to the FMN reductase genes of Klebsiella pneumonia and Raoultella ornithinolytica, which belong to the flavodoxin-2 superfamily. Furthermore, ChrT was shown to have a 85.6% similarity to the three-dimensional structure of Escherichia coli ChrR, sharing four common enzyme active sites for chromate reduction. Therefore, ChrT gene cloning and protein structure determination demonstrated the ability of the gene for chromate reduction. The results of the present study provide a basis for further studies on ChrT gene expression and protein function. PMID:25667630
Literak, Ivan; Manga, Ivan; Wojczulanis-Jakubas, Katarzyna; Chroma, Magdalena; Jamborova, Ivana; Dobiasova, Hana; Sedlakova, Miroslava Htoutou; Cizek, Alois
2014-07-16
We aimed at Escherichia coli and Enterobacter cloacae isolates resistant to cephalosporins and fluoroquinolones and Salmonella isolates in wild birds in Arctic Svalbard, Norway. Cloacal swabs of little auks (Alle alle, n=215) and samples of faeces of glaucous gulls (Larus hyperboreus, n=15) were examined. Inducible production of AmpC enzyme was detected in E. cloacae KW218 isolate. Sequence analysis of the 1146 bp PCR product of the ampC gene from this isolate revealed 99% sequence homology with the blaACT-14 and blaACT-5 AmpC beta-lactamase genes. Four, respectively six of the identified single nucleotide polymorphisms generated amino acid substitutions in the amino acid chain. As the ampC sequence polymorphism in the investigated E. cloacae strain was identified as unique, we revealed a novel variant of the ampC beta-lactamase gene blaACT-23. Copyright © 2014 Elsevier B.V. All rights reserved.
Highlander, S K; Wickersham, E A; Garza, O; Weinstock, G M
1993-01-01
Multicopy and single-copy chromosomal fusions between the Pasteurella haemolytica leukotoxin regulatory region and the Escherichia coli beta-galactosidase gene have been constructed. These fusions were used as reporters to identify and isolate regulators of leukotoxin expression from a P. haemolytica cosmid library. A cosmid clone, which inhibited leukotoxin expression from multicopy and single-copy protein fusions, was isolated and found to contain the complete leukotoxin gene cluster plus additional upstream sequences. The locus responsible for inhibition of expression from leukotoxin-beta-galactosidase fusions was mapped within these upstream sequences, by transposon mutagenesis with Tn5, and its DNA sequence was determined. The inhibitory activity was found to be associated with a predicted 440-amino-acid reading frame (lapA) that lies within a four-gene arginine transport locus. LapA is predicted to be the nucleotide-binding component of this transport system and shares homology with the Clp family of proteases. Images PMID:8359916
Intrinsic sequence specificity of the Cas1 integrase directs new spacer acquisition
Rollie, Clare; Schneider, Stefanie; Brinkmann, Anna Sophie; Bolt, Edward L; White, Malcolm F
2015-01-01
The adaptive prokaryotic immune system CRISPR-Cas provides RNA-mediated protection from invading genetic elements. The fundamental basis of the system is the ability to capture small pieces of foreign DNA for incorporation into the genome at the CRISPR locus, a process known as Adaptation, which is dependent on the Cas1 and Cas2 proteins. We demonstrate that Cas1 catalyses an efficient trans-esterification reaction on branched DNA substrates, which represents the reverse- or disintegration reaction. Cas1 from both Escherichia coli and Sulfolobus solfataricus display sequence specific activity, with a clear preference for the nucleotides flanking the integration site at the leader-repeat 1 boundary of the CRISPR locus. Cas2 is not required for this activity and does not influence the specificity. This suggests that the inherent sequence specificity of Cas1 is a major determinant of the adaptation process. DOI: http://dx.doi.org/10.7554/eLife.08716.001 PMID:26284603
Structural insights into cell cycle control by essential GTPase Era.
Ji, Xinhua
Era (Escherichia coli Ras-like protein), essential for bacterial cell viability, is composed of an N-terminal GTPase domain and a C-terminal KH domain. In bacteria, it is required for the processing of 16S ribosomal RNA (rRNA) and maturation of 30S (small) ribosomal subunit. Era recognizes 10 nucleotides ( 1530 GAUCACCUCC 1539 ) near the 3' end of 16S rRNA and interacts with helix 45 (h45, nucleotides 1506-1529). GTP binding enables Era to bind RNA, RNA binding stimulates Era's GTP-hydrolyzing activity, and GTP hydrolysis releases Era from matured 30S ribosomal subunit. As such, Era controls cell growth rate via regulating the maturation of the 30S ribosomal subunit. Ribosomes manufacture proteins in all living organisms. The GAUCA sequence and h45 are highly conserved in all three kingdoms of life. Homologues of Era are present in eukaryotic cells. Hence, the mechanism of bacterial Era action also sheds light on the cell cycle control of eukaryotes.
Quick, Joshua; Quinlan, Aaron R; Loman, Nicholas J
2014-01-01
The MinION™ is a new, portable single-molecule sequencer developed by Oxford Nanopore Technologies. It measures four inches in length and is powered from the USB 3.0 port of a laptop computer. The MinION™ measures the change in current resulting from DNA strands interacting with a charged protein nanopore. These measurements can then be used to deduce the underlying nucleotide sequence. We present a read dataset from whole-genome shotgun sequencing of the model organism Escherichia coli K-12 substr. MG1655 generated on a MinION™ device during the early-access MinION™ Access Program (MAP). Sequencing runs of the MinION™ are presented, one generated using R7 chemistry (released in July 2014) and one using R7.3 (released in September 2014). Base-called sequence data are provided to demonstrate the nature of data produced by the MinION™ platform and to encourage the development of customised methods for alignment, consensus and variant calling, de novo assembly and scaffolding. FAST5 files containing event data within the HDF5 container format are provided to assist with the development of improved base-calling methods.
Analysis of genomic sequences by Chaos Game Representation.
Almeida, J S; Carriço, J A; Maretzek, A; Noble, P A; Fletcher, M
2001-05-01
Chaos Game Representation (CGR) is an iterative mapping technique that processes sequences of units, such as nucleotides in a DNA sequence or amino acids in a protein, in order to find the coordinates for their position in a continuous space. This distribution of positions has two properties: it is unique, and the source sequence can be recovered from the coordinates such that distance between positions measures similarity between the corresponding sequences. The possibility of using the latter property to identify succession schemes have been entirely overlooked in previous studies which raises the possibility that CGR may be upgraded from a mere representation technique to a sequence modeling tool. The distribution of positions in the CGR plane were shown to be a generalization of Markov chain probability tables that accommodates non-integer orders. Therefore, Markov models are particular cases of CGR models rather than the reverse, as currently accepted. In addition, the CGR generalization has both practical (computational efficiency) and fundamental (scale independence) advantages. These results are illustrated by using Escherichia coli K-12 as a test data-set, in particular, the genes thrA, thrB and thrC of the threonine operon.
Mirzaii, Mehdi; Jamshidi, Sanaz; Zamanzadeh, Maryam; Marashifard, Masoud; Malek Hosseini, Seyed Ali Asghar; Haeili, Mehri; Jahanbin, Fariba; Mansouri, Fariba; Darban-Sarokhalil, Davood; Khoramrooz, Seyed Sajjad
2018-06-01
Fluoroquinolones (FQs) are recommended as the drugs of choice for the empirical treatment of urinary tract infections (UTIs). This study investigated the molecular determinants of FQ resistance in Escherichia coli and Klebsiella pneumoniae isolates in Iran. A total of 364 clinical isolates of E. coli (n=144) and K. pneumoniae (n=220) were collected from patients with UTI. Susceptibility of the isolates to ciprofloxacin, levofloxacin, gatifloxacin and nalidixic acid was evaluated by disk diffusion. The presence of qnrA, qnrB and qnrS genes was assessed by PCR. Nucleotide sequences of the gyrA and parC genes were determined. Eighty-seven (60.4%) and 15 (6.8%) E. coli and K. pneumoniae isolates, respectively, were resistant to at least one of the tested FQs. Plasmid-mediated quinolone resistance (PMQR) genes were detected in 12.6% and 60.0% of FQ-resistant E. coli and K. pneumoniae, respectively. Whilst qnrB predominated in K. pneumoniae, qnrS was the most prevalent PMQR gene in E. coli. S83L (98.9%) and D87N (59.8%) were the most frequent mutations identified in GyrA of E. coli, and 55.2% (n=48) of FQ-resistant E. coli isolates had mutation in ParC harbouring S80I and E84V substitutions. The GyrAS83L substitution was found in only one FQ-resistant K. pneumoniae isolate. FQ resistance was much more common in E. coli isolates than in K. pneumoniae. Whilst mutations in the drug target-encoding genes gyrA and parC were the major mechanisms involved in FQ resistance in E. coli, PMQR determinants commonly mediated FQ resistance in K. pneumoniae. Copyright © 2018. Published by Elsevier Ltd.
High Prevalence of CTX-M-15-Type ESBL-Producing E. coli from Migratory Avian Species in Pakistan.
Mohsin, Mashkoor; Raza, Shahbaz; Schaufler, Katharina; Roschanski, Nicole; Sarwar, Fatima; Semmler, Torsten; Schierack, Peter; Guenther, Sebastian
2017-01-01
The increased presence of clinically relevant multidrug resistant bacteria in natural environments is an emerging challenge for global health care. Little is known regarding the occurrence of extended-spectrum beta-lactamase producing Escherichia coli (ESBL- E. coli ) from environmental sentinels in Pakistan. The goal of the current study was to gain insights into the prevalence and phylogenetic relationships of ESBL- E. coli recovered from wild birds in Pakistan during winter migration. After initial screening of fecal samples on selective chromogenic agar, ESBL- E.coli were analyzed phenotypically using the Vitek-2 automated system. Genotypic characterization was performed using whole genome sequencing (WGS) followed by an in-depth in silico analysis. Of 150 birds screened, 26 (17.3%) were fecal carriers of ESBL- E. coli . Of these, 88.4% isolates exhibited multidrug resistance (MDR) phenotypes. Resistance to cefotaxime, ceftazidime, ampicillin, doxycycline, tetracycline and sulfamethoxazole/trimethoprim (CTX-CAZ-AM-DC-TE-SXT) represented the most common pattern of MDR (76.9%). WGS data analysis found bla CTX-M-15 as the predominant ESBL genotype (92.3%). Other genes encoding resistance to sulfonamides ( sul1/sul2/sul3 ), aminoglycosides ( strA, strB, aadA1, aadA2, aadA5, aac(3)-IId-like, aac(3)-IVa-like and aph(4)-Ia) , trimethoprim (dfrA14 or dfrA17) , tetracyclines [ tet(A)/tet(B) ], and fluoroquinolones ( qnr S1) were detected commonly, often encoded on IncF-type plasmids (76.9%). ESBL- E. coli were assigned to 17 different sequence types (STs) of which ST10 and ST7097 (4 isolates each) were the most abundant followed by ST4720, ST93, and ST1139 (2 isolates each). Core-genome phylogeny of the isolates found low numbers (0-29) of single nucleotide polymorphisms (SNPs) in isolates belonged to ST7097 originated from two different locations (Chashma barrage and Rasul barrage). Similar trends were found among isolates belong to ST1139. In addition, WGS-based plasmid typing and S1-digestion found plasmids of the same pMLST type (IncF[F-:A-:B53]) and similar sizes in different bacterial and avian hosts suggesting horizontal gene transfer as another possibility for the spread of ESBL- E. coli in avian wildlife in Pakistan.
Overproduction in Escherichia coli and Characterization of a Soybean Ferric Leghemoglobin Reductase.
Ji, L.; Becana, M.; Sarath, G.; Shearman, L.; Klucas, R. V.
1994-01-01
We previously cloned and sequenced a cDNA encoding soybean ferric leghemoglobin reductase (FLbR), an enzyme postulated to play an important role in maintaining leghemoglobin in a functional ferrous state in nitrogen-fixing root nodules. This cDNA was sub-cloned into an expression plasmid, pTrcHis C, and overexpressed in Escherichia coli. The recombinant FLbR protein, which was purified by two steps of column chromatography, was catalytically active and fully functional. The recombinant FLbR cross-reacted with antisera raised against native FLbR purified from soybean root nodules. The recombinant FLbR, the native FLbR purified from soybean (Glycine max L.) root nodules, and dihydrolipoamide dehydrogenases from pig heart and yeast had similar but not identical ultraviolet-visible absorption and fluorescence spectra, cofactor binding, and kinetic properties. FLbR shared common structural features in the active site and prosthetic group binding sites with other pyridine nucleotide-disulfide oxidoreductases such as dihydrolipoamide dehydrogenases, but displayed different microenvironments for the prosthetic groups. PMID:12232320
Penno, Christophe; Sharma, Virag; Coakley, Arthur; O'Connell Motherway, Mary; van Sinderen, Douwe; Lubkowska, Lucyna; Kireeva, Maria L; Kashlev, Mikhail; Baranov, Pavel V; Atkins, John F
2015-04-21
Escherichia coli and yeast DNA-dependent RNA polymerases are shown to mediate efficient nascent transcript stem loop formation-dependent RNA-DNA hybrid realignment. The realignment was discovered on the heteropolymeric sequence T5C5 and yields transcripts lacking a C residue within a corresponding U5C4. The sequence studied is derived from a Roseiflexus insertion sequence (IS) element where the resulting transcriptional slippage is required for transposase synthesis. The stability of the RNA structure, the proximity of the stem loop to the slippage site, the length and composition of the slippage site motif, and the identity of its 3' adjacent nucleotides (nt) are crucial for transcripts lacking a single C. In many respects, the RNA structure requirements for this slippage resemble those for hairpin-dependent transcription termination. In a purified in vitro system, the slippage efficiency ranges from 5% to 75% depending on the concentration ratios of the nucleotides specified by the slippage sequence and the 3' nt context. The only previous proposal of stem loop mediated slippage, which was in Ebola virus expression, was based on incorrect data interpretation. We propose a mechanical slippage model involving the RNAP translocation state as the main motor in slippage directionality and efficiency. It is distinct from previously described models, including the one proposed for paramyxovirus, where following random movement efficiency is mainly dependent on the stability of the new realigned hybrid. In broadening the scope for utilization of transcription slippage for gene expression, the stimulatory structure provides parallels with programmed ribosomal frameshifting at the translation level.
Nucleotide sequences specific to Yersinia pestis and methods for the detection of Yersinia pestis
McCready, Paula M [Tracy, CA; Radnedge, Lyndsay [San Mateo, CA; Andersen, Gary L [Berkeley, CA; Ott, Linda L [Livermore, CA; Slezak, Thomas R [Livermore, CA; Kuczmarski, Thomas A [Livermore, CA; Motin, Vladinir L [League City, TX
2009-02-24
Nucleotide sequences specific to Yersinia pestis that serve as markers or signatures for identification of this bacterium were identified. In addition, forward and reverse primers and hybridization probes derived from these nucleotide sequences that are used in nucleotide detection methods to detect the presence of the bacterium are disclosed.
Nucleotide sequences specific to Brucella and methods for the detection of Brucella
DOE Office of Scientific and Technical Information (OSTI.GOV)
McCready, Paula M; Radnedge, Lyndsay; Andersen, Gary L
Nucleotide sequences specific to Brucella that serves as a marker or signature for identification of this bacterium were identified. In addition, forward and reverse primers and hybridization probes derived from these nucleotide sequences that are used in nucleotide detection methods to detect the presence of the bacterium are disclosed.
USDA-ARS?s Scientific Manuscript database
Cattle are a major reservoir for Shiga toxin-producing Escherichia coli O157 (STEC O157) and harbor genetic subtypes that do not all associate with human disease. STEC O157 evolved from an E. coli O55:H7 progenitor, however, depauperate nucleotide polymorphism discovery from cattle and human origin...
RNAcode: Robust discrimination of coding and noncoding regions in comparative sequence data
Washietl, Stefan; Findeiß, Sven; Müller, Stephan A.; Kalkhof, Stefan; von Bergen, Martin; Hofacker, Ivo L.; Stadler, Peter F.; Goldman, Nick
2011-01-01
With the availability of genome-wide transcription data and massive comparative sequencing, the discrimination of coding from noncoding RNAs and the assessment of coding potential in evolutionarily conserved regions arose as a core analysis task. Here we present RNAcode, a program to detect coding regions in multiple sequence alignments that is optimized for emerging applications not covered by current protein gene-finding software. Our algorithm combines information from nucleotide substitution and gap patterns in a unified framework and also deals with real-life issues such as alignment and sequencing errors. It uses an explicit statistical model with no machine learning component and can therefore be applied “out of the box,” without any training, to data from all domains of life. We describe the RNAcode method and apply it in combination with mass spectrometry experiments to predict and confirm seven novel short peptides in Escherichia coli and to analyze the coding potential of RNAs previously annotated as “noncoding.” RNAcode is open source software and available for all major platforms at http://wash.github.com/rnacode. PMID:21357752
RNAcode: robust discrimination of coding and noncoding regions in comparative sequence data.
Washietl, Stefan; Findeiss, Sven; Müller, Stephan A; Kalkhof, Stefan; von Bergen, Martin; Hofacker, Ivo L; Stadler, Peter F; Goldman, Nick
2011-04-01
With the availability of genome-wide transcription data and massive comparative sequencing, the discrimination of coding from noncoding RNAs and the assessment of coding potential in evolutionarily conserved regions arose as a core analysis task. Here we present RNAcode, a program to detect coding regions in multiple sequence alignments that is optimized for emerging applications not covered by current protein gene-finding software. Our algorithm combines information from nucleotide substitution and gap patterns in a unified framework and also deals with real-life issues such as alignment and sequencing errors. It uses an explicit statistical model with no machine learning component and can therefore be applied "out of the box," without any training, to data from all domains of life. We describe the RNAcode method and apply it in combination with mass spectrometry experiments to predict and confirm seven novel short peptides in Escherichia coli and to analyze the coding potential of RNAs previously annotated as "noncoding." RNAcode is open source software and available for all major platforms at http://wash.github.com/rnacode.
Bioinformatic Analysis of the Human Recombinant Iduronate 2-Sulfate Sulfatase
Morales-Álvarez, Edwin D.; Rivera-Hoyos, Claudia M.; Landázuri, Patricia; Poutou-Piñales, Raúl A.; Pedroza-Rodríguez, Aura M.
2016-01-01
Mucopolysaccharidosis type II is a human recessive disease linked to the X chromosome caused by deficiency of lysosomal enzyme Iduronate 2-Sulfate Sulfatase (IDS), which leads to accumulation of glycosaminoglycans in tissues and organs. The human enzyme has been expressed in Escherichia coli and Pichia pastoris in attempt to develop more successful expression systems that allow the production of recombinant IDS for Enzyme Replacement Therapy (ERT). However, the preservation of native signal peptide in the sequence has caused conflicts in processing and recognition in the past, which led to problems in expression and enzyme activity. With the main object being the improvement of the expression system, we eliminate the native signal peptide of human recombinant IDS. The resulting sequence showed two modified codons, thus, our study aimed to analyze computationally the nucleotide sequence of the IDSnh without signal peptide in order to determine the 3D structure and other biochemical properties to compare them with the native human IDS (IDSnh). Results showed that there are no significant differences between both molecules in spite of the two-codon modifications detected in the recombinant DNA sequence. PMID:27335624
Lin, J W; Lu, H C; Chen, H Y; Weng, S F
1997-10-09
Partial 3'-end nucleotide sequence of the pkI gene (GenBank accession No. AF019143) from Photobacterium leiognathi ATCC 25521 has been determined, and the encoded pyruvate kinase I is deduced. Pyruvate kinase I is the key enzyme of glycolysis, which converts phosphoenol pyruvate to pyruvate. Alignment and comparison of pyruvate kinase Is from P. leiognathi, E. coli and Salmonella typhimurium show that they are homologous. Nucleotide sequence reveals that the pkI gene is linked to the luxZ gene that enhances bioluminescence of the lux operon from P. leiognathi. The gene order of the pkI and luxZ genes is-pk1-ter-->-R&R"-luxZ-ter"-->, whereas ter is transcriptional terminator for the pkI and related genes, and R&R" is the regulatory region and ter" is transcriptional terminator for the luxZ gene. It clearly elicits that the pkI gene and luxZ gene are divided to two operons. Functional analysis confirms that the potential hairpin loop omega T is the transcriptional terminator for the pkI and related genes. It infers that the pkI and related genes are simply linked to the luxZ gene in P. leiognathi genome.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Richardson, C.C.
1993-12-31
This project focuses on the DNA polymerase (gene 5 protein) of phage T7 for use in DNA sequence analysis. Gene 5 protein interacts with accessory proteins to acquire properties essential for DNA replication. One goal is to understand these interactions in order to modify the proteins for use in DNA sequencing. E. coli thioredoxin, binds to gene 5 protein and clamps it to a primer-template. They have analyzed the binding of gene 5 protein-thioredoxin to primer-templates and have defined the optimal conditions to form an extremely stable complex with a dNTP in the polymerase catalytic site. The spatial proximity ofmore » these components has been determined using fluorescence emission anisotropy. The T7 DNA binding protein, the gene 2.5 protein, interacts with gene 5 protein and gene 4 protein to increase processivity and primer synthesis, respectively. Mutant gene 2.5 proteins have been isolated that do not interact with T7 DNA polymerase and can not support T7 growth. The nucleotide binding site of the T7 helicase has been identified and mutations affecting the site provide information on how the hydrolysis of NTPs fuel its unidirectional translocation. The sequence, GTC, has been shown to be necessary and sufficient for recognition by the T7 primase. The T7 gene 5.5 protein interacts with the E. coli nucleoid protein, H-NS, and also overcomes the phage {lambda} rex restriction system.« less
Ruffet, M L; Lebrun, M; Droux, M; Douce, R
1995-01-15
The intracellular compartmentation of serine acetyltransferase, a key enzyme in the L-cysteine biosynthesis pathway, has been investigated in pea (Pisum sativum) leaves, by isolation of organelles and fractionation of protoplasts. Enzyme activity was mainly located in mitochondria (approximately 76% of total cellular activity). Significant activity was also identified in both the cytosol (14% of total activity) and chloroplasts (10% of total activity). Three enzyme forms were separated by anion-exchange chromatography, and each form was found to be specific for a given intracellular compartment. To obtain cDNA encoding the isoforms, functional complementation experiments were performed using an Arabidopsis thaliana expression library and an Escherichia coli mutant devoid of serine acetyltransferase activity. This strategy allowed isolation of three distinct cDNAs encoding serine acetyltransferase isoforms, as confirmed by enzyme activity measurements, genomic hybridizations, and nucleotide sequencing. The cDNA and related gene for one of the three isoforms have been characterized. The predicted amino acid sequence shows that it encodes a polypeptide of M(r) 34,330 exhibiting 41% amino acid identity with the E. coli serine acetyltransferase. Since none of the general features of transit peptides could be observed in the N-terminal region of this isoform, we assume that it is a cytosolic form.
Liger, D; Masson, A; Blanot, D; van Heijenoort, J; Parquet, C
1996-01-01
The UDP-N-acetylmuramate:L-alanine ligase of Escherichia coli is responsible for the addition of the first amino acid of the peptide moiety in the assembly of the monomer unit of peptidoglycan. It catalyzes the formation of the amide bond between UDP-N-acetylmuramic acid (UDP-MurNAc) and L-alanine. The UDP-MurNAc-L-alanine ligase was overproduced 2000-fold in a strain harboring a recombinant plasmid (pAM1005) with the murC gene under the control of the inducible promoter trc. The murC gene product appears as a 50-kDa protein accounting for ca. 50% of total cell proteins. A two-step purification led to 1 g of a homogeneous protein from an 8-liter culture. The N-terminal sequence of the purified protein correlated with the nucleotide sequence of the gene. The stability of the enzymatic activity is strictly dependent on the presence of 2-mercaptoethanol. The K(m) values for substrates UDP-N-acetylmuramic acid, L-alanine, and ATP were estimated; 100, 20, and 450 microM, respectively. The specificity of the enzyme for its substrates was investigated with various analogues. Preliminary experiments attempting to elucidate the enzymatic mechanism were consistent with the formation of an acylphosphate intermediate.
Strachan, Norval J C; Rotariu, Ovidiu; Lopes, Bruno; MacRae, Marion; Fairley, Susan; Laing, Chad; Gannon, Victor; Allison, Lesley J; Hanson, Mary F; Dallman, Tim; Ashton, Philip; Franz, Eelco; van Hoek, Angela H A M; French, Nigel P; George, Tessy; Biggs, Patrick J; Forbes, Ken J
2015-10-07
Genetic variation in an infectious disease pathogen can be driven by ecological niche dissimilarities arising from different host species and different geographical locations. Whole genome sequencing was used to compare E. coli O157 isolates from host reservoirs (cattle and sheep) from Scotland and to compare genetic variation of isolates (human, animal, environmental/food) obtained from Scotland, New Zealand, Netherlands, Canada and the USA. Nei's genetic distance calculated from core genome single nucleotide polymorphisms (SNPs) demonstrated that the animal isolates were from the same population. Investigation of the Shiga toxin bacteriophage and their insertion sites (SBI typing) revealed that cattle and sheep isolates had statistically indistinguishable rarefaction profiles, diversity and genotypes. In contrast, isolates from different countries exhibited significant differences in Nei's genetic distance and SBI typing. Hence, after successful international transmission, which has occurred on multiple occasions, local genetic variation occurs, resulting in a global patchwork of continental and trans-continental phylogeographic clades. These findings are important for three reasons: first, understanding transmission and evolution of infectious diseases associated with multiple host reservoirs and multi-geographic locations; second, highlighting the relevance of the sheep reservoir when considering farm based interventions; and third, improving our understanding of why human disease incidence varies across the world.
Christiaens, H; Leer, R J; Pouwels, P H; Verstraete, W
1992-12-01
The conjugated bile acid hydrolase gene from the silage isolate Lactobacillus plantarum 80 was cloned and expressed in Escherichia coli MC1061. For the screening of this hydrolase gene within the gene bank, a direct plate assay developed by Dashkevicz and Feighner (M. P. Dashkevicz and S. D. Feighner, Appl. Environ. Microbiol. 53:331-336, 1989) was adapted to the growth requirements of E. coli. Because of hydrolysis and medium acidification, hydrolase-active colonies were surrounded with big halos of precipitated, free bile acids. This phenomenon was also obtained when the gene was cloned into a multicopy shuttle vector and subsequently reintroduced into the parental Lactobacillus strain. The cbh gene and surrounding regions were characterized by nucleotide sequence analysis. The deduced amino acid sequence was shown to have 52% similarity with a penicillin V amidase from Bacillus sphaericus. Preliminary characterization of the gene product showed that it is a cholylglycine hydrolase (EC 3.5.1.24) with only slight activity against taurine conjugates. The optimum pH was between 4.7 and 5.5. Optimum temperature ranged from 30 to 45 degrees C. Southern blot analysis indicated that the cloned gene has similarity with genomic DNA of bile acid hydrolase-active Lactobacillus spp. of intestinal origin.
Guleria, Shiwani; Walia, Abhishek; Chauhan, Anjali; Shirkot, C K
2016-09-02
An alkaline protease gene was amplified from genomic DNA of Bacillus amyloliquefaciens SP1 which was involved in effective biocontrol of Fusarium oxysporum. We investigated the antagonistic capacity of protease of B. amyloliquifaciens SP1, under in vitro conditions. The 5.62 fold purified enzyme with specific activity of 607.69U/mg reported 24.14% growth inhibition of F. oxysporum. However, no antagonistic activity was found after addition of protease inhibitor i.e. PMSF (15mM) to purified enzyme. An 1149bp nucleotide sequence of protease gene encoded 382 amino acids of 43kDa and calculated isoelectric point of 9.29. Analysis of deduced amino acid sequence revealed high homology (86%) with subtilisin E of Bacillus subtilis. The B. amyloliquefaciens SP1 protease gene was expressed in Escherichiax coli BL21. The expressed protease was secreted into culture medium by E. coli and exhibited optimum activity at pH8.0 and 60°C. The most reliable three dimensional structure of alkaline protease was determined using Phyre 2 server which was validated on the basis of Ramachandran plot and ERRAT value. The expression and structure prediction of the enzyme offers potential value for commercial application in agriculture and industry. Copyright © 2016 Elsevier B.V. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Greene, T.W.; Chantler, S.E.; Kahn, M.L.
ADPglucose pyrophosphorylase (glucose-1-phosphate adenylytransferase; AD P:{alpha}-D-glucose-1-phosphate adenylyltransferase, EC 2.7.7.27) catalyzes a key regulatory step in {alpha}-glucan synthesis in bacteria and higher plants. We have previously shown that the expression of the cDNA sequences of the potato tuber large (LS) and small (SS) subunits yielded a functional heterotetrameric enzyme capable of complementing a mutation in the single AGP (glgC) structural gene of Escherichia coli. This heterologous complementation provides a powerful genetic approach to obtain biochemical information on the specific roles of LS and SS in enzyme function. By mutagenizing the LS cDNA with hydroxylamine and then coexpressing with wild-type SS inmore » an E. coli glgC{sup {minus}} strain, >350 mutant colonies were identified that were impaired in glycogen production. One mutant exhibited enzymatic and antigen levels comparable to the wild-type recombinant enzyme but required 45-fold greater levels of the activator 3-phosphoglycerate for maximum activity. Sequence analysis identified a single nucleotide change that resulted in the change of Pro-52 to Leu. This heterologous genetic system provides and efficient means to identify residues important for catalysis and allosteric functioning and should lead to novel approaches to increase plant productivity. 31 refs., 4 figs., 1 tab.« less
Skipping of exon 27 in C3 gene compromises TED domain and results in complete human C3 deficiency.
da Silva, Karina Ribeiro; Fraga, Tatiana Rodrigues; Lucatelli, Juliana Faggion; Grumach, Anete Sevciovic; Isaac, Lourdes
2016-05-01
Primary deficiency of complement C3 is rare and usually associated with increased susceptibility to bacterial infections. In this work, we investigated the molecular basis of complete C3 deficiency in a Brazilian 9-year old female patient with a family history of consanguinity. Hemolytic assays revealed complete lack of complement-mediated hemolytic activity in the patient's serum. While levels of the complement regulatory proteins Factor I, Factor H and Factor B were normal in the patient's and family members' sera, complement C3 levels were undetectable in the patient's serum and were reduced by at least 50% in the sera of the patient's parents and brother. Additionally, no C3 could be observed in the patient's plasma and cell culture supernatants by Western blot. We also observed that patient's skin fibroblasts stimulated with Escherichia coli LPS were unable to secrete C3, which might be accumulated within the cells before being intracellularly degraded. Sequencing analysis of the patient's C3 cDNA revealed a genetic mutation responsible for the complete skipping of exon 27, resulting in the loss of 99 nucleotides (3450-3549) located in the TED domain. Sequencing of the intronic region between the exons 26 and 27 of the C3 gene (nucleotides 6690313-6690961) showed a nucleotide exchange (T→C) at position 6690626 located in a splicing donor site, resulting in the complete skipping of exon 27 in the C3 mRNA. Copyright © 2016. Published by Elsevier GmbH.
Shahid, M S; Yoshida, S; Khatri-Chhetri, G B; Briddon, R W; Natsuaki, K T
2013-06-01
Carica papaya (papaya) is a fruit crop that is cultivated mostly in kitchen gardens throughout Nepal. Leaf samples of C. papaya plants with leaf curling, vein darkening, vein thickening, and a reduction in leaf size were collected from a garden in Darai village, Rampur, Nepal in 2010. Full-length clones of a monopartite Begomovirus, a betasatellite and an alphasatellite were isolated. The complete nucleotide sequence of the Begomovirus showed the arrangement of genes typical of Old World begomoviruses with the highest nucleotide sequence identity (>99 %) to an isolate of Ageratum yellow vein virus (AYVV), confirming it as an isolate of AYVV. The complete nucleotide sequence of betasatellite showed greater than 89 % nucleotide sequence identity to an isolate of Tomato leaf curl Java betasatellite originating from Indonesian. The sequence of the alphasatellite displayed 92 % nucleotide sequence identity to Sida yellow vein China alphasatellite. This is the first identification of these components in Nepal and the first time they have been identified in papaya.
Exploring the sequence-function relationship in transcriptional regulation by the lac O1 operator.
Maity, Tuhin S; Jha, Ramesh K; Strauss, Charlie E M; Dunbar, John
2012-07-01
Understanding how binding of a transcription factor to an operator is influenced by the operator sequence is an ongoing quest. It facilitates discovery of alternative binding sites as well as tuning of transcriptional regulation. We investigated the behavior of the Escherichia coli Lac repressor (LacI) protein with a large set of lac O(1) operator variants. The 114 variants examined contained a mean of 2.9 (range 0-4) mutations at positions -4, -2, +2 and +4 in the minimally required 17 bp operator. The relative affinity of LacI for the operators was examined by quantifying expression of a GFP reporter gene and Rosetta structural modeling. The combinations of mutations in the operator sequence created a wide range of regulatory behaviors. We observed variations in the GFP fluorescent signal among the operator variants of more than an order of magnitude under both uninduced and induced conditions. We found that a single nucleotide change may result in changes of up to six- and 12-fold in uninduced and induced GFP signals, respectively. Among the four positions mutated, we found that nucleotide G at position -4 is strongly correlated with strong repression. By Rosetta modeling, we found a significant correlation between the calculated binding energy and the experimentally observed transcriptional repression strength for many operators. However, exceptions were also observed, underscoring the necessity for further improvement in biophysical models of protein-DNA interactions. © 2012 The Authors Journal compilation © 2012 FEBS.
First Report of Prevalence of CTX-M-15-Producing Escherichia coli O25b/ST131 from Iran.
Namaei, Mohammad Hasan; Yousefi, Masoud; Ziaee, Masoud; Salehabadi, Alireza; Ghannadkafi, Malaknaz; Amini, Elham; Askari, Parvin
2017-10-01
The emergence of Escherichia coli sequence type 131 (ST131) as a multidrug-resistant and virulent pathogen represents a major challenge to public health globally. Recently, the O25b/ST131 E. coli producing CTX-M-15 with high virulence potential has been reported worldwide, but has received little attention in Iran. This study is the first in Iran to specifically determine the spread of the O25b/ST131 clone producing CTX-M-15 among E. coli isolates belonging to the B2 phylogenetic group. ST131 clone in phylogenetic group B2 was detected based on PCR detection of ST131-specific single-nucleotide polymorphisms in mdh and gyrB. O25b/ST131 E. coli clone was confirmed utilizing O25b/ST131 clone allele-specific PCR for the pabB gene. All group B2 E. coli isolates were characterized based on antibiotic susceptibility, extended-spectrum β-lactamase (ESBL) enzymes, and virulence traits. Our results demonstrated that 38 out of the 154 B2 group isolates (24.7%) were identified as belonging to the ST131 clone. Furthermore, of these, 28 isolates (73.6%) were detected as O25b/ST131 clone. Antibiotic resistance of ST131 E. coli isolates to ciprofloxacin, gentamicin, cefotaxime, and aztreonam was significantly higher than non-ST131 isolates. Almost all of the O25b/ST131 isolates with the ability for ESBL production were reported as CTX-M-15 producing (95.5%). Our results showed that the most prevalent virulence trait in ST131 clone was ompT (94.7%). This study is the first to report the prevalence of the CTX-M-15-producing O25b/ST131 E. coli in Iran. Our findings reinforce the surveillance of dissemination of ST131 E. coli clone as a major drug-resistant pathogen and an important new public health threat.
Nucleotide sequences encoding a thermostable alkaline protease
Wilson, David B.; Lao, Guifang
1998-01-01
Nucleotide sequences, derived from a thermophilic actinomycete microorganism, which encode a thermostable alkaline protease are disclosed. Also disclosed are variants of the nucleotide sequences which encode a polypeptide having thermostable alkaline proteolytic activity. Recombinant thermostable alkaline protease or recombinant polypeptide may be obtained by culturing in a medium a host cell genetically engineered to contain and express a nucleotide sequence according to the present invention, and recovering the recombinant thermostable alkaline protease or recombinant polypeptide from the culture medium.
Vian, A; Carrascosa, A V; García, J L; Cortés, E
1998-06-01
The nucleotide sequence of both the bgaA gene, coding for a thermostable beta-galactosidase of Thermus sp. strain T2, and its flanking regions was determined. The deduced amino acid sequence of the enzyme predicts a polypeptide of 645 amino acids (Mr, 73,595). Comparative analysis of the open reading frames located in the flanking regions of the bgaA gene revealed that they might encode proteins involved in the transport and hydrolysis of sugars. The observed homology between the deduced amino acid sequences of BgaA and the beta-galactosidase of Bacillus stearothermophilus allows us to classify the new enzyme within family 42 of glycosyl hydrolases. BgaA was overexpressed in its active form in Escherichia coli, but more interestingly, an active chimeric beta-galactosidase was constructed by fusing the BgaA protein to the choline-binding domain of the major pneumococcal autolysin. This chimera illustrates a novel approach for producing an active and thermostable hybrid enzyme that can be purified in a single step by affinity chromatography on DEAE-cellulose, retaining the catalytic properties of the native enzyme. The chimeric enzyme showed a specific activity of 191,000 U/mg at 70 degrees C and a Km value of 1.6 mM with o-nitrophenyl-beta-D-galactopyranoside as a substrate, and it retained 50% of its initial activity after 1 h of incubation at 70 degrees C.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Barnell, W.O.; Kyung Cheol Yi; Conway, T.
1990-12-01
The Zymomonas mobilis genes that encode glucose-6-phosphate dehydrogenase (zwf), 6-phosphogluconate dehydratase (edd), and glucokinase (glk) were cloned independently by genetic complementation of specific defects in Escherichia coli metabolism. The identify of these cloned genes was confirmed by various biochemical means. Nucleotide sequence analysis established that these three genes are clustered on the genome and revealed an additional open reading frame in this region that has significant amino acid identity to the E.coli xylose-proton symporter and the human glucose transporter. On the basis of this evidence and structural analysis of the deduced primary amino acid sequence, this gene is believed tomore » encode the Z. mobilis glucose-facilitated diffusion protein, glf. The four genes in the 6-kb cluster are organized in the order glf, zwf, edd, glk. The glf and zwf genes are separated by 146 bp. The zwf and edd genes overlap by 8 bp, and their expression may be translationally coupled. The edd and glk genes are separated by 203 bp. The glk gene is followed by tandem transcriptional terminators. The four genes appear to be organized in an operon. Such an arrangement of the genes that govern glucose uptake and the first three steps of the Entner-Doudoroff glycolytic pathway provides the organism with a mechanism for carefully regulating the levels of the enzymes that control carbon flux into the pathway.« less
Cowley, Lauren A; Dallman, Timothy J; Fitzgerald, Stephen; Irvine, Neil; Rooney, Paul J; McAteer, Sean P; Day, Martin; Perry, Neil T; Bono, James L; Jenkins, Claire; Gally, David L
2016-09-01
Shiga toxin-producing Escherichia coli (STEC) O157:H7 is a public health threat and outbreaks occur worldwide. Here, we investigate genomic differences between related STEC O157:H7 that caused two outbreaks, eight weeks apart, at the same restaurant. Short-read genome sequencing divided the outbreak strains into two sub-clusters separated by only three single-nucleotide polymorphisms in the core genome while traditional typing identified them as separate phage types, PT8 and PT54. Isolates did not cluster with local strains but with those associated with foreign travel to the Middle East/North Africa. Combined long-read sequencing approaches and optical mapping revealed that the two outbreak strains had undergone significant microevolution in the accessory genome with prophage gain, loss and recombination. In addition, the PT54 sub-type had acquired a 240 kbp multi-drug resistance (MDR) IncHI2 plasmid responsible for the phage type switch. A PT54 isolate had a general fitness advantage over a PT8 isolate in rich medium, including an increased capacity to use specific amino acids and dipeptides as a nitrogen source. The second outbreak was considerably larger and there were multiple secondary cases indicative of effective human-to-human transmission. We speculate that MDR plasmid acquisition and prophage changes have adapted the PT54 strain for human infection and transmission. Our study shows the added insights provided by combining whole-genome sequencing approaches for outbreak investigations.
Dallman, Timothy J.; Fitzgerald, Stephen; Irvine, Neil; Rooney, Paul J.; McAteer, Sean P.; Day, Martin; Perry, Neil T.; Bono, James L.; Jenkins, Claire; Gally, David L.
2016-01-01
Shiga toxin-producing Escherichia coli (STEC) O157:H7 is a public health threat and outbreaks occur worldwide. Here, we investigate genomic differences between related STEC O157:H7 that caused two outbreaks, eight weeks apart, at the same restaurant. Short-read genome sequencing divided the outbreak strains into two sub-clusters separated by only three single-nucleotide polymorphisms in the core genome while traditional typing identified them as separate phage types, PT8 and PT54. Isolates did not cluster with local strains but with those associated with foreign travel to the Middle East/North Africa. Combined long-read sequencing approaches and optical mapping revealed that the two outbreak strains had undergone significant microevolution in the accessory genome with prophage gain, loss and recombination. In addition, the PT54 sub-type had acquired a 240 kbp multi-drug resistance (MDR) IncHI2 plasmid responsible for the phage type switch. A PT54 isolate had a general fitness advantage over a PT8 isolate in rich medium, including an increased capacity to use specific amino acids and dipeptides as a nitrogen source. The second outbreak was considerably larger and there were multiple secondary cases indicative of effective human-to-human transmission. We speculate that MDR plasmid acquisition and prophage changes have adapted the PT54 strain for human infection and transmission. Our study shows the added insights provided by combining whole-genome sequencing approaches for outbreak investigations. PMID:28348875
McCready, Paula M [Tracy, CA; Radnedge, Lyndsay [San Mateo, CA; Andersen, Gary L [Berkeley, CA; Ott, Linda L [Livermore, CA; Slezak, Thomas R [Livermore, CA; Kuczmarski, Thomas A [Livermore, CA; Vitalis, Elizabeth A [Livermore, CA
2007-02-06
Described herein is the identification of nucleotide sequences specific to Francisella tularensis that serves as a marker or signature for identification of this bacterium. In addition, forward and reverse primers and hybridization probes derived from these nucleotide sequences that are used in nucleotide detection methods to detect the presence of the bacterium are disclosed.
McCready, Paula M [Tracy, CA; Radnedge, Lyndsay [San Mateo, CA; Andersen, Gary L [Berkeley, CA; Ott, Linda L [Livermore, CA; Slezak, Thomas R [Livermore, CA; Kuczmarski, Thomas A [Livermore, CA; Vitalis, Elizabeth A [Livermore, CA
2009-02-24
Described herein is the identification of nucleotide sequences specific to Francisella tularensis that serves as a marker or signature for identification of this bacterium. In addition, forward and reverse primers and hybridization probes derived from these nucleotide sequences that are used in nucleotide detection methods to detect the presence of the bacterium are disclosed.
Rapid construction of insulated genetic circuits via synthetic sequence-guided isothermal assembly
DOE Office of Scientific and Technical Information (OSTI.GOV)
Torella, JP; Boehm, CR; Lienert, F
2013-12-28
In vitro recombination methods have enabled one-step construction of large DNA sequences from multiple parts. Although synthetic biological circuits can in principle be assembled in the same fashion, they typically contain repeated sequence elements such as standard promoters and terminators that interfere with homologous recombination. Here we use a computational approach to design synthetic, biologically inactive unique nucleotide sequences (UNSes) that facilitate accurate ordered assembly. Importantly, our designed UNSes make it possible to assemble parts with repeated terminator and insulator sequences, and thereby create insulated functional genetic circuits in bacteria and mammalian cells. Using UNS-guided assembly to construct repeating promoter-gene-terminatormore » parts, we systematically varied gene expression to optimize production of a deoxychromoviridans biosynthetic pathway in Escherichia coli. We then used this system to construct complex eukaryotic AND-logic gates for genomic integration into embryonic stem cells. Construction was performed by using a standardized series of UNS-bearing BioBrick-compatible vectors, which enable modular assembly and facilitate reuse of individual parts. UNS-guided isothermal assembly is broadly applicable to the construction and optimization of genetic circuits and particularly those requiring tight insulation, such as complex biosynthetic pathways, sensors, counters and logic gates.« less
Vital, Marius; Chai, Benli; Østman, Bjørn; Cole, James; Konstantinidis, Konstantinos T; Tiedje, James M
2015-01-01
Escherichia coli spans a genetic continuum from enteric strains to several phylogenetically distinct, atypical lineages that are rare in humans, but more common in extra-intestinal environments. To investigate the link between gene regulation, phylogeny and diversification in this species, we analyzed global gene expression profiles of four strains representing distinct evolutionary lineages, including a well-studied laboratory strain, a typical commensal (enteric) strain and two environmental strains. RNA-Seq was employed to compare the whole transcriptomes of strains grown under batch, chemostat and starvation conditions. Highly differentially expressed genes showed a significantly lower nucleotide sequence identity compared with other genes, indicating that gene regulation and coding sequence conservation are directly connected. Overall, distances between the strains based on gene expression profiles were largely dependent on the culture condition and did not reflect phylogenetic relatedness. Expression differences of commonly shared genes (all four strains) and E. coli core genes were consistently smaller between strains characterized by more similar primary habitats. For instance, environmental strains exhibited increased expression of stress defense genes under carbon-limited growth and entered a more pronounced survival-like phenotype during starvation compared with other strains, which stayed more alert for substrate scavenging and catabolism during no-growth conditions. Since those environmental strains show similar genetic distance to each other and to the other two strains, these findings cannot be simply attributed to genetic relatedness but suggest physiological adaptations. Our study provides new insights into ecologically relevant gene-expression and underscores the role of (differential) gene regulation for the diversification of the model bacterial species. PMID:25343512
Nucleotide sequences encoding a thermostable alkaline protease
Wilson, D.B.; Lao, G.
1998-01-06
Nucleotide sequences, derived from a thermophilic actinomycete microorganism, which encode a thermostable alkaline protease are disclosed. Also disclosed are variants of the nucleotide sequences which encode a polypeptide having thermostable alkaline proteolytic activity. Recombinant thermostable alkaline protease or recombinant polypeptide may be obtained by culturing in a medium a host cell genetically engineered to contain and express a nucleotide sequence according to the present invention, and recovering the recombinant thermostable alkaline protease or recombinant polypeptide from the culture medium. 3 figs.
Thakur, Chandar S.; Sama, Jacob N.; Jackson, Melantha E.; Chen, Bin
2010-01-01
Escherichia coli (E. coli) is an ideal organism to tailor-make labeled nucleotides for biophysical studies of RNA. Recently, we showed that adding labeled formate enhanced the isotopic enrichment at protonated carbon sites in nucleotides. In this paper, we show that growth of a mutant E. coli strain DL323 (lacking succinate and malate dehydrogenases) on 13C-2-glycerol and 13C-1,3-glycerol enables selective labeling at many useful sites for RNA NMR spectroscopy. For DL323 E. coli grown in 13C-2-glycerol without labeled formate, all the ribose carbon atoms are labeled except the C3′ and C5′ carbon positions. Consequently the C1′, C2′ and C4′ positions remain singlet. In addition, only the pyrimidine base C6 atoms are substantially labeled to ~96% whereas the C2 and C8 atoms of purine are labeled to ~5%. Supplementing the growth media with 13C-formate increases the labeling at C8 to ~88%, but not C2. Not unexpectedly, addition of exogenous formate is unnecessary for attaining the high enrichment levels of ~88% for the C2 and C8 purine positions in a 13C-1,3-glycerol based growth. Furthermore, the ribose ring is labeled in all but the C4′ carbon position, such that the C2′ and C3′ positions suffer from multiplet splitting but the C5′ position remains singlet and the C1′ position shows a small amount of residual C1′–C2′ coupling. As expected, all the protonated base atoms, except C6, are labeled to ~90%. In addition, labeling with 13C-1,3-glycerol affords an isolated methylene ribose with high enrichment at the C5′ position (~90%) that makes it particularly attractive for NMR applications involving CH2-TROSY modules without the need for decoupling the C4′ carbon. To simulate the tumbling of large RNA molecules, perdeuterated glycerol was added to a mixture of the four nucleotides, and the methylene TROSY experiment recorded at various temperatures. Even under conditions of slow tumbling, all the expected carbon correlations were observed, which indicates this approach of using nucleotides obtained from DL323 E. coli will be applicable to high molecular weight RNA systems. PMID:21057854
Platell, Joanne L; Cobbold, Rowland N; Johnson, James R; Trott, Darren J
2010-09-01
To determine the phylogenetic group distribution and prevalence of three major globally disseminated clonal groups [clonal group A (CGA) and O15:K52:H1, associated with phylogenetic group D, and sequence type ST131, associated with phylogenetic group B2] among fluoroquinolone-resistant extra-intestinal Escherichia coli isolates from humans and companion animals in Australia. Clinical extra-intestinal fluoroquinolone-resistant E. coli isolates were obtained from humans (n = 582) and companion animals (n = 125), on Australia's east coast (October 2007-October 2009). Isolates were tested for susceptibility to seven antimicrobial agents, and for phylogenetic group, O type and clonal-group-specific single nucleotide polymorphisms by PCR. The fluoroquinolone-resistant isolates were typically resistant to multiple agents (median of four). Analysis revealed that clonal group ST131 accounted for a large subset of the human isolates (202/585, 35%), but for a much smaller proportion of the companion animal isolates (9/125, 7.2%; P
Identification and characterization of a gene encoding for a nucleotidase from Phaseolus vulgaris.
Cabello-Díaz, Juan Miguel; Gálvez-Valdivieso, Gregorio; Caballo, Cristina; Lambert, Rocío; Quiles, Francisco Antonio; Pineda, Manuel; Piedras, Pedro
2015-08-01
Nucleotidases are phosphatases that catalyze the removal of phosphate from nucleotides, compounds with an important role in plant metabolism. A phosphatase enzyme, with high affinity for nucleotides monophosphate previously identified and purified in embryonic axes from French bean, has been analyzed by MALDI TOF/TOF and two internal peptides have been obtained. The information of these peptide sequences has been used to search in the genome database and only a candidate gene that encodes for the phosphatase was identified (PvNTD1). The putative protein contains the conserved domains (motif I-IV) for haloacid dehalogenase-like hydrolases superfamily. The residues involved in the catalytic activity are also conserved. A recombinant protein overexpressed in Escherichia coli has shown molybdate resistant phosphatase activity with nucleosides monophosphate as substrate, confirming that the identified gene encodes for the phosphatase with high affinity for nucleotides purified in French bean embryonic axes. The activity of the purified protein was inhibited by adenosine. The expression of PvNTD1 gene was induced at the specific moment of radicle protrusion in embryonic axes. The gene was also highly expressed in young leaves whereas the level of expression in mature tissues was minimal. Copyright © 2015 The Authors. Published by Elsevier GmbH.. All rights reserved.
Williams, M L; Pearl, D L; Lejeune, J T
2011-10-01
To provide molecular epidemiological evidence of avian transmission of Escherichia coli O157:H7 between dairy farms in Ohio, this study was designed to identify genetic relatedness between isolates originating from bovine faecal samples and intestinal contents of European starlings captured on these farms. During a three-year period (2007-2009), cattle (n = 9000) and starlings (n = 430) on 150 different dairy farms in northern Ohio were sampled for the presence of E. coli O157:H7. Isolates were subjected to multiple-locus variable-nucleotide tandem repeat analysis (MLVA). Distinct allelic groups were identified on most farms; however, isolates clustering into three MLVA groups originated from both cattle and birds on different farms. Sharing of indistinguishable epidemiologically linked E. coli O157 MLVA subtypes between starlings and cattle on different farms supports the hypothesis that these birds contribute to the transmission of E. coli O157:H7 between dairy farms. A continued need exists to identify and to improve preharvest measures for controlling E. coli O157:H7. Controlling wildlife intrusion, particularly European starlings, on livestock operations, may be an important strategy for reducing dissemination of E. coli O157:H7 between farms and thereby potentially decreasing the on-farm prevalence of E. coli O157:H7 and enhancing the safety of the food supply. © 2011 The Authors. Journal of Applied Microbiology © 2011 The Society for Applied Microbiology.
Melano, Roberto; Petroni, Alejandro; Garutti, Alicia; Saka, Héctor Alex; Mange, Laura; Pasterán, Fernando; Rapoport, Melina; Rossi, Alicia; Galas, Marcelo
2002-01-01
In a previous study, an analysis of 77 ampicillin-nonsusceptible (resistant plus intermediate categories) strains of Vibrio cholerae non-O1, non-O139, isolated from aquatic environment and diarrheal stool, showed that all of them produced a β-lactamase with a pI of 5.4. Hybridization or amplification by PCR with a probe for blaTEM or primers for blaCARB gene families was negative. In this work, an environmental ampicillin-resistant strain from this sample, ME11762, isolated from a waterway in the west region of Argentina, was studied. The nucleotide sequence of the structural gene of the β-lactamase was determined by bidirectional sequencing of a Sau3AI fragment belonging to this isolate. The gene encodes a new 288-amino-acid protein, designated CARB-7, that shares 88.5% homology with the CARB-6 enzyme; an overall 83.2% homology with PSE-4, PSE-1, CARB-3, and the Proteus mirabilis N29 enzymes; and 79% homology with CARB-4 enzyme. The gene for this β-lactamase could not be transferred to Escherichia coli by conjugation. The nucleotide sequence of the flanking regions of the blaCARB-7 gene showed the occurrence of three 123-bp V. cholerae repeated sequences, all of which were found outside the predicted open reading frame. The upstream fragment of the blaCARB-7 gene shared 93% identity with a locus situated inside V. cholerae's chromosome 2. These results strongly suggest the chromosomal location of the blaCARB-7 gene, making this the first communication of a β-lactamase gene located on the VCR island of the V. cholerae genome. PMID:12069969
Kim, Ju-Sim; Holmes, Randall K.
2012-01-01
Corynebacterium diphtheriae and Corynebacterium glutamicum each have one gene (cat) encoding catalase. In-frame Δcat mutants of C. diphtheriae and C. glutamicum were hyper-sensitive to growth inhibition and killing by H2O2. In C. diphtheriae C7(β), both catalase activity and cat transcription decreased ∼2-fold during transition from exponential growth to early stationary phase. Prototypic OxyR in Escherichia coli senses oxidative stress and it activates katG transcription and catalase production in response to H2O2. In contrast, exposure of C. diphtheriae C7(β) to H2O2 did not stimulate transcription of cat. OxyR from C. diphtheriae and C. glutamicum have 52% similarity with E. coli OxyR and contain homologs of the two cysteine residues involved in H2O2 sensing by E. coli OxyR. In-frame ΔoxyR deletion mutants of C. diphtheriae C7(β), C. diphtheriae NCTC13129, and C. glutamicum were much more resistant than their parental wild type strains to growth inhibition by H2O2. In the C. diphtheriae C7(β) ΔoxyR mutant, cat transcripts were about 8-fold more abundant and catalase activity was about 20-fold greater than in the C7(β) wild type strain. The oxyR gene from C. diphtheriae or C. glutamicum, but not from E. coli, complemented the defect in ΔoxyR mutants of C. diphtheriae and C. glutamicum and decreased their H2O2 resistance to the level of their parental strains. Gel-mobility shift, DNaseI footprint, and primer extension assays showed that purified OxyR from C. diphtheriae C7(β) bound, in the presence or absence of DTT, to a sequence in the cat promoter region that extends from nucleotide position −55 to −10 with respect to the +1 nucleotide in the cat ORF. These results demonstrate that OxyR from C. diphtheriae or C. glutamicum functions as a transcriptional repressor of the cat gene by a mechanism that is independent of oxidative stress induced by H2O2. PMID:22438866
Genomic epidemiology of the Escherichia coli O104:H4 outbreaks in Europe, 2011.
Grad, Yonatan H; Lipsitch, Marc; Feldgarden, Michael; Arachchi, Harindra M; Cerqueira, Gustavo C; Fitzgerald, Michael; Godfrey, Paul; Haas, Brian J; Murphy, Cheryl I; Russ, Carsten; Sykes, Sean; Walker, Bruce J; Wortman, Jennifer R; Young, Sarah; Zeng, Qiandong; Abouelleil, Amr; Bochicchio, James; Chauvin, Sara; Desmet, Timothy; Gujja, Sharvari; McCowan, Caryn; Montmayeur, Anna; Steelman, Scott; Frimodt-Møller, Jakob; Petersen, Andreas M; Struve, Carsten; Krogfelt, Karen A; Bingen, Edouard; Weill, François-Xavier; Lander, Eric S; Nusbaum, Chad; Birren, Bruce W; Hung, Deborah T; Hanage, William P
2012-02-21
The degree to which molecular epidemiology reveals information about the sources and transmission patterns of an outbreak depends on the resolution of the technology used and the samples studied. Isolates of Escherichia coli O104:H4 from the outbreak centered in Germany in May-July 2011, and the much smaller outbreak in southwest France in June 2011, were indistinguishable by standard tests. We report a molecular epidemiological analysis using multiplatform whole-genome sequencing and analysis of multiple isolates from the German and French outbreaks. Isolates from the German outbreak showed remarkably little diversity, with only two single nucleotide polymorphisms (SNPs) found in isolates from four individuals. Surprisingly, we found much greater diversity (19 SNPs) in isolates from seven individuals infected in the French outbreak. The German isolates form a clade within the more diverse French outbreak strains. Moreover, five isolates derived from a single infected individual from the French outbreak had extremely limited diversity. The striking difference in diversity between the German and French outbreak samples is consistent with several hypotheses, including a bottleneck that purged diversity in the German isolates, variation in mutation rates in the two E. coli outbreak populations, or uneven distribution of diversity in the seed populations that led to each outbreak.
Genomic epidemiology of the Escherichia coli O104:H4 outbreaks in Europe, 2011
Grad, Yonatan H.; Lipsitch, Marc; Feldgarden, Michael; Arachchi, Harindra M.; Cerqueira, Gustavo C.; FitzGerald, Michael; Godfrey, Paul; Haas, Brian J.; Murphy, Cheryl I.; Russ, Carsten; Sykes, Sean; Walker, Bruce J.; Wortman, Jennifer R.; Young, Sarah; Zeng, Qiandong; Abouelleil, Amr; Bochicchio, James; Chauvin, Sara; DeSmet, Timothy; Gujja, Sharvari; McCowan, Caryn; Montmayeur, Anna; Steelman, Scott; Frimodt-Møller, Jakob; Petersen, Andreas M.; Struve, Carsten; Krogfelt, Karen A.; Bingen, Edouard; Weill, François-Xavier; Lander, Eric S.; Nusbaum, Chad; Birren, Bruce W.; Hung, Deborah T.; Hanage, William P.
2012-01-01
The degree to which molecular epidemiology reveals information about the sources and transmission patterns of an outbreak depends on the resolution of the technology used and the samples studied. Isolates of Escherichia coli O104:H4 from the outbreak centered in Germany in May–July 2011, and the much smaller outbreak in southwest France in June 2011, were indistinguishable by standard tests. We report a molecular epidemiological analysis using multiplatform whole-genome sequencing and analysis of multiple isolates from the German and French outbreaks. Isolates from the German outbreak showed remarkably little diversity, with only two single nucleotide polymorphisms (SNPs) found in isolates from four individuals. Surprisingly, we found much greater diversity (19 SNPs) in isolates from seven individuals infected in the French outbreak. The German isolates form a clade within the more diverse French outbreak strains. Moreover, five isolates derived from a single infected individual from the French outbreak had extremely limited diversity. The striking difference in diversity between the German and French outbreak samples is consistent with several hypotheses, including a bottleneck that purged diversity in the German isolates, variation in mutation rates in the two E. coli outbreak populations, or uneven distribution of diversity in the seed populations that led to each outbreak. PMID:22315421
DOE Office of Scientific and Technical Information (OSTI.GOV)
Pettengill, Emily A.; Pettengill, James B.; Binet, Rachel
As a leading cause of bacterial dysentery, Shigella represents a significant threat to public health and food safety. Related, but often overlooked, enteroinvasive Escherichia coli (EIEC) can also cause dysentery. Current typing methods have limited ability to identify and differentiate between these pathogens despite the need for rapid and accurate identification of pathogens for clinical treatment and outbreak response. We present a comprehensive phylogeny of Shigella and EIEC using whole genome sequencing of 169 samples, constituting unparalleled strain diversity, and observe a lack of monophyly between Shigella and EIEC and among Shigella taxonomic groups. The evolutionary relationships in the phylogenymore » are supported by analyses of population structure and hierarchical clustering patterns of translated gene homolog abundance. Lastly, we identified a panel of 404 single nucleotide polymorphism (SNP) markers specific to each phylogenetic cluster for more accurate identification of Shigella and EIEC. Our findings show that Shigella and EIEC are not distinct evolutionary groups within the E. coli genus and, thus, EIEC as a group is not the ancestor to Shigella. The multiple analyses presented provide evidence for reconsidering the taxonomic placement of Shigella. The SNP markers offer more discriminatory power to molecular epidemiological typing methods involving these bacterial pathogens.« less
Pettengill, Emily A.; Pettengill, James B.; Binet, Rachel
2016-01-19
As a leading cause of bacterial dysentery, Shigella represents a significant threat to public health and food safety. Related, but often overlooked, enteroinvasive Escherichia coli (EIEC) can also cause dysentery. Current typing methods have limited ability to identify and differentiate between these pathogens despite the need for rapid and accurate identification of pathogens for clinical treatment and outbreak response. We present a comprehensive phylogeny of Shigella and EIEC using whole genome sequencing of 169 samples, constituting unparalleled strain diversity, and observe a lack of monophyly between Shigella and EIEC and among Shigella taxonomic groups. The evolutionary relationships in the phylogenymore » are supported by analyses of population structure and hierarchical clustering patterns of translated gene homolog abundance. Lastly, we identified a panel of 404 single nucleotide polymorphism (SNP) markers specific to each phylogenetic cluster for more accurate identification of Shigella and EIEC. Our findings show that Shigella and EIEC are not distinct evolutionary groups within the E. coli genus and, thus, EIEC as a group is not the ancestor to Shigella. The multiple analyses presented provide evidence for reconsidering the taxonomic placement of Shigella. The SNP markers offer more discriminatory power to molecular epidemiological typing methods involving these bacterial pathogens.« less
Wu, Jianwei; Cai, Lei; Qian, Wei; Jiao, Liyuan; Li, Jiangfeng; Song, Xiaoli; Wang, Jihua
2015-07-01
To construct a prokaryotic expression vector of human neutrophil gelatinase associated lipocalin (NGAL) and identify the bioactivity of the fusion protein. The cDNA of human NGAL obtained from GenBank was linked to a cloning vector to construct the prokaryotic expression vector pCold-NGAL. Then the vector was transformed into E.coli BL21(DE3) plysS. Under the optimal induction condition, the recombinant NGAL (rNGAL) was expressed and purified by Ni Sepharose 6 Fast Flow affinity chromatography. The purity and activity of the rNGAL were respectively identified by SDS-PAGE and Western blotting combined with NGAL reagent (Latex enhanced immunoturbidimetry). Restriction enzyme digestion and nucleotide sequencing proved that the expression vector pCold-NGAL was successfully constructed. Under the optimal induction condition that we determined, the rNGAL was expressed in soluble form in E.coli BL21(DE3) plysS. The relative molecular mass of the rNGAL was 25 000, and its purity was more than 98.0%. Furthermore, Western blotting and immunoturbidimetry indicated that the rNGAL reacted with NGAL mAb specifically. Human rNGAL of high purity and bioactivity was successfully constructed in E.coli BL21(DE3) plysS using the expression vector pCold-NGAL.
Li, Yongqiang; Deng, Congliang; Bian, Yong; Zhao, Xiaoli; Zhou, Qi
2017-04-01
Apple stem grooving virus (ASGV), apple chlorotic leaf spot virus (ACLSV), and prunus necrotic ringspot virus (PNRSV) were identified in a crab apple tree by small RNA deep sequencing. The complete genome sequence of ACLSV isolate BJ (ACLSV-BJ) was 7554 nucleotides and shared 67.0%-83.0% nucleotide sequence identity with other ACLSV isolates. A phylogenetic tree based on the complete genome sequence of all available ACLSV isolates showed that ACLSV-BJ clustered with the isolates SY01 from hawthorn, MO5 from apple, and JB, KMS and YH from pear. The complete nucleotide sequence of ASGV-BJ was 6509 nucleotides (nt) long and shared 78.2%-80.7% nucleotide sequence identity with other isolates. ASGV-BJ and the isolate ASGV_kfp clustered together in the phylogenetic tree as an independent clade. Recombination analysis showed that isolate ASGV-BJ was a naturally occurring recombinant.
Composition for nucleic acid sequencing
Korlach, Jonas [Ithaca, NY; Webb, Watt W [Ithaca, NY; Levene, Michael [Ithaca, NY; Turner, Stephen [Ithaca, NY; Craighead, Harold G [Ithaca, NY; Foquet, Mathieu [Ithaca, NY
2008-08-26
The present invention is directed to a method of sequencing a target nucleic acid molecule having a plurality of bases. In its principle, the temporal order of base additions during the polymerization reaction is measured on a molecule of nucleic acid, i.e. the activity of a nucleic acid polymerizing enzyme on the template nucleic acid molecule to be sequenced is followed in real time. The sequence is deduced by identifying which base is being incorporated into the growing complementary strand of the target nucleic acid by the catalytic activity of the nucleic acid polymerizing enzyme at each step in the sequence of base additions. A polymerase on the target nucleic acid molecule complex is provided in a position suitable to move along the target nucleic acid molecule and extend the oligonucleotide primer at an active site. A plurality of labelled types of nucleotide analogs are provided proximate to the active site, with each distinguishable type of nucleotide analog being complementary to a different nucleotide in the target nucleic acid sequence. The growing nucleic acid strand is extended by using the polymerase to add a nucleotide analog to the nucleic acid strand at the active site, where the nucleotide analog being added is complementary to the nucleotide of the target nucleic acid at the active site. The nucleotide analog added to the oligonucleotide primer as a result of the polymerizing step is identified. The steps of providing labelled nucleotide analogs, polymerizing the growing nucleic acid strand, and identifying the added nucleotide analog are repeated so that the nucleic acid strand is further extended and the sequence of the target nucleic acid is determined.
Method for sequencing nucleic acid molecules
Korlach, Jonas; Webb, Watt W.; Levene, Michael; Turner, Stephen; Craighead, Harold G.; Foquet, Mathieu
2006-06-06
The present invention is directed to a method of sequencing a target nucleic acid molecule having a plurality of bases. In its principle, the temporal order of base additions during the polymerization reaction is measured on a molecule of nucleic acid, i.e. the activity of a nucleic acid polymerizing enzyme on the template nucleic acid molecule to be sequenced is followed in real time. The sequence is deduced by identifying which base is being incorporated into the growing complementary strand of the target nucleic acid by the catalytic activity of the nucleic acid polymerizing enzyme at each step in the sequence of base additions. A polymerase on the target nucleic acid molecule complex is provided in a position suitable to move along the target nucleic acid molecule and extend the oligonucleotide primer at an active site. A plurality of labelled types of nucleotide analogs are provided proximate to the active site, with each distinguishable type of nucleotide analog being complementary to a different nucleotide in the target nucleic acid sequence. The growing nucleic acid strand is extended by using the polymerase to add a nucleotide analog to the nucleic acid strand at the active site, where the nucleotide analog being added is complementary to the nucleotide of the target nucleic acid at the active site. The nucleotide analog added to the oligonucleotide primer as a result of the polymerizing step is identified. The steps of providing labelled nucleotide analogs, polymerizing the growing nucleic acid strand, and identifying the added nucleotide analog are repeated so that the nucleic acid strand is further extended and the sequence of the target nucleic acid is determined.
Method for sequencing nucleic acid molecules
Korlach, Jonas; Webb, Watt W.; Levene, Michael; Turner, Stephen; Craighead, Harold G.; Foquet, Mathieu
2006-05-30
The present invention is directed to a method of sequencing a target nucleic acid molecule having a plurality of bases. In its principle, the temporal order of base additions during the polymerization reaction is measured on a molecule of nucleic acid, i.e. the activity of a nucleic acid polymerizing enzyme on the template nucleic acid molecule to be sequenced is followed in real time. The sequence is deduced by identifying which base is being incorporated into the growing complementary strand of the target nucleic acid by the catalytic activity of the nucleic acid polymerizing enzyme at each step in the sequence of base additions. A polymerase on the target nucleic acid molecule complex is provided in a position suitable to move along the target nucleic acid molecule and extend the oligonucleotide primer at an active site. A plurality of labelled types of nucleotide analogs are provided proximate to the active site, with each distinguishable type of nucleotide analog being complementary to a different nucleotide in the target nucleic acid sequence. The growing nucleic acid strand is extended by using the polymerase to add a nucleotide analog to the nucleic acid strand at the active site, where the nucleotide analog being added is complementary to the nucleotide of the target nucleic acid at the active site. The nucleotide analog added to the oligonucleotide primer as a result of the polymerizing step is identified. The steps of providing labelled nucleotide analogs, polymerizing the growing nucleic acid strand, and identifying the added nucleotide analog are repeated so that the nucleic acid strand is further extended and the sequence of the target nucleic acid is determined.
Strouhal, Michal; Mikalová, Lenka; Havlíčková, Pavla; Tenti, Paolo; Čejková, Darina; Rychlík, Ivan; Bruisten, Sylvia; Šmajs, David
2017-09-01
Treponema pallidum subsp. pertenue (TPE) is the causative agent of yaws, a multi-stage disease, endemic in tropical regions of Africa, Asia, Oceania, and South America. To date, four TPE strains have been completely sequenced including three TPE strains of human origin (Samoa D, CDC-2, and Gauthier) and one TPE strain (Fribourg-Blanc) isolated from a baboon. All TPE strains are highly similar to T. pallidum subsp. pallidum (TPA) strains. The mutation rate in syphilis and related treponemes has not been experimentally determined yet. Complete genomes of two TPE strains, CDC 2575 and Ghana-051, that infected patients in Ghana and were isolated in 1980 and 1988, respectively, were sequenced and analyzed. Both strains had identical consensus genome nucleotide sequences raising the question whether TPE CDC 2575 and Ghana-051 represent two different strains. Several lines of evidence support the fact that both strains represent independent samples including regions showing intrastrain heterogeneity (13 and 5 intrastrain heterogeneous sites in TPE Ghana-051 and TPE CDC 2575, respectively). Four of these heterogeneous sites were found in both genomes but the frequency of alternative alleles differed. The identical consensus genome sequences were used to estimate the upper limit of the yaws treponeme evolution rate, which was 4.1 x 10-10 nucleotide changes per site per generation. The estimated upper limit for the mutation rate of TPE was slightly lower than the mutation rate of E. coli, which was determined during a long-term experiment. Given the known diversity between TPA and TPE genomes and the assumption that both TPA and TPE have a similar mutation rate, the most recent common ancestor of syphilis and yaws treponemes appears to be more than ten thousand years old and likely even older.
Fukumori, F; Saint, C P
1997-01-01
A 9,233-bp HindIII fragment of the aromatic amine catabolic plasmid pTDN1, isolated from a derivative of Pseudomonas putida mt-2 (UCC22), confers the ability to degrade aniline on P. putida KT2442. The fragment encodes six open reading frames which are arranged in the same direction. Their 5' upstream region is part of the direct-repeat sequence of pTDN1. Nucleotide sequence of 1.8 kb of the repeat sequence revealed only a single base pair change compared to the known sequence of IS1071 which is involved in the transposition of the chlorobenzoate genes (C. Nakatsu, J. Ng, R. Singh, N. Straus, and C. Wyndham, Proc. Natl. Acad. Sci. USA 88:8312-8316, 1991). Four open reading frames encode proteins with considerable homology to proteins found in other aromatic-compound degradation pathways. On the basis of sequence similarity, these genes are proposed to encode the large and small subunits of aniline oxygenase (tdnA1 and tdnA2, respectively), a reductase (tdnB), and a LysR-type regulatory gene (tdnR). The putative large subunit has a conserved [2Fe-2S]R Rieske-type ligand center. Two genes, tdnQ and tdnT, which may be involved in amino group transfer, are localized upstream of the putative oxygenase genes. The tdnQ gene product shares about 30% similarity with glutamine synthetases; however, a pUC-based plasmid carrying tdnQ did not support the growth of an Escherichia coli glnA strain in the absence of glutamine. TdnT possesses domains that are conserved among amidotransferases. The tdnQ, tdnA1, tdnA2, tdnB, and tdnR genes are essential for the conversion of aniline to catechol. PMID:8990291
USDA-ARS?s Scientific Manuscript database
Shiga toxin-producing Escherichia coli (STEC) cause severe disease and hemorrhagic colitis in humans. Of the STECs, E. coli O157:H7 is the most widely recognized and researched serotype, and the majority of cases of hemolytic-uremic syndrome in the United States are associated with this serotype. ...
Kouse, Andrew B.; Righetti, Francesco; Kortmann, Jens; Narberhaus, Franz; Murphy, Erin R.
2013-01-01
The initiation, progression and transmission of most bacterial infections is dependent upon the ability of the invading pathogen to acquire iron from each of the varied environments encountered during the course of a natural infection. In total, 95% of iron within the human body is complexed within heme, making heme a potentially rich source of host-associated nutrient iron for invading bacteria. As heme is encountered only within the host, pathogenic bacteria often regulate synthesis of heme utilization factors such that production is maximal under host-associated environmental conditions. This study examines the regulated production of ShuA, an outer-membrane receptor required for the utilization of heme as a source of nutrient iron by Shigella dysenteriae, a pathogenic bacterium that causes severe diarrheal diseases in humans. Specifically, the impact of the distinct environmental temperatures encountered during infection within a host (37°C) and transmission between hosts (25°C) on shuA expression is investigated. We show that shuA expression is subject to temperature-dependent post-transcriptional regulation resulting in increased ShuA production at 37°C. The observed thermoregulation is mediated by nucleic acid sequences within the 5′ untranslated region. In addition, we have identified similar nucleotide sequences within the 5′ untranslated region of the orthologous chuA transcript of enteropathogenic E. coli and have demonstrated that it also functions to confer temperature-dependent post-transcriptional regulation. In both function and predicted structure, the regulatory element within the shuA and chuA 5′ untranslated regions closely resembles a FourU RNA thermometer, a zipper-like RNA structure that occludes the Shine-Dalgarno sequence at low temperatures. Increased production of ShuA and ChuA in response to the host body temperature allows for maximal production of these heme acquisition factors within the environment where S. dysenteriae and pathogenic E. coli strains would encounter heme, a host-specific iron source. PMID:23704938
The Dermatophagoides farinae group 22 allergen: cloning and expression in Escherichia coli.
Cui, Yu-bao; Cai, Hong-xing; Zhou, Ying; Wang, Nan; Yu, Li-li; Yang, Li; Zhang, Cheng-bo
2015-09-01
Dermatophagoides farinae (Hughes) (Acari: Pyroglyphidae) and other domestic mites produce allergens that affect people worldwide. Here, the complementary DNA (cDNA) coding for group 22 allergen of D. farinae (Der f 22) from China was cloned, sequenced, and expressed successfully. The cDNA encoding Der f 22 was synthesized by reverse transcription polymerase chain reaction (RT-PCR), then ligated to the pCold-TF for expression in Escherichia coli BL21 cells. The purified recombinant fusion protein was identified by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), Western-blotting, and tandem matrix-assisted laser desorption ionization time-of-flight (MALDI-TOF/TOF). The full-length cDNA comprised 468 nucleotides and was 99.57% (466/468) identical with the reference sequence (GenBank: DQ643992). After the plasmid pCold-TF-Der f 22 was transformed into E. coli BL21 and expressed with the induction of IPTG, SDS-PAGE showed a specific band for the recombinant fusion protein. The recombinant fusion protein, which was purified by chromatography, bound with a His-tagged antibody by Western blotting. MALDI-TOF/TOF mass spectrometry revealed that the structure of the recombinant protein was identical to the predicted Der f 22 structure. The hydrophilic protein contains a signal peptide of 20 amino acids, and the mature Der f 22 consists of 135 amino acid residues with a molecular weight of 14.7 kDa and theoretical isoelectric points (pI) of 6.38. Its secondary structure comprises an alpha helix (38.5%), beta-sheet (45.9%), random coils (11.85%), and beta-turns (11.1%). This work represents the first reported full-length sequence and successful cloning of Der f 22 from D. farinae in China; bioinformatics analysis can be used to further study the allergenicity and clinical utility of the recombinant Der f 22. © 2015 ARS-AAOA, LLC.
Labeled nucleotide phosphate (NP) probes
Korlach, Jonas [Ithaca, NY; Webb, Watt W [Ithaca, NY; Levene, Michael [Ithaca, NY; Turner, Stephen [Ithaca, NY; Craighead, Harold G [Ithaca, NY; Foquet, Mathieu [Ithaca, NY
2009-02-03
The present invention is directed to a method of sequencing a target nucleic acid molecule having a plurality of bases. In its principle, the temporal order of base additions during the polymerization reaction is measured on a molecule of nucleic acid, i.e. the activity of a nucleic acid polymerizing enzyme on the template nucleic acid molecule to be sequenced is followed in real time. The sequence is deduced by identifying which base is being incorporated into the growing complementary strand of the target nucleic acid by the catalytic activity of the nucleic acid polymerizing enzyme at each step in the sequence of base additions. A polymerase on the target nucleic acid molecule complex is provided in a position suitable to move along the target nucleic acid molecule and extend the oligonucleotide primer at an active site. A plurality of labelled types of nucleotide analogs are provided proximate to the active site, with each distinguishable type of nucleotide analog being complementary to a different nucleotide in the target nucleic acid sequence. The growing nucleic acid strand is extended by using the polymerase to add a nucleotide analog to the nucleic acid strand at the active site, where the nucleotide analog being added is complementary to the nucleotide of the target nucleic acid at the active site. The nucleotide analog added to the oligonucleotide primer as a result of the polymerizing step is identified. The steps of providing labelled nucleotide analogs, polymerizing the growing nucleic acid strand, and identifying the added nucleotide analog are repeated so that the nucleic acid strand is further extended and the sequence of the target nucleic acid is determined.
The primary structure of the Saccharomyces cerevisiae gene for 3-phosphoglycerate kinase.
Hitzeman, R A; Hagie, F E; Hayflick, J S; Chen, C Y; Seeburg, P H; Derynck, R
1982-01-01
The DNA sequence of the gene for the yeast glycolytic enzyme, 3-phosphoglycerate kinase (PGK), has been obtained by sequencing part of a 3.1 kbp HindIII fragment obtained from the yeast genome. The structural gene sequence corresponds to a reading frame of 1251 bp coding for 416 amino acids with no intervening DNA sequences. The amino acid sequence is approximately 65 percent homologous with human and horse PGK protein sequences and is in general agreement with the published protein sequence for yeast PGK. As for other highly expressed structural genes in yeast, the coding sequence is highly codon biased with 95 percent of the amino acids coded for by a select 25 codons (out of 61 possible). Besides structural DNA sequence, 291 bp of 5'-flanking sequence and 286 bp of 3'-flanking sequence were determined. Transcription starts 36 nucleotides upstream from the translational start and stops 86-93 nucleotides downstream from the translational stop. These results suggest a non-polyadenylated mRNA length of 1373 to 1380 nucleotides, which is consistent with the observed length of 1500 nucleotides for polyadenylated PGK mRNA. A sequence TATATATAAA is found at 145 nucleotides upstream from the translational start. This sequence resembles the TATAAA box that is possibly associated with RNA polymerase II binding. Images PMID:6296791
Code of Federal Regulations, 2011 CFR
2011-07-01
... from abandonment 1.135 Amino Acid Sequences. (See Nucleotide and/or Amino Acid Sequences) Appeal to... Appeals and Interference 41.47 Of rejection of an application 1.104(a) Nucleotide and/or Amino Acid...) Symbols for nucleotide and/or amino acid sequence data 1.822 T Tables in patent applications 1.58 Terminal...
A novel site-specific recombination system derived from bacteriophage phiMR11.
Rashel, Mohammad; Uchiyama, Jumpei; Ujihara, Takako; Takemura, Iyo; Hoshiba, Hiroshi; Matsuzaki, Shigenobu
2008-04-04
We report identification of a novel site-specific DNA recombination system that functions in both in vivo and in vitro, derived from lysogenic Staphylococcus aureus phage phiMR11. In silico analysis of the phiMR11 genome indicated orf1 as a putative integrase gene. Phage and bacterial attachment sites (attP and attB, respectively) and attachment junctions were determined and their nucleotide sequences decoded. Sequences of attP and attB were mostly different to each other except for a two bp common core that was the crossover point. We found several inverted repeats adjacent to the core sequence of attP as potential protein binding sites. The precise and efficient integration properties of phiMR11 integrase were shown on attP and attB in Escherichia coli and the minimum size of attP was found to be 34bp. In in vitro assays using crude or purified integrase, only buffer and substrate DNAs were required for the recombination reaction, indicating that other bacterially encoded factors are not essential for activity.
Terminator Detection by Support Vector Machine Utilizing aStochastic Context-Free Grammar
DOE Office of Scientific and Technical Information (OSTI.GOV)
Francis-Lyon, Patricia; Cristianini, Nello; Holbrook, Stephen
2006-12-30
A 2-stage detector was designed to find rho-independent transcription terminators in the Escherichia coli genome. The detector includes a Stochastic Context Free Grammar (SCFG) component and a Support Vector Machine (SVM) component. To find terminators, the SCFG searches the intergenic regions of nucleotide sequence for local matches to a terminator grammar that was designed and trained utilizing examples of known terminators. The grammar selects sequences that are the best candidates for terminators and assigns them a prefix, stem-loop, suffix structure using the Cocke-Younger-Kasaami (CYK) algorithm, modified to incorporate energy affects of base pairing. The parameters from this inferred structure aremore » passed to the SVM classifier, which distinguishes terminators from non-terminators that score high according to the terminator grammar. The SVM was trained with negative examples drawn from intergenic sequences that include both featureless and RNA gene regions (which were assigned prefix, stem-loop, suffix structure by the SCFG), so that it successfully distinguishes terminators from either of these. The classifier was found to be 96.4% successful during testing.« less
Cloning and expression of a cDNA coding for catalase from zebrafish (Danio rerio).
Ken, C F; Lin, C T; Wu, J L; Shaw, J F
2000-06-01
A full-length complementary DNA (cDNA) clone encoding a catalase was amplified by the rapid amplication of cDNA ends-polymerase chain reaction (RACE-PCR) technique from zebrafish (Danio rerio) mRNA. Nucleotide sequence analysis of this cDNA clone revealed that it comprised a complete open reading frame coding for 526 amino acid residues and that it had a molecular mass of 59 654 Da. The deduced amino acid sequence showed high similarity with the sequences of catalase from swine (86.9%), mouse (85.8%), rat (85%), human (83.7%), fruit fly (75.6%), nematode (71.1%), and yeast (58.6%). The amino acid residues for secondary structures are apparently conserved as they are present in other mammal species. Furthermore, the coding region of zebrafish catalase was introduced into an expression vector, pET-20b(+), and transformed into Escherichia coli expression host BL21(DE3)pLysS. A 60-kDa active catalase protein was expressed and detected by Coomassie blue staining as well as activity staining on polyacrylamide gel followed electrophoresis.
WEB-server for search of a periodicity in amino acid and nucleotide sequences
NASA Astrophysics Data System (ADS)
E Frenkel, F.; Skryabin, K. G.; Korotkov, E. V.
2017-12-01
A new web server (http://victoria.biengi.ac.ru/splinter/login.php) was designed and developed to search for periodicity in nucleotide and amino acid sequences. The web server operation is based upon a new mathematical method of searching for multiple alignments, which is founded on the position weight matrices optimization, as well as on implementation of the two-dimensional dynamic programming. This approach allows the construction of multiple alignments of the indistinctly similar amino acid and nucleotide sequences that accumulated more than 1.5 substitutions per a single amino acid or a nucleotide without performing the sequences paired comparisons. The article examines the principles of the web server operation and two examples of studying amino acid and nucleotide sequences, as well as information that could be obtained using the web server.
Nucleotide sequence and genetic organization of barley stripe mosaic virus RNA gamma.
Gustafson, G; Hunter, B; Hanau, R; Armour, S L; Jackson, A O
1987-06-01
The complete nucleotide sequences of RNA gamma from the Type and ND18 strains of barley stripe mosaic virus (BSMV) have been determined. The sequences are 3164 (Type) and 2791 (ND18) nucleotides in length. Both sequences contain a 5'-noncoding region (87 or 88 nucleotides) which is followed by a long open reading frame (ORF1). A 42-nucleotide intercistronic region separates ORF1 from a second, shorter open reading frame (ORF2) located near the 3'-end of the RNA. There is a high degree of homology between the Type and ND18 strains in the nucleotide sequence of ORF1. However, the Type strain contains a 366 nucleotide direct tandem repeat within ORF1 which is absent in the ND18 strain. Consequently, the predicted translation product of Type RNA gamma ORF1 (mol wt 87,312) is significantly larger than that of ND18 RNA gamma ORF1 (mol wt 74,011). The amino acid sequence of the ORF1 polypeptide contains homologies with putative RNA polymerases from other RNA viruses, suggesting that this protein may function in replication of the BSMV genome. The nucleotide sequence of RNA gamma ORF2 is nearly identical in the Type and ND18 strains. ORF2 codes for a polypeptide with a predicted molecular weight of 17,209 (Type) or 17,074 (ND18) which is known to be translated from a subgenomic (sg) RNA. The initiation point of this sgRNA has been mapped to a location 27 nucleotides upstream of the ORF2 initiation codon in the intercistronic region between ORF1 and ORF2. The sgRNA is not coterminal with the 3'-end of the genomic RNA, but instead contains heterogeneous poly(A) termini up to 150 nucleotides long (J. Stanley, R. Hanau, and A. O. Jackson, 1984, Virology 139, 375-383). In the genomic RNA gamma, ORF2 is followed by a short poly(A) tract and a 238-nucleotide tRNA-like structure.
Seo, Gi Won; Jo, Yong Hun; Seong, Jeong Hwan; Park, Ki Beom; Patnaik, Bharat Bhusan; Tindwa, Hamisi; Kim, Sun-Am; Lee, Yong Seok; Kim, Yu Jung; Han, Yeon Soo
2016-08-20
The 14-3-3 family of phosphorylated serine-binding proteins acts as signaling molecules in biological processes such as metabolism, division, differentiation, autophagy, and apoptosis. Herein, we report the requirement of 14-3-3ɛ isoform from Tenebrio molitor (Tm14-3-3ɛ) in the hemocyte antimicrobial activity. The Tm14-3-3ɛ transcript is 771 nucleotides in length and encodes a polypeptide of 256 amino acid residues. The protein has the typical 14-3-3 domain, the nuclear export signal (NES) sequence, and the peptide binding residues. The Tm14-3-3ɛ transcript shows a significant three-fold expression in the hemocyte of T. molitor larvae when infected with Escherichia coli Tm14-3-3ɛ silenced larvae show significantly lower survival rates when infected with E. coli. Under Tm14-3-3ɛ silenced condition, a strong antimicrobial activity is elicited in the hemocyte of the host inoculated with E. coli. This suggests impaired secretion of antimicrobial peptides (AMP) into the hemolymph. Furthermore, a reduction in AMP secretion under Tm14-3-3ɛ silenced condition would be responsible for loss in the capacity to kill bacteria and might explain the reduced survivability of the larvae upon E. coli challenge. This shows that Tm14-3-3ɛ is required to maintain innate immunity in T. molitor by enabling antimicrobial secretion into the hemolymph and explains the functional specialization of the isoform.
Seo, Gi Won; Jo, Yong Hun; Seong, Jeong Hwan; Park, Ki Beom; Patnaik, Bharat Bhusan; Tindwa, Hamisi; Kim, Sun-Am; Lee, Yong Seok; Kim, Yu Jung; Han, Yeon Soo
2016-01-01
The 14-3-3 family of phosphorylated serine-binding proteins acts as signaling molecules in biological processes such as metabolism, division, differentiation, autophagy, and apoptosis. Herein, we report the requirement of 14-3-3ɛ isoform from Tenebrio molitor (Tm14-3-3ɛ) in the hemocyte antimicrobial activity. The Tm14-3-3ɛ transcript is 771 nucleotides in length and encodes a polypeptide of 256 amino acid residues. The protein has the typical 14-3-3 domain, the nuclear export signal (NES) sequence, and the peptide binding residues. The Tm14-3-3ɛ transcript shows a significant three-fold expression in the hemocyte of T. molitor larvae when infected with Escherichia coli Tm14-3-3ɛ silenced larvae show significantly lower survival rates when infected with E. coli. Under Tm14-3-3ɛ silenced condition, a strong antimicrobial activity is elicited in the hemocyte of the host inoculated with E. coli. This suggests impaired secretion of antimicrobial peptides (AMP) into the hemolymph. Furthermore, a reduction in AMP secretion under Tm14-3-3ɛ silenced condition would be responsible for loss in the capacity to kill bacteria and might explain the reduced survivability of the larvae upon E. coli challenge. This shows that Tm14-3-3ɛ is required to maintain innate immunity in T. molitor by enabling antimicrobial secretion into the hemolymph and explains the functional specialization of the isoform. PMID:27556493
Huy, Nguyen Tien; Hang, Le Thi Thuy; Boamah, Daniel; Lan, Nguyen Thi Phuong; Van Thanh, Phan; Watanabe, Kiwao; Huong, Vu Thi Thu; Kikuchi, Mihoko; Ariyoshi, Koya; Morita, Kouichi; Hirayama, Kenji
2012-12-01
Several loop-mediated isothermal amplification (LAMP) assays have been developed to detect common causative pathogens of bacterial meningitis (BM). However, no LAMP assay is reported to detect Streptococcus agalactiae and Streptococcus suis, which are also among common pathogens of BM. Moreover, it is laborious and expensive by performing multiple reactions for each sample to detect bacterial pathogen. Thus, we aimed to design and develop a single-tube LAMP assay capable of detecting multiple bacterial species, based on the nucleotide sequences of the 16S rRNA genes of the bacteria. The nucleotide sequences of the 16S rRNA genes of main pathogens involved in BM were aligned to identify conserved regions, which were further used to design broad range specific LAMP assay primers. We successfully designed a set of broad range specific LAMP assay primers for simultaneous detection of four species including Staphylococcus aureus, Streptococcus pneumoniae, S. suis and S. agalactiae. The broad range LAMP assay was highly specific without cross-reactivity with other bacteria including Haemophilus influenzae, Neisseria meningitidis and Escherichia coli. The sensitivity of our LAMP assay was 100-1000 times higher compared with the conventional PCR assay. The bacterial species could be identified after digestion of the LAMP products with restriction endonuclease DdeI and HaeIII. © 2012 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.
Chakraborty, Anirban; Tapryal, Nisha; Venkova, Tatiana; Horikoshi, Nobuo; Pandita, Raj K.; Sarker, Altaf H.; Sarkar, Partha S.; Pandita, Tej K.; Hazra, Tapas K.
2016-01-01
DNA double-strand breaks (DSBs) leading to loss of nucleotides in the transcribed region can be lethal. Classical non-homologous end-joining (C-NHEJ) is the dominant pathway for DSB repair (DSBR) in adult mammalian cells. Here we report that during such DSBR, mammalian C-NHEJ proteins form a multiprotein complex with RNA polymerase II and preferentially associate with the transcribed genes after DSB induction. Depletion of C-NHEJ factors significantly abrogates DSBR in transcribed but not in non-transcribed genes. We hypothesized that nascent RNA can serve as a template for restoring the missing sequences, thus allowing error-free DSBR. We indeed found pre-mRNA in the C-NHEJ complex. Finally, when a DSB-containing plasmid with several nucleotides deleted within the E. coli lacZ gene was allowed time to repair in lacZ-expressing mammalian cells, a functional lacZ plasmid could be recovered from control but not C-NHEJ factor-depleted cells, providing important mechanistic insights into C-NHEJ-mediated error-free DSBR of the transcribed genome. PMID:27703167
Genome Sequence of the Enterohemorrhagic Escherichia coli Bacteriophage UFV-AREG1
Batalha, Laís Silva; Albino, Luiz Augusto A.; Boggione, Delaine Meireles Gouveia; Gontijo, Marco Tulio Pardini; Bazzolli, Denise M. Soares; Mendonca, Regina C. Santos
2016-01-01
Here, we present the genome sequence of the Escherichia coli bacteriophage UFV-AREG1. This phage was isolated from cowshed wastewater and showed specificity for enterohemorrhagic E. coli O157:H7 (ATCC 43895), E. coli 0111 (CDC O11ab) and E. coli (ATCC 23229). PMID:27738021
Gleave, A P; Taylor, R K; Morris, B A; Greenwood, D R
1995-09-15
Janthinobacterium lividum secretes a major 56-kDa chitinase and a minor 69-kDa chitinase. A chitinase gene was defined on a 3-kb fragment of clone pRKT10, by virtue of fluorescent colonies in the presence of 4-methylumbelliferyl-beta-D-N,N',N"-chitotrioside. Nucleotide sequencing revealed an 1998-bp open reading frame with the potential to encode a 69,716-Da protein with amino acid sequences similar to those in other chitinases, suggesting it encodes the minor chitinase (Chi69). Chitinase activity of Escherichia coli (pRKT10) lysates was detected mainly in the periplasmic fraction and immunoblotting detected a 70-kDa protein in this fraction. Chi69 has an N-terminal secretory leader peptide preceding two probable chitin-binding domains and a catalytic domain. These functional domains are separated by linker regions of proline-threonine repeats. Amino acid sequencing of cyanogen bromide cleavage-derived peptides from the major 56-kDa chitinase suggested that Chi69 may be a precursor of Chi56. In addition, an N-terminally truncated version of Chi69 retained chitinase activity as expected if in vivo processing of Chi69 generates Chi56.
Characterization of cDNAs and genomic DNAs for human threonyl- and cysteinyl-tRNA synthetases
DOE Office of Scientific and Technical Information (OSTI.GOV)
Cruzen, M.E.
1993-01-01
Techniques of molecular biology were used to clone, sequence and map two human aminoacyl-tRNA synthetase (aaRS) cDNAs: threonyl-tRNA synthetase (ThrRS) a class II enzyme and cysteinyl-tRNA synthetase (CysRS) a class I enzyme. The predicted protein sequence of human ThrRS is highly homologous to that of lower eukaryotic and prokaryotic ThRSs, particularly in the regions containing the three structural motifs common to all class II synthetases. Signature regions 1 and 2, which characterize the class IIa subgroup (SerRS, ThrRS and HisRS) are highly conserved from bacteria to human. Structural predictions for human ThrRS based on the known structure of the closelymore » related SerRS from E.coli implicate strongly conserved residues in the signature sequences to be important in substrate binding. The amino terminal 100 residues of the deduced amino acid sequence of ThrRS shares structural similarity to SerRS consistent with forming an antiparallel helix implicated in tRNA binding. The 5' untranslated sequence of the human ThrRS gene shares short stretches of common sequence with the gene for hamster HisRS including a binding site for the promoter specific transcription factor sp-1. The deduced amino acid sequence of human CysRS has a high degree of sequence identify to E. coli CysRS. Human CysRS possesses the classic characteristics of a class I synthetase and is most closely related to the MetRS subgroup. The amino terminal half of human CysRS can be modeled as a nucleotide binding fold and shares significant sequence and structural similarity to the other enzymes in this subgroup. The CysRS structural gene (CARS) was mapped to human chromosome 11p15.5 by fluorescent in situ hybridization. CARS is the first aaRS gene to be mapped to chromosome 11. The steady state of both CysRS and ThrRs mRNA were quantitated in several human tissues. Message levels for these enzymes appear to be subjected to differential regulation in different cell types.« less
Liger, D; Masson, A; Blanot, D; van Heijenoort, J; Parquet, C
1995-05-15
The UDP-N-acetylmuramate:L-alanine ligase of Escherichia coli was over-produced in strains harbouring recombinant plasmids bearing the murC gene under the control of the lac or trc promoter. Plasmid pAM1005, in which the promoter and ribosome-binding site region of murC were removed and in which the gene was directly under the control of promoter trc, led to a 2000-fold amplification of the L-alanine-adding activity after induction by isopropyl-thio-beta-D-galactopyranoside. The murC gene product was visualized as a 50-kDa protein accounting for approximately 50% of the cell protein. A two-step purification led to 1 g of a homogeneous protein from an 18-1 culture. The N-terminal sequence of the purified protein correlated with the nucleotide sequence of the murC gene. The presence of 2-mercaptoethanol and glycerol was essential for the stability of the enzyme. The Km values for UDP-N-acetylmuramic acid, L-alanine and ATP/Mg2+ were estimated at 100, 20 and 450 microM, respectively. Under the optimal in vitro conditions a turnover number of 928 min-1 was calculated and a copy number/cell of 600 could be roughly estimated. The specificity of the enzyme for its substrates was investigated with various analogues. The enzyme also catalysed the reverse reaction.
Tao, Bo; Shao, Bai-Hui; Qiao, Yu-Xin; Wang, Xiao-Qin; Chang, Shu-Jun; Qiu, Li-Juan
2017-08-01
Glyphosate is a widely used broad spectrum herbicide; however, this limits its use once crops are planted. If glyphosate-resistant crops are grown, glyphosate can be used for weed control in crops. While several glyphosate resistance genes are used in commercial glyphosate tolerant crops, there is interest in identifying additional genes for glyphosate tolerance. This research constructed a high-quality cDNA library form the glyphosate-resistant fungus Aspergillus oryzae RIB40 to identify genes that may confer resistance to glyphosate. Using a medium containing glyphosate (120mM), we screened several clones from the library. Based on a nucleotide sequence analysis, we identified a gene of unknown function (GenBank accession number: XM_001826835.2) that encoded a hypothetical 344-amino acid protein. The gene was named MFS40. Its ORF was amplified to construct an expression vector, pGEX-4T-1-MFS40, to express the protein in Escherichia coli BL21. The gene conferred glyphosate tolerance to E. coli ER2799 cells. Copyright © 2017 Elsevier B.V. All rights reserved.
Nucleotide cleaving agents and method
Que, Jr., Lawrence; Hanson, Richard S.; Schnaith, Leah M. T.
2000-01-01
The present invention provides a unique series of nucleotide cleaving agents and a method for cleaving a nucleotide sequence, whether single-stranded or double-stranded DNA or RNA, using and a cationic metal complex having at least one polydentate ligand to cleave the nucleotide sequence phosphate backbone to yield a hydroxyl end and a phosphate end.
2017-01-01
Tight and tunable control of gene expression is a highly desirable goal in synthetic biology for constructing predictable gene circuits and achieving preferred phenotypes. Elucidating the sequence–function relationship of promoters is crucial for manipulating gene expression at the transcriptional level, particularly for inducible systems dependent on transcriptional regulators. Sort-seq methods employing fluorescence-activated cell sorting (FACS) and high-throughput sequencing allow for the quantitative analysis of sequence–function relationships in a robust and rapid way. Here we utilized a massively parallel sort-seq approach to analyze the formaldehyde-inducible Escherichia coli promoter (Pfrm) with single-nucleotide resolution. A library of mutated formaldehyde-inducible promoters was cloned upstream of gfp on a plasmid. The library was partitioned into bins via FACS on the basis of green fluorescent protein (GFP) expression level, and mutated promoters falling into each expression bin were identified with high-throughput sequencing. The resulting analysis identified two 19 base pair repressor binding sites, one upstream of the −35 RNA polymerase (RNAP) binding site and one overlapping with the −10 site, and assessed the relative importance of each position and base therein. Key mutations were identified for tuning expression levels and were used to engineer formaldehyde-inducible promoters with predictable activities. Engineered variants demonstrated up to 14-fold lower basal expression, 13-fold higher induced expression, and a 3.6-fold stronger response as indicated by relative dynamic range. Finally, an engineered formaldehyde-inducible promoter was employed to drive the expression of heterologous methanol assimilation genes and achieved increased biomass levels on methanol, a non-native substrate of E. coli. PMID:28463494
Foster, Patricia L; Niccum, Brittany A; Popodi, Ellen; Townes, Jesse P; Lee, Heewook; MohammedIsmail, Wazim; Tang, Haixu
2018-06-15
Mismatch repair (MMR) is a major contributor to replication fidelity, but its impact varies with sequence context and the nature of the mismatch. Mutation accumulation experiments followed by whole-genome sequencing of MMR-defective E. coli strains yielded ≈30,000 base-pair substitutions, revealing mutational patterns across the entire chromosome. The base-pair substitution spectrum was dominated by A:T > G:C transitions, which occurred predominantly at the center base of 5'N A C3'+5'G T N3' triplets. Surprisingly, growth on minimal medium or at low temperature attenuated these mutations. Mononucleotide runs were also hotspots for base-pair substitutions, and the rate at which these occurred increased with run length. Comparison with ≈2000 base-pair substitutions accumulated in MMR-proficient strains revealed that both kinds of hotspots appeared in the wild-type spectrum and so are likely to be sites of frequent replication errors. In MMR-defective strains transitions were strand biased, occurring twice as often when A and C rather than T and G were on the lagging-strand template. Loss of nucleotide diphosphate kinase increases the cellular concentration of dCTP, which resulted in increased rates of mutations due to misinsertion of C opposite A and T. In an mmr ndk double mutant strain, these mutations were more frequent when the template A and T were on the leading strand, suggesting that lagging-strand synthesis was more error-prone or less well corrected by proofreading than was leading strand synthesis. Copyright © 2018, Genetics.
Matsuda, M; Tai, K; Moore, J E; Millar, B C; Murayama, O
2004-01-01
Nucleotide sequencing after TA cloning of the amplicon of the almost-full length recA gene from three strains of UPTC (A1, A2, and A3) isolated from seagulls in Northern Ireland, the phenotypical and genotypical characteristics of which have been demonstrated to be indistinguishable, clarified nucleotide differences at three nucleotide positions among the three strains. In conclusion, the nucleotide sequences of the recA gene were found to discriminate among the three strains of UPTC, A1, A2, and A3, which are indistinguishable phenotypically and genotypically. Thus, the present study strongly suggests that nucleotide sequence data of the amplicon of a suitable gene or region could aid in discriminating among isolates of the UPTC group, which are indistinguishable phenotypically and genotypically. Copyright 2004 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim
Nucleic acid analysis using terminal-phosphate-labeled nucleotides
Korlach, Jonas [Ithaca, NY; Webb, Watt W [Ithaca, NY; Levene, Michael [Ithaca, NY; Turner, Stephen [Ithaca, NY; Craighead, Harold G [Ithaca, NY; Foquet, Mathieu [Ithaca, NY
2008-04-22
The present invention is directed to a method of sequencing a target nucleic acid molecule having a plurality of bases. In its principle, the temporal order of base additions during the polymerization reaction is measured on a molecule of nucleic acid, i.e. the activity of a nucleic acid polymerizing enzyme on the template nucleic acid molecule to be sequenced is followed in real time. The sequence is deduced by identifying which base is being incorporated into the growing complementary strand of the target nucleic acid by the catalytic activity of the nucleic acid polymerizing enzyme at each step in the sequence of base additions. A polymerase on the target nucleic acid molecule complex is provided in a position suitable to move along the target nucleic acid molecule and extend the oligonucleotide primer at an active site. A plurality of labelled types of nucleotide analogs are provided proximate to the active site, with each distinguishable type of nucleotide analog being complementary to a different nucleotide in the target nucleic acid sequence. The growing nucleic acid strand is extended by using the polymerase to add a nucleotide analog to the nucleic acid strand at the active site, where the nucleotide analog being added is complementary to the nucleotide of the target nucleic acid at the active site. The nucleotide analog added to the oligonucleotide primer as a result of the polymerizing step is identified. The steps of providing labelled nucleotide analogs, polymerizing the growing nucleic acid strand, and identifying the added nucleotide analog are repeated so that the nucleic acid strand is further extended and the sequence of the target nucleic acid is determined.
Yusoff, K; Millar, N S; Chambers, P; Emmerson, P T
1987-01-01
The nucleotide sequence of the L gene of the Beaudette C strain of Newcastle disease virus (NDV) has been determined. The L gene is 6704 nucleotides long and encodes a protein of 2204 amino acids with a calculated molecular weight of 248822. Mung bean nuclease mapping of the 5' terminus of the L gene mRNA indicates that the transcription of the L gene is initiated 11 nucleotides upstream of the translational start site. Comparison with the amino acid sequences of the L genes of Sendai virus and vesicular stomatitis virus (VSV) suggests that there are several regions of homology between the sequences. These data provide further evidence for an evolutionary relationship between the Paramyxoviridae and the Rhabdoviridae. A non-coding sequence of 46 nucleotides downstream of the presumed polyadenylation site of the L gene may be part of a negative strand leader RNA. Images PMID:3035486
Chromosomal features of Escherichia coli serotype O2:K2, an avian pathogenic E. coli.
Jørgensen, Steffen L; Kudirkiene, Egle; Li, Lili; Christensen, Jens P; Olsen, John E; Nolan, Lisa; Olsen, Rikke H
2017-01-01
Escherichia coli causing infection outside the gastrointestinal system are referred to as extra-intestinal pathogenic E. coli. Avian pathogenic E. coli is a subgroup of extra-intestinal pathogenic E. coli and infections due to avian pathogenic E. coli have major impact on poultry production economy and welfare worldwide. An almost defining characteristic of avian pathogenic E. coli is the carriage of plasmids, which may encode virulence factors and antibiotic resistance determinates. For the same reason, plasmids of avian pathogenic E. coli have been intensively studied. However, genes encoded by the chromosome may also be important for disease manifestation and antimicrobial resistance. For the E. coli strain APEC_O2 the plasmids have been sequenced and analyzed in several studies, and E. coli APEC_O2 may therefore serve as a reference strain in future studies. Here we describe the chromosomal features of E. coli APEC_O2. E. coli APEC_O2 is a sequence type ST135, has a chromosome of 4,908,820 bp (plasmid removed), comprising 4672 protein-coding genes, 110 RNA genes, and 156 pseudogenes, with an average G + C content of 50.69%. We identified 82 insertion sequences as well as 4672 protein coding sequences, 12 predicated genomic islands, three prophage-related sequences, and two clustered regularly interspaced short palindromic repeats regions on the chromosome, suggesting the possible occurrence of horizontal gene transfer in this strain. The wildtype strain of E. coli APEC_O2 is resistant towards multiple antimicrobials, however, no (complete) antibiotic resistance genes were present on the chromosome, but a number of genes associated with extra-intestinal disease were identified. Together, the information provided here on E. coli APEC_O2 will assist in future studies of avian pathogenic E. coli strains, in particular regarding strain of E. coli APEC_O2, and aid in the general understanding of the pathogenesis of avian pathogenic E. coli .
Wang, Yaru; Luo, Huiying; Huang, Huoqing; Shi, Pengjun; Bai, Yingguo; Yang, Peilong; Yao, Bin
2012-01-01
Background Efficient degradation of pectin in the rumen is necessary for plant-based feed utilization. The objective of this study was to characterize the diversity, abundance, and functions of pectinases from microorganisms in the sheep rumen. Methodology/Principal Findings A total of 103 unique fragments of polygalacturonase (PF00295) and pectate lyase (PF00544 and PF09492) genes were retrieved from microbial DNA in the rumen of a Small Tail Han sheep, and 66% of the sequences of these fragments had low identities (<65%) with known sequences. Phylogenetic tree building separated the PF00295, PF00544, and PF09492 sequences into five, three, and three clades, respectively. Cellulolytic and noncellulolytic Butyrivibrio, Prevotella, and Fibrobacter species were the major sources of the pectinases. The two most abundant pectate lyase genes were cloned, and their protein products, expressed in Escherichia coli, were characterized. Both enzymes probably act extracellularly as their nucleotide sequences contained signal sequences, and they had optimal activities at the ruminal physiological temperature and complementary pH-dependent activity profiles. Conclusion/Significance This study reveals the specificity, diversity, and abundance of pectinases in the rumen ecosystem and provides two additional ruminal pectinases for potential industrial use under physiological conditions. PMID:22815874
37 CFR 1.821 - Nucleotide and/or amino acid sequence disclosures in patent applications.
Code of Federal Regulations, 2014 CFR
2014-07-01
...” means those amino acids other than “Xaa” and those nucleotide bases other than “n”defined in accordance... 37 Patents, Trademarks, and Copyrights 1 2014-07-01 2014-07-01 false Nucleotide and/or amino acid... Biotechnology Invention Disclosures Application Disclosures Containing Nucleotide And/or Amino Acid Sequences...
37 CFR 1.821 - Nucleotide and/or amino acid sequence disclosures in patent applications.
Code of Federal Regulations, 2013 CFR
2013-07-01
...” means those amino acids other than “Xaa” and those nucleotide bases other than “n”defined in accordance... 37 Patents, Trademarks, and Copyrights 1 2013-07-01 2013-07-01 false Nucleotide and/or amino acid... Biotechnology Invention Disclosures Application Disclosures Containing Nucleotide And/or Amino Acid Sequences...
37 CFR 1.821 - Nucleotide and/or amino acid sequence disclosures in patent applications.
Code of Federal Regulations, 2012 CFR
2012-07-01
...” means those amino acids other than “Xaa” and those nucleotide bases other than “n”defined in accordance... 37 Patents, Trademarks, and Copyrights 1 2012-07-01 2012-07-01 false Nucleotide and/or amino acid... Biotechnology Invention Disclosures Application Disclosures Containing Nucleotide And/or Amino Acid Sequences...
Hall, L; Laird, J E; Craig, R K
1984-01-01
Nucleotide sequence analysis of cloned guinea-pig casein B cDNA sequences has identified two casein B variants related to the bovine and rat alpha s1 caseins. Amino acid homology was largely confined to the known bovine or predicted rat phosphorylation sites and within the 'signal' precursor sequence. Comparison of the deduced nucleotide sequence of the guinea-pig and rat alpha s1 casein mRNA species showed greater sequence conservation in the non-coding than in the coding regions, suggesting a functional and possibly regulatory role for the non-coding regions of casein mRNA. The results provide insight into the evolution of the casein genes, and raise questions as to the role of conserved nucleotide sequences within the non-coding regions of mRNA species. Images Fig. 1. PMID:6548375
Di Gennaro, Simone; Ficca, Anna G; Panichi, Daniela; Poerio, Elia
2005-04-01
A cDNA encoding the proteinase inhibitor WSCI (wheat subtilisin/chymotrypsin inhibitor) was isolated by RT-PCR. Degenerate oligonucleotide primers were designed based on the amino acid sequence of WSCI and on the nucleotide sequence of the two homologous inhibitors (CI-2A and CI-2B) isolated from barley. For large-scale production, wsci cDNA was cloned into the E. coli vector pGEX-2T. The fusion protein GST-WSCI was efficiently produced in the bacterial expression system and, as the native inhibitor, was capable of inhibiting bacterial subtilisin, mammalian chymotrypsins and chymotrypsin-like activities present in crude extracts of a number of insect larvae ( Helicoverpa armigera , Plodia interpunctella and Tenebrio molitor ). The recombinant protein produced was also able to interfere with chymotrypsin-like activity isolated from immature wheat caryopses. These findings support a physiological role for this inhibitor during grain maturation.
Pasion, S G; Hines, J C; Aebersold, R; Ray, D S
1992-01-01
A type II DNA topoisomerase, topoIImt, was shown previously to be associated with the kinetoplast DNA of the trypanosomatid Crithidia fasciculata. The gene encoding this kinetoplast-associated topoisomerase has been cloned by immunological screening of a Crithidia genomic expression library with monoclonal antibodies raised against the purified enzyme. The gene CfaTOP2 is a single copy gene and is expressed as a 4.8-kb polyadenylated transcript. The nucleotide sequence of CfaTOP2 has been determined and encodes a predicted polypeptide of 1239 amino acids with a molecular mass of 138,445. The identification of the cloned gene is supported by immunoblot analysis of the beta-galactosidase-CfaTOP2 fusion protein expressed in Escherichia coli and by analysis of tryptic peptide sequences derived from purified topoIImt. CfaTOP2 shares significant homology with nuclear type II DNA topoisomerases of other eukaryotes suggesting that in Crithidia both nuclear and mitochondrial forms of topoisomerase II are encoded by the same gene.
Wang, Quanfu; Hou, Yanhua; Shi, Yonglei; Han, Xiao; Chen, Qian; Hu, Zhiguo; Liu, Yuanping; Li, YuJin
2014-01-01
Glutaredoxins (Grxs) are small ubiquitous redox enzymes that catalyze glutathione-dependent reactions to reduce protein disulfide. In this study, a full-length Grx gene (PsGrx) with 270 nucleotides was isolated from Antarctic sea-ice bacterium Pseudoalteromonas sp. AN178. It encoded deduced 89 amino acid residues with the molecular weight 9.8 kDa. Sequence analysis of the amino acid sequence revealed the catalytic motif CPYC. Recombinant PsGrx (rPsGrx) stably expressed in E. coli BL21 was purified to apparent homogeneity by Ni-affinity chromatography. rPsGrx exhibited optimal activity at 30°C and pH 8.0 and showed 25.5% of the activity at 0°C. It retained 65.0% of activity after incubation at 40°C for 20 min and still exhibited 37.0% activity in 1.0 M NaCl. These results indicated that rPsGrx was a typical cold active protein with low thermostability.
Widespread and Persistent Populations of a Major New Marine Actinomycete Taxon in Ocean Sediments
Mincer, Tracy J.; Jensen, Paul R.; Kauffman, Christopher A.; Fenical, William
2002-01-01
A major taxon of obligate marine bacteria within the order Actinomycetales has been discovered from ocean sediments. Populations of these bacteria (designated MAR 1) are persistent and widespread, spanning at least three distinct ocean systems. In this study, 212 actinomycete isolates possessing MAR 1 morphologies were examined and all but two displayed an obligate requirement of seawater for growth. Forty-five of these isolates, representing all observed seawater-requiring morphotypes, were partially sequenced and found to share characteristic small-subunit rRNA signature nucleotides between positions 207 and 468 (Escherichia coli numbering). Phylogenetic characterization of seven representative isolates based on almost complete sequences of genes encoding 16S rRNA (16S ribosomal DNA) yielded a monophyletic clade within the family Micromonosporaceae and suggests novelty at the genus level. This is the first evidence for the existence of widespread populations of obligate marine actinomycetes. Organic extracts from cultured members of this new group exhibit remarkable biological activity, suggesting that they represent a prolific resource for biotechnological applications. PMID:12324350
Matsuda, M; Tazumi, A; Kagawa, S; Sekizuka, T; Murayama, O; Moore, JE; Millar, BC
2006-01-01
Background At present, six accessible sequences of 16S rDNA from Taylorella equigenitalis (T. equigenitalis) are available, whose sequence differences occur at a few nucleotide positions. Thus it is important to determine these sequences from additional strains in other countries, if possible, in order to clarify any anomalies regarding 16S rDNA sequence heterogeneity. Here, we clone and sequence the approximate full-length 16S rDNA from additional strains of T. equigenitalis isolated in Japan, Australia and France and compare these sequences to the existing published sequences. Results Clarification of any anomalies regarding 16S rDNA sequence heterogeneity of T. equigenitalis was carried out. When cloning, sequencing and comparison of the approximate full-length 16S rDNA from 17 strains of T. equigenitalis isolated in Japan, Australia and France, nucleotide sequence differences were demonstrated at the six loci in the 1,469 nucleotide sequence. Moreover, 12 polymorphic sites occurred among 23 sequences of the 16S rDNA, including the six reference sequences. Conclusion High sequence similarity (99.5% or more) was observed throughout, except from nucleotide positions 138 to 501 where substitutions and deletions were noted. PMID:16398935
Trucco, Verónica; de Breuil, Soledad; Bejerman, Nicolás; Lenardon, Sergio; Giolitti, Fabián
2014-06-01
The complete nucleotide sequence of an Alfalfa mosaic virus (AMV) isolate infecting alfalfa (Medicago sativa L.) in Argentina, AMV-Arg, was determined. The virus genome has the typical organization described for AMV, and comprises 3,643, 2,593, and 2,038 nucleotides for RNA1, 2 and 3, respectively. The whole genome sequence and each encoding region were compared with those of other four isolates that have been completely sequenced from China, Italy, Spain and USA. The nucleotide identity percentages ranged from 95.9 to 99.1 % for the three RNAs and from 93.7 to 99 % for the protein 1 (P1), protein 2 (P2), movement protein and coat protein (CP) encoding regions, whereas the amino acid identity percentages of these proteins ranged from 93.4 to 99.5 %, the lowest value corresponding to P2. CP sequences of AMV-Arg were compared with those of other 25 available isolates, and the phylogenetic analysis based on the CP gene was carried out. The highest percentage of nucleotide sequence identity of the CP gene was 98.3 % with a Chinese isolate and 98.6 % at the amino acid level with four isolates, two from Italy, one from Brazil and the remaining one from China. The phylogenetic analysis showed that AMV-Arg is closely related to subgroup I of AMV isolates. To our knowledge, this is the first report of a complete nucleotide sequence of AMV from South America and the first worldwide report of complete nucleotide sequence of AMV isolated from alfalfa as natural host.
Financsek, I; Mizumoto, K; Mishima, Y; Muramatsu, M
1982-01-01
The transcription initiation site of the human ribosomal RNA gene (rDNA) was located by using the single-strand specific nuclease protection method and by determining the first nucleotide of the in vitro capped 45S preribosomal RNA. The sequence of 1,211 nucleotides surrounding the initiation site was determined. The sequenced region was found to consist of 75% G and C and to contain a number of short direct and inverted repeats and palindromes. By comparison of the corresponding initiation regions of three mammalian species, several conserved sequences were found upstream and downstream from the transcription starting point. Two short A + T-rich sequences are present on human, mouse, and rat ribosomal RNA genes between the initiation site and 40 nucleotides upstream, and a C + T cluster is located at a position around -60. At and downstream from the initiation site, a common sequence, T-AG-C-T-G-A-C-A-C-G-C-T-G-T-C-C-T-CT-T, was found in the three genes from position -1 through +18. The strong conservation of these sequences suggests their functional significance in rDNA. The S1 nuclease protection experiments with cloned rDNA fragments indicated the presence in human 45S RNA of molecules several hundred nucleotides shorter than the supposed primary transcript. The first 19 nucleotides of these molecules appear identical--except for one mismatch--to the nucleotide sequence of the 5' end of a supposed early processing product of the mouse 45S RNA. Images PMID:6954460
Bacterial RecA Protein Promotes Adenoviral Recombination during In Vitro Infection
Lee, Jeong Yoon; Lee, Ji Sun; Materne, Emma C.; Rajala, Rahul; Ismail, Ashrafali M.; Seto, Donald; Dyer, David W.
2018-01-01
ABSTRACT Adenovirus infections in humans are common and sometimes lethal. Adenovirus-derived vectors are also commonly chosen for gene therapy in human clinical trials. We have shown in previous work that homologous recombination between adenoviral genomes of human adenovirus species D (HAdV-D), the largest and fastest growing HAdV species, is responsible for the rapid evolution of this species. Because adenovirus infection initiates in mucosal epithelia, particularly at the gastrointestinal, respiratory, genitourinary, and ocular surfaces, we sought to determine a possible role for mucosal microbiota in adenovirus genome diversity. By analysis of known recombination hot spots across 38 human adenovirus genomes in species D (HAdV-D), we identified nucleotide sequence motifs similar to bacterial Chi sequences, which facilitate homologous recombination in the presence of bacterial Rec enzymes. These motifs, referred to here as ChiAD, were identified immediately 5′ to the sequence encoding penton base hypervariable loop 2, which expresses the arginine-glycine-aspartate moiety critical to adenoviral cellular entry. Coinfection with two HAdV-Ds in the presence of an Escherichia coli lysate increased recombination; this was blocked in a RecA mutant strain, E. coli DH5α, or upon RecA depletion. Recombination increased in the presence of E. coli lysate despite a general reduction in viral replication. RecA colocalized with viral DNA in HAdV-D-infected cell nuclei and was shown to bind specifically to ChiAD sequences. These results indicate that adenoviruses may repurpose bacterial recombination machinery, a sharing of evolutionary mechanisms across a diverse microbiota, and unique example of viral commensalism. IMPORTANCE Adenoviruses are common human mucosal pathogens of the gastrointestinal, respiratory, and genitourinary tracts and ocular surface. Here, we report finding Chi-like sequences in adenovirus recombination hot spots. Adenovirus coinfection in the presence of bacterial RecA protein facilitated homologous recombination between viruses. Genetic recombination led to evolution of an important external feature on the adenoviral capsid, namely, the penton base protein hypervariable loop 2, which contains the arginine-glycine-aspartic acid motif critical to viral internalization. We speculate that free Rec proteins present in gastrointestinal secretions upon bacterial cell death facilitate the evolution of human adenoviruses through homologous recombination, an example of viral commensalism and the complexity of virus-host interactions, including regional microbiota. PMID:29925671
Quantum Point Contact Single-Nucleotide Conductance for DNA and RNA Sequence Identification.
Afsari, Sepideh; Korshoj, Lee E; Abel, Gary R; Khan, Sajida; Chatterjee, Anushree; Nagpal, Prashant
2017-11-28
Several nanoscale electronic methods have been proposed for high-throughput single-molecule nucleic acid sequence identification. While many studies display a large ensemble of measurements as "electronic fingerprints" with some promise for distinguishing the DNA and RNA nucleobases (adenine, guanine, cytosine, thymine, and uracil), important metrics such as accuracy and confidence of base calling fall well below the current genomic methods. Issues such as unreliable metal-molecule junction formation, variation of nucleotide conformations, insufficient differences between the molecular orbitals responsible for single-nucleotide conduction, and lack of rigorous base calling algorithms lead to overlapping nanoelectronic measurements and poor nucleotide discrimination, especially at low coverage on single molecules. Here, we demonstrate a technique for reproducible conductance measurements on conformation-constrained single nucleotides and an advanced algorithmic approach for distinguishing the nucleobases. Our quantum point contact single-nucleotide conductance sequencing (QPICS) method uses combed and electrostatically bound single DNA and RNA nucleotides on a self-assembled monolayer of cysteamine molecules. We demonstrate that by varying the applied bias and pH conditions, molecular conductance can be switched ON and OFF, leading to reversible nucleotide perturbation for electronic recognition (NPER). We utilize NPER as a method to achieve >99.7% accuracy for DNA and RNA base calling at low molecular coverage (∼12×) using unbiased single measurements on DNA/RNA nucleotides, which represents a significant advance compared to existing sequencing methods. These results demonstrate the potential for utilizing simple surface modifications and existing biochemical moieties in individual nucleobases for a reliable, direct, single-molecule, nanoelectronic DNA and RNA nucleotide identification method for sequencing.
Sequence-based prediction of protein-binding sites in DNA: comparative study of two SVM models.
Park, Byungkyu; Im, Jinyong; Tuvshinjargal, Narankhuu; Lee, Wook; Han, Kyungsook
2014-11-01
As many structures of protein-DNA complexes have been known in the past years, several computational methods have been developed to predict DNA-binding sites in proteins. However, its inverse problem (i.e., predicting protein-binding sites in DNA) has received much less attention. One of the reasons is that the differences between the interaction propensities of nucleotides are much smaller than those between amino acids. Another reason is that DNA exhibits less diverse sequence patterns than protein. Therefore, predicting protein-binding DNA nucleotides is much harder than predicting DNA-binding amino acids. We computed the interaction propensity (IP) of nucleotide triplets with amino acids using an extensive dataset of protein-DNA complexes, and developed two support vector machine (SVM) models that predict protein-binding nucleotides from sequence data alone. One SVM model predicts protein-binding nucleotides using DNA sequence data alone, and the other SVM model predicts protein-binding nucleotides using both DNA and protein sequences. In a 10-fold cross-validation with 1519 DNA sequences, the SVM model that uses DNA sequence data only predicted protein-binding nucleotides with an accuracy of 67.0%, an F-measure of 67.1%, and a Matthews correlation coefficient (MCC) of 0.340. With an independent dataset of 181 DNAs that were not used in training, it achieved an accuracy of 66.2%, an F-measure 66.3% and a MCC of 0.324. Another SVM model that uses both DNA and protein sequences achieved an accuracy of 69.6%, an F-measure of 69.6%, and a MCC of 0.383 in a 10-fold cross-validation with 1519 DNA sequences and 859 protein sequences. With an independent dataset of 181 DNAs and 143 proteins, it showed an accuracy of 67.3%, an F-measure of 66.5% and a MCC of 0.329. Both in cross-validation and independent testing, the second SVM model that used both DNA and protein sequence data showed better performance than the first model that used DNA sequence data. To the best of our knowledge, this is the first attempt to predict protein-binding nucleotides in a given DNA sequence from the sequence data alone. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.
Sjöberg, B M; Gräslund, A; Eckstein, F
1983-07-10
The B2 subunit of ribonucleotide reductase from Escherichia coli contains a tyrosine radical which is essential for enzyme activity. In the reaction between ribonucleotide reductase and the substrate analogue 2'-azido-2'-deoxycytidine 5'-diphosphate a new transient radical is formed. The EPR characteristics of this new radical species are consistent with a localization of the unpaired electron at the sugar moiety of the nucleotide. The radical shows hyperfine couplings to a hydrogen and a nitrogen nucleus, the latter probably being part of the azide substituent. The formation of the nucleotide radical in this suicidal reaction is concomitant with the decay of the tyrosine radical of the B2 subunit. Kinetic data argue for a first (pseudosecond) order decay of the B2 radical via generation of the nucleotide radical followed by a slower first order decay of the nucleotide radical. End products in the reaction are cytosine and radical-free protein B2. In the reaction between bacteriophage T4 ribonucleotide reductase and 2'-azido-2'-deoxycytidine 5'-diphosphate an identical nucleotide radical is formed. The present results are consistent with the hypothesis that the appearance and structure of the transient radical mimic stages in the normal reaction pathway of ribonucleotide reductase, postulated to proceed via 3'-hydrogen abstraction and cation radical formation of the substrate nucleotide (Stubbe, J., and Ackles, D. (1980) J. Biol. Chem. 255, 8027-8030). The nucleotide radical described here might be equivalent to such a cation radical intermediate.
Array of nucleic acid probes on biological chips for diagnosis of HIV and methods of using the same
Chee, Mark; Gingeras, Thomas R.; Fodor, Stephen P. A.; Hubble, Earl A.; Morris, MacDonald S.
1999-01-19
The invention provides an array of oligonucleotide probes immobilized on a solid support for analysis of a target sequence from a human immunodeficiency virus. The array comprises at least four sets of oligonucleotide probes 9 to 21 nucleotides in length. A first probe set has a probe corresponding to each nucleotide in a reference sequence from a human immunodeficiency virus. A probe is related to its corresponding nucleotide by being exactly complementary to a subsequence of the reference sequence that includes the corresponding nucleotide. Thus, each probe has a position, designated an interrogation position, that is occupied by a complementary nucleotide to the corresponding nucleotide. The three additional probe sets each have a corresponding probe for each probe in the first probe set. Thus, for each nucleotide in the reference sequence, there are four corresponding probes, one from each of the probe sets. The three corresponding probes in the three additional probe sets are identical to the corresponding probe from the first probe or a subsequence thereof that includes the interrogation position, except that the interrogation position is occupied by a different nucleotide in each of the four corresponding probes.
Brandon Schlautman; Vera Pfeiffer; Juan Zalapa; Johanne Brunet
2014-01-01
Numerous microsatellite markers were developed for Aquilegia formosafrom sequences deposited within the Expressed Sequence Tag (EST), Genomic Survey Sequence (GSS), and Nucleotide databases in NCBI. Microsatellites (SSRs) were identified and primers were designed for 9 SSR containing sequences in the Nucleotide database, 3803 sequences in the EST...
Switchgrass ubiquitin promoter (PVUBI2) and uses thereof
Stewart, C. Neal; Mann, David George James
2013-12-10
The subject application provides polynucleotides, compositions thereof and methods for regulating gene expression in a plant. Polynucleotides disclosed herein comprise novel sequences for a promoter isolated from Panicum virgatum (switchgrass) that initiates transcription of an operably linked nucleotide sequence. Thus, various embodiments of the invention comprise the nucleotide sequence of SEQ ID NO: 2 or fragments thereof comprising nucleotides 1 to 692 of SEQ ID NO: 2 that are capable of driving the expression of an operably linked nucleic acid sequence.
USDA-ARS?s Scientific Manuscript database
Polymorphic genetic markers were identified and characterized using a partial genomic library of Heliothis virescens enriched for simple sequence repeats (SSR) and nucleotide sequences of expressed sequence tags (EST). Nucleotide sequences of 192 clones from the partial genomic library yielded 147 u...
Extension of the COG and arCOG databases by amino acid and nucleotide sequences
Meereis, Florian; Kaufmann, Michael
2008-01-01
Background The current versions of the COG and arCOG databases, both excellent frameworks for studies in comparative and functional genomics, do not contain the nucleotide sequences corresponding to their protein or protein domain entries. Results Using sequence information obtained from GenBank flat files covering the completely sequenced genomes of the COG and arCOG databases, we constructed NUCOCOG (nucleotide sequences containing COG databases) as an extended version including all nucleotide sequences and in addition the amino acid sequences originally utilized to construct the current COG and arCOG databases. We make available three comprehensive single XML files containing the complete databases including all sequence information. In addition, we provide a web interface as a utility suitable to browse the NUCOCOG database for sequence retrieval. The database is accessible at . Conclusion NUCOCOG offers the possibility to analyze any sequence related property in the context of the COG and arCOG framework simply by using script languages such as PERL applied to a large but single XML document. PMID:19014535
Villadsen, I S; Michelsen, O
1977-01-01
The ribonucleoside triphosphate, deoxyribonucleoside triphosphate, 3' -diphosphate guanosine 5' -diphosphate (ppGpp), and 5-phosphoribosyl 1-pyrophosphate (PRPP) pools in Escherichia coli B were determined by thin-layer chromatography during changing conditions to ammonium starvation. The intracellular concentrations of all nucleotides were found to change in a well-defined order several minutes before andy observed change in the optical density of the culture. The levels of purine nucleoside triphosphates (adenosine 5' -triphosphate [CTP], dCTP) and uridine nucleotides (uridine 5' -triphosphate, deoxythymidine 5'-triphosphate). The deoxyribonucleotides thus behaved as the ribonucleotides. The levels of ppGpp increased 11-fold after the decrease in uridine nucleotides, when the accumulation of stable ribonucleic acid (RNA) stopped. The level of the nucleotide pool did not stabilize until 30 min after the change in optical density. The pool of dGTP dropped concomitantly with the pool of CTP. The nucleotide precursor PRPP exhibited a transient increase, wtih maximum value of four times the exponential levels at the onset of starvation. Apparently the cell adjusts early to starvation by reducing either the phosphorylating activity or the nucleotide biosynthetic activity. As in other downshift systems, the accumulation of stable RNA stopped before the break in optical density and before the stop in protein accumulation. Cell divisions were quite insensitive to the control mechanisms operating on RNA and protein accumulation under ammonium starvation, since the cells continued to divide for 21 min without any net accumulation of RNA. Images PMID:323222
DNA Nucleotide Sequence Restricted by the RI Endonuclease
Hedgpeth, Joe; Goodman, Howard M.; Boyer, Herbert W.
1972-01-01
The sequence of DNA base pairs adjacent to the phosphodiester bonds cleaved by the RI restriction endonuclease in unmodified DNA from coliphage λ has been determined. The 5′-terminal nucleotide labeled with 32P and oligonucleotides up to the heptamer were analyzed from a pancreatic DNase digest. The following sequence of nucleotides adjacent to the RI break made in λ DNA was deduced from these data and from the 3′-dinucleotide sequence and nearest-neighbor analysis obtained from repair synthesis with the DNA polymerase of Rous sarcoma virus [Formula: see text] The RI endonuclease cleavage of the phosphodiester bonds (indicated by arrows) generates 5′-phosphoryls and short cohesive termini of four nucleotides, pApApTpT. The most striking feature of the sequence is its symmetry. PMID:4343974
Derakhshandeh, A; Zahraei Salehi, T; Tadjbakhsh, H; Karimi, V
2009-09-01
To identify, clone and sequence the iss (increased serum survival) gene from E. coli strain chi1378 isolated from Iranian poultry and to predict its protein product, Iss. The iss gene from E. coli strain chi1378 was amplified and cloned into the pTZ57R/T vector and sequenced. From the DNA sequence, the Iss predictive protein was evaluated using bioinformatics. Iss from strain chi1378 had 100% identity with other E. coli serotypes and isolates from different origins and also 98% identity with E. coli O157:H7 Iss protein. Phylogenetic analysis showed no significant different phylogenic groups among E. coli strains. The strong association of predicted Iss protein among different E. coli strains suggests that it could be a good antigen to control and detect avian pathogenic E. coli (APEC). Because the exact pathogenesis and the role of virulence factors are unknown, the Iss protein could be used as a target for vaccination in the future, but further research is required.
USDA-ARS?s Scientific Manuscript database
Background: In many bacteria including E. coli, genes encoding O-antigens are clustered in the chromosome, with a 39-bp JUMPstart sequence and gnd gene located upstream and downstream of the cluster, respectively. For determining the DNA sequence of the E. coli O-antigen gene cluster, one set of P...
Cao, Guojie; Allard, Marc; Hoffmann, Maria; Muruvanda, Tim; Luo, Yan; Payne, Justin; Meng, Kevin; Zhao, Shaohua; McDermott, Patrick; Brown, Eric; Meng, Jianghong
2018-06-01
Multidrug-resistant (MDR) plasmids play an important role in disseminating antimicrobial resistance genes. To elucidate the antimicrobial resistance gene compositions in A/C incompatibility complex (IncA/C) plasmids carried by animal-derived MDR Salmonella Newport, and to investigate the spread mechanism of IncA/C plasmids, this study characterizes the complete nucleotide sequences of IncA/C plasmids by comparative analysis. Complete nucleotide sequencing of plasmids and chromosomes of six MDR Salmonella Newport strains was performed using PacBio RSII. Open reading frames were assigned using prokaryotic genome annotation pipeline (PGAP). To understand genomic diversity and evolutionary relationships among Salmonella Newport IncA/C plasmids, we included three complete IncA/C plasmid sequences with similar backbones from Salmonella Newport and Escherichia coli: pSN254, pAM04528, and peH4H, and additional 200 draft chromosomes. With the exception of canine isolate CVM22462, which contained an additional IncI1 plasmid, each of the six MDR Salmonella Newport strains contained only the IncA/C plasmid. These IncA/C plasmids (including references) ranged in size from 80.1 (pCVM21538) to 176.5 kb (pSN254) and carried various resistance genes. Resistance genes floR, tetA, tetR, strA, strB, sul, and mer were identified in all IncA/C plasmids. Additionally, bla CMY-2 and sugE were present in all IncA/C plasmids, excepting pCVM21538. Plasmid pCVM22462 was capable of being transferred by conjugation. The IncI1 plasmid pCVM22462b in CVM22462 carried bla CMY-2 and sugE. Our data showed that MDR Salmonella Newport strains carrying similar IncA/C plasmids clustered together in the phylogenetic tree using chromosome sequences and the IncA/C plasmids from animal-derived Salmonella Newport contained diverse resistance genes. In the current study, we analyzed genomic diversities and phylogenetic relationships among MDR Salmonella Newport using complete plasmids and chromosome sequences and provided possible spread mechanism of IncA/C plasmids in Salmonella Newport Lineage II.
Discovery and biological characterization of geranylated RNA in bacteria.
Dumelin, Christoph E; Chen, Yiyun; Leconte, Aaron M; Chen, Y Grace; Liu, David R
2012-11-01
A general MS-based screen for unusually hydrophobic cellular small molecule-RNA conjugates revealed geranylated RNA in Escherichia coli, Enterobacter aerogenes, Pseudomonas aeruginosa and Salmonella enterica var. Typhimurium. The geranyl group is conjugated to the sulfur atom in two 5-methylaminomethyl-2-thiouridine nucleotides. These geranylated nucleotides occur in the first anticodon position of tRNA(Glu)(UUC), tRNA(Lys)(UUU) and tRNA(Gln)(UUG) at a frequency of up to 6.7% (~400 geranylated nucleotides per cell). RNA geranylation can be increased or abolished by mutation or deletion of the selU (ybbB) gene in E. coli, and purified SelU protein in the presence of geranyl pyrophosphate and tRNA can produce geranylated tRNA. The presence or absence of the geranyl group in tRNA(Glu)(UUC), tRNA(Lys)(UUU) and tRNA(Gln)(UUG) affects codon bias and frameshifting during translation. These RNAs represent the first reported examples of oligoisoprenylated cellular nucleic acids.
Chromosomal 16S Ribosomal RNA Methyltransferase RmtE1 in Escherichia coli Sequence Type 448
Li, Bin; Pacey, Marissa P.
2017-01-01
We identified rmtE1, an uncommon 16S ribosomal methyltransferase gene, in an aminoglycoside- and cephalosporin-resistant Escherichia coli sequence type 448 clinical strain co-harboring blaCMY-2. Long-read sequencing revealed insertion of a 101,257-bp fragment carrying both resistance genes to the chromosome. Our findings underscore E. coli sequence type 448 as a potential high-risk multidrug-resistant clone. PMID:28418308
Sequence of a cDNA encoding pancreatic preprosomatostatin-22.
Magazin, M; Minth, C D; Funckes, C L; Deschenes, R; Tavianini, M A; Dixon, J E
1982-01-01
We report the nucleotide sequence of a precursor to somatostatin that upon proteolytic processing may give rise to a hormone of 22 amino acids. The nucleotide sequence of a cDNA from the channel catfish (Ictalurus punctatus) encodes a precursor to somatostatin that is 105 amino acids (Mr, 11,500). The cDNA coding for somatostatin-22 consists of 36 nucleotides in the 5' untranslated region, 315 nucleotides that code for the precursor to somatostatin-22, 269 nucleotides at the 3' untranslated region, and a variable length of poly(A). The putative preprohormone contains a sequence of hydrophobic amino acids at the amino terminus that has the properties of a "signal" peptide. A connecting sequence of approximately 57 amino acids is followed by a single Arg-Arg sequence, which immediately precedes the hormone. Somatostatin-22 is homologous to somatostatin-14 in 7 of the 14 amino acids, including the Phe-Trp-Lys sequence. Hybridization selection of mRNA, followed by its translation in a wheat germ cell-free system, resulted in the synthesis of a single polypeptide having a molecular weight of approximately 10,000 as estimated on Na-DodSO4/polyacrylamide gels. Images PMID:6127673
NASA Astrophysics Data System (ADS)
Barman, Ranjan Kumar; Mukhopadhyay, Anirban; Das, Santasabuj
2017-04-01
Bacterial small non-coding RNAs (sRNAs) are not translated into proteins, but act as functional RNAs. They are involved in diverse biological processes like virulence, stress response and quorum sensing. Several high-throughput techniques have enabled identification of sRNAs in bacteria, but experimental detection remains a challenge and grossly incomplete for most species. Thus, there is a need to develop computational tools to predict bacterial sRNAs. Here, we propose a computational method to identify sRNAs in bacteria using support vector machine (SVM) classifier. The primary sequence and secondary structure features of experimentally-validated sRNAs of Salmonella Typhimurium LT2 (SLT2) was used to build the optimal SVM model. We found that a tri-nucleotide composition feature of sRNAs achieved an accuracy of 88.35% for SLT2. We validated the SVM model also on the experimentally-detected sRNAs of E. coli and Salmonella Typhi. The proposed model had robustly attained an accuracy of 81.25% and 88.82% for E. coli K-12 and S. Typhi Ty2, respectively. We confirmed that this method significantly improved the identification of sRNAs in bacteria. Furthermore, we used a sliding window-based method and identified sRNAs from complete genomes of SLT2, S. Typhi Ty2 and E. coli K-12 with sensitivities of 89.09%, 83.33% and 67.39%, respectively.
Baumler, David J.; Banta, Lois M.; Hung, Kai F.; Schwarz, Jodi A.; Cabot, Eric L.; Glasner, Jeremy D.; Perna, Nicole T.
2012-01-01
Genomics and bioinformatics are topics of increasing interest in undergraduate biological science curricula. Many existing exercises focus on gene annotation and analysis of a single genome. In this paper, we present two educational modules designed to enable students to learn and apply fundamental concepts in comparative genomics using examples related to bacterial pathogenesis. Students first examine alignments of genomes of Escherichia coli O157:H7 strains isolated from three food-poisoning outbreaks using the multiple-genome alignment tool Mauve. Students investigate conservation of virulence factors using the Mauve viewer and by browsing annotations available at the A Systematic Annotation Package for Community Analysis of Genomes database. In the second module, students use an alignment of five Yersinia pestis genomes to analyze single-nucleotide polymorphisms of three genes to classify strains into biovar groups. Students are then given sequences of bacterial DNA amplified from the teeth of corpses from the first and second pandemics of the bubonic plague and asked to classify these new samples. Learning-assessment results reveal student improvement in self-efficacy and content knowledge, as well as students' ability to use BLAST to identify genomic islands and conduct analyses of virulence factors from E. coli O157:H7 or Y. pestis. Each of these educational modules offers educators new ready-to-implement resources for integrating comparative genomic topics into their curricula. PMID:22383620
USDA-ARS?s Scientific Manuscript database
The objective of this study was to develop a canonical SNP panel for subtyping of Shiga-toxin producing Escherichia coli (STEC). To this purpose, 906 putative SNPs were identified using resequencing tiling arrays. A subset of 391 SNPs was further screened using high-throughput TaqMan PCR against a d...
Plant nitrogen regulatory P-PII genes
Coruzzi, Gloria M.; Lam, Hon-Ming; Hsieh, Ming-Hsiun
2001-01-01
The present invention generally relates to plant nitrogen regulatory PII gene (hereinafter P-PII gene), a gene involved in regulating plant nitrogen metabolism. The invention provides P-PII nucleotide sequences, expression constructs comprising said nucleotide sequences, and host cells and plants having said constructs and, optionally expressing the P-PII gene from said constructs. The invention also provides substantially pure P-PII proteins. The P-PII nucleotide sequences and constructs of the
Tan, Lianjiang; Liu, Yazhi; Li, Xiaowei; Wu, Xin-Yan; Gong, Bing; Shen, Yu-Mei; Shao, Zhifeng
2016-02-11
An acid-cleavable linker based on a dimethylketal moiety was synthesized and used to connect a nucleotide with a fluorophore to produce a 3'-OH unblocked nucleotide analogue as an excellent reversible terminator for DNA sequencing by synthesis.
Fuller, Carl W.; Kumar, Shiv; Porel, Mintu; Chien, Minchen; Bibillo, Arek; Stranges, P. Benjamin; Dorwart, Michael; Tao, Chuanjuan; Li, Zengmin; Guo, Wenjing; Shi, Shundi; Korenblum, Daniel; Trans, Andrew; Aguirre, Anne; Liu, Edward; Harada, Eric T.; Pollard, James; Bhat, Ashwini; Cech, Cynthia; Yang, Alexander; Arnold, Cleoma; Palla, Mirkó; Hovis, Jennifer; Chen, Roger; Morozova, Irina; Kalachikov, Sergey; Russo, James J.; Kasianowicz, John J.; Davis, Randy; Roever, Stefan; Church, George M.; Ju, Jingyue
2016-01-01
DNA sequencing by synthesis (SBS) offers a robust platform to decipher nucleic acid sequences. Recently, we reported a single-molecule nanopore-based SBS strategy that accurately distinguishes four bases by electronically detecting and differentiating four different polymer tags attached to the 5′-phosphate of the nucleotides during their incorporation into a growing DNA strand catalyzed by DNA polymerase. Further developing this approach, we report here the use of nucleotides tagged at the terminal phosphate with oligonucleotide-based polymers to perform nanopore SBS on an α-hemolysin nanopore array platform. We designed and synthesized several polymer-tagged nucleotides using tags that produce different electrical current blockade levels and verified they are active substrates for DNA polymerase. A highly processive DNA polymerase was conjugated to the nanopore, and the conjugates were complexed with primer/template DNA and inserted into lipid bilayers over individually addressable electrodes of the nanopore chip. When an incoming complementary-tagged nucleotide forms a tight ternary complex with the primer/template and polymerase, the tag enters the pore, and the current blockade level is measured. The levels displayed by the four nucleotides tagged with four different polymers captured in the nanopore in such ternary complexes were clearly distinguishable and sequence-specific, enabling continuous sequence determination during the polymerase reaction. Thus, real-time single-molecule electronic DNA sequencing data with single-base resolution were obtained. The use of these polymer-tagged nucleotides, combined with polymerase tethering to nanopores and multiplexed nanopore sensors, should lead to new high-throughput sequencing methods. PMID:27091962
Mu-Like Prophage in Serogroup B Neisseria meningitidis Coding for Surface-Exposed Antigens
Masignani, Vega; Giuliani, Marzia Monica; Tettelin, Hervé; Comanducci, Maurizio; Rappuoli, Rino; Scarlato, Vincenzo
2001-01-01
Sequence analysis of the genome of Neisseria meningititdis serogroup B revealed the presence of an ∼35-kb region inserted within a putative gene coding for an ABC-type transporter. The region contains 46 open reading frames, 29 of which are colinear and homologous to the genes of Escherichia coli Mu phage. Two prophages with similar organizations were also found in serogroup A meningococcus, and one was found in Haemophilus influenzae. Early and late phage functions are well preserved in this family of Mu-like prophages. Several regions of atypical nucleotide content were identified. These likely represent genes acquired by horizontal transfer. Three of the acquired genes are shown to code for surface-associated antigens, and the encoded proteins are able to induce bactericidal antibodies. PMID:11254622
USDA-ARS?s Scientific Manuscript database
: Hemoglobin-y gene of channel catfish , lctalurus punctatus, was cloned and sequenced . Total RNA from head kidneys was isolated, reverse transcribed and amplified . The sequence of the channel catfish hemoglobin-y gene consists of 600 nucleotides . Analysis of the nucleotide sequence reveals one o...
Novel methodologies for spectral classification of exon and intron sequences
NASA Astrophysics Data System (ADS)
Kwan, Hon Keung; Kwan, Benjamin Y. M.; Kwan, Jennifer Y. Y.
2012-12-01
Digital processing of a nucleotide sequence requires it to be mapped to a numerical sequence in which the choice of nucleotide to numeric mapping affects how well its biological properties can be preserved and reflected from nucleotide domain to numerical domain. Digital spectral analysis of nucleotide sequences unfolds a period-3 power spectral value which is more prominent in an exon sequence as compared to that of an intron sequence. The success of a period-3 based exon and intron classification depends on the choice of a threshold value. The main purposes of this article are to introduce novel codes for 1-sequence numerical representations for spectral analysis and compare them to existing codes to determine appropriate representation, and to introduce novel thresholding methods for more accurate period-3 based exon and intron classification of an unknown sequence. The main findings of this study are summarized as follows: Among sixteen 1-sequence numerical representations, the K-Quaternary Code I offers an attractive performance. A windowed 1-sequence numerical representation (with window length of 9, 15, and 24 bases) offers a possible speed gain over non-windowed 4-sequence Voss representation which increases as sequence length increases. A winner threshold value (chosen from the best among two defined threshold values and one other threshold value) offers a top precision for classifying an unknown sequence of specified fixed lengths. An interpolated winner threshold value applicable to an unknown and arbitrary length sequence can be estimated from the winner threshold values of fixed length sequences with a comparable performance. In general, precision increases as sequence length increases. The study contributes an effective spectral analysis of nucleotide sequences to better reveal embedded properties, and has potential applications in improved genome annotation.
USDA-ARS?s Scientific Manuscript database
The complete nucleotide sequence of a recently discovered Florida (FL) isolate of Hibiscus infecting Cilevirus (HiCV) was determined by Sanger sequencing. The movement- and coat- protein gene sequences of the HiCV-FL isolate are more divergent than other genes of the previously sequenced HiCV-HA (Ha...
A homolog of an Escherichia coli phosphate-binding protein gene from Xanthomonas oryzae pv. oryzae
NASA Technical Reports Server (NTRS)
Hopkins, C. M.; White, F. F.; Heaton, L. A.; Guikema, J. A.; Leach, J. E.; Spooner, B. S. (Principal Investigator)
1995-01-01
A Xanthomonas oryzae pv. oryzae gene with sequence similarity to an Escherichia coli phosphate-binding protein gene (phoS) produces a periplasmic protein of apparent M(r) 35,000 when expressed in E. coli. Amino terminal sequencing revealed that a signal peptide is removed during transport to the periplasm in E. coli.
Statistical analysis of nucleotide sequences of the hemagglutinin gene of human influenza A viruses.
Ina, Y; Gojobori, T
1994-01-01
To examine whether positive selection operates on the hemagglutinin 1 (HA1) gene of human influenza A viruses (H1 subtype), 21 nucleotide sequences of the HA1 gene were statistically analyzed. The nucleotide sequences were divided into antigenic and nonantigenic sites. The nucleotide diversities for antigenic and nonantigenic sites of the HA1 gene were computed at synonymous and nonsynonymous sites separately. For nonantigenic sites, the nucleotide diversities were larger at synonymous sites than at nonsynonymous sites. This is consistent with the neutral theory of molecular evolution. For antigenic sites, however, the nucleotide diversities at nonsynonymous sites were larger than those at synonymous sites. These results suggest that positive selection operates on antigenic sites of the HA1 gene of human influenza A viruses (H1 subtype). PMID:8078892
Code of Federal Regulations, 2010 CFR
2010-07-01
..., flowers, and pollen. Noncoding, nonexpressed nucleotide sequences means the nucleotide sequences are not... surgical alteration of the plant pistil, bud pollination, mentor pollen, immunosuppressants, in vitro...
Code of Federal Regulations, 2012 CFR
2012-07-01
..., flowers, and pollen. Noncoding, nonexpressed nucleotide sequences means the nucleotide sequences are not... surgical alteration of the plant pistil, bud pollination, mentor pollen, immunosuppressants, in vitro...
Code of Federal Regulations, 2013 CFR
2013-07-01
..., flowers, and pollen. Noncoding, nonexpressed nucleotide sequences means the nucleotide sequences are not... surgical alteration of the plant pistil, bud pollination, mentor pollen, immunosuppressants, in vitro...
Code of Federal Regulations, 2011 CFR
2011-07-01
..., flowers, and pollen. Noncoding, nonexpressed nucleotide sequences means the nucleotide sequences are not... surgical alteration of the plant pistil, bud pollination, mentor pollen, immunosuppressants, in vitro...
Code of Federal Regulations, 2014 CFR
2014-07-01
..., flowers, and pollen. Noncoding, nonexpressed nucleotide sequences means the nucleotide sequences are not... surgical alteration of the plant pistil, bud pollination, mentor pollen, immunosuppressants, in vitro...
Hypochlorous acid-promoted loss of metabolic energy in Escherichia coli.
Barrette, W C; Albrich, J M; Hurst, J K
1987-01-01
Oxidation of Escherichia coli by hypochlorous acid (HOCl) or chloramine (NH2Cl) gives rise to massive hydrolysis of cytosolic nucleotide phosphoanhydride bonds, although no immediate change occurs in either the nucleotide pool size or the concentrations of extracellular end products of AMP catabolism. Titrimetric curves of the extent of hydrolysis coincide with curves for loss of cell viability, e.g., reduction in the adenylate energy charge from 0.8 to 0.1-0.2 accompanies loss of 99% of the bacterial CFU. The oxidative damage caused by HOCl is irreversible within 100 ms of exposure of the organism, although nucleotide phosphate bond hydrolysis requires several minutes to reach completion. Neither HOCl nor NH2Cl reacts directly with nucleotides to hydrolyze phosphoanhydride bonds. Loss of viability is also accompanied by inhibition of induction of beta-galactosidase. The proton motive force, determined from the distribution of 14C-radiolabeled lipophilic ions, declines with incremental addition of HOCl after loss of respiratory function; severalfold more oxidant is required for the dissipation of the proton motive force than for loss of viability. These observations establish a causal link between loss of metabolic energy and cellular death and indicate that the mechanisms of oxidant-induced nucleotide phosphate bond hydrolysis are indirect and that they probably involve damage to the energy-transducing and transport proteins located in the bacterial plasma membrane. PMID:2820883
Genome sequences of a mouse-avirulent and a mouse-virulent strain of Ross River virus.
Faragher, S G; Meek, A D; Rice, C M; Dalgarno, L
1988-04-01
The nucleotide sequence of the genomic RNA of a mouse-avirulent strain of Ross River virus, RRV NB5092 (isolated in 1969), has been determined and the corresponding sequence for the prototype mouse-virulent strain, RRV T48 (isolated in 1959), has been completed. The RRV NB5092 genome is approximately 11,674 nucleotides in length, compared with 11,853 nucleotides for RRV T48. RRV NB5092 and RRV T48 have the same genome organization. For both viruses an untranslated region of 80 nucleotides at the 5' end of the genome is followed by a 7440-nucleotide open reading frame which is interrupted after 5586 nucleotides by a single opal termination codon. By homology with other alphaviruses, the 5586-nucleotide open reading frame encodes the nonstructural proteins nsP1, nsP2, and nsP3; a fourth nonstructural protein, nsP4, is produced by read-through of the opal codon. The RRV nonstructural proteins show strong homology with the corresponding proteins of Sindbis virus and Semliki Forest virus in terms of size, net charge, and hydropathy characteristics. However, homology is not uniform between or within the proteins; nsP1, nsP2, and nsP4 contain extended domains which are highly conserved between alphaviruses, while the C-terminal region of nsP3 shows little conservation in sequence or length between alphaviruses. An untranslated "junction" region of 44 nucleotides (for RRV NB5092) or 47 nucleotides (for RRV T48) separates the nonstructural and structural protein coding regions. The structural proteins (capsid-E3-E2-6K-E1) are translated from an open reading frame of 3762 nucleotides which is followed by a 3'-untranslated region of approximately 348 nucleotides (for RRV NB5092) or 524 nucleotides (for RRV T48). Excluding deletions and insertions, the genomes of RRV NB5092 and RRV T48 differ at 284 nucleotides, representing a sequence divergence of 2.38%. Sequence deletions or insertions were found only in the noncoding regions and include a 173-nucleotide deletion in the 3'-untranslated region of RRV NB5092, compared with RRV T48. In the coding regions, most of the nucleotide differences are silent; there are 36 amino acid differences in the nonstructural proteins and 12 in the structural proteins. The distribution of amino acid differences between the two RRV strains correlates with the location of domains which are poorly conserved in sequence between alphaviruses. The possible role of amino acid differences in envelope glycoproteins E1 and E2 in determining the different antigenic and biological properties of RRV NB5092 and RRV T48 is discussed.
Hao, Yan-Zhe; Hou, Wan-Ru; Hou, Yi-Ling; Du, Yu-Jie; Zhang, Tian; Peng, Zheng-Song
2009-11-01
RPS25 is a component of the 40S small ribosomal subunit encoded by RPS25 gene, which is specific to eukaryotes. Studies in reference to RPS25 gene from animals were handful. The Giant Panda (Ailuropoda melanoleuca), known as a "living fossil", are increasingly concerned by the world community. Studies on RPS25 of the Giant Panda could provide scientific data for inquiring into the hereditary traits of the gene and formulating the protective strategy for the Giant Panda. The cDNA of the RPS25 cloned from Giant Panda is 436 bp in size, containing an open reading frame of 378 bp encoding 125 amino acids. The length of the genomic sequence is 1,992 bp, which was found to possess four exons and three introns. Alignment analysis indicated that the nucleotide sequence of the coding sequence shows a high homology to those of Homo sapiens, Bos taurus, Mus musculus and Rattus norvegicus as determined by Blast analysis, 92.6, 94.4, 89.2 and 91.5%, respectively. Primary structure analysis revealed that the molecular weight of the putative RPS25 protein is 13.7421 kDa with a theoretical pI 10.12. Topology prediction showed there is one N-glycosylation site, one cAMP and cGMP-dependent protein kinase phosphorylation site, two Protein kinase C phosphorylation sites and one Tyrosine kinase phosphorylation site in the RPS25 protein of the Giant Panda. The RPS25 gene was overexpressed in E. coli BL21 and Western Blotting of the RPS25 protein was also done. The results indicated that the RPS25 gene can be really expressed in E. coli and the RPS25 protein fusioned with the N-terminally his-tagged form gave rise to the accumulation of an expected 17.4 kDa polypeptide. The cDNA and the genomic sequence of RPS25 were cloned successfully for the first time from the Giant Panda using RT-PCR technology and Touchdown-PCR, respectively, which were both sequenced and analyzed preliminarily; then the cDNA of the RPS25 gene was overexpressed in E. coli BL21 and immunoblotted, which is the first report on the RPS25 gene from the Giant Panda. The data will enrich and supplement the information about RPS25, which will contribute to the protection for gene resources and the discussion of the genetic polymorphism.
Kumazaki, T; Hori, H; Osawa, S; Ishii, N; Suzuki, K
1982-11-11
The nucleotide sequences of 5S rRNAs from a rotifer, Brachionus plicatilis, and two nematodes, Rhabditis tokai and Caenorhabditis elegans have been determined. The rotifer has two 5S rRNA species that are composed of 120 and 121 nucleotides, respectively. The sequences of these two 5S rRNAs are the same except that the latter has an additional base at its 3'-terminus. The 5S rRNAs from the two nematode species are both 119 nucleotides long. The sequence similarity percents are 79% (Brachionus/Rhabditis), 80% (Brachionus/Caenorhabditis), and 95% (Rhabditis/Caenorhabditis) among these three species. Brachionus revealed the highest similarity to Lingula (89%), but not to the nematodes (79%).
Olson, Nathan D.; Lund, Steven P.; Zook, Justin M.; Rojas-Cornejo, Fabiola; Beck, Brian; Foy, Carole; Huggett, Jim; Whale, Alexandra S.; Sui, Zhiwei; Baoutina, Anna; Dobeson, Michael; Partis, Lina; Morrow, Jayne B.
2015-01-01
This study presents the results from an interlaboratory sequencing study for which we developed a novel high-resolution method for comparing data from different sequencing platforms for a multi-copy, paralogous gene. The combination of PCR amplification and 16S ribosomal RNA gene (16S rRNA) sequencing has revolutionized bacteriology by enabling rapid identification, frequently without the need for culture. To assess variability between laboratories in sequencing 16S rRNA, six laboratories sequenced the gene encoding the 16S rRNA from Escherichia coli O157:H7 strain EDL933 and Listeria monocytogenes serovar 4b strain NCTC11994. Participants performed sequencing methods and protocols available in their laboratories: Sanger sequencing, Roche 454 pyrosequencing®, or Ion Torrent PGM®. The sequencing data were evaluated on three levels: (1) identity of biologically conserved position, (2) ratio of 16S rRNA gene copies featuring identified variants, and (3) the collection of variant combinations in a set of 16S rRNA gene copies. The same set of biologically conserved positions was identified for each sequencing method. Analytical methods using Bayesian and maximum likelihood statistics were developed to estimate variant copy ratios, which describe the ratio of nucleotides at each identified biologically variable position, as well as the likely set of variant combinations present in 16S rRNA gene copies. Our results indicate that estimated variant copy ratios at biologically variable positions were only reproducible for high throughput sequencing methods. Furthermore, the likely variant combination set was only reproducible with increased sequencing depth and longer read lengths. We also demonstrate novel methods for evaluating variable positions when comparing multi-copy gene sequence data from multiple laboratories generated using multiple sequencing technologies. PMID:27077030
Limitations and potentials of current motif discovery algorithms
Hu, Jianjun; Li, Bin; Kihara, Daisuke
2005-01-01
Computational methods for de novo identification of gene regulation elements, such as transcription factor binding sites, have proved to be useful for deciphering genetic regulatory networks. However, despite the availability of a large number of algorithms, their strengths and weaknesses are not sufficiently understood. Here, we designed a comprehensive set of performance measures and benchmarked five modern sequence-based motif discovery algorithms using large datasets generated from Escherichia coli RegulonDB. Factors that affect the prediction accuracy, scalability and reliability are characterized. It is revealed that the nucleotide and the binding site level accuracy are very low, while the motif level accuracy is relatively high, which indicates that the algorithms can usually capture at least one correct motif in an input sequence. To exploit diverse predictions from multiple runs of one or more algorithms, a consensus ensemble algorithm has been developed, which achieved 6–45% improvement over the base algorithms by increasing both the sensitivity and specificity. Our study illustrates limitations and potentials of existing sequence-based motif discovery algorithms. Taking advantage of the revealed potentials, several promising directions for further improvements are discussed. Since the sequence-based algorithms are the baseline of most of the modern motif discovery algorithms, this paper suggests substantial improvements would be possible for them. PMID:16284194
The EMBL nucleotide sequence database
Stoesser, Guenter; Baker, Wendy; van den Broek, Alexandra; Camon, Evelyn; Garcia-Pastor, Maria; Kanz, Carola; Kulikova, Tamara; Lombard, Vincent; Lopez, Rodrigo; Parkinson, Helen; Redaschi, Nicole; Sterk, Peter; Stoehr, Peter; Tuli, Mary Ann
2001-01-01
The EMBL Nucleotide Sequence Database (http://www.ebi.ac.uk/embl/) is maintained at the European Bioinformatics Institute (EBI) in an international collaboration with the DNA Data Bank of Japan (DDBJ) and GenBank at the NCBI (USA). Data is exchanged amongst the collaborating databases on a daily basis. The major contributors to the EMBL database are individual authors and genome project groups. Webin is the preferred web-based submission system for individual submitters, whilst automatic procedures allow incorporation of sequence data from large-scale genome sequencing centres and from the European Patent Office (EPO). Database releases are produced quarterly. Network services allow free access to the most up-to-date data collection via ftp, email and World Wide Web interfaces. EBI’s Sequence Retrieval System (SRS), a network browser for databanks in molecular biology, integrates and links the main nucleotide and protein databases plus many specialized databases. For sequence similarity searching a variety of tools (e.g. Blitz, Fasta, BLAST) are available which allow external users to compare their own sequences against the latest data in the EMBL Nucleotide Sequence Database and SWISS-PROT. PMID:11125039
Shah, M S; Ashraf, A; Khan, M I; Rahman, M; Habib, M; Qureshi, J A
2016-01-01
Fowl adenovirus-4 is an infectious agent causing Hydropericardium syndrome in chickens. Adenovirus are non-enveloped virions having linear, double stranded DNA. Viral genome codes for few structural and non structural proteins. 100K is an important non-structural viral protein. Open reading frame for coding sequence of 100K protein was cloned with oligo histidine tag and expressed in Escherichia coli as a fusion protein. Nucleotide sequence of the gene revealed that 100K gene of FAdV-4 has high homology (98%) with the respective gene of FAdV-10. Recombinant 100K protein was expressed in E. coli and purified by nickel affinity chromatography. Immunization of chickens with recombinant 100K protein elicited significant serum antibody titers. However challenge protection test revealed that 100K protein conferred little protection (40%) to the immunized chicken against pathogenic viral challenge. So it was concluded that 100K gene has 2397 bp length and recombinant 100K protein has molecular weight of 95 kDa. It was also found that the recombinant protein has little capacity to affect the immune response because in-spite of having an important role in intracellular transport & folding of viral capsid proteins during viral replication, it is not exposed on the surface of the virus at any stage. Copyright © 2015 The International Alliance for Biological Standardization. All rights reserved.
Kijima, Kumiko; Mita, Hajime; Kawakami, Mitsuyasu; Amada, Kei
2018-02-02
In the present study, we confirm that 2,4-dichlorophenoxyacetic acid (2,4-D) oxygenase from Sphingomonas agrestis 58-1 belongs to the family of Rieske non-heme iron aromatic ring-hydroxylating oxygenases, which comprise a core enzyme (oxygenase), ferredoxin, and oxidoreductase. It has previously been shown that cadAB genes are necessary for the conversion of 2,4-D to 2,4-dichlorophenol; however, the respective roles of ferredoxin and oxidoreductase in the 2,4-D oxygenase system from S. agrestis 58-1 remain unknown. Using nucleotide sequence analysis of the plasmid pCADAB1 from Sphingomonas sp. ERG5, which degrades 4-chloro-2-methylphenoxyacetic acid and 2,4-D, Nielsen et al. identified orf95, upstream of cadA, and orf98, downstream of cadB, which were predicted and designated as cadD (oxidoreductase) and cadC (ferredoxin), respectively (Nielsen et al., PLoS One, 8, 1-9, 2013). These designations were the result of sequence analysis; therefore, we constructed an expression system of CadABC and CadABCD in Escherichia coli and assayed their enzyme activities. Our findings indicate that CadC is essential for the activity of 2,4-D oxygenase and CadD promotes CadABC activity in recombinant E. coli cells. Copyright © 2018 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.
Complete genome sequence of uropathogenic Escherichia coli isolate UPEC 26-1.
Subhadra, Bindu; Kim, Dong Ho; Kim, Jaeseok; Woo, Kyungho; Sohn, Kyung Mok; Kim, Hwa-Jung; Han, Kyudong; Oh, Man Hwan; Choi, Chul Hee
2018-06-01
Urinary tract infections (UTIs) are among the most common infections in humans, predominantly caused by uropathogenic Escherichia coli (UPEC). The diverse genomes of UPEC strains mostly impede disease prevention and control measures. In this study, we comparatively analyzed the whole genome sequence of a highly virulent UPEC strain, namely UPEC 26-1, which was isolated from urine sample of a patient suffering from UTI in Korea. Whole genome analysis showed that the genome consists of one circular chromosome of 5,329,753 bp, comprising 5064 protein-coding genes, 122 RNA genes (94 tRNA, 22 rRNA and 6 ncRNA genes), and 100 pseudogenes, with an average G+C content of 50.56%. In addition, we identified 8 prophage regions comprising 5 intact, 2 incomplete and 1 questionable ones and 63 genomic islands, suggesting the possibility of horizontal gene transfer in this strain. Comparative genome analysis of UPEC 26-1 with the UPEC strain CFT073 revealed an average nucleotide identity of 99.7%. The genome comparison with CFT073 provides major differences in the genome of UPEC 26-1 that would explain its increased virulence and biofilm formation. Nineteen of the total GIs were unique to UPEC 26-1 compared to CFT073 and nine of them harbored unique genes that are involved in virulence, multidrug resistance, biofilm formation and bacterial pathogenesis. The data from this study will assist in future studies of UPEC strains to develop effective control measures.
CCC CGA is a weak translational recoding site in Escherichia coli.
Shu, Ping; Dai, Huacheng; Mandecki, Wlodek; Goldman, Emanuel
2004-12-08
Previously published experiments had indicated unexpected expression of a control vector in which a beta-galactosidase reporter was in the +1 reading frame relative to the translation start. This control vector contained the codon pair CCC CGA in the zero reading frame, raising the possibility that ribosomes rephased on this sequence, with peptidyl-tRNA(Pro) pairing with CCC in the +1 frame. This putative rephasing might also be exacerbated by the rare CGA Arg codon in the second position due to increased vacancy of the ribosomal A-site. To test this hypothesis, a series of site-directed mutants was constructed, including mutations in both the first and second codons of this codon pair. The results show that interrupting the continuous run of C residues with synonymous codon changes essentially abolishes the frameshift. Further, changing the rare Arg codon to a common Arg codon also reduces the frequency of the frameshift. These results provide strong support for the hypothesis that CCC CGA in the zero frame is indeed a weak translational frameshift site in Escherichia coli, with a 1-2% efficiency. Because the vector sequence also contains another CCC triplet in the +1 reading frame starting within the next codon after the CGA, our data also support possible contribution to expression of a +7 nucleotide ribosome hop into the same +1 reading frame. We also confirm here a previous report that CCC UGA is a translational frameshift site, in these experiments, with about 5% efficiency.
Interactive computer programs for the graphic analysis of nucleotide sequence data.
Luckow, V A; Littlewood, R K; Rownd, R H
1984-01-01
A group of interactive computer programs have been developed which aid in the collection and graphical analysis of nucleotide and protein sequence data. The programs perform the following basic functions: a) enter, edit, list, and rearrange sequence data; b) permit automatic entry of nucleotide sequence data directly from an autoradiograph into the computer; c) search for restriction sites or other specified patterns and plot a linear or circular restriction map, or print their locations; d) plot base composition; e) analyze homology between sequences by plotting a two-dimensional graphic matrix; and f) aid in plotting predicted secondary structures of RNA molecules. PMID:6546437
Traverse, Charles C.
2017-01-01
ABSTRACT Advances in sequencing technologies have enabled direct quantification of genome-wide errors that occur during RNA transcription. These errors occur at rates that are orders of magnitude higher than rates during DNA replication, but due to technical difficulties such measurements have been limited to single-base substitutions and have not yet quantified the scope of transcription insertions and deletions. Previous reporter gene assay findings suggested that transcription indels are produced exclusively by elongation complex slippage at homopolymeric runs, so we enumerated indels across the protein-coding transcriptomes of Escherichia coli and Buchnera aphidicola, which differ widely in their genomic base compositions and incidence of repeat regions. As anticipated from prior assays, transcription insertions prevailed in homopolymeric runs of A and T; however, transcription deletions arose in much more complex sequences and were rarely associated with homopolymeric runs. By reconstructing the relocated positions of the elongation complex as inferred from the sequences inserted or deleted during transcription, we show that continuation of transcription after slippage hinges on the degree of nucleotide complementarity within the RNA:DNA hybrid at the new DNA template location. PMID:28851848
Khan, A S
1984-01-01
The sequence of 363 nucleotides near the 3' end of the pol gene and 564 nucleotides from the 5' terminus of the env gene in an endogenous murine leukemia viral (MuLV) DNA segment, cloned from AKR/J mouse DNA and designated as A-12, was obtained. For comparison, the nucleotide sequence in an analogous portion of AKR mink cell focus-forming (MCF) 247 MuLV provirus was also determined. Sequence features unique to MCF247 MuLV DNA in the 3' pol and 5' env regions were identified by comparison with nucleotide sequences in analogous regions of NFS -Th-1 xenotropic and AKR ecotropic MuLV proviruses. These included (i) an insertion of 12 base pairs encoding four amino acids located 60 base pairs from the 3' terminus of the pol gene and immediately preceding the env gene, (ii) the deletion of 12 base pairs (encoding four amino acids) and the insertion of 3 base pairs (encoding one amino acid) in the 5' portion of the env gene, and (iii) single base substitutions resulting in 2 MCF247 -specific amino acids in the 3' pol and 23 in the 5' env regions. Nucleotide sequence comparison involving the 3' pol and 5' env regions of AKR MCF247 , NFS xenotropic, and AKR ecotropic MuLV proviruses with the cloned endogenous MuLV DNA indicated that MCF247 proviral DNA sequences were conserved in the cloned endogenous MuLV proviral segment. In fact, total nucleotide sequence identity existed between the endogenous MuLV DNA and the MCF247 MuLV provirus in the 3' portion of the pol gene. In the 5' env region, only 4 of 564 nucleotides were different, resulting in three amino acid changes between AKR MCF247 MuLV DNA and the endogenous MuLV DNA present in clone A-12. In addition, nucleotide sequence comparison indicated that Moloney-and Friend-MCF MuLVs were also highly related in the 3' pol and 5' env regions to the cloned endogenous MuLV DNA. These results establish the role of endogenous MuLV DNA segments in generation of recombinant MCF viruses. PMID:6328017
Saeed, A M; Magnuson, N S; Sriranganathan, N; Burger, D; Cosand, W
1984-01-01
Heat-stable enterotoxins (STs) from four strains of bovine enterotoxigenic Escherichia coli representing four serogroups were purified to homogeneity by utilizing previously published purification schemata. Biochemical characterization of the purified STs showed that they met the basic criteria for the heat-stable enterotoxins of E. coli. Amino acid analysis of the purified STs revealed that they were peptides of identical amino acid composition. This composition consisted of 18 residues of 10 different amino acids, 6 of which were cysteine. The amino acid composition of the four ST peptides was identical to that reported for the STs of human and porcine E. coli. In addition, complete sequence analysis of two of the ST peptides and partial sequencing of several others revealed strong homology to the sequences of STs from human and porcine E. coli and to the sequence predicted from the last 18 codons of the transposon Tn1681. There was also substantial homology to the sequence predicted from the ST-coding genetic element of human E. coli, which may indicate the existence of identical bioactive configuration among ST peptides of E. coli strains of various host origins. These data support the hypothesis that STs produced by human, bovine, and porcine E. coli are coded by a closely related genetic element which may have originated from a single, widely disseminated transposon. Images PMID:6376355
Fonseca, A S; Campos, V M A; Magalhães, L A G; Paoli, F
2015-10-01
Low-intensity lasers are used for prevention and management of oral mucositis induced by anticancer therapy, but the effectiveness of treatment depends on the genetic characteristics of affected cells. This study evaluated the survival and induction of filamentation of Escherichia coli cells deficient in the nucleotide excision repair pathway, and the action of T4endonuclease V on plasmid DNA exposed to low-intensity red and near-infrared laser light. Cultures of wild-type (strain AB1157) E. coli and strain AB1886 (deficient in uvrA protein) were exposed to red (660 nm) and infrared (808 nm) lasers at various fluences, powers and emission modes to study bacterial survival and filamentation. Also, plasmid DNA was exposed to laser light to study DNA lesions produced in vitro by T4endonuclease V. Low-intensity lasers:i) had no effect on survival of wild-type E. coli but decreased the survival of uvrA protein-deficient cells,ii) induced bacterial filamentation, iii) did not alter the electrophoretic profile of plasmids in agarose gels, andiv) did not alter the electrophoretic profile of plasmids incubated with T4 endonuclease V. These results increase our understanding of the effects of laser light on cells with various genetic characteristics, such as xeroderma pigmentosum cells deficient in nucleotide excision pathway activity in patients with mucositis treated by low-intensity lasers.
Fonseca, A.S.; Campos, V.M.A.; Magalhães, L.A.G.; Paoli, F.
2015-01-01
Low-intensity lasers are used for prevention and management of oral mucositis induced by anticancer therapy, but the effectiveness of treatment depends on the genetic characteristics of affected cells. This study evaluated the survival and induction of filamentation of Escherichia coli cells deficient in the nucleotide excision repair pathway, and the action of T4endonuclease V on plasmid DNA exposed to low-intensity red and near-infrared laser light. Cultures of wild-type (strain AB1157) E. coli and strain AB1886 (deficient in uvrA protein) were exposed to red (660 nm) and infrared (808 nm) lasers at various fluences, powers and emission modes to study bacterial survival and filamentation. Also, plasmid DNA was exposed to laser light to study DNA lesions produced in vitro by T4endonuclease V. Low-intensity lasers:i) had no effect on survival of wild-type E. coli but decreased the survival of uvrA protein-deficient cells,ii) induced bacterial filamentation, iii) did not alter the electrophoretic profile of plasmids in agarose gels, andiv) did not alter the electrophoretic profile of plasmids incubated with T4 endonuclease V. These results increase our understanding of the effects of laser light on cells with various genetic characteristics, such as xeroderma pigmentosum cells deficient in nucleotide excision pathway activity in patients with mucositis treated by low-intensity lasers. PMID:26445337
USDA-ARS?s Scientific Manuscript database
A new species of the family Alphaflexiviridae provisionally named Alfalfa virus S (AVS) was diagnosed in alfalfa samples originating from Sudan. A complete nucleotide sequence of the viral genome consisting of 8,349 nucleotides excluding the 3’ poly(A) tail was determined by Illumina NGS technology ...
The primary structure of the thymidine kinase gene of fish lymphocystis disease virus.
Schnitzler, P; Handermann, M; Szépe, O; Darai, G
1991-06-01
The DNA nucleotide sequence of the thymidine kinase (TK) gene of fish lymphocystis disease virus (FLDV) which has been localized between the coordinates 0.678 to 0.688 of the viral genome was determined. The analysis of the DNA nucleotide sequence located between the recognition sites of HindIII (0.669 map unit; nucleotide position 1) and AccI (nucleotide position 2032) revealed the presence of an open reading frame of 954 bp on the lower strand of this region between nucleotide positions 1868 (ATG) and 915 (TAA). It encodes for a protein of 318 amino acid residues. The evolutionary relationships of the TK gene of FLDV to the other known TK genes was investigated using the method of progressive sequence alignment. These analyses revealed a high degree of diversity between the protein sequence of FLDV TK gene and the amino acid composition of other TKs tested. However, significant conservations were detected at several regions of amino acid residues of the FLDV TK protein when compared to the amino acid sequence of TKs of African swine fever virus, fowlpox virus, shope fibroma virus, and vaccinia virus and to the amino acid sequences of the cellular cytoplasmic TK of chicken, mouse, and man.
Structure of apo-CAP reveals that large conformational changes are necessary for DNA binding
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sharma, Hitesh; Yu, Shaoning; Kong, Jilie
2009-10-21
The binding of cAMP to the Escherichia coli catabolite gene activator protein (CAP) produces a conformational change that enables it to bind specific DNA sequences and regulate transcription, which it cannot do in the absence of the nucleotide. The crystal structures of the unliganded CAP containing a D138L mutation and the unliganded WT CAP were determined at 2.3 and 3.6 {angstrom} resolution, respectively, and reveal that the two DNA binding domains have dimerized into one rigid body and their two DNA recognition helices become buried. The WT structure shows multiple orientations of this rigid body relative to the nucleotide bindingmore » domain supporting earlier biochemical data suggesting that the inactive form exists in an equilibrium among different conformations. Comparison of the structures of the liganded and unliganded CAP suggests that cAMP stabilizes the active DNA binding conformation of CAP through the interactions that the N{sup 6} of the adenosine makes with the C-helices. These interactions are associated with the reorientation and elongation of the C-helices that precludes the formation of the inactive structure.« less
Chapell, J D; Goral, M I; Rodgers, S E; dePamphilis, C W; Dermody, T S
1994-01-01
To better understand genetic diversity within mammalian reoviruses, we determined S2 nucleotide and deduced sigma 2 amino acid sequences of nine reovirus strains and compared these sequences with those of prototype strains of the three reovirus serotypes. The S2 gene and sigma 2 protein are highly conserved among the four type 1, one type 2, and seven type 3 strains studied. Phylogenetic analyses based on S2 nucleotide sequences of the 12 reovirus strains indicate that diversity within the S2 gene is independent of viral serotype. Additionally, we found marked topological differences between phylogenetic trees generated from S1 and S2 gene nucleotide sequences of the seven type 3 strains. These results demonstrate that reovirus S1 and S2 genes have distinct evolutionary histories, thus providing phylogenetic evidence for lateral transfer of reovirus genes in nature. When variability among the 12 sigma 2-encoding S2 nucleotide sequences was analyzed at synonymous positions, we found that approximately 60 nucleotides at the 5' terminus and 30 nucleotides at the 3' terminus were markedly conserved in comparison with other sigma 2-encoding regions of S2. Predictions of RNA secondary structures indicate that the more conserved S2 sequences participate in the formation of an extended region of duplex RNA interrupted by a pair of stem-loops. Among the 12 deduced sigma 2 amino acid sequences examined, substitutions were observed at only 11% of amino acid positions. This finding suggests that constraints on the structure or function of sigma 2, perhaps in part because of its location in the virion core, have limited sequence diversity within this protein. PMID:8289378
Barkan, A; Mertz, J E
1981-02-01
The nucleotide sequences of 10 viable yet partially defective deletion mutants of simian virus 40 were determined. The deletions mapped within, and, in many cases, 5' to, the predominant leader sequence of the late viral mRNA's. They ranged from 74 to 187 nucleotide pairs in length. Six of the mutants had lost the sequence that corresponds to the "cap" site (5' terminus) of the most abundant class of 16S mRNA's. One of these mutants had a deletion that extended 103 nucleotide pairs into the region preceding this primary cap site and, therefore, was missing many secondary cap sites as well. A seventh mutant lacked the entire major 16S leader sequence except for the first six nucleotides at its 5' end and the last nine at its 3' end. Although these mutants differed in the size and position of their deletions, we were unable to discover any simple correlations between their growth characteristics and their DNA sequences. This finding indicates that the secondary structures of the RNA transcripts may play a more important role than the exact nucleotide sequence of the RNAs in determining how they function within the cell.
High-Resolution Melting Analysis for Rapid Detection of Sequence Type 131 Escherichia coli.
Harrison, Lucas B; Hanson, Nancy D
2017-06-01
Escherichia coli isolates belonging to the sequence type 131 (ST131) clonal complex have been associated with the global distribution of fluoroquinolone and β-lactam resistance. Whole-genome sequencing and multilocus sequence typing identify sequence type but are expensive when evaluating large numbers of samples. This study was designed to develop a cost-effective screening tool using high-resolution melting (HRM) analysis to differentiate ST131 from non-ST131 E. coli in large sample populations in the absence of sequence analysis. The method was optimized using DNA from 12 E. coli isolates. Singleplex PCR was performed using 10 ng of DNA, Type-it HRM buffer, and multilocus sequence typing primers and was followed by multiplex PCR. The amplicon sizes ranged from 630 to 737 bp. Melt temperature peaks were determined by performing HRM analysis at 0.1°C resolution from 50 to 95°C on a Rotor-Gene Q 5-plex HRM system. Derivative melt curves were compared between sequence types and analyzed by principal component analysis. A blinded study of 191 E. coli isolates of ST131 and unknown sequence types validated this methodology. This methodology returned 99.2% specificity (124 true negatives and 1 false positive) and 100% sensitivity (66 true positives and 0 false negatives). This HRM methodology distinguishes ST131 from non-ST131 E. coli without sequence analysis. The analysis can be accomplished in about 3 h in any laboratory with an HRM-capable instrument and principal component analysis software. Therefore, this assay is a fast and cost-effective alternative to sequencing-based ST131 identification. Copyright © 2017 Harrison and Hanson.
Altier, Daniel J.; Dahlbacka, Glen; Ellanskaya, legal representative, Natalia; Herrmann, Rafael; Hunter-Cevera, Jennie; McCutchen, Billy F.; Presnail, James K.; Rice, Janet A.; Schepers, Eric; Simmons, Carl R.; Torok, Tamas; Yalpani, Nasser; Ellanskaya, deceased, Irina
2007-12-11
Compositions and methods for protecting a plant from a pathogen, particularly a fungal pathogen, are provided. Compositions include novel amino acid sequences, and variants and fragments thereof, for antipathogenic polypeptides that were isolated from microbial fermentation broths. Nucleic acid molecules comprising nucleotide sequences that encode the antipathogenic polypeptides of the invention are also provided. A method for inducing pathogen resistance in a plant using the nucleotide sequences disclosed herein is further provided. The method comprises introducing into a plant an expression cassette comprising a promoter operably linked to a nucleotide sequence that encodes an antipathogenic polypeptide of the invention. Compositions comprising an antipathogenic polypeptide or a transformed microorganism comprising a nucleic acid of the invention in combination with a carrier and methods of using these compositions to protect a plant from a pathogen are further provided. Transformed plants, plant cells, seeds, and microorganisms comprising a nucleotide sequence that encodes an antipathogenic polypeptide of the invention, or variant or fragment thereof, are also disclosed.
Altier, Daniel J.; Dahlbacka, Glen; Elleskaya, Irina; Ellanskaya, legal representative; Natalia; Herrmann, Rafael; Hunter-Cevera, Jennie; McCutchen, Billy F.; Presnail, James K.; Rice, Janet A.; Schepers, Eric; Simmons, Carl R.; Torok, Tamas; Yalpani, Nasser
2010-08-10
Compositions and methods for protecting a plant from a pathogen, particularly a fungal pathogen, are provided. Compositions include novel amino acid sequences, and variants and fragments thereof, for antipathogenic polypeptides that were isolated from microbial fermentation broths. Nucleic acid molecules comprising nucleotide sequences that encode the antipathogenic polypeptides of the invention are also provided. A method for inducing pathogen resistance in a plant using the nucleotide sequences disclosed herein is further provided. The method comprises introducing into a plant an expression cassette comprising a promoter operably linked to a nucleotide sequence that encodes an antipathogenic polypeptide of the invention. Compositions comprising an antipathogenic polypeptide or a transformed microorganism comprising a nucleic acid of the invention in combination with a carrier and methods of using these compositions to protect a plant from a pathogen are further provided. Transformed plants, plant cells, seeds, and microorganisms comprising a nucleotide sequence that encodes an antipathogenic polypeptide of the invention, or variant or fragment thereof, are also disclosed.
Altier, Daniel J [Waukee, IA; Dahlbacka, Glen [Oakland, CA; Elleskaya, Irina [Kyiv, UA; Ellanskaya, legal representative, Natalia; Herrmann, Rafael [Wilmington, DE; Hunter-Cevera, Jennie [Elliott City, MD; McCutchen, Billy F [College Station, IA; Presnail, James K [Avondale, PA; Rice, Janet A [Wilmington, DE; Schepers, Eric [Port Deposit, MD; Simmons, Carl R [Des Moines, IA; Torok, Tamas [Richmond, CA; Yalpani, Nasser [Johnston, IA
2011-04-12
Compositions and methods for protecting a plant from a pathogen, particularly a fungal pathogen, are provided. Compositions include novel amino acid sequences, and variants and fragments thereof, for antipathogenic polypeptides that were isolated from microbial fermentation broths. Nucleic acid molecules comprising nucleotide sequences that encode the antipathogenic polypeptides of the invention are also provided. A method for inducing pathogen resistance in a plant using the nucleotide sequences disclosed herein is further provided. The method comprises introducing into a plant an expression cassette comprising a promoter operably linked to a nucleotide sequence that encodes an antipathogenic polypeptide of the invention. Compositions comprising an antipathogenic polypeptide or a transformed microorganism comprising a nucleic acid of the invention in combination with a carrier and methods of using these compositions to protect a plant from a pathogen are further provided. Transformed plants, plant cells, seeds, and microorganisms comprising a nucleotide sequence that encodes an antipathogenic polypeptide of the invention, or variant or fragment thereof, are also disclosed.
Altier, Daniel J [Granger, IA; Dahlbacka, Glen [Oakland, CA; Ellanskaya, Irina [Kyiv, UA; Ellanskaya, legal representative, Natalia; Herrmann, Rafael [Wilmington, DE; Hunter-Cevera, Jennie [Elliott City, MD; McCutchen, Billy F [College Station, TX; Presnail, James K [Avondale, PA; Rice, Janet A [Wilmington, DE; Schepers, Eric [Port Deposit, MD; Simmons, Carl R [Des Moines, IA; Torok, Tamas [Richmond, CA; Yalpani, Nasser [Johnston, IA
2012-04-03
Compositions and methods for protecting a plant from a pathogen, particularly a fungal pathogen, are provided. Compositions include novel amino acid sequences, and variants and fragments thereof, for antipathogenic polypeptides that were isolated from microbial fermentation broths. Nucleic acid molecules comprising nucleotide sequences that encode the antipathogenic polypeptides of the invention are also provided. A method for inducing pathogen resistance in a plant using the nucleotide sequences disclosed herein is further provided. The method comprises introducing into a plant an expression cassette comprising a promoter operably linked to a nucleotide sequence that encodes an antipathogenic polypeptide of the invention. Compositions comprising an antipathogenic polypeptide or a transformed microorganism comprising a nucleic acid of the invention in combination with a carrier and methods of using these compositions to protect a plant from a pathogen are further provided. Transformed plants, plant cells, seeds, and microorganisms comprising a nucleotide sequence that encodes an antipathogenic polypeptide of the invention, or variant or fragment thereof, are also disclosed.
Sidell, Neil; Mathad, Raveendra I.; Shu, Feng-jue; Zhang, Zhenjiang; Kallen, Caleb B.; Yang, Danzhou
2011-01-01
DNA-intercalating molecules can impair DNA replication, DNA repair, and gene transcription. We previously demonstrated that XR5944, a DNA bis-intercalator, specifically blocks binding of estrogen receptor-α (ERα) to the consensus estrogen response element (ERE). The consensus ERE sequence is AGGTCAnnnTGACCT, where nnn is known as the tri-nucleotide spacer. Recent work has shown that the tri-nucleotide spacer can modulate ERα-ERE binding affinity and ligand-mediated transcriptional responses. To further understand the mechanism by which XR5944 inhibits ERα-ERE binding, we tested its ability to interact with consensus EREs with variable tri-nucleotide spacer sequences and with natural but non-consensus ERE sequences using one dimensional nuclear magnetic resonance (1D 1H NMR) titration studies. We found that the tri-nucleotide spacer sequence significantly modulates the binding of XR5944 to EREs. Of the sequences that were tested, EREs with CGG and AGG spacers showed the best binding specificity with XR5944, while those spaced with TTT demonstrated the least specific binding. The binding stoichiometry of XR5944 with EREs was 2:1, which can explain why the spacer influences the drug-DNA interaction; each XR5944 spans four nucleotides (including portions of the spacer) when intercalating with DNA. To validate our NMR results, we conducted functional studies using reporter constructs containing consensus EREs with tri-nucleotide spacers CGG, CTG, and TTT. Results of reporter assays in MCF-7 cells indicated that XR5944 was significantly more potent in inhibiting the activity of CGG- than TTT-spaced EREs, consistent with our NMR results. Taken together, these findings predict that the anti-estrogenic effects of XR5944 will depend not only on ERE half-site composition but also on the tri-nucleotide spacer sequence of EREs located in the promoters of estrogen-responsive genes. PMID:21333738
Heide, C; Pfeiffer, T; Nolan, J M; Hartmann, R K
1999-01-01
We have identified by nucleotide analog interference mapping (NAIM) exocyclic NH2 groups of guanosines in RNase P RNA from Escherichia coli that are important for tRNA binding. The majority of affected guanosines represent phylogenetically conserved nucleotides. Several sites of interference could be assigned to direct contacts with the tRNA moiety, whereas others were interpreted as reflecting indirect effects on tRNA binding due to the disruption of tertiary contacts within the catalytic RNA. Our results support the involvement of the 2-NH2 groups of G292/G293 in pairing with C74 and C75 of tRNA CCA-termini, as well as formation of two consecutive base triples involving C75 and A76 of CCA-ends interacting with G292/A258 and G291/G259, respectively. Moreover, we present first biochemical evidence for two tertiary contacts (L18/P8 and L8/P4) within the catalytic RNA, whose formation has been postulated previously on the basis of phylogenetic comparative analyses. The tRNA binding interference data obtained in this and our previous studies are consistent with the formation of a consecutive nucleotide triple and quadruple between the tetraloop L18 and helix P8. Formation of the nucleotide triple (G316 and A94:U104 in wild-type E. coli RNase P RNA) is also supported by mutational analysis. For the mutant RNase P RNA carrying a G94:C104 double mutation, an additional G316-to-A mutation resulted in a restoration of binding affinity for mature and precursor tRNA. PMID:9917070
Naidu, Hariprasad; Subramanian, B Mohana; Chinchkar, Shankar Ramchandra; Sriraman, Rajan; Rana, Samir Kumar; Srinivasan, V A
2012-05-01
The antigenic types of canine parvovirus (CPV) are defined based on differences in the amino acids of the major capsid protein VP2. Type specificity is conferred by a limited number of amino acid changes and in particular by few nucleotide substitutions. PCR based methods are not particularly suitable for typing circulating variants which differ in a few specific nucleotide substitutions. Assays for determining SNPs can detect efficiently nucleotide substitutions and can thus be adapted to identify CPV types. In the present study, CPV typing was performed by single nucleotide extension using the mini-sequencing technique. A mini-sequencing signature was established for all the four CPV types (CPV2, 2a, 2b and 2c) and feline panleukopenia virus. The CPV typing using the mini-sequencing reaction was performed for 13 CPV field isolates and the two vaccine strains available in our repository. All the isolates had been typed earlier by full-length sequencing of the VP2 gene. The typing results obtained from mini-sequencing matched completely with that of sequencing. Typing could be achieved with less than 100 copies of standard plasmid DNA constructs or ≤10¹ FAID₅₀ of virus by mini-sequencing technique. The technique was also efficient for detecting multiple types in mixed infections. Copyright © 2012 Elsevier B.V. All rights reserved.
Kumazaki, T; Hori, H; Osawa, S; Ishii, N; Suzuki, K
1982-01-01
The nucleotide sequences of 5S rRNAs from a rotifer, Brachionus plicatilis, and two nematodes, Rhabditis tokai and Caenorhabditis elegans have been determined. The rotifer has two 5S rRNA species that are composed of 120 and 121 nucleotides, respectively. The sequences of these two 5S rRNAs are the same except that the latter has an additional base at its 3'-terminus. The 5S rRNAs from the two nematode species are both 119 nucleotides long. The sequence similarity percents are 79% (Brachionus/Rhabditis), 80% (Brachionus/Caenorhabditis), and 95% (Rhabditis/Caenorhabditis) among these three species. Brachionus revealed the highest similarity to Lingula (89%), but not to the nematodes (79%). PMID:6891053
McCutchen-Maloney, Sandra L.
2002-01-01
DNA mutation binding proteins alone and as chimeric proteins with nucleases are used with solid supports to detect DNA sequence variations, DNA mutations and single nucleotide polymorphisms. The solid supports may be flow cytometry beads, DNA chips, glass slides or DNA dips sticks. DNA molecules are coupled to solid supports to form DNA-support complexes. Labeled DNA is used with unlabeled DNA mutation binding proteins such at TthMutS to detect DNA sequence variations, DNA mutations and single nucleotide length polymorphisms by binding which gives an increase in signal. Unlabeled DNA is utilized with labeled chimeras to detect DNA sequence variations, DNA mutations and single nucleotide length polymorphisms by nuclease activity of the chimera which gives a decrease in signal.
Bruni, C B; Musti, A M; Frunzio, R; Blasi, F
1980-01-01
A fragment of deoxyribonucleic acid 5,300 base paris long and containing the promoter-proximal portion of the histidine operon of Escherichia coli K-12, has been cloned in plasmid pBR313 (plasmids pCB2 and pCB3). Restriction mapping, partial nucleotide sequencing, and studies on functional expression in vivo and on protein synthesis in minicells have shown that the fragment contains the regulatory region of the operon, the hisG, hisD genes, and part of the hisC gene. Another plasmid (pCB5) contained the hisG gene and part of the hisD gene. Expression of the hisG gene in the latter plasmid was under control of the tetracycline promoter of the pBR313 plasmid. The in vivo expression of the two groups of plasmids described above, as well as their effect on the expression of the histidine genes not carried by the plasmids but present on the host chromosome, has been studied. The presence of multiple copies of pCB2 or pCB3, but not of pCB5, prevented derepression of the chromosomal histidine operon. Possible interpretations of this phenomenon are discussed. Images PMID:6246067
Weckbecker, Andrea; Hummel, Werner
2004-11-01
Recombinant pyridine nucleotide transhydrogenase (PNT) from Escherichia coli has been used to regenerate NAD+ and NADPH. The pnta and pntb genes encoding for the alpha- and beta-subunits were cloned and co-expressed with NADP+-dependent alcohol dehydrogenase (ADH) from Lactobacillus kefir and NAD+-dependent formate dehydrogenase (FDH) from Candida boidinii. Using this whole-cell biocatalyst, efficient conversion of prochiral ketones to chiral alcohols was achieved: 66% acetophenone was reduced to (R)-phenylethanol over 12 h, whereas only 19% (R)-phenylethanol was formed under the same conditions with cells containing ADH and FDH genes but without PNT genes. Cells that were permeabilized with toluene showed ketone reduction only if both cofactors were present.
Hung, Siu Chun; Gottesman, Max E.
1997-01-01
Bacteriophage HK022 Nun protein blocks transcription elongation by Escherichia coli RNA polymerase in vitro without dissociating the transcription complex. Nun is active on complexes located at any template site tested. Ultimately, only the 3′-OH terminal nucleotide of the nascent transcript in an arrested complex can turn over; it is removed by pyrophosphate and restored with NTPs. This suggests that Nun inhibits the translocation of RNA polymerase without abolishing its catalytic activities. Unlike spontaneously arrested complexes, Nun-arrested complexes cannot be reactivated by transcription factor GreB. The various complexes show distinct patterns of nucleotide incorporation and pyrophosphorolysis before or after treatment with Nun, suggesting that the configuration of RNAP, transcript, and template DNA is different in each complex. PMID:9334329
37 CFR 1.823 - Requirements for nucleotide and/or amino acid sequences as part of the application.
Code of Federal Regulations, 2011 CFR
2011-07-01
... and/or amino acid sequences as part of the application. 1.823 Section 1.823 Patents, Trademarks, and... Amino Acid Sequences § 1.823 Requirements for nucleotide and/or amino acid sequences as part of the... incorporation-by-reference of the Sequence Listing as required by § 1.52(e)(5). The presentation of the...
37 CFR 1.823 - Requirements for nucleotide and/or amino acid sequences as part of the application.
Code of Federal Regulations, 2013 CFR
2013-07-01
... and/or amino acid sequences as part of the application. 1.823 Section 1.823 Patents, Trademarks, and... Amino Acid Sequences § 1.823 Requirements for nucleotide and/or amino acid sequences as part of the... incorporation-by-reference of the Sequence Listing as required by § 1.52(e)(5). The presentation of the...
37 CFR 1.823 - Requirements for nucleotide and/or amino acid sequences as part of the application.
Code of Federal Regulations, 2012 CFR
2012-07-01
... and/or amino acid sequences as part of the application. 1.823 Section 1.823 Patents, Trademarks, and... Amino Acid Sequences § 1.823 Requirements for nucleotide and/or amino acid sequences as part of the... incorporation-by-reference of the Sequence Listing as required by § 1.52(e)(5). The presentation of the...
37 CFR 1.823 - Requirements for nucleotide and/or amino acid sequences as part of the application.
Code of Federal Regulations, 2010 CFR
2010-07-01
... and/or amino acid sequences as part of the application. 1.823 Section 1.823 Patents, Trademarks, and... Amino Acid Sequences § 1.823 Requirements for nucleotide and/or amino acid sequences as part of the... incorporation-by-reference of the Sequence Listing as required by § 1.52(e)(5). The presentation of the...
37 CFR 1.823 - Requirements for nucleotide and/or amino acid sequences as part of the application.
Code of Federal Regulations, 2014 CFR
2014-07-01
... and/or amino acid sequences as part of the application. 1.823 Section 1.823 Patents, Trademarks, and... Amino Acid Sequences § 1.823 Requirements for nucleotide and/or amino acid sequences as part of the... incorporation-by-reference of the Sequence Listing as required by § 1.52(e)(5). The presentation of the...
Biological nanopore MspA for DNA sequencing
NASA Astrophysics Data System (ADS)
Manrao, Elizabeth A.
Unlocking the information hidden in the human genome provides insight into the inner workings of complex biological systems and can be used to greatly improve health-care. In order to allow for widespread sequencing, new technologies are required that provide fast and inexpensive readings of DNA. Nanopore sequencing is a third generation DNA sequencing technology that is currently being developed to fulfill this need. In nanopore sequencing, a voltage is applied across a small pore in an electrolyte solution and the resulting ionic current is recorded. When DNA passes through the channel, the ionic current is partially blocked. If the DNA bases uniquely modulate the ionic current flowing through the channel, the time trace of the current can be related to the sequence of DNA passing through the pore. There are two main challenges to realizing nanopore sequencing: identifying a pore with sensitivity to single nucleotides and controlling the translocation of DNA through the pore so that the small single nucleotide current signatures are distinguishable from background noise. In this dissertation, I explore the use of Mycobacterium smegmatis porin A (MspA) for nanopore sequencing. In order to determine MspA's sensitivity to single nucleotides, DNA strands of various compositions are held in the pore as the resulting ionic current is measured. DNA is immobilized in MspA by attaching it to a large molecule which acts as an anchor. This technique confirms the single nucleotide resolution of the pore and additionally shows that MspA is sensitive to epigenetic modifications and single nucleotide polymorphisms. The forces from the electric field within MspA, the effective charge of nucleotides, and elasticity of DNA are estimated using a Freely Jointed Chain model of single stranded DNA. These results offer insight into the interactions of DNA within the pore. With the nucleotide sensitivity of MspA confirmed, a method is introduced to controllably pass DNA through the pore. Using a DNA polymerase, DNA strands are stepped through MspA one nucleotide at a time. The steps are observable as distinct levels on the ionic-current time-trace and are related to the DNA sequence. These experiments overcome the two fundamental challenges to realizing MspA nanopore sequencing and pave the way to the development of a commercial technology.
First report of Beet western yellows virus infecting Epiphyllum spp
USDA-ARS?s Scientific Manuscript database
Beet western yellow virus (BWYV) was identified from an orchid cactus (Epiphyllum spp.) hybrid without obvious symptoms by high-throughput sequencing. The nearly complete genomic sequence of 5,458 nucleotides of the virus was determined. The isolate has the highest nucleotide sequence identity (93%)...
USDA-ARS?s Scientific Manuscript database
Single-nucleotide polymorphisms (SNPs) are highly abundant markers, which are broadly distributed in animal genomes. For rainbow trout, SNP discovery has been done through sequencing of restriction-site associated DNA (RAD) libraries, reduced representation libraries (RRL), RNA sequencing, and whole...
Gardner, Shea N.; Hall, Barry G.
2013-01-01
Effective use of rapid and inexpensive whole genome sequencing for microbes requires fast, memory efficient bioinformatics tools for sequence comparison. The kSNP v2 software finds single nucleotide polymorphisms (SNPs) in whole genome data. kSNP v2 has numerous improvements over kSNP v1 including SNP gene annotation; better scaling for draft genomes available as assembled contigs or raw, unassembled reads; a tool to identify the optimal value of k; distribution of packages of executables for Linux and Mac OS X for ease of installation and user-friendly use; and a detailed User Guide. SNP discovery is based on k-mer analysis, and requires no multiple sequence alignment or the selection of a single reference genome. Most target sets with hundreds of genomes complete in minutes to hours. SNP phylogenies are built by maximum likelihood, parsimony, and distance, based on all SNPs, only core SNPs, or SNPs present in some intermediate user-specified fraction of targets. The SNP-based trees that result are consistent with known taxonomy. kSNP v2 can handle many gigabases of sequence in a single run, and if one or more annotated genomes are included in the target set, SNPs are annotated with protein coding and other information (UTRs, etc.) from Genbank file(s). We demonstrate application of kSNP v2 on sets of viral and bacterial genomes, and discuss in detail analysis of a set of 68 finished E. coli and Shigella genomes and a set of the same genomes to which have been added 47 assemblies and four “raw read” genomes of H104:H4 strains from the recent European E. coli outbreak that resulted in both bloody diarrhea and hemolytic uremic syndrome (HUS), and caused at least 50 deaths. PMID:24349125
Luisi-DeLuca, C; Clark, A J; Kolodner, R D
1988-01-01
Exonuclease VIII (exoVIII) of Escherichia coli has been purified from a strain carrying a plasmid-encoded recE gene by using a new procedure. This procedure yielded 30 times more protein per gram of cells, and the protein had a twofold higher specific activity than the enzyme purified by the previously published procedure (J. W. Joseph and R. Kolodner, J. Biol. Chem. 258:10411-10417, 1983). The sequence of the 12 N-terminal amino acids was also obtained and found to correspond to one of the open reading frames predicted from the nucleic acid sequence of the recE region of Rac (C. Chu, A. Templin, and A. J. Clark, manuscript in preparation). Polyclonal antibodies directed against purified exoVIII were also prepared. Cell-free extracts prepared from strains containing a wide range of chromosomal- or plasmid-encoded point, insertion, and deletion mutations which result in expression of exoVIII were examined by Western blot (immunoblot) analysis. This analysis showed that two point sbcA mutations (sbcA5 and sbcA23) and the sbc insertion mutations led to the synthesis of the 140-kilodalton (kDa) polypeptide of wild-type exoVIII. Plasmid-encoded partial deletion mutations of recE reduced the size of the cross-reacting protein(s) in direct proportion to the size of the deletion, even though exonuclease activity was still present. The analysis suggests that 39 kDa of the 140-kDa exoVIII subunit is all that is essential for exonuclease activity. One of the truncated but functional exonucleases (the pRAC3 exonuclease) has been purified and confirmed to be a 41-kDa polypeptide. The first 18 amino acids from the N terminus of the 41-kDa pRAC3 exonuclease were sequenced and fond to correspond to one of the translational start signals predicted from the nucleotide sequence of radC (Chu et al., in preparation). Images PMID:3056915
Gardner, Shea N; Hall, Barry G
2013-01-01
Effective use of rapid and inexpensive whole genome sequencing for microbes requires fast, memory efficient bioinformatics tools for sequence comparison. The kSNP v2 software finds single nucleotide polymorphisms (SNPs) in whole genome data. kSNP v2 has numerous improvements over kSNP v1 including SNP gene annotation; better scaling for draft genomes available as assembled contigs or raw, unassembled reads; a tool to identify the optimal value of k; distribution of packages of executables for Linux and Mac OS X for ease of installation and user-friendly use; and a detailed User Guide. SNP discovery is based on k-mer analysis, and requires no multiple sequence alignment or the selection of a single reference genome. Most target sets with hundreds of genomes complete in minutes to hours. SNP phylogenies are built by maximum likelihood, parsimony, and distance, based on all SNPs, only core SNPs, or SNPs present in some intermediate user-specified fraction of targets. The SNP-based trees that result are consistent with known taxonomy. kSNP v2 can handle many gigabases of sequence in a single run, and if one or more annotated genomes are included in the target set, SNPs are annotated with protein coding and other information (UTRs, etc.) from Genbank file(s). We demonstrate application of kSNP v2 on sets of viral and bacterial genomes, and discuss in detail analysis of a set of 68 finished E. coli and Shigella genomes and a set of the same genomes to which have been added 47 assemblies and four "raw read" genomes of H104:H4 strains from the recent European E. coli outbreak that resulted in both bloody diarrhea and hemolytic uremic syndrome (HUS), and caused at least 50 deaths.
Strategies for Protein Overproduction in Escherichia coli.
ERIC Educational Resources Information Center
Mott, John E.
1984-01-01
Examines heterologous expression in Escherichia coli and the role of regulatory sequences which control gene expression at transcription resulting in abundant production of messenger RNA and regulatory sequences in mRNA which promote efficient translation. Also examines the role of E. coli cells in stabilizing mRNA and protein that is…
Rasmussen, C.; Purcell, M.K.; Gregg, J.L.; LaPatra, S.E.; Winton, J.R.; Hershberger, P.K.
2010-01-01
The mesomycetozoean parasite Ichthyophonus hoferi is most commonly associated with marine fish hosts but also occurs in some components of the freshwater rainbow trout Oncorhynchus mykiss aquaculture industry in Idaho, USA. It is not certain how the parasite was introduced into rainbow trout culture, but it might have been associated with the historical practice of feeding raw, ground common carp Cyprinus carpio that were caught by commercial fisherman. Here, we report a major genetic division between west coast freshwater and marine isolates of Ichthyophonus hoferi. Sequence differences were not detected in 2 regions of the highly conserved small subunit (18S) rDNA gene; however, nucleotide variation was seen in internal transcribed spacer loci (ITS1 and ITS2), both within and among the isolates. Intra-isolate variation ranged from 2.4 to 7.6 nucleotides over a region consisting of ~740 bp. Majority consensus sequences from marine/anadromous hosts differed in only 0 to 3 nucleotides (99.6 to 100% nucleotide identity), while those derived from freshwater rainbow trout had no nucleotide substitutions relative to each other. However, the consensus sequences between isolates from freshwater rainbow trout and those from marine/anadromous hosts differed in 13 to 16 nucleotides (97.8 to 98.2% nucleotide identity).
Miyoshi-Akiyama, Tohru; Sherchan, Jatan Bahadur; Doi, Yohei; Nagamatsu, Maki; Sherchand, Jeevan B.; Tandukar, Sarmila; Ohmagari, Norio; Kirikae, Teruo; Ohara, Hiroshi
2016-01-01
ABSTRACT The global spread of extended-spectrum-β-lactamase (ESBL)-producing Escherichia coli (ESBL-E. coli) has largely been driven by the pandemic sequence type 131 (ST131). This study aimed to determine the molecular epidemiology of their spread in two Asian countries with contrasting prevalence. We conducted whole-genome sequencing (WGS) of ESBL-E. coli ST131 strains collected prospectively from Nepal and Japan, two countries in Asia with a high and low prevalence of ESBL-E. coli, respectively. We also systematically compared these genomes with those reported from other regions using publicly available WGS data for E. coli ST131 strains. Further, we conducted phylogenetic analysis of these isolates and all genome sequence data for ST131 strains to determine sequence diversity. One hundred five unique ESBL-E. coli isolates from Nepal (February 2013 to July 2013) and 76 isolates from Japan (October 2013 to September 2014) were included. Of these isolates, 54 (51%) isolates from Nepal and 11 (14%) isolates from Japan were identified as ST131 by WGS. Phylogenetic analysis based on WGS suggested that the majority of ESBL-E. coli ST131 isolates from Nepal clustered together, whereas those from Japan were more diverse. Half of the ESBL-E. coli ST131 isolates from Japan belonged to virotype C, whereas half of the isolates from Nepal belonged to a virotype other than virotype A, B, C, D, or E (A/B/C/D/E). The dominant sublineage of E. coli ST131 was H30Rx, which was most prominent in ESBL-E. coli ST131 isolates from Nepal. Our results revealed distinct phylogenetic characteristics of ESBL-E. coli ST131 spread in the two geographical areas of Asia, indicating the involvement of multiple factors in its local spread in each region. IMPORTANCE The global spread of ESBL-E. coli has been driven in large part by pandemic sequence type 131 (ST131). A recent study suggested that, within E. coli ST131, certain sublineages have disseminated worldwide with little association with their geographical origin, highlighting the complexity of the epidemiology of this pandemic clone. ST131 bacteria have also been classified into four virotypes based on the distribution of certain virulence genes. Information on virotype distribution in Asian ST131 strains is limited. We conducted whole-genome sequencing of ESBL-E. coli ST131 strains collected in Nepal and Japan, two Asian countries with a high and low prevalence of ESBL-E. coli, respectively. We systematically compared these ST131 genomes with those reported from other regions to gain insights into the molecular epidemiology of their spread and found the distinct phylogenetic characteristics of the spread of ESBL-E. coli ST131 in these two geographical areas of Asia. PMID:27830191
DOE Office of Scientific and Technical Information (OSTI.GOV)
George, Kevin W.; Thompson, Mitchell; Kim, Joonhoon
Isopentenyl pyrophosphate (IPP) toxicity presents a challenge in engineered microbial systems since its formation is unavoidable in terpene biosynthesis. Here in this work, we develop an experimental platform to study IPP toxicity in isoprenol-producing Escherichia coli. We first characterize the physiological response to IPP accumulation, demonstrating that elevated IPP levels are linked to growth inhibition, reduced cell viability, and plasmid instability. We show that IPP toxicity selects for pathway “breakage”, using proteomics to identify a reduction in phosphomevalonate kinase (PMK) as a probable recovery mechanism. Next, using multi-omics data, we demonstrate that endogenous E. coli metabolism is globally impacted bymore » IPP accumulation, which slows nutrient uptake, decreases ATP levels, and perturbs nucleotide metabolism. We also observe the extracellular accumulation of IPP and present preliminary evidence that IPP can be transported by E. coli, findings that might be broadly relevant for the study of isoprenoid biosynthesis. Finally, we discover that IPP accumulation leads to the formation of ApppI, a nucleotide analog of IPP that may contribute to observed toxicity phenotypes. This comprehensive assessment of IPP stress suggests potential strategies for the alleviation of prenyl diphosphate toxicity and highlights possible engineering targets for improved IPP flux and high titer isoprenoid production.« less
George, Kevin W.; Thompson, Mitchell; Kim, Joonhoon; ...
2018-03-09
Isopentenyl pyrophosphate (IPP) toxicity presents a challenge in engineered microbial systems since its formation is unavoidable in terpene biosynthesis. Here in this work, we develop an experimental platform to study IPP toxicity in isoprenol-producing Escherichia coli. We first characterize the physiological response to IPP accumulation, demonstrating that elevated IPP levels are linked to growth inhibition, reduced cell viability, and plasmid instability. We show that IPP toxicity selects for pathway “breakage”, using proteomics to identify a reduction in phosphomevalonate kinase (PMK) as a probable recovery mechanism. Next, using multi-omics data, we demonstrate that endogenous E. coli metabolism is globally impacted bymore » IPP accumulation, which slows nutrient uptake, decreases ATP levels, and perturbs nucleotide metabolism. We also observe the extracellular accumulation of IPP and present preliminary evidence that IPP can be transported by E. coli, findings that might be broadly relevant for the study of isoprenoid biosynthesis. Finally, we discover that IPP accumulation leads to the formation of ApppI, a nucleotide analog of IPP that may contribute to observed toxicity phenotypes. This comprehensive assessment of IPP stress suggests potential strategies for the alleviation of prenyl diphosphate toxicity and highlights possible engineering targets for improved IPP flux and high titer isoprenoid production.« less
Finished Genome Sequence of Escherichia coli K-12 Strain HMS174 (ATCC 47011).
Mairhofer, Juergen; Krempl, Peter M; Thallinger, Gerhard G; Striedner, Gerald
2014-11-20
Escherichia coli strain K-12 substrain HMS174 is an engineered descendant of the E. coli K-12 wild-type strain. Like its ancestor, it is an important organism in biotechnological research and is used in fermentation processes for heterologous protein production. Here, we report the complete genome sequence of E. coli HMS174 (ATCC 47011). Copyright © 2014 Mairhofer et al.
Hassell, James M; Blake, Damer P; Cranfield, Michael R; Ramer, Jan; Hogan, Jennifer N; Noheli, Jean Bosco; Waters, Michael; Hermosilla, Carlos
2013-10-01
Cysts morphologically resembling Balantidium coli were identified in the feces of a mountain gorilla (Gorilla beringei beringei). Confirmatory PCR and sequencing revealed two distinct B. coli-specific sequences (ITS-1, sub-types A0 and B1). This represents the first report of B. coli in this species, raising the possibility of infection from a reservoir host.
[Study on the genetic difference of SEO type Hantaviruses].
Zhang, X; Zhou, S; Wang, H; Hu, J; Guan, Z; Liu, H
2000-10-01
To understand the genetic type of Hantaviruses and the difference between them caused by rodents in Beijing and to furhter explore the source of the infectious factors. Hantavirus RNA, isolated from lungs of rodents captured in Beijing and positive with Hantavirus antigens with frozen sectioning and Immunofluorescent assay, were reverse-transcribed and amplified with PCR with Hantavirus-specific primers. Five of the PCR amplifications were discovered and sequenced with 300 bp sequence data of M segments (from 2003 - 2302nt according cDNA of seoul 8039 strain). Nucleotide sequence homology showed that they were sequences of SEO-type Hantavirus. Compared with SEO type Hantavirus, the nucleotide sequence homology of these samples was more than 94% while the homology of amonia acid sequence was more than 98%. When compared with HNT type Hantavirus, the homology of nucleotide sequence became less than 72% with the homology of amonia acid sequence less than 81%. Similar to other Hantavirus of SEO type, their nucleotide sequences and deduced amino acid sequences were highly preserved. Phylogenetic tree analysis showed that the five viruses could be divided into at least 4 branches. It was quite likely that there were at least two sub-type SEO viruses with 4 branches that were circulating in Beijing.
Laing, Chad R; Buchanan, Cody; Taboada, Eduardo N; Zhang, Yongxiang; Karmali, Mohamed A; Thomas, James E; Gannon, Victor Pj
2009-06-29
Many approaches have been used to study the evolution, population structure and genetic diversity of Escherichia coli O157:H7; however, observations made with different genotyping systems are not easily relatable to each other. Three genetic lineages of E. coli O157:H7 designated I, II and I/II have been identified using octamer-based genome scanning and microarray comparative genomic hybridization (mCGH). Each lineage contains significant phenotypic differences, with lineage I strains being the most commonly associated with human infections. Similarly, a clade of hyper-virulent O157:H7 strains implicated in the 2006 spinach and lettuce outbreaks has been defined using single-nucleotide polymorphism (SNP) typing. In this study an in silico comparison of six different genotyping approaches was performed on 19 E. coli genome sequences from 17 O157:H7 strains and single O145:NM and K12 MG1655 strains to provide an overall picture of diversity of the E. coli O157:H7 population, and to compare genotyping methods for O157:H7 strains. In silico determination of lineage, Shiga-toxin bacteriophage integration site, comparative genomic fingerprint, mCGH profile, novel region distribution profile, SNP type and multi-locus variable number tandem repeat analysis type was performed and a supernetwork based on the combination of these methods was produced. This supernetwork showed three distinct clusters of strains that were O157:H7 lineage-specific, with the SNP-based hyper-virulent clade 8 synonymous with O157:H7 lineage I/II. Lineage I/II/clade 8 strains clustered closest on the supernetwork to E. coli K12 and E. coli O55:H7, O145:NM and sorbitol-fermenting O157 strains. The results of this study highlight the similarities in relationships derived from multi-locus genome sampling methods and suggest a "common genotyping language" may be devised for population genetics and epidemiological studies. Future genotyping methods should provide data that can be stored centrally and accessed locally in an easily transferable, informative and extensible format based on comparative genomic analyses.
Crystal structures of catalytic complexes of the oxidative DNA/RNA repair enzyme AlkB
DOE Office of Scientific and Technical Information (OSTI.GOV)
Yu,B.; Edstrom, W.; Benach, J.
2006-01-01
Nucleic acid damage by environmental and endogenous alkylation reagents creates lesions that are both mutagenic and cytotoxic, with the latter effect accounting for their widespread use in clinical cancer chemotherapy. Escherichia coliAlkB and the homologous human proteins ABH2 and ABH3 (refs 5, 7) promiscuously repair DNA and RNA bases damaged by SN2 alkylation reagents, which attach hydrocarbons to endocyclic ring nitrogen atoms (N1 of adenine and guanine and N3 of thymine and cytosine). Although the role of AlkB in DNA repair has long been established based on phenotypic studies, its exact biochemical activity was only elucidated recently after sequence profilemore » analysis revealed it to be a member of the Fe-oxoglutarate-dependent dioxygenase superfamily. These enzymes use an Fe(ii) cofactor and 2-oxoglutarate co-substrate to oxidize organic substrates. AlkB hydroxylates an alkylated nucleotide base to produce an unstable product that releases an aldehyde to regenerate the unmodified base. Here we have determined crystal structures of substrate and product complexes of E. coli AlkB at resolutions from 1.8 to 2.3 Angstroms. Whereas the Fe-2-oxoglutarate dioxygenase core matches that in other superfamily members, a unique subdomain holds a methylated trinucleotide substrate into the active site through contacts to the polynucleotide backbone. Amide hydrogen exchange studies and crystallographic analyses suggest that this substrate-binding 'lid' is conformationally flexible, which may enable docking of diverse alkylated nucleotide substrates in optimal catalytic geometry. Different crystal structures show open and closed states of a tunnel putatively gating O2 diffusion into the active site. Exposing crystals of the anaerobic Michaelis complex to air yields slow but substantial oxidation of 2-oxoglutarate that is inefficiently coupled to nucleotide oxidation. These observations suggest that protein dynamics modulate redox chemistry and that a hypothesized migration of the reactive oxy-ferryl ligand on the catalytic Fe ion may be impeded when the protein is constrained in the crystal lattice.« less
Lee, Won-Heong; Shin, So-Yeon; Kim, Myoung-Dong; Han, Nam Soo; Seo, Jin-Ho
2012-03-01
Guanosine 5'-triphosphate (GTP) is the key substrate for biosynthesis of guanosine 5'-diphosphate (GDP)-L-fucose. In this study, improvement of GDP-L-fucose production was attempted by manipulating the biosynthetic pathway for guanosine nucleotides in recombinant Escherichia coli-producing GDP-L-fucose. The effects of overexpression of inosine 5'-monophosphate (IMP) dehydrogenase, guanosine 5'-monophosphate (GMP) synthetase (GuaB and GuaA), GMP reductase (GuaC) and guanosine-inosine kinase (Gsk) on GDP-L-fucose production were investigated in a series of fed-batch fermentations. Among the enzymes tested, overexpression of Gsk led to a significant improvement of GDP-L-fucose production. Maximum GDP-L-fucose concentration of 305.5 ± 5.3 mg l(-1) was obtained in the pH-stat fed-batch fermentation of recombinant E. coli-overexpressing Gsk, which corresponds to a 58% enhancement in the GDP-L-fucose production compared with the control strain overexpressing GDP-L-fucose biosynthetic enzymes. Such an enhancement of GDP-L-fucose production could be due to the increase in the intracellular level of GMP.
Tan, Hao; Wu, Xiang; Xie, Liyuan; Huang, Zhongqian; Gan, Bingcheng; Peng, Weihong
2015-06-01
A phytase gene was identified in a publicly available metagenome derived from subsurface groundwater, which was deduced to encode for a protein of the histidine acid phosphatase (HAP) family. The nucleotide sequence of the phytase gene was chemically synthesized and cloned, in order to further overexpress the phytase in Escherichia coli. Purified protein of the recombinant phytase demonstrated an activity for phytic acid of 298 ± 17 μmol P/min/mg, at the pH optimum of 2.0 with the temperature of 37 °C. Interestingly, the pH optimum of this phytase is much lower in comparison with most HAP phytases known to date. It suggests that the phytase could possess improved adaptability to the low pH condition caused by the gastric acid in livestock and poultry stomachs.
Structure, function, and evolution of bacterial ATP-binding cassette systems
DOE Office of Scientific and Technical Information (OSTI.GOV)
Davidson, A.L.; Dassa, E.; Orelle, C.
2010-07-27
The ATP-binding cassette (ABC) systems constitute one of the largest superfamilies of paralogous sequences. All ABC systems share a highly conserved ATP-hydrolyzing domain or protein (the ABC; also referred to as a nucleotide-binding domain [NBD]) that is unequivocally characterized by three short sequence motifs (Fig. 1): these are the Walker A and Walker B motifs, indicative of the presence of a nucleotide-binding site, and the signature motif, unique to ABC proteins, located upstream of the Walker B motif (426). Other motifs diagnostic of ABC proteins are also indicated in Fig. 1. The biological significance of these motifs is discussed inmore » Structure, Function, and Dynamics of the ABC. ABC systems are widespread among living organisms and have been detected in all genera of the three kingdoms of life, with remarkable conservation in the primary sequence of the cassette and in the organization of the constitutive domains or subunits (203, 420). ABC systems couple the energy of ATP hydrolysis to an impressively large variety of essential biological phenomena, comprising not only transmembrane (TM) transport, for which they are best known, but also several non-transport-related processes, such as translation elongation (62) and DNA repair (174). Although ABC systems deserve much attention because they are involved in severe human inherited diseases (107), they were first discovered and characterized in detail in prokaryotes, as early as the 1970s (13, 148, 238, 468). The most extensively analyzed systems were the high-affinity histidine and maltose uptake systems of Salmonella enterica serovar Typhimurium and Escherichia coli. Over 2 decades ago, after the completion of the nucleotide sequences encoding these transporters in the respective laboratories of Giovanna Ames and Maurice Hofnung, Hiroshi Nikaido and colleagues noticed that the two systems displayed a global similarity in the nature of their components and, moreover, that the primary sequences of MalK and HisP, the proteins suspected to energize these transporters, shared as much as 32% identity in amino acid residues when their sequences were aligned (171). Later, it was found that several bacterial proteins involved in uptake of nutrients, export of toxins, cell division, bacterial nodulation of plants, and DNA repair displayed the same similarity in their sequences (127, 196). This led to the notion that the conserved protein, which had been shown to bind ATP (198, 201), would probably energize the systems mentioned above by coupling the energy of ATP hydrolysis to transport. The latter was demonstrated with the maltose and histidine transporters by use of isolated membrane vesicles (105, 379) and purified transporters reconstituted into proteoliposomes (30, 98). The determination of the sequence of the first eukaryotic protein strongly similar to these bacterial transporters (the P-glycoprotein, involved in resistance of cancer cells to multiple drugs) (169, 179) demonstrated that these proteins were not restricted to prokaryotes. Two names, 'traffic ATPases' (15) and the more accepted name 'ABC transporters' (193, 218), were proposed for members of this new superfamily. ABC systems can be divided into three main functional categories, as follows. Importers mediate the uptake of nutrients in prokaryotes. The nature of the substrates that are transported is very wide, including mono- and oligosaccharides, organic and inorganic ions, amino acids, peptides, ironsiderophores, metals, polyamine cations, opines, and vitamins. Exporters are involved in the secretion of various molecules, such as peptides, lipids, hydrophobic drugs, polysaccharides, and proteins, including toxins such as hemolysin. The third category of systems is apparently not involved in transport, with some members being involved in translation of mRNA and in DNA repair. Despite the large, diverse population of substrates handled and the difference in the polarity of transport, importers and exporters share a common organization made of two hydrophobic membrane-spanning or integral membrane (IM) domains and two hydrophilic domains carrying the ABC peripherally associated with the IM domains on the cytosolic side of the membrane (26). In importers, these four domains are almost always independent polypeptide chains that come together to form a multimeric complex. In most exporters, including the E. coli hemolysin exporter HlyB, the N-terminal IM and the C-terminal ABC domains are fused as a single polypeptide chain (IM-ABC). An inverted organization in which the IM domain is C-terminal with respect to the ABC domain (ABC-IM) exists, such as in the MacB protein, involved in macrolide resistance in E. coli. No IM domain partners have been identified for ABC proteins falling into the third category, and these proteins consist of two ABCs fused together (ABC2).« less
VecScreen_plus_taxonomy: imposing a tax(onomy) increase on vector contamination screening.
Schäffer, Alejandro A; Nawrocki, Eric P; Choi, Yoon; Kitts, Paul A; Karsch-Mizrachi, Ilene; McVeigh, Richard
2018-03-01
Nucleic acid sequences in public databases should not contain vector contamination, but many sequences in GenBank do (or did) contain vectors. The National Center for Biotechnology Information uses the program VecScreen to screen submitted sequences for contamination. Additional tools are needed to distinguish true-positive (contamination) from false-positive (not contamination) VecScreen matches. A principal reason for false-positive VecScreen matches is that the sequence and the matching vector subsequence originate from closely related or identical organisms (for example, both originate in Escherichia coli). We collected information on the taxonomy of sources of vector segments in the UniVec database used by VecScreen. We used that information in two overlapping software pipelines for retrospective analysis of contamination in GenBank and for prospective analysis of contamination in new sequence submissions. Using the retrospective pipeline, we identified and corrected over 8000 contaminated sequences in the nonredundant nucleotide database. The prospective analysis pipeline has been in production use since April 2017 to evaluate some new GenBank submissions. Data on the sources of UniVec entries were included in release 10.0 (ftp://ftp.ncbi.nih.gov/pub/UniVec/). The main software is freely available at https://github.com/aaschaffer/vecscreen_plus_taxonomy. aschaffe@helix.nih.gov. Supplementary data are available at Bioinformatics online. Published by Oxford University Press 2017. This work is written by US Government employees and are in the public domain in the US.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Pang, Jinsong, E-mail: pangjs542@nenu.edu.cn; Dong, Mingyue; Li, Ning
Highlights: ► A rice de novo DNA methyltransferase OsDRM2 was cloned. ► In vitro methylation activity of OsDRM2 was characterized with Escherichia coli. ► Assays of OsDRM2 in vivo methylation were done with Saccharomyces cerevisiae. ► OsDRM2 methylation activity is not preferential to any type of cytosine context. ► The activity of OsDRM2 is independent of RdDM pathway. - Abstract: DNA methylation of cytosine nucleotides is an important epigenetic modification that occurs in most eukaryotic organisms and is established and maintained by various DNA methyltransferases together with their co-factors. There are two major categories of DNA methyltransferases: de novo andmore » maintenance. Here, we report the isolation and functional characterization of a de novo methyltransferase, named OsDRM2, from rice (Oryza sativa L.). The full-length coding region of OsDRM2 was cloned and transformed into Escherichia coli and Saccharomyces cerevisiae. Both of these organisms expressed the OsDRM2 protein, which exhibited stochastic de novo methylation activity in vitro at CG, CHG, and CHH di- and tri-nucleotide patterns. Two lines of evidence demonstrated the de novo activity of OsDRM2: (1) a 5′-CCGG-3′ containing DNA fragment that had been pre-treated with OsDRM2 protein expressed in E. coli was protected from digestion by the CG-methylation-sensitive isoschizomer HpaII; (2) methylation-sensitive amplified polymorphism (MSAP) analysis of S. cerevisiae genomic DNA from transformants that had been introduced with OsDRM2 revealed CG and CHG methylation levels of 3.92–9.12%, and 2.88–6.93%, respectively, whereas the mock control S. cerevisiae DNA did not exhibit cytosine methylation. These results were further supported by bisulfite sequencing of the 18S rRNA and EAF5 genes of the transformed S. cerevisiae, which exhibited different DNA methylation patterns, which were observed in the genomic DNA. Our findings establish that OsDRM2 is an active de novo DNA methyltransferase gene with conserved activity in both prokaryotic and eukaryotic non-host species.« less
Fragmentation of whole-transcriptome RNA using E. coli RNase III.
Ares, Manuel
2013-05-01
High-throughput sequencing (HTS) methods can provide short sequence reads for many millions of individual molecules in a sample, allowing the use of sequencing to measure the abundance of RNA molecules. To quantify the amount of a particular sequence in a sample of large RNAs (e.g., mRNAs), it is important to fragment the RNA into short pieces that can be ligated to oligonucleotides that allow polymerase chain reaction (PCR) amplification and sequencing. The most desired end structure of RNA for such ligation steps is a 5' phosphate and a 3' OH. Thus, enzymes that leave these groups after cleavage are of particular utility, avoiding the need to dephosphorylate the 3' end with phosphatases or phosphorylate the 5' end with kinase before proceeding. One such enzyme, RNase III, is widely available. Although it primarily cuts duplex RNA, this specificity is salt- and concentration-dependent, and many RNAs that lack strong extended duplexes are nonetheless susceptible to cleavage at many spots. RNA fragmentation by RNase III does not seem to grossly affect the distribution of RNA sequencing reads. Thus, it has become a standard method for creating nominally representative pools of transcriptome sequences with 5' phosphates and 3' OH for library construction. Three steps in preparing fragmented transcriptome RNA for sequencing library construction are described here: (1) fragmenting the RNA with RNase III to the extent that ~60-100-nucleotide fragments are created, (2) purifying the RNA from the RNase III reaction, and (3) analyzing the digestion products for their suitability in library production.
Sequencing and phylogenetic analysis of tobacco virus 2, a polerovirus from Nicotiana tabacum.
Zhou, Benguo; Wang, Fang; Zhang, Xuesong; Zhang, Lina; Lin, Huafeng
2017-07-01
The complete genome sequence of a new virus, provisionally named tobacco virus 2 (TV2), was determined and identified from leaves of tobacco (Nicotiana tabacum) exhibiting leaf mosaic, yellowing, and deformity, in Anhui Province, China. The genome sequence of TV2 comprises 5,979 nucleotides, with 87% nucleotide sequence identity to potato leafroll virus (PLRV). Its genome organization is similar to that of PLRV, containing six open reading frames (ORFs) that potentially encode proteins with putative functions in cell-to-cell movement and suppression of RNA silencing. Phylogenetic analysis of the nucleotide sequence placed TV2 alongside members of the genus Polerovirus in the family Luteoviridae. To the best our knowledge, this study is the first report of a complete genome sequence of a new polerovirus identified in tobacco.
Dasgupta, R; Kaesberg, P
1982-01-01
The nucleotide sequences of the subgenomic coat protein messengers (RNA4's) of two related bromoviruses, brome mosaic virus (BMV) and cowpea chlorotic mottle virus (CCMV), have been determined by direct RNA and CDNA sequencing without cloning. BMV RNA4 is 876 b long including a 5' noncoding region of nine nucleotides and a 3' noncoding region of 300 nucleotides. CCMV RNA 4 is 824 b long, including a 5' noncoding region of 10 nucleotides and a 3' noncoding region of 244 nucleotides. The encoded coat proteins are similar in length (188 amino acids for BMV and 189 amino acids for CCMV) and display about 70% homology in their amino acid sequences. Length difference between the two RNAs is due mostly to a single deletion, in CCMV with respect to BMV, of about 57 b immediately following the coding region. Allowing for this deletion the RNAs are indicate that mutations leading to divergence were constrained in the coding region primarily by the requirement of maintaining a favorable coat protein structure and in the 3' noncoding region primarily by the requirement of maintaining a favorable RNA spatial configuration. PMID:6895941
Shimamoto, I; Sonoda, S; Vazquez, P; Minaka, N; Nishiguchi, M
1998-01-01
The 3' terminal 2378 nucleotides of a wasabi strain of crucifer tobamovirus (CTMV-W) infectious to crucifer plants was determined. This includes the 3' non-coding region of 235 nucleotides, coat protein (CP) gene (468 nucleotides), movement protein (MP) gene (798 nucleotides) and C-terminal partial readthrough portion of 180 K protein gene (940 nucleotides). Comparison of the sequence with homologous regions of thirteen other tobamovirus genomes showed that it had much higher identity to those of four other crucifer tobamoviruses, 85.2% to cr-TMV and turnip vein-clearing virus (TVCV), 87.4% to oilseed rape mosaic virus (ORMV) and 87.1% to TMV-Cg, than to those of other tobamoviruses. Thus CTMV-W was most similar to ORMV and TMV-Cg in sequence, but only marginally so, whereas the location and size of its MP gene was the same as cr-TMV amd TVCV. These results, together with other analyses, show that CTMV-W is a new crucifer tobamovirus, that the five crucifer tobamoviruses can be classified into two subgroups based on MP gene organization, and that the rate of sequence change is not the same in all lineages.
Ogembo, Javier Gordon; Caoili, Barbara L; Shikata, Masamitsu; Chaeychomsri, Sudawan; Kobayashi, Michihiro; Ikeda, Motoko
2009-10-01
A newly cloned Helicoverpa armigera nucleopolyhedrovirus (HearNPV) from Kenya, HearNPV-NNg1, has a higher insecticidal activity than HearNPV-G4, which also exhibits lower insecticidal activity than HearNPV-C1. In the search for genes and/or nucleotide sequences that might be involved in the observed virulence differences among Helicoverpa spp. NPVs, the entire genome of NNg1 was sequenced and compared with previously sequenced genomes of G4, C1 and Helicoverpa zea single-nucleocapsid NPV (Hz). The NNg1 genome was 132,425 bp in length, with a total of 143 putative open reading frames (ORFs), and shared high levels of overall amino acid and nucleotide sequence identities with G4, C1 and Hz. Three NNg1 ORFs, ORF5, ORF100 and ORF124, which were shared with C1, were absent in G4 and Hz, while NNg1 and C1 were missing a homologue of G4/Hz ORF5. Another three ORFs, ORF60 (bro-b), ORF119 and ORF120, and one direct repeat sequence (dr) were unique to NNg1. Relative to the overall nucleotide sequence identity, lower sequence identities were observed between NNg1 hrs and the homologous hrs in the other three Helicoverpa spp. NPVs, despite containing the same number of hrs located at essentially the same positions on the genomes. Differences were also observed between NNg1 and each of the other three Helicoverpa spp. NPVs in the diversity of bro genes encoded on the genomes. These results indicate several putative genes and nucleotide sequences that may be responsible for the virulence differences observed among Helicoverpa spp., yet the specific genes and/or nucleotide sequences responsible have not been identified.
Peirano, Gisele; van der Bij, Akke K; Gregson, Daniel B; Pitout, Johann D D
2012-02-01
A study was designed to assess the importance of sequence types among extended-spectrum β-lactamase (ESBL)-producing Escherichia coli isolates causing bacteremia over an 11-year period (2000 to 2010) in a centralized Canadian region. A total of 197 patients with incident infections were identified; the majority presented with community-onset urosepsis, with a significant increase in the prevalence of ESBL-producing E. coli during the later part of the study. The majority of E. coli isolates produced either CTX-M-15 or CTX-M-14. We identified 7 different major sequence types among 91% of isolates (i.e., the ST10 clonal complex, ST38, ST131, ST315, ST393, ST405, and ST648) and provided insight into their clinical and molecular characteristics. ST38 was the most antimicrobial-susceptible sequence type and predominated during 2000 to 2004 but disappeared after 2008. ST131 was the most antimicrobial-resistant sequence type, and the influx of a single pulsotype of this sequence type was responsible for the significant increase of ESBL-producing E. coli strains since 2007. During 2010, 49/63 (78%) of the ESBL-producing E. coli isolates belonged to ST131, and this sequence type had established itself as a major drug-resistant pathogen in Calgary, Alberta, Canada, posing an important new public health threat within our region. We urgently need well-designed epidemiological and molecular studies to understand the dynamics of transmission, risk factors, and reservoirs for E. coli ST131. This will provide insight into the emergence and spread of this multiresistant sequence type.
Chen, Qilei; Hu, Youjia; Zhao, Wenjie; Zhu, Chunbao; Zhu, Baoquan
2010-01-01
A gene encoding a novel (S)-specific NADH-dependent alcohol dehydrogenase (LK-ADH) was isolated from the genomic DNA of Lactobacillus kefir DSM 20587 by thermal asymmetric interlaced-polymerase chain reaction. The nucleotide sequence of (S)-LK-ADH gene (adhS) was determined, which consists of an open reading frame of 1,044 bp, coding for 347 amino acids with a molecular mass of 37.065 kDa. After a BLAST similarity search in GenBank database, the amino acid sequence of (S)-LK-ADH showed some homologies to several zinc containing medium-chain alcohol dehydrogenases. This novel gene was deposited into GenBank with the accession number of EU877965. adhS gene was subcloned into plasmid pET-28a(+), and recombinant (S)-LK-ADH was successfully expressed in E. coli BL21(DE3) by isopropyl-beta-D-1-thiogalactopyranoside induction. Purified enzyme showed a high enantioselectivity in the reduction of acetophenone to (S)-phenylethanol with an ee value of 99.4%. The substrate specificity and cofactor preference of recombinant (S)-LK-ADH were also tested.
Use of mutation spectra analysis software.
Rogozin, I; Kondrashov, F; Glazko, G
2001-02-01
The study and comparison of mutation(al) spectra is an important problem in molecular biology, because these spectra often reflect on important features of mutations and their fixation. Such features include the interaction of DNA with various mutagens, the function of repair/replication enzymes, and properties of target proteins. It is known that mutability varies significantly along nucleotide sequences, such that mutations often concentrate at certain positions, called "hotspots," in a sequence. In this paper, we discuss in detail two approaches for mutation spectra analysis: the comparison of mutation spectra with a HG-PUBL program, (FTP: sunsite.unc.edu/pub/academic/biology/dna-mutations/hyperg) and hotspot prediction with the CLUSTERM program (www.itba.mi.cnr.it/webmutation; ftp.bionet.nsc.ru/pub/biology/dbms/clusterm.zip). Several other approaches for mutational spectra analysis, such as the analysis of a target protein structure, hotspot context revealing, multiple spectra comparisons, as well as a number of mutation databases are briefly described. Mutation spectra in the lacI gene of E. coli and the human p53 gene are used for illustration of various difficulties of such analysis. Copyright 2001 Wiley-Liss, Inc.
Merino, Susana; Aguilar, Alicia; Nogueras, Maria Mercedes; Regue, Miguel; Swift, Simon; Tomás, Juan M.
1999-01-01
Two different representative recombinant clones encoding Aeromonas hydrophila lipases were found upon screening on tributyrin (phospholipase A1) and egg yolk agar (lecithinase-phospholipase C) plates of a cosmid-based genomic library of Aeromonas hydrophila AH-3 (serogroup O34) introduced into Escherichia coli DH5α. Subcloning, nucleotide sequencing, and in vitro-coupled transcription-translation experiments showed that the phospholipase A1 (pla) and C (plc) genes code for an 83-kDa putative lipoprotein and a 65-kDa protein, respectively. Defined insertion mutants of A. hydrophila AH-3 defective in either pla or plc genes were defective in phospholipase A1 and C activities, respectively. Lecithinase (phospholipase C) was shown to be cytotoxic but nonhemolytic or poorly hemolytic. A. hydrophila AH-3 plc mutants showed a more than 10-fold increase in their 50% lethal dose on fish and mice, and complementation of the plc single gene on these mutants abolished this effect, suggesting that Plc protein is a virulence factor in the mesophilic Aeromonas sp. serogroup O:34 infection process. PMID:10417167
Analysis of the gene cluster encoding toluene/o-xylene monooxygenase from Pseudomonas stutzeri OX1
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bertoni, G.; Martino, M.; Galli, E.
The toluene/o-xylene monooxygenase cloned from Pseudomonas stutzeri OX1 displays a very broad range of substrates and a very peculiar regioselectivity, because it is able to hydroxylate more than one position on the aromatic ring of several hydrocarbons and phenols. The nucleotide sequence of the gene cluster coding for this enzymatic system has been determined. The sequence analysis revealed the presence of six open reading frames (ORFs) homologous to other genes clustered in operons coding for multicomponent monooxygenases found in benzene- and toluene-degradative pathways cloned from Pseudomonas strains. Significant similarities were also found with multicomponent monooxygenase systems for phenol, methane, alkene,more » and dimethyl sulfide cloned from different bacterial strains. The knockout of each ORF and complementation with the wild-type allele indicated that all six ORFs are essential for the full activity of the toluene/o-xylene monooxygenase in Escherichia coli. This analysis also shows that despite its activity on both hydrocarbons and phenols, toluene/o-xylene monooxygenase belongs to a toluene multicomponent monooxygenase subfamily rather than to the monooxygenases active on phenols.« less
USDA-ARS?s Scientific Manuscript database
Potential Extraintestinal pathogenic Escherichia coli isolates DP254, WH333, WH398, F356, FEX675 and FEX725 were isolated from retail chicken meat products. Here, we report the draft genome sequences for these six E. coli isolates, which are currently being used in food safety research....
USDA-ARS?s Scientific Manuscript database
Escherichia coli O145 strains RM14715 and RM14723 were isolated from wildlife feces near a leafy greens-growing region in Yuma, Arizona. Both strains carry a distinct genotype compared with the E. coli O145 strains isolated from Salinas Valley, California. Here we report complete genome sequences an...
Strockbine, Nancy; Changayil, Shankar; Ranganathan, Satishkumar; Zhao, Kun; Weil, Ryan; MacCannell, Duncan; Sabol, Ashley; Schmidtke, Amber; Martin, Haley; Stripling, Devon; Ribot, Efrain M.; Gerner-Smidt, Peter
2014-01-01
Shiga toxin-producing Escherichia coli (STEC) are a common cause for food-borne diarrheal illness outbreaks and sporadic cases. Here, we report the availability of the draft genome sequences of 228 STEC strains representing 32 serotypes with known pulsed-field gel electrophoresis (PFGE) types and epidemiological relationships, as well as 12 strains representing other diarrheagenic E. coli pathotypes. PMID:25103754
Synthetic Promoters Functional in Francisella novicida and Escherichia coli
McWhinnie, Ralph L.
2014-01-01
In this work, we describe the identification of synthetic, controllable promoters that function in the bacterial pathogen Francisella novicida, a model facultative intracellular pathogen. Synthetic DNA fragments consisting of the tetracycline operator (tetO) flanked by a random nucleotide sequence were inserted into a Francisella novicida shuttle plasmid upstream of a promoterless artificial operon containing the reporter genes cat and lacZ. Fragments able to promote transcription were selected for based on their ability to drive expression of the cat gene, conferring chloramphenicol resistance. Promoters of various strengths were found, many of which were repressed in the presence of the tetracycline repressor (TetR) and promoted transcription only in the presence of the TetR inducer anhydrotetracycline. A subset of both constitutive and inducible synthetic promoters were characterized to find their induction ratios and to identify their transcription start sites. In cases where tetO was located between or downstream of the −10 and −35 regions of the promoter, control by TetR was observed. If the tetO region was upstream of the −35 region by more than 9 bp, it did not confer TetR control. We found that three of three promoters isolated in F. novicida functioned at a comparable level in E. coli; however, none of the 10 promoters isolated in E. coli functioned at a significant level in F. novicida. Our results allowed us to isolate minimal F. novicida promoters of 47 and 48 bp in length. PMID:24141126
Seal, B S; Neill, J D; Ridpath, J F
1994-07-01
Caliciviruses are nonenveloped with a polyadenylated genome of approximately 7.6 kb and a single capsid protein. The "RNA Fold" computer program was used to analyze 3'-terminal noncoding sequences of five feline calicivirus (FCV), rabbit hemorrhagic disease virus (RHDV), and two San Miguel sea lion virus (SMSV) isolates. The FCV 3'-terminal sequences are 40-46 nucleotides in length and 72-91% similar. The FCV sequences were predicted to contain two possible duplex structures and one stem-loop structure with free energies of -2.1 to -18.2 kcal/mole. The RHDV genomic 3'-terminal RNA sequences are 54 nucleotides in length and share 49% sequence similarity to homologous regions of the FCV genome. The RHDV sequence was predicted to form two duplex structures in the 3'-terminal noncoding region with a single stem-loop structure, resembling that of FCV. In contrast, the SMSV 1 and 4 genomic 3'-terminal noncoding sequences were 185 and 182 nucleotides in length, respectively. Ten possible duplex structures were predicted with an average structural free energy of -35 kcal/mole. Sequence similarity between the two SMSV isolates was 75%. Furthermore, extensive cloverleaflike structures are predicted in the 3' noncoding region of the SMSV genome, in contrast to the predicted single stem-loop structures of FCV or RHDV.
Angart, Phillip A.; Carlson, Rebecca J.; Adu-Berchie, Kwasi
2016-01-01
Efficient short interfering RNA (siRNA)-mediated gene silencing requires selection of a sequence that is complementary to the intended target and possesses sequence and structural features that encourage favorable functional interactions with the RNA interference (RNAi) pathway proteins. In this study, we investigated how terminal sequence and structural characteristics of siRNAs contribute to siRNA strand loading and silencing activity and how these characteristics ultimately result in a functionally asymmetric duplex in cultured HeLa cells. Our results reiterate that the most important characteristic in determining siRNA activity is the 5′ terminal nucleotide identity. Our findings further suggest that siRNA loading is controlled principally by the hybridization stability of the 5′ terminus (Nucleotides: 1–2) of each siRNA strand, independent of the opposing terminus. Postloading, RNA-induced silencing complex (RISC)–specific activity was found to be improved by lower hybridization stability in the 5′ terminus (Nucleotides: 3–4) of the loaded siRNA strand and greater hybridization stability toward the 3′ terminus (Nucleotides: 17–18). Concomitantly, specific recognition of the 5′ terminal nucleotide sequence by human Argonaute 2 (Ago2) improves RISC half-life. These findings indicate that careful selection of siRNA sequences can maximize both the loading and the specific activity of the intended guide strand. PMID:27399870
Correlation approach to identify coding regions in DNA sequences
NASA Technical Reports Server (NTRS)
Ossadnik, S. M.; Buldyrev, S. V.; Goldberger, A. L.; Havlin, S.; Mantegna, R. N.; Peng, C. K.; Simons, M.; Stanley, H. E.
1994-01-01
Recently, it was observed that noncoding regions of DNA sequences possess long-range power-law correlations, whereas coding regions typically display only short-range correlations. We develop an algorithm based on this finding that enables investigators to perform a statistical analysis on long DNA sequences to locate possible coding regions. The algorithm is particularly successful in predicting the location of lengthy coding regions. For example, for the complete genome of yeast chromosome III (315,344 nucleotides), at least 82% of the predictions correspond to putative coding regions; the algorithm correctly identified all coding regions larger than 3000 nucleotides, 92% of coding regions between 2000 and 3000 nucleotides long, and 79% of coding regions between 1000 and 2000 nucleotides. The predictive ability of this new algorithm supports the claim that there is a fundamental difference in the correlation property between coding and noncoding sequences. This algorithm, which is not species-dependent, can be implemented with other techniques for rapidly and accurately locating relatively long coding regions in genomic sequences.
Porcine insulin receptor substrate 4 (IRS4) gene: cloning, polymorphism and association study
USDA-ARS?s Scientific Manuscript database
Using PCR and IPCR techniques we obtained a 4498 bp nucleotide sequence FN424076 encompassing the complete coding sequence of the porcine IRS4 gene and its proximal promoter. The 1269-amino acid porcine protein deduced from the nucleotide sequence shares 92% identity with the human IRS4 and possesse...
The nucleotide sequence of 5S ribosomal RNA from Micrococcus lysodeikticus.
Hori, H; Osawa, S; Murao, K; Ishikura, H
1980-01-01
The nucleotide sequence of ribosomal 5S RNA from Micrococcus lysodeikticus is pGUUACGGCGGCUAUAGCGUGGGGGAAACGCCCGGCCGUAUAUCGAACCCGGAAGCUAAGCCCCAUAGCGCCGAUGGUUACUGUAACCGGGAGGUUGUGGGAGAGUAGGUCGCCGCCGUGAOH. When compared to other 5S RNAs, the sequence homology is greatest with Thermus aquaticus, and these two 5S RNAs reveal several features intermediate between those of typical gram-positive bacteria and gram-negative bacteria. PMID:6780979
Effects of bfp Mutations on Biogenesis of Functional Enteropathogenic Escherichia coli Type IV Pili
Anantha, Ravi P.; Stone, Kelly D.; Donnenberg, Michael S.
2000-01-01
Enteropathogenic Escherichia coli expresses a type IV fimbria known as the bundle-forming pilus (BFP) that is required for autoaggregation and localized adherence (LA) to host cells. A cluster of 14 genes is sufficient to reconstitute BFP biogenesis in a laboratory strain of E. coli. We have undertaken a systematic mutagenesis of the individual genes to determine the effect of each mutation on BFP biogenesis and LA. Here we report the construction and analysis of nonpolar mutations in six genes of the bfp cluster, bfpG, bfpB, bfpC, bfpD, bfpP, and bfpH, as well as the further analysis of a previously described bfpA mutant strain that is unable to express bundlin, the pilin protein. We found that mutations in bfpB, which encodes an outer membrane protein; bfpD, which encodes a putative nucleotide-binding protein; and bfpG and bfpC, which do not have sequence homologues in other type IV pilus systems, do not affect prebundlin expression or processing but block both BFP biogenesis and LA. The mutation in bfpP, the prepilin peptidase gene, does not affect prebundlin expression but blocks signal sequence cleavage of prebundlin, BFP biogenesis, and LA. The mutation in bfpH, which is predicted to encode a lytic transglycosylase, has no effect on prebundlin expression, prebundlin processing, BFP biogenesis, or LA. For each mutant for which altered phenotypes were detected, complementation with a plasmid containing the corresponding wild-type allele restored the wild-type phenotypes. We also found that association of prebundlin or bundlin with sucrose density flotation gradient fractions containing both inner and outer membrane proteins does not require any accessory proteins. These studies indicate that many bfp gene products are required for biogenesis of functional type IV pili but that mutations in the individual genes do not lead to the identification of new phases of pilus assembly. PMID:10762251
Faragher, S G; Dalgarno, L
1986-07-20
The 3' untranslated (UT) sequences of the genomic RNAs of five geographic variants of the alphavirus Ross River virus (RRV) were determined and compared with the 3' UT sequence of RRV T48, the prototype strain. Part of the 3' UT region of Getah virus, a close serological relative of RRV, was also sequenced. The RRV 3' UT region varies markedly in length between variants. Large deletions or insertions, sequence rearrangements and single nucleotide substitutions are observed. A sequence tract of 49 to 58 nucleotides, which is repeated as four blocks in the RRV T48 3' UT region, occurs only once in the 3' UT region of one RRV strain (NB5092), indicating that the existence of repeat sequence blocks is not essential for RRV replication. However, the precise sequence of the 3' proximal copy of the repeat block and its position relative to the poly(A) tail were identical in all RRV isolates examined, suggesting that it has an important role in RRV replication. Nucleotide substitutions between RRV variants are distributed non-randomly along the length of the 3' UT region. The sequence of 120 to 130 nucleotides adjacent to the poly(A) tail is strongly conserved. Getah virus RNA contains three repeat sequence blocks in the 3' UT region. These are similar in sequence to those in RRV RNA but differ in their arrangement. Homology between the RRV and Getah 3' UT sequences is greatest in the 3' proximal repeat sequence block that shows three differences in 49 nucleotides. The 3' proximal repeat in Getah RNA occurs at the same position, relative to the poly(A) tail, as in all RRV variants. The RRV and Getah virus 3' UT sequences show extensive homology in the region between the 3' proximal repeat and the poly(A) tail but, apart from the repeat blocks themselves, they show no significant homology elsewhere.
Antalis, T M; Clark, M A; Barnes, T; Lehrbach, P R; Devine, P L; Schevzov, G; Goss, N H; Stephens, R W; Tolstoshev, P
1988-02-01
Human monocyte-derived plasminogen activator inhibitor (mPAI-2) was purified to homogeneity from the U937 cell line and partially sequenced. Oligonucleotide probes derived from this sequence were used to screen a cDNA library prepared from U937 cells. One positive clone was sequenced and contained most of the coding sequence as well as a long incomplete 3' untranslated region (1112 base pairs). This cDNA sequence was shown to encode mPAI-2 by hybrid-select translation. A cDNA clone encoding the remainder of the mPAI-2 mRNA was obtained by primer extension of U937 poly(A)+ RNA using a probe complementary to the mPAI-2 coding region. The coding sequence for mPAI-2 was placed under the control of the lambda PL promoter, and the protein expressed in Escherichia coli formed a complex with urokinase that could be detected immunologically. By nucleotide sequence analysis, mPAI-2 cDNA encodes a protein containing 415 amino acids with a predicted unglycosylated Mr of 46,543. The predicted amino acid sequence of mPAI-2 is very similar to placental PAI-2 (3 amino acid differences) and shows extensive homology with members of the serine protease inhibitor (serpin) superfamily. mPAI-2 was found to be more homologous to ovalbumin (37%) than the endothelial plasminogen activator inhibitor, PAI-1 (26%). Like ovalbumin, mPAI-2 appears to have no typical amino-terminal signal sequence. The 3' untranslated region of the mPAI-2 cDNA contains a putative regulatory sequence that has been associated with the inflammatory mediators.
Antalis, T M; Clark, M A; Barnes, T; Lehrbach, P R; Devine, P L; Schevzov, G; Goss, N H; Stephens, R W; Tolstoshev, P
1988-01-01
Human monocyte-derived plasminogen activator inhibitor (mPAI-2) was purified to homogeneity from the U937 cell line and partially sequenced. Oligonucleotide probes derived from this sequence were used to screen a cDNA library prepared from U937 cells. One positive clone was sequenced and contained most of the coding sequence as well as a long incomplete 3' untranslated region (1112 base pairs). This cDNA sequence was shown to encode mPAI-2 by hybrid-select translation. A cDNA clone encoding the remainder of the mPAI-2 mRNA was obtained by primer extension of U937 poly(A)+ RNA using a probe complementary to the mPAI-2 coding region. The coding sequence for mPAI-2 was placed under the control of the lambda PL promoter, and the protein expressed in Escherichia coli formed a complex with urokinase that could be detected immunologically. By nucleotide sequence analysis, mPAI-2 cDNA encodes a protein containing 415 amino acids with a predicted unglycosylated Mr of 46,543. The predicted amino acid sequence of mPAI-2 is very similar to placental PAI-2 (3 amino acid differences) and shows extensive homology with members of the serine protease inhibitor (serpin) superfamily. mPAI-2 was found to be more homologous to ovalbumin (37%) than the endothelial plasminogen activator inhibitor, PAI-1 (26%). Like ovalbumin, mPAI-2 appears to have no typical amino-terminal signal sequence. The 3' untranslated region of the mPAI-2 cDNA contains a putative regulatory sequence that has been associated with the inflammatory mediators. Images PMID:3257578
[A surveillance study on CRISPR/Cas molecular biomarker in Escherichia coli].
Liang, W J; Zhang, R G; Duan, G C; Hong, L J; Zhang, B; Xi, Y L; Yang, H Y; Chen, S Y; Lou, T Y; Zhao, Y X
2016-08-10
A new method related to molecular biomarker with CRISPR/Cas (clustered regularly interspaced short palindromic repeats-cas) in Escherichia (E.) coli was developed and used for surveillance programs. CRISPR/Cas sequence that containing 135 strains with complete sequence and 203 strains with whole genome shotgun sequence of E. coli in GenBank by BLAST and 361 strains of E. coli (including 38 strains of E. coli O157∶H7) in laboratory were identified by PCR and analyzed with the CRISPR Finder. Spacers were compared with DANMAN and the phylogenetic trees of cas gene were constructed under Clustal Ⅹ and Mega 5.1. With new perspective, a descriptive method was developed targeting on the position of CRISPR/cas in E. coli. The CRISPR1 was detected in 77.04%, 100.00% and 75.62% and the CRISPR2 was detected in 74.81%, 100.00% and 92.24% and the CRISPR3 and CRISPR4 were detected in 11.85%, 0 and 1.39% for 135 strains with complete sequence, 203 strains with whole genome shotgun sequence and 361 strains in the laboratory, respectively. One strain downloaded in GenBank with whole genome sequencing and 2 strains in the our laboratory were identified that containing four CRISPR locus. The other E. coli strain was with insertion sequence in downstream of the non-cas CRISPR1. The unique CRISPR was found in 8 strains of O55∶H7, in 180 strains of O157∶H7, in 8 strains of O157∶HNM, in 40 strains of O104∶H4, in 4 strains of O145∶H28, in all the 699 E. coli strains. The phylogenetic tree could be divided into two groups-cas with type I-E or type I-F. CRISPR/Cas might be used as a valuable molecular biomarker in epidemiological surveillance studies to identify the high virulent strains or new strains of E. coli. Phage night be related to the missing or obtaining of spacers.
Lee, Chao-Hung; Helweg-Larsen, Jannik; Tang, Xing; Jin, Shaoling; Li, Baozheng; Bartlett, Marilyn S.; Lu, Jang-Jih; Lundgren, Bettina; Lundgren, Jens D.; Olsson, Mats; Lucas, Sebastian B.; Roux, Patricia; Cargnel, Antonietta; Atzori, Chiara; Matos, Olga; Smith, James W.
1998-01-01
Pneumocystis carinii f. sp. hominis isolates from 207 clinical specimens from nine countries were typed based on nucleotide sequence variations in the internal transcribed spacer regions I and II (ITS1 and ITS2, respectively) of rRNA genes. The number of ITS1 nucleotides has been revised from the previously reported 157 bp to 161 bp. Likewise, the number of ITS2 nucleotides has been changed from 177 to 192 bp. The number of ITS1 sequence types has increased from 2 to 15, and that of ITS2 has increased from 3 to 14. The 15 ITS1 sequence types are designated types A through O, and the 14 ITS2 types are named types a through n. A total of 59 types of P. carinii f. sp. hominis were found in this study. PMID:9508304
He, Shui-Lian; Yang, Yang; Morrell, Peter L; Yi, Ting-Shuang
2015-01-01
Foxtail millet (Setaria italica (L.) Beauv) is one of the earliest domesticated grains, which has been cultivated in northern China by 8,700 years before present (YBP) and across Eurasia by 4,000 YBP. Owing to a small genome and diploid nature, foxtail millet is a tractable model crop for studying functional genomics of millets and bioenergy grasses. In this study, we examined nucleotide sequence diversity, geographic structure, and levels of linkage disequilibrium at four nuclear loci (ADH1, G3PDH, IGS1 and TPI1) in representative samples of 311 landrace accessions across its cultivated range. Higher levels of nucleotide sequence and haplotype diversity were observed in samples from China relative to other sampled regions. Genetic assignment analysis classified the accessions into seven clusters based on nucleotide sequence polymorphisms. Intralocus LD decayed rapidly to half the initial value within ~1.2 kb or less.
Hamamoto, Kouta; Ueda, Shuhei; Yamamoto, Yoshimasa
2015-01-01
Genotyping and characterization of bacterial isolates are essential steps in the identification and control of antibiotic-resistant bacterial infections. Recently, one novel genotyping method using three genomic guided Escherichia coli markers (GIG-EM), dinG, tonB, and dipeptide permease (DPP), was reported. Because GIG-EM has not been fully evaluated using clinical isolates, we assessed this typing method with 72 E. coli collection of reference (ECOR) environmental E. coli reference strains and 63 E. coli isolates of various genetic backgrounds. In this study, we designated 768 bp of dinG, 745 bp of tonB, and 655 bp of DPP target sequences for use in the typing method. Concatenations of the processed marker sequences were used to draw GIG-EM phylogenetic trees. E. coli isolates with identical sequence types as identified by the conventional multilocus sequence typing (MLST) method were localized to the same branch of the GIG-EM phylogenetic tree. Sixteen clinical E. coli isolates were utilized as test isolates without prior characterization by conventional MLST and phylogenetic grouping before GIG-EM typing. Of these, 14 clinical isolates were assigned to a branch including only isolates of a pandemic clone, E. coli B2-ST131-O25b, and these results were confirmed by conventional typing methods. Our results suggested that the GIG-EM typing method and its application to phylogenetic trees might be useful tools for the molecular characterization and determination of the genetic relationships among E. coli isolates. PMID:25809972
Hamamoto, Kouta; Ueda, Shuhei; Yamamoto, Yoshimasa; Hirai, Itaru
2015-06-01
Genotyping and characterization of bacterial isolates are essential steps in the identification and control of antibiotic-resistant bacterial infections. Recently, one novel genotyping method using three genomic guided Escherichia coli markers (GIG-EM), dinG, tonB, and dipeptide permease (DPP), was reported. Because GIG-EM has not been fully evaluated using clinical isolates, we assessed this typing method with 72 E. coli collection of reference (ECOR) environmental E. coli reference strains and 63 E. coli isolates of various genetic backgrounds. In this study, we designated 768 bp of dinG, 745 bp of tonB, and 655 bp of DPP target sequences for use in the typing method. Concatenations of the processed marker sequences were used to draw GIG-EM phylogenetic trees. E. coli isolates with identical sequence types as identified by the conventional multilocus sequence typing (MLST) method were localized to the same branch of the GIG-EM phylogenetic tree. Sixteen clinical E. coli isolates were utilized as test isolates without prior characterization by conventional MLST and phylogenetic grouping before GIG-EM typing. Of these, 14 clinical isolates were assigned to a branch including only isolates of a pandemic clone, E. coli B2-ST131-O25b, and these results were confirmed by conventional typing methods. Our results suggested that the GIG-EM typing method and its application to phylogenetic trees might be useful tools for the molecular characterization and determination of the genetic relationships among E. coli isolates. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
Mandl, C W; Holzmann, H; Kunz, C; Heinz, F X
1993-05-01
The complete nucleotide sequence of the positive-stranded RNA genome of the tick-borne flavivirus Powassan (10,839 nucleotides) was elucidated and the amino acid sequence of all viral proteins was derived. Based on this sequence as well as serological data, Powassan virus represents the most divergent member of the tick-borne serocomplex within the genus flaviviruses, family Flaviviridae. The primary nucleotide sequence and potential RNA secondary structures of the Powassan virus genome as well as the protein sequences and the reactivities of the virion with a panel of monoclonal antibodies were compared to other tick-borne and mosquito-borne flaviviruses. These analyses corroborated significant differences between tick-borne and mosquito-borne flaviviruses, but also emphasized structural elements that are conserved among both vector groups. The comparisons among tick-borne flaviviruses revealed conserved sequence elements that might represent important determinants of the tick-borne flavivirus phenotype.
CoSMoS: Conserved Sequence Motif Search in the proteome
Liu, Xiao I; Korde, Neeraj; Jakob, Ursula; Leichert, Lars I
2006-01-01
Background With the ever-increasing number of gene sequences in the public databases, generating and analyzing multiple sequence alignments becomes increasingly time consuming. Nevertheless it is a task performed on a regular basis by researchers in many labs. Results We have now created a database called CoSMoS to find the occurrences and at the same time evaluate the significance of sequence motifs and amino acids encoded in the whole genome of the model organism Escherichia coli K12. We provide a precomputed set of multiple sequence alignments for each individual E. coli protein with all of its homologues in the RefSeq database. The alignments themselves, information about the occurrence of sequence motifs together with information on the conservation of each of the more than 1.3 million amino acids encoded in the E. coli genome can be accessed via the web interface of CoSMoS. Conclusion CoSMoS is a valuable tool to identify highly conserved sequence motifs, to find regions suitable for mutational studies in functional analyses and to predict important structural features in E. coli proteins. PMID:16433915
Detection of a divergent variant of grapevine virus F by next-generation sequencing.
Molenaar, Nicholas; Burger, Johan T; Maree, Hans J
2015-08-01
The complete genome sequence of a South African isolate of grapevine virus F (GVF) is presented. It was first detected by metagenomic next-generation sequencing of field samples and validated through direct Sanger sequencing. The genome sequence of GVF isolate V5 consists of 7539 nucleotides and contains a poly(A) tail. It has a typical vitivirus genome arrangement that comprises five open reading frames (ORFs), which share only 88.96 % nucleotide sequence identity with the existing complete GVF genome sequence (JX105428).
USDA-ARS?s Scientific Manuscript database
Uropathogenic Escherichia coli O4: H5 isolates ATCC 700414, 700415, 700416, and 700417 were recovered from women with first-time urinary tract infections. Here, we report the draft genome sequences for these four E. coli isolates, which are currently being used to validate food safety processing tec...
Xu, Aixia; Johnson, James R.; Sheen, Shiowshuh; Needleman, David S.
2018-01-01
ABSTRACT Potential extraintestinal pathogenic Escherichia coli strains DP254, WH333, WH398, F356, FEX675, and FEX725 were isolated from retail chicken meat products. Here, we report the draft genome sequences for these six E. coli isolates, which are currently being used in food safety research. PMID:29798928
Whole-genome sequence of Escherichia coli serotype O157:H7 strain EDL932 (ATCC 43894)
USDA-ARS?s Scientific Manuscript database
Escherichia coli serotype O157:H7 EDL 933 is a ground beef isolate associated with a 1983 hemorrhagic colitis outbreak. Considered the prototype O157:H7 strain, its derived genome sequence is a standard reference strain for comparative genomic studies of Shiga toxin-producing E. coli (STEC). Here we...
Purification and biochemical characterization of a novel ecto-apyrase, MP67, from Mimosa pudica.
Okuhata, Riku; Takishima, Takeshi; Nishimura, Naoaki; Ueda, Shogo; Tsuchiya, Takahide; Kanzawa, Nobuyuki
2011-09-01
We have previously reported the presence of an apyrase in Mimosa pudica. However, only limited information is available for this enzyme. Thus, in this study, the apyrase was purified to homogeneity. The purified enzyme had a molecular mass of around 67 kD and was able to hydrolyze both nucleotide triphosphate and nucleotide diphosphate as substrates. The ratio of ATP to ADP hydrolysis velocity of the purified protein was 0.01 in the presence of calcium ion, showing extremely high substrate specificity toward ADP. Thus, we designated this novel apyrase as MP67. A cDNA clone of MP67 was obtained using primers designed from the amino acid sequence of trypsin-digested fragments of the protein. In addition, rapid amplification of cDNA ends-polymerase chain reaction was performed to clone a conventional apyrase (MpAPY2). Comparison of the deduced amino acid sequences showed that MP67 is similar to ecto-apyrases; however, it was distinct from conventional apyrase based on phylogenetic classification. MP67 and MpAPY2 were expressed in Escherichia coli, and the recombinant proteins were purified. The recombinant MP67 showed high substrate specificity toward ADP rather than ATP. A polyclonal antibody raised against the recombinant MP67 was used to examine the tissue distribution and localization of native MP67 in the plant. The results showed that MP67 was ubiquitously distributed in various tissues, most abundantly in leaves, and was localized to plasma membranes. Thus, MP67 is a novel ecto-apyrase with extremely high substrate specificity for ADP.
Okuhata, Riku; Takishima, Takeshi; Nishimura, Naoaki; Ueda, Shogo; Tsuchiya, Takahide; Kanzawa, Nobuyuki
2011-01-01
We have previously reported the presence of an apyrase in Mimosa pudica. However, only limited information is available for this enzyme. Thus, in this study, the apyrase was purified to homogeneity. The purified enzyme had a molecular mass of around 67 kD and was able to hydrolyze both nucleotide triphosphate and nucleotide diphosphate as substrates. The ratio of ATP to ADP hydrolysis velocity of the purified protein was 0.01 in the presence of calcium ion, showing extremely high substrate specificity toward ADP. Thus, we designated this novel apyrase as MP67. A cDNA clone of MP67 was obtained using primers designed from the amino acid sequence of trypsin-digested fragments of the protein. In addition, rapid amplification of cDNA ends-polymerase chain reaction was performed to clone a conventional apyrase (MpAPY2). Comparison of the deduced amino acid sequences showed that MP67 is similar to ecto-apyrases; however, it was distinct from conventional apyrase based on phylogenetic classification. MP67 and MpAPY2 were expressed in Escherichia coli, and the recombinant proteins were purified. The recombinant MP67 showed high substrate specificity toward ADP rather than ATP. A polyclonal antibody raised against the recombinant MP67 was used to examine the tissue distribution and localization of native MP67 in the plant. The results showed that MP67 was ubiquitously distributed in various tissues, most abundantly in leaves, and was localized to plasma membranes. Thus, MP67 is a novel ecto-apyrase with extremely high substrate specificity for ADP. PMID:21788364
Singh, Vineet K; Ring, Robert P; Aswani, Vijay; Stemper, Mary E; Kislow, Jennifer; Ye, Zhan; Shukla, Sanjay K
2017-12-01
Staphylococcus aureus is an opportunistic human pathogen that can cause serious infections in humans. A plethora of known and putative virulence factors are produced by staphylococci that collectively orchestrate pathogenesis. Ear protein (Escherichia coli ampicillin resistance) in S. aureus is an exoprotein in COL strain, predicted to be a superantigen, and speculated to play roles in antibiotic resistance and virulence. The goal of this study was to determine if expression of ear is modulated by single nucleotide polymorphisms in its promoter and coding sequences and whether this gene plays roles in antibiotic resistance and virulence. Promoter, coding sequences and expression of the ear gene in clinical and carriage S. aureus strains with distinct genetic backgrounds were analysed. The JE2 strain and its isogenic ear mutant were used in a systemic infection mouse model to determine the competiveness of the ear mutant.Results/Key findings. The ear gene showed a variable expression, with USA300FPR3757 showing a high-level expression compared to many of the other strains tested including some showing negligible expression. Higher expression was associated with agr type 1 but not correlated with phylogenetic relatedness of the ear gene based upon single nucleotide polymorphisms in the promoter or coding regions suggesting a complex regulation. An isogenic JE2 (USA300 background) ear mutant showed no significant difference in its growth, antibiotic susceptibility or virulence in a mouse model. Our data suggests that despite being highly expressed in a USA300 genetic background, Ear is not a significant contributor to virulence in that strain.
Alves, Marta S; Pereira, Anabela; Araújo, Susana M; Castro, Bruno B; Correia, António C M; Henriques, Isabel
2014-01-01
The aim of this study was to examine antibiotic resistance (AR) dissemination in coastal water, considering the contribution of different sources of fecal contamination. Samples were collected in Berlenga, an uninhabited island classified as Natural Reserve and visited by tourists for aquatic recreational activities. To achieve our aim, AR in Escherichia coli isolates from coastal water was compared to AR in isolates from two sources of fecal contamination: human-derived sewage and seagull feces. Isolation of E. coli was done on Chromocult agar. Based on genetic typing 414 strains were established. Distribution of E. coli phylogenetic groups was similar among isolates of all sources. Resistances to streptomycin, tetracycline, cephalothin, and amoxicillin were the most frequent. Higher rates of AR were found among seawater and feces isolates, except for last-line antibiotics used in human medicine. Multi-resistance rates in isolates from sewage and seagull feces (29 and 32%) were lower than in isolates from seawater (39%). Seawater AR profiles were similar to those from seagull feces and differed significantly from sewage AR profiles. Nucleotide sequences matching resistance genes bla TEM, sul1, sul2, tet(A), and tet(B), were present in isolates of all sources. Genes conferring resistance to 3rd generation cephalosporins were detected in seawater (bla CTX-M-1 and bla SHV-12) and seagull feces (bla CMY-2). Plasmid-mediated determinants of resistance to quinolones were found: qnrS1 in all sources and qnrB19 in seawater and seagull feces. Our results show that seawater is a relevant reservoir of AR and that seagulls are an efficient vehicle to spread human-associated bacteria and resistance genes. The E. coli resistome recaptured from Berlenga coastal water was mainly modulated by seagulls-derived fecal pollution. The repertoire of resistance genes covers antibiotics critically important for humans, a potential risk for human health.
Alves, Marta S.; Pereira, Anabela; Araújo, Susana M.; Castro, Bruno B.; Correia, António C. M.; Henriques, Isabel
2014-01-01
The aim of this study was to examine antibiotic resistance (AR) dissemination in coastal water, considering the contribution of different sources of fecal contamination. Samples were collected in Berlenga, an uninhabited island classified as Natural Reserve and visited by tourists for aquatic recreational activities. To achieve our aim, AR in Escherichia coli isolates from coastal water was compared to AR in isolates from two sources of fecal contamination: human-derived sewage and seagull feces. Isolation of E. coli was done on Chromocult agar. Based on genetic typing 414 strains were established. Distribution of E. coli phylogenetic groups was similar among isolates of all sources. Resistances to streptomycin, tetracycline, cephalothin, and amoxicillin were the most frequent. Higher rates of AR were found among seawater and feces isolates, except for last-line antibiotics used in human medicine. Multi-resistance rates in isolates from sewage and seagull feces (29 and 32%) were lower than in isolates from seawater (39%). Seawater AR profiles were similar to those from seagull feces and differed significantly from sewage AR profiles. Nucleotide sequences matching resistance genes blaTEM, sul1, sul2, tet(A), and tet(B), were present in isolates of all sources. Genes conferring resistance to 3rd generation cephalosporins were detected in seawater (blaCTX-M-1 and blaSHV-12) and seagull feces (blaCMY-2). Plasmid-mediated determinants of resistance to quinolones were found: qnrS1 in all sources and qnrB19 in seawater and seagull feces. Our results show that seawater is a relevant reservoir of AR and that seagulls are an efficient vehicle to spread human-associated bacteria and resistance genes. The E. coli resistome recaptured from Berlenga coastal water was mainly modulated by seagulls-derived fecal pollution. The repertoire of resistance genes covers antibiotics critically important for humans, a potential risk for human health. PMID:25191308
Discovery of Escherichia coli CRISPR sequences in an undergraduate laboratory.
Militello, Kevin T; Lazatin, Justine C
2017-05-01
Clustered regularly interspaced short palindromic repeats (CRISPRs) represent a novel type of adaptive immune system found in eubacteria and archaebacteria. CRISPRs have recently generated a lot of attention due to their unique ability to catalog foreign nucleic acids, their ability to destroy foreign nucleic acids in a mechanism that shares some similarity to RNA interference, and the ability to utilize reconstituted CRISPR systems for genome editing in numerous organisms. In order to introduce CRISPR biology into an undergraduate upper-level laboratory, a five-week set of exercises was designed to allow students to examine the CRISPR status of uncharacterized Escherichia coli strains and to allow the discovery of new repeats and spacers. Students started the project by isolating genomic DNA from E. coli and amplifying the iap CRISPR locus using the polymerase chain reaction (PCR). The PCR products were analyzed by Sanger DNA sequencing, and the sequences were examined for the presence of CRISPR repeat sequences. The regions between the repeats, the spacers, were extracted and analyzed with BLASTN searches. Overall, CRISPR loci were sequenced from several previously uncharacterized E. coli strains and one E. coli K-12 strain. Sanger DNA sequencing resulted in the discovery of 36 spacer sequences and their corresponding surrounding repeat sequences. Five of the spacers were homologous to foreign (non-E. coli) DNA. Assessment of the laboratory indicates that improvements were made in the ability of students to answer questions relating to the structure and function of CRISPRs. Future directions of the laboratory are presented and discussed. © 2016 by The International Union of Biochemistry and Molecular Biology, 45(3):262-269, 2017. © 2016 The International Union of Biochemistry and Molecular Biology.
Nucleotide sequence composition and method for detection of neisseria gonorrhoeae
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lo, A.; Yang, H.L.
1990-02-13
This patent describes a composition of matter that is specific for {ital Neisseria gonorrhoeae}. It comprises: at least one nucleotide sequence for which the ratio of the amount of the sequence which hybridizes to chromosomal DNA of {ital Neisseria gonorrhoeae} to the amount of the sequence which hybridizes to chromosomal DNA of {ital Neisseria meningitidis} is greater than about five. The ratio being obtained by a method described.
Liu, Zhandong; Venkatesh, Santosh S; Maley, Carlo C
2008-01-01
Background Genomes store information for building and maintaining organisms. Complete sequencing of many genomes provides the opportunity to study and compare global information properties of those genomes. Results We have analyzed aspects of the information content of Homo sapiens, Mus musculus, Drosophila melanogaster, Caenorhabditis elegans, Arabidopsis thaliana, Saccharomyces cerevisiae, and Escherichia coli (K-12) genomes. Virtually all possible (> 98%) 12 bp oligomers appear in vertebrate genomes while < 2% of 19 bp oligomers are present. Other species showed different ranges of > 98% to < 2% of possible oligomers in D. melanogaster (12–17 bp), C. elegans (11–17 bp), A. thaliana (11–17 bp), S. cerevisiae (10–16 bp) and E. coli (9–15 bp). Frequencies of unique oligomers in the genomes follow similar patterns. We identified a set of 2.6 M 15-mers that are more than 1 nucleotide different from all 15-mers in the human genome and so could be used as probes to detect microbes in human samples. In a human sample, these probes would detect 100% of the 433 currently fully sequenced prokaryotes and 75% of the 3065 fully sequenced viruses. The human genome is significantly more compact in sequence space than a random genome. We identified the most frequent 5- to 20-mers in the human genome, which may prove useful as PCR primers. We also identified a bacterium, Anaeromyxobacter dehalogenans, which has an exceptionally low diversity of oligomers given the size of its genome and its GC content. The entropy of coding regions in the human genome is significantly higher than non-coding regions and chromosomes. However chromosomes 1, 2, 9, 12 and 14 have a relatively high proportion of coding DNA without high entropy, and chromosome 20 is the opposite with a low frequency of coding regions but relatively high entropy. Conclusion Measures of the frequency of oligomers are useful for designing PCR assays and for identifying chromosomes and organisms with hidden structure that had not been previously recognized. This information may be used to detect novel microbes in human tissues. PMID:18973670
Matsunaga, James; Schlax, Paula J; Haake, David A
2013-11-01
The spirochete Leptospira interrogans causes a systemic infection that provokes a febrile illness. The putative lipoproteins LigA and LigB promote adhesion of Leptospira to host proteins, interfere with coagulation, and capture complement regulators. In this study, we demonstrate that the expression level of the LigA and LigB proteins was substantially higher when L. interrogans proliferated at 37°C instead of the standard culture temperature of 30°C. The RNA comprising the 175-nucleotide 5' untranslated region (UTR) and first six lig codons, whose sequence is identical in ligA and ligB, is predicted to fold into two distinct stem-loop structures separated by a single-stranded region. The ribosome-binding site is partially sequestered in double-stranded RNA within the second structure. Toeprint analysis revealed that in vitro formation of a 30S-tRNA(fMet)-mRNA ternary complex was inhibited unless a 5' deletion mutation disrupted the second stem-loop structure. To determine whether the lig sequence could mediate temperature-regulated gene expression in vivo, the 5' UTR and the first six codons were inserted between the Escherichia coli l-arabinose promoter and bgaB (β-galactosidase from Bacillus stearothermophilus) to create a translational fusion. The lig fragment successfully conferred thermoregulation upon the β-galactosidase reporter in E. coli. The second stem-loop structure was sufficient to confer thermoregulation on the reporter, while sequences further upstream in the 5' UTR slightly diminished expression at each temperature tested. Finally, the expression level of β-galactosidase was significantly higher when point mutations predicted to disrupt base pairs in the second structure were introduced into the stem. Compensatory mutations that maintained base pairing of the stem without restoring the wild-type sequence reinstated the inhibitory effect of the 5' UTR on expression. These results indicate that ligA and ligB expression is limited by double-stranded RNA that occludes the ribosome-binding site. At elevated temperatures, the ribosome-binding site is exposed to promote translation initiation.
Liu, Zhandong; Venkatesh, Santosh S; Maley, Carlo C
2008-10-30
Genomes store information for building and maintaining organisms. Complete sequencing of many genomes provides the opportunity to study and compare global information properties of those genomes. We have analyzed aspects of the information content of Homo sapiens, Mus musculus, Drosophila melanogaster, Caenorhabditis elegans, Arabidopsis thaliana, Saccharomyces cerevisiae, and Escherichia coli (K-12) genomes. Virtually all possible (> 98%) 12 bp oligomers appear in vertebrate genomes while < 2% of 19 bp oligomers are present. Other species showed different ranges of > 98% to < 2% of possible oligomers in D. melanogaster (12-17 bp), C. elegans (11-17 bp), A. thaliana (11-17 bp), S. cerevisiae (10-16 bp) and E. coli (9-15 bp). Frequencies of unique oligomers in the genomes follow similar patterns. We identified a set of 2.6 M 15-mers that are more than 1 nucleotide different from all 15-mers in the human genome and so could be used as probes to detect microbes in human samples. In a human sample, these probes would detect 100% of the 433 currently fully sequenced prokaryotes and 75% of the 3065 fully sequenced viruses. The human genome is significantly more compact in sequence space than a random genome. We identified the most frequent 5- to 20-mers in the human genome, which may prove useful as PCR primers. We also identified a bacterium, Anaeromyxobacter dehalogenans, which has an exceptionally low diversity of oligomers given the size of its genome and its GC content. The entropy of coding regions in the human genome is significantly higher than non-coding regions and chromosomes. However chromosomes 1, 2, 9, 12 and 14 have a relatively high proportion of coding DNA without high entropy, and chromosome 20 is the opposite with a low frequency of coding regions but relatively high entropy. Measures of the frequency of oligomers are useful for designing PCR assays and for identifying chromosomes and organisms with hidden structure that had not been previously recognized. This information may be used to detect novel microbes in human tissues.
Ho, Wing Sze; Yap, Kien-Pong; Yeo, Chew Chieng; Rajasekaram, Ganeswrie; Thong, Kwai Lin
2015-01-01
Extraintestinal pathogenic Escherichia coli (ExPEC) that causes extraintestinal infections often harbor plasmids encoding fitness traits such as resistance and virulence determinants that are of clinical importance. We determined the complete nucleotide sequence of plasmid pEC302/04 from a multidrug-resistant E. coli EC302/04 which was isolated from the tracheal aspirate of a patient in Malaysia. In addition, we also performed comparative sequence analyses of 18 related IncFIIA plasmids to determine the phylogenetic relationship and diversity of these plasmids. The 140,232 bp pEC302/04 is a multireplicon plasmid that bears three replication systems (FII, FIA, and FIB) with subtype of F2:A1:B1. The plasmid is self-transmissible with a complete transfer region. pEC302/04 also carries antibiotic resistance genes such as bla TEM-1 and a class I integron containing sul1, cml and aadA resistance genes, conferring multidrug resistance (MDR) to its host, E. coli EC302/04. Besides, two iron acquisition systems (SitABCD and IutA-IucABCD) which are the conserved virulence determinants of ExPEC-colicin V or B and M (ColV/ColBM)-producing plasmids were identified in pEC302/04. Multiple toxin-antitoxin (TA)-based addiction systems (i.e., PemI/PemK, VagC/VagD, CcdA/CcdB, and Hok/Sok) and a plasmid partitioning system, ParAB, and PsiAB, which are important for plasmid maintenance were also found. Comparative plasmid analysis revealed only one conserved gene, the repA1 as the core genome, showing that there is an extensive diversity among the IncFIIA plasmids. The phylogenetic relationship of 18 IncF plasmids based on the core regions revealed that ColV/ColBM-plasmids and non-ColV/ColBM plasmids were separated into two distinct groups. These plasmids, which carry highly diverse genetic contents, are also mosaic in nature. The atypical combination of genetic materials, i.e., the MDR- and ColV/ColBM-plasmid-virulence encoding regions in a single ExPEC plasmid is rare but of clinical importance. Such phenomenon is bothersome when the plasmids are transmissible, facilitating the spread of virulence and resistance plasmids among pathogenic bacteria. Notably, certain TA systems are more commonly found in particular ExPEC plasmid types, indicating the possible relationships between certain TA systems and ExPEC pathogenesis.
Sampson, Juliana K.; Sheth, Nihar U.; Koparde, Vishal N.; Scalora, Allison F.; Serrano, Myrna G.; Lee, Vladimir; Roberts, Catherine H.; Jameson-Lee, Max; Ferreira-Gonzalez, Andrea; Manjili, Masoud H.; Buck, Gregory A.; Neale, Michael C.; Toor, Amir A.
2016-01-01
Summary Whole exome sequencing (WES) was performed on stem cell transplant donor-recipient (D-R) pairs to determine the extent of potential antigenic variation at a molecular level. In a small cohort of D-R pairs, a high frequency of sequence variation was observed between the donor and recipient exomes independent of human leucocyte antigen (HLA) matching. Nonsynonymous, nonconservative single nucleotide polymorphisms were approximately twice as frequent in HLA-matched unrelated, compared with related D-R pairs. When mapped to individual chromosomes, these polymorphic nucleotides were uniformly distributed across the entire exome. In conclusion, WES reveals extensive nucleotide sequence variation in the exomes of HLA-matched donors and recipients. PMID:24749631
Pritchard, Leighton; Holden, Nicola J; Bielaszewska, Martina; Karch, Helge; Toth, Ian K
2012-01-01
An Escherichia coli O104:H4 outbreak in Germany in summer 2011 caused 53 deaths, over 4000 individual infections across Europe, and considerable economic, social and political impact. This outbreak was the first in a position to exploit rapid, benchtop high-throughput sequencing (HTS) technologies and crowdsourced data analysis early in its investigation, establishing a new paradigm for rapid response to disease threats. We describe a novel strategy for design of diagnostic PCR primers that exploited this rapid draft bacterial genome sequencing to distinguish between E. coli O104:H4 outbreak isolates and other pathogenic E. coli isolates, including the historical hæmolytic uræmic syndrome (HUSEC) E. coli HUSEC041 O104:H4 strain, which possesses the same serotype as the outbreak isolates. Primers were designed using a novel alignment-free strategy against eleven draft whole genome assemblies of E. coli O104:H4 German outbreak isolates from the E. coli O104:H4 Genome Analysis Crowd-Sourcing Consortium website, and a negative sequence set containing 69 E. coli chromosome and plasmid sequences from public databases. Validation in vitro against 21 'positive' E. coli O104:H4 outbreak and 32 'negative' non-outbreak EHEC isolates indicated that individual primer sets exhibited 100% sensitivity for outbreak isolates, with false positive rates of between 9% and 22%. A minimal combination of two primers discriminated between outbreak and non-outbreak E. coli isolates with 100% sensitivity and 100% specificity. Draft genomes of isolates of disease outbreak bacteria enable high throughput primer design and enhanced diagnostic performance in comparison to traditional molecular assays. Future outbreak investigations will be able to harness HTS rapidly to generate draft genome sequences and diagnostic primer sets, greatly facilitating epidemiology and clinical diagnostics. We expect that high throughput primer design strategies will enable faster, more precise responses to future disease outbreaks of bacterial origin, and help to mitigate their societal impact.
Meier-Kolthoff, Jan P; Hahnke, Richard L; Petersen, Jörn; Scheuner, Carmen; Michael, Victoria; Fiebig, Anne; Rohde, Christine; Rohde, Manfred; Fartmann, Berthold; Goodwin, Lynne A; Chertkov, Olga; Reddy, Tbk; Pati, Amrita; Ivanova, Natalia N; Markowitz, Victor; Kyrpides, Nikos C; Woyke, Tanja; Göker, Markus; Klenk, Hans-Peter
2014-01-01
Although Escherichia coli is the most widely studied bacterial model organism and often considered to be the model bacterium per se, its type strain was until now forgotten from microbial genomics. As a part of the G enomic E ncyclopedia of B acteria and A rchaea project, we here describe the features of E. coli DSM 30083(T) together with its genome sequence and annotation as well as novel aspects of its phenotype. The 5,038,133 bp containing genome sequence includes 4,762 protein-coding genes and 175 RNA genes as well as a single plasmid. Affiliation of a set of 250 genome-sequenced E. coli strains, Shigella and outgroup strains to the type strain of E. coli was investigated using digital DNA:DNA-hybridization (dDDH) similarities and differences in genomic G+C content. As in the majority of previous studies, results show Shigella spp. embedded within E. coli and in most cases forming a single subgroup of it. Phylogenomic trees also recover the proposed E. coli phylotypes as monophyla with minor exceptions and place DSM 30083(T) in phylotype B2 with E. coli S88 as its closest neighbor. The widely used lab strain K-12 is not only genomically but also physiologically strongly different from the type strain. The phylotypes do not express a uniform level of character divergence as measured using dDDH, however, thus an alternative arrangement is proposed and discussed in the context of bacterial subspecies. Analyses of the genome sequences of a large number of E. coli strains and of strains from > 100 other bacterial genera indicate a value of 79-80% dDDH as the most promising threshold for delineating subspecies, which in turn suggests the presence of five subspecies within E. coli.
Origins of the E. coli Strain Causing an Outbreak of Hemolytic–Uremic Syndrome in Germany
Rasko, David A.; Webster, Dale R.; Sahl, Jason W.; Bashir, Ali; Boisen, Nadia; Scheutz, Flemming; Paxinos, Ellen E.; Sebra, Robert; Chin, Chen-Shan; Iliopoulos, Dimitris; Klammer, Aaron; Peluso, Paul; Lee, Lawrence; Kislyuk, Andrey O.; Bullard, James; Kasarskis, Andrew; Wang, Susanna; Eid, John; Rank, David; Redman, Julia C.; Steyert, Susan R.; Frimodt-Møller, Jakob; Struve, Carsten; Petersen, Andreas M.; Krogfelt, Karen A.; Nataro, James P.; Schadt, Eric E.; Waldor, Matthew K.
2011-01-01
BACKGROUND A large outbreak of diarrhea and the hemolytic–uremic syndrome caused by an unusual serotype of Shiga-toxin–producing Escherichia coli (O104:H4) began in Germany in May 2011. As of July 22, a large number of cases of diarrhea caused by Shiga-toxin–producing E. coli have been reported — 3167 without the hemolytic–uremic syndrome (16 deaths) and 908 with the hemolytic–uremic syndrome (34 deaths) — indicating that this strain is notably more virulent than most of the Shiga-toxin–producing E. coli strains. Preliminary genetic characterization of the outbreak strain suggested that, unlike most of these strains, it should be classified within the enteroaggregative pathotype of E. coli. METHODS We used third-generation, single-molecule, real-time DNA sequencing to determine the complete genome sequence of the German outbreak strain, as well as the genome sequences of seven diarrhea-associated enteroaggregative E. coli serotype O104:H4 strains from Africa and four enteroaggregative E. coli reference strains belonging to other serotypes. Genomewide comparisons were performed with the use of these enteroaggregative E. coli genomes, as well as those of 40 previously sequenced E. coli isolates. RESULTS The enteroaggregative E. coli O104:H4 strains are closely related and form a distinct clade among E. coli and enteroaggregative E. coli strains. However, the genome of the German outbreak strain can be distinguished from those of other O104:H4 strains because it contains a prophage encoding Shiga toxin 2 and a distinct set of additional virulence and antibiotic-resistance factors. CONCLUSIONS Our findings suggest that horizontal genetic exchange allowed for the emergence of the highly virulent Shiga-toxin–producing enteroaggregative E. coli O104:H4 strain that caused the German outbreak. More broadly, these findings highlight the way in which the plasticity of bacterial genomes facilitates the emergence of new pathogens. PMID:21793740
Hori, H; Osawa, S; Takaiwa, F; Sugiura, M
1984-01-01
The nucleotide sequences from two Pteridophyta species, a fern Dryopteris acuminata and a horsetail Equisetum arvense have been determined. These two sequences are more related to those of the Bryophyta species (88% identity on average) than to those of seed plants (84% identity on average). PMID:6538332
Energy efficiency trade-offs drive nucleotide usage in transcribed regions
Chen, Wei-Hua; Lu, Guanting; Bork, Peer; Hu, Songnian; Lercher, Martin J.
2016-01-01
Efficient nutrient usage is a trait under universal selection. A substantial part of cellular resources is spent on making nucleotides. We thus expect preferential use of cheaper nucleotides especially in transcribed sequences, which are often amplified thousand-fold compared with genomic sequences. To test this hypothesis, we derive a mutation-selection-drift equilibrium model for nucleotide skews (strand-specific usage of ‘A' versus ‘T' and ‘G' versus ‘C'), which explains nucleotide skews across 1,550 prokaryotic genomes as a consequence of selection on efficient resource usage. Transcription-related selection generally favours the cheaper nucleotides ‘U' and ‘C' at synonymous sites. However, the information encoded in mRNA is further amplified through translation. Due to unexpected trade-offs in the codon table, cheaper nucleotides encode on average energetically more expensive amino acids. These trade-offs apply to both strand-specific nucleotide usage and GC content, causing a universal bias towards the more expensive nucleotides ‘A' and ‘G' at non-synonymous coding sites. PMID:27098217
Seier, Tracey; Padgett, Dana R; Zilberberg, Gal; Sutera, Vincent A; Toha, Noor; Lovett, Susan T
2011-06-01
Strand misalignments at DNA repeats during replication are implicated in mutational hotspots. To study these events, we have generated strains carrying mutations in the Escherichia coli chromosomal lacZ gene that revert via deletion of a short duplicated sequence or by template switching within imperfect inverted repeat (quasipalindrome, QP) sequences. Using these strains, we demonstrate that mutation of the distal repeat of a quasipalindrome, with respect to replication fork movement, is about 10-fold higher than the proximal repeat, consistent with more common template switching on the leading strand. The leading strand bias was lost in the absence of exonucleases I and VII, suggesting that it results from more efficient suppression of template switching by 3' exonucleases targeted to the lagging strand. The loss of 3' exonucleases has no effect on strand misalignment at direct repeats to produce deletion. To compare these events to other mutations, we have reengineered reporters (designed by Cupples and Miller 1989) that detect specific base substitutions or frameshifts in lacZ with the reverting lacZ locus on the chromosome rather than an F' element. This set allows rapid screening of potential mutagens, environmental conditions, or genetic loci for effects on a broad set of mutational events. We found that hydroxyurea (HU), which depletes dNTP pools, slightly elevated templated mutations at inverted repeats but had no effect on deletions, simple frameshifts, or base substitutions. Mutations in nucleotide diphosphate kinase, ndk, significantly elevated simple mutations but had little effect on the templated class. Zebularine, a cytosine analog, elevated all classes.
Detection of possible restriction sites for type II restriction enzymes in DNA sequences.
Gagniuc, P; Cimponeriu, D; Ionescu-Tîrgovişte, C; Mihai, Andrada; Stavarachi, Monica; Mihai, T; Gavrilă, L
2011-01-01
In order to make a step forward in the knowledge of the mechanism operating in complex polygenic disorders such as diabetes and obesity, this paper proposes a new algorithm (PRSD -possible restriction site detection) and its implementation in Applied Genetics software. This software can be used for in silico detection of potential (hidden) recognition sites for endonucleases and for nucleotide repeats identification. The recognition sites for endonucleases may result from hidden sequences through deletion or insertion of a specific number of nucleotides. Tests were conducted on DNA sequences downloaded from NCBI servers using specific recognition sites for common type II restriction enzymes introduced in the software database (n = 126). Each possible recognition site indicated by the PRSD algorithm implemented in Applied Genetics was checked and confirmed by NEBcutter V2.0 and Webcutter 2.0 software. In the sequence NG_008724.1 (which includes 63632 nucleotides) we found a high number of potential restriction sites for ECO R1 that may be produced by deletion (n = 43 sites) or insertion (n = 591 sites) of one nucleotide. The second module of Applied Genetics has been designed to find simple repeats sizes with a real future in understanding the role of SNPs (Single Nucleotide Polymorphisms) in the pathogenesis of the complex metabolic disorders. We have tested the presence of simple repetitive sequences in five DNA sequence. The software indicated exact position of each repeats detected in the tested sequences. Future development of Applied Genetics can provide an alternative for powerful tools used to search for restriction sites or repetitive sequences or to improve genotyping methods.
Information Entropy of Influenza A Segment 7
NASA Astrophysics Data System (ADS)
Thompson, William A.; Fan, Shaohua; Weltman, Joel K.
2008-12-01
Information entropy (H) is a measure of uncertainty at each position within in a sequence of nucleotides.H was used to characterize a set of influenza A segment 7 nucleotide sequences. Nucleotide locations of high entropy were identified near the 5’ start of all of the sequences and the sequences were assigned to subsets according to synonymous nucleotide variants at those positions: either uracil at position six (U6), cytosine at position six (C6), adenine (A12) at position 12, guanine at position 12 (G12), adenine at position 15 (A15) or cytosine (C15) at position 15. H values were found to be correlated/corresponding (Kendall tau) along the lengths of the nucleotide segments of the subset pairs at each position. However, the H values of each subset of sequences were statistically distinguishable from those of the other member of the pair (Kolmogorov-Smirnov test). The joint probability of uncorrelated distributions of U6 and C6 sequences to viral subtypes and to viral host species was 34 times greater than for the A12:G12 subset pair and 214 times greater than for the A15:C15 pair. This result indicates that the high entropy position six of segment 7 is either a reporter or a sentinel location. The fact that not one of the H5N1 sequences in the dataset was a member of the C6 subset, but all 125 H5N1 sequences are members of the U6 subset suggests a non-random sentinel function.
CloVR-Comparative: automated, cloud-enabled comparative microbial genome sequence analysis pipeline.
Agrawal, Sonia; Arze, Cesar; Adkins, Ricky S; Crabtree, Jonathan; Riley, David; Vangala, Mahesh; Galens, Kevin; Fraser, Claire M; Tettelin, Hervé; White, Owen; Angiuoli, Samuel V; Mahurkar, Anup; Fricke, W Florian
2017-04-27
The benefit of increasing genomic sequence data to the scientific community depends on easy-to-use, scalable bioinformatics support. CloVR-Comparative combines commonly used bioinformatics tools into an intuitive, automated, and cloud-enabled analysis pipeline for comparative microbial genomics. CloVR-Comparative runs on annotated complete or draft genome sequences that are uploaded by the user or selected via a taxonomic tree-based user interface and downloaded from NCBI. CloVR-Comparative runs reference-free multiple whole-genome alignments to determine unique, shared and core coding sequences (CDSs) and single nucleotide polymorphisms (SNPs). Output includes short summary reports and detailed text-based results files, graphical visualizations (phylogenetic trees, circular figures), and a database file linked to the Sybil comparative genome browser. Data up- and download, pipeline configuration and monitoring, and access to Sybil are managed through CloVR-Comparative web interface. CloVR-Comparative and Sybil are distributed as part of the CloVR virtual appliance, which runs on local computers or the Amazon EC2 cloud. Representative datasets (e.g. 40 draft and complete Escherichia coli genomes) are processed in <36 h on a local desktop or at a cost of <$20 on EC2. CloVR-Comparative allows anybody with Internet access to run comparative genomics projects, while eliminating the need for on-site computational resources and expertise.
Du, Wuying; Hu, Fengyu; Yang, Yabo; Hu, Dong; Hu, Xuchu; Yu, Xinbing; Xu, Jin; Dai, Jialin; Liao, Xinjiang; Huang, Jiang
2011-09-01
Two novel genes encoding lactate dehydrogenase A (LDHA) and B (LDHB) homologues, respectively, were identified from the cDNA libraries of adult Taenia solium (T. solium). The two deduced amino acid sequences both show more than 50% identity to the homologues for Danio rerio, Xenopus laevis, Schistosoma japonicum, Sus scrofa, Homo sapiens, et al. The identity of the amino acid sequence between TsLDHA and TsLDHB is 57.4%, and that of the nucleotide sequence is 61.5%. Recombinant TsLDHA homologue (rTsLDHA) and TsLDHB homologue (rTsLDHB) were expressed in Escherichia coli BL21/DE3 and purified. Though there were some differences in the sequence, the two LDH isozyme homologues show similarity in the conserved LDH domain, topological structure, primary immunological traits, localization on the tegument of T. solium adult, and partial physicochemical properties. The linear B-cell epitope analysis of TsLDHA and TsLDHB discovered a TsLDHA specific epitope. The purified rTsLDHA and rTsLDHB could be recognized by rat immuno-sera, serum from swine, or a patient infected with T. solium, respectively, but Western blot analysis showed cross-reactions, not only between these two LDH members but also with other common human tapeworms or helminths. The results suggested that the two LDH homologues are similar in the characteristics of LDH family, and they are not specific antigens for immunodiagnosis.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tanaka, Yoshiyuki; Matsuoka, Makoto; Yamanoto, Naoki
A cDNA clone for phenylalanine ammonia-lyase (PAL) induced in wounded sweet potato (Ipomoea batatas Lam.) root was obtained by immunoscreening a cDNA library. The protein produced in Escherichia coli cells containing the plasmid pPAL02 was indistinguishable from sweet potato PAL as judged by Ouchterlony double diffusion assays. The M{sub r} of its subunit was 77,000. The cells converted ({sup 14}C)-L-phenylalanine into ({sup 14}C)-t-cinnamic acid and PAL activity was detected in the homogenate of the cells. The activity was dependent on the presence of the pPAL02 plasmid DNA. The nucleotide sequence of the cDNA contained a 2,121-base pair (bp) open-reading framemore » capable of coding for a polypeptide with 707 amino acids (M{sub r} 77,137), a 22-bp 5{prime}-noncoding region and a 207-bp 3{prime}-noncoding region. The results suggest that the insert DNA fully encoded the amino acid sequence for sweet potato PAL that is induced by wounding. Comparison of the deduced amino acid sequence with that of a PAL cDNA fragment from Phaseolus vulgaris revealed 78.9% homology. The sequence from amino acid residues 258 to 494 was highly conserved, showing 90.7% homology.« less
Klaassen, V A; Boeshore, M; Dolja, V V; Falk, B W
1994-07-01
Purified virions of lettuce infectious yellows virus (LIYV), a tentative member of the closterovirus group, contained two RNAs of approximately 8500 and 7300 nucleotides (RNAs 1 and 2 respectively) and a single coat protein species with M(r) of approximately 28,000. LIYV-infected plants contained multiple dsRNAs. The two largest were the correct size for the replicative forms of LIYV virion RNAs 1 and 2. To assess the relationships between LIYV RNAs 1 and 2, cDNAs corresponding to the virion RNAs were cloned. Northern blot hybridization analysis showed no detectable sequence homology between these RNAs. A partial amino acid sequence obtained from purified LIYV coat protein was found to align in the most upstream of four complete open reading frames (ORFs) identified in a LIYV RNA 2 cDNA clone. The identity of this ORF was confirmed as the LIYV coat protein gene by immunological analysis of the gene product expressed in vitro and in Escherichia coli. Computer analysis of the LIYV coat protein amino acid sequence indicated that it belongs to a large family of proteins forming filamentous capsids of RNA plant viruses. The LIYV coat protein appears to be most closely related to the coat proteins of two closteroviruses, beet yellows virus and citrus tristeza virus.
Lambert, I. B.; Gordon, AJE.; Glickman, B. W.; McCalla, D. R.
1992-01-01
We have examined the mutational specificity of 1-nitroso-8-nitropyrene (1,8-NONP), an activated metabolite of the carcinogen 1,8-dinitropyrene, in the lacI gene of Escherichia coli strains which differ with respect to nucleotide excision repair (+/-ΔuvrB) and MucA/B-mediated error-prone translesion synthesis (+/-pKM101). Several different classes of mutation were recovered, of which frameshifts, base substitutions, and deletions were clearly induced by 1,8-NONP treatment. The high proportion of point mutations (>92%) which occurred at G·C sites correlates with the percentage of 1,8-NONP-DNA adducts which occur at the C(8) position of guanine. The most prominent frameshift mutations were -(G·C) events, which were induced by 1,8-NONP treatment in all strains, occurred preferentially in runs of guanine residues, and whose frequency increased markedly with the length of the reiterated sequence. Of the base substitution mutations G·C -> T·A transversions were induced to the greatest extent by 1,8-NONP. The distribution of the G·C -> T·A transversions was not influenced by the nature of flanking bases, nor was there a strand preference for these events. The presence of plasmid pKM101 specifically increased the frequency of G·C -> T·A transversions by a factor of 30-60. In contrast, the -(G·C) frameshift mutation frequency was increased only 2-4-fold in strains harboring pKM101 as compared to strains lacking this plasmid. There was, however, a marked influence of pKM101 on the strand specificity of frameshift mutation; a preference was observed for -G events on the transcribed strand. The ability of the bacteria to carry out nucleotide excision repair had a strong effect on the frequency of all classes of mutation but did not significantly influence either the overall distribution of mutational classes or the strand specificity of G·C -> T·A transversions and -(G·C) frameshifts. Deletion mutations were induced in the Δuvr, pKM101 strain. The endpoints of the majority of the deletion mutations were G·C rich and contained regions of considerable homology. The specificity of 1,8-NONP-induced mutation suggests that DNA containing 1,8-NONP adducts can be processed through different mutational pathways depending on the DNA sequence context of the adduct and the DNA repair background of the cell. PMID:1459443
Multidrug-resistant Escherichia coli in Asia: epidemiology and management.
Sidjabat, Hanna E; Paterson, David L
2015-05-01
Escherichia coli has become multiresistant by way of production of a variety of β-lactamases. The prevalence of CTX-M-producing E. coli has reached 60-79% in certain parts of Asia. The acquisition of CTX-M plasmids by E. coli sequence type 131, a successful clone of E. coli, has caused further dissemination of CTX-M-producing E. coli. The prevalence of carbapenemase-producing E. coli, especially Klebsiella pneumoniae carbapenemase, and New Delhi metallo-β-lactamase (NDM)-producing E. coli has been increasing in Asia. K. pneumoniae carbapenemase and NDM have now been found in E. coli sequence type 131. The occurrence of NDM-producing E. coli is a major concern particularly in the Indian subcontinent, but now elsewhere in Asia as well. There are multiple reasons why antibiotic resistance in E. coli in Asia has reached such extreme levels. Approaches beyond antibiotic therapy, such as prevention of antibiotic resistance by antibiotic stewardship and protecting natural microbiome, are strategies to avoid further spread of antibiotic resistance.
Kitchen, J L; Li, Z; Crooke, E
1999-05-11
The initiation of Escherichia coli chromosomal replication by DnaA protein is strongly influenced by the tight binding of the nucleotides ATP and ADP. Anionic phospholipids in a fluid bilayer promote the conversion of inactive ADP-DnaA protein to replicatively active ATP-DnaA protein in vitro, and thus likely play a key role in regulating DnaA activity. Previous studies have revealed that, during this reactivation, a specific region of DnaA protein inserts into the hydrophobic portion of the lipid bilayer in an acidic phospholipid-dependent manner. To elucidate the requirement for acidic phospholipids in the reactivation process, the contribution of electrostatic forces in the interaction of DnaA and lipid was examined. DnaA-lipid binding required anionic phospholipids, and DnaA-lipid binding as well as lipid-mediated release of DnaA-bound nucleotide were inhibited by increased ionic strength, suggesting the involvement of electrostatic interactions in these processes. As the vesicular content of acidic phospholipids was increased, both nucleotide release and DnaA-lipid binding increased in a linear, parallel manner. Given that DnaA-membrane binding, the insertion of DnaA into the membrane, and the consequent nucleotide release all require anionic phospholipids, the acidic headgroup may be necessary to recruit DnaA protein to the membrane for insertion and subsequent reactivation for replication.
Li, Xi; Sun, Long; Zhu, Yongze; Shen, Mengyuan; Tu, Yuexing
2018-04-14
The emergence of carbapenem-resistant Escherichia coli has become a serious challenge to manage in the clinic because of multidrug resistance. Here we report the draft genome sequence of NDM-3-producing E. coli strain NT1 isolated from a bloodstream infection in China. Whole genomic DNA of E. coli strain NT1 was extracted and was sequenced using an Illumina HiSeq™ X Ten platform. The generated sequence reads were assembled using CLC Genomics Workbench. The draft genome was annotated using Rapid Annotation using Subsystem Technology (RAST). Bioinformatics analysis was further performed. The genome size was calculated at 5,353 620bp, with 5297 protein-coding sequences and the presence of genes conferring resistance to aminoglycosides, β-lactams, quinolones, macrolides, phenicols, sulphonamides, tetracycline and trimethoprim. In addition, genes encoding virulence factors were also identified. To our knowledge, this is the first report of an E. coli strain producing NDM-3 isolated from a human bloodstream infection. The genome sequence will provide valuable information to understand antibiotic resistance mechanisms and pathogenic mechanisms in this strain. Close surveillance is urgently needed to monitor the spread of NDM-3-producing isolates. Copyright © 2018 International Society for Chemotherapy of Infection and Cancer. Published by Elsevier Ltd. All rights reserved.
PUTATIVE GENE PROMOTER SEQUENCES IN THE CHLORELLA VIRUSES
Fitzgerald, Lisa A.; Boucher, Philip T.; Yanai-Balser, Giane; Suhre, Karsten; Graves, Michael V.; Van Etten, James L.
2008-01-01
Three short (7 to 9 nucleotides) highly conserved nucleotide sequences were identified in the putative promoter regions (150 bp upstream and 50 bp downstream of the ATG translation start site) of three members of the genus Chlorovirus, family Phycodnaviridae. Most of these sequences occurred in similar locations within the defined promoter regions. The sequence and location of the motifs were often conserved among homologous ORFs within the Chlorovirus family. One of these conserved sequences (AATGACA) is predominately associated with genes expressed early in virus replication. PMID:18768195
The complete sequence of Cymbidium mosaic virus from Vanilla fragrans in Hainan, China.
He, Zhen; Jiang, Dongmei; Liu, Aiqin; Sang, Liwei; Li, Wenfeng; Li, Shifang
2011-06-01
The complete nucleotide sequence of Cymbidium mosaic virus (CymMV) isolated from vanilla in Hainan province, China was determined for the first time. It comprised 6,224 nucleotides; sequence analysis suggested that the isolate we obtained was a member of the genus Potexvirus, and its sequence shared 86.67-96.61% identities with previously reported sequences. Phylogenetic analysis suggested that CymMV from vanilla fragrans was clustered into subgroup A and the isolates in this subgroup displayed little regional difference.
USDA-ARS?s Scientific Manuscript database
A recent widespread outbreak of Escherichia coli O104:H4 in Germany demonstrates the dynamic nature of emerging and re-emerging food-borne pathogens, particularly STECs and related pathogenic E. coli. Rapid genomic sequencing and public availability of these data from the German outbreak strain allo...
USDA-ARS?s Scientific Manuscript database
Transmissible colistin resistance conferred by mcr-1 gene bearing IncI2 plasmid has been recently reported in Esherichia coli in the US. We report the completed genome sequence of a second E. coli isolated from swine in the US that carried the mcr-1 gene on an IncI2 type plasmid....
Genome Sequence of Enterohemorrhagic Escherichia coli NCCP15658
Song, Ju Yeon; Yoo, Ran Hee; Jang, Song Yee; Seong, Won-Keun; Kim, Seon-Young; Jeong, Haeyoung; Kang, Sung Gyun; Kim, Byung Kwon; Kwon, Soon-Kyeong; Lee, Choong Hoon; Yu, Dong Su; Park, Mi-Sun
2012-01-01
Enterohemorrhagic Escherichia coli causes severe food-borne disease in the guts of humans and animals. Here, we report the high-quality draft genome sequence of E. coli NCCP15658 isolated from a patient in the Republic of Korea. Its genome size was determined to be 5.46 Mb, and its genomic features, including genes encoding virulence factors, were analyzed. PMID:22740673
Virulence genes in a probiotic E. coli product with a recorded long history of safe use
Zschüttig, Anke; Beimfohr, Claudia; Geske, Thomas; Auerbach, Christian; Cook, Helen; Zimmermann, Kurt; Gunzer, Florian
2015-01-01
The probiotic product Symbioflor2 (DSM 17252) is a bacterial concentrate of six different Escherichia coli genotypes, whose complete genome sequences are compared here, between each other as well as to other E. coli genomes. The genome sequences of Symbioflor2 E. coli components contained a number of virulence-associated genes. Their presence seems to be in conflict with a recorded history of safe use, and with the observed low frequency of adverse effects over a period of more than 6 years. The genome sequences were used to identify unique sequences for each component, for which strain-specific hybridization probes were designed. A colonization study was conducted whereby five volunteers were exposed to an exceptionally high single dose. The results showed that the probiotic E. coli could be detected for 3 months or longer in their stools, and this was in particular the case for those components containing higher numbers of virulence-associated genes. Adverse effects from this long-term colonization were absent. Thus, the presence of the identified virulence genes does not result in a pathogenic phenotype in the genetic background of these probiotic E. coli. PMID:25883796
Enzymatic Incorporation of Modified Purine Nucleotides in DNA.
Abu El Asrar, Rania; Margamuljana, Lia; Abramov, Mikhail; Bande, Omprakash; Agnello, Stefano; Jang, Miyeon; Herdewijn, Piet
2017-12-14
A series of nucleotide analogues, with a hypoxanthine base moiety (8-aminohypoxanthine, 1-methyl-8-aminohypoxanthine, and 8-oxohypoxanthine), together with 5-methylisocytosine were tested as potential pairing partners of N 8 -glycosylated nucleotides with an 8-azaguanine or 8-aza-9-deazaguanine base moiety by using DNA polymerases (incorporation studies). The best results were obtained with the 5-methylisocytosine nucleotide followed by the 1-methyl-8-aminohypoxanthine nucleotide. The experiments demonstrated that small differences in the structure (8-azaguanine versus 8-aza-9-deazaguanine) might lead to significant differences in recognition efficiency and selectivity, base pairing by Hoogsteen recognition at the polymerase level is possible, 8-aza-9-deazaguanine represents a self-complementary base pair, and a correlation exists between in vitro incorporation studies and in vivo recognition by natural bases in Escherichia coli, but this recognition is not absolute (exceptions were observed). © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
The interaction of the Eco R1 restriction enzyme E.coli with nucleotides
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hollis, Donald F.
1979-11-01
The Eco R1 restriction enzyme can be shown to be inhibited by nucleotides which correspond to any part of its known site of phosphodiesterase activity. A series of di-, tetra-, and hexa-nucleotide fragments were synthesized and their effect on the activity of the enzyme upon superhelical Co1 E1 DNA studied. The inhibition caused by the individual mononucleotides were also studied. In general all the nucleotide fragments showed some form of interaction with the enzyme system. Tetranucleotides were stronger inhibitors than dinucleotides, which in turn were stronger inhibitors than the mononucleotides. Within each category of inhibitors, those containing the phosphodiester bondmore » which is acted upon by the enzyme were the strongest inhibitors. Only those fragments which were consistent with the enzymes site of activity showed competitive inhibition kinetics. Nucleotides which do not fit within the site of phosphodiesterase activity show non-competitive inhibition kinetics.« less
Arias-Pulido, Hugo; Peyton, Cheri L; Torrez-Martínez, Norah; Anderson, D Nelson; Wheeler, Cosette M
2005-07-20
While HPV 16 variant lineages have been well characterized, the knowledge about HPV 18 variants is limited. In this study, HPV 18 nucleotide variations in the E2 hinge region were characterized by sequence analysis in 47 control and 51 tumor specimens. Fifty of these specimens were randomly selected for sequencing of an LCR-E6 segment and 20 samples representative of LCR-E6 and E2 sequence variants were examined across the L1 region. A total of 2770 nucleotides per HPV 18 variant genome were considered in this study. HPV 18 variant nucleotides were linked among all gene segments analyzed and grouped into three main branches: Asian-American (AA), European (E), and African (Af). These three branches were equally distributed among controls and cases and when stratified by Hispanic and non-Hispanic ethnicities. Among invasive cervical cancer cases, no significant differences in the three HPV variant branches were observed among ethnic groups or when stratified by histopathology (squamous vs. adenocarcinoma). The Af branch showed the greatest nucleotide variability when compared to the HPV 18 reference sequence and was more closely related to HPV 45 than either AA or E branches. Our data also characterize nucleotide and amino acid variations in the L1 capsid gene among HPV 18 variants, which may be relevant to vaccine strategies and subsequent studies of naturally occurring HPV 18 variants. Several novel HPV 18 nucleotide variations were identified in this study.
Advances in Molecular Serotyping and Subtyping of Escherichia coli.
Fratamico, Pina M; DebRoy, Chitrita; Liu, Yanhong; Needleman, David S; Baranzoni, Gian Marco; Feng, Peter
2016-01-01
Escherichia coli plays an important role as a member of the gut microbiota; however, pathogenic strains also exist, including various diarrheagenic E. coli pathotypes and extraintestinal pathogenic E. coli that cause illness outside of the GI-tract. E. coli have traditionally been serotyped using antisera against the ca. 186 O-antigens and 53 H-flagellar antigens. Phenotypic methods, including bacteriophage typing and O- and H- serotyping for differentiating and characterizing E. coli have been used for many years; however, these methods are generally time consuming and not always accurate. Advances in next generation sequencing technologies have made it possible to develop genetic-based subtyping and molecular serotyping methods for E. coli, which are more discriminatory compared to phenotypic typing methods. Furthermore, whole genome sequencing (WGS) of E. coli is replacing established subtyping methods such as pulsed-field gel electrophoresis, providing a major advancement in the ability to investigate food-borne disease outbreaks and for trace-back to sources. A variety of sequence analysis tools and bioinformatic pipelines are being developed to analyze the vast amount of data generated by WGS and to obtain specific information such as O- and H-group determination and the presence of virulence genes and other genetic markers.
Van Kreijl, C F; Bos, J L
1977-01-01
The repeating nucleotide sequence of 68 base pairs in the mtDNA from an ethidium-induced cytoplasmic petite mutant of yeast has been determined. For sequence analysis specifically primed and terminated RNA copies, obtained by in vitro transcription of the separated strands, were use. The sequence consists of 66 consecutive AT base pairs flanked by two GC pairs and comprises nearly all of the mutant mitochondrial genome. The sequence, moreover, also represents the first part of wild-type mtDNA sequence so far. Images PMID:198740
Sekizuka, Tsuyoshi; Yokoi, Taeko; Murayama, Ohoshi; Millar, B Cherie; Moore, Johne; Matsuda, Motoo
2005-08-01
A newly constructed primer pair (lari-Af/lari-Ar) designed to generate a product of the flagellin (flaA) gene for urease-negative Campylobacter lari produced a PCR amplicon of about 1700 bp for 16 isolates from 7 seagulls, 5 humans, 3 food animals and one mussel in Japan and Northern Ireland. Nucleotide sequencing and alignments of the flaA amplicons from these isolates demonstrated that the deduced amino acid sequences of the possible open reading frame were 564-572 amino acid residues in length with calculated molecular weights of 58,804 to 59,463. The deduced amino acid sequence similarity analysis strongly suggested that the ORF of the flaA from the 16 isolates showed 70-75% sequence similarities to those of Campylobacter jejuni isolates. The approximate Mr of the flagellin purified from some of the isolates of urease-negative C. lari was estimated to range from 59.6 to 61.8 kDa. Thus, flagellin from the isolates of urease-negative C. lari was shown for the first time to have a molecular size similar to those of C. jejuni and Campylobacter coli isolates, but to be different from the shorter flaA and smaller flagellin of urease-positive thermophilic Campylobacter (UPTC) isolates. Flagellins from C. lari spp., consisting of the two representative taxa of urease-negative C. lari and UPTC, thus show genotypic and phenotypic diversity.
Inui, Masayuki; Roh, Jung Hyeob; Zahn, Kenneth; Yukawa, Hideaki
2000-01-01
A 15-kb cryptic plasmid was obtained from a natural isolate of Rhodopseudomonas palustris. The plasmid, designated pMG101, was able to replicate in R. palustris and in closely related strains of Bradyrhizobium japonicum and phototrophic Bradyrhizobium species. However, it was unable to replicate in the purple nonsulfur bacterium Rhodobacter sphaeroides and in Rhizobium species. The replication region of pMG101 was localized to a 3.0-kb SalI-XhoI fragment, and this fragment was stably maintained in R. palustris for over 100 generations in the absence of selection. The complete nucleotide sequence of this fragment revealed two open reading frames (ORFs), ORF1 and ORF2. The deduced amino acid sequence of ORF1 is similar to sequences of Par proteins, which mediate plasmid stability from certain plasmids, while ORF2 was identified as a putative rep gene, coding for an initiator of plasmid replication, based on homology with the Rep proteins of several other plasmids. The function of these sequences was studied by deletion mapping and gene disruptions of ORF1 and ORF2. pMG101-based Escherichia coli-R. palustris shuttle cloning vectors pMG103 and pMG105 were constructed and were stably maintained in R. palustris growing under nonselective conditions. The ability of plasmid pMG101 to replicate in R. palustris and its close phylogenetic relatives should enable broad application of these vectors within this group of α-proteobacteria. PMID:10618203
Simon, J W; Slabas, A R
1998-09-18
The GenBank database was searched using the E. coli malonyl CoA:ACP transacylase (MCAT) sequence, for plant protein/cDNA sequences corresponding to MCAT, a component of plant fatty acid synthetase (FAS), for which the plant cDNA has not been isolated. A 272-bp Zea mays EST sequence (GenBank accession number: AA030706) was identified which has strong homology to the E. coli MCAT. A PCR derived cDNA probe from Zea mays was used to screen a Brassica napus (rape) cDNA library. This resulted in the isolation of a 1200-bp cDNA clone which encodes an open reading frame corresponding to a protein of 351 amino acids. The protein shows 47% homology to the E. coli MCAT amino acid sequence in the coding region for the mature protein. Expression of a plasmid (pMCATrap2) containing the plant cDNA sequence in Fab D89, an E. coli mutant, in MCAT activity restores growth demonstrating functional complementation and direct function of the cloned cDNA. This is the first functional evidence supporting the identification of a plant cDNA for MCAT.
Complete genome sequence of the clinical Campylobacter coli isolate 15-537360
USDA-ARS?s Scientific Manuscript database
Campylobacter coli strain 15-537360 was originally isolated from a 42 year-old patient with gastroenteritis. Here we report its complete genome sequence, which comprises a 1.7 Mbp chromosome and a 29 kbp conjugative cryptic plasmid. This is the first complete genome sequence of a clinical isolate of...
Code of Federal Regulations, 2010 CFR
2010-07-01
... 37 Patents, Trademarks, and Copyrights 1 2010-07-01 2010-07-01 false Form and format for... And/or Amino Acid Sequences § 1.824 Form and format for nucleotide and/or amino acid sequence... Code for Information Interchange (ASCII) text. No other formats shall be allowed. (3) The computer...
The nucleotide sequence of 5S rRNA from a cellular slime mold Dictyostelium discoideum.
Hori, H; Osawa, S; Iwabuchi, M
1980-01-01
The nucleotide sequence of ribosomal 5S rRNA from a cellular slime mold Dictyostelium discoideum is GUAUACGGCCAUACUAGGUUGGAAACACAUCAUCCCGUUCGAUCUGAUA AGUAAAUCGACCUCAGGCCUUCCAAGUACUCUGGUUGGAGACAACAGGGGAACAUAGGGUGCUGUAUACU. A model for the secondary structure of this 5S rRNA is proposed. The sequence is more similar to those of animals (62% similarity on the average) rather than those of yeasts (56%). Images PMID:7465421
Hughes, M. S.; Hoey, E. M.; Coyle, P. V.
1993-01-01
Ten coxsackievirus B4 (CVB4) strains isolated from clinical and environmental sources in Northern Ireland in 1985-7, were compared at the nucleotide sequence level. Dideoxynucleotide sequencing of a polymerase chain reaction (PCR) amplified fragment, spanning the VP1/P2A genomic region, classified the isolates into two distinct groups or genotypes as defined by Rico-Hesse and colleagues for poliovirus type 1. Isolates within each group shared approximately 99% sequence identity at the nucleotide level whereas < or = 86% sequence identity was shared between groups. One isolate derived from a clinical specimen in 1987 was grouped with six CVB4 isolates recovered from the aquatic environment in 1986-7. The second group comprised CVB4 isolates from clinical specimens in 1985-6. Both groups were different at the nucleotide level from the prototype strain isolated in 1950. It was concluded that the method could be used to sub-type CVB4 isolates and would be of value in epidemiological studies of CVB4. Predicted amino acid sequences revealed non-conservation of the tyrosine residue at the VP1/P2A cleavage site but were of little value in distinguishing CVB4 variants. PMID:8386098
The complete nucleotide sequence of RNA beta from the type strain of barley stripe mosaic virus.
Gustafson, G; Armour, S L
1986-01-01
The complete nucleotide sequence of RNA beta from the type strain of barley stripe mosaic virus (BSMV) has been determined. The sequence is 3289 nucleotides in length and contains four open reading frames (ORFs) which code for proteins of Mr 22,147 (ORF1), Mr 58,098 (ORF2), Mr 17,378 (ORF3), and Mr 14,119 (ORF4). The predicted N-terminal amino acid sequence of the polypeptide encoded by the ORF nearest the 5'-end of the RNA (ORF1) is identical (after the initiator methionine) to the published N-terminal amino acid sequence of BSMV coat protein for 29 of the first 30 amino acids. ORF2 occupies the central portion of the coding region of RNA beta and ORF3 is located at the 3'-end. The ORF4 sequence overlaps the 3'-region of ORF2 and the 5'-region of ORF3 and differs in codon usage from the other three RNA beta ORFs. The coding region of RNA beta is followed by a poly(A) tract and a 238 nucleotide tRNA-like structure which are common to all three BSMV genomic RNAs. Images PMID:3754962
International congress on DNA damage and repair: Book of abstracts
DOE Office of Scientific and Technical Information (OSTI.GOV)
Not Available
This document contains the abstracts of 105 papers presented at the Congress. Topics covered include the Escherichia coli nucleotide excision repair system, DNA repair in malignant transformations, defective DNA repair, and gene regulation. (TEM)
The evolution of energy-transducing systems. Studies with archaebacteria
NASA Technical Reports Server (NTRS)
Stan-Lotter, Helga
1994-01-01
N-ethylmaleimide (NEM) inhibits the ATPase of H. saccharovorum in a nucleotide protectable manner. The bulk of C-14 NEM is incorporated into subunit one. Cyanogen bromide cleavage of labeled subunit one indicated that NEM bound to a peptide of a Mr of about 8,900. Thus, Cys 262 (H. salinarium numbering) may be the NEM binding site. Cyanogen bromide fragments have been submitted for sequencing. To prove the presence of three Cys residues in subunit one, alkaline cleavage following treatment with NTCB was carried out. Thiol reagents such as p-chloro mercuri phenyl sulfonate also inhibited the ATPase. However, this inhibition was not nucleotide-protectable, suggesting a different location and role for the PCMS-sensitive Cys. The proteolipid which was extracted with chloroform/methanol from the membranes of H. saccharovorum cross-reacted with an antiserum against subunit c (the DCCD-binding protein) of Escherichia coli. Following labeling of membranes from H. saccharovorum with C-14 DCCD under conditions, which inhibited ATP synthesis, the isotope was incorporated into one protein of Mr of about 6,500. Thus, the proteolipid of H. saccharovorum and the DCCD-labeled peptide may be identical. If so, these results suggest that the proteolipid is a component of the membrane sector of an archaeal F-type ATP synthase.
Holland, Erika G; Buhr, Diane L; Acca, Felicity E; Alderman, Dawn; Bovat, Kristin; Busygina, Valeria; Kay, Brian K; Weiner, Michael P; Kiss, Margaret M
2013-08-30
Affinity maturation is an important part of the recombinant antibody development process. There are several well-established approaches for generating libraries of mutated antibody genes for affinity maturation, but these approaches are generally too laborious or expensive to allow high-throughput, parallel processing of multiple antibodies. Here, we describe a scalable approach that enables the generation of libraries with greater than 10(8) clones from a single Escherichia coli transformation. In our method, a mutated DNA fragment is produced using PCR conditions that promote nucleotide misincorporation into newly synthesized DNA. In the PCR reaction, one of the primers contains at least three phosphorothioate linkages at its 5' end, and treatment of the PCR product with a 5' to 3' exonuclease is used to preferentially remove the strand synthesized with the non-modified primer, resulting in a single-stranded DNA fragment. This fragment then serves as a megaprimer to prime DNA synthesis on a uracilated, circular, single-stranded template in a Kunkel-like mutagenesis reaction that biases nucleotide base-changes between the megaprimer and uracilated DNA sequence in favor of the in vitro synthesized megaprimer. This method eliminates the inefficient subcloning steps that are normally required for the construction of affinity maturation libraries from randomly mutagenized antibody genes. Copyright © 2013. Published by Elsevier B.V.
Brzuszkiewicz, Elzbieta; Thürmer, Andrea; Schuldes, Jörg; Leimbach, Andreas; Liesegang, Heiko; Meyer, Frauke-Dorothee; Boelter, Jürgen; Petersen, Heiko; Gottschalk, Gerhard; Daniel, Rolf
2011-12-01
The genome sequences of two Escherichia coli O104:H4 strains derived from two different patients of the 2011 German E. coli outbreak were determined. The two analyzed strains were designated E. coli GOS1 and GOS2 (German outbreak strain). Both isolates comprise one chromosome of approximately 5.31 Mbp and two putative plasmids. Comparisons of the 5,217 (GOS1) and 5,224 (GOS2) predicted protein-encoding genes with various E. coli strains, and a multilocus sequence typing analysis revealed that the isolates were most similar to the entero-aggregative E. coli (EAEC) strain 55989. In addition, one of the putative plasmids of the outbreak strain is similar to pAA-type plasmids of EAEC strains, which contain aggregative adhesion fimbrial operons. The second putative plasmid harbors genes for extended-spectrum β-lactamases. This type of plasmid is widely distributed in pathogenic E. coli strains. A significant difference of the E. coli GOS1 and GOS2 genomes to those of EAEC strains is the presence of a prophage encoding the Shiga toxin, which is characteristic for enterohemorrhagic E. coli (EHEC) strains. The unique combination of genomic features of the German outbreak strain, containing characteristics from pathotypes EAEC and EHEC, suggested that it represents a new pathotype Entero-Aggregative-Haemorrhagic E scherichia c oli (EAHEC).