Isolation of a novel plasmid from Couchioplanes caeruleus and construction of two plasmid vectors for gene expression in Actinoplanes missouriensis.

PubMed

Jang, Moon-Sun; Fujita, Azusa; Ikawa, Satomi; Hanawa, Keitaro; Yamamura, Hideki; Tamura, Tomohiko; Hayakawa, Masayuki; Tezuka, Takeaki; Ohnishi, Yasuo

2015-01-01

To date, no plasmid vector has been developed for the rare actinomycete Actinoplanes missouriensis. Moreover, no small circular plasmid has been reported to exist in the genus Actinoplanes. Here, a novel plasmid, designated pCAZ1, was isolated from Couchioplanes caeruleus subsp. azureus via screening for small circular plasmids in Actinoplanes (57 strains) and Couchioplanes (2 strains). Nucleotide sequencing revealed that pCAZ1 is a 5845-bp circular molecule with a G + C content of 67.5%. The pCAZ1 copy number was estimated at 30 per chromosome. pCAZ1 contains seven putative open reading frames, one of which encodes a protein containing three motifs conserved among plasmid-encoded replication proteins that are involved in the rolling-circle mechanism of replication. Detection of single-stranded DNA intermediates in C. caeruleus confirmed that pCAZ1 replicates by this mechanism. The ColE1 origin from pBluescript SK(+) and the oriT sequence with the apramycin resistance gene aac(3)IV from pIJ773 were inserted together into pCAZ1, to construct the Escherichia coli-A. missouriensis shuttle vectors, pCAM1 and pCAM2, in which the foreign DNA fragment was inserted into pCAZ1 in opposite directions. pCAM1 and pCAM2 were successfully transferred to A. missouriensis through the E. coli-mediated conjugative transfer system. The copy numbers of pCAM1 and pCAM2 in A. missouriensis were estimated to be one and four per chromosome, respectively. Thus, these vectors can be used as effective genetic tools for homologous and heterologous gene expression studies in A. missouriensis. Copyright © 2014 Elsevier Inc. All rights reserved.

Integration of narrow-host-range vectors from Escherichia coli into the genomes of amino acid-producing corynebacteria after intergeneric conjugation.

PubMed

Mateos, L M; Schäfer, A; Kalinowski, J; Martin, J F; Pühler, A

1996-10-01

Conjugative transfer of mobilizable derivatives of the Escherichia coli narrow-host-range plasmids pBR322, pBR325, pACYC177, and pACYC184 from E. coli to species of the gram-positive genera Corynebacterium and Brevibacterium resulted in the integration of the plasmids into the genomes of the recipient bacteria. Transconjugants appeared at low frequencies and reproducibly with a delay of 2 to 3 days compared with matings with replicative vectors. Southern analysis of corynebacterial transconjugants and nucleotide sequences from insertion sites revealed that integration occurs at different locations and that different parts of the vector are involved in the process. Integration is not dependent on indigenous insertion sequence elements but results from recombination between very short homologous DNA segments (8 to 12 bp) present in the vector and in the host DNA. In the majority of the cases (90%), integration led to cointegrate formation, and in some cases, deletions or rearrangements occurred during the recombination event. Insertions were found to be quite stable even in the absence of selective pressure.

Integration of narrow-host-range vectors from Escherichia coli into the genomes of amino acid-producing corynebacteria after intergeneric conjugation.

PubMed Central

Mateos, L M; Schäfer, A; Kalinowski, J; Martin, J F; Pühler, A

1996-01-01

Conjugative transfer of mobilizable derivatives of the Escherichia coli narrow-host-range plasmids pBR322, pBR325, pACYC177, and pACYC184 from E. coli to species of the gram-positive genera Corynebacterium and Brevibacterium resulted in the integration of the plasmids into the genomes of the recipient bacteria. Transconjugants appeared at low frequencies and reproducibly with a delay of 2 to 3 days compared with matings with replicative vectors. Southern analysis of corynebacterial transconjugants and nucleotide sequences from insertion sites revealed that integration occurs at different locations and that different parts of the vector are involved in the process. Integration is not dependent on indigenous insertion sequence elements but results from recombination between very short homologous DNA segments (8 to 12 bp) present in the vector and in the host DNA. In the majority of the cases (90%), integration led to cointegrate formation, and in some cases, deletions or rearrangements occurred during the recombination event. Insertions were found to be quite stable even in the absence of selective pressure. PMID:8824624

GeneGuard: A modular plasmid system designed for biosafety.

PubMed

Wright, Oliver; Delmans, Mihails; Stan, Guy-Bart; Ellis, Tom

2015-03-20

Synthetic biology applications in biosensing, bioremediation, and biomining envision the use of engineered microbes beyond a contained laboratory. Deployment of such microbes in the environment raises concerns of unchecked cellular proliferation or unwanted spread of synthetic genes. While antibiotic-resistant plasmids are the most utilized vectors for introducing synthetic genes into bacteria, they are also inherently insecure, acting naturally to propagate DNA from one cell to another. To introduce security into bacterial synthetic biology, we here took on the task of completely reformatting plasmids to be dependent on their intended host strain and inherently disadvantageous for others. Using conditional origins of replication, rich-media compatible auxotrophies, and toxin-antitoxin pairs we constructed a mutually dependent host-plasmid platform, called GeneGuard. In this, replication initiators for the R6K or ColE2-P9 origins are provided in trans by a specified host, whose essential thyA or dapA gene is translocated from a genomic to a plasmid location. This reciprocal arrangement is stable for at least 100 generations without antibiotic selection and is compatible for use in LB medium and soil. Toxin genes ζ or Kid are also employed in an auxiliary manner to make the vector disadvantageous for strains not expressing their antitoxins. These devices, in isolation and in concert, severely reduce unintentional plasmid propagation in E. coli and B. subtilis and do not disrupt the intended E. coli host's growth dynamics. Our GeneGuard system comprises several versions of modular cargo-ready vectors, along with their requisite genomic integration cassettes, and is demonstrated here as an efficient vector for heavy-metal biosensors.

A Simple And Rapid Minicircle DNA Vector Manufacturing System

PubMed Central

Kay, Mark A; He, Cheng-Yi; Chen, Zhi-Ying

2010-01-01

Minicircle DNA vectors consisting of a circular expression cassette devoid of the bacterial plasmid DNA backbone provides several advantages including sustained transgene expression in quiescent cells/tissues. Their use has been limited by labor-intensive production. We report on a strategy for making multiple genetic modifications in E.coli to construct a producer strain that stably expresses a set of inducible minicircle-assembly enzymes, the øC31-integrase and I-SceI homing-endonuclease. This bacterial strain is capable of producing highly purified minicircle yields in the same time frame as routine plasmid DNA. It is now feasible for minicircle DNA vectors to replace routine plasmids in mammalian transgene expression studies. PMID:21102455

Preclinical development of BCG.HIVA2auxo.int, harboring an integrative expression vector, for a HIV-TB Pediatric vaccine. Enhancement of stability and specific HIV-1 T-cell immunity.

PubMed

Mahant, Aakash; Saubi, Narcís; Eto, Yoshiki; Guitart, Núria; Gatell, Josep Ma; Hanke, Tomáš; Joseph, Joan

2017-08-03

One of the critical issues that should be addressed in the development of a BCG-based HIV vaccine is genetic plasmid stability. Therefore, to address this issue we have considered using integrative vectors and the auxotrophic mutant of BCG complemented with a plasmid carrying a wild-type complementing gene. In this study, we have constructed an integrative E. coli-mycobacterial shuttle plasmid, p2auxo.HIVA int , expressing the HIV-1 clade A immunogen HIVA. This shuttle vector uses an antibiotic resistance-free mechanism for plasmid selection and maintenance. It was first transformed into a glycine auxotrophic E. coli strain and subsequently transformed into a lysine auxotrophic Mycobacterium bovis BCG strain to generate the vaccine BCG.HIVA 2auxo.int . Presence of the HIVA gene sequence and protein expression was confirmed. We demonstrated that the in vitro stability of the integrative plasmid p2auxo.HIVA int was increased 4-fold, as compared with the BCG strain harboring the episomal plasmid, and was genetically and phenotypically characterized. The BCG.HIVA 2auxo.int vaccine in combination with modified vaccinia virus Ankara (MVA).HIVA was found to be safe and induced HIV-1 and Mycobacterium tuberculosis-specific interferon-γ-producing T-cell responses in adult BALB/c mice. We have engineered a more stable and immunogenic BCG-vectored vaccine using the prototype immunogen HIVA. Thus, the use of integrative expression vectors and the antibiotic-free plasmid selection system based on "double" auxotrophic complementation are likely to improve the mycobacterial vaccine stability in vivo and immunogenicity to develop not only recombinant BCG-based vaccines expressing second generation of HIV-1 immunogens but also other major pediatric pathogens to prime protective responses shortly following birth.

Direct Cloning of Yeast Genes from an Ordered Set of Lambda Clones in Saccharomyces Cerevisiae by Recombination in Vivo

PubMed Central

Erickson, J. R.; Johnston, M.

1993-01-01

We describe a technique that facilitates the isolation of yeast genes that are difficult to clone. This technique utilizes a plasmid vector that rescues lambda clones as yeast centromere plasmids. The source of these lambda clones is a set of clones whose location in the yeast genome has been determined by L. Riles et al. in 1993. The Esherichia coli-yeast shuttle plasmid carries URA3, ARS4 and CEN6, and contains DNA fragments from the lambda vector that flank the cloned yeast insert. When yeast is cotransformed with linearized plasmid and lambda clone DNA, Ura(+) transformants are obtained by a recombination event between the lambda clone and the plasmid vector that generates an autonomously replicating plasmid containing the cloned yeast DNA sequences. Genes whose genetic map positions are known can easily be identified and recovered in this plasmid by testing only those lambda clones that map to the relevant region of the yeast genome for their ability to complement the mutant phenotype. This technique facilitates the isolation of yeast genes that resist cloning either because (1) they are underrepresented in yeast genomic libraries amplified in E. coli, (2) they provide phenotypes that are too marginal to allow selection of the gene by genetic complementation or (3) they provide phenotypes that are laborious to score. We demonstrate the utility of this technique by isolating three genes, GAL83, SSN2 and MAK7, each of which presents one of these problems for cloning. PMID:8514124

Characterization of a Theta-Type Plasmid from Lactobacillus sakei: a Potential Basis for Low-Copy-Number Vectors in Lactobacilli

PubMed Central

Alpert, Carl-Alfred; Crutz-Le Coq, Anne-Marie; Malleret, Christine; Zagorec, Monique

2003-01-01

The complete nucleotide sequence of the 13-kb plasmid pRV500, isolated from Lactobacillus sakei RV332, was determined. Sequence analysis enabled the identification of genes coding for a putative type I restriction-modification system, two genes coding for putative recombinases of the integrase family, and a region likely involved in replication. The structural features of this region, comprising a putative ori segment containing 11- and 22-bp repeats and a repA gene coding for a putative initiator protein, indicated that pRV500 belongs to the pUCL287 subfamily of theta-type replicons. A 3.7-kb fragment encompassing this region was fused to an Escherichia coli replicon to produce the shuttle vector pRV566 and was observed to be functional in L. sakei for plasmid replication. The L. sakei replicon alone could not support replication in E. coli. Plasmid pRV500 and its derivative pRV566 were determined to be at very low copy numbers in L. sakei. pRV566 was maintained at a reasonable rate over 20 generations in several lactobacilli, such as Lactobacillus curvatus, Lactobacillus casei, and Lactobacillus plantarum, in addition to L. sakei, making it an interesting basis for developing vectors. Sequence relationships with other plasmids are described and discussed. PMID:12957947

Molecular cloning and expression of Corynebacterium glutamicum genes for amino acid synthesis in Escherichia coli cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Beskrovnaya, O.Yu.; Fonshtein, M.Yu.; Kolibaba, L.G.

1989-01-01

Molecular cloning of Corynebacterium glutamicum genes for threonine and lysine synthesis has been done in Escherichia coli cells. The clonal library of EcoRI fragments of chromosomal DNA of C. glutamicum was constructed on the plasmid vector /lambda/pSL5. The genes for threonine and lysine synthesis were identified by complementation of E. coli mutations in thrB and lysA genes, respectively. Recombinant plasmids, isolated from independent ThrB/sup +/ clone have a common 4.1-kb long EcoRI DNA fragment. Hybrid plasmids isolated from LysA/sup +/ transductants of E. coli have common 2.2 and 3.3 kb long EcoRI fragments of C. glutamicum DNA. The hybrid plasmidsmore » consistently transduced the markers thrB/sup +/ and lysA/sup +/. The Southern hybridization analysis showed that the cloned DNA fragments hybridized with the fragments of identical length in C. glutamicum chromosomes.« less

[Cloning and sequence analysis of recombinant fusion gene of Escherichia coli heat-liable enterotoxin B subunit and Actinobacillus actinomycetemcomitans fimbria associative protein].

PubMed

Li, Yi; Sun, Hong-chen; Guo, Xue-jun; Feng, Shu-zhang

2005-02-01

To clone the recombinant fusion gene of Escherichia coli heat-liable enterotoxin B subunit (Ltb) and Actinobacillus actinomycetemcomitans fimbria associative protein (Fap). Two couples of primers were designed for PCR according to the known sequence of ltb and fap. The ltb and fap gene were obtained by amplification PCR technique from plasmid EWD299 of Escherichia coli and Actinobacillus actinomycetemcomitans 310 DNA respectively, and fused them by PCR. The fusion gene ltb-fap were cloning into plasmid pET28a(+). The recombined plasmid pET28a ltb-fap was transformed into Escherichia coli DH5alpha. The recombinant was screened and identified by restriction enzyme and PCR. The cloned gene was sequenced. The ltb-fap about 531bp in size was obtained successfully, and identified by PCR, restrictive enzyme and sequence analysis. The vector of pET28a ltb-fap was obtained.

Comparative Sequence Analysis of Plasmids from Lactobacillus delbrueckii and Construction of a Shuttle Cloning Vector▿

PubMed Central

Lee, Ju-Hoon; Halgerson, Jamie S.; Kim, Jeong-Hwan; O'Sullivan, Daniel J.

2007-01-01

While plasmids are very commonly associated with the majority of the lactic acid bacteria, they are only very rarely associated with Lactobacillus delbrueckii, with only four characterized to date. In this study, the complete sequence of a native plasmid, pDOJ1, from a strain of Lactobacillus delbrueckii subsp. bulgaricus was determined. It consisted of a circular DNA molecule of 6,220 bp with a G+C content of 44.6% and a characteristic ori and encoded six open reading frames (ORFs), of which functions could be predicted for three—a mobilization (Mob) protein, a transposase, and a fused primase-helicase replication protein. Comparative analysis of pDOJ1 and the other available L. delbrueckii plasmids (pLBB1, pJBL2, pN42, and pLL1212) revealed a very similar organization and amino acid identities between 85 and 98% for the putative proteins of all six predicted ORFs from pDOJ1, reflecting a common origin for L. delbrueckii plasmids. Analysis of the fused primase-helicase replication gene found a similar fused organization only in the theta replicating group B plasmids from Streptococcus thermophilus. This observation and the ability of the replicon to function in S. thermophilus support the idea that the origin of plasmids in L. delbrueckii was likely from S. thermophilus. This may reflect the close association of these two species in dairy fermentations, particularly yogurt production. As no vector based on plasmid replicons from L. delbrueckii has previously been constructed, an Escherichia coli-L. delbrueckii shuttle cloning vector, pDOJ4, was constructed from pDOJ1, the p15A ori, the chloramphenicol resistance gene of pCI372, and the lacZ polylinker from pUC18. This cloning vector was successfully introduced into E. coli, L. delbrueckii subsp. bulgaricus, S. thermophilus, and Lactococcus lactis. This shuttle cloning vector provides a new tool for molecular analysis of Lactobacillus delbrueckii and other lactic acid bacteria. PMID:17526779

Characterization of new plasmids from methylotrophic bacteria.

PubMed

Brenner, V; Holubová, I; Benada, O; Hubácek, J

1991-07-01

Several tens of methanol-utilizing bacterial strains isolated from soil were screened for the presence of plasmids. From the obligate methylotroph Methylomonas sp. strain R103a plasmid pIH36 (36 kb) was isolated and its restriction map was constructed. In pink-pigmented facultative methylotrophs (PPFM), belonging to the genus Methylobacterium four plasmids were detected: plasmids pIB200 (200 kb) and pIB14 (14 kb) in the strain R15d and plasmids pWU14 (14 kb) and pWU7 (7.8 kb) in the strain M17. Because of the small size and the presence of several unique REN sites (HindIII, EcoRI, NcoI), plasmid pWU7 was chosen for the construction of a vector for cloning in methylotrophs. Cointegrates pKWU7A and pKWU7B were formed between pWU7 and the E. coli plasmid pK19 Kmr, which were checked for conjugative transfer from E. coli into the methylotrophic host.

The construction of a synthetic Escherichia coli trp promoter and its use in the expression of a synthetic interferon gene.

PubMed Central

Windass, J D; Newton, C R; De Maeyer-Guignard, J; Moore, V E; Markham, A F; Edge, M D

1982-01-01

An 82 base pair DNA fragment has been synthesised which contains the E. coli trp promoter and operator sequences and also encodes the first Shine Dalgarno sequence of the trp operon. This DNA fragment is flanked by EcoRI and ClaI/TaqI cohesive ends and is thus easy to clone, transfer between vector systems and couple to genes to drive their expression. It has been cloned into plasmid pAT153, producing a convenient trp promoter vector. We have also joined the fragment to a synthetic IFN-alpha 1 gene, using synthetic oligonucleotides to generate a completely natural, highly efficient bacterial translation initiation signal on the promoter proximal side of the IFN gene. Plasmids carrying this construction enable E. coli cells to express IFN-alpha 1 almost constitutively and with significantly higher efficiency than from a lacUV5 promoter based system. Images PMID:6184675

Design and construction of functional AAV vectors.

PubMed

Gray, John T; Zolotukhin, Serge

2011-01-01

Using the basic principles of molecular biology and laboratory techniques presented in this chapter, researchers should be able to create a wide variety of AAV vectors for both clinical and basic research applications. Basic vector design concepts are covered for both protein coding gene expression and small non-coding RNA gene expression cassettes. AAV plasmid vector backbones (available via AddGene) are described, along with critical sequence details for a variety of modular expression components that can be inserted as needed for specific applications. Protocols are provided for assembling the various DNA components into AAV vector plasmids in Escherichia coli, as well as for transferring these vector sequences into baculovirus genomes for large-scale production of AAV in the insect cell production system.

Partial complementation of the UV sensitivity of E. coli and yeast excision repair mutants by the cloned denV gene of bacteriophage T4.

PubMed

Chenevert, J M; Naumovski, L; Schultz, R A; Friedberg, E C

1986-04-01

The denV gene of bacteriophage T4 was reconstituted from two overlapping DNA fragments cloned in M13 vectors. The coding region of the intact gene was tailored into a series of plasmid vectors containing different promoters suitable for expression of the gene in E. coli and in yeast. Induction of the TAC promoter with IPTG resulted in overexpression of the gene, which was lethal to E. coli. Expression of the TACdenV gene in the absence of IPTG, or the use of the yeast GAL1 or ADH promoters resulted in partial complementation of the UV sensitivity of uvrA, uvrB, uvrC and recA mutants of E. coli and rad1, rad2, rad3, rad4 and rad10 mutants of S. cerevisiae. The extent of denV-mediated reactivation of excision-defective mutants was approximately equal to that of photoreactivation of such strains. Excision proficient E. coli cells transformed with a plasmid containing the denV gene were slightly more resistant to ultraviolet (UV) radiation than control cells without the denV gene. On the other hand, excision proficient yeast cells were slightly more sensitive to killing by UV radiation following transformation with a plasmid containing the denV gene. This effect was more pronounced in yeast mutants of the RAD52 epistasis group.

Construction of a novel gene bank of Bacillus subtilis using a low copy number vector in Escherichia coli.

PubMed

Hasnain, S; Thomas, C M

1986-07-01

Low copy number vector plasmid pCT571 was constructed to clone Bacillus subtilis genomic fragments in Escherichia coli. pCT571 confers KmR, TcR and CmR in E. coli and CmR in B. subtilis. It has unique restriction sites within the KmR and TcR markers to allow screening for recombinant plasmids by insertional inactivation of these genes. It contains the pSC101 replicon and replicates normally at six to eight copies per chromosome equivalent in E. coli. It also contains oriVRK2, which when supplied with the product of the trfA gene of RK2 in trans, allows pCT571 to replicate at 35-40 copies per chromosome equivalent. A B. subtilis gene bank was created by cloning partially Sau3A-digested and size-fractionated fragments of B. subtilis chromosomal DNA into the BamHI site of pCT571. DNA from 1097 KmR TcS transformants was extracted and analysed electrophoretically as supercoiled DNA and after digesting with EcoRI or EcoRI and SalI. Approximately 1000 hybrid plasmids were found with reasonably sized B. subtilis fragments. The mean size of the inserts in pCT571 is 8 kb, ranging from 4 to 20 kb in different plasmids. The gene bank covers most of the B. subtilis chromosome, as demonstrated by the results of screening the gene bank for selectable nutritional markers in E. coli and B. subtilis. Hybrid plasmids which complement E. coli mutants for arg, his, lys, met, pdx, pyr and thr markers were identified from the gene bank. In B. subtilis the presence of argC, cysA, dal, hisA, ilvA, leuA, lys, metB, metC, phe, purA, purB, thr and trpC was established by transformation experiments. The effects of copy number on cloning and long-term maintenance in the bacterial strains were also investigated. At high copy number some hybrid plasmids cannot be maintained at all, while others show an increased rate of structural deletions and rearrangements.

Functional characterization of replication and stability factors of an incompatibility group P-1 plasmid from Xylella fastidiosa.

PubMed

Lee, Min Woo; Rogers, Elizabeth E; Stenger, Drake C

2010-12-01

Xylella fastidiosa strain riv11 harbors a 25-kbp plasmid (pXF-RIV11) belonging to the IncP-1 incompatibility group. Replication and stability factors of pXF-RIV11 were identified and used to construct plasmids able to replicate in X. fastidiosa and Escherichia coli. Replication in X. fastidiosa required a 1.4-kbp region from pXF-RIV11 containing a replication initiation gene (trfA) and the adjacent origin of DNA replication (oriV). Constructs containing trfA and oriV from pVEIS01, a related IncP-1 plasmid of the earthworm symbiont Verminephrobacter eiseniae, also were competent for replication in X. fastidiosa. Constructs derived from pXF-RIV11 but not pVEIS01 replicated in Agrobacterium tumefaciens, Xanthomonas campestris, and Pseudomonas syringae. Although plasmids bearing replication elements from pXF-RIV11 or pVEIS01 could be maintained in X. fastidiosa under antibiotic selection, removal of selection resulted in plasmid extinction after 3 weekly passages. Addition of a toxin-antitoxin addiction system (pemI/pemK) from pXF-RIV11 improved plasmid stability such that >80 to 90% of X. fastidiosa cells retained plasmid after 5 weekly passages in the absence of antibiotic selection. Expression of PemK in E. coli was toxic for cell growth, but toxicity was nullified by coexpression of PemI antitoxin. Deletion of N-terminal sequences of PemK containing the conserved motif RGD abolished toxicity. In vitro assays revealed a direct interaction of PemI with PemK, suggesting that antitoxin activity of PemI is mediated by toxin sequestration. IncP-1 plasmid replication and stability factors were added to an E. coli cloning vector to constitute a stable 6.0-kbp shuttle vector (pXF20-PEMIK) suitable for use in X. fastidiosa.

Cloning-independent plasmid construction for genetic studies in streptococci

PubMed Central

Xie, Zhoujie; Qi, Fengxia; Merritt, Justin

2013-01-01

Shuttle plasmids are among the few routinely utilized tools in the Streptococcus mutans genetic system that still require the use of classical cloning methodologies and intermediate hosts for genetic manipulation. Accordingly, it typically requires considerably less time and effort to introduce mutations onto the S. mutans chromosome than it does to construct shuttle vectors for expressing genes in trans. Occasionally, shuttle vector constructs also exhibit toxicity in E. coli, which prevents their proper assembly. To circumvent these limitations, we modified a prolonged overlap extension PCR (POE-PCR) protocol to facilitate direct plasmid assembly in S. mutans. Using solely PCR, we created the reporter vector pZX7, which contains a single minimal streptococcal replication origin and harbors a spectinomycin resistance cassette and the gusA gene encoding β-glucuronidase. We compared the efficiency of pZX7 assembly using multiple strains of S. mutans and were able to obtain from 5×103 – 2×105 CFU/μg PCR product. Likewise, we used pZX7 to further demonstrate that Streptococcus sanguinis and Streptococcus gordonii are also excellent hosts for cloning-independent plasmid assembly, which suggests that this system is likely to function in numerous other streptococci. Consequently, it should be possible to completely forgo the use of E. coli – Streptococcus shuttle vectors in many streptococcal species, thereby decreasing the time and effort required to assemble constructs and eliminating any toxicity issues associated with intermediate hosts. PMID:23673081

Cloning-independent plasmid construction for genetic studies in streptococci.

PubMed

Xie, Zhoujie; Qi, Fengxia; Merritt, Justin

2013-08-01

Shuttle plasmids are among the few routinely utilized tools in the Streptococcus mutans genetic system that still require the use of classical cloning methodologies and intermediate hosts for genetic manipulation. Accordingly, it typically requires considerably less time and effort to introduce mutations onto the S. mutans chromosome than it does to construct shuttle vectors for expressing genes in trans. Occasionally, shuttle vector constructs also exhibit toxicity in Escherichia coli, which prevents their proper assembly. To circumvent these limitations, we modified a prolonged overlap extension PCR (POE-PCR) protocol to facilitate direct plasmid assembly in S. mutans. Using solely PCR, we created the reporter vector pZX7, which contains a single minimal streptococcal replication origin and harbors a spectinomycin resistance cassette and the gusA gene encoding β-glucuronidase. We compared the efficiency of pZX7 assembly using multiple strains of S. mutans and were able to obtain from 5 × 10³ to 2 × 10⁵ CFU/μg PCR product. Likewise, we used pZX7 to further demonstrate that Streptococcus sanguinis and Streptococcus gordonii are also excellent hosts for cloning-independent plasmid assembly, which suggests that this system is likely to function in numerous other streptococci. Consequently, it should be possible to completely forgo the use of E. coli-Streptococcus shuttle vectors in many streptococcal species, thereby decreasing the time and effort required to assemble constructs and eliminating any toxicity issues associated with intermediate hosts. Copyright © 2013 Elsevier B.V. All rights reserved.

Cloning systems for Rhodococcus and related bacteria

DOEpatents

Finnerty, W.R.; Singer, M.E.

1990-08-28

A plasmid transformation system for Rhodococcus was developed using an Escherichia coli-Rhodococcus shuttle plasmid. Rhodococcus sp. H13-A contains three cryptic indigenous plasmids, designated pMVS100, pMVS200 and pMVS300, of 75, 19.5 and 13.4 kilobases (Kb), respectively. A 3.8 Kb restriction fragment of pMVS300 was cloned into pIJ30, a 6.3 Kb pBR322 derivative, containing the E. coli origin of replication (ori) and ampicillin resistance determinant (bla) as well as a Streptomyces gene for thiostrepton resistance, tsr. The resulting 10.1 Kb recombinant plasmid, designated pMVS301, was isolated from E. coli DH1 (pMVS301) and transformed into Rhodococcus sp. AS-50, a derivative of strain H13-A, by polyethylene glycol-assisted transformation of Rhodococcus protoplasts and selection for thiostrepton-resistant transformants. This strain was deposited with the ATCC on Feb. 1, 1988 and assigned ATCC 53719. The plasmid contains the Rhodococcus origin of replication. The plasmid and derivatives thereof can therefore be used to introduce nucleic acid sequences to and from Rhodococcus for subsequent expression and translation into protein. The isolated origin of replication can also be used in the construction of new vectors. 2 figs.

Cloning systems for Rhodococcus and related bacteria

DOEpatents

Finnerty, William R.; Singer, Mary E.

1990-01-01

A plasmid transformation system for Rhodococcus was developed using an Escherichia coli-Rhodococcus shuttle plasmid. Rhodococcus sp. H13-A contains three cryptic indigenous plasmids, designated pMVS100, pMVS200 and pMVS300, of 75, 19.5 and 13.4 kilobases (Kb), respectively. A 3.8 Kb restriction fragment of pMVS300 was cloned into pIJ30, a 6.3 Kb pBR322 derivative, containing the E. coli origin of replication (ori) and ampicillin resistance determinant (bla) as well as a Streptomyces gene for thiostrepton resistance, tsr. The resulting 10.1 Kb recombinant plasmid, designated pMVS301, was isolated from E. coli DH1 (pMVS301) and transformed into Rhodococcus sp. AS-50, a derivative of strain H13-A, by polyethylene glycol-assisted transformation of Rhodococcus protoplasts and selection for thiostrepton-resistant transformants. This strain was deposited with the ATCC on Feb. 1, 1988 and assigned ATCC 53719. The plasmid contains the Rhodococcus origin of replication. The plasmid and derivatives thereof can therefore be used to introduce nucleic acid sequences to and from Rhodococcus for subsequent expression and translation into protein. The isolated origin of replication can also be used in the construction of new vectors.

F14:A-:B- and IncX4 Inc group cfr-positive plasmids circulating in Escherichia coli of animal origin in Northeast China.

PubMed

Wang, Xiumei; Zhu, Yao; Hua, Xin; Chen, Fuguang; Wang, Changzhen; Zhang, Yanhe; Liu, Siguo; Zhang, Wanjiang

2018-04-01

The objective of this study was to investigate the prevalence of the cfr gene in Escherichia coli isolates from domestic animals in Northeast China and to characterize the cfr-containing plasmids. Between June 2015 and April 2016, 370 E. coli isolates were collected from pigs, chickens, and dairy cows in Northeast China. Among these, 111 were florfenicol resistant, including 109 isolates carrying the floR gene and 6 positives for cfr. The prevalence of cfr in E. coli isolates from the four northeast provinces in China was 1.6% (6/370), which was higher than that previously reported (0.08% and 0.5%). All six cfr-containing E. coli isolates were highly resistant to florfenicol (100%), cefotaxime (100%), and fosfomycin (100%). Complete sequence analysis of two cfr-carrying plasmids revealed high homology of the IncX4-type pEC14cfr plasmid with two other cfr-harboring plasmids, pSD11 and pGXEC6, found in swine E. coli isolates from southern China. pEC14cfr-like plasmids have been isolated in five provinces in southern and northern China. The isolation sites were up to 2700 kilometers apart, implying that pEC14cfr-like plasmids are likely to be national epidemic cfr-carrying plasmids that mediate the dissemination of cfr in China. Moreover, the genetic structure (IS26-IS26-cfr-rec-pre/mob-ramA-IS26) of the second cfr-carrying plasmid, IncF14:A-:B- pEC295cfr, represents a novel genetic environment for cfr identified for the first time in the present study. Sequence homology analysis indicated that the cfr-carrying element was most likely introduced into a cfr-negative pEC12 plasmid backbone, which evolved into the cfr-carrying vector, pEC295cfr. Moreover, isolation of the IncF14:A-:B- pEC295cfr plasmid harboring cfr suggests that IncFII plasmids maybe have become additional effective vehicles for cfr dissemination. These results highlight the importance of surveying the prevalence of IncX4 and IncFII plasmids in gram-negative bacteria, especially in swine E. coli isolates. Copyright © 2018 Elsevier B.V. All rights reserved.

Transformation of Saccharomyces cerevisiae and Schizosaccharomyces pombe with linear plasmids containing 2 micron sequences.

PubMed Central

Guerrini, A M; Ascenzioni, F; Tribioli, C; Donini, P

1985-01-01

Linear plasmids were constructed by adding telomeres prepared from Tetrahymena pyriformis rDNA to a circular hybrid Escherichia coli-yeast vector and transforming Saccharomyces cerevisiae. The parental vector contained the entire 2 mu yeast circle and the LEU gene from S. cerevisiae. Three transformed clones were shown to contain linear plasmids which were characterized by restriction analysis and shown to be rearranged versions of the desired linear plasmids. The plasmids obtained were imperfect palindromes: part of the parental vector was present in duplicated form, part as unique sequences and part was absent. The sequences that had been lost included a large portion of the 2 mu circle. The telomeres were approximately 450 bp longer than those of T. pyriformis. DNA prepared from transformed S. cerevisiae clones was used to transform Schizosaccharomyces pombe. The transformed S. pombe clones contained linear plasmids identical in structure to their linear parents in S. cerevisiae. No structural re-arrangements or integration into S. pombe was observed. Little or no telomere growth had occurred after transfer from S. cerevisiae to S. pombe. A model is proposed to explain the genesis of the plasmids. Images Fig. 1. Fig. 2. Fig. 4. PMID:3896773

Facile Construction of Random Gene Mutagenesis Library for Directed Evolution Without the Use of Restriction Enzyme in Escherichia coli.

PubMed

Kim, Jae-Eung; Huang, Rui; Chen, Hui; You, Chun; Zhang, Y-H Percival

2016-09-01

A foolproof protocol was developed for the construction of mutant DNA library for directed protein evolution. First, a library of linear mutant gene was generated by error-prone PCR or molecular shuffling, and a linear vector backbone was prepared by high-fidelity PCR. Second, the amplified insert and vector fragments were assembled by overlap-extension PCR with a pair of 5'-phosphorylated primers. Third, full-length linear plasmids with phosphorylated 5'-ends were self-ligated with T4 ligase, yielding circular plasmids encoding mutant variants suitable for high-efficiency transformation. Self-made competent Escherichia coli BL21(DE3) showed a transformation efficiency of 2.4 × 10(5) cfu/µg of the self-ligated circular plasmid. Using this method, three mutants of mCherry fluorescent protein were found to alter their colors and fluorescent intensities under visible and UV lights, respectively. Also, one mutant of 6-phosphorogluconate dehydrogenase from a thermophilic bacterium Moorella thermoacetica was found to show the 3.5-fold improved catalytic efficiency (kcat /Km ) on NAD(+) as compared to the wild-type. This protocol is DNA-sequence independent, and does not require restriction enzymes, special E. coli host, or labor-intensive optimization. In addition, this protocol can be used for subcloning the relatively long DNA sequences into any position of plasmids. Copyright © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

A novel approach to investigate the uptake and internalization of Escherichia coli O157:H7 in spinach cultivated in soil and hydroponic media

USDA-ARS?s Scientific Manuscript database

Internalization of E. coli O157:H7 into spinach plants through root uptake is a potential route of contamination. A Tn7-based plasmid vector was used to insert the green fluorescent protein (gfp) gene into the attTn7 site in the E. coli chromosome. Three gfp-labeled E. coli inocula, O157:H7 strains ...

A series of vectors to construct lacZ fusions for the study of gene expression in Schizosaccharomyces pombe.

PubMed

Lafuente, M J; Petit, T; Gancedo, C

1997-12-22

We have constructed a series of plasmids to facilitate the fusion of promoters with or without coding regions of genes of Schizosaccharomyces pombe to the lacZ gene of Escherichia coli. These vectors carry a multiple cloning region in which fission yeast DNA may be inserted in three different reading frames with respect to the coding region of lacZ. The plasmids were constructed with the ura4+ or the his3+ marker of S. pombe. Functionality of the plasmids was tested measuring in parallel the expression of fructose 1,6-bisphosphatase and beta-galactosidase under the control of the fbp1+ promoter in different conditions.

Cloning and expression of L-asparaginase gene in Escherichia coli.

PubMed

Wang, Y; Qian, S; Meng, G; Zhang, S

2001-08-01

The L-asparaginase (ASN) from Escherichia coli AS1.357 was cloned as a DNA fragment generated using polymerase chain reaction technology and primers derived from conserved regions of published ASN gene sequences. Recombinant plasmid pASN containing ASN gene and expression vector pBV220 was transformed in different E. coli host strains. The activity and expression level of ASN in the engineering strains could reach 228 IU/mL of culture fluid and about 50% of the total soluble cell protein respectively, more than 40-fold the enzyme activity of the wild strain. The recombinant plasmid in E. coli AS1.357 remained stable after 72 h of cultivation and 5 h of heat induction without selective pressure. The ASN gene of E. coli AS1.357 was sequenced and had high homology compared to the reported data.

An Efficient Intergeneric Conjugation of DNA from Escherichia coli to Mycelia of the Lincomycin-Producer Streptomyces lincolnensis

PubMed Central

Du, Lei; Liu, Rui-Hua; Ying, Li; Zhao, Guang-Rong

2012-01-01

Streptomyces lincolnensis is a producer of lincomycin, which is a lincosamide antibiotic for the treatment of infective diseases caused by Gram-positive bacteria. S. lincolnensis is refractory to introducing plasmid DNA into cells because of resistance of foreign DNAs and poor sporulation. In this study, a simple and efficient method of transferring plasmids into S. lincolnensis through the intergeneric Escherichia coli-mycelia conjugation was established and optimized for the first time. The recipient mycelia of S. lincolnensis were prepared in liquid SM medium containing 10.3% sucrose for three days. The dispersed mycelia were conjugated with competent E. coli donor cells. The exconjugants were regenerated efficiently on solid mannitol soya flour (MS) medium containing 20 mM MgCl2. The average conjugation frequency was observed at 1.1 × 10−4 per input donor cell and validated functionally by transferring two types of vectors containing lincomycin resistance genes lmrA, lmrB and lmrC into S. lincolnensis mycelia. The data of fermentation in shaking flasks showed the lincomycin yield of the exconjugants increased by 52.9% for the multiple copy vector and 38.3% for the integrative one, compared with the parental strain. The efficient and convenient method of intergeneric E. coli-mycelia conjugation in this study provides a promising procedure to introduce plasmid DNA into other refractory streptomycetes. PMID:22606009

Progress in directed energy control of vectors for microbes and other cells

NASA Astrophysics Data System (ADS)

Kiel, Johnathan L.; Parker, Jill E.; Holwitt, Eric A.; Vivekananda, Jeeva; Sloan, Mark A.; Stribling, Lucille J. V.

2004-07-01

Biosynthetic semiconductor, diazoluminomelanin (DALM), is a polymer of tyrosine, luminol, and nitrite. DALM has a very large cross section of absorption for light from ultraviolet to radio frequencies. This polymer can be made efficiently in a genetically engineered E.coli, JM109/pIC2ORNR1.1 (ATCC# 69905). We have been pursuing ways to couple electromagnetic radiation to vectors using this polymer. DNA capture elements (DCEs; formerly aptamers) have made this possible. We incorporated DCEs into the plasmid of this E. coli to direct binding to whatever microbe or cell desired and to produce DALM attached to the plasmid DNA. Using two other vectors pSV2neoNR101 or pSV2neoNR8005 (ATCC # 69617 and 69618, respectively), both propagated in the E. coli host HB101, we have also inserted genes necessary for DALM production into animal and human cell lines (mouse monocytic leukemia: ATCC # CRL- 11771, -11772, -1173, mouse mammary adenocarcinoma: ATCC# CRL-12184, -12185; and human carcinoma of the cervix: ATCC # CRL-12510). The DCE/DALM vectors can be used to tag target cells, detectable by broad-spectrum light absorbance, luminescence, or fluorescence. DCE/DALM can further be activated with light, microwave energy, or by oxidative chemistry to kill the targeted microbes or other cells.

Versatile plasmid-based expression systems for Gram-negative bacteria--General essentials exemplified with the bacterium Ralstonia eutropha H16.

PubMed

Gruber, Steffen; Schwab, Helmut; Koefinger, Petra

2015-12-25

The Gram-negative bacterium Escherichia coli is currently the most efficient and widely used prokaryotic host for recombinant protein and metabolite production. However, due to some limitations and to various interesting features of other Gram-negative bacteria efficient vector systems applicable to a broad range are desired. Basic building blocks for plasmid-based vectors include besides the need for a suitable selection marker in the first line a proper replication and maintenance system. In addition to these basic requirements, further elements are needed for Gram-negative bacteria beyond E. coli, such as Pseudomonas pudita, Ralstonia eutropha, Burkholderia glumae or Acinetobacter sp.. Established building blocks have to be adapted and new building blocks providing the desired functions need to be identified and exploited. This minireview addresses so far described and used genetic elements for broad host range replication, efficient plasmid maintenance, and conjugative plasmid transfer as well as expression elements and protein secretion signals. The industrially important bacterium R. eutropha H16 was chosen as a model organism to provide specific data on the effectivity and utility of building blocks based on such genetic elements. Copyright © 2015 Elsevier B.V. All rights reserved.

Development of a chromosome-plasmid balanced lethal system for Lactobacillus acidophilus with thyA gene as selective marker.

PubMed

Fu, X; Xu, J G

2000-01-01

A chromosome-plasmid balanced lethal gene delivery system for Lactobacillus acidophilus based on the thyA gene was developed. The selected L. acidophilus DOM La strain carries a mutated thyA gene and has an obligate requirement for thymidine. This strain can be used as a host for the constructed shuttle vector pFXL03, lacking antibiotic-resistant markers but having the wild-type thyA gene from L. casei which complements the thyA chromosomal mutation. The vector also contains the replicon region from plasmid pUC19 and that of the Lactococcus plasmid pWV01, which allows the transfer between Escherichia coli, L. casei and L. acidophilus. Eight unique restriction sites (i.e., PstI, HindIII, SphI, SalI, AccI, XbaI, KpnI and SacI) are available for cloning. After 40-time transfers in modified MRS medium, no plasmid loss was observed. The vector pFXL03 is potentially useful as a food-grade vaccine delivery system for L. acidophilus.

[Prokaryotic expression, purification and antigenicity identification of recombinant human survivin protein].

PubMed

Yin, Xiaotao; Wang, Wei; Tian, Renli; Xu, Yuanji; Yan, Jinqi; Zhang, Wei; Gao, Jiangping; Yu, Jiyun

2013-08-01

To construct a prokaryotic expression plasmid pET28a-survivin, optimize the recombinant protein expression conditions in E.coli, and purify the survivin recombinant protein and identify its antigenicity. Survivin cDNA segment was amplified by PCR and cloned into prokaryotic expression vector pET28a(+) to construct the recombinant expression vector pET28a-survivin. The expression vector was transformed into BL21 (DE3) and the fusion protein survivin/His was induced by IPTG. The fusion protein was purified through Ni affinity chromatography. The antigenicity of the purified survivin protein was identified by Western blotting and ELISA. The recombinant expression vector was verified successfully by BamHI and HindIII. The fusion protein induced by IPTG was obtained with Mr; about 24 000. The purity of the purified protein reached 90% by SDS-PAGE analysis. And the antigenicity of the survivin protein was validated by Western blotting and ELISA. The prokaryotic expression plasmid pET28a-survivin was successfully constructed and the survivin protein was expressed and purified in E.coli. The antigenicity of the purified survivin protein was demonstrated desirable.

Cloning of cellulase genes from acidothermus cellulolyticus

DOEpatents

Lastick, deceased, Stanley M.; Tucker, Melvin P.; Grohmann, Karel

1996-01-01

A process is described for moving fragments that code for cellulase activity from the genome of A. cellulolyticus to several plasmid vectors and the subsequent expression of active cellulase acitivty in E. coli.

Development of a Novel Escherichia coli-Kocuria Shuttle Vector Using the Cryptic pKPAL3 Plasmid from K. palustris IPUFS-1 and Its Utilization in Producing Enantiopure (S)-Styrene Oxide.

PubMed

Toda, Hiroshi; Itoh, Nobuya

2017-01-01

The novel cryptic pKPAL3 plasmid was isolated from the Gram-positive microorganism Kocuria palustris IPUFS-1 and characterized in detail. pKPAL3 is a circular plasmid that is 4,443 bp in length. Open reading frame (ORF) and homology search analyses indicated that pKPAL3 possesses four ORFs; however, there were no replication protein coding genes predicted in the plasmid. Instead, there were two nucleotide sequence regions that showed significant identities with untranslated regions of K. rhizophila DC2201 (NBRC 103217) genomic sequences, and these sequences were essential for autonomous replication of pKPAL3 in Kocuria cells. Based on these findings, we constructed the novel Escherichia coli - Kocuria shuttle vectors pKITE301 (kanamycin resistant) and pKITE303 (thiostrepton resistant) from pKPAL3. The copy numbers of the constructed shuttle vectors were estimated to be 20 per cell, and they exhibited low segregation stability in Kocuria transformant cells in the absence of antibiotics. Moreover, constructed vectors showed compatibility with the other K. rhizophila shuttle vector pKITE103. We successfully expressed multiple heterologous genes, including the styrene monooxygenase gene from Rhodococcus sp. ST-10 ( rhsmo ) and alcohol dehydrogenase gene from Leifsonia sp. S749 ( lsadh ), in K . rhizophila DC2201 using the pKITE301P and pKITE103P vectors under the control of the glyceraldehyde 3-phosphate dehydrogenase ( gapdh ) promotor. The RhSMO-LSADH co-expressing K. rhizophila was used as a biocatalyst in an organic solvent-water biphasic reaction system to efficiently convert styrene into ( S )-styrene oxide with 99% ee in the presence of 2-propanol as a hydrogen donor. The product concentration of the reaction in the organic solvent reached 235 mM after 30 h under optimum conditions. Thus, we demonstrated that this novel shuttle vector is useful for developing biocatalysts based on organic solvent-tolerant Kocuria cells.

Quantifying and resolving multiple vector transformants in S. cerevisiae plasmid libraries.

PubMed

Scanlon, Thomas C; Gray, Elizabeth C; Griswold, Karl E

2009-11-20

In addition to providing the molecular machinery for transcription and translation, recombinant microbial expression hosts maintain the critical genotype-phenotype link that is essential for high throughput screening and recovery of proteins encoded by plasmid libraries. It is known that Escherichia coli cells can be simultaneously transformed with multiple unique plasmids and thusly complicate recombinant library screening experiments. As a result of their potential to yield misleading results, bacterial multiple vector transformants have been thoroughly characterized in previous model studies. In contrast to bacterial systems, there is little quantitative information available regarding multiple vector transformants in yeast. Saccharomyces cerevisiae is the most widely used eukaryotic platform for cell surface display, combinatorial protein engineering, and other recombinant library screens. In order to characterize the extent and nature of multiple vector transformants in this important host, plasmid-born gene libraries constructed by yeast homologous recombination were analyzed by DNA sequencing. It was found that up to 90% of clones in yeast homologous recombination libraries may be multiple vector transformants, that on average these clones bear four or more unique mutant genes, and that these multiple vector cells persist as a significant proportion of library populations for greater than 24 hours during liquid outgrowth. Both vector concentration and vector to insert ratio influenced the library proportion of multiple vector transformants, but their population frequency was independent of transformation efficiency. Interestingly, the average number of plasmids born by multiple vector transformants did not vary with their library population proportion. These results highlight the potential for multiple vector transformants to dominate yeast libraries constructed by homologous recombination. The previously unrecognized prevalence and persistence of multiply transformed yeast cells have important implications for yeast library screens. The quantitative information described herein should increase awareness of this issue, and the rapid sequencing approach developed for these studies should be widely useful for identifying multiple vector transformants and avoiding complications associated with cells that have acquired more than one unique plasmid.

Enhanced expression of the Escherichia coli serA gene in a plasmid vector. Purification, crystallization, and preliminary X-ray data of D-3 phosphoglycerate dehydrogenase.

PubMed

Schuller, D J; Fetter, C H; Banaszak, L J; Grant, G A

1989-02-15

The serA gene of Escherichia coli strain K-12, which codes for the cooperative allosteric enzyme D-3-phosphoglycerate dehydrogenase, was inserted into an inducible expression vector which produced phosphoglycerate dehydrogenase as 8% of the soluble protein of E. coli. The purified protein was used to grow several different single crystal forms. One of these, with space group P2(1), appears to contain all four subunits of the tetrameric enzyme in the asymmetric unit and diffracts to sufficient resolution to allow determination of the structure of phosphoglycerate dehydrogenase.

Cloning of the active thymidine kinase gene of herpes simplex virus type 1 in Escherichia coli K-12.

PubMed

Colbere-Garapin, F; Chousterman, S; Horodniceanu, F; Kourilsky, P; Garapin, A C

1979-08-01

A herpes simplex virus DNA fragment that is produced by digestion with BamHI endonuclease and carries the thymidine kinase (TK; ATP:thymidine 5'-phosphotransferase, EC 2.7.1.21) gene has been cloned in Escherichia coli. A recombinat plasmid, pFG5, has been analyzed extensively and a detailed restriction map is presented. pFG5 DNA efficiently transforms TK- mouse L cells. The TK coding sequence in the cloned fragment has been localized and a smaller recombinant plasmid, pAG0, also carrying an active TK gene, has been constructed to serve as a more convenient vector for transfer, into TK- cells, of genes previously cloned in E. coli.

Cloning of cellulase genes from Acidothermus cellulolyticus

DOEpatents

Lastick, S.M.; Tucker, M.P.; Grohmann, K.

1996-05-07

A process is described for moving fragments that code for cellulase activity from the genome of A. cellulolyticus to several plasmid vectors and the subsequent expression of active cellulase activity in E. coli. 5 figs.

Exploiting translational coupling for the selection of cells producing toxic recombinant proteins from expression vectors.

PubMed

Tagliavia, Marcello; Cuttitta, Angela

2016-01-01

High rates of plasmid instability are associated with the use of some expression vectors in Escherichia coli, resulting in the loss of recombinant protein expression. This is due to sequence alterations in vector promoter elements caused by the background expression of the cloned gene, which leads to the selection of fast-growing, plasmid-containing cells that do not express the target protein. This phenomenon, which is worsened when expressing toxic proteins, results in preparations containing very little or no recombinant protein, or even in clone loss; however, no methods to prevent loss of recombinant protein expression are currently available. We have exploited the phenomenon of translational coupling, a mechanism of prokaryotic gene expression regulation, in order to select cells containing plasmids still able to express recombinant proteins. Here we designed an expression vector in which the cloned gene and selection marker are co-expressed. Our approach allowed for the selection of the recombinant protein-expressing cells and proved effective even for clones encoding toxic proteins.

Construction of a Schizosaccharomyces pombe gene bank in a yeast bacterial shuttle vector and its use to isolate genes by complementation.

PubMed

Beach, D; Piper, M; Nurse, P

1982-01-01

A gene bank of partial Sau3A restriction fragments of S. pombe DNA has been constructed in the plasmid vector, pDB248', which is capable of high frequency transformation of S. pombe. Procedures are described which enable plasmids to be recovered from S. pombe by their reintroduction into E. coli. These methods have been used to detect the S. pombe genes lys 1+, ade 6+ and his 2+ in the gene bank by complementation of mutant gene functions, and to physically isolate the lys 1+ gene.

Bacterial plasmid transfer under space flight conditions: The Mobilisatsia experience

NASA Astrophysics Data System (ADS)

de Boever, P.; Ilyin, V.; Mahillon, J.; Mergeay, M.

Background Microorganisms are subject to a genetic evolution which may lead to the capacity to colonize new environments and to cause infections Central players in this evolutionary process are mobile genetic elements phages plasmids and transposons The latter help to mobilize and reorganize genes be it within a given genome intragenomic mobility or between bacterial cells intercellular mobility Confined environment and space flight related factors such as microgravity and cosmic radiation may influence the frequency with which mobile genetic elements are exchanged between microorganisms Aim Within the frame of the Mobilisatsia experiment a triparental microbial plasmid transfer was promoted aboard the International Space Station ISS The efficiency of the plasmid exchange process was compared with a synchronously performed ground control experiment An experiment was carried out with well-characterized Gram-negative test strains and one experiment was done with Gram-positive test strains Results The experiment took place during the Soyouz Mission 8 to the ISS from April 19th until April 30th 2004 Liquid cultures of the bacterial strains Cupriavidus metallidurans AE815 final recipient Escherichia coli CM1962 carrying a mobilisable vector with a nickel-resistance marker and E coli CM140 carrying the Broad Host Range plasmid RP4 for the Gram-negative experiment and Bacillus thuringiensis Bti AND931 carrying the conjugative plasmid pXO16 Bti 4Q7 with mobilisable vector pC194 carrying a resistance to chloramphenicol and Bti GBJ002

Structural and physiological studies of the Escherichia coli histidine operon inserted into plasmid vectors.

PubMed Central

Bruni, C B; Musti, A M; Frunzio, R; Blasi, F

1980-01-01

A fragment of deoxyribonucleic acid 5,300 base paris long and containing the promoter-proximal portion of the histidine operon of Escherichia coli K-12, has been cloned in plasmid pBR313 (plasmids pCB2 and pCB3). Restriction mapping, partial nucleotide sequencing, and studies on functional expression in vivo and on protein synthesis in minicells have shown that the fragment contains the regulatory region of the operon, the hisG, hisD genes, and part of the hisC gene. Another plasmid (pCB5) contained the hisG gene and part of the hisD gene. Expression of the hisG gene in the latter plasmid was under control of the tetracycline promoter of the pBR313 plasmid. The in vivo expression of the two groups of plasmids described above, as well as their effect on the expression of the histidine genes not carried by the plasmids but present on the host chromosome, has been studied. The presence of multiple copies of pCB2 or pCB3, but not of pCB5, prevented derepression of the chromosomal histidine operon. Possible interpretations of this phenomenon are discussed. Images PMID:6246067

Cloning of cDNA of major antigen of foot and mouth disease virus and expression in E. coli

NASA Astrophysics Data System (ADS)

Küpper, Hans; Keller, Walter; Kurz, Christina; Forss, Sonja; Schaller, Heinz

1981-02-01

Double-stranded DNA copies of the single-stranded genomic RNA of foot and mouth disease virus have been cloned into the Escherichia coli plasmid pBR322. A restriction map of the viral genome was established and aligned with the biochemical map of foot and mouth disease virus. The coding sequence for structural protein VP1, the major antigen of the virus, was identified and inserted into a plasmid vector where the expression of this sequence is under control of the phage λ PL promoter. In an appropriate host the synthesis of antigenic polypeptide can be demonstrated by radioimmunoassay.

Sequence Analysis of the Cryptic Plasmid pMG101 from Rhodopseudomonas palustris and Construction of Stable Cloning Vectors

PubMed Central

Inui, Masayuki; Roh, Jung Hyeob; Zahn, Kenneth; Yukawa, Hideaki

2000-01-01

A 15-kb cryptic plasmid was obtained from a natural isolate of Rhodopseudomonas palustris. The plasmid, designated pMG101, was able to replicate in R. palustris and in closely related strains of Bradyrhizobium japonicum and phototrophic Bradyrhizobium species. However, it was unable to replicate in the purple nonsulfur bacterium Rhodobacter sphaeroides and in Rhizobium species. The replication region of pMG101 was localized to a 3.0-kb SalI-XhoI fragment, and this fragment was stably maintained in R. palustris for over 100 generations in the absence of selection. The complete nucleotide sequence of this fragment revealed two open reading frames (ORFs), ORF1 and ORF2. The deduced amino acid sequence of ORF1 is similar to sequences of Par proteins, which mediate plasmid stability from certain plasmids, while ORF2 was identified as a putative rep gene, coding for an initiator of plasmid replication, based on homology with the Rep proteins of several other plasmids. The function of these sequences was studied by deletion mapping and gene disruptions of ORF1 and ORF2. pMG101-based Escherichia coli-R. palustris shuttle cloning vectors pMG103 and pMG105 were constructed and were stably maintained in R. palustris growing under nonselective conditions. The ability of plasmid pMG101 to replicate in R. palustris and its close phylogenetic relatives should enable broad application of these vectors within this group of α-proteobacteria. PMID:10618203

An 'instant gene bank' method for gene cloning by mutant complementation.

PubMed

Gems, D; Aleksenko, A; Belenky, L; Robertson, S; Ramsden, M; Vinetski, Y; Clutterbuck, A J

1994-02-01

We describe a new method of gene cloning by complementation of mutant alleles which obviates the need for construction of a gene library in a plasmid vector in vitro and its amplification in Escherichia coli. The method involves simultaneous transformation of mutant strains of the fungus Aspergillus nidulans with (i) fragmented chromosomal DNA from a donor species and (ii) DNA of a plasmid without a selectable marker gene, but with a fungal origin of DNA replication ('helper plasmid'). Transformant colonies appear as the result of the joining of chromosomal DNA fragments carrying the wild-type copies of the mutant allele with the helper plasmid. Joining may occur either by ligation (if the helper plasmid is in linear form) or recombination (if it is cccDNA). This event occurs with high efficiency in vivo, and generates an autonomously replicating plasmid cointegrate. Transformants containing Penicillium chrysogenum genomic DNA complementing A. nidulans niaD, nirA and argB mutations have been obtained. While some of these cointegrates were evidently rearranged or consisted only of unaltered replicating plasmid, in other cases plasmids could be recovered into E. coli and were subsequently shown to contain the selected gene. The utility of this "instant gene bank" technique is demonstrated here by the molecular cloning of the P. canescens trpC gene.

Characterization of the cryptic plasmid pOfk55 from Legionella pneumophila and construction of a pOfk55-derived shuttle vector.

PubMed

Nishida, Takashi; Watanabe, Kenta; Tachibana, Masato; Shimizu, Takashi; Watarai, Masahisa

2017-03-01

In this study, a cryptic plasmid pOfk55 from Legionella pneumophila was isolated and characterized. pOfk55 comprised 2584bp with a GC content of 37.3% and contained three putative open reading frames (ORFs). orf1 encoded a protein of 195 amino acids and the putative protein shared 39% sequence identity with a putative plasmid replication protein RepL. ORF1 was needed for replication in L. pneumophila but pOfk55 did not replicate in Escherichia coli. orf2 and orf3 encoded putative hypothetical proteins of 114 amino acids and 78 amino acids, respectively, but the functions of the putative proteins ORF2 and OFR3 are not clear. The transfer mechanism for pOfk55 was independent on the type IVB secretion system in the original host. A L. pneumophila-E. coli shuttle vector, pNT562 (5058bp, Km R ), was constructed by In-Fusion Cloning of pOfk55 with a kanamycin-resistance gene from pUTmini-Tn5Km and the origin of replication from pBluescript SK(+) (pNT561). Multiple cloning sites from pBluescript SK(+) as well as the tac promoter region and lacI gene from pAM239-GFP were inserted into pNT561 to construct pNT562. The transformation efficiency of pNT562 in L. pneumophila strains ranged from 1.6×10 1 to 1.0×10 5 CFU/ng. The relative number of pNT562 was estimated at 5.7±1.0 copies and 73.6% of cells maintained the plasmid after 1week in liquid culture without kanamycin. A green fluorescent protein (GFP) expression vector, pNT563, was constructed by ligating pNT562 with the gfpmut3 gene from pAM239-GFP. pNT563 was introduced into L. pneumophila Lp02 and E. coli DH5α, and both strains expressed GFP successfully. These results suggest that the shuttle vector is useful for genetic studies in L. pneumophila. Copyright © 2017 Elsevier Inc. All rights reserved.

Development of Genetically Stable Escherichia coli Strains for Poly(3-Hydroxypropionate) Production

PubMed Central

Gao, Yongqiang; Liu, Changshui; Ding, Yamei; Sun, Chao; Zhang, Rubing; Xian, Mo; Zhao, Guang

2014-01-01

Poly(3-hydroxypropionate) (P3HP) is a biodegradable and biocompatible thermoplastic. In our previous study, a pathway for P3HP production was constructed in recombinant Esecherichia coli. Seven exogenous genes in P3HP synthesis pathway were carried by two plasmid vectors. However, the P3HP production was severely suppressed by strain instability due to plasmid loss. In this paper, two strategies, chromosomal gene integration and plasmid addiction system (PAS) based on amino acid anabolism, were applied to construct a genetically stable strain. Finally, a combination of those two methods resulted in the best results. The resultant strain carried a portion of P3HP synthesis genes on chromosome and the others on plasmid, and also brought a tyrosine-auxotrophy based PAS. In aerobic fed-batch fermentation, this strain produced 25.7 g/L P3HP from glycerol, about 2.5-time higher than the previous strain with two plasmids. To the best of our knowledge, this is the highest P3HP production from inexpensive carbon sources. PMID:24837211

Rational Development of A Polycistronic Plasmid with A CpG-Free Bacterial Backbone as A Potential Tool for Direct Reprogramming.

PubMed

Dormiani, Kianoush; Mir Mohammad Sadeghi, Hamid; Sadeghi-Aliabadi, Hojjat; Forouzanfar, Mahboobeh; Baharvand, Hossein; Ghaedi, Kamran; Nasr-Esfahani, Mohammad Hossein

2017-01-01

Induced pluripotent stem cells are generated from somatic cells by direct reprogramming. These reprogrammed pluripotent cells have different applications in biomedical fields such as regenerative medicine. Although viral vectors are widely used for efficient reprogramming, they have limited applications in the clinic due to the risk for immunogenicity and insertional mutagenesis. Accordingly, we designed and developed a small, non-integrating plasmid named pLENSO/Zeo as a 2A-mediated polycistronic expression vector. In this experimental study, we developed a single plasmid which includes a single expression cassette containing open reading frames of human LIN28, NANOG, SOX2 and OCT4 along with an EGFP reporter gene. Each reprogramming factor is separated by an intervening sequence that encodes a 2A self-processing peptide. The reprogramming cassette is located downstream of a CMV promoter. The vector is easily propagated in the E. coli GT115 strain through a CpG-depleted vector backbone. We evaluated the stability of the constructed vector bioinformatically, and its ability to stoichiometric expression of the reprogramming factors using quantitative molecular methods analysis after transient transfection into HEK293 cells. In the present study, we developed a nonviral episomal vector named pLENSO/ Zeo. Our results demonstrated the general structural stability of the plasmid DNA. This relatively small vector showed concomitant, high-level expression of the four reprogramming factors with similar titers, which are considered as the critical parameters for efficient and consistent reprogramming. According to our experimental results, this stable extrachromosomal plasmid expresses reliable amounts of four reprogramming factors simultaneously. Consequently, these promising results encouraged us to evaluate the capability of pLENSO/Zeo as a simple and feasible tool for generation of induced pluripotent stem cells from primary cells in the future.

New ΦBT1 site-specific integrative vectors with neutral phenotype in Streptomyces.

PubMed

Gonzalez-Quiñonez, Nathaly; López-García, María Teresa; Yagüe, Paula; Rioseras, Beatriz; Pisciotta, Annalisa; Alduina, Rosa; Manteca, Ángel

2016-03-01

Integrative plasmids are one of the best options to introduce genes in low copy and in a stable form into bacteria. The ΦC31-derived plasmids constitute the most common integrative vectors used in Streptomyces. They integrate at different positions (attB and pseudo-attB sites) generating different mutations. The less common ΦBT1-derived vectors integrate at the unique attB site localized in the SCO4848 gene (S. coelicolor genome) or their orthologues in other streptomycetes. This work demonstrates that disruption of SCO4848 generates a delay in spore germination. SCO4848 is co-transcribed with SCO4849, and the spore germination phenotype is complemented by SCO4849. Plasmids pNG1-4 were created by modifying the ΦBT1 integrative vector pMS82 by introducing a copy of SCO4849 under the control of the promoter region of SCO4848. pNG2 and pNG4 also included a copy of the P ermE * in order to facilitate gene overexpression. pNG3 and pNG4 harboured a copy of the bla gene (ampicillin resistance) to facilitate selection in E. coli. pNG1-4 are the only integrative vectors designed to produce a neutral phenotype when they are integrated into the Streptomyces genome. The experimental approach developed in this work can be applied to create phenotypically neutral integrative plasmids in other bacteria.

Vectors for co-expression of an unrestricted number of proteins

PubMed Central

Scheich, Christoph; Kümmel, Daniel; Soumailakakis, Dimitri; Heinemann, Udo; Büssow, Konrad

2007-01-01

A vector system is presented that allows generation of E. coli co-expression clones by a standardized, robust cloning procedure. The number of co-expressed proteins is not limited. Five ‘pQLink’ vectors for expression of His-tag and GST-tag fusion proteins as well as untagged proteins and for cloning by restriction enzymes or Gateway cloning were generated. The vectors allow proteins to be expressed individually; to achieve co-expression, two pQLink plasmids are combined by ligation-independent cloning. pQLink co-expression plasmids can accept an unrestricted number of genes. As an example, the co-expression of a heterotetrameric human transport protein particle (TRAPP) complex from a single plasmid, its isolation and analysis of its stoichiometry are shown. pQLink clones can be used directly for pull-down experiments if the proteins are expressed with different tags. We demonstrate pull-down experiments of human valosin-containing protein (VCP) with fragments of the autocrine motility factor receptor (AMFR). The cloning method avoids PCR or gel isolation of restriction fragments, and a single resistance marker and origin of replication are used, allowing over-expression of rare tRNAs from a second plasmid. It is expected that applications are not restricted to bacteria, but could include co-expression in other hosts such as Bacluovirus/insect cells. PMID:17311810

Testing plasmid stability of Escherichia coli using the Continuously Operated Shaken BIOreactor System.

PubMed

Sieben, Michaela; Steinhorn, Gregor; Müller, Carsten; Fuchs, Simone; Ann Chin, Laura; Regestein, Lars; Büchs, Jochen

2016-11-01

Plasmids are common vectors to genetically manipulate Escherichia coli or other microorganisms. They are easy to use and considerable experience has accumulated on their application in heterologous protein production. However, plasmids can be lost during cell growth, if no selection pressure like, e.g., antibiotics is used, hampering the production of the desired protein and endangering the economic success of a biotechnological production process. Thus, in this study the Continuously Operated Shaken BIOreactor System (COSBIOS) is applied as a tool for fast parallel testing of strain stability and operation conditions and to evaluate measures to counter such plasmid loss. In specific, by applying various ampicillin concentrations, the lowest effective ampicillin dosage is investigated to secure plasmid stability while lowering adverse ecological effects. A significant difference was found in the growth rates of plasmid-bearing and plasmid-free cells. The undesired plasmid-free cells grew 30% faster than the desired plasmid-bearing cells. During the testing of plasmid stability without antibiotics, the population fraction of plasmid-bearing cells rapidly decreased in continuous culture to zero within the first 48 h. An initial single dosage of ampicillin did not prevent plasmid loss. By contrast, a continuous application of a low dosage of 10 µg/mL ampicillin in the feed medium maintained plasmid stability in the culture. Consequently, the COSBIOS is an apt reactor system for measuring plasmid stability and evaluating methods to enhance this stability. Hence, decreased production of heterologous protein can be prevented. © 2016 American Institute of Chemical Engineers Biotechnol. Prog., 32:1418-1425, 2016. © 2016 American Institute of Chemical Engineers.

Tightly-wound miniknot vectors for gene therapy: a potential improvement over supercoiled minicircle DNA.

PubMed

Tolmachov, Oleg E

2010-04-01

Minimized derivatives of bacterial plasmids with removed bacterial backbones are promising vectors for the efficient delivery and for the long-term expression of therapeutic genes. The absence of the bacterial plasmid backbone, a known inducer of innate immune response and a known silencer of transgene expression, provides a partial explanation for the high efficiency of gene transfer using minimized DNA vectors. Supercoiled minicircle DNA is a type of minimized DNA vector obtained via intra-plasmid recombination in bacteria. Minicircle vectors seem to get an additional advantage from their physical compactness, which reduces DNA damage due to the mechanical stress during gene delivery. An independent topological means for DNA compression is knotting, with some knotted DNA isoforms offering superior compactness. I propose that, firstly, knotted DNA can be a suitable compact DNA form for the efficient transfection of a range of human cells with therapeutic genes, and, secondly, that knotted minimized DNA vectors without bacterial backbones ("miniknot" vectors) can surpass supercoiled minicircle DNA vectors in the efficiency of therapeutic gene delivery. Crucially, while the introduction of a single nick to a supercoiled DNA molecule leads to the loss of the compact supercoiled status, the introduction of nicks to knotted DNA does not change knotting. Tight miniknot vectors can be readily produced by the direct action of highly concentrated type II DNA topoisomerase on minicircle DNA or, alternatively, by annealing of the 19-base cohesive ends of the minimized vectors confined within the capsids of Escherichia coli bacteriophage P2 or its satellite bacteriophage P4. After reaching the nucleoplasm of the target cell, the knotted DNA is expected to be unknotted through type II topoisomerase activity and thus to become available for transcription, chromosomal integration or episomal maintenance. The hypothesis can be tested by comparing the gene transfer efficiency achieved with the proposed miniknot vectors, the minicircle vectors described previously, knotted plasmid vectors and standard plasmid vectors. Tightly-wound miniknots can be particularly useful in the gene administration procedures involving considerable forces acting on vector DNA: aerosol inhalation, jet-injection, electroporation, particle bombardment and ultrasound DNA transfer. (c) 2009 Elsevier Ltd. All rights reserved.

Stable transformation of a mosquito cell line results in extraordinarily high copy numbers of the plasmid.

PubMed Central

Monroe, T J; Muhlmann-Diaz, M C; Kovach, M J; Carlson, J O; Bedford, J S; Beaty, B J

1992-01-01

Stable incorporation of high copy numbers (greater than 10,000 per cell) of a plasmid vector containing a gene conferring resistance to the antibiotic hygromycin was achieved in a cell line derived from the Aedes albopictus mosquito. Plasmid sequences were readily observed by ethidium bromide staining of cellular DNA after restriction endonuclease digestion and agarose gel electrophoresis. The plasmid was demonstrated by in situ hybridization to be present in large arrays integrated in metaphase chromosomes and in minute and double-minute replicating elements. In one subclone, approximately 60,000 copies of the plasmid were organized in a large array that resembles a chromosome, morphologically and in the segregation of its chromatids during anaphase. The original as well as modified versions of the plasmid were rescued by transformation of Escherichia coli using total cellular DNA. Southern blot analyses of recovered plasmids indicate the presence of mosquito-derived sequences. Images PMID:1631052

Genetic control of ColE1 plasmid stability that is independent of plasmid copy number regulation.

PubMed

Standley, Melissa S; Million-Weaver, Samuel; Alexander, David L; Hu, Shuai; Camps, Manel

2018-06-16

ColE1-like plasmid vectors are widely used for expression of recombinant genes in E. coli. For these vectors, segregation of individual plasmids into daughter cells during cell division appears to be random, making them susceptible to loss over time when no mechanisms ensuring their maintenance are present. Here we use the plasmid pGFPuv in a recA relA strain as a sensitized model to study factors affecting plasmid stability in the context of recombinant gene expression. We find that in this model, plasmid stability can be restored by two types of genetic modifications to the plasmid origin of replication (ori) sequence: point mutations and a novel 269 nt duplication at the 5' end of the plasmid ori, which we named DAS (duplicated anti-sense) ori. Combinations of these modifications produce a range of copy numbers and of levels of recombinant expression. In direct contradiction with the classic random distribution model, we find no correlation between increased plasmid copy number and increased plasmid stability. Increased stability cannot be explained by reduced levels of recombinant gene expression either. Our observations would be more compatible with a hybrid clustered and free-distribution model, which has been recently proposed based on detection of individual plasmids in vivo using super-resolution fluorescence microscopy. This work suggests a role for the plasmid ori in the control of segregation of ColE1 plasmids that is distinct from replication initiation, opening the door for the genetic regulation of plasmid stability as a strategy aimed at enhancing large-scale recombinant gene expression or bioremediation.

Construction of a novel shuttle vector for use in Gluconobacter oxydans.

PubMed

Zhang, Lin; Lin, Jinping; Ma, Yushu; Wei, Dongzhi; Sun, Ming

2010-11-01

A shuttle vector pZL1 which can replicate both in Gluconobacter oxydans and Escherichia coli was constructed based on G. oxydans DSM2003 cryptic plasmid pGOX3, a homology of G. oxydans 621H pGOX3, and E. coli cloning vector pUC18. It was found to be stably maintained in G. oxydans during the serial subcultures in the absence of antibiotic pressure for 144 h. With pGOX3 as the reference sample, the relative copy number of pZL1 in G. oxydans is 13 determined by real-time fluorescence quantitative PCR (qPCR). The copy number of pZL1 is much higher than pBBR1MCS5 in E. coli. The vector pZL1 contains six commonly used restriction endonuclease sites, HindIII, SalI, XbaI, BamHI, SmaI, KpnI, and SacI, and is easy to manipulate in molecular biology experiments. The shuttle vector was used to express a reporter protein wasabi successfully in G. oxydans DSM2003 under the control of the tufB promoter.

Broad-host-range plasmids for red fluorescent protein labeling of gram-negative bacteria for use in the zebrafish model system.

PubMed

Singer, John T; Phennicie, Ryan T; Sullivan, Matthew J; Porter, Laura A; Shaffer, Valerie J; Kim, Carol H

2010-06-01

To observe real-time interactions between green fluorescent protein-labeled immune cells and invading bacteria in the zebrafish (Danio rerio), a series of plasmids was constructed for the red fluorescent protein (RFP) labeling of a variety of fish and human pathogens. The aim of this study was to create a collection of plasmids that would express RFP pigments both constitutively and under tac promoter regulation and that would be nontoxic and broadly transmissible to a variety of Gram-negative bacteria. DNA fragments encoding the RFP dimeric (d), monomeric (m), and tandem dimeric (td) derivatives d-Tomato, td-Tomato, m-Orange, and m-Cherry were cloned into the IncQ-based vector pMMB66EH in Escherichia coli. Plasmids were mobilized into recipient strains by conjugal mating. Pigment production was inducible in Escherichia coli, Pseudomonas aeruginosa, Edwardsiella tarda, and Vibrio (Listonella) anguillarum strains by isopropyl-beta-d-thiogalactopyranoside (IPTG) treatment. A spontaneous mutant exconjugant of P. aeruginosa PA14 was isolated that expressed td-Tomato constitutively. Complementation analysis revealed that the constitutive phenotype likely was due to a mutation in lacI(q) carried on pMMB66EH. DNA sequence analysis confirmed the presence of five transitions, four transversions, and a 2-bp addition within a 14-bp region of lacI. Vector DNA was purified from this constitutive mutant, and structural DNA sequences for RFP pigments were cloned into the constitutive vector. Exconjugants of P. aeruginosa, E. tarda, and V. anguillarum expressed all pigments in an IPTG-independent fashion. Results from zebrafish infectivity studies indicate that RFP-labeled pathogens will be useful for the study of real-time interactions between host cells of the innate immune system and the infecting pathogen.

[Construction of the eukaryotic recombinant vector and expression of the outer membrane protein LipL32 gene from Leptospira serovar Lai].

PubMed

Huang, Bi; Bao, Lang; Zhong, Qi; Shang, Zheng-ling; Zhang, Hui-dong; Zhang, Ying

2008-02-01

To construct the eukaryotic experssion vector of LipL32 gene from Leptospira serovar Lai and express the recombinant plasmid in COS-7 cell. The LipL32 gene was amplified from Leptospira strain 017 genomic DNA by PCR and cloned into pcDNA3.1, through restriction nuclease enzyme digestion. Then the recombinant plasmid was transformed into E.coli DH5alpha. After identified by nuclease digestion, PCR and sequencing analysis, the recombinant vector was transfected into COS-7 cell with lipsome. The expression of the target gene was detected by RT-PCR and Western blot. The eukaryotic experssion vector pcDNA3.1-LipL32 was successfully constructed and stably expressed in COS-7 cell. The eukaryotic recombinant vector of outer membrane protein LipL32 gene from Leptospira serovar Lai can be expressed in mammalian cell, which provides an experimental basis for the application of the Leptospira DNA vaccine.

Plasmid-encoded biosynthetic genes alleviate metabolic disadvantages while increasing glucose conversion to shikimate in an engineered Escherichia coli strain.

PubMed

Rodriguez, Alberto; Martínez, Juan A; Millard, Pierre; Gosset, Guillermo; Portais, Jean-Charles; Létisse, Fabien; Bolivar, Francisco

2017-06-01

Metabolic engineering strategies applied over the last two decades to produce shikimate (SA) in Escherichia coli have resulted in a battery of strains bearing many expression systems. However, the effects that these systems have on the host physiology and how they impact the production of SA are still not well understood. In this work we utilized an engineered E. coli strain to determine the consequences of carrying a vector that promotes SA production from glucose with a high-yield but that is also expected to impose a significant cellular burden. Kinetic comparisons in fermentors showed that instead of exerting a negative effect, the sole presence of the plasmid increased glucose consumption without diminishing the growth rate. By constitutively expressing a biosynthetic operon from this vector, the more active glycolytic metabolism was exploited to redirect intermediates toward the production of SA, which further increased the glucose consumption rate and avoided excess acetate production. Fluxomics and metabolomics experiments revealed a global remodeling of the carbon and energy metabolism in the production strain, where the increased SA production reduced the carbon available for oxidative and fermentative pathways. Moreover, the results showed that the production of SA relies on a specific setup of the pentose phosphate pathway, where both its oxidative and non-oxidative branches are strongly activated to supply erythrose-4-phosphate and balance the NADPH requirements. This work improves our understanding of the metabolic reorganization observed in E. coli in response to the plasmid-based expression of the SA biosynthetic pathway. Biotechnol. Bioeng. 2017;114: 1319-1330. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

The tunable pReX expression vector enables optimizing the T7-based production of membrane and secretory proteins in E. coli.

PubMed

Kuipers, Grietje; Karyolaimos, Alexandros; Zhang, Zhe; Ismail, Nurzian; Trinco, Gianluca; Vikström, David; Slotboom, Dirk Jan; de Gier, Jan-Willem

2017-12-16

To optimize the production of membrane and secretory proteins in Escherichia coli, it is critical to harmonize the expression rates of the genes encoding these proteins with the capacity of their biogenesis machineries. Therefore, we engineered the Lemo21(DE3) strain, which is derived from the T7 RNA polymerase-based BL21(DE3) protein production strain. In Lemo21(DE3), the T7 RNA polymerase activity can be modulated by the controlled co-production of its natural inhibitor T7 lysozyme. This setup enables to precisely tune target gene expression rates in Lemo21(DE3). The t7lys gene is expressed from the pLemo plasmid using the titratable rhamnose promoter. A disadvantage of the Lemo21(DE3) setup is that the system is based on two plasmids, a T7 expression vector and pLemo. The aim of this study was to simplify the Lemo21(DE3) setup by incorporating the key elements of pLemo in a standard T7-based expression vector. By incorporating the gene encoding the T7 lysozyme under control of the rhamnose promoter in a standard T7-based expression vector, pReX was created (ReX stands for Regulated gene eXpression). For two model membrane proteins and a model secretory protein we show that the optimized production yields obtained with the pReX expression vector in BL21(DE3) are similar to the ones obtained with Lemo21(DE3) using a standard T7 expression vector. For another secretory protein, a c-type cytochrome, we show that pReX, in contrast to Lemo21(DE3), enables the use of a helper plasmid that is required for the maturation and hence the production of this heme c protein. Here, we created pReX, a T7-based expression vector that contains the gene encoding the T7 lysozyme under control of the rhamnose promoter. pReX enables regulated T7-based target gene expression using only one plasmid. We show that with pReX the production of membrane and secretory proteins can be readily optimized. Importantly, pReX facilitates the use of helper plasmids. Furthermore, the use of pReX is not restricted to BL21(DE3), but it can in principle be used in any T7 RNAP-based strain. Thus, pReX is a versatile alternative to Lemo21(DE3).

Optimization of a one-step heat-inducible in vivo mini DNA vector production system.

PubMed

Nafissi, Nafiseh; Sum, Chi Hong; Wettig, Shawn; Slavcev, Roderick A

2014-01-01

While safer than their viral counterparts, conventional circular covalently closed (CCC) plasmid DNA vectors offer a limited safety profile. They often result in the transfer of unwanted prokaryotic sequences, antibiotic resistance genes, and bacterial origins of replication that may lead to unwanted immunostimulatory responses. Furthermore, such vectors may impart the potential for chromosomal integration, thus potentiating oncogenesis. Linear covalently closed (LCC), bacterial sequence free DNA vectors have shown promising clinical improvements in vitro and in vivo. However, the generation of such minivectors has been limited by in vitro enzymatic reactions hindering their downstream application in clinical trials. We previously characterized an in vivo temperature-inducible expression system, governed by the phage λ pL promoter and regulated by the thermolabile λ CI[Ts]857 repressor to produce recombinant protelomerase enzymes in E. coli. In this expression system, induction of recombinant protelomerase was achieved by increasing culture temperature above the 37°C threshold temperature. Overexpression of protelomerase led to enzymatic reactions, acting on genetically engineered multi-target sites called "Super Sequences" that serve to convert conventional CCC plasmid DNA into LCC DNA minivectors. Temperature up-shift, however, can result in intracellular stress responses and may alter plasmid replication rates; both of which may be detrimental to LCC minivector production. We sought to optimize our one-step in vivo DNA minivector production system under various induction schedules in combination with genetic modifications influencing plasmid replication, processing rates, and cellular heat stress responses. We assessed different culture growth techniques, growth media compositions, heat induction scheduling and temperature, induction duration, post-induction temperature, and E. coli genetic background to improve the productivity and scalability of our system, achieving an overall LCC DNA minivector production efficiency of ∼ 90%.We optimized a robust technology conferring rapid, scalable, one-step in vivo production of LCC DNA minivectors with potential application to gene transfer-mediated therapeutics.

Optimization of a One-Step Heat-Inducible In Vivo Mini DNA Vector Production System

PubMed Central

Wettig, Shawn; Slavcev, Roderick A.

2014-01-01

While safer than their viral counterparts, conventional circular covalently closed (CCC) plasmid DNA vectors offer a limited safety profile. They often result in the transfer of unwanted prokaryotic sequences, antibiotic resistance genes, and bacterial origins of replication that may lead to unwanted immunostimulatory responses. Furthermore, such vectors may impart the potential for chromosomal integration, thus potentiating oncogenesis. Linear covalently closed (LCC), bacterial sequence free DNA vectors have shown promising clinical improvements in vitro and in vivo. However, the generation of such minivectors has been limited by in vitro enzymatic reactions hindering their downstream application in clinical trials. We previously characterized an in vivo temperature-inducible expression system, governed by the phage λ pL promoter and regulated by the thermolabile λ CI[Ts]857 repressor to produce recombinant protelomerase enzymes in E. coli. In this expression system, induction of recombinant protelomerase was achieved by increasing culture temperature above the 37°C threshold temperature. Overexpression of protelomerase led to enzymatic reactions, acting on genetically engineered multi-target sites called “Super Sequences” that serve to convert conventional CCC plasmid DNA into LCC DNA minivectors. Temperature up-shift, however, can result in intracellular stress responses and may alter plasmid replication rates; both of which may be detrimental to LCC minivector production. We sought to optimize our one-step in vivo DNA minivector production system under various induction schedules in combination with genetic modifications influencing plasmid replication, processing rates, and cellular heat stress responses. We assessed different culture growth techniques, growth media compositions, heat induction scheduling and temperature, induction duration, post-induction temperature, and E. coli genetic background to improve the productivity and scalability of our system, achieving an overall LCC DNA minivector production efficiency of ∼90%.We optimized a robust technology conferring rapid, scalable, one-step in vivo production of LCC DNA minivectors with potential application to gene transfer-mediated therapeutics. PMID:24586704

[Prokaryotic expression of Nanog gene and preparation of anti-Nanog antibody].

PubMed

Li, Jun; Wang, Xiao-min; Dou, Zhong-ying; Li, Yong

2012-07-01

To express Nanog fusion protein in Escherichia coli ( E.coli), and to prepare rabbit anti-mouse polyclonal antibodies to the Nanog fusion protein. Mouse Nanog gene was amplified from the pNA992 recombinant plasmid and inserted into pET-32a vector to construct a recombinant expression vector pET-32a-Nanog. The recombinant vector was transfected into E.coli BL21 and induced by IPTG to express in them. The acquired Nanog fusion protein was purified with HisTrap affinity column and injected as an antigen into rabbits for preparing polyclonal antibodies. At last, the titer and specificity of the polyclonal antibodies were analyzed with indirect ELISA, Western blotting and immunocytochemical staining, respectively. The recombinant expression vector pET-32a-Nanog was successfully prepared, transfected and induced to obtain the high expression of the Nanog fusion protein in a form of inclusion bodies in E.coli. After purification, its purity was up to 97%. The titer of anti-Nanog antibodies was 1:32 000 in the immunized rabbit serum, and exhibited a high specificity to Nanog protein. The rabbit anti-mouse polyclonal antibodies have been prepared successfully with a high titer and specificity to the Nanog fusion protein.

Development of new plasmid DNA vaccine vectors with R1-based replicons

PubMed Central

2012-01-01

Background There has been renewed interest in biopharmaceuticals based on plasmid DNA (pDNA) in recent years due to the approval of several veterinary DNA vaccines, on-going clinical trials of human pDNA-based therapies, and significant advances in adjuvants and delivery vehicles that have helped overcome earlier efficacy deficits. With this interest comes the need for high-yield, cost-effective manufacturing processes. To this end, vector engineering is one promising strategy to improve plasmid production. Results In this work, we have constructed a new DNA vaccine vector, pDMB02-GFP, containing the runaway R1 origin of replication. The runaway replication phenotype should result in plasmid copy number amplification after a temperature shift from 30°C to 42°C. However, using Escherichia coli DH5α as a host, we observed that the highest yields of pDMB02-GFP were achieved during constant-temperature culture at 30°C, with a maximum yield of approximately 19 mg pDNA/g DCW being observed. By measuring mRNA and protein levels of the R1 replication initiator protein, RepA, we determined that RepA may be limiting pDMB02-GFP yield at 42°C. A mutant plasmid, pDMB-ATG, was constructed by changing the repA start codon from the sub-optimal GTG to ATG. In cultures of DH5α[pDMB-ATG], temperature-induced plasmid amplification was more dramatic than that observed with pDMB02-GFP, and RepA protein was detectable for several hours longer than in cultures of pDMB02-GFP at 42°C. Conclusions Overall, we have demonstrated that R1-based plasmids can produce high yields of high-quality pDNA without the need for a temperature shift, and have laid the groundwork for further investigation of this class of vectors in the context of plasmid DNA production. PMID:22889338

Identification of three extra-chromosomal replicons in Leptospira pathogenic strain and development of new shuttle vectors.

PubMed

Zhu, Weinan; Wang, Jin; Zhu, Yongzhang; Tang, Biao; Zhang, Yunyi; He, Ping; Zhang, Yan; Liu, Boyu; Guo, Xiaokui; Zhao, Guoping; Qin, Jinhong

2015-02-15

The genome of pathogenic Leptospira interrogans contains two chromosomes. Plasmids and prophages are known to play specific roles in gene transfer in bacteria and can potentially serve as efficient genetic tools in these organisms. Although plasmids and prophage remnants have recently been reported in Leptospira species, their characteristics and potential applications in leptospiral genetic transformation systems have not been fully evaluated. Three extrachromosomal replicons designated lcp1 (65,732 bp), lcp2 (56,757 bp), and lcp3 (54,986 bp) in the L. interrogans serovar Linhai strain 56609 were identified through whole genome sequencing. All three replicons were stable outside of the bacterial chromosomes. Phage particles were observed in the culture supernatant of 56609 after mitomycin C induction, and lcp3, which contained phage-related genes, was considered to be an inducible prophage. L. interrogans-Escherichia coli shuttle vectors, constructed with the predicted replication elements of single rep or rep combined with parAB loci from the three plasmids were shown to successfully transform into both saprophytic and pathogenic Leptospira species, suggesting an essential function for rep genes in supporting auto-replication of the plasmids. Additionally, a wide distribution of homologs of the three rep genes was identified in L. interrogans isolates, and correlation tests showed that the transformability of the shuttle vectors in L. interrogans isolates depended, to certain extent, on genetic compatibility between the rep sequences of both plasmid and host. Three extrachromosomal replicons co-exist in L. interrogans, one of which we consider to be an inducible prophage. The vectors constructed with the rep genes of the three replicons successfully transformed into saprophytic and pathogenic Leptospira species alike, but this was partly dependent on genetic compatibility between the rep sequences of both plasmid and host.

Construction of new cloning, lacZ reporter and scarless-markerless suicide vectors for genetic studies in Aggregatibacter actinomycetemcomitans

PubMed Central

Juárez-Rodríguez, María Dolores; Torres-Escobar, Ascención; Demuth, Donald R.

2013-01-01

To elucidate the putative function of a gene, effective tools are required for genetic characterization that facilitate its inactivation, deletion or modification on the bacterial chromosome. In the present study, the nucleotide sequence of the Escherichia coli/Aggregatibacter actinomycetemcomitans shuttle vector pYGK was determined, allowing us to redesign and construct a new shuttle cloning vector, pJT4, and promoterless lacZ transcriptional/translational fusion plasmids, pJT3 and pJT5. Plasmids pJT4 and pJT5 contain the origin of replication necessary to maintain shuttle vector replication. In addition, a new suicide vector, pJT1, was constructed for the generation of scarless and markerless deletion mutations of genes in the oral pathogen A. actinomycetemcomitans. Plasmid pJT1 is a pUC-based suicide vector that is counter-selectable for sucrose sensitivity. This vector does not leave antibiotic markers or scars on the chromosome after gene deletion and thus provides the option to combine several mutations in the same genetic background. The effectiveness of pJT1 was demonstrated by the construction of A. actinomycetemcomitans isogenic qseB single deletion (ΔqseB) mutant and lsrRK double deletion mutants (ΔlsrRK). These new vectors may offer alternatives for genetic studies in A. actinomycetemcomitans and other members of the HACEK (Haemophilus spp., A. actinomycetemcomitans, Cardiobacterium hominis, Eikenella corrodens, and Kingella kingae) group of Gram-negative bacteria. PMID:23353051

Trial and error: how the unclonable human mitochondrial genome was cloned in yeast.

PubMed

Bigger, Brian W; Liao, Ai-Yin; Sergijenko, Ana; Coutelle, Charles

2011-11-01

Development of a human mitochondrial gene delivery vector is a critical step in the ability to treat diseases arising from mutations in mitochondrial DNA. Although we have previously cloned the mouse mitochondrial genome in its entirety and developed it as a mitochondrial gene therapy vector, the human mitochondrial genome has been dubbed unclonable in E. coli, due to regions of instability in the D-loop and tRNA(Thr) gene. We tested multi- and single-copy vector systems for cloning human mitochondrial DNA in E. coli and Saccharomyces cerevisiae, including transformation-associated recombination. Human mitochondrial DNA is unclonable in E. coli and cannot be retained in multi- or single-copy vectors under any conditions. It was, however, possible to clone and stably maintain the entire human mitochondrial genome in yeast as long as a single-copy centromeric plasmid was used. D-loop and tRNA(Thr) were both stable and unmutated. This is the first report of cloning the entire human mitochondrial genome and the first step in developing a gene delivery vehicle for human mitochondrial gene therapy.

Facile Recovery of Individual High-Molecular-Weight, Low-Copy-Number Natural Plasmids for Genomic Sequencing

DOE Office of Scientific and Technical Information (OSTI.GOV)

Williams, L.E.; Detter, C,; Barrie, K.

2006-06-01

Sequencing of the large (>50 kb), low-copy-number (<5 per cell) plasmids that mediate horizontal gene transfer has been hindered by the difficulty and expense of isolating DNA from individual plasmids of this class. We report here that a kit method previously devised for purification of bacterial artificial chromosomes (BACs) can be adapted for effective preparation of individual plasmids up to 220 kb from wild gram-negative and gram-positive bacteria. Individual plasmid DNA recovered from less than 10 ml of Escherichia coli, Staphylococcus, and Corynebacterium cultures was of sufficient quantity and quality for construction of highcoverage libraries, as shown by sequencing fivemore » native plasmids ranging in size from 30 kb to 94 kb. We also report recommendations for vector screening to optimize plasmid sequence assembly, preliminary annotation of novel plasmid genomes, and insights on mobile genetic element biology derived from these sequences. Adaptation of this BAC method for large plasmid isolation removes one major technical hurdle to expanding our knowledge of the natural plasmid gene pool.« less

Genetic & virulence profiling of ESBL-positive E. coli from nosocomial & veterinary sources.

PubMed

Tyrrell, J M; Wootton, M; Toleman, M A; Howe, R A; Woodward, M; Walsh, T R

2016-04-15

CTX-M genes are the most prevalent ESBL globally, infiltrating nosocomial, community and environmental settings. Wild and domesticated animals may act as effective vectors for the dissemination of CTX-producing Enterobacteriaceae. This study aimed to contextualise blaCTX-M-14-positive, cephalosporin-resistant Enterobacteriaceae human infections and compared resistance and pathogenicity markers with veterinary isolates. Epidemiologically related human (n=18) and veterinary (n=4) blaCTX-M-14-positive E. coli were fully characterised. All were typed by XbaI pulsed field gel electrophoresis and ST. Chromosomal/plasmidic locations of blaCTX-M-14 were deduced by S1-nuclease digestion, and association with ISEcp1 was investigated by sequencing. Conjugation experiments assessed transmissibility of plasmids carrying blaCTX-M-14. Presence of virulence determinants was screened by PCR assay and pathogenicity potential was determined by in vitro Galleria mellonella infection models. 84% of clinical E. coli originated from community patients. blaCTX-M-14 was found ubiquitously downstream of ISEcp1 upon conjugative plasmids (25-150 kb). blaCTX-M-14 was also found upon the chromosome of eight E. coli isolates. CTX-M-14-producing E. coli were found at multiple hospital sites. Clonal commonality between patient, hospitals and livestock microbial populations was found. In vivo model survival rates from clinical isolates (30%) and veterinary isolates (0%) were significantly different (p<0.05). Co-transfer of blaCTX-M-14 and virulence determinants was demonstrated. There is evidence of clonal spread of blaCTX-M-14-positive E. coli involving community patients and farm livestock. blaCTX-M-14 positive human clinical isolates carry a lower intrinsic pathogenic potential than veterinary E. coli highlighting the need for greater veterinary practices in preventing dissemination of MDR E. coli among livestock. Copyright © 2016. Published by Elsevier B.V.

Transfer of Herb-Resistance Plasmid From Escherichia coli to Staphylococcus aureus Residing in the Human Urinary Tract

PubMed Central

Tong, Yan Qing; Xin, Bing; Zhu, Li

2014-01-01

Background: Plasmid transfer among bacteria provides a means for dissemination of resistance. Plasmid Analysis has made it possible to track plasmids that induce resistance in bacterial population. Objectives: To screen the presence of herb-resistance plasmid in Escherichia coli strains and determine the transferability of this resistance plasmid directly from E. coli to the Gram-positive, Staphylococcus aureus. Materials and Methods: The donor strain E. coli CP9 and recipient strain S. aureus RN450RF were isolated from UTI patients. E. coli CP9 was highly resistant to herbal concoction. Isolates of S. aureus RN450RF were fully susceptible. Total plasmid DNA was prepared and transferred into E. coli DH5α. Transconjugants were selected on agar plates containing serial dilutions of herbal concoction. Resistance plasmid was transferred to susceptible S. aureus RN450RFin triple replicas. The mating experiments were repeated twice. Results: The identified 45 kb herb-resistance plasmid could be transferred from E. coli CP9 isolates to E. coli DH5α. As a consequence E. coli DH5α transconjugant MIC increased from 0.0125 g/mL to 0.25 g/mL. The plasmid was easily transferred from E. coli CP9 strain to S. aureus RN450RF with a mean transfer rate of 1×10-2 transconjugants/recipient. The E. coli donor and the S. aureus RN450RF transconjugant contained a plasmid of the same size, which was absent in the recipient before mating. Susceptibility testing showed that the S. aureus RN450RF transconjugant was resistant to herbal concoction. Conclusions: E. coli herb-resistance plasmid can replicate and be expressed in S. aureus. PMID:25147679

Occurrence of plasmid-mediated quinolone resistance genes in Escherichia coli and Klebsiella spp. recovered from Corvus brachyrhynchos and Corvus corax roosting in Canada.

PubMed

Janecko, Nicol; Halova, Dana; Jamborova, Ivana; Papousek, Ivo; Masarikova, Martina; Dolejska, Monika; Literak, Ivan

2018-04-19

The spread of antimicrobial resistance from human activity derived sources to natural habitats implicates wildlife as potential vectors of antimicrobial resistance transfer. Wild birds, including corvid species can disseminate mobile genetic resistance determinants through feces. This study aimed to determine the occurrence of plasmid-mediated quinolone resistance (PMQR) genes in Escherichia coli and Klebsiella spp. isolates obtained from winter roosting sites of American crows (Corvus brachyrhynchos) and common ravens (Corvus corax) in Canada. Fecal swabs were collected at five roosting sites across Canada. Selective media isolation and multiplex PCR screening was utilized to identify PMQR genes followed by gene sequencing, PFGE and MLST to characterize isolates. Despite the low prevalence of E. coli containing PMQR (1.3%, 6/449), qnrS1, qnrB19, qnrC, oqxAB and aac(6')-Ib-cr genes were found in five sequence types (ST), including E. coli ST 131. Conversely, one isolate of Klebsiella pneumoniae contained the plasmid-mediated resistance gene qnrB19. Five different K. pneumoniae STs were identified, including two novel types. The occurrence of PMQR genes and STs of public health significance in E. coli and Klebsiella pneumoniae recovered from corvids gives further evidence of the anthropogenic derived dissemination of antimicrobial resistance determinants at the human activity-wildlife-environment interface. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

Construction and Characterization of an in-vivo Linear Covalently Closed DNA Vector Production System

PubMed Central

2012-01-01

Background While safer than their viral counterparts, conventional non-viral gene delivery DNA vectors offer a limited safety profile. They often result in the delivery of unwanted prokaryotic sequences, antibiotic resistance genes, and the bacterial origins of replication to the target, which may lead to the stimulation of unwanted immunological responses due to their chimeric DNA composition. Such vectors may also impart the potential for chromosomal integration, thus potentiating oncogenesis. We sought to engineer an in vivo system for the quick and simple production of safer DNA vector alternatives that were devoid of non-transgene bacterial sequences and would lethally disrupt the host chromosome in the event of an unwanted vector integration event. Results We constructed a parent eukaryotic expression vector possessing a specialized manufactured multi-target site called “Super Sequence”, and engineered E. coli cells (R-cell) that conditionally produce phage-derived recombinase Tel (PY54), TelN (N15), or Cre (P1). Passage of the parent plasmid vector through R-cells under optimized conditions, resulted in rapid, efficient, and one step in vivo generation of mini lcc—linear covalently closed (Tel/TelN-cell), or mini ccc—circular covalently closed (Cre-cell), DNA constructs, separated from the backbone plasmid DNA. Site-specific integration of lcc plasmids into the host chromosome resulted in chromosomal disruption and 105 fold lower viability than that seen with the ccc counterpart. Conclusion We offer a high efficiency mini DNA vector production system that confers simple, rapid and scalable in vivo production of mini lcc DNA vectors that possess all the benefits of “minicircle” DNA vectors and virtually eliminate the potential for undesirable vector integration events. PMID:23216697

Construction and characterization of an in-vivo linear covalently closed DNA vector production system.

PubMed

Nafissi, Nafiseh; Slavcev, Roderick

2012-12-06

While safer than their viral counterparts, conventional non-viral gene delivery DNA vectors offer a limited safety profile. They often result in the delivery of unwanted prokaryotic sequences, antibiotic resistance genes, and the bacterial origins of replication to the target, which may lead to the stimulation of unwanted immunological responses due to their chimeric DNA composition. Such vectors may also impart the potential for chromosomal integration, thus potentiating oncogenesis. We sought to engineer an in vivo system for the quick and simple production of safer DNA vector alternatives that were devoid of non-transgene bacterial sequences and would lethally disrupt the host chromosome in the event of an unwanted vector integration event. We constructed a parent eukaryotic expression vector possessing a specialized manufactured multi-target site called "Super Sequence", and engineered E. coli cells (R-cell) that conditionally produce phage-derived recombinase Tel (PY54), TelN (N15), or Cre (P1). Passage of the parent plasmid vector through R-cells under optimized conditions, resulted in rapid, efficient, and one step in vivo generation of mini lcc--linear covalently closed (Tel/TelN-cell), or mini ccc--circular covalently closed (Cre-cell), DNA constructs, separated from the backbone plasmid DNA. Site-specific integration of lcc plasmids into the host chromosome resulted in chromosomal disruption and 10(5) fold lower viability than that seen with the ccc counterpart. We offer a high efficiency mini DNA vector production system that confers simple, rapid and scalable in vivo production of mini lcc DNA vectors that possess all the benefits of "minicircle" DNA vectors and virtually eliminate the potential for undesirable vector integration events.

Production and purification of non replicative canine adenovirus type 2 derived vectors.

PubMed

Szelechowski, Marion; Bergeron, Corinne; Gonzalez-Dunia, Daniel; Klonjkowski, Bernard

2013-12-03

Adenovirus (Ad) derived vectors have been widely used for short or long-term gene transfer, both for gene therapy and vaccine applications. Because of the frequent pre-existing immunity against the classically used human adenovirus type 5, canine adenovirus type 2 (CAV2) has been proposed as an alternative vector for human gene transfer. The well-characterized biology of CAV2, together with its ease of genetic manipulation, offer major advantages, notably for gene transfer into the central nervous system, or for inducing a wide range of protective immune responses, from humoral to cellular immunity. Nowadays, CAV2 represents one of the most appealing nonhuman adenovirus for use as a vaccine vector. This protocol describes a simple method to construct, produce and titer recombinant CAV2 vectors. After cloning the expression cassette of the gene of interest into a shuttle plasmid, the recombinant genomic plasmid is obtained by homologous recombination in the E. coli BJ5183 bacterial strain. The resulting genomic plasmid is then transfected into canine kidney cells expressing the complementing CAV2-E1 genes (DK-E1). A viral amplification enables the production of a large viral stock, which is purified by ultracentrifugation through cesium chloride gradients and desalted by dialysis. The resulting viral suspension routinely has a titer of over 10(10) infectious particles per ml and can be directly administrated in vivo.

Construction of a recombinant-BCG containing the LMP2A and BZLF1 genes and its significance in the Epstein-Barr virus positive gastric carcinoma.

PubMed

Xue, Qing-Jie; Dai, Jun; Li, Xiu-Zhen; Zhu, Wei; Si, Chuan-Ping; Chen, Ting

2014-10-01

The signal peptide Ag85B of Bacillus Chalmette-Guerin (BCG) was used to construct a recombinant plasmid of BCG. The BCG-Ag85B gene and fused EBV LMP2A and BZLF1 genes were amplified and successively inserted into the Escherichia coli-BCG shuttle-vector pMV261. The recombinant plasmids were then amplified in E. coli DH5α and transformed into competent BCG. The expression of BZLF1 and LMP2A fusion proteins in recombinant-BCG (rBCG) was shown by Western blot. After the injection of recombinant-BCG into mice, antibodies against the fusion protein BZLF1 and LMP2A were measured by ELISA, and the cellular immune effects were determined by the lactate dehydrogenate (LDH) release assays. The results confirmed that the cloned genes of BCG-Ag85B and Z2A were correctly inserted into the vector pMV261. The recombinant plasmid pMVZ2A expressed Z2A in BCG effectively after transformation. The rBCG proteins were recognized by the BZLF1 (LMP2A) antibody. An ELISA demonstrated that rBCG could stimulate the generation of antibody against the fusion protein. The fusion gene was constructed successfully, and the rBCG induced humoral and cellular immune response in mice. © 2014 Wiley Periodicals, Inc.

In vivo and in vitro cloning and phenotype characterization of tellurite resistance determinant conferred by plasmid pTE53 of a clinical isolate of Escherichia coli.

PubMed

Burian, J; Tu, N; Kl'ucár, L; Guller, L; Lloyd-Jones, G; Stuchlík, S; Fejdi, P; Siekel, P; Turna, J

1998-01-01

A determinant encoding resistance against potassium tellurite (Te(r)) was discovered in a clinical isolate of Escherichia coli strain KL53. The strain formed typical black colonies on solid LB medium with tellurite. The determinant was located on a large conjugative plasmid designated pTE53. Electron-dense particles were observed in cells harboring pTE53 by electron microscopy. X-Ray identification analysis identified these deposits as elemental tellurium and X-ray diffraction analysis showed patterns typical of crystalline structures. Comparison with JCPDS 4-0554 (Joint Committee on Powder Diffraction Standards) reference data confirmed that these crystals were pure tellurium crystals. In common with other characterized Te(r) determinants, accumulation studies with radioactively labeled tellurite showed that reduced uptake of tellurite did not contribute to the resistance mechanism. Tellurite accumulation rates for E. coli strain AB1157 harboring pTE53 were twice higher than for the plasmid-free host strain. In addition, no efflux mechanism was detected. The potassium tellurite resistance determinant of plasmid pTE53 was cloned using both in vitro and in vivo techniques in low-copy-number vectors pACYC184 and mini-Mu derivative pPR46. Cloning of the functional Te(r) determinant into high-copy cloning vectors pTZ19R and mini-Mu derivatives pBEf and pJT2 was not successful. During in vivo cloning experiments, clones with unusual "white colony" phenotypes were found on solid LB with tellurite. All these clones were Mucts62 lysogens. Their tellurite resistance levels were in the same order as the wild type strains. Clones with the "white" phenotype had a 3.6 times lower content of tellurium than the tellurite-reducing strain. Transformation of a "white" mutant with a recombinant pACYC184 based Te(r) plasmid did not change the phenotype. However, when one clone was cured from Mucts62 the "white" phenotype reverted to the wild-type "black" phenotype. It was suggested that the "white" phenotype was the result of an insertional inactivation of an unknown chromosomal gene by Mucts62, which reduced the tellurite uptake.

Plasmid Replicon Typing of Commensal and Pathogenic Escherichia coli Isolates▿

PubMed Central

Johnson, Timothy J.; Wannemuehler, Yvonne M.; Johnson, Sara J.; Logue, Catherine M.; White, David G.; Doetkott, Curt; Nolan, Lisa K.

2007-01-01

Despite the critical role of plasmids in horizontal gene transfer, few studies have characterized plasmid relatedness among different bacterial populations. Recently, a multiplex PCR replicon typing protocol was developed for classification of plasmids occurring in members of the Enterobacteriaceae. Here, a simplified version of this replicon typing procedure which requires only three multiplex panels to identify 18 plasmid replicons is described. This method was used to screen 1,015 Escherichia coli isolates of avian, human, and poultry meat origin for plasmid replicon types. Additionally, the isolates were assessed for their content of several colicin-associated genes. Overall, a high degree of plasmid variability was observed, with 221 different profiles occurring among the 1,015 isolates examined. IncFIB plasmids were the most common type identified, regardless of the source type of E. coli. IncFIB plasmids occurred significantly more often in avian pathogenic E. coli (APEC) and retail poultry E. coli (RPEC) than in uropathogenic E. coli (UPEC) and avian and human fecal commensal E. coli isolates (AFEC and HFEC, respectively). APEC and RPEC were also significantly more likely than UPEC, HFEC, and AFEC to possess the colicin-associated genes cvaC, cbi, and/or cma in conjunction with one or more plasmid replicons. The results suggest that E. coli isolates contaminating retail poultry are notably similar to APEC with regard to plasmid profiles, with both generally containing multiple plasmid replicon types in conjunction with colicin-related genes. In contrast, UPEC and human and avian commensal E. coli isolates generally lack the plasmid replicons and colicin-related genes seen in APEC and RPEC, suggesting limited dissemination of such plasmids among these bacterial populations. PMID:17277222

Ecological and genetic determinants of plasmid distribution in Escherichia coli.

PubMed

Medaney, Frances; Ellis, Richard J; Raymond, Ben

2016-11-01

Bacterial plasmids are important carriers of virulence and antibiotic resistance genes. Nevertheless, little is known of the determinants of plasmid distribution in bacterial populations. Here the factors affecting the diversity and distribution of the large plasmids of Escherichia coli were explored in cattle grazing on semi-natural grassland, a set of populations with low frequencies of antibiotic resistance genes. Critically, the population genetic structure of bacterial hosts was chararacterized. This revealed structured E. coli populations with high diversity between sites and individuals but low diversity within cattle hosts. Plasmid profiles, however, varied considerably within the same E. coli genotype. Both ecological and genetic factors affected plasmid distribution: plasmid profiles were affected by site, E. coli diversity, E. coli genotype and the presence of other large plasmids. Notably 3/26 E. coli serotypes accounted for half the observed plasmid-free isolates indicating that within species variation can substantially affect carriage of the major conjugative plasmids. The observed population structure suggest that most of the opportunities for within species plasmid transfer occur between different individuals of the same genotype and support recent experimental work indicating that plasmid-host coevolution, and epistatic interactions on fitness costs are likely to be important in determining occupancy. © 2016 The Authors. Environmental Microbiology published by Society for Applied Microbiology and John Wiley & Sons Ltd.

A cell engineering strategy to enhance supercoiled plasmid DNA production for gene therapy.

PubMed

Hassan, Sally; Keshavarz-Moore, Eli; Ward, John

2016-09-01

With the recent revival of the promise of plasmid DNA vectors in gene therapy, a novel synthetic biology approach was used to enhance the quantity, (yield), and quality of the plasmid DNA. Quality was measured by percentage supercoiling and supercoiling density, as well as improving segregational stability in fermentation. We examined the hypothesis that adding a Strong Gyrase binding Site (SGS) would increase DNA gyrase-mediated plasmid supercoiling. SGS from three different replicons, (the Mu bacteriophage and two plasmids, pSC101 and pBR322) were inserted into the plasmid, pUC57. Different sizes of these variants were transformed into E. coli DH5α, and their supercoiling properties and segregational stability measured. A 36% increase in supercoiling density was found in pUC57-SGS, but only when SGS was derived from the Mu phage and was the larger sized version of this fragment. These results were also confirmed at fermentation scale. Total percentage supercoiled monomer was maintained to 85-90%. A twofold increase in plasmid yield was also observed for pUC57-SGS in comparison to pUC57. pUC57-SGS displayed greater segregational stability than pUC57-cer and pUC57, demonstrating a further potential advantage of the SGS site. These findings should augment the potential of plasmid DNA vectors in plasmid DNA manufacture. Biotechnol. Bioeng. 2016;113: 2064-2071. © 2016 The Authors. Biotechnology and Bioengineering Published by Wiley Periodicals, Inc. © 2016 The Authors. Biotechnology and Bioengineering Published by Wiley Periodicals, Inc.

Complete genetic analysis of plasmids carrying mcr-1 and other resistance genes in an Escherichia coli isolate of animal origin.

PubMed

Li, Ruichao; Xie, Miaomiao; Lv, Jingzhang; Wai-Chi Chan, Edward; Chen, Sheng

2017-03-01

To investigate the genetic features of three plasmids recovered from an MCR-1 and ESBL-producing Escherichia coli strain, HYEC7, and characterize the transmission mechanism of mcr-1 . The genetic profiles of three plasmids were determined by PCR, S1-PFGE, Southern hybridization and WGS analysis. The ability of the mcr-1 -bearing plasmid to undergo conjugation was also assessed. The mcr-1 -bearing transposon Tn 6330 was characterized by PCR and DNA sequencing. Complete sequences of three plasmids were obtained. A non-conjugative phage P7-like plasmid, pHYEC7- mcr1 , was found to harbour the mcr-1 -bearing transposon Tn 6330 , which could be excised from the plasmid by generating a circular intermediate harbouring mcr-1 and the IS Apl1 element. The insertion of the circular intermediate into another plasmid, pHYEC7-IncHI2, could form pHNSHP45-2, the original IncHI2-type mcr-1 -carrying plasmid that was reported. The third plasmid, pHYEC7-110, harboured two replicons, IncX1 and IncFIB, and comprised multiple antimicrobial resistance mobile elements, some of which were shared by pHYEC7-IncHI2. The Tn 6330 element located in the phage-like plasmid pHYEC7- mcr1 could be excised from the plasmid and formed a circular intermediate that could be integrated into plasmids containing the IS Apl1 element. This phenomenon indicated that Tn 6330 is a key element responsible for widespread dissemination of mcr-1 among various types of plasmids and bacterial chromosomes. The dissemination rate of such an element may be further enhanced upon translocation into phage-like vectors, which may also be transmitted via transduction events. © The Author 2016. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Expression of hygromycin B resistance in oyster culinary-medicinal mushroom, Pleurotus ostreatus (Jacq.:Fr.)P. Kumm. (higher Basidiomycetes) using three gene expression systems.

PubMed

Dong, Xiaoya; Zhang, Ke; Gao, Yuqian; Qi, Yuancheng; Shen, Jinwen; Qiu, Liyou

2012-01-01

Three hygromycin B phosphotransferase (hph) gene expression systems for culinary-medicinal Oyster mushroom, Pleurotus ostreatus, plasmid pSHC, pAN7-1, and pBHt1 were evaluated through PEG/CaCl(2)-mediated protoplast transformation. Plasmid pSHC is a newly constructed hph gene expression system, composed of Escherichia coli hph gene, the P. ostreatus sdi promoter, and the CaMV35S terminator. The vector pAN7-1 was commonly used for integrative transformation in filamentous fungi. Plasmid pBHtl is a T-DNA binary vector, usually introduced into fungi by Agrobacterium-mediated transformation. The results showed that plasmids pSHC, pAN7-1, and pBHt1 were all integrated into the host chromosomes and expressed hygromycin B resistance in P. ostreatus. pAN7-1 had the highest transformation efficiency and hph gene expression level, pSHC the second, and pBHt1 the lowest. Growth rates of the transformants on plates containing hygromycin B were in correspondence with their hph gene expression levels. To our knowledge, this is the first report on integrated transformation of plasmid pAN7-1 and pBHt1 in P. ostreatus.

Manipulation for plasmid elimination by transforming synthetic competitors diversifies lactococcus lactis starters applicable to food products.

PubMed

Kobayashi, Miho; Nomura, Masaru; Kimoto, Hiromi

2007-11-01

This study was designed selectively to eliminate a theta-plasmid from Lactococcus lactis strains by transforming synthetic competitors. A shuttle vector for Escherichia coli and L. lactis, pDB1, was constructed by ligating a partial replicon of pDR1-1B, which is a 7.3 kb theta-plasmid in L. lactis DRC1, with an erythromycin resistance gene into pBluescript II KS(+). This versatile vector was used to construct competitors to common lactococcal theta-plasmids. pDB1 contains the 5' half of the replication origin and the 3' region of repB of pDR1-1B, but lacks the 1.1-kb region normally found between these two segments. A set of primers, Pv3 and Pv4, was designed to amplify the 1.1-kb middle parts of the general theta-replicons of lactococcal plasmids. When the PCR products were cloned into the Nru I and Xho I sites of pDB1, synthetic replicons were constructed and replication activity was restored. A number of theta-plasmids in L. lactis ssp. lactis and cremoris were eliminated selectively by transforming the synthetic competitors. These competitors were easily eliminated by subculture for a short time in the absence of selection. The resulting variants contained no exogenous DNA and are suitable for food products, since part of the phenotype was altered without altering other plasmids indispensable for fermentation.

DIY series of genetic cassettes useful in construction of versatile vectors specific for Alphaproteobacteria.

PubMed

Dziewit, Lukasz; Adamczuk, Marcin; Szuplewska, Magdalena; Bartosik, Dariusz

2011-08-01

We have developed a DIY (Do It Yourself) series of genetic cassettes, which facilitate construction of novel versatile vectors for Alphaproteobacteria. All the cassettes are based on defined genetic modules derived from three natural plasmids of Paracoccus aminophilus JCM 7686. We have constructed over 50 DIY cassettes, which differ in structure and specific features. All of them are functional in eight strains representing three orders of Alphaproteobacteria: Rhodobacterales, Rhizobiales and Caulobacterales. Besides various replication and stabilization systems, many of the cassettes also contain selective markers appropriate for Alphaproteobacteria (40 cassettes) and genetic modules responsible for mobilization for conjugal transfer (24 cassettes). All the DIY cassettes are bordered by different types of polylinkers, which facilitate vector construction. Using these DIY cassettes, we have created a set of compatible Escherichia coli-Alphaproteobacteria mobilizable shuttle vectors (high or low copy number in E. coli), which will greatly assist the genetic manipulation of Alphaproteobacteria. Copyright © 2011 Elsevier B.V. All rights reserved.

Design of a Retrovirus-Derived Vector for Expression and Transduction of Exogenous Genes in Mammalian Cells

PubMed Central

Perkins, Archibald S.; Kirschmeier, Paul T.; Gattoni-Celli, Sebastiano; Weinstein, I. Bernard

1983-01-01

We have developed a transfection vector for animal cells that contains long terminal repeat (LTR) sequences to promote expression. Plasmid p101/101, a derivative of plasmid pBR322 containing the complete Moloney murine sarcoma virus genome, was cut with restriction enzymes and religated so that both the 5′ and 3′ LTRs were retained and all but about 700 base pairs of the intervening viral sequences were removed. To test this vector, the Escherichia coli gene gpt was cloned into a unique PstI site, between the two LTRs, with guanine and cytosine tailing, a method that can be generalized for insertion of any DNA segment into this vector. When DNA from recombinant plasmids in which the gpt gene was inserted in the same transcriptional polarity as the LTR sequences was transfected onto murine or rat fibroblast cultures, we obtained a high yield of Gpt+ colonies. However, plasmid constructs with the gpt gene in the opposite polarity were virtually devoid of activity. With gpt in the proper orientation, restriction enzyme cuts within the LTRs or between the 5′ LTR and the gpt gene reduced transfection by more than 98%, whereas a cut between the gpt gene and the 3′ LTR gave an 80% reduction in activity. Thus, both 5′ and 3′ LTR sequences are essential for optimal gpt expression, although the 5′ LTR appears to play a more important role. When the LTR-gpt plasmid was transfected onto murine leukemia virus-infected mouse fibroblasts, we obtained evidence that RNA copies became pseudotyped into viral particles which could transfer the Gpt+ phenotype into rodent cells with extremely high efficiency. This vector should prove useful for high-efficiency transduction of a variety of genes in mammalian cells. Images PMID:6308426

Development of genetic techniques for the psychrotrophic fish pathogen Flavobacterium psychrophilum.

PubMed

Alvarez, B; Secades, P; McBride, M J; Guijarro, J A

2004-01-01

Flavobacterium psychrophilum, a member of the Cytophaga-Flavobacterium-Bacteroides group, is an important pathogen of salmonid fish. Previous attempts to develop genetic techniques for this fastidious, psychrotrophic bacterium have met with failure. Here we describe the development of techniques for the genetic manipulation of F. psychrophilum and the identification of plasmids, selectable markers, a reporter system, and a transposon that function in several isolates of this fish pathogen. The antibiotic resistance genes ermF, cfxA, and tetQ function in F. psychrophilum. Cloning vectors based on the F. psychrophilum cryptic plasmid pCP1 which carried these selectable markers were introduced by conjugation from E. coli, resulting in antibiotic-resistant colonies of F. psychrophilum. Conjugative transfer of DNA into F. psychrophilum was strain dependent. Efficient transfer was observed for two of the seven strains tested (THC02-90 and THC04-90). E. coli lacZY functioned in F. psychrophilum when expressed from a pCP1 promoter, allowing its development as a reporter for studies of gene expression. Plasmids isolated from F. psychrophilum were efficiently introduced into F. psychrophilum by electroporation, but plasmids isolated from E. coli were not suitable for transfer by this route, suggesting the presence of a restriction barrier. DNA isolated from F. psychrophilum was resistant to digestion by Sau3AI and BamHI, indicating that a Sau3AI-like restriction modification system may constitute part of this barrier. Tn4351 was introduced into F. psychrophilum from E. coli and transposed with apparent randomness, resulting in erythromycin-resistant colonies. The techniques developed in this study allow for genetic manipulation and analysis of this important fish pathogen.

Cloning of hydrogenase genes and fine structure analysis of an operon essential for H/sub 2/ metabolism in Escherichia coli

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sankar, P.; Lee, J.H.; Shanmugam, K.T.

1985-04-01

Escherichia coli has two unlinked genes that code for hydrogenase synthesis and activity. The DNA fragments containing the two genes (hydA and hydB) were cloned into a plasmid vector, pBR322. The plasmids containing the hyd genes (pSE-290 and pSE-111 carrying the hydA and hydB genes, respectively) were used to genetically map a total of 51 mutant strains with defects in hydrogenase activity. A total of 37 mutants carried a mutation in the hydB gene, whereas the remaining 14 hyd were hydA. This complementation analysis also established the presence of two new genes, so far unidentified, one coding for formate dehydrogenase-2more » (fdv) and another producing an electron transport protein (fhl) coupling formate dehydrogenase-2 to hydrogenase. Three of the four genes, hydB, fhl, and fdv, may constitute a single operon, and all three genes are carried by a 5.6-kilobase-pair chromosomal DNA insert in plasmid pSE-128. Plasmids carrying a part of this 5.6-kilobase-pair DNA (pSE-130) or fragments derived from this DNA in different orientations (pSE-126 and pSE-129) inhibited the production of active formate hydrogenlyase. This inhibition occurred even in a prototrophic E. coli, strain K-10, but only during an early induction period. These results, based on complementation analysis with cloned DNA fragments, show that both hydA and hydB genes are essential for the production of active hydrogenase. For the expression of active formate hydrogenlyase, two other gene products, fhl and fdv are also needed. All four genes map between 58 and 59 min in the E. coli chromosome.« less

Cytotoxic Effect Associated with Overexpression of QNR Proteins in Escherichia coli.

PubMed

Machuca, Jesús; Diaz de Alba, Paula; Recacha, Esther; Pascual, Álvaro; Rodriguez-Martinez, José Manuel

2017-10-01

The objective was to evaluate the cytotoxic effect associated with overexpression of multiple Qnr-like plasmid-mediated quinolone resistance (PMQR) mechanisms in Escherichia coli. Coding regions of different PMQR genes (qnrA1, qnrB1, qnrC, qnrD1, qnrS1, and qepA2) and efsqnr were cloned into pET29a(+) vector and overexpressed in E. coli BL21. E. coli BL21 with and without an empty pET29a(+) vector were used as controls. The cytotoxic effect associated with PMQR mechanism overexpression was determined by transmission electron microscopy and viability assays. Overexpressed qnr genes produced loss of bacterial viability in the range of 77-97% compared with the controls, comparable with loss of viability associated with EfsQnr overexpression (97%). No loss of viability was observed in E. coli overexpressing QepA2. In transmission electron microscopy assays, signs of cytotoxicity were observed in E. coli cells overexpressing EfsQnr and Qnr proteins (30-45% of the bacterial population showed morphological changes). Morphological changes were observed in less than 5% of bacterial populations from the control strains and E. coli overexpressing QepA2. Overexpression of qnr genes produces a cytotoxic cellular and structural effect in E. coli, the magnitude of which varies depending on the family of Qnr proteins.

Molecular Characterization of Heterologous HIV-1gp120 Gene Expression Disruption in Mycobacterium bovis BCG Host Strain: A Critical Issue for Engineering Mycobacterial Based-Vaccine Vectors

PubMed Central

Joseph, Joan; Fernández-Lloris, Raquel; Pezzat, Elías; Saubi, Narcís; Cardona, Pere-Joan; Mothe, Beatriz; Gatell, Josep Maria

2010-01-01

Mycobacterium bovis Bacillus Calmette-Guérin (BCG) as a live vector of recombinant bacterial vaccine is a promising system to be used. In this study, we evaluate the disrupted expression of heterologous HIV-1gp120 gene in BCG Pasteur host strain using replicative vectors pMV261 and pJH222. pJH222 carries a lysine complementing gene in BCG lysine auxotrophs. The HIV-1 gp120 gene expression was regulated by BCG hsp60 promoter (in plasmid pMV261) and Mycobacteria spp. α-antigen promoter (in plasmid pJH222). Among 14 rBCG:HIV-1gp120 (pMV261) colonies screened, 12 showed a partial deletion and two showed a complete deletion. However, deletion was not observed in all 10 rBCG:HIV-1gp120 (pJH222) colonies screened. In this study, we demonstrated that E. coli/Mycobacterial expression vectors bearing a weak promoter and lysine complementing gene in a recombinant lysine auxotroph of BCG could prevent genetic rearrangements and disruption of HIV 1gp120 gene expression, a key issue for engineering Mycobacterial based vaccine vectors. PMID:20617151

The reversed terminator of octopine synthase gene on the Agrobacterium Ti plasmid has a weak promoter activity in prokaryotes.

PubMed

Shao, Jun-Li; Long, Yue-Sheng; Chen, Gu; Xie, Jun; Xu, Zeng-Fu

2010-06-01

Agrobacterium tumefaciens transfers DNA from its Ti plasmid to plant host cells. The genes located within the transferred DNA of Ti plasmid including the octopine synthase gene (OCS) are expressed in plant host cells. The 3'-flanking region of OCS gene, known as OCS terminator, is widely used as a transcriptional terminator of the transgenes in plant expression vectors. In this study, we found the reversed OCS terminator (3'-OCS-r) could drive expression of hygromycin phosphotransferase II gene (hpt II) and beta-glucuronidase gene in Escherichia coli, and expression of hpt II in A. tumefaciens. Furthermore, reverse transcription-polymerase chain reaction analysis revealed that an open reading frame (ORF12) that is located downstream to the 3'-OCS-r was transcribed in A. tumefaciens, which overlaps in reverse with the coding region of the OCS gene in octopine Ti plasmid.

Cloning and characterization of an autonomous replication sequence from Coxiella burnetii.

PubMed Central

Suhan, M; Chen, S Y; Thompson, H A; Hoover, T A; Hill, A; Williams, J C

1994-01-01

A Coxiella burnetii chromosomal fragment capable of functioning as an origin for the replication of a kanamycin resistance (Kanr) plasmid was isolated by use of origin search methods utilizing an Escherichia coli host. The 5.8-kb fragment was subcloned into phagemid vectors and was deleted progressively by an exonuclease III-S1 technique. Plasmids containing progressively shorter DNA fragments were then tested for their capability to support replication by transformation of an E. coli polA strain. A minimal autonomous replication sequence (ARS) was delimited to 403 bp. Sequencing of the entire 5.8-kb region revealed that the minimal ARS contained two consensus DnaA boxes, three A + T-rich 21-mers, a transcriptional promoter leading rightwards, and potential integration host factor and factor of inversion stimulation binding sites. Database comparisons of deduced amino acid sequences revealed that open reading frames located around the ARS were homologous to genes often, but not always, found near bacterial chromosomal origins; these included identities with rpmH and rnpA in E. coli and identities with the 9K protein and 60K membrane protein in E. coli and Pseudomonas species. These and direct hybridization data suggested that the ARS was chromosomal and not associated with the resident plasmid QpH1. Two-dimensional agarose gel electrophoresis did not reveal the presence of initiating intermediates, indicating that the ARS did not initiate chromosome replication during laboratory growth of C. burnetii. Images PMID:8071197

Changing plasmid types responsible for extended spectrum cephalosporin resistance in Escherichia coli O157:H7 in the United States, 1996–2009

PubMed Central

Folster, J. P.; Pecic, G.; Stroika, S.; Rickert, R.; Whichard, J.

2015-01-01

Escherichia coli O157 is a major cause of foodborne illness. Plasmids are genetic elements that mobilize antimicrobial resistance determinants including blaCMY β-lactamases that confer resistance to extended-spectrum cephalosporins (ESC). ESCs are important for treating a variety of infections. IncA/C plasmids are found among diverse sources, including cattle, the principal source of E. coli O157 infections in humans. IncI1 plasmids are common among E. coli and Salmonella from poultry and other avian sources. To broaden our understanding of reservoirs of blaCMY, we determined the types of plasmids carrying blaCMY among E. coli O157. From 1996 to 2009, 3742 E. coli O157 isolates were tested. Eleven (0.29%) were ceftriaxone resistant and had a blaCMY-2-containing plasmid. All four isolates submitted before 2001 and a single 2001 isolate had blaCMY encoded on IncA/C plasmids, while all five isolates submitted after 2001 and a single 2001 isolate had blaCMY carried on IncI1 plasmids. The IncI1 plasmids were ST2, ST20, and ST23. We conclude that cephalosporin resistance among E. coli O157:H7 is due to plasmid-encoded blaCMY genes and that plasmid types appear to have shifted from IncA/C to IncI1. This shift suggests either a change in plasmid type among animal reservoirs or that the organism has expanded into avian reservoirs. More analysis of human, retail meat, and food animal isolates is necessary to broaden our understanding of the antimicrobial resistance determinants of ESC resistance among E. coli O157. PMID:26478858

Insights into the environmental resistance gene pool from the genome sequence of the multidrug-resistant environmental isolate Escherichia coli SMS-3-5.

PubMed

Fricke, W Florian; Wright, Meredith S; Lindell, Angela H; Harkins, Derek M; Baker-Austin, Craig; Ravel, Jacques; Stepanauskas, Ramunas

2008-10-01

The increasing occurrence of multidrug-resistant pathogens of clinical and agricultural importance is a global public health concern. While antimicrobial use in human and veterinary medicine is known to contribute to the dissemination of antimicrobial resistance, the impact of microbial communities and mobile resistance genes from the environment in this process is not well understood. Isolated from an industrially polluted aquatic environment, Escherichia coli SMS-3-5 is resistant to a record number of antimicrobial compounds from all major classes, including two front-line fluoroquinolones (ciprofloxacin and moxifloxacin), and in many cases at record-high concentrations. To gain insights into antimicrobial resistance in environmental bacterial populations, the genome of E. coli SMS-3-5 was sequenced and compared to the genome sequences of other E. coli strains. In addition, selected genetic loci from E. coli SMS-3-5 predicted to be involved in antimicrobial resistance were phenotypically characterized. Using recombinant vector clones from shotgun sequencing libraries, resistance to tetracycline, streptomycin, and sulfonamide/trimethoprim was assigned to a single mosaic region on a 130-kb plasmid (pSMS35_130). The remaining plasmid backbone showed similarity to virulence plasmids from avian-pathogenic E. coli (APEC) strains. Individual resistance gene cassettes from pSMS35_130 are conserved among resistant bacterial isolates from multiple phylogenetic and geographic sources. Resistance to quinolones was assigned to several chromosomal loci, mostly encoding transport systems that are also present in susceptible E. coli isolates. Antimicrobial resistance in E. coli SMS-3-5 is therefore dependent both on determinants acquired from a mobile gene pool that is likely available to clinical and agricultural pathogens, as well, and on specifically adapted multidrug efflux systems. The association of antimicrobial resistance with APEC virulence genes on pSMS35_130 highlights the risk of promoting the spread of virulence through the extensive use of antibiotics.

Overproduction of α-Lipoic Acid by Gene Manipulated Escherichia coli

PubMed Central

Sun, Yirong; Zhang, Wenbin; Ma, Jincheng; Pang, Hongshen; Wang, Haihong

2017-01-01

Alpha-lipoic acid (LA) is an important enzyme cofactor widely used by organisms and is also a natural antioxidant for the treatment of pathologies driven by low levels of endogenous antioxidants. In order to establish a safer and more efficient process for LA production, we developed a new biological method for LA synthesis based on the emerging knowledge of lipoic acid biosynthesis. We first cloned the lipD gene, which encodes the lipoyl domain of the E2 subunit of pyruvate dehydrogenase, allowing high levels of LipD production. Plasmids containing genes for the biosynthesis of LA were subsequently constructed utilizing various vectors and promotors to produce high levels of LA. These plasmids were transformed into the Escherichia coli strain BL21. Octanoic acid (OA) was used as the substrate for LA synthesis. One transformant, YS61, which carried lipD, lplA, and lipA, produced LA at levels over 200-fold greater than the wild-type strain, showing that LA could be produced efficiently in E. coli using genetic engineering methods. PMID:28068366

Human HOXA5 homeodomain enhances protein transduction and its application to vascular inflammation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lee, Ji Young; Park, Kyoung sook; Cho, Eun Jung

2011-07-01

Highlights: {yields} We have developed an E. coli protein expression vector including human specific gene sequences for protein cellular delivery. {yields} The plasmid was generated by ligation the nucleotides 770-817 of the homeobox A5 mRNA sequence. {yields} HOXA5-APE1/Ref-1 inhibited TNF-alpha-induced monocyte adhesion to endothelial cells. {yields} Human HOXA5-PTD vector provides a powerful research tools for uncovering cellular functions of proteins or for the generation of human PTD-containing proteins. -- Abstract: Cellular protein delivery is an emerging technique by which exogenous recombinant proteins are delivered into mammalian cells across the membrane. We have developed an Escherichia coli expression vector including humanmore » specific gene sequences for protein cellular delivery. The plasmid was generated by ligation the nucleotides 770-817 of the homeobox A5 mRNA sequence which was matched with protein transduction domain (PTD) of homeodomain protein A5 (HOXA5) into pET expression vector. The cellular uptake of HOXA5-PTD-EGFP was detected in 1 min and its transduction reached a maximum at 1 h within cell lysates. The cellular uptake of HOXA5-EGFP at 37 {sup o}C was greater than in 4 {sup o}C. For study for the functional role of human HOXA5-PTD, we purified HOXA5-APE1/Ref-1 and applied it on monocyte adhesion. Pretreatment with HOXA5-APE1/Ref-1 (100 nM) inhibited TNF-{alpha}-induced monocyte adhesion to endothelial cells, compared with HOXA5-EGFP. Taken together, our data suggested that human HOXA5-PTD vector provides a powerful research tools for uncovering cellular functions of proteins or for the generation of human PTD-containing proteins.« less

Restricted ultraviolet mutational spectrum in a shuttle vector propagated in xeroderma pigmentosum cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bredberg, A.; Kraemer, K.H.; Seidman, M.M.

1986-11-01

A shuttle vector plasmid, pZ189, carrying a bacterial suppressor tRNA marker gene, was treated with ultraviolet radiation and propagated in cultured skin cells from a patient with the skin-cancer-prone, DNA repair-deficient disease xeroderma pigmentosum and in repair-proficient cells. After replication in the human cells, progeny plasmids were purified. Plasmid survival and mutations inactivating the marker gene were scored by transforming an indicator strain of Escherichia coli carrying a suppressible amber mutation in the beta-galactosidase gene. Plasmid survival in the xeroderma pigmentosum cells was less than that of pZ189 harvested from repair-proficient human cells. The point-mutation frequency in the 150-base-pair tRNAmore » marker gene increased up to 100-fold with ultraviolet dose. Sequence analysis of 150 mutant plasmids revealed that mutations were infrequent at potential thymine-thymine dimer sites. Ninety-three percent of the mutant plasmids from the xeroderma pigmentosum cells showed G X C----A X T transitions, compared to 73% in the normal cells (P less than 0.002). There were significantly fewer transversions (P less than 0.002) (especially G X C----T X A) and multiple base substitutions (P less than 0.00001) than when pZ189 was passaged in repair-proficient cells. The subset of mutational changes that are common to ultraviolet-treated plasmids propagated in both repair-proficient and xeroderma pigmentosum skin cells may be associated with the development of ultraviolet-induced skin cancer in humans.« less

Assessment of the Mobilizable Vector Plasmids pSUP202 and pSUP404.2 as Genetic Tools for the Predatory Bacterium Bdellovibrio bacteriovorus

PubMed Central

Roschanski, Nicole

2010-01-01

Bdellovibrio and like organisms (BALOs) form the group of predatory bacteria which require Gram-negative bacteria as prey. Genetic studies with Bdellovibrio bacteriovorus can be performed with vectors which are introduced into the predator via conjugation. The usefulness of the two vectors pSUP202 and pSUP404.2 as genetic tools were assessed. Both vectors were transferable into B. bacteriovorus by conjugative matings with an Escherichia coli K12 strain as donor. The transfer frequency was higher for vector pSUP404.2 (approx. 10−1–10−4) as for pSUP202 (approx. 10−5–10−6). Vector pSUP202 with a pMB1 origin is unstable in the predatory bacterium, whereas pSUP404.2 is stably maintained in the absence of selective antibiotics. pSUP404.2 harbors two plasmid replicons, the p15A ori and the RSF1010 replication region The copy number of pSUP404.2 was determined by quantitative PCR in B. bacteriovorus and averages seven copies per genome. pSUP404.2 harbors two resistance genes (chloramphenicol and kanamycin) which can be used for cloning either by selection for transconjugants or by insertional inactivation. PMID:20824276

Evidence for Transfer of CMY-2 AmpC β-Lactamase Plasmids between Escherichia coli and Salmonella Isolates from Food Animals and Humans

PubMed Central

Winokur, P. L.; Vonstein, D. L.; Hoffman, L. J.; Uhlenhopp, E. K.; Doern, G. V.

2001-01-01

Escherichia coli is an important pathogen that shows increasing antimicrobial resistance in isolates from both animals and humans. Our laboratory recently described Salmonella isolates from food animals and humans that expressed an identical plasmid-mediated, AmpC-like β-lactamase, CMY-2. In the present study, 59 of 377 E. coli isolates from cattle and swine (15.6%) and 6 of 1,017 (0.6%) isolates of human E. coli from the same geographic region were resistant to both cephamycins and extended-spectrum cephalosporins. An ampC gene could be amplified with CMY-2 primers in 94.8% of animal and 33% of human isolates. Molecular epidemiological studies of chromosomal DNA revealed little clonal relatedness among the animal and human E. coli isolates harboring the CMY-2 gene. The ampC genes from 10 animal and human E. coli isolates were sequenced, and all carried an identical CMY-2 gene. Additionally, all were able to transfer a plasmid containing the CMY-2 gene to a laboratory strain of E. coli. CMY-2 plasmids demonstrated two different plasmid patterns that each showed strong similarities to previously described Salmonella CMY-2 plasmids. Additionally, Southern blot analyses using a CMY-2 probe demonstrated conserved fragments among many of the CMY-2 plasmids identified in Salmonella and E. coli isolates from food animals and humans. These data demonstrate that common plasmids have been transferred between animal-associated Salmonella and E. coli, and identical CMY-2 genes carried by similar plasmids have been identified in humans, suggesting that the CMY-2 plasmid has undergone transfer between different bacterial species and may have been transmitted between food animals and humans. PMID:11557460

Characterization of a Large Antibiotic Resistance Plasmid Found in Enteropathogenic Escherichia coli Strain B171 and Its Relatedness to Plasmids of Diverse E. coli and Shigella Strains.

PubMed

Hazen, Tracy H; Michalski, Jane; Nagaraj, Sushma; Okeke, Iruka N; Rasko, David A

2017-09-01

Enteropathogenic Escherichia coli (EPEC) is a leading cause of severe infantile diarrhea in developing countries. Previous research has focused on the diversity of the EPEC virulence plasmid, whereas less is known regarding the genetic content and distribution of antibiotic resistance plasmids carried by EPEC. A previous study demonstrated that in addition to the virulence plasmid, reference EPEC strain B171 harbors a second, larger plasmid that confers antibiotic resistance. To further understand the genetic diversity and dissemination of antibiotic resistance plasmids among EPEC strains, we describe the complete sequence of an antibiotic resistance plasmid from EPEC strain B171. The resistance plasmid, pB171_90, has a completed sequence length of 90,229 bp, a GC content of 54.55%, and carries protein-encoding genes involved in conjugative transfer, resistance to tetracycline ( tetA ), sulfonamides ( sulI ), and mercury, as well as several virulence-associated genes, including the transcriptional regulator hha and the putative calcium sequestration inhibitor ( csi ). In silico detection of the pB171_90 genes among 4,798 publicly available E. coli genome assemblies indicates that the unique genes of pB171_90 ( csi and traI ) are primarily restricted to genomes identified as EPEC or enterotoxigenic E. coli However, conserved regions of the pB171_90 plasmid containing genes involved in replication, stability, and antibiotic resistance were identified among diverse E. coli pathotypes. Interestingly, pB171_90 also exhibited significant similarity with a sequenced plasmid from Shigella dysenteriae type I. Our findings demonstrate the mosaic nature of EPEC antibiotic resistance plasmids and highlight the need for additional sequence-based characterization of antibiotic resistance plasmids harbored by pathogenic E. coli . Copyright © 2017 American Society for Microbiology.

Structural similarity and distribution of small cryptic plasmids of Lactobacillus curvatus and L. sake.

PubMed

Vogel, R F; Lohmann, M; Weller, A N; Hugas, M; Hammes, W P

1991-11-15

Plasmid profiles of strains of Lactobacillus curvatus and L. sake isolated from meat or sauerkraut were analysed to investigate plasmid homology and distribution in relation to the ecology of these organisms in fermenting foods. A hybridisation probe was constructed by cloning of pLc2, a cryptic, 2.6-kbp plasmid from L. curvatus LTH683, into the Escherichia coli plasmid pRV50. In Southern hybridisations with the digoxygenine labeled pLc2 probe, pLc2-related small plasmids were frequently detected in meat-borne strains of L. casei subsp. pseudoplantarum, L. curvatus, L. sake, L. alimentarius, L. farciminis and L. halotolerans and in L. curvatus and L. sake isolated from sauerkraut. Among 27 Lactobacillus type strains originally isolated from habitats other than meat this type of homology was detected only with plasmids of L. buchneri and L. mali. Restriction-enzyme mapping of six small cryptic plasmids from L. curvatus and L. sake revealed strong structural homology but no similarity to previously characterized plasmids of lactobacilli. The presence of a variable region in addition to a conserved one and the occurrence of deletions during cloning of pLc2 suggest that vectors derived from these plasmids are likely to be structurally unstable.

Molecular cloning and physical mapping of the genome of fish lymphocystis disease virus.

PubMed

Darai, G; Delius, H; Clarke, J; Apfel, H; Schnitzler, P; Flügel, R M

1985-10-30

A defined and complete gene library of the fish lymphocystis disease virus (FLDV) genome was established. FLDV DNA was cleaved with EcoRI, BamHI, EcoRI/BamHI and EcoRI/HindIII and the resulting fragments were inserted into the corresponding sites of the pACYC184 or pAT153 plasmid vectors using T4 DNA ligase. Since FLDV DNA is highly methylated at CpG sequences (Darai et al., 1983; Wagner et al., 1985), an Escherichia coli GC-3 strain was required to amplify the recombinant plasmids harboring the FLDV DNA fragments. Bacterial colonies harboring recombinant plasmids were selected. All cloned fragments were individually identified by digestion of the recombinant plasmid DNA with different restriction enzymes and screened by hybridization of recombinant plasmid DNA to viral DNA. This analysis revealed that sequences representing 100% of the viral genome were cloned. Using these recombinant plasmids, the physical maps of the genome were constructed for BamHI, EcoRI, BestEII, and PstI restriction endonucleases. Although the FLDV genome is linear, due to circular permutation the restriction maps are circular.

Identical plasmid AmpC beta-lactamase genes and plasmid types in E. coli isolates from patients and poultry meat in the Netherlands.

PubMed

Voets, Guido M; Fluit, Ad C; Scharringa, Jelle; Schapendonk, Claudia; van den Munckhof, Thijs; Leverstein-van Hall, Maurine A; Stuart, James Cohen

2013-11-01

The increasing prevalence of third-generation cephalosporin-resistant Enterobacteriaceae is a worldwide problem. Recent studies showed that poultry meat and humans share identical Extended-Spectrum Beta-Lactamase genes, plasmid types, and Escherichia coli strain types, suggesting that transmission from poultry meat to humans may occur. The aim of this study was to compare plasmid-encoded Ambler class C beta-lactamase (pAmpC) genes, their plasmids, and bacterial strain types between E. coli isolates from retail chicken meat and clinical isolates in the Netherlands. In total, 98 Dutch retail chicken meat samples and 479 third-generation cephalosporin non-susceptible human clinical E. coli isolates from the same period were screened for pAmpC production. Plasmid typing was performed using PCR-based replicon typing (PBRT). E coli strains were compared using Multi-Locus-Sequence-Typing (MLST). In 12 of 98 chicken meat samples (12%), pAmpC producing E. coli were detected (all blaCMY-2). Of the 479 human E. coli, 25 (5.2%) harboured pAmpC genes (blaCMY-2 n = 22, blaACT n = 2, blaMIR n = 1). PBRT showed that 91% of poultry meat isolates harboured blaCMY-2 on an IncK plasmid, and 9% on an IncI1 plasmid. Of the human blaCMY-2 producing isolates, 42% also harboured blaCMY-2 on an IncK plasmid, and 47% on an IncI1 plasmid. Thus, 68% of human pAmpC producing E. coli have the same AmpC gene (blaCMY-2) and plasmid type (IncI1 or IncK) as found in poultry meat. MLST showed one cluster containing one human isolate and three meat isolates, with an IncK plasmid. These findings imply that a foodborne transmission route of blaCMY-2 harbouring plasmids cannot be excluded and that further evaluation is required. © 2013.

The use of the replication region of plasmid pRS7 from Oenococcus oeni as a putative tool to generate cloning vectors for lactic acid bacteria.

PubMed

Rodríguez, M Carmen; Alegre, M Teresa; Martín, M Cruz; Mesas, Juan M

2015-01-01

A chimeric plasmid, pRS7Rep (6.1 kb), was constructed using the replication region of pRS7, a large plasmid from Oenococcus oeni, and pEM64, a plasmid derived from pIJ2925 and containing a gene for resistance to chloramphenicol. pRS7Rep is a shuttle vector that replicates in Escherichia coli using its pIJ2925 component and in lactic acid bacteria (LAB) using the replication region of pRS7. High levels of transformants per µg of DNA were obtained by electroporation of pRS7Rep into Pediococcus acidilactici (1.5 × 10(7)), Lactobacillus plantarum (5.7 × 10(5)), Lactobacillus casei (2.3 × 10(5)), Leuconostoc citreum (2.7 × 10(5)), and Enterococcus faecalis (2.4 × 10(5)). A preliminary optimisation of the technical conditions of electrotransformation showed that P. acidilactici and L. plantarum are better transformed at a later exponential phase of growth, whereas L. casei requires the early exponential phase for better electrotransformation efficiency. pRS7Rep contains single restriction sites useful for cloning purposes, BamHI, XbaI, SalI, HincII, SphI and PstI, and was maintained at an acceptable rate (>50%) over 100 generations without selective pressure in L. plantarum, but was less stable in L. casei and P. acidilactici. The ability of pRS7Rep to accept and express other genes was assessed. To the best of our knowledge, this is the first time that the replication region of a plasmid from O. oeni has been used to generate a cloning vector. Copyright © 2014 Elsevier Inc. All rights reserved.

Expression of the core antigen gene of hepatitis B virus (HBV) in Acetobacter methanolicus using broad-host-range vectors.

PubMed

Schröder, R; Maassen, A; Lippoldt, A; Börner, T; von Baehr, R; Dobrowolski, P

1991-08-01

Using the broad-host-range promoter probe vector pRS201 for cloning of phage Acm1 promoters, we established a convenient vector system for expression of heterologous genes in different Gram-negative bacteria. The usefulness of this system was demonstrated by expression of the HBV core gene in Acetobacter methanolicus. Plasmids carrying the HBV core gene downstream of different Acm1-phage promoters were transferred to A. methanolicus, a new potential host for recombinant DNA expression. Using enzyme immunoassay and immunoblot techniques, the amount and composition of core antigen produced in A. methanolicus were compared with that derived from Escherichia coli. The expression of immunoreactive core antigen in A. methanolicus exceeds by sevenfold that in E. coli using an expression system with tandemly arranged promoters. Morphological observations by electron microscopy show that the HBV core gene products isolated from both hosts are assembled into regular spherical particles with a diameter of about 28 nm that are comparable to original viral nucleocapsids.

Occurrence of small Hsd plasmids in Salmonella typhi, Shigella boydii, and Escherichia coli.

PubMed Central

Yoshida, Y; Mise, K

1986-01-01

The natural occurrence of small Hsd (host specificity for DNA) plasmids was demonstrated in restriction endonuclease-producing strains of Salmonella typhi, Shigella boydii, and Escherichia coli. The five Hsd plasmids isolated were between 5.0 and 12.2 kilobases long. The copy number of all the Hsd plasmids was high (more than 10 copies per cell). Introduction of these small plasmids into E. coli strain 0 drastically lowered the efficiency of plating of the lambda.0 phages (the efficiency of plating was less than 5 X 10(-5) PFU-1). High restriction endonuclease activities were detected in the Hsd plasmid-positive strains because of the elevated copy numbers of the hsdR+ gene. The advantages of using E. coli strains containing the small Hsd plasmids for purification of type II restriction endonucleases are discussed. Images PMID:3003023

Copy number variability of expression plasmids determined by cell sorting and Droplet Digital PCR.

PubMed

Jahn, Michael; Vorpahl, Carsten; Hübschmann, Thomas; Harms, Hauke; Müller, Susann

2016-12-19

Plasmids are widely used for molecular cloning or production of proteins in laboratory and industrial settings. Constant modification has brought forth countless plasmid vectors whose characteristics in terms of average plasmid copy number (PCN) and stability are rarely known. The crucial factor determining the PCN is the replication system; most replication systems in use today belong to a small number of different classes and are available through repositories like the Standard European Vector Architecture (SEVA). In this study, the PCN was determined in a set of seven SEVA-based expression plasmids only differing in the replication system. The average PCN for all constructs was determined by Droplet Digital PCR and ranged between 2 and 40 per chromosome in the host organism Escherichia coli. Furthermore, a plasmid-encoded EGFP reporter protein served as a means to assess variability in reporter gene expression on the single cell level. Only cells with one type of plasmid (RSF1010 replication system) showed a high degree of heterogeneity with a clear bimodal distribution of EGFP intensity while the others showed a normal distribution. The heterogeneous RSF1010-carrying cell population and one normally distributed population (ColE1 replication system) were further analyzed by sorting cells of sub-populations selected according to EGFP intensity. For both plasmids, low and highly fluorescent sub-populations showed a remarkable difference in PCN, ranging from 9.2 to 123.4 for ColE1 and from 0.5 to 11.8 for RSF1010, respectively. The average PCN determined here for a set of standardized plasmids was generally at the lower end of previously reported ranges and not related to the degree of heterogeneity. Further characterization of a heterogeneous and a homogeneous population demonstrated considerable differences in the PCN of sub-populations. We therefore present direct molecular evidence that the average PCN does not represent the true number of plasmid molecules in individual cells.

Quantification of Plasmid Copy Number with Single Colour Droplet Digital PCR.

PubMed

Plotka, Magdalena; Wozniak, Mateusz; Kaczorowski, Tadeusz

2017-01-01

Bacteria can be considered as biological nanofactories that manufacture a cornucopia of bioproducts most notably recombinant proteins. As such, they must perfectly match with appropriate plasmid vectors to ensure successful overexpression of target genes. Among many parameters that correlate positively with protein productivity plasmid copy number plays pivotal role. Therefore, development of new and more accurate methods to assess this critical parameter will result in optimization of expression of plasmid-encoded genes. In this study, we present a simple and highly accurate method for quantifying plasmid copy number utilizing an EvaGreen single colour, droplet digital PCR. We demonstrate the effectiveness of this method by examining the copy number of the pBR322 vector within Escherichia coli DH5α cells. The obtained results were successfully validated by real-time PCR. However, we observed a strong dependency of the plasmid copy number on the method chosen for isolation of the total DNA. We found that application of silica-membrane-based columns for DNA purification or DNA isolation with use of bead-beating, a mechanical cell disruption lead to determination of an average of 20.5 or 7.3 plasmid copies per chromosome, respectively. We found that recovery of the chromosomal DNA from purification columns was less efficient than plasmid DNA (46.5 ± 1.9% and 87.4 ± 5.5%, respectively) which may lead to observed differences in plasmid copy number. Besides, the plasmid copy number variations dependent on DNA template isolation method, we found that droplet digital PCR is a very convenient method for measuring bacterial plasmid content. Careful determination of plasmid copy number is essential for better understanding and optimization of recombinant proteins production process. Droplet digital PCR is a very precise method that allows performing thousands of individual PCR reactions in a single tube. The ddPCR does not depend on running standard curves and is a straightforward and reliable method to quantify the plasmid copy number. Therefore we believe that the ddPCR designed in this study will be widely used for any plasmid copy number calculation in the future.

Quantification of Plasmid Copy Number with Single Colour Droplet Digital PCR

PubMed Central

Plotka, Magdalena; Wozniak, Mateusz; Kaczorowski, Tadeusz

2017-01-01

Bacteria can be considered as biological nanofactories that manufacture a cornucopia of bioproducts most notably recombinant proteins. As such, they must perfectly match with appropriate plasmid vectors to ensure successful overexpression of target genes. Among many parameters that correlate positively with protein productivity plasmid copy number plays pivotal role. Therefore, development of new and more accurate methods to assess this critical parameter will result in optimization of expression of plasmid-encoded genes. In this study, we present a simple and highly accurate method for quantifying plasmid copy number utilizing an EvaGreen single colour, droplet digital PCR. We demonstrate the effectiveness of this method by examining the copy number of the pBR322 vector within Escherichia coli DH5α cells. The obtained results were successfully validated by real-time PCR. However, we observed a strong dependency of the plasmid copy number on the method chosen for isolation of the total DNA. We found that application of silica-membrane-based columns for DNA purification or DNA isolation with use of bead-beating, a mechanical cell disruption lead to determination of an average of 20.5 or 7.3 plasmid copies per chromosome, respectively. We found that recovery of the chromosomal DNA from purification columns was less efficient than plasmid DNA (46.5 ± 1.9% and 87.4 ± 5.5%, respectively) which may lead to observed differences in plasmid copy number. Besides, the plasmid copy number variations dependent on DNA template isolation method, we found that droplet digital PCR is a very convenient method for measuring bacterial plasmid content. Careful determination of plasmid copy number is essential for better understanding and optimization of recombinant proteins production process. Droplet digital PCR is a very precise method that allows performing thousands of individual PCR reactions in a single tube. The ddPCR does not depend on running standard curves and is a straightforward and reliable method to quantify the plasmid copy number. Therefore we believe that the ddPCR designed in this study will be widely used for any plasmid copy number calculation in the future. PMID:28085908

Expression in Escherichia coli of the Saccharomyces cerevisiae CCT gene encoding cholinephosphate cytidylyltransferase.

PubMed Central

Tsukagoshi, Y; Nikawa, J; Hosaka, K; Yamashita, S

1991-01-01

The coding region of the CCT gene from the yeast Saccharomyces cerevisiae was cloned into the pUC18 expression vector. The plasmid directed the synthesis of an active cholinephosphate cytidylyltransferase in Escherichia coli, confirming that CCT is the structural gene for this enzyme. The enzyme produced in E. coli efficiently utilized cholinephosphate and N,N-dimethylethanolaminephosphate, but N-methylethanolamine-phosphate and ethanolaminephosphate were poor substrates. Consistently, disruption of the CCT locus in the wild-type yeast cells resulted in a drastic decrease in activities with respect to the former two substrates. When activity was expressed in E. coli, over 90% was recovered in the cytosol, whereas most of the activity of yeast cells was associated with membranes, suggesting that yeast cells possess a mechanism that promotes membrane association of cytidylyltransferase. Images PMID:1848222

Transformation of Schwanniomyces occidentalis with an ADE2 gene cloned from S. occidentalis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Klein, R.D.; Favreau, M.A.

1988-12-01

We have developed an efficient transformation system for the industrial yeast Schwanniomyces occidentalis (formerly Schwanniomyces castellii). The transformation system is based on ade2 mutants of S. occidentalis deficient for phosphoribosylaminoimidazole carboxylase that were generated by mutagenesis. As a selectable marker, we isolated and characterized the S. occidentalis ADE2 gene by complementation in an ade2 strain of Saccharomyces cerevisiae. S. occidentalis was transformed with the recombinant plasmid pADE, consisting of a 4.5-kilobase-pair (kbp) DNA fragment from S. occidentalis containing the ADE2 gene inserted into the S. cerevisiae expression vector pYcDE8 by a modification of the spheroplasting procedure of Beggs. Intact plasmidsmore » were recovered in Escherichia coli from whole-cell lysates of ADE+ transformants, indicating that plasmids were replicating autonomously. High-molecular-mass species of pADE2 were found by Southern hybridization analysis of intact genomic DNA preparations. The shift to higher molecular mass of these plasmids during electrophoresis in the presence ethidium bromide after exposure to shortwave UV suggests that they exist in a supercoiled form in the transformed host. Subclones of the 4.5-kbp insert indicated that ADE2-complementing activity and sequences conferring autonomous replication in S. occidentalis were located within a 2.7-kbp EcoRI-SphI fragment. Plasmids containing this region cloned into the bacterial vector pUC19 complemented ade2 mutants of S. occidentalis with efficiencies identical to those of the original plasmid pADE.« less

Biochemistry and genetics of autotrophy in Methanococcus. Progress report

DOE Office of Scientific and Technical Information (OSTI.GOV)

Whitman, W.B.

In the last two years of this research, the most exciting results have come from the work on the genetics of methanococci. First, the author demonstrated that the cryptic plasmid from Methanococcus maripaludis C5, pURB500, could be transformed into Methanococcus maripaludis JJ. Strain JJ is the type strain of M. maripaludis and has only about 65% DNA:DNA hybridization to strain C5. Because of the low relatedness of these strains, it was not obvious that pURB500 could be transferred between them. This goal was achieved by first transforming strain C5 with a series of suicide plasmids containing the pac cassette, whichmore » possessed the selectable puromycin resistance marker, and different cloned fragments of pURB500. From the puromycin-resistant transformants, a plasmid was isolated that transformed strain JJ. However, when this plasmid was electroporated into E. coli, only rearrangement products were obtained that contained small portions of the original pURB500. These plasmids no longer transformed Methanococcus. While these experiments did not yield a shuttle vector, they demonstrated that pURB500 could replicate in strain JJ.« less

Antibiotic resistance pattern and plasmid profiling of thermotolerant Escherichia coli isolates in drinking water.

PubMed

Subba, P; Joshi, D R; Bhatta, D R

2013-01-01

Antibiotic resistant Escherichia coli is potential source of transmission of resistance to other water borne pathogens where plasmid borne resistance is most significant. Drinking water samples were collected from different water sources: that is to say- tap, well and spring from different places of Kathmandu where E. coli and thermotolerant E. coli were isolated using membrane filtration technique. Antibiotic susceptibility was determined using a modified Kirby Bauer disc diffusion method and thermotolerant E. coli isolates from tap water were subjected for plasmid profiling. Type of water sources were not associated with the presence of coliform (P=0.155) and thermotolerant coliform (P=0.235) but the significant association was observed in thermotolerant coliform and thermotolerant E. coli for all sources tap (P=0.029), well (P=0.028), spring (P=0.05) but total coliform and E. coli association was found for well (P=0.01). All E. coli and thermotolerant E. coli isolates were susceptible to Ofloxacin, Chloramphenicol and Cotrimixazole. Resistance to Cefexime, Amikacin, Nalidixic acid, Amoxicillin, Tetracycline were 17 (54.8%), 9 (29%), 11 (35.5%), 25 (80.6%), 29 (93.5%) and 19 (57.6%), 12 (36.4%), 13 (39.4%), 31 (94%), 33 (100%) was observed in E. coli and thermotolerant E. coli respectively where 25 (75.8%) thermotolerant E. coli and 22 (70.9%) E. coli were observed with multiple drug resistance patterns. Single band of plasmid were observed in three MDRs and one non-MDR isolates and size varied from 2kb to >10kb. All Nalidixic acid resistant thermotolerant E. coli were found to harbor a plasmid. Presence of plasmid in Nalidixic acid resistant thermotolerant E. coli heightens public health issue and the need of monitoring Quinolone resistance bacteria in environment.

Characterization of blaCTX-M IncFII plasmids and clones of Escherichia coli from pets in France.

PubMed

Dahmen, Safia; Haenni, Marisa; Châtre, Pierre; Madec, Jean-Yves

2013-12-01

To characterize bla(CTX-M) IncFII plasmids and clones of Escherichia coli from cats and dogs and to compare them with bla(CTX-M) IncFII plasmids reported in humans. From December 2006 to April 2010, 518 E. coli isolates from clinical infections in cats and dogs were screened for extended-spectrum β-lactamase (ESBL) production. Antimicrobial susceptibility was performed by disc diffusion and resistance genes were identified by PCR and sequencing. Plasmids were characterized using PCR-based replicon typing and sub-typing schemes, restriction fragment length polymorphism analysis, S1-PFGE and Southern hybridization. Isolates were characterized by PFGE, phylogenetic grouping, O25b typing and multilocus sequence typing. Nineteen E. coli isolates (3.7%) produced ESBLs, of which 14 (74%) carried bla(CTX-M) IncFII plasmids. The bla(CTX-M) gene was predominant and located on F31:A4:B1, F36:A4:B1 or F36:A1:B20 plasmids, abundantly reported in humans. The bla(CTX-M) F22:A1:B20 or F2:A2:B20 plasmids were also found. Different sequence types (STs) were identified, such as ST10, ST410, ST359, ST617 and ST224. Only one E. coli isolate belonged to the ST131 E. coli clone and carried a bla(CTX-M) F2:A2:B20 plasmid. This is the first known extensive study on ESBL-producing E. coli isolates from pets in France. The ST131 clone was rare. However, the predominance of human-like bla(CTX-M) IncFII plasmids suggests exchanges of these plasmids with the human reservoir.

Frame-Insensitive Expression Cloning of Fluorescent Protein from Scolionema suvaense.

PubMed

Horiuchi, Yuki; Laskaratou, Danai; Sliwa, Michel; Ruckebusch, Cyril; Hatori, Kuniyuki; Mizuno, Hideaki; Hotta, Jun-Ichi

2018-01-26

Expression cloning from cDNA is an important technique for acquiring genes encoding novel fluorescent proteins. However, the probability of in-frame cDNA insertion following the first start codon of the vector is normally only 1/3, which is a cause of low cloning efficiency. To overcome this issue, we developed a new expression plasmid vector, pRSET-TriEX, in which transcriptional slippage was induced by introducing a DNA sequence of (dT) 14 next to the first start codon of pRSET. The effectiveness of frame-insensitive cloning was validated by inserting the gene encoding eGFP with all three possible frames to the vector. After transformation with one of these plasmids, E. coli cells expressed eGFP with no significant difference in the expression level. The pRSET-TriEX vector was then used for expression cloning of a novel fluorescent protein from Scolionema suvaense . We screened 3658 E. coli colonies transformed with pRSET-TriEX containing Scolionema suvaense cDNA, and found one colony expressing a novel green fluorescent protein, ScSuFP. The highest score in protein sequence similarity was 42% with the chain c of multi-domain green fluorescent protein like protein "ember" from Anthoathecata sp. Variations in the N- and/or C-terminal sequence of ScSuFP compared to other fluorescent proteins indicate that the expression cloning, rather than the sequence similarity-based methods, was crucial for acquiring the gene encoding ScSuFP. The absorption maximum was at 498 nm, with an extinction efficiency of 1.17 × 10⁵ M -1 ·cm -1 . The emission maximum was at 511 nm and the fluorescence quantum yield was determined to be 0.6. Pseudo-native gel electrophoresis showed that the protein forms obligatory homodimers.

Asymmetry and Extent of In Vivo Transcripition of R-Plasmid Deoxyribonucleic Acid in Escherichia coli

PubMed Central

Vapnek, Daniel; Spingler, Elizabeth

1974-01-01

Deoxyribonucleic acid-ribonucleic acid (DNA-RNA) hybridization studies have been performed with R-plasmid DNA (R538-1drd) and in vivo-synthesized RNA. R-plasmid DNA was isolated from Escherichia coli K-12, and the complementary strands were separated in cesium chloride-polyuridylic acid-polyguanylic acid gradients. DNA-RNA hybridization was performed with the separated DNA strands and RNA purified from R-plasmid-carrying cells. The results demonstrated that an asymmetric transcription of the R-plasmid DNA occurs in vivo. Hybridization was only detected with the H strand (denser strand in cesium chloride-polyuridylic acid-polyguanylic acid). By determining the density of the RNA-DNA hybrid in CsCl gradients, it was estimated that greater than 60% of the nucleotide sequences in the R-plasmid DNA are transcribed in logarithmically growing E. coli cells. No R-plasmid-specific RNA was detected in E. coli cells that did not carry the plasmid. PMID:4612013

Tightly regulated, high-level expression from controlled copy number vectors based on the replicon of temperate phage N15.

PubMed

Mardanov, Andrey V; Strakhova, Taisia S; Smagin, Vladimir A; Ravin, Nikolai V

2007-06-15

A new Escherichia coli host/vector system has been developed to allow a dual regulation of both the plasmid copy number and gene expression. The new pN15E vectors are low copy number plasmids based on the replicon of temperate phage N15, comprising the repA replicase gene and cB repressor gene, controlling the plasmid copy number. Regulation of pN15E copy number is achieved through arabinose-inducible expression of phage N15 antirepressor protein, AntA, whose gene was integrated into the chromosome of the host strain under control of the PBAD promoter. The host strain also carried phage N15 partition operon, sop, allowing stable inheritance of pN15E vectors in the absence of selection pressure. In the first vector, pN15E4, the same PBAD promoter controls expression of a cloned gene. The second vector, pN15E6, carries the phage T5 promoter with a double lac operator repression module thus allowing independent regulation of promoter activity and copy number. Using the lacZ gene to monitor expression in these vectors, we show that the ratio of induction/repression can be about 7600-fold for pN15E4 and more than 15,000-fold for pN15E6. The low copy number of these vectors ensures very low basal level of expression allowing cloning genes encoding toxic products that was demonstrated by the stable maintenance of a gene encoding a restriction endonuclease in pN15E4. The tight control of transcription and the potential to regulate gene activities quantitatively over wide ranges will open up new approaches in the study of gene function in vivo and controlled expression of heterologous genes.

Electrotransformation and expression of bacterial genes encoding hygromycin phosphotransferase and beta-galactosidase in the pathogenic fungus Histoplasma capsulatum.

PubMed

Woods, J P; Heinecke, E L; Goldman, W E

1998-04-01

We developed an efficient electrotransformation system for the pathogenic fungus Histoplasma capsulatum and used it to examine the effects of features of the transforming DNA on transformation efficiency and fate of the transforming DNA and to demonstrate fungal expression of two recombinant Escherichia coli genes, hph and lacZ. Linearized DNA and plasmids containing Histoplasma telomeric sequences showed the greatest transformation efficiencies, while the plasmid vector had no significant effect, nor did the derivation of the selectable URA5 marker (native Histoplasma gene or a heterologous Podospora anserina gene). Electrotransformation resulted in more frequent multimerization, other modification, or possibly chromosomal integration of transforming telomeric plasmids when saturating amounts of DNA were used, but this effect was not observed with smaller amounts of transforming DNA. We developed another selection system using a hygromycin B resistance marker from plasmid pAN7-1, consisting of the E. coli hph gene flanked by Aspergillus nidulans promoter and terminator sequences. Much of the heterologous fungal sequences could be removed without compromising function in H. capsulatum, allowing construction of a substantially smaller effective marker fragment. Transformation efficiency increased when nonselective conditions were maintained for a time after electrotransformation before selection with the protein synthesis inhibitor hygromycin B was imposed. Finally, we constructed a readily detectable and quantifiable reporter gene by fusing Histoplasma URA5 with E. coli lacZ, resulting in expression of functional beta-galactosidase in H. capsulatum. Demonstration of expression of bacterial genes as effective selectable markers and reporters, together with a highly efficient electrotransformation system, provide valuable approaches for molecular genetic analysis and manipulation of H. capsulatum, which have proven useful for examination of targeted gene disruption, regulated gene expression, and potential virulence determinants in this fungus.

Streptococcus mutans genes that code for extracellular proteins in Escherichia coli K-12.

PubMed

Holt, R G; Abiko, Y; Saito, S; Smorawinska, M; Hansen, J B; Curtiss, R

1982-10-01

Chromosomal DNA from Streptococcus mutans 6715 (serotype g) was cloned into Escherichia coli K-12 by using the cosmid pJC74 cloning vector and a bacteriophage lambda in vitro packaging system. Rabbit antiserum against S. mutans extracellular proteins was used for immunological screening of the clone bank. Twenty-one clones produced weak to strong precipitin bands around the colonies, but only after the lambda c1857 prophage was induced by being heated to lyse the E. coli cells. None of the clones expressed enzyme activity for several known S. mutans extracellular enzymes. One of these clones contained a 45-kilobase recombinant plasmid designated pYA721. An 8.5-kilobase fragment of S. mutans DNA from pYA721 was isolated and recloned into the BamHI restriction site of the plasmid vector pACYC184 to construct pYA726. pYA726 contained all, or nearly all, of the gene for a surface protein antigen (the spaA protein) of S. mutans 6715. This was deduced from immunological studies in which extracts of cells harboring pYA726 reacted with antisera against both purified 6715 spaA protein (about 210,000 daltons) and the immunologically similar antigen I/II of serotype c strains of S. mutans. In addition, the S. mutans spaA protein was found to possess at least one antigenic determinant not present on the protein specified by pYA726. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis of E. coli clone extracts revealed that pYA726 produced a polypeptide with a molecular mass of about 180,000 daltons which was predominantly found in the periplasmic space of E. coli cells. Antisera to the spaA protein of S. mutans reacted with extracellular protein from representative strains of S. mutans serotypes a, c, d, e, f, and g, but not b.

Novel “Superspreader” Bacteriophages Promote Horizontal Gene Transfer by Transformation

PubMed Central

Bliskovsky, Valery V.; Malagon, Francisco; Baker, James D.; Prince, Jeffrey S.; Klaus, James S.; Adhya, Sankar L.

2017-01-01

ABSTRACT Bacteriophages infect an estimated 1023 to 1025 bacterial cells each second, many of which carry physiologically relevant plasmids (e.g., those encoding antibiotic resistance). However, even though phage-plasmid interactions occur on a massive scale and have potentially significant evolutionary, ecological, and biomedical implications, plasmid fate upon phage infection and lysis has not been investigated to date. Here we show that a subset of the natural lytic phage population, which we dub “superspreaders,” releases substantial amounts of intact, transformable plasmid DNA upon lysis, thereby promoting horizontal gene transfer by transformation. Two novel Escherichia coli phage superspreaders, SUSP1 and SUSP2, liberated four evolutionarily distinct plasmids with equal efficiency, including two close relatives of prominent antibiotic resistance vectors in natural environments. SUSP2 also mediated the extensive lateral transfer of antibiotic resistance in unbiased communities of soil bacteria from Maryland and Wyoming. Furthermore, the addition of SUSP2 to cocultures of kanamycin-resistant E. coli and kanamycin-sensitive Bacillus sp. bacteria resulted in roughly 1,000-fold more kanamycin-resistant Bacillus sp. bacteria than arose in phage-free controls. Unlike many other lytic phages, neither SUSP1 nor SUSP2 encodes homologs to known hydrolytic endonucleases, suggesting a simple potential mechanism underlying the superspreading phenotype. Consistent with this model, the deletion of endonuclease IV and the nucleoid-disrupting protein ndd from coliphage T4, a phage known to extensively degrade chromosomal DNA, significantly increased its ability to promote plasmid transformation. Taken together, our results suggest that phage superspreaders may play key roles in microbial evolution and ecology but should be avoided in phage therapy and other medical applications. PMID:28096488

[Construction and expression of fusion protein TRX-hJagged1 in E.coli BL21].

PubMed

Li, Guo-Hui; Fan, Yu-Zhen; Huang, Si-Yong; Liu, Qiang; Yin, Dan-Dan; Liu, Li; Chen, Ren-An; Hao, Miao-Wang; Liang, Ying-Min

2014-06-01

This study was purposed to construct prokaryotic expression vector and to investigate the expression of Notch ligand Jagged1 in E.coli. An expression vector pET-hJagged1 was constructed, which can be inserted in Jagged1 with different lengths, but the DSL domain of human Jagged1 should be contained. Then the recombinant plasmids were transformed into the competent cell of E.coli BL21, and the expression of the fusion protein was induced by IPTG. Fusion protein was purified from the supernatant of cell lysates via the Nickel affinity chromatography. The results showed that prokaryotic expression vectors pET-hJagged1 (Bgl II), pET-hJagged1 (Hind I) and pET-hJagged1 (Stu I) were successfully constructed, but only pET-hJagged1 (Stu I) could express the soluble TRX-hJagged1. The purified TRX-Jagged1 protein could be obtained via the Nickel affinity chromatography, and then confirmed by Western Blot. It is concluded that prokaryotic expression vector pET-hJagged1 is successfully constructed, but only pET-hJagged1 (Stu I) can express the soluble TRX-hJagged1 and the TRX-Jagged1 fusion protein is obtained through the prokaryotic expression system, which laid a solid foundation for further to explore the effects of Jagged1 in hematopoietic and lymphoid system.

Application of methylation in improving plasmid transformation into Helicobacter pylori.

PubMed

Zhao, Huilin; Xu, Linlin; Rong, Qianyu; Xu, Zheng; Ding, Yunfei; Zhang, Ying; Wu, Yulong; Li, Boqing; Ji, Xiaofei

2018-05-23

Helicobacter pylori is an important gastrointestinal pathogen. Its strains possess different levels of powerful restriction modification systems, which are significant barriers to genetic tools used for studying the role of functional genes in its pathogenesis. Methylating vectors in vitro was reported as an alternative to overcome this barrier in several bacteria. In this study we used two H. pylori-E. coli shuttle plasmids and several single/double-crossover homologous recombination gene-targeting plasmids, to test the role of methylation in H. pylori transformation. According to our results, transformants could be obtained only after shuttle plasmids were methylated before transformation. It is helpful in gene complementation and over-expression although at a low frequency. The frequency of gene-targeting transformation was also increased after methylation, especially for the single-crossover recombination plasmids, the transformants of which could only be obtained after methylation. For the double-crossover recombination targeting plasmids, the initial yield of transformants was 0.3-0.8 × 10 2 CFUs per microgram plasmid DNA. With the help of methylation, the yield was increased to 0.4-1.3 × 10 2 CFUs per microgram plasmid DNA. These results suggest that in vitro methylation can improve H. pylori transformation by different plasmids, which will benefit the pathogenic mechanism research. Copyright © 2018. Published by Elsevier B.V.

Prevalence and characterization of plasmids carrying sulfonamide resistance genes among Escherichia coli from pigs, pig carcasses and human.

PubMed

Wu, Shuyu; Dalsgaard, Anders; Hammerum, Anette M; Porsbo, Lone J; Jensen, Lars B

2010-07-30

Sulfonamide resistance is very common in Escherichia coli. The aim of this study was to characterize plasmids carrying sulfonamide resistance genes (sul1, sul2 and sul3) in E. coli isolated from pigs and humans with a specific objective to assess the genetic diversity of plasmids involved in the mobility of sul genes. A total of 501 E. coli isolates from pig feces, pig carcasses and human stools were tested for their susceptibility to selected antimicrobial. Multiplex PCR was conducted to detect the presence of three sul genes among the sulfonamide-resistant E. coli isolates. Fifty-seven sulfonamide-resistant E. coli were selected based on presence of sul resistance genes and subjected to conjugation and/or transformation experiments. S1 nuclease digestion followed by pulsed-field gel electrophoresis was used to visualize and determine the size of plasmids. Plasmids carrying sul genes were characterized by PCR-based replicon typing to allow a comparison of the types of sul genes, the reservoir and plasmid present. A total of 109/501 isolates exhibited sulfonamide resistance. The relative prevalences of sul genes from the three reservoirs (pigs, pig carcasses and humans) were 65%, 45% and 12% for sul2, sul1, and sul3, respectively. Transfer of resistance through conjugation was observed in 42/57 isolates. Resistances to streptomycin, ampicillin and trimethoprim were co-transferred in most strains. Class 1 integrons were present in 80% of sul1-carrying plasmids and 100% of sul3-carrying plasmids, but only in 5% of sul2-carrying plasmids. The sul plasmids ranged from 33 to 160-kb in size and belonged to nine different incompatibility (Inc) groups: FII, FIB, I1, FIA, B/O, FIC, N, HI1 and X1. IncFII was the dominant type in sul2-carrying plasmids (52%), while IncI1 was the most common type in sul1 and sul3-carrying plasmids (33% and 45%, respectively). Multireplicons were found associated with all three sul genes. Sul genes were distributed widely in E. coli isolated from pigs and humans with sul2 being most prevalent. Sul-carrying plasmids belonged to diverse replicon types, but most of detected plasmids were conjugative enabling horizontal transfer. IncFII seems to be the dominant replicon type in sul2-carrying plasmids from all three sources.

Cloning and expression in Escherichia coli of a hygromycin B phosphotransferase gene from Streptomyces hygroscopicus.

PubMed

Zalacain, M; Malpartida, F; Pulido, D; Jiménez, A

1987-01-15

The Streptomyces hygroscopicus hyg gene encoding a hygromycin B phosphotransferase has been introduced into different sites of both the Escherichia coli plasmid pBR322 and the Escherichia coli-Saccharomyces cerevisiae shuttle vector YRp7. When this gene was inserted into the BamHI site of pBR322 and then cloned in E. coli phosphorylating activity was not detected, indicating that the hyg gene promoter was not functional in this bacterium. However, when the hyg gene was inserted into either the unique PstI site of pBR322 or into each of the two PstI sites of YRp7, phosphotransferase activity was observed. Analysis of the translation products from these constructions by coupled in vitro transcription-translation systems suggested that in all cases transcrition was regulated by a promoter not provided by the inserted hyg gene and that the synthesized polypeptide was identical to that present in S. hygroscopicus.

Exotoxin A of Pseudomonas aeruginosa: active, cloned toxin is secreted into the periplasmic space of Escherichia coli.

PubMed

Douglas, C M; Guidi-Rontani, C; Collier, R J

1987-11-01

We subcloned the structural gene for exotoxin A (ETA) of Pseudomonas aeruginosa in front of the tac promoter in an Escherichia coli expression vector and studied the intracellular location and properties of the protein product. The E. coli K-12 strain that carried this recombinant plasmid produced an immunoreactive protein that was identical to authentic ETA in size and in cytotoxic and ADP-ribosyl transferase activities per unit of immunoreactive material. The protein was predominantly in the periplasmic fraction; and a mutation in the secA gene blocked secretion, processing, and conversion of the protein to a fully toxic conformation. The results indicate that expression of the ETA gene in E. coli yields native ETA, which is localized within the periplasmic space. This organism may therefore serve as a useful host for studying structure and function in ETA.

pSW2, a Novel Low-Temperature-Inducible Gene Expression Vector Based on a Filamentous Phage of the Deep-Sea Bacterium Shewanella piezotolerans WP3.

PubMed

Yang, Xin-Wei; Jian, Hua-Hua; Wang, Feng-Ping

2015-08-15

A low-temperature-inducible protein expression vector (pSW2) based on a filamentous phage (SW1) of the deep-sea bacterium Shewanella piezotolerans WP3 was constructed. This vector replicated stably in Escherichia coli and Shewanella species, and its copy number increased at low temperatures. The pSW2 vector can be utilized as a complementation plasmid in WP3, and it can also be used for the production of complex cytochromes with multiple heme groups, which has the potential for application for metal ion recovery or bioremediation. Promoters of low-temperature-inducible genes in WP3 were fused into the vector to construct a series of vectors for enhancing protein expression at low temperature. The maximum green fluorescent protein intensity was obtained when the promoter for the hfq gene was used. The WP3/pSW2 system can efficiently produce a patatin-like protein (PLP) from a metagenomic library that tends to form inclusion bodies in E. coli. The yields of PLP in the soluble fraction were 8.3 mg/liter and 4.7 mg/liter of culture at 4°C and 20°C, respectively. Moreover, the pSW2 vector can be broadly utilized in other Shewanella species, such as S. oneidensis and S. psychrophila. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

Associations Between Multidrug Resistance, Plasmid Content, and Virulence Potential Among Extraintestinal Pathogenic and Commensal Escherichia coli from Humans and Poultry

PubMed Central

Johnson, Timothy J.; Logue, Catherine M.; Johnson, James R.; Kuskowski, Michael A.; Sherwood, Julie S.; Barnes, H. John; DebRoy, Chitrita; Wannemuehler, Yvonne M.; Obata-Yasuoka, Mana; Spanjaard, Lodewijk

2012-01-01

Abstract The emergence of plasmid-mediated multidrug resistance (MDR) among enteric bacteria presents a serious challenge to the treatment of bacterial infections in humans and animals. Recent studies suggest that avian Escherichia coli commonly possess the ability to resist multiple antimicrobial agents, and might serve as reservoirs of MDR for human extraintestinal pathogenic Escherichia coli (ExPEC) and commensal E. coli populations. We determined antimicrobial susceptibility profiles for 2202 human and avian E. coli isolates, then sought for associations among resistance profile, plasmid content, virulence factor profile, and phylogenetic group. Avian-source isolates harbored greater proportions of MDR than their human counterparts, and avian ExPEC had higher proportions of MDR than did avian commensal E. coli. MDR was significantly associated with possession of the IncA/C, IncP1-α, IncF, and IncI1 plasmid types. Overall, inferred virulence potential did not correlate with drug susceptibility phenotype. However, certain virulence genes were positively associated with MDR, including ireA, ibeA, fyuA, cvaC, iss, iutA, iha, and afa. According to the total dataset, isolates segregated significantly according to host species and clinical status, thus suggesting that avian and human ExPEC and commensal E. coli represent four distinct populations with limited overlap. These findings suggest that in extraintestinal E. coli, MDR is most commonly associated with plasmids, and that these plasmids are frequently found among avian-source E. coli from poultry production systems. PMID:21988401

Construction of conjugative gene transfer system between E. coli and moderately thermophilic, extremely acidophilic Acidithiobacillus caldus MTH-04.

PubMed

Liu, Xiangmei; Lin, Jianqun; Zhang, Zheng; Bian, Jiang; Zhao, Qing; Liu, Ying; Lin, Jianqiang; Yan, Wangming

2007-01-01

A genetic transfer system for introducing foreign genes to biomining microorganisms is urgently needed. Thus, a conjugative gene transfer system was investigated for a moderately thermophilic, extremely acidophilic biomining bacterium, Acidithiobacillus caldus MTH-04. The broad-host-range IncP plasmids RP4 and R68.45 were transferred directly into A. caldus MTH-04 from Escherichia coli by conjugation at relatively high frequencies. Additionally the broad-host-range IncQ plasmids pJRD215, pVLT33, and pVLT35 were also transferred into A. caldus MTH-04 with the help of plasmid RP4 or strains with plasmid RP4 integrated into their chromosome, such as E. coli SM10. The Km(r) and Sm(r) selectable markers from these plasmids were successfully expressed in A. caldus MTH-04. Futhermore, the IncP and IncQ plasmids were transferred back into E. coli cells from A. caldus MTH-04, thereby confirming the initial transfer of these plasmids from E. coli to A. caldus MTH-04. All the IncP and IncQ plasmids studied were stable in A. caldus MTH-04. Consequently, this development of a conjugational system for A. caldus MTH-04 will greatly facilitate its genetic study.

Phenotypic and molecular characterization of 5 novel CTX-M enzymes carried by Klebsiella pneumoniae and Escherichia coli.

PubMed

Cheng, Jun; Ye, Ying; Wang, Ying-ying; Li, Hui; Li, Xu; Li, Jia-bin

2008-02-01

The aim of the present study was to study the phenotypic and molecular characterization of 5 novel CTX-M-beta-1actamases carried by 5 Klebsiella pneumoniae isolates and 3 Escherichia coli isolates collected from 4 hospitals in Hefei, China. The purified PCR products were ligated with pGEM-Teasy vectors, expressed, and sequenced. The complete genes of the CTX-M-beta-lactamases were ligated with the pHSG398 vector to express prokaryotic recombinant proteins. Plasmids were extracted by rapid alkaline lysis protocol, and the PCR method was performed to determine whether the prokaryotic expression was successful or not. Antimicrobial susceptibility was tested and the phenotypes of transformants were determined according to criteria recommended by the Clinical and Laboratory Standards Institute. The kinetic parameters of enzymes were confirmed. The isoelectric points (pI) were determined by isoelectric focusing assay. Pulsed-field gel electrophoresis and plasmid profiling were performed. The PCR products had 1101 nucleotides and were determined as CTX-M-46, CTX-M-47, CTX-M-48, CTX-M-49, and CTX-M-50. All strains were resistant to cefotaxime, but most of them were susceptible or intermediate to ceftazidime. The phenotypes of novel enzymes were determined as extended-spectrum-beta-lactamases (ESBL). Penicillin G, cephalothin, cefuroxime, and cefotaxime were determined to good substrates, whereas ceftazidime hydrolysis was not detected. The pI of the 5 novel CTX-M-beta-lactamases were 8.0. CTX-M-derivatives could be the multiplex genesis in our area. This is the first report of these 5 novel plasmid-mediated CTX-M ESBL produced from China in the world. Molecular typing reveals notably different origin in genes encoding different CTX-M variants of 8 strains.

[Recombinant OspC identification and antigenicity detection from Borrelia burgdorferi PD91 in China].

PubMed

Chen, Jian; Wan, Kang-Lin

2003-10-01

To recombine OspC gene from Borrelia burgdorferi PD91 of China and expressed it in E. coli for early diagnosis of Lyme disease. The OspC gene was amplified from the genome of Borrelia burgdorferi PD91 strain by polymerase chain reaction and recombined with plasmid PET-11D. The recombinant plasmid PET-11D-OspC was identified with PCR, restriction endonuclease analysis and sequencing. The antigenicity was verified with Western Blot. OspC gene was cloned correctly into vector PET-11D. The resultant sequence was definitely different from the published sequence. The recombinant OspC seemed to have had strong antigenicity. The findings laid basis for the studies on early diagnosis of Lyme disease.

[Escherichia coli heat-labile enterotoxin B subunit enhances the immune response against canine parvovirus VP2 in mice immunized by VP2 DNA vaccine].

PubMed

Han, Dongmei; Zhong, Fei; Li, Xiujin; Wang, Wei; Wang, Xingxing; Pan, Sumin

2011-01-01

To investigate the effect of Escherichia coli heat-labile enterotoxin (LT) B subunit (LTB) gene on canine parvovirus (CPV) VP2 gene vaccine. The LTB gene was amplified by PCR from genomic DNA of E. coli 44815 strain. The VP2-70 fragment (210 bp) encoding major epitope of VP2 (70 amino acids) was amplified by PCR from a plasmid encoding VP2 gene. VP2-70 and LTB genes were inserted into the eukaryotic vector to construct VP2-70 gene,LTB gene and VP2-70-LTB fused gene vectors. The mice were immunized with VP2-70 vector, VP2-70-LTB fused vector, or VP2-70 vector plus LTB vector, respectively. The antibody titers at the different time were measured by using ELISA method. The spleen lymphocyte proliferation activity was analyzed by 3-(4, 5-Dimethylthiazol-2-yl)-2, 5-diphenyltetrazolium bromide (MTT) assay. The sequence of VP2-70 and LTB genes was identified. The recombinant VP2-70 and LTB proteins could be expressed in HEK293T cells in a secretory manner. The mice immunized with VP2-70 vector, VP2-70-LTB vector or VP2-70 vector plus LTB vector could generate the specific antibody against VP2 protein. The antibody titer immunized with VP2-70-LTB vector reached 1:5120 at 35 d post immunization, significantly higher than that of other two groups (P < 0.01). For antibody isotype analysis, the IgG1 isotype antibody titers in all test groups were significantly higher than of IgG2a (P < 0.01). The high-level spleen lymphocyte stimulation index was observed in the three test groups under the stimulation with Con A, higher than that in control groups (P < 0.01). LTB gene could enhance the humoral immune response of CPV VP2 gene vaccine in mice.

Replication and Transcription of Eukaryotic DNA in Esherichia coli

PubMed Central

Morrow, John F.; Cohen, Stanley N.; Chang, Annie C. Y.; Boyer, Herbert W.; Goodman, Howard M.; Helling, Robert B.

1974-01-01

Fragments of amplified Xenopus laevis DNA, coding for 18S and 28S ribosomal RNA and generated by EcoRI restriction endonuclease, have been linked in vitro to the bacterial plasmid pSC101; and the recombinant molecular species have been introduced into E. coli by transformation. These recombinant plasmids, containing both eukaryotic and prokaryotic DNA, replicate stably in E. coli. RNA isolated from E. coli minicells harboring the plasmids hybridizes to amplified X. laevis rDNA. Images PMID:4600264

Cloning and expression of clostridium acetobutylicum ATCC 824 acetoacetyl-coenzyme A:acetate/butyrate:coenzyme A-transferase in Escherichia coli

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cary, J.W.; Petersen, D.J.; Bennett, G.N.

1990-06-01

Coenzyme A (CoA)-transferase (acetoacetyl-CoA:acetate/butyrate:CoA-transferase (butyrate-acetoacetate CoA-transferase) (EC 2.8.3.9)) of Clostridium acetobutylicum ATCC 824 is an important enzyme in the metabolic shift between the acid-producing and solvent-forming states of this organism. The genes encoding the two subunits of this enzyme have been cloned and subsequent subcloning experiments established the position of the structural genes for CoA-transferase. Complementation of Escherichia coli ato mutants with the recombinant plasmid pCoAT4 (pUC19 carrying a 1.8-kilobase insert of C. acetobutylicum DNA encoding CoA-transferase activity) enabled the transformants to grow on butyrate as a sole carbon source. Despite the ability of CoA-transferase to complement the ato defectmore » in E. coli mutants, Southern blot and Western blot (immunoblot) analyses showed showed that neither the C. acetobutylicum genes encoding CoA-transferase nor the enzyme itself shared any apparent homology with its E. coli counterpart. Polypeptides of M{sub r} of the purified CoA-transferase subunits were observed by Western blot and maxicell analysis of whole-cell extracts of E.coli harboring pCoAT4. The proximity and orientation of the genes suggest that the genes encoding the two subunits of CoA-transferase may form an operon similar to that found in E. coli. In the plasmid, however, transcription appears to be primarily from the lac promoter of the vector.« less

Genome sequence analyses of two isolates from the recent Escherichia coli outbreak in Germany reveal the emergence of a new pathotype: Entero-Aggregative-Haemorrhagic Escherichia coli (EAHEC).

PubMed

Brzuszkiewicz, Elzbieta; Thürmer, Andrea; Schuldes, Jörg; Leimbach, Andreas; Liesegang, Heiko; Meyer, Frauke-Dorothee; Boelter, Jürgen; Petersen, Heiko; Gottschalk, Gerhard; Daniel, Rolf

2011-12-01

The genome sequences of two Escherichia coli O104:H4 strains derived from two different patients of the 2011 German E. coli outbreak were determined. The two analyzed strains were designated E. coli GOS1 and GOS2 (German outbreak strain). Both isolates comprise one chromosome of approximately 5.31 Mbp and two putative plasmids. Comparisons of the 5,217 (GOS1) and 5,224 (GOS2) predicted protein-encoding genes with various E. coli strains, and a multilocus sequence typing analysis revealed that the isolates were most similar to the entero-aggregative E. coli (EAEC) strain 55989. In addition, one of the putative plasmids of the outbreak strain is similar to pAA-type plasmids of EAEC strains, which contain aggregative adhesion fimbrial operons. The second putative plasmid harbors genes for extended-spectrum β-lactamases. This type of plasmid is widely distributed in pathogenic E. coli strains. A significant difference of the E. coli GOS1 and GOS2 genomes to those of EAEC strains is the presence of a prophage encoding the Shiga toxin, which is characteristic for enterohemorrhagic E. coli (EHEC) strains. The unique combination of genomic features of the German outbreak strain, containing characteristics from pathotypes EAEC and EHEC, suggested that it represents a new pathotype Entero-Aggregative-Haemorrhagic E scherichia c oli (EAHEC).

Transformation of Rhodococcus fascians by High-Voltage Electroporation and Development of R. fascians Cloning Vectors

PubMed Central

Desomer, Jan; Dhaese, Patrick; Montagu, Marc Van

1990-01-01

The analysis of the virulence determinants of phytopathogenic Rhodococcus fascians has been hampered by the lack of a system for introducing exogenous DNA. We investigated the possibility of genetic transformation of R. fascians by high-voltage electroporation of intact bacterial cells in the presence of plasmid DNA. Electrotransformation in R. fascians D188 resulted in transformation frequencies ranging from 105/μg of DNA to 107/μg of DNA, depending on the DNA concentration. The effects of different electrical parameters and composition of electroporation medium on transformation efficiency are presented. By this transformation method, a cloning vector (pRF28) for R. fascians based on an indigenous 160-kilobase (chloramphenicol and cadmium resistance-encoding) plasmid pRF2 from strain NCPPB 1675 was developed. The origin of replication and the chloramphenicol resistance gene on pRF28 were used to construct cloning vectors that are capable of replication in R. fascians and Escherichia coli. The electroporation method presented was efficient enough to allow detection of the rare integration of replication-deficient pRF28 derivatives in the R. fascians D188 genome via either homologous or illegitimate recombination. Images PMID:16348290

Cloning and expression of Tenebrio molitor antifreeze protein in Escherichia coli.

PubMed

Yue, Chang-Wu; Zhang, Yi-Zheng

2009-03-01

A novel antifreeze protein cDNA was cloned by RT-PCR from the larva of the yellow mealworm Tenebrio molitor. The coding fragment of 339 bp encodes a protein of 112 amino acid residues and was fused to the expression vectors pET32a and pTWIN1. The resulted expression plasmids were transformed into Escherischia coli strains BL21 (DE3), ER2566, and Origami B (DE3), respectively. Several strategies were used for expression of the highly disulfide-bonded beta-helix-contained protein with the activity of antifreeze in different expression systems. A protocol for production of refolded and active T. molitor antifreeze protein in bacteria was obtained.

Development of a genetically engineered Escherichia coli strain for plasmid transformation in Corynebacterium glutamicum.

PubMed

Li, Hedan; Zhang, Lirong; Guo, Wei; Xu, Daqing

2016-12-01

Gene disruption and replacement in Corynebacterium glutamicum is dependent upon a high transformation efficiency. The cglIR-cgIIR restriction system is a major barrier to introduction of foreign DNA into Corynebacterium glutamicum cells. To improve the transformation efficiency of C. glutamicum, the cglIM gene encoding methyltransferase in the cglIR-cglIIR-cglIM restriction-modification system of C. glutamicum ATCC 13032 was chromosomally integrated and expressed in Escherichia coli, resulting in an engineered strain E. coli AU1. The electro-transformation experiments of C. glutamicum ATCC 13032 with the E. coli-C. glutamicum shuttle plasmid pAU4 showed that the transformation efficiency of C. glutamicum with pAU4 DNA extracted from E. coli TG1/pAU4 was 1.80±0.21×10 2 cfu/μg plasmid DNA, while using pAU4 DNA extracted from E. coli AU1/pAU4, the transformation efficiency reached up to 5.22±0.33×10 6 cfu/μg plasmid DNA. The results demonstrated that E. coli AU1 is able to confer the cglIM-specific DNA methylation pattern to its resident plasmid, which makes the plasmid resistant to the cglIR-cglIIR restriction and efficiently transferred into C. glutamicum. E. coli AU1 is a useful intermediate host for efficient transformation of C. glutamicum. Copyright © 2016. Published by Elsevier B.V.

Prevalence and characterization of plasmids carrying sulfonamide resistance genes among Escherichia coli from pigs, pig carcasses and human

PubMed Central

2010-01-01

Background Sulfonamide resistance is very common in Escherichia coli. The aim of this study was to characterize plasmids carrying sulfonamide resistance genes (sul1, sul2 and sul3) in E. coli isolated from pigs and humans with a specific objective to assess the genetic diversity of plasmids involved in the mobility of sul genes. Methods A total of 501 E. coli isolates from pig feces, pig carcasses and human stools were tested for their susceptibility to selected antimicrobial. Multiplex PCR was conducted to detect the presence of three sul genes among the sulfonamide-resistant E. coli isolates. Fifty-seven sulfonamide-resistant E. coli were selected based on presence of sul resistance genes and subjected to conjugation and/or transformation experiments. S1 nuclease digestion followed by pulsed-field gel electrophoresis was used to visualize and determine the size of plasmids. Plasmids carrying sul genes were characterized by PCR-based replicon typing to allow a comparison of the types of sul genes, the reservoir and plasmid present. Results A total of 109/501 isolates exhibited sulfonamide resistance. The relative prevalences of sul genes from the three reservoirs (pigs, pig carcasses and humans) were 65%, 45% and 12% for sul2, sul1, and sul3, respectively. Transfer of resistance through conjugation was observed in 42/57 isolates. Resistances to streptomycin, ampicillin and trimethoprim were co-transferred in most strains. Class 1 integrons were present in 80% of sul1-carrying plasmids and 100% of sul3-carrying plasmids, but only in 5% of sul2-carrying plasmids. The sul plasmids ranged from 33 to 160-kb in size and belonged to nine different incompatibility (Inc) groups: FII, FIB, I1, FIA, B/O, FIC, N, HI1 and X1. IncFII was the dominant type in sul2-carrying plasmids (52%), while IncI1 was the most common type in sul1 and sul3-carrying plasmids (33% and 45%, respectively). Multireplicons were found associated with all three sul genes. Conclusions Sul genes were distributed widely in E. coli isolated from pigs and humans with sul2 being most prevalent. Sul-carrying plasmids belonged to diverse replicon types, but most of detected plasmids were conjugative enabling horizontal transfer. IncFII seems to be the dominant replicon type in sul2-carrying plasmids from all three sources. PMID:20670455

Occurrence and characterization of mcr-1-harbouring Escherichia coli isolated from pigs in Great Britain from 2013 to 2015.

PubMed

Duggett, Nicholas A; Sayers, Ellie; AbuOun, Manal; Ellis, Richard J; Nunez-Garcia, Javier; Randall, Luke; Horton, Robert; Rogers, Jon; Martelli, Francesca; Smith, Richard P; Brena, Camilla; Williamson, Susanna; Kirchner, Miranda; Davies, Robert; Crook, Derrick; Evans, Sarah; Teale, Chris; Anjum, Muna F

2017-03-01

To determine the occurrence of mcr-1 -harbouring Escherichia coli in archived pig material originating in Great Britain (GB) from 2013 to 2015 and characterize mcr-1 plasmids. Enrichment and selective culture of 387 archived porcine caecal contents and recovery from archive of 1109 E. coli isolates to identify colistin-resistant bacteria by testing for the presence of mcr-1 by PCR and RT-PCR. mcr-1 -harbouring E. coli were characterized by WGS and compared with other available mcr-1 WGS. Using selective isolation following enrichment, the occurrence of mcr-1 E. coli in caeca from healthy pigs at slaughter from unique farms in GB was 0.6% (95% CI 0%-1.5%) in 2015. mcr-1 E. coli were also detected in isolates from two porcine veterinary diagnostic submissions in 2015. All isolates prior to 2015 were negative. WGS analysis of the four mcr-1 -positive E. coli indicated no other antimicrobial resistance (AMR) genes were linked to mcr-1 -plasmid-bearing contigs, despite all harbouring multiple AMR genes. The sequence similarity between mcr-1 -plasmid-bearing contigs identified and those found in GB, Chinese and South African human isolates and Danish, French and Estonian livestock-associated isolates was 90%-99%. mcr-1- harbouring plasmids were diverse, implying transposable elements are involved in mcr-1 transmission in GB. The low number of mcr-1 -positive E. coli isolates identified suggested mcr-1 is currently uncommon in E. coli from pigs within GB. The high sequence similarity between mcr-1 plasmid draft genomes identified in pig E. coli and plasmids found in human and livestock-associated isolates globally requires further investigation to understand the full implications. © Crown copyright 2016.

A dual host vector for Fab phage display and expression of native IgG in mammalian cells.

PubMed

Tesar, Devin; Hötzel, Isidro

2013-10-01

A significant bottleneck in antibody discovery by phage display is the transfer of immunoglobulin variable regions from phage clones to vectors that express immunoglobulin G (IgG) in mammalian cells for screening. Here, we describe a novel phagemid vector for Fab phage display that allows expression of native IgG in mammalian cells without sub-cloning. The vector uses an optimized mammalian signal sequence that drives robust expression of Fab fragments fused to an M13 phage coat protein in Escherichia coli and IgG expression in mammalian cells. To allow the expression of Fab fragments fused to a phage coat protein in E.coli and full-length IgG in mammalian cells from the same vector without sub-cloning, the sequence encoding the phage coat protein was embedded in an optimized synthetic intron within the immunoglobulin heavy chain gene. This intron is removed from transcripts in mammalian cells by RNA splicing. Using this vector, we constructed a synthetic Fab phage display library with diversity in the heavy chain only and selected for clones binding different antigens. Co-transfection of mammalian cells with DNA from individual phage clones and a plasmid expressing the invariant light chain resulted in the expression of native IgG that was used to assay affinity, ligand blocking activity and specificity.

blaCMY-2-positive IncA/C plasmids from escherichia coli and salmonella enterica are a distinct component of a larger lineage of plasmids

USDA-ARS?s Scientific Manuscript database

Large multidrug resistance plasmids of the A/C incompatibility complex (IncA/C) have been found in a diverse group of Gram-negative commensal and pathogenic bacteria. We present three completed sequences from IncA/C plasmids that originated from Escherichia coli (cattle) and Salmonella enterica sero...

A simple Gateway-assisted construction system of TALEN genes for plant genome editing.

PubMed

Kusano, Hiroaki; Onodera, Hitomi; Kihira, Miho; Aoki, Hiromi; Matsuzaki, Hikaru; Shimada, Hiroaki

2016-07-25

TALEN is an artificial nuclease being applied for sequence-specific genome editing. For the plant genome editing, a pair of TALEN genes is expressed in the cells, and a binary plasmid for Agrobacterium-mediated transformation should be assembled. We developed a novel procedure using the Gateway-assisted plasmids, named Emerald-Gateway TALEN system. We constructed entry vectors, pPlat plasmids, for construction of a desired TALEN gene using Platinum Gate TALEN kit. We also created destination plasmid, pDual35SGw1301, which allowed two TALEN genes to both DNA strands to recruit using Gateway technology. Resultant TALEN genes were evaluated by the single-strand annealing (SSA) assay in E. coli cells. By this assay, the TALENs recognized the corresponding targets in the divided luciferase gene, and induced a specific recombination to generate an active luciferase gene. Using the TALEN genes constructed, we created a transformant potato cells in which a site-specific mutation occurred at the target site of the GBSS gene. This suggested that our system worked effectively and was applicable as a convenient tool for the plant genome editing.

Orpheus recombination : a comprehensive bacteriophage system for murine targeting vector construction by transplacement.

PubMed

Woltjen, Knut; Ito, Kenichi; Tsuzuki, Teruhisa; Rancourt, Derrick E

2008-01-01

In recent years, methods to address the simplification of targeting vector (TV) construction have been developed and validated. Based on in vivo recombination in Escherichia coli, these protocols have reduced dependence on restriction endonucleases, allowing the fabrication of complex TV constructs with relative ease. Using a methodology based on phage-plasmid recombination, we have developed a comprehensive TV construction protocol dubbed Orpheus recombination (ORE). The ORE system addresses all necessary requirements for TV construction; from the isolation of genespecific regions of homology to the deposition of selection/disruption cassettes. ORE makes use of a small recombination plasmid, which bears positive and negative selection markers and a cloned homologous "probe" region. This probe plasmid may be introduced into and excised from phage-borne murine genomic clones by two rounds of single crossover recombination. In this way, desired clones can be specifically isolated from a heterogeneous library of phage. Furthermore, if the probe region contains a designed mutation, it may be deposited seamlessly into the genomic clone. The complete removal of operational sequences allows unlimited repetition of the procedure to customize and finalize TVs within a few weeks. Successful gene-specific clone isolation, point mutations, large deletions, cassette insertions, and finally coincident clone isolation and mutagenesis have all been demonstrated with this method.

Large plasmids of Escherichia coli and Salmonella encode highly diverse arrays of accessory genes on common replicon families.

PubMed

Williams, Laura E; Wireman, Joy; Hilliard, Valda C; Summers, Anne O

2013-01-01

Plasmids are important in evolution and adaptation of host bacteria, yet we lack a comprehensive picture of their own natural variation. We used replicon typing and RFLP analysis to assess diversity and distribution of plasmids in the ECOR, SARA, SARB and SARC reference collections of Escherichia coli and Salmonella. Plasmids, especially large (≥30 kb) plasmids, are abundant in these collections. Host species and genotype clearly impact plasmid prevalence; plasmids are more abundant in ECOR than SAR, but, within ECOR, subgroup B2 strains have the fewest large plasmids. The majority of large plasmids have unique RFLP patterns, suggesting high variation, even within dominant replicon families IncF and IncI1. We found only four conserved plasmid types within ECOR, none of which are widely distributed. Within SAR, conserved plasmid types are primarily serovar-specific, including a pSLT-like plasmid in 13 Typhimurium strains. Conservation of pSLT contrasts with variability of other plasmids, suggesting evolution of serovar-specific virulence plasmids is distinct from that of most enterobacterial plasmids. We sequenced a conserved serovar Heidelberg plasmid but did not detect virulence or antibiotic resistance genes. Our data illustrate the high degree of natural variation in large plasmids of E. coli and Salmonella, even among plasmids sharing backbone genes. Copyright © 2012 Elsevier Inc. All rights reserved.

Production of Phytase Enzyme by a Bioengineered Probiotic for Degrading of Phytate Phosphorus in the Digestive Tract of Poultry.

PubMed

Pakbaten, Bahareh; Majidzadeh Heravi, Reza; Kermanshahi, Hassan; Sekhavati, Mohammad-Hadi; Javadmanesh, Ali; Mohammadi Ziarat, Masoud

2018-04-21

Probiotics are beneficial microorganisms and have long been used in food production as well as health promotion products. Bioengineered probiotics are used to express and transfer native or recombinant molecules to the mucosal surface of the digestive tract to improve feed efficiency and promote health. Lactococcus lactis is a potential probiotic candidate to produce useful biological proteins. The aim of this investigation was to develop a recombinant Lactococcus lactis with the potential of producing phytase. To enhance the efficiency of expression and secretion of recombinant phytase, usp45 signal peptide was added to the expression vector containing phytase gene (appA2) derived from Escherichia coli. Sequencing of recombinant plasmid containing appA2 showed the correct construction of plasmid. Total length of the phytase insert was 1.25 kbp. A Blast search of the cloned fragment showed 99% similarity to the reported E. coli phytase sequence in the GenBank (accession number: AM946981.2). A plasmid containing usp45 and appA2 electrotransferred into Lactococcus lactis. Zymogram with polyacrylamide gel revealed that the protein extract from the supernatant and the cell pellet of recombinant bacteria had phytase activity. Enzyme activity of 4 U/ml was obtained in cell extracts, and supernatant maximal phytase activity was 19 U/ml. The recombinant L. lactis was supplemented in broiler chicken feed and showed the increase of apparent digestibility on phytate phosphorus in the digestive tract and it was same as performance of E. coli commercial phytase.

Survival of Escherichia coli with and without ColE1::Tn5 after aerosol dispersal in a laboratory and a farm environment.

PubMed Central

Marshall, B; Flynn, P; Kamely, D; Levy, S B

1988-01-01

The survival of a laboratory strain and a naturally occurring fecal strain of Escherichia coli, with and without a Tn5-containing derivative of ColE1, was examined after aerosol dispersal in a laboratory office and a barn under ambient temperature and humidity conditions. Following the release of paired strains, air and diverse types of surfaces were assayed for the test organisms. In both environments, the number of airborne bacteria declined rapidly within the first 2 h. Longer survival was found on surfaces and varied with surface type: recovery was greatest from wood products. Organisms persisted for 1 day in the office and for up to 20 days in the barn. Survival of the fecal strain was better than that of the laboratory strain in both test environments. In general, plasmid-bearing strains fared similarly to their plasmidless parents, but in several comparisons the ColE1::Tn5-containing strain showed enhanced survival. These studies have implications for the present and proposed release of genetically engineered organisms with and without plasmid vectors. PMID:2843099

[Cloning of Clostridium perfringens alpha-toxin gene and extracellular expression in Escherichia coli].

PubMed

Inoue, Masaharu; Kikuchi, Maho; Komoriya, Tomoe; Watanabe, Kunitomo; Kouno, Hideki

2007-01-01

Clostridium perfringens (C. perfringens) is a Gram-positive bacterial pathogen that widely propagets in the soil and the gastrointestinal tract of human and animals. This bacteria causes food poisoning, gas gangrene and other various range of infectious diseases. But there is no standard diagnosis method of C. perfringens. In order to develop a new type of immunoassay for clinical purpose, we studied expression and extracellular secretion of recombinant alpha-toxin having enzyme activity in E. coli expression system. Cloning was carried out after PCR amplification from C. perfringens GAI 94074 which was clinical isolate. Three kinds of fragment were cloned using pET100/D-TOPO vector. These fragments coded for ribosome binding site, signal peptide, and alpha-toxin gene respectively. Recombinant pET100 plasmid transformed into TOP 10 cells and the obtained plasmids were transformed into BL21 (DE3) cells. Then, the transformants were induced expression with IPTG. In conclusion, we successfully cloned, expressed and exteracellular secreted C. perfringens alpha-toxin containing signal peptide. Biologically, the obtained recombinant protein was positive for phospholipase C activity.

Cross-Sectional Study on Prevalence and Molecular Characteristics of Plasmid Mediated ESBL/AmpC-Producing Escherichia coli Isolated from Veal Calves at Slaughter

PubMed Central

Hordijk, Joost; Wagenaar, Jaap A.; Kant, Arie; van Essen-Zandbergen, Alieda; Dierikx, Cindy; Veldman, Kees; Wit, Ben; Mevius, Dik

2013-01-01

Objectives The presence of ESBL/AmpC-producing E. coli in cattle has been reported previously, however information on veal calves is limited. This study describes the prevalence and molecular characteristics of E. coli with non-wild type susceptibility to cefotaxime in veal calves at slaughter. Methods Faecal samples from 100 herds, 10 individual animals per herd, were screened for E. coli with non-wild type susceptibility for cefotaxime. Molecular characterization of ESBL/AmpC genes and plasmids was performed on one isolate per herd by microarray, PCR and sequence analysis. Results 66% of the herds were positive for E. coli with non-wild type susceptibility for cefotaxime. Within-herd prevalence varied from zero to 90%. 83% of E. coli producing ESBL/AmpC carried bla CTX-M genes, of which bla CTX-M-1, bla CTX-M-14 and bla CTX-M-15 were most prevalent. The dominant plasmids were IncI1 and IncF-type plasmids. Conclusions A relatively high prevalence of various bla CTX-M producing E. coli was found in veal calves at slaughter. The genes were mainly located on IncI1 and IncF plasmids. PMID:23724148

Mitochondrial Gene Therapy: Advances in Mitochondrial Gene Cloning, Plasmid Production, and Nanosystems Targeted to Mitochondria.

PubMed

Coutinho, Eduarda; Batista, Cátia; Sousa, Fani; Queiroz, João; Costa, Diana

2017-03-06

Mitochondrial gene therapy seems to be a valuable and promising strategy to treat mitochondrial disorders. The use of a therapeutic vector based on mitochondrial DNA, along with its affinity to the site of mitochondria, can be considered a powerful tool in the reestablishment of normal mitochondrial function. In line with this and for the first time, we successfully cloned the mitochondrial gene ND1 that was stably maintained in multicopy pCAG-GFP plasmid, which is used to transform E. coli. This mitochondrial-gene-based plasmid was encapsulated into nanoparticles. Furthermore, the functionalization of nanoparticles with polymers, such as cellulose or gelatin, enhances their overall properties and performance for gene therapy. The fluorescence arising from rhodamine nanoparticles in mitochondria and a fluorescence microscopy study show pCAG-GFP-ND1-based nanoparticles' cell internalization and mitochondria targeting. The quantification of GFP expression strongly supports this finding. This work highlights the viability of gene therapy based on mitochondrial DNA instigating further in vitro research and clinical translation.

Development of a rapid high-efficiency scalable process for acetylated Sus scrofa cationic trypsin production from Escherichia coli inclusion bodies.

PubMed

Zhao, Mingzhi; Wu, Feilin; Xu, Ping

2015-12-01

Trypsin is one of the most important enzymatic tools in proteomics and biopharmaceutical studies. Here, we describe the complete recombinant expression and purification from a trypsinogen expression vector construct. The Sus scrofa cationic trypsin gene with a propeptide sequence was optimized according to Escherichia coli codon-usage bias and chemically synthesized. The gene was inserted into pET-11c plasmid to yield an expression vector. Using high-density E. coli fed-batch fermentation, trypsinogen was expressed in inclusion bodies at 1.47 g/L. The inclusion body was refolded with a high yield of 36%. The purified trypsinogen was then activated to produce trypsin. To address stability problems, the trypsin thus produced was acetylated. The final product was generated upon gel filtration. The final yield of acetylated trypsin was 182 mg/L from a 5-L fermenter. Our acetylated trypsin product demonstrated higher BAEE activity (30,100 BAEE unit/mg) than a commercial product (9500 BAEE unit/mg, Promega). It also demonstrated resistance to autolysis. This is the first report of production of acetylated recombinant trypsin that is stable and suitable for scale-up. Copyright © 2015 Elsevier Inc. All rights reserved.

Utilization of Virus ϕCh1 Elements To Establish a Shuttle Vector System for Halo(alkali)philic Archaea via Transformation of Natrialba magadii

PubMed Central

Mayrhofer-Iro, M.; Ladurner, A.; Meissner, C.; Derntl, C.; Reiter, M.; Haider, F.; Dimmel, K.; Rössler, N.; Klein, R.; Baranyi, U.; Scholz, H.

2013-01-01

In the study described here, we successfully developed a transformation system for halo(alkali)philic members of the Archaea. This transformation system comprises a series of Natrialba magadii/Escherichia coli shuttle vectors based on a modified method to transform halophilic members of the Archaea and genomic elements of the N. magadii virus ϕCh1. The shuttle vector pRo-5, based on the repH-containing region of ϕCh1, stably replicated in E. coli and N. magadii and in several halophilic and haloalkaliphilic members of the Archaea not transformable so far. The ϕCh1 operon ORF53/ORF54 (repH) was essential for pRo-5 replication and was thus identified as the minimal replication origin. The plasmid allowed homologous and heterologous gene expression, as exemplified by the expression of ϕCh1 ORF3452, which encodes a structural protein, and the reporter gene bgaH of Haloferax lucentense in N. magadii. The new transformation/vector system will facilitate genetic studies within N. magadii and other haloalkaliphilic archaea and will allow the detailed characterization of the gene functions of N. magadii virus ϕCh1 in their extreme environments. PMID:23416999

Degenerate primer MOB typing of multiresistant clinical isolates of E. coli uncovers new plasmid backbones.

PubMed

Garcillán-Barcia, M Pilar; Ruiz del Castillo, Belén; Alvarado, Andrés; de la Cruz, Fernando; Martínez-Martínez, Luis

2015-01-01

Degenerate Primer MOB Typing is a PCR-based protocol for the classification of γ-proteobacterial transmissible plasmids in five phylogenetic relaxase MOB families. It was applied to a multiresistant E. coli collection, previously characterized by PCR-based replicon-typing, in order to compare both methods. Plasmids from 32 clinical isolates of multiresistant E. coli (19 extended spectrum beta-lactamase producers and 13 non producers) and their transconjugants were analyzed. A total of 95 relaxases were detected, at least one per isolate, underscoring the high potential of these strains for antibiotic-resistance transmission. MOBP12 and MOBF12 plasmids were the most abundant. Most MOB subfamilies detected were present in both subsets of the collection, indicating a shared mobilome among multiresistant E. coli. The plasmid profile obtained by both methods was compared, which provided useful data upon which decisions related to the implementation of detection methods in the clinic could be based. The phylogenetic depth at which replicon and MOB-typing classify plasmids is different. While replicon-typing aims at plasmid replication regions with non-degenerate primers, MOB-typing classifies plasmids into relaxase subfamilies using degenerate primers. As a result, MOB-typing provides a deeper phylogenetic depth than replicon-typing and new plasmid groups are uncovered. Significantly, MOB typing identified 17 plasmids and an integrative and conjugative element, which were not detected by replicon-typing. Four of these backbones were different from previously reported elements. Copyright © 2014 Elsevier Inc. All rights reserved.

Critical design criteria for minimal antibiotic-free plasmid vectors necessary to combine robust RNA Pol II and Pol III-mediated eukaryotic expression with high bacterial production yields

PubMed Central

Carnes, Aaron E.; Luke, Jeremy M.; Vincent, Justin M.; Anderson, Sheryl; Schukar, Angela; Hodgson, Clague P.; Williams, James A.

2010-01-01

Background For safety considerations, regulatory agencies recommend elimination of antibiotic resistance markers and nonessential sequences from plasmid DNA-based gene medicines. In the present study we analyzed antibiotic-free (AF) vector design criteria impacting bacterial production and mammalian transgene expression. Methods Both CMV-HTLV-I R RNA Pol II promoter (protein transgene) and murine U6 RNA Pol III promoter (RNA transgene) vector designs were studied. Plasmid production yield was assessed through inducible fed-batch fermentation. RNA Pol II-directed EGFP and RNA Pol III-directed RNA expression were quantified by fluorometry and quantitative real-time polymerase chain reaction (RT-PCR), respectively, after transfection of human HEK293 cells. Results Sucrose-selectable minimalized protein and therapeutic RNA expression vector designs that combined an RNA-based AF selection with highly productive fermentation manufacturing (>1,000 mg/L plasmid DNA) and high level in vivo expression of encoded products were identified. The AF selectable marker was also successfully applied to convert existing kanamycin-resistant DNA vaccine plasmids gWIZ and pVAX1 into AF vectors, demonstrating a general utility for retrofitting existing vectors. A minimum vector size for high yield plasmid fermentation was identified. A strategy for stable fermentation of plasmid dimers with improved vector potency and fermentation yields up to 1,740 mg/L was developed. Conclusions We report the development of potent high yield AF gene medicine expression vectors for protein or RNA (e.g. short hairpin RNA or microRNA) products. These AF expression vectors were optimized to exceed a newly identified size threshold for high copy plasmid replication and direct higher transgene expression levels than alternative vectors. PMID:20806425

MCR-1 and OXA-48 In Vivo Acquisition in KPC-Producing Escherichia coli after Colistin Treatment.

PubMed

Beyrouthy, Racha; Robin, Frederic; Lessene, Aude; Lacombat, Igor; Dortet, Laurent; Naas, Thierry; Ponties, Valérie; Bonnet, Richard

2017-08-01

The spread of mcr-1 -encoding plasmids into carbapenem-resistant Enterobacteriaceae raises concerns about the emergence of untreatable bacteria. We report the acquisition of mcr-1 in a carbapenem-resistant Escherichia coli strain after a 3-week course of colistin in a patient repatriated to France from Portugal. Whole-genome sequencing revealed that the Klebsiella pneumoniae carbapenemase-producing E. coli strain acquired two plasmids, an IncL OXA-48-encoding plasmid and an IncX4 mcr-1 -encoding plasmid. This is the first report of mcr-1 in carbapenemase-encoding bacteria in France. Copyright © 2017 American Society for Microbiology.

GPo1 alkB gene expression for improvement of the degradation of diesel oil by a bacterial consortium.

PubMed

Luo, Qun; He, Ying; Hou, Deng-Yong; Zhang, Jian-Guo; Shen, Xian-Rong

2015-01-01

To facilitate the biodegradation of diesel oil, an oil biodegradation bacterial consortium was constructed. The alkane hydroxylase (alkB) gene of Pseudomonas putida GPo1 was constructed in a pCom8 expression vector, and the pCom8-GPo1 alkB plasmid was transformed into Escherichia coli DH5α. The AlkB protein was expressed by diesel oil induction and detected through SDS-polyacrylamide gel electrophoresis. The culture of the recombinant (pCom8-GPo1 alkB/E. coli DH5α) with the oil biodegradation bacterial consortium increased the degradation ratio of diesel oil at 24 h from 31% to 50%, and the facilitation rates were increased as the proportion of pCom8-GPo1 alkB/E. coli DH5α to the consortium increased. The results suggested that the expression of the GPo1 gene in E. coli DH5α could enhance the function of diesel oil degradation by the bacterial consortium.

GPo1 alkB gene expression for improvement of the degradation of diesel oil by a bacterial consortium

PubMed Central

Luo, Qun; He, Ying; Hou, Deng-Yong; Zhang, Jian-Guo; Shen, Xian-Rong

2015-01-01

To facilitate the biodegradation of diesel oil, an oil biodegradation bacterial consortium was constructed. The alkane hydroxylase (alkB) gene of Pseudomonas putida GPo1 was constructed in a pCom8 expression vector, and the pCom8-GPo1 alkB plasmid was transformed into Escherichia coli DH5α. The AlkB protein was expressed by diesel oil induction and detected through SDS-polyacrylamide gel electrophoresis. The culture of the recombinant (pCom8-GPo1 alkB/E. coli DH5α) with the oil biodegradation bacterial consortium increased the degradation ratio of diesel oil at 24 h from 31% to 50%, and the facilitation rates were increased as the proportion of pCom8-GPo1 alkB/E. coli DH5α to the consortium increased. The results suggested that the expression of the GPo1 gene in E. coli DH5α could enhance the function of diesel oil degradation by the bacterial consortium. PMID:26413044

Knock-in/Knock-out (KIKO) vectors for rapid integration of large DNA sequences, including whole metabolic pathways, onto the Escherichia coli chromosome at well-characterised loci.

PubMed

Sabri, Suriana; Steen, Jennifer A; Bongers, Mareike; Nielsen, Lars K; Vickers, Claudia E

2013-06-24

Metabolic engineering projects often require integration of multiple genes in order to control the desired phenotype. However, this often requires iterative rounds of engineering because many current insertion approaches are limited by the size of the DNA that can be transferred onto the chromosome. Consequently, construction of highly engineered strains is very time-consuming. A lack of well-characterised insertion loci is also problematic. A series of knock-in/knock-out (KIKO) vectors was constructed for integration of large DNA sequences onto the E. coli chromosome at well-defined loci. The KIKO plasmids target three nonessential genes/operons as insertion sites: arsB (an arsenite transporter); lacZ (β-galactosidase); and rbsA-rbsR (a ribose metabolism operon). Two homologous 'arms' target each insertion locus; insertion is mediated by λ Red recombinase through these arms. Between the arms is a multiple cloning site for the introduction of exogenous sequences and an antibiotic resistance marker (either chloramphenicol or kanamycin) for selection of positive recombinants. The resistance marker can subsequently be removed by flippase-mediated recombination. The insertion cassette is flanked by hairpin loops to isolate it from the effects of external transcription at the integration locus. To characterize each target locus, a xylanase reporter gene (xynA) was integrated onto the chromosomes of E. coli strains W and K-12 using the KIKO vectors. Expression levels varied between loci, with the arsB locus consistently showing the highest level of expression. To demonstrate the simultaneous use of all three loci in one strain, xynA, green fluorescent protein (gfp) and a sucrose catabolic operon (cscAKB) were introduced into lacZ, arsB and rbsAR respectively, and shown to be functional. The KIKO plasmids are a useful tool for efficient integration of large DNA fragments (including multiple genes and pathways) into E. coli. Chromosomal insertion provides stable expression without the need for continuous antibiotic selection. Three non-essential loci have been characterised as insertion loci; combinatorial insertion at all three loci can be performed in one strain. The largest insertion at a single site described here was 5.4 kb; we have used this method in other studies to insert a total of 7.3 kb at one locus and 11.3 kb across two loci. These vectors are particularly useful for integration of multigene cassettes for metabolic engineering applications.

Predominance of IncL/M and IncF plasmid types among CTX-M-ESBL-producing Escherichia coli and Klebsiella pneumoniae in Bulgarian hospitals.

PubMed

Markovska, Rumyana; Schneider, Ines; Ivanova, Dobrinka; Mitov, Ivan; Bauernfeind, Adolf

2014-07-01

Our objective was to investigate the plasmid replicon-types involved in spread of ESBLs among Bulgarian Klebsiella pneumoniae and Escherichia coli. Sixty-three isolates, with transferable beta-lactam resistance determinants, collected between 2007 and 2009 in six medical institutions, were analysed with respect to their antimicrobial susceptibility, ESBL-, RAPD-, and plasmid replicon-type. Phylogenetic typing and screening for the O25b-ST131 lineage were carried out for E. coli. The predominant ESBLs were CTX-M-15 (81%) among E. coli and CTX-M-3 (58%) among K. pneumoniae. Other sporadically found ESBLs were SHV-12 and TEM-139, and for the first time in Bulgaria, CTX-M-1 and CTX-M-14. Replicon typing revealed that plasmids carrying blaCTX-M-3 exclusively belonged to IncL/M-type, while blaCTX-M-15 was predominantly (94%) associated with IncF-type plasmids. Among E. coli, 59% of the isolates were clonally related. Isolates of that cluster produced CTX-M-15, belonged to the O25b-ST131 lineage, predominantly harboured plasmids with the FIA replicon, and were found in five centres. Among CTX-M-3-producing K. pneumoniae, two prevailing RAPD-types were found, one remained restricted to one centre and the second was found in three centres. The incompatibility groups IncN and IncA/C linked with blaSHV-12 respectively blaTEM-139 were found only once. To the best of our knowledge, this is the first detailed investigation of plasmids carrying ESBL genes among Bulgarian isolates demonstrating wide distribution of conjugative IncF plasmids among CTX-M-15-producing E. coli and IncL/M plasmids among CTX-M-3 positive K. pneumoniae isolates. © 2013 APMIS. Published by John Wiley & Sons Ltd.

Imipenem-resistance in Serratia marcescens is mediated by plasmid expression of KPC-2.

PubMed

Su, W-Q; Zhu, Y-Q; Deng, N-M; Li, L

2017-04-01

Imipenem is a broad-spectrum carbapenem antibiotic with applications against severe bacterial infections. Here, we describe the identification of imipenem-resistant Serratia marcescens in our hospital and the role of plasmid-mediated KPC-2 expression in imipenem resistance. We used the modified Hodge test to detect carbapenemase produced in imipenem-resistant strains. His resistance can be transferred to E. coli in co-culture tests, which implicates the plasmid in imipenem resistance. PCR amplification from the plasmid identified two products consistent with KPC-2 of 583 and 1050 bp that were also present in E. coli after co-culture. The restriction pattern for both plasmids was identical, supporting the transfer from the S. marcescens isolate to E. coli. Finally, gene sequencing confirmed KPC-2 in the plasmid. Due to the presence of KPC-2 in the imipenem-resistant S. marcescens, we propose that KPC-2 mediates antibiotic resistance in the S. marcescens isolate.

The 987P fimbrial gene cluster of enterotoxigenic Escherichia coli is plasmid encoded.

PubMed Central

Schifferli, D M; Beachey, E H; Taylor, R K

1990-01-01

A clone containing the 987P fimbrial gene cluster was selected from a cosmid library of total DNA of the prototype Escherichia coli strain 987 by using 987P-specific antiserum. A subclone of 12 kilobases containing all of the genes required for fimbrial expression on a nonfimbriated K-12 strain of E. coli and a DNA fragment internal to the fimbrial subunit gene were used to probe the prototype strain and various isolates of 987P-fimbriated enterotoxigenic E. coli. All strains had several plasmids, as shown by agarose gel electrophoresis, and each of five strains which expressed 987P fimbriae showed a plasmid of 35 to 40 megadaltons (MDa) hybridizing to both 987P-specific probes. Hybridization to restricted DNA of strain 987 supported a plasmid origin for the cloned 987P gene cluster. Moreover, an isogenic strain which had lost its 35-MDa plasmid was no longer capable of synthesizing fimbrial subunits, but regained fimbrial expression after reintroduction of the TnphoA (Tn5 IS50L::phoA)-tagged 35-MDa plasmid. Absence of fimbrial subunit synthesis in K-12 strains transformed with the 35-MDa plasmid alone suggested the requirement of regulatory elements existing in strain 987 but missing in K-12 strains. A probe for the heat-stable enterotoxin STIa hybridized in each of the 987P-fimbriated strains to the plasmid containing the 987P genes and in most of these strains to an additional plasmid which contained the gene for the heat-stable enterotoxin STII. Occurrence of the 987P and STIa genes on the same replicon correlates with epidemiological observations, STIa being the most prevalent toxin produced by 987P-fimbriated E. coli. Images PMID:1967167

Isolation and characterization of novel mutations in the pSC101 origin that increase copy number

DOE Office of Scientific and Technical Information (OSTI.GOV)

Thompson, Mitchell G.; Sedaghatian, Nima; Barajas, Jesus F.

pSC101 is a narrow host range, low-copy plasmid commonly used for genetically manipulating Escherichia coli. As a byproduct of a genetic screen for a more sensitive lactam biosensor, we identified multiple novel mutations that increase the copy number of plasmids with the pSC101 origin. All mutations identified in this study occurred on plasmids which also contained at least one mutation localized to the RepA protein encoded within the origin. Homology modelling predicts that many of these mutations occur within the dimerization interface of RepA. Mutant RepA resulted in plasmid copy numbers between ~31 and ~113 copies/cell, relative to ~5 copies/cellmore » in wild-type pSC101 plasmids. Combining the mutations that were predicted to disrupt multiple contacts on the dimerization interface resulted in copy numbers of ~500 copies/cell, while also attenuating growth in host strains. Fluorescent protein production expressed from an arabinose-inducible promoter on mutant origin derived plasmids did correlate with copy number. Plasmids harboring RepA with one of two mutations, E83K and N99D, resulted in fluorescent protein production similar to that from p15a- (~20 copies/cell) and ColE1- (~31 copies/cell) based plasmids, respectively. The mutant copy number variants retained compatibility with p15a, pBBR, and ColE1 origins of replication. Thus, these pSC101 variants may be useful in future metabolic engineering efforts that require medium or high-copy vectors compatible with p15a- and ColE1-based plasmids.« less

Isolation and characterization of novel mutations in the pSC101 origin that increase copy number

DOE PAGES

Thompson, Mitchell G.; Sedaghatian, Nima; Barajas, Jesus F.; ...

2018-01-25

pSC101 is a narrow host range, low-copy plasmid commonly used for genetically manipulating Escherichia coli. As a byproduct of a genetic screen for a more sensitive lactam biosensor, we identified multiple novel mutations that increase the copy number of plasmids with the pSC101 origin. All mutations identified in this study occurred on plasmids which also contained at least one mutation localized to the RepA protein encoded within the origin. Homology modelling predicts that many of these mutations occur within the dimerization interface of RepA. Mutant RepA resulted in plasmid copy numbers between ~31 and ~113 copies/cell, relative to ~5 copies/cellmore » in wild-type pSC101 plasmids. Combining the mutations that were predicted to disrupt multiple contacts on the dimerization interface resulted in copy numbers of ~500 copies/cell, while also attenuating growth in host strains. Fluorescent protein production expressed from an arabinose-inducible promoter on mutant origin derived plasmids did correlate with copy number. Plasmids harboring RepA with one of two mutations, E83K and N99D, resulted in fluorescent protein production similar to that from p15a- (~20 copies/cell) and ColE1- (~31 copies/cell) based plasmids, respectively. The mutant copy number variants retained compatibility with p15a, pBBR, and ColE1 origins of replication. Thus, these pSC101 variants may be useful in future metabolic engineering efforts that require medium or high-copy vectors compatible with p15a- and ColE1-based plasmids.« less

[Construction of eukaryotic recombinant vector and expression in COS7 cell of LipL32-HlyX fusion gene from Leptospira serovar Lai].

PubMed

Huang, Bi; Bao, Lang; Zhong, Qi; Zhang, Huidong; Zhang, Ying

2009-04-01

This study was conducted to construct eukaryotic recombinant vector of LipL32-HlyX fusion gene from Leptospira serovar Lai and express it in mammalian cell. Both of LipL32 gene and HlyX gene were amplified from Leptospira strain O17 genomic DNA by PCR. Then with the two genes as template, LipL32-HlyX fusion gene was obtained by SOE PCR (gene splicing by overlap extension PCR). The fusion gene was then cloned into pcDNA3.1 by restriction nuclease digestion. Having been transformed into E. coli DH5alpha, the recombiant plasmid was identified by restriction nuclease digestion, PCR analysis and sequencing. The recombinant plasmid was then transfected into COS7 cell whose expression was detected by RT-PCR and Western blotting analysis. RT-PCR amplified a fragment about 2000 bp and Western blotting analysis found a specific band about 75 KD which was consistent with the expected fusion protein size. In conclusion, the successful construction of eukaryotic recombinant vector containing LipL32-HlyX fusion gene and the effective expression in mammalian have laid a foundation for the application of Leptospira DNA vaccine.

An improved ternary vector system for Agrobacterium-mediated rapid maize transformation.

PubMed

Anand, Ajith; Bass, Steven H; Wu, Emily; Wang, Ning; McBride, Kevin E; Annaluru, Narayana; Miller, Michael; Hua, Mo; Jones, Todd J

2018-05-01

A simple and versatile ternary vector system that utilizes improved accessory plasmids for rapid maize transformation is described. This system facilitates high-throughput vector construction and plant transformation. The super binary plasmid pSB1 is a mainstay of maize transformation. However, the large size of the base vector makes it challenging to clone, the process of co-integration is cumbersome and inefficient, and some Agrobacterium strains are known to give rise to spontaneous mutants resistant to tetracycline. These limitations present substantial barriers to high throughput vector construction. Here we describe a smaller, simpler and versatile ternary vector system for maize transformation that utilizes improved accessory plasmids requiring no co-integration step. In addition, the newly described accessory plasmids have restored virulence genes found to be defective in pSB1, as well as added virulence genes. Testing of different configurations of the accessory plasmids in combination with T-DNA binary vector as ternary vectors nearly doubles both the raw transformation frequency and the number of transformation events of usable quality in difficult-to-transform maize inbreds. The newly described ternary vectors enabled the development of a rapid maize transformation method for elite inbreds. This vector system facilitated screening different origins of replication on the accessory plasmid and T-DNA vector, and four combinations were identified that have high (86-103%) raw transformation frequency in an elite maize inbred.

Tetrahedral DNA Nanoparticle Vector for Intracellular Delivery of Targeted Peptide Nucleic Acid Antisense Agents to Restore Antibiotic Sensitivity in Cefotaxime-Resistant Escherichia coli.

PubMed

Readman, John Benedict; Dickson, George; Coldham, Nick G

2017-06-01

The bacterial cell wall presents a barrier to the uptake of unmodified synthetic antisense oligonucleotides, such as peptide nucleic acids, and so is one of the greatest obstacles to the development of their use as therapeutic anti-bacterial agents. Cell-penetrating peptides have been covalently attached to antisense agents, to facilitate penetration of the bacterial cell wall and deliver their cargo into the cytoplasm. Although they are an effective vector for antisense oligonucleotides, they are not specific for bacterial cells and can exhibit growth inhibitory properties at higher doses. Using a bacterial cell growth assay in the presence of cefotaxime (CTX 16 mg/L), we have developed and evaluated a self-assembling non-toxic DNA tetrahedron nanoparticle vector incorporating a targeted anti-bla CTX-M-group 1 antisense peptide nucleic acid (PNA4) in its structure for penetration of the bacterial cell wall. A dose-dependent CTX potentiating effect was observed when PNA4 (0-40 μM) was incorporated into the structure of a DNA tetrahedron vector. The minimum inhibitory concentration (to CTX) of an Escherichia coli field isolate harboring a plasmid carrying bla CTX-M-3 was reduced from 35 to 16 mg/L in the presence of PNA4 carried by the DNA tetrahedron vector (40 μM), contrasting with no reduction in MIC in the presence of PNA4 alone. No growth inhibitory effects of the DNA tetrahedron vector alone were observed.

DNA sequence of a ColV plasmid and prevalence of selected plasmid-encoded virulence genes among avian Escherichia coli strains.

PubMed

Johnson, Timothy J; Siek, Kylie E; Johnson, Sara J; Nolan, Lisa K

2006-01-01

ColV plasmids have long been associated with the virulence of Escherichia coli, despite the fact that their namesake trait, ColV production, does not appear to contribute to virulence. Such plasmids or their associated sequences appear to be quite common among avian pathogenic E. coli (APEC) and are strongly linked to the virulence of these organisms. In the present study, a 180-kb ColV plasmid was sequenced and analyzed. This plasmid, pAPEC-O2-ColV, possesses a 93-kb region containing several putative virulence traits, including iss, tsh, and four putative iron acquisition and transport systems. The iron acquisition and transport systems include those encoding aerobactin and salmochelin, the sit ABC iron transport system, and a putative iron transport system novel to APEC, eit. In order to determine the prevalence of the virulence-associated genes within this region among avian E. coli strains, 595 APEC and 199 avian commensal E. coli isolates were examined for genes of this region using PCR. Results indicate that genes contained within a portion of this putative virulence region are highly conserved among APEC and that the genes of this region occur significantly more often in APEC than in avian commensal E. coli. The region of pAPEC-O2-ColV containing genes that are highly prevalent among APEC appears to be a distinguishing trait of APEC strains.

DNA Sequence of a ColV Plasmid and Prevalence of Selected Plasmid-Encoded Virulence Genes among Avian Escherichia coli Strains

PubMed Central

Johnson, Timothy J.; Siek, Kylie E.; Johnson, Sara J.; Nolan, Lisa K.

2006-01-01

ColV plasmids have long been associated with the virulence of Escherichia coli, despite the fact that their namesake trait, ColV production, does not appear to contribute to virulence. Such plasmids or their associated sequences appear to be quite common among avian pathogenic E. coli (APEC) and are strongly linked to the virulence of these organisms. In the present study, a 180-kb ColV plasmid was sequenced and analyzed. This plasmid, pAPEC-O2-ColV, possesses a 93-kb region containing several putative virulence traits, including iss, tsh, and four putative iron acquisition and transport systems. The iron acquisition and transport systems include those encoding aerobactin and salmochelin, the sit ABC iron transport system, and a putative iron transport system novel to APEC, eit. In order to determine the prevalence of the virulence-associated genes within this region among avian E. coli strains, 595 APEC and 199 avian commensal E. coli isolates were examined for genes of this region using PCR. Results indicate that genes contained within a portion of this putative virulence region are highly conserved among APEC and that the genes of this region occur significantly more often in APEC than in avian commensal E. coli. The region of pAPEC-O2-ColV containing genes that are highly prevalent among APEC appears to be a distinguishing trait of APEC strains. PMID:16385064

Cloning of the nptII gene of Escherichia coli and construction of a recombinant strain harboring functional recA and nptII antibiotic resistance.

PubMed

Ghanem, S

2011-01-01

In an attempt to clone the ORF of the nptII gene of Escherichia coli K12 (ATCC 10798), two degenerate primers were designed based on the nptII sequence of its Tn5 transposon. The nptII ORF was placed under the control of the E. coli hybrid trc promoter, in the pKK388-1 vector, transformed into E. coli DH5α ΔrecA (recombinant, deficient strain). Transferred cells were tested for ampicillin, tetracycline, kanamycin, neomycin, geneticin, paromomycin, penicillin, and UV resistance. The neomycin phosphotransferase gene of E. coli was cloned successfully and conferred kanamycin, neomycin, geneticin, and paromomycin resistance to recombinant DH5α; this did not inhibit insertion of additional antibiotic resistance against ampicillin and tetracycline, meaning the trc promoter can express two different genes carried by two different plasmids harbored in the same cell. This resistance conferral process could be considered as an emulation of horizontal gene transfer occurring in nature and would be a useful tool for understanding mechanisms of evolution of multidrug-resistant strains.

Sorbitol-Fermenting Enterohemorrhagic Escherichia coli O157:H− Isolates from Czech Patients with Novel Plasmid Composition Not Previously Seen in German Isolates

PubMed Central

Bauwens, Andreas; Marejková, Monika; Middendorf-Bauchart, Barbara; Prager, Rita; Kossow, Annelene; Zhang, Wenlan; Karch, Helge

2017-01-01

ABSTRACT Sorbitol-fermenting (SF) enterohemorrhagic Escherichia coli (EHEC) O157:H− strains, first identified in Germany, have emerged as important pathogens throughout Europe. Besides chromosomally encoded Shiga toxin 2a (the major virulence factor), several putative virulence loci, including the hly, etp, and sfp operons, encoding EHEC hemolysin, type II secretion system proteins, and Sfp fimbriae, respectively, are located on the 121-kb plasmid pSFO157 in German strains. Here we report novel SF EHEC O157:H− strains isolated from patients in the Czech Republic. These strains share the core genomes and chromosomal virulence loci encoding toxins (stx2a and the cdtV-ABC operon) and adhesins (eae-γ, efa1, lpfAO157OI-141, and lpfAO157OI-154) with German strains but differ essentially in their plasmids. In contrast to all previously detected SF EHEC O157:H− strains, the Czech strains carry two plasmids, of 79 kb and 86 kb. The 79-kb plasmid harbors the sfp operon, but neither of the plasmids contains the hly and etp operons. Sequence analyses demonstrated that the 79-kb plasmid (pSFO157 258/98-1) evolved from pSFO157 of German strains by deletion of a 41,534-bp region via homologous recombination, resulting in loss of the hly and etp operons. The 86-kb plasmid (pSFO157 258/98-2) displays 98% sequence similarity to a 92.7-kb plasmid of an extraintestinal pathogenic E. coli bloodstream isolate. Our finding of this novel plasmid composition in SF EHEC O157:H− strains extends the evolutionary history of EHEC O157 plasmids. Moreover, the unique molecular plasmid characteristics permit the identification of such strains, thereby facilitating further investigations of their geographic distribution, clinical significance, and epidemiology. IMPORTANCE Since their first identification in Germany in 1989, sorbitol-fermenting enterohemorrhagic Escherichia coli O157:H− (nonmotile) strains have emerged as important causes of the life-threatening disease hemolytic-uremic syndrome in Europe. They account for 10 to 20% of sporadic cases of this disease and have caused several large outbreaks. The strains isolated throughout Europe share conserved chromosomal and plasmid characteristics. Here we identified novel sorbitol-fermenting enterohemorrhagic E. coli O157:H− patient isolates in the Czech Republic which differ from all such strains reported previously by their unique plasmid characteristics, including plasmid number, composition of plasmid-carried virulence genes, and plasmid origins. Our findings contribute substantially to understanding the evolution of E. coli O157 strains and their plasmids. In practical terms, they enable the identification of strains with these novel plasmid characteristics in patient stool samples and thus the investigation of their roles as human pathogens in other geographic areas. PMID:28970221

Sorbitol-Fermenting Enterohemorrhagic Escherichia coli O157:H- Isolates from Czech Patients with Novel Plasmid Composition Not Previously Seen in German Isolates.

PubMed

Bauwens, Andreas; Marejková, Monika; Middendorf-Bauchart, Barbara; Prager, Rita; Kossow, Annelene; Zhang, Wenlan; Karch, Helge; Mellmann, Alexander; Bielaszewska, Martina

2017-12-01

Sorbitol-fermenting (SF) enterohemorrhagic Escherichia coli (EHEC) O157:H - strains, first identified in Germany, have emerged as important pathogens throughout Europe. Besides chromosomally encoded Shiga toxin 2a (the major virulence factor), several putative virulence loci, including the hly , etp , and sfp operons, encoding EHEC hemolysin, type II secretion system proteins, and Sfp fimbriae, respectively, are located on the 121-kb plasmid pSFO157 in German strains. Here we report novel SF EHEC O157:H - strains isolated from patients in the Czech Republic. These strains share the core genomes and chromosomal virulence loci encoding toxins ( stx 2a and the cdtV -ABC operon) and adhesins ( eae -γ, efa1 , lpfA O157OI-141 , and lpfA O157OI-154 ) with German strains but differ essentially in their plasmids. In contrast to all previously detected SF EHEC O157:H - strains, the Czech strains carry two plasmids, of 79 kb and 86 kb. The 79-kb plasmid harbors the sfp operon, but neither of the plasmids contains the hly and etp operons. Sequence analyses demonstrated that the 79-kb plasmid (pSFO157 258/98-1) evolved from pSFO157 of German strains by deletion of a 41,534-bp region via homologous recombination, resulting in loss of the hly and etp operons. The 86-kb plasmid (pSFO157 258/98-2) displays 98% sequence similarity to a 92.7-kb plasmid of an extraintestinal pathogenic E. coli bloodstream isolate. Our finding of this novel plasmid composition in SF EHEC O157:H - strains extends the evolutionary history of EHEC O157 plasmids. Moreover, the unique molecular plasmid characteristics permit the identification of such strains, thereby facilitating further investigations of their geographic distribution, clinical significance, and epidemiology. IMPORTANCE Since their first identification in Germany in 1989, sorbitol-fermenting enterohemorrhagic Escherichia coli O157:H - (nonmotile) strains have emerged as important causes of the life-threatening disease hemolytic-uremic syndrome in Europe. They account for 10 to 20% of sporadic cases of this disease and have caused several large outbreaks. The strains isolated throughout Europe share conserved chromosomal and plasmid characteristics. Here we identified novel sorbitol-fermenting enterohemorrhagic E. coli O157:H - patient isolates in the Czech Republic which differ from all such strains reported previously by their unique plasmid characteristics, including plasmid number, composition of plasmid-carried virulence genes, and plasmid origins. Our findings contribute substantially to understanding the evolution of E. coli O157 strains and their plasmids. In practical terms, they enable the identification of strains with these novel plasmid characteristics in patient stool samples and thus the investigation of their roles as human pathogens in other geographic areas. Copyright © 2017 American Society for Microbiology.

A new series of yeast shuttle vectors for the recovery and identification of multiple plasmids from Saccharomyces cerevisiae.

PubMed

Frazer, LilyAnn Novak; O'Keefe, Raymond T

2007-09-01

The availability of Saccharomyces cerevisiae yeast strains with multiple auxotrophic markers allows the stable introduction and selection of more than one yeast shuttle vector containing marker genes that complement the auxotrophic markers. In certain experimental situations there is a need to recover more than one shuttle vector from yeast. To facilitate the recovery and identification of multiple plasmids from S. cerevisiae, we have constructed a series of plasmids based on the pRS series of yeast shuttle vectors. Bacterial antibiotic resistance genes to chloramphenicol, kanamycin and zeocin have been combined with the yeast centromere sequence (CEN6), the autonomously replicating sequence (ARSH4) and one of the four yeast selectable marker genes (HIS3, TRP1, LEU2 or URA3) from the pRS series of vectors. The 12 plasmids produced differ in antibiotic resistance and yeast marker gene within the backbone of the multipurpose plasmid pBluescript II. The newly constructed vectors show similar mitotic stability to the original pRS vectors. In combination with the ampicillin-resistant pRS series of yeast shuttle vectors, these plasmids now allow the recovery and identification in bacteria of up to four different vectors from S. cerevisiae. Copyright (c) 2007 John Wiley & Sons, Ltd.

Cloning of the citrate permease gene of Lactococcus lactis subsp. lactis biovar diacetylactis and expression in Escherichia coli.

PubMed Central

Sesma, F; Gardiol, D; de Ruiz Holgado, A P; de Mendoza, D

1990-01-01

The citrate plasmid (Cit+ plasmid) from Lactococcus lactis subsp. lactis biovar diacetylactis was cloned into the EcoRI site of plasmid pUC18. This recombinant plasmid enabled Escherichia coli K-12 to transport and utilize citrate as a source of energy, indicating expression of the citrate permease from L. lactis biovar diacetylactis. The citrate permease was under the control of the lac promoter of pUC18. Genetic expression of the Cit+ plasmid in maxicells revealed that the plasmid encoded two polypeptides of 47 and 32 kilodaltons, determined by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. Images PMID:2117878

Genomic and functional characterisation of IncX3 plasmids encoding blaSHV-12 in Escherichia coli from human and animal origin.

PubMed

Liakopoulos, Apostolos; van der Goot, Jeanet; Bossers, Alex; Betts, Jonathan; Brouwer, Michael S M; Kant, Arie; Smith, Hilde; Ceccarelli, Daniela; Mevius, Dik

2018-05-16

The bla SHV-12 β-lactamase gene is one of the most prevalent genes conferring resistance to extended-spectrum β-lactams in Enterobacteriaceae disseminating within and between reservoirs, mostly via plasmid-mediated horizontal gene transfer. Yet, studies regarding the biology of plasmids encoding bla SHV-12 are very limited. In this study, we revealed the emergence of IncX3 plasmids alongside IncI1α/γ in bla SHV-12 in animal-related Escherichia coli isolates. Four representative bla SHV-12 -encoding IncX3 plasmids were selected for genome sequencing and further genetic and functional characterization. We report here the first complete sequences of IncX3 plasmids of animal origin and show that IncX3 plasmids exhibit remarkable synteny in their backbone, while the major differences lie in their bla SHV-12 -flanking region. Our findings indicate that plasmids of this subgroup are conjugative and highly stable, while they exert no fitness cost on their bacterial host. These favourable features might have contributed to the emergence of IncX3 amongst SHV-12-producing E. coli in the Netherlands, highlighting the epidemic potential of these plasmids.

[Prokaryotic expression and histological localization of the Taenia solium CDC37 gene].

PubMed

Huang, Jiang; Li, Bo; Dai, Jia-Lin; Zhang, Ai-Hua

2013-02-01

To express Taenia solium gene encoding cell division cycle 37 protein (TsCDC37) and investigate its antigenicity and localization in adults of Taenia solium. The complete coding sequence of TsCDC37 was amplified by PCR based on the recombinant plasmid clone from the cDNA library of adult Taenia solium. The PCR product was cloned into a prokaryotic expression vector pET-28a (+). The recombinant expression plasmid was identified by PCR, double endonuclease digestion and sequencing. The recombinant plasmid was transformed into E. coli BL21/DE3 and followed by expression of the protein induced by IPTG. The mice were immunized subcutaneously with purified recombinant TsCDC37 formulated in Freund's adjuvant. The antigenicity of the recombinant protein was examined by Western blotting. The localization of TsCDC37 in adult worms was demonstrated by immunofluorescent technique. The recombinant expression vector was constructed successfully. The recombinant protein was about M(r) 52 000, it was then purified and specifically recognized by immuno sera of SD rats and sera from patients infected with Taenia solium, Taenia saginata or Taenia asiatica. The immunofluorescence assay revealed that TsCDC37 located at the tegument of T. solium adult and the eggs. TsCDC37 gene has been expressed with immunoreactivity. The recombinant protein is mainly expressed in tegument and egg, and is a common antigen of the three human taenia cestodes.

Occurrence and molecular characteristics of ESBL/AmpC-producing Escherichia coli in faecal samples from horses in an equine clinic.

PubMed

Apostolakos, Ilias; Franz, Eelco; van Hoek, Angela H A M; Florijn, Alice; Veenman, Christiaan; Sloet-van Oldruitenborgh-Oosterbaan, Marianne M; Dierikx, Cindy; van Duijkeren, Engeline

2017-07-01

To investigate the occurrence and characteristics of ESBL/AmpC-producing Escherichia coli in faecal samples from horses at one equine clinic in the Netherlands. A total of 91 horses, including residents and patients, were sampled. ESBL/AmpC-producing E. coli were identified by a combination disc diffusion test. Phylogenetic groups and MLST were determined. ESBL/AmpC genes were analysed using PCR and sequencing. Plasmids were characterized by transformation and PCR-based replicon typing. Subtyping of plasmids was done by plasmid MLST. At least one E. coli isolate with a confirmed ESBL/AmpC gene was found in samples from 76 horses (84%). Although phylogenetic group B1 E. coli bla CTX-M-1 predominated, a diverse E. coli population was found, indicating that clonal nosocomial spread was not the only reason for the high occurrence found. MLST analysis revealed the presence of 47 E. coli STs, organized in four clusters of genetically related strains. ST10, ST641, ST1079 and ST1250 were most commonly found. With regard to the genes, bla CTX-M-1 was most prevalent ( n  =   91), followed by bla CTX-M-2 ( n  =   26). The most frequently found plasmid type was IncHI1, but plasmids belonging to the IncF, IncI1 and IncN groups were also identified. A high occurrence of ESBL-producing E. coli in faecal samples was found among horses in an equine clinic and the variety of STs, ESBL genes and plasmid types suggests nosocomial transmission. ESBL E. coli can cause difficult-to-treat infections in horses and prudent use of antimicrobials is warranted. A further assessment of the risks of transmission to persons in close contact with horses, such as caretakers or veterinarians, is crucial. © The Author 2017. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

High-level fluorescence labeling of gram-positive pathogens.

PubMed

Aymanns, Simone; Mauerer, Stefanie; van Zandbergen, Ger; Wolz, Christiane; Spellerberg, Barbara

2011-01-01

Fluorescence labeling of bacterial pathogens has a broad range of interesting applications including the observation of living bacteria within host cells. We constructed a novel vector based on the E. coli streptococcal shuttle plasmid pAT28 that can propagate in numerous bacterial species from different genera. The plasmid harbors a promoterless copy of the green fluorescent variant gene egfp under the control of the CAMP-factor gene (cfb) promoter of Streptococcus agalactiae and was designated pBSU101. Upon transfer of the plasmid into streptococci, the bacteria show a distinct and easily detectable fluorescence using a standard fluorescence microscope and quantification by FACS-analysis demonstrated values that were 10-50 times increased over the respective controls. To assess the suitability of the construct for high efficiency fluorescence labeling in different gram-positive pathogens, numerous species were transformed. We successfully labeled Streptococcus pyogenes, Streptococcus agalactiae, Streptococcus dysgalactiae subsp. equisimilis, Enterococcus faecalis, Enterococcus faecium, Streptococcus mutans, Streptococcus anginosus and Staphylococcus aureus strains utilizing the EGFP reporter plasmid pBSU101. In all of these species the presence of the cfb promoter construct resulted in high-level EGFP expression that could be further increased by growing the streptococcal and enterococcal cultures under high oxygen conditions through continuous aeration.

Whole genome sequencing of diverse Shiga toxin-producing and non-producing Escherichia coli strains reveals a variety of virulence and novel antibiotic resistance plasmids

USDA-ARS?s Scientific Manuscript database

The genomes of a diverse set of Shiga toxin-producing E. coli strains and the presence of 38 plasmids among all the isolates were determined. Among the novel plasmids found, there were eight that encoded resistance genes to antibiotics, including aminoglycosides, carbapenems, penicillins, cephalosp...

Natural Escherichia coli strains undergo cell-to-cell plasmid transformation.

PubMed

Matsumoto, Akiko; Sekoguchi, Ayuka; Imai, Junko; Kondo, Kumiko; Shibata, Yuka; Maeda, Sumio

2016-12-02

Horizontal gene transfer is a strong tool that allows bacteria to adapt to various environments. Although three conventional mechanisms of horizontal gene transfer (transformation, transduction, and conjugation) are well known, new variations of these mechanisms have also been observed. We recently reported that DNase-sensitive cell-to-cell transfer of nonconjugative plasmids occurs between laboratory strains of Escherichia coli in co-culture. We termed this phenomenon "cell-to-cell transformation." In this report, we found that several combinations of Escherichia coli collection of reference (ECOR) strains, which were co-cultured in liquid media, resulted in DNase-sensitive cell-to-cell transfer of antibiotic resistance genes. Plasmid isolation of these new transformants demonstrated cell-to-cell plasmid transfer between the ECOR strains. Natural transformation experiments, using a combination of purified plasmid DNA and the same ECOR strains, revealed that cell-to-cell transformation occurs much more frequently than natural transformation under the same culture conditions. Thus, cell-to-cell transformation is both unique and effective. In conclusion, this study is the first to demonstrate cell-to-cell plasmid transformation in natural E. coli strains. Copyright © 2016 Elsevier Inc. All rights reserved.

A genome-wide inducible phenotypic screen identifies antisense RNA constructs silencing Escherichia coli essential genes

PubMed Central

Meng, Jia; Kanzaki, Gregory; Meas, Diane; Lam, Christopher K.; Crummer, Heather; Tain, Justina; Xu, H. Howard

2013-01-01

Regulated antisense RNA (asRNA) expression has been employed successfully in Gram-positive bacteria for genome-wide essential gene identification and drug target determination. However, there have been no published reports describing the application of asRNA gene silencing for comprehensive analyses of essential genes in Gram-negative bacteria. In this study, we report the first genome-wide identification of asRNA constructs for essential genes in Escherichia coli. We screened 250,000 library transformants for conditional growth-inhibitory recombinant clones from two shot-gun genomic libraries of E. coli using a paired-termini expression vector (pHN678). After sequencing plasmid inserts of 675 confirmed inducer-sensitive cell clones, we identified 152 separate asRNA constructs of which 134 inserts came from essential genes while 18 originated from non-essential genes (but share operons with essential genes). Among the 79 individual essential genes silenced by these asRNA constructs, 61 genes (77%) engage in processes related to protein synthesis. The cell-based assays of an asRNA clone targeting fusA (encoding elongation factor G) showed that the induced cells were sensitized 12 fold to fusidic acid, a known specific inhibitor. Our results demonstrate the utility of the paired-termini expression vector and feasibility of large-scale gene silencing in E. coli using regulated asRNA expression. PMID:22268863

Easy preparation of a large-size random gene mutagenesis library in Escherichia coli.

PubMed

You, Chun; Percival Zhang, Y-H

2012-09-01

A simple and fast protocol for the preparation of a large-size mutant library for directed evolution in Escherichia coli was developed based on the DNA multimers generated by prolonged overlap extension polymerase chain reaction (POE-PCR). This protocol comprised the following: (i) a linear DNA mutant library was generated by error-prone PCR or shuffling, and a linear vector backbone was prepared by regular PCR; (ii) the DNA multimers were generated based on these two DNA templates by POE-PCR; and (iii) the one restriction enzyme-digested DNA multimers were ligated to circular plasmids, followed by transformation to E. coli. Because the ligation efficiency of one DNA fragment was several orders of magnitude higher than that of two DNA fragments for typical mutant library construction, it was very easy to generate a mutant library with a size of more than 10(7) protein mutants per 50 μl of the POE-PCR product. Via this method, four new fluorescent protein mutants were obtained based on monomeric cherry fluorescent protein. This new protocol was simple and fast because it did not require labor-intensive optimizations in restriction enzyme digestion and ligation, did not involve special plasmid design, and enabled constructing a large-size mutant library for directed enzyme evolution within 1 day. Copyright © 2012 Elsevier Inc. All rights reserved.

Rainbow Vectors for Broad-Range Bacterial Fluorescence Labeling.

PubMed

Barbier, Mariette; Damron, F Heath

2016-01-01

Since their discovery, fluorescent proteins have been widely used to study protein function, localization or interaction, promoter activity and regulation, drug discovery or for non-invasive imaging. They have been extensively modified to improve brightness, stability, and oligomerization state. However, only a few studies have focused on understanding the dynamics of fluorescent proteins expression in bacteria. In this work, we developed a set plasmids encoding 12 fluorescent proteins for bacterial labeling to facilitate the study of pathogen-host interactions. These broad-spectrum plasmids can be used with a wide variety of Gram-negative microorganisms including Escherichia coli, Pseudomonas aeruginosa, Burkholderia cepacia, Bordetella bronchiseptica, Shigella flexneri or Klebsiella pneumoniae. For comparison, fluorescent protein expression and physical characteristics in Escherichia coli were analyzed using fluorescence microscopy, flow cytometry and in vivo imaging. Fluorescent proteins derived from the Aequorea Victoria family showed high photobleaching, while proteins form the Discosoma sp. and the Fungia coccina family were more photostable for microscopy applications. Only E2-Crimson, mCherry and mKeima were successfully detected for in vivo applications. Overall, E2-Crimson was the fastest maturing protein tested in E. coli with the best overall performance in the study parameters. This study provides a unified comparison and comprehensive characterization of fluorescent protein photostability, maturation and toxicity, and offers general recommendations on the optimal fluorescent proteins for in vitro and in vivo applications.

Distribution of extended-spectrum cephalosporin resistance determinants in Salmonella enterica and Escherichia coli isolated from broilers in southern Japan.

PubMed

Shahada, F; Chuma, T; Kosugi, G; Kusumoto, M; Iwata, T; Akiba, M

2013-06-01

This study was conducted to investigate the distribution and diversity of extended-spectrum cephalosporin (ESC) resistance determinants in Salmonella enterica and Escherichia coli obtained from the same cecal samples and to provide evidence of transmission of the resistance determinants among these bacteria in broiler farms in southern Japan. Salmonella enterica and E. coli were characterized by serotyping and multilocus sequence typing, respectively. An antimicrobial susceptibility test, plasmid analysis, and identification and localization of resistance genes were performed to determine the relatedness of ESC resistance determinants among the isolates. Of 48 flocks examined, 14 had S. enterica. In total, 57 S. enterica isolates were obtained, 45 of which showed ESC resistance. Extended-spectrum cephalosporin-resistant E. coli were also obtained from all of these ESC-resistant Salmonella-positive samples. β-Lactamase genes, blaTEM-52 (38 isolates), blaCTX-M-14 (1 isolate), and blaCMY-2 (6 isolates), were carried by conjugative untypable or IncP plasmids detected in the S. enterica serovars Infantis and Manhattan. The β-lactamase genes blaCTX-M-14 (3 isolates), blaCTX-M-15 (3 isolates), blaSHV-2 (1 isolate), blaSHV-12 (2 isolates), and blaCMY-2 (32 isolates) associated with IncI1-Iγ, IncFIB, IncFIC, IncK, IncB/O, and IncY plasmids were detected in E. coli co-isolates. Restriction mapping revealed similar plasmids in Salmonella Infantis and Salmonella Manhattan and in different sequence types of E. coli. Intraspecies transmission of plasmids was suggested within S. enterica and E. coli populations, whereas interspecies transmission was not observed. This study highlights the importance of plasmids as carriers of ESC resistance determinants.

Enhanced gene disruption by programmable nucleases delivered by a minicircle vector.

PubMed

Dad, A-B K; Ramakrishna, S; Song, M; Kim, H

2014-11-01

Targeted genetic modification using programmable nucleases such as zinc finger nucleases (ZFNs) and transcription activator-like effector nucleases (TALENs) is of great value in biomedical research, medicine and biotechnology. Minicircle vectors, which lack extraneous bacterial sequences, have several advantages over conventional plasmids for transgene delivery. Here, for the first time, we delivered programmable nucleases into human cells using transient transfection of a minicircle vector and compared the results with those obtained using a conventional plasmid. Surrogate reporter assays and T7 endonuclease analyses revealed that cells in the minicircle vector group displayed significantly higher mutation frequencies at the target sites than those in the conventional plasmid group. Quantitative PCR and reverse transcription-PCR showed higher vector copy number and programmable nuclease transcript levels, respectively, in 293T cells after minicircle versus conventional plasmid vector transfection. In addition, tryphan blue staining and flow cytometry after annexin V and propidium iodide staining showed that cell viability was also significantly higher in the minicircle group than in the conventional plasmid group. Taken together, our results show that gene disruption using minicircle vector-mediated delivery of ZFNs and TALENs is a more efficient, safer and less toxic method than using a conventional plasmid, and indicate that the minicircle vector could serve as an advanced delivery method for programmable nucleases.

[Construction, identification and expression of three kinds of shuttle plasmids of adenovirus expression vector of hepatitis C virus structure gene].

PubMed

Cao, Yi-zhan; Hao, Chun-qiu; Feng, Zhi-hua; Zhou, Yong-xing; Li, Jin-ge; Jia, Zhan-sheng; Wang, Ping-zhong

2003-02-01

To construct three recombinant shuttle plasmids of adenovirus expression vector which can express hepatitis C virus(HCV) different structure genes(C, C+E1, C+E1+E2) in order to pack adenovirus expression vectors which can express HCV different structure gene effectively. The different HCV structure genes derived from the plasmid pBRTM/HCV1-3011 by using polymerase chain reaction (PCR) were inserted into the backward position of cytomegalovirus(CMV) immediate early promotor element of shuttle plasmid(pAd.CMV-Link.1) of adenovirus expression vector respectively, then the three recombinant plasmids (pAd.HCV-C, pAd.HCV-CE1, pAd.HCV-S) were obtained. The recombinant plasmids were identified by endonuclease, PCR and sequencing. HCV structure genes were expressed transiently with Lipofectamine 2000 coated in HepG2 cells which were confirmed by immunofluorescence and Western-Blot. Insert DNAs of the three recombinant plasmids' were confirmed to be HCV different structure genes by endonuclease, PCR and sequencing. The three recombinant plasmids can express HCV structure gene (C, C+E1, C+E1+E2) transiently in HepG2 cells which were confirmed by immunofluorescence and Western-Blot. The three recombinant shuttle plasmids of adenovirus expression vector can express HCV structure gene(C, C+E1, C+E1+E2) transiently. This should be useful to pack adenovirus expression vector which can express HCV structure genes.

Houseflies (Musca domestica) as Vectors for Extended-Spectrum β-Lactamase-Producing Escherichia coli on Spanish Broiler Farms.

PubMed

Solà-Ginés, Marc; González-López, Juan José; Cameron-Veas, Karla; Piedra-Carrasco, Nuria; Cerdà-Cuéllar, Marta; Migura-Garcia, Lourdes

2015-06-01

Flies may act as potential vectors for the spread of resistant bacteria to different environments. This study was intended to evaluate the presence of Escherichia coli strains resistant to cephalosporins in flies captured in the areas surrounding five broiler farms. Phenotypic and molecular characterization of the resistant population was performed by different methods: MIC determination, pulsed-field gel electrophoresis (PFGE), multilocus sequence typing (MLST), and phylotyping. The presence of extended-spectrum beta-lactamase (ESBL) genes, their plasmid location, and the mobile genetic elements involved in their mobilization were studied. Additionally, the presence of 35 genes associated with virulence was evaluated. Out of 682 flies captured, 42 yielded ESBL-producing E. coli. Of these isolates, 23 contained bla(CTX-M-1), 18 contained bla(CTX-M-14), and 1 contained bla(CTX-M-9). ESBL genes were associated mainly with the presence of the IncI1 and IncFIB replicons. Additionally, all the strains were multiresistant, and five of them also harbored qnrS. Identical PFGE profiles were found for E. coli isolates obtained from flies at different sampling times, indicating a persistence of the same clones in the farm environment over months. According to their virulence genes, 81% of the isolates were considered avian-pathogenic E. coli (APEC) and 29% were considered extraintestinal pathogenic E. coli (ExPEC). The entrance of flies into broiler houses constitutes a considerable risk for colonization of broilers with multidrug-resistant E. coli. ESBLs in flies reflect the contamination status of the farm environment. Additionally, this study demonstrates the potential contribution of flies to the dissemination of virulence and resistance genes into different ecological niches. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

Molecular cloning and characterization of Bacillus alvei thiol-dependent cytolytic toxin expressed in Escherichia coli.

PubMed

Geoffroy, C; Alouf, J E

1988-07-01

A chromosomal DNA fragment from Bacillus alvei, encoding a thiol-dependent haemolytic product known as alveolysin (Mr 60,000, pI 5.0) was cloned in Escherichia coli SK1592, using pBR322 as the vector plasmid. Only a single haemolysin-positive clone was identified, by testing for haemolysis on blood agar plates. The haemolytic material was associated with the host bacterial cell. It was released by ultrasonic disruption and purified 267-fold. A 64 kDa polypeptide of pI 8.2 cofractionated with haemolytic activity during gel filtration chromatography and isoelectric focusing. It behaved identically to alveolysin in its activation by thiols, inactivation by thiol group reagents, inhibition by cholesterol, and neutralization, immunoprecipitation and immunoblotting by immune sera raised against alveolysin and streptolysin O.

Genetically engineering adenoviral vectors for gene therapy.

PubMed

Coughlan, Lynda

2014-01-01

Adenoviral (Ad) vectors are commonly used for various gene therapy applications. Significant advances in the genetic engineering of Ad vectors in recent years has highlighted their potential for the treatment of metastatic disease. There are several methods to genetically modify the Ad genome to incorporate retargeting peptides which will redirect the natural tropism of the viruses, including homologous recombination in bacteria or yeast. However, homologous recombination in yeast is highly efficient and can be achieved without the need for extensive cloning strategies. In addition, the method does not rely on the presence of unique restriction sites within the Ad genome and the reagents required for this method are widely available and inexpensive. Large plasmids containing the entire adenoviral genome (~36 kbp) can be modified within Saccharomyces cerevisiae yeast and genomes easily rescued in Escherichia coli hosts for analysis or amplification. A method for two-step homologous recombination in yeast is described in this chapter.

Adenosine monophosphate affects competence development and plasmid DNA transformation in Escherichia coli.

PubMed

Zhang, Yan; Li, Wenhua; Wang, Liming; Shen, Ping; Xie, Zhixiong

2013-11-01

Artificial plasmid DNA transformation of Escherichia coli induced by calcium chloride is a routine technique in molecular biology and genetic engineering processes, but its mechanism has remained elusive. Because adenosine monophosphate (AMP) has been found to regulate natural transformation in Haemophilus influenza, we aimed to investigate the effects of AMP and its derivatives on E. coli transformation by treating competence with different concentrations of them. Analysis of the transformation efficiencies revealed that AMP inhibited the artificial plasmid DNA transformation of E. coli in a concentration- and time-dependent manner. Furthermore, we found that AMP had no effect on the expression of the transformed gene but that the intracellular AMP level of the competent cells rose after a 6 h treatment. These results suggested that the intracellular AMP level had an important role in E. coli transformation. And these have useful implications for the further investigation of the mechanism of E. coli transformation.

The plasmid of Escherichia coli strain S88 (O45:K1:H7) that causes neonatal meningitis is closely related to avian pathogenic E. coli plasmids and is associated with high-level bacteremia in a neonatal rat meningitis model.

PubMed

Peigne, Chantal; Bidet, Philippe; Mahjoub-Messai, Farah; Plainvert, Céline; Barbe, Valérie; Médigue, Claudine; Frapy, Eric; Nassif, Xavier; Denamur, Erick; Bingen, Edouard; Bonacorsi, Stéphane

2009-06-01

A new Escherichia coli virulent clonal group, O45:K1, belonging to the highly virulent subgroup B2(1) was recently identified in France, where it accounts for one-third of E. coli neonatal meningitis cases. Here we describe the sequence, epidemiology and function of the large plasmid harbored by strain S88, which is representative of the O45:K1 clonal group. Plasmid pS88 is 133,853 bp long and contains 144 protein-coding genes. It harbors three different iron uptake systems (aerobactin, salmochelin, and the sitABCD genes) and other putative virulence genes (iss, etsABC, ompT(P), and hlyF). The pS88 sequence is composed of several gene blocks homologous to avian pathogenic E. coli plasmids pAPEC-O2-ColV and pAPEC-O1-ColBM. PCR amplification of 11 open reading frames scattered throughout the plasmid was used to investigate the distribution of pS88 and showed that a pS88-like plasmid is present in other meningitis clonal groups such as O18:K1, O1:K1, and O83:K1. A pS88-like plasmid was also found in avian pathogenic strains and human urosepsis strains belonging to subgroup B2(1). A variant of S88 cured of its plasmid displayed a marked loss of virulence relative to the wild-type strain in a neonatal rat model, with bacteremia more than 2 log CFU/ml lower. The salmochelin siderophore, a known meningovirulence factor, could not alone explain the plasmid's contribution to virulence, as a salmochelin mutant displayed only a minor fall in bacteremia (0.9 log CFU/ml). Thus, pS88 is a major virulence determinant related to avian pathogenic plasmids that has spread not only through meningitis clonal groups but also human urosepsis and avian pathogenic strains.

Multiple antibiotic resistant Escherichia coli from a tropical rain forest stream

DOE Office of Scientific and Technical Information (OSTI.GOV)

Carrasco, C.E.; Alvarez, H.J.; Ortiz, N.

1988-12-31

High densities of fecal coliforms were obtained from a pristine site and sewage contaminated site in a tropical rain forest watershed in Puerto Rico. Confirmation of fecal coliform isolates as Escherichia coli was significantly lower than for temperate waters. Antibiotic resistance and multiple antibiotic resistance were common for isolates at both sites; however, the site receiving sewage effluent had a greater proportion of multiple antibiotic resistant isolates. R. plasmids were recovered from 4 MAR isolates, 2 from each site. All recovered plasmids were approximately 1 kilobase. The recovered plasmid were also capable of transforming E. coli HB101 in vitro. Themore » high concentrations of enterobacteriaceae, small R-plasmid size, R-plasmid transformability, and long term survival of fecal origin bacteria in tropical freshwater environments give increasing importance to adequate sewage treatment, and better indicator monitoring methods for tropical areas.« less

Horizontal Transfer of Plasmid-Mediated Cephalosporin Resistance Genes in the Intestine of Houseflies (Musca domestica).

PubMed

Fukuda, Akira; Usui, Masaru; Okubo, Torahiko; Tamura, Yutaka

2016-06-01

Houseflies are a mechanical vector for various types of bacteria, including antimicrobial-resistant bacteria (ARB). If the intestine of houseflies is a suitable site for the transfer of antimicrobial resistance genes (ARGs), houseflies could also serve as a biological vector for ARB. To clarify whether cephalosporin resistance genes are transferred efficiently in the housefly intestine, we compared with conjugation experiments in vivo (in the intestine) and in vitro by using Escherichia coli with eight combinations of four donor and two recipient strains harboring plasmid-mediated cephalosporin resistance genes and chromosomal-encoded rifampicin resistance genes, respectively. In the in vivo conjugation experiment, houseflies ingested donor strains for 6 hr and then recipient strains for 3 hr, and 24 hr later, the houseflies were surface sterilized and analyzed. In vitro conjugation experiments were conducted using the broth-mating method. In 3/8 combinations, the in vitro transfer frequency (Transconjugants/Donor) was ≥1.3 × 10(-4); the in vivo transfer rates of cephalosporin resistance genes ranged from 2.0 × 10(-4) to 5.7 × 10(-5). Moreover, cephalosporin resistance genes were transferred to other species of enteric bacteria of houseflies such as Achromobacter sp. and Pseudomonas fluorescens. These results suggest that houseflies are not only a mechanical vector for ARB but also a biological vector for the occurrence of new ARB through the horizontal transfer of ARGs in their intestine.

The LE1 Bacteriophage Replicates as a Plasmid within Leptospira biflexa: Construction of an L. biflexa-Escherichia coli Shuttle Vector

PubMed Central

Girons, Isabelle Saint; Bourhy, Pascale; Ottone, Catherine; Picardeau, Mathieu; Yelton, David; Hendrix, Roger W.; Glaser, Philippe; Charon, Nyles

2000-01-01

We have discovered that LE1, one of the plaque-forming phages previously described as lytic for the Leptospira biflexa saprophytic spirochete (I. Saint Girons, D. Margarita, P. Amouriaux, and G. Baranton, Res. Microbiol. 141:1131–1138, 1990), was indeed temperate. LE1 was found to be unusual, as Southern blot analysis indicated that it is one of the few phages to replicate in the prophage state as a circular plasmid. The unavailability of such small endogenous replicons has hindered genetic experimentation in Leptospira. We have developed a shuttle vector with DNA derived from LE1. Random LE1 DNA fragments were cloned into a pGEM 7Zf(+) derivative devoid of most of the bla gene but carrying a kanamycin resistance marker from the gram-positive bacterium Enterococcus (Streptococcus) faecalis. These constructs were transformed into L. biflexa strain Patoc 1 by electroporation, giving rise to kanamycin-resistant transformants. A 2.2-kb fragment from LE1 was responsible for replication of the vector in L. biflexa. However, a larger region including an intact parA gene homologue was necessary for the stability of the shuttle vector. Direct repeats and AT-rich regions characterized the LE1 origin of replication. Our data indicate that the replicon derived from the LE1 leptophage, together with the kanamycin resistance gene, is a promising tool with which to develop the genetics of Leptospira species. PMID:11004167

IncX2 and IncX1-X2 Hybrid Plasmids Coexisting in a FosA6-Producing Escherichia coli Strain

PubMed Central

Su, Jiachun; McElheny, Christi Lee; Wang, Minggui

2017-01-01

ABSTRACT IncX plasmids are receiving much attention as vehicles of carbapenem and colistin resistance genes, such as blaNDM, blaKPC, and mcr-1. Among them, IncX2 subgroup plasmids remain rare. Here, we characterized IncX2 and IncX1-X2 hybrid plasmids coexisting in a FosA6-producing Escherichia coli strain that were possibly generated as a consequence of recombination events between an R6K-like IncX2 plasmid and a pLN126_33-like IncX1 plasmid. Variable multidrug resistance mosaic regions were observed in these plasmids, indicating their potential to serve as flexible carriers of resistance genes. The diversity of IncX group plasmid backbones and accessory genes and the evolution of hybrid IncX plasmids pose a challenge in detecting and classifying them. PMID:28438937

Flanking sequence determination and specific PCR identification of transgenic wheat B102-1-2.

PubMed

Cao, Jijuan; Xu, Junyi; Zhao, Tongtong; Cao, Dongmei; Huang, Xin; Zhang, Piqiao; Luan, Fengxia

2014-01-01

The exogenous fragment sequence and flanking sequence between the exogenous fragment and recombinant chromosome of transgenic wheat B102-1-2 were successfully acquired using genome walking technology. The newly acquired exogenous fragment encoded the full-length sequence of transformed genes with transformed plasmid and corresponding functional genes including ubi, vector pBANF-bar, vector pUbiGUSPlus, vector HSP, reporter vector pUbiGUSPlus, promoter ubiquitin, and coli DH1. A specific polymerase chain reaction (PCR) identification method for transgenic wheat B102-1-2 was established on the basis of designed primers according to flanking sequence. This established specific PCR strategy was validated by using transgenic wheat, transgenic corn, transgenic soybean, transgenic rice, and non-transgenic wheat. A specifically amplified target band was observed only in transgenic wheat B102-1-2. Therefore, this method is characterized by high specificity, high reproducibility, rapid identification, and excellent accuracy for the identification of transgenic wheat B102-1-2.

Complete sequence of a colistin resistance gene (mcr-1) bearing isolate of Escherichia coli from the United States

USDA-ARS?s Scientific Manuscript database

Transmissible colistin resistance conferred by mcr-1 gene bearing IncI2 plasmid has been recently reported in Esherichia coli in the US. We report the completed genome sequence of a second E. coli isolated from swine in the US that carried the mcr-1 gene on an IncI2 type plasmid....

Complete sequences of IncHI1 plasmids carrying blaCTX-M-1 and qnrS1 in equine Escherichia coli provide new insights into plasmid evolution.

PubMed

Dolejska, Monika; Villa, Laura; Minoia, Marco; Guardabassi, Luca; Carattoli, Alessandra

2014-09-01

To determine the structure of two multidrug-resistant IncHI1 plasmids carrying blaCTX-M-1 in Escherichia coli isolates disseminated in an equine clinic in the Czech Republic. A complete nucleotide sequencing of 239 kb IncHI1 (pEQ1) and 287 kb IncHI1/X1 (pEQ2) plasmids was performed using the 454-Genome Sequencer FLX system. The sequences were compared using bioinformatic tools with other sequenced IncHI1 plasmids. A comparative analysis of pEQ1 and pEQ2 identified high nucleotide identity with the IncHI1 type 2 plasmids. A novel 24 kb module containing an operon involved in short-chain fructooligosaccharide uptake and metabolism was found in the pEQ backbones. The role of the pEQ plasmids in the metabolism of short-chain fructooligosaccharides was demonstrated by studying the growth of E. coli cells in the presence of these sugars. The module containing the blaCTX-M-1 gene was formed by a truncated macrolide resistance cluster and flanked by IS26 as previously observed in IncI1 and IncN plasmids. The IncHI1 plasmid changed size and gained the quinolone resistance gene qnrS1 as a result of IS26-mediated fusion with an IncX1 plasmid. Our data highlight the structure and evolution of IncHI1 from equine E. coli. A plasmid-mediated sugar metabolic element could play a key role in strain fitness, contributing to the successful dissemination and maintenance of these plasmids in the intestinal microflora of horses. © The Author 2014. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

Cloning of a promoter-like soybean DNA sequence responding to IAA induction in Escherichia coli K12.

PubMed

Kline, E L; Chiang, S J; Lattora, D; Chaung, W

1992-02-01

We have constructed a soybean genomic DNA library in Escherichia coli K12 strain KC13 using plasmid pPV33, which consists of a promoter-less tetracycline resistance (Tcr) gene. A recombinant clone, KC13(pAU-SB1)+, was obtained by selecting for resistance to tetracycline in the presence of indole-3-acetic acid (IAA). Restriction enzyme cleavage and Southern hybridization analysis revealed that the pAU-SB1 plasmid has a 250 bp soybean DNA insert fused with the Tcr gene. In the presence of a selected group of auxins, induction of the Tcr phenotype and mRNA synthesis of the Tcr gene are observed only in KC13(pAU-SB1)+ cultures. On the other hand, induction of the Tcr phenotype and mRNA synthesis of the Tcr gene are absent in cells harboring the cloning vector pPV33 or a recombinant plasmid containing the 250 bp insert in the reverse orientation, pAU-SB1ro. This demonstrated a need for the insertion of the 250 bp soybean DNA and the specificity of its orientation in response to IAA induction. The start point of mRNA transcription in response to IAA, IBA, IPA, 2,4,5-T, and a-NAP is at base pair -96 or -95 upstream of the translational start site of the Tcr gene and base pair -98 with 2,4-D.

High Incidence of Escherichia coli Strains Coharboring mcr-1 and blaNDM from Chickens.

PubMed

Liu, Bao-Tao; Song, Feng-Jing; Zou, Ming; Zhang, Qi-Di; Shan, Hu

2017-03-01

This study investigated the characteristics of Escherichia coli isolates carrying mcr-1-bla NDM from a chicken farm in China. Of the 78 E. coli isolates, 21 clonally unrelated isolates carried mcr-1-bla NDM Diverse IncI2 plasmids disseminated mcr-1 , while the dissemination of bla NDM was mediated by diverse IncB/O plasmids. More striking was the colocalization of resistance genes mcr-1 and bla NDM-4 in an IncHI2/ST3 plasmid, which might pose a great challenge for public health. Copyright © 2017 American Society for Microbiology.

Streptomyces griseus streptomycin phosphotransferase: expression of its gene in Escherichia coli and sequence homology with other antibiotic phosphotransferases and with eukaryotic protein kinases.

PubMed

Lim, C K; Smith, M C; Petty, J; Baumberg, S; Wootton, J C

1989-12-01

The aphD gene of Streptomyces griseus, encoding a streptomycin 6-phosphotransferase (SPH), was sub-cloned in the pBR322-based expression vector pRK9 (which contains the Serratia marcescens trp promoter) with selection for expression of streptomycin resistance in Escherichia coli. Two hybrid plasmids, pCKL631 and pCKL711, were isolated which conferred resistance. Both contained a approximately 2 kbp fragment already suspected to include aphD. The properties of in vitro deletion derivatives of these plasmids were consistent with the presumed location of aphD. In vitro deletion of a sequence including most of the trp promoter largely, but not quite completely, abolished the ability of the plasmid to confer streptomycin resistance, confirming that expression was indeed principally from the trp promoter. A polypeptide of approximately 34.5 kDa was present in minicells containing plasmids that conferred streptomycin resistance, but was absent when the plasmids contained in vitro deletions removing streptomycin resistance. Part of the fragment was sequenced and an open reading frame corresponding to aphD identified. A computer-assisted comparison of the deduced SPH sequence with those of other antibiotic phosphotransferases suggested a common structure A-B-C-D-E, where B and D were conserved between all sequences compared while A, C and E divided between the streptomycin and hygromycin B phosphotransferases on one hand and kanamycin/neomycin ones on the other. A composite sequence data base was searched for homologues to consensus matrices constructed from five approximately 12-residue subsequences within blocks B and D. For one subsequence, corresponding to the N-terminal portion of block D, those sequences from the database that yielded the highest homology scores comprised almost entirely either antibiotic phosphotransferases or eukaryotic protein kinases. Possible evolutionary implications of this homology, previously described by other groups, are discussed.

Chromosomal features of Escherichia coli serotype O2:K2, an avian pathogenic E. coli.

PubMed

Jørgensen, Steffen L; Kudirkiene, Egle; Li, Lili; Christensen, Jens P; Olsen, John E; Nolan, Lisa; Olsen, Rikke H

2017-01-01

Escherichia coli causing infection outside the gastrointestinal system are referred to as extra-intestinal pathogenic E. coli. Avian pathogenic E. coli is a subgroup of extra-intestinal pathogenic E. coli and infections due to avian pathogenic E. coli have major impact on poultry production economy and welfare worldwide. An almost defining characteristic of avian pathogenic E. coli is the carriage of plasmids, which may encode virulence factors and antibiotic resistance determinates. For the same reason, plasmids of avian pathogenic E. coli have been intensively studied. However, genes encoded by the chromosome may also be important for disease manifestation and antimicrobial resistance. For the E. coli strain APEC_O2 the plasmids have been sequenced and analyzed in several studies, and E. coli APEC_O2 may therefore serve as a reference strain in future studies. Here we describe the chromosomal features of E. coli APEC_O2. E. coli APEC_O2 is a sequence type ST135, has a chromosome of 4,908,820 bp (plasmid removed), comprising 4672 protein-coding genes, 110 RNA genes, and 156 pseudogenes, with an average G + C content of 50.69%. We identified 82 insertion sequences as well as 4672 protein coding sequences, 12 predicated genomic islands, three prophage-related sequences, and two clustered regularly interspaced short palindromic repeats regions on the chromosome, suggesting the possible occurrence of horizontal gene transfer in this strain. The wildtype strain of E. coli APEC_O2 is resistant towards multiple antimicrobials, however, no (complete) antibiotic resistance genes were present on the chromosome, but a number of genes associated with extra-intestinal disease were identified. Together, the information provided here on E. coli APEC_O2 will assist in future studies of avian pathogenic E. coli strains, in particular regarding strain of E. coli APEC_O2, and aid in the general understanding of the pathogenesis of avian pathogenic E. coli .

A freeze-thaw method for disintegration of Escherichia coli cells producing T7 lysozyme used in pBAD expression systems.

PubMed

Wanarska, Marta; Hildebrandt, Piotr; Kur, Józef

2007-01-01

The pLysN plasmid containing the T7 lysozyme gene under control of the lac promoter was constructed to facilitate cell disintegration after expression of recombinant proteins in arabinose-induced expression systems. The usefulness of this plasmid was tested in Escherichia coli TOP10 and E. coli LMG194 cells carrying pBADMHADgeSSB plasmid containing Deinococcus geothermalis SSB protein gene under control of the araBAD promoter. The results showed that low-level expression of T7 lysozyme did not interfere with the target SSB protein production, and that the freezing-thawing treatment was sufficient for disruption of the E. coli cells producing low amounts of T7 lysozyme.

The effects of a low-intensity red laser on bacterial growth, filamentation and plasmid DNA

NASA Astrophysics Data System (ADS)

Roos, C.; Santos, J. N.; Guimarães, O. R.; Geller, M.; Paoli, F.; Fonseca, A. S.

2013-07-01

Exposure of nonphotosynthesizing microorganisms to light could increase cell division in cultures, a phenomenon denominated as biostimulation. However, data concerning the importance of the genetic characteristics of cells on this effect are as yet scarce. The aim of this work was to evaluate the effects of a low-intensity red laser on the growth, filamentation and plasmids in Escherichia coli cells proficient and deficient in DNA repair. E. coli cultures were exposed to a laser (658 nm, 10 mW, 1 and 8 J cm-2) to study bacterial growth and filamentation. Also, bacterial cultures hosting pBSK plasmids were exposed to the laser to study DNA topological forms from the electrophoretic profile in agarose gels. Data indicate the low-intensity red laser: (i) had no effect on the growth of E. coli wild type and exonuclease III deficient cells; (ii) induced bacterial filamentation, (iii) led to no alteration in the electrophoretic profile of plasmids from exonuclease III deficient cells, but plasmids from wild type cells were altered. A low-intensity red laser at the low fluences used in phototherapy has no effect on growth, but induces filamentation and alters the topological forms of plasmid DNA in E. coli cultures depending on the DNA repair mechanisms.

Global phylogenetic analysis of Escherichia coli and plasmids carrying the mcr-1 gene indicates bacterial diversity but plasmid restriction.

PubMed

Matamoros, Sébastien; van Hattem, Jarne M; Arcilla, Maris S; Willemse, Niels; Melles, Damian C; Penders, John; Vinh, Trung Nguyen; Thi Hoa, Ngo; de Jong, Menno D; Schultsz, Constance

2017-11-10

To understand the dynamics behind the worldwide spread of the mcr-1 gene, we determined the population structure of Escherichia coli and of mobile genetic elements (MGEs) carrying the mcr-1 gene. After a systematic review of the literature we included 65 E. coli whole genome sequences (WGS), adding 6 recently sequenced travel related isolates, and 312 MLST profiles. We included 219 MGEs described in 7 Enterobacteriaceae species isolated from human, animal and environmental samples. Despite a high overall diversity, 2 lineages were observed in the E. coli population that may function as reservoirs of the mcr-1 gene, the largest of which was linked to ST10, a sequence type known for its ubiquity in human faecal samples and in food samples. No genotypic clustering by geographical origin or isolation source was observed. Amongst a total of 13 plasmid incompatibility types, the IncI2, IncX4 and IncHI2 plasmids accounted for more than 90% of MGEs carrying the mcr-1 gene. We observed significant geographical clustering with regional spread of IncHI2 plasmids in Europe and IncI2 in Asia. These findings point towards promiscuous spread of the mcr-1 gene by efficient horizontal gene transfer dominated by a limited number of plasmid incompatibility types.

The Complete Sequence and Comparative Analysis of a Multidrug-Resistance and Virulence Multireplicon IncFII Plasmid pEC302/04 from an Extraintestinal Pathogenic Escherichia coli EC302/04 Indicate Extensive Diversity of IncFII Plasmids.

PubMed

Ho, Wing Sze; Yap, Kien-Pong; Yeo, Chew Chieng; Rajasekaram, Ganeswrie; Thong, Kwai Lin

2015-01-01

Extraintestinal pathogenic Escherichia coli (ExPEC) that causes extraintestinal infections often harbor plasmids encoding fitness traits such as resistance and virulence determinants that are of clinical importance. We determined the complete nucleotide sequence of plasmid pEC302/04 from a multidrug-resistant E. coli EC302/04 which was isolated from the tracheal aspirate of a patient in Malaysia. In addition, we also performed comparative sequence analyses of 18 related IncFIIA plasmids to determine the phylogenetic relationship and diversity of these plasmids. The 140,232 bp pEC302/04 is a multireplicon plasmid that bears three replication systems (FII, FIA, and FIB) with subtype of F2:A1:B1. The plasmid is self-transmissible with a complete transfer region. pEC302/04 also carries antibiotic resistance genes such as bla TEM-1 and a class I integron containing sul1, cml and aadA resistance genes, conferring multidrug resistance (MDR) to its host, E. coli EC302/04. Besides, two iron acquisition systems (SitABCD and IutA-IucABCD) which are the conserved virulence determinants of ExPEC-colicin V or B and M (ColV/ColBM)-producing plasmids were identified in pEC302/04. Multiple toxin-antitoxin (TA)-based addiction systems (i.e., PemI/PemK, VagC/VagD, CcdA/CcdB, and Hok/Sok) and a plasmid partitioning system, ParAB, and PsiAB, which are important for plasmid maintenance were also found. Comparative plasmid analysis revealed only one conserved gene, the repA1 as the core genome, showing that there is an extensive diversity among the IncFIIA plasmids. The phylogenetic relationship of 18 IncF plasmids based on the core regions revealed that ColV/ColBM-plasmids and non-ColV/ColBM plasmids were separated into two distinct groups. These plasmids, which carry highly diverse genetic contents, are also mosaic in nature. The atypical combination of genetic materials, i.e., the MDR- and ColV/ColBM-plasmid-virulence encoding regions in a single ExPEC plasmid is rare but of clinical importance. Such phenomenon is bothersome when the plasmids are transmissible, facilitating the spread of virulence and resistance plasmids among pathogenic bacteria. Notably, certain TA systems are more commonly found in particular ExPEC plasmid types, indicating the possible relationships between certain TA systems and ExPEC pathogenesis.

Plasmid Flux in Escherichia coli ST131 Sublineages, Analyzed by Plasmid Constellation Network (PLACNET), a New Method for Plasmid Reconstruction from Whole Genome Sequences

PubMed Central

Garcillán-Barcia, M. Pilar; Mora, Azucena; Blanco, Jorge; Coque, Teresa M.; de la Cruz, Fernando

2014-01-01

Bacterial whole genome sequence (WGS) methods are rapidly overtaking classical sequence analysis. Many bacterial sequencing projects focus on mobilome changes, since macroevolutionary events, such as the acquisition or loss of mobile genetic elements, mainly plasmids, play essential roles in adaptive evolution. Existing WGS analysis protocols do not assort contigs between plasmids and the main chromosome, thus hampering full analysis of plasmid sequences. We developed a method (called plasmid constellation networks or PLACNET) that identifies, visualizes and analyzes plasmids in WGS projects by creating a network of contig interactions, thus allowing comprehensive plasmid analysis within WGS datasets. The workflow of the method is based on three types of data: assembly information (including scaffold links and coverage), comparison to reference sequences and plasmid-diagnostic sequence features. The resulting network is pruned by expert analysis, to eliminate confounding data, and implemented in a Cytoscape-based graphic representation. To demonstrate PLACNET sensitivity and efficacy, the plasmidome of the Escherichia coli lineage ST131 was analyzed. ST131 is a globally spread clonal group of extraintestinal pathogenic E. coli (ExPEC), comprising different sublineages with ability to acquire and spread antibiotic resistance and virulence genes via plasmids. Results show that plasmids flux in the evolution of this lineage, which is wide open for plasmid exchange. MOBF12/IncF plasmids were pervasive, adding just by themselves more than 350 protein families to the ST131 pangenome. Nearly 50% of the most frequent γ–proteobacterial plasmid groups were found to be present in our limited sample of ten analyzed ST131 genomes, which represent the main ST131 sublineages. PMID:25522143

Plasmid flux in Escherichia coli ST131 sublineages, analyzed by plasmid constellation network (PLACNET), a new method for plasmid reconstruction from whole genome sequences.

PubMed

Lanza, Val F; de Toro, María; Garcillán-Barcia, M Pilar; Mora, Azucena; Blanco, Jorge; Coque, Teresa M; de la Cruz, Fernando

2014-12-01

Bacterial whole genome sequence (WGS) methods are rapidly overtaking classical sequence analysis. Many bacterial sequencing projects focus on mobilome changes, since macroevolutionary events, such as the acquisition or loss of mobile genetic elements, mainly plasmids, play essential roles in adaptive evolution. Existing WGS analysis protocols do not assort contigs between plasmids and the main chromosome, thus hampering full analysis of plasmid sequences. We developed a method (called plasmid constellation networks or PLACNET) that identifies, visualizes and analyzes plasmids in WGS projects by creating a network of contig interactions, thus allowing comprehensive plasmid analysis within WGS datasets. The workflow of the method is based on three types of data: assembly information (including scaffold links and coverage), comparison to reference sequences and plasmid-diagnostic sequence features. The resulting network is pruned by expert analysis, to eliminate confounding data, and implemented in a Cytoscape-based graphic representation. To demonstrate PLACNET sensitivity and efficacy, the plasmidome of the Escherichia coli lineage ST131 was analyzed. ST131 is a globally spread clonal group of extraintestinal pathogenic E. coli (ExPEC), comprising different sublineages with ability to acquire and spread antibiotic resistance and virulence genes via plasmids. Results show that plasmids flux in the evolution of this lineage, which is wide open for plasmid exchange. MOBF12/IncF plasmids were pervasive, adding just by themselves more than 350 protein families to the ST131 pangenome. Nearly 50% of the most frequent γ-proteobacterial plasmid groups were found to be present in our limited sample of ten analyzed ST131 genomes, which represent the main ST131 sublineages.

Clinical Features and Molecular Epidemiology of CMY-Type β-Lactamase-Producing Escherichia coli

PubMed Central

Sidjabat, Hanna E.; Paterson, David L.; Qureshi, Zubair A.; Adams-Haduch, Jennifer M.; O’Keefe, Alexandra; Pascual, Alvaro; Rodríguez-Baño, Jesús; Doi, Yohei

2009-01-01

Background Knowledge on the clinical features of infections caused by Escherichia coli producing plasmid-mediated AmpC β-lactamase is limited. Of the several groups of plasmid-mediated AmpC β-lactamase, CMY-type β-lactamase is the most common in the United States. Methods We prospectively identified E. coli producing CMY-type β-lactamase and collected clinical data over a seven-month period. A retrospective cohort study was performed to identify features associated with these cases, using cases due to extended-spectrum β-lactamase (ESBL)-producing E. coli as controls. Pulsed-field gel electrophoresis (PFGE), plasmid analysis and phylogenetic typing were performed. Results Twenty-two cases with CMY-producing E. coli and 25 cases with ESBL-producing E. coli were identified. The demographics of the patients were similar between the CMY and ESBL cohorts. CMY cases were significantly more likely to represent symptomatic infection compared with ESBL cases (P=0.028). The CMY-type β-lactamase was identified as CMY-2 or its variants. Ninety-four percent of the CMY-producing isolates belonged to E. coli phylogenetic groups B2 and D, which are associated with virulence. Many of them shared similar plasmid profiles, whereas the PFGE profiles were diverse. Co-resistance to non-β-lactam antimicrobials was common. Conclusion In Pittsburgh, CMY-producing E. coli is almost as common as ESBL-producing E. coli and causes symptomatic infection in the majority of cases. PMID:19187027

Isolation of a conjugative F-like plasmid from a multidrug-resistant Escherichia coli strain CM6 using tandem shock wave-mediated transformation.

PubMed

Soto-Alonso, G; Cruz-Medina, J A; Caballero-Pérez, J; Arvizu-Hernández, I; Ávalos-Esparza, L M; Cruz-Hernández, A; Romero-Gómez, S; Rodríguez, A L; Pastrana-Martínez, X; Fernández, F; Loske, A M; Campos-Guillén, J

2015-07-01

Genetic characterization of plasmids from bacterial strains provides insight about multidrug resistance. Ten wild type Escherichia coli (E. coli) strains isolated from cow fecal samples were characterized by their antibiotic resistance profile, plasmid patterns and three different identification methods. From one of the strains, a fertility factor-like plasmid was replicated using tandem shock wave-mediated transformation. Underwater shock waves with a positive pressure peak of up to approximately 40 MPa, followed by a pressure trough of approximately -19 MPa were generated using an experimental piezoelectric shock wave source. Three different shock wave energies and a fixed delay of 750 μs were used to study the relationship between energy and transformation efficiency (TE), as well as the influence of shock wave energy on the integrity of the plasmid. Our results showed that the mean shock wave-mediated TE and the integrity of the large plasmid (~70 kb) were reduced significantly at the energy levels tested. The sequencing analysis of the plasmid revealed a high identity to the pHK17a plasmid, including the replication system, which was similar to the plasmid incompatibility group FII. It also showed that it carried an extended spectrum beta-lactamase gene, ctx-m-14. Furthermore, diverse genes for the conjugative mechanism were identified. Our results may be helpful in improving methodologies for conjugative plasmid transfer and directly selecting the most interesting plasmids from environmental samples. Copyright © 2015 Elsevier B.V. All rights reserved.

First Detection of an Escherichia coli Strain Harboring the mcr-1 Gene in Retail Domestic Chicken Meat in Japan.

PubMed

Ohsaki, Yusuke; Hayashi, Wataru; Saito, Satomi; Osaka, Shunsuke; Taniguchi, Yui; Koide, Shota; Kawamura, Kumiko; Nagano, Yukiko; Arakawa, Yoshichika; Nagano, Noriyuki

2017-09-25

Global spread of the plasmid-mediated colistin resistance gene, mcr-1 poses a challenge to public health because colistin is the last-line-of-defense against severe infections of multidrug-resistant Gram-negative bacteria. In Japan, a few studies have reported the prevalence of mcr-1 among food animal-derived Escherichia coli isolates, but the prevalence of mcr-1 in retail meats is not well known. We report here the first detection of mcr-1 in retail chicken meat. A total of 70 extended-spectrum beta-lactamase-producing E. coli isolates, recovered from retail chicken meats between August 2015 and June 2016, were screened for mcr-1. We found 1 CTX-M-1 beta-lactamase-producing E. coli isolate belonging to ST1684, phylogroup A. The mcr-1 gene was not located on an IncI1 plasmid encoding the bla CTX-M-1 gene. However, whole plasmid sequencing revealed that mcr-1 was located on an IncI2 plasmid. The sequences of the nikB-mcr-1-pap2-ydfA-topB region of the IncI2 plasmid in this study was almost identical to that of the previously described IncI2 plasmid, pECJS-61-63 present in E. coli isolated from pig feces in China, except for containing a synonymous mutation in the mcr-1 gene. Plasmid carrying the mcr-1 gene have not yet been identified in human isolates in Japan. Thus, strict monitoring or surveillance of colistin resistance among Gram-negative bacteria recovered from retail meat of food animals under colistin pressure, and humans, is crucial.

A transposase strategy for creating libraries of circularly permuted proteins.

PubMed

Mehta, Manan M; Liu, Shirley; Silberg, Jonathan J

2012-05-01

A simple approach for creating libraries of circularly permuted proteins is described that is called PERMutation Using Transposase Engineering (PERMUTE). In PERMUTE, the transposase MuA is used to randomly insert a minitransposon that can function as a protein expression vector into a plasmid that contains the open reading frame (ORF) being permuted. A library of vectors that express different permuted variants of the ORF-encoded protein is created by: (i) using bacteria to select for target vectors that acquire an integrated minitransposon; (ii) excising the ensemble of ORFs that contain an integrated minitransposon from the selected vectors; and (iii) circularizing the ensemble of ORFs containing integrated minitransposons using intramolecular ligation. Construction of a Thermotoga neapolitana adenylate kinase (AK) library using PERMUTE revealed that this approach produces vectors that express circularly permuted proteins with distinct sequence diversity from existing methods. In addition, selection of this library for variants that complement the growth of Escherichia coli with a temperature-sensitive AK identified functional proteins with novel architectures, suggesting that PERMUTE will be useful for the directed evolution of proteins with new functions.

A transposase strategy for creating libraries of circularly permuted proteins

PubMed Central

Mehta, Manan M.; Liu, Shirley; Silberg, Jonathan J.

2012-01-01

A simple approach for creating libraries of circularly permuted proteins is described that is called PERMutation Using Transposase Engineering (PERMUTE). In PERMUTE, the transposase MuA is used to randomly insert a minitransposon that can function as a protein expression vector into a plasmid that contains the open reading frame (ORF) being permuted. A library of vectors that express different permuted variants of the ORF-encoded protein is created by: (i) using bacteria to select for target vectors that acquire an integrated minitransposon; (ii) excising the ensemble of ORFs that contain an integrated minitransposon from the selected vectors; and (iii) circularizing the ensemble of ORFs containing integrated minitransposons using intramolecular ligation. Construction of a Thermotoga neapolitana adenylate kinase (AK) library using PERMUTE revealed that this approach produces vectors that express circularly permuted proteins with distinct sequence diversity from existing methods. In addition, selection of this library for variants that complement the growth of Escherichia coli with a temperature-sensitive AK identified functional proteins with novel architectures, suggesting that PERMUTE will be useful for the directed evolution of proteins with new functions. PMID:22319214

DNA transformations of Candida tropicalis with replicating and integrative vectors.

PubMed

Sanglard, D; Fiechter, A

1992-12-01

The alkane-assimilating yeast Candida tropicalis was used as a host for DNA transformations. A stable ade2 mutant (Ha900) obtained by UV-mutagenesis was used as a recipient for different vectors carrying selectable markers. A first vector, pMK16, that was developed for the transformation of C. albicans and carries an ADE2 gene marker and a Candida autonomously replicating sequence (CARS) element promoting autonomous replication, was compatible for transforming Ha900. Two transformant types were observed: (i) pink transformants which easily lose pMK16 under non-selective growth conditions; (ii) white transformants, in which the same plasmid exhibited a higher mitotic stability. In both cases pMK16 could be rescued from these cells in Escherichia coli. A second vector, pADE2, containing the isolated C. tropicalis ADE2, gene, was used to transform Ha900. This vector integrated in the yeast genome at homologous sites of the ade2 locus. Different integration types were observed at one or both ade2 alleles in single or in tandem repeats.

Changes in cultivar-specificity toward pea can result from transfer of plasmid RP4 and other incompatibility group P1 replicons to Pseudomonas syringae pv. pisi.

PubMed

Moulton, P J; Vivian, A; Hunter, P J; Taylor, J D

1993-12-01

Transfer of RP4 and related replicons belonging to the Escherichia coli incompatibility group P (Pseudomonas aeruginosa IncP1) to races 2 and 6 of P. syringae pv. pisi was associated with the creation of two types of transconjugant, one resembling the parental race and the other showing an altered cultivar-specificity towards pea. The latter, irrespective of the parental race, exhibited a novel pattern of interaction with pea that corresponded to race 4; consequently such transconjugants were termed race 4-like. Curing of RP4 did not affect the phenotype, except in relation to the antibiotic resistances specified by RP4. The race 4-like strains were non-fluorescent when cultured on appropriate media (in contrast to the particular isolates of races 2 and 6 from which they were derived), showed an enhanced ability to inherit RP4 subsequently (at frequencies up to 10(-1) per recipient) and differed from their parental race in their pattern of plasmid profile. The plasmid profiles were similar for all race 4-like strains irrespective of origin. There was no evidence that RP4 had recombined with DNA in the recipient and probing failed to detect the retention of any part of RP4 in cured strains. The inheritance of the related cosmid vector, pLAFR3, had similar effects in races 2 and 6. This observation is important since this vector has been widely used to clone avirulence genes in plant pathogenic bacteria. Transfer of the IncW plasmids S-a and R388 did not cause any changes in the fluorescence or cultivar-specificity of races 2 or 6.(ABSTRACT TRUNCATED AT 250 WORDS)

DNA sequence analysis of the composite plasmid pTC conferring virulence and antimicrobial resistance for porcine enterotoxigenic Escherichia coli.

PubMed

Fekete, Péter Z; Brzuszkiewicz, Elzbieta; Blum-Oehler, Gabriele; Olasz, Ferenc; Szabó, Mónika; Gottschalk, Gerhard; Hacker, Jörg; Nagy, Béla

2012-01-01

In this study the plasmid pTC, a 90 kb self-conjugative virulence plasmid of the porcine enterotoxigenic Escherichia coli (ETEC) strain EC2173 encoding the STa and STb heat-stable enterotoxins and tetracycline resistance, has been sequenced in two steps. As a result we identified five main distinct regions of pTC: (i) the maintenance region responsible for the extreme stability of the plasmid, (ii) the TSL (toxin-specific locus comprising the estA and estB genes) which is unique and characteristic for pTC, (iii) a Tn10 transposon, encoding tetracycline resistance, (iv) the tra (plasmid transfer) region, and (v) the colE1-like origin of replication. It is concluded that pTC is a self-transmissible composite plasmid harbouring antibiotic resistance and virulence genes. pTC belongs to a group of large conjugative E. coli plasmids represented by NR1 with a widespread tra backbone which might have evolved from a common ancestor. This is the first report of a completely sequenced animal ETEC virulence plasmid containing an antimicrobial resistance locus, thereby representing a selection advantage for spread of pathogenicity in the presence of antimicrobials leading to increased disease potential. Copyright © 2011. Published by Elsevier GmbH.

[Dynamics of the population structure of the Escherichia coli recombinant strain during continuous culture].

PubMed

Popova, L Iu; Lutskaia, N I; Bogucharov, A A; Bril'kov, A V; Pechurkin, N S

1992-01-01

The populational structure of the Escherichia coli strain Z905 containing the recombinant plasmid with the phenotype AprLux+ was studied in chemostat. It was shown that the stability of the ratio of plasmid containing cells and cells without plasmids depends in the first place on the presence of the selective factor (ampicillin) in the medium and on the sources of carbon and energy limiting growth.

Comparison of expression of monomeric and multimeric adenoregulin genes in Escherichia coli and Pichia pastorias.

PubMed

Zhou, Yuxun; Cao, Wei; Wang, Jinzhi; Ma, Yushu; Wei, Dongzhi

2005-05-01

Adenoregulin is a 33 amino acid antibiotic peptide who belongs to dermaseptin family which is the first vertebrate family to show lethal effects against filamentous fungi, as well as a broad spectrum of pathogenic microorganisms. Synthetic adenoregulin gene was cloned in 2, 4 and 6 tandem repeats and subcloned in pET32a and pET22b vectors. Recombinant plasmids were transformed into E. coli BL21(DE3), Fusion proteins of Trx-ADR1, Trx-ADR2 and Trx-ADR4 could be expressed after the hosts were induced by IPTG, but the expression level decreased dramatically with the number of tandem repeats increased. ADR1, ADR4 and ADR6 could not be expressed by E. coli without carrier proteins. But for Pichia pastoris GS115, ADR1 and ADR6 in the fermentation broth of the hosts could be detected by ELISA, and the bactericidal activities could also be observed.

Cloning and high level expression of gene encoding ES antigen from Trichinella spiralis muscle larvae.

PubMed

Yan, Y; Xu, W; Chen, H; Ma, Z; Zhu, Y; Cai, S

1994-01-01

The partial structure gene encoding ES antigen derived from Trichinella spiralis (TSP) muscle larvae was cloned, characterized, and expressed in E. coli. The target DNA (0.7 kb) was directly obtained from the TSP total RNA by using RNA PCR technique. Based on the analysis with the RE digestion, the fragment was cloned into the fusion expression vector pEX31C. It was shown that a kind of 37kDa fusion protein was expressed in E. coli containing the recombinant plasmid by SDS-PAGE electrophoresis. The expressed protein was over 22% of the total cell protein, and it was aggregated in the form of inclusion bodies in E. coli. The purified protein could be recognized in ELISA both by sera from swine-infected with TSP and by the monoclonal antibody against TSP. These findings suggest that the recombinant protein is a potentially valuable antigen both for immunodiagnosis and vaccine development of trichinellosis.

The Role of Flies in the Maintenance of Antimicrobial Resistance in Farm Environments.

PubMed

Fukuda, Akira; Usui, Masaru; Okamura, Masashi; Dong-Liang, Hu; Tamura, Yutaka

2018-04-30

Flies play an important role as vectors in the transmission of antimicrobial-resistant bacteria (ARB) and are hypothesized to transfer ARB between internal and external livestock housing areas. The aim of this study was to understand the role that flies may play in the maintenance of ARB in the farm environment. We first evaluated the fate of ingested antimicrobial-resistant Escherichia coli harboring a plasmid containing antimicrobial-resistance genes (ARGs) throughout the housefly (Musca domestica) life cycle, from adult to the subsequent F1 generation. Antimicrobial-resistant E. coli was isolated from different life cycle stages and ARG carriage quantified. The ingested E. coli persisted throughout the fly life cycle, and ARG carriage was maintained at a constant level in the housefly microbiota. To clarify the transmission of ARB from flies to livestock, 30-day-old chickens were inoculated with maggots containing antimicrobial-resistant E. coli. Based on the quantification of bacteria isolated from cecal samples, antimicrobial-resistant E. coli persisted in these chickens for at least 16 days. These results suggest that flies act as a reservoir of ARB throughout their life cycle and may therefore be involved in the maintenance and circulation of ARB in the farm environment.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Stols, L.; Donnelly, M.I.; Kulkarni, G.

The malic enzyme gene of Ascaris suum was cloned into the vector pTRC99a in two forms encoding alternative amino-termini. The resulting plasmids, pMEA1 and pMEA2, were introduced into Escherichia coli NZN111, a strain that is unable to grow fermentatively because of inactivation of the genes encoding pyruvate dissimilation. Induction of pMEA1, which encodes the native animoterminus, gave better overexpression of malic enzyme, approx 12-fold compared to uninduced cells. Under the appropriate culture conditions, expression of malic enzyme allowed the fermentative dissimilation of glucose by NZN111. The major fermentation product formed in induced cultures was succinic acid.

A genome-wide inducible phenotypic screen identifies antisense RNA constructs silencing Escherichia coli essential genes.

PubMed

Meng, Jia; Kanzaki, Gregory; Meas, Diane; Lam, Christopher K; Crummer, Heather; Tain, Justina; Xu, H Howard

2012-04-01

Regulated antisense RNA (asRNA) expression has been employed successfully in Gram-positive bacteria for genome-wide essential gene identification and drug target determination. However, there have been no published reports describing the application of asRNA gene silencing for comprehensive analyses of essential genes in Gram-negative bacteria. In this study, we report the first genome-wide identification of asRNA constructs for essential genes in Escherichia coli. We screened 250 000 library transformants for conditional growth inhibitory recombinant clones from two shotgun genomic libraries of E. coli using a paired-termini expression vector (pHN678). After sequencing plasmid inserts of 675 confirmed inducer sensitive cell clones, we identified 152 separate asRNA constructs of which 134 inserts came from essential genes, while 18 originated from nonessential genes (but share operons with essential genes). Among the 79 individual essential genes silenced by these asRNA constructs, 61 genes (77%) engage in processes related to protein synthesis. The cell-based assays of an asRNA clone targeting fusA (encoding elongation factor G) showed that the induced cells were sensitized 12-fold to fusidic acid, a known specific inhibitor. Our results demonstrate the utility of the paired-termini expression vector and feasibility of large-scale gene silencing in E. coli using regulated asRNA expression. © 2012 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

A 5′ Noncoding Exon Containing Engineered Intron Enhances Transgene Expression from Recombinant AAV Vectors in vivo

PubMed Central

Lu, Jiamiao; Williams, James A.; Luke, Jeremy; Zhang, Feijie; Chu, Kirk; Kay, Mark A.

2017-01-01

We previously developed a mini-intronic plasmid (MIP) expression system in which the essential bacterial elements for plasmid replication and selection are placed within an engineered intron contained within a universal 5′ UTR noncoding exon. Like minicircle DNA plasmids (devoid of bacterial backbone sequences), MIP plasmids overcome transcriptional silencing of the transgene. However, in addition MIP plasmids increase transgene expression by 2 and often >10 times higher than minicircle vectors in vivo and in vitro. Based on these findings, we examined the effects of the MIP intronic sequences in a recombinant adeno-associated virus (AAV) vector system. Recombinant AAV vectors containing an intron with a bacterial replication origin and bacterial selectable marker increased transgene expression by 40 to 100 times in vivo when compared with conventional AAV vectors. Therefore, inclusion of this noncoding exon/intron sequence upstream of the coding region can substantially enhance AAV-mediated gene expression in vivo. PMID:27903072

High Heterogeneity of Escherichia coli Sequence Types Harbouring ESBL/AmpC Genes on IncI1 Plasmids in the Colombian Poultry Chain

PubMed Central

Donado-Godoy, Pilar; León, Maribel; Clavijo, Viviana; Arevalo, Alejandra; Bernal, Johan F.; Timmerman, Arjen J.; Mevius, Dik J.; Wagenaar, Jaap A.; Hordijk, Joost

2017-01-01

Background Escherichia coli producing ESBL/AmpC enzymes are unwanted in animal production chains as they may pose a risk to human and animal health. Molecular characterization of plasmids and strains carrying genes that encode these enzymes is essential to understand their local and global spread. Objectives To investigate the diversity of genes, plasmids and strains in ESBL/AmpC-producing E. coli from the Colombian poultry chain isolated within the Colombian Integrated Program for Antimicrobial Resistance Surveillance (Coipars). Methods A total of 541 non-clinical E. coli strains from epidemiologically independent samples and randomly isolated between 2008 and 2013 within the Coipars program were tested for antimicrobial susceptibility. Poultry isolates resistant to cefotaxime (MIC ≥ 4 mg/L) were screened for ESBL/AmpC genes including blaCTX-M, blaSHV, blaTEM, blaCMY and blaOXA. Plasmid and strain characterization was performed for a selection of the ESBL/AmpC-producing isolates. Plasmids were purified and transformed into E. coli DH10B cells or transferred by conjugation to E. coli W3110. When applicable, PCR Based Replicon Typing (PBRT), plasmid Multi Locus Sequence Typing (pMLST), plasmid Double Locus Sequence Typing (pDLST) and/or plasmid Replicon Sequence Typing (pRST) was performed on resulting transformants and conjugants. Multi Locus Sequence Typing (MLST) was used for strain characterization. Results In total, 132 of 541 isolates were resistant to cefotaxime and 122 were found to carry ESBL/AmpC genes. Ninety-two harboured blaCMY-2 (75%), fourteen blaSHV-12 (11%), three blaSHV-5 (2%), five blaCTX-M-2 (4%), one blaCTX-M-15 (1%), one blaCTX-M-8 (1%), four a combination of blaCMY-2 and blaSHV-12 (4%) and two a combination of blaCMY-2 and blaSHV-5 (2%). A selection of 39 ESBL/AmpC-producing isolates was characterized at the plasmid and strain level. ESBL/AmpC genes from 36 isolates were transferable by transformation or conjugation of which 22 were located on IncI1 plasmids. These IncI1 plasmids harboured predominantly blaCMY-2 (16/22), and to a lesser extend blaSHV-12 (5/22) and blaCTX-M-8 (1/22). Other plasmid families associated with ESBL/AmpC-genes were IncK (4/33), IncHI2 (3/33), IncA/C (2/33), IncΒ/O (1/33) and a non-typeable replicon (1/33). Subtyping of IncI1 and IncHI2 demonstrated IncI1/ST12 was predominantly associated with blaCMY-2 (12/16) and IncHI2/ST7 with blaCTX-M-2 (2/3). Finally, 31 different STs were detected among the 39 selected isolates. Conclusions Resistance to extended spectrum cephalosporins in E. coli from Colombian poultry is mainly caused by blaCMY-2 and blaSHV-12. The high diversity of strain Sequence Types and the dissemination of homogeneous IncI1/ST12 plasmids suggest that spread of the resistance is mainly mediated by horizontal gene transfer. PMID:28125687

High Heterogeneity of Escherichia coli Sequence Types Harbouring ESBL/AmpC Genes on IncI1 Plasmids in the Colombian Poultry Chain.

PubMed

Castellanos, Luis Ricardo; Donado-Godoy, Pilar; León, Maribel; Clavijo, Viviana; Arevalo, Alejandra; Bernal, Johan F; Timmerman, Arjen J; Mevius, Dik J; Wagenaar, Jaap A; Hordijk, Joost

2017-01-01

Escherichia coli producing ESBL/AmpC enzymes are unwanted in animal production chains as they may pose a risk to human and animal health. Molecular characterization of plasmids and strains carrying genes that encode these enzymes is essential to understand their local and global spread. To investigate the diversity of genes, plasmids and strains in ESBL/AmpC-producing E. coli from the Colombian poultry chain isolated within the Colombian Integrated Program for Antimicrobial Resistance Surveillance (Coipars). A total of 541 non-clinical E. coli strains from epidemiologically independent samples and randomly isolated between 2008 and 2013 within the Coipars program were tested for antimicrobial susceptibility. Poultry isolates resistant to cefotaxime (MIC ≥ 4 mg/L) were screened for ESBL/AmpC genes including blaCTX-M, blaSHV, blaTEM, blaCMY and blaOXA. Plasmid and strain characterization was performed for a selection of the ESBL/AmpC-producing isolates. Plasmids were purified and transformed into E. coli DH10B cells or transferred by conjugation to E. coli W3110. When applicable, PCR Based Replicon Typing (PBRT), plasmid Multi Locus Sequence Typing (pMLST), plasmid Double Locus Sequence Typing (pDLST) and/or plasmid Replicon Sequence Typing (pRST) was performed on resulting transformants and conjugants. Multi Locus Sequence Typing (MLST) was used for strain characterization. In total, 132 of 541 isolates were resistant to cefotaxime and 122 were found to carry ESBL/AmpC genes. Ninety-two harboured blaCMY-2 (75%), fourteen blaSHV-12 (11%), three blaSHV-5 (2%), five blaCTX-M-2 (4%), one blaCTX-M-15 (1%), one blaCTX-M-8 (1%), four a combination of blaCMY-2 and blaSHV-12 (4%) and two a combination of blaCMY-2 and blaSHV-5 (2%). A selection of 39 ESBL/AmpC-producing isolates was characterized at the plasmid and strain level. ESBL/AmpC genes from 36 isolates were transferable by transformation or conjugation of which 22 were located on IncI1 plasmids. These IncI1 plasmids harboured predominantly blaCMY-2 (16/22), and to a lesser extend blaSHV-12 (5/22) and blaCTX-M-8 (1/22). Other plasmid families associated with ESBL/AmpC-genes were IncK (4/33), IncHI2 (3/33), IncA/C (2/33), IncΒ/O (1/33) and a non-typeable replicon (1/33). Subtyping of IncI1 and IncHI2 demonstrated IncI1/ST12 was predominantly associated with blaCMY-2 (12/16) and IncHI2/ST7 with blaCTX-M-2 (2/3). Finally, 31 different STs were detected among the 39 selected isolates. Resistance to extended spectrum cephalosporins in E. coli from Colombian poultry is mainly caused by blaCMY-2 and blaSHV-12. The high diversity of strain Sequence Types and the dissemination of homogeneous IncI1/ST12 plasmids suggest that spread of the resistance is mainly mediated by horizontal gene transfer.

High-Level Fluorescence Labeling of Gram-Positive Pathogens

PubMed Central

Aymanns, Simone; Mauerer, Stefanie; van Zandbergen, Ger; Wolz, Christiane; Spellerberg, Barbara

2011-01-01

Fluorescence labeling of bacterial pathogens has a broad range of interesting applications including the observation of living bacteria within host cells. We constructed a novel vector based on the E. coli streptococcal shuttle plasmid pAT28 that can propagate in numerous bacterial species from different genera. The plasmid harbors a promoterless copy of the green fluorescent variant gene egfp under the control of the CAMP-factor gene (cfb) promoter of Streptococcus agalactiae and was designated pBSU101. Upon transfer of the plasmid into streptococci, the bacteria show a distinct and easily detectable fluorescence using a standard fluorescence microscope and quantification by FACS-analysis demonstrated values that were 10–50 times increased over the respective controls. To assess the suitability of the construct for high efficiency fluorescence labeling in different gram-positive pathogens, numerous species were transformed. We successfully labeled Streptococcus pyogenes, Streptococcus agalactiae, Streptococcus dysgalactiae subsp. equisimilis, Enterococcus faecalis, Enterococcus faecium, Streptococcus mutans, Streptococcus anginosus and Staphylococcus aureus strains utilizing the EGFP reporter plasmid pBSU101. In all of these species the presence of the cfb promoter construct resulted in high-level EGFP expression that could be further increased by growing the streptococcal and enterococcal cultures under high oxygen conditions through continuous aeration. PMID:21731607

Genome Dynamics of Escherichia coli during Antibiotic Treatment: Transfer, Loss, and Persistence of Genetic Elements In situ of the Infant Gut.

PubMed

Porse, Andreas; Gumpert, Heidi; Kubicek-Sutherland, Jessica Z; Karami, Nahid; Adlerberth, Ingegerd; Wold, Agnes E; Andersson, Dan I; Sommer, Morten O A

2017-01-01

Elucidating the adaptive strategies and plasticity of bacterial genomes in situ is crucial for understanding the epidemiology and evolution of pathogens threatening human health. While much is known about the evolution of Escherichia coli in controlled laboratory environments, less effort has been made to elucidate the genome dynamics of E. coli in its native settings. Here, we follow the genome dynamics of co-existing E. coli lineages in situ of the infant gut during the first year of life. One E. coli lineage causes a urinary tract infection (UTI) and experiences several alterations of its genomic content during subsequent antibiotic treatment. Interestingly, all isolates of this uropathogenic E. coli strain carried a highly stable plasmid implicated in virulence of diverse pathogenic strains from all over the world. While virulence elements are certainly beneficial during infection scenarios, their role in gut colonization and pathogen persistence is poorly understood. We performed in vivo competitive fitness experiments to assess the role of this highly disseminated virulence plasmid in gut colonization, but found no evidence for a direct benefit of plasmid carriage. Through plasmid stability assays, we demonstrate that this plasmid is maintained in a parasitic manner, by strong first-line inheritance mechanisms, acting on the single-cell level, rather than providing a direct survival advantage in the gut. Investigating the ecology of endemic accessory genetic elements, in their pathogenic hosts and native environment, is of vital importance if we want to understand the evolution and persistence of highly virulent and drug resistant bacterial isolates.

Contamination of sequence databases with adaptor sequences

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yoshikawa, Takeo; Sanders, A.R.; Detera-Wadleigh, S.D.

Because of the exponential increase in the amount of DNA sequences being added to the public databases on a daily basis, it has become imperative to identify sources of contamination rapidly. Previously, contaminations of sequence databases have been reported to alert the scientific community to the problem. These contaminations can be divided into two categories. The first category comprises host sequences that have been difficult for submitters to manage or control. Examples include anomalous sequences derived from Escherichia coli, which are inserted into the chromosomes (and plasmids) of the bacterial hosts. Insertion sequences are highly mobile and are capable ofmore » transposing themselves into plasmids during cloning manipulation. Another example of the first category is the infection with yeast genomic DNA or with bacterial DNA of some commercially available cDNA libraries from Clontech. The second category of database contamination is due to the inadvertent inclusion of nonhost sequences. This category includes incorporation of cloning-vector sequences and multicloning sites in the database submission. M13-derived artifacts have been common, since M13-based vectors have been widely used for subcloning DNA fragments. Recognizing this problem, the National Center for Biotechnology Information (NCBI) started to screen, in April 1994, all sequences directly submitted to GenBank, against a set of vector data retrieved from GenBank by use of key-word searches, such as {open_quotes}vector.{close_quotes} In this report, we present evidence for another sequence artifact that is widespread but that, to our knowledge, has not yet been reported. 11 refs., 1 tab.« less

Emergence of Colistin Resistance Gene mcr-1 in Cronobacter sakazakii Producing NDM-9 and in Escherichia coli from the Same Animal.

PubMed

Liu, Bao-Tao; Song, Feng-Jing; Zou, Ming; Hao, Zhi-Hui; Shan, Hu

2017-02-01

We report the presence of mcr-1 in Escherichia coli and carbapenem-resistant Cronobacter sakazakii from the same diseased chicken. The mcr-1 gene linked with ISApl1 was located on two different IncI2 plasmids, including one multidrug plasmid in E. coli, whereas fosA3-bla NDM-9 was on an IncB/O plasmid in C. sakazakii The development of the fosA3-bla NDM-9 resistance region was mediated by IS26 The colocation of mcr-1 or bla NDM-9 with other resistance genes will accelerate the dissemination of the two genes. Copyright © 2017 American Society for Microbiology.

Construction of plasmid-free Escherichia coli for the production of arabitol-free xylitol from corncob hemicellulosic hydrolysate.

PubMed

Su, Buli; Zhang, Zhe; Wu, Mianbin; Lin, Jianping; Yang, Lirong

2016-05-26

High costs and low production efficiency are a serious constraint to bio-based xylitol production. For industrial-scale production of xylitol, a plasmid-free Escherichia coli for arabitol-free xylitol production from corncob hemicellulosic hydrolysate has been constructed. Instead of being plasmid and inducer dependent, this strain relied on multiple-copy integration of xylose reductase (XR) genes into the chromosome, where their expression was controlled by the constitutive promoter P43. In addition, to minimize the flux from L-arabinose to arabitol, two strategies including low XR total activity and high selectivity of XR has been adopted. Arabitol was significantly decreased using plasmid-free strain which had lower XR total activity and an eight point-mutations of XR with a 27-fold lower enzyme activity toward L-arabinose was achieved. The plasmid-free strain in conjunction with this mutant XR can completely eliminate arabitol formation in xylitol production. In fed-batch fermentation, this plasmid-free strain produced 143.8 g L(-1) xylitol at 1.84 g L(-1) h(-1) from corncob hemicellulosic hydrolysate. From these results, we conclude that this route by plasmid-free E. coli has potential to become a commercially viable process for xylitol production.

Construction of plasmid-free Escherichia coli for the production of arabitol-free xylitol from corncob hemicellulosic hydrolysate

PubMed Central

Su, Buli; Zhang, Zhe; Wu, Mianbin; Lin, Jianping; Yang, Lirong

2016-01-01

High costs and low production efficiency are a serious constraint to bio-based xylitol production. For industrial-scale production of xylitol, a plasmid-free Escherichia coli for arabitol-free xylitol production from corncob hemicellulosic hydrolysate has been constructed. Instead of being plasmid and inducer dependent, this strain relied on multiple-copy integration of xylose reductase (XR) genes into the chromosome, where their expression was controlled by the constitutive promoter P43. In addition, to minimize the flux from L-arabinose to arabitol, two strategies including low XR total activity and high selectivity of XR has been adopted. Arabitol was significantly decreased using plasmid-free strain which had lower XR total activity and an eight point-mutations of XR with a 27-fold lower enzyme activity toward L-arabinose was achieved. The plasmid-free strain in conjunction with this mutant XR can completely eliminate arabitol formation in xylitol production. In fed-batch fermentation, this plasmid-free strain produced 143.8 g L−1 xylitol at 1.84 g L−1 h−1 from corncob hemicellulosic hydrolysate. From these results, we conclude that this route by plasmid-free E. coli has potential to become a commercially viable process for xylitol production. PMID:27225023

3G vector-primer plasmid for constructing full-length-enriched cDNA libraries.

PubMed

Zheng, Dong; Zhou, Yanna; Zhang, Zidong; Li, Zaiyu; Liu, Xuedong

2008-09-01

We designed a 3G vector-primer plasmid for the generation of full-length-enriched complementary DNA (cDNA) libraries. By employing the terminal transferase activity of reverse transcriptase and the modified strand replacement method, this plasmid (assembled with a polydT end and a deoxyguanosine [dG] end) combines priming full-length cDNA strand synthesis and directional cDNA cloning. As a result, the number of steps involved in cDNA library preparation is decreased while simplifying downstream gene manipulation, sequencing, and subcloning. The 3G vector-primer plasmid method yields fully represented plasmid primed libraries that are equivalent to those made by the SMART (switching mechanism at 5' end of RNA transcript) approach.

Characterization of the 101-Kilobase-Pair Megaplasmid pKB1, Isolated from the Rubber-Degrading Bacterium Gordonia westfalica Kb1

PubMed Central

Bröker, Daniel; Arenskötter, Matthias; Legatzki, Antje; Nies, Dietrich H.; Steinbüchel, Alexander

2004-01-01

The complete sequence of the circular 101,016-bp megaplasmid pKB1 from the cis-1,4-polyisoprene-degrading bacterium Gordonia westfalica Kb1, which represents the first described extrachromosomal DNA of a member of this genus, was determined. Plasmid pKB1 harbors 105 open reading frames. The predicted products of 46 of these are significantly related to proteins of known function. Plasmid pKB1 is organized into three functional regions that are flanked by insertion sequence (IS) elements: (i) a replication and putative partitioning region, (ii) a putative metabolic region, and (iii) a large putative conjugative transfer region, which is interrupted by an additional IS element. Southern hybridization experiments revealed the presence of another copy of this conjugational transfer region on the bacterial chromosome. The origin of replication (oriV) of pKB1 was identified and used for construction of Escherichia coli-Gordonia shuttle vectors, which was also suitable for several other Gordonia species and related genera. The metabolic region included the heavy-metal resistance gene cadA, encoding a P-type ATPase. Expression of cadA in E. coli mediated resistance to cadmium, but not to zinc, and decreased the cellular content of cadmium in this host. When G. westfalica strain Kb1 was cured of plasmid pKB1, the resulting derivative strains exhibited slightly decreased cadmium resistance. Furthermore, they had lost the ability to use isoprene rubber as a sole source of carbon and energy, suggesting that genes essential for rubber degradation are encoded by pKB1. PMID:14679241

Limited Dissemination of Extended-Spectrum β-Lactamase- and Plasmid-Encoded AmpC-Producing Escherichia coli from Food and Farm Animals, Sweden.

PubMed

Börjesson, Stefan; Ny, Sofia; Egervärn, Maria; Bergström, Jakob; Rosengren, Åsa; Englund, Stina; Löfmark, Sonja; Byfors, Sara

2016-04-01

Extended-spectrum β-lactamase (ESBL)- and plasmid-encoded ampC (pAmpC)-producing Enterobacteriaceae might spread from farm animals to humans through food. However, most studies have been limited in number of isolates tested and areas studied. We examined genetic relatedness of 716 isolates from 4,854 samples collected from humans, farm animals, and foods in Sweden to determine whether foods and farm animals might act as reservoirs and dissemination routes for ESBL/pAmpC-producing Escherichia coli. Results showed that clonal spread to humans appears unlikely. However, we found limited dissemination of genes encoding ESBL/pAmpC and plasmids carrying these genes from foods and farm animals to healthy humans and patients. Poultry and chicken meat might be a reservoir and dissemination route to humans. Although we found no evidence of clonal spread of ESBL/pAmpC-producing E. coli from farm animals or foods to humans, ESBL/pAmpC-producing E. coli with identical genes and plasmids were present in farm animals, foods, and humans.

Lambda Red Mediated Gap Repair Utilizes a Novel Replicative Intermediate in Escherichia coli

PubMed Central

Reddy, Thimma R.; Fevat, Léna M. S.; Munson, Sarah E.; Stewart, A. Francis; Cowley, Shaun M.

2015-01-01

The lambda phage Red recombination system can mediate efficient homologous recombination in Escherichia coli, which is the basis of the DNA engineering technique termed recombineering. Red mediated insertion of DNA requires DNA replication, involves a single-stranded DNA intermediate and is more efficient on the lagging strand of the replication fork. Lagging strand recombination has also been postulated to explain the Red mediated repair of gapped plasmids by an Okazaki fragment gap filling model. Here, we demonstrate that gap repair involves a different strand independent mechanism. Gap repair assays examining the strand asymmetry of recombination did not show a lagging strand bias. Directly testing an ssDNA plasmid showed lagging strand recombination is possible but dsDNA plasmids did not employ this mechanism. Insertional recombination combined with gap repair also did not demonstrate preferential lagging strand bias, supporting a different gap repair mechanism. The predominant recombination route involved concerted insertion and subcloning though other routes also operated at lower frequencies. Simultaneous insertion of DNA resulted in modification of both strands and was unaffected by mutations to DNA polymerase I, responsible for Okazaki fragment maturation. The lower efficiency of an alternate Red mediated ends-in recombination pathway and the apparent lack of a Holliday junction intermediate suggested that gap repair does not involve a different Red recombination pathway. Our results may be explained by a novel replicative intermediate in gap repair that does not involve a replication fork. We exploited these observations by developing a new recombineering application based on concerted insertion and gap repair, termed SPI (subcloning plus insertion). SPI selected against empty vector background and selected for correct gap repair recombinants. We used SPI to simultaneously insert up to four different gene cassettes in a single recombineering reaction. Consequently, our findings have important implications for the understanding of E. coli replication and Red recombination. PMID:25803509

Construction, expression and in vitro biological behaviors of Ig scFv fragment in patients with chronic B cell leukemia.

PubMed

Zhu, Lijuan; Liao, Wenjun; Zhu, Huifen; Lei, Ping; Wang, Zhihua; Shao, Jingfang; Zhang, Yue; Shen, Guanxin

2006-01-01

The expression vector of SmIg scFv fragment was constructed in patient with B cell chronic lymphocyte leukemia (B-CLL) and expressed in E. coli to obtain scFv fragment, and the effect of the protein on the proliferation of stimulated peripheral blood mononuclear cells (PBMC) was investigated in vitro. Two pairs of primers were designed, and variable region genes of light chain and heavy chain were amplified by PCR respectively from the pGEM-T vectors previously constructed in our laboratory which containing light chain gene or Fd fragment of heavy chain gene. The PCR product was digested, purified and inserted into pHEN2 vector to construct the soluble expression vector pHEN2-scFv. After the induction by IPTG, the scFv protein was identified by SDS-PAGE electrophoresis and purified by Ni-NTA-Chromatography. MTT was used to determine the effect of purified protein on the proliferation of stimulated PBMC in vitro. Plasmid PCR and restriction enzyme digestion of pHEN2-scFv revealed the pHEN2-scFv vector was constructed successfully. Id-scFv protein was expressed in positive clone after induced by IPTG. SDS-PAGE analysis showed that the relative molecular weight of fusion protein was about 30 kD (1 kD= 0.9921 ku), which was consistent with the theoretically predicted value. Proliferation of PBMC could be induced by purified Id-scFv. It was suggested that the expression vector of SmIg scFv fragment was constructed successfully, and scFv protein was expressed and secreted from E. coli, which could induce proliferation of PBMC. This may lay an experimental foundation for further research of Id-HSP complex vaccine for B-CLL.

Sequential cloning of chromosomes

DOEpatents

Lacks, Sanford A.

1995-07-18

A method for sequential cloning of chromosomal DNA of a target organism is disclosed. A first DNA segment homologous to the chromosomal DNA to be sequentially cloned is isolated. The first segment has a first restriction enzyme site on either side. A first vector product is formed by ligating the homologous segment into a suitably designed vector. The first vector product is circularly integrated into the target organism's chromosomal DNA. The resulting integrated chromosomal DNA segment includes the homologous DNA segment at either end of the integrated vector segment. The integrated chromosomal DNA is cleaved with a second restriction enzyme and ligated to form a vector-containing plasmid, which is replicated in a host organism. The replicated plasmid is then cleaved with the first restriction enzyme. Next, a DNA segment containing the vector and a segment of DNA homologous to a distal portion of the previously isolated DNA segment is isolated. This segment is then ligated to form a plasmid which is replicated within a suitable host. This plasmid is then circularly integrated into the target chromosomal DNA. The chromosomal DNA containing the circularly integrated vector is treated with a third, retrorestriction (class IIS) enzyme. The cleaved DNA is ligated to give a plasmid that is used to transform a host permissive for replication of its vector. The sequential cloning process continues by repeated cycles of circular integration and excision. The excision is carried out alternately with the second and third enzymes.

Draft Genome Sequences of Three European Laboratory Derivatives from Enterohemorrhagic Escherichia coli O157:H7 Strain EDL933, Including Two Plasmids

PubMed Central

Fellner, Lea; Huptas, Christopher; Simon, Svenja; Mühlig, Anna; Neuhaus, Klaus

2016-01-01

Escherichia coli O157:H7 EDL933, isolated in 1982 in the United States, was the first enterohemorrhagic E. coli (EHEC) strain sequenced. Unfortunately, European labs can no longer receive the original strain. We checked three European EDL933 derivatives and found major genetic deviations (deletions, inversions) in two strains. All EDL933 strains contain the cryptic EHEC-plasmid, not reported before. PMID:27056239

Molecular characterization of resistance to extended-spectrum cephalosporins in clinical Escherichia coli isolates from companion animals in the United States.

PubMed

Shaheen, Bashar W; Nayak, Rajesh; Foley, Steven L; Kweon, Ohgew; Deck, Joanna; Park, Miseon; Rafii, Fatemeh; Boothe, Dawn M

2011-12-01

Resistance to extended-spectrum cephalosporins (ESC) among members of the family Enterobacteriaceae occurs worldwide; however, little is known about ESC resistance in Escherichia coli strains from companion animals. Clinical isolates of E. coli were collected from veterinary diagnostic laboratories throughout the United States from 2008 to 2009. E. coli isolates (n = 54) with reduced susceptibility to ceftazidime or cefotaxime (MIC ≥ 16 μg/ml) and extended-spectrum-β-lactamase (ESBL) phenotypes were analyzed. PCR and sequencing were used to detect mutations in ESBL-encoding genes and the regulatory region of the chromosomal gene ampC. Conjugation experiments and plasmid identification were conducted to examine the transferability of resistance to ESCs. All isolates carried the bla(CTX-M-1)-group β-lactamase genes in addition to one or more of the following β-lactamase genes: bla(TEM), bla(SHV-3), bla(CMY-2), bla(CTX-M-14-like), and bla(OXA-1.) Different bla(TEM) sequence variants were detected in some isolates (n = 40). Three isolates harbored a bla(TEM-181) gene with a novel mutation resulting in an Ala184Val substitution. Approximately 78% of the isolates had mutations in promoter/attenuator regions of the chromosomal gene ampC, one of which was a novel insertion of adenine between bases -28 and -29. Plasmids ranging in size from 11 to 233 kbp were detected in the isolates, with a common plasmid size of 93 kbp identified in 60% of isolates. Plasmid-mediated transfer of β-lactamase genes increased the MICs (≥ 16-fold) of ESCs for transconjugants. Replicon typing among isolates revealed the predominance of IncI and IncFIA plasmids, followed by IncFIB plasmids. This study shows the emergence of conjugative plasmid-borne ESBLs among E. coli strains from companion animals in the United States, which may compromise the effective therapeutic use of ESCs in veterinary medicine.

[Cloning and gene expression in lactic acid bacteria].

PubMed

Bondarenko, V M; Beliavskaia, V A

2000-01-01

The possibility of using the genera Lactobacillus and Lactococcus as vector representatives is widely discussed at present. The prospects of the construction of recombinant bacteria are closely connected with the solution of a number of problems: the level of the transcription of cloned genes, the effectiveness of the translation of heterologous mRNA, the stability of protein with respect to bacterial intracellular proteases, the method by protein molecules leave the cell (by secretion or as the result of lysis). To prevent segregation instability, the construction of vector molecules on the basis of stable cryptic plasmids found in wild strains of lactic acid bacteria was proposed. High copying plasmids with low molecular weight were detected in L. plantarum and L. pentosus strains. Several plasmids with molecular weights of 1.7, 1.8 and 2.3 kb were isolated from bacterial cells to be used as the basis for the construction of vector molecules. Genes of chloramphenicol- and erythromycin-resistance from Staphylococcus aureus plasmids were used as marker genes ensuring cell transformation. The vector plasmids thus constructed exhibited high transformation activity in the electroporation of different strains, including L. casei, L. plantarum, L. acidophilus, L. fermentum and L. brevis which could be classified with the replicons of a wide circle of hosts. But the use of these plasmids was limited due to the risk of the uncontrolled dissemination of recombinant plasmids. L. acidophilus were also found to have strictly specific plasmids with good prospects of being used as the basis for the creation of vectors, incapable of dissemination. In addition to the search of strain-specific plasmids, incapable of uncontrolled gene transmission, the use of chromosome-integrated heterologous genes is recommended in cloning to ensure the maximum safety.

Designer diatom episomes delivered by bacterial conjugation

DOE PAGES

Karas, Bogumil J.; Diner, Rachel E.; Lefebvre, Stephane C.; ...

2015-04-21

Eukaryotic microalgae hold great promise for the bioproduction of fuels and higher value chemicals. However, compared with model genetic organisms such as Escherichia coli and Saccharomyces cerevisiae, characterization of the complex biology and biochemistry of algae and strain improvement has been hampered by the inefficient genetic tools. To date, many algal species are transformable only via particle bombardment, and the introduced DNA is integrated randomly into the nuclear genome. Here we describe the first nuclear episomal vector for diatoms and a plasmid delivery method via conjugation from Escherichia coli to the diatoms Phaeodactylum tricornutum and Thalassiosira pseudonana. We identify amore » yeast-derived sequence that enables stable episome replication in these diatoms even in the absence of antibiotic selection and show that episomes are maintained as closed circles at copy number equivalent to native chromosomes. This highly efficient genetic system facilitates high-throughput functional characterization of algal genes and accelerates molecular phytoplankton research.« less

Designer diatom episomes delivered by bacterial conjugation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Karas, Bogumil J.; Diner, Rachel E.; Lefebvre, Stephane C.

Eukaryotic microalgae hold great promise for the bioproduction of fuels and higher value chemicals. However, compared with model genetic organisms such as Escherichia coli and Saccharomyces cerevisiae, characterization of the complex biology and biochemistry of algae and strain improvement has been hampered by the inefficient genetic tools. To date, many algal species are transformable only via particle bombardment, and the introduced DNA is integrated randomly into the nuclear genome. Here we describe the first nuclear episomal vector for diatoms and a plasmid delivery method via conjugation from Escherichia coli to the diatoms Phaeodactylum tricornutum and Thalassiosira pseudonana. We identify amore » yeast-derived sequence that enables stable episome replication in these diatoms even in the absence of antibiotic selection and show that episomes are maintained as closed circles at copy number equivalent to native chromosomes. This highly efficient genetic system facilitates high-throughput functional characterization of algal genes and accelerates molecular phytoplankton research.« less

EcoFlex: A Multifunctional MoClo Kit for E. coli Synthetic Biology.

PubMed

Lai, Hung-En; Moore, Simon; Polizzi, Karen; Freemont, Paul

2018-01-01

Development of advanced synthetic biology tools is always in demand since they act as a platform technology to enable rapid prototyping of biological constructs in a high-throughput manner. EcoFlex is a modular cloning (MoClo) kit for Escherichia coli and is based on the Golden Gate principles, whereby Type IIS restriction enzymes (BsaI, BsmBI, BpiI) are used to construct modular genetic elements (biological parts) in a bottom-up approach. Here, we describe a collection of plasmids that stores various biological parts including promoters, RBSs, terminators, ORFs, and destination vectors, each encoding compatible overhangs allowing hierarchical assembly into single transcription units or a full-length polycistronic operon or biosynthetic pathway. A secondary module cloning site is also available for pathway optimization, in order to limit library size if necessary. Here, we show the utility of EcoFlex using the violacein biosynthesis pathway as an example.

Improved electro-transformation of highly DNA-restrictive corynebacteria with DNA extracted from starved Escherichia coli.

PubMed

Ankri, S; Reyes, O; Leblon, G

1996-07-01

Differences of up to 33 000-fold in electro-transformability of highly DNA restrictive corynebacteria are observed in the DNA of a shuttle plasmid extracted from Escherichia coli hosts propagated in different nutritional conditions. Growth of the host in minimal medium increases plasmid transformability, whereas growth on rich media decreases it. In the E. coli DH5 alpha host, the starvation-dependent increase DNA transformability is reverted by supplementing with methionine, an obligate 5-adenosyl-methionine (SAM) precursor. This suggests that an E. coli nutritionally modulated SAM-dependent DNA-methyltransferase may be involved in this phenomenon.

Two-stage continuous operation of recombinant Escherichia coli using the bacteriophage lambda Q- vector.

PubMed

Oh, Jeong Seok; Cho, Daechul; Park, Tai Hyun

2005-11-01

A two-stage continuous culture of Escherichia coli in combination with a bacteriophage lambda system was performed in order to overcome the intrinsic plasmid instability that is frequently observed in recombinant fermentation. A phage lambda vector with a Q(-) mutation was used to enhance the expression of the lambda system. The optimal values of the important operational variables such as the substrate concentration, the dilution rate, and the mean residence time on the expression of the cloned gene were determined in both batch and continuous cultures. For all culturing modes, the full induction of the cloned gene was observed 4 h after the temperature shift. In the two stage continuous culture, the overproduction reached their maxima at D=0.25 h(-1) with 1.5 S(0) of the medium supply. The maximum productivity of the total beta-galactosidase was 16.3x10(6) U l(-1) h(-1), which was approximately seven times higher than that in the single-copy lysogenic stage. The recombinant cells were stable in the lysogenic state for more than 260 h, while they were stable for 40 h in the lytic state. The instability that developed rapidly in the second tank is believed to be due to the accumulation of lysis proteins as a result of vector leakage during the operation.

In vivo directed evolution for thermostabilization of Escherichia coli hygromycin B phosphotransferase and the use of the gene as a selection marker in the host-vector system of Thermus thermophilus.

PubMed

Nakamura, Akira; Takakura, Yasuaki; Kobayashi, Hideo; Hoshino, Takayuki

2005-08-01

An in vivo-directed evolutionary strategy was used to obtain a thermostabilized Escherichia coli hygromycin B phosphotransferase, using a host-vector system of Thermus thermophilus. Introduction of the mutant gene containing two amino acid substitutions, S52T and W238C, which was previously reported by Cannio et al. [J. Bacteriol., 180, 3237-3240 (1998)], did not confer hygromycin resistance on T. thermophilus cells at 55 degrees C; however, five spontaneously-generated independent mutants were obtained by selection of the transformants at this temperature. Each mutant gene contained one amino acid substitution of either A118V or T246A. Further selection with increasing temperature, at 58 degrees C and then 61 degrees C, led to acquisition of three more substitutions: D20G, S225P and Q226L. These mutations cumulatively influenced the maximum growth temperature of the T. thermophilus transformants in the presence of hygromycin; T. thermophilus carrying a mutant gene containing all the five substitutions was able to grow at up to 67 degrees C. This mutant gene, hph5, proved useful as a selection marker in the T. thermophilus host-vector system, either on the plasmid or by genome integration, at temperatures up to 65 degrees C.

Draft Genome Sequences of Three European Laboratory Derivatives from Enterohemorrhagic Escherichia coli O157:H7 Strain EDL933, Including Two Plasmids.

PubMed

Fellner, Lea; Huptas, Christopher; Simon, Svenja; Mühlig, Anna; Scherer, Siegfried; Neuhaus, Klaus

2016-04-07

Escherichia coliO157:H7 EDL933, isolated in 1982 in the United States, was the first enterohemorrhagicE. coli(EHEC) strain sequenced. Unfortunately, European labs can no longer receive the original strain. We checked three European EDL933 derivatives and found major genetic deviations (deletions, inversions) in two strains. All EDL933 strains contain the cryptic EHEC-plasmid, not reported before. Copyright © 2016 Fellner et al.

Role of IncP-1β Plasmids pWDL7::rfp and pNB8c in Chloroaniline Catabolism as Determined by Genomic and Functional Analyses

PubMed Central

Król, J. E.; Penrod, J. T.; McCaslin, H.; Rogers, L. M.; Yano, H.; Stancik, A. D.; Dejonghe, W.; Brown, C. J.; Parales, R. E.; Wuertz, S.

2012-01-01

Broad-host-range catabolic plasmids play an important role in bacterial degradation of man-made compounds. To gain insight into the role of these plasmids in chloroaniline degradation, we determined the first complete nucleotide sequences of an IncP-1 chloroaniline degradation plasmid, pWDL7::rfp and its close relative pNB8c, as well as the expression pattern, function, and bioaugmentation potential of the putative 3-chloroaniline (3-CA) oxidation genes. Based on phylogenetic analysis of backbone proteins, both plasmids are members of a distinct clade within the IncP-1β subgroup. The plasmids are almost identical, but whereas pWDL7::rfp carries a duplicate inverted catabolic transposon, Tn6063, containing a putative 3-CA oxidation gene cluster, dcaQTA1A2BR, pNB8c contains only a single copy of the transposon. No genes for an aromatic ring cleavage pathway were detected on either plasmid, suggesting that only the upper 3-CA degradation pathway was present. The dcaA1A2B gene products expressed from a high-copy-number vector were shown to convert 3-CA to 4-chlorocatechol in Escherichia coli. Slight differences in the dca promoter region between the plasmids and lack of induction of transcription of the pNB8c dca genes by 3-CA may explain previous findings that pNB8C does not confer 3-CA transformation. Bioaugmentation of activated sludge with pWDL7::rfp accelerated removal of 3-CA, but only in the presence of an additional carbon source. Successful bioaugmentation requires complementation of the upper pathway genes with chlorocatechol cleavage genes in indigenous bacteria. The genome sequences of these plasmids thus help explain the molecular basis of their catabolic activities. PMID:22101050

Plasmid vectors for Xylella fastidiosa utilizing a toxin-antitoxin system for plasmid stability in the absence of antibiotic selection

USDA-ARS?s Scientific Manuscript database

The phytopathogen Xylella fastidiosa causes disease in a variety of important crop and landscape plants. Functional genetic studies have led to a broader understanding of virulence mechanisms used by this pathogen in the grapevine host. Plasmid shuttle vectors are important tools in studies of bacte...

Plasmid ColE1 as a Molecular Vehicle for Cloning and Amplification of DNA

PubMed Central

Hershfield, Vickers; Boyer, Herbert W.; Yanofsky, Charles; Lovett, Michael A.; Helinski, Donald R.

1974-01-01

DNA fragments obtained from EcoRI endonuclease digestion of bacteriophage ϕ80pt190 (trp+) and the plasmid ColE1 were covalently joined with polynucleotide ligase. Transformation of Escherichia coli trp- strains to tryptophan independence with the recombined DNA selected for reconstituted ColE1 plasmids containing the tryptophan operon and the ϕ80 immunity region. Similarly, an EcoRI endonuclease generated fragment of plasmid pSC105 DNA containing the genetic determinant of kanamycin resistance was inserted into the ColE1 plasmid and recovered in E. coli. The plasmids containing the trp operon (ColE1-trp) and the kanamycin resistance gene were maintained under logarithmic growth conditions at a level of 25-30 copies per cell and accumulate to the extent of several hundred copies per cell in the presence of chloramphenicol. Cells carrying the ColE1-trp plasmid determined the production of highly elevated levels of trp operon-specific mRNA and tryptophan biosynthetic enzymes. Images PMID:4610576

Plasmid-controlled colonization factor associated with virulence in Esherichia coli enterotoxigenic for humans.

PubMed Central

Evans, D G; Silver, R P; Evans, D J; Chase, D G; Gorbach, S L

1975-01-01

An enterotoxin-producing strain of Escherichia coli isolated from a case of cholera-like diarrhea (E. coli strain H-10407) was found to possess a surface-associated colonization factor. Colonization was manifested as the ability of small inocula (10(5) bacteria) to attain large (10(9)) populations in the infant rabbit intestine with a concomitant diarrheal response. A laboratory-passed derivative of E. coli H-10407, designated H-10407-P, failed to exhibit an increase in population in the infant rabbit and also failed to induce diarrhea. Cell-free culture supernatant fluids of E. coli H-10407 and H-10407-P produced equivalent enterotoxic responses in infant and in adult rabbits. Specific anti-colonization factor antiserum was produced by adsorbing hyperimmune anti-H-10407 serum with both heat-killed and living cells E. coli H-10407-P. This specific adsorbed serum protected infant rabbits from challenge with living E. coli H-10407 although the serum did not possess bactericidal activity. The anti-colonization factor serum did not agglutinate a strain of E. coli K-12 possessing the K88 colonization factor peculiar to E. coli enterotoxigenic for swine. By electron microscopy it was demonstrated that E. coli H-10407, but not H10407-, possessed pilus-like surface structures which agglutinated with the specific adsorbed (anti-colonization factor) antiserum. E. coli H-10407 possessed three species of plasmid deoxyribonucleic acid, measuring 60 X 10(6), 42 X 10(6), and 3.7 X 10(6) daltons, respectively. E. coli H-10407-P possessed only the 42 X 10(6)- and the 3.7 X 10(6)-dalton plasmid species. Spontaneous loss of the specific H-10407 surface-associated antigen was accompanied by loss of the 60 X 10(6)-dalton species of plasmid deoxyribonucleic acid and loss of colonizing ability. Thus, it is concluded that the E. coli colonization factor described here is a virulence factor which may play an important and possibly essential role in naturally occurring E. coli enterotoxic diarrhea in man. Images PMID:1100526

Plasmid-controlled colonization factor associated with virulence in Esherichia coli enterotoxigenic for humans.

PubMed

Evans, D G; Silver, R P; Evans, D J; Chase, D G; Gorbach, S L

1975-09-01

An enterotoxin-producing strain of Escherichia coli isolated from a case of cholera-like diarrhea (E. coli strain H-10407) was found to possess a surface-associated colonization factor. Colonization was manifested as the ability of small inocula (10(5) bacteria) to attain large (10(9)) populations in the infant rabbit intestine with a concomitant diarrheal response. A laboratory-passed derivative of E. coli H-10407, designated H-10407-P, failed to exhibit an increase in population in the infant rabbit and also failed to induce diarrhea. Cell-free culture supernatant fluids of E. coli H-10407 and H-10407-P produced equivalent enterotoxic responses in infant and in adult rabbits. Specific anti-colonization factor antiserum was produced by adsorbing hyperimmune anti-H-10407 serum with both heat-killed and living cells E. coli H-10407-P. This specific adsorbed serum protected infant rabbits from challenge with living E. coli H-10407 although the serum did not possess bactericidal activity. The anti-colonization factor serum did not agglutinate a strain of E. coli K-12 possessing the K88 colonization factor peculiar to E. coli enterotoxigenic for swine. By electron microscopy it was demonstrated that E. coli H-10407, but not H10407-, possessed pilus-like surface structures which agglutinated with the specific adsorbed (anti-colonization factor) antiserum. E. coli H-10407 possessed three species of plasmid deoxyribonucleic acid, measuring 60 X 10(6), 42 X 10(6), and 3.7 X 10(6) daltons, respectively. E. coli H-10407-P possessed only the 42 X 10(6)- and the 3.7 X 10(6)-dalton plasmid species. Spontaneous loss of the specific H-10407 surface-associated antigen was accompanied by loss of the 60 X 10(6)-dalton species of plasmid deoxyribonucleic acid and loss of colonizing ability. Thus, it is concluded that the E. coli colonization factor described here is a virulence factor which may play an important and possibly essential role in naturally occurring E. coli enterotoxic diarrhea in man.

Cloning of the Escherichia coli endo-1,4-D-glucanase gene and identification of its product.

PubMed

Park, Y W; Yun, H D

1999-03-01

A plasmid (pYP17) containing a genomic DNA insert from Escherichia coli K-12 that confers the ability to hydrolyze carboxymethylcellulose (CMC) was isolated from a genomic library constructed in the cosmid vector pLAFR3 in E. coli DH5alpha. A small 1.65-kb fragment, designated bcsC (pYP300), was sequenced and found to contain an ORF of 1,104 bp encoding a protein of 368 amino acid residues, with a calculated molecular weight of 41,700 Da. BcsC carries a typical prokaryotic signal peptide of 21 amino acid residues. The predicted amino acid sequence of the BcsC protein is similar to that of CelY of Erwinia chrysanthemi, CMCase of Cellulomonas uda, EngX of Acetobacter xylinum, and CelC of Agrobacterium tumefaciens. Based on these sequence similarities, we propose that the bcsC gene is a member of glycosyl hydrolase family 8. The apparent molecular mass of the protein, when expressed in E. coli, is approximately 40 kDa, and the CMCase activity is found mainly in the extracellular space. The enzyme is optimally active at pH 7 and a temperature of 40 degrees C.

Characterization of a cfr-Carrying Plasmid from Porcine Escherichia coli That Closely Resembles Plasmid pEA3 from the Plant Pathogen Erwinia amylovora.

PubMed

Zhang, Rongmin; Sun, Bin; Wang, Yang; Lei, Lei; Schwarz, Stefan; Wu, Congming

2016-01-01

The multiresistance gene cfr was found in two porcine Escherichia coli isolates, one harboring it on the conjugative 33,885-bp plasmid pFSEC-01, the other harboring it in the chromosomal DNA. Sequence analysis of pFSEC-01 revealed that a 6,769-bp fragment containing the cfr gene bracketed by two IS26 elements was inserted into a plasmid closely related to pEA3 from the plant pathogen Erwinia amylovora, suggesting that pFSEC-01 may be transferred between different bacterial genera of both animal and plant origin. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

The 2-micron plasmid as a nonselectable, stable, high copy number yeast vector

NASA Technical Reports Server (NTRS)

Ludwig, D. L.; Bruschi, C. V.

1991-01-01

The endogenous 2-microns plasmid of Saccharomyces cerevisiae has been used extensively for the construction of yeast cloning and expression plasmids because it is a native yeast plasmid that is able to be maintained stably in cells at high copy number. Almost invariably, these plasmid constructs, containing some or all 2-microns sequences, exhibit copy number levels lower than 2-microns and are maintained stably only under selective conditions. We were interested in determining if there was a means by which 2-microns could be utilized for vector construction, without forfeiting either copy number or nonselective stability. We identified sites in the 2-microns plasmid that could be used for the insertion of genetic sequences without disrupting 2-microns coding elements and then assessed subsequent plasmid constructs for stability and copy number in vivo. We demonstrate the utility of a previously described 2-microns recombination chimera, pBH-2L, for the manipulation and transformation of 2-microns as a pure yeast plasmid vector. We show that the HpaI site near the STB element in the 2-microns plasmid can be utilized to clone yeast DNA of at least 3.9 kb with no loss of plasmid stability. Additionally, the copy number of these constructs is as high as levels reported for the endogenous 2-microns.

Co-expression of five genes in E coli for L-phenylalanine in Brevibacterium flavum

PubMed Central

Wu, Yong-Qing; Jiang, Pei-Hong; Fan, Chang-Sheng; Wang, Jian-Gang; Shang, Liang; Huang, Wei-Da

2003-01-01

AIM: To study the effect of co-expression of ppsA, pckA, aroG, pheA and tyrB genes on the production of L-phenylalanine, and to construct a genetic engineering strain for L-phenylalanine. METHODS: ppsA and pckA genes were amplified from genomic DNA of E. coli by polymerase chain reaction, and then introduced into shuttle vectors between E coli and Brevibacterium flavum to generate constructs pJN2 and pJN5. pJN2 was generated by inserting ppsA and pckA genes into vector pCZ; whereas pJN5 was obtained by introducing ppsA and pckA genes into pCZ-GAB, which was originally constructed for co-expression of aroG, pheA and tyrB genes. The recombinant plasmids were then introduced into B. flavum by electroporation and the transformants were used for L-phenylalanine fermentation. RESULTS: Compared with the original B. flavum cells, all the transformants were showed to have increased five enzyme activities specifically, and have enhanced L-phenylalanine biosynthesis ability variably. pJN5 transformant was observed to have the highest elevation of L-phenylalanine production by a 3.4-fold. Co-expression of ppsA and pckA increased activity of DAHP synthetase significantly. CONCLUSION: Co-expression of ppsA and pckA genes in B. flavum could remarkably increase the expression of DAHP synthetase; Co-expression of ppsA, pckA, aroG, pheA and tyrB of E. coli in B. flavum was a feasible approach to construct a strain for phenylalanine production. PMID:12532463

[Cloning and expression of Micrococcus luteus IAM 14879 Rpf and its role in the recovery of the VBNC state in Rhodococcus sp. DS471].

PubMed

Ding, Linxian; Zhang, Pinghua; Hong, Huachang; Lin, Hongjun; Yokota, Akira

2012-01-01

The purpose of the present study was to produce the Rpf (resuscitation promoting factor) protein by cloning and expressing the rpf gene, secreted by Micrococcus luteus IAM 14879, in Escherichia coli and to evaluate its role in the recovery of the VBNC (viable but non-culturable) state in high-GC Gram-positive bacteria. Genomic DNA was extracted from Micrococcus luteus IAM 14879 and the rpf gene was amplified by PCR using specific primers. The PCR products was purified, cloned into a pET15b expression vector, and transformed into Escherichia coli BL21 (DE3). Then the pET15b plasmid expression vector was used to confirm the purification of the recombinant proteins via SDS-PAGE. The VBNC state cells from the high-GC Gram-positive bacteria, Rhodococcus sp. DS471, were used to confirm the promotion and recovery of growth capacity. Rhodococcus sp. DS471 were isolated from soil and closely related to Micrococcus luteus IAM 14879. The gene sequences confirmed that the rpf gene from Micrococcus luteus IAM 14879 that was expressed in Escherichia coli, was 672 bp. SDS-PAGE analysis showed that the recombinant Rpf protein was obtained successfully, and further studies showed it capable of promoting the recovery of the VBNC state by about 100-fold relative to the control. Rpf of Micrococus luteus IAM 14879 can be successfully cloned and expressed in Escherichia coli and shows a strong ability to promote the recovery of the VBNC state of cells of Rhodococcus sp. DS471.

Role of the parCBA Operon of the Broad-Host-Range Plasmid RK2 in Stable Plasmid Maintenance

PubMed Central

Easter, Carla L.; Schwab, Helmut; Helinski, Donald R.

1998-01-01

The par region of the stably maintained broad-host-range plasmid RK2 is organized as two divergent operons, parCBA and parDE, and a cis-acting site. parDE encodes a postsegregational killing system, and parCBA encodes a resolvase (ParA), a nuclease (ParB), and a protein of unknown function (ParC). The present study was undertaken to further delineate the role of the parCBA region in the stable maintenance of RK2 by first introducing precise deletions in the three genes and then assessing the abilities of the different constructs to stabilize RK2 in three strains of Escherichia coli and two strains of Pseudomonas aeruginosa. The intact parCBA operon was effective in stabilizing a conjugation-defective RK2 derivative in E. coli MC1061K and RR1 but was relatively ineffective in E. coli MV10Δlac. In the two strains in which the parCBA operon was effective, deletions in parB, parC, or both parB and parC caused an approximately twofold reduction in the stabilizing ability of the operon, while a deletion in the parA gene resulted in a much greater loss of parCBA activity. For P. aeruginosa PAO1161Rifr, the parCBA operon provided little if any plasmid stability, but for P. aeruginosa PAC452Rifr, the RK2 plasmid was stabilized to a substantial extent by parCBA. With this latter strain, parA and res alone were sufficient for stabilization. The cer resolvase system of plasmid ColE1 and the loxP/Cre system of plasmid P1 were tested in comparison with the parCBA operon. We found that, not unlike what was previously observed with MC1061K, cer failed to stabilize the RK2 plasmid with par deletions in strain MV10Δlac, but this multimer resolution system was effective in stabilizing the plasmid in strain RR1. The loxP/Cre system, on the other hand, was very effective in stabilizing the plasmid in all three E. coli strains. These observations indicate that the parA gene, along with its res site, exhibits a significant level of plasmid stabilization in the absence of the parC and parB genes but that in at least one E. coli strain, all three genes are required for maximum stabilization. It cannot be determined from these results whether or not the stabilization effects seen with parCBA or the cer and loxP/Cre systems are strictly due to a reduction in the level of RK2 dimers and an increase in the number of plasmid monomer units or if these systems play a role in a more complex process of plasmid stabilization that requires as an essential step the resolution of plasmid dimers. PMID:9811663

Sequential cloning of chromosomes

DOEpatents

Lacks, S.A.

1995-07-18

A method for sequential cloning of chromosomal DNA of a target organism is disclosed. A first DNA segment homologous to the chromosomal DNA to be sequentially cloned is isolated. The first segment has a first restriction enzyme site on either side. A first vector product is formed by ligating the homologous segment into a suitably designed vector. The first vector product is circularly integrated into the target organism`s chromosomal DNA. The resulting integrated chromosomal DNA segment includes the homologous DNA segment at either end of the integrated vector segment. The integrated chromosomal DNA is cleaved with a second restriction enzyme and ligated to form a vector-containing plasmid, which is replicated in a host organism. The replicated plasmid is then cleaved with the first restriction enzyme. Next, a DNA segment containing the vector and a segment of DNA homologous to a distal portion of the previously isolated DNA segment is isolated. This segment is then ligated to form a plasmid which is replicated within a suitable host. This plasmid is then circularly integrated into the target chromosomal DNA. The chromosomal DNA containing the circularly integrated vector is treated with a third, retrorestriction (class IIS) enzyme. The cleaved DNA is ligated to give a plasmid that is used to transform a host permissive for replication of its vector. The sequential cloning process continues by repeated cycles of circular integration and excision. The excision is carried out alternately with the second and third enzymes. 9 figs.

Plasmidic Expression of nemA and yafC* Increased Resistance of Ethanologenic Escherichia coli LY180 to Nonvolatile Side Products from Dilute Acid Treatment of Sugarcane Bagasse and Artificial Hydrolysate

PubMed Central

Shi, Aiqin; Zheng, Huabao; Yomano, Lorraine P.; York, Sean W.; Shanmugam, Keelnatham T.

2016-01-01

Hydrolysate-resistant Escherichia coli SL100 was previously isolated from ethanologenic LY180 after sequential transfers in AM1 medium containing a dilute acid hydrolysate of sugarcane bagasse and was used as a source of resistance genes. Many genes that affect tolerance to furfural, the most abundant inhibitor, have been described previously. To identify genes associated with inhibitors other than furfural, plasmid clones were selected in an artificial hydrolysate that had been treated with a vacuum to remove furfural. Two new resistance genes were discovered from Sau3A1 libraries of SL100 genomic DNA: nemA (N-ethylmaleimide reductase) and a putative regulatory gene containing a mutation in the coding region, yafC*. The presence of these mutations in SL100 was confirmed by sequencing. A single mutation was found in the upstream regulatory region of nemR (nemRA operon) in SL100. This mutation increased nemA activity 20-fold over that of the parent organism (LY180) in AM1 medium without hydrolysate and increased nemA mRNA levels >200-fold. Addition of hydrolysates induced nemA expression (mRNA and activity), in agreement with transcriptional control. NemA activity was stable in cell extracts (9 h, 37°C), eliminating a role for proteinase in regulation. LY180 with a plasmid expressing nemA or yafC* was more resistant to a vacuum-treated sugarcane bagasse hydrolysate and to a vacuum-treated artificial hydrolysate than LY180 with an empty-vector control. Neither gene affected furfural tolerance. The vacuum-treated hydrolysates inhibited the reduction of N-ethylmaleimide by NemA while also serving as substrates. Expression of the nemA or yafC* plasmid in LY180 doubled the rate of ethanol production from the vacuum-treated sugarcane bagasse hydrolysate. PMID:26826228

Plasmidic Expression of nemA and yafC* Increased Resistance of Ethanologenic Escherichia coli LY180 to Nonvolatile Side Products from Dilute Acid Treatment of Sugarcane Bagasse and Artificial Hydrolysate.

PubMed

Shi, Aiqin; Zheng, Huabao; Yomano, Lorraine P; York, Sean W; Shanmugam, Keelnatham T; Ingram, Lonnie O

2016-01-29

Hydrolysate-resistant Escherichia coli SL100 was previously isolated from ethanologenic LY180 after sequential transfers in AM1 medium containing a dilute acid hydrolysate of sugarcane bagasse and was used as a source of resistance genes. Many genes that affect tolerance to furfural, the most abundant inhibitor, have been described previously. To identify genes associated with inhibitors other than furfural, plasmid clones were selected in an artificial hydrolysate that had been treated with a vacuum to remove furfural. Two new resistance genes were discovered from Sau3A1 libraries of SL100 genomic DNA: nemA (N-ethylmaleimide reductase) and a putative regulatory gene containing a mutation in the coding region, yafC*. The presence of these mutations in SL100 was confirmed by sequencing. A single mutation was found in the upstream regulatory region of nemR (nemRA operon) in SL100. This mutation increased nemA activity 20-fold over that of the parent organism (LY180) in AM1 medium without hydrolysate and increased nemA mRNA levels >200-fold. Addition of hydrolysates induced nemA expression (mRNA and activity), in agreement with transcriptional control. NemA activity was stable in cell extracts (9 h, 37°C), eliminating a role for proteinase in regulation. LY180 with a plasmid expressing nemA or yafC* was more resistant to a vacuum-treated sugarcane bagasse hydrolysate and to a vacuum-treated artificial hydrolysate than LY180 with an empty-vector control. Neither gene affected furfural tolerance. The vacuum-treated hydrolysates inhibited the reduction of N-ethylmaleimide by NemA while also serving as substrates. Expression of the nemA or yafC* plasmid in LY180 doubled the rate of ethanol production from the vacuum-treated sugarcane bagasse hydrolysate. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

Norwegian patients and retail chicken meat share cephalosporin-resistant Escherichia coli and IncK/blaCMY-2 resistance plasmids.

PubMed

Berg, E S; Wester, A L; Ahrenfeldt, J; Mo, S S; Slettemeås, J S; Steinbakk, M; Samuelsen, Ø; Grude, N; Simonsen, G S; Løhr, I H; Jørgensen, S B; Tofteland, S; Lund, O; Dahle, U R; Sunde, M

2017-06-01

In 2012 and 2014 the Norwegian monitoring programme for antimicrobial resistance in the veterinary and food production sectors (NORM-VET) showed that 124 of a total of 406 samples (31%) of Norwegian retail chicken meat were contaminated with extended-spectrum cephalosporin-resistant Escherichia coli. The aim of this study was to compare selected cephalosporin-resistant E. coli from humans and poultry to determine their genetic relatedness based on whole genome sequencing (WGS). Escherichia coli representing three prevalent cephalosporin-resistant multi-locus sequence types (STs) isolated from poultry (n=17) were selected from the NORM-VET strain collections. All strains carried an IncK plasmid with a bla CMY-2 gene. Clinical E. coli isolates (n=284) with AmpC-mediated resistance were collected at Norwegian microbiology laboratories from 2010 to 2014. PCR screening showed that 29 of the clinical isolates harboured both IncK and bla CMY-2 . All IncK/bla CMY-2 -positive isolates were analysed with WGS-based bioinformatics tools. Analysis of single nucleotide polymorphisms (SNP) in 2.5 Mbp of shared genome sequences showed close relationship, with fewer than 15 SNP differences between five clinical isolates from urinary tract infections (UTIs) and the ST38 isolates from poultry. Furthermore, all of the 29 clinical isolates harboured IncK/bla CMY-2 plasmid variants highly similar to the IncK/bla CMY-2 plasmid present in the poultry isolates. Our results provide support for the hypothesis that clonal transfer of cephalosporin-resistant E. coli from chicken meat to humans may occur, and may cause difficult-to-treat infections. Furthermore, these E. coli can be a source of AmpC-resistance plasmids for opportunistic pathogens in the human microbiota. Copyright © 2017 European Society of Clinical Microbiology and Infectious Diseases. Published by Elsevier Ltd. All rights reserved.

Environmental emission of multiresistant Escherichia coli carrying the colistin resistance gene mcr-1 from German swine farms.

PubMed

Guenther, Sebastian; Falgenhauer, Linda; Semmler, Torsten; Imirzalioglu, Can; Chakraborty, Trinad; Roesler, Uwe; Roschanski, Nicole

2017-05-01

Pigs have been the focus of the worldwide spread of colistin resistance. However, there is little information on the transmission of mcr-1 -containing bacteria into the environment of pig farms. We therefore rescreened environmental Escherichia coli isolates from the surrounding farm areas of three previously mcr-1 -positive swine herds in Germany. Thirty-five mixed bacterial cultures obtained from boot swabs, flies, dog faeces and manure from three pig farms in Germany in 2011-12 were non-selectively recultivated and the presence of the mcr-1 gene was checked by real-time PCR. After separation, single E. coli colonies were subsequently isolated and the presence of mcr-1 was confirmed by PCR and sequencing. In addition, phenotypic antimicrobial resistance screening and WGS followed by phylogenetic analysis and resistance genotyping as well as plasmid typing were performed. Seven mcr-1 -positive E. coli strains originating from environmental boot swabs, dog faeces, stable flies and manure were found. The isolates belonged to five different STs (ST10, ST1011, ST1140, ST5281 and ST342) and harboured extensive additional resistance genes. Comparative plasmid analysis predominantly located mcr-1 on IncX4 plasmids, which are strongly related to a recently described plasmid of human clinical origin (pICBEC72Hmcr). WGS-based analysis of the environmental E. coli isolates of farm surroundings showed clear links to mcr-1 -harbouring E. coli recovered from pig production in Europe as well as from human clinical isolates worldwide, presenting another piece of the puzzle, which further complicates the rapidly evolving epidemiology of plasmid-mediated colistin-resistant E. coli strains. © The Author 2017. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Analysis of blaCTX-M-Carrying Plasmids from Escherichia coli Isolates Collected in the BfT-GermVet Study ▿

PubMed Central

Schink, Anne-Kathrin; Kadlec, Kristina; Schwarz, Stefan

2011-01-01

In this study, 417 Escherichia coli isolates from defined disease conditions of companion and farm animals collected in the BfT-GermVet study were investigated for the presence of extended-spectrum β-lactamase (ESBL) genes. Three ESBL-producing E. coli isolates were identified among the 100 ampicillin-resistant isolates. The E. coli isolates 168 and 246, of canine and porcine origins, respectively, harbored blaCTX-M-1, and the canine isolate 913 harbored blaCTX-M-15, as confirmed by PCR and sequence analysis. The isolates 168 and 246 belonged to the novel multilocus sequence typing (MLST) types ST1576 and ST1153, respectively, while isolate 913 had the MLST type ST410. The ESBL genes were located on structurally related IncN plasmids in isolates 168 and 246 and on an IncF plasmid in isolate 913. The blaCTX-M-1 upstream regions of plasmids pCTX168 and pCTX246 were similar, whereas the downstream regions showed structural differences. The genetic environment of the blaCTX-M-15 gene on plasmid pCTX913 differed distinctly from that of both blaCTX-M-1 genes. Detailed sequence analysis showed that the integration of insertion sequences, as well as interplasmid recombination events, accounted for the structural variability in the blaCTX-M gene regions. PMID:21685166

Infrared laser effects at fluences used for treatment of dentin hypersensitivity on DNA repair in Escherichia coli and plasmids

NASA Astrophysics Data System (ADS)

Rocha Teixeira, Gleica; da Silva Marciano, Roberta; da Silva Sergio, Luiz Philippe; Castanheira Polignano, Giovanni Augusto; Roberto Guimarães, Oscar; Geller, Mauro; de Paoli, Flavia; de Souza da Fonseca, Adenilson

2014-12-01

Low-intensity infrared lasers are proposed in clinical protocols based on biostimulative effects, yet dosimetry is inaccurate and their effects on DNA at therapeutic doses are controversial. The aim of this work was to evaluate the effects of low-intensity infrared laser on survival and induction of filamentation of Escherichia coli cells, and induction of DNA lesions in bacterial plasmids. E. coli cultures were exposed to laser (808 nm, 100 mW, 40 and 60 J/cm2) to study bacterial survival and filamentation. Also, bacterial plasmids were exposed to laser to study DNA lesions by electrophoretic profile and action of DNA repair enzymes. Data indicate low-intensity infrared laser has no effect on survival of E. coli wild type and exonuclease III, but decreases the survival of formamidopyrimidine DNA glycosylase/MutM protein and endonuclease III deficient cells in stationary growth phase, induces bacterial filamentation, does not alter the electrophoretic profile of plasmids in agarose gels and does not alter the electrophoretic profile of plasmids incubated with endonuclease III, formamidopyrimidine DNA glycosylase/MutM protein and exonuclease III. Our findings show that low-intensity laser exposure causes DNA lesions at sub-lethal level and induces cellular mechanisms involved in repair of oxidative lesions in DNA. Studies about laser dosimetry and safety strategies are necessary for professionals and patients exposed to low-intensity lasers at therapeutic doses.

PSI:Biology-Materials Repository: A Biologist’s Resource for Protein Expression Plasmids

PubMed Central

Cormier, Catherine Y.; Park, Jin G.; Fiacco, Michael; Steel, Jason; Hunter, Preston; Kramer, Jason; Singla, Rajeev; LaBaer, Joshua

2011-01-01

The Protein Structure Initiative:Biology-Materials Repository (PSI:Biology-MR; MR; http://psimr.asu.edu) sequence-verifies, annotates, stores, and distributes the protein expression plasmids and vectors created by the Protein Structure Initiative (PSI). The MR has developed an informatics and sample processing pipeline that manages this process for thousands of samples per month from nearly a dozen PSI centers. DNASU (http://dnasu.asu.edu), a freely searchable database, stores the plasmid annotations, which include the full-length sequence, vector information, and associated publications for over 130,000 plasmids created by our laboratory, by the PSI and other consortia, and by individual laboratories for distribution to researchers worldwide. Each plasmid links to external resources, including the PSI Structural Biology Knowledgebase (http://sbkb.org), which facilitates cross-referencing of a particular plasmid to additional protein annotations and experimental data. To expedite and simplify plasmid requests, the MR uses an expedited material transfer agreement (EP-MTA) network, where researchers from network institutions can order and receive PSI plasmids without institutional delays. Currently over 39,000 protein expression plasmids and 78 empty vectors from the PSI are available upon request from DNASU. Overall, the MR’s repository of expression-ready plasmids, its automated pipeline, and the rapid process for receiving and distributing these plasmids more effectively allows the research community to dissect the biological function of proteins whose structures have been studied by the PSI. PMID:21360289

Requirement for two or more Erwinia carotovora subsp. carotovora pectolytic gene products for maceration of potato tuber tissue by Escherichia coli.

PubMed

Roberts, D P; Berman, P M; Allen, C; Stromberg, V K; Lacy, G H; Mount, M S

1986-07-01

Several genes encoding enzymes capable of degrading plant cell wall components have been cloned from Erwinia carotovora subsp. carotovora EC14. Plasmids containing cloned EC14 DNA mediate the production of endo-pectate lyases, exo-pectate lyase, endo-polygalacturonase, and cellulase(s). Escherichia coli strains containing one of these plasmids or combinations of two plasmids were tested for their ability to macerate potato tuber slices. Only one E. coli strain, containing two plasmids that encode endo-pectate lyases, exo-pectate lyase, and endo-polygalacturonase, caused limited maceration. The pectolytic proteins associated with one of these plasmids, pDR1, have been described previously (D. P. Roberts, P. M. Berman, C. Allen, V. K. Stromberg, G. H. Lacy, and M. S. Mount, Can. J. Plant Pathol. 8:17-27, 1986) and include two secreted endo-pectate lyases. The second plasmid, pDR30, contains a 2.1-kilobase EC14 DNA insert that mediates the production of an exo-pectate lyase and an endo-polygalacturonase. These enzymes are similar in physicochemical properties to those produced by EC14. Our results suggest that the concerted activities of endo-pectate lyases with endo-polygalacturonase or exo-pectate lyase or both cause maceration.

Requirement for two or more Erwinia carotovora subsp. carotovora pectolytic gene products for maceration of potato tuber tissue by Escherichia coli.

PubMed Central

Roberts, D P; Berman, P M; Allen, C; Stromberg, V K; Lacy, G H; Mount, M S

1986-01-01

Several genes encoding enzymes capable of degrading plant cell wall components have been cloned from Erwinia carotovora subsp. carotovora EC14. Plasmids containing cloned EC14 DNA mediate the production of endo-pectate lyases, exo-pectate lyase, endo-polygalacturonase, and cellulase(s). Escherichia coli strains containing one of these plasmids or combinations of two plasmids were tested for their ability to macerate potato tuber slices. Only one E. coli strain, containing two plasmids that encode endo-pectate lyases, exo-pectate lyase, and endo-polygalacturonase, caused limited maceration. The pectolytic proteins associated with one of these plasmids, pDR1, have been described previously (D. P. Roberts, P. M. Berman, C. Allen, V. K. Stromberg, G. H. Lacy, and M. S. Mount, Can. J. Plant Pathol. 8:17-27, 1986) and include two secreted endo-pectate lyases. The second plasmid, pDR30, contains a 2.1-kilobase EC14 DNA insert that mediates the production of an exo-pectate lyase and an endo-polygalacturonase. These enzymes are similar in physicochemical properties to those produced by EC14. Our results suggest that the concerted activities of endo-pectate lyases with endo-polygalacturonase or exo-pectate lyase or both cause maceration. Images PMID:3013836

Puromycin-resistant lentiviral control shRNA vector, pLKO.1 induces unexpected cellular differentiation of P19 embryonic stem cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kanungo, Jyotshna

RNA silencing is used as a common method for investigating loss-of-function effects of genes of interest. In mammalian cells, RNA interference (RNAi) or RNA silencing can be achieved by transient siRNA (small or short interfering RNA) transfection or by stable shRNA (short hairpin RNA) systems. Various vectors are used for efficient delivery of shRNA. Lentiviral vectors offer an efficient delivery system for stable and long-term expression of the shRNA in mammalian cells. The widely used lentiviral pLKO.1 plasmid vector is very popular in RNAi studies. A large RNAi database, a TRC (the RNAi Consortium) library, was established based on themore » pLKO.1-TRC plasmid vector. This plasmid (also called pLKO.1-puro) has a puromycin-resistant gene for selection in mammalian cells along with designs for generating lentiviral particles as well for RNA silencing. While using the pLKO.1-puro TRC control shRNA plasmid for transfection in murine P19 embryonic stem (ES) cells, it was unexpectedly discovered that this plasmid vector induced robust endodermal differentiation. Since P19 ES cells are pluripotent and respond to external stimuli that have the potential to alter the phenotype and thus its stemness, other cell types used in RNA silencing studies do not display the obvious effect and therefore, may affect experiments in subtle ways that would go undetected. This study for the first time provides evidence that raises concern and warrants extreme caution while using the pLKO.1-puro control shRNA vector because of its unexpected non-specific effects on cellular integrity. - Highlights: • In P19 ES cells the pLKO.1-puro lentiviral control shRNA vector induced endodermal differentiation. • P19 ES cells harboring the pCDNA3 plasmid vector retained their stem-ness as opposed to those harboring the pLKO.1-puro vector. • P19 ES cells can serve as a sensor to determine vector safety. • Extreme caution is warranted while using the widely used pLKO.1-puro lentiviral vector for experimental and therapeutic designs.« less

8-Methoxypsoralen photoinduced plasmid-chromosome recombination in Saccharomyces cerevisiae using a centromeric vector.

PubMed Central

Meira, L B; Henriques, J A; Magaña-Schwencke, N

1995-01-01

The characterization of a new system to study the induction of plasmid-chromosome recombination is described. Single-stranded and double-stranded centromeric vectors bearing 8-methoxypsoralen photoinduced lesions were used to transform a wild-type yeast strain bearing the leu2-3,112 marker. Using the SSCP methodology and DNA sequencing, it was demonstrated that repair of the lesions in plasmid DNA was mainly due to conversion of the chromosomal allele to the plasmid DNA. Images PMID:7784218

Complex dissemination of the diversified mcr-1-harbouring plasmids in Escherichia coli of different sequence types

PubMed Central

Lin, Jingxia; Wang, Xiuna; Deng, Xianbo; Feng, Youjun

2016-01-01

The emergence of the mobilized colistin resistance gene, representing a novel mechanism for bacterial drug resistance, challenges the last resort against the severe infections by Gram-negative bacteria with multi-drug resistances. Very recently, we showed the diversity in the mcr-1-carrying plasmid reservoirs from the gut microbiota. Here, we reported that a similar but more complex scenario is present in the healthy swine populations, Southern China, 2016. Amongst the 1026 pieces of Escherichia coli isolates from 3 different pig farms, 302 E. coli isolates were determined to be positive for the mcr-1 gene (30%, 302/1026). Multi-locus sequence typing assigned no less than 11 kinds of sequence types including one novel Sequence Type to these mcr-1-positive strains. PCR analyses combined with the direct DNA sequencing revealed unexpected complexity of the mcr-1-harbouring plasmids whose backbones are at least grouped into 6 types four of which are new. Transcriptional analyses showed that the mcr-1 promoter of different origins exhibits similar activity. It seems likely that complex dissemination of the diversified mcr-1-bearing plasmids occurs amongst the various ST E. coli inhabiting the healthy swine populations, in Southern China. PMID:27741523

Expression and Bioinformatics Analysis of Pectate Lyase Gene from Bacillus subtilis521

NASA Astrophysics Data System (ADS)

Xiao, Jing; Lu, Fu-Ping; Li, Yu; Li, Jin-Ting

In order to exploit new genetic resources, Pectate lyase(PEL) gene was amplified by PCR using the genome DNA from an alkaline Bacillus subtilis521. The PCR product was inserted into pET22b(+) vector. The recombinant plasmids were cloned in E.coli DH5α and then expressed in E.coli BL21. When cultured in the optimized medium, the positive clones E.coli BL21(pET22b(+)pel)showed intracellular pectate lyase activity of 90.0 U/mL. It was indicated that we had obtained the correct PEL gene. The pel has an open reading frame of 1263 nucleotides and codes for a product of 420 amino acids with a calculated molecular mass of 45.5 kD. Based on computer assisted analysis, a signal peptides and two conserved domains were revealed. The sequence analysis for PEL showed that it shares 26-82% homology with other strains in GenBank. In addition, the advanced structure of PEL were also predicted and analysed. This study will help to the experimental design of PEL fermentation and production purification and enzyme evolution.

Comparative method of protein expression and isolation of EBV epitope in E.coli DH5α

NASA Astrophysics Data System (ADS)

Anyndita, Nadya V. M.; Dluha, Nurul; Himmah, Karimatul; Rifa'i, Muhaimin; Widodo

2017-11-01

Epstein-Barr Virus (EBV) or human herpes virus 4 (HHV-4) is a virus that infects human B cell and leads to nasopharyngeal carcinoma (NPC). The prevention of this disease remains unsuccessful since the vaccine has not been discovered. The objective of this study is to over-produce EBV gp350/220 epitope using several methods in E.coli DH5α. EBV epitope sequences were inserted into pMAL-p5x vector, then transformed into DH5α E.coli and over-produced using 0.3, 1 and 2 mM IPTG. Plasmid transformation was validated using AflIII restriction enzyme in 0.8% agarose. Periplasmic protein was isolated using 2 comparative methods and then analyzed using SDS-PAGE. Method A produced a protein band around 50 kDa and appeared only at transformant. Method B failed to isolate the protein, indicated by no protein band appearing. In addition, any variations in IPTG concentration didn't give a different result. Thus it can be concluded that even the lowest IPTG concentration is able to induce protein expression.

Closely related NDM-1-encoding plasmids from Escherichia coli and Klebsiella pneumoniae in Taiwan.

PubMed

Chen, Chao-Ju; Wu, Tsu-Lan; Lu, Po-Liang; Chen, Ying-Tsong; Fung, Chang-Phone; Chuang, Yin-Ching; Lin, Jung-Chung; Siu, L Kristopher

2014-01-01

Two plasmids carrying blaNDM-1 isolated from carbapenem-resistant Klebsiella pneumoniae (CR-KP) and carbapenem-resistant Escherichia coli (CR-EC) were sequenced. CR-KP and CR-EC were isolated from two Taiwanese patients without travel histories. Complete sequencing of the plasmids (pLK75 and pLK78) was conducted using a shotgun approach. Annotation of the contigs was performed using the RAST Server, followed by manual inspection and correction. These similar plasmids were obtained from two patients with overlapping stays at the same hospital. The pLK75 and pLK78 plasmids were 56,489-bp and 56,072-bp in length, respectively. Plasmid annotation revealed a common backbone similar to the IncN plasmid pR46. The regions flanking the blaNDM-1 genes in these plasmids were very similar to plasmid pNDM-HU01 in Japan, which contains a complex class 1 integron located next to an ISCR1 element. The ISCR1 element has been suggested to provide a powerful mechanism for mobilising antibiotic resistance genes. Two indigenous NDM-1-producing Enterobacteriaceae cases were identified for the first time in Taiwan, highlighting the alarming introduction of NDM-1-producing Enterobacteriaceae in this region.

Evolution of the iss gene in Escherichia coli.

PubMed

Johnson, Timothy J; Wannemuehler, Yvonne M; Nolan, Lisa K

2008-04-01

The increased serum survival gene iss has long been recognized for its role in extraintestinal pathogenic Escherichia coli (ExPEC) virulence. iss has been identified as a distinguishing trait of avian ExPEC but not of human ExPEC. This gene has been localized to large virulence plasmids and shares strong similarities with the bor gene from bacteriophage lambda. Here, we demonstrate that three alleles of iss occur among E. coli isolates that appear to have evolved from a common lambda bor precursor. In addition to the occurrence of iss on the ColV/BM virulence plasmids, at least two iss alleles occur within the E. coli chromosome. One of these alleles (designated type 3) was found to occur in the genomes of all currently sequenced ExPEC strains on a similar prophage element that also harbors the Sit iron and manganese transport system. When the prevalence of the three iss types was examined among 487 E. coli isolates, the iss type 3 gene was found to occur at a high frequency among ExPEC isolates, irrespective of the host source. The plasmid-borne iss allele (designated type 1) was highly prevalent among avian pathogenic E. coli and neonatal meningitis-associated E. coli isolates but not among uropathogenic E. coli isolates. This study demonstrates the evolution of iss in E. coli and provides an additional tool for discriminating among E. coli pathotypes through the differentiation of the three iss allele types and bor.

Genomic epidemiology of global Klebsiella pneumoniae carbapenemase (KPC)-producing Escherichia coli.

PubMed

Stoesser, N; Sheppard, A E; Peirano, G; Anson, L W; Pankhurst, L; Sebra, R; Phan, H T T; Kasarskis, A; Mathers, A J; Peto, T E A; Bradford, P; Motyl, M R; Walker, A S; Crook, D W; Pitout, J D

2017-07-19

The dissemination of carbapenem resistance in Escherichia coli has major implications for the management of common infections. bla KPC , encoding a transmissible carbapenemase (KPC), has historically largely been associated with Klebsiella pneumoniae, a predominant plasmid (pKpQIL), and a specific transposable element (Tn4401, ~10 kb). Here we characterize the genetic features of bla KPC emergence in global E. coli, 2008-2013, using both long- and short-read whole-genome sequencing. Amongst 43/45 successfully sequenced bla KPC -E. coli strains, we identified substantial strain diversity (n = 21 sequence types, 18% of annotated genes in the core genome); substantial plasmid diversity (≥9 replicon types); and substantial bla KPC -associated, mobile genetic element (MGE) diversity (50% not within complete Tn4401 elements). We also found evidence of inter-species, regional and international plasmid spread. In several cases bla KPC was found on high copy number, small Col-like plasmids, previously associated with horizontal transmission of resistance genes in the absence of antimicrobial selection pressures. E. coli is a common human pathogen, but also a commensal in multiple environmental and animal reservoirs, and easily transmissible. The association of bla KPC with a range of MGEs previously linked to the successful spread of widely endemic resistance mechanisms (e.g. bla TEM , bla CTX-M ) suggests that it may become similarly prevalent.

Tailor-made gene silencing of Staphylococcus aureus clinical isolates by CRISPR interference

PubMed Central

Sato’o, Yusuke; Hisatsune, Junzo; Yu, Liansheng; Sakuma, Tetsushi; Yamamoto, Takashi

2018-01-01

Preparing the genetically modified organisms have required much time and labor, making it the rate-limiting step but CRISPR/Cas9 technology appearance has changed this difficulty. Although reports on CRISPR/Cas9 technology such as genome editing and CRISPR interference (CRISPRi) in eukaryotes increased, those in prokaryotes especially in Staphylococci were limited. Thus, its potential in the bacteriology remains unexplored. This is attributed to ecological difference between eukaryotes and prokaryotes. Here, we constructed a novel CRISPRi plasmid vector, pBACi for Staphylococcus aureus. The transformation efficiency of S. aureus was ~104 CFU/μg DNA using a vector extracted from dcm negative, which encoded one of DNA modification genes, E. coli. Further, pBACi was introduced into various clinical isolates including that not accepting the conventional temperature-sensitive vector. dcas9 in the vector was expressed throughout the growth phases of S. aureus and this vector decreased various gene mRNA expressions based on the crRNA targeting sequences and altered the knockdown strains’ phenotypes. The targeted genes included various virulence and antibiotic resistant genes. Bioinformatics suggest this vector can be introduced into wide range of low-GC Gram-positive bacteria. Because this new CRISPR/Cas9-based vector can easily prepare knockdown strains, we believe the novel vector will facilitate the characterization of the function of genes from S. aureus and other Gram-positive bacteria. PMID:29377933

Characterization of the Basic Replicon of Rhodococcus Plasmid pSOX and Development of a Rhodococcus-Escherichia coli Shuttle Vector†

PubMed Central

Denis-Larose, Claude; Bergeron, Hélène; Labbé, Diane; Greer, Charles W.; Hawari, Jalal; Grossman, Matthew J.; Sankey, Bruce M.; Lau, Peter C. K.

1998-01-01

The replication region of a 100-kb desulfurization plasmid (pSOX) from Rhodococcus sp. strain X309 was localized to a 4-kb KpnI fragment, and its sequence was determined. The amino acid sequence of one of the predicted open reading frames (ORFs) was related to the putative replication (Rep) protein sequences of the mycobacterial pLR7 family of plasmids. Three of the five predicted ORF products were identified by radiolabelling with the Escherichia coli T7 polymerase/promoter system. In E. coli, the Rep protein of pSOX was apparently synthesized in a shortened form, 21.3 kDa instead of the predicted 41.3 kDa, as a result of an internal initiation. This situation is reminescent of that for some bacterial Rep proteins. A shuttle plasmid was constructed with the pSOX origin, pBluescript II KS−, and the chloramphenicol resistance (Cmr) gene from pRF29. This new shuttle plasmid was used to demonstrate expression of the Bacillus subtilis sacB gene in a strain of Rhodococcus, rendering it sensitive to the presence of sucrose. PMID:9797291

Multiresistance in Pasteurella multocida Is Mediated by Coexistence of Small Plasmids▿

PubMed Central

San Millan, Alvaro; Escudero, Jose Antonio; Gutierrez, Belen; Hidalgo, Laura; Garcia, Nerea; Llagostera, Montserrat; Dominguez, Lucas; Gonzalez-Zorn, Bruno

2009-01-01

In most gram-negative bacteria, acquired multiresistance is conferred by large plasmids compiling numerous antimicrobial resistance genes. Here, we show an evolutionary alternative strategy used by Pasteurella multocida to become resistant to multiple clinically relevant antibiotics. Thirteen β-lactam-resistant clinical isolates, concomitantly resistant to tetracyclines and/or streptomycin as well as to sulfonamides, were studied. Pulsed-field gel electrophoresis analysis revealed different profiles among the isolates, showing that clonal dissemination was not the sole event responsible for the spread of multiresistance. Each P. multocida strain carried two or three small plasmids between 4 and 6 kb in size. A direct association between resistance profile and plasmid content was found. Complete nucleotide sequencing of all plasmids revealed seven different replicons, six of them belonging to the ColE1 superfamily. All plasmids carried one, or a maximum of two, antimicrobial resistance determinants. Plasmids pB1000 and pB1002 bore blaROB-1, pB1001 carried tet(B), pB1003 and pB1005 carried sul2 and strA, pB1006 harbored tet(O), and p9956 bore the tet(H) gene. All plasmids except pB1002 and pB1006 were successfully transformed into Escherichia coli. pB1000, also involved in β-lactam resistance in Haemophilus parasuis (A. San Millan et al., Antimicrob. Agents Chemother. 51:2260-2264, 2007), was mobilized in E. coli using the conjugation machinery of an IncP plasmid. Stability experiments proved that pB1000 was stable in P. multocida but highly unstable in E. coli. In conclusion, blaROB-1 is responsible for β-lactam resistance in P. multocida in Spain. Coexistence and the spread of small plasmids are used by P. multocida to become multiresistant. PMID:19528282

Single inverted terminal repeats of the Junonia coenia Densovirus promotes somatic chromosomal integration of vector plasmids in insect cells and supports high efficiency expression

USDA-ARS?s Scientific Manuscript database

Plasmids that contain a disrupted genome of the Junonia coenia densovirus (JcDNV) integrate into the chromosomes of the somatic cells of insects. When subcloned individually, both the P9 inverted terminal repeat (P9-ITR) and the P93-ITR promote the chromosomal integration of vector plasmids in insec...

Fluorescent dye technique as an alternative to gfp-labeled plasmid for visualization of Escherichia coli O157:H7 cells on romaine lettuce leaves following sanitizer treatment

USDA-ARS?s Scientific Manuscript database

The task of imaging Escherichia coli O157:H7 cells on artificially inoculated produce often requires genetic modification of the cells through the introduction of gfp-labeled plasmid. However, these modified cells do not behave as the parent cells and the auto fluorescence of lettuce leaves interfe...

Characterization of clinically isolated thymidine-dependent small-colony variants of Escherichia coli producing extended-spectrum β-lactamase.

PubMed

Negishi, Tatsuya; Matsumoto, Takehisa; Horiuchi, Kazuki; Kasuga, Eriko; Natori, Tatsuya; Matsuoka, Mina; Ogiwara, Naoko; Sugano, Mitsutoshi; Uehara, Takeshi; Nagano, Noriyuki; Honda, Takayuki

2018-01-01

Thymidine-dependent small-colony variants (TD-SCVs) are difficult to detect or test for antimicrobial susceptibility. We investigated the characteristics of clonal TD-SCVs of Escherichia coli, both with and without blaCTX-M-3, isolated from a patient. Mutation in the thyA gene was analysed by sequencing, and morphological abnormalities in the colonies and cells of the isolates were examined. Additionally, conjugational transfer experiments were performed to prove the horizontal transferability of plasmids harbouring resistance genes. The TD-SCVs contained a single nucleotide substitution in the thyA gene, c.62G>A, corresponding to p.Arg21His. Morphologically, their colonies were more translucent and flattened than those of the wild-type strain. In addition, cells of the TD-SCVs were swollen and elongated, sometimes with abnormal and incomplete divisions; a large amount of cell debris was also observed. Changing c.62G>A back to the wild-type sequence reversed these abnormalities. Conjugational transfer experiments showed that the TD-SCV of E. coli with blaCTX-M-3 failed to transfer blaCTX-M-3 to E. coli CSH2. However, the TD-SCV of E. coli without blaCTX-M-3 experimentally received the plasmid encoding blaSHV-18 from Klebsiella pneumoniae ATCC 700603 and transferred it to E. coli CSH2. Mutation in the thyA gene causes morphological abnormalities in the colonies and cells of E. coli, as well as inducing thymidine auxotrophy. In addition, TD-SCVs horizontally transmit plasmids encoding resistance genes. It is important to detect TD-SCVs based on their characteristics because they serve as reservoirs of transferable antibiotic resistance plasmids.

Characterization of epidemic IncI1-Iγ plasmids harboring ambler class A and C genes in Escherichia coli and Salmonella enterica from animals and humans.

PubMed

Smith, Hilde; Bossers, Alex; Harders, Frank; Wu, Guanghui; Woodford, Neil; Schwarz, Stefan; Guerra, Beatriz; Rodríguez, Irene; van Essen-Zandbergen, Alieda; Brouwer, Michael; Mevius, Dik

2015-09-01

The aim of the study was to identify the plasmid-encoded factors contributing to the emergence and spread of epidemic IncI1-Iγ plasmids obtained from Escherichia coli and Salmonella enterica isolates from animal and human reservoirs. For this, 251 IncI1-Iγ plasmids carrying various extended-spectrum β-lactamase (ESBL) or AmpC β-lactamase genes were compared using plasmid multilocus sequence typing (pMLST). Thirty-two of these plasmids belonging to different pMLST types were sequenced using Roche 454 and Illumina platforms. Epidemic IncI1-Iγ plasmids could be assigned to various dominant clades, whereas rarely detected plasmids clustered together as a distinct clade. Similar phylogenetic trees were obtained using only the plasmid backbone sequences, showing that the differences observed between the plasmids belonging to distinct clades resulted mainly from differences between their backbone sequences. Plasmids belonging to the various clades differed particularly in the presence/absence of genes encoding partitioning and addiction systems, which contribute to stable inheritance during cell division and plasmid maintenance. Despite this, plasmids belonging to the various phylogenetic clades also showed marked resistance gene associations, indicating the circulation of successful plasmid-gene combinations. The variation in traY and excA genes found in IncI1-Iγ plasmids is conserved within pMLST sequence types and plays a role in incompatibility, although functional study is needed to elucidate the role of these genes in plasmid epidemiology. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

Recombination between bacteriophage lambda and plasmid pBR322 in Escherichia coli.

PubMed Central

Pogue-Geile, K L; Dassarma, S; King, S R; Jaskunas, S R

1980-01-01

Recombinant lambda phages were isolated that resulted from recombination between the lambda genome and plasmid pBR322 in Escherichia coli, even though these deoxyribonucleic acids (DNAs) did not share extensive regions of homology. The characterization of these recombinant DNAs by heteroduplex analysis and restriction endonucleases is described. All but one of the recombinants appeared to have resulted from reciprocal recombination between a site on lambda DNA and a site on the plasmid. In general, there were two classes of recombinants. One class appeared to have resulted from recombination at the phage attachment site that probably resulted from lambda integration into secondary attachment sites on the plasmid. Seven different secondary attachment sites on pBR322 were found. The other class resulted from plasmid integration at other sites that were widely scattered on the lambda genome. For this second class of recombinants, more than one site on the plasmid could recombine with lambda DNA. Thus, the recombination did not appear to be site specific with respect to lambda or the plasmid. Possible mechanisms for generating these recombinants are discussed. Images PMID:6247334

[Enhancement of functional expression of wheat peroxidase WP1 in prokaryotic system by co-transforming with hemA and hemL of Esherichia coli].

PubMed

Zhang, Chao; Shan, Liwei; Su, Shuaikun; Nan, Yanni; Guo, Zhongyu; Fan, Sanhong

2012-07-01

Wheat grain peroxidase 1 (WP1) belonged to class III plant peroxidase with cofactor heme, which not only has antifungal activity, but also influences the processing quality of flour. In order to enhance functional expression of WP1 in prokaryotic system by increasing endogenous heme synthesis, we constructed a recombinant plasmid pACYC-A-L containing hemA and hemL of Esherichia coli. Then, we co-transformed it into host strain T7 Express with secretive expression vector (pMAL-p4x-WP1) or non-secretive expression vector (pET21a-MBP-WP1), respectively. The MBP-WP1 fusion protein was further purified by amylose affinity chromatography and its peroxidase activity was assayed using 2,2'-azino-bis (3-ethylbenzothiazoline-6-sulfonate) (ABTS) as substrate. At 12 h after induction at 28 degree, the extracellular 5-aminolevulinic acid (5-ALA) production of T7 Express/pACYC-A-L was up to 146.73 mg/L, simultaneously the extracellular porphrins also increased dramatically. The peroxidase activity of functional MBP-WP1 obtained from T7 Express/ (pACYC-A-L + pMAL-p4x-WP1) was 14.6-folds of that purified from T7 Express/ pET21a-MBP-WP1. This study not only successfully enhanced functional expression of wheat peroxidase 1 in Esherichia coli, but also provided beneficial references for other important proteins with cofactor heme.

Construction of Biologically Functional Bacterial Plasmids In Vitro

PubMed Central

Cohen, Stanley N.; Chang, Annie C. Y.; Boyer, Herbert W.; Helling, Robert B.

1973-01-01

The construction of new plasmid DNA species by in vitro joining of restriction endonuclease-generated fragments of separate plasmids is described. Newly constructed plasmids that are inserted into Escherichia coli by transformation are shown to be biologically functional replicons that possess genetic properties and nucleotide base sequences from both of the parent DNA molecules. Functional plasmids can be obtained by reassociation of endonuclease-generated fragments of larger replicons, as well as by joining of plasmid DNA molecules of entirely different origins. Images PMID:4594039

Vertical transmission of highly similar blaCTX-M-1-harboring IncI1 plasmids in Escherichia coli with different MLST types in the poultry production pyramid

PubMed Central

Zurfluh, Katrin; Wang, Juan; Klumpp, Jochen; Nüesch-Inderbinen, Magdalena; Fanning, Séamus; Stephan, Roger

2014-01-01

Objectives: The purpose of this study was to characterize sets of extended-spectrum β-lactamases (ESBL)-producing Enterobacteriaceae collected longitudinally from different flocks of broiler breeders, meconium of 1-day-old broilers from theses breeder flocks, as well as from these broiler flocks before slaughter. Methods: Five sets of ESBL-producing Escherichia coli were studied by multi-locus sequence typing (MLST), phylogenetic grouping, PCR-based replicon typing and resistance profiling. The blaCTX-M-1-harboring plasmids of one set (pHV295.1, pHV114.1, and pHV292.1) were fully sequenced and subjected to comparative analysis. Results: Eleven different MLST sequence types (ST) were identified with ST1056 the predominant one, isolated in all five sets either on the broiler breeder or meconium level. Plasmid sequencing revealed that blaCTX-M-1 was carried by highly similar IncI1/ST3 plasmids that were 105 076 bp, 110 997 bp, and 117 269 bp in size, respectively. Conclusions: The fact that genetically similar IncI1/ST3 plasmids were found in ESBL-producing E. coli of different MLST types isolated at the different levels in the broiler production pyramid provides strong evidence for a vertical transmission of these plasmids from a common source (nucleus poultry flocks). PMID:25324838

Vertical transmission of highly similar bla CTX-M-1-harboring IncI1 plasmids in Escherichia coli with different MLST types in the poultry production pyramid.

PubMed

Zurfluh, Katrin; Wang, Juan; Klumpp, Jochen; Nüesch-Inderbinen, Magdalena; Fanning, Séamus; Stephan, Roger

2014-01-01

The purpose of this study was to characterize sets of extended-spectrum β-lactamases (ESBL)-producing Enterobacteriaceae collected longitudinally from different flocks of broiler breeders, meconium of 1-day-old broilers from theses breeder flocks, as well as from these broiler flocks before slaughter. Five sets of ESBL-producing Escherichia coli were studied by multi-locus sequence typing (MLST), phylogenetic grouping, PCR-based replicon typing and resistance profiling. The bla CTX-M-1-harboring plasmids of one set (pHV295.1, pHV114.1, and pHV292.1) were fully sequenced and subjected to comparative analysis. Eleven different MLST sequence types (ST) were identified with ST1056 the predominant one, isolated in all five sets either on the broiler breeder or meconium level. Plasmid sequencing revealed that bla CTX-M-1 was carried by highly similar IncI1/ST3 plasmids that were 105 076 bp, 110 997 bp, and 117 269 bp in size, respectively. The fact that genetically similar IncI1/ST3 plasmids were found in ESBL-producing E. coli of different MLST types isolated at the different levels in the broiler production pyramid provides strong evidence for a vertical transmission of these plasmids from a common source (nucleus poultry flocks).

Transcriptional analysis of the Escherichia coli ColV-Ia plasmid pS88 during growth in human serum and urine.

PubMed

Lemaître, Chloé; Bidet, Philippe; Bingen, Edouard; Bonacorsi, Stéphane

2012-06-21

The sequenced O45:K1:H7 Escherichia coli meningitis strain S88 harbors a large virulence plasmid. To identify possible genetic determinants of pS88 virulence, we examined the transcriptomes of 88 plasmidic ORFs corresponding to known and putative virulence genes, and 35 ORFs of unknown function. Quantification of plasmidic transcripts was obtained by quantitative real-time reverse transcription of extracted RNA, normalized on three housekeeping genes. The transcriptome of E. coli strain S88 grown in human serum and urine ex vivo were compared to that obtained during growth in Luria Bertani broth, with and without iron depletion. We also analyzed the transcriptome of a pS88-like plasmid recovered from a neonate with urinary tract infection. The transcriptome obtained after ex vivo growth in serum and urine was very similar to those obtained in iron-depleted LB broth. Genes encoding iron acquisition systems were strongly upregulated. ShiF and ORF 123, two ORFs encoding protein with hypothetical function and physically linked to aerobactin and salmochelin loci, respectively, were also highly expressed in iron-depleted conditions and may correspond to ancillary iron acquisition genes. Four ORFs were induced ex vivo, independently of the iron concentration. Other putative virulence genes such as iss, etsC, ompTp and hlyF were not upregulated in any of the conditions studied. Transcriptome analysis of the pS88-like plasmid recovered in vivo showed a similar pattern of induction but at much higher levels. We identify new pS88 genes potentially involved in the growth of E. coli meningitis strain S88 in human serum and urine.

In vivo transcription of R-plasmid deoxyribonucleic acid in Escherichia coli strains with altered antibiotic resistance levels and/or conjugal proficiency.

PubMed Central

Davis, R; Vapnek, D

1976-01-01

The amounts of plasmid deoxyribonucleic acid (DNA) and the levels of the in vivo transcription of the Escherichia coli plasmids R538-1 (repressed for conjugal transfer) and R538-1drd (derepressed for transfer) were determined by DNA-DNA hybridization and DNA-ribonucleic acid hybridization, respectively. The results demonstrate that the level of plasmid transcription is increased by two-fold in the strain carrying the derepressed plasmid, compared to an isogenic strain carrying the repressed plasmid, whereas the amount of plasmid DNA is approximately the same, suggesting that the transfer genes are under transcriptional control. Levels of plasmid DNA, plasmid DNA transcription, and chloramphenicol acetyltransferase activity were also compared in a mutant strain that carried the R538-1drd plasmid and was resistant to high levels of antibiotics. This strain produces about 13 copies of plasmid DNA per chromosome compared to five copies for the parent strain. The level of transcription of plasmid DNA was found to be twofold higher in the high-level resistant strain, whereas the level of chloramphenition, acetyltransferase activity was increased by 10-fold. In addition the levels of plasmid DNA transcription and chloramphenicol acetyltransferase activity in the high-level resistant strain were found to be further increased by the presence of high levels of chloramphenicol in the growth medium. The amount of plasmid DNA remained constant under these conditions, indicating that high levels of chloramphenicol can stimulate the expression of plasmid genes at the level of transcription in this strain. PMID:767321

Assessing the biocompatibility of click-linked DNA in Escherichia coli

PubMed Central

Sanzone, A. Pia; El-Sagheer, Afaf H.; Brown, Tom; Tavassoli, Ali

2012-01-01

The biocompatibility of a triazole mimic of the DNA phosphodiester linkage in Escherichia coli has been evaluated. The requirement for selective pressure on the click-containing gene was probed via a plasmid containing click DNA backbone linkages in each strand of the gene encoding the fluorescent protein mCherry. The effect of proximity of the click linkers on their biocompatibility was also probed by placing two click DNA linkers 4-bp apart at the region encoding the fluorophore of the fluorescent protein. The resulting click-containing plasmid was found to encode mCherry in E. coli at a similar level to the canonical equivalent. The ability of the cellular machinery to read through click-linked DNA was further probed by using the above click-linked plasmid to express mCherry using an in vitro transcription/translation system, and found to also be similar to that from canonical DNA. The yield and fluorescence of recombinant mCherry expressed from the click-linked plasmid was also compared to that from the canonical equivalent, and found to be the same. The biocompatibility of click DNA ligation sites at close proximity in a non-essential gene demonstrated in E. coli suggests the possibility of using click DNA ligation for the enzyme-free assembly of chemically modified genes and genomes. PMID:22904087

Conjugation-Mediated Transfer of Antibiotic-Resistance Plasmids Between Enterobacteriaceae in the Digestive Tract of Blaberus craniifer (Blattodea: Blaberidae).

PubMed

Anacarso, I; Iseppi, R; Sabia, C; Messi, P; Condò, C; Bondi, M; de Niederhäusern, S

2016-05-01

Cockroaches, insects of the order Blattodea, seem to play a crucial role in the possible conjugation-mediated genetic exchanges that occur among bacteria that harbor in the cockroach intestinal tract. The gut of these insects can be thought of as an effective in vivo model for the natural transfer of antimicrobial resistance plasmids among bacteria. In our study, we evaluated the conjugation-mediated horizontal transfer of resistance genes between Escherichia coli and other microorganisms of the same Enterobacteriaceae family within the intestinal tract of Blaberus craniifer Burmeister, 1838 (Blattodea: Blaberidae). Different in vivo mating experiments were performed using E. coli RP4 harboring the RP4 plasmid carrying ampicillin, kanamycin, and tetracycline resistance genes as the donor and E. coli K12 resistant to nalidixic acid or Salmonella enterica serovar Enteritidis IMM39 resistant to streptomycin as the recipients. The RP4 plasmid was successfully transferred to both recipients, producing E. coli K12-RP4 and S. Enteritidis IMM39-RP4 transconjugants. Conjugation frequencies in vivo were similar to those previously observed in vitro. The transfer of the RP4 plasmid in all transconjugants was confirmed by small-scale plasmid isolation and agar gel electrophoresis, suggesting that the intestinal tract of cockroaches is an effective in vivo model for natural gene transfer. Our results confirm that cockroaches allow for the exchange of antimicrobial resistance plasmids among bacteria and may represent a potential reservoir for the dissemination of antibiotic-resistant bacteria in different environments. These findings are particularly significant to human health in the context of health care settings such as hospitals. © The Authors 2016. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Phage-mediated Delivery of Targeted sRNA Constructs to Knock Down Gene Expression in E. coli.

PubMed

Bernheim, Aude G; Libis, Vincent K; Lindner, Ariel B; Wintermute, Edwin H

2016-03-20

RNA-mediated knockdowns are widely used to control gene expression. This versatile family of techniques makes use of short RNA (sRNA) that can be synthesized with any sequence and designed to complement any gene targeted for silencing. Because sRNA constructs can be introduced to many cell types directly or using a variety of vectors, gene expression can be repressed in living cells without laborious genetic modification. The most common RNA knockdown technology, RNA interference (RNAi), makes use of the endogenous RNA-induced silencing complex (RISC) to mediate sequence recognition and cleavage of the target mRNA. Applications of this technique are therefore limited to RISC-expressing organisms, primarily eukaryotes. Recently, a new generation of RNA biotechnologists have developed alternative mechanisms for controlling gene expression through RNA, and so made possible RNA-mediated gene knockdowns in bacteria. Here we describe a method for silencing gene expression in E. coli that functionally resembles RNAi. In this system a synthetic phagemid is designed to express sRNA, which may designed to target any sequence. The expression construct is delivered to a population of E. coli cells with non-lytic M13 phage, after which it is able to stably replicate as a plasmid. Antisense recognition and silencing of the target mRNA is mediated by the Hfq protein, endogenous to E. coli. This protocol includes methods for designing the antisense sRNA, constructing the phagemid vector, packaging the phagemid into M13 bacteriophage, preparing a live cell population for infection, and performing the infection itself. The fluorescent protein mKate2 and the antibiotic resistance gene chloramphenicol acetyltransferase (CAT) are targeted to generate representative data and to quantify knockdown effectiveness.

Cloning of an origin of DNA replication of Xenopus laevis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Watanabe, S.; Taylor, J.H.

1980-09-01

DNA fragments of Xenopus laevis, the African frog, were cloned in the EcoRI site of the Eschrichia coli plasmid pACYC189 and tested for ability to initiate and complete replication of the recombinant plasmid when injected into unfertilized eggs of X. laevis. After measurement of the (/sup 3/H)-thymidine incorporation per egg for a number of recombinant plasmids, pSW14 and pSW9, which respectively contain a small segment (550 base pairs) and several kilobases of frog DNA, were selected for more extensive analysis. In spite of the small size of th segment in pSW14, it incorporates in 2 hr at least 3 timesmore » as much labeled thymidine as either pSW9 or the vector alone. To determine the number of replications of pSW14, a novel method was employed. The results showed that about 50% of the labeled, supercoiled DNA recovered from eggs after 4 hr was sensitive to EcoRI digestion, which indicates that most of the DNA that incorporated (/sup 3/H)thymidine had replicated twice during the 4 hr in the unfertilized eggs of X. laevis. We conclude the pSW14 has a functional origin in the Xenopus DNA segment.« less

Antibiotic free selection for the high level biosynthesis of a silk-elastin-like protein

PubMed Central

Barroca, Mário; Rodrigues, Paulo; Sobral, Rómulo; Costa, M. Manuela R.; Chaves, Susana R.; Machado, Raul; Casal, Margarida; Collins, Tony

2016-01-01

Silk-elastin-like proteins (SELPs) are a family of genetically engineered recombinant protein polymers exhibiting mechanical and biological properties suited for a wide range of applications in the biomedicine and materials fields. They are being explored as the next generation of biomaterials but low productivities and use of antibiotics during production undermine their economic viability and safety. We have developed an industrially relevant, scalable, fed-batch process for the high level production of a novel SELP in E. coli in which the commonly used antibiotic selection marker of the expression vector is exchanged for a post segregational suicide system, the separate-component-stabilisation system (SCS). SCS significantly augments SELP productivity but also enhances the product safety profile and reduces process costs by eliminating the use of antibiotics. Plasmid content increased following induction but no significant differences in plasmid levels were discerned when using SCS or the antibiotic selection markers under the controlled fed-batch conditions employed. It is suggested that the absence of competing plasmid-free cells improves host cell viability and enables increased productivity with SCS. With the process developed, 12.8 g L−1 purified SELP was obtained, this is the highest SELP productivity reported to date and clearly demonstrates the commercial viability of these promising polymers. PMID:27982135

A prototype stable RNA identification cassette for monitoring plasmids of genetically engineered microorganisms

NASA Technical Reports Server (NTRS)

Hedenstierna, K. O.; Lee, Y. H.; Yang, Y.; Fox, G. E.

1993-01-01

A prototype stable RNA identification cassette for monitoring genetically engineered plasmids carried by strains of Escherichia coli has been developed. The cassette consists of a Vibrio proteolyticus 5S ribosomal RNA (rRNA) gene surrounded by promoters and terminators from the rrnB operon of Escherischia coli. The identifier RNA is expressed and successfully processed so that approximately 30% of the 5S rRNA isolated from either whole cells or 70S ribosomes is of the V. proteolyticus type. Cells carrying the identifier are readily detectable by hybridization. Accurate measurements show that the identification cassette has little effect on fitness compared to a strain containing an analogous plasmid carrying wild type E. coli 5S rRNA, and the V. proteolyticus 5S rRNA gene is not inactivated after prolonged growth. These results demonstrate the feasibility of developing small standardized identification cassettes that can utilize already existing highly sensitive rRNA detection methods. Cassettes of this type could in principle be incorporated into either the engineered regions of recombinant plasmids or their hosts.

High Diversity of Extended-Spectrum β-Lactamases in Escherichia coli Isolates from Italian Broiler Flocks ▿

PubMed Central

Bortolaia, Valeria; Guardabassi, Luca; Trevisani, Marcello; Bisgaard, Magne; Venturi, Luciano; Bojesen, Anders Miki

2010-01-01

We characterized 67 Escherichia coli isolates with reduced susceptibility to cefotaxime or ceftiofur obtained from healthy broilers housed in five Italian farms. The blaCTX-M-1, blaCTX-M-32 and blaSHV-12 β-lactamase genes were identified on IncI1, IncN, or IncFIB plasmids. Considerable genetic diversity was detected among the extended-spectrum β-lactamase (ESBL)-producing isolates, and we identified indistinguishable strains in unrelated farms and indistinguishable plasmids in genetically unrelated strains. The detection of highly mobile plasmids suggests a potential animal reservoir for β-lactamase genes. PMID:20100875

A novel approach for Escherichia coli genome editing combining in vivo cloning and targeted long-length chromosomal insertion.

PubMed

Hook, Ch D; Samsonov, V V; Ublinskaya, A A; Kuvaeva, T M; Andreeva, E V; Gorbacheva, L Yu; Stoynova, N V

2016-11-01

Despite the abundance of genetic manipulation approaches, particularly for Escherichia coli, new techniques and increased flexibility in the application of existing techniques are required to address novel aims. The most widely used approaches for chromosome editing are based on bacteriophage site-specific and λRed/RecET-mediated homologous recombination. In the present study, these techniques were combined to develop a novel approach for in vivo cloning and targeted long-length chromosomal insertion. This approach permits direct λRed-mediated cloning of DNA fragment with lengths of 10kb or greater from the E. coli chromosome into the plasmid vector pGL2, which carries the ori of pSC101, the ϕ80-attP site of ϕ80 phage, and an excisable Cm R marker bracketed by λ-attL/attR sites. In pGL2-based recombinant plasmids, the origin of replication can be eliminated in vitro via hydrolysis by SceI endonuclease and recircularization by DNA ligase. The resulting ori-less circular recombinant DNA can be used for targeted insertion of the cloned sequence into the chromosome at a selected site via ϕ80 phage-specific integrase-mediated recombination using the Dual-In/Out approach (Minaeva et al., 2008). At the final stage of chromosomal editing, the Cm R -marker can be excised from the chromosome due to expression of the λint/xis genes. Notably, the desired fragment can be inserted as multiple copies in the chromosome by combining insertions at different sites in one strain using the P1 general transduction technique (Moore, 2011). The developed approach is useful for the construction of plasmidless, markerless recombinant strains for fundamental and industrial purposes. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.

Development and preliminary application of an indirect ELISA for detecting antibodies against Avian Influenza Virus.

PubMed

Wang, G; Ding, J; Hu, S; Yang, X

2012-10-01

Fragment of 759 bp DNA spanning the Matrix 1 (M1) gene of Avian Influenza Virus (AIV) was inserted into an expression vector pET28c to construct a recombinant plasmid pET28c-M1. The pET28c-M1 plasmid was transformed into the Escherichia coli BL21 (DE3) competent cell to produce a recombinant strain E. coli 21 (DE3). After being induced by Isopropyl-b-D-galactopyranoside (IPTG), E. coli 21 (DE3) expressed a 28-kDa fusion protein at a high level. This protein can bind anti-AIV (H5N1) positive serum by Western-blot analysis. After being denatured, renatured, and purified by Ni(2+)-column, the fusion protein was used as an antigen to develop Matrix 1 Enzyme-Linked Immunosorbent Assay (M1-ELISA) for detecting antibodies against AIV from chicken serum. We found that this indirect M1-ELISA was sensitive for differentiating antisera against AIV and antisera against other six kinds of avian viruses apart from AIV and this method is more sensitive than Hemagglutination Inhibition (HI) test. When compared with HI test and ELISA (IDEXX) in evaluating 581 serum samples from field vaccinated chickens, this assay showed 93.3% agreement ratio with the HI test, as well as 96.0% agreement ratio with ELISA (IDEXX). In a preliminary application, the assay successfully detected 19 AIVs from 51 nonvaccinated chicken lungs. It concludes that an indirect ELISA was successfully developed for detecting AIV. The assay is specific and sensitive. The application will greatly contribute to the long-term prevention and control of avian influenza in China. Copyright © 2011 Elsevier Ltd. All rights reserved.

An unusual occurrence of plasmid-mediated blaOXA-23 carbapenemase in clinical isolates of Escherichia coli from India.

PubMed

Paul, Deepjyoti; Ingti, Birson; Bhattacharjee, Dibyojyoti; Maurya, Anand Prakash; Dhar, Debadatta; Chakravarty, Atanu; Bhattacharjee, Amitabha

2017-05-01

The bla OXA-23 group was considered as the first group of OXA-type β-lactamases conferring carbapenem resistance and has been reported worldwide in Acinetobacter baumannii, however their presence in Escherichia coli is very rare and unique. This study describes an unusual occurrence of bla OXA-23 in 14 clinical isolates of E. coli obtained from intensive care unit patients admitted to a tertiary referral hospital in India. The bla OXA-23 gene was found located within a self-conjugative plasmid of IncF rep B and IncK incompatibility types and simultaneously carrying bla CTX-M-15 , bla VEB-1 , bla PER-1 and/or bla NDM-1 . The copy number of bla OXA-23 within the IncK-type plasmid was inversely proportional to increasing concentrations of imipenem, whereas in the case of the IncF rep B-type the result was variable; and increased copy number of the IncK-type plasmid was observed with increasing concentrations of meropenem. Plasmids encoding bla OXA-23 could be successfully eliminated after single treatment and were found to be not highly stable, as complete loss of plasmids was observed within 5-10 days. This study emphasises that carbapenem stress invariably altered the copy number of two different Inc type plasmids encoding the bla OXA-23 resistance gene and also highlights a potential threat of clonal expansion of this class D carbapenemase through a heterologous host in this country, which is in second incidence globally. Copyright © 2017 Elsevier B.V. and International Society of Chemotherapy. All rights reserved.

Comparison of 2,4-Dichlorophenoxyacetic Acid Degradation and Plasmid Transfer in Soil Resulting from Bioaugmentation with Two Different pJP4 Donors

PubMed Central

Newby, D. T.; Gentry, T. J.; Pepper, I. L.

2000-01-01

A pilot field study was conducted to assess the impact of bioaugmentation with two plasmid pJP4-bearing microorganisms: the natural host, Ralstonia eutropha JMP134, and a laboratory-generated strain amenable to donor counterselection, Escherichia coli D11. The R. eutropha strain contained chromosomal genes necessary for mineralization of 2,4-dichlorophenoxyacetic acid (2,4-D), while the E. coli strain did not. The soil system was contaminated with 2,4-D alone or was cocontaminated with 2,4-D and Cd. Plasmid transfer to indigenous populations, plasmid persistence in soil, and degradation of 2,4-D were monitored over a 63-day period in the bioreactors. To assess the impact of contaminant reexposure, aliquots of bioreactor soil were reamended with additional 2,4-D. Both introduced donors remained culturable and transferred plasmid pJP4 to indigenous recipients, although to different extents. Isolated transconjugants were members of the Burkholderia and Ralstonia genera, suggesting multiple, if not successive, plasmid transfers. Upon a second exposure to 2,4-D, enhanced degradation was observed for all treatments, suggesting microbial adaptation to 2,4-D. Upon reexposure, degradation was most rapid for the E. coli D11-inoculated treatments. Cd did not significantly impact 2,4-D degradation or transconjugant formation. This study demonstrated that the choice of donor microorganism might be a key factor to consider for bioaugmentation efforts. In addition, the establishment of an array of stable indigenous plasmid hosts at sites with potential for reexposure or long-term contamination may be particularly useful. PMID:10919798

CrpP Is a Novel Ciprofloxacin-Modifying Enzyme Encoded by the Pseudomonas aeruginosa pUM505 Plasmid.

PubMed

Chávez-Jacobo, Víctor M; Hernández-Ramírez, Karen C; Romo-Rodríguez, Pamela; Pérez-Gallardo, Rocío Viridiana; Campos-García, Jesús; Gutiérrez-Corona, J Félix; García-Merinos, Juan Pablo; Meza-Carmen, Víctor; Silva-Sánchez, Jesús; Ramírez-Díaz, Martha I

2018-06-01

The pUM505 plasmid, isolated from a clinical Pseudomonas aeruginosa isolate, confers resistance to ciprofloxacin (CIP) when transferred into the standard P. aeruginosa strain PAO1. CIP is an antibiotic of the quinolone family that is used to treat P. aeruginosa infections. In silico analysis, performed to identify CIP resistance genes, revealed that the 65-amino-acid product encoded by the orf131 gene in pUM505 displays 40% amino acid identity to the Mycobacterium smegmatis aminoglycoside phosphotransferase (an enzyme that phosphorylates and inactivates aminoglycoside antibiotics). We cloned orf131 (renamed crpP , for c iprofloxacin r esistance p rotein, p lasmid encoded) into the pUCP20 shuttle vector. The resulting recombinant plasmid, pUC- crpP , conferred resistance to CIP on Escherichia coli strain J53-3, suggesting that this gene encodes a protein involved in CIP resistance. Using coupled enzymatic analysis, we determined that the activity of CrpP on CIP is ATP dependent, while little activity against norfloxacin was detected, suggesting that CIP may undergo phosphorylation. Using a recombinant His-tagged CrpP protein and liquid chromatography-tandem mass spectrometry, we also showed that CIP was phosphorylated prior to its degradation. Thus, our findings demonstrate that CrpP, encoded on the pUM505 plasmid, represents a new mechanism of CIP resistance in P. aeruginosa , which involves phosphorylation of the antibiotic. Copyright © 2018 American Society for Microbiology.

Identification and characterization of plasmid-mediated quinolone resistance determinants in Enterobacteriaceae isolated from healthy poultry in Brazil.

PubMed

Ferreira, Joseane Cristina; Penha Filho, Rafael Antonio Casarin; Kuaye, Ana Paula Yorika; Andrade, Leonardo Neves; Berchieri Junior, Angelo; Darini, Ana Lúcia da Costa

2018-06-01

The expression of plasmid-mediated quinolone resistance (PMQR) genes confers low-level quinolone and fluoroquinolones resistance alone. However, the association to chromosomal resistance mechanisms determines an expressively higher resistance in Enterobacteriaceae. These mechanisms are horizontally disseminated within plasmids and have contributed to the emergence of bacteria with reduced susceptibility or resistant to therapies worldwide. The epidemiological characterization of PMQR dissemination is highly relevant in the scientific and medical context, to investigate the dissemination within enterobacteria, from different populations, including humans and food-producing animals. In the present study, 200 Enterobacteriaceae isolates were harvested from poultry with cloacal swabs and identified as Escherichia coli (90.5%), Escherichia fergusonii (5.5%), Klebsiella oxytoca (2.5%) and Klebsiella pneumoniae (1.5%). Among isolates evaluated, 46 (23%) harboured PMQR genes including qnrB (43/200), qnrS (2/200) and aac(6')-Ib-cr (1/200). All isolates carrying PMQR genes showed multidrug-resistance phenotype. The 36 E. coli isolates showed 18 different PFGE types. All E. fergusonii isolates showed the same PFGE type. The two Klebsiella oxytoca belonged to two different PFGE types. The phylogenetic groups A, B1, and D were found among the E. coli harboring PMQR genes. Based on the phylogenetic analysis and PFGE, the population structure of E. coli isolates was diverse, even within the same farm. All isolates carrying qnrB and qnrS genes also harboured ColE-like plasmids. The Southern blot hybridization using the S1-PFGE revealed that the qnrB genes were located on low molecular weight plasmids, smaller than 10Kb. Resistance plasmids were sequenced and showed 100% identity with plasmid pPAB19-3. The association of PMQR genes with mobile genetic elements, such as transferable plasmids, favours the selection and dissemination of (fluoro) quinolones resistant bacteria among food-producing animals, and may play an important role in the current increased prevalence of resistant bacteria in different environments reported worldwide. Copyright © 2018. Published by Elsevier B.V.

Occurrence of the Plasmid-Mediated Fluoroquinolone Resistance qepA1 Gene in Two Clonal Clinical Isolates of CTX-M-15-Producing Escherichia coli from Algeria.

PubMed

Yanat, Betitera; Dali Yahia, Radia; Yazi, Leila; Machuca, Jesús; Díaz-De-Alba, Paula; Touati, Abdelaziz; Pascual, Álvaro; Rodríguez-Martínez, José-Manuel

2017-06-01

QepA is a plasmid-mediated quinolone resistance determinant of low prevalence described worldwide, mainly in Enterobacteriaceae. This study describes, for the first time in Algeria, two clonally related, QepA-producing Escherichia coli clinical isolates positive for CTX-M-15. The clonal spread of these multidrug-resistant isolates is a major public health concern.

Large IncHI2-plasmids encode extended-spectrum β-lactamases (ESBLs) in Enterobacter spp. bloodstream isolates, and support ESBL-transfer to Escherichia coli.

PubMed

Nilsen, E; Haldorsen, B C; Sundsfjord, A; Simonsen, G S; Ingebretsen, A; Naseer, U; Samuelsen, O

2013-11-01

We investigated the prevalence of extended-spectrum β-lactamases (ESBLs) in Enterobacter spp. bloodstream isolates from 19 hospital laboratories in Norway during 2011. A total of 62/230 (27%) isolates were resistant to third-generation cephalosporins and four (1.7%) were ESBL-positive; blaCTX -M-15 (n = 3) and blaSHV -12 (n = 1). This is comparable to the prevalence of ESBLs in clinical isolates of Escherichia coli and Klebsiella pneumoniae in Norway during the same period. All ESBL-positive isolates were multidrug resistant (MDR) and harboured plasmid-mediated quinolone resistance. Three isolates supported transfer of large IncHI2-plasmids harbouring ESBL- and MDR-encoding genes to E. coli recipients by in vitro conjugation. © 2013 The Authors Clinical Microbiology and Infection © 2013 European Society of Clinical Microbiology and Infectious Diseases.

Novel gyrA point mutation in a strain of Escherichia coli resistant to fluoroquinolones but not to nalidixic acid.

PubMed

Cambau, E; Bordon, F; Collatz, E; Gutmann, L

1993-06-01

We have previously described a clinical isolate of Escherichia coli (Q2) that is highly resistant to fluoroquinolones (MIC of ciprofloxacin, 16 micrograms/ml) but susceptible to nalidixic acid (MIC of nalidixic acid, 4 micrograms/ml) (N. Moniot-Ville, J. Guibert, N. Moreau, J.F. Acar, E. Collatz, and L. Gutmann, Antimicrob. Agents Chemother. 35:519-523, 1991). Transformation of strain Q2 with a plasmid carrying the wild-type gyrA gene from E. coli K-12(pAFF801) resulted in a 32-fold decrease in the MIC of ciprofloxacin, suggesting that at least one mutation in gyrA was involved in the resistance of Q2. Intragenic gyrA fragments of 668 and 2,500 bp from strain Q2 were amplified by the polymerase chain reaction. We sequenced the 668-bp fragment and identified a single novel point mutation (transition from G to A at position 242), leading to an amino acid substitution (Gly-81 to Asp) in the gyrase A subunit. We constructed hybrid plasmids by substituting either the 668-bp fragment or the 2,500-bp fragment from Q2 DNA, both of which contained the gyrA point mutation, for the corresponding fragments in wild-type gyrA (2,625 bp) of E. coli K-12. When introduced into E. coli KNK453 (gyrA temperature sensitive), both plasmids conferred an eightfold increase in the MIC of ciprofloxacin, but only a twofold increase in the MIC of nalidixic acid. When introduced into E. coli Q2, neither plasmid conferred any change in the MICs of ciprofloxacin or nalidixic acid, suggesting that only the point mutation found in gyrA was involved in the resistance that we observed.

Transformation of NIH3T3 Cells with Synthetic c‐Ha‐ras Genes

PubMed Central

Kamiya, Hiroyuki; Miura, Kazunobu; Ohtomo, Noriko; Koda, Toshiaki; Kakinuma, Mitsuaki; Nishimura, Susumu

1989-01-01

Synthetic human c‐Ha‐ras genes in which amino acid codons were altered to those which are frequently used in highly expressed Escherichia coli genes were ligated to the 3′‐end of Rous sarcoma virus long terminal repeat. When NIH3T3 cells were transfected with the plasmids having those genes with valine at codon 12, leucine at codon 61 or arginine at codon 61, transformants were efficiently produced. These results indicated that the synthetic c‐Ha‐ras genes are expressed in a mammalian system even though their codon usage is altered to correspond with that of E. colt. This expression vector system should he useful for studies on the structure‐function relationships of c‐Ha‐ras, since the synthetic gene can be easily modified to have multiple base alterations, and can also be used simultaneously for the production of large amounts of p21 in E. coli for biochemical and biophysical studies. PMID:2542206

Development of potent in vivo mutagenesis plasmids with broad mutational spectra

PubMed Central

Badran, Ahmed H.; Liu, David R.

2015-01-01

Methods to enhance random mutagenesis in cells offer advantages over in vitro mutagenesis, but current in vivo methods suffer from a lack of control, genomic instability, low efficiency and narrow mutational spectra. Using a mechanism-driven approach, we created a potent, inducible, broad-spectrum and vector-based mutagenesis system in E. coli that enhances mutation 322,000-fold over basal levels, surpassing the mutational efficiency and spectra of widely used in vivo and in vitro methods. We demonstrate that this system can be used to evolve antibiotic resistance in wild-type E. coli in <24 h, outperforming chemical mutagens, ultraviolet light and the mutator strain XL1-Red under similar conditions. This system also enables the continuous evolution of T7 RNA polymerase variants capable of initiating transcription using the T3 promoter in <10 h. Our findings enable broad-spectrum mutagenesis of chromosomes, episomes and viruses in vivo, and are applicable to both bacterial and bacteriophage-mediated laboratory evolution platforms. PMID:26443021

Development of potent in vivo mutagenesis plasmids with broad mutational spectra.

PubMed

Badran, Ahmed H; Liu, David R

2015-10-07

Methods to enhance random mutagenesis in cells offer advantages over in vitro mutagenesis, but current in vivo methods suffer from a lack of control, genomic instability, low efficiency and narrow mutational spectra. Using a mechanism-driven approach, we created a potent, inducible, broad-spectrum and vector-based mutagenesis system in E. coli that enhances mutation 322,000-fold over basal levels, surpassing the mutational efficiency and spectra of widely used in vivo and in vitro methods. We demonstrate that this system can be used to evolve antibiotic resistance in wild-type E. coli in <24 h, outperforming chemical mutagens, ultraviolet light and the mutator strain XL1-Red under similar conditions. This system also enables the continuous evolution of T7 RNA polymerase variants capable of initiating transcription using the T3 promoter in <10 h. Our findings enable broad-spectrum mutagenesis of chromosomes, episomes and viruses in vivo, and are applicable to both bacterial and bacteriophage-mediated laboratory evolution platforms.

Conjugal Transfer of R-Plasmid R1drd-19 in Escherichia coli Below 22°C

PubMed Central

Singleton, Paul; Anson, Avril E.

1981-01-01

The conjugal transfer of R-plasmids is known to occur at temperatures above 22°C. We found that R1drd-19 is transferable below 22°C, and we discuss this finding in the context of plasmid transfer in environmental waters. PMID:7032420

A novel, easy and rapid method for constructing yeast two-hybrid vectors using In-Fusion technology.

PubMed

Yu, Deshui; Liao, Libing; Zhang, Ju; Zhang, Yi; Xu, Kedong; Liu, Kun; Li, Xiaoli; Tan, Guangxuan; Chen, Ran; Wang, Yulu; Liu, Xia; Zhang, Xuan; Han, Xiaomeng; Wei, Zhangkun; Li, Chengwei

2018-05-01

Yeast two-hybrid systems are powerful tools for analyzing interactions between proteins. Vector construction is an essential step in yeast two-hybrid experiments, which require bait and prey plasmids. In this study, we modified the multiple cloning site sequence of the yeast plasmid pGADT7 by site-directed mutagenesis PCR to generate the pGADT7-In vector, which resulted in an easy and rapid method for constructing yeast two-hybrid vectors using the In-Fusion cloning technique. This method has three key advantages: only one pair of primers and one round of PCR are needed to generate bait and prey plasmids for each gene, it is restriction endonuclease- and ligase-independent, and it is fast and easily performed.

Reprint of "versatile and stable vectors for efficient gene expression in Ralstonia eutropha H16".

PubMed

Gruber, Steffen; Hagen, Jeremias; Schwab, Helmut; Koefinger, Petra

2014-12-20

The Gram-negative β-proteobacterium Ralstonia eutropha H16 is primarily known for polyhydroxybutyrate (PHB) production and its ability to grow chemolithoautotrophically by using CO2 and H2 as sole carbon and energy sources. The majority of metabolic engineering and heterologous expression studies conducted so far rely on a small number of suitable expression systems. Particularly the plasmid based expression systems already developed for the use in R. eutropha H16 suffer from high segregational instability and plasmid loss after a short time of fermentation. In order to develop efficient and highly stable plasmid expression vectors for the use in R. eutropha H16, a new plasmid design was created including the RP4 partitioning system, as well as various promoters and origins of replication. The application of minireplicons derived from broad-host-range plasmids RSF1010, pBBR1, RP4 and pSa for the construction of expression vectors and the use of numerous, versatile promoters extend the range of feasible expression levels considerably. In particular, the use of promoters derived from the bacteriophage T5 was described for the first time in this work, characterizing the j5 promoter as the strongest promoter yet to be applied in R. eutropha H16. Moreover, the implementation of the RP4 partition sequence in plasmid design increased plasmid stability significantly and enables fermentations with marginal plasmid loss of recombinant R. eutropha H16 for at least 96h. The utility of the new vector family in R. eutropha H16 is demonstrated by providing expression data with different model proteins and consequently further raises the value of this organism as cell factory for biotechnological applications including protein and metabolite production. Copyright © 2014 Elsevier B.V. All rights reserved.

Versatile and stable vectors for efficient gene expression in Ralstonia eutropha H16.

PubMed

Gruber, Steffen; Hagen, Jeremias; Schwab, Helmut; Koefinger, Petra

2014-09-30

The Gram-negative β-proteobacterium Ralstonia eutropha H16 is primarily known for polyhydroxybutyrate (PHB) production and its ability to grow chemolithoautotrophically by using CO2 and H2 as sole carbon and energy sources. The majority of metabolic engineering and heterologous expression studies conducted so far rely on a small number of suitable expression systems. Particularly the plasmid based expression systems already developed for the use in R. eutropha H16 suffer from high segregational instability and plasmid loss after a short time of fermentation. In order to develop efficient and highly stable plasmid expression vectors for the use in R. eutropha H16, a new plasmid design was created including the RP4 partitioning system, as well as various promoters and origins of replication. The application of minireplicons derived from broad-host-range plasmids RSF1010, pBBR1, RP4 and pSa for the construction of expression vectors and the use of numerous, versatile promoters extend the range of feasible expression levels considerably. In particular, the use of promoters derived from the bacteriophage T5 was described for the first time in this work, characterizing the j5 promoter as the strongest promoter yet to be applied in R. eutropha H16. Moreover, the implementation of the RP4 partition sequence in plasmid design increased plasmid stability significantly and enables fermentations with marginal plasmid loss of recombinant R. eutropha H16 for at least 96 h. The utility of the new vector family in R. eutropha H16 is demonstrated by providing expression data with different model proteins and consequently further raises the value of this organism as cell factory for biotechnological applications including protein and metabolite production. Copyright © 2014 Elsevier B.V. All rights reserved.

New restriction enzymes discovered from Escherichia coli clinical strains using a plasmid transformation method

PubMed Central

Kasarjian, Julie K. A.; Iida, Masatake; Ryu, Junichi

2003-01-01

The presence of restriction enzymes in bacterial cells has been predicted by either classical phage restriction-modification (R-M) tests, direct in vitro enzyme assays or more recently from bacterial genome sequence analysis. We have applied phage R-M test principles to the transformation of plasmid DNA and established a plasmid R-M test. To validate this test, six plasmids that contain BamHI fragments of phage lambda DNA were constructed and transformed into Escherichia coli strains containing known R-M systems including: type I (EcoBI, EcoAI, Eco124I), type II (HindIII) and type III (EcoP1I). Plasmid DNA with a single recognition site showed a reduction of relative efficiency of transformation (EOT = 10–1–10–2). When multiple recognition sites were present, greater reductions in EOT values were observed. Once established in the cell, the plasmids were subjected to modification (EOT = 1.0). We applied this test to screen E.coli clinical strains and detected the presence of restriction enzymes in 93% (14/15) of cells. Using additional subclones and the computer program, RM Search, we identified four new restriction enzymes, Eco377I, Eco585I, Eco646I and Eco777I, along with their recognition sequences, GGA(8N)ATGC, GCC(6N)TGCG, CCA(7N)CTTC, and GGA(6N)TATC, respectively. Eco1158I, an isoschizomer of EcoBI, was also found in this study. PMID:12595571

Dcm methylation is detrimental to plasmid transformation in Clostridium thermocellum

DOE Office of Scientific and Technical Information (OSTI.GOV)

Guss, Adam M; Olson, Daniel G.; Caiazza, Nicky

2012-01-01

BACKGROUND: Industrial production of biofuels and other products by cellulolytic microorganisms is of interest but hindered by the nascent state of genetic tools. Although a genetic system for Clostridium thermocellum DSM1313 has recently been developed, available methods achieve relatively low efficiency and similar plasmids can transform C. thermocellum at dramatically different efficiencies. RESULTS: We report an increase in transformation efficiency of C. thermocellum for a variety of plasmids by using DNA that has been methylated by Escherichia coli Dam but not Dcm methylases. When isolated from a dam+ dcm+ E. coli strain, pAMG206 transforms C. thermocellum 100-fold better than themore » similar plasmid pAMG205, which contains an additional Dcm methylation site in the pyrF gene. Upon removal of Dcm methylation, transformation with pAMG206 showed a four- to seven-fold increase in efficiency; however, transformation efficiency of pAMG205 increased 500-fold. Removal of the Dcm methylation site from the pAM205 pyrF gene via silent mutation resulted in increased transformation efficiencies equivalent to that of pAMG206. Upon proper methylation, transformation efficiency of plasmids bearing the pMK3 and pB6A origins of replication increased ca. three orders of magnitude. CONCLUSION: E. coli Dcm methylation decreases transformation efficiency in C. thermocellum DSM1313. The use of properly methylated plasmid DNA should facilitate genetic manipulation of this industrially relevant bacterium.« less

Properties of new Escherichia coli Hfr strains constructed by integration of pSC101-derived conjugative plasmids.

PubMed Central

François, V; Conter, A; Louarn, J M

1990-01-01

Conjugative temperature-sensitive plasmids were derived from pSC101. These plasmids are useful in genetic analysis for two reasons: (i) they render possible the construction of new Hfr lines by plasmid integration at predetermined chromosomal loci via Tn10 inverse transposition, and (ii) the Hfr characters are transducible via bacteriophage P1. We also showed that replication from pSC101 origin is deleterious for the plasmid-chromosome fusion. PMID:2155201

Metronidazole activation and isolation of Clostridium acetobutylicum electron transport genes.

PubMed Central

Santangelo, J D; Jones, D T; Woods, D R

1991-01-01

An Escherichia coli F19 recA, nitrate reductase-deficient mutant was constructed by transposon mutagenesis and shown to be resistant to metronidazole. This mutant was a most suitable host for the isolation of Clostridium acetobutylicum genes on recombinant plasmids, which activated metronidazole and rendered the E. coli F19 strain sensitive to metronidazole. Twenty-five E. coli F19 clones containing different recombinant plasmids were isolated and classified into five groups on the basis of their sensitivity to metronidazole. The clones were tested for nitrate reductase, pyruvate-ferredoxin oxidoreductase, and hydrogenase activities. DNA hybridization and restriction endonuclease mapping revealed that four of the C. acetobutylicum insert DNA fragments on recombinant plasmids were linked in an 11.1-kb chromosomal fragment. DNA sequencing and amino acid homology studies indicated that this DNA fragment contained a flavodoxin gene which encoded a protein of 160 amino acids that activated metronidazole and made the E. coli F19 mutant very sensitive to metronidazole. The flavodoxin and hydrogenase genes which are involved in electron transfer systems were linked on the 11.1-kb DNA fragment from C. acetobutylicum. Images PMID:1991710

Dichromatic laser radiation effects on DNA of Escherichia coli and plasmids

NASA Astrophysics Data System (ADS)

Martins, W. A.; Polignano, G. A. C.; Guimarães, O. R.; Geller, M.; Paoli, F.; Fonseca, A. S.

2015-04-01

Dichromatic and consecutive laser radiations have attracted increased attention for clinical applications as offering new tools for the treatment of dysfunctional tissues in situations where monochromatic radiation is not effective. This work evaluated the survival, filamentation and morphology of Escherichia coli cells, and the induction of DNA lesions, in plasmid DNA exposed to low-intensity consecutive dichromatic laser radiation. Exponential and stationary wild type and formamidopyrimidine DNA glycosylase/MutM protein deficient E. coli cultures were exposed to consecutive low-intensity dichromatic laser radiation (infrared laser immediately after red laser) to study the survival, filamentation and morphology of bacterial cells. Plasmid DNA samples were exposed to dichromatic radiation to study DNA lesions by electrophoretic profile. Dichromatic laser radiation affects the survival, filamentation and morphology of E. coli cultures depending on the growth phase and the functional repair mechanism of oxidizing lesions in DNA, but does not induce single/double strands breaks or alkali-labile DNA lesions. Results show that low-intensity consecutive dichromatic laser radiation induces biological effects that differ from those induced by monochromatic laser radiation, suggesting that other therapeutic effects could be obtained using dichromatic radiation.

[Construction of plant expression plasmid of chimera SBR-CT delta A1].

PubMed

Mai, Sui; Ling, Junqi

2003-08-01

The purpose of this study is to construct plant expression plasmid containing the gene encoding chimera SBR-CT delta A1. The target gene fragment P2, including the gene-encoded chimera SBR-CT delta A1 (3,498-5,378 bp), was obtained by standard PCR amplification. The PCR products were ligated with pGEM-easy vector through TA clone to form plasmid pTSC. The plasmid pTSC and plasmid pPOKII were digested by restricted endonuclease BamHI and KpnI, and the digested products were extracted and purified for recombination. Then the purified P2 and plasmid pPOKII were recombined by T4 DNA ligase to form recombinant plasmid pROSC; inserting bar gene into the plasmid and form pROSB plasmid. The recombined plasmids were isolated and identified by restricted endonuclease cutting and Sanger dideoxy DNA sequencing. P2 gene was linked to pPOKII plasmid and formed recombinant plasmid pROSC. The DNA sequence and orientation were corrected. And bar gene was inserted into pPOSC and form recombinant plasmid pROSB. Plant expression vector pROSC and pROSB containing the gene encoding chimera SBR-CT delta A1, which may provide useful experiment foundation for further study on edible vaccine against caries have been successfully constructed.

Plasmid DNA production combining antibiotic-free selection, inducible high yield fermentation, and novel autolytic purification.

PubMed

Carnes, Aaron E; Hodgson, Clague P; Luke, Jeremy M; Vincent, Justin M; Williams, James A

2009-10-15

DNA vaccines and gene medicines, derived from bacterial plasmids, are emerging as an important new class of pharmaceuticals. However, the challenges of performing cell lysis processes for plasmid DNA purification at an industrial scale are well known. To address downstream purification challenges, we have developed autolytic Escherichia coli host strains that express endolysin (phage lambdaR) in the cytoplasm. Expression of the endolysin is induced during fermentation by a heat inducible promoter. The endolysin remains in the cytoplasm, where it is separated from its peptidoglycan substrate in the cell wall; hence the cells remain alive and intact and can be harvested by the usual methods. The plasmid DNA is then recovered by autolytic extraction under slightly acidic, low salt buffer conditions and treatment with a low concentration of non-ionic detergent. Under these conditions the E. coli genomic DNA remains associated with the insoluble cell debris and is removed by a solid-liquid separation. Here, we report fermentation, lysis methods, and plasmid purification using autolytic hosts.

Longevity of rAAV vector and plasmid DNA in blood after intramuscular injection in nonhuman primates: implications for gene doping.

PubMed

Ni, W; Le Guiner, C; Gernoux, G; Penaud-Budloo, M; Moullier, P; Snyder, R O

2011-07-01

Legitimate uses of gene transfer technology can benefit from sensitive detection methods to determine vector biodistribution in pre-clinical studies and in human clinical trials, and similar methods can detect illegitimate gene transfer to provide sports-governing bodies with the ability to maintain fairness. Real-time PCR assays were developed to detect a performance-enhancing transgene (erythropoietin, EPO) and backbone sequences in the presence of endogenous cellular sequences. In addition to developing real-time PCR assays, the steps involved in DNA extraction, storage and transport were investigated. By real-time PCR, the vector transgene is distinguishable from the genomic DNA sequence because of the absence of introns, and the vector backbone can be identified by heterologous gene expression control elements. After performance of the assays was optimized, cynomolgus macaques received a single dose by intramuscular (IM) injection of plasmid DNA, a recombinant adeno-associated viral vector serotype 1 (rAAV1) or a rAAV8 vector expressing cynomolgus macaque EPO. Macaques received a high plasmid dose intended to achieve a significant, but not life-threatening, increase in hematocrit. rAAV vectors were used at low doses to achieve a small increase in hematocrit and to determine the limit of sensitivity for detecting rAAV sequences by single-step PCR. DNA extracted from white blood cells (WBCs) was tested to determine whether WBCs can be collaterally transfected by plasmid or transduced by rAAV vectors in this context, and can be used as a surrogate marker for gene doping. We demonstrate that IM injection of a conventional plasmid and rAAV vectors results in the presence of DNA that can be detected at high levels in blood before rapid elimination, and that rAAV genomes can persist for several months in WBCs.

Dissemination of blaNDM-5 gene via an IncX3-type plasmid among non-clonal Escherichia coli in China.

PubMed

Li, Xi; Fu, Ying; Shen, Mengyuan; Huang, Danyan; Du, Xiaoxing; Hu, Qingfeng; Zhou, Yonglie; Wang, Dairong; Yu, Yunsong

2018-01-01

The emergence and spread of New Delhi metallo-β-lactamase-producing Enterobacteriaceae has been a serious challenge to manage in the clinic due to its rapid dissemination of multi-drug resistance worldwide. As one main type of carbapenemases, New Delhi metallo-β-lactamase (NDM)is able to confer resistance to almost all β-lactams, including carbapenems, in Enterobacteriaceae . Recently, New Delhi metallo-β-lactamase-5 attracted extensive attention because of increased resistance to carbapenems and widespread dissemination. However, the dissemination mechanism of bla NDM-5 gene remains unclear. A total of 224 carbapenem-resistant Enterobacteriaceae isolates (CRE) were collected from different hospitals in Zhejiang province. NDM-5-positive isolates were identified and subjected to genotyping, susceptibility testing, and clinical data analysis. We established the genetic location of bla NDM-5 with southern blot hybridisation, and analysed plasmids containing bla NDM-5 with filter mating and DNA sequencing. Eleven New Delhi metallo-β-lactamase-5 (NDM-5)-producing strains were identified, including 9 Escherichia coli strains, 1 Klebsiella pneumoniae strain, and 1 Citrobacter freundii strain. No epidemiological links for E. coli isolates were identified by multilocus sequence typing (MLST) and pulsed-field gel electrophoresis (PFGE). S1-PFGE and southern blot suggested that the bla NDM-5 gene was located on a 46-kb IncX3-type plasmid in all isolates. Nine of the 11 isolates (81.8%) tested could successfully transfer their carbapenem-resistant phenotype to E. coli strain C600. Moreover, sequence analysis further showed that this plasmid possessed high sequence similarity to most of previously reported bla NDM-5 -habouring plasmids in China. The present data in this study showed the IncX3 type plasmid played an important role in the dissemination of bla NDM-5 in Enterobacteriaceae . In addition, to the best of our knowledge, this report is the first to isolate both E. coli and C. freundii strains carrying bla NDM-5 from one single patient, which further indicated the possibility of bla NDM-5 transmission among diverse species. Close surveillance is urgently needed to monitor the further dissemination of NDM-5-producing isolates.

Effects of Halides on Plasmid-Mediated Silver Resistance in Escherichia coli

PubMed Central

Gupta, Amit; Maynes, Maria; Silver, Simon

1998-01-01

Silver resistance of sensitive Escherichia coli J53 and resistance plasmid-containing J53(pMG101) was affected by halides in the growth medium. The effects of halides on Ag+ resistance were measured with AgNO3 and silver sulfadiazine, both on agar and in liquid. Low concentrations of chloride made the differences in MICs between sensitive and resistant strains larger. High concentrations of halides increased the sensitivities of both strains to Ag+. PMID:9835606

Effects of halides on plasmid-mediated silver resistance in Escherichia coli.

PubMed

Gupta, A; Maynes, M; Silver, S

1998-12-01

Silver resistance of sensitive Escherichia coli J53 and resistance plasmid-containing J53(pMG101) was affected by halides in the growth medium. The effects of halides on Ag+ resistance were measured with AgNO3 and silver sulfadiazine, both on agar and in liquid. Low concentrations of chloride made the differences in MICs between sensitive and resistant strains larger. High concentrations of halides increased the sensitivities of both strains to Ag+.

Properties of an R Factor from Pseudomonas aeruginosa

PubMed Central

Datta, Naomi; Hedges, R. W.; Shaw, Elizabeth J.; Sykes, R. B.; Richmond, M. H.

1971-01-01

An R factor from Pseudomonas aeruginosa, which confers resistance to penicillins, kanamycin, and tetracycline, was studied in Escherichia coli K-12. The R factor could coexist with F-like or I-like plasmids and therefore constituted a novel compatibility group. The R factor was transferable from E. coli to bacterial genera outside the Enterobacteriaceae (Pseudomonas and members of the Rhizobiaceae) to which transfer of F-like and I-like plasmids could not be demonstrated. PMID:4945193

Change in the plasmid copy number in acetic acid bacteria in response to growth phase and acetic acid concentration.

PubMed

Akasaka, Naoki; Astuti, Wiwik; Ishii, Yuri; Hidese, Ryota; Sakoda, Hisao; Fujiwara, Shinsuke

2015-06-01

Plasmids pGE1 (2.5 kb), pGE2 (7.2 kb), and pGE3 (5.5 kb) were isolated from Gluconacetobacter europaeus KGMA0119, and sequence analyses revealed they harbored 3, 8, and 4 genes, respectively. Plasmid copy numbers (PCNs) were determined by real-time quantitative PCR at different stages of bacterial growth. When KGMA0119 was cultured in medium containing 0.4% ethanol and 0.5% acetic acid, PCN of pGE1 increased from 7 copies/genome in the logarithmic phase to a maximum of 12 copies/genome at the beginning of the stationary phase, before decreasing to 4 copies/genome in the late stationary phase. PCNs for pGE2 and pGE3 were maintained at 1-3 copies/genome during all phases of growth. Under a higher concentration of ethanol (3.2%) the PCN for pGE1 was slightly lower in all the growth stages, and those of pGE2 and pGE3 were unchanged. In the presence of 1.0% acetic acid, PCNs were higher for pGE1 (10 copies/genome) and pGE3 (6 copies/genome) during the logarithmic phase. Numbers for pGE2 did not change, indicating that pGE1 and pGE3 increase their PCNs in response to acetic acid. Plasmids pBE2 and pBE3 were constructed by ligating linearized pGE2 and pGE3 into pBR322. Both plasmids were replicable in Escherichia coli, Acetobacter pasteurianus and G. europaeus, highlighting their suitability as vectors for acetic acid bacteria. Copyright © 2014 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

ColE1-Plasmid Production in Escherichia coli: Mathematical Simulation and Experimental Validation.

PubMed

Freudenau, Inga; Lutter, Petra; Baier, Ruth; Schleef, Martin; Bednarz, Hanna; Lara, Alvaro R; Niehaus, Karsten

2015-01-01

Plasmids have become very important as pharmaceutical gene vectors in the fields of gene therapy and genetic vaccination in the past years. In this study, we present a dynamic model to simulate the ColE1-like plasmid replication control, once for a DH5α-strain carrying a low copy plasmid (DH5α-pSUP 201-3) and once for a DH5α-strain carrying a high copy plasmid (DH5α-pCMV-lacZ) by using ordinary differential equations and the MATLAB software. The model includes the plasmid replication control by two regulatory RNA molecules (RNAI and RNAII) as well as the replication control by uncharged tRNA molecules. To validate the model, experimental data like RNAI- and RNAII concentration, plasmid copy number (PCN), and growth rate for three different time points in the exponential phase were determined. Depending on the sampled time point, the measured RNAI- and RNAII concentrations for DH5α-pSUP 201-3 reside between 6 ± 0.7 and 34 ± 7 RNAI molecules per cell and 0.44 ± 0.1 and 3 ± 0.9 RNAII molecules per cell. The determined PCNs averaged between 46 ± 26 and 48 ± 30 plasmids per cell. The experimentally determined data for DH5α-pCMV-lacZ reside between 345 ± 203 and 1086 ± 298 RNAI molecules per cell and 22 ± 2 and 75 ± 10 RNAII molecules per cell with an averaged PCN of 1514 ± 1301 and 5806 ± 4828 depending on the measured time point. As the model was shown to be consistent with the experimentally determined data, measured at three different time points within the growth of the same strain, we performed predictive simulations concerning the effect of uncharged tRNA molecules on the ColE1-like plasmid replication control. The hypothesis is that these tRNA molecules would have an enhancing effect on the plasmid production. The in silico analysis predicts that uncharged tRNA molecules would indeed increase the plasmid DNA production.

Molecular Characterization of Plasmids Encoding CTX-M β-Lactamases and their Associated Addiction Systems Circulating Among Escherichia coli from Retail Chickens, Chicken Farms, and Slaughterhouses in Korea.

PubMed

Jo, Su-Jin; Woo, Gun-Jo

2016-02-01

Extended-spectrum β-lactamases (ESBLs), particularly those of the CTX-M types, are the predominant resistance determinants of Escherichia coli that are rapidly spreading worldwide. To determine CTX-M types, E. coli isolates were collected from retail chickens (n = 390) and environmental samples from chicken farms (n = 32) and slaughterhouses (n = 67) in Korea. Fifteen strains harboring blaCTX-M genes were isolated from 358 E. coli isolates. The most common CTX-M type was eight of CTX-M-15, followed by six of CTX-M-1 and one of CTX-M- 14. The blaCTX-M genes were identified in the isolates from retail chickens (n = 9), followed by feces, water pipes, floors, and walls. Conjugations confirmed the transferability of the plasmids carrying blaCTX-M genes to the recipient E. coli J53 strain. Furthermore, eight addiction systems carried by the replicons in CTX-M types were confirmed. The dominant system was identified as ccdAB, vagCD, and pndAC in donor strains and transconjugants. The clonal relationship between the two strains carrying blaCTX-M genes indicates that E. coli may transmit from the farm to retail chickens, suggesting a possible public health risk. Our findings demonstrate that the detection of CTX-M types in E. coli isolates is important for tracking ESBL production in animals, and suggest linkage of multiple addiction systems in plasmids bearing blaCTX-M genes.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Finnerty, W.R.

We have sought the structural elucidation of the glycolipid biosurfactant. The extracellular glycolipid consists of 1 major component (>90%) plus 6--7 minor molecular species. The deacylated water-soluble backbone is common to all molecular species of the glycolipid. A complex fatty acid composition characterizes the glycolipid and contributes to its surface active character. The water soluble backbone consists of glycerol, trehalose and 3--5 glucose residues. FTIR spectroscopy has confirmed the presence of these polyhydric components. The next major objective has been to clone the genes for glycolipid biosynthesis in Rhodococcus sp. H13-A. Improvements in the E. coli-Rhodococcus shuttle vector, pMVS301, weremore » made prior to the construction and screening of a genomic library in Rhodococcus. A system is being developed for transpositional mutagenesis in Rhodococcus, using Tn917 containing plasmids used successfully in Bacillus sp. for the isolation and analysis of sporulation and developmental genes. We are also actively assessing the utility of this cloning and transformation system which we have developed for Rhodococcus, for use in mycobacterium, a related Actinomycete for which there exists no systems for plasmid transformation or molecular cloning. 8 refs., 1 fig.« less

Single molecule sequencing to track plasmid diversity of hospital-associated carbapenemase-producing Enterobacteriaceae

PubMed Central

Conlan, Sean; Thomas, Pamela J.; Deming, Clayton; Park, Morgan; Lau, Anna F.; Dekker, John P.; Snitkin, Evan S.; Clark, Tyson A.; Luong, Khai; Song, Yi; Tsai, Yu-Chih; Boitano, Matthew; Gupta, Jyoti; Brooks, Shelise Y.; Schmidt, Brian; Young, Alice C.; Thomas, James W.; Bouffard, Gerard G.; Blakesley, Robert W.; Mullikin, James C.; Korlach, Jonas; Henderson, David K.; Frank, Karen M.; Palmore, Tara N.; Segre, Julia A.

2014-01-01

Public health officials have raised concerns that plasmid transfer between Enterobacteriaceae species may spread resistance to carbapenems, an antibiotic class of last resort, thereby rendering common healthcare-associated infections nearly impossible to treat. We performed comprehensive surveillance and genomic sequencing to identify carbapenem-resistant Enterobacteriaceae in the NIH Clinical Center patient population and hospital environment in order to to articulate the diversity of carbapenemase-encoding plasmids and survey the mobility of and assess the mobility of these plasmids between bacterial species. We isolated a repertoire of carbapenemase-encoding Enterobacteriaceae, including multiple strains of Klebsiella pneumoniae, Klebsiella oxytoca, Escherichia coli, Enterobacter cloacae, Citrobacter freundii, and Pantoea species. Long-read genome sequencing with full end-to-end assembly revealed that these organisms carry the carbapenem-resistance genes on a wide array of plasmids. Klebsiella pneumoniae and Enterobacter cloacae isolated simultaneously from a single patient harbored two different carbapenemase-encoding plasmids, overriding the epidemiological scenario of plasmid transfer between organisms within this patient. We did, however, find evidence supporting horizontal transfer of carbapenemase-encoding plasmids between Klebsiella pneumoniae, Enterobacter cloacae and Citrobacter freundii in the hospital environment. Our comprehensive sequence data, with full plasmid identification, challenges assumptions about horizontal gene transfer events within patients and identified wider possible connections between patients and the hospital environment. In addition, we identified a new carbapenemase-encoding plasmid of potentially high clinical impact carried by Klebsiella pneumoniae, Escherichia coli, Enterobacter cloacae and Pantoea species, from unrelated patients and the hospital environment. PMID:25232178

Roles of Salmonella typhimurium umuDC and samAB in UV mutagenesis and UV sensitivity.

PubMed Central

Nohmi, T; Yamada, M; Watanabe, M; Murayama, S Y; Sofuni, T

1992-01-01

Expression of the umuDC operon is required for UV mutagenesis and most chemical mutagenesis in Escherichia coli. The closely related species Salmonella typhimurium has two sets of umuDC-like operons; the samAB operon is located in a 60-MDa cryptic plasmid, while the S. typhimurium umuDC (umuDCST) operon resides in a chromosome. The roles of these two umuDC-like operons in UV mutagenesis and UV sensitivity of S. typhimurium were investigated. A pBR322-derived plasmid carrying the samAB operon more efficiently restored UV mutability to a umuD44 strain and a umuC122::Tn5 strain of E. coli than a plasmid carrying the umuDCST operon did. When the umuDCST operon was specifically deleted from the chromosome of S. typhimurium TA2659, the resulting strain was not UV mutable and was more sensitive to the killing effect of UV irradiation than the parent strain was. Curing of the 60-MDa cryptic plasmid carrying the samAB operon did not influence the UV mutability of strain TA2659 but did increase its resistance to UV killing. A pSC101-derived plasmid carrying the samAB operon did not restore UV mutability to a umuD44 strain of E. coli, whereas pBR322- or pBluescript-derived plasmids carrying the samAB operon efficiently did restore UV mutability. We concluded that the umuDCST operon plays a major role in UV mutagenesis in S. typhimurium and that the ability of the samAB operon to promote UV mutagenesis is strongly affected by gene dosage. Possible reasons for the poor ability of samAB to promote UV mutagenesis when it is present on low-copy-number plasmids are discussed. Images PMID:1400244

Cloning, Expression, and Purification of Histidine-Tagged Escherichia coli Dihydrodipicolinate Reductase.

PubMed

Trigoso, Yvonne D; Evans, Russell C; Karsten, William E; Chooback, Lilian

2016-01-01

The enzyme dihydrodipicolinate reductase (DHDPR) is a component of the lysine biosynthetic pathway in bacteria and higher plants. DHDPR catalyzes the NAD(P)H dependent reduction of 2,3-dihydrodipicolinate to the cyclic imine L-2,3,4,5,-tetrahydropicolinic acid. The dapB gene that encodes dihydrodipicolinate reductase has previously been cloned, but the expression of the enzyme is low and the purification is time consuming. Therefore the E. coli dapB gene was cloned into the pET16b vector to improve the protein expression and simplify the purification. The dapB gene sequence was utilized to design forward and reverse oligonucleotide primers that were used to PCR the gene from Escherichia coli genomic DNA. The primers were designed with NdeI or BamHI restriction sites on the 5'and 3' terminus respectively. The PCR product was sequenced to confirm the identity of dapB. The gene was cloned into the expression vector pET16b through NdeI and BamHI restriction endonuclease sites. The resulting plasmid containing dapB was transformed into the bacterial strain BL21 (DE3). The transformed cells were utilized to grow and express the histidine-tagged reductase and the protein was purified using Ni-NTA affinity chromatography. SDS/PAGE gel analysis has shown that the protein was 95% pure and has approximate subunit molecular weight of 28 kDa. The protein purification is completed in one day and 3 liters of culture produced approximately 40-50 mgs of protein, an improvement on the previous protein expression and multistep purification.

Cloning, Expression, and Purification of Histidine-Tagged Escherichia coli Dihydrodipicolinate Reductase

PubMed Central

Trigoso, Yvonne D.; Evans, Russell C.; Karsten, William E.; Chooback, Lilian

2016-01-01

The enzyme dihydrodipicolinate reductase (DHDPR) is a component of the lysine biosynthetic pathway in bacteria and higher plants. DHDPR catalyzes the NAD(P)H dependent reduction of 2,3-dihydrodipicolinate to the cyclic imine L-2,3,4,5,-tetrahydropicolinic acid. The dapB gene that encodes dihydrodipicolinate reductase has previously been cloned, but the expression of the enzyme is low and the purification is time consuming. Therefore the E. coli dapB gene was cloned into the pET16b vector to improve the protein expression and simplify the purification. The dapB gene sequence was utilized to design forward and reverse oligonucleotide primers that were used to PCR the gene from Escherichia coli genomic DNA. The primers were designed with NdeI or BamHI restriction sites on the 5’and 3’ terminus respectively. The PCR product was sequenced to confirm the identity of dapB. The gene was cloned into the expression vector pET16b through NdeI and BamHI restriction endonuclease sites. The resulting plasmid containing dapB was transformed into the bacterial strain BL21 (DE3). The transformed cells were utilized to grow and express the histidine-tagged reductase and the protein was purified using Ni-NTA affinity chromatography. SDS/PAGE gel analysis has shown that the protein was 95% pure and has approximate subunit molecular weight of 28 kDa. The protein purification is completed in one day and 3 liters of culture produced approximately 40–50 mgs of protein, an improvement on the previous protein expression and multistep purification. PMID:26815040

Plasmids of corynebacteria.

PubMed

Deb, J K; Nath, N

1999-06-01

Corynebacteria are pleomorphic, asporogenous, Gram-positive bacteria. Included in this group are nonpathogenic soil corynebacteria, which are widely used for the industrial production of amino acids and detergents, and in biotransformation of steroids. Other members of this group are plant and animal pathogens. This review summarizes the current information available about the plasmids of corynebacteria. The emphasis is mainly on the small plasmids, which have been used for construction of vectors for expression of genes in these bacteria. Moreover, considerable information is now available on their nucleotide sequence, gene organization and modes of replication, which would make it possible to further manipulate these plasmids. Other plasmid properties, such as incompatibility and host range, are also discussed. Finally, use of these plasmids as cloning vectors for the expression of heterologous proteins using corynebacteria as hosts is also summarized to highlight the potential of these bacteria as hosts for recombinant DNA.

Uropathogenic Escherichia coli are less likely than paired fecal E. coli to have CRISPR loci.

PubMed

Dang, Trang Nguyen Doan; Zhang, Lixin; Zöllner, Sebastian; Srinivasan, Usha; Abbas, Khadija; Marrs, Carl F; Foxman, Betsy

2013-10-01

CRISPRs (Clustered Regularly Interspaced Short Palindromic Repeats) are short fragments of DNA that act as an adaptive immune system protecting bacteria against invasion by phages, plasmids or other forms of foreign DNA. Bacteria without a CRISPR locus may more readily adapt to environmental changes by acquiring foreign genetic material. Uropathogenic Escherichia coli (UPEC) live in a number of environments suggesting an ability to rapidly adapt to new environments. If UPEC are more adaptive than commensal E. coli we would expect that UPEC would have fewer CRISPR loci, and--if loci are present--that they would harbor fewer spacers than CRISPR loci in fecal E. coli. We tested this in vivo by comparing the number of CRISPR loci and spacers, and sensitivity to antibiotics (resistance is often obtained via plasmids) among 81 pairs of UPEC and fecal E. coli isolated from women with urinary tract infection. Each pair included one uropathogen and one commensal (fecal) sample from the same female patient. Fecal isolates had more repeats (p=0.009) and more unique spacers (p<0.0001) at four CRISPR loci than uropathogens. By contrast, uropathogens were more likely than fecal E. coli to be resistant to ampicillin, cefazolin and trimethoprim/sulfamethoxazole. However, no consistent association between CRISPRs and antibiotic resistance was identified. To our knowledge, this is the first study to compare fecal E. coli and pathogenic E. coli from the same individuals, and to test the association of CRISPR loci with antibiotic resistance. Our results suggest that the absence of CRISPR loci may make UPEC more susceptible to infection by phages or plasmids and allow them to adapt more quickly to various environments. Copyright © 2013 Elsevier B.V. All rights reserved.

Dynamics of CMY-2 producing E. coli in a broiler parent flock.

PubMed

Dame-Korevaar, Anita; Fischer, Egil A J; Stegeman, Arjan; Mevius, Dik; van Essen-Zandbergen, Alieda; Velkers, Francisca; van der Goot, Jeanet

2017-05-01

Extended-spectrum β-lactamase and plasmid mediated AmpC β-lactamase (ESBL/pAmpC) producing bacteria are resistant to Extended Spectrum Cephalosporins (ESC), and are present in all levels of the broiler production chain. We determined the prevalence, concentration, and persistence of ESBL/pAmpC-Escherichia coli in a broiler parent flock during the rearing and laying period. One-day old chickens were housed in four separate pens. Until week 33 no antibiotics or coccidiostatics were used. During rearing 57 chickens in each pen (n=228), and in the laying period two groups of 33 chickens were individually sampled (n=66). Environmental samples were taken from week 16 onwards. ESBL/pAmpC-E. coli presence was determined by selective culturing. In the samples of week 16-19 the concentration of ESBL/pAmpC-E. coli was determined. All ESC-resistant isolates found were positive for pAmpC gene bla CMY-2 located on IncA/C plasmids, in several E. coli MLST types. CMY-2-E. coli prevalence decreased from 91% (95%CI 86-94%) at day 7 (week 1) to 0% (95%CI 0-5%) in week 21. However, CMY-2-E. coli remained present in the environmental samples during the whole study. CMY-2-E. coli concentration varied between detection limit (<10^3) and 2·10^4 cfu/g faeces. The sharp reduction of CMY-2-E. coli in this broiler parent flock in absence of antibiotics suggests a selective disadvantage of bla CMY-2 on IncA/C plasmids on animal level. The underlying mechanism should be studied further as this may provide new insights on how to reduce ESBL/pAmpC prevalence and transmission in the broiler production chain. Copyright © 2017 Elsevier B.V. All rights reserved.

DNA adenine methylation is required to replicate both Vibrio cholerae chromosomes once per cell cycle.

PubMed

Demarre, Gaëlle; Chattoraj, Dhruba K

2010-05-06

DNA adenine methylation is widely used to control many DNA transactions, including replication. In Escherichia coli, methylation serves to silence newly synthesized (hemimethylated) sister origins. SeqA, a protein that binds to hemimethylated DNA, mediates the silencing, and this is necessary to restrict replication to once per cell cycle. The methylation, however, is not essential for replication initiation per se but appeared so when the origins (oriI and oriII) of the two Vibrio cholerae chromosomes were used to drive plasmid replication in E. coli. Here we show that, as in the case of E. coli, methylation is not essential for oriI when it drives chromosomal replication and is needed for once-per-cell-cycle replication in a SeqA-dependent fashion. We found that oriII also needs SeqA for once-per-cell-cycle replication and, additionally, full methylation for efficient initiator binding. The requirement for initiator binding might suffice to make methylation an essential function in V. cholerae. The structure of oriII suggests that it originated from a plasmid, but unlike plasmids, oriII makes use of methylation for once-per-cell-cycle replication, the norm for chromosomal but not plasmid replication.

Engineered Saccharomyces cerevisiae strain for improved xylose utilization with a three-plasmid SUMO yeast expression system

USDA-ARS?s Scientific Manuscript database

A three-plasmid yeast expression system utilizing the portable small ubiquitin-like modifier (SUMO) vector set combined with the efficient endogenous yeast protease Ulp1 was developed for production of large amounts of soluble functional protein in Saccharomyces cerevisiae. Each vector has a differ...

High-efficiency transformation of Pichia stipitis based on its URA3 gene and a homologous autonomous replication sequence, ARS2.

PubMed Central

Yang, V W; Marks, J A; Davis, B P; Jeffries, T W

1994-01-01

This paper describes the first high-efficiency transformation system for the xylose-fermenting yeast Pichia stipitis. The system includes integrating and autonomously replicating plasmids based on the gene for orotidine-5'-phosphate decarboxylase (URA3) and an autonomous replicating sequence (ARS) element (ARS2) isolated from P. stipitis CBS 6054. Ura- auxotrophs were obtained by selecting for resistance to 5-fluoroorotic acid and were identified as ura3 mutants by transformation with P. stipitis URA3. P. stipitis URA3 was cloned by its homology to Saccharomyces cerevisiae URA3, with which it is 69% identical in the coding region. P. stipitis ARS elements were cloned functionally through plasmid rescue. These sequences confer autonomous replication when cloned into vectors bearing the P. stipitis URA3 gene. P. stipitis ARS2 has features similar to those of the consensus ARS of S. cerevisiae and other ARS elements. Circular plasmids bearing the P. stipitis URA3 gene with various amounts of flanking sequences produced 600 to 8,600 Ura+ transformants per micrograms of DNA by electroporation. Most transformants obtained with circular vectors arose without integration of vector sequences. One vector yielded 5,200 to 12,500 Ura+ transformants per micrograms of DNA after it was linearized at various restriction enzyme sites within the P. stipitis URA3 insert. Transformants arising from linearized vectors produced stable integrants, and integration events were site specific for the genomic ura3 in 20% of the transformants examined. Plasmids bearing the P. stipitis URA3 gene and ARS2 element produced more than 30,000 transformants per micrograms of plasmid DNA. Autonomously replicating plasmids were stable for at least 50 generations in selection medium and were present at an average of 10 copies per nucleus. Images PMID:7811063

SapTrap, a Toolkit for High-Throughput CRISPR/Cas9 Gene Modification in Caenorhabditis elegans.

PubMed

Schwartz, Matthew L; Jorgensen, Erik M

2016-04-01

In principle, clustered regularly interspaced short palindromic repeats (CRISPR)/Cas9 allows genetic tags to be inserted at any locus. However, throughput is limited by the laborious construction of repair templates and guide RNA constructs and by the identification of modified strains. We have developed a reagent toolkit and plasmid assembly pipeline, called "SapTrap," that streamlines the production of targeting vectors for tag insertion, as well as the selection of modified Caenorhabditis elegans strains. SapTrap is a high-efficiency modular plasmid assembly pipeline that produces single plasmid targeting vectors, each of which encodes both a guide RNA transcript and a repair template for a particular tagging event. The plasmid is generated in a single tube by cutting modular components with the restriction enzyme SapI, which are then "trapped" in a fixed order by ligation to generate the targeting vector. A library of donor plasmids supplies a variety of protein tags, a selectable marker, and regulatory sequences that allow cell-specific tagging at either the N or the C termini. All site-specific sequences, such as guide RNA targeting sequences and homology arms, are supplied as annealed synthetic oligonucleotides, eliminating the need for PCR or molecular cloning during plasmid assembly. Each tag includes an embedded Cbr-unc-119 selectable marker that is positioned to allow concurrent expression of both the tag and the marker. We demonstrate that SapTrap targeting vectors direct insertion of 3- to 4-kb tags at six different loci in 10-37% of injected animals. Thus SapTrap vectors introduce the possibility for high-throughput generation of CRISPR/Cas9 genome modifications. Copyright © 2016 by the Genetics Society of America.

Cloning, expression, and purification of the virulence-associated protein D from Xylella fastidiosa.

PubMed

Catani, Cleide Ferreira; Azzoni, Adriano Rodrigues; Paula, Débora Pires; Tada, Susely Ferraz Siqueira; Rosselli, Luciana Kauer; de Souza, Anete Pereira; Yano, Tomomasa

2004-10-01

In this study, an efficient expression system, based on the pET32Xa/LIC vector, for producing a Xylella fastidiosa virulence-associated protein D, found to have a strong similarity to Riemerella anatipestifer and Actinobacillus actinomycetencomitans VapD protein, is presented. The protein has a molecular mass of 17.637 Da and a calculated pI of 5.49. The selected XFa0052 gene was cloned in the pET32Xa/LIC vector and the plasmid was transformed into Escherichia coli BL21 (DE3) strain at 37 degrees C, with an induction time of 2 h and 1 mM IPTG concentration. The protein present in the soluble fraction was purified by immobilized metal affinity chromatography (IMAC), and had its identity determined by mass spectrometry (MALDI-TOF) and N-terminal sequencing. The purified protein was found as a single band on SDS-PAGE and its correct folding was verified by circular dichroism spectroscopy.

Expression of the human blood coagulation protein factor XIIIa in Saccharomyces cerevisiae: dependence of the expression levels from host-vector systems and medium conditions.

PubMed

Bröker, M; Bäuml, O; Göttig, A; Ochs, J; Bodenbenner, M; Amann, E

1991-03-01

The human blood coagulation protein Factor XIIIa (FXIIIa) was expressed in Saccharomyces cerevisiae employing Escherichia coli-yeast shuttle vectors based on a 2-mu plasmid. Several factors affecting high production yield of recombinant FXIIIa were analysed. The use of the regulatable GAL-CYC1 hybrid promoter resulted in higher FXIIIa expression when compared with the constitutive ADCI promoter. Screening for suitable yeast strains for expression of FXIIIa under the transcriptional control of the GAL-CYC1 hybrid promoter revealed a broad spectrum of productivity. No obvious correlation between the expression rate and the genetic markers of the strains could be identified. The medium composition markedly influenced the FXIIIa expression rates. The expression of FXIIIa was strictly regulated by the carbon source. Glucose as the only sugar and energy source repressed the synthesis of FXIIIa, whereas addition of galactose induced FXIIIa expression. Special feeding schemes resulted in a productivity of up to 100 mg FXIIIa/l in shake flasks.

Selfish restriction modification genes: resistance of a resident R/M plasmid to displacement by an incompatible plasmid mediated by host killing.

PubMed

Naito, Y; Naito, T; Kobayashi, I

1998-01-01

Previous work from this laboratory demonstrated that plasmids carrying a type II restriction-modification gene complex are not easily lost from their bacterial host because plasmid-free segregant cells are killed through chromosome cleavage. Here, we have followed the course of events that takes place when an Escherichia coli rec BC sbcA strain carrying a plasmid coding for the PaeR7I restriction-modification (R/M) gene complex is transformed by a plasmid with an identical origin of replication. The number of transformants that appeared was far fewer than with the restriction-minus (r-) control. Most of the transformants were very small. After prolonged incubation, the number and the size of the colonies increased, but this increase never attained the level of the r- control. Most of the transformed colonies retained the drug-resistance of the resident, r+ m+ plasmid. These results indicate that post-segregational host killing occurs when a plasmid bearing an R/M gene complex is displaced by an incompatible plasmid. Such cell killing eliminates the competitor plasmid along with the host and, thus, would allow persistence of the R/M plasmid in the neighboring, clonal host cells in nature. This phenomenon is reminiscent of mammalian apoptosis and other forms of altruistic cell death strategy against infection. This type of resistance to displacement was also studied in a wild type Escherichia coli strain that was normal for homologous recombination (rec+). A number of differences between the recBC sbcA strain and the rec+ strain were observed and these will be discussed.

Genotypic Analysis of Escherichia coli Strains from Poultry Carcasses and Their Susceptibilities to Antimicrobial Agents

PubMed Central

Geornaras, Ifigenia; Hastings, John W.; von Holy, Alexander

2001-01-01

Plasmid profiling and amplified fragment length polymorphism (AFLP) analysis were used to genotype 50 Escherichia coli strains from poultry carcasses. Thirty different plasmid profiles were evident, and clustering of the AFLP data showed that they were a distinctly heterogeneous group of strains. Susceptibility testing against five antimicrobial agents used in the South African poultry industry showed all strains to be susceptible to danofloxacin and colistin, while the majority (96%) were resistant to two tetracyclines. PMID:11282652

First Report of an ST410 OXA-181 and CTX-M-15 Coproducing Escherichia coli Clone in Italy: A Whole-Genome Sequence Characterization.

PubMed

Piazza, Aurora; Comandatore, Francesco; Romeri, Francesca; Pagani, Cristina; Floriano, Anna Maria; Ridolfo, Annalisa; Antona, Carlo; Brilli, Matteo; Mattioni Marchetti, Vittoria; Bandi, Claudio; Gismondo, Maria Rita; Rimoldi, Sara Giordana

2018-02-23

We investigated an Italian OXA-181-producing Escherichia coli clinical isolate (ECS1_14) by whole-genome sequencing. The strain coharbored bla CTX-M-15 , bla CMY-2 , and qnrS1 genes; it belonged to ST410(Achtman)/ST692(Pasteur) and phylogroup A. The bla OXA-181 gene was harbored on a plasmid highly similar (99% identity) to the pOXA181_EC14828 plasmid, recently reported in China.

Distribution of Oxytetracycline Resistance Plasmids between Aeromonads in Hospital and Aquaculture Environments: Implication of Tn1721 in Dissemination of the Tetracycline Resistance Determinant Tet A

PubMed Central

Rhodes, Glenn; Huys, Geert; Swings, Jean; Mcgann, Patrick; Hiney, Maura; Smith, Peter; Pickup, Roger W.

2000-01-01

Oxytetracycline-resistant (OTr) mesophilic aeromonads were recovered from untreated hospital effluent (72 isolates) and from fish farm hatchery tanks (91 isolates) at sites within the English Lake District, Cumbria, England. The transfer of OTr plasmids from these isolates was investigated. Using Escherichia coli J53-1 as a recipient, 11 isolates from the hospital site and 6 isolates from the fish farm site transferred OTr plasmids (designated pFBAOT1 to 17). Original isolates were identified using fatty acid methyl ester and fluorescent amplified fragment length polymorphism comparisons as either Aeromonas hydrophila HG3 (eight isolates), A. veronii b.v. sobria HG8 (six isolates), and A. caviae HGB5 (one isolate). One isolate remained unidentified, and one could not be assigned a taxonomic designation beyond the genus level. Plasmids pFBAOT1 to -17 were screened for the presence of the tetracycline resistance determinants Tet A to E and Tet G. Only determinant Tet A (10 plasmids) was detected in these plasmids, with 7 tet gene determinants remaining unclassified. In all cases, Tet A was located on a 5.5-kb EcoRI restriction fragment. Hybridization with inc-rep probes N, P, Q, W, and U showed pFBAOT3, -4, -5, -6, -7, -9, and -11, from the hospital environment, to be IncU plasmids. Further, restriction fragment length polymorphism (RFLP) analyses and DNA probing demonstrated that pFBAOT plasmids were closely related to IncU OTr plasmids pASOT, pASOT2, pASOT3, pRAS1 (originally isolated from A. salmonicida strains from fish farms in Scotland and Norway, respectively), and pIE420 (isolated from a German hospital E. coli strain). In addition, DNA analyses demonstrated that plasmids pRAS1 and pIE420 had identical RFLP profiles and that all fragments hybridized to each other. The presence of tetracycline resistance transposon Tn1721 in its entirety or in a truncated form in these plasmids was demonstrated. These results provided direct evidence that related tetracycline resistance-encoding plasmids have disseminated between different Aeromonas species and E. coli and between the human and aquaculture environments in distinct geographical locations. Collectively, these findings provide evidence to support the hypothesis that the aquaculture and human compartments of the environment behave as a single interactive compartment. PMID:10966404

blaNDM-21, a new variant of blaNDM in an Escherichia coli clinical isolate carrying blaCTX-M-55 and rmtB.

PubMed

Liu, Lu; Feng, Yu; McNally, Alan; Zong, Zhiyong

2018-06-14

New Delhi MBL (NDM) is a type of carbapenemase; 20 variants of NDM have been identified to date. We have found a new variant of NDM, NDM-21, and describe it here. A carbapenem-resistant Escherichia coli was subjected to WGS using an Illumina X10 sequencer to identify the antimicrobial resistance genes and its ST. The gene encoding the new variant of NDM was cloned into E. coli DH5α, with blaNDM-5 being cloned as the control. Transformants were tested for susceptibility to carbapenems. Mating was performed to obtain the plasmid carrying the new blaNDM gene and the complete plasmid sequence was obtained using long-read MinION sequencing. The E. coli isolate belonged to ST617 and phylogenetic group A. It had a gene encoding NDM-21, a new NDM variant. NDM-21 differs from NDM-5 by a Gly-to-Ser amino acid substitution at position 69 (G69S). NDM-21 retains the same activity against carbapenems as NDM-5. blaNDM-21 is carried by a 46.1 kb IncX3 plasmid, which is self-transmissible, and is located in a complex genetic context as blaNDM-5. The isolate also carried blaCTX-M-55, which encodes an ESBL conferring resistance to aztreonam (which completed its resistance to all clinically available β-lactams), and rmtB, which mediates high-level resistance to aminoglycosides, on an IncFII plasmid. A new NDM variant has been identified and blaNDM-21 has evolved from blaNDM-5 on an IncX3 plasmid.

Deletion of the Clostridium thermocellum recA gene reveals that it is required for thermophilic plasmid replication but not plasmid integration at homologous DNA sequences.

PubMed

Groom, Joseph; Chung, Daehwan; Kim, Sun-Ki; Guss, Adam; Westpheling, Janet

2018-05-28

A limitation to the engineering of cellulolytic thermophiles is the availability of functional, thermostable (≥ 60 °C) replicating plasmid vectors for rapid expression and testing of genes that provide improved or novel fuel molecule production pathways. A series of plasmid vectors for genetic manipulation of the cellulolytic thermophile Caldicellulosiruptor bescii has recently been extended to Clostridium thermocellum, another cellulolytic thermophile that very efficiently solubilizes plant biomass and produces ethanol. While the C. bescii pBAS2 replicon on these plasmids is thermostable, the use of homologous promoters, signal sequences and genes led to undesired integration into the bacterial chromosome, a result also observed with less thermostable replicating vectors. In an attempt to overcome undesired plasmid integration in C. thermocellum, a deletion of recA was constructed. As expected, C. thermocellum ∆recA showed impaired growth in chemically defined medium and an increased susceptibility to UV damage. Interestingly, we also found that recA is required for replication of the C. bescii thermophilic plasmid pBAS2 in C. thermocellum, but it is not required for replication of plasmid pNW33N. In addition, the C. thermocellum recA mutant retained the ability to integrate homologous DNA into the C. thermocellum chromosome. These data indicate that recA can be required for replication of certain plasmids, and that a recA-independent mechanism exists for the integration of homologous DNA into the C. thermocellum chromosome. Understanding thermophilic plasmid replication is not only important for engineering of these cellulolytic thermophiles, but also for developing genetic systems in similar new potentially useful non-model organisms.

Deletion of the Clostridium thermocellum recA Gene Reveals that it is Required for Thermophilic Plasmid Replication but not Plasmid Integration at Homologous DNA Sequences

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chung, Daehwan; Groom, Joseph; Kim, Sun-Ki

A limitation to the engineering of cellulolytic thermophiles is the availability of functional, thermostable (>/= 60 degrees C) replicating plasmid vectors for rapid expression and testing of genes that provide improved or novel fuel molecule production pathways. A series of plasmid vectors for genetic manipulation of the cellulolytic thermophile Caldicellulosiruptor bescii has recently been extended to Clostridium thermocellum, another cellulolytic thermophile that very efficiently solubilizes plant biomass and produces ethanol. While the C. bescii pBAS2 replicon on these plasmids is thermostable, the use of homologous promoters, signal sequences and genes led to undesired integration into the bacterial chromosome, a resultmore » also observed with less thermostable replicating vectors. In an attempt to overcome undesired plasmid integration in C. thermocellum, a deletion of recA was constructed. As expected, C. thermocellum ..delta..recA showed impaired growth in chemically defined medium and an increased susceptibility to UV damage. Interestingly, we also found that recA is required for replication of the C. bescii thermophilic plasmid pBAS2 in C. thermocellum, but it is not required for replication of plasmid pNW33N. In addition, the C. thermocellum recA mutant retained the ability to integrate homologous DNA into the C. thermocellum chromosome. These data indicate that recA can be required for replication of certain plasmids, and that a recA-independent mechanism exists for the integration of homologous DNA into the C. thermocellum chromosome. Understanding thermophilic plasmid replication is not only important for engineering of these cellulolytic thermophiles, but also for developing genetic systems in similar new potentially useful non-model organisms.« less

Characterization of the aes gene of Escherichia coli encoding an enzyme with esterase activity.

PubMed Central

Peist, R; Koch, A; Bolek, P; Sewitz, S; Kolbus, T; Boos, W

1997-01-01

malQ mutants of Escherichia coli lacking amylomaltase cannot grow on maltose. They express the maltose system constitutively and are sensitive to maltose when grown on another carbon source. In an attempt to isolate a multicopy suppressor that would result in growth on maltose, we transformed a malQ mutant with a gene bank of E. coli DNA which had been digested with Sau3a and cloned in pBR322. We screened the transformants on MacConkey maltose plates. A colony was isolated that appeared to be resistant to maltose and was pink on these plates, but it was still unable to grow on minimal medium with maltose as the carbon source. The plasmid was isolated, and the gene causing this phenotype was characterized. The deduced amino acid sequence of the encoded protein shows homology to that of lipases and esterases. We termed the gene aes, for acetyl esterase. Extracts of cells harboring plasmid-encoded aes under its own promoter exhibit a fivefold higher capacity to hydrolyze p-nitrophenyl acetate than do extracts of cells of plasmid-free strains. Similarly, strains harboring plasmid-encoded aes are able to grow on triacetyl glycerol (triacetin) whereas the plasmid-free strains are not. The expression of plasmid-encoded aes resulted in strong repression of the maltose transport genes in malT+ strains (10-fold reduction), but not in a malT(Con) strain which is independent of the inducer. Also, overproduction of MalT counteracted the Aes-dependent repression, indicating a direct interaction between MalT and Aes. PMID:9401025

The Transposable Element Mariner Mediates Germline Transformation in Drosophila Melanogaster

PubMed Central

Lidholm, D. A.; Lohe, A. R.; Hartl, D. L.

1993-01-01

A vector for germline transformation in Drosophila melanogaster was constructed using the transposable element mariner. The vector, denoted pMlwB, contains a mariner element disrupted by an insertion containing the wild-type white gene from D. melanogaster, the β-galactosidase gene from Escherichia coli and sequences that enable plasmid replication and selection in E. coli. The white gene is controlled by the promoter of the D. melanogaster gene for heat-shock protein 70, and the β-galactosidase gene is flanked upstream by the promoter of the transposable element P as well as that of mariner. The MlwB element was introduced into the germline of D. melanogaster by co-injection into embryos with an active mariner element, Mos1, which codes for a functional transposase and serves as a helper. Two independent germline insertions were isolated and characterized. The results show that the MlwB element inserted into the genome in a mariner-dependent manner with the termini of the inverted repeats inserted at a TA dinucleotide. Both insertions exhibit an unexpected degree of germline and somatic stability, even in the presence of an active mariner element in the genetic background. These results demonstrate that the mariner transposable element, which is small (1286 bp) and relatively homogeneous in size among different copies, is nevertheless capable of promoting the insertion of the large (13.2 kb) MlwB element. Because of the widespread phylogenetic distribution of mariner among insects, these results suggest that mariner might provide a wide hostrange transformation vector for insects. PMID:8394264

Association of tellurium resistance and bacteriophage inhibition conferred by R plasmids.

PubMed Central

Taylor, D E; Summers, A O

1979-01-01

Concomitant resistance to tellurium compounds (Ter) and inhibition of coli-phage development (Phi) are properties mediated by many H2 incompatibility group R plasmids which have been isolated from diverse bacterial and geographic sources. Ter plasmids from tellurium-resistant bacteria that were isolated from sewage and industrial wastes also mediated phage inhibition. Of these Ter plasmids, three from Citrobacter freundii belonged to the H incompatibility group, whereas three from Klebsiella pneumoniae did not. Images PMID:374351

Overcoming codon bias: a method for high-level overexpression of Plasmodium and other AT-rich parasite genes in Escherichia coli.

PubMed

Baca, A M; Hol, W G

2000-02-01

Parasite genes often use codons which are rarely used in the highly expressed genes of Escherichia coli, possibly resulting in translational stalling and lower yields of recombinant protein. We have constructed the "RIG" plasmid to overcome the potential codon-bias problem seen in Plasmodium genes. RIG contains the genes that encode three tRNAs (Arg, Ile, Gly), which recognise rare codons found in parasite genes. When co-transformed into E. coli along with expression plasmids containing parasite genes, RIG can greatly increase levels of overexpressed protein. Codon frequency analysis suggests that RIG may be applied to a variety of protozoan and helminth genes.

Prevalence and characterization of plasmid-mediated blaESBL with their genetic environment in Escherichia coli and Klebsiella pneumoniae in patients with pneumonia.

PubMed

Wang, Xiao-rong; Chen, Ji-chao; Kang, Yu; Jiang, Ning; An, Shu-chang; Gao, Zhan-cheng

2012-03-01

The extended spectrum β-lactamase (ESBL)-producing Escherichia coli (E. coli) and Klebsiella pneumoniae (K. pneumoniae) are the major pathogens causing pneumonia and have a significant impact on the clinical course. Limited data exist on molecular characterization of ESBL-producing E. coli and K. pneumoniae that cause pneumonia. The aim of this study was to investigate the comprehensive multilevel characteristics of E. coli and K. pneumoniae causing pneumonia in China for the first time. E. coli (17) and K. pneumoniae (21) isolates responsible for pneumonia were isolated from 1270 specimens collected in a prospective multi-center study in eight teaching hospitals in China from June to December in 2007. The susceptibilities, ESBL confirmation, sequence typing, blaCTX-M and blaSHV genes, their genetic environment and plasmid Inc/rep types were determined. Sixteen E. coli (94.1%) and eleven K. pneumoniae (52.4%) isolates were ESBL producers. About 77.8% and 66.7% of them were resistance to ciprofloxacin and levofloxacin, and 100% were susceptible to imipenem. The most prevalent ESBL gene was CTX-M-14, followed by SHV-2, CTX-M-15, CTX-M-3, CTX-M-65, SHV-12, SHV-26 and SHV-28. SHV-1 and SHV-11 were also detected and coexisted with blaCTX-Ms in five strains, and three strains contained only SHV-1. All CTX-M-14 were detected ISEcp1 upstream and nine were found IS903 downstream and the majority of them (64.3%) were carried by IncF plasmids. All blaSHV were flanked by recF and deoR, located on IncF, IncN, IncX and IncH plasmids. Two SHV-2, one SHV-1 and the only SHV-28 were further preceded by IS26. Genes lacY and lacZ were detected at further upstream of two blaSHV-1. The K. pneumoniae carrying SHV-28 was susceptible to β-lactams, and no mutations or deletions in gene or promoter sequences were identified to account for susceptibility. Multilocus sequence typing experiments showed the ESBL-producing strains were genetically diverse. The rate of occurrence of blaESBL in E. coli and K. pneumoniae causing pneumonia was high, and blaCTX-M-14 was dominant and probably mobilized by ISEcp1 mainly on IncF plasmids. Importantly, unexpressed blaESBL genes may occur in susceptible isolates and hence may have clinical implications.

Gene Transfer in Leptolyngbya sp. Strain BL0902, a Cyanobacterium Suitable for Production of Biomass and Bioproducts

PubMed Central

Taton, Arnaud; Lis, Ewa; Adin, Dawn M.; Dong, Guogang; Cookson, Scott; Kay, Steve A.; Golden, Susan S.; Golden, James W.

2012-01-01

Current cyanobacterial model organisms were not selected for their growth traits or potential for the production of renewable biomass, biofuels, or other products. The cyanobacterium strain BL0902 emerged from a search for strains with superior growth traits. Morphology and 16S rRNA sequence placed strain BL0902 in the genus Leptolyngbya. Leptolyngbya sp. strain BL0902 (hereafter Leptolyngbya BL0902) showed robust growth at temperatures from 22°C to 40°C and tolerated up to 0.5 M NaCl, 32 mM urea, high pH, and high solar irradiance. Its growth rate under outdoor conditions rivaled Arthrospira (“pirulina” strains. Leptolyngbya BL0902 accumulated higher lipid content and a higher proportion of monounsaturated fatty acids than Arthrospira strains. In addition to these desirable qualities, Leptolyngbya BL0902 is amenable to genetic engineering that is reliable, efficient, and stable. We demonstrated conjugal transfer from Escherichia coli of a plasmid based on RSF1010 and expression of spectinomycin/streptomycin resistance and yemGFP reporter transgenes. Conjugation efficiency was investigated in biparental and triparental matings with and without a “elper”plasmid that carries DNA methyltransferase genes, and with two different conjugal plasmids. We also showed that Leptolyngbya BL0902 is amenable to transposon mutagenesis with a Tn5 derivative. To facilitate genetic manipulation of Leptolyngbya BL0902, a conjugal plasmid vector was engineered to carry a trc promoter upstream of a Gateway recombination cassette. These growth properties and genetic tools position Leptolyngbya BL0902 as a model cyanobacterial production strain. PMID:22292073

An efficient procedure for marker-free mutagenesis of S. coelicolor by site-specific recombination for secondary metabolite overproduction.

PubMed

Zhang, Bo; Zhang, Lin; Dai, Ruixue; Yu, Meiying; Zhao, Guoping; Ding, Xiaoming

2013-01-01

Streptomyces bacteria are known for producing important natural compounds by secondary metabolism, especially antibiotics with novel biological activities. Functional studies of antibiotic-biosynthesizing gene clusters are generally through homologous genomic recombination by gene-targeting vectors. Here, we present a rapid and efficient method for construction of gene-targeting vectors. This approach is based on Streptomyces phage φBT1 integrase-mediated multisite in vitro site-specific recombination. Four 'entry clones' were assembled into a circular plasmid to generate the destination gene-targeting vector by a one-step reaction. The four 'entry clones' contained two clones of the upstream and downstream flanks of the target gene, a selectable marker and an E. coli-Streptomyces shuttle vector. After targeted modification of the genome, the selectable markers were removed by φC31 integrase-mediated in vivo site-specific recombination between pre-placed attB and attP sites. Using this method, part of the calcium-dependent antibiotic (CDA) and actinorhodin (Act) biosynthetic gene clusters were deleted, and the rrdA encoding RrdA, a negative regulator of Red production, was also deleted. The final prodiginine production of the engineered strain was over five times that of the wild-type strain. This straightforward φBT1 and φC31 integrase-based strategy provides an alternative approach for rapid gene-targeting vector construction and marker removal in streptomycetes.

Comparison of broad-spectrum cephalosporin-resistant Escherichia coli isolated from dogs and humans in Hokkaido, Japan.

PubMed

Okubo, Torahiko; Sato, Toyotaka; Yokota, Shin-ichi; Usui, Masaru; Tamura, Yutaka

2014-04-01

Resistance to broad-spectrum cephalosporins (BSCs) in Enterobacteriaceae in companion animals has become a great concern for public health. To estimate the dissemination of BSC-resistant bacteria between dog and human, we examined the BSC-resistance determinants of and genetic similarities between 69 BSC-resistant Escherichia coli isolates derived from canine rectal swabs (n = 28) and human clinical samples (n = 41). Some E. coli isolates possessed blaTEM-1b (14 canine and 16 human isolates), blaCTx-M-2 (6 human isolates), blaCTx-M-14 (3 canine and 14 human isolates), blaCTx-M-27 (1 canine and 15 human isolates), and blaCMY-2 (11 canine and 3 human isolates). The possession of CTX-M-type β-lactamases was significantly more frequent in human isolates, whereas CMY-2 was more common in canine isolates. Bacterial typing methods (phylogenetic typing, O-antigen serotyping, and pulsed-field gel electrophoresis) showed little clonal relationship between canine isolates and human isolates. Plasmid analysis and Southern blotting indicated that the plasmids encoding CMY-2 were similar among canine and human isolates. Based on the differences in the major β-lactamase and the divergence of bacterial types between canine and human isolates, it seems that clonal dissemination of BSC-resistant E. coli between canines and humans is limited. The similarity of the CMY-2-encoding plasmid suggests that plasmid-mediated β-lactamase gene transmission plays a role in interspecies diffusion of BSC-resistant E. coli between dog and human. Copyright © 2013 Japanese Society of Chemotherapy and The Japanese Association for Infectious Diseases. Published by Elsevier Ltd. All rights reserved.

Genetic markers for detection of Escherichia coli K-12 harboring ampicillin-resistance plasmid from an industrial wastewater treatment effluent pond.

PubMed

Simões, G A R; Xavier, M A S; Oliveira, D A; Menezes, E V; Magalhães, S S G; Gandra, J A C D; Xavier, A R E O

2016-06-17

Biotechnology industries that use recombinant DNA technology are potential sources for release of genetically modified organisms to the environment. Antibiotic-resistance marker genes are commonly used for recombinant bacteria selection. One example is the marker gene coding for β-lactamase (bla) in plasmids found in Escherichia coli K-12. The aim of this study was to provide an approach to develop a molecular method for genetic marker detection in E. coli K-12 harboring bla genes from an industrial wastewater treatment effluent pond (IWTEP). For the detection of bla and Achromobacter lyticus protease I (api) genes in samples from IWTEP, we employed multiplex polymerase chain reaction (PCR) using E. coli K-12 genetic marker detection primers, previously described in the literature, and primers designed in our laboratory. The microbiological screening method resulted in 22 bacterial colony-forming units isolated from three different IWTEP harvesting points. The multiplex PCR amplicons showed that five isolates were positive for the bla gene marker and negative for the E. coli K-12 and api genes. The 16S rRNA regions of positive microorganisms carrying the bla gene were genotyped by the MicroSeq®500 system. The bacteria found were Escherichia spp (3/5), Chromobacterium spp (1/5), and Aeromonas spp (1/5). None of the 22 isolated microorganisms presented the molecular pattern of E. coli K-12 harboring the bla gene. The presence of microorganisms positive for the bla gene and negative for E. coli K-12 harboring bla genes at IWTEP suggests that the ampicillin resistance found in the isolated bacteria could be from microorganisms other than the E. coli K-12 strain harboring plasmid.

An In Vitro Chicken Gut Model Demonstrates Transfer of a Multidrug Resistance Plasmid from Salmonella to Commensal Escherichia coli.

PubMed

Card, Roderick M; Cawthraw, Shaun A; Nunez-Garcia, Javier; Ellis, Richard J; Kay, Gemma; Pallen, Mark J; Woodward, Martin J; Anjum, Muna F

2017-07-18

The chicken gastrointestinal tract is richly populated by commensal bacteria that fulfill various beneficial roles for the host, including helping to resist colonization by pathogens. It can also facilitate the conjugative transfer of multidrug resistance (MDR) plasmids between commensal and pathogenic bacteria which is a significant public and animal health concern as it may affect our ability to treat bacterial infections. We used an in vitro chemostat system to approximate the chicken cecal microbiota, simulate colonization by an MDR Salmonella pathogen, and examine the dynamics of transfer of its MDR plasmid harboring several genes, including the extended-spectrum beta-lactamase bla CTX-M1 We also evaluated the impact of cefotaxime administration on plasmid transfer and microbial diversity. Bacterial community profiles obtained by culture-independent methods showed that Salmonella inoculation resulted in no significant changes to bacterial community alpha diversity and beta diversity, whereas administration of cefotaxime caused significant alterations to both measures of diversity, which largely recovered. MDR plasmid transfer from Salmonella to commensal Escherichia coli was demonstrated by PCR and whole-genome sequencing of isolates purified from agar plates containing cefotaxime. Transfer occurred to seven E. coli sequence types at high rates, even in the absence of cefotaxime, with resistant strains isolated within 3 days. Our chemostat system provides a good representation of bacterial interactions, including antibiotic resistance transfer in vivo It can be used as an ethical and relatively inexpensive approach to model dissemination of antibiotic resistance within the gut of any animal or human and refine interventions that mitigate its spread before employing in vivo studies. IMPORTANCE The spread of antimicrobial resistance presents a grave threat to public health and animal health and is affecting our ability to respond to bacterial infections. Transfer of antimicrobial resistance via plasmid exchange is of particular concern as it enables unrelated bacteria to acquire resistance. The gastrointestinal tract is replete with bacteria and provides an environment for plasmid transfer between commensals and pathogens. Here we use the chicken gut microbiota as an exemplar to model the effects of bacterial infection, antibiotic administration, and plasmid transfer. We show that transfer of a multidrug-resistant plasmid from the zoonotic pathogen Salmonella to commensal Escherichia coli occurs at a high rate, even in the absence of antibiotic administration. Our work demonstrates that the in vitro gut model provides a powerful screening tool that can be used to assess and refine interventions that mitigate the spread of antibiotic resistance in the gut before undertaking animal studies. Copyright © 2017 Card et al.

[Prokaryotic expression of recombinant prochymosin gene and its antiserum preparation].

PubMed

Li, Xin-ping; Liu, Huan-huan; Pu, Yan; Zhang, Fu-chun; Li, Yi-jie

2012-07-01

To optimize the prochymosin (pCHY) gene codons and express the gene in Escherichia coli (E.coli), and to prepare its antiserum and detect chymosin protein specifically. According to codon usage bias of E.coli, prochymosin gene sequence was synthesized based on the conserved sequences of prochymosin gene from bovine, lamb and camel, and then cloned into the plasmid pET-30a and pcDNA3-AAT-COMP-C3d3 (pcD-ACC), respectively. pET-30a-pCHY was expressed, as the detected antigen, in E.coli BL21(DE3) after IPTG induction. RT-PCR was used to detect prochymosin mRNA expression in liver from the mice injected pcDNA3-AAT-COMP-pCHY-C3d3(pACCC) by hydrodynamics-based transfection method. To prepare the antiserum of prochymosin, pACCC and GST-pCHY proteins were used to immunize New Zealand rabbits in accordance with DNA prime-protein boost strategy. Antibody levels were tested by ELISA. Western blotting showed the molecular weight of His-pCHY protein was about 55 000, similar to the expected molecular size. ELISA demonstrated that the titer level of prochymosin antiserum was high. Based on the codon optimization, we have obtained high-titer prochymosin antiserum through DNA vaccine vector pcD-ACC combined with DNA prime-protein boost strategy, similar to that by protein vaccine.

Integron, Plasmid and Host Strain Characteristics of Escherichia coli from Humans and Food Included in the Norwegian Antimicrobial Resistance Monitoring Programs.

PubMed

Sunde, Marianne; Simonsen, Gunnar Skov; Slettemeås, Jannice Schau; Böckerman, Inger; Norström, Madelaine

2015-01-01

Antimicrobial resistant Escherichia coli (n=331) isolates from humans with bloodstream infections were investigated for the presence of class 1 and class 2 integrons. The integron cassettes arrays were characterized and the findings were compared with data from similar investigations on resistant E. coli from meat and meat products (n=241) produced during the same time period. All isolates were obtained from the Norwegian monitoring programs for antimicrobial resistance in human pathogens and in the veterinary sector. Methods used included PCR, sequencing, conjugation experiments, plasmid replicon typing and subtyping, pulsed-field-gel-electrophoresis and serotyping. Integrons of class 1 and 2 occurred significantly more frequently among human isolates; 45.4% (95% CI: 39.9-50.9) than among isolates from meat; 18% (95% CI: 13.2 -23.3), (p<0.01, Chi-square test). Identical cassette arrays including dfrA1-aadA1, aadA1, dfrA12-orfF-aadA2, oxa-30-aadA1 (class 1 integrons) and dfrA1-sat1-aadA1 (class 2 integrons) were detected from both humans and meat. However, the most prevalent cassette array in human isolates, dfrA17-aadA5, did not occur in isolates from meat, suggesting a possible linkage between this class 1 integron and a subpopulation of E. coli adapted to a human host. The drfA1-aadA1 and aadA1 class 1 integrons were found frequently in both human and meat isolates. These isolates were subjected to further studies to investigate similarities with regard to transferability, plasmid and host strain characteristics. We detected incF plasmids with pMLST profile F24:A-:B1 carrying drfA1-aadA1 integrons in isolates from pork and in a more distantly related E. coli strain from a human with septicaemia. Furthermore, we showed that most of the class 1 integrons with aadA1 were located on incF plasmids with pMLST profile F51:A-:B10 in human isolates. The plasmid was present in unrelated as well as closely related host strains, demonstrating that dissemination of this integron also could be attributed to clonal spread. In conclusion, among the systematically collected isolates from two different sources, some significant differences concerning integron prevalence and integron variants were observed. However, closely related plasmids as vehicles for specific class 1 integrons in isolates from meat and from a human with bloodstream infection were found. The occurrence of similar multi-resistance plasmids in bacteria from a food source and from a human clinical sample highlights the possible role of meat as a source of resistance elements for pathogenic bacteria.

Cloning and study of the pectate lyase gene of Erwinia carotovora

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bukanov, N.O.; Fonshtein, M.Yu.; Evtushenkov, A.N.

1986-04-01

The cloning of the gene of a secretable protein of Erwinia carotovora, pectate lyase, in Escherichia coli was described. Primary cloning was conducted using the phage vector lambda 47.1. In the gene library of E. carotovora obtained, eight phages carrying the gene sought were identified according to the appearance of enzymatic activity of the gene product, pectate lyase, in situ. The BamHI fragment of DNA, common to all these phages, was recloned on the plasmid pUC19. It was shown that the cloned pectate lyase gene is represented on the E. carotovora chromosome in one copy. Methods of production of representativemore » gene libraries on phage vectors from no less than 1 ..mu..g of cloned DNA even for the genomes of eukaryotes have now been developed. Vectors have been created, for example, lambda 47.1, permitting the selection only of hybrid molecules. A number of methods have been developed for the search for a required gene in the library, depending on whether the cloned gene can be expressed or not, and if it can, what properties it will impart to the hybrid clone containing it.« less

An Enterobacter plasmid as a new genetic background for the transposon Tn1331

PubMed Central

Alavi, Mohammad R; Antonic, Vlado; Ravizee, Adrien; Weina, Peter J; Izadjoo, Mina; Stojadinovic, Alexander

2011-01-01

Background Genus Enterobacter includes important opportunistic nosocomial pathogens that could infect complex wounds. The presence of antibiotic resistance genes in these microorganisms represents a challenging clinical problem in the treatment of these wounds. In the authors’ screening of antibiotic-resistant bacteria from complex wounds, an Enterobacter species was isolated that harbors antibiotic-resistant plasmids conferring resistance to Escherichia coli. The aim of this study was to identify the resistance genes carried by one of these plasmids. Methods The plasmids from the Enterobacter isolate were propagated in E. coli and one of the plasmids, designated as pR23, was sequenced by the Sanger method using fluorescent dyeterminator chemistry on a genetic analyzer. The assembled sequence was annotated by search of the GenBank database. Results Plasmid pR23 is composed of the transposon Tn1331 and a backbone plasmid that is identical to the plasmid pPIGDM1 from Enterobacter agglomerans. The multidrug-resistance transposon Tn1331, which confers resistance to aminoglycoside and beta lactam antibiotics, has been previously isolated only from Klebsiella. The Enterobacter plasmid pPIGDM1, which carries a ColE1-like origin of replication and has no apparent selective marker, appears to provide a backbone for propagation of Tn1331 in Enterobacter. The recognition sequence of Tn1331 transposase for insertion into pPIGDM1 is the pentanucleotide TATTA, which occurs only once throughout the length of this plasmid. Conclusion Transposition of Tn1331 into the Enterobacter plasmid pPIGDM1 enables this transposon to propagate in this Enterobacter. Since Tn1331 was previously isolated only from Klebsiella, this report suggests horizontal transfer of this transposon between the two bacterial genera. PMID:22259249

A novel packaging system for the generation of helper-free oncolytic MVM vector stocks.

PubMed

Brandenburger, A; Russell, S

1996-10-01

MVM-based autonomous parvoviral vectors have been shown to target the expression of heterologous genes in neoplastic cells and are therefore of interest for cancer gene therapy. The traditional method for production of parvoviral vectors requires the cotransfection of vector and helper plasmids into MVM-permissive cell lines, but recombination between the cotransfected plasmids invariably gives rise to vector stocks that are heavily contaminated with wild-type MVM. Therefore, to minimise recombination between the vector and helper genomes we have utilised a cell line in which the MVM helper functions are expressed inducibly from a modified MVM genome that is stably integrated into the host cell chromosome. Using this MVM packaging cell line, we could reproducibly generate MVM vector stocks that contained no detectable helper virus.

Detection and molecular characterization of Escherichia coli CTX-M-15 and Klebsiella pneumoniae SHV-12 β-lactamases from bovine mastitis isolates in the United Kingdom.

PubMed

Timofte, Dorina; Maciuca, Iuliana E; Evans, Nicholas J; Williams, Helen; Wattret, Andrew; Fick, Jenny C; Williams, Nicola J

2014-01-01

Recent reports raised concerns about the role that farm stock may play in the dissemination of extended-spectrum β-lactamase (ESBL)-producing bacteria. This study characterized the ESBLs in two Escherichia coli and three Klebsiella pneumoniae subsp. pneumoniae isolates from cases of clinical bovine mastitis in the United Kingdom. Bacterial culture and sensitivity testing of bovine mastitic milk samples identified Gram-negative cefpodoxime-resistant isolates, which were assessed for their ESBL phenotypes. Conjugation experiments and PCR-based replicon typing (PBRT) were used for characterization of transferable plasmids. E. coli isolates belonged to sequence type 88 (ST88; determined by multilocus sequence typing) and carried blaCTX-M-15 and blaTEM-1, while K. pneumoniae subsp. pneumoniae isolates carried blaSHV-12 and blaTEM-1. Conjugation experiments demonstrated that blaCTX-M-15 and blaTEM-1 were carried on a conjugative plasmid in E. coli, and PBRT identified this to be an IncI1 plasmid. The resistance genes were nontransferable in K. pneumoniae subsp. pneumoniae isolates. Moreover, in the E. coli isolates, an association of ISEcp1 and IS26 with blaCTX-M-15 was found where the IS26 element was inserted upstream of both ISEcp1 and the blaCTX-M promoter, a genetic arrangement highly similar to that described in some United Kingdom human isolates. We report the first cases in Europe of bovine mastitis due to E. coli CTX-M-15 and also of bovine mastitis due to K. pneumoniae subsp. pneumoniae SHV-12 β-lactamases in the United Kingdom. We also describe the genetic environment of blaCTX-M-15 and highlight the role that IncI1 plasmids may play in the spread and dissemination of ESBL genes, which have been described in both human and cattle isolates.

Detection and Molecular Characterization of Escherichia coli CTX-M-15 and Klebsiella pneumoniae SHV-12 β-Lactamases from Bovine Mastitis Isolates in the United Kingdom

PubMed Central

Maciuca, Iuliana E.; Evans, Nicholas J.; Williams, Helen; Wattret, Andrew; Fick, Jenny C.; Williams, Nicola J.

2014-01-01

Recent reports raised concerns about the role that farm stock may play in the dissemination of extended-spectrum β-lactamase (ESBL)-producing bacteria. This study characterized the ESBLs in two Escherichia coli and three Klebsiella pneumoniae subsp. pneumoniae isolates from cases of clinical bovine mastitis in the United Kingdom. Bacterial culture and sensitivity testing of bovine mastitic milk samples identified Gram-negative cefpodoxime-resistant isolates, which were assessed for their ESBL phenotypes. Conjugation experiments and PCR-based replicon typing (PBRT) were used for characterization of transferable plasmids. E. coli isolates belonged to sequence type 88 (ST88; determined by multilocus sequence typing) and carried blaCTX-M-15 and blaTEM-1, while K. pneumoniae subsp. pneumoniae isolates carried blaSHV-12 and blaTEM-1. Conjugation experiments demonstrated that blaCTX-M-15 and blaTEM-1 were carried on a conjugative plasmid in E. coli, and PBRT identified this to be an IncI1 plasmid. The resistance genes were nontransferable in K. pneumoniae subsp. pneumoniae isolates. Moreover, in the E. coli isolates, an association of ISEcp1 and IS26 with blaCTX-M-15 was found where the IS26 element was inserted upstream of both ISEcp1 and the blaCTX-M promoter, a genetic arrangement highly similar to that described in some United Kingdom human isolates. We report the first cases in Europe of bovine mastitis due to E. coli CTX-M-15 and also of bovine mastitis due to K. pneumoniae subsp. pneumoniae SHV-12 β-lactamases in the United Kingdom. We also describe the genetic environment of blaCTX-M-15 and highlight the role that IncI1 plasmids may play in the spread and dissemination of ESBL genes, which have been described in both human and cattle isolates. PMID:24247146

Expression of recombinant organophosphorus hydrolase in the original producer of the enzyme, Sphingobium fuliginis ATCC 27551.

PubMed

Nakayama, Kosuke; Ohmori, Takeshi; Ishikawa, Satoshi; Iwata, Natsumi; Seto, Yasuo; Kawahara, Kazuyoshi

2016-05-01

The plasmid encoding His-tagged organophosphorus hydrolase (OPH) cloned from Sphingobium fuliginis was modified to be transferred back to this bacterium. The replication function of S. amiense plasmid was inserted at downstream of OPH gene, and S. fuliginis was transformed with this plasmid. The transformant produced larger amount of active OPH with His-tag than E. coli.

[Construction of recombinant lentiviral vector of Tie2-RNAi and its influence on malignant melanoma cells in vitro].

PubMed

Shan, Xiu-ying; Liu, Zhao-liang; Wang, Biao; Guo, Guo-xiang; Wang, Mei-shui; Zhuang, Fu-lian; Cai, Chuan-shu; Zhang, Ming-feng; Zhang, Yan-ding

2011-07-01

To construct lentivector carrying Tie2-Small interfering RNA (SiRNA), so as to study its influence on malignant melanoma cells. Recombinant plasmid pSilencer 1.0-U6-Tie2-siRNA and plasmid pNL-EGFP were digested with XbaI, ligated a target lentiviral transfer plasmid of pNL-EGFP-U6-Tie2-I or pNL-EGFP-U6-Tie2-II, and then the electrophoresis clones was sequenced. Plasmids of pNL-EGFP-U6-Tie2-I and pNL-EGFP-U6-Tie2-II were constructed and combined with pVSVG and pHelper, respectively, to constitute lentiviral vector system of three plasmids. The Lentiviral vector system was transfected into 293T cell to produce pNL-EGFP-U6-Tie2- I and pNL-EGFP-U6-Tie2-II lentivirus. Then the supernatant was collected to determine the titer. Malignant melanoma cells were infected by both lentiviruses and identified by Realtime RT-PCR to assess inhibitory efficiency. The recombinant lentiviral vectors of Tie2-RNAi were constructed successfully which were analyzed with restriction enzyme digestion and identified by sequencing. And the titer of lentiviral vector was 8.8 x 10(3)/ml, which was determined by 293T cell. The results of Realtime RT-PCR demonstrated that the lentiviral vectors of Tie2-RNAi could infect malignant melanoma cells and inhibit the expression of Tie2 genes in malignant melanoma cells (P<0.01). There was no significant difference in the expression level (P>0.05) between the two lentiviral vectors of Tie2-RNAi. Lentivector carrying Tie2-SiRNA can be constructed successfully and inhibit the expression of Tie2 gene in vitro significantly. The study will supply the theory basis for the further research on the inhibition of tumor growth in vivo.

Persistence of transferable extended-spectrum-β-lactamase resistance in the absence of antibiotic pressure.

PubMed

Cottell, Jennifer L; Webber, Mark A; Piddock, Laura J V

2012-09-01

The treatment of infections caused by antibiotic-resistant bacteria is one of the great challenges faced by clinicians in the 21st century. Antibiotic resistance genes are often transferred between bacteria by mobile genetic vectors called plasmids. It is commonly believed that removal of antibiotic pressure will reduce the numbers of antibiotic-resistant bacteria due to the perception that carriage of resistance imposes a fitness cost on the bacterium. This study investigated the ability of the plasmid pCT, a globally distributed plasmid that carries an extended-spectrum-β-lactamase (ESBL) resistance gene (bla(CTX-M-14)), to persist and disseminate in the absence of antibiotic pressure. We investigated key attributes in plasmid success, including conjugation frequencies, bacterial-host growth rates, ability to cause infection, and impact on the fitness of host strains. We also determined the contribution of the bla(CTX-M-14) gene itself to the biology of the plasmid and host bacterium. Carriage of pCT was found to impose no detectable fitness cost on various bacterial hosts. An absence of antibiotic pressure and inactivation of the antibiotic resistance gene also had no effect on plasmid persistence, conjugation frequency, or bacterial-host biology. In conclusion, plasmids such as pCT have evolved to impose little impact on host strains. Therefore, the persistence of antibiotic resistance genes and their vectors is to be expected in the absence of antibiotic selective pressure regardless of antibiotic stewardship. Other means to reduce plasmid stability are needed to prevent the persistence of these vectors and the antibiotic resistance genes they carry.

Hepatitis B virus core antigen: synthesis in Escherichia coli and application in diagnosis.

PubMed Central

Stahl, S; MacKay, P; Magazin, M; Bruce, S A; Murray, K

1982-01-01

Fragments of hepatitis B virus DNA cloned in plasmid pBR322 carrying the gene for the viral core antigen have been placed under the control of the lac promoter of Escherichia coli. Several of the new recombinants direct higher levels of synthesis of the antigen, but the degree of enhancement varies with the different structures of the plasmids and hence the mRNAs produced. The antigen in crude bacterial lysates is a satisfactory diagnostic reagent for antibodies to the core antigen in serum samples. Images PMID:7041126

Detection of XerC and XerD recombinases in gram-negative bacteria of the family Enterobacteriaceae.

PubMed Central

Sirois, S; Szatmari, G

1995-01-01

XerC and XerD are site-specific recombinases of the lambda integrase family which resolve multimeric replicons to monomers by acting at specific sites such as cer, ckr, nmr, parB, and psi, which are found in plasmids, or at the dif site found in the Escherichia coli chromosome. By using Southern hybridizations to cloned E. coli xerC and xerD genes and a cer-nmr plasmid-based resolution assay, the presence of these genes in several species of Enterobacteriaceae is shown. PMID:7608100

Dissemination of CTX-M-15 β-Lactamase Genes Carried on Inc FI and FII Plasmids among Clinical Isolates of Escherichia coli in a University Hospital in Istanbul, Turkey▿

PubMed Central

Gonullu, Nevriye; Aktas, Zerrin; Kayacan, Cigdem Bal; Salcioglu, Melek; Carattoli, Alessandra; Yong, Dong Eun; Walsh, Timothy R.

2008-01-01

The CTX-M-1 group was found in 86.8% of the Escherichia coli isolates from Istanbul. A subset study revealed all isolates carrying blaCTX-M-15 genes flanked by the insertion element ISEcp1. Plasmid typing of transconjugates carrying blaCTX-M-15 showed that most isolates belonged to the Inc/rep FII group but that one isolate also belonged to the FI group. PMID:18184851

Identification and characterization of a gene product that regulates type 1 piliation in Escherichia coli.

PubMed Central

Orndorff, P E; Falkow, S

1984-01-01

The recombinant plasmid pSH2 confers type 1 piliation (Pil+) on a nonpiliated (Pil-) strain of Escherichia coli K-12. At least four plasmid-encoded gene products are involved in pilus biosynthesis and expression. We present evidence which indicates that one gene encodes an inhibitor of piliation. Hyperpiliated (Hyp) mutants were isolated after Tn5 insertion mutagenesis of pSH2 and introduction of the plasmid DNA into a Pil- strain of E. coli as unique small, compact colonies. Also, Hyp mutants clumped during growth in static broth and were piliated under several cultural conditions that normally suppressed piliation. Electron microscopic examination of Hyp mutants associated an observed 40-fold increase in pilin antigen with an increase in the number and length of pili per cell. All Hyp mutants examined failed to produce a 23-kilodalton protein that was encoded by a gene adjacent to the structural (pilin) gene for type 1 pili, and all Tn5 insertion mutations that produced the Hyp phenotype mapped in this region (hyp). Piliation in Hyp mutants could be reduced to near parental levels by introducing a second plasmid containing a parental hyp gene. Thus the 23-kilodalton (hyp) protein appears to act in trans to regulate the level of piliation. Images PMID:6148338

A method for constructing single-copy lac fusions in Salmonella typhimurium and its application to the hemA-prfA operon.

PubMed

Elliott, T

1992-01-01

This report describes a set of Escherichia coli and Salmonella typhimurium strains that permits the reversible transfer of lac fusions between a plasmid and either bacterial chromosome. The system relies on homologous recombination in an E. coli recD host for transfer from plasmid to chromosome. This E. coli strain carries the S. typhimurium put operon inserted into trp, and the resulting fusions are of the form trp::put::[Kanr-X-lac], where X is the promoter or gene fragment under study. The put homology flanks the lac fusion segment, so that fusions can be transduced into S. typhimurium, replacing the resident put operon. Subsequent transduction into an S. typhimurium strain with a large chromosomal deletion covering put allows selection for recombinants that inherit the fusion on a plasmid. A transposable version of the put operon was constructed and used to direct lac fusions to novel locations, including the F plasmid and the ara locus. Transductional crosses between strains with fusions bearing different segments of the hemA-prfA operon were used to determine the contribution of the hemA promoter region to expression of the prfA gene and other genes downstream of hemA in S. typhimurium.

Widespread distribution of CTX-M and plasmid-mediated AmpC β-lactamases in Escherichia coli from Brazilian chicken meat.

PubMed

Botelho, Larissa Alvarenga Batista; Kraychete, Gabriela Bergiante; Costa e Silva, Jacqueline Lapa; Regis, Douglas Viller Vieira; Picão, Renata Cristina; Moreira, Beatriz Meurer; Bonelli, Raquel Regina

2015-04-01

The dissemination of plasmid-mediated antimicrobial resistance genes may pose a substantial public health risk. In the present work, the occurrences of blaCTX-M and plasmid-mediated ampC and qnr genes were investigated in Escherichia coli from 16 chicken carcasses produced by four commercial brands in Brazil. Of the brands tested, three were exporters, including one of organic chicken. Our study assessed 136 E. coli isolates that were grouped into 77 distinct biotypes defined by their origin, resistance profiling, the presence of β-lactamase and plasmid-mediated quinolone resistance genes and enterobacterial repetitive intergenic consensus-polimerase chain reaction typing. The blaCTX-M-15, blaCTX-M-2 and blaCTX-M-8 genes were detected in one, 17 and eight different biotypes, respectively (45 isolates). Twenty-one biotypes (46 isolates) harboured blaCMY-2. Additionally, blaCMY-2 was identified in isolates that also carried either blaCTX-M-2 or blaCTX-M-8. The qnrB and/or qnrS genes occurred in isolates carrying each of the four types of β-lactamase determinants detected and also in oxyimino-cephalosporin-susceptible strains. Plasmid-mediated extended-spectrum β-lactamase (ESBL) and AmpC determinants were identified in carcasses from the four brands tested. Notably, this is the first description of blaCTX-M-15 genes in meat or food-producing animals from South America. The blaCTX-M-8, blaCTX-M-15 and blaCMY-2 genes were transferable in conjugation experiments. The findings of the present study indicate that plasmid-mediated ESBL and AmpC-encoding genes are widely distributed in Brazilian chicken meat.

pLS010 plasmid vector

DOEpatents

Lacks, Sanford A.; Balganesh, Tanjore S.

1988-01-01

Disclosed is recombinant plasmid pLS101, consisting essentially of a 2.0 Kb malM gene fragment ligated to a 4.4 Kb T.sub.c r DNA fragment, which is particularly useful for transforming Gram-positive bacteria. This plasmid contains at least four restriction sites suitable for inserting exogeneous gene sequences. Also disclosed is a method for plasmid isolation by penicillin selection, as well as processes for enrichment of recombinant plasmids in Gram-positive bacterial systems.

Production of immunologically active surface antigens of hepatitis B virus by Escherichia coli.

PubMed Central

MacKay, P; Pasek, M; Magazin, M; Kovacic, R T; Allet, B; Stahl, S; Gilbert, W; Schaller, H; Bruce, S A; Murray, K

1981-01-01

Several plasmids have been constructed which direct the synthesis of hepatitis B virus surface antigens in Escherichia coli either as the native polypeptide or fused to other plasmid encoded polypeptides. When injected into rabbits, extracts from bacteria carrying some of these plasmids induced the synthesis of antibodies to the antigens even though the extracts did not give satisfactory positive results in radioimmunoassay for them. Either the NH2-terminal segment or the COOH-terminal segment of the surface antigens alone was sufficient to elicit the immune response, but antibodies against the two segments showed different specificities. The results emphasize the value of an in vivo assay for the presence of antigens in crude cell extracts and illustrate the feasibility of this type of screening with laboratory animals. PMID:6170067

Plasmid expression and maintenance during long-term starvation-survival of bacteria in well water.

PubMed Central

Caldwell, B A; Ye, C; Griffiths, R P; Moyer, C L; Morita, R Y

1989-01-01

Strains of enteric bacteria and pseudomonads containing plasmid R388::Tnl721 (Tpr, Tcr) or pRO101 (Hgr, Tcr) were starved for over 250 days in sterile well water to evaluate effects of starvation-survival on plasmid expression and maintenance. Viable populations dropped to between approximately 0.1 and 1% of the initial populations. Escherichia coli(pRO101) and Pseudomonas cepacia(pRO101) lost both viability and plasmid expression at a lower rate than strains containing R388::Tnl721. Three patterns of host-plasmid interaction were detected: (i) no apparent loss of plasmid expression, (ii) loss of plasmid expression on initial recovery with subsequent expression upon resuscitation, and (iii) loss of capability to produce functional plasmid resistance. PMID:2782868

Advanced Design of Dumbbell-shaped Genetic Minimal Vectors Improves Non-coding and Coding RNA Expression.

PubMed

Jiang, Xiaoou; Yu, Han; Teo, Cui Rong; Tan, Genim Siu Xian; Goh, Sok Chin; Patel, Parasvi; Chua, Yiqiang Kevin; Hameed, Nasirah Banu Sahul; Bertoletti, Antonio; Patzel, Volker

2016-09-01

Dumbbell-shaped DNA minimal vectors lacking nontherapeutic genes and bacterial sequences are considered a stable, safe alternative to viral, nonviral, and naked plasmid-based gene-transfer systems. We investigated novel molecular features of dumbbell vectors aiming to reduce vector size and to improve the expression of noncoding or coding RNA. We minimized small hairpin RNA (shRNA) or microRNA (miRNA) expressing dumbbell vectors in size down to 130 bp generating the smallest genetic expression vectors reported. This was achieved by using a minimal H1 promoter with integrated transcriptional terminator transcribing the RNA hairpin structure around the dumbbell loop. Such vectors were generated with high conversion yields using a novel protocol. Minimized shRNA-expressing dumbbells showed accelerated kinetics of delivery and transcription leading to enhanced gene silencing in human tissue culture cells. In primary human T cells, minimized miRNA-expressing dumbbells revealed higher stability and triggered stronger target gene suppression as compared with plasmids and miRNA mimics. Dumbbell-driven gene expression was enhanced up to 56- or 160-fold by implementation of an intron and the SV40 enhancer compared with control dumbbells or plasmids. Advanced dumbbell vectors may represent one option to close the gap between durable expression that is achievable with integrating viral vectors and short-term effects triggered by naked RNA.

Mainstreams of Horizontal Gene Exchange in Enterobacteria: Consideration of the Outbreak of Enterohemorrhagic E. coli O104:H4 in Germany in 2011

PubMed Central

Bezuidt, Oliver; Pierneef, Rian; Mncube, Kingdom; Lima-Mendez, Gipsi; Reva, Oleg N.

2011-01-01

Background Escherichia coli O104:H4 caused a severe outbreak in Europe in 2011. The strain TY-2482 sequenced from this outbreak allowed the discovery of its closest relatives but failed to resolve ways in which it originated and evolved. On account of the previous statement, may we expect similar upcoming outbreaks to occur recurrently or spontaneously in the future? The inability to answer these questions shows limitations of the current comparative and evolutionary genomics methods. Principal Findings The study revealed oscillations of gene exchange in enterobacteria, which originated from marine γ-Proteobacteria. These mobile genetic elements have become recombination hotspots and effective ‘vehicles’ ensuring a wide distribution of successful combinations of fitness and virulence genes among enterobacteria. Two remarkable peculiarities of the strain TY-2482 and its relatives were observed: i) retaining the genetic primitiveness by these strains as they somehow avoided the main fluxes of horizontal gene transfer which effectively penetrated other enetrobacteria; ii) acquisition of antibiotic resistance genes in a plasmid genomic island of β-Proteobacteria origin which ontologically is unrelated to the predominant genomic islands of enterobacteria. Conclusions Oscillations of horizontal gene exchange activity were reported which result from a counterbalance between the acquired resistance of bacteria towards existing mobile vectors and the generation of new vectors in the environmental microflora. We hypothesized that TY-2482 may originate from a genetically primitive lineage of E. coli that has evolved in confined geographical areas and brought by human migration or cattle trade onto an intersection of several independent streams of horizontal gene exchange. Development of a system for monitoring the new and most active gene exchange events was proposed. PMID:22022434

A strategy for high-level expression of a single-chain variable fragment against TNFα by subcloning antibody variable regions from the phage display vector pCANTAB 5E into pBV220.

PubMed

Yang, Tao; Yang, Lijun; Chai, Weiran; Li, Renke; Xie, Jun; Niu, Bo

2011-03-01

A phage display single-chain variable fragment (scFv) library against TNFα was constructed using a recombinant phage antibody system (RPAS). The cloned scFv gene was introduced into the phage display vector pCANTAB 5E and expressed in Escherichia coli (E. coli) with a yield of up to 0.15 mg/l of total protein. With the attempt to improve the expression level of TNF-scFv, a strategy was established for subcloning the scFv gene from pCANTAB 5E into the plasmid pBV220. Under the control of a highly efficient tandem P(R)P(L) promoter system, scFv production was increased to 30% of total protein as inclusion bodies. After extraction from the cell pellet by sonication, the inclusion bodies were solubilized and denatured in the presence of 8M urea. Purification of denatured scFv was performed using nickel column chromatography followed by renaturation. The purity and activity of the refolded scFv were confirmed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), Western blotting and by an enzyme-linked immunoabsorbent assay (ELISA). The results reveal that the overall yield of bioactive TNF-scFv from E. coli flask cultures was more than 45 mg/l culture medium and 15 mg/g wet weight cells. The renatured scFv exhibited binding activity similarly to soluble scFv. In conclusion we developed a method to over-express TNF-scFv, which have biological function after purification and renaturation. Copyright © 2010 Elsevier Inc. All rights reserved.

EcoliWiki: a wiki-based community resource for Escherichia coli

PubMed Central

McIntosh, Brenley K.; Renfro, Daniel P.; Knapp, Gwendowlyn S.; Lairikyengbam, Chanchala R.; Liles, Nathan M.; Niu, Lili; Supak, Amanda M.; Venkatraman, Anand; Zweifel, Adrienne E.; Siegele, Deborah A.; Hu, James C.

2012-01-01

EcoliWiki is the community annotation component of the PortEco (http://porteco.org; formerly EcoliHub) project, an online data resource that integrates information on laboratory strains of Escherichia coli, its phages, plasmids and mobile genetic elements. As one of the early adopters of the wiki approach to model organism databases, EcoliWiki was designed to not only facilitate community-driven sharing of biological knowledge about E. coli as a model organism, but also to be interoperable with other data resources. EcoliWiki content currently covers genes from five laboratory E. coli strains, 21 bacteriophage genomes, F plasmid and eight transposons. EcoliWiki integrates the Mediawiki wiki platform with other open-source software tools and in-house software development to extend how wikis can be used for model organism databases. EcoliWiki can be accessed online at http://ecoliwiki.net. PMID:22064863

Physical Characterization of Gemini Surfactant-Based Synthetic Vectors for the Delivery of Linear Covalently Closed (LCC) DNA Ministrings

PubMed Central

Sum, Chi Hong; Nafissi, Nafiseh; Slavcev, Roderick A.; Wettig, Shawn

2015-01-01

In combination with novel linear covalently closed (LCC) DNA minivectors, referred to as DNA ministrings, a gemini surfactant-based synthetic vector for gene delivery has been shown to exhibit enhanced delivery and bioavailability while offering a heightened safety profile. Due to topological differences from conventional circular covalently closed (CCC) plasmid DNA vectors, the linear topology of LCC DNA ministrings may present differences with regards to DNA interaction and the physicochemical properties influencing DNA-surfactant interactions in the formulation of lipoplexed particles. In this study, N,N-bis(dimethylhexadecyl)-α,ω-propanediammonium(16-3-16)gemini-based synthetic vectors, incorporating either CCC plasmid or LCC DNA ministrings, were characterized and compared with respect to particle size, zeta potential, DNA encapsulation, DNase sensitivity, and in vitro transgene delivery efficacy. Through comparative analysis, differences between CCC plasmid DNA and LCC DNA ministrings led to variations in the physical properties of the resulting lipoplexes after complexation with 16-3-16 gemini surfactants. Despite the size disparities between the plasmid DNA vectors (CCC) and DNA ministrings (LCC), differences in DNA topology resulted in the generation of lipoplexes of comparable particle sizes. The capacity for ministring (LCC) derived lipoplexes to undergo complete counterion release during lipoplex formation contributed to improved DNA encapsulation, protection from DNase degradation, and in vitro transgene delivery. PMID:26561857

A fully decompressed synthetic bacteriophage øX174 genome assembled and archived in yeast.

PubMed

Jaschke, Paul R; Lieberman, Erica K; Rodriguez, Jon; Sierra, Adrian; Endy, Drew

2012-12-20

The 5386 nucleotide bacteriophage øX174 genome has a complicated architecture that encodes 11 gene products via overlapping protein coding sequences spanning multiple reading frames. We designed a 6302 nucleotide synthetic surrogate, øX174.1, that fully separates all primary phage protein coding sequences along with cognate translation control elements. To specify øX174.1f, a decompressed genome the same length as wild type, we truncated the gene F coding sequence. We synthesized DNA encoding fragments of øX174.1f and used a combination of in vitro- and yeast-based assembly to produce yeast vectors encoding natural or designer bacteriophage genomes. We isolated clonal preparations of yeast plasmid DNA and transfected E. coli C strains. We recovered viable øX174 particles containing the øX174.1f genome from E. coli C strains that independently express full-length gene F. We expect that yeast can serve as a genomic 'drydock' within which to maintain and manipulate clonal lineages of other obligate lytic phage. Copyright © 2012 Elsevier Inc. All rights reserved.

Use of hydrophilic extra-viral domain of canine distemper virus H protein for enzyme-linked immunosorbent assay development.

PubMed

Cho, Ki-hyun; Kim, Jeongmi; Yoo, Hyun-ah; Kim, Dae-hee; Park, Seung-yong; Song, Chang-seon; Choi, In-soo; Lee, Joong-bok

2014-12-01

Simple methods for measuring the levels of serum antibody against canine distemper virus (CDV) would assist in the effective vaccination of dogs. To develop an enzyme-linked immunosorbent assay (ELISA) specific for CDV, we expressed hydrophilic extra-viral domain (HEVD) protein of the A75/17-CDV H gene in a pET 28a plasmid-based Escherichia (E.) coli vector system. Expression was confirmed by dot and Western blotting. We proposed that detection of E. coli-expressed H protein might be conformation- dependent because intensities of the reactions observed with these two methods varied. The H gene HEVD protein was further purified and used as an antigen for an ELISA. Samples from dogs with undetectable to high anti-CDV antibody titers were analyzed using this HEVD-specific ELISA and a commercial CDV antibody detection kit (ImmunoComb). Levels of HEVD antigenicity measured with the assays and immunochromatography correlated. These data indicated that the HEDV protein may be used as antigen to develop techniques for detecting antibodies against CDV.

Osmoregulated TAQ polymerase gene expression in Escherichia coli.

PubMed

Cabrera Artiles, Yeosvany; Martínez García, Duniesky; Pérez Cruz, Enrique R; Márquez Perera, Gabriel J; Feble, Manuel Luis

2002-01-01

The Thermus aquaticus DNA Polymerase I (Taq Pol I) gene was cloned into the pOSEX4 plasmid under the osmo-inducible promoter proU and subsequently expressed into the Escherichia coli MKH13 strain. The suitability of the enzyme in polymerase assays was determined in standard 35S dATP incorporation tests and by PCR. The Taq Pol I expression in this system, which is under the control of the osmotic pressure in the growth medium, was analyzed in different media and in different sodium chloride concentrations. A study of the osmolarity effects in the growth of the strain and in Taq Pol I expression shows that an increase in sodium chloride concentration limits the growth. At 0.25 M of NaCl maximum activity was observed; at higher values of osmolarity, we found an unexpected decline of activity. This is the first report of using the pOSEX vector for the expression of an heterologous protein and it is very advantageous to make a regulated, non toxic, simple and cost-effective manner of induction in a biotechnology process using just NaCl or other non-permeable osmolyte.

A conserved virulence plasmidic region contributes to the virulence of the multiresistant Escherichia coli meningitis strain S286 belonging to phylogenetic group C.

PubMed

Lemaître, Chloé; Mahjoub-Messai, Farah; Dupont, Damien; Caro, Valérie; Diancourt, Laure; Bingen, Edouard; Bidet, Philippe; Bonacorsi, Stéphane

2013-01-01

Recent isolation of the non-K1 Escherichia coli neonatal meningitis strain S286, belonging to phylogroup C, which is closely related to major group B1, and producing an extended-spectrum beta-lactamase, encouraged us to seek the genetic determinants responsible for its virulence. We show that S286 belongs to the sequence O type ST23O78 and harbors 4 large plasmids. The largest one, pS286colV (~120 kb), not related to resistance, contains genes characteristic of a Conserved Virulence Plasmidic (CVP) region initially identified in B2 extra-intestinal avian pathogenic E. coli (APEC) strains and in the B2 neonatal meningitis E. coli strain S88. The sequence of this CVP region has a strong homology (98%) with that of the recently sequenced plasmid pChi7122-1 of the O78 APEC strain Chi7122. A CVP plasmid-cured variant of S286 was less virulent than the wild type strain in a neonatal rat sepsis model with a significant lower level of bacteremia at 24 h (4.1 ± 1.41 versus 2.60 ± 0.16 log CFU/ml, p = 0.001) and mortality. However, the mortality in the model of adult mice was comparable between wild type and variant indicating that pS286colV is not sufficient by itself to fully explain the virulence of S286. Gene expression analysis of pS286colV in iron depleted environment was very close to that of pS88, suggesting that genes of CVP region may be expressed similarly in two very different genetic backgrounds (group C versus group B2). Screening a collection of 178 human A/B1 extraintestinal pathogenic E. coli (ExPEC) strains revealed that the CVP region is highly prevalent (23%) and MLST analysis indicated that these CVP positive strains belong to several clusters and mostly to phylogroup C. The virulence of S286 is explained in part by the presence of CVP region and this region has spread in different clusters of human A/B1 ExPEC, especially in group C.

Expression in Escherichia coli and purification of bioactive antibacterial peptide ABP-CM4 from the Chinese silk worm, Bombyx mori.

PubMed

Li, Bao-Cun; Zhang, Shuang-Quan; Dan, Wen-Bing; Chen, Yu-Qing; Cao, Peng

2007-07-01

The antibacterial peptide CM4 (ABP-CM4), isolated from Chinese Bombys mori, is a 35-residue cationic, amphipathic alpha-helical peptide that exhibits a broad range of antimicrobial activity. To explore a new approach for the expression of ABP-CM4 in E. coli, the gene ABP-CM4, obtained by recursive PCR (rPCR), was cloned into the vector pET32a to construct a fusion expression plasmid. The fusion protein Trx-CM4 was expressed in soluble form, purified by Ni(2+)-chelating chromatography, and cleaved by formic acid to release recombinant CM4. Purification of rCM4 was achieved by affinity chromatography and reverse-phase HPLC. The purified of recombinant peptide showed antimicrobial activities against E. coli K(12)D(31), Penicillium chrysogenum, Aspergillus niger and Gibberella saubinetii. According to the antimicrobial peptide database (http://aps.unmc.edu/AP/main.html), 116 peptides contain a Met residue, but only 5 peptides contain the AspPro site, indicating a broader application of formic acid than CNBr in cleaving fusion protein. The successful application to the expression of the ABP-CM4 indicates that the system is a low-cost, efficient way of producting milligram quantities of ABP-CM4 that is biologically active.

Detection & characterization of necrotoxin producing Escherichia coli (NTEC) from patients with urinary tract infection (UTI).

PubMed

Rahman, Helina; Deka, Manab

2014-04-01

Urinary tract infections (UTI) are a serious health problem affecting millions of people each year. Although appreciable work on various aspects of UTI including aetiology per se has been done, information on the emerging pathogens like necrotoxigenic Escherichia coli (NTEC) is largely lacking in India. In the present study E. coli isolates from patients with urinary tract infection from northeastern India were investigated for detection and characterization of NTEC. E. coli isolated and identified from urine samples of patients with UTI were serotyped. Antibiogram was determined by disc diffusion test. Plasmid profile was also determined. Virulence genes of NTEC (cnf1, cnf2, pap, aer, sfa, hly, afa) were detected by PCR assay. E.coli isolates carrying cnf gene (s) were identified as NTEC. A total of 550 E. coli were isolated and tested for the presence of cnf genes. Of these, 84 (15.27%) belonged to NTEC. The cnf1 gene was present in 52 (61.9%) isolates, cnf2 in 23 (27.4%) and 9 (10.7%) carried both cnf1 and cnf2 genes. All the NTEC strains were found to harbour the pap and aer genes. Serogroup O4 was found to be the most common among the 12 serogroups identified amongst the NTEC isolates. Majority of the isolates (96.4%) were sensitive to furazolidone and were highly resistant to ampicillin. NTEC were found to harbour different numbers of plasmids (1 to 7). No association was observed between the number of plasmids and the antibiotic resistance of the isolates. The results of the present study showed that about 15 per cent of E. coli isolates associated with UTI belonged to NTEC. More studies need to be done from other parts of the country.

Overexpression of Salmonella enterica serovar Typhi recA gene confers fluoroquinolone resistance in Escherichia coli DH5α.

PubMed

Yassien, M A M; Elfaky, M A

2015-11-01

A spontaneous fluoroquinolone-resistant mutant (STM1) was isolated from its parent Salmonella enterica serovar Typhi (S. Typhi) clinical isolate. Unlike its parent isolate, this mutant has selective resistance to fluoroquinolones without any change in its sensitivity to various other antibiotics. DNA gyrase assays revealed that the fluoroquinolone resistance phenotype of the STM1 mutant did not result from alteration of the fluoroquinolone sensitivity of the DNA gyrase isolated from it. To study the mechanism of fluoroquinolone resistance, a genomic library from the STM1 mutant was constructed in Escherichia coli DH5α and two recombinant plasmids were obtained. Only one of these plasmids (STM1-A) conferred the selective fluoroquinolone resistance phenotype to E. coli DH5α. The chromosomal insert from STM1-A, digested with EcoRI and HindIII restriction endonucleases, produced two DNA fragments and these were cloned separately into pUC19 thereby generating two new plasmids, STM1-A1 and STM1-A2. Only STM1-A1 conferred the selective fluoroquinolone resistance phenotype to E. coli DH5α. Sequence and subcloning analyses of STM1-A1 showed the presence of an intact RecA open reading frame. Unlike that of the wild-type E. coli DH5α, protein analysis of a crude STM1-A1 extract showed overexpression of a 40 kDa protein. Western blotting confirmed the 40 kDa protein band to be RecA. When a RecA PCR product was cloned into pGEM-T and introduced into E. coli DH5α, the STM1-A11 subclone retained fluoroquinolone resistance. These results suggest that overexpression of RecA causes selective fluoroquinolone resistance in E. coli DH5α.

[Molecular cloning, expression and characterization of lysine decarboxylase gene of endophytic fungus Shiraia sp. Slf14 from Huperzia serrata].

PubMed

Peng, Silu; Yang, Huilin; Zhu, Du; Zhang, Zhibin; Yan, Riming; Wang, Ya

2016-04-14

Huperzine A (HupA) was approved as a drug for the treatment of Alzheimer's disease. The HupA biosynthetic pathway was started from lysine decarboxylase (LDC), which catalyzes lysine to cadaverine. In this study, we cloned and expressed an LDC gene from a HupA-producing endophytic fungus, and tested LDC activities. An endophytic fungus Shiraia sp. Slf14 from Huperzia serrata was used. LDC gene was obtained by RT-PCR, and cloned into pET-22b(+) and pET-32a(+) vectors to construct recombinant plasmids pET- 22b-LDC and pET-32a-LDC. These two recombinant plasmids were transformed into E. coli BL21, cultured for 8 h at 24 °C, 200 r/min with 1×10–3 mol/L IPTG into medium to express the LDC proteins, respectively. LDC proteins were purified by Ni2+ affinity chromatography. Catalytic activities were measured by Thin Layer Chromatography. At last, the physicochemical properties and structures of these two LDCs were obtained by bioinformatics software. LDC and Trx-LDC were expressed in E. coli BL21 successfully. SDS-PAGE analysis shows that the molecular weight of LDC and Trx-LDC were 24.4 kDa and 42.7 kDa respectively, which are consistent with bioinformatics analysis. In addition, TLC analysis reveals that both LDC and Trx-LDC had catalytic abilities. This work can provide fundamental data for enriching LDC molecular information and reveal the HupA biosynthetic pathway in endophytic fungi.

[Construction and prokaryotic expression of recombinant gene EGFRvIII HBcAg and immunogenicity analysis of the fusion protein].

PubMed

Duan, Xiao-yi; Wang, Jian-sheng; Guo, You-min; Han, Jun-li; Wang, Quan-ying; Yang, Guang-xiao

2007-01-01

To construct recombinant prokaryotic expression plasmid pET28a(+)/c-PEP-3-c and evaluate the immunogenicity of the fusion protein. cDNA fragment encoding PEP-3 was obtained from pGEM-T Easy/PEP-3 and inserted into recombinant plasmid pGEMEX/HBcAg. Then it was subcloned in prokaryotic expression vector and transformed into E.coli BL21(DE3). The fusion protein was expressed by inducing IPTG and purified by Ni(2+)-NTA affinity chromatography. BALB/c mice were immunized with fusion protein and the antibody titre was determined by indirect ELISA. The recombinant gene was confirmed to be correct by restriction enzyme digestion and DNA sequencing. After prokaryotic expression, fusion protein existed in sediment and accounted for 56% of all bacterial lysate. The purified product accounted for 92% of all protein and its concentration was 8 g/L. The antibody titre in blood serum reached 1:16 000 after the fourth immunization and reached 1:2.56x10(5) after the sixth immunization. The titre of anti-PEP-3 antibody reached 1:1.28x10(5) and the titre of anti-HBcAg antibody was less than 1:4x10(3). Fusion gene PEP-3-HBcAg is highly expressed in E.coli BL21. The expressed fusion protein can induce neutralizing antibody with high titer and specificity, which lays a foundation for the study of genetically engineering vaccine for malignant tumors with the high expression of EGFRvIII.

Characterization of Endogenous Plasmids from Lactobacillus salivarius UCC118▿ †

PubMed Central

Fang, Fang; Flynn, Sarah; Li, Yin; Claesson, Marcus J.; van Pijkeren, Jan-Peter; Collins, J. Kevin; van Sinderen, Douwe; O'Toole, Paul W.

2008-01-01

The genome of Lactobacillus salivarius UCC118 comprises a 1.83-Mb chromosome, a 242-kb megaplasmid (pMP118), and two smaller plasmids of 20 kb (pSF118-20) and 44 kb (pSF118-44). Annotation and bioinformatic analyses suggest that both of the smaller plasmids replicate by a theta replication mechanism. Furthermore, it appears that they are transmissible, although neither possesses a complete set of conjugation genes. Plasmid pSF118-20 encodes a toxin-antitoxin system composed of pemI and pemK homologs, and this plasmid could be cured when PemI was produced in trans. The minimal replicon of pSF118-20 was determined by deletion analysis. Shuttle vector derivatives of pSF118-20 were generated that included the replication region (pLS203) and the replication region plus mobilization genes (pLS208). The plasmid pLS203 was stably maintained without selection in Lactobacillus plantarum, Lactobacillus fermentum, and the pSF118-20-cured derivative strain of L. salivarius UCC118 (strain LS201). Cloning in pLS203 of genes encoding luciferase and green fluorescent protein, and expression from a constitutive L. salivarius promoter, demonstrated the utility of this vector for the expression of heterologous genes in Lactobacillus. This study thus expands the knowledge base and vector repertoire of probiotic lactobacilli. PMID:18390685

Anaerobically controlled expression system derived from the arcDABC operon of Pseudomonas aeruginosa: application to lipase production.

PubMed Central

Winteler, H V; Schneidinger, B; Jaeger, K E; Haas, D

1996-01-01

The anaerobically inducible arcDABC operon encodes the enzymes of the arginine deiminase pathway in Pseudomonas aeruginosa. Upon induction, the arcAB mRNAs and proteins reach high intracellular levels, because of a strong anaerobically controlled promoter and mRNA processing in arcD, leading to stable downstream transcripts. We explored the usefulness of this system for the construction of expression vectors. The lacZ gene of Escherichia coli was expressed to the highest levels when fused close to the arc promoter. Insertion of lacZ further downstream into arcA or arcB did not stabilize the intrinsically unstable lacZ mRNA. On the contrary, lacZ mRNA appeared to be a vulnerable endonuclease target destabilizing arcAB mRNAs in the 5'-to-3' direction in P. aeruginosa. The native arc promoter was modified for optional expression in the -10 sequence and in the -40 region, which is a binding site for the anaerobic regulator ANR. In P. aeruginosa grown either anaerobically or with oxygen limitation in unshaken cultures, this promoter was stronger than the induced tac promoter. The P. aeruginosa lipAH genes, which encode extracellular lipase and lipase foldase, respectively, were fused directly to the modified arc promoter in an IncQ vector plasmid. Semianaerobic static cultures of P. aeruginosa PAO1 carrying this recombinant plasmid overproduced extracellular lipase 30-fold during stationary phase compared with the production by strain PAO1 without the plasmid. Severe oxygen limitation, in contrast, resulted in poor lipase productivity despite effective induction of the ANR-dependent promoter, suggesting that secretion of active lipase is blocked by the absence of oxygen. In conclusion, the modified arc promoter is useful for driving the expression of cloned genes in P. aeruginosa during oxygen-limited growth and stationary phase. PMID:8795231

AAVS1-Targeted Plasmid Integration in AAV Producer Cell Lines.

PubMed

Luo, Yuxia; Frederick, Amy; Martin, John M; Scaria, Abraham; Cheng, Seng H; Armentano, Donna; Wadsworth, Samuel C; Vincent, Karen A

2017-06-01

Adeno-associated virus (AAV) producer cell lines are created via transfection of HeLaS3 cells with a single plasmid containing three components (the vector sequence, the AAV rep and cap genes, and a selectable marker gene). As this plasmid contains both the cis (Rep binding sites) and trans (Rep protein encoded by the rep gene) elements required for site-specific integration, it was predicted that plasmid integration might occur within the AAVS1 locus on human chromosome 19 (chr19). The objective of this study was to investigate whether integration in AAVS1 might be correlated with vector yield. Plasmid integration sites within several independent cell lines were assessed via Southern, fluorescence in situ hybridization (FISH) and PCR analyses. In the Southern analyses, the presence of fragments detected by both rep- and AAVS1-specific probes suggested that for several mid- and high-producing lines, plasmid DNA had integrated into the AAVS1 locus. Analysis with puroR and AAVS1-specific probes suggested that integration in AAVS1 was a more widespread phenomenon. High-producing AAV2-secreted alkaline phosphatase (SEAP) lines (masterwell 82 [MW82] and MW278) were evaluated via FISH using probes specific for the plasmid, AAVS1, and a chr19 marker. FISH analysis detected two plasmid integration sites in MW278 (neither in AAVS1), while a total of three sites were identified in MW82 (two in AAVS1). An inverse PCR assay confirmed integration within AAVS1 for several mid- and high-producing lines. In summary, the FISH, Southern, and PCR data provide evidence of site-specific integration of the plasmid within AAVS1 in several AAV producer cell lines. The data also suggest that integration in AAVS1 is a general phenomenon that is not necessarily restricted to high producers. The results also suggest that plasmid integration within the AAVS1 locus is not an absolute requirement for a high vector yield.

Genetic characteristics and antimicrobial resistance of Escherichia coli from Japanese macaques (Macaca fuscata) in rural Japan.

PubMed

Ogawa, Keiko; Yamaguchi, Keiji; Suzuki, Masatsugu; Tsubota, Toshio; Ohya, Kenji; Fukushi, Hideto

2011-04-01

Escherichia coli was isolated from wild and captive Japanese macaques (Macaca fuscata) to investigate the risk of zoonotic infections and the prevalence of antimicrobial-resistant Escherichia coli in the wild macaque population in Shimokita Peninsula, a rural area of Japan. We collected 265 fresh fecal samples from wild macaques and 20 samples from captive macaques in 2005 and 2006 for E. coli isolation. The predominant isolates were characterized by serotyping, virulence gene profiling, plasmid profiling, pulsed-field gel electrophoresis (PFGE), and microbial sensitivity tests. In total, 248 E. coli strains were isolated from 159 fecal samples from wild macaques, and 42 E. coli were isolated from 17 samples from captive macaques. None of the virulence genes eae, stx, elt, and est were detected in any of the isolates. The relatedness between wild- and captive-derived isolates was low by serotyping, PFGE, and plasmid profiling. Serotypes O8:H6, O8:H34, O8:H42, O8:HUT, O103:H27, O103:HNM, and OUT:H27 were found in wild macaque feces; serotypes O157:H42 and O119:H21 were recovered from captive macaques. O-and H-serotypes of the 26 isolates were not typed by commercial typing antisera and were named OUT and HUT, respectively. Twenty-eight isolates had no flagellar antigen, and their H-serotypes were named HNM. Similarity of PFGE patterns between wild-derived isolates and captive-derived isolates was <70%. No plasmid profile was shared between wild-derived and captive-derived isolates. The prevalence of antimicrobial-resistant E. coli was 6.5% (n=62) in wild macaques, and these isolates were resistant to cephalothin. We conclude that wild Japanese macaques in Shimokita Peninsula were unlikely to act as a reservoir of pathogenic E. coli for humans and that antimicrobial-resistant E. coli in wild macaques may be derived from humans.

Sequences of two related multiple antibiotic resistance virulence plasmids sharing a unique IS26-related molecular signature isolated from different Escherichia coli pathotypes from different hosts.

PubMed

Venturini, Carola; Hassan, Karl A; Roy Chowdhury, Piklu; Paulsen, Ian T; Walker, Mark J; Djordjevic, Steven P

2013-01-01

Enterohemorrhagic Escherichia coli (EHEC) and atypical enteropathogenic E. coli (aEPEC) are important zoonotic pathogens that increasingly are becoming resistant to multiple antibiotics. Here we describe two plasmids, pO26-CRL125 (125 kb) from a human O26:H- EHEC, and pO111-CRL115 (115kb) from a bovine O111 aEPEC, that impart resistance to ampicillin, kanamycin, neomycin, streptomycin, sulfathiazole, trimethoprim and tetracycline and both contain atypical class 1 integrons with an identical IS26-mediated deletion in their 3´-conserved segment. Complete sequence analysis showed that pO26-CRL125 and pO111-CRL115 are essentially identical except for a 9.7 kb fragment, present in the backbone of pO26-CRL125 but absent in pO111-CRL115, and several indels. The 9.7 kb fragment encodes IncI-associated genes involved in plasmid stability during conjugation, a putative transposase gene and three imperfect repeats. Contiguous sequence identical to regions within these pO26-CRL125 imperfect repeats was identified in pO111-CRL115 precisely where the 9.7 kb fragment is missing, suggesting it may be mobile. Sequences shared between the plasmids include a complete IncZ replicon, a unique toxin/antitoxin system, IncI stability and maintenance genes, a novel putative serine protease autotransporter, and an IncI1 transfer system including a unique shufflon. Both plasmids carry a derivate Tn21 transposon with an atypical class 1 integron comprising a dfrA5 gene cassette encoding resistance to trimethoprim, and 24 bp of the 3´-conserved segment followed by Tn6026, which encodes resistance to ampicillin, kanymycin, neomycin, streptomycin and sulfathiazole. The Tn21-derivative transposon is linked to a truncated Tn1721, encoding resistance to tetracycline, via a region containing the IncP-1α oriV. Absence of the 5 bp direct repeats flanking Tn3-family transposons, indicates that homologous recombination events played a key role in the formation of this complex antibiotic resistance gene locus. Comparative sequence analysis of these closely related plasmids reveals aspects of plasmid evolution in pathogenic E. coli from different hosts.

pLS101 plasmid vector

DOEpatents

Lacks, S.A.; Balganesh, T.S.

1985-02-19

Disclosed is recombinant plasmid pLS101, consisting essentially of a 2.0 Kb ma1M gene fragment ligated to a 4.4 Kb Tcr DNA fragment, which is particularly useful for transforming Gram-positive bacteria. This plasmid contains at least four restriction sites suitable for inserting exogeneous gene sequences. Also disclosed is a method for plasmid isolation by penicillin selection, as well as processes for enrichment of recombinant plasmids in Gram-positive bacterial systems. 5 figs., 2 tabs.

DETECTION OF DNA DAMAGE USING MELTING ANALYSIS TECHNIQUES

EPA Science Inventory

A rapid and simple fluorescence screening assay for UV radiation-, chemical-, and enzyme-induced DNA damage is reported. This assay is based on a melting/annealing analysis technique and has been used with both calf thymus DNA and plasmid DNA (puc 19 plasmid from E. coli). DN...

Construction of small plasmid vectors for use in genetic improvement of the extremely acidophilic Acidithiobacillus caldus.

PubMed

Meng, Jianzhou; Wang, Huiyan; Liu, Xiangmei; Lin, Jianqun; Pang, Xin; Lin, Jianqiang

2013-10-01

The genetic improvement of biomining bacteria including Acidithiobacillus caldus could facilitate the bioleaching process of sulfur-containing minerals. However, the available vectors for use in A. caldus are very scanty and limited to relatively large broad-host-range IncQ plasmids. In this study, a set of small, mobilizable plasmid vectors (pBBR1MCS-6, pMSD1 and pMSD2) were constructed based on plasmid pBBR1MCS-2, which does not belong to the IncQ, IncW, or IncP groups. The function of the tac promoter on 5.8-kb pMSD2 was determined by inserting a kanamycin-resistant reporter gene. The resulting recombinant pMSD2-Km was successfully transferred by conjugation into A. caldus MTH-04 with transfer frequency of 1.38±0.64×10(-5). The stability and plasmid copy number of pMSD2-Km in A. caldus MTH-04 were 75±2.7% and 5-6 copies per cell, respectively. By inserting an arsABC operon into pMSD2, an arsenic-resistant recombinant pMSD2-As was constructed and transferred into A. caldus MTH-04 by conjugation. The arsenic tolerance of A. caldus MTH-04 containing pMSD2-As was obviously increased up to 45mM of NaAsO2. These vectors could be applied in genetic improvement of A. caldus as well as other bioleaching bacteria. Copyright © 2013 Elsevier GmbH. All rights reserved.

[Construction of a plant effective expression vector containing the gene of hepatitis B virus surface antigen].

PubMed

Lin, Bing-Ying; Jin, Zhi-Qiang; Li, Mei

2006-11-01

To construct a plant effective expression vector driven by a fruit specific promoter for the expression of hepatitis B virus surface antigen (HBsAg), to further improve the expression of exogenous gene in plant, and to prepare for the development of an effective anti-hepatitis vaccine. Tomato fruit-specific promoters' gene 2A12 and E8 were respectively introduced to pBPFOmega7 to form pB2A12 and pBE8. The DNA fragment containing HBsAg-s gene from plasmid YEP-HBs was inserted respectively into pB2A12 and pBE8 to form pB2A12-HBs and pBE8-HBs. The fragment containing "p35S+2A12+Omega+HBsAg-s+Tnos" of the pB2A12-HBs was sub-cloned into plasmid pCAMBIA1301 to yield the reconstructed plant binary expression plasmid pCAM2A12-HBs, and the fragment containing "p35S+E8+Omega+HBsAg-s+Tnos" of the pBE8-HBs was sub-cloned into plasmid pCAMBIA1301 to yield the plasmid pCAME8-HBs. The inserted gene HBsAg and fruit-specific promoters in the reconstructed plant binary expression vectors were confirmed by sequencing. Then, pCAM2A12-HBs and pCAME8-HBs were directly introduced into Agrobacterium tumefaciens strain EHA105. Digestion with restriction enzymes proved that all recombinant vectors had the inserts with expected length of the target fragments, and the sequencing results were confirmed correct. In this study, plant expression vector containing HBsAg gene driven by fruit specific promoter and CaMV35s promoter was successfully constructed.

Cloning Should Be Simple: Escherichia coli DH5α-Mediated Assembly of Multiple DNA Fragments with Short End Homologies

PubMed Central

Richardson, Ruth E.; Suzuki, Yo

2015-01-01

Numerous DNA assembly technologies exist for generating plasmids for biological studies. Many procedures require complex in vitro or in vivo assembly reactions followed by plasmid propagation in recombination-impaired Escherichia coli strains such as DH5α, which are optimal for stable amplification of the DNA materials. Here we show that despite its utility as a cloning strain, DH5α retains sufficient recombinase activity to assemble up to six double-stranded DNA fragments ranging in size from 150 bp to at least 7 kb into plasmids in vivo. This process also requires surprisingly small amounts of DNA, potentially obviating the need for upstream assembly processes associated with most common applications of DNA assembly. We demonstrate the application of this process in cloning of various DNA fragments including synthetic genes, preparation of knockout constructs, and incorporation of guide RNA sequences in constructs for clustered regularly interspaced short palindromic repeats (CRISPR) genome editing. This consolidated process for assembly and amplification in a widely available strain of E. coli may enable productivity gain across disciplines involving recombinant DNA work. PMID:26348330

X-Ray Crystal Structure of the passenger domain of Plasmid encoded toxin(Pet), an Autotransporter Enterotoxin from enteroaggregative Escherichia coli (EAEC)

PubMed Central

Meza-Aguilar, J. Domingo; Fromme, Petra; Torres-Larios, Alfredo; Mendoza-Hernández, Guillermo; Hernandez-Chiñas, Ulises; Monteros, Roberto A. Arreguin-Espinosa de los; Campos, Carlos A. Eslava; Fromme, Raimund

2014-01-01

Autotransporters (ATs) represent a superfamily of proteins produced by a variety of pathogenic bacteria, which include the pathogenic groups of Escherichia coli (E. coli) associated with gastrointestinal and urinary tract infections. We present the first X-ray structure of the passenger domain from the Plasmid-encoded toxin (Pet) a 100 kDa protein at 2.3 Å resolution which is a cause of acute diarrhea in both developing and industrialized countries. Pet is a cytoskeleton-altering toxin that induces loss of actin stress fibers. While Pet (pdb code: 4OM9) shows only a sequence identity of 50 % compared to the closest related protein sequence, extracellular serine protease plasmid (EspP) the structural features of both proteins are conserved. A closer structural look reveals that Pet contains a β-pleaded sheet at the sequence region of residues 181-190, the corresponding structural domain in EspP consists of a coiled loop. Secondary, the Pet passenger domain features a more pronounced beta sheet between residues 135-143 compared to the structure of EspP. PMID:24530907

Characterization of a minimal pKW2124 replicon from Weissella cibaria KLC140 and its application for the construction of the Weissella expression vector pKUCm1

PubMed Central

Ku, Hye-Jin; Park, Myeong Soo; Lee, Ju-Hoon

2015-01-01

A 2.1-kb plasmid was previously isolated from Weissella cibaria KLC140 in kimchi and cloned into pUC19 along with the slpA and gfp genes, resulting in an 8.6-kb pKWCSLGFP construct for use as a novel surface display vector. To reduce the size of the vector, the minimal replicon of pKW2124 was determined. The pKW2124 plasmid contains a putative origin of replication (ori), a potential ribosomal binding site (RBS), and the repA gene encoding a plasmid replication protein. To conduct the minimal replicon experiment, four different PCR products (MR1, ori+RBS+repA; MR2, RBS+repA; MR2’, repA; MR3, fragment of repA) were obtained and cloned into pUC19 (pKUCm1, pKUCm2, pKUCm2’, and pKUCm3, respectively) containing the chloramphenicol acetyltransferase (CAT) gene. These constructed vectors were electroporated into W. confusa ATCC 10881 with different transformation efficiencies of 1.5 × 105 CFU/μg, 1.3 × 101 CFU/μg, and no transformation, respectively, suggesting that the putative ori, RBS, and repA gene are essential for optimum plasmid replication. Subsequent segregational plasmid stability testing of pKUCm1 and pKUCm2 showed that the vector pKUCm1 is highly stable up to 100 generations but pKUCm2 was completely lost after 60 generations, suggesting that the putative ori may be important for plasmid stability in the host strain. In addition, a host range test of pKUCm1 revealed that it has a broad host range spectrum including Weissella, Lactococcus, Leuconostoc, and even Lactobacillus. To verify the application of pKUCm1, the β-galactosidase gene and its promoter region from W. cibaria KSD1 were cloned in the vector, resulting in pKUGal. Expression of the β-galactosidase gene was confirmed using blue-white screening after IPTG induction. The small and stable pKUGal vector will be useful for gene transfer, expression, and manipulation in the Weissella genome and in other lactic acid bacteria. PMID:25691882

Genetic Transformation of Bacteria.

ERIC Educational Resources Information Center

Moss, Robert.

1991-01-01

An activity in which students transform an ampicillin-sensitive strain of E. coli with a plasmid containing a gene for ampicillin resistance is described. The procedure for the preparation of competent cells and the transformation of competent E. coli is provided. (KR)

Nonradioactive Screening Method for Isolation of Disease-Specific Probes To Diagnose Plant Diseases Caused by Mycoplasmalike Organisms

PubMed Central

Lee, Ing-Ming; Davis, Robert E.; DeWitt, Natalie D.

1990-01-01

DNA fragments of tomato big bud (BB) mycoplasmalike organism (MLO) in diseased periwinkle plants (Catharanthus roseus L.) were cloned to pSP6 plasmid vectors and amplified in Escherichia coli JM83. A nonradioactive method was developed and used to screen for MLO-specific recombinants. Cloned DNA probes were prepared by nick translation of the MLO recombinant plasmids by using biotinylated nucleotides. The probes all hybridized with nucleic acid from BB MLO-infected, but not healthy, plants. Results from dot hybridization analyses indicated that several MLOs, e.g., those of Italian tomato big bud, periwinkle little leaf, and clover phyllody, are closely related to BB MLO. The Maryland strain of aster yellows and maize bushy stunt MLOs are also related to BB MLO. Among the remaining MLOs used in this study, Vinca virescence and elm yellows MLOs may be very distantly related, if at all, to BB MLO. Potato witches' broom, clover proliferation, ash yellows, western X, and Canada X MLOs are distantly related to BB MLO. Southern hybridization analyses revealed that BB MLO contains extrachromosomal DNA that shares sequence homologies with extrachromosomal DNAs from aster yellows and periwinkle little leaf MLOs. Images PMID:16348195

A replicative plasmid vector allows efficient complementation of pathogenic Leptospira strains.

PubMed

Pappas, Christopher J; Benaroudj, Nadia; Picardeau, Mathieu

2015-05-01

Leptospirosis, an emerging zoonotic disease, remains poorly understood because of a lack of genetic manipulation tools available for pathogenic leptospires. Current genetic manipulation techniques include insertion of DNA by random transposon mutagenesis and homologous recombination via suicide vectors. This study describes the construction of a shuttle vector, pMaORI, that replicates within saprophytic, intermediate, and pathogenic leptospires. The shuttle vector was constructed by the insertion of a 2.9-kb DNA segment including the parA, parB, and rep genes into pMAT, a plasmid that cannot replicate in Leptospira spp. and contains a backbone consisting of an aadA cassette, ori R6K, and oriT RK2/RP4. The inserted DNA segment was isolated from a 52-kb region within Leptospira mayottensis strain 200901116 that is not found in the closely related strain L. mayottensis 200901122. Because of the size of this region and the presence of bacteriophage-like proteins, it is possible that this region is a result of a phage-related genomic island. The stability of the pMaORI plasmid within pathogenic strains was tested by passaging cultures 10 times without selection and confirming the presence of pMaORI. Concordantly, we report the use of trans complementation in the pathogen Leptospira interrogans. Transformation of a pMaORI vector carrying a functional copy of the perR gene in a null mutant background restores the expression of PerR and susceptibility to hydrogen peroxide comparable to that of wild-type cells. In conclusion, we demonstrate the replication of a stable plasmid vector in a large panel of Leptospira strains, including pathogens. The shuttle vector described will expand our ability to perform genetic manipulation of Leptospira spp. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

[Expression and Preliminary Research on the Soluble Domain of EV-D68 3A Protein].

PubMed

Li, Ting; Kong, Jia; Yu, Xiao-fang; Han, Xue

2015-11-01

To understand the structure of the soluble region of Enterovirus 68 3A protein, we construct a prokaryotic expression vector expressing the soluble region of EV-D68 3A protein, and identify the forms of expression product after purification. The EV-D68 3A(1-61) gene was amplified by PCR and then cloned into the expression vector pET-28a-His-SUMO. The recombinant plasmid was transformed into Escherichia coli BL21 induced by IPTG to express the fusion protein His-SUMO-3A(1-61). The recombinant protein was purified by Ni-NTA Agarose and cleaved by ULP Protease to remove His-SUMO tag. After that, the target protein 3A(1-61) was purified by a series of purification methods such as Ni-NTA, anion exchange chromatography and gel filtration chromato- graphy. Chemical cross-linking reaction assay was taken to determine the multiple polymerization state of the 3A soluble region. A prokaryotic expression vector pET28a-His-SUMO-3A(1-61) expressing the solution region of EV-D68 3A was successfully constructed and plenty of highly pure target proteins were obtained by multiple purification steps . The total protein amount was about 5 mg obtained from 1L Escherichia coli BL21 with purity > 95%. At the same time, those results determined the homomultimer form of soluble 3A construct. These data demonstrated that the expression and purification system of the soluble region of 3A were successfully set up and provide some basic konwledge for the research about 3A crystal structure and the development of antiviral drugs targeted at 3A to block viral replication.

Multiple ESBL-Producing Escherichia coli Sequence Types Carrying Quinolone and Aminoglycoside Resistance Genes Circulating in Companion and Domestic Farm Animals in Mwanza, Tanzania, Harbor Commonly Occurring Plasmids

PubMed Central

Seni, Jeremiah; Falgenhauer, Linda; Simeo, Nabina; Mirambo, Mariam M.; Imirzalioglu, Can; Matee, Mecky; Rweyemamu, Mark; Chakraborty, Trinad; Mshana, Stephen E.

2016-01-01

The increased presence of extended-spectrum beta-lactamase (ESBL)-producing bacteria in humans, animals, and their surrounding environments is of global concern. Currently there is limited information on ESBL presence in rural farming communities worldwide. We performed a cross-sectional study in Mwanza, Tanzania, involving 600 companion and domestic farm animals between August/September 2014. Rectal swab/cloaca specimens were processed to identify ESBL-producing Enterobacteriaceae. We detected 130 (21.7%) animals carrying ESBL-producing bacteria, the highest carriage being among dogs and pigs [39.2% (51/130) and 33.1% (43/130), respectively]. The majority of isolates were Escherichia coli [93.3% (125/134)] and exotic breed type [OR (95%CI) = 2.372 (1.460–3.854), p-value < 0.001] was found to be a predictor of ESBL carriage among animals. Whole-genome sequences of 25 ESBL-producing E. coli were analyzed for phylogenetic relationships using multi-locus sequence typing (MLST) and core genome comparisons. Fourteen different sequence types were detected of which ST617 (7/25), ST2852 (3/25), ST1303 (3/25) were the most abundant. All isolates harbored the blaCTX-M-15 allele, 22/25 carried strA and strB, 12/25 aac(6′)-lb-cr, and 11/25 qnrS1. Antibiotic resistance was associated with IncF, IncY, as well as non-typable plasmids. Eleven isolates carried pPGRT46-related plasmids, previously reported from isolates in Nigeria. Five isolates had plasmids exhibiting 85–99% homology to pCA28, previously detected in isolates from the US. Our findings indicate a pan-species distribution of ESBL-producing E. coli clonal groups in farming communities and provide evidence for plasmids harboring antibiotic resistances of regional and international impact. PMID:26904015

Plasmid-mediated bioaugmentation of sequencing batch reactors for enhancement of 2,4-dichlorophenoxyacetic acid removal in wastewater using plasmid pJP4.

PubMed

Tsutsui, Hirofumi; Anami, Yasutaka; Matsuda, Masami; Hashimoto, Kurumi; Inoue, Daisuke; Sei, Kazunari; Soda, Satoshi; Ike, Michihiko

2013-06-01

Plasmid-mediated bioaugmentation was demonstrated using sequencing batch reactors (SBRs) for enhancing 2,4-dichlorophenoxyacetic acid (2,4-D) removal by introducing Cupriavidus necator JMP134 and Escherichia coli HB101 harboring 2,4-D-degrading plasmid pJP4. C. necator JMP134(pJP4) can mineralize and grow on 2,4-D, while E. coli HB101(pJP4) cannot assimilate 2,4-D because it lacks the chromosomal genes to degrade the intermediates. The SBR with C. necator JMP134(pJP4) showed 100 % removal against 200 mg/l of 2,4-D just after its introduction, after which 2,4-D removal dropped to 0 % on day 7 with the decline in viability of the introduced strain. The SBR with E. coli HB101(pJP4) showed low 2,4-D removal, i.e., below 10 %, until day 7. Transconjugant strains of Pseudomonas and Achromobacter isolated on day 7 could not grow on 2,4-D. Both SBRs started removing 2,4-D at 100 % after day 16 with the appearance of 2,4-D-degrading transconjugants belonging to Achromobacter, Burkholderia, Cupriavidus, and Pandoraea. After the influent 2,4-D concentration was increased to 500 mg/l on day 65, the SBR with E. coli HB101(pJP4) maintained stable 2,4-D removal of more than 95 %. Although the SBR with C. necator JMP134(pJP4) showed a temporal depression of 2,4-D removal of 65 % on day 76, almost 100 % removal was achieved thereafter. During this period, transconjugants isolated from both SBRs were mainly Achromobacter with high 2,4-D-degrading capability. In conclusion, plasmid-mediated bioaugmentation can enhance the degradation capability of activated sludge regardless of the survival of introduced strains and their 2,4-D degradation capacity.

Internalization of E. coli O157:H7 in spinach cultivated in soil and hydroponic media

USDA-ARS?s Scientific Manuscript database

Introduction: Internalization of E. coli O157:H7 into spinach plants through root uptake is a potential route of contamination. Previous studies that have investigated uptake of E. coli O157:H7 into leafy greens have expressed green fluorescent protein (gfp) from a plasmid, possibly limiting detecti...

Fosfomycin Resistance in Escherichia coli, Pennsylvania, USA.

PubMed

Alrowais, Hind; McElheny, Christi L; Spychala, Caressa N; Sastry, Sangeeta; Guo, Qinglan; Butt, Adeel A; Doi, Yohei

2015-11-01

Fosfomycin resistance in Escherichia coli is rare in the United States. An extended-spectrum β-lactamase-producing E. coli clinical strain identified in Pennsylvania, USA, showed high-level fosfomycin resistance caused by the fosA3 gene. The IncFII plasmid carrying this gene had a structure similar to those found in China, where fosfomycin resistance is commonly described.

Effect of disinfectants on stability and transmissibility of R-plasmid in E. coli isolated from drinking water.

PubMed

Tewari, Suman; Ramteke, Pramod W; Garg, S K

2003-03-01

Drug resistant enteropathogenic E. coli (EPEC, 086 serotype) isolated from contaminated piped drinking water supply (Fecal coliform 160/100 ml) was studied for effect of disinfectants (chlorine and UVB) on stability and transmissibility of R-plasmid. The strain was resistant to streptomycin and bacitracin and tolerant to multiple metal ions of Cd, Cr, Co, As, Ni, Zn and Hg. A plasmid of molecular size of 3.7 Kb was detected in the organism. After exposure to sublethal doses of disinfectants, complete elimination of resistances to streptomycin and Cr was observed. Partial loss of resistance to Hg due to chlorine was detected. Although UVB did not effected the pattern of transmissibility effect on frequency of transfer was observed. Surprisingly, in UVB irradiated cells, significantly enhanced rate of transfer was noted.

KPC-2 carbapenemase and DHA-1 AmpC determinants carried on the same plasmid in Enterobacter aerogenes.

PubMed

Kuai, Shougang; Shao, Haifeng; Huang, Lihua; Pei, Hao; Lu, Zhonghua; Wang, Weiping; Liu, Jun

2014-03-01

This study was conducted to analyse the presence of a plasmid-mediated carbapenem resistance mechanism in a clinical Enterobacter aerogenes isolate from a patient from Jiangsu province, People's Republic of China. PCR and sequencing confirmed that the isolate harboured Klebsiella pneumoniae carbapenemase (KPC)-2, DHA-1 and TEM-1 β-lactamase genes. Both the KPC-2 and DHA-1 genes were transferred to Escherichia coli C600 by transconjugation, and Southern blotting confirmed that these two genes were located on the same plasmid, which was of approximately 56 kb in size. The Enterobacter aerogenes isolate was resistant to carbapenems and other tested antimicrobial agents. The Escherichia coli transconjugant showed reduced susceptibility but not resistance to carbapenems and other β-lactams, indicating the presence of another, possibly permeability-related, resistance mechanism in the clinical isolate.

The "Frankenplasmid" Lab: An Investigative Exercise for Teaching Recombinant DNA Methods

ERIC Educational Resources Information Center

Dean, Derek M.; Wilder, Jason A.

2011-01-01

We describe an investigative laboratory module designed to give college undergraduates strong practical and theoretical experience with recombinant DNA methods within 3 weeks. After deducing restriction enzyme maps for two different plasmids, students ligate the plasmids together in the same reaction, transform "E. coli" with this mixture of…

DETECTION OF LOW DOSE RADIATION INDUCED DNA DAMAGE USING TEMPERATURE DIFFERENTIAL FLUORESCENCE ASSAY

EPA Science Inventory

A rapid and sensitive fluorescence assay for radiation-induced DNA damage is reported. Changes in temperature-induced strand separation in both calf thymus DNA and plasmid DNA (puc 19 plasmid from Escherichia coli) were measured after exposure to low doses of radiation. Exposur...

DETECTION OF LOW DOSE RADIATION INDUCED DNA DAMAGE USING TEMPERATURE DIFFERENNTIAL FLUORESENCE ASSAY

EPA Science Inventory

A rapid and sensitive fluorescence assay for radiation-induced DNA damage is reported. Changes in temperature-induced strand separation in both calf thymus DNA and plasmid DNA (puc 19 plasmid from Escherichia coli) were measured after exposure to low doses of radiation. Exposures...

Genetic and molecular characterization of the guaC-nadC-aroP region of Escherichia coli K-12.

PubMed

Roberts, R E; Lienhard, C I; Gaines, C G; Smith, J M; Guest, J R

1988-01-01

The guaC (GMP reductase), nadC (quinolinate phosphoribosyltransferase), and aroP (aromatic amino acid permease) genes of Escherichia coli K-12 were located in the 2.5-min region of the chromosome (muT-guaC-nadC-aroP-aceE) by a combination of linkage analysis, deletion mapping, restriction analysis, and plasmid subcloning. The guaC locus expressed a product of Mr 37,000 with a clockwise transcriptional polarity, and the GMP reductase activities of guaC+ plasmid-containing strains were amplified 15- to 20-fold.

Cloning of a Recombinant Plasmid Encoding Thiol-Specific Antioxidant Antigen (TSA) Gene of Leishmania majorand Expression in the Chinese Hamster Ovary Cell Line.

PubMed

Fatemeh, Ghaffarifar; Fatemeh, Tabatabaie; Zohreh, Sharifi; Abdolhosein, Dalimiasl; Mohammad Zahir, Hassan; Mehdi, Mahdavi

2012-01-01

TSA (thiol-specific antioxidant antigen) is the immune-dominant antigen of Leishmania major and is considered to be the most promising candidate molecule for a recombinant or DNA vaccine against leishmaniasis. The aim of the present work was to express a plasmid containing the TSA gene in eukaryotic cells. Genomic DNA was extracted, and the TSA gene was amplified by polymerase chain reaction (PCR). The PCR product was cloned into the pTZ57R/T vector, followed by subcloning into the eukaryotic expression vector pcDNA3 (EcoRI and HindIII sites). The recombinant plasmid was characterised by restriction digest and PCR. Eukaryotic Chinese hamster ovary cells were transfected with the plasmid containing the TSA gene. Expression of the L. major TSA gene was confirmed by sodium dodecyl sulphate-polyacrylamide gel electrophoresis and Western blotting. The plasmid containing the TSA gene was successfully expressed, as demonstrated by a band of 22.1 kDa on Western blots. The plasmid containing the TSA gene can be expressed in a eukaryotic cell line. Thus, the recombinant plasmid may potentially be used as a DNA vaccine in animal models.

Degradation of Substituted Phenylurea Herbicides by Arthrobacter globiformis Strain D47 and Characterization of a Plasmid-Associated Hydrolase Gene, puhA

PubMed Central

Turnbull, Gillian A.; Ousley, Margaret; Walker, Allan; Shaw, Eve; Morgan, J. Alun W.

2001-01-01

Arthrobacter globiformis D47 was shown to degrade a range of substituted phenylurea herbicides in soil. This strain contained two plasmids of approximately 47 kb (pHRIM620) and 34 kb (pHRIM621). Plasmid-curing experiments produced plasmid-free strains as well as strains containing either the 47- or the 34-kb plasmid. The strains were tested for their ability to degrade diuron, which demonstrated that the degradative genes were located on the 47-kb plasmid. Studies on the growth of these strains indicated that the ability to degrade diuron did not offer a selective advantage to A. globiformis D47 on minimal medium designed to contain the herbicide as a sole carbon source. The location of the genes on a plasmid and a lack of selection would explain why the degradative phenotype, as with many other pesticide-degrading bacteria, can be lost on subculture. A 22-kb EcoRI fragment of plasmid pHRIM620 was expressed in Escherichia coli and enabled cells to degrade diuron. Transposon mutagenesis of this fragment identified one open reading frame that was essential for enzyme activity. A smaller subclone of this gene (2.5 kb) expressed in E. coli coded for the protein that degraded diuron. This gene and its predicted protein sequence showed only a low level of protein identity (25% over ca. 440 amino acids) to other database sequences and was named after the enzyme it encoded, phenylurea hydrolase (puhA gene). PMID:11319111

DNASU plasmid and PSI:Biology-Materials repositories: resources to accelerate biological research

PubMed Central

Seiler, Catherine Y.; Park, Jin G.; Sharma, Amit; Hunter, Preston; Surapaneni, Padmini; Sedillo, Casey; Field, James; Algar, Rhys; Price, Andrea; Steel, Jason; Throop, Andrea; Fiacco, Michael; LaBaer, Joshua

2014-01-01

The mission of the DNASU Plasmid Repository is to accelerate research by providing high-quality, annotated plasmid samples and online plasmid resources to the research community through the curated DNASU database, website and repository (http://dnasu.asu.edu or http://dnasu.org). The collection includes plasmids from grant-funded, high-throughput cloning projects performed in our laboratory, plasmids from external researchers, and large collections from consortia such as the ORFeome Collaboration and the NIGMS-funded Protein Structure Initiative: Biology (PSI:Biology). Through DNASU, researchers can search for and access detailed information about each plasmid such as the full length gene insert sequence, vector information, associated publications, and links to external resources that provide additional protein annotations and experimental protocols. Plasmids can be requested directly through the DNASU website. DNASU and the PSI:Biology-Materials Repositories were previously described in the 2010 NAR Database Issue (Cormier, C.Y., Mohr, S.E., Zuo, D., Hu, Y., Rolfs, A., Kramer, J., Taycher, E., Kelley, F., Fiacco, M., Turnbull, G. et al. (2010) Protein Structure Initiative Material Repository: an open shared public resource of structural genomics plasmids for the biological community. Nucleic Acids Res., 38, D743–D749.). In this update we will describe the plasmid collection and highlight the new features in the website redesign, including new browse/search options, plasmid annotations and a dynamic vector mapping feature that was developed in collaboration with LabGenius. Overall, these plasmid resources continue to enable research with the goal of elucidating the role of proteins in both normal biological processes and disease. PMID:24225319

Construction of an easy-to-use CRISPR-Cas9 system by patching a newly designed EXIT circuit.

PubMed

Tang, Qiang; Lou, Chunbo; Liu, Shuang-Jiang

2017-01-01

Plasmid-borne genetic editing tools, including the widely used CRISPR-Cas9 system, have greatly facilitated bacterial programming to obtain novel functionalities. However, the lack of effective post-editing plasmid elimination methods impedes follow-up genetic manipulation or application. Conventional strategies including exposure to physical and chemical treatments, or exploiting temperature-sensitive replication origins have several drawbacks (e.g., they are limited for efficiency and are time-consuming). Therefore, the demand is apparent for easy and rapid elimination of the tool plasmids from their bacterial hosts after genetic manipulation. To bridge this gap, we designed a novel EXIT circuit with the homing endonuclease, which can be exploited for rapid and efficient elimination of various plasmids with diverse replication origins. As a proof of concept, we validated the EXIT circuit in Escherichia coli by harnessing homing endonuclease I- Sce I and its cleavage site. When integrated into multiple plasmids with different origins, the EXIT circuit allowed them to be eliminated from the host cells, simultaneously. By combining the widely used plasmid-borne CRISPR-Cas9 system and the EXIT circuit, we constructed an easy-to-use CRISPR-Cas9 system that eliminated the Cas9- and the single-guide RNA (sgRNA)-encoding plasmids in one-step. Within 3 days, we successfully constructed an atrazine-degrading E. coli strain, thus further demonstrating the advantage of this new CRISPR-Cas9 system for bacterial genome editing. Our novel EXIT circuit, which exploits the homing endonuclease I- Sce I, enables plasmid(s) with different replication origins to be eliminated from their host cells rapidly and efficiently. We also developed an easy-to-use CRISPR-Cas9 system with the EXIT circuit, and this new system can be widely applied to bacterial genome editing.

Nucleotide excision repair pathway assessment in DNA exposed to low-intensity red and infrared lasers.

PubMed

Fonseca, A S; Campos, V M A; Magalhães, L A G; Paoli, F

2015-10-01

Low-intensity lasers are used for prevention and management of oral mucositis induced by anticancer therapy, but the effectiveness of treatment depends on the genetic characteristics of affected cells. This study evaluated the survival and induction of filamentation of Escherichia coli cells deficient in the nucleotide excision repair pathway, and the action of T4endonuclease V on plasmid DNA exposed to low-intensity red and near-infrared laser light. Cultures of wild-type (strain AB1157) E. coli and strain AB1886 (deficient in uvrA protein) were exposed to red (660 nm) and infrared (808 nm) lasers at various fluences, powers and emission modes to study bacterial survival and filamentation. Also, plasmid DNA was exposed to laser light to study DNA lesions produced in vitro by T4endonuclease V. Low-intensity lasers:i) had no effect on survival of wild-type E. coli but decreased the survival of uvrA protein-deficient cells,ii) induced bacterial filamentation, iii) did not alter the electrophoretic profile of plasmids in agarose gels, andiv) did not alter the electrophoretic profile of plasmids incubated with T4 endonuclease V. These results increase our understanding of the effects of laser light on cells with various genetic characteristics, such as xeroderma pigmentosum cells deficient in nucleotide excision pathway activity in patients with mucositis treated by low-intensity lasers.

X-ray crystal structure of the passenger domain of plasmid encoded toxin(Pet), an autotransporter enterotoxin from enteroaggregative Escherichia coli (EAEC)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Domingo Meza-Aguilar, J.; Laboratorio de Patogenicidad Bacteriana, Unidad de Hemato Oncología e Investigación, Hospital Infantil de México Federico Gómez 06720, D.F.; Fromme, Petra

Highlights: • X-ray crystal structure of the passenger domain of Plasmid encoded toxin at 2.3 Å. • Structural differences between Pet passenger domain and EspP protein are described. • High flexibility of the C-terminal beta helix is structurally assigned. - Abstract: Autotransporters (ATs) represent a superfamily of proteins produced by a variety of pathogenic bacteria, which include the pathogenic groups of Escherichia coli (E. coli) associated with gastrointestinal and urinary tract infections. We present the first X-ray structure of the passenger domain from the Plasmid-encoded toxin (Pet) a 100 kDa protein at 2.3 Å resolution which is a cause ofmore » acute diarrhea in both developing and industrialized countries. Pet is a cytoskeleton-altering toxin that induces loss of actin stress fibers. While Pet (pdb code: 4OM9) shows only a sequence identity of 50% compared to the closest related protein sequence, extracellular serine protease plasmid (EspP) the structural features of both proteins are conserved. A closer structural look reveals that Pet contains a β-pleaded sheet at the sequence region of residues 181–190, the corresponding structural domain in EspP consists of a coiled loop. Secondary, the Pet passenger domain features a more pronounced beta sheet between residues 135 and 143 compared to the structure of EspP.« less

Nucleotide excision repair pathway assessment in DNA exposed to low-intensity red and infrared lasers

PubMed Central

Fonseca, A.S.; Campos, V.M.A.; Magalhães, L.A.G.; Paoli, F.

2015-01-01

Low-intensity lasers are used for prevention and management of oral mucositis induced by anticancer therapy, but the effectiveness of treatment depends on the genetic characteristics of affected cells. This study evaluated the survival and induction of filamentation of Escherichia coli cells deficient in the nucleotide excision repair pathway, and the action of T4endonuclease V on plasmid DNA exposed to low-intensity red and near-infrared laser light. Cultures of wild-type (strain AB1157) E. coli and strain AB1886 (deficient in uvrA protein) were exposed to red (660 nm) and infrared (808 nm) lasers at various fluences, powers and emission modes to study bacterial survival and filamentation. Also, plasmid DNA was exposed to laser light to study DNA lesions produced in vitro by T4endonuclease V. Low-intensity lasers:i) had no effect on survival of wild-type E. coli but decreased the survival of uvrA protein-deficient cells,ii) induced bacterial filamentation, iii) did not alter the electrophoretic profile of plasmids in agarose gels, andiv) did not alter the electrophoretic profile of plasmids incubated with T4 endonuclease V. These results increase our understanding of the effects of laser light on cells with various genetic characteristics, such as xeroderma pigmentosum cells deficient in nucleotide excision pathway activity in patients with mucositis treated by low-intensity lasers. PMID:26445337

Using Phage Display to Create Recombinant Antibodies.

PubMed

Dasch, James R; Dasch, Amy L

2017-09-01

A variety of phage display technologies have been developed since the approach was first described for antibodies. The most widely used approaches incorporate antibody sequences into the minor coat protein pIII of the nonlytic filamentous phage fd or M13. Libraries of variable gene sequences, encoding either scFv or Fab fragments, are made by incorporating sequences into phagemid vectors. The phagemid is packaged into phage particles with the assistance of a helper phage to produce the antibody display phage. This protocol describes a method for creating a phagemid library. The multiple cloning site (MCS) of the pBluescript KS(-) phagemid vector is replaced by digestion with the restriction enzyme BssHII, followed by the insertion of four overlapping oligonucleotides to create a new MCS within the vector. Next, the 3' portion of gene III (from M13mp18) is amplified and combined with an antibody sequence using overlap extension PCR. This product is inserted into the phagemid vector to create pPDS. Two helper plasmids are also created from the modified pBluescript vector: pLINK provides the linker between the heavy and light chains, and pFABC provides the CH1 domain of the heavy chain. An antibody cDNA library is constructed from the RNA of interest and ligated into pPDS. The phagemid library is electroporated into Escherichia coli cells along with the VCS-M13 helper phage. © 2017 Cold Spring Harbor Laboratory Press.

pYEMF, a pUC18-derived XcmI T-vector for efficient cloning of PCR products.

PubMed

Gu, Jingsong; Ye, Chunjiang

2011-03-01

A 1330-bp DNA sequence with two XcmI cassettes was inserted into pUC18 to construct an efficient XcmI T-vector parent plasmid, pYEMF. The large size of the inserted DNA fragment improved T-vector cleavage efficiency, and guaranteed good separation of the molecular components after restriction digestion. The pYEMF-T-vector generated from parent plasmid pYEMF permits blue/white colony screening; cloning efficiency analysis showed that most white colonies (>75%) were putative transformants which carried the cloning product. The sequence analysis and design approach presented here will facilitate applications in the fields of molecular biology and genetic engineering.

Does Nonlinear Modeling Play a Role in Plasmid Bioprocess Monitoring Using Fourier Transform Infrared Spectra?

PubMed

Lopes, Marta B; Calado, Cecília R C; Figueiredo, Mário A T; Bioucas-Dias, José M

2017-06-01

The monitoring of biopharmaceutical products using Fourier transform infrared (FT-IR) spectroscopy relies on calibration techniques involving the acquisition of spectra of bioprocess samples along the process. The most commonly used method for that purpose is partial least squares (PLS) regression, under the assumption that a linear model is valid. Despite being successful in the presence of small nonlinearities, linear methods may fail in the presence of strong nonlinearities. This paper studies the potential usefulness of nonlinear regression methods for predicting, from in situ near-infrared (NIR) and mid-infrared (MIR) spectra acquired in high-throughput mode, biomass and plasmid concentrations in Escherichia coli DH5-α cultures producing the plasmid model pVAX-LacZ. The linear methods PLS and ridge regression (RR) are compared with their kernel (nonlinear) versions, kPLS and kRR, as well as with the (also nonlinear) relevance vector machine (RVM) and Gaussian process regression (GPR). For the systems studied, RR provided better predictive performances compared to the remaining methods. Moreover, the results point to further investigation based on larger data sets whenever differences in predictive accuracy between a linear method and its kernelized version could not be found. The use of nonlinear methods, however, shall be judged regarding the additional computational cost required to tune their additional parameters, especially when the less computationally demanding linear methods herein studied are able to successfully monitor the variables under study.

Stability, Entrapment and Variant Formation of Salmonella Genomic Island 1

PubMed Central

Kiss, János; Nagy, Béla; Olasz, Ferenc

2012-01-01

Background The Salmonella genomic island 1 (SGI1) is a 42.4 kb integrative mobilizable element containing several antibiotic resistance determinants embedded in a complex integron segment In104. The numerous SGI1 variants identified so far, differ mainly in this segment and the explanations of their emergence were mostly based on comparative structure analyses. Here we provide experimental studies on the stability, entrapment and variant formation of this peculiar gene cluster originally found in S. Typhimurium. Methodology/Principal Findings Segregation and conjugation tests and various molecular techniques were used to detect the emerging SGI1 variants in Salmonella populations of 17 Salmonella enterica serovar Typhimurium DT104 isolates from Hungary. The SGI1s in these isolates proved to be fully competent in excision, conjugal transfer by the IncA/C helper plasmid R55, and integration into the E. coli chromosome. A trap vector has been constructed and successfully applied to capture the island on a plasmid. Monitoring of segregation of SGI1 indicated high stability of the island. SGI1-free segregants did not accumulate during long-term propagation, but several SGI1 variants could be obtained. Most of them appeared to be identical to SGI1-B and SGI1-C, but two new variants caused by deletions via a short-homology-dependent recombination process have also been detected. We have also noticed that the presence of the conjugation helper plasmid increased the formation of these deletion variants considerably. Conclusions/Significance Despite that excision of SGI1 from the chromosome was proven in SGI1+ Salmonella populations, its complete loss could not be observed. On the other hand, we demonstrated that several variants, among them two newly identified ones, arose with detectable frequencies in these populations in a short timescale and their formation was promoted by the helper plasmid. This reflects that IncA/C helper plasmids are not only involved in the horizontal spreading of SGI1, but may also contribute to its evolution. PMID:22384263

Prevalence of 16S rRNA Methylase Gene rmtB Among Escherichia coli Isolated from Bovine Mastitis in Ningxia, China.

PubMed

Yu, Ting; He, Tao; Yao, Hong; Zhang, Jin-Bao; Li, Xiao-Na; Zhang, Rong-Ming; Wang, Gui-Qin

2015-09-01

The aim of this study is to understand the prevalence and molecular characterization of 16S rRNA methylase gene, rmtB, among Escherichia coli strains isolated from bovine mastitis in China. A total of 245 E. coli isolates were collected from bovine mastitis in China between 2013 and 2014 and were screened for 16S rRNA methylase genes (armA, rmtA, rmtB, rmtC, rmtD, rmtE, and npmA) by polymerase chain reaction. About 5.3% (13/245) of the isolates carried the rmtB gene; the isolates were highly resistant to amikacin. Thirteen rmtB-positive strains were analyzed for the presence of extended-spectrum β-lactamase genes (bla(TEM), bla(CTX-M), bla(OXA), and bla(SHV)). All the isolates harbored both bla(TEM-1) and bla(CTX-M-15) genes and two of the isolates were also positive for bla(OXA-1). Pulsed-field gel electrophoresis (PFGE) analysis indicated that the nine rmtB-positive strains belonging to ST10 from one farm showed the similar PFGE pattern, indicating a clonal expansion in this farm. S1-PFGE and Southern blotting showed that 12 isolates harbored the rmtB gene in plasmids of two different sizes (≈45 kb [n=10] and ≈48 kb [n=2]), while only 1 strain harbored the rmtB gene in the chromosome. These plasmids were transferable by conjugation studies, and two isolates from two respective farms carried the same size of plasmid, suggesting that the horizontal transmission of plasmids also contributed to the spread of rmtB gene. This is the first report of prevalence of the 16S rRNA methylase gene rmtB among E. coli isolated from bovine mastitis in China, and rmtB-carrying E. coli may pose a threat to the treatment of bovine mastitis.

Genetic background of novel sequence types of CTX-M-8- and CTX-M-15-producing Escherichia coli and Klebsiella pneumoniae from public wastewater treatment plants in São Paulo, Brazil.

PubMed

Dropa, Milena; Lincopan, Nilton; Balsalobre, Livia C; Oliveira, Danielle E; Moura, Rodrigo A; Fernandes, Miriam Rodriguez; da Silva, Quézia Moura; Matté, Glavur R; Sato, Maria I Z; Matté, Maria H

2016-03-01

The release of extended-spectrum β-lactamase (ESBL)-producing Enterobacteriaceae to the environment is a public health issue worldwide. The aim of this study was to investigate the genetic background of genes encoding ESBLs in wastewater treatment plants (WWTPs) in São Paulo, southeastern Brazil. In 2009, during a local surveillance study, seven ESBL-producing Enterobacteriaceae strains were recovered from five WWTPs and screened for ESBL genes and mobile genetic elements. Multilocus sequence typing (MLST) was carried out, and wild plasmids were transformed into electrocompetent Escherichia coli. S1-PFGE technique was used to verify the presence of high molecular weight plasmids in wild-type strains and in bla ESBL-containing E. coli transformants. Strains harbored bla CTX-M-8, bla CTX-M-15, and/or bla SHV-28. Sequencing results showed that bla CTX-M-8 and bla CTX-M-15 genes were associated with IS26. MLST revealed new sequence types for E. coli (ST4401, ST4402, ST4403, and ST4445) and Klebsiella pneumoniae (ST1574), except for one K. pneumoniae from ST307 and Enterobacter cloacae from ST131. PCR and S1-PFGE results showed CTX-M-producing E. coli transformants carried heavy plasmids sizing 48.5-209 kb, which belonged to IncI1, IncF, and IncM1 incompatibility groups. This is the first report of CTX-M-8 and SHV-28 enzymes in environmental samples, and the present results demonstrate the plasmid-mediated spread of CTX-M-encoding genes through five WWTPs in São Paulo, Brazil, suggesting WWTPs are hotspots for the transfer of ESBL genes and confirming the urgent need to improve the management of sewage in order to minimize the dissemination of resistance genes to the environment.

[Isolation and characterization of petroleum catabolic broad-host-range plasmids from Shen-Fu wastewater irrigation zone].

PubMed

Wang, Ya-Fei; Wang, Ya-Fei; Li, Hui; Li, Xiao-Bin

2013-11-01

Based on triparental mating, we isolated a total of eight broad host range (BHR) petroleum hydrocarbon catabolic plasmids from the soils, sediments, and wastewater samples in the Shen-Fu irrigation zone. The antibiotic resistance of the plasmids was tested, and then, the plasmids were transferred to Escherichia coli EC100. The plasmids carrying no antibiotic resistance were tagged by miniTn5 transposon consisting of antibiotic resistant genes. The PCR-based incompatibility test revealed that the pS3-2C and pS4-6G belonged to Inc P group, the pS3-2G, pW22-3G, and pA15-7G belonged to Inc N group, the pS7-2G was identified as Inc W plasmid, and the pA23-1G and pA10-1C were placed into Inc Q group. By adopting the reported PCR amplification methods of petroleum hydrocarbon-degrading catabolic genes, the petroleum-degrading capability of these BHR plasmids were preliminarily analyzed. The plasmids pS3-2G, pS7-2G, pA23-1G, pW22-3G, and pA10-1C carried aromatic ring- hydroxylating dioxygenase gene phdA and toluene monooxygenase gene touA; the plasmid pA15-7G carried touA and toluene dioxygenase gene tod; the plasmid pS3-2C carried ben, phdA, and tod; whereas the pS4-6G only carried ben. The host range test showed that all the isolated plasmids except pS3-2C could be transferred and maintained stably in the representative strains Agrobacterium tumefaciens C58, Cupriavidus necator JMP228, and E. coli EC100 of the alpha-, beta-, and gamma-Proteobacteria, respectively.

Gene expression promoted by the SV40 DNA targeting sequence and the hypoxia-responsive element under normoxia and hypoxia.

PubMed

Sacramento, C B; Moraes, J Z; Denapolis, P M A; Han, S W

2010-08-01

The main objective of the present study was to find suitable DNA-targeting sequences (DTS) for the construction of plasmid vectors to be used to treat ischemic diseases. The well-known Simian virus 40 nuclear DTS (SV40-DTS) and hypoxia-responsive element (HRE) sequences were used to construct plasmid vectors to express the human vascular endothelial growth factor gene (hVEGF). The rate of plasmid nuclear transport and consequent gene expression under normoxia (20% O2) and hypoxia (less than 5% O2) were determined. Plasmids containing the SV40-DTS or HRE sequences were constructed and used to transfect the A293T cell line (a human embryonic kidney cell line) in vitro and mouse skeletal muscle cells in vivo. Plasmid transport to the nucleus was monitored by real-time PCR, and the expression level of the hVEGF gene was measured by ELISA. The in vitro nuclear transport efficiency of the SV40-DTS plasmid was about 50% lower under hypoxia, while the HRE plasmid was about 50% higher under hypoxia. Quantitation of reporter gene expression in vitro and in vivo, under hypoxia and normoxia, confirmed that the SV40-DTS plasmid functioned better under normoxia, while the HRE plasmid was superior under hypoxia. These results indicate that the efficiency of gene expression by plasmids containing DNA binding sequences is affected by the concentration of oxygen in the medium.

On the Cutting Edge with Gene Splicing.

ERIC Educational Resources Information Center

Ehrman, Patrick; Fritz, Lucie

1989-01-01

Describes a program in which second-year biology students use plasmid isolation to remove DNA from Escherichia coli bacteria and subsequently ligate and transform it into other E. coli bacteria. Cites ways teachers can get involved in current research that allows student participation. (RT)

Detection and Molecular Characterization of Escherichia coli Strains Producers of Extended-Spectrum and CMY-2 Type Beta-Lactamases, Isolated from Turtles in Mexico.

PubMed

Cortés-Cortés, Gerardo; Lozano-Zarain, Patricia; Torres, Carmen; Castañeda, Miguel; Sánchez, Gabriela Moreno; Alonso, Carla A; López-Pliego, Liliana; Mayen, María G Gutiérrez; Martínez-Laguna, Ygnacio; Rocha-Gracia, Rosa Del Carmen

2016-09-01

Multidrug-resistant bacteria are a growing problem in different environments and hosts, but scarce information exists about their prevalence in reptiles. The aim of this study was to analyze the resistance mechanisms, molecular typing, and plasmid content of cefotaxime-resistant (CTX(R)) Escherichia coli isolates recovered from cloacal samples of 71 turtles sheltered in a herpetarium in Mexico. CTX(R)-E. coli were recovered in 11 of 71 samples (15.5%), and one isolate/sample was characterized. Extended-spectrum β-lactamase (ESBL)-producing E. coli isolates were detected in four samples (5.6%): two strains carried the blaCTX-M-2 gene (phylogroup D and ST2732) and two contained the blaCTX-M-15 gene (phylogroup B1 and lineages ST58 and ST156). The blaCMY-2 gene was detected by PCR in E. coli isolates of eight samples (9.8%) (one of them also carried blaCTX-M-2); these isolates were distributed into phylogroups A (n = 1), B1 (n = 6), and D (n = 1) and typed as ST155, ST156, ST2329, and ST2732. Plasmid-mediated quinolone resistance (PMQR) genes were detected in five isolates [aac(6')Ib-cr, qnrA, qnrB19, and oqxB]. From three to five replicon plasmids were detected among the strains, being IncFIB, IncI1, IncFrep, and IncK the most prevalent. ESBL or pAmpC genes were transferred by conjugation in four strains, and the blaCTX-M-15 and blaCMY-2 genes were localized in IncFIB or IncI1 plasmids by Southern blot hybridization assays. Class 1 and/or class 2 integrons were detected in eight strains with six different structures of gene cassette arrays. Nine pulsed-field gel electrophoresis patterns were found among the 11 studied strains. To our knowledge, this is the first detection of ESBL, CMY-2, PMQR, and mobile determinants of antimicrobial resistance in E. coli of turtle origin, highlighting the potential dissemination of multidrug-resistant bacteria from these animals to other environments and hosts, including humans.

Enteroaggregative, Shiga Toxin-Producing Escherichia coli O111:H2 Associated with an Outbreak of Hemolytic-Uremic Syndrome

PubMed Central

Morabito, Stefano; Karch, Helge; Mariani-Kurkdjian, Patrizia; Schmidt, Herbert; Minelli, Fabio; Bingen, Edouard; Caprioli, Alfredo

1998-01-01

Shiga toxin-producing Escherichia coli O111:H2 strains from an outbreak of hemolytic-uremic syndrome showed aggregative adhesion to HEp-2 cells and harbored large plasmids which hybridized with the enteroaggregative E. coli probe PCVD432. These strains present a novel combination of virulence factors and might be as pathogenic to humans as the classic enterohemorrhagic E. coli. PMID:9508328

Emergence of colistin-resistant Escherichia coli clinical isolates harboring mcr-1 in Vietnam.

PubMed

Tada, Tatsuya; Nhung, Pham Hong; Shimada, Kayo; Tsuchiya, Mitsuhiro; Phuong, Doan Mai; Anh, Nguyen Quoc; Ohmagari, Norio; Kirikae, Teruo

2017-10-01

The mcr-1 was first detected on a plasmid in colistin-resistant Escherichia coli from livestock and patients in China. We described here the emergence of colistin-resistant E. coli clinical isolates harboring mcr-1 on the chromosomes in Vietnam. To our knowledge, this is the first report of hospital-acquired E. coli isolates harboring mcr-1 in a medical setting in Vietnam. Copyright © 2017. Published by Elsevier Ltd.

Survey of Navy Funded Marine Mammal Research and Studies FY 00-01

DTIC Science & Technology

2001-05-10

protein of canine distemper virus as a reporter system in order to evaluate 103 the humoral response to DNA-mediated vaccination in cetaceans. If...PCR/ RT PCR, DNA cloning and sequencing, etc. Efforts are ongoing to design and clone a vector encoding Canine Distemper Virus, a virus closely...alternative plasmid as our reporter gene delivery vector. This alternate plasmid will encode for Canine Distemper virus genes, closely related to

Genetic engineering in Actinoplanes sp. SE50/110 - development of an intergeneric conjugation system for the introduction of actinophage-based integrative vectors.

PubMed

Gren, Tetiana; Ortseifen, Vera; Wibberg, Daniel; Schneiker-Bekel, Susanne; Bednarz, Hanna; Niehaus, Karsten; Zemke, Till; Persicke, Marcus; Pühler, Alfred; Kalinowski, Jörn

2016-08-20

The α-glucosidase inhibitor acarbose is used for treatment of diabetes mellitus type II, and is manufactured industrially with overproducing derivatives of Actinoplanes sp. SE50/110, reportedly obtained by conventional mutagenesis. Despite of high industrial significance, only limited information exists regarding acarbose metabolism, function and regulation of these processes, due to the absence of proper genetic engineering methods and tools developed for this strain. Here, a basic toolkit for genetic engineering of Actinoplanes sp. SE50/110 was developed, comprising a standardized protocol for a DNA transfer through Escherichia coli-Actinoplanes intergeneric conjugation and applied for the transfer of ϕC31, ϕBT1 and VWB actinophage-based integrative vectors. Integration sites, occurring once per genome for all vectors, were sequenced and characterized for the first time in Actinoplanes sp. SE50/110. Notably, in case of ϕC31 based vector pSET152, the integration site is highly conserved, while for ϕBT1 and the VWB based vectors pRT801 and pSOK804, respectively, no sequence similarities to those in other bacteria were detected. The studied plasmids were proven to be stable and neutral with respect to strain morphology and acarbose production, enabling future use for genetic manipulations of Actinoplanes sp. SE50/110. To further broaden the spectrum of available tools, a GUS reporter system, based on the pSET152 derived vector, was also established in Actinoplanes sp. SE50/110. Copyright © 2016 Elsevier B.V. All rights reserved.

Novel Type of Fimbriae Encoded by the Large Plasmid of Sorbitol-Fermenting Enterohemorrhagic Escherichia coli O157:H−

PubMed Central

Brunder, Werner; Khan, A. Salam; Hacker, Jörg; Karch, Helge

2001-01-01

Sorbitol-fermenting (SF) enterohemorrhagic Escherichia coli (EHEC) O157:H− have emerged as important causes of diarrheal diseases and the hemolytic-uremic syndrome in Germany. In this study, we characterized a 32-kb fragment of the plasmid of SF EHEC O157:H−, pSFO157, which differs markedly from plasmid pO157 of classical non-sorbitol-fermenting EHEC O157:H7. We found a cluster of six genes, termed sfpA, sfpH, sfpC, sfpD, sfpJ, and sfpG, which mediate mannose-resistant hemagglutination and the expression of fimbriae. sfp genes are similar to the pap genes, encoding P-fimbriae of uropathogenic E. coli, but the sfp cluster lacks homologues of genes encoding subunits of a tip fibrillum as well as regulatory genes. The major pilin, SfpA, despite its similarity to PapA, does not cluster together with known PapA alleles in a phylogenetic tree but is structurally related to the PmpA pilin of Proteus mirabilis. The putative adhesin gene sfpG, responsible for the hemagglutination phenotype, shows significant homology neither to papG nor to other known sequences. Sfp fimbriae are 3 to 5 nm in diameter, in contrast to P-fimbriae, which are 7 nm in diameter. PCR analyses showed that the sfp gene cluster is a characteristic of SF EHEC O157:H− strains and is not present in other EHEC isolates, diarrheagenic E. coli, or other Enterobacteriaceae. The sfp gene cluster is flanked by two blocks of insertion sequences and an origin of plasmid replication, indicating that horizontal gene transfer may have contributed to the presence of Sfp fimbriae in SF EHEC O157:H−. PMID:11401985

Rapid modification of the pET-28 expression vector for ligation independent cloning using homologous recombination in Saccharomyces cerevisiae

PubMed Central

Gay, Glen; Wagner, Drew T.; Keatinge-Clay, Adrian T.; Gay, Darren C.

2014-01-01

The ability to rapidly customize an expression vector of choice is a valuable tool for any researcher involved in high-throughput molecular cloning for protein overexpression. Unfortunately, it is common practice to amend or neglect protein targets if the gene that encodes the protein of interest is incompatible with the multiple-cloning region of a preferred expression vector. To address this issue, a method was developed to quickly exchange the multiple-cloning region of the popular expression plasmid pET-28 with a ligation-independent cloning cassette, generating pGAY-28. This cassette contains dual inverted restriction sites that reduce false positive clones by generating a linearized plasmid incapable of self-annealing after a single restriction-enzyme digest. We also establish that progressively cooling the vector and insert leads to a significant increase in ligation-independent transformation efficiency, demonstrated by the incorporation of a 10.3 kb insert into the vector. The method reported to accomplish plasmid reconstruction is uniquely versatile yet simple, relying on the strategic placement of primers combined with homologous recombination of PCR products in yeast. PMID:25304917

KatP contributes to OxyR-regulated hydrogen peroxide resistance in Escherichia coli serotype O157:H7

USDA-ARS?s Scientific Manuscript database

Escherichia coli K12 defends against peroxide mediated oxidative damage using two catalases, hydroperoxidase I (katG) and hydroperoxidase II (katE) and the peroxiredoxin, alkyl hydroperoxide reductase (ahpC). In E. coli O157:H7 strain ATCC 43895 (EDL933), plasmid pO157 encodes for an additional cata...

Adeno-associated virus vectors can be efficiently produced without helper virus.

PubMed

Matsushita, T; Elliger, S; Elliger, C; Podsakoff, G; Villarreal, L; Kurtzman, G J; Iwaki, Y; Colosi, P

1998-07-01

The purpose of this work was to develop an efficient method for the production of adeno-associated virus (AAV) vectors in the absence of helper virus. The adenovirus regions that mediate AAV vector replication were identified and assembled into a helper plasmid. These included the VA, E2A and E4 regions. When this helper plasmid was cotransfected into 293 cells, along with plasmids encoding the AAV vector, and rep and cap genes, AAV vector was produced as efficiently as when using adenovirus infection as a source of help. CMV-driven constructs expressing the E4orf6 and the 72-M(r), E2A proteins were able to functionally replace the E4 and E2A regions, respectively. Therefore the minimum set of genes required to produce AAV helper activity equivalent to that provided by adenovirus infection consists of, or is a subset of, the following genes: the E4orf6 gene, the 72-M(r), E2A protein gene, the VA RNA genes and the E1 region. AAV vector preparations made with adenovirus and by the helper virus-free method were essentially indistinguishable with respect to particle density, particle to infectivity ratio, capsimer ratio and efficiency of muscle transduction in vivo. Only AAV vector preparations made by the helper virus-free method were not reactive with anti-adenovirus sera.

Plasmid-determined resistance to tellurium compounds.

PubMed Central

Summers, A O; Jacoby, G A

1977-01-01

Transferable plasmids in gram-negative bacteria that confer resistance to potassium tellurite or tellurate were found. This re-istance was distinct from resistance to mercury, silver, or arsenic compounds and was unrelated to antibiotic resistance. In Escherichia coli, plasmids determine a 100-fold increase in the minimal inhibitory concentration for tellurite and a 10-fold increase in tellurate resistance. Many, but not all, of the plasmids belong to incompatibility group S. In Pseudomonas aeruginosa, tellurium resistance is specifically associated with incompatibility group P-2 and involves a 5- to 10-fold increase in tellurite or tellurate resistance. Images PMID:401494

“Black holes” and bacterial pathogenicity: A large genomic deletion that enhances the virulence of Shigella spp. and enteroinvasive Escherichia coli

PubMed Central

Maurelli, Anthony T.; Fernández, Reinaldo E.; Bloch, Craig A.; Rode, Christopher K.; Fasano, Alessio

1998-01-01

Plasmids, bacteriophages, and pathogenicity islands are genomic additions that contribute to the evolution of bacterial pathogens. For example, Shigella spp., the causative agents of bacillary dysentery, differ from the closely related commensal Escherichia coli in the presence of a plasmid in Shigella that encodes virulence functions. However, pathogenic bacteria also may lack properties that are characteristic of nonpathogens. Lysine decarboxylase (LDC) activity is present in ≈90% of E. coli strains but is uniformly absent in Shigella strains. When the gene for LDC, cadA, was introduced into Shigella flexneri 2a, virulence became attenuated, and enterotoxin activity was inhibited greatly. The enterotoxin inhibitor was identified as cadaverine, a product of the reaction catalyzed by LDC. Comparison of the S. flexneri 2a and laboratory E. coli K-12 genomes in the region of cadA revealed a large deletion in Shigella. Representative strains of Shigella spp. and enteroinvasive E. coli displayed similar deletions of cadA. Our results suggest that, as Shigella spp. evolved from E. coli to become pathogens, they not only acquired virulence genes on a plasmid but also shed genes via deletions. The formation of these “black holes,” deletions of genes that are detrimental to a pathogenic lifestyle, provides an evolutionary pathway that enables a pathogen to enhance virulence. Furthermore, the demonstration that cadaverine can inhibit enterotoxin activity may lead to more general models about toxin activity or entry into cells and suggests an avenue for antitoxin therapy. Thus, understanding the role of black holes in pathogen evolution may yield clues to new treatments of infectious diseases. PMID:9520472

``Black Holes" and Bacterial Pathogenicity: A Large Genomic Deletion that Enhances the Virulence of Shigella spp. and Enteroinvasive Escherichia coli

NASA Astrophysics Data System (ADS)

Maurelli, Anthony T.; Fernandez, Reinaldo E.; Bloch, Craig A.; Rode, Christopher K.; Fasano, Alessio

1998-03-01

Plasmids, bacteriophages, and pathogenicity islands are genomic additions that contribute to the evolution of bacterial pathogens. For example, Shigella spp., the causative agents of bacillary dysentery, differ from the closely related commensal Escherichia coli in the presence of a plasmid in Shigella that encodes virulence functions. However, pathogenic bacteria also may lack properties that are characteristic of nonpathogens. Lysine decarboxylate (LDC) activity is present in ≈ 90% of E. coli strains but is uniformly absent in Shigella strains. When the gene for LDC, cadA, was introduced into Shigella flexneri 2a, virulence became attenuated, and enterotoxin activity was inhibited greatly. The enterotoxin inhibitor was identified as cadaverine, a product of the reaction catalyzed by LDC. Comparison of the S. flexneri 2a and laboratory E. coli K-12 genomes in the region of cadA revealed a large deletion in Shigella. Representative strains of Shigella spp. and enteroinvasive E. coli displayed similar deletions of cadA. Our results suggest that, as Shigella spp. evolved from E. coli to become pathogens, they not only acquired virulence genes on a plasmid but also shed genes via deletions. The formation of these ``black holes,'' deletions of genes that are detrimental to a pathogenic lifestyle, provides an evolutionary pathway that enables a pathogen to enhance virulence. Furthermore, the demonstration that cadaverine can inhibit enterotoxin activity may lead to more general models about toxin activity or entry into cells and suggests an avenue for antitoxin therapy. Thus, understanding the role of black holes in pathogen evolution may yield clues to new treatments of infectious diseases.

TLA-1: a New Plasmid-Mediated Extended-Spectrum β-Lactamase from Escherichia coli

PubMed Central

Silva, J.; Aguilar, C.; Ayala, G.; Estrada, M. A.; Garza-Ramos, U.; Lara-Lemus, R.; Ledezma, L.

2000-01-01

Escherichia coli R170, isolated from the urine of an infected patient, was resistant to expanded-spectrum cephalosporins, aztreonam, ciprofloxacin, and ofloxacin but was susceptible to amikacin, cefotetan, and imipenem. This particular strain contained three different plasmids that encoded two β-lactamases with pIs of 7.0 and 9.0. Resistance to cefotaxime, ceftazidime, aztreonam, trimethoprim, and sulfamethoxazole was transferred by conjugation from E. coli R170 to E. coli J53-2. The transferred plasmid, RZA92, which encoded a single β-lactamase, was 150 kb in length. The cefotaxime resistance gene that encodes the TLA-1 β-lactamase (pI 9.0) was cloned from the transconjugant by transformation to E. coli DH5α. Sequencing of the blaTLA-1 gene revealed an open reading frame of 906 bp, which corresponded to 301 amino acid residues, including motifs common to class A β-lactamases: 70SXXK, 130SDN, and 234KTG. The amino acid sequence of TLA-1 shared 50% identity with the CME-1 chromosomal class A β-lactamase from Chryseobacterium (Flavobacterium) meningosepticum; 48.8% identity with the VEB-1 class A β-lactamase from E. coli; 40 to 42% identity with CblA of Bacteroides uniformis, PER-1 of Pseudomonas aeruginosa, and PER-2 of Salmonella typhimurium; and 39% identity with CepA of Bacteroides fragilis. The partially purified TLA-1 β-lactamase had a molecular mass of 31.4 kDa and a pI of 9.0 and preferentially hydrolyzed cephaloridine, cefotaxime, cephalothin, benzylpenicillin, and ceftazidime. The enzyme was markedly inhibited by sulbactam, tazobactam, and clavulanic acid. TLA-1 is a new extended-spectrum β-lactamase of Ambler class A. PMID:10722503

TLA-1: a new plasmid-mediated extended-spectrum beta-lactamase from Escherichia coli.

PubMed

Silva, J; Aguilar, C; Ayala, G; Estrada, M A; Garza-Ramos, U; Lara-Lemus, R; Ledezma, L

2000-04-01

Escherichia coli R170, isolated from the urine of an infected patient, was resistant to expanded-spectrum cephalosporins, aztreonam, ciprofloxacin, and ofloxacin but was susceptible to amikacin, cefotetan, and imipenem. This particular strain contained three different plasmids that encoded two beta-lactamases with pIs of 7.0 and 9.0. Resistance to cefotaxime, ceftazidime, aztreonam, trimethoprim, and sulfamethoxazole was transferred by conjugation from E. coli R170 to E. coli J53-2. The transferred plasmid, RZA92, which encoded a single beta-lactamase, was 150 kb in length. The cefotaxime resistance gene that encodes the TLA-1 beta-lactamase (pI 9.0) was cloned from the transconjugant by transformation to E. coli DH5alpha. Sequencing of the bla(TLA-1) gene revealed an open reading frame of 906 bp, which corresponded to 301 amino acid residues, including motifs common to class A beta-lactamases: (70)SXXK, (130)SDN, and (234)KTG. The amino acid sequence of TLA-1 shared 50% identity with the CME-1 chromosomal class A beta-lactamase from Chryseobacterium (Flavobacterium) meningosepticum; 48.8% identity with the VEB-1 class A beta-lactamase from E. coli; 40 to 42% identity with CblA of Bacteroides uniformis, PER-1 of Pseudomonas aeruginosa, and PER-2 of Salmonella typhimurium; and 39% identity with CepA of Bacteroides fragilis. The partially purified TLA-1 beta-lactamase had a molecular mass of 31.4 kDa and a pI of 9.0 and preferentially hydrolyzed cephaloridine, cefotaxime, cephalothin, benzylpenicillin, and ceftazidime. The enzyme was markedly inhibited by sulbactam, tazobactam, and clavulanic acid. TLA-1 is a new extended-spectrum beta-lactamase of Ambler class A.

Plasmid-encoded amikacin resistance in multiresistant strains of Klebsiella pneumoniae isolated from neonates with meningitis.

PubMed Central

Woloj, M; Tolmasky, M E; Roberts, M C; Crosa, J H

1986-01-01

Two multiresistant Klebsiella pneumoniae strains isolated from cerebrospinal fluid of human neonates were analyzed for their plasmid content. Two of the plasmids harbored by these strains, pJHCMW1 (11 kilobase pairs) and pJHCMW4 (75 kilobase pairs), carried genetic determinants for amikacin resistance. These plasmids also encoded resistance to kanamycin, tobramycin, and ampicillin which could be transferred to Escherichia coli by conjugation. Extracts from transconjugant derivatives carrying pJHCMW4 produced an acetyltransferase activity that acetylated all three aminoglycosides. Transconjugant derivatives carrying pJHCMW1 encoded both acetylating and phosphorylating activities. Southern blot hybridization analysis indicated considerable DNA homology between these two plasmids. Images PMID:3521478

FATE IN SOIL OF A RECOMBINANT PLASMID CARRYING A 'DROSOPHILA' GENE

EPA Science Inventory

A recombinant plasmid (C357;3.5 Mdal) containing heterologous DNA(pBR322(2.6 Mdal) with cDNA for an egg yolk protein from Drosophila grimshawi) in Escherichia coli strain HB 101 survived in and was recovered on selective media from sterile and nonsterile soil during 27 days at fr...

LONG-TERM STARVATION-INDUCED LOSS OF APPARENT ANTIBIOTIC RESISTANCE IN CELLS CONTAINING THE PLASMID PSA

EPA Science Inventory

Escherichia coli, Pseudomonas fluorescens, and a Pseudomonas sp. strain 133B containing the pSa plasmid were starved in well water for up to 523 days. There were two patterns of apparent antibiotic resistance loss observed. In Pseudomonas sp. strain 133B, there was no apparent lo...

Mechanisms of iron regulation of luminescence in Vibrio fischeri.

PubMed Central

Haygood, M G; Nealson, K H

1985-01-01

Synthesis of luciferase (an autoinducible enzyme) is repressed by iron in the symbiotic bioluminescent bacterium Vibrio fischeri. Possible mechanisms of iron regulation of luciferase synthesis were tested with V. fischeri and with Escherichia coli clones containing plasmids carrying V. fischeri luminescence genes. Experiments were conducted in complete medium with and without the synthetic iron chelator ethylenediamine-di(o-hydroxyphenyl acetic acid). Comparison of the effect of ethylenediamine-di(o-hydroxyphenyl acetic acid) and another growth inhibitor, (2-n-heptyl-4-hydroxyquinoline-N-oxide), showed that iron repression is not due to inhibition of growth. A quantitative bioassay for autoinducer was developed with E. coli HB101 containing pJE411, a plasmid carrying V. fischeri luminescence genes with a transcriptional fusion between luxI and E. coli lacZ. Bioassay experiments showed no effect of iron on either autoinducer activity or production (before induction) or transcription of the lux operon. Ethylenediamine-di(o-hydroxyphenyl acetic acid) did not affect luciferase induction in E. coli strains with wild-type iron assimilation (ED8654) or impaired iron assimilation (RW193) bearing pJE202 (a plasmid with functional V. fischeri lux genes), suggesting that the genes responsible for the iron effect are missing or substituted in these clones. Two models are consistent with the data: (i) iron represses autoinducer transport, and (ii) iron acts through an autoinduction-independent regulatory system (e.g., an iron repressor). PMID:3920202

Engineering Escherichia coli into a protein delivery system for mammalian cells.

PubMed

Reeves, Analise Z; Spears, William E; Du, Juan; Tan, Kah Yong; Wagers, Amy J; Lesser, Cammie F

2015-05-15

Many Gram-negative pathogens encode type 3 secretion systems, sophisticated nanomachines that deliver proteins directly into the cytoplasm of mammalian cells. These systems present attractive opportunities for therapeutic protein delivery applications; however, their utility has been limited by their inherent pathogenicity. Here, we report the reengineering of a laboratory strain of Escherichia coli with a tunable type 3 secretion system that can efficiently deliver heterologous proteins into mammalian cells, thereby circumventing the need for virulence attenuation. We first introduced a 31 kB region of Shigella flexneri DNA that encodes all of the information needed to form the secretion nanomachine onto a plasmid that can be directly propagated within E. coli or integrated into the E. coli chromosome. To provide flexible control over type 3 secretion and protein delivery, we generated plasmids expressing master regulators of the type 3 system from either constitutive or inducible promoters. We then constructed a Gateway-compatible plasmid library of type 3 secretion sequences to enable rapid screening and identification of sequences that do not perturb function when fused to heterologous protein substrates and optimized their delivery into mammalian cells. Combining these elements, we found that coordinated expression of the type 3 secretion system and modified target protein substrates produces a nonpathogenic strain that expresses, secretes, and delivers heterologous proteins into mammalian cells. This reengineered system thus provides a highly flexible protein delivery platform with potential for future therapeutic applications.

Generation of Marker- and/or Backbone-Free Transgenic Wheat Plants via Agrobacterium-Mediated Transformation.

PubMed

Wang, Gen-Ping; Yu, Xiu-Dao; Sun, Yong-Wei; Jones, Huw D; Xia, Lan-Qin

2016-01-01

Horizontal transfer of antibiotic resistance genes to animals and vertical transfer of herbicide resistance genes to the weedy relatives are perceived as major biosafety concerns in genetically modified (GM) crops. In this study, five novel vectors which used gusA and bar as a reporter gene and a selection marker gene, respectively, were constructed based on the pCLEAN dual binary vector system. Among these vectors, 1G7B and 5G7B carried two T-DNAs located on two respective plasmids with 5G7B possessing an additional virGwt gene. 5LBTG154 and 5TGTB154 carried two T-DNAs in the target plasmid with either one or double right borders, and 5BTG154 carried the selectable marker gene on the backbone outside of the T-DNA left border in the target plasmid. In addition, 5BTG154, 5LBTG154, and 5TGTB154 used pAL154 as a helper plasmid which contains Komari fragment to facilitate transformation. These five dual binary vector combinations were transformed into Agrobacterium strain AGL1 and used to transform durum wheat cv Stewart 63. Evaluation of the co-transformation efficiencies, the frequencies of marker-free transgenic plants, and integration of backbone sequences in the obtained transgenic lines indicated that two vectors (5G7B and 5TGTB154) were more efficient in generating marker-free transgenic wheat plants with no or minimal integration of backbone sequences in the wheat genome. The vector series developed in this study for generation of marker- and/or backbone-free transgenic wheat plants via Agrobacterium -mediated transformation will be useful to facilitate the creation of "clean" GM wheat containing only the foreign genes of agronomic importance.

Knockdown of the bovine prion gene PRNP by RNA interference (RNAi) technology.

PubMed

Sutou, Shizuyo; Kunishi, Miho; Kudo, Toshiyuki; Wongsrikeao, Pimprapar; Miyagishi, Makoto; Otoi, Takeshige

2007-07-26

Since prion gene-knockout mice do not contract prion diseases and animals in which production of prion protein (PrP) is reduced by half are resistant to the disease, we hypothesized that bovine animals with reduced PrP would be tolerant to BSE. Hence, attempts were made to produce bovine PRNP (bPRNP) that could be knocked down by RNA interference (RNAi) technology. Before an in vivo study, optimal conditions for knocking down bPRNP were determined in cultured mammalian cell systems. Factors examined included siRNA (short interfering RNA) expression plasmid vectors, target sites of PRNP, and lengths of siRNAs. Four siRNA expression plasmid vectors were used: three harboring different cloning sites were driven by the human U6 promoter (hU6), and one by the human tRNAVal promoter. Six target sites of bovine PRNP were designed using an algorithm. From 1 (22 mer) to 9 (19, 20, 21, 22, 23, 24, 25, 27, and 29 mer) siRNA expression vectors were constructed for each target site. As targets of siRNA, the entire bPRNP coding sequence was connected to the reporter gene of the fluorescent EGFP, or of firefly luciferase or Renilla luciferase. Target plasmid DNA was co-transfected with siRNA expression vector DNA into HeLaS3 cells, and fluorescence or luminescence was measured. The activities of siRNAs varied widely depending on the target sites, length of the siRNAs, and vectors used. Longer siRNAs were less effective, and 19 mer or 21 mer was generally optimal. Although 21 mer GGGGAGAACTTCACCGAAACT expressed by a hU6-driven plasmid with a Bsp MI cloning site was best under the present experimental conditions, the corresponding tRNA promoter-driven plasmid was almost equally useful. The effectiveness of this siRNA was confirmed by immunostaining and Western blotting. Four siRNA expression plasmid vectors, six target sites of bPRNP, and various lengths of siRNAs from 19 mer to 29 mer were examined to establish optimal conditions for knocking down of bPRNP in vitro. The most effective siRNA so far tested was 21 mer GGGGAGAACTTCACCGAAACT driven either by a hU6 or tRNA promoter, a finding that provides a basis for further studies in vivo.

Complete Sequencing of pNDM-HK Encoding NDM-1 Carbapenemase from a Multidrug-Resistant Escherichia coli Strain Isolated in Hong Kong

PubMed Central

Ho, Pak Leung; Lo, Wai U.; Yeung, Man Kiu; Lin, Chi Ho; Chow, Kin Hung; Ang, Irene; Tong, Amy Hin Yan; Bao, Jessie Yun-Juan; Lok, Si; Lo, Janice Yee Chi

2011-01-01

Background The emergence of plasmid-mediated carbapenemases, such as NDM-1 in Enterobacteriaceae is a major public health issue. Since they mediate resistance to virtually all β-lactam antibiotics and there is often co-resistance to other antibiotic classes, the therapeutic options for infections caused by these organisms are very limited. Methodology We characterized the first NDM-1 producing E. coli isolate recovered in Hong Kong. The plasmid encoding the metallo-β-lactamase gene was sequenced. Principal Findings The plasmid, pNDM-HK readily transferred to E. coli J53 at high frequencies. It belongs to the broad host range IncL/M incompatibility group and is 88803 bp in size. Sequence alignment showed that pNDM-HK has a 55 kb backbone which shared 97% homology with pEL60 originating from the plant pathogen, Erwina amylovora in Lebanon and a 28.9 kb variable region. The plasmid backbone includes the mucAB genes mediating ultraviolet light resistance. The 28.9 kb region has a composite transposon-like structure which includes intact or truncated genes associated with resistance to β-lactams (bla TEM-1, bla NDM-1, Δbla DHA-1), aminoglycosides (aacC2, armA), sulphonamides (sul1) and macrolides (mel, mph2). It also harbors the following mobile elements: IS26, ISCR1, tnpU, tnpAcp2, tnpD, ΔtnpATn1 and insL. Certain blocks within the 28.9 kb variable region had homology with the corresponding sequences in the widely disseminated plasmids, pCTX-M3, pMUR050 and pKP048 originating from bacteria in Poland in 1996, in Spain in 2002 and in China in 2006, respectively. Significance The genetic support of NDM-1 gene suggests that it has evolved through complex pathways. The association with broad host range plasmid and multiple mobile genetic elements explain its observed horizontal mobility in multiple bacterial taxa. PMID:21445317

Plasmid-mediated AmpC-type beta-lactamase isolated from Klebsiella pneumoniae confers resistance to broad-spectrum beta-lactams, including moxalactam.

PubMed Central

Horii, T; Arakawa, Y; Ohta, M; Ichiyama, S; Wacharotayankun, R; Kato, N

1993-01-01

Klebsiella pneumoniae NU2936 was isolated from a patient and was found to produce a plasmid-encoded beta-lactamase (MOX-1) which conferred resistance to broad spectrum beta-lactams, including moxalactam, flomoxef, ceftizoxime, cefotaxime, and ceftazidime. Resistance could be transferred from K. pneumoniae NU2936 to Escherichia coli CSH2 by conjugation with a transfer frequency of 5 x 10(-7). The structural gene of MOX-1 (blaMOX-1) was cloned and expressed in E. coli HB101. The MIC of moxalactam for E. coli HB101 producing MOX-1 was > 512 micrograms/ml. The apparent molecular mass and pI of this enzyme were calculated to be 38 kDa and 8.9, respectively. Hg2+ and Cu2+ failed to block enzyme activity, and the presence of EDTA in the reaction buffer did not reduce the enzyme activity. However, clavulanate and cloxacillin, serine beta-lactamase inhibitors, inhibited the enzyme activity competitively (Kis = 5.60 and 0.35 microM, respectively). The kinetic study of MOX-1 suggested that it effectively hydrolyzed broad-spectrum beta-lactams. A hybridization study confirmed that blaMOX-1 is encoded on a large resident plasmid (pRMOX1; 180 kb) of strain NU2936. By deletion analysis, the functional region was localized within a 1.2-kb region of the plasmid. By amino acid sequencing, 18 of 33 amino acid residues at the N terminus of MOX-1 were found to be identical to those of Pseudomonas aeruginosa AmpC. These findings suggest that MOX-1 is a plasmid-mediated AmpC-type beta-lactamase that provides enteric bacteria resistance to broad-spectrum beta-lactams, including moxalactam. Images PMID:8517725

Plasmid acquisition in microgravity

NASA Technical Reports Server (NTRS)

Juergensmeyer, Margaret A.; Juergensmeyer, Elizabeth A.; Guikema, James A.

1995-01-01

In microgravity, bacteria often show an increased resistance to antibiotics. Bacteria can develop resistance to an antibiotic after transformation, the acquisition of DNA, usually in the form of a plasmid containing a gene for resistance to one or more antibiotics. In order to study the capacity of bacteria to become resistant to antibiotics in microgravity, we have modified the standard protocol for transformation of Escherichia coli for use in the NASA-flight-certified hardware package, The Fluid Processing Apparatus (FPA). Here we report on the ability of E. coli to remain competent for long periods of time at temperatures that are readily available on the Space Shuttle, and present some preliminary flight results.

Deletions in the tetracycline resistance determinant reduce the thermosensitivity of a trfA(Ts) derivative of plasmid RP1 in Pseudomonas aeruginosa.

PubMed

Rella, M; Watson, J M; Thomas, C M; Haas, D

1987-01-01

A derivative of the broad-host-range plasmid RP1, pME301, was temperature-sensitive (Ts) at 43 degrees C for maintenance in Pseudomonas aeruginosa, P. mendocina, Klebsiella aerogenes and Escherichia coli. In E. coli, the Ts defect of pME301 could be complemented in trans by the cloned trfA gene, which is known to be essential for RP1 replication in E. coli and P. aeruginosa. Because pME301 expressed a Ts phenotype in P. mendocina and K. aerogenes, we assume that the trfA function is also vital in these organisms. When plasmid-encoded carbenicillin resistance (on transposon Tn801) was selected at non-permissive temperatures in P. aeruginosa strain PAO carrying pME301, we obtained either Tn801 insertions into the chromosome or pME301 derivatives having a deletion (or point mutation) in their tet genes, which determine resistance to tetracycline and are not transposable. From cloning experiments, we infer that the tet gene product(s) destabilize the pME301 replicon in P. aeruginosa at 40-43 degrees C.

Cloning should be simple: Escherichia coli DH5α-mediated assembly of multiple DNA fragments with short end homologies

DOE PAGES

Kostylev, Maxim; Otwell, Anne E.; Richardson, Ruth E.; ...

2015-09-08

Numerous DNA assembly technologies exist for generating plasmids for biological studies. Many procedures require complex in vitro or in vivo assembly reactions followed by plasmid propagation in recombination-impaired Escherichia coli strains such as DH5α, which are optimal for stable amplification of the DNA materials. Here we show that despite its utility as a cloning strain, DH5α retains sufficient recombinase activity to assemble up to six doublestranded DNA fragments ranging in size from 150 bp to at least 7 kb into plasmids in vivo. This process also requires surprisingly small amounts of DNA, potentially obviating the need for upstream assembly processesmore » associated with most common applications of DNA assembly. In addition, we demonstrate the application of this process in cloning of various DNA fragments including synthetic genes, preparation of knockout constructs, and incorporation of guide RNA sequences in constructs for clustered regularly interspaced short palindromic repeats (CRISPR) genome editing. This consolidated process for assembly and amplification in a widely available strain of E. coli may enable productivity gain across disciplines involving recombinant DNA work.« less

Cloning should be simple: Escherichia coli DH5α-mediated assembly of multiple DNA fragments with short end homologies

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kostylev, Maxim; Otwell, Anne E.; Richardson, Ruth E.

Numerous DNA assembly technologies exist for generating plasmids for biological studies. Many procedures require complex in vitro or in vivo assembly reactions followed by plasmid propagation in recombination-impaired Escherichia coli strains such as DH5α, which are optimal for stable amplification of the DNA materials. Here we show that despite its utility as a cloning strain, DH5α retains sufficient recombinase activity to assemble up to six doublestranded DNA fragments ranging in size from 150 bp to at least 7 kb into plasmids in vivo. This process also requires surprisingly small amounts of DNA, potentially obviating the need for upstream assembly processesmore » associated with most common applications of DNA assembly. In addition, we demonstrate the application of this process in cloning of various DNA fragments including synthetic genes, preparation of knockout constructs, and incorporation of guide RNA sequences in constructs for clustered regularly interspaced short palindromic repeats (CRISPR) genome editing. This consolidated process for assembly and amplification in a widely available strain of E. coli may enable productivity gain across disciplines involving recombinant DNA work.« less

Expression of chimeric ras protein with OmpF signal peptide in Escherichia coli: localization of OmpF fusion protein in the inner membrane.

PubMed

Yamamoto, T; Okawa, N; Endo, T; Kaji, A

1991-08-01

The ras gene was fused with the DNA sequence of OmpF signal peptide or with the DNA sequence of OmpF signal peptide plus the amino terminal portion of the OmpF gene. They were placed in plasmids together with the bacteriophage lambda PL promoter. These plasmids were introduced into Escherichia coli strain K-12 and the OmpF signal peptide fusion proteins were expressed. These fusion proteins were identified as 29.0 and 30.0 kDa proteins. However, processed products of these proteins were not found in the extract. The fusion proteins were localized mostly in the cytoplasm and the inner membrane, but none of them was secreted into the periplasmic space. On the other hand, the ras protein alone was found in the cytoplasm and not in the inner membrane. Viable counts of E. coli harbouring these plasmids decreased when these fused proteins were induced. Induction of the ras protein alone did not harm cells. These observations suggest that insertion of the heterologous proteins into the inner membrane may cause the bactericidal effect.

Genetic studies on a nitrogen-fixing cyanobacterium. [Anabaena; Escherichi coli

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wolk, C.P.; Cardemil, L.; Elhai, J.

1987-04-01

Mutants of Anabaena PCC7120 capable of aerobic growth with NO/sub 3//sup -/ but not N/sub 2/, and capable of microaerobic reduction of C/sub 2/H/sub 2/, were isolated by penicillin enrichment after UV irradiation. Heterocysts of two mutants lack the principal envelope glycolipid, those of EF116 have a non-cohesive envelope polysaccharide, and those of other strains have other defects. A Nm/sup r/ cosmid library of DNA from wild type Anabaena PCC7120 was established in Escherichia coli bearing the Ap helper plasmid pDS4101. A conjugative plasmid was introduced, and the bacteria replicated to lawns of individual mutant strains of Anabaena. After onemore » day of non-selective growth, selection was applied for Nm/sup r/ and nitrogen fixation. Overlapping cosmids complementing EF116 and one complementing another mutant have been mapped. The complementing genes are thought to act early in differentiation. Inclusion, in an E. coli donor of an appropriate methylase gene enhanced, by a factor of 10/sup 2/ to 10/sup 3/, transfer to Anabaena PCC7120 of a plasmid containing numerous sites for the Anabaena restriction endonuclease, AvaII.« less

[Experimental study of human umbilical cord blood derived stromal cells transfected with recombinant adenoviral vector co-expressing VCAM-1 and GFP].

PubMed

Zhang, Xi; Si, Ying-Jian; Chen, Xing-Hua; Liu, Yao; Gao, Li; Gao, Lei; Peng, Xian-Gui; Wang, Qing-Yu

2008-06-01

This study was aimed to investigate the effect of vcam-1 gene-modified human umbilical cord blood derived stromal cells (CBDSCs) on hematopoietic regulation so as to establish the experimental foundation for further study. The target gene vcam-1 was cloned into the shuttle plasmid with the report gene GFP. The recombinant shuttle plasmid was transformed into BJ5183 bacteria to recombine with backbone vector pAdeasy-l, and the recombinant adenoviral vector ad-vcam-1-gfp was confirmed after transfection with CBDSCs. The results indicated that two fragments of about 9 kb and 2 kb were obtained after digestion of recombinant plasmid pAdTrack-vcam-1 with NotIand XhoI, and single fragment of 600 bp was obtained after amplification with PCR; two fragments of about 31 kb and 4 kb were obtained after digestion of recombinant plasmid pad-vcam-1-gfp with PacI, which suggested a successful homologous recombination. The expression of vcam-1 gene in ad-vcam-1-gfp transfected CBDSCs could be detected by immunocytochemistry, RT-PCR and fluorescent microscopy. It is concluded that the recombinant adenoviral vector ad-vcam-1-gfp has been constructed successfully, and the expression of vcam-1 is up-regulated in CBDSCs transfected by gene ad-vcam-1-gfp.

Rational plasmid design and bioprocess optimization to enhance recombinant adeno-associated virus (AAV) productivity in mammalian cells.

PubMed

Emmerling, Verena V; Pegel, Antje; Milian, Ernest G; Venereo-Sanchez, Alina; Kunz, Marion; Wegele, Jessica; Kamen, Amine A; Kochanek, Stefan; Hoerer, Markus

2016-02-01

Viral vectors used for gene and oncolytic therapy belong to the most promising biological products for future therapeutics. Clinical success of recombinant adeno-associated virus (rAAV) based therapies raises considerable demand for viral vectors, which cannot be met by current manufacturing strategies. Addressing existing bottlenecks, we improved a plasmid system termed rep/cap split packaging and designed a minimal plasmid encoding adenoviral helper function. Plasmid modifications led to a 12-fold increase in rAAV vector titers compared to the widely used pDG standard system. Evaluation of different production approaches revealed superiority of processes based on anchorage- and serum-dependent HEK293T cells, exhibiting about 15-fold higher specific and volumetric productivity compared to well-established suspension cells cultivated in serum-free medium. As for most other viral vectors, classical stirred-tank bioreactor production is thus still not capable of providing drug product of sufficient amount. We show that manufacturing strategies employing classical surface-providing culture systems can be successfully transferred to the new fully-controlled, single-use bioreactor system Integrity(TM) iCELLis(TM) . In summary, we demonstrate substantial bioprocess optimizations leading to more efficient and scalable production processes suggesting a promising way for flexible large-scale rAAV manufacturing. Copyright © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Remarkable Diversity of Escherichia coli Carrying mcr-1 from Hospital Sewage with the Identification of Two New mcr-1 Variants.

PubMed

Zhao, Feifei; Feng, Yu; Lü, Xiaoju; McNally, Alan; Zong, Zhiyong

2017-01-01

The plasmid-borne colistin-resistant gene mcr-1 has rapidly become a worldwide public health concern. This study aims to determine the host bacterial strains, plasmids, and genetic contexts of mcr-1 in hospital sewage. A 1-ml hospital sewage sample was cultured. Colistin-resistant bacterial colonies were selected on agar plates and were subjected to whole genome sequencing and subsequent analysis. The transfer of mcr-1 between bacterial strains was tested using conjugation. New variants of mcr-1 were cloned to test the impact of variations on the function of mcr-1 . Plasmids carrying mcr-1 were retrieved from GenBank for comparison based on concatenated backbone genes. In the sewage sample, we observed that mcr-1 was located in various genetic contexts on the chromosome, or plasmids of four different replicon types (IncHI2, IncI2, IncP, and IncX4), in Klebsiella pneumoniae, Kluyvera spp. and seven Escherichia coli strains of six different sequence types (ST10, ST34, ST48, ST1196, ST7086, and ST7087). We also identified two new variants of mcr-1, mcr-1.4 and mcr-1.7 , both of which encode an amino acid variation from mcr-1 . mcr-1 -carrying IncX4 plasmids, which have a global distribution across the Enterobacteriaceae , are the result of global dissemination of a single common plasmid, while IncI2 mcr-1 plasmids appear to acquire mcr-1 in multiple events. In conclusion, the unprecedented remarkable diversity of species, strains, plasmids, and genetic contexts carrying mcr-1 present in a single sewage sample from a single healthcare site highlights the continued evolution and dynamic transmission of mcr-1 in healthcare-associated environments.

Evaluation of a Recombinant Escherichia coli Strain that Uses the Sarin Simulant Isopropylmethylphosphonic Acid (IMPA) as a Sole Carbon and Phosphate Source

DTIC Science & Technology

2016-04-01

phosphate use by these recombinant strains was evaluated because carbon use by these strains is still undergoing optimization by LBNL. The E . coli ...plasmids, had successful growth when transformed into a different E . coli background, which correlated with IMPA degradation. Ultimately, the...transformed E . coli strains, optimized at ECBC, were able to grow using IMPA as the phosphate source. 15. SUBJECT TERMS Acetylcholinesterase (AChE

Genome analysis of E. coli isolated from Crohn's disease patients.

PubMed

Rakitina, Daria V; Manolov, Alexander I; Kanygina, Alexandra V; Garushyants, Sofya K; Baikova, Julia P; Alexeev, Dmitry G; Ladygina, Valentina G; Kostryukova, Elena S; Larin, Andrei K; Semashko, Tatiana A; Karpova, Irina Y; Babenko, Vladislav V; Ismagilova, Ruzilya K; Malanin, Sergei Y; Gelfand, Mikhail S; Ilina, Elena N; Gorodnichev, Roman B; Lisitsyna, Eugenia S; Aleshkin, Gennady I; Scherbakov, Petr L; Khalif, Igor L; Shapina, Marina V; Maev, Igor V; Andreev, Dmitry N; Govorun, Vadim M

2017-07-19

Escherichia coli (E. coli) has been increasingly implicated in the pathogenesis of Crohn's disease (CD). The phylogeny of E. coli isolated from Crohn's disease patients (CDEC) was controversial, and while genotyping results suggested heterogeneity, the sequenced strains of E. coli from CD patients were closely related. We performed the shotgun genome sequencing of 28 E. coli isolates from ten CD patients and compared genomes from these isolates with already published genomes of CD strains and other pathogenic and non-pathogenic strains. CDEC was shown to belong to A, B1, B2 and D phylogenetic groups. The plasmid and several operons from the reference CD-associated E. coli strain LF82 were demonstrated to be more often present in CDEC genomes belonging to different phylogenetic groups than in genomes of commensal strains. The operons include carbon-source induced invasion GimA island, prophage I, iron uptake operons I and II, capsular assembly pathogenetic island IV and propanediol and galactitol utilization operons. Our findings suggest that CDEC are phylogenetically diverse. However, some strains isolated from independent sources possess highly similar chromosome or plasmids. Though no CD-specific genes or functional domains were present in all CD-associated strains, some genes and operons are more often found in the genomes of CDEC than in commensal E. coli. They are principally linked to gut colonization and utilization of propanediol and other sugar alcohols.

Investigating the Relatedness of Enteroinvasive Escherichia coli to Other E. coli and Shigella Isolates by Using Comparative Genomics

PubMed Central

Hazen, Tracy H.; Leonard, Susan R.; Lampel, Keith A.; Lacher, David W.

2016-01-01

Enteroinvasive Escherichia coli (EIEC) is a unique pathovar that has a pathogenic mechanism nearly indistinguishable from that of Shigella species. In contrast to isolates of the four Shigella species, which are widespread and can be frequent causes of human illness, EIEC causes far fewer reported illnesses each year. In this study, we analyzed the genome sequences of 20 EIEC isolates, including 14 first described in this study. Phylogenomic analysis of the EIEC genomes demonstrated that 17 of the isolates are present in three distinct lineages that contained only EIEC genomes, compared to reference genomes from each of the E. coli pathovars and Shigella species. Comparative genomic analysis identified genes that were unique to each of the three identified EIEC lineages. While many of the EIEC lineage-specific genes have unknown functions, those with predicted functions included a colicin and putative proteins involved in transcriptional regulation or carbohydrate metabolism. In silico detection of the Shigella virulence plasmid (pINV), which is essential for the invasion of host cells, demonstrated that a form of pINV was present in nearly all EIEC genomes, but the Mxi-Spa-Ipa region of the plasmid that encodes the invasion-associated proteins was absent from several of the EIEC isolates. The comparative genomic findings in this study support the hypothesis that multiple EIEC lineages have evolved independently from multiple distinct lineages of E. coli via the acquisition of the Shigella virulence plasmid and, in some cases, the Shigella pathogenicity islands. PMID:27271741

Investigating the Relatedness of Enteroinvasive Escherichia coli to Other E. coli and Shigella Isolates by Using Comparative Genomics.

PubMed

Hazen, Tracy H; Leonard, Susan R; Lampel, Keith A; Lacher, David W; Maurelli, Anthony T; Rasko, David A

2016-08-01

Enteroinvasive Escherichia coli (EIEC) is a unique pathovar that has a pathogenic mechanism nearly indistinguishable from that of Shigella species. In contrast to isolates of the four Shigella species, which are widespread and can be frequent causes of human illness, EIEC causes far fewer reported illnesses each year. In this study, we analyzed the genome sequences of 20 EIEC isolates, including 14 first described in this study. Phylogenomic analysis of the EIEC genomes demonstrated that 17 of the isolates are present in three distinct lineages that contained only EIEC genomes, compared to reference genomes from each of the E. coli pathovars and Shigella species. Comparative genomic analysis identified genes that were unique to each of the three identified EIEC lineages. While many of the EIEC lineage-specific genes have unknown functions, those with predicted functions included a colicin and putative proteins involved in transcriptional regulation or carbohydrate metabolism. In silico detection of the Shigella virulence plasmid (pINV), which is essential for the invasion of host cells, demonstrated that a form of pINV was present in nearly all EIEC genomes, but the Mxi-Spa-Ipa region of the plasmid that encodes the invasion-associated proteins was absent from several of the EIEC isolates. The comparative genomic findings in this study support the hypothesis that multiple EIEC lineages have evolved independently from multiple distinct lineages of E. coli via the acquisition of the Shigella virulence plasmid and, in some cases, the Shigella pathogenicity islands. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

Occurrence and genetic characteristics of third-generation cephalosporin-resistant Escherichia coli in Swiss retail meat.

PubMed

Vogt, Debora; Overesch, Gudrun; Endimiani, Andrea; Collaud, Alexandra; Thomann, Andreas; Perreten, Vincent

2014-10-01

Prevalence and genetic relatedness were determined for third-generation cephalosporin-resistant Escherichia coli (3GC-R-Ec) detected in Swiss beef, veal, pork, and poultry retail meat. Samples from meat-packing plants (MPPs) processing 70% of the slaughtered animals in Switzerland were purchased at different intervals between April and June 2013 and analyzed. Sixty-nine 3GC-R-Ec isolates were obtained and characterized by microarray, PCR/DNA sequencing, Multi Locus Sequence Typing (MLST), and plasmid replicon typing. Plasmids of selected strains were transformed by electroporation into E. coli TOP10 cells and analyzed by plasmid MLST. The prevalence of 3GC-R-Ec was 73.3% in chicken and 2% in beef meat. No 3GC-R-Ec were found in pork and veal. Overall, the bla(CTX-M-1) (79.4%), bla(CMY-2) (17.6%), bla(CMY-4) (1.5%), and bla(SHV-12) (1.5%) β-lactamase genes were detected, as well as other genes conferring resistance to chloramphenicol (cmlA1-like), sulfonamides (sul), tetracycline (tet), and trimethoprim (dfrA). The 3GC-R-Ec from chicken meat often harbored virulence genes associated with avian pathogens. Plasmid incompatibility (Inc) groups IncI1, IncFIB, IncFII, and IncB/O were the most frequent. A high rate of clonality (e.g., ST1304, ST38, and ST93) among isolates from the same MPPs suggests that strains persist at the plant and spread to meat at the carcass-processing stage. Additionally, the presence of the blaCTX-M-1 gene on an IncI1 plasmid sequence type 3 (IncI1/pST3) in genetically diverse strains indicates interstrain spread of an epidemic plasmid. The bla(CMY-2) and bla(CMY-4) genes were located on IncB/O plasmids. This study represents the first comprehensive assessment of 3GC-R-Ec in meat in Switzerland. It demonstrates the need for monitoring contaminants and for the adaptation of the Hazard Analysis and Critical Control Point concept to avoid the spread of multidrug-resistant bacteria through the food chain.

The evolution of heart gene delivery vectors.

PubMed

Wasala, Nalinda B; Shin, Jin-Hong; Duan, Dongsheng

2011-10-01

Gene therapy holds promise for treating numerous heart diseases. A key premise for the success of cardiac gene therapy is the development of powerful gene transfer vehicles that can achieve highly efficient and persistent gene transfer specifically in the heart. Other features of an ideal vector include negligible toxicity, minimal immunogenicity and easy manufacturing. Rapid progress in the fields of molecular biology and virology has offered great opportunities to engineer various genetic materials for heart gene delivery. Several nonviral vectors (e.g. naked plasmids, plasmid lipid/polymer complexes and oligonucleotides) have been tested. Commonly used viral vectors include lentivirus, adenovirus and adeno-associated virus. Among these, adeno-associated virus has shown many attractive features for pre-clinical experimentation in animal models of heart diseases. We review the history and evolution of these vectors for heart gene transfer. Copyright © 2011 John Wiley & Sons, Ltd.

The evolution of heart gene delivery vectors

PubMed Central

Wasala, Nalinda B.; Shin, Jin-Hong; Duan, Dongsheng

2012-01-01

Gene therapy holds promise for treating numerous heart diseases. A key premise for the success of cardiac gene therapy is the development of powerful gene transfer vehicles that can achieve highly efficient and persistent gene transfer specifically in the heart. Other features of an ideal vector include negligible toxicity, minimal immunogenicity and easy manufacturing. Rapid progress in the fields of molecular biology and virology has offered great opportunities to engineer various genetic materials for heart gene delivery. Several nonviral vectors (e.g. naked plasmids, plasmid lipid/polymer complexes and oligonucleotides) have been tested. Commonly used viral vectors include lentivirus, adenovirus and adeno-associated virus. Among these, adeno-associated virus has shown many attractive features for pre-clinical experimentation in animal models of heart diseases. We review the history and evolution of these vectors for heart gene transfer. PMID:21837689

Production and purification of recombinant human glucagon overexpressed as intein fusion protein in Escherichia coli.

PubMed

Esipov, Roman S; Stepanenko, Vasily N; Gurevich, Alexandr I; Chupova, Larisa A; Miroshnikov, Anatoly I

2006-01-01

Chemico-enzymatic synthesis and cloning in Esherichia coli of an artificial gene coding human glucagon was performed. Recombinant plasmid containing hybrid glucagons gene and intein Ssp dnaB from Synechocestis sp. was designed. Expression of the obtained hybrid gene in E. coli, properties of the formed hybrid protein, and conditions of its autocatalytic cleavage leading to glucagon formation were studied.

Draft Genome Sequence of Escherichia coli K-12 (ATCC 10798).

PubMed

Dimitrova, Daniela; Engelbrecht, Kathleen C; Putonti, Catherine; Koenig, David W; Wolfe, Alan J

2017-07-06

Here, we present the draft genome sequence of Escherichia coli ATCC 10798. E. coli ATCC 10798 is a K-12 strain, one of the most well-studied model microorganisms. The size of the genome was 4,685,496 bp, with a G+C content of 50.70%. This assembly consists of 62 contigs and the F plasmid. Copyright © 2017 Dimitrova et al.

Draft Genome Sequence of Escherichia coli K-12 (ATCC 10798)

PubMed Central

Dimitrova, Daniela; Engelbrecht, Kathleen C.; Koenig, David W.; Wolfe, Alan J.

2017-01-01

ABSTRACT Here, we present the draft genome sequence of Escherichia coli ATCC 10798. E. coli ATCC 10798 is a K-12 strain, one of the most well-studied model microorganisms. The size of the genome was 4,685,496 bp, with a G+C content of 50.70%. This assembly consists of 62 contigs and the F plasmid. PMID:28684574

Plasmid partition system of the P1par family from the pWR100 virulence plasmid of Shigella flexneri.

PubMed

Sergueev, Kirill; Dabrazhynetskaya, Alena; Austin, Stuart

2005-05-01

P1par family members promote the active segregation of a variety of plasmids and plasmid prophages in gram-negative bacteria. Each has genes for ParA and ParB proteins, followed by a parS partition site. The large virulence plasmid pWR100 of Shigella flexneri contains a new P1par family member: pWR100par. Although typical parA and parB genes are present, the putative pWR100parS site is atypical in sequence and organization. However, pWR100parS promoted accurate plasmid partition in Escherichia coli when the pWR100 Par proteins were supplied. Unique BoxB hexamer motifs within parS define species specificities among previously described family members. Although substantially different from P1parS from the P1 plasmid prophage of E. coli, pWR100parS has the same BoxB sequence. As predicted, the species specificity of the two types proved identical. They also shared partition-mediated incompatibility, consistent with the proposed mechanistic link between incompatibility and species specificity. Among several informative sequence differences between pWR100parS and P1parS is the presence of a 21-bp insert at the center of the pWR100parS site. Deletion of this insert left much of the parS activity intact. Tolerance of central inserts with integral numbers of helical DNA turns reflects the critical topology of these sites, which are bent by binding the host IHF protein.

Characterization of the Campylobacter jejuni cryptic plasmid pTIW94 recovered from wild birds in the southeastern United States.

PubMed

Hiett, Kelli L; Rothrock, Michael J; Seal, Bruce S

2013-09-01

The complete nucleotide sequence was determined for a cryptic plasmid, pTIW94, recovered from several Campylobacter jejuni isolates from wild birds in the southeastern United States. pTIW94 is a circular molecule of 3860 nucleotides, with a G+C content (31.0%) similar to that of many Campylobacter spp. genomes. A typical origin of replication, with iteron sequences, was identified upstream of DNA sequences that demonstrated similarity to replication initiation proteins. A total of five open reading frames (ORFs) were identified; two of the five ORFs demonstrated significant similarity to plasmid pCC2228-2 found within Campylobacter coli. These two ORFs were similar to essential replication proteins RepA (100%; 26/26 aa identity) and RepB (95%; 327/346 aa identity). A third identified ORF demonstrated significant similarity (99%; 421/424 aa identity) to the MOB protein from C. coli 67-8, originally recovered from swine. The other two identified ORFs were either similar to hypothetical proteins from other Campylobacter spp., or exhibited no significant similarity to any DNA or protein sequence in the GenBank database. Promoter regions (-35 and -10 signal sites), ribosomal binding sites upstream of ORFs, and stem-loop structures were also identified within the plasmid. These results demonstrate that pTIW94 represents a previously un-reported small cryptic plasmid with unique sequences as well as highly similar sequences to other small plasmids found within Campylobacter spp., and that this cryptic plasmid is present among Campylobacter spp. recovered from different genera of wild birds. Copyright © 2013. Published by Elsevier Inc.

Treatment with Cefotaxime Affects Expression of Conjugation Associated Proteins and Conjugation Transfer Frequency of an IncI1 Plasmid in Escherichia coli

PubMed Central

Møller, Thea S. B.; Liu, Gang; Boysen, Anders; Thomsen, Line E.; Lüthje, Freja L.; Mortensen, Sisse; Møller-Jensen, Jakob; Olsen, John E.

2017-01-01

Horizontal gene transfer (HGT) is the major mechanism responsible for spread of antibiotic resistance. Antibiotic treatment has been suggested to promote HGT, either by directly affecting the conjugation process itself or by selecting for conjugations subsequent to DNA transfer. However, recent research suggests that the effect of antibiotic treatment on plasmid conjugation frequencies, and hence the spread of resistance plasmids, may have been overestimated. We addressed the question by quantifying transfer proteins and conjugation frequencies of a blaCTX−M−1 encoding IncI1 resistance plasmid in Escherichia coli MG1655 in the presence and absence of therapeutically relevant concentrations of cefotaxime (CTX). Analysis of the proteome by iTRAQ labeling and liquid chromatography tandem mass spectrometry revealed that Tra proteins were significantly up-regulated in the presence of CTX. The up-regulation of the transfer machinery was confirmed at the transcriptional level for five selected genes. The CTX treatment did not cause induction of the SOS-response as revealed by absence of significantly regulated SOS associated proteins in the proteome and no significant up-regulation of recA and sfiA genes. The frequency of plasmid conjugation, measured in an antibiotic free environment, increased significantly when the donor was pre-grown in broth containing CTX compared to growth without this drug, regardless of whether blaCTX-M-1 was located on the plasmid or in trans on the chromosome. The results shows that antibiotic treatment can affect expression of a plasmid conjugation machinery and subsequent DNA transfer. PMID:29238335

Food-grade host/vector expression system for Lactobacillus casei based on complementation of plasmid-associated phospho-beta-galactosidase gene lacG.

PubMed

Takala, T M; Saris, P E J; Tynkkynen, S S H

2003-01-01

A new food-grade host/vector system for Lactobacillus casei based on lactose selection was constructed. The wild-type non-starter host Lb. casei strain E utilizes lactose via a plasmid-encoded phosphotransferase system. For food-grade cloning, a stable lactose-deficient mutant was constructed by deleting a 141-bp fragment from the phospho-beta-galactosidase gene lacG via gene replacement. The deletion resulted in an inactive phospho-beta-galactosidase enzyme with an internal in-frame deletion of 47 amino acids. A complementation plasmid was constructed containing a replicon from Lactococcus lactis, the lacG gene from Lb. casei, and the constitutive promoter of pepR for lacG expression from Lb. rhamnosus. The expression of the lacG gene from the resulting food-grade plasmid pLEB600 restored the ability of the lactose-negative mutant strain to grow on lactose to the wild-type level. The vector pLEB600 was used for expression of the proline iminopeptidase gene pepI from Lb. helveticus in Lb. casei. The results show that the food-grade expression system reported in this paper can be used for expression of foreign genes in Lb. casei.

Construction of pTM series plasmids for gene expression in Brucella species.

PubMed

Tian, Mingxing; Qu, Jing; Bao, Yanqing; Gao, Jianpeng; Liu, Jiameng; Wang, Shaohui; Sun, Yingjie; Ding, Chan; Yu, Shengqing

2016-04-01

Brucellosis, the most common widespread zoonotic disease, is caused by Brucella spp., which are facultative, intracellular, Gram-negative bacteria. With the development of molecular biology techniques, more and more virulence-associated factors have been identified in Brucella spp. A suitable plasmid system is an important tool to study virulence genes in Brucella. In this study, we constructed three constitutive replication plasmids (pTM1-Cm, pTM2-Amp, and pTM3-Km) using the replication origin (rep) region derived from the pBBR1-MCS vector. Also, a DNA fragment containing multiple cloning sites (MCSs) and a terminator sequence derived from the pCold vector were produced for complementation of the deleted genes. Besides pGH-6×His, a plasmid containing the groE promoter of Brucella spp. was constructed to express exogenous proteins in Brucella with high efficiency. Furthermore, we constructed the inducible expression plasmid pZT-6×His, containing the tetracycline-inducible promoter pzt1, which can induce expression by the addition of tetracycline in the Brucella culture medium. The constructed pTM series plasmids will play an important role in the functional investigation of Brucella spp. Copyright © 2016 Elsevier B.V. All rights reserved.

A New Suite of Plasmid Vectors for Fluorescence-Based Imaging of Root Colonizing Pseudomonads

DOE PAGES

Wilton, Rosemarie; Ahrendt, Angela J.; Shinde, Shalaka; ...

2018-02-01

In the terrestrial ecosystem, plant-microbe symbiotic associations are ecologically and economically important processes. To better understand these associations at structural and functional levels, different molecular and biochemical tools are applied. In this study, we have constructed a suite of vectors that incorporates several new elements into the rhizosphere stable, broad-host vector pME6031. The new vectors are useful for studies requiring multi-color tagging and visualization of plant-associated, Gram negative bacterial strains such as Pseudomonas plant growth promotion and biocontrol strains. A number of genetic elements, including constitutive promoters and signal peptides that target secretion to the periplasm, have been evaluated. Severalmore » next generation fluorescent proteins, namely mTurquoise2, mNeonGreen, mRuby2, DsRed-Express2 and E2-Crimson have been incorporated into the vectors for whole cell labeling or protein tagging. Secretion of mTurquoise2 and mNeonGreen into the periplasm of Pseudomonas fluorescens SBW25 has also been demonstrated, providing a vehicle for tagging proteins in the periplasmic compartment. A higher copy number version of select plasmids has been produced by introduction of a previously described repA mutation, affording an increase in protein expression levels. The utility of these plasmids for fluorescence-based imaging is demonstrated by root colonization of Solanum lycopersicum seedlings by P. fluorescens SBW25 in a hydroponic growth system. As a result, the plasmids are stably maintained during root colonization in the absence of selective pressure for more than two weeks.« less

A New Suite of Plasmid Vectors for Fluorescence-Based Imaging of Root Colonizing Pseudomonads

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wilton, Rosemarie; Ahrendt, Angela J.; Shinde, Shalaka

In the terrestrial ecosystem, plant-microbe symbiotic associations are ecologically and economically important processes. To better understand these associations at structural and functional levels, different molecular and biochemical tools are applied. In this study, we have constructed a suite of vectors that incorporates several new elements into the rhizosphere stable, broad-host vector pME6031. The new vectors are useful for studies requiring multi-color tagging and visualization of plant-associated, Gram negative bacterial strains such as Pseudomonas plant growth promotion and biocontrol strains. A number of genetic elements, including constitutive promoters and signal peptides that target secretion to the periplasm, have been evaluated. Severalmore » next generation fluorescent proteins, namely mTurquoise2, mNeonGreen, mRuby2, DsRed-Express2 and E2-Crimson have been incorporated into the vectors for whole cell labeling or protein tagging. Secretion of mTurquoise2 and mNeonGreen into the periplasm of Pseudomonas fluorescens SBW25 has also been demonstrated, providing a vehicle for tagging proteins in the periplasmic compartment. A higher copy number version of select plasmids has been produced by introduction of a previously described repA mutation, affording an increase in protein expression levels. The utility of these plasmids for fluorescence-based imaging is demonstrated by root colonization of Solanum lycopersicum seedlings by P. fluorescens SBW25 in a hydroponic growth system. As a result, the plasmids are stably maintained during root colonization in the absence of selective pressure for more than two weeks.« less

Prevalence of O25b-ST131 clone among Escherichia coli strains producing CTX-M-15, CTX-M-14 and CTX-M-92 β-lactamases.

PubMed

Giedraitienė, Agnė; Vitkauskienė, Astra; Pavilonis, Alvydas; Patamsytė, Vaiva; Genel, Nathalie; Decre, Dominique; Arlet, Guillaume

2017-02-01

Dissemination of multidrug-resistant Escherichia coli is closely associated with the worldwide spread of a single clone ST131, which is the main cause of urinary tract and bloodstream infections in patients from nursing homes and immunocompromised patients. The aim of our study was to determine the prevalence of ST131 clone and the replicons involved in the spread of bla CTX-M genes among O25b-ST131 CTX-M-producing E. coli isolates in Lithuania. The strains included in this study were screened for CTX-M β-lactamase-encoding genes, phylogenetic groups and ST131 clone by PCR. Bacterial conjugation was performed to identify plasmid replicon types responsible for bla CTX-M genes dissemination. A total of 158 E. coli clinical non-duplicate ESBL isolates were analyzed. Nearly half (n = 67, 42.4%) of the investigated E. coli isolates belonged to phylogenetic group B2. The isolates producing CTX-M-92 β-lactamases were identified to be the ST131 clone more frequently than the non-ST131 clone (11.5% vs. 3.1%, p = .035). The CTX-M-15 isolates were identified as ST131 isolates less frequently than non-ST131 isolates (50.8% vs. 71.1%; p = .015). The ST131 clone isolates contained type L/M and A/C replicons; a fused FII/FIB replicon was found in four isolates (23.5%). Type HI1 replicon was identified in ST131 E. coli isolates producing CTX-M-15 β-lactamases. This study demonstrates the predominance of the ST131 clone among CTX-M β-lactamase-producing E. coli isolates. Dissemination of bla CTX-M genes in ST131 strains can be linked not only to highly adapted IncF plasmids such as FII/FIB and FII, but also to plasmid replicon types A/C, L/M and HI1.

Biosynthetic burden and plasmid burden limit expression of chromosomally integrated heterologous genes (pdc, adhB) in Escherichia coli

DOE Office of Scientific and Technical Information (OSTI.GOV)

Martinez, A.; York, S.W.; Yomano, L.P.

1999-10-01

Previous studies have shown an unexpectedly high nutrient requirement for efficient ethanol production by ethanologenic recombinants of Escherichia coli B such as LY01 which contain chromosomally integrated Zymomonas mobilis genes (pdc, adhB) encoding the ethanol pathway. The basis for this requirement has been identified as a media-dependent effect on the expression of the Z. mobilis genes rather than a nutritional limitation. Ethanol production was substantially increased without additional nutrients simply by increasing the level of pyruvate decarboxylase activity. This was accomplished by adding a multicopy plasmid containing pdc alone (but not adhB alone) to strain LY01, and by adding multicopymore » plasmids which express pdc and adhB from strong promoters. New strong promoters were isolated from random fragments of Z. mobilis DNA and characterized but were not used to construct integrated biocatalysts. These promoters contained regions resembling recognition sites for 3 different E. coli sigma factors: {sigma}{sup 70}, {sigma}{sup 38}, and {sigma}{sup 28}. The most effective plasmid-based promoters for fermentation were recognized by multiple sigma factors, expressed both pdc and adhB at high levels, and produced ethanol efficiently while allowing up to 80% reduction in complex nutrients as compared to LY01. The ability to utilize multiple sigma factors may be advantageous to maintain the high levels of PDC and ADH needed for efficient ethanol production throughout batch fermentation.« less