Use of Ti plasmid DNA probes for determining tumorigenicity of agrobacterium strains

DOE Office of Scientific and Technical Information (OSTI.GOV)

Burr, T.J.; Norelli, J.L.; Katz, B.H.

1990-06-01

Probes consisting of T-DNA genes from the Ti plasmid of Agrobacterium tumefaciens were used for determining tumorigenicity of strains. Two {sup 32}P-labeled probes hybridized with 28 of 28 tumorigenic strains of the pathogen but not with 20 of 22 nontumorigenic strains. One probe, pTHE17, consists of all but the far left portion of the T-DNA of strain C58. Probe SmaI7 consists of SmaI fragment 7 of pTiC58, including onc genes 1, 4, and 6a and most of 2. Another probe, pAL4044, consisting of the vir region of strain Ach-5, hybridized with several nontumorigenic as well as tumorigenic strains. Colony hybridizationsmore » were done with 28 tumorigenic and 22 nontumorigenic Agrobacterium strains. About 10{sup 6} CFU of the different tumorigenic strains were detectable with this method. Southern analyses confirmed the presence or absence of Ti plasmids in strains for which tumorigenicity was questioned. Colony hybridization with the T-DNA probes provides a rapid and sensitive means for determining the tumorigenic nature of Agrobacterium strains.« less

[Detection of verotoxin-producing E. coli (VTEC) in healthy cattle and swine with the DNA-DNA colony hybridization method].

PubMed

Bülte, M; Montenegro, M A; Helmuth, R; Trumpf, T; Reuter, G

1990-11-01

With the DNA-DNA colony hybridization technique using specific gene probes for Verotoxin 1 (VT 1) and Verotoxin 2 (VT 2) 2100 E. coli strains from healthy animals were tested. Ten out of 82 milk cows (21.2%), 20 out of 212 beef cattle (9.4%) and five out of 75 pigs (6.7%) were found to carry genes for VT 1, VT 2 or both toxins, respectively. Among these strains the biotypes 5 and 6 were predominant. Some of the serotyped isolates have been described to be pathogenic for humans, like O157:H7, 082:H8, 0116, 0113, 0126 and 091, respectively. The unexpected high incidence of VTEC positive healthy animals possibly indicates a health hazard for human beings. Further investigations on the incidence of VTEC in food are necessary.

Doing Educational Development Ambivalently: Applying Post-Colonial Metaphors to Educational Development?

ERIC Educational Resources Information Center

Manathunga, Catherine

2006-01-01

Post-colonial theories about liminality, hybridity, unhomeliness, and identity form a novel lens through which to re-theorise educational development work. Applying these conceptual frameworks allows practitioners and the academics they work with the opportunity to problematise some of educational development's colonial underpinnings and…

Hybridization of two major termite invaders as a consequence of human activity.

PubMed

Chouvenc, Thomas; Helmick, Ericka E; Su, Nan-Yao

2015-01-01

While hybridization of an invasive species with a native species is a common occurrence, hybridization between two invasive species is rare. Formosan subterranean termites (Coptotermes formosanus) and Asian subterranean termites (C. gestroi) are both ecologically successful and are the two most economically important termite pests in the world. Both species have spread throughout many areas of the world due to human activity; however, their distributions overlap in only three narrow areas because of distinct ecological requirements. In south Florida, where C. formosanus and C. gestroi are both invasive, the dispersal flight seasons of both species overlapped for the first time on record in 2013 and 2014. Pairings of heterospecific individuals were readily observed in the field and C. gestroi males preferentially engaged in mating behavior with C. formosanus females rather than females from their own species. In the laboratory, heterospecific and conspecific pairings had an equal colony establishment rate, but heterospecific incipient colonies had twice the growth rate of conspecific incipient colonies, suggesting a potential case of hybrid vigor. As all pre-zygotic barriers were lifted between the two species in the field, the apparent absence of post-zygotic barriers in the laboratory raises the possibility for introgressive hybridization in south Florida. While laboratory observations remain to be confirmed in the field, and the alate hybrid fertility is currently unknown, our results raise a tangible concern about the hybridization of two major destructive pest species. Such hybridization would likely be associated with a new economic impact.

The Contemporary Reality of Canadian Imperialism: Settler Colonialism and the Hybrid Colonial State

ERIC Educational Resources Information Center

Barker, Adam J.

2009-01-01

The author's fundamental contention is this: Canadian society remains driven by the logic of imperialism and engages in concerted colonial action against Indigenous peoples whose claims to land and self-determination continue to undermine the legitimacy of Canadian authority and hegemony. The imperial ambitions of the Canadian state and its…

Colonial Nesting Sea and Wading Bird Use of Estuarine Islands in the Pacific Northwest.

DTIC Science & Technology

1978-05-01

glaucous-winged (hybrid) gulls, ring-billed gulls, Caspian terns , and common terns . Colonies of great blue herons were found on two islands 61 and 97 km...from the mouth of the Columbia River . Habitat maps were prepared for each island studied and detailed floristic descriptions of each bird colony

Production and molecular characterization of somatic hybrids between Pleurotus florida and Lentinula edodes.

PubMed

Mallick, Pijush; Sikdar, Samir Ranjan

2014-08-01

Nine inter-generic somatic hybrids named as pfle were produced through PEG-mediated protoplast fusion between Pleurotus florida and Lentinula edodes using double selection method. Hybridity of the newly developed strains was established on the basis of colony morphology, mycelial growth, hyphal traits, fruit-body productivity and inter single sequence repeat (ISSR) marker profiling. Hybrid population was assessed with different phenotypic variables by one-way analysis of variance. Principal component matrices were analyzed for the six phenotypic variables in scatter plot showing maximum positive correlation between each variable for all strains examined. Six ISSR primers generated 66 reproducible fragments with 98.48 % polymorphism. The dendrogram thus created based on unweighted pair-group method with mathematic averages method of clustering and Euclidean distance which exhibited three major groups between the parents and pfle hybrids. Though P. florida parent remained in one group but it showed different degrees of genetic distance with all the hybrid lines belonging to the other two groups while L. edodes was most distantly related to all the hybrid lines. L. edodes specific sequence-rich ISSR amplicon was recorded in all the hybrid lines and in L. edodes but not in P. florida. All the fruit body generating pfle hybrid lines could produce basidiocarp on paddy straw in sub-tropical climate and showed phenotypic resemblance to the P. florida parent.

Detection of the Light Organ Symbiont, Vibrio fischeri, in Hawaiian Seawater by Using lux Gene Probes †

PubMed Central

Lee, Kyu-Ho; Ruby, Edward G.

1992-01-01

Symbiotic bacteria that inhabit the light-emitting organ of the Hawaiian squid Euprymna scolopes are distinctive from typical Vibrio fischeri organisms in that they are not visibly luminous when grown in laboratory culture. Therefore, the abundance of these bacteria in seawater samples cannot be estimated simply by identifying them among luminous colonies that arise on nutrient agar plates. Instead, we have used luxR and polymerase chain reaction generated luxA gene probes to identify both luminous and non-visibly luminous V. fischeri colonies by DNA-DNA hybridization. The probes were specific, hybridizing at least 50 to 100 times more strongly to immobilized DNAs from V. fischeri strains than to those of pure cultures of other related species. Thus, even non-visibly luminous V. fischeri colonies could be identified among colonies obtained from natural seawater samples by their probe-positive reaction. Bacteria in seawater samples, obtained either within or distant from squid habitats, were collected on membrane filters and incubated until colonies appeared. The filters were then observed for visibly luminous V. fischeri colonies and hybridized with the lux gene probes to determine the number of total V. fischeri colonies (both luminous and non-visibly luminous). We detected no significant differences in the abundance of luminous V. fischeri CFU in any of the water samples observed (≤1 to 3 CFU/100 ml). However, probe-positive colonies of V. fischeri (up to 900 CFU/100 ml) were found only in seawater collected from within the natural habitats of the squids. A number of criteria were used to confirm that these probe-positive strains were indistinguishable from symbiotic V. fischeri. Therefore, the luxA and luxR gene probes were species specific and gave a reliable estimate of the number of culturable V. fischeri colonies in natural water samples. Images PMID:16348678

Detection of the Light Organ Symbiont, Vibrio fischeri, in Hawaiian Seawater by Using lux Gene Probes.

PubMed

Lee, K H; Ruby, E G

1992-03-01

Symbiotic bacteria that inhabit the light-emitting organ of the Hawaiian squid Euprymna scolopes are distinctive from typical Vibrio fischeri organisms in that they are not visibly luminous when grown in laboratory culture. Therefore, the abundance of these bacteria in seawater samples cannot be estimated simply by identifying them among luminous colonies that arise on nutrient agar plates. Instead, we have used luxR and polymerase chain reaction generated luxA gene probes to identify both luminous and non-visibly luminous V. fischeri colonies by DNA-DNA hybridization. The probes were specific, hybridizing at least 50 to 100 times more strongly to immobilized DNAs from V. fischeri strains than to those of pure cultures of other related species. Thus, even non-visibly luminous V. fischeri colonies could be identified among colonies obtained from natural seawater samples by their probe-positive reaction. Bacteria in seawater samples, obtained either within or distant from squid habitats, were collected on membrane filters and incubated until colonies appeared. The filters were then observed for visibly luminous V. fischeri colonies and hybridized with the lux gene probes to determine the number of total V. fischeri colonies (both luminous and non-visibly luminous). We detected no significant differences in the abundance of luminous V. fischeri CFU in any of the water samples observed (

An Ant Colony Optimization and Hybrid Metaheuristics Algorithm to Solve the Split Delivery Vehicle Routing Problem

DTIC Science & Technology

2015-01-01

programming formulation of traveling salesman problems , Journal of the ACM, 7(4), 326-329. Montemanni, R., Gambardella, L. M., Rizzoli, A.E., Donati. A.V... salesman problem . BioSystem, 43(1), 73-81. Dror, M., Trudeau, P., 1989. Savings by split delivery routing. Transportation Science, 23, 141- 145. Dror, M...An Ant Colony Optimization and Hybrid Metaheuristics Algorithm to solve the Split Delivery Vehicle Routing Problem Authors: Gautham Rajappa

Occurrence of H2-Uptake Hydrogenases in Bradyrhizobium sp. (Lupinus) and Their Expression in Nodules of Lupinus spp. and Ornithopus compressus1

PubMed Central

Murillo, Jesús; Villa, Ana; Chamber, Manuel; Ruiz-Argüeso, Tomás

1989-01-01

Fifty-four strains of Bradyrhizobium sp. (Lupinus) from worldwide collections were screened by a colony hybridization method for the presence of DNA sequences homologous to the structural genes of the Bradyrhizobium japonicum hydrogenase. Twelve strains exhibited strong colony hybridization signals, and subsequent Southern blot hybridization experiments showed that they fell into two different groups on the basis of the pattern of EcoRI fragments containing the homology to the hup probe. All strains in the first group (UPM860, UPM861, and 750) expressed uptake hydrogenase activity in symbiosis with Lupinus albus, Lupinus angustifolius, Lupinus luteus, and Ornithopus compressus, but both the rate of H2 uptake by bacteroids and the relative efficiency of N2 fixation (RE = 1 - [H2 evolved in air/acetylene reduced]) by nodules were markedly affected by the legume host. L. angustifolius was the less permissive host for hydrogenase expression in symbiosis with the three strains (average RE = 0.76), and O. compressus was the more permissive (average RE = 1.0). None of the strains in the second group expressed hydrogenase activity in lupine nodules, and only one exhibited low H2-uptake activity in symbiosis with O. compressus. The inability of these putative Hup+ strains to induce hydrogenase activity in lupine nodules is discussed on the basis of the legume host effect. Among the 42 strains showing no homology to the B. japonicum hup-specific probe in the colony hybridization assay, 10 were examined in symbiosis with L. angustifolius. The average RE for these strains was 0.51. However, one strain, IM43B, exhibited high RE values (higher than 0.80) and high levels of hydrogenase activity in symbiosis with L. angustifolius, L. albus, and L. luteus. In Southern blot hybridization experiments, no homology was detected between the B. japonicum hup-specific DNA probe and total DNA from vegetative cells or bacteroids from strain IM43B even under low stringency hybridization conditions. We conclude from these results that strain IM43B contains hup DNA sequences different from those in B. japonicum and in other lupine rhizobia strains. Images Figure 1 Figure 2 PMID:16666550

Identification of Dekkera bruxellensis (Brettanomyces) from Wine by Fluorescence In Situ Hybridization Using Peptide Nucleic Acid Probes

PubMed Central

Stender, Henrik; Kurtzman, Cletus; Hyldig-Nielsen, Jens J.; Sørensen, Ditte; Broomer, Adam; Oliveira, Kenneth; Perry-O'Keefe, Heather; Sage, Andrew; Young, Barbara; Coull, James

2001-01-01

A new fluorescence in situ hybridization method using peptide nucleic acid (PNA) probes for identification of Brettanomyces is described. The test is based on fluorescein-labeled PNA probes targeting a species-specific sequence of the rRNA of Dekkera bruxellensis. The PNA probes were applied to smears of colonies, and results were interpreted by fluorescence microscopy. The results obtained from testing 127 different yeast strains, including 78 Brettanomyces isolates from wine, show that the spoilage organism Brettanomyces belongs to the species D. bruxellensis and that the new method is able to identify Brettanomyces (D. bruxellensis) with 100% sensitivity and 100% specificity. PMID:11157265

Structural Organization and Strain Variation in the Genome of Varicella Zoster Virus

DTIC Science & Technology

1984-10-23

Zoster 6 Growth of VZV in tissue culture 9 Structure and proteins of VZV 15 Structure of HSV DNA 20 Classification of herpesviruses based on DNA...structure 28 Strain variation in herpesvirus DNA 31 VZV DNA 33 Specific aims 36 II. MATERIALS AND METHODS 38 Cells and viruses 38 Isolation of virus...endonuclease fragments by colony hybridization 106 21. Selected methods of restriction endonuclease mapping .... 109 22. Identification of

A Hybrid Ant Colony Optimization Algorithm for the Extended Capacitated Arc Routing Problem.

PubMed

Li-Ning Xing; Rohlfshagen, P; Ying-Wu Chen; Xin Yao

2011-08-01

The capacitated arc routing problem (CARP) is representative of numerous practical applications, and in order to widen its scope, we consider an extended version of this problem that entails both total service time and fixed investment costs. We subsequently propose a hybrid ant colony optimization (ACO) algorithm (HACOA) to solve instances of the extended CARP. This approach is characterized by the exploitation of heuristic information, adaptive parameters, and local optimization techniques: Two kinds of heuristic information, arc cluster information and arc priority information, are obtained continuously from the solutions sampled to guide the subsequent optimization process. The adaptive parameters ease the burden of choosing initial values and facilitate improved and more robust results. Finally, local optimization, based on the two-opt heuristic, is employed to improve the overall performance of the proposed algorithm. The resulting HACOA is tested on four sets of benchmark problems containing a total of 87 instances with up to 140 nodes and 380 arcs. In order to evaluate the effectiveness of the proposed method, some existing capacitated arc routing heuristics are extended to cope with the extended version of this problem; the experimental results indicate that the proposed ACO method outperforms these heuristics.

A Hybrid Swarm Intelligence Algorithm for Intrusion Detection Using Significant Features.

PubMed

Amudha, P; Karthik, S; Sivakumari, S

2015-01-01

Intrusion detection has become a main part of network security due to the huge number of attacks which affects the computers. This is due to the extensive growth of internet connectivity and accessibility to information systems worldwide. To deal with this problem, in this paper a hybrid algorithm is proposed to integrate Modified Artificial Bee Colony (MABC) with Enhanced Particle Swarm Optimization (EPSO) to predict the intrusion detection problem. The algorithms are combined together to find out better optimization results and the classification accuracies are obtained by 10-fold cross-validation method. The purpose of this paper is to select the most relevant features that can represent the pattern of the network traffic and test its effect on the success of the proposed hybrid classification algorithm. To investigate the performance of the proposed method, intrusion detection KDDCup'99 benchmark dataset from the UCI Machine Learning repository is used. The performance of the proposed method is compared with the other machine learning algorithms and found to be significantly different.

A Hybrid Swarm Intelligence Algorithm for Intrusion Detection Using Significant Features

PubMed Central

Amudha, P.; Karthik, S.; Sivakumari, S.

2015-01-01

Intrusion detection has become a main part of network security due to the huge number of attacks which affects the computers. This is due to the extensive growth of internet connectivity and accessibility to information systems worldwide. To deal with this problem, in this paper a hybrid algorithm is proposed to integrate Modified Artificial Bee Colony (MABC) with Enhanced Particle Swarm Optimization (EPSO) to predict the intrusion detection problem. The algorithms are combined together to find out better optimization results and the classification accuracies are obtained by 10-fold cross-validation method. The purpose of this paper is to select the most relevant features that can represent the pattern of the network traffic and test its effect on the success of the proposed hybrid classification algorithm. To investigate the performance of the proposed method, intrusion detection KDDCup'99 benchmark dataset from the UCI Machine Learning repository is used. The performance of the proposed method is compared with the other machine learning algorithms and found to be significantly different. PMID:26221625

Cultivation of a Synergistetes strain representing a previously uncultivated lineage

PubMed Central

Vartoukian, S R; Palmer, R M; Wade, W G

2010-01-01

Subgingival plaque samples obtained from human subjects with periodontitis, shown to include previously uncultivable members of the phylum Synergistetes, were used to inoculate Cooked Meat Medium (CMM). The presence of Cluster A (uncultivable) Synergistetes was monitored by fluorescent in situ hybridization (FISH) and quantitative PCR (Q-PCR). Cluster A Synergistetes were found to grow in CMM in co-culture with other plaque bacteria and growth was stimulated by the addition of mucin and serum. Plaque samples were also used to inoculate Blood Agar (BA) plates and growth of Cluster A Synergistetes was revealed after anaerobic incubation, by colony hybridization with specific probes. Surface growth on the plates in regions identified by colony hybridization was harvested and used to inoculate fresh plates, thus enriching for Cluster A Synergistetes. Cross-streaks of other plaque bacteria were also used to stimulate Synergistetes growth. In the early passages, no discrete Synergistetes colonies were seen, but after eight passages and the use of cross-streaks of other bacteria present in the enriched community, colonies arose, which consisted solely of Cluster A Synergistetes cells, as determined by 16S rRNA gene PCR and cloning. This is the first report of the successful culture of a member of the uncultivable branch of this phylum. PMID:20074237

Survival ability of Mexican fruit fly males from different strains in presence of the predatory orb-weaving spider Argiope argentata (Araneae: Araneidae).

PubMed

Dor, A; Liedo, P

2018-04-18

The sterile insect technique (SIT) is a key element for the integrated management of pest populations of the Mexican fruit fly, Anastrepha ludens, in Mexico. Its success depends on the survival of mass-reared sterile males and their ability to mate with wild females. However, colonization and mass-rearing conditions can adversely affect their ability to avoid predators. To test if colony management strategies could contribute to improve field survival abilities of mass-reared flies, we compared the survival of males exposed to the orb-weaver spider Argiope argentata. Males compared originated from three strains with different colonization strategies: (a) a colony started from field-collected wild flies (replacement), (b) a colony started by hybridizing wild males with mass-reared adapted females (hybrid) and (c) a colony started with mass-reared males selected on the basis of their survival ability and mating competitiveness in field cages (selected). Mass-reared males and wild males were used as controls. Males were exposed to spiders under laboratory cage conditions. Overall, wild males showed better survival ability than mass-reared males. Regarding the colonization approach, wild males survived better than a hybrid, replaced and selected males. We conclude that mass-rearing conditions have a strong negative effect on the ability of males to escape spiders. The colonization systems evaluated did not counter this effect. The lower survival of males from the selected colony suggests that the selection over one generation did not contribute to improve males' predator avoidance and escape abilities and probably needs to be modified. Possible explanations for this and implications on colonization and colony management for SIT purpose are discussed.

Genetic Bee Colony (GBC) algorithm: A new gene selection method for microarray cancer classification.

PubMed

Alshamlan, Hala M; Badr, Ghada H; Alohali, Yousef A

2015-06-01

Naturally inspired evolutionary algorithms prove effectiveness when used for solving feature selection and classification problems. Artificial Bee Colony (ABC) is a relatively new swarm intelligence method. In this paper, we propose a new hybrid gene selection method, namely Genetic Bee Colony (GBC) algorithm. The proposed algorithm combines the used of a Genetic Algorithm (GA) along with Artificial Bee Colony (ABC) algorithm. The goal is to integrate the advantages of both algorithms. The proposed algorithm is applied to a microarray gene expression profile in order to select the most predictive and informative genes for cancer classification. In order to test the accuracy performance of the proposed algorithm, extensive experiments were conducted. Three binary microarray datasets are use, which include: colon, leukemia, and lung. In addition, another three multi-class microarray datasets are used, which are: SRBCT, lymphoma, and leukemia. Results of the GBC algorithm are compared with our recently proposed technique: mRMR when combined with the Artificial Bee Colony algorithm (mRMR-ABC). We also compared the combination of mRMR with GA (mRMR-GA) and Particle Swarm Optimization (mRMR-PSO) algorithms. In addition, we compared the GBC algorithm with other related algorithms that have been recently published in the literature, using all benchmark datasets. The GBC algorithm shows superior performance as it achieved the highest classification accuracy along with the lowest average number of selected genes. This proves that the GBC algorithm is a promising approach for solving the gene selection problem in both binary and multi-class cancer classification. Copyright © 2015 Elsevier Ltd. All rights reserved.

Automated hybridization/imaging device for fluorescent multiplex DNA sequencing

DOEpatents

Weiss, R.B.; Kimball, A.W.; Gesteland, R.F.; Ferguson, F.M.; Dunn, D.M.; Di Sera, L.J.; Cherry, J.L.

1995-11-28

A method is disclosed for automated multiplex sequencing of DNA with an integrated automated imaging hybridization chamber system. This system comprises an hybridization chamber device for mounting a membrane containing size-fractionated multiplex sequencing reaction products, apparatus for fluid delivery to the chamber device, imaging apparatus for light delivery to the membrane and image recording of fluorescence emanating from the membrane while in the chamber device, and programmable controller apparatus for controlling operation of the system. The multiplex reaction products are hybridized with a probe, the enzyme (such as alkaline phosphatase) is bound to a binding moiety on the probe, and a fluorogenic substrate (such as a benzothiazole derivative) is introduced into the chamber device by the fluid delivery apparatus. The enzyme converts the fluorogenic substrate into a fluorescent product which, when illuminated in the chamber device with a beam of light from the imaging apparatus, excites fluorescence of the fluorescent product to produce a pattern of hybridization. The pattern of hybridization is imaged by a CCD camera component of the imaging apparatus to obtain a series of digital signals. These signals are converted by the controller apparatus into a string of nucleotides corresponding to the nucleotide sequence an automated sequence reader. The method and apparatus are also applicable to other membrane-based applications such as colony and plaque hybridization and Southern, Northern, and Western blots. 9 figs.

Automated hybridization/imaging device for fluorescent multiplex DNA sequencing

DOEpatents

Weiss, Robert B.; Kimball, Alvin W.; Gesteland, Raymond F.; Ferguson, F. Mark; Dunn, Diane M.; Di Sera, Leonard J.; Cherry, Joshua L.

1995-01-01

A method is disclosed for automated multiplex sequencing of DNA with an integrated automated imaging hybridization chamber system. This system comprises an hybridization chamber device for mounting a membrane containing size-fractionated multiplex sequencing reaction products, apparatus for fluid delivery to the chamber device, imaging apparatus for light delivery to the membrane and image recording of fluorescence emanating from the membrane while in the chamber device, and programmable controller apparatus for controlling operation of the system. The multiplex reaction products are hybridized with a probe, then an enzyme (such as alkaline phosphatase) is bound to a binding moiety on the probe, and a fluorogenic substrate (such as a benzothiazole derivative) is introduced into the chamber device by the fluid delivery apparatus. The enzyme converts the fluorogenic substrate into a fluorescent product which, when illuminated in the chamber device with a beam of light from the imaging apparatus, excites fluorescence of the fluorescent product to produce a pattern of hybridization. The pattern of hybridization is imaged by a CCD camera component of the imaging apparatus to obtain a series of digital signals. These signals are converted by the controller apparatus into a string of nucleotides corresponding to the nucleotide sequence an automated sequence reader. The method and apparatus are also applicable to other membrane-based applications such as colony and plaque hybridization and Southern, Northern, and Western blots.

A multilevel ant colony optimization algorithm for classical and isothermic DNA sequencing by hybridization with multiplicity information available.

PubMed

Kwarciak, Kamil; Radom, Marcin; Formanowicz, Piotr

2016-04-01

The classical sequencing by hybridization takes into account a binary information about sequence composition. A given element from an oligonucleotide library is or is not a part of the target sequence. However, the DNA chip technology has been developed and it enables to receive a partial information about multiplicity of each oligonucleotide the analyzed sequence consist of. Currently, it is not possible to assess the exact data of such type but even partial information should be very useful. Two realistic multiplicity information models are taken into consideration in this paper. The first one, called "one and many" assumes that it is possible to obtain information if a given oligonucleotide occurs in a reconstructed sequence once or more than once. According to the second model, called "one, two and many", one is able to receive from biochemical experiment information if a given oligonucleotide is present in an analyzed sequence once, twice or at least three times. An ant colony optimization algorithm has been implemented to verify the above models and to compare with existing algorithms for sequencing by hybridization which utilize the additional information. The proposed algorithm solves the problem with any kind of hybridization errors. Computational experiment results confirm that using even the partial information about multiplicity leads to increased quality of reconstructed sequences. Moreover, they also show that the more precise model enables to obtain better solutions and the ant colony optimization algorithm outperforms the existing ones. Test data sets and the proposed ant colony optimization algorithm are available on: http://bioserver.cs.put.poznan.pl/download/ACO4mSBH.zip. Copyright © 2016 Elsevier Ltd. All rights reserved.

Swarm Intelligence for Optimizing Hybridized Smoothing Filter in Image Edge Enhancement

NASA Astrophysics Data System (ADS)

Rao, B. Tirumala; Dehuri, S.; Dileep, M.; Vindhya, A.

In this modern era, image transmission and processing plays a major role. It would be impossible to retrieve information from satellite and medical images without the help of image processing techniques. Edge enhancement is an image processing step that enhances the edge contrast of an image or video in an attempt to improve its acutance. Edges are the representations of the discontinuities of image intensity functions. For processing these discontinuities in an image, a good edge enhancement technique is essential. The proposed work uses a new idea for edge enhancement using hybridized smoothening filters and we introduce a promising technique of obtaining best hybrid filter using swarm algorithms (Artificial Bee Colony (ABC), Particle Swarm Optimization (PSO) and Ant Colony Optimization (ACO)) to search for an optimal sequence of filters from among a set of rather simple, representative image processing filters. This paper deals with the analysis of the swarm intelligence techniques through the combination of hybrid filters generated by these algorithms for image edge enhancement.

Pollen Collection, Honey Production, and Pollination Services: Managing Honey Bees in an Agricultural Setting.

PubMed

Hoover, Shelley E; Ovinge, Lynae P

2018-05-09

Hybrid canola seed production is an important pollination market in Canada; typically both honey bees (Apis mellifera L. (Hymenoptera: Apidae)) and Alfalfa Leafcutting bees (Megachile rotundata Fab. (Hymenoptera: Megachilidae)) are concurrently managed to ensure pollination in this high-value crop. Beekeepers are paid to provide pollination services, and the colonies also produce a honey crop from the canola. Pollen availability from male-fertile plants is carefully managed in this crop to provide an abundance of pollen to fertilize male-sterile ('female') plants. This abundance of pollen represents an underutilized resource for beekeepers, and an opportunity to diversify the hive-products produced for market in this management system. We used a commercial-style pollen trap to collect pollen from colonies twice weekly for the duration of canola pollination, and compared the honey production and amount of sealed brood in colonies with pollen traps to those without pollen traps. We found that while pollen trapping reduced honey production, there was no negative impact on brood production, and at current market prices, the per-hive revenue was higher in colonies from which pollen was trapped. Pollen trapping honey bee colonies in the context of hybrid canola pollination, therefore, offers beekeepers an opportunity to diversify their products and increase their revenue.

Simple sequence repeat markers for interspecific hybrid detections in Agrostis

USDA-ARS?s Scientific Manuscript database

Agrostis stolonifera L. (creeping bentgrass) and Agrostis capillaris (colonial bentgrass) are turfgrass species that are well adapted for golf course use in regions of the world where cool-season grasses are grown. Interspecific hybrids between the species do form and have the potential to incorpora...

Elucidation of proliferative capability of mononuclear tetraploid cells, emerging spontaneously from diploid cells, using image cytometry and fluorescence in situ hybridization.

PubMed

Ito, Hideaki; Oga, Atsunori; Furuya, Tomoko; Ikemoto, Kenzo; Amakawa, Genta; Chochi, Yasuyo; Kawauchi, Shigeto; Sasaki, Kohsuke

2013-06-01

Proliferation of tetraploid cells (TCs) emerging from diploid cells is considered to be a critical event toward tumourigenesis, or cancer progression. Recently, several studies have reported that binuclear TCs emerging from normal cells are capable of mitosis, however, it has not been confirmed directly whether mononuclear TCs emerging from normal cells could proliferate, even cancer cells. The aim of this study is to detect mononuclear TCs in vitro, spontaneously emerging from diploid cells and to elucidate their proliferative capability directly. For this purpose, we have developed a novel method. In this study, two completely disomic cell lines were used, TIG-7, a fibroblast cell line and CAL-51, a breast cancer cell line. Cells were cultured on microscope slides and their DNA content was determined using an image cytometer. On the same slides, chromosome numbers were scored using centromere fluorescence in situ hybridization (FISH). For evaluating proliferative capability of TCs, bromodeoxyuridine (BrdUrd) incorporation and colony-forming ability were examined. Using our method, spontaneous emergence of mononuclear TCs was detected in both TIG-7 and CAL-51. Colonies of TIG-7 TCs were not observed, but were observed of CAL-51 TCs. Our method enables detection of mononuclear TCs and elucidation of their proliferative capability, directly; this evidence reveals that mononuclear TIG-7 TCs do not proliferate but that mononuclear CAL-51 TCs are able to. © 2013 Blackwell Publishing Ltd.

Optimising the production of succinate and lactate in Escherichia coli using a hybrid of artificial bee colony algorithm and minimisation of metabolic adjustment.

PubMed

Tang, Phooi Wah; Choon, Yee Wen; Mohamad, Mohd Saberi; Deris, Safaai; Napis, Suhaimi

2015-03-01

Metabolic engineering is a research field that focuses on the design of models for metabolism, and uses computational procedures to suggest genetic manipulation. It aims to improve the yield of particular chemical or biochemical products. Several traditional metabolic engineering methods are commonly used to increase the production of a desired target, but the products are always far below their theoretical maximums. Using numeral optimisation algorithms to identify gene knockouts may stall at a local minimum in a multivariable function. This paper proposes a hybrid of the artificial bee colony (ABC) algorithm and the minimisation of metabolic adjustment (MOMA) to predict an optimal set of solutions in order to optimise the production rate of succinate and lactate. The dataset used in this work was from the iJO1366 Escherichia coli metabolic network. The experimental results include the production rate, growth rate and a list of knockout genes. From the comparative analysis, ABCMOMA produced better results compared to previous works, showing potential for solving genetic engineering problems. Copyright © 2014 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

Colonial Legacies and Neo-Colonial Practices in Papua New Guinean Higher Education

ERIC Educational Resources Information Center

Papoutsaki, Evangelia; Rooney, Dick

2006-01-01

This paper explores the Westernization of academic quality within the Papua New Guinea higher education system and the hybridity of the university sector where different actors force knowledge to be created for the needs of a small, formal economy, rather than for the development needs of the country. The country has yet to find a system that best…

Molecular Evidence for a Natural Primary Triple Hybrid in Plants Revealed from Direct Sequencing

PubMed Central

Kaplan, Zdenek; Fehrer, Judith

2007-01-01

Background and Aims Molecular evidence for natural primary hybrids composed of three different plant species is very rarely reported. An investigation was therefore carried out into the origin and a possible scenario for the rise of a sterile plant clone showing a combination of diagnostic morphological features of three separate, well-defined Potamogeton species. Methods The combination of sequences from maternally inherited cytoplasmic (rpl20-rps12) and biparentally inherited nuclear ribosomal DNA (ITS) was used to identify the exact identity of the putative triple hybrid. Key Results Direct sequencing showed ITS variants of three parental taxa, P. gramineus, P. lucens and P. perfoliatus, whereas chloroplast DNA identified P. perfoliatus as the female parent. A scenario for the rise of the triple hybrid through a fertile binary hybrid P. gramineus × P. lucens crossed with P. perfoliatus is described. Conclusions Even though the triple hybrid is sterile, it possesses an efficient strategy for its existence and became locally successful even in the parental environment, perhaps as a result of heterosis. The population investigated is the only one known of this hybrid, P. × torssanderi, worldwide. Isozyme analysis indicated the colony to be genetically uniform. The plants studied represented a single clone that seems to have persisted at this site for a long time. PMID:17478544

Detection and molecular characterization of Vibrio parahaemolyticus isolated from seafood harvested along the southwest coast of India.

PubMed

Raghunath, Pendru; Acharya, Sadananda; Bhanumathi, Amarbahadur; Karunasagar, Iddya; Karunasagar, Indrani

2008-09-01

The levels of total and tdh(+)Vibrio parahaemolyticus were estimated in 83 seafood samples from southwest coast of India by colony hybridization. Conventional enrichment and isolation technique was also used to study the prevalence. Polymerase chain reaction (PCR) was performed on bacterial cell lyates for detection of total and pathogenic V. parahaemolyticus by amplification of specific genes. Of 83 samples tested, V. parahaemolyticus could be detected in 74 (89.2%) samples and tdh(+)V. parahaemolyticus in 5 (6.0%) samples by colony hybridization. V. parahaemolyticus was detected in 68 (81.9%) of 83 samples after 18 h of enrichment by PCR, and isolated from 63 (75.9%) of 83 samples by conventional isolation. The virulence genes tdh and trh could be detected in 8.4% and 25.3%, respectively, in the sample enrichment broths by PCR. Use of colony hybridization following enrichment to achieve sensitive detection of tdh(+)V. parahaemolyticus in seafood was evaluated using another set of 58 seafood samples. Thirty pathogenic V. parahaemolyticus strains isolated during the study were screened by PCR for genetic markers to be specific for the detection of the pandemic clone. Results of this study suggest that the GS-PCR may serve as a reliable genetic marker for the pandemic clone of V. parahaemolyticus.

Hybrid clone cells derived from human breast epithelial cells and human breast cancer cells exhibit properties of cancer stem/initiating cells.

PubMed

Gauck, Daria; Keil, Silvia; Niggemann, Bernd; Zänker, Kurt S; Dittmar, Thomas

2017-08-02

The biological phenomenon of cell fusion has been associated with cancer progression since it was determined that normal cell × tumor cell fusion-derived hybrid cells could exhibit novel properties, such as enhanced metastatogenic capacity or increased drug resistance, and even as a mechanism that could give rise to cancer stem/initiating cells (CS/ICs). CS/ICs have been proposed as cancer cells that exhibit stem cell properties, including the ability to (re)initiate tumor growth. Five M13HS hybrid clone cells, which originated from spontaneous cell fusion events between M13SV1-EGFP-Neo human breast epithelial cells and HS578T-Hyg human breast cancer cells, and their parental cells were analyzed for expression of stemness and EMT-related marker proteins by Western blot analysis and confocal laser scanning microscopy. The frequency of ALDH1-positive cells was determined by flow cytometry using AldeRed fluorescent dye. Concurrently, the cells' colony forming capabilities as well as the cells' abilities to form mammospheres were investigated. The migratory activity of the cells was analyzed using a 3D collagen matrix migration assay. M13HS hybrid clone cells co-expressed SOX9, SLUG, CK8 and CK14, which were differently expressed in parental cells. A variation in the ALDH1-positive putative stem cell population was observed among the five hybrids ranging from 1.44% (M13HS-7) to 13.68% (M13HS-2). In comparison to the parental cells, all five hybrid clone cells possessed increased but also unique colony formation and mammosphere formation capabilities. M13HS-4 hybrid clone cells exhibited the highest colony formation capacity and second highest mammosphere formation capacity of all hybrids, whereby the mean diameter of the mammospheres was comparable to the parental cells. In contrast, the largest mammospheres originated from the M13HS-2 hybrid clone cells, whereas these cells' mammosphere formation capacity was comparable to the parental breast cancer cells. All M13HS hybrid clones exhibited a mesenchymal phenotype and, with the exception of one hybrid clone, responded to EGF with an increased migratory activity. Fusion of human breast epithelial cells and human breast cancer cells can give rise to hybrid clone cells that possess certain CS/IC properties, suggesting that cell fusion might be a mechanism underlying how tumor cells exhibiting a CS/IC phenotype could originate.

Lutzomyia Longipalpis is a Species Complex: Genetic Divergence and Interspecific Hybrid Sterility Among Three Populations

DTIC Science & Technology

1993-01-01

FUNDING NUMBERS Lutzomyia Longipalpis is a Species Complex:Genetic Divergence and Interspecific Hybrid Sterility Among Three 6. AUTHOR(S) Populations...genus Lutzomyia . Between 7% and 22% of the loci studied were diagnostic for any two of the colony,-populations. Experimental hybridization between...our results to natural populations. 14. SUBJECT TERMS UES 1S. NUMBER Of PAGlE Lutzomyia longipalpis, Leishmania donovani chagasi 16. PRICE CODE 17

Modeling design iteration in product design and development and its solution by a novel artificial bee colony algorithm.

PubMed

Chen, Tinggui; Xiao, Renbin

2014-01-01

Due to fierce market competition, how to improve product quality and reduce development cost determines the core competitiveness of enterprises. However, design iteration generally causes increases of product cost and delays of development time as well, so how to identify and model couplings among tasks in product design and development has become an important issue for enterprises to settle. In this paper, the shortcomings existing in WTM model are discussed and tearing approach as well as inner iteration method is used to complement the classic WTM model. In addition, the ABC algorithm is also introduced to find out the optimal decoupling schemes. In this paper, firstly, tearing approach and inner iteration method are analyzed for solving coupled sets. Secondly, a hybrid iteration model combining these two technologies is set up. Thirdly, a high-performance swarm intelligence algorithm, artificial bee colony, is adopted to realize problem-solving. Finally, an engineering design of a chemical processing system is given in order to verify its reasonability and effectiveness.

Dynamics of change in multiethnic societies: An archaeological perspective from colonial North America.

PubMed

Lightfoot, Kent G

2015-07-28

This Perspective presents an overview of the archaeology of pluralistic colonies (approximately late 1500s-1800s) in North America. It complements the other special feature papers in this issue on ancient societies in Mesoamerica, the Near East, the Armenian Highlands, Peru, and China by presenting another body of literature for examining the dynamics of change in multiethnic societies from a different time and place. In synthesizing archaeological investigations of mercantile, plantation, and missionary colonies, this Perspective shows how this research is relevant to the study of pluralism in both historic and ancient societies in three ways. (i) It enhances our understanding of interethnic relationships that took place in complex societies with imposing political hierarchies and labor structures. (ii) It helps us to refine the methods used by archaeologists to define and analyze multiethnic communities that were spatially delimited by ethnic neighborhoods. Finally, (iii) it presents more than a half century of experimentation with various models (e.g., acculturation, creolization, ethnogenesis, and hybridity) that have been used to study the dynamics of culture change in multiethnic societies.

Dynamics of change in multiethnic societies: An archaeological perspective from colonial North America

PubMed Central

Lightfoot, Kent G.

2015-01-01

This Perspective presents an overview of the archaeology of pluralistic colonies (approximately late 1500s–1800s) in North America. It complements the other special feature papers in this issue on ancient societies in Mesoamerica, the Near East, the Armenian Highlands, Peru, and China by presenting another body of literature for examining the dynamics of change in multiethnic societies from a different time and place. In synthesizing archaeological investigations of mercantile, plantation, and missionary colonies, this Perspective shows how this research is relevant to the study of pluralism in both historic and ancient societies in three ways. (i) It enhances our understanding of interethnic relationships that took place in complex societies with imposing political hierarchies and labor structures. (ii) It helps us to refine the methods used by archaeologists to define and analyze multiethnic communities that were spatially delimited by ethnic neighborhoods. Finally, (iii) it presents more than a half century of experimentation with various models (e.g., acculturation, creolization, ethnogenesis, and hybridity) that have been used to study the dynamics of culture change in multiethnic societies. PMID:25870288

Assembly of ordered contigs of cosmids selected with YACs of human chromosome 13

DOE Office of Scientific and Technical Information (OSTI.GOV)

Fischer, S.G.; Cayanis, E.; Boukhgalter, B.

1994-06-01

The authors have developed an efficient method for assembling ordered cosmid contigs aligned to mega-YACs and midi-YACs (average insert sizes of 1.0 and 0.35 Mb, respectively) and used this general method to initiate high-resolution physical mapping of human chromosome 13 (Chr 13). Chr 13-enriched midi-YAC (mYAC) and mega-YAC (MYAC) sublibraries were obtained from corresponding CEPH total human YAC libraries by selecting colonies with inter-Alu PCR probes derived from Chr 13 monochromosomal cell hybrid DNA. These sublibraries were arrayed on filters at high density. In this approach, the MYAC 13 sublibrary is screened by hybridization with cytogenetically assigned Chr 13 DNAmore » probes to select one or a small subset of MYACs. Inter-Alu PCR products from each mYAC are then hybridized to the MYAC and mYAC sublibraries to identify overlapping YACs and to an arrayed Chr 13-specific cosmid library to select corresponding cosmids. The set of selected cosmids, gridded on filters at high density, is hybridized with inter-Alu PCR products from each of the overlapping YACs to identify subsets of cosmids and also with riboprobes from each cosmid of the arrayed set ({open_quotes}cosmid matrix cross-hybridization{close_quotes}). From these data, cosmid contigs are assembled by a specifically designed computer program. Application of this method generates cosmid contigs spanning the length of a MYAC with few gaps. To provide a high-resolution map, ends of cosmids are sequenced at preselected sites to position densely spaced sequence-tagged sites. 33 refs., 7 figs., 1 tab.« less

Phenol emulsion-enhanced DNA-driven subtractive cDNA cloning: isolation of low-abundance monkey cortex-specific mRNAs.

PubMed Central

Travis, G H; Sutcliffe, J G

1988-01-01

To isolate cDNA clones of low-abundance mRNAs expressed in monkey cerebral cortex but absent from cerebellum, we developed an improved subtractive cDNA cloning procedure that requires only modest quantities of mRNA. Plasmid DNA from a monkey cerebellum cDNA library was hybridized in large excess to radiolabeled monkey cortex cDNA in a phenol emulsion-enhanced reaction. The unhybridized cortex cDNA was isolated by chromatography on hydroxyapatite and used to probe colonies from a monkey cortex cDNA library. Of 60,000 colonies screened, 163 clones were isolated and confirmed by colony hybridization or RNA blotting to represent mRNAs, ranging from 0.001% to 0.1% abundance, specific to or highly enriched in cerebral cortex relative to cerebellum. Clones of one medium-abundance mRNA were recovered almost quantitatively. Two of the lower-abundance mRNAs were expressed at levels reduced by a factor of 10 in Alzheimer disease relative to normal human cortex. One of these was identified as the monkey preprosomatostatin I mRNA. Images PMID:2894033

Brain tissue segmentation in MR images based on a hybrid of MRF and social algorithms.

PubMed

Yousefi, Sahar; Azmi, Reza; Zahedi, Morteza

2012-05-01

Effective abnormality detection and diagnosis in Magnetic Resonance Images (MRIs) requires a robust segmentation strategy. Since manual segmentation is a time-consuming task which engages valuable human resources, automatic MRI segmentations received an enormous amount of attention. For this goal, various techniques have been applied. However, Markov Random Field (MRF) based algorithms have produced reasonable results in noisy images compared to other methods. MRF seeks a label field which minimizes an energy function. The traditional minimization method, simulated annealing (SA), uses Monte Carlo simulation to access the minimum solution with heavy computation burden. For this reason, MRFs are rarely used in real time processing environments. This paper proposed a novel method based on MRF and a hybrid of social algorithms that contain an ant colony optimization (ACO) and a Gossiping algorithm which can be used for segmenting single and multispectral MRIs in real time environments. Combining ACO with the Gossiping algorithm helps find the better path using neighborhood information. Therefore, this interaction causes the algorithm to converge to an optimum solution faster. Several experiments on phantom and real images were performed. Results indicate that the proposed algorithm outperforms the traditional MRF and hybrid of MRF-ACO in speed and accuracy. Copyright © 2012 Elsevier B.V. All rights reserved.

Assessing the transferability of a hybrid Taguchi-objective function method to optimize image segmentation for detecting and counting cave roosting birds using terrestrial laser scanning data

NASA Astrophysics Data System (ADS)

Idrees, Mohammed Oludare; Pradhan, Biswajeet; Buchroithner, Manfred F.; Shafri, Helmi Zulhaidi Mohd; Khairunniza Bejo, Siti

2016-07-01

As far back as early 15th century during the reign of the Ming Dynasty (1368 to 1634 AD), Gomantong cave in Sabah (Malaysia) has been known as one of the largest roosting sites for wrinkle-lipped bats (Chaerephon plicata) and swiftlet birds (Aerodramus maximus and Aerodramus fuciphagus) in very large colonies. Until recently, no study has been done to quantify or estimate the colony sizes of these inhabitants in spite of the grave danger posed to this avifauna by human activities and potential habitat loss to postspeleogenetic processes. This paper evaluates the transferability of a hybrid optimization image analysis-based method developed to detect and count cave roosting birds. The method utilizes high-resolution terrestrial laser scanning intensity image. First, segmentation parameters were optimized by integrating objective function and the statistical Taguchi methods. Thereafter, the optimized parameters were used as input into the segmentation and classification processes using two images selected from Simud Hitam (lower cave) and Simud Putih (upper cave) of the Gomantong cave. The result shows that the method is capable of detecting birds (and bats) from the image for accurate population censusing. A total number of 9998 swiftlet birds were counted from the first image while 1132 comprising of both bats and birds were obtained from the second image. Furthermore, the transferability evaluation yielded overall accuracies of 0.93 and 0.94 (area under receiver operating characteristic curve) for the first and second image, respectively, with p value of <0.0001 at 95% confidence level. The findings indicate that the method is not only efficient for the detection and counting cave birds for which it was developed for but also useful for counting bats; thus, it can be adopted in any cave.

Modeling Design Iteration in Product Design and Development and Its Solution by a Novel Artificial Bee Colony Algorithm

PubMed Central

2014-01-01

Due to fierce market competition, how to improve product quality and reduce development cost determines the core competitiveness of enterprises. However, design iteration generally causes increases of product cost and delays of development time as well, so how to identify and model couplings among tasks in product design and development has become an important issue for enterprises to settle. In this paper, the shortcomings existing in WTM model are discussed and tearing approach as well as inner iteration method is used to complement the classic WTM model. In addition, the ABC algorithm is also introduced to find out the optimal decoupling schemes. In this paper, firstly, tearing approach and inner iteration method are analyzed for solving coupled sets. Secondly, a hybrid iteration model combining these two technologies is set up. Thirdly, a high-performance swarm intelligence algorithm, artificial bee colony, is adopted to realize problem-solving. Finally, an engineering design of a chemical processing system is given in order to verify its reasonability and effectiveness. PMID:25431584

A simple nucleic acid hybridization/latex agglutination assay for the rapid detection of polymerase chain reaction amplicons.

PubMed

Vollenhofer-Schrumpf, Sabine; Buresch, Ronald; Schinkinger, Manfred

2007-03-01

We have developed a new method for the detection of nucleic acid hybridization, based on a simple latex agglutination test that can be evaluated by the unaided eye. Nucleic acid, e.g., a polymerase chain reaction (PCR) product, is denatured and incubated with polystyrene beads carrying covalently bound complementary oligonucleotide sequences. Hybridization of the nucleic acids leads to aggregation of the latex particles, thereby verifying the presence of target sequence. The test is performed at room temperature, and results are available within 10 min. As a proof of principle, the hybridization/latex agglutination assay was applied to the detection of purified PCR fragments either specific for Salmonella spp. or a synthetic sequence, and to the detection of Salmonella enterica in artificially contaminated chicken samples. A few nanograms of purified PCR fragments were detectable. In artificially contaminated chicken samples, 3 colony-forming units (cfu)/25 g were detected in one of three replicates, and 30 cfu/25 g were detected in both of two replicates when samples for PCR were taken directly from primary enrichment, demonstrating the practical applicability of this test system. Even multiplex detection might be achievable. This novel kind of assay could be useful for a range of applications where hybridization of nucleic acids, e.g., PCR fragments, is to be detected.

Spawning and fertility of F1 hybrids of the coral genus Acropora in the Indo-Pacific

NASA Astrophysics Data System (ADS)

Isomura, Naoko; Iwao, Kenji; Morita, Masaya; Fukami, Hironobu

2016-09-01

The role of hybridization through multi-specific synchronous spawning in the evolution of reef-building corals has been discussed since the 1990s, particularly for the genus Acropora. However, F1 hybrids have been reported as common in only one case in the Caribbean, with no evidence of mechanisms that would allow continuous reproduction of the hybrids. In this study, we report for the first time the fecundity of two F1 hybrid colonies produced experimentally from two Indo-Pacific species, A. intermedia and A. florida. These F1 hybrids spawned at the same time as the parental corals. Backcrossing and F1 hybrid crossing were successful in both directions. Furthermore, more than 90% self-fertilization was achieved in an F1 hybrid, although it was negligible in the parental corals. While it is possible that the F1 hybrid was a chimera, these results suggest that some products of interspecific hybridization may persist as the offspring of self-fertilizing F1 hybrids.

Somatic hybridization of sexually incompatible petunias: Petunia parodii, Petunia parviflora.

PubMed

Power, J B; Berry, S F; Chapman, J V; Cocking, E C

1980-01-01

Somatic hybrid plants were regenerated following the fusion of leaf mesophyll protoplasts of P. parodii with those isolated from a nuclear-albino mutant of P. parviflora. Attempts at sexual hybridization of these two species repeatedly failed thus confirming their previously established cross-incompatibility. Selection of somatic hybrid plants was possible since protoplasts of P. parodii would not develop beyond the cell colony stage, whilst those of the somatic hybrid and albino P. parviflora produced calluses. Green somatic hybrid calluses were visible against a background of albino cells/calluses, and upon transfer to regeneration media gave rise to shoots. Shoots and the resultant flowering plants were confirmed as somatic hybrids based on their growth habit, floral pigmentation and morphology, leaf hair structure, chromosome number and Fraction 1 protein profiles. The relevance of such hybrid material for the development of new, and extensively modified cultivars, is discussed.

Seismic-Acoustic Hybrid Sensor & Its Applications

DTIC Science & Technology

2002-02-25

Most evidence shows that termites communicate primarily by secreting chemicals called pheromones . Each colony develops its own characteristic odor...Instrumenting the Wall Plate with the Hybrid Sensor The seismic-acoustic sensor is designed to play a role in the housing industry as a termite detector...Taking advantage of the sensor’s flexibility to mold to its environment, the device is used in its extended mode for termite detection. Which means

Elucidation of Small RNAs that Activate Transcription in Bacteria

DTIC Science & Technology

2012-03-01

bacterial sRNAs that activate transcription of a target gene in E. coli to varying degrees. Mutation of the strongest activator modified its...identified RNA- based transcriptional activators in yeast (Buskirk et al., 2003) although the underlying mechanism was not elucidated. We show that the...previous yeast two-hybrid (Buskirk et al., 2003) and three-hybrid studies (Bernstein et al., 2002). Colonies were observed from co-transformations of pBT

Lessons from the British Defeat Combating Colonial Hybrid Warfare in the 1781 Southern Theater of Operations

DTIC Science & Technology

2014-05-22

Society for Army Historical Research 16, no. 61 (1937): 3-23; Henry Clinton, The Headquarters Papers of the British Army in North America During the War...Rejoinder to ‘Future Threats and Strategic Thinking,” Infinity Journal 2, no. 2 (Spring 2012): 24-29. 19Department of the Army, ADRP 3-0, Unified Land...represented his security zone. The colony provided food for Greene’s army, a staging base for manufactured material and forces from New England, and a

Development and validation of a FISH-based method for the detection and quantification of E. coli and coliform bacteria in water samples.

PubMed

Hügler, Michael; Böckle, Karin; Eberhagen, Ingrid; Thelen, Karin; Beimfohr, Claudia; Hambsch, Beate

2011-01-01

Monitoring of microbiological contaminants in water supplies requires fast and sensitive methods for the specific detection of indicator organisms or pathogens. We developed a protocol for the simultaneous detection of E. coli and coliform bacteria based on the Fluorescence in situ Hybridization (FISH) technology. This protocol consists of two approaches. The first allows the direct detection of single E. coli and coliform bacterial cells on the filter membranes. The second approach includes incubation of the filter membranes on a nutrient agar plate and subsequent detection of the grown micro-colonies. Both approaches were validated using drinking water samples spiked with pure cultures and naturally contaminated water samples. The effects of heat, chlorine and UV disinfection were also investigated. The micro-colony approach yielded very good results for all samples and conditions tested, and thus can be thoroughly recommended for usage as an alternative method to detect E. coli and coliform bacteria in water samples. However, during this study, some limitations became visible for the single cell approach. The method cannot be applied for water samples which have been disinfected by UV irradiation. In addition, our results indicated that green fluorescent dyes are not suitable to be used with chlorine disinfected samples.

Africanization of a feral honey bee (Apis mellifera) population in South Texas: does a decade make a difference?

PubMed

Rangel, Juliana; Giresi, Melissa; Pinto, Maria Alice; Baum, Kristen A; Rubink, William L; Coulson, Robert N; Johnston, John Spencer

2016-04-01

The arrival to the United States of the Africanized honey bee, a hybrid between European subspecies and the African subspecies Apis mellifera scutellata, is a remarkable model for the study of biological invasions. This immigration has created an opportunity to study the dynamics of secondary contact of honey bee subspecies from African and European lineages in a feral population in South Texas. An 11-year survey of this population (1991-2001) showed that mitochondrial haplotype frequencies changed drastically over time from a resident population of eastern and western European maternal ancestry, to a population dominated by the African haplotype. A subsequent study of the nuclear genome showed that the Africanization process included bidirectional gene flow between European and Africanized honey bees, giving rise to a new panmictic mixture of A. m. scutellata- and European-derived genes. In this study, we examined gene flow patterns in the same population 23 years after the first hybridization event occurred. We found 28 active colonies inhabiting 92 tree cavities surveyed in a 5.14 km(2) area, resulting in a colony density of 5.4 colonies/km(2). Of these 28 colonies, 25 were of A. m. scutellata maternal ancestry, and three were of western European maternal ancestry. No colonies of eastern European maternal ancestry were detected, although they were present in the earlier samples. Nuclear DNA revealed little change in the introgression of A. m. scutellata-derived genes into the population compared to previous surveys. Our results suggest this feral population remains an admixed swarm with continued low levels of European ancestry and a greater presence of African-derived mitochondrial genetic composition.

Hybrid Warfare Dilemmas in the Middle Colonies during the American Revolution

DTIC Science & Technology

2017-05-25

Livingston spoke of the fight against the Loyalists in fall of 1777 stating, “A Tory is an incorrigible Animal : And nothing but the extinction of...defensive capabilities in legitimate service to the state or alliance. Training Circular (TC) 7- 100 , Hybrid Threat (Washington, DC: Government Printing...10 TC- 100 , 1-2. 6 the Army as part of a Joint Force presents adversaries with multiple dilemmas to achieve sustainable

Cost- and reliability-oriented aggregation point association in long-term evolution and passive optical network hybrid access infrastructure for smart grid neighborhood area network

NASA Astrophysics Data System (ADS)

Cheng, Xiao; Feng, Lei; Zhou, Fanqin; Wei, Lei; Yu, Peng; Li, Wenjing

2018-02-01

With the rapid development of the smart grid, the data aggregation point (AP) in the neighborhood area network (NAN) is becoming increasingly important for forwarding the information between the home area network and wide area network. Due to limited budget, it is unable to use one-single access technology to meet the ongoing requirements on AP coverage. This paper first introduces the wired and wireless hybrid access network with the integration of long-term evolution (LTE) and passive optical network (PON) system for NAN, which allows a good trade-off among cost, flexibility, and reliability. Then, based on the already existing wireless LTE network, an AP association optimization model is proposed to make the PON serve as many APs as possible, considering both the economic efficiency and network reliability. Moreover, since the features of the constraints and variables of this NP-hard problem, a hybrid intelligent optimization algorithm is proposed, which is achieved by the mixture of the genetic, ant colony and dynamic greedy algorithm. By comparing with other published methods, simulation results verify the performance of the proposed method in improving the AP coverage and the performance of the proposed algorithm in terms of convergence.

A hybrid gene selection approach for microarray data classification using cellular learning automata and ant colony optimization.

PubMed

Vafaee Sharbaf, Fatemeh; Mosafer, Sara; Moattar, Mohammad Hossein

2016-06-01

This paper proposes an approach for gene selection in microarray data. The proposed approach consists of a primary filter approach using Fisher criterion which reduces the initial genes and hence the search space and time complexity. Then, a wrapper approach which is based on cellular learning automata (CLA) optimized with ant colony method (ACO) is used to find the set of features which improve the classification accuracy. CLA is applied due to its capability to learn and model complicated relationships. The selected features from the last phase are evaluated using ROC curve and the most effective while smallest feature subset is determined. The classifiers which are evaluated in the proposed framework are K-nearest neighbor; support vector machine and naïve Bayes. The proposed approach is evaluated on 4 microarray datasets. The evaluations confirm that the proposed approach can find the smallest subset of genes while approaching the maximum accuracy. Copyright © 2016 Elsevier Inc. All rights reserved.

Two hybrid common x roseate terns fledge at Falkner Island, Connecticut

USGS Publications Warehouse

Zingo, James M.; Church, Christopher A.; Spendelow, Jeffrey A.

1994-01-01

Although these two similarly-sized species are sympatric throughout much of their breeding range, there are few published records of hybridization between Roseate (Sterna dougallii) and Common (S. hirundo) Terns. Records include at least five from Europe (Witherby and Ticehurst 1908, Perry 1972, Robbins 1974, Burggraeve 1977, van den Berg 1980) and only one from North America (Hays 1975), but we are aware of several unpublished records of hybridization at colonies in Massachusetts (I. Nisbet, pers. comm.) and New York (J. Burger, pers. comm.). Differences in sexual display probably serve as the principal barrier to hybridization (Palmer 1941 ), and in the northeastem United States where both species breed, Common Terns tend to nest in more open areas while Roseate Terns tend to nest in or under cover (Hays 1975, Nisbet 1981, Spendelow 1982, Burger and Gochfeld 1988).From 1984 through 1993, we recorded several instances of interbreeding in a mixed colony of several thousand Common Terns and a few hundred Roseates at the Falkner Island Unit of the Stewart B. McKinney National Wildlife Refuge. This 2-ha island is located at 41 °13'N and 72° 39'W in Long Island Sound, approximately 5 km off the coast of Guilford, Connecticut. Spendelow (1982) briefly described the island and the areas used by the nesting terns; a more detailed description of the island is in Helander (1988). The mixed pair we observed in 1993 nested in a subcolony of about 25 pairs of Roseates on the southeast section of the island's rocky beach, where we put out 30 boxes to create more protected nest sites for Roseate Terns. Here we present a summary of their successful nesting, which we followed almost daily from several days prior to the laying of the first egg until departure of these birds from the colony site.

Correlation of Particle Traversals with Clonogenic Survival Using Cell-Fluorescent Ion Track Hybrid Detector.

PubMed

Dokic, Ivana; Niklas, Martin; Zimmermann, Ferdinand; Mairani, Andrea; Seidel, Philipp; Krunic, Damir; Jäkel, Oliver; Debus, Jürgen; Greilich, Steffen; Abdollahi, Amir

2015-01-01

Development of novel approaches linking the physical characteristics of particles with biological responses are of high relevance for the field of particle therapy. In radiobiology, the clonogenic survival of cells is considered the gold standard assay for the assessment of cellular sensitivity to ionizing radiation. Toward further development of next generation biodosimeters in particle therapy, cell-fluorescent ion track hybrid detector (Cell-FIT-HD) was recently engineered by our group and successfully employed to study physical particle track information in correlation with irradiation-induced DNA damage in cell nuclei. In this work, we investigated the feasibility of Cell-FIT-HD as a tool to study the effects of clinical beams on cellular clonogenic survival. Tumor cells were grown on the fluorescent nuclear track detector as cell culture, mimicking the standard procedures for clonogenic assay. Cell-FIT-HD was used to detect the spatial distribution of particle tracks within colony-initiating cells. The physical data were associated with radiation-induced foci as surrogates for DNA double-strand breaks, the hallmark of radiation-induced cell lethality. Long-term cell fate was monitored to determine the ability of cells to form colonies. We report the first successful detection of particle traversal within colony-initiating cells at subcellular resolution using Cell-FIT-HD.

Stable chromosomal aberrations in haemopoietic stem cells in the blood of radiation accident victims.

PubMed

Kreja, L; Greulich, K M; Fliedner, T M; Heinze, B

1999-10-01

The detection of long-term persistent chromosome aberrations in circulating haemopoietic stem cells after accidental radiation exposure. Peripheral blood samples from highly exposed persons were collected 7-25 years after the radiation accidents in Moscow (1971), Kazan (1975) and Chernobyl (1996). Haemopoietic blood stem cells were analysed when investigating individual colonies derived from haemopoietic progenitor cells: burst-forming units-erythroid (BFU-E), granulocyte-macrophage-colony-forming cells (GM-CFC) and multipotent granulocyte-erythrocyte-macrophage- megakaryocyte-colony-forming cells (GEMM-CFC). Colony formation was obtained in methylcellulose cultures. Chromosome preparations in single colonies were performed using a microtechnique. Nine patients were investigated at 1 to 4 follow-up time points after radiation exposure. Three hundred and thirty-four single colonies were analyzed resulting in 1375 mitoses. It was found that colonies showed chromosome aberrations (ChA) up to 25 years after radiation exposure by classical cytogenetics and by fluorescence in situ hybridization (FISH). Stable aberrations were detected in 21% of colonies. They were clonal in 19% of colonies, i.e. the same abnormality was found in all cells derived from a single colony. In 2% of colonies ChA were stable but non-clonal; unstable ChA were not observed. The results indicate that blood-derived haemopoietic stem cells may serve as a biological indicator to detect radiation-induced ChA. Since they are considered to be in dynamic and functional exchange with stem cells in the medullary sites of blood cell formation such as bone marrow, the use of blood stem cells as a marker of radiation effects should be explored to assess the repair status of the stem cell pool as such.

Construction and Characterization of Isogenic Series of Saccharomyces cerevisiae Polyploid Strains

PubMed Central

Takagi, Atsuko; Harashima, Satoshi; Oshima, Yasuji

1983-01-01

Tetraploid cells of Saccharomyces cerevisiae are generated spontaneously in a homothallic MATa/MATα diploid population at low frequency (approximately 10−6 per cell) through the homozygosity of mating-type alleles by mitotic recombination followed by homothallic switching of the mating-type alleles. To isolate tetraploid clones more effectively, a selection method was developed that used a dye plate containing 40 mg each of eosin Y and amaranth in synthetic nutrient agar per liter. It was possible to isolate tetraploid clones on the dye plate at a frequency of 1 to 3% among the colonies colored dark red in contrast to the light red of the original diploid colonies. Isogenic series of haploid to tetraploid clones with homozygous or heterozygous genomic configurations were easily constructed with the tetraploid strains. No significant differences in specific growth rate or fermentative rate were observed corresponding to differences in ploidy, although the haploid clones showed a higher frequency of spontaneous respiratory-deficient cells than did the others. However, a significant increment in the fermentative rate in glucose nutrient medium was observed in the hybrid strains constructed with two independent homozygous cell lines. These observations strongly suggest that the polyploid strains favored by the brewing and baking industries perform well not because of the physical increment of the cellular volume by polyploidy but because of the genetic complexity or heterosis by heterozygosity of the genome in the hybrid polyploid cells. Images PMID:16346227

Rail Mounted Gantry Crane Scheduling Optimization in Railway Container Terminal Based on Hybrid Handling Mode

PubMed Central

Zhu, Xiaoning

2014-01-01

Rail mounted gantry crane (RMGC) scheduling is important in reducing makespan of handling operation and improving container handling efficiency. In this paper, we present an RMGC scheduling optimization model, whose objective is to determine an optimization handling sequence in order to minimize RMGC idle load time in handling tasks. An ant colony optimization is proposed to obtain near optimal solutions. Computational experiments on a specific railway container terminal are conducted to illustrate the proposed model and solution algorithm. The results show that the proposed method is effective in reducing the idle load time of RMGC. PMID:25538768

The Home Network: Identity and Materiality in Early Modern and Modern Ulster

NASA Astrophysics Data System (ADS)

Whalen, Kathryn M.

This dissertation looks at three categories of ceramics and the creation of a hybrid culture during the Early Modern and Modern period in Ireland. During these time periods Ireland was a part of the English global colonial enterprises, and was the site of many legal and cultural changes due to its subordinate position in the hierarchy of socio-political and economic phenomenon that characterize the pinnacle of British global power. This study looks to understand how these powers articulated with England's one European colony, Ireland, and if that articulation has similarities to other colonial cultures across time and space. To study the possibility of hybridity between the Irish and English inhabitants of Ireland during the Post-Medieval Period, three categories of ceramics have been analyzed. Fine earthenwares in the form of tablewares and tea sets were macroscopically analyzed for patterns, age, and place of origin. Coarse earthenwares were subjected to X-ray florescence to look for patterns in the spectral data to see if a point of origin could be ascribed to them. And lastly, white ball clay pipe fragments were both macroscopically analyzed for makers' marks and subjected to X-ray florescence to verify their point of origin. The relationship between where these artifacts come from- if they are local productions or imports- and where they were disposed of- either across the landscaper or only associated with households of particular ethnicities- says something about how people negotiate their ethnic identities in colonial settings. As people in Ireland adopt the English style of tea drinking and start to use English mass-produced fine earthenwares, it disrupts the local cottage industry of coarse earthenware manufacturing. What this study seeks to know is if there is a difference in the adoption of English tea drinking, and if the purchasing of certain types of ceramic vessels contributes to the performance of ethnic identity in a colonial setting.

High-Throughput Method for Automated Colony and Cell Counting by Digital Image Analysis Based on Edge Detection

PubMed Central

Choudhry, Priya

2016-01-01

Counting cells and colonies is an integral part of high-throughput screens and quantitative cellular assays. Due to its subjective and time-intensive nature, manual counting has hindered the adoption of cellular assays such as tumor spheroid formation in high-throughput screens. The objective of this study was to develop an automated method for quick and reliable counting of cells and colonies from digital images. For this purpose, I developed an ImageJ macro Cell Colony Edge and a CellProfiler Pipeline Cell Colony Counting, and compared them to other open-source digital methods and manual counts. The ImageJ macro Cell Colony Edge is valuable in counting cells and colonies, and measuring their area, volume, morphology, and intensity. In this study, I demonstrate that Cell Colony Edge is superior to other open-source methods, in speed, accuracy and applicability to diverse cellular assays. It can fulfill the need to automate colony/cell counting in high-throughput screens, colony forming assays, and cellular assays. PMID:26848849

"Unhomely" Academic Developer Identities: More Post-Colonial Explorations

ERIC Educational Resources Information Center

Manathunga, Catherine

2007-01-01

Academic developers are very often disciplinary migrants, performing hybrid, liminal roles at the "fault lines" between teachers and learners, between academics and managers, and between teaching and research. As a result, their identities as scholars can be described as "unhomely." While this in-between space is uncomfortable…

Design and implementation of intelligent electronic warfare decision making algorithm

NASA Astrophysics Data System (ADS)

Peng, Hsin-Hsien; Chen, Chang-Kuo; Hsueh, Chi-Shun

2017-05-01

Electromagnetic signals and the requirements of timely response have been a rapid growth in modern electronic warfare. Although jammers are limited resources, it is possible to achieve the best electronic warfare efficiency by tactical decisions. This paper proposes the intelligent electronic warfare decision support system. In this work, we develop a novel hybrid algorithm, Digital Pheromone Particle Swarm Optimization, based on Particle Swarm Optimization (PSO), Ant Colony Optimization (ACO) and Shuffled Frog Leaping Algorithm (SFLA). We use PSO to solve the problem and combine the concept of pheromones in ACO to accumulate more useful information in spatial solving process and speed up finding the optimal solution. The proposed algorithm finds the optimal solution in reasonable computation time by using the method of matrix conversion in SFLA. The results indicated that jammer allocation was more effective. The system based on the hybrid algorithm provides electronic warfare commanders with critical information to assist commanders in effectively managing the complex electromagnetic battlefield.

PSO/ACO algorithm-based risk assessment of human neural tube defects in Heshun County, China.

PubMed

Liao, Yi Lan; Wang, Jin Feng; Wu, Ji Lei; Wang, Jiao Jiao; Zheng, Xiao Ying

2012-10-01

To develop a new technique for assessing the risk of birth defects, which are a major cause of infant mortality and disability in many parts of the world. The region of interest in this study was Heshun County, the county in China with the highest rate of neural tube defects (NTDs). A hybrid particle swarm optimization/ant colony optimization (PSO/ACO) algorithm was used to quantify the probability of NTDs occurring at villages with no births. The hybrid PSO/ACO algorithm is a form of artificial intelligence adapted for hierarchical classification. It is a powerful technique for modeling complex problems involving impacts of causes. The algorithm was easy to apply, with the accuracy of the results being 69.5%±7.02% at the 95% confidence level. The proposed method is simple to apply, has acceptable fault tolerance, and greatly enhances the accuracy of calculations. Copyright © 2012 The Editorial Board of Biomedical and Environmental Sciences. Published by Elsevier B.V. All rights reserved.

Construction of an 800-kb contig in the near-centromeric region of the rice blast resistance gene Pi-ta2 using a highly representative rice BAC library.

PubMed

Nakamura, S; Asakawa, S; Ohmido, N; Fukui, K; Shimizu, N; Kawasaki, S

1997-05-01

We constructed a rice Bacterial Artificial Chromosome (BAC) library from green leaf protoplasts of the cultivar Shimokita harboring the rice blast resistance gene Pi-ta. The average insert size of 155 kb and the library size of seven genome equivalents make it one of the most comprehensive BAC libraries available, and larger than many plant YAC libraries. The library clones were plated on seven high density membranes of microplate size, enabling efficient colony identification in colony hybridization experiments. Seven percent of clones carried chloroplast DNA. By probing with markers close to the blast resistance genes Pi-ta2(closely linked to Pi-ta) and Pi-b, respectively located in the centromeric region of chromosome 12 and near the telomeric end of chromosome 2, on average 2.2 +/- 1.3 and 8.0 +/- 2.6 BAC clones/marker were isolated. Differences in chromosomal structures may contribute to this wide variation in yield. A contig of about 800 kb, consisting of 19 clones, was constructed in the Pi-ta2 region. This region had a high frequency of repetitive sequences. To circumvent this difficulty, we devised a "two-step walking" method. The contig spanned a 300 kb region between markers located at 0 cM and 0.3 cM from Pi-ta. The ratio of physical to genetic distances (> 1,000 kb/cM) was more than three times larger than the average of rice (300 kb/cM). The low recombination rate and high frequency of repetitive sequences may also be related to the near centromeric character of this region. Fluorescent in situ hybridization (FISH) with a BAC clone from the Pi-b region yielded very clear signals on the long arm of chromosome 2, while a clone from the Pi-ta2 region showed various cross-hybridizing signals near the centromeric regions of all chromosomes.

Modeling and control of operator functional state in a unified framework of fuzzy inference petri nets.

PubMed

Zhang, Jian-Hua; Xia, Jia-Jun; Garibaldi, Jonathan M; Groumpos, Petros P; Wang, Ru-Bin

2017-06-01

In human-machine (HM) hybrid control systems, human operator and machine cooperate to achieve the control objectives. To enhance the overall HM system performance, the discrete manual control task-load by the operator must be dynamically allocated in accordance with continuous-time fluctuation of psychophysiological functional status of the operator, so-called operator functional state (OFS). The behavior of the HM system is hybrid in nature due to the co-existence of discrete task-load (control) variable and continuous operator performance (system output) variable. Petri net is an effective tool for modeling discrete event systems, but for hybrid system involving discrete dynamics, generally Petri net model has to be extended. Instead of using different tools to represent continuous and discrete components of a hybrid system, this paper proposed a method of fuzzy inference Petri nets (FIPN) to represent the HM hybrid system comprising a Mamdani-type fuzzy model of OFS and a logical switching controller in a unified framework, in which the task-load level is dynamically reallocated between the operator and machine based on the model-predicted OFS. Furthermore, this paper used a multi-model approach to predict the operator performance based on three electroencephalographic (EEG) input variables (features) via the Wang-Mendel (WM) fuzzy modeling method. The membership function parameters of fuzzy OFS model for each experimental participant were optimized using artificial bee colony (ABC) evolutionary algorithm. Three performance indices, RMSE, MRE, and EPR, were computed to evaluate the overall modeling accuracy. Experiment data from six participants are analyzed. The results show that the proposed method (FIPN with adaptive task allocation) yields lower breakdown rate (from 14.8% to 3.27%) and higher human performance (from 90.30% to 91.99%). The simulation results of the FIPN-based adaptive HM (AHM) system on six experimental participants demonstrate that the FIPN framework provides an effective way to model and regulate/optimize the OFS in HM hybrid systems composed of continuous-time OFS model and discrete-event switching controller. Copyright © 2017 Elsevier B.V. All rights reserved.

Hybridogenesis through thelytokous parthenogenesis in two Cataglyphis desert ants.

PubMed

Eyer, P A; Leniaud, L; Darras, H; Aron, S

2013-02-01

Hybridogenesis is a sexual reproductive system, whereby parents from different genetic origin hybridize. Both the maternal and paternal genomes are expressed in somatic tissues, but the paternal genome is systematically excluded from the germ line, which is therefore purely maternal. Recently, a unique case of hybridogenesis at a social level was reported in the desert ant Cataglyphis hispanica. All workers are sexually produced hybridogens, whereas sexual forms (new queens and males) are produced by queens through parthenogenesis. Thus, only maternal genes are perpetuated across generations. Here, we show that such an unusual reproductive strategy also evolved in two other species of Cataglyphis belonging to the same phylogenetic group, Cataglyphis velox and Cataglyphis mauritanica. In both species, queens mate exclusively with males originating from a different genetic lineage than their own to produce hybrid workers, while they use parthenogenesis to produce the male and female reproductive castes. In contrast to single-queen colonies of C. hispanica, colonies of C. velox and C. mauritanica are headed by several queens. Most queens within colonies share the same multilocus genotype and never transmit their mates' alleles to the reproductive castes. Social hybridogenesis in the desert ants has direct consequences on the genetic variability of populations and on caste determination. We also discuss the maintenance of this reproductive strategy within the genus Cataglyphis. © 2012 Blackwell Publishing Ltd.

A Winner Determination Algorithm for Combinatorial Auctions Based on Hybrid Artificial Fish Swarm Algorithm

NASA Astrophysics Data System (ADS)

Zheng, Genrang; Lin, ZhengChun

The problem of winner determination in combinatorial auctions is a hotspot electronic business, and a NP hard problem. A Hybrid Artificial Fish Swarm Algorithm(HAFSA), which is combined with First Suite Heuristic Algorithm (FSHA) and Artificial Fish Swarm Algorithm (AFSA), is proposed to solve the problem after probing it base on the theories of AFSA. Experiment results show that the HAFSA is a rapidly and efficient algorithm for The problem of winner determining. Compared with Ant colony Optimization Algorithm, it has a good performance with broad and prosperous application.

English Elsewhere: Glocalization, Assessment and Ethics

ERIC Educational Resources Information Center

Rhedding-Jones, Jeanette

2002-01-01

This paper explores standardized English curriculum practice in a globalizing world. It uses one particular site of formative/summative assessment to show how colonial and modernist trajectories are carried in these times. The argument is that an ethical evaluative practice would allow for local hybridizations. To represent and theorize from a…

Somatic hybrid plants of Nicotiana × sanderae (+) N. debneyi with fungal resistance to Peronospora tabacina

PubMed Central

Patel, Deval; Power, J. Brian; Anthony, Paul; Badakshi, Farah; (Pat) Heslop-Harrison, J. S.; Davey, Michael R.

2011-01-01

Background and Aims The genus Nicotiana includes diploid and tetraploid species, with complementary ecological, agronomic and commercial characteristics. The species are of economic value for tobacco, as ornamentals, and for secondary plant-product biosynthesis. They show substantial differences in disease resistance because of their range of secondary products. In the last decade, sexual hybridization and transgenic technologies have tended to eclipse protoplast fusion for gene transfer. Somatic hybridization was exploited in the present investigation to generate a new hybrid combination involving two sexually incompatible tetraploid species. The somatic hybrid plants were characterized using molecular, molecular cytogenetic and phenotypic approaches. Methods Mesophyll protoplasts of the wild fungus-resistant species N. debneyi (2n = 4x = 48) were electrofused with those of the ornamental interspecific sexual hybrid N. × sanderae (2n = 2x = 18). From 1570 protoplast-derived cell colonies selected manually in five experiments, 580 tissues were sub-cultured to shoot regeneration medium. Regenerated plants were transferred to the glasshouse and screened for their morphology, chromosomal composition and disease resistance. Key Results Eighty-nine regenerated plants flowered; five were confirmed as somatic hybrids by their intermediate morphology compared with parental plants, cytological constitution and DNA-marker analysis. Somatic hybrid plants had chromosome complements of 60 or 62. Chromosomes were identified to parental genomes by genomic in situ hybridization and included all 18 chromosomes from N. × sanderae, and 42 or 44 chromosomes from N. debneyi. Four or six chromosomes of one ancestral genome of N. debneyi were eliminated during culture of electrofusion-treated protoplasts and plant regeneration. Both chloroplasts and mitochondria of the somatic hybrid plants were probably derived from N. debneyi. All somatic hybrid plants were fertile. In contrast to parental plants of N. × sanderae, the seed progeny of somatic hybrid plants were resistant to infection by Peronospora tabacina, a trait introgressed from the wild parent, N. debneyi. Conclusions Sexual incompatibility between N. × sanderae and N. debneyi was circumvented by somatic hybridization involving protoplast fusion. Asymmetrical nuclear hybridity was seen in the hybrids with loss of chromosomes, although importantly, somatic hybrids were fertile and stable. Expression of fungal resistance makes these somatic hybrids extremely valuable germplasm in future breeding programmes in ornamental tobacco. PMID:21880657

Hybrid Pareto artificial bee colony algorithm for multi-objective single machine group scheduling problem with sequence-dependent setup times and learning effects.

PubMed

Yue, Lei; Guan, Zailin; Saif, Ullah; Zhang, Fei; Wang, Hao

2016-01-01

Group scheduling is significant for efficient and cost effective production system. However, there exist setup times between the groups, which require to decrease it by sequencing groups in an efficient way. Current research is focused on a sequence dependent group scheduling problem with an aim to minimize the makespan in addition to minimize the total weighted tardiness simultaneously. In most of the production scheduling problems, the processing time of jobs is assumed as fixed. However, the actual processing time of jobs may be reduced due to "learning effect". The integration of sequence dependent group scheduling problem with learning effects has been rarely considered in literature. Therefore, current research considers a single machine group scheduling problem with sequence dependent setup times and learning effects simultaneously. A novel hybrid Pareto artificial bee colony algorithm (HPABC) with some steps of genetic algorithm is proposed for current problem to get Pareto solutions. Furthermore, five different sizes of test problems (small, small medium, medium, large medium, large) are tested using proposed HPABC. Taguchi method is used to tune the effective parameters of the proposed HPABC for each problem category. The performance of HPABC is compared with three famous multi objective optimization algorithms, improved strength Pareto evolutionary algorithm (SPEA2), non-dominated sorting genetic algorithm II (NSGAII) and particle swarm optimization algorithm (PSO). Results indicate that HPABC outperforms SPEA2, NSGAII and PSO and gives better Pareto optimal solutions in terms of diversity and quality for almost all the instances of the different sizes of problems.

NEW APPLICATIONS OF ADAPTOGENS TO REDUCE RADIATION SIDE EFFECTS.

PubMed

Alekseeva, S N; Antipina, U D; Arzhakova, L I; Protodyakonov, S V

2015-01-01

One of the live medical issues today is to find medication to prevent adverse effects of ionizing radiation on the immune and hematopoietic systems. In Yakutia where in most of its regions the overall environmental situation is getting worse due to the development of natural deposits including radioactive deposits, this problem remains vital. The purpose of this work is to study radioprotective properties of adaptogens in the case of the hematopoietic system under irradiation. The studies were conducted on certain groups of hybrid mice. We used the methods of radiation exposure by a radiological apparatus RUM-25 on hybrid mice followed by studying the cellularity of bone marrow, spleen and thymus. The functional activity of all compartments of early hematopoiesis (bone marrow hematopoiesis) was identified by the exogenous colony forming method. The study found that the extracts of reindeer and moose antlers have a stimulating effect on the functional activity of the hematopoietic precursors in response to radiation. The study medication stimulates regeneration processes in the thymus and bone marrow after irradiation. Further, the adaptogens stimulatory effect on CFU functional activity was identified. The most pronounced effect has the extracts of reindeer antlers "Epsorin".

Colony mapping: A new technique for monitoring crevice-nesting seabirds

USGS Publications Warehouse

Renner, H.M.; Renner, M.; Reynolds, J.H.; Harping, A.M.A.; Jones, I.L.; Irons, D.B.; Byrd, G.V.

2006-01-01

Monitoring populations of auklets and other crevice-nesting seabirds remains problematic, although numerous methods have been attempted since the mid-1960s. Anecdotal evidence suggests several large auklet colonies have recently decreased in both abundance and extent, concurrently with vegetation encroachment and succession. Quantifying changes in the geographical extent of auklet colonies may be a useful alternative to monitoring population size directly. We propose a standardized method for colony mapping using a randomized systematic grid survey with two components: a simple presence/absence survey and an auklet evidence density survey. A quantitative auklet evidence density index was derived from the frequency of droppings and feathers. This new method was used to map the colony on St. George Island in the southeastern Bering Sea and results were compared to previous colony mapping efforts. Auklet presence was detected in 62 of 201 grid cells (each grid cell = 2500 m2) by sampling a randomly placed 16 m2 plot in each cell; estimated colony area = 155 000 m2. The auklet evidence density index varied by two orders of magnitude across the colony and was strongly correlated with means of replicated counts of birds socializing on the colony surface. Quantitatively mapping all large auklet colonies is logistically feasible using this method and would provide an important baseline for monitoring colony status. Regularly monitoring select colonies using this method may be the best means of detecting changes in distribution and population size of crevice-nesting seabirds. ?? The Cooper Ornithological Society 2006.

Experimental Study for Automatic Colony Counting System Based Onimage Processing

NASA Astrophysics Data System (ADS)

Fang, Junlong; Li, Wenzhe; Wang, Guoxin

Colony counting in many colony experiments is detected by manual method at present, therefore it is difficult for man to execute the method quickly and accurately .A new automatic colony counting system was developed. Making use of image-processing technology, a study was made on the feasibility of distinguishing objectively white bacterial colonies from clear plates according to the RGB color theory. An optimal chromatic value was obtained based upon a lot of experiments on the distribution of the chromatic value. It has been proved that the method greatly improves the accuracy and efficiency of the colony counting and the counting result is not affected by using inoculation, shape or size of the colony. It is revealed that automatic detection of colony quantity using image-processing technology could be an effective way.

Thermally adapted design strategy of colonial houses in Surabaya

NASA Astrophysics Data System (ADS)

Antaryama, I. G. N.; Ekasiwi, S. N. N.; Mappajaya, A.; Ulum, M. S.

2018-03-01

Colonial buildings, including houses, have been considered as a representation of climate-responsive architecture. The design was thought to be a hybrid model of Dutch and tropical architecture. It was created by way of reinventing tropical and Dutch architecture design principles, and expressed in a new form, i.e. neither resembling Dutch nor tropical building. Aside from this new image, colonial house does show good climatic responses. Previous researches on colonial house generally focus on qualitative assessment of climate performance of the building. Yet this kind of study tends to concentrate on building elements, e.g. wall, window, etc. The present study is designed to give more complete picture of architecture design strategy of the house by exploring and analysing thermal performance of colonial buildings and their related architecture design strategies. Field measurements are conducted during the dry season in several colonial building in Surabaya. Air temperature and humidity are both taken, representing internal and external thermal conditions of the building. These data are then evaluated to determine thermal performance of the house. Finally, various design strategies are examined in order to reveal their significant contributions to its thermal performance. Results of the study in Surabaya confirm findings of the previous researches that are conducted in other locations, which stated that thermal performance of the house is generally good. Passive design strategies such as mass effect and ventilation play an important role in determining performance of the building.

Improved Ant Colony Clustering Algorithm and Its Performance Study

PubMed Central

Gao, Wei

2016-01-01

Clustering analysis is used in many disciplines and applications; it is an important tool that descriptively identifies homogeneous groups of objects based on attribute values. The ant colony clustering algorithm is a swarm-intelligent method used for clustering problems that is inspired by the behavior of ant colonies that cluster their corpses and sort their larvae. A new abstraction ant colony clustering algorithm using a data combination mechanism is proposed to improve the computational efficiency and accuracy of the ant colony clustering algorithm. The abstraction ant colony clustering algorithm is used to cluster benchmark problems, and its performance is compared with the ant colony clustering algorithm and other methods used in existing literature. Based on similar computational difficulties and complexities, the results show that the abstraction ant colony clustering algorithm produces results that are not only more accurate but also more efficiently determined than the ant colony clustering algorithm and the other methods. Thus, the abstraction ant colony clustering algorithm can be used for efficient multivariate data clustering. PMID:26839533

Spatial arrangement of legionella colonies in intact biofilms from a model cooling water system.

PubMed

Taylor, Michael; Ross, Kirstin; Bentham, Richard

2013-01-01

There is disagreement among microbiologists about whether Legionella requires a protozoan host in order to replicate. This research sought to determine where in biofilm Legionellae are found and whether all biofilm associated Legionella would be located within protozoan hosts. While it is accepted that Legionella colonizes biofilm, its life cycle and nutritional fastidiousness suggest that Legionella employs multiple survival strategies to persist within microbial systems. Fluorescent in situ hybridization (FISH) and confocal laser scanning microscopy (CLSM) demonstrated an undulating biofilm surface architecture and a roughly homogenous distribution of heterotrophic bacteria with clusters of protozoa. Legionella displayed 3 distinct spatial arrangements either contained within or directly associated with protozoa, or dispersed in loosely associated clusters or in tightly packed aggregations of cells forming dense colonial clusters. The formation of discreet clusters of tightly packed Legionella suggests that colony formation is influenced by specific environmental conditions allowing for limited extracellular replication. This work represents the first time that an environmentally representative, multispecies biofilm containing Legionella has been fluorescently tagged and Legionella colony morphology noted within a complex microbial system.

Development of goose- and duck-specific DNA markers to determine sources of Escherichia coli in waterways.

PubMed

Hamilton, Matthew J; Yan, Tao; Sadowsky, Michael J

2006-06-01

The contamination of waterways with fecal material is a persistent threat to public health. Identification of the sources of fecal contamination is a vital component for abatement strategies and for determination of total maximum daily loads. While phenotypic and genotypic techniques have been used to determine potential sources of fecal bacteria in surface waters, most methods require construction of large known-source libraries, and they often fail to adequately differentiate among environmental isolates originating from different animal sources. In this study, we used pooled genomic tester and driver DNAs in suppression subtractive hybridizations to enrich for host source-specific DNA markers for Escherichia coli originating from locally isolated geese. Seven markers were identified. When used as probes in colony hybridization studies, the combined marker DNAs identified 76% of the goose isolates tested and cross-hybridized, on average, with 5% of the human E. coli strains and with less than 10% of the strains obtained from other animal hosts. In addition, the combined probes identified 73% of the duck isolates examined, suggesting that they may be useful for determining the contribution of waterfowl to fecal contamination. However, the hybridization probes reacted mainly with E. coli isolates obtained from geese in the upper midwestern United States, indicating that there is regional specificity of the markers identified. Coupled with high-throughput, automated macro- and microarray screening, these markers may provide a quantitative, cost-effective, and accurate library-independent method for determining the sources of genetically diverse E. coli strains for use in source-tracking studies. However, future efforts to generate DNA markers specific for E. coli must include isolates obtained from geographically diverse animal hosts.

Hybrid Optimization of Object-Based Classification in High-Resolution Images Using Continous ANT Colony Algorithm with Emphasis on Building Detection

NASA Astrophysics Data System (ADS)

Tamimi, E.; Ebadi, H.; Kiani, A.

2017-09-01

Automatic building detection from High Spatial Resolution (HSR) images is one of the most important issues in Remote Sensing (RS). Due to the limited number of spectral bands in HSR images, using other features will lead to improve accuracy. By adding these features, the presence probability of dependent features will be increased, which leads to accuracy reduction. In addition, some parameters should be determined in Support Vector Machine (SVM) classification. Therefore, it is necessary to simultaneously determine classification parameters and select independent features according to image type. Optimization algorithm is an efficient method to solve this problem. On the other hand, pixel-based classification faces several challenges such as producing salt-paper results and high computational time in high dimensional data. Hence, in this paper, a novel method is proposed to optimize object-based SVM classification by applying continuous Ant Colony Optimization (ACO) algorithm. The advantages of the proposed method are relatively high automation level, independency of image scene and type, post processing reduction for building edge reconstruction and accuracy improvement. The proposed method was evaluated by pixel-based SVM and Random Forest (RF) classification in terms of accuracy. In comparison with optimized pixel-based SVM classification, the results showed that the proposed method improved quality factor and overall accuracy by 17% and 10%, respectively. Also, in the proposed method, Kappa coefficient was improved by 6% rather than RF classification. Time processing of the proposed method was relatively low because of unit of image analysis (image object). These showed the superiority of the proposed method in terms of time and accuracy.

An Effective Hybrid Routing Algorithm in WSN: Ant Colony Optimization in combination with Hop Count Minimization.

PubMed

Jiang, Ailian; Zheng, Lihong

2018-03-29

Low cost, high reliability and easy maintenance are key criteria in the design of routing protocols for wireless sensor networks (WSNs). This paper investigates the existing ant colony optimization (ACO)-based WSN routing algorithms and the minimum hop count WSN routing algorithms by reviewing their strengths and weaknesses. We also consider the critical factors of WSNs, such as energy constraint of sensor nodes, network load balancing and dynamic network topology. Then we propose a hybrid routing algorithm that integrates ACO and a minimum hop count scheme. The proposed algorithm is able to find the optimal routing path with minimal total energy consumption and balanced energy consumption on each node. The algorithm has unique superiority in terms of searching for the optimal path, balancing the network load and the network topology maintenance. The WSN model and the proposed algorithm have been implemented using C++. Extensive simulation experimental results have shown that our algorithm outperforms several other WSN routing algorithms on such aspects that include the rate of convergence, the success rate in searching for global optimal solution, and the network lifetime.

An Effective Hybrid Routing Algorithm in WSN: Ant Colony Optimization in combination with Hop Count Minimization

PubMed Central

2018-01-01

Low cost, high reliability and easy maintenance are key criteria in the design of routing protocols for wireless sensor networks (WSNs). This paper investigates the existing ant colony optimization (ACO)-based WSN routing algorithms and the minimum hop count WSN routing algorithms by reviewing their strengths and weaknesses. We also consider the critical factors of WSNs, such as energy constraint of sensor nodes, network load balancing and dynamic network topology. Then we propose a hybrid routing algorithm that integrates ACO and a minimum hop count scheme. The proposed algorithm is able to find the optimal routing path with minimal total energy consumption and balanced energy consumption on each node. The algorithm has unique superiority in terms of searching for the optimal path, balancing the network load and the network topology maintenance. The WSN model and the proposed algorithm have been implemented using C++. Extensive simulation experimental results have shown that our algorithm outperforms several other WSN routing algorithms on such aspects that include the rate of convergence, the success rate in searching for global optimal solution, and the network lifetime. PMID:29596336

A hybrid artificial bee colony algorithm for numerical function optimization

NASA Astrophysics Data System (ADS)

Alqattan, Zakaria N.; Abdullah, Rosni

2015-02-01

Artificial Bee Colony (ABC) algorithm is one of the swarm intelligence algorithms; it has been introduced by Karaboga in 2005. It is a meta-heuristic optimization search algorithm inspired from the intelligent foraging behavior of the honey bees in nature. Its unique search process made it as one of the most competitive algorithm with some other search algorithms in the area of optimization, such as Genetic algorithm (GA) and Particle Swarm Optimization (PSO). However, the ABC performance of the local search process and the bee movement or the solution improvement equation still has some weaknesses. The ABC is good in avoiding trapping at the local optimum but it spends its time searching around unpromising random selected solutions. Inspired by the PSO, we propose a Hybrid Particle-movement ABC algorithm called HPABC, which adapts the particle movement process to improve the exploration of the original ABC algorithm. Numerical benchmark functions were used in order to experimentally test the HPABC algorithm. The results illustrate that the HPABC algorithm can outperform the ABC algorithm in most of the experiments (75% better in accuracy and over 3 times faster).

Decellularized heart valve as a scaffold for in vivo recellularization: deleterious effects of granulocyte colony-stimulating factor.

PubMed

Juthier, Francis; Vincentelli, André; Gaudric, Julien; Corseaux, Delphine; Fouquet, Olivier; Calet, Christine; Le Tourneau, Thierry; Soenen, Valérie; Zawadzki, Christophe; Fabre, Olivier; Susen, Sophie; Prat, Alain; Jude, Brigitte

2006-04-01

Autologous recellularization of decellularized heart valve scaffolds is a promising challenge in the field of tissue-engineered heart valves and could be boosted by bone marrow progenitor cell mobilization. The aim of this study was to examine the spontaneous in vivo recolonization potential of xenogeneic decellularized heart valves in a lamb model and the effects of granulocyte colony-stimulating factor mobilization of bone marrow cells on this process. Decellularized porcine aortic valves were implanted in 12 lambs. Six lambs received granulocyte colony-stimulating factor (10 microg x kg(-1) x d(-1) for 7 days, granulocyte colony-stimulating factor group), and 6 received no granulocyte colony-stimulating factor (control group). Additionally, nondecellularized porcine valves were implanted in 5 lambs (xenograft group). Angiographic and histologic evaluation was performed at 3, 6, 8, and 16 weeks. Few macroscopic modifications of leaflets and the aortic wall were observed in the control group, whereas progressive shrinkage and thickening of the leaflets appeared in the granulocyte colony-stimulating factor and xenograft groups. In the 3 groups progressive ovine cell infiltration (fluorescence in situ hybridization) was observed in the leaflets and in the adventitia and the intima of the aortic wall but not in the media. Neointimal proliferation of alpha-actin-positive cells, inflammatory infiltration, adventitial neovascularization, and calcifications were more important in the xenograft and the granulocyte colony-stimulating factor groups than in the control group. Continuous re-endothelialization appeared only in the control group. Decellularized xenogeneic heart valve scaffolds allowed partial autologous recellularization. Granulocyte colony-stimulating factor led to accelerated heart valve deterioration similar to that observed in nondecellularized xenogeneic cardiac bioprostheses.

Top-down and bottom-up interactions influence fledging success at North America’s largest colony of Caspian terns (Hydroprogne caspia)

USGS Publications Warehouse

Collar, Stefanie; Roby, Daniel D.; Lyons, Donald E.

2017-01-01

Our study investigated the influence of bottom-up and top-down drivers on the declining fledging success at a once thriving breeding colony of Caspian terns (Hydroprogne caspia). Situated at the mouth of the Columbia River, OR, East Sand Island (ESI) is home to the largest Caspian tern breeding colony in North America. Since 2001, the decline in fledging success of Caspian terns at ESI has been associated with a significant increase in average river discharge during May and June. During the years 2001–2011, the abundance of forage fish available to terns in the estuary was inversely related to river discharge. This relationship also apparently affected the reliance of nest predators on the tern colony as a food source, resulting in increased disturbance and decreased fledging success at the tern colony in years of higher river discharge. There was a significant longitudinal increase in disturbance rates by bald eagles (Haliaeetus leucocephalus) during June for terns nesting at the ESI colony, and eagle disturbance rates were positively associated with May river discharge. We also found a significant increase in kleptoparasitism rates of terns by hybrid glaucous-winged/western gulls (Larus glaucescens x Larus occidentalis) since 2001, and Caspian tern fledging success at ESI decreased with increasing average annual rates of gull kleptoparasitism. Our results support the hypothesis that the decline in Caspian tern fledging success at this large estuarine colony was primarily driven by the interaction of bottom-up and top-down factors, influencing tern fledging success through the food supply and triggering potential predators to identify the tern breeding colony as an alternative source of prey.

Real-time PCR quantification of Vibrio parahaemolyticus in oysters using an alternative matrix.

PubMed

Kaufman, G E; Blackstone, G M; Vickery, M C L; Bej, A K; Bowers, J; Bowen, Michael D; Meyer, Richard F; DePaola, A

2004-11-01

This study examined the relationship between levels of total Vibrio parahaemolyticus found in oyster tissues and mantle fluid with the goal of using mantle fluid as a template matrix in a new quantitative real-time PCR assay targeting the thermolabile hemolysin (tlh) gene for the enumeration of total V. parahaemolyticus in oysters. Oysters were collected near Mobile Bay, Ala., in June, July, and September and tested immediately after collection and storage at 26 degrees C for 24 h. Initial experiments using DNA colony hybridization targeting tlh demonstrated that natural V. parahaemolyticus levels in the mantle fluid of individual oysters were strongly correlated (r = 0.85, P < 0.05) with the levels found in their tissues. When known quantities of cultured V. parahaemolyticus cells were added to real-time PCR reactions that contained mantle fluid and oyster tissue matrices separately pooled from multiple oysters, a strong linear correlation was observed between the real-time PCR cycle threshold and the log concentration of cells inoculated into each PCR reaction (mantle fluid: r = 0.98, P < 0.05; and oyster: r = 0.99, P < 0.05). However, the mantle fluid exhibited less inhibition of the PCR amplification than the homogenized oyster tissue. Analysis of natural V. parahaemolyticus populations in mantle fluids using both colony hybridization and real-time PCR demonstrated a significant (P < 0.05) but reduced correlation (r = -0.48) between the two methods. Reductions in the efficiency of the real-time PCR that resulted from low population densities of V. parahaemolyticus and PCR inhibitors present in the mantle fluid of some oysters (with significant oyster-to-oyster variation) contributed to the reduction in correlation between the methods that was observed when testing natural V. parahaemolyticus populations. The V. parahaemolyticus-specific real-time PCR assay used for this study could estimate elevated V. parahaemolyticus levels in oyster mantle fluid within 1 h from sampling time.

A novel approach for dimension reduction of microarray.

PubMed

Aziz, Rabia; Verma, C K; Srivastava, Namita

2017-12-01

This paper proposes a new hybrid search technique for feature (gene) selection (FS) using Independent component analysis (ICA) and Artificial Bee Colony (ABC) called ICA+ABC, to select informative genes based on a Naïve Bayes (NB) algorithm. An important trait of this technique is the optimization of ICA feature vector using ABC. ICA+ABC is a hybrid search algorithm that combines the benefits of extraction approach, to reduce the size of data and wrapper approach, to optimize the reduced feature vectors. This hybrid search technique is facilitated by evaluating the performance of ICA+ABC on six standard gene expression datasets of classification. Extensive experiments were conducted to compare the performance of ICA+ABC with the results obtained from recently published Minimum Redundancy Maximum Relevance (mRMR) +ABC algorithm for NB classifier. Also to check the performance that how ICA+ABC works as feature selection with NB classifier, compared the combination of ICA with popular filter techniques and with other similar bio inspired algorithm such as Genetic Algorithm (GA) and Particle Swarm Optimization (PSO). The result shows that ICA+ABC has a significant ability to generate small subsets of genes from the ICA feature vector, that significantly improve the classification accuracy of NB classifier compared to other previously suggested methods. Copyright © 2017 Elsevier Ltd. All rights reserved.

Deposition of silver nanoparticles on multiwalled carbon nanotubes by chemical reduction process and their antimicrobial effects

NASA Astrophysics Data System (ADS)

Haider, Adawiya J.; Thamir, Amin D.; Ahmed, Duha S.; Mohammad, M. R.

2016-07-01

In this paper, the functionalization of raw-MWCNTs involves oxidation reaction using concentrated acid mixture of HNO3:H2SO4 (1:3), via ultrasonic bath (170 W, 50 kHz) to obtain functional groups. Then Ag nanoparticles are decorated the outside over the surface of functionalized MWCNTs using a chemical reduction process resulting in the formation of(Ag/ MWCNTs) hybrid material. The results showed that outer diameter functionalized F-MWCNTs andAg nanoparticles size was about (11-80) nm and (10 to 25) nm, respectively using TEM and HRTEM. The crystallographic structure of MWCNTs using X-ray diffraction (XRD) analysis proved diffraction peaks at 38.1°, 44.3°, 64.7° and 77.4° degrees namely, Ag (111), Ag (200), Ag (220), and Ag (311) of the face-centered cubic lattice of Ag, respectively, excepting the peak at 2θ =25.6°, which correspond to the (0 0 2) reflection of the MWNTs are corresponding to Ag/MWNTs. The antimicrobial activities of Ag/MWCNTs hybrid using plate count method showed that decreasing a large number of bacteria colonies of E. coli and S. aureu with increasing the hybrid concentrations after incubation for 24h in shaker incubator with percentage of inhibition approaching 100%.

Evaluation of the neotropical stingless bee Melipona quadrifasciata (Hymenoptera: Apidae) as pollinator of greenhouse tomatoes.

PubMed

Del Sarto, M C L; Peruquetti, R C; Campos, L A O

2005-04-01

The Neotropical stingless bee Melipona quadrifasciata Lepeletier was evaluated for pollinating tomatoes (variety Rodas; long-life hybrid) in greenhouses under plastic and with a hydroponic system and "organic concepts" in Minas Gerais State, Brazil. Flowers not pollinated did not set any fruit. Pollination by bees plus manual pollination did not differ from either bee or manual pollination. Maximum fruit diameter, fruit height, and roundness (quotient between maximum fruit diameter and fruit height) were not significantly different between treatments, but fruit visited by M. quadrifasciata had 10.8% less seeds (dry mass) than manual pollination. This apparently low efficiency of M. quadrifasciata pollination was attributed to the overlap of only 30 min between highest bee foraging activity and highest flower stigma receptivity. Thus, it was concluded that M. quadrifasciata is a feasible pollinator of greenhouse tomatoes because of 1) the observed increase in fruit quality with lower mechanical injury than traditional manual pollination, 2) no significant decrease in fruit size, and 3) high price of such product in the market. Some considerations for sustainable use of M. quadrifasciata as greenhouse pollinator are presented. Although techniques for keeping captive colonies of M. quadrifasciata are currently available, the sole current method for acquiring new colonies is removing them from the forest, and if demand was created for large numbers of colonies for commercial use, techniques for captive rearing must be developed to prevent serious declines in wild populations.

Escherichia coli O104 in Feedlot Cattle Feces: Prevalence, Isolation and Characterization.

PubMed

Shridhar, Pragathi B; Noll, Lance W; Shi, Xiaorong; Cernicchiaro, Natalia; Renter, David G; Bai, J; Nagaraja, T G

2016-01-01

Escherichia coli O104:H4, an hybrid pathotype of Shiga toxigenic and enteroaggregative E. coli, involved in a major foodborne outbreak in Germany in 2011, has not been detected in cattle feces. Serogroup O104 with H type other than H4 has been reported to cause human illnesses, but their prevalence and characteristics in cattle have not been reported. Our objectives were to determine the prevalence of E. coli O104 in feces of feedlot cattle, by culture and PCR detection methods, and characterize the isolated strains. Rectal fecal samples from a total of 757 cattle originating from 29 feedlots were collected at a Midwest commercial slaughter plant. Fecal samples, enriched in E. coli broth, were subjected to culture and PCR methods of detection. The culture method involved immunomagnetic separation with O104-specific beads and plating on a selective chromogenic medium, followed by serogroup confirmation of pooled colonies by PCR. If pooled colonies were positive for the wzxO104 gene, then colonies were tested individually to identify wzxO104-positive serogroup and associated genes of the hybrid strains. Extracted DNA from feces were also tested by a multiplex PCR to detect wzxO104-positive serogroup and associated major genes of the O104 hybrid pathotype. Because wzxO104 has been shown to be present in E. coli O8/O9/O9a, wzxO104-positive isolates and extracted DNA from fecal samples were also tested by a PCR targeting wbdDO8/O9/O9a, a gene specific for E. coli O8/O9/O9a serogroups. Model-adjusted prevalence estimates of E. coli O104 (positive for wzxO104 and negative for wbdDO8/O9/O9a) at the feedlot level were 5.7% and 21.2%, and at the sample level were 0.5% and 25.9% by culture and PCR, respectively. The McNemar's test indicated that there was a significant difference (P < 0.01) between the proportions of samples that tested positive for wzxO104 and samples that were positive for wzxO104, but negative for wbdDO8/O9/O9a by PCR and culture methods. A total of 143 isolates, positive for the wzxO104, were obtained in pure culture from 146 positive fecal samples. Ninety-two of the 143 isolates (64.3%) also tested positive for the wbdDO8/O9/O9a, indicating that only 51 (35.7%) isolates truly belonged to the O104 serogroup (positive for wzxO104 and negative for wbdDO8/O9/O9a). All 51 isolates tested negative for eae, and 16 tested positive for stx1 gene of the subtype 1c. Thirteen of the 16 stx1-positive O104 isolates were from one feedlot. The predominant serotype was O104:H7. Pulsed-field gel electrophoresis analysis indicated that stx1-positive O104:H7 isolates had 62.4% homology to the German outbreak strain and 67.9% to 77.5% homology to human diarrheagenic O104:H7 strains. The 13 isolates obtained from the same feedlot were of the same PFGE subtype with 100% Dice similarity. Although cattle do not harbor the O104:H4 pathotype, they do harbor and shed Shiga toxigenic O104 in the feces and the predominant serotype was O104:H7.

English Rustic in Black Skin: Post-Colonial Education, Cultural Hybridity and Racial Identity in the New Century

ERIC Educational Resources Information Center

McCarthy, Cameron

2005-01-01

This article is written against the backdrop of deepening xenophobia and ethnic absolutism (forms of "racial cruelty") that have come to dominate human relations between individuals and groups worldwide in the new millennium. Cameron McCarthy argues that these tendencies towards ethnic absolutism and ethnic essentialism have their counterparts in…

Investigating Identity, Ambivalence, Hybridity: A Bhabhaian Reading of J. M. Coetzee's "Foe" and "Disgrace"

ERIC Educational Resources Information Center

Mostafaee, Jalal

2016-01-01

The present paper seeks to investigate J.M. Coetzee's "Foe" and "Disgrace" in terms of Homi K. Bhabha's concept of Identities/Subjectivities. Homi K. Bhabha is one of the most important contemporary figure in postcolonial studies; he argues that ambivalence is existed at the site of colonial dominance. He argues that…

Real-Time PCR Analysis of Vibrio vulnificus from Oysters

PubMed Central

Campbell, Mark S.; Wright, Anita C.

2003-01-01

Vibrio vulnificus is an opportunistic human pathogen commonly found in estuarine environments. Infections are associated with raw oyster consumption and can produce rapidly fatal septicemia in susceptible individuals. Standard enumeration of this organism in shellfish or seawater is laborious and inaccurate; therefore, more efficient assays are needed. An oligonucleotide probe derived from the cytolysin gene, vvhA, was previously used for colony hybridizations to enumerate V. vulnificus. However, this method requires overnight growth, and vibrios may lack culturability under certain conditions. In the present study, we targeted the same locus for development of a TaqMan real-time PCR assay. Probe specificity was confirmed by amplification of 28 V. vulnificus templates and by the lack of a PCR product with 22 non-V. vulnificus strains. Detection of V. vulnificus in pure cultures was observed over a 6-log-unit linear range of concentration (102 to 108 CFU ml−1), with a lower limit of 72 fg of genomic DNA μl of PCR mixture−1 or the equivalent of six cells. Similar sensitivity was observed in DNA extracted from mixtures of V. vulnificus and V. parahaemolyticus cells. Real-time PCR enumeration of artificially inoculated oyster homogenates correlated well with colony hybridization counts (r2 = 0.97). Numbers of indigenous V. vulnificus cells in oysters by real-time PCR showed no significant differences from numbers from plate counts with probe (t test; P = 0.43). Viable but nonculturable cells were also enumerated by real-time PCR and confirmed by the BacLight viability assay. These data indicate that real-time PCR can provide sensitive species-specific detection and enumeration of V. vulnificus in seafood. PMID:14660359

Sequences characterization of microsatellite DNA sequences in Pacific abalone ( Haliotis discus hannai)

NASA Astrophysics Data System (ADS)

Li, Qi; Akihiro, Kijima

2007-01-01

The microsatellite-enriched library was constructed using magnetic bead hybridization selection method, and the microsatellite DNA sequences were analyzed in Pacific abalone Haliotis discus hannai. Three hundred and fifty white colonies were screened using PCR-based technique, and 84 clones were identified to potentially contain microsatellite repeat motif. The 84 clones were sequenced, and 42 microsatellites and 4 minisatellites with a minimum of five repeats were found (13.1% of white colonies screened). Besides the motif of CA contained in the oligoprobe, we also found other 16 types of microsatellite repeats including a dinucleotide repeat, two tetranucleotide repeats, twelve pentanucleotide repeats and a hexanucleotide repeat. According to Weber (1990), the microsatellite sequences obtained could be categorized structurally into perfect repeats (73.3%), imperfect repeats (13.3%), and compound repeats (13.4%). Among the microsatellite repeats, relatively short arrays (<20 repeats) were most abundant, accounting for 75.0%. The largest length of microsatellites was 48 repeats, and the average number of repeats was 13.4. The data on the composition and length distribution of microsatellites obtained in the present study can be useful for choosing the repeat motifs for microsatellite isolation in other abalone species.

Evaluation of DNA colony hybridization and other techniques for detection of virulence in Yersinia species.

PubMed Central

Robins-Browne, R M; Miliotis, M D; Cianciosi, S; Miller, V L; Falkow, S; Morris, J G

1989-01-01

The virulence of yersiniae varies according to (i) species and biotype and (ii) possession of a 67- to 72-kilobase virulence plasmid. Y. pestis, Y. pseudotuberculosis, and biotypes 1B, 2, 3, 4, and 5 of Y. enterocolitica are inherently virulent but express full virulence only when in possession of a virulence plasmid. Other Yersinia species and biotypes 1A and 3B of Y. enterocolitica are seldom implicated in disease. In this study, we prepared DNA probes from eight nonoverlapping regions of the virulence plasmid of a strain of Y. enterocolitica and from the inv and ail chromosomal loci responsible for the invasive capacity of Y. enterocolitica and Y. pseudotuberculosis. The probes were used in colony hybridization experiments to investigate 156 yersiniae of various species and biotypes and of differing virulence. Probes prepared from the inv gene of Y. pseudotuberculosis hybridized with Y. pseudotuberculosis and Y. pestis only, whereas an analogous probe prepared from Y. enterocolitica hybridized with all species and biotypes of yersiniae (but not with other bacteria) regardless of virulence or potential virulence. Probes prepared from the ail region of Y. enterocolitica reacted almost exclusively with Y. enterocolitica strains of pathogenic biotypes. Probes prepared from the virulence plasmid of a serogroup O:8, biotype 1B isolate of Y. enterocolitica identified virulent yersiniae in all species with a high degree of sensitivity and specificity. These probes did not react with yersiniae of avirulent biotypes or species. Of the other assays of virulence evaluated (calcium dependence, binding of crystal violet, and pyrazinamidase activity), binding of crystal violet provided a simple means for identifying plasmid-bearing strains. Images PMID:2723033

The modification of hybrid method of ant colony optimization, particle swarm optimization and 3-OPT algorithm in traveling salesman problem

NASA Astrophysics Data System (ADS)

Hertono, G. F.; Ubadah; Handari, B. D.

2018-03-01

The traveling salesman problem (TSP) is a famous problem in finding the shortest tour to visit every vertex exactly once, except the first vertex, given a set of vertices. This paper discusses three modification methods to solve TSP by combining Ant Colony Optimization (ACO), Particle Swarm Optimization (PSO) and 3-Opt Algorithm. The ACO is used to find the solution of TSP, in which the PSO is implemented to find the best value of parameters α and β that are used in ACO.In order to reduce the total of tour length from the feasible solution obtained by ACO, then the 3-Opt will be used. In the first modification, the 3-Opt is used to reduce the total tour length from the feasible solutions obtained at each iteration, meanwhile, as the second modification, 3-Opt is used to reduce the total tour length from the entire solution obtained at every iteration. In the third modification, 3-Opt is used to reduce the total tour length from different solutions obtained at each iteration. Results are tested using 6 benchmark problems taken from TSPLIB by calculating the relative error to the best known solution as well as the running time. Among those modifications, only the second and third modification give satisfactory results except the second one needs more execution time compare to the third modifications.

Discrimination of clostridium species using a magnetic bead based hybridization assay

NASA Astrophysics Data System (ADS)

Pahlow, Susanne; Seise, Barbara; Pollok, Sibyll; Seyboldt, Christian; Weber, Karina; Popp, Jürgen

2014-05-01

Clostridium chauvoei is the causative agent of blackleg, which is an endogenous bacterial infection. Mainly cattle and other ruminants are affected. The symptoms of blackleg are very similar to those of malignant edema, an infection caused by Clostridium septicum. [1, 2] Therefore a reliable differentiation of Clostridium chauvoei from other Clostridium species is required. Traditional microbiological detection methods are time consuming and laborious. Additionally, the unique identification is hindered by the overgrowing tendency of swarming Clostridium septicum colonies when both species are present. [1, 3, 4] Thus, there is a crucial need to improve and simplify the specific detection of Clostridium chauvoei and Clostridium septicum. Here we present an easy and fast Clostridium species discrimination method combining magnetic beads and fluorescence spectroscopy. Functionalized magnetic particles exhibit plentiful advantages, like their simple manipulation in combination with a large binding capacity of biomolecules. A specific region of the pathogenic DNA is amplified and labelled with biotin by polymerase chain reaction (PCR). These PCR products were then immobilized on magnetic beads exploiting the strong biotin-streptavidin interaction. The specific detection of different Clostridium species is achieved by using fluorescence dye labeled probe DNA for the hybridization with the immobilized PCR products. Finally, the samples were investigated by fluorescence spectroscopy. [5

Differential Gene Expression at Coral Settlement and Metamorphosis - A Subtractive Hybridization Study

PubMed Central

Hayward, David C.; Hetherington, Suzannah; Behm, Carolyn A.; Grasso, Lauretta C.; Forêt, Sylvain; Miller, David J.; Ball, Eldon E.

2011-01-01

Background A successful metamorphosis from a planktonic larva to a settled polyp, which under favorable conditions will establish a future colony, is critical for the survival of corals. However, in contrast to the situation in other animals, e.g., frogs and insects, little is known about the molecular basis of coral metamorphosis. We have begun to redress this situation with previous microarray studies, but there is still a great deal to learn. In the present paper we have utilized a different technology, subtractive hybridization, to characterize genes differentially expressed across this developmental transition and to compare the success of this method to microarray. Methodology/Principal Findings Suppressive subtractive hybridization (SSH) was used to identify two pools of transcripts from the coral, Acropora millepora. One is enriched for transcripts expressed at higher levels at the pre-settlement stage, and the other for transcripts expressed at higher levels at the post-settlement stage. Virtual northern blots were used to demonstrate the efficacy of the subtractive hybridization technique. Both pools contain transcripts coding for proteins in various functional classes but transcriptional regulatory proteins were represented more frequently in the post-settlement pool. Approximately 18% of the transcripts showed no significant similarity to any other sequence on the public databases. Transcripts of particular interest were further characterized by in situ hybridization, which showed that many are regulated spatially as well as temporally. Notably, many transcripts exhibit axially restricted expression patterns that correlate with the pool from which they were isolated. Several transcripts are expressed in patterns consistent with a role in calcification. Conclusions We have characterized over 200 transcripts that are differentially expressed between the planula larva and post-settlement polyp of the coral, Acropora millepora. Sequence, putative function, and in some cases temporal and spatial expression are reported. PMID:22065994

On the Effectiveness of Nature-Inspired Metaheuristic Algorithms for Performing Phase Equilibrium Thermodynamic Calculations

PubMed Central

Fateen, Seif-Eddeen K.; Bonilla-Petriciolet, Adrian

2014-01-01

The search for reliable and efficient global optimization algorithms for solving phase stability and phase equilibrium problems in applied thermodynamics is an ongoing area of research. In this study, we evaluated and compared the reliability and efficiency of eight selected nature-inspired metaheuristic algorithms for solving difficult phase stability and phase equilibrium problems. These algorithms are the cuckoo search (CS), intelligent firefly (IFA), bat (BA), artificial bee colony (ABC), MAKHA, a hybrid between monkey algorithm and krill herd algorithm, covariance matrix adaptation evolution strategy (CMAES), magnetic charged system search (MCSS), and bare bones particle swarm optimization (BBPSO). The results clearly showed that CS is the most reliable of all methods as it successfully solved all thermodynamic problems tested in this study. CS proved to be a promising nature-inspired optimization method to perform applied thermodynamic calculations for process design. PMID:24967430

On the effectiveness of nature-inspired metaheuristic algorithms for performing phase equilibrium thermodynamic calculations.

PubMed

Fateen, Seif-Eddeen K; Bonilla-Petriciolet, Adrian

2014-01-01

The search for reliable and efficient global optimization algorithms for solving phase stability and phase equilibrium problems in applied thermodynamics is an ongoing area of research. In this study, we evaluated and compared the reliability and efficiency of eight selected nature-inspired metaheuristic algorithms for solving difficult phase stability and phase equilibrium problems. These algorithms are the cuckoo search (CS), intelligent firefly (IFA), bat (BA), artificial bee colony (ABC), MAKHA, a hybrid between monkey algorithm and krill herd algorithm, covariance matrix adaptation evolution strategy (CMAES), magnetic charged system search (MCSS), and bare bones particle swarm optimization (BBPSO). The results clearly showed that CS is the most reliable of all methods as it successfully solved all thermodynamic problems tested in this study. CS proved to be a promising nature-inspired optimization method to perform applied thermodynamic calculations for process design.

Protein Tertiary Structure Prediction Based on Main Chain Angle Using a Hybrid Bees Colony Optimization Algorithm

NASA Astrophysics Data System (ADS)

Mahmood, Zakaria N.; Mahmuddin, Massudi; Mahmood, Mohammed Nooraldeen

Encoding proteins of amino acid sequence to predict classified into their respective families and subfamilies is important research area. However for a given protein, knowing the exact action whether hormonal, enzymatic, transmembranal or nuclear receptors does not depend solely on amino acid sequence but on the way the amino acid thread folds as well. This study provides a prototype system that able to predict a protein tertiary structure. Several methods are used to develop and evaluate the system to produce better accuracy in protein 3D structure prediction. The Bees Optimization algorithm which inspired from the honey bees food foraging method, is used in the searching phase. In this study, the experiment is conducted on short sequence proteins that have been used by the previous researches using well-known tools. The proposed approach shows a promising result.

A novel alphaproteobacterial ectosymbiont promotes the growth of the hydrocarbon-rich green alga Botryococcus braunii

PubMed Central

Tanabe, Yuuhiko; Okazaki, Yusuke; Yoshida, Masaki; Matsuura, Hiroshi; Kai, Atsushi; Shiratori, Takashi; Ishida, Ken-ichiro; Nakano, Shin-ichi; Watanabe, Makoto M.

2015-01-01

Botryococcus braunii is a colony-forming green alga that accumulates large amounts of liquid hydrocarbons within the colony. The utilization of B. braunii for biofuel production is however hindered by its low biomass productivity. Here we describe a novel bacterial ectosymbiont (BOTRYCO-2) that confers higher biomass productivity to B. braunii. 16S rDNA analysis indicated that the sequence of BOTRYCO-2 shows low similarity (<90%) to cultured bacterial species and located BOTRYCO-2 within a phylogenetic lineage consisting of uncultured alphaproteobacterial clones. Fluorescence in situ hybridization (FISH) studies and transmission electric microscopy indicated that BOTRYCO-2 is closely associated with B. braunii colonies. Interestingly, FISH analysis of a water bloom sample also found BOTRYCO-2 bacteria in close association with cyanobacterium Microcystis aeruginosa colonies, suggesting that BOTRYCO-2 relatives have high affinity to phytoplankton colonies. A PCR survey of algal bloom samples revealed that the BOTRYCO-2 lineage is commonly found in Microcystis associated blooms. Growth experiments indicated that B. braunii Ba10 can grow faster and has a higher biomass (1.8-fold) and hydrocarbon (1.5-fold) yield in the presence of BOTRYCO-2. Additionally, BOTRYCO-2 conferred a higher biomass yield to BOT-22, one of the fastest growing strains of B. braunii. We propose the species name ‘Candidatus Phycosocius bacilliformis’ for BOTRYCO-2. PMID:26130609

Gnrh mRNA expression in the brain of cooperatively breeding female Damaraland mole-rats.

PubMed

Voigt, Cornelia; Bennett, Nigel C

2017-04-01

The Damaraland mole-rat ( Fukomys damarensis ) is a eusocial, subterranean rodent, in which breeding is limited to a single reproductive pair within each colony. Non-reproductive females, while in the confines of the colony, exhibit socially induced infertility. Anovulation is thought to be caused by a disruption in the normal gonadotropin-releasing hormone (GNRH) secretion from the hypothalamus. To assess whether social suppression is associated with altered Gnrh mRNA expression in the brain, we investigated the distribution and gene expression levels by means of in situ hybridization in female breeders and non-breeders from field captured colonies of the Damaraland mole-rat. We found expression of Gnrh mRNA as a loose network in several forebrain areas of female Damaraland mole-rats with the majority of labelling in the preoptic and anterior hypothalamus. The distribution matched previous findings using immunocytochemistry in this and other social mole-rat species. Quantification of the hybridisation signal revealed no difference between breeding and non-breeding females in the average optical density of the hybridization signal and the size of the total area covered by Gnrh mRNA. However, analysis along the rostro-caudal axis revealed significantly elevated Gnrh mRNA expression in the rostral preoptic region of breeders compared to non-breeders, whereas the latter had increased Gnrh mRNA expression at the caudal level of the anterior hypothalamus. This study indicates that social suppression affects the expression of Gnrh mRNA in female Damaraland mole-rats. Furthermore, differential regulation occurs within different neuron subpopulations. © 2017 Society for Reproduction and Fertility.

Exploitation of a high genomic mutation rate in Solenopsis invicta virus 1 to infer demographic information about its host, Solenopsis invicta

USDA-ARS?s Scientific Manuscript database

The RNA-dependent RNA polymerase (RdRp) region of Solenopsis invicta virus 1 (SINV-1) was sequenced from 47 infected colonies of S. invicta, S. richteri, S. geminata, and S. invicta/ richteri hybrids collected from across the USA, northern Argentina, and northern Taiwan in an attempt to infer demogr...

"Enactment of Sámi Past in School Textbooks: Towards Multiple Pasts for Future Making"

ERIC Educational Resources Information Center

Ekeland, Torun Granstrøm

2017-01-01

The article examines the use of archaeological knowledge in elementary history textbooks used in Norwegian schools today. The aim is to determine whether we can find any traces of colonialism by reviewing how these narratives perform in interrelations within and between the Sámi and Norse pasts, and how the narratives allow for hybridity and…

Division of Labor in Colonies of the Eusocial Wasp, Mischocyttarus consimilis

PubMed Central

Torres, Viviana O.; Montagna, Thiago S.; Raizer, Josué; Antonialli-Junior, William F.

2012-01-01

The division of labor between castes and the division of labor in workers according to age (temporal polyethism) in social wasps are crucial for maintaining social organization. This study evaluated the division of labor between castes, and the temporal polyethism in workers of Mischocyttarus consimilis Zikán (Hymenoptera: Vespidae). To describe the behavioral repertory of this species, observations were made of 21 colonies, with 100 hours of observations. In order to observe temporal polyethism, each newly emerged wasp was marked with colored dots on the upper area of the thorax. This allowed the observation of behavioral acts performed by each worker from the time of emergence to its death. Through hybrid multidimensional scaling, a clear division between queens and workers could be identified, in which the behaviors of physical dominance and food solicitation characterized the queen caste; while behaviors such as adult—adult trophallaxis, destruction of cells, alarm, foraging for prey, foraging for nectar, and unsuccessful foraging characterized the worker caste. Hybrid multidimensional scaling characterized two groups, with intra—nest activities preferentially accomplished by younger workers, while extra—nest activities such as foraging were executed more frequently by older workers. PMID:22954231

Portable evanescent wave fiber biosensor for highly sensitive detection of Shigella

NASA Astrophysics Data System (ADS)

Xiao, Rui; Rong, Zhen; Long, Feng; Liu, Qiqi

2014-11-01

A portable evanescent wave fiber biosensor was developed to achieve the rapid and highly sensitive detection of Shigella. In this study, a DNA probe was covalently immobilized onto fiber-optic biosensors that can hybridize with a fluorescently labeled complementary DNA. The sensitivity of detection for synthesized oligonucleotides can reach 10-10 M. The surface of the sensor can be regenerated with 0.5% sodium dodecyl sulfate solution (pH 1.9) for over 30 times without significant deterioration of performance. The total analysis time for a single sample, including the time for measurement and surface regeneration, was less than 6 min. We employed real-time polymerase chain reaction (PCR) and compared the results of both methods to investigate the actual Shigella DNA detection capability of the fiber-optic biosensor. The fiber-optic biosensor could detect as low as 102 colony-forming unit/mL Shigella. This finding was comparable with that by real-time PCR, which suggests that this method is a potential alternative to existing detection methods.

Deposition of silver nanoparticles on multiwalled carbon nanotubes by chemical reduction process and their antimicrobial effects

DOE Office of Scientific and Technical Information (OSTI.GOV)

Haider, Adawiya J., E-mail: adawiyahaider@yahoo.com; Thamir, Amin D.; Ahmed, Duha S.

In this paper, the functionalization of raw-MWCNTs involves oxidation reaction using concentrated acid mixture of HNO{sub 3}:H{sub 2}SO{sub 4} (1:3), via ultrasonic bath (170 W, 50 kHz) to obtain functional groups. Then Ag nanoparticles are decorated the outside over the surface of functionalized MWCNTs using a chemical reduction process resulting in the formation of(Ag/ MWCNTs) hybrid material. The results showed that outer diameter functionalized F-MWCNTs andAg nanoparticles size was about (11-80) nm and (10 to 25) nm, respectively using TEM and HRTEM. The crystallographic structure of MWCNTs using X-ray diffraction (XRD) analysis proved diffraction peaks at 38.1°, 44.3°, 64.7° andmore » 77.4° degrees namely, Ag (111), Ag (200), Ag (220), and Ag (311) of the face-centered cubic lattice of Ag, respectively, excepting the peak at 2θ =25.6°, which correspond to the (0 0 2) reflection of the MWNTs are corresponding to Ag/MWNTs. The antimicrobial activities of Ag/MWCNTs hybrid using plate count method showed that decreasing a large number of bacteria colonies of E. coli and S. aureu with increasing the hybrid concentrations after incubation for 24 h in shaker incubator with percentage of inhibition approaching 100%.« less

A Rapid and Efficient Screening Method for Antibacterial Compound-Producing Bacteria.

PubMed

Hettiarachchi, Sachithra; Lee, Su-Jin; Lee, Youngdeuk; Kwon, Young-Kyung; De Zoysa, Mahanama; Moon, Song; Jo, Eunyoung; Kim, Taeho; Kang, Do-Hyung; Heo, Soo-Jin; Oh, Chulhong

2017-08-28

Antibacterial compounds are widely used in the treatment of human and animal diseases. The overuse of antibiotics has led to a rapid rise in the prevalence of drug-resistant bacteria, making the development of new antibacterial compounds essential. This study focused on developing a fast and easy method for identifying marine bacteria that produce antibiotic compounds. Eight randomly selected marine target bacterial species ( Agrococcus terreus, Bacillus algicola, Mesoflavibacter zeaxanthinifaciens, Pseudoalteromonas flavipulchra, P. peptidolytica, P. piscicida, P. rubra , and Zunongwangia atlantica ) were tested for production of antibacterial compounds against four strains of test bacteria ( B. cereus, B. subtilis, Halomonas smyrnensis , and Vibrio alginolyticus ). Colony picking was used as the primary screening method. Clear zones were observed around colonies of P. flavipulchra, P. peptidolytica, P. piscicida , and P. rubra tested against B. cereus, B. subtilis , and H. smyrnensis . The efficiency of colony scraping and broth culture methods for antimicrobial compound extraction was also compared using a disk diffusion assay. P. peptidolytica, P. piscicida , and P. rubra showed antagonistic activity against H. smyrnensis, B. cereus , and B. subtilis , respectively, only in the colony scraping method. Our results show that colony picking and colony scraping are effective, quick, and easy methods of screening for antibacterial compound-producing bacteria.

Optimizing Robinson Operator with Ant Colony Optimization As a Digital Image Edge Detection Method

NASA Astrophysics Data System (ADS)

Yanti Nasution, Tarida; Zarlis, Muhammad; K. M Nasution, Mahyuddin

2017-12-01

Edge detection serves to identify the boundaries of an object against a background of mutual overlap. One of the classic method for edge detection is operator Robinson. Operator Robinson produces a thin, not assertive and grey line edge. To overcome these deficiencies, the proposed improvements to edge detection method with the approach graph with Ant Colony Optimization algorithm. The repairs may be performed are thicken the edge and connect the edges cut off. Edge detection research aims to do optimization of operator Robinson with Ant Colony Optimization then compare the output and generated the inferred extent of Ant Colony Optimization can improve result of edge detection that has not been optimized and improve the accuracy of the results of Robinson edge detection. The parameters used in performance measurement of edge detection are morphology of the resulting edge line, MSE and PSNR. The result showed that Robinson and Ant Colony Optimization method produces images with a more assertive and thick edge. Ant Colony Optimization method is able to be used as a method for optimizing operator Robinson by improving the image result of Robinson detection average 16.77 % than classic Robinson result.

Construction of high-density bacterial colony arrays and patterns by the ink-jet method.

PubMed

Xu, Tao; Petridou, Sevastioni; Lee, Eric H; Roth, Elizabeth A; Vyavahare, Narendra R; Hickman, James J; Boland, Thomas

2004-01-05

We have developed a method for fabricating bacterial colony arrays and complex patterns using commercially available ink-jet printers. Bacterial colony arrays with a density of 100 colonies/cm(2) were obtained by directly ejecting Escherichia coli (E. coli) onto agar-coated substrates at a rapid arraying speed of 880 spots per second. Adjusting the concentration of bacterial suspensions allowed single colonies of viable bacteria to be obtained. In addition, complex patterns of viable bacteria as well as bacteria density gradients were constructed using desktop printers controlled by a simple software program. Copyright 2003 Wiley Periodicals, Inc.

Methods and measurement variance for field estimations of coral colony planar area using underwater photographs and semi-automated image segmentation.

PubMed

Neal, Benjamin P; Lin, Tsung-Han; Winter, Rivah N; Treibitz, Tali; Beijbom, Oscar; Kriegman, David; Kline, David I; Greg Mitchell, B

2015-08-01

Size and growth rates for individual colonies are some of the most essential descriptive parameters for understanding coral communities, which are currently experiencing worldwide declines in health and extent. Accurately measuring coral colony size and changes over multiple years can reveal demographic, growth, or mortality patterns often not apparent from short-term observations and can expose environmental stress responses that may take years to manifest. Describing community size structure can reveal population dynamics patterns, such as periods of failed recruitment or patterns of colony fission, which have implications for the future sustainability of these ecosystems. However, rapidly and non-invasively measuring coral colony sizes in situ remains a difficult task, as three-dimensional underwater digital reconstruction methods are currently not practical for large numbers of colonies. Two-dimensional (2D) planar area measurements from projection of underwater photographs are a practical size proxy, although this method presents operational difficulties in obtaining well-controlled photographs in the highly rugose environment of the coral reef, and requires extensive time for image processing. Here, we present and test the measurement variance for a method of making rapid planar area estimates of small to medium-sized coral colonies using a lightweight monopod image-framing system and a custom semi-automated image segmentation analysis program. This method demonstrated a coefficient of variation of 2.26% for repeated measurements in realistic ocean conditions, a level of error appropriate for rapid, inexpensive field studies of coral size structure, inferring change in colony size over time, or measuring bleaching or disease extent of large numbers of individual colonies.

Identification of Prostate Cancer Prognostic Markers

DTIC Science & Technology

2015-10-01

downregulation of GABARAPL2, a gene located in a chromosomal region deleted in PCa metastases, showed increase in autophagy in a PCa cell line and reduced...alteration, chromosome gain and deletion, fluorescence in situ hybridization (FISH), prognostic markers, biomarkers, tissue microarrays, autophagy 16...TMA), colony formation assay, cell growth, autophagy . 3. ACCOMPLISHMENTS: What were the major goals of the project? The hypothesis of the project is

To increase size or decrease density? Different Microcystis species has different choice to form blooms.

PubMed

Li, Ming; Zhu, Wei; Guo, Lili; Hu, Jing; Chen, Huaimin; Xiao, Man

2016-11-14

The buoyancy of Microcystis colonies is a principal factor determining blooms occurrence but the knowledge of seasonal variation in buoyancy is quite poor because of challenge in analysis method. In this study, a method based on the Stokes' Law after researching on the effects of shapes on settling velocity of Microcystis colonies, whose gas vesicles were collapsed, to accurately measure density was established. The method was used in Lake Taihu. From January to May, mean density of Microcystis colonies decreased from 995 kg m -3 to 978 kg m -3 and then increased to 992 kg m -3 in December. The density of colonies in different Microcystis species was in the order M. wesenbergii > M. aeruginosa > M. ichthyoblabe. For all the Microcystis species, the density of colonies with gas vasicles increased significantly along with the increase of colony size. Our results suggested that the main driving factor of Microcystis blooms formation in Lake Taihu was low density for M. ichthyoblabe from May to July but was large colony size for M. wesenbergii and M. aeruginosa from August to October.

cDNA cloning of rat and human medium chain acyl-CoA dehydrogenase (MCAD)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Matsubara, Y.; Kraus, J.P.; Rosenberg, L.E.

MCAD is one of three mitochondrial flavoenzymes which catalyze the first step in the ..beta..-oxidation of straight chain fatty acids. It is a tetramer with a subunit Mr of 45 kDa. MCAD is synthesized in the cytosol as a 49 kDa precursor polypeptide (pMCAD), imported into mitochondria, and cleaved to the mature form. Genetic deficiency of MCAD causes recurrent episodes of hypoglycemic coma accompanied by medium chain dicarboxylic aciduria. Employing a novel approach, the authors now report isolation of partial rat and human cDNA clones encoding pMCAD. mRNA encoding pMCAD was purified to near homogeneity by polysome immunoadsorption using polyclonalmore » monospecific antibody. Single-stranded (/sup 32/P)labeled cDNA probe was synthesized using the enriched mRNA as template, and was used to screen directly 16,000 colonies from a total rat liver cDNA library constructed in pBR322. One clone (600 bp) was detected by in situ hybridization. Hybrid-selected translation with this cDNA yielded a 49 kDa polypeptide indistinguishable in size from rat pMCAD and immunoprecipitable with anti-MCAD antibody. Using the rat cDNA as probe, 43,000 colonies from a human liver cDNA library were screened. Four identical positive clones (400 bp) were isolated and positively identified by hybrid-selected translation and immunoprecipitation. The sizes of rat and human mRNAs encoding pMCAD were 2.2 kb and 2.4 kb, respectively, as determined by Northern blotting.« less

Artificial Bee Colony Optimization of Capping Potentials for Hybrid Quantum Mechanical/Molecular Mechanical Calculations.

PubMed

Schiffmann, Christoph; Sebastiani, Daniel

2011-05-10

We present an algorithmic extension of a numerical optimization scheme for analytic capping potentials for use in mixed quantum-classical (quantum mechanical/molecular mechanical, QM/MM) ab initio calculations. Our goal is to minimize bond-cleavage-induced perturbations in the electronic structure, measured by means of a suitable penalty functional. The optimization algorithm-a variant of the artificial bee colony (ABC) algorithm, which relies on swarm intelligence-couples deterministic (downhill gradient) and stochastic elements to avoid local minimum trapping. The ABC algorithm outperforms the conventional downhill gradient approach, if the penalty hypersurface exhibits wiggles that prevent a straight minimization pathway. We characterize the optimized capping potentials by computing NMR chemical shifts. This approach will increase the accuracy of QM/MM calculations of complex biomolecules.

Programmable assembly of pressure sensors using pattern-forming bacteria.

PubMed

Cao, Yangxiaolu; Feng, Yaying; Ryser, Marc D; Zhu, Kui; Herschlag, Gregory; Cao, Changyong; Marusak, Katherine; Zauscher, Stefan; You, Lingchong

2017-11-01

Biological systems can generate microstructured materials that combine organic and inorganic components and possess diverse physical and chemical properties. However, these natural processes in materials fabrication are not readily programmable. Here, we use a synthetic-biology approach to assemble patterned materials. We demonstrate programmable fabrication of three-dimensional (3D) materials by printing engineered self-patterning bacteria on permeable membranes that serve as a structural scaffold. Application of gold nanoparticles to the colonies creates hybrid organic-inorganic dome structures. The dynamics of the dome structures' response to pressure is determined by their geometry (colony size, dome height, and pattern), which is easily modified by varying the properties of the membrane (e.g., pore size and hydrophobicity). We generate resettable pressure sensors that process signals in response to varying pressure intensity and duration.

An Electrochemical DNA Biosensor for the Detection of Salmonella Using Polymeric Films and Electrochemical Labels

NASA Astrophysics Data System (ADS)

Diaz Serrano, Madeline

Waterborne and foodborne diseases are one of the principal public health problems worldwide. Microorganisms are the major agents of foodborne illness: pathogens such as Salmonella, Campylobacter jejuni and Escherichia coli, and parasites such as cryptosporidium. The most popular methods to detect Salmonella are based on culture and colony counting methods, ELISA, Gel electrophoresis and the polymerase chain reaction. Conventional detection methods are laborious and time-consuming, allowing for portions of the food to be distributed, marketed, sold and eaten before the analysis is done and the problem even detected. By these reasons, the rapid, easy and portable detection of foodborne organisms will facilitate the disease treatment. Our particular interest is to develop a nucleic acid biosensor (NAB) for the detection of pathogenic microorganisms in food and water samples. In this research, we report on the development of a NAB prototype using a polymer modified electrode surface together with sequences of different lengths for the OmpC gene from Salmonella as probes and Ferrocene-labeled target (Fc-ssDNA), Ferrocene-labeled tri(ethylene glycol) (Fc-PEG) and Ruthenium-Ferrocene (Ru-Fe) bimetallic complex as an electrochemical labels. We have optimized several PS films and anchored nucleic acid sequences with different lengths at gold and carbon surfaces. Non contact mode AFM and XPS were used to monitor each step of the NAB preparation, from polymer modification to oligos hybridization (conventional design). The hybridization reaction was followed electrochemically using a Fc-ssDNA and Fc-PEG in solution taking advantage of the morphological changes generated upon hybridization. We observed a small current at the potential for the Fe oxidation without signal amplification at +296 mV vs. Ag/AgCl for the Fc-ssDNA strategy and a small current at +524 mV for the Fc-PEG strategy. The immobilization, hybridization and signal amplification of Biotin- OmpC Salmonella genes generated by E.Z. Vega were obtained on NHS-PS-NHS 10.3 KD and detected by SWV and CC using Ru-Fe bimetallic complex as a redox label and GOx/glucose in PBS buffer. Calibration curves of biotin-OmpC probe hybridization were performed by CC, a catalytic charge was observed due to the presence of Ru-Fe bimetallic complex, GOx-A and glucose. The lowest target sequence detectable concentration was 0.41 microM.

Ant colony optimisation-direct cover: a hybrid ant colony direct cover technique for multi-level synthesis of multiple-valued logic functions

NASA Astrophysics Data System (ADS)

Abd-El-Barr, Mostafa

2010-12-01

The use of non-binary (multiple-valued) logic in the synthesis of digital systems can lead to savings in chip area. Advances in very large scale integration (VLSI) technology have enabled the successful implementation of multiple-valued logic (MVL) circuits. A number of heuristic algorithms for the synthesis of (near) minimal sum-of products (two-level) realisation of MVL functions have been reported in the literature. The direct cover (DC) technique is one such algorithm. The ant colony optimisation (ACO) algorithm is a meta-heuristic that uses constructive greediness to explore a large solution space in finding (near) optimal solutions. The ACO algorithm mimics the ant's behaviour in the real world in using the shortest path to reach food sources. We have previously introduced an ACO-based heuristic for the synthesis of two-level MVL functions. In this article, we introduce the ACO-DC hybrid technique for the synthesis of multi-level MVL functions. The basic idea is to use an ant to decompose a given MVL function into a number of levels and then synthesise each sub-function using a DC-based technique. The results obtained using the proposed approach are compared to those obtained using existing techniques reported in the literature. A benchmark set consisting of 50,000 randomly generated 2-variable 4-valued functions is used in the comparison. The results obtained using the proposed ACO-DC technique are shown to produce efficient realisation in terms of the average number of gates (as a measure of chip area) needed for the synthesis of a given MVL function.

Unique honey bee (Apis mellifera) hive component-based communities as detected by a hybrid of phospholipid fatty-acid and fatty-acid methyl ester analyses.

PubMed

Grubbs, Kirk J; Scott, Jarrod J; Budsberg, Kevin J; Read, Harry; Balser, Teri C; Currie, Cameron R

2015-01-01

Microbial communities (microbiomes) are associated with almost all metazoans, including the honey bee Apis mellifera. Honey bees are social insects, maintaining complex hive systems composed of a variety of integral components including bees, comb, propolis, honey, and stored pollen. Given that the different components within hives can be physically separated and are nutritionally variable, we hypothesize that unique microbial communities may occur within the different microenvironments of honey bee colonies. To explore this hypothesis and to provide further insights into the microbiome of honey bees, we use a hybrid of fatty acid methyl ester (FAME) and phospholipid-derived fatty acid (PLFA) analysis to produce broad, lipid-based microbial community profiles of stored pollen, adults, pupae, honey, empty comb, and propolis for 11 honey bee hives. Averaging component lipid profiles by hive, we show that, in decreasing order, lipid markers representing fungi, Gram-negative bacteria, and Gram-positive bacteria have the highest relative abundances within honey bee colonies. Our lipid profiles reveal the presence of viable microbial communities in each of the six hive components sampled, with overall microbial community richness varying from lowest to highest in honey, comb, pupae, pollen, adults and propolis, respectively. Finally, microbial community lipid profiles were more similar when compared by component than by hive, location, or sampling year. Specifically, we found that individual hive components typically exhibited several dominant lipids and that these dominant lipids differ between components. Principal component and two-way clustering analyses both support significant grouping of lipids by hive component. Our findings indicate that in addition to the microbial communities present in individual workers, honey bee hives have resident microbial communities associated with different colony components.

The Chapel Hill hemophilia A dog colony exhibits a factor VIII gene inversion

PubMed Central

Lozier, Jay N.; Dutra, Amalia; Pak, Evgenia; Zhou, Nan; Zheng, Zhili; Nichols, Timothy C.; Bellinger, Dwight A.; Read, Marjorie; Morgan, Richard A.

2002-01-01

In the Chapel Hill colony of factor VIII-deficient dogs, abnormal sequence (ch8, for canine hemophilia 8, GenBank no. AF361485) follows exons 1–22 in the factor VIII transcript in place of exons 23–26. The canine hemophilia 8 locus (ch8) sequence was found in a 140-kb normal dog genomic DNA bacterial artificial chromosome (BAC) clone that was completely outside the factor VIII gene, but not in BAC clones containing the factor VIII gene. The BAC clone that contained ch8 also contained a homologue of F8A (factor 8 associated) sequence, which participates in a common inversion that causes severe hemophilia A in humans. Fluorescence in situ hybridization analysis indicated that exons 1–26 normally proceed sequentially from telomere to centromere at Xq28, and ch8 is telomeric to the factor VIII gene. The appearance of an “upstream” genomic sequence element (ch8) at the end of the aberrant factor VIII transcript suggested that an inversion of genomic DNA replaced factor VIII exons 22–26 with ch8. The F8A sequence appeared also in overlapping normal BAC clones containing factor VIII sequence. We hypothesized that homologous recombination between copies of canine F8A inside and outside the factor VIII gene had occurred, as in human hemophilia A. High-resolution fluorescent in situ hybridization on hemophilia A dog DNA revealed a pattern consistent with this inversion mechanism. We also identified a HindIII restriction fragment length polymorphism of F8A fragments that distinguished hemophilia A, carrier, and normal dogs' DNA. The Chapel Hill hemophilia A dog colony therefore replicates the factor VIII gene inversion commonly seen in humans with severe hemophilia A. PMID:12242334

Unique Honey Bee (Apis mellifera) Hive Component-Based Communities as Detected by a Hybrid of Phospholipid Fatty-Acid and Fatty-Acid Methyl Ester Analyses

PubMed Central

2015-01-01

Microbial communities (microbiomes) are associated with almost all metazoans, including the honey bee Apis mellifera. Honey bees are social insects, maintaining complex hive systems composed of a variety of integral components including bees, comb, propolis, honey, and stored pollen. Given that the different components within hives can be physically separated and are nutritionally variable, we hypothesize that unique microbial communities may occur within the different microenvironments of honey bee colonies. To explore this hypothesis and to provide further insights into the microbiome of honey bees, we use a hybrid of fatty acid methyl ester (FAME) and phospholipid-derived fatty acid (PLFA) analysis to produce broad, lipid-based microbial community profiles of stored pollen, adults, pupae, honey, empty comb, and propolis for 11 honey bee hives. Averaging component lipid profiles by hive, we show that, in decreasing order, lipid markers representing fungi, Gram-negative bacteria, and Gram-positive bacteria have the highest relative abundances within honey bee colonies. Our lipid profiles reveal the presence of viable microbial communities in each of the six hive components sampled, with overall microbial community richness varying from lowest to highest in honey, comb, pupae, pollen, adults and propolis, respectively. Finally, microbial community lipid profiles were more similar when compared by component than by hive, location, or sampling year. Specifically, we found that individual hive components typically exhibited several dominant lipids and that these dominant lipids differ between components. Principal component and two-way clustering analyses both support significant grouping of lipids by hive component. Our findings indicate that in addition to the microbial communities present in individual workers, honey bee hives have resident microbial communities associated with different colony components. PMID:25849080

Quantitative real-time PCR as a sensitive protein-protein interaction quantification method and a partial solution for non-accessible autoactivator and false-negative molecule analysis in the yeast two-hybrid system.

PubMed

Maier, Richard H; Maier, Christina J; Hintner, Helmut; Bauer, Johann W; Onder, Kamil

2012-12-01

Many functional proteomic experiments make use of high-throughput technologies such as mass spectrometry combined with two-dimensional polyacrylamide gel electrophoresis and the yeast two-hybrid (Y2H) system. Currently there are even automated versions of the Y2H system available that can be used for proteome-wide research. The Y2H system has the capacity to deliver a profusion of Y2H positive colonies from a single library screen. However, subsequent analysis of these numerous primary candidates with complementary methods can be overwhelming. Therefore, a method to select the most promising candidates with strong interaction properties might be useful to reduce the number of candidates requiring further analysis. The method described here offers a new way of quantifying and rating the performance of positive Y2H candidates. The novelty lies in the detection and measurement of mRNA expression instead of proteins or conventional Y2H genetic reporters. This method correlates well with the direct genetic reporter readouts usually used in the Y2H system, and has greater sensitivity for detecting and quantifying protein-protein interactions (PPIs) than the conventional Y2H system, as demonstrated by detection of the Y2H false-negative PPI of RXR/PPARG. Approximately 20% of all proteins are not suitable for the Y2H system, the so-called autoactivators. A further advantage of this method is the possibility to evaluate molecules that usually cannot be analyzed in the Y2H system, exemplified by a VDR-LXXLL motif peptide interaction. Copyright © 2012 Elsevier Inc. All rights reserved.

Effects of Colony Creation Method and Beekeeper Education on Honeybee ("Apis mellifera") Mortality

ERIC Educational Resources Information Center

Findlay, J. Reed; Eborn, Benjamin; Jones, Wayne

2015-01-01

The two-part study reported here analyzed the effects of beekeeper education and colony creation methods on colony mortality. The first study examined the difference in hive mortality between hives managed by beekeepers who had received formal training in beekeeping with beekeepers who had not. The second study examined the effect on hive…

To increase size or decrease density? Different Microcystis species has different choice to form blooms

PubMed Central

Li, Ming; Zhu, Wei; Guo, Lili; Hu, Jing; Chen, Huaimin; Xiao, Man

2016-01-01

The buoyancy of Microcystis colonies is a principal factor determining blooms occurrence but the knowledge of seasonal variation in buoyancy is quite poor because of challenge in analysis method. In this study, a method based on the Stokes’ Law after researching on the effects of shapes on settling velocity of Microcystis colonies, whose gas vesicles were collapsed, to accurately measure density was established. The method was used in Lake Taihu. From January to May, mean density of Microcystis colonies decreased from 995 kg m−3 to 978 kg m−3 and then increased to 992 kg m−3 in December. The density of colonies in different Microcystis species was in the order M. wesenbergii > M. aeruginosa > M. ichthyoblabe. For all the Microcystis species, the density of colonies with gas vasicles increased significantly along with the increase of colony size. Our results suggested that the main driving factor of Microcystis blooms formation in Lake Taihu was low density for M. ichthyoblabe from May to July but was large colony size for M. wesenbergii and M. aeruginosa from August to October. PMID:27841329

Estimation method for serial dilution experiments.

PubMed

Ben-David, Avishai; Davidson, Charles E

2014-12-01

Titration of microorganisms in infectious or environmental samples is a corner stone of quantitative microbiology. A simple method is presented to estimate the microbial counts obtained with the serial dilution technique for microorganisms that can grow on bacteriological media and develop into a colony. The number (concentration) of viable microbial organisms is estimated from a single dilution plate (assay) without a need for replicate plates. Our method selects the best agar plate with which to estimate the microbial counts, and takes into account the colony size and plate area that both contribute to the likelihood of miscounting the number of colonies on a plate. The estimate of the optimal count given by our method can be used to narrow the search for the best (optimal) dilution plate and saves time. The required inputs are the plate size, the microbial colony size, and the serial dilution factors. The proposed approach shows relative accuracy well within ±0.1log10 from data produced by computer simulations. The method maintains this accuracy even in the presence of dilution errors of up to 10% (for both the aliquot and diluent volumes), microbial counts between 10(4) and 10(12) colony-forming units, dilution ratios from 2 to 100, and plate size to colony size ratios between 6.25 to 200. Published by Elsevier B.V.

Aerial surveys adjusted by ground surveys to estimate area occupied by black-tailed prairie dog colonies

USGS Publications Warehouse

Sidle, John G.; Augustine, David J.; Johnson, Douglas H.; Miller, Sterling D.; Cully, Jack F.; Reading, Richard P.

2012-01-01

Aerial surveys using line-intercept methods are one approach to estimate the extent of prairie dog colonies in a large geographic area. Although black-tailed prairie dogs (Cynomys ludovicianus) construct conspicuous mounds at burrow openings, aerial observers have difficulty discriminating between areas with burrows occupied by prairie dogs (colonies) versus areas of uninhabited burrows (uninhabited colony sites). Consequently, aerial line-intercept surveys may overestimate prairie dog colony extent unless adjusted by an on-the-ground inspection of a sample of intercepts. We compared aerial line-intercept surveys conducted over 2 National Grasslands in Colorado, USA, with independent ground-mapping of known black-tailed prairie dog colonies. Aerial line-intercepts adjusted by ground surveys using a single activity category adjustment overestimated colonies by ≥94% on the Comanche National Grassland and ≥58% on the Pawnee National Grassland. We present a ground-survey technique that involves 1) visiting on the ground a subset of aerial intercepts classified as occupied colonies plus a subset of intercepts classified as uninhabited colony sites, and 2) based on these ground observations, recording the proportion of each aerial intercept that intersects a colony and the proportion that intersects an uninhabited colony site. Where line-intercept techniques are applied to aerial surveys or remotely sensed imagery, this method can provide more accurate estimates of black-tailed prairie dog abundance and trends

Pancreatic ductal cells acquire mesenchymal characteristics through cell fusion with bone marrow-derived mesenchymal stem cells and SIRT1 attenuates the apoptosis of hybrid cells.

PubMed

Gou, Shanmiao; Liu, Tao; Li, Xiangsheng; Cui, Jing; Wan, Chidan; Wang, Chunyou

2012-01-01

Bone marrow-derived mesenchymal stem cells (bMSCs) contribute to tissue repair and regeneration. Cell fusion between somatic cells and bMSCs to form hybrid cells may have an important role in tissue repair through the subsequent reprogramming of the somatic cell nucleus. Few studies have assessed the mesenchymal characteristics of fusion-induced hybrid cells and their survival mechanisms. In this study, we investigated the effect of cell fusion on the biological characteristics of pancreatic ductal cells (PDCs) and on the survival mechanism of hybrid cells. To this end, we generated mouse-mouse hybrid cells in vitro by polyethylene glycol-mediated fusion of primary mouse bMSCs with primary mouse PDCs. Hybrid cells showed an enhanced capacity for proliferation and self-renewal compared with PDCs. No PDC had the capacity for anchorage-independent growth or invasion into Matrigel, but some hybrid cells were able to form colonies in soft agar and invade Matrigel. Expression of the tumor suppressor protein p53, which initiates apoptosis, was detected in hybrid cells but not in PDCs or bMSCs. However, the p53 deacetylase, sirtuin 1 (SIRT1), was also detected in hybrid cells, and the level of acetylated p53, the active form, was low. The addition of nicotinamide (Nam) inhibited the deacetylation activity of SIRT1 on p53 and induced cell apoptosis in hybrid cells. This study demonstrated that PDCs could obtain high proliferation rates, self-renewal capabilities, and mesenchymal characteristics by fusion with bMSCs. SIRT1 expression in the hybrid cells attenuated their apoptosis. Copyright © 2012 S. Karger AG, Basel.

The Psychology of Superorganisms: Collective Decision Making by Insect Societies.

PubMed

Sasaki, Takao; Pratt, Stephen C

2018-01-07

Under the superorganism concept, insect societies are so tightly integrated that they possess features analogous to those of single organisms, including collective cognition. If so, colony function might fruitfully be studied using methods developed to understand individual animals. Here, we review research that uses psychological approaches to understand decision making by colonies. The application of neural models to collective choice shows fundamental similarities between how brains and colonies balance speed/accuracy trade-offs in decision making. Experimental analyses have explored collective rationality, cognitive capacity, and perceptual discrimination at both individual and colony levels. A major theme is the emergence of improved colony-level function from interactions among relatively less capable individuals. However, colonies also encounter performance costs due to their reliance on positive feedback, which generates consensus but can also amplify errors. Collective learning is a nascent field for the further application of psychological methods to colonies. The research strategy reviewed here shows how the superorganism concept can serve as more than an illustrative analogy.

Design of two-channel filter bank using nature inspired optimization based fractional derivative constraints.

PubMed

Kuldeep, B; Singh, V K; Kumar, A; Singh, G K

2015-01-01

In this article, a novel approach for 2-channel linear phase quadrature mirror filter (QMF) bank design based on a hybrid of gradient based optimization and optimization of fractional derivative constraints is introduced. For the purpose of this work, recently proposed nature inspired optimization techniques such as cuckoo search (CS), modified cuckoo search (MCS) and wind driven optimization (WDO) are explored for the design of QMF bank. 2-Channel QMF is also designed with particle swarm optimization (PSO) and artificial bee colony (ABC) nature inspired optimization techniques. The design problem is formulated in frequency domain as sum of L2 norm of error in passband, stopband and transition band at quadrature frequency. The contribution of this work is the novel hybrid combination of gradient based optimization (Lagrange multiplier method) and nature inspired optimization (CS, MCS, WDO, PSO and ABC) and its usage for optimizing the design problem. Performance of the proposed method is evaluated by passband error (ϕp), stopband error (ϕs), transition band error (ϕt), peak reconstruction error (PRE), stopband attenuation (As) and computational time. The design examples illustrate the ingenuity of the proposed method. Results are also compared with the other existing algorithms, and it was found that the proposed method gives best result in terms of peak reconstruction error and transition band error while it is comparable in terms of passband and stopband error. Results show that the proposed method is successful for both lower and higher order 2-channel QMF bank design. A comparative study of various nature inspired optimization techniques is also presented, and the study singles out CS as a best QMF optimization technique. Copyright © 2014 ISA. Published by Elsevier Ltd. All rights reserved.

Different types of maximum power point tracking techniques for renewable energy systems: A survey

NASA Astrophysics Data System (ADS)

Khan, Mohammad Junaid; Shukla, Praveen; Mustafa, Rashid; Chatterji, S.; Mathew, Lini

2016-03-01

Global demand for electricity is increasing while production of energy from fossil fuels is declining and therefore the obvious choice of the clean energy source that is abundant and could provide security for development future is energy from the sun. In this paper, the characteristic of the supply voltage of the photovoltaic generator is nonlinear and exhibits multiple peaks, including many local peaks and a global peak in non-uniform irradiance. To keep global peak, MPPT is the important component of photovoltaic systems. Although many review articles discussed conventional techniques such as P & O, incremental conductance, the correlation ripple control and very few attempts have been made with intelligent MPPT techniques. This document also discusses different algorithms based on fuzzy logic, Ant Colony Optimization, Genetic Algorithm, artificial neural networks, Particle Swarm Optimization Algorithm Firefly, Extremum seeking control method and hybrid methods applied to the monitoring of maximum value of power at point in systems of photovoltaic under changing conditions of irradiance.

COMPARISON OF TAXONOMIC, COLONY MORPHOTYPE AND PCR-RFLP METHODS TO CHARACTERIZE MICROFUNGAL DIVERSITY

EPA Science Inventory

We compared three methods for estimating fungal species diversity in soil samples. A rapid screening method based on gross colony morphological features and color reference standards was compared with traditional fungal taxonomic methods and PCR-RFLP for estimation of ecological ...

Laboratory colonization and mass rearing of phlebotomine sand flies (Diptera, Psychodidae)

PubMed Central

Lawyer, Phillip; Killick-Kendrick, Mireille; Rowland, Tobin; Rowton, Edgar; Volf, Petr

2017-01-01

Laboratory colonies of phlebotomine sand flies are necessary for experimental study of their biology, behaviour and mutual relations with disease agents and for testing new methods of vector control. They are indispensable in genetic studies and controlled observations on the physiology and behaviour of sand flies, neglected subjects of high priority. Colonies are of particular value for screening insecticides. Colonized sand flies are used as live vector models in a diverse array of research projects, including xenodiagnosis, that are directed toward control of leishmaniasis and other sand fly-associated diseases. Historically, labour-intensive maintenance and low productivity have limited their usefulness for research, especially for species that do not adapt well to laboratory conditions. However, with growing interest in leishmaniasis research, rearing techniques have been developed and refined, and sand fly colonies have become more common, enabling many significant breakthroughs. Today, there are at least 90 colonies representing 21 distinct phlebotomine sand fly species in 35 laboratories in 18 countries worldwide. The materials and methods used by various sand fly workers differ, dictated by the availability of resources, cost or manpower constraints rather than choice. This paper is not intended as a comprehensive review but rather a discussion of methods and techniques most commonly used by researchers to initiate, establish and maintain sand fly colonies, with emphasis on the methods proven to be most effective for the species the authors have colonized. Topics discussed include collecting sand flies for colony stock, colony initiation, maintenance and mass-rearing procedures, and control of sand fly pathogens in colonies. PMID:29139377

Stance and strategy: post-structural perspective and post-colonial engagement to develop nursing knowledge.

PubMed

Sochan, Anne M

2011-07-01

How should nursing knowledge advance? This exploration contextualizes its evolution past and present. In addressing how it evolved in the past, a probable historical evolution of its development draws on the perspectives of Frank & Gills's World System Theory, Kuhn's treatise on Scientific Revolutions, and Foucault's notions of Discontinuities in scientific knowledge development. By describing plausible scenarios of how nursing knowledge evolved, I create a case for why nursing knowledge developers should adopt a post-structural stance in prioritizing their research agenda(s). Further, by adopting a post-structural stance, I create a case on how nurses can advance their disciplinary knowledge using an engaging post-colonial strategy. Given an interrupted history caused by influence(s) constraining nursing's knowledge development by power structures external, and internal, to nursing, knowledge development can evolve in the future by drawing on post-structural interpretation, and post-colonial strategy. The post-structural writings of Deleuze & Guattari's understanding of 'Nomadology' as a subtle means to resist being constrained by existing knowledge development structures, might be a useful stance to understanding the urgency of why nursing knowledge should advance addressing the structural influences on its development. Furthermore, Bhabha's post-colonial elucidation of 'Hybridity' as an equally discreet means to change the culture of those constraining structures is an appropriate strategy to enact how nursing knowledge developers can engage with existing power structures, and simultaneously influence that engagement. Taken together, 'post-structural stance' and 'post-colonial strategy' can refocus nursing scholarship to learn from its past, in order to develop relevant disciplinary knowledge in its future. © 2011 Blackwell Publishing Ltd.

Pteridine levels and head weights are correlated with age and colony task in the honey bee, Apis mellifera

PubMed Central

Rinkevich, Frank D.; Margotta, Joseph W.; Pittman, Jean M.; Ottea, James A.

2016-01-01

Background. The age of an insect strongly influences many aspects of behavior and reproduction. The interaction of age and behavior is epitomized in the temporal polyethism of honey bees in which young adult bees perform nurse and maintenance duties within the colony, while older bees forage for nectar and pollen. Task transition is dynamic and driven by colony needs. However, an abundance of precocious foragers or overage nurses may have detrimental effects on the colony. Additionally, honey bee age affects insecticide sensitivity. Therefore, determining the age of a set of individual honey bees would be an important measurement of colony health. Pteridines are purine-based pigment molecules found in many insect body parts. Pteridine levels correlate well with age, and wild caught insects may be accurately aged by measuring pteridine levels. The relationship between pteridines and age varies with a number of internal and external factors among many species. Thus far, no studies have investigated the relationship of pteridines with age in honey bees. Methods. We established single-cohort colonies to obtain age-matched nurse and forager bees. Bees of known ages were also sampled from colonies with normal demographics. Nurses and foragers were collected every 3–5 days for up to 42 days. Heads were removed and weighed before pteridines were purified and analyzed using previously established fluorometric methods. Results. Our analysis showed that pteridine levels significantly increased with age in a linear manner in both single cohort colonies and colonies with normal demography. Pteridine levels were higher in foragers than nurses of the same age in bees from single cohort colonies. Head weight significantly increased with age until approximately 28-days of age and then declined for both nurse and forager bees in single cohort colonies. A similar pattern of head weight in bees from colonies with normal demography was observed but head weight was highest in 8-day old nurse bees and there was no relationship of head weight with age of foragers. Discussion. Although the relationship between pteridine levels and age was significant, variation in the data yielded a +4-day range in age estimation. This allows an unambiguous method to determine whether a bee may be a young nurse or old forager in colonies with altered demographics as in the case of single cohort colonies. Pteridine levels in bees do not correlate with age as well as in other insects. However, most studies used insects reared under tightly controlled laboratory conditions, while we used free-living bees. The dynamics of head weight change with age is likely to be due to growth and atrophy of the hypopharyngeal glands. Taken together, these methods represent a useful tool for assessing the age of an insect. Future studies utilizing these methods will provide a more holistic view of colony health. PMID:27413635

Programmable assembly of pressure sensors using pattern-forming bacteria

PubMed Central

Cao, Yangxiaolu; Feng, Yaying; Ryser, Marc D.; Zhu, Kui; Herschlag, Gregory; Cao, Changyong; Marusak, Katherine; Zauscher, Stefan; You, Lingchong

2017-01-01

Biological systems can generate microstructured materials that combine organic and inorganic components and possess diverse physical and chemical properties. However, these natural processes in materials fabrication are not readily programmable. Here, we use a synthetic-biology approach to mimic such natural processes to assemble patterned materials.. We demonstrate programmable fabrication of three-dimensional (3D) materials by printing engineered self-patterning bacteria on permeable membranes that serve as a structural scaffold. Application of gold nanoparticles to the colonies creates hybrid organic-inorganic dome structures. The dynamics of the dome structures' response to pressure is determined by their geometry (colony size, dome height and pattern), which is easily modified by varying the properties of the membrane (e.g., pore size and hydrophobicity). We generate resettable pressure sensors that process signals in response to varying pressure intensity and duration. PMID:28991268

Data for automated, high-throughput microscopy analysis of intracellular bacterial colonies using spot detection.

PubMed

Ernstsen, Christina L; Login, Frédéric H; Jensen, Helene H; Nørregaard, Rikke; Møller-Jensen, Jakob; Nejsum, Lene N

2017-10-01

Quantification of intracellular bacterial colonies is useful in strategies directed against bacterial attachment, subsequent cellular invasion and intracellular proliferation. An automated, high-throughput microscopy-method was established to quantify the number and size of intracellular bacterial colonies in infected host cells (Detection and quantification of intracellular bacterial colonies by automated, high-throughput microscopy, Ernstsen et al., 2017 [1]). The infected cells were imaged with a 10× objective and number of intracellular bacterial colonies, their size distribution and the number of cell nuclei were automatically quantified using a spot detection-tool. The spot detection-output was exported to Excel, where data analysis was performed. In this article, micrographs and spot detection data are made available to facilitate implementation of the method.

Symbiotic Role of the Viable but Nonculturable State of Vibrio fischeri in Hawaiian Coastal Seawater.

PubMed

Lee, K; Ruby, E G

1995-01-01

To achieve functional bioluminescence, the developing light organ of newly hatched juveniles of the Hawaiian squid Euprymna scolopes must become colonized by luminous, symbiosis-competent Vibrio fischeri present in the ambient seawater. This benign infection occurs rapidly in animals placed in seawater from the host's natural habitat. Therefore, it was surprising that colony hybridization studies with a V. fischeri-specific luxA gene probe indicated the presence of only about 2 CFU of V. fischeri per ml of this infective seawater. To examine this paradox, we estimated the total concentration of V. fischeri cells present in seawater from the host's habitat in two additional ways. In the first approach, the total bacterial assemblage in samples of seawater was collected on polycarbonate membrane filters and used as a source of both a crude cell lysate and purified DNA. These preparations were then assayed by quantitative DNA-DNA hybridization with the luxA gene probe. The results suggested the presence of between 200 and 400 cells of V. fischeri per ml of natural seawater, a concentration more than 100 times that revealed by colony hybridization. In the second approach, we amplified V. fischeri-specific luxA sequences from microliter volumes of natural seawater by PCR. Most-probable-number analyses of the frequency of positive PCR results from cell lysates in these small volumes gave an estimate of the concentration of V. fischeri luxA gene targets of between 130 and 1,680 copies per ml. From these measurements, we conclude that in their natural seawater environment, the majority of V. fischeri cells become nonculturable while remaining viable and symbiotically infective. Experimental studies indicated that V. fischeri cells suspended in natural Hawaiian seawater enter such a state within a few days.

Ant colony algorithm for clustering in portfolio optimization

NASA Astrophysics Data System (ADS)

Subekti, R.; Sari, E. R.; Kusumawati, R.

2018-03-01

This research aims to describe portfolio optimization using clustering methods with ant colony approach. Two stock portfolios of LQ45 Indonesia is proposed based on the cluster results obtained from ant colony optimization (ACO). The first portfolio consists of assets with ant colony displacement opportunities beyond the defined probability limits of the researcher, where the weight of each asset is determined by mean-variance method. The second portfolio consists of two assets with the assumption that each asset is a cluster formed from ACO. The first portfolio has a better performance compared to the second portfolio seen from the Sharpe index.

The evolution of coloniality in birds in relation to food, habitat, predation, and life-history traits: a comparative analysis.

PubMed

Rolland, C; Danchin, E; de Fraipont, M

1998-06-01

Coloniality in birds has been intensively studied under the cost and benefit approach, but no general conclusion can be given concerning its evolutionary function. Here, we report on a comparative analysis carried out on 320 species of birds using the general method of comparative analysis for discrete variables and the contrast method to analyze the evolution of coloniality. Showing a mean of 23 convergences and 10 reversals, coloniality appears to be a rather labile trait. Colonial breeding appears strongly correlated with the absence of feeding territory, the aquatic habitat, and nest exposure to predators but was not correlated with changes in life-history traits (body mass and clutch size). The correlation of coloniality with the aquatic habitat is in fact explained by a strong correlation with the marine habitat. Unexpectedly, we found that the evolution toward a marine habitat in birds was contingent on coloniality and that coloniality evolved before the passage to a marine life. These results-along with the lack of transitions from the nonmarine to marine habitat in solitary species and the precedence of the loss of feeding territoriality on the passage to a marine life-contradict most of the hypotheses classically accepted to explain coloniality and suggest that we use a different framework to study this evolutionary enigma.

The endangered Florida pondweed (Potamogeton floridanus) is a hybrid: Why we need to understand biodiversity thoroughly.

PubMed

Kaplan, Zdeněk; Fehrer, Judith; Bambasová, Veronika; Hellquist, C Barre

2018-01-01

Thorough understanding of biodiversity is a fundamental prerequisite for biological research. A lack of taxonomic knowledge and species misidentifications are particularly critical for conservation. Here we present an example of Potamogeton floridanus, the Florida Pondweed, an endangered taxon endemic to a small area in the Florida panhandle, whose taxonomic status remained controversial for more than a century, and all previous attempts to elucidate its identity have failed. We applied molecular approaches to tackle the origin of the mysterious taxon and supplemented them with morphological and anatomical investigations of both historical herbarium collections and plants recently collected in the type area for a comprehensive taxonomic reassessment. Sequencing of two nuclear ribosomal markers and one chloroplast non-coding spacer resulted in the surprising discovery that P. floridanus is a hybrid of P. pulcher and P. oakesianus, with the former being the maternal parent. The hybrid colony is currently geographically isolated from the distribution range of P. oakesianus. We show that previous molecular analyses have failed to reveal its hybrid identity due to inadequate nuclear DNA sequence editing. This is an example how the uncritical use of automized sequence reads can hamper molecular species identifications and also affect phylogenetic tree construction and interpretation. This unique hybrid taxon, P. ×floridanus, adds another case study to the debate on hybrid protection; consequences for its conservation are discussed.

The endangered Florida pondweed (Potamogeton floridanus) is a hybrid: Why we need to understand biodiversity thoroughly

PubMed Central

Fehrer, Judith; Bambasová, Veronika; Hellquist, C. Barre

2018-01-01

Thorough understanding of biodiversity is a fundamental prerequisite for biological research. A lack of taxonomic knowledge and species misidentifications are particularly critical for conservation. Here we present an example of Potamogeton floridanus, the Florida Pondweed, an endangered taxon endemic to a small area in the Florida panhandle, whose taxonomic status remained controversial for more than a century, and all previous attempts to elucidate its identity have failed. We applied molecular approaches to tackle the origin of the mysterious taxon and supplemented them with morphological and anatomical investigations of both historical herbarium collections and plants recently collected in the type area for a comprehensive taxonomic reassessment. Sequencing of two nuclear ribosomal markers and one chloroplast non-coding spacer resulted in the surprising discovery that P. floridanus is a hybrid of P. pulcher and P. oakesianus, with the former being the maternal parent. The hybrid colony is currently geographically isolated from the distribution range of P. oakesianus. We show that previous molecular analyses have failed to reveal its hybrid identity due to inadequate nuclear DNA sequence editing. This is an example how the uncritical use of automized sequence reads can hamper molecular species identifications and also affect phylogenetic tree construction and interpretation. This unique hybrid taxon, P. ×floridanus, adds another case study to the debate on hybrid protection; consequences for its conservation are discussed. PMID:29608584

A Lactuca universal hybridizer, and its use in creation of fertile interspecific somatic hybrids.

PubMed

Chupeau, M C; Maisonneuve, B; Bellec, Y; Chupeau, Y

1994-10-28

A Lactuca sativa cv. Ardente line heterozygous for a gene encoding resistance to kanamycin, a positive and dominant trait, was crossed with cv. Girelle, which is heterozygous for a recessive albinism marker. The resulting seeds yielded 25% albino seedlings, of which 50% were also resistant to kanamycin. Such plantlets (KR, a) grown in vitro were used for preparation of universal hybridizer protoplasts, since green buds that can develop on kanamycin containing-medium should result from fusion with any wild-type protoplast. To test the practicability of this selection scheme, we fused L. sativa KR, a protoplasts with protoplasts derived from various wild Lactuca as well as various other related species. Protoplast-derived cell colonies were selected for resistance to kanamycin at the regeneration stage. Green buds were regenerated after fusion with protoplasts of L. tatarica and of L. perennis. So far, 9 interspecific hybrid plants have been characterized morphologically. In addition, random amplified polymorphic DNA (RAPD) analysis with selected primers confirmed that these plants are indeed interspecific hybrids. Some plants are female-fertile and production of backcross progenies with L. sativa is in progress. Since many desirable traits such as resistances to viruses, bacteria and fungi (Bremia lactucae) have been characterized in wild Lactuca species, the use of somatic hybridization in breeding programmes now appears a practical possibility.

Generation of human β-thalassemia induced pluripotent cell lines by reprogramming of bone marrow-derived mesenchymal stromal cells using modified mRNA.

PubMed

Varela, Ioanna; Karagiannidou, Angeliki; Oikonomakis, Vasilis; Tzetis, Maria; Tzanoudaki, Marianna; Siapati, Elena-Konstantina; Vassilopoulos, George; Graphakos, Stelios; Kanavakis, Emmanuel; Goussetis, Evgenios

2014-12-01

Synthetic modified mRNA molecules encoding pluripotency transcription factors have been used successfully in reprogramming human fibroblasts to induced pluripotent stem cells (iPSCs). We have applied this method on bone marrow-derived mesenchymal stromal cells (BM-MSCs) obtained from a patient with β-thalassemia (β-thal) with the aim to generate trangene-free β-thal-iPSCs. Transfection of 10(4) BM-MSCs by lipofection with mRNA encoding the reprogramming factors Oct4, Klf4, Sox2, cMyc, and Lin28 resulted in formation of five iPSC colonies, from which three were picked up and expanded in β-thal-iPSC lines. After 10 serial passages in vitro, β-thal-iPSCs maintain genetic stability as shown by array comparative genomic hybridization (aCGH) and are capable of forming embryoid bodies in vitro and teratomas in vivo. Their gene expression profile compared to human embryonic stem cells (ESCs) and BM-MSCs seems to be similar to that of ESCs, whereas it differs from the profile of the parental BM-MSCs. Differentiation cultures toward a hematopoietic lineage showed the generation of CD34(+) progenitors up to 10%, but with a decreased hematopoietic colony-forming capability. In conclusion, we report herein the generation of transgene-free β-thal-iPSCs that could be widely used for disease modeling and gene therapy applications. Moreover, it was demonstrated that the mRNA-based reprogramming method, used mainly in fibroblasts, is also suitable for reprogramming of human BM-MSCs.

Development of a colony lift immunoassay to facilitate rapid detection and quantification of Escherichia coli O157:H7 from agar plates and filter monitor membranes.

PubMed

Ingram, D T; Lamichhane, C M; Rollins, D M; Carr, L E; Mallinson, E T; Joseph, S W

1998-07-01

E. coli O157:H7 is a food-borne adulterant that can cause hemorrhagic ulcerative colitis and hemolytic uremic syndrome. Faced with an increasing risk of foods contaminated with E. coli O157:H7, food safety officials are seeking improved methods to detect and isolate E. coli O157:H7 in hazard analysis and critical control point systems in meat- and poultry-processing plants. A colony lift immunoassay was developed to facilitate the positive identification and quantification of E. coli O157:H7 by incorporating a simple colony lift enzyme-linked immunosorbent assay with filter monitors and traditional culture methods. Polyvinylidene difluoride (PVDF) membranes (Millipore, Bedford, Mass.) were prewet with methanol and were used to make replicates of every bacterial colony on agar plates or filter monitor membranes that were then reincubated for 15 to 18 h at 36 +/- 1 degree C, during which the colonies not only remained viable but were reestablished. The membranes were dried, blocked with blocking buffer (Kirkegaard and Perry Laboratories [KPL], Gaithersburg, Md.), and exposed for 7 min to an affinity-purified horseradish peroxidase-labeled goat anti-E. coli O157 antibody (KPL). The membranes were washed, exposed to a 3,3',5,5'-tetramethylbenzidine membrane substrate (TMB; KPL) or aminoethyl carbazole (AEC; Sigma Chemical Co., St. Louis, Mo.), rinsed in deionized water, and air dried. Colonies of E. coli O157:H7 were identified by either a blue (via TMB) or a red (via AEC) color reaction. The colored spots on the PVDF lift membrane were then matched to their respective parent colonies on the agar plates or filter monitor membranes. The colony lift immunoassay was tested with a wide range of genera in the family Enterobacteriaceae as well as different serotypes within the E. coli genus. The colony lift immunoassay provided a simple, rapid, and accurate method for confirming the presence of E. coli O157:H7 colonies isolated on filter monitors or spread plates by traditional culture methods. An advantage of using the colony lift immunoassay is the ability to test every colony serologically on an agar plate or filter monitor membrane simultaneously for the presence of the E. coli O157 antigen. This colony lift immunoassay has recently been successfully incorporated into a rapid-detection, isolation, and quantification system for E. coli O157:H7, developed in our laboratories for retail meat sampling.

Development of a Colony Lift Immunoassay To Facilitate Rapid Detection and Quantification of Escherichia coli O157:H7 from Agar Plates and Filter Monitor Membranes

PubMed Central

Ingram, David T.; Lamichhane, Chinta M.; Rollins, David M.; Carr, Lewis E.; Mallinson, Edward T.; Joseph, Sam W.

1998-01-01

E. coli O157:H7 is a food-borne adulterant that can cause hemorrhagic ulcerative colitis and hemolytic uremic syndrome. Faced with an increasing risk of foods contaminated with E. coli O157:H7, food safety officials are seeking improved methods to detect and isolate E. coli O157:H7 in hazard analysis and critical control point systems in meat- and poultry-processing plants. A colony lift immunoassay was developed to facilitate the positive identification and quantification of E. coli O157:H7 by incorporating a simple colony lift enzyme-linked immunosorbent assay with filter monitors and traditional culture methods. Polyvinylidene difluoride (PVDF) membranes (Millipore, Bedford, Mass.) were prewet with methanol and were used to make replicates of every bacterial colony on agar plates or filter monitor membranes that were then reincubated for 15 to 18 h at 36 ± 1°C, during which the colonies not only remained viable but were reestablished. The membranes were dried, blocked with blocking buffer (Kirkegaard and Perry Laboratories [KPL], Gaithersburg, Md.), and exposed for 7 min to an affinity-purified horseradish peroxidase-labeled goat anti-E. coli O157 antibody (KPL). The membranes were washed, exposed to a 3,3′,5,5′-tetramethylbenzidine membrane substrate (TMB; KPL) or aminoethyl carbazole (AEC; Sigma Chemical Co., St. Louis, Mo.), rinsed in deionized water, and air dried. Colonies of E. coli O157:H7 were identified by either a blue (via TMB) or a red (via AEC) color reaction. The colored spots on the PVDF lift membrane were then matched to their respective parent colonies on the agar plates or filter monitor membranes. The colony lift immunoassay was tested with a wide range of genera in the family Enterobacteriaceae as well as different serotypes within the E. coli genus. The colony lift immunoassay provided a simple, rapid, and accurate method for confirming the presence of E. coli O157:H7 colonies isolated on filter monitors or spread plates by traditional culture methods. An advantage of using the colony lift immunoassay is the ability to test every colony serologically on an agar plate or filter monitor membrane simultaneously for the presence of the E. coli O157 antigen. This colony lift immunoassay has recently been successfully incorporated into a rapid-detection, isolation, and quantification system for E. coli O157:H7, developed in our laboratories for retail meat sampling. PMID:9665968

Screening For Alcohol-Producing Microbes

NASA Technical Reports Server (NTRS)

Schubert, Wayne W.

1988-01-01

Dye reaction rapidly identifies alcohol-producing microbial colonies. Method visually detects alcohol-producing micro-organisms, and distinguishes them from other microbial colonies that do not produce alcohol. Method useful for screening mixed microbial populations in environmental samples.

Rational Design of Potent Antagonists to the Human Growth Hormone Receptor

NASA Astrophysics Data System (ADS)

Fuh, Germaine; Cunningham, Brian C.; Fukunaga, Rikiro; Nagata, Shigekazu; Goeddel, David V.; Wells, James A.

1992-06-01

A hybrid receptor was constructed that contained the extracellular binding domain of the human growth hormone (hGH) receptor linked to the transmembrane and intracellular domains of the murine granulocyte colony-stimulating factor receptor. Addition of hGH to a myeloid leukemia cell line (FDC-P1) that expressed the hybrid receptor caused proliferation of these cells. The mechanism for signal transduction of the hybrid receptor required dimerization because monoclonal antibodies to the hGH receptor were agonists whereas their monovalent fragments were not. Receptor dimerization occurs sequentially-a receptor binds to site 1 on hGH, and then a second receptor molecule binds to site 2 on hGH. On the basis of this sequential mechanism, which may occur in many other cytokine receptors, inactive hGH analogs were designed that were potent antagonists to hGH-induced cell proliferation. Such antagonists could be useful for treating clinical conditions of hGH excess, such as acromegaly.

Methods comparison for microsatellite marker development: Different isolation methods, different yield efficiency

NASA Astrophysics Data System (ADS)

Zhan, Aibin; Bao, Zhenmin; Hu, Xiaoli; Lu, Wei; Hu, Jingjie

2009-06-01

Microsatellite markers have become one kind of the most important molecular tools used in various researches. A large number of microsatellite markers are required for the whole genome survey in the fields of molecular ecology, quantitative genetics and genomics. Therefore, it is extremely necessary to select several versatile, low-cost, efficient and time- and labor-saving methods to develop a large panel of microsatellite markers. In this study, we used Zhikong scallop ( Chlamys farreri) as the target species to compare the efficiency of the five methods derived from three strategies for microsatellite marker development. The results showed that the strategy of constructing small insert genomic DNA library resulted in poor efficiency, while the microsatellite-enriched strategy highly improved the isolation efficiency. Although the mining public database strategy is time- and cost-saving, it is difficult to obtain a large number of microsatellite markers, mainly due to the limited sequence data of non-model species deposited in public databases. Based on the results in this study, we recommend two methods, microsatellite-enriched library construction method and FIASCO-colony hybridization method, for large-scale microsatellite marker development. Both methods were derived from the microsatellite-enriched strategy. The experimental results obtained from Zhikong scallop also provide the reference for microsatellite marker development in other species with large genomes.

Estimating 3-dimensional colony surface area of field corals

EPA Science Inventory

Colony surface area is a critical descriptor for biological and physical attributes of reef-building (scleractinian, stony) corals. The three-dimensional (3D) size and structure of corals are directly related to many ecosystem values and functions. Most methods to estimate colony...

Comparison of direct colony method versus extraction method for identification of gram-positive cocci by use of Bruker Biotyper matrix-assisted laser desorption ionization-time of flight mass spectrometry.

PubMed

Alatoom, Adnan A; Cunningham, Scott A; Ihde, Sherry M; Mandrekar, Jayawant; Patel, Robin

2011-08-01

We evaluated Bruker Biotyper (version 2.0) matrix-assisted laser desorption ionization-time of flight (MALDI-TOF) mass spectrometry (MS) for the identification of 305 clinical isolates of staphylococci, streptococci, and related genera by comparing direct colony testing with preparatory extraction. Isolates were previously identified by use of phenotypic testing and/or 16S rRNA gene sequencing. Manufacturer-specified score cutoffs for genus- and species-level identification were used. After excluding 7 isolates not present in the Biotyper library, the Biotyper correctly identified 284 (95%) and 207 (69%) isolates to the genus and species levels, respectively, using extraction. By using direct colony testing, the Biotyper identified 168 (56%) and 60 (20%) isolates to the genus and species levels, respectively. Overall, more isolates were identified to the genus and species levels with preparatory extraction than with direct colony testing (P < 0.0001). The analysis was repeated after dividing the isolates into two subgroups, staphylococci, streptococci, and enterococci (n = 217) and "related genera" (n = 81). For the former subgroup, the extraction method resulted in the identification of 213 (98%) and 171 (79%) isolates to the genus and species levels, respectively, whereas the direct colony method identified 136 (63%) and 56 (26%) isolates to the genus and species levels, respectively. In contrast, for the subgroup of related genera, the extraction method identified 71 (88%) and 36 (44%) isolates to the genus and species levels, respectively, while the direct colony method identified 32 (40%) and 4 (5%) isolates to the genus and species levels, respectively. For both subgroups, preparatory extraction was superior to direct colony testing for the identification of isolates to the genus and species levels (P < 0.0001). Preparatory extraction is needed for the identification of a substantial proportion of Gram-positive cocci using the Biotyper method according to manufacturer-specified score cutoffs.

Somatic hybrid plants of Nicotiana x sanderae (+) N. debneyi with fungal resistance to Peronospora tabacina.

PubMed

Patel, Deval; Power, J Brian; Anthony, Paul; Badakshi, Farah; Pat Heslop-Harrison, J S; Davey, Michael R

2011-10-01

The genus Nicotiana includes diploid and tetraploid species, with complementary ecological, agronomic and commercial characteristics. The species are of economic value for tobacco, as ornamentals, and for secondary plant-product biosynthesis. They show substantial differences in disease resistance because of their range of secondary products. In the last decade, sexual hybridization and transgenic technologies have tended to eclipse protoplast fusion for gene transfer. Somatic hybridization was exploited in the present investigation to generate a new hybrid combination involving two sexually incompatible tetraploid species. The somatic hybrid plants were characterized using molecular, molecular cytogenetic and phenotypic approaches. Mesophyll protoplasts of the wild fungus-resistant species N. debneyi (2n = 4x = 48) were electrofused with those of the ornamental interspecific sexual hybrid N. × sanderae (2n = 2x = 18). From 1570 protoplast-derived cell colonies selected manually in five experiments, 580 tissues were sub-cultured to shoot regeneration medium. Regenerated plants were transferred to the glasshouse and screened for their morphology, chromosomal composition and disease resistance. Eighty-nine regenerated plants flowered; five were confirmed as somatic hybrids by their intermediate morphology compared with parental plants, cytological constitution and DNA-marker analysis. Somatic hybrid plants had chromosome complements of 60 or 62. Chromosomes were identified to parental genomes by genomic in situ hybridization and included all 18 chromosomes from N. × sanderae, and 42 or 44 chromosomes from N. debneyi. Four or six chromosomes of one ancestral genome of N. debneyi were eliminated during culture of electrofusion-treated protoplasts and plant regeneration. Both chloroplasts and mitochondria of the somatic hybrid plants were probably derived from N. debneyi. All somatic hybrid plants were fertile. In contrast to parental plants of N. × sanderae, the seed progeny of somatic hybrid plants were resistant to infection by Peronospora tabacina, a trait introgressed from the wild parent, N. debneyi. Sexual incompatibility between N. × sanderae and N. debneyi was circumvented by somatic hybridization involving protoplast fusion. Asymmetrical nuclear hybridity was seen in the hybrids with loss of chromosomes, although importantly, somatic hybrids were fertile and stable. Expression of fungal resistance makes these somatic hybrids extremely valuable germplasm in future breeding programmes in ornamental tobacco.

Stem cell isolation by a morphology-based selection method in postnatal mouse ovary

PubMed Central

Parvari, Soraya; Abbasi, Niloufar; Malek, Valliollah Gerayeli; Amidi, Fardin; Aval, Fereydoon Sargolzaei; Roudkenar, Mehryar Habibi; Izadyar, Fariburz

2015-01-01

Introduction An increasing body of evidence has emerged regarding the existence and function of spermatogonial stem cells (SSCs); however, their female counterparts are the subject of extensive debate. Theoretically, ovarian germ stem cells (GSCs) have to reside in the murine ovary to support and replenish the follicle pool during the reproductive life span. Recently, various methods have been recruited to isolate and describe aspects of ovarian GSCs, but newer and more convenient strategies in isolation are still growing. Herein, a morphology-based method was used to isolate GSCs. Material and methods A cell suspension of mouse neonatal ovaries was cultured. Colonies of GSCs were harvested mechanically and cultivated on mouse embryonic fibroblasts (MEF). Alkaline phosphatase activity was assessed to verify stemness features of cells in colonies. Expression of germ and stem cell specific genes (Oct-4, Nanog, Fragilis, C-kit, Dazl, and Mvh) was analyzed by reverse transcription-polymerase chain reaction (RT-PCR). Immunofluorescence of Oct4, Dazl, Mvh, and SSEA-1 was also performed. Results Small colonies without a clear border appeared during the first 4 days of culture, and the size of colonies increased rapidly. Cells in colonies were positive for alkaline phosphatase activity. Reverse transcription-polymerase chain reaction showed that Oct-4, Fragilis, C-kit, Nanog, Mvh, and Dazl were expressed in colony-forming cells. Immunofluorescence revealed a positive signal for Oct4, Dazl, Mvh, and SSEA-1 in colonies as well. Conclusions The applicability of morphological selection for isolation of GSCs was verified. This method is easier and more economical than other techniques. The availability of ovarian stem cells can motivate further studies in development of oocyte and cell-based therapies. PMID:26170863

Assessing coral health and disease from digital photographs and in situ surveys.

PubMed

Page, C A; Field, S N; Pollock, F J; Lamb, J B; Shedrawi, G; Wilson, S K

2017-01-01

Methods for monitoring the status of marine communities are increasingly adopting the use of images captured in the field. However, it is not always clear how data collected from photographic images relate to historic data collected using traditional underwater visual census methods. Here, we compare coral health and disease data collected in situ by scuba divers with photographic images collected simultaneously at 12 coral reef sites. Five globally relevant coral diseases were detected on 194 colonies from in situ surveys and 79 colonies from photos, whilst 698 colonies from in situ surveys and 535 colonies from photos exhibited signs of compromised health other than disease. Comparisons of in situ surveys with photographic analyses indicated that the number of disease cases occurring in the examined coral populations (prevalence) was six times higher (4.5 vs. 0.8% of colonies), whilst compromised health was three times higher (14 vs. 4% of colonies) from in situ surveys. Skeletal eroding band disease, sponge overgrowth and presence of Waminoa flatworms were not detected in photographs, though they were identified in situ. Estimates of black band disease and abnormally pigmented coral tissues were similar between the two methods. Estimates of the bleached and healthy colonies were also similar between methods and photographic analyses were a strong predictor of bleached (r 2  = 0.8) and healthy (r 2  = 0.5) colony prevalence from in situ surveys. Moreover, when data on disease and compromised health states resulting in white or pale coral colony appearance were pooled, the prevalence of 'white' colonies from in situ (14%) and photographic analyses (11%) were statistically similar. Our results indicate that information on coral disease and health collected by in situ surveys and photographic analyses are not directly comparable, with in situ surveys generally providing higher estimates of prevalence and greater ability to identify some diseases and compromised states. Careful sampling of photographs can however identify signs of coral stress, including some coral diseases, which may be used to trigger early-warning management interventions.

Ant colony clustering with fitness perception and pheromone diffusion for community detection in complex networks

NASA Astrophysics Data System (ADS)

Ji, Junzhong; Song, Xiangjing; Liu, Chunnian; Zhang, Xiuzhen

2013-08-01

Community structure detection in complex networks has been intensively investigated in recent years. In this paper, we propose an adaptive approach based on ant colony clustering to discover communities in a complex network. The focus of the method is the clustering process of an ant colony in a virtual grid, where each ant represents a node in the complex network. During the ant colony search, the method uses a new fitness function to percept local environment and employs a pheromone diffusion model as a global information feedback mechanism to realize information exchange among ants. A significant advantage of our method is that the locations in the grid environment and the connections of the complex network structure are simultaneously taken into account in ants moving. Experimental results on computer-generated and real-world networks show the capability of our method to successfully detect community structures.

A child of the empire: British sociology and colonialism, 1940s-1960s.

PubMed

Steinmetz, George

2013-01-01

British sociology was established as an academic discipline between 1945 and 1965, just as the British Empire was gearing up for a new phase of developmental colonialism backed by the social and other sciences. Many parts of the emerging sociological discipline became entangled with colonialism. Key themes and methods in sociology and the staff of sociology departments emerged from this colonial context. Historians have tended to place postwar British sociology in the context of expanding higher education and the welfare state, and have overlooked this colonial constellation. The article reconstructs this forgotten moment of disciplinary founding and explores three of the factors that promoted colonial sociology: the Colonial Social Science Research Council, the so-called Asquith universities, and the social research institutes in the colonies; and the involvement of sociologists from the London School of Economics in training colonial officials. © 2013 Wiley Periodicals, Inc.

Isolation of the human chromosomal band Xq28 within somatic cell hybrids by fragile X site breakage.

PubMed Central

Warren, S T; Knight, S J; Peters, J F; Stayton, C L; Consalez, G G; Zhang, F P

1990-01-01

The chromosomal fragile-site mapping to Xq27.3 is associated with a frequent form of mental retardation and is prone to breakage after induced deoxyribonucleotide pool perturbation. The human hypoxanthine phosphoribosyltransferase (HPRT) and glucose-6-phosphate dehydrogenase (G6PD) genes flank the fragile X chromosome site and can be used to monitor integrity of the site in human-hamster somatic cell hybrids deficient in the rodent forms of these activities. After induction of the fragile X site, negative selection for HPRT and positive enrichment for G6PD resulted in 31 independent colonies of HPRT-,G6PD+ phenotype. Southern blot analysis demonstrated the loss of all tested markers proximal to the fragile X site with retention of all tested human Xq28 loci in a majority of the hybrids. In situ hybridization with a human-specific probe demonstrated the translocation of a small amount of human DNA to rodent chromosomes in these hybrids, suggesting chromosome breakage at the fragile X site and the subsequent translocation of Xq28. Southern blot hybridization of hybrid-cell DNA, resolved by pulsed-field gel electrophoresis, for human-specific repetitive sequences revealed abundant CpG-islands within Xq28, consistent with its known gene density. The electrophoretic banding patterns of human DNA among the hybrids were remarkably consistent, suggesting that fragile X site breakage is limited to a relatively small region in Xq27-28. These somatic cell hybrids, containing Xq27.3-qter as the sole human DNA, will aid the search for DNA associated with the fragile X site and will augment the high resolution genomic analysis of Xq28, including the identification of candidate genes for genetic-disease loci mapping to this region. Images PMID:2339126

Creating Cultural Hybridity by Exporting Metropolitan Structures and Cultures of Schooling and Educationalisation? The Emergence of a Congolese "Elite" in the 1950s as a Starting Point for Further Research

ERIC Educational Resources Information Center

DePapae, Marc; Hulstaert, Karen

2013-01-01

This article consists of five sections. First, it briefly describes the results of the authors' previous studies on the history of colonial education in view of the problem introduced by the special issue of which this article is a part. Second, it links these results to such central concepts as the so-called grammars of schooling and…

Localization of deformed wing virus (DWV) in the brains of the honeybee, Apis mellifera Linnaeus.

PubMed

Shah, Karan S; Evans, Elizabeth C; Pizzorno, Marie C

2009-10-30

Deformed wing virus (DWV) is a positive-strand RNA virus that infects European honeybees (Apis mellifera L.) and has been isolated from the brains of aggressive bees in Japan. DWV is known to be transmitted both vertically and horizontally between bees in a colony and can lead to both symptomatic and asymptomatic infections in bees. In environmentally stressful conditions, DWV can contribute to the demise of a honeybee colony. The purpose of the current study is to identify regions within the brains of honeybees where DWV replicates using in-situ hybridization. In-situ hybridizations were conducted with both sense and antisense probes on the brains of honeybees that were positive for DWV as measured by real-time RT-PCR. The visual neuropils demonstrated detectable levels of the DWV positive-strand genome. The mushroom bodies and antenna lobe neuropils also showed the presence of the viral genome. Weaker staining with the sense probe in the same regions demonstrates that the antigenome is also present and that the virus is actively replicating in these regions of the brain. These results demonstrate that in bees infected with DWV the virus is replicating in critical regions of the brain, including the neuropils responsible for vision and olfaction. Therefore DWV infection of the brain could adversely affect critical sensory functions and alter normal bee behavior.

Comparison of MI, Chromocult® coliform, and Compass CC chromogenic culture-based methods to detect Escherichia coli and total coliforms in water using 16S rRNA sequencing for colony identification.

PubMed

Maheux, Andrée F; Bouchard, Sébastien; Bérubé, Ève; Bergeron, Michel G

2017-06-01

The MI, Chromocult ® coliform, and Compass CC chromogenic culture-based methods used to assess water quality by the detection of Escherichia coli and total coliforms were compared in terms of their specificity and sensitivity, using 16S rRNA sequencing for colony identification. A sewage water sample was divided in 2-μL subsamples for testing by all three culture-based methods. All growing colonies were harvested and subjected to 16S rRNA sequencing. Test results showed that all E. coli colonies were correctly identified by all three methods, for a specificity and a sensitivity of 100%. However, for the total coliform detection, the MI agar, Chromocult ® coliform agar, and Compass CC agar were specific for only 69.2% (9/13), 47.2% (25/53), and 40.5% (17/42), whereas sensitive for 97.8% (45/46), 97.5% (39/40), and 85.7% (24/28), respectively. Thus, given the low level of specificity of these methods for the detection of total coliforms, confirming the identity of total coliform colonies could help to take public health decisions, in particular for cities connected to a public drinking water distribution system since the growth of few putative total coliform colonies on chromogenic agar is problematic and can lead to unnecessary and costly boiling notices from public health authorities.

Characteristics of cytotoxic necrotizing factor and cytolethal distending toxin producing Escherichia coli strains isolated from meat samples in Northern Ireland.

PubMed

Kadhum, H J; Ball, H J; Oswald, E; Rowe, M T

2006-08-01

Swabs collected from pig, lamb and beef carcasses and samples of pork, lamb and beef mince were cultured for Escherichia coli strains. Strains harbouring cytotoxic necrotizing factors (CNF1 and 2) and cytolethal distending toxins (CDT-I,-II,-III and -IV) were identified in plate cultures of the isolates by colony hybridization with labelled probes and multiplex PCR assays. Simplex and multiplex PCR assays were used to further characterize the isolates to determine the presence of P, S and F17 fimbriae as well as afimbrial adhesins and haemolysin. The serotype was also determined where possible. Thirty strains with the capacity to code for CNF (4), CDT (24) or both (2) were isolated and characterized, and a wide range of associated factor patterns was observed. The methods utilized were successful in demonstrating the detection of viable strains with potentially significant pathogenic factors from human food sources.

Somatic mosaicism in Fanconi anemia: Evidence of genotypic reversion in lymphohematopoietic stem cells

PubMed Central

Gregory, John J.; Wagner, John E.; Verlander, Peter C.; Levran, Orna; Batish, Sat Dev; Eide, Cindy R.; Steffenhagen, Amy; Hirsch, Betsy; Auerbach, Arleen D.

2001-01-01

Somatic mosaicism has been observed previously in the lymphocyte population of patients with Fanconi anemia (FA). To identify the cellular origin of the genotypic reversion, we examined each lymphohematopoietic and stromal cell lineage in an FA patient with a 2815–2816ins19 mutation in FANCA and known lymphocyte somatic mosaicism. DNA extracted from individually plucked peripheral blood T cell colonies and marrow colony-forming unit granulocyte–macrophage and burst-forming unit erythroid cells revealed absence of the maternal FANCA exon 29 mutation in 74.0%, 80.3%, and 86.2% of colonies, respectively. These data, together with the absence of the FANCA exon 29 mutation in Epstein–Barr virus-transformed B cells and its presence in fibroblasts, indicate that genotypic reversion, most likely because of back mutation, originated in a lymphohematopoietic stem cell and not solely in a lymphocyte population. Contrary to a predicted increase in marrow cellularity resulting from reversion in a hematopoietic stem cell, pancytopenia was progressive. Additional evaluations revealed a partial deletion of 11q in 3 of 20 bone marrow metaphase cells. By using interphase fluorescence in situ hybridization with an MLL gene probe mapped to band 11q23 to identify colony-forming unit granulocyte–macrophage and burst-forming unit erythroid cells with the 11q deletion, the abnormal clone was exclusive to colonies with the FANCA exon 29 mutation. Thus, we demonstrate the spontaneous genotypic reversion in a lymphohematopoietic stem cell. The subsequent development of a clonal cytogenetic abnormality in nonrevertant cells suggests that ex vivo correction of hematopoietic stem cells by gene transfer may not be sufficient for providing life-long stable hematopoiesis in patients with FA. PMID:11226273

In Situ Modulation of Dendritic Cells by Injectable Thermosensitive Hydrogels for Cancer Vaccines in Mice

PubMed Central

2014-01-01

Attempts to develop cell-based cancer vaccines have shown limited efficacy, partly because transplanted dendritic cells (DCs) do not survive long enough to reach the lymph nodes. The development of biomaterials capable of modulating DCs in situ to enhance antigen uptake and presentation has emerged as a novel method toward developing more efficient cancer vaccines. Here, we propose a two-step hybrid strategy to produce a more robust cell-based cancer vaccine in situ. First, a significant number of DCs are recruited to an injectable thermosensitive mPEG–PLGA hydrogel through sustained release of chemoattractants, in particular, granulocyte-macrophage colony-stimulating factor (GM-CSF). Then, these resident DCs can be loaded with cancer antigens through the use of viral or nonviral vectors. We demonstrate that GM-CSF-releasing mPEG–PLGA hydrogels successfully recruit and house DCs and macrophages, allowing the subsequent introduction of antigens by vectors to activate the resident cells, thus, initiating antigen presentation and triggering immune response. Moreover, this two-step hybrid strategy generates a high level of tumor-specific immunity, as demonstrated in both prophylactic and therapeutic models of murine melanoma. This injectable thermosensitive hydrogel shows great promise as an adjuvant for cancer vaccines, potentially providing a new approach for cell therapies through in situ modulation of cells. PMID:25207465

Annealing Ant Colony Optimization with Mutation Operator for Solving TSP.

PubMed

Mohsen, Abdulqader M

2016-01-01

Ant Colony Optimization (ACO) has been successfully applied to solve a wide range of combinatorial optimization problems such as minimum spanning tree, traveling salesman problem, and quadratic assignment problem. Basic ACO has drawbacks of trapping into local minimum and low convergence rate. Simulated annealing (SA) and mutation operator have the jumping ability and global convergence; and local search has the ability to speed up the convergence. Therefore, this paper proposed a hybrid ACO algorithm integrating the advantages of ACO, SA, mutation operator, and local search procedure to solve the traveling salesman problem. The core of algorithm is based on the ACO. SA and mutation operator were used to increase the ants population diversity from time to time and the local search was used to exploit the current search area efficiently. The comparative experiments, using 24 TSP instances from TSPLIB, show that the proposed algorithm outperformed some well-known algorithms in the literature in terms of solution quality.

Semi-permeable species boundaries in the coral genus Madracis: introgression in a brooding coral system.

PubMed

Frade, P R; Reyes-Nivia, M C; Faria, J; Kaandorp, J A; Luttikhuizen, P C; Bak, R P M

2010-12-01

Introgressive hybridization is described in several phylogenetic studies of mass-spawning corals. However, the prevalence of this process among brooding coral species is unclear. We used a mitochondrial (mtDNA: nad5) and two nuclear (nDNA: ATPSα and SRP54) intron markers to explore species barriers in the coral genus Madracis and address the role of hybridization in brooding systems. Specimens of six Caribbean Madracis morphospecies were collected from 5 to 60 m depth at Buoy One, Curaçao, supplemented by samples from Aruba, Trinidad & Tobago and Bermuda. Polymerase chain reaction and denaturing gradient gel electrophoresis were coupled to detect distinct alleles within single colonies. The recurrent nDNA phylogenetic non-monophyly among taxa is only challenged by Madracis senaria, the single monophyletic species within the genus. nDNA AMOVAs indicated overall statistical divergence (0.1% significance level) among species but pairwise comparisons of genetic differentiation revealed some gene exchange between Madracis taxa. mtDNA sequences clustered in two main groups representing typical shallow and deep water Madracis species. Madracis pharensis shallow and deep colonies (with threshold at about 23-24 m) clustered in different mtDNA branches, together with their depth-sympatric congenerics. This divergence was repeated for the nDNA (ATPSα) suggestive of distinct M. pharensis depth populations. These matched the vertical distribution of the dinoflagellate symbionts hosted by M. pharensis, with Symbiodinium ITS2 type B7 in the shallows but type B15 in the deep habitats, suggesting symbiont-related disruptive selection. Recurrent non-monophyly of Madracis taxa and high levels of shared polymorphism reflected in ambiguous phylogenetic networks indicate that hybridization is likely to have played a role in the evolution of the genus. Using coalescent forward-in-time simulations, lineage sorting alone was rejected as an explanation to the SRP54 genetic variation contained in Madracis mirabilis and Madracis decactis (species with an old fossil record), showing that introgressive hybridization has taken place between these species, either directly or through the gene pool of other Madracis taxa. Madracis widespread non-monophyly and the absence of statistical divergence between some species suggest that introgressive hybridization plays an important role in the evolution of the genus. Different reproductive traits and symbiont signatures of taxa forming distinct genetic clusters also point to the same conclusion. We suggest that Madracis morphospecies remain recognizable because introgressive hybridization is non-pervasive and/or because disruptive selection is in action. Copyright © 2010 Elsevier Inc. All rights reserved.

An improved self-adaptive ant colony algorithm based on genetic strategy for the traveling salesman problem

NASA Astrophysics Data System (ADS)

Wang, Pan; Zhang, Yi; Yan, Dong

2018-05-01

Ant Colony Algorithm (ACA) is a powerful and effective algorithm for solving the combination optimization problem. Moreover, it was successfully used in traveling salesman problem (TSP). But it is easy to prematurely converge to the non-global optimal solution and the calculation time is too long. To overcome those shortcomings, a new method is presented-An improved self-adaptive Ant Colony Algorithm based on genetic strategy. The proposed method adopts adaptive strategy to adjust the parameters dynamically. And new crossover operation and inversion operation in genetic strategy was used in this method. We also make an experiment using the well-known data in TSPLIB. The experiment results show that the performance of the proposed method is better than the basic Ant Colony Algorithm and some improved ACA in both the result and the convergence time. The numerical results obtained also show that the proposed optimization method can achieve results close to the theoretical best known solutions at present.

Transfer of chromosome 3 fragments suppresses tumorigenicity of an ovarian cancer cell line monoallelic for chromosome 3p.

PubMed

Cody, N A L; Ouellet, V; Manderson, E N; Quinn, M C J; Filali-Mouhim, A; Tellis, P; Zietarska, M; Provencher, D M; Mes-Masson, A-M; Chevrette, M; Tonin, P N

2007-01-25

Multiple chromosome 3p tumor suppressor genes (TSG) have been proposed in the pathogenesis of ovarian cancer based on complex patterns of 3p loss. To attain functional evidence in support of TSGs and identify candidate regions, we applied a chromosome transfer method involving cell fusions of the tumorigenic OV90 human ovarian cancer cell line, monoallelic for 3p and an irradiated mouse cell line containing a human chromosome 3 in order to derive OV90 hybrids containing normal 3p fragments. The resulting hybrids showed complete or incomplete suppression of tumorigenicity in nude mouse xenograft assays, and varied in their ability to form colonies in soft agarose and three-dimensional spheroids in a manner consistent with alteration of their in vivo tumorigenic phenotypes. Expression microarray analysis identified a set of common differentially expressed genes, such as SPARC, DAB2 and VEGF, some of which have been shown implicated in ovarian cancer. Genotyping assays revealed that they harbored normal 3p fragments, some of which overlapped candidate TSG regions (3p25-p26, 3p24 and 3p14-pcen) identified previously in loss of heterozygosity analyses of ovarian cancers. However, only the 3p12-pcen region was acquired in common by all hybrids where expression microarray analysis identified differentially expressed genes. The correlation of 3p12-pcen transfer and tumor suppression with a concerted re-programming of the cellular transcriptome suggest that the putative TSG may have affected key underlying events in ovarian cancer.

Assignment of the human glutamate receptor gene GLUR5 to 21q22 by screening a chromosome 21 YAC library

DOE Office of Scientific and Technical Information (OSTI.GOV)

Potier, M.C.; Dutriaux, A.; Lambolez, B.

1993-03-01

Ionotropic L-glutamate receptors form transmembrane channels permeant to cations which are involved in synaptic transmission. Nine different subunits coding for non-NMDA (N-methyl-D-aspartate) receptors have been cloned and sequenced in rat. One of them, the GluR5 subunit, has a high affinity binding site for kainate and is expressed in neurons of the developing and adult nervous system. The permeability of the GluR5 receptor channel is modulated by edition of the transcripts. In human, GluR1 and GluR2 cDNAs have been sequenced and mapped to chromosomes 5 and 4, respectively. Also, GluR3 and GluR4 genes have been mapped to chromosome X and 11,more » respectively. Screening of the YAC chromosome 21 library was performed by colony hybridization on nylon Hybond-N filters at high stringency, as previously described, with the pore located in the center of the rat cDNA. Two positive colonies were obtained and analyzed for their YAC content by PFGE and Southern blotting. Only one (HY128) contained a 450-kb YAC hybridizing to the central rat cDNA probe as well as to the 5[prime] and 3[prime] end probes. Since GluR5 and GluR6 are highly homologous in rat, a probe in the 3[prime] untranslated region of GluR6, showing low homology to GluR5, was synthetized by PCR. Sequences and positions of the PCR primers on the rat sequence (9) are from 5[prime] to 3[prime]: CGACAGAAGGTTGCCAGGT (sense, position 2690-2708)/GATGTTCTGCCTTCAGTTCCAC (antisense, 3314-3335). HY128 YAC did not hybridize to the GluR6 probe (data not shown). Southern blot of human genomic DNA and yeast DNA from HY128 clone cut with EcoRI and HindIII showed the same bands of more than 10 and 6.6 kb, respectively, when hybridized to the 3[prime] end rat cDNA probe (data not shown). This last result confirms the presence of human GluR5 gene in HY128.« less

Identification of Vibrio parahaemolyticus Strains at the Species Level by PCR Targeted to the toxR Gene

PubMed Central

Kim, Yung Bu; Okuda, Jun; Matsumoto, Chiho; Takahashi, Naoki; Hashimoto, Satoru; Nishibuchi, Mitsuaki

1999-01-01

The DNA colony hybridization test with the polynucleotide probe for Vibrio parahaemolyticus toxR gene was performed. All 373 strains of V. parahaemolyticus gave positive results, and the strains belonging to four other Vibrio species including Vibrio alginolyticus gave weakly positive results, suggesting that toxR sequence variation may reflect the phylogenetic relationships of Vibrio species. We then established a toxR-targeted PCR protocol for the specific detection of V. parahaemolyticus. PMID:10074546

Big data analytics in hyperspectral imaging for detection of microbial colonies on agar plates (Conference Presentation)

NASA Astrophysics Data System (ADS)

Yoon, Seung-Chul; Park, Bosoon; Lawrence, Kurt C.

2017-05-01

Various types of optical imaging techniques measuring light reflectivity and scattering can detect microbial colonies of foodborne pathogens on agar plates. Until recently, these techniques were developed to provide solutions for hypothesis-driven studies, which focused on developing tools and batch/offline machine learning methods with well defined sets of data. These have relatively high accuracy and rapid response time because the tools and methods are often optimized for the collected data. However, they often need to be retrained or recalibrated when new untrained data and/or features are added. A big-data driven technique is more suitable for online learning of new/ambiguous samples and for mining unknown or hidden features. Although big data research in hyperspectral imaging is emerging in remote sensing and many tools and methods have been developed so far in many other applications such as bioinformatics, the tools and methods still need to be evaluated and adjusted in applications where the conventional batch machine learning algorithms were dominant. The primary objective of this study is to evaluate appropriate big data analytic tools and methods for online learning and mining of foodborne pathogens on agar plates. After the tools and methods are successfully identified, they will be applied to rapidly search big color and hyperspectral image data of microbial colonies collected over the past 5 years in house and find the most probable colony or a group of colonies in the collected big data. The meta-data, such as collection time and any unstructured data (e.g. comments), will also be analyzed and presented with output results. The expected results will be novel, big data-driven technology to correctly detect and recognize microbial colonies of various foodborne pathogens on agar plates.

Stem cell isolation by a morphology-based selection method in postnatal mouse ovary.

PubMed

Parvari, Soraya; Abbasi, Mehdi; Abbasi, Niloufar; Malek, Valliollah Gerayeli; Amidi, Fardin; Aval, Fereydoon Sargolzaei; Roudkenar, Mehryar Habibi; Izadyar, Fariburz

2015-06-19

An increasing body of evidence has emerged regarding the existence and function of spermatogonial stem cells (SSCs); however, their female counterparts are the subject of extensive debate. Theoretically, ovarian germ stem cells (GSCs) have to reside in the murine ovary to support and replenish the follicle pool during the reproductive life span. Recently, various methods have been recruited to isolate and describe aspects of ovarian GSCs, but newer and more convenient strategies in isolation are still growing. Herein, a morphology-based method was used to isolate GSCs. A cell suspension of mouse neonatal ovaries was cultured. Colonies of GSCs were harvested mechanically and cultivated on mouse embryonic fibroblasts (MEF). Alkaline phosphatase activity was assessed to verify stemness features of cells in colonies. Expression of germ and stem cell specific genes (Oct-4, Nanog, Fragilis, C-kit, Dazl, and Mvh) was analyzed by reverse transcription-polymerase chain reaction (RT-PCR). Immunofluorescence of Oct4, Dazl, Mvh, and SSEA-1 was also performed. Small colonies without a clear border appeared during the first 4 days of culture, and the size of colonies increased rapidly. Cells in colonies were positive for alkaline phosphatase activity. Reverse transcription-polymerase chain reaction showed that Oct-4, Fragilis, C-kit, Nanog, Mvh, and Dazl were expressed in colony-forming cells. Immunofluorescence revealed a positive signal for Oct4, Dazl, Mvh, and SSEA-1 in colonies as well. The applicability of morphological selection for isolation of GSCs was verified. This method is easier and more economical than other techniques. The availability of ovarian stem cells can motivate further studies in development of oocyte and cell-based therapies.

Comparison and assessment of aerial and ground estimates of waterbird colonies

USGS Publications Warehouse

Green, M.C.; Luent, M.C.; Michot, T.C.; Jeske, C.W.; Leberg, P.L.

2008-01-01

Aerial surveys are often used to quantify sizes of waterbird colonies; however, these surveys would benefit from a better understanding of associated biases. We compared estimates of breeding pairs of waterbirds, in colonies across southern Louisiana, USA, made from the ground, fixed-wing aircraft, and a helicopter. We used a marked-subsample method for ground-counting colonies to obtain estimates of error and visibility bias. We made comparisons over 2 sampling periods: 1) surveys conducted on the same colonies using all 3 methods during 3-11 May 2005 and 2) an expanded fixed-wing and ground-survey comparison conducted over 4 periods (May and Jun, 2004-2005). Estimates from fixed-wing aircraft were approximately 65% higher than those from ground counts for overall estimated number of breeding pairs and for both dark and white-plumaged species. The coefficient of determination between estimates based on ground and fixed-wing aircraft was ???0.40 for most species, and based on the assumption that estimates from the ground were closer to the true count, fixed-wing aerial surveys appeared to overestimate numbers of nesting birds of some species; this bias often increased with the size of the colony. Unlike estimates from fixed-wing aircraft, numbers of nesting pairs made from ground and helicopter surveys were very similar for all species we observed. Ground counts by one observer resulted in underestimated number of breeding pairs by 20% on average. The marked-subsample method provided an estimate of the number of missed nests as well as an estimate of precision. These estimates represent a major advantage of marked-subsample ground counts over aerial methods; however, ground counts are difficult in large or remote colonies. Helicopter surveys and ground counts provide less biased, more precise estimates of breeding pairs than do surveys made from fixed-wing aircraft. We recommend managers employ ground counts using double observers for surveying waterbird colonies when feasible. Fixed-wing aerial surveys may be suitable to determine colony activity and composition of common waterbird species. The most appropriate combination of survey approaches will be based on the need for precise and unbiased estimates, balanced with financial and logistical constraints.

Direct Colony Baiting of Termite Colonies: A Tool for Ecological Studies

Treesearch

Don McG Ewart

1991-01-01

The benefits of direct colony baiting are described: bait substrates enclosed in polyvinyl chloride tubes are applied in direct contact with the galleries of the termite nest. Attention of researchers is drawn to the potential of this method for species other than the mound-building Coptotermes 1acteus. \\t

A new method for distinguishing colony social forms of the fire ant Solenopsis invicta

USDA-ARS?s Scientific Manuscript database

Two distinct forms of colony social organization occur in the fire ant Solenopsis invicta: Colonies of the monogyne social form are headed by a single egg-laying queen, whereas those of the polygyne social form contain multiple egg-laying queens. This major difference in social organization is ass...

Deconvolving molecular signatures of interactions between microbial colonies

PubMed Central

Harn, Y.-C.; Powers, M. J.; Shank, E. A.; Jojic, V.

2015-01-01

Motivation: The interactions between microbial colonies through chemical signaling are not well understood. A microbial colony can use different molecules to inhibit or accelerate the growth of other colonies. A better understanding of the molecules involved in these interactions could lead to advancements in health and medicine. Imaging mass spectrometry (IMS) applied to co-cultured microbial communities aims to capture the spatial characteristics of the colonies’ molecular fingerprints. These data are high-dimensional and require computational analysis methods to interpret. Results: Here, we present a dictionary learning method that deconvolves spectra of different molecules from IMS data. We call this method MOLecular Dictionary Learning (MOLDL). Unlike standard dictionary learning methods which assume Gaussian-distributed data, our method uses the Poisson distribution to capture the count nature of the mass spectrometry data. Also, our method incorporates universally applicable information on common ion types of molecules in MALDI mass spectrometry. This greatly reduces model parameterization and increases deconvolution accuracy by eliminating spurious solutions. Moreover, our method leverages the spatial nature of IMS data by assuming that nearby locations share similar abundances, thus avoiding overfitting to noise. Tests on simulated datasets show that this method has good performance in recovering molecule dictionaries. We also tested our method on real data measured on a microbial community composed of two species. We confirmed through follow-up validation experiments that our method recovered true and complete signatures of molecules. These results indicate that our method can discover molecules in IMS data reliably, and hence can help advance the study of interaction of microbial colonies. Availability and implementation: The code used in this paper is available at: https://github.com/frizfealer/IMS_project. Contact: vjojic@cs.unc.edu Supplementary information: Supplementary data are available at Bioinformatics online. PMID:26072476

Recourse-based facility-location problems in hybrid uncertain environment.

PubMed

Wang, Shuming; Watada, Junzo; Pedrycz, Witold

2010-08-01

The objective of this paper is to study facility-location problems in the presence of a hybrid uncertain environment involving both randomness and fuzziness. A two-stage fuzzy-random facility-location model with recourse (FR-FLMR) is developed in which both the demands and costs are assumed to be fuzzy-random variables. The bounds of the optimal objective value of the two-stage FR-FLMR are derived. As, in general, the fuzzy-random parameters of the FR-FLMR can be regarded as continuous fuzzy-random variables with an infinite number of realizations, the computation of the recourse requires solving infinite second-stage programming problems. Owing to this requirement, the recourse function cannot be determined analytically, and, hence, the model cannot benefit from the use of techniques of classical mathematical programming. In order to solve the location problems of this nature, we first develop a technique of fuzzy-random simulation to compute the recourse function. The convergence of such simulation scenarios is discussed. In the sequel, we propose a hybrid mutation-based binary ant-colony optimization (MBACO) approach to the two-stage FR-FLMR, which comprises the fuzzy-random simulation and the simplex algorithm. A numerical experiment illustrates the application of the hybrid MBACO algorithm. The comparison shows that the hybrid MBACO finds better solutions than the one using other discrete metaheuristic algorithms, such as binary particle-swarm optimization, genetic algorithm, and tabu search.

Improved soft-agar colony assay in a fluid processing apparatus.

PubMed

Forsman, A D; Herpich, A R; Chapes, S K

1999-01-01

The standard method for quantitating bone marrow precursor cells has been to count the number of colony-forming units that form in semisolid (0.3%) agar. Recently we adapted this assay for use in hardware, the Fluid Processing Apparatus, that is flown in standard payload lockers of the space shuttle. When mouse or rat macrophage colony-forming units were measured with this hardware in ground-based assays, we found significantly more colony growth than that seen in standard plate assays. The improved growth correlates with increased agar thickness but also appears to be due to properties inherent to the Fluid Processing Apparatus. This paper describes an improved method for determining bone marrow macrophage precursor numbers in semisolid agar.

Solving the vehicle routing problem by a hybrid meta-heuristic algorithm

NASA Astrophysics Data System (ADS)

Yousefikhoshbakht, Majid; Khorram, Esmaile

2012-08-01

The vehicle routing problem (VRP) is one of the most important combinational optimization problems that has nowadays received much attention because of its real application in industrial and service problems. The VRP involves routing a fleet of vehicles, each of them visiting a set of nodes such that every node is visited by exactly one vehicle only once. So, the objective is to minimize the total distance traveled by all the vehicles. This paper presents a hybrid two-phase algorithm called sweep algorithm (SW) + ant colony system (ACS) for the classical VRP. At the first stage, the VRP is solved by the SW, and at the second stage, the ACS and 3-opt local search are used for improving the solutions. Extensive computational tests on standard instances from the literature confirm the effectiveness of the presented approach.

Microcolony Cultivation on a Soil Substrate Membrane System Selects for Previously Uncultured Soil Bacteria

PubMed Central

Ferrari, Belinda C.; Binnerup, Svend J.; Gillings, Michael

2005-01-01

Traditional microbiological methods of cultivation recover less than 1% of the total bacterial species, and the culturable portion of bacteria is not representative of the total phylogenetic diversity. Classical cultivation strategies are now known to supply excessive nutrients to a system and therefore select for fast-growing bacteria that are capable of colony or biofilm formation. New approaches to the cultivation of bacteria which rely on growth in dilute nutrient media or simulated environments are beginning to address this problem of selection. Here we describe a novel microcultivation method for soil bacteria that mimics natural conditions. Our soil slurry membrane system combines a polycarbonate membrane as a growth support and soil extract as the substrate. The result is abundant growth of uncharacterized bacteria as microcolonies. By combining microcultivation with fluorescent in situ hybridization, previously “unculturable” organisms belonging to cultivated and noncultivated divisions, including candidate division TM7, can be identified by fluorescence microscopy. Successful growth of soil bacteria as microcolonies confirmed that the missing culturable majority may have a growth strategy that is not observed when traditional cultivation indicators are used. PMID:16332866

Visualization of Biosurfactant Film Flow in a Bacillus subtilis Swarm Colony on an Agar Plate

PubMed Central

Kim, Kyunghoon; Kim, Jung Kyung

2015-01-01

Collective bacterial dynamics plays a crucial role in colony development. Although many research groups have studied the behavior of fluidic swarm colonies, the detailed mechanics of its motion remains elusive. Here, we developed a visualization method using submicron fluorescent beads for investigating the flow field in a thin layer of fluid that covers a Bacillus subtilis swarm colony growing on an agar plate. The beads were initially embedded in the agar plate and subsequently distributed spontaneously at the upper surface of the expanding colony. We conducted long-term live cell imaging of the B. subtilis colony using the fluorescent tracers, and obtained high-resolution velocity maps of microscale vortices in the swarm colony using particle image velocimetry. A distinct periodic fluctuation in the average speed and vorticity of flow in swarm colony was observed at the inner region of the colony, and correlated with the switch between bacterial swarming and growth phases. At the advancing edge of the colony, both the magnitudes of velocity and vorticity of flow in swarm colony were inversely correlated with the spreading speed of the swarm edge. The advanced imaging tool developed in this study would facilitate further understanding of the effect of micro vortices in swarm colony on the collective dynamics of bacteria. PMID:26343634

Visualization of Biosurfactant Film Flow in a Bacillus subtilis Swarm Colony on an Agar Plate.

PubMed

Kim, Kyunghoon; Kim, Jung Kyung

2015-08-26

Collective bacterial dynamics plays a crucial role in colony development. Although many research groups have studied the behavior of fluidic swarm colonies, the detailed mechanics of its motion remains elusive. Here, we developed a visualization method using submicron fluorescent beads for investigating the flow field in a thin layer of fluid that covers a Bacillus subtilis swarm colony growing on an agar plate. The beads were initially embedded in the agar plate and subsequently distributed spontaneously at the upper surface of the expanding colony. We conducted long-term live cell imaging of the B. subtilis colony using the fluorescent tracers, and obtained high-resolution velocity maps of microscale vortices in the swarm colony using particle image velocimetry. A distinct periodic fluctuation in the average speed and vorticity of flow in swarm colony was observed at the inner region of the colony, and correlated with the switch between bacterial swarming and growth phases. At the advancing edge of the colony, both the magnitudes of velocity and vorticity of flow in swarm colony were inversely correlated with the spreading speed of the swarm edge. The advanced imaging tool developed in this study would facilitate further understanding of the effect of micro vortices in swarm colony on the collective dynamics of bacteria.

Dual-threshold segmentation using Arimoto entropy based on chaotic bee colony optimization

NASA Astrophysics Data System (ADS)

Li, Li

2018-03-01

In order to extract target from complex background more quickly and accurately, and to further improve the detection effect of defects, a method of dual-threshold segmentation using Arimoto entropy based on chaotic bee colony optimization was proposed. Firstly, the method of single-threshold selection based on Arimoto entropy was extended to dual-threshold selection in order to separate the target from the background more accurately. Then intermediate variables in formulae of Arimoto entropy dual-threshold selection was calculated by recursion to eliminate redundant computation effectively and to reduce the amount of calculation. Finally, the local search phase of artificial bee colony algorithm was improved by chaotic sequence based on tent mapping. The fast search for two optimal thresholds was achieved using the improved bee colony optimization algorithm, thus the search could be accelerated obviously. A large number of experimental results show that, compared with the existing segmentation methods such as multi-threshold segmentation method using maximum Shannon entropy, two-dimensional Shannon entropy segmentation method, two-dimensional Tsallis gray entropy segmentation method and multi-threshold segmentation method using reciprocal gray entropy, the proposed method can segment target more quickly and accurately with superior segmentation effect. It proves to be an instant and effective method for image segmentation.

Rapid and automated enumeration of viable bacteria in compost using a micro-colony auto counting system.

PubMed

Wang, Xiaodan; Yamaguchi, Nobuyasu; Someya, Takashi; Nasu, Masao

2007-10-01

The micro-colony method was used to enumerate viable bacteria in composts. Cells were vacuum-filtered onto polycarbonate filters and incubated for 18 h on LB medium at 37 degrees C. Bacteria on the filters were stained with SYBR Green II, and enumerated using a newly developed micro-colony auto counting system which can automatically count micro-colonies on half the area of the filter within 90 s. A large number of bacteria in samples retained physiological activity and formed micro-colonies within 18 h, whereas most could not form large colonies on conventional media within 1 week. The results showed that this convenient technique can enumerate viable bacteria in compost rapidly for its efficient quality control.

Enhanced regeneration potential of mobilized dental pulp stem cells from immature teeth.

PubMed

Nakayama, H; Iohara, K; Hayashi, Y; Okuwa, Y; Kurita, K; Nakashima, M

2017-07-01

We have previously demonstrated that dental pulp stem cells (DPSCs) isolated from mature teeth by granulocyte colony-stimulating factor (G-CSF)-induced mobilization method can enhance angiogenesis/vasculogenesis and improve pulp regeneration when compared with colony-derived DPSCs. However, the efficacy of this method in immature teeth with root-formative stage has never been investigated. Therefore, the aim of this study was to examine the stemness, biological characteristics, and regeneration potential in mobilized DPSCs compared with colony-derived DPSCs from immature teeth. Mobilized DPSCs isolated from immature teeth were compared to colony-derived DPSCs using methods including flow cytometry, migration assays, mRNA expression of angiogenic/neurotrophic factor, and induced differentiation assays. They were also compared in trophic effects of the secretome. Regeneration potential was further compared in an ectopic tooth transplantation model. Mobilized DPSCs had higher migration ability and expressed more angiogenic/neurotrophic factors than DPSCs. The mobilized DPSC secretome produced a higher stimulatory effect on migration, immunomodulation, anti-apoptosis, endothelial differentiation, and neurite extension. In addition, vascularization and pulp regeneration potential were higher in mobilized DPSCs than in DPSCs. G-CSF-induced mobilization method enhances regeneration potential of colony-derived DPSCs from immature teeth. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Genetic Stock Identification Of Production Colonies Of Russian Honey Bees

USDA-ARS?s Scientific Manuscript database

The prevalence of Nosema ceranae in managed honey bee colonies has increased dramatically in the past 10 – 20 years worldwide. A variety of genetic testing methods for species identification and prevalence are now available. However sample size and preservation method of samples prior to testing hav...

Monitoring colony-level effects of sublethal pesticide exposure on honey bees

USDA-ARS?s Scientific Manuscript database

The effects of sublethal pesticide exposure to honey bee colonies may be significant but difficult to detect in the field using standard visual assessment methods. Here we describe methods to measure the quantities of adult bees, brood and food resources by weighing hives and hive parts, by photogra...

Simplified methods of evaluating colonies for levels of Varroa Sensitive Hygiene (VSH)

USDA-ARS?s Scientific Manuscript database

Varroa sensitive hygiene (VSH) is a trait of honey bees, Apis mellifera, that supports resistance to varroa mites, Varroa destructor. Components of VSH were evaluated to identify simple methods for selection of the trait. Varroa mite population growth was measured in colonies with variable levels of...

MicroRNA-26a Promotes Cholangiocarcinoma Growth by Activating β-catenin

PubMed Central

Zhang, Jinqiang; Han, Chang; Wu, Tong

2013-01-01

Background & Aims MicroRNAs (miRNAs) have been implicated in the development and progression of human cancers. We investigated the roles and mechanisms of miR-26a in human cholangiocarcinoma. Methods We used in situ hybridization and quantitative reverse transcriptase polymerase chain reaction to measure expression of miR-26a in human cholangiocarcinoma tissues and cell lines (eg, CCLP1, SG231, HuCCT1, TFK1). Human cholangiocarcinoma cell lines were transduced with lentiviruses that expressed miR-26a1 or a scrambled sequence (control); proliferation and colony formation were analyzed. We analyzed growth of human cholangiocarcinoma cells that overexpress miR-26a or its inhibitor in severe combined immune-deficient mice. Immunoblot, immunoprecipitation, DNA pull-down, immunofluorescence, and luciferase reporter assays were used to measure expression and activity of glycogen synthase kinase (GSK)-3β, β-catenin, and related signaling molecules. Results Human cholangiocarcinoma tissues and cell lines had increased levels of miR-26a compared with the noncancerous biliary epithelial cells. Overexpression of miR-26a increased proliferation of cholangiocarcinoma cells and colony formation in vitro, whereas miR-26 depletion reduced these parameters. In severe combined immune-deficient mice, overexpression of miR-26a by cholangiocarcinoma cells increased tumor growth and overexpression of the miR-26a inhibitor reduced it. GSK-3β messenger RNA was identified as a direct target of miR-26a by computational analysis and experimental assays. miR-26a–mediated reduction of GSK-3β resulted in activation of β-catenin and induction of several downstream genes including c-Myc, cyclinD1, and peroxisome proliferator-activated receptor δ. Depletion of β-catenin partially prevented miR-26a-induced tumor cell proliferation and colony formation. Conclusions miR-26a promotes cholangiocarcinoma growth by inhibition of GSK-3β and subsequent activation of β-catenin. These signaling molecules might be targets for prevention or treatment of cholangiocarcinoma. PMID:22484120

Development of a Monitoring Method for Nonlabeled Human Pluripotent Stem Cell Growth by Time-Lapse Image Analysis.

PubMed

Suga, Mika; Kii, Hiroaki; Niikura, Keiichi; Kiyota, Yasujiro; Furue, Miho K

2015-07-01

: Cell growth is an important criterion for determining healthy cell conditions. When somatic cells or cancer cells are dissociated into single cells for passaging, the cell numbers can be counted at each passage, providing information on cell growth as an indicator of the health conditions of these cells. In the case of human pluripotent stem cells (hPSCs), because the cells are usually dissociated into cell clumps of ∼50-100 cells for passaging, cell counting is time-consuming. In the present study, using a time-lapse imaging system, we developed a method to determine the growth of hPSCs from nonlabeled live cell phase-contrast images without damaging these cells. Next, the hPSC colony areas and number of nuclei were determined and used to derive equations to calculate the cell number in hPSC colonies, which were assessed on time-lapse images acquired using a culture observation system. The relationships between the colony areas and nuclei numbers were linear, although the equation coefficients were dependent on the cell line used, colony size, colony morphology, and culture conditions. When the culture conditions became improper, the change in cell growth conditions could be detected by analysis of the phase-contrast images. This method provided real-time information on colony growth and cell growth rates without using treatments that can damage cells and could be useful for basic research on hPSCs and cell processing for hPSC-based therapy. This is the first study to use a noninvasive method using images to systemically determine the growth of human pluripotent stem cells (hPSCs) without damaging or wasting cells. This method would be useful for quality control during cell culture of clinical hPSCs. ©AlphaMed Press.

An American termite in Paris: temporal colony dynamics.

PubMed

Baudouin, Guillaume; Dedeine, Franck; Bech, Nicolas; Bankhead-Dronnet, Stéphanie; Dupont, Simon; Bagnères, Anne-Geneviève

2017-12-01

Termites of the genus Reticulitermes are widespread invaders, particularly in urban habitats. Their cryptic and subterranean lifestyle makes them difficult to detect, and we know little about their colony dynamics over time. In this study we examined the persistence of Reticulitermes flavipes (Kollar) colonies in the city of Paris over a period of 15 years. The aim was (1) to define the boundaries of colonies sampled within the same four areas over two sampling periods, (2) to determine whether the colonies identified during the first sampling period persisted to the second sampling period, and (3) to compare the results obtained when colonies were delineated using a standard population genetic approach versus a Bayesian clustering method that combined both spatial and genetic information. Herein, colony delineations were inferred from genetic differences at nine microsatellite loci and one mitochondrial locus. Four of the 18 identified colonies did not show significant differences in their genotype distributions between the two sampling periods. While allelic richness was low, making it hard to reliably distinguish colony family type, most colonies appeared to retain the same breeding structure over time. These large and expansive colonies showed an important ability to fuse (39% were mixed-family colonies), contained hundreds of reproductives and displayed evidence of isolation-by-distance, suggesting budding dispersal. These traits, which favor colony persistence over time, present a challenge for pest control efforts, which apply treatment locally. The other colonies showed significant differences, but we cannot exclude the possibility that their genotype distributions simply changed over time.

An intelligent identification algorithm for the monoclonal picking instrument

NASA Astrophysics Data System (ADS)

Yan, Hua; Zhang, Rongfu; Yuan, Xujun; Wang, Qun

2017-11-01

The traditional colony selection is mainly operated by manual mode, which takes on low efficiency and strong subjectivity. Therefore, it is important to develop an automatic monoclonal-picking instrument. The critical stage of the automatic monoclonal-picking and intelligent optimal selection is intelligent identification algorithm. An auto-screening algorithm based on Support Vector Machine (SVM) is proposed in this paper, which uses the supervised learning method, which combined with the colony morphological characteristics to classify the colony accurately. Furthermore, through the basic morphological features of the colony, system can figure out a series of morphological parameters step by step. Through the establishment of maximal margin classifier, and based on the analysis of the growth trend of the colony, the selection of the monoclonal colony was carried out. The experimental results showed that the auto-screening algorithm could screen out the regular colony from the other, which meets the requirement of various parameters.

Validation of an automated colony counting system for group A Streptococcus.

PubMed

Frost, H R; Tsoi, S K; Baker, C A; Laho, D; Sanderson-Smith, M L; Steer, A C; Smeesters, P R

2016-02-08

The practice of counting bacterial colony forming units on agar plates has long been used as a method to estimate the concentration of live bacteria in culture. However, due to the laborious and potentially error prone nature of this measurement technique, an alternative method is desirable. Recent technologic advancements have facilitated the development of automated colony counting systems, which reduce errors introduced during the manual counting process and recording of information. An additional benefit is the significant reduction in time taken to analyse colony counting data. Whilst automated counting procedures have been validated for a number of microorganisms, the process has not been successful for all bacteria due to the requirement for a relatively high contrast between bacterial colonies and growth medium. The purpose of this study was to validate an automated counting system for use with group A Streptococcus (GAS). Twenty-one different GAS strains, representative of major emm-types, were selected for assessment. In order to introduce the required contrast for automated counting, 2,3,5-triphenyl-2H-tetrazolium chloride (TTC) dye was added to Todd-Hewitt broth with yeast extract (THY) agar. Growth on THY agar with TTC was compared with growth on blood agar and THY agar to ensure the dye was not detrimental to bacterial growth. Automated colony counts using a ProtoCOL 3 instrument were compared with manual counting to confirm accuracy over the stages of the growth cycle (latent, mid-log and stationary phases) and in a number of different assays. The average percentage differences between plating and counting methods were analysed using the Bland-Altman method. A percentage difference of ±10 % was determined as the cut-off for a critical difference between plating and counting methods. All strains measured had an average difference of less than 10 % when plated on THY agar with TTC. This consistency was also observed over all phases of the growth cycle and when plated in blood following bactericidal assays. Agreement between these methods suggest the use of an automated colony counting technique for GAS will significantly reduce time spent counting bacteria to enable a more efficient and accurate measurement of bacteria concentration in culture.

Study of budding yeast colony formation and its characterizations by using circular granular cell

NASA Astrophysics Data System (ADS)

Aprianti, D.; Haryanto, F.; Purqon, A.; Khotimah, S. N.; Viridi, S.

2016-03-01

Budding yeast can exhibit colony formation in solid substrate. The colony of pathogenic budding yeast can colonize various surfaces of the human body and medical devices. Furthermore, it can form biofilm that resists drug effective therapy. The formation of the colony is affected by the interaction between cells and with its growth media. The cell budding pattern holds an important role in colony expansion. To study this colony growth, the molecular dynamic method was chosen to simulate the interaction between budding yeast cells. Every cell was modelled by circular granular cells, which can grow and produce buds. Cohesion force, contact force, and Stokes force govern this model to mimic the interaction between cells and with the growth substrate. Characterization was determined by the maximum (L max) and minimum (L min) distances between two cells within the colony and whether two lines that connect the two cells in the maximum and minimum distances intersect each other. Therefore, it can be recognized the colony shape in circular, oval, and irregular shapes. Simulation resulted that colony formation are mostly in oval shape with little branch. It also shows that greater cohesion strength obtains more compact colony formation.

Improved Ant Algorithms for Software Testing Cases Generation

PubMed Central

Yang, Shunkun; Xu, Jiaqi

2014-01-01

Existing ant colony optimization (ACO) for software testing cases generation is a very popular domain in software testing engineering. However, the traditional ACO has flaws, as early search pheromone is relatively scarce, search efficiency is low, search model is too simple, positive feedback mechanism is easy to porduce the phenomenon of stagnation and precocity. This paper introduces improved ACO for software testing cases generation: improved local pheromone update strategy for ant colony optimization, improved pheromone volatilization coefficient for ant colony optimization (IPVACO), and improved the global path pheromone update strategy for ant colony optimization (IGPACO). At last, we put forward a comprehensive improved ant colony optimization (ACIACO), which is based on all the above three methods. The proposed technique will be compared with random algorithm (RND) and genetic algorithm (GA) in terms of both efficiency and coverage. The results indicate that the improved method can effectively improve the search efficiency, restrain precocity, promote case coverage, and reduce the number of iterations. PMID:24883391

Application of hybrid artificial fish swarm algorithm based on similar fragments in VRP

NASA Astrophysics Data System (ADS)

Che, Jinnuo; Zhou, Kang; Zhang, Xueyu; Tong, Xin; Hou, Lingyun; Jia, Shiyu; Zhen, Yiting

2018-03-01

Focused on the issue that the decrease of convergence speed and the precision of calculation at the end of the process in Artificial Fish Swarm Algorithm(AFSA) and instability of results, a hybrid AFSA based on similar fragments is proposed. Traditional AFSA enjoys a lot of obvious advantages in solving complex optimization problems like Vehicle Routing Problem(VRP). AFSA have a few limitations such as low convergence speed, low precision and instability of results. In this paper, two improvements are introduced. On the one hand, change the definition of the distance for artificial fish, as well as increase vision field of artificial fish, and the problem of speed and precision can be improved when solving VRP. On the other hand, mix artificial bee colony algorithm(ABC) into AFSA - initialize the population of artificial fish by the ABC, and it solves the problem of instability of results in some extend. The experiment results demonstrate that the optimal solution of the hybrid AFSA is easier to approach the optimal solution of the standard database than the other two algorithms. In conclusion, the hybrid algorithm can effectively solve the problem that instability of results and decrease of convergence speed and the precision of calculation at the end of the process.

Molecular cloning of cDNAs for the nerve-cell specific phosphoprotein, synapsin I.

PubMed Central

Kilimann, M W; DeGennaro, L J

1985-01-01

To provide access to synapsin I-specific DNA sequences, we have constructed cDNA clones complementary to synapsin I mRNA isolated from rat brain. Synapsin I mRNA was specifically enriched by immunoadsorption of polysomes prepared from the brains of 10-14 day old rats. Employing this enriched mRNA, a cDNA library was constructed in pBR322 and screened by differential colony hybridization with single-stranded cDNA probes made from synapsin I mRNA and total polysomal poly(A)+ RNA. This screening procedure proved to be highly selective. Five independent recombinant plasmids which exhibited distinctly stronger hybridization with the synapsin I probe were characterized further by restriction mapping. All of the cDNA inserts gave restriction enzyme digestion patterns which could be aligned. In addition, some of the cDNA inserts were shown to contain poly(dA) sequences. Final identification of synapsin I cDNA clones relied on the ability of the cDNA inserts to hybridize specifically to synapsin I mRNA. Several plasmids were tested by positive hybridization selection. They specifically selected synapsin I mRNA which was identified by in vitro translation and immunoprecipitation of the translation products. The established cDNA clones were used for a blot-hybridization analysis of synapsin I mRNA. A fragment (1600 bases) from the longest cDNA clone hybridized with two discrete RNA species 5800 and 4500 bases long, in polyadenylated RNA from rat brain and PC12 cells. No hybridization was detected to RNA from rat liver, skeletal muscle or cardiac muscle. Images Fig. 1. Fig. 2. Fig. 4. Fig. 5. PMID:3933975

A seismic fault recognition method based on ant colony optimization

NASA Astrophysics Data System (ADS)

Chen, Lei; Xiao, Chuangbai; Li, Xueliang; Wang, Zhenli; Huo, Shoudong

2018-05-01

Fault recognition is an important section in seismic interpretation and there are many methods for this technology, but no one can recognize fault exactly enough. For this problem, we proposed a new fault recognition method based on ant colony optimization which can locate fault precisely and extract fault from the seismic section. Firstly, seismic horizons are extracted by the connected component labeling algorithm; secondly, the fault location are decided according to the horizontal endpoints of each horizon; thirdly, the whole seismic section is divided into several rectangular blocks and the top and bottom endpoints of each rectangular block are considered as the nest and food respectively for the ant colony optimization algorithm. Besides that, the positive section is taken as an actual three dimensional terrain by using the seismic amplitude as a height. After that, the optimal route from nest to food calculated by the ant colony in each block is judged as a fault. Finally, extensive comparative tests were performed on the real seismic data. Availability and advancement of the proposed method were validated by the experimental results.

Development of uracil-DNA-glycosylase-supplemented loop-mediated isothermal amplification coupled with nanogold probe (UDG-LAMP-AuNP) for specific detection of Pseudomonas aeruginosa.

PubMed

Manajit, Orapan; Longyant, Siwaporn; Sithigorngul, Paisarn; Chaivisuthangkura, Parin

2018-04-01

Pseudomonas aeruginosa (P. aeruginosa) is an important opportunistic pathogen that causes serious infections in humans, including keratitis in contact lens wearers. Therefore, establishing a rapid, specific and sensitive method for the identification of P. aeruginosa is imperative. In the present study, the uracil-DNA-glycosylase-supplemented loop-mediated isothermal amplification combined with nanogold labeled hybridization probe (UDG-LAMP-AuNP) was developed for the detection of P. aeruginosa. UDG-LAMP was performed to prevent carry over contamination and the LAMP reactions can be readily observed using the nanogold probe. A set of 4 primers and a hybridization probe were designed based on the ecfX gene. The UDG-LAMP reactions were performed at 65˚C for 60 min using the ratio of 40% deoxyuridine triphosphate to 60% deoxythymidine triphosphate. The detection of UDG-LAMP products using the nanogold labeled hybridization probe, which appeared as a red-purple color, was examined at 65˚C for 5 min with 40 mM MgSO4. The UDG-LAMP-AuNP demonstrated specificity to all tested isolates of P. aeruginosa without cross reaction to other bacteria. The sensitivity for the detection of pure culture was 1.6x103 colony-forming units (CFU) ml-1 or equivalent to 3 CFU per reaction while that of polymerase chain reaction was 30 CFU per reaction. The detection limit of spiked contact lenses was 1.1x103 CFU ml-1 or equivalent to 2 CFU per reaction. In conclusion, the UDG-LAMP-AuNP assay was rapid, simple, specific and was effective for the identification of P. aeruginosa in contaminated samples.

Development of uracil-DNA-glycosylase-supplemented loop-mediated isothermal amplification coupled with nanogold probe (UDG-LAMP-AuNP) for specific detection of Pseudomonas aeruginosa

PubMed Central

Manajit, Orapan; Longyant, Siwaporn; Sithigorngul, Paisarn; Chaivisuthangkura, Parin

2018-01-01

Pseudomonas aeruginosa (P. aeruginosa) is an important opportunistic pathogen that causes serious infections in humans, including keratitis in contact lens wearers. Therefore, establishing a rapid, specific and sensitive method for the identification of P. aeruginosa is imperative. In the present study, the uracil-DNA-glycosylase-supplemented loop-mediated isothermal amplification combined with nanogold labeled hybridization probe (UDG-LAMP-AuNP) was developed for the detection of P. aeruginosa. UDG-LAMP was performed to prevent carry over contamination and the LAMP reactions can be readily observed using the nanogold probe. A set of 4 primers and a hybridization probe were designed based on the ecfX gene. The UDG-LAMP reactions were performed at 65°C for 60 min using the ratio of 40% deoxyuridine triphosphate to 60% deoxythymidine triphosphate. The detection of UDG-LAMP products using the nanogold labeled hybridization probe, which appeared as a red-purple color, was examined at 65°C for 5 min with 40 mM MgSO4. The UDG-LAMP-AuNP demonstrated specificity to all tested isolates of P. aeruginosa without cross reaction to other bacteria. The sensitivity for the detection of pure culture was 1.6×103 colony-forming units (CFU) ml−1 or equivalent to 3 CFU per reaction while that of polymerase chain reaction was 30 CFU per reaction. The detection limit of spiked contact lenses was 1.1×103 CFU ml−1 or equivalent to 2 CFU per reaction. In conclusion, the UDG-LAMP-AuNP assay was rapid, simple, specific and was effective for the identification of P. aeruginosa in contaminated samples. PMID:29436623

Novel Perspectives on the Characterization of Species-Dependent Optical Signatures of Bacterial Colonies by Digital Holography.

PubMed

Buzalewicz, Igor; Kujawińska, Małgorzata; Krauze, Wojciech; Podbielska, Halina

2016-01-01

The use of light diffraction for the microbiological diagnosis of bacterial colonies was a significant breakthrough with widespread implications for the food industry and clinical practice. We previously confirmed that optical sensors for bacterial colony light diffraction can be used for bacterial identification. This paper is focused on the novel perspectives of this method based on digital in-line holography (DIH), which is able to reconstruct the amplitude and phase properties of examined objects, as well as the amplitude and phase patterns of the optical field scattered/diffracted by the bacterial colony in any chosen observation plane behind the object from single digital hologram. Analysis of the amplitude and phase patterns inside a colony revealed its unique optical properties, which are associated with the internal structure and geometry of the bacterial colony. Moreover, on a computational level, it is possible to select the desired scattered/diffracted pattern within the entire observation volume that exhibits the largest amount of unique, differentiating bacterial features. These properties distinguish this method from the already proposed sensing techniques based on light diffraction/scattering of bacterial colonies. The reconstructed diffraction patterns have a similar spatial distribution as the recorded Fresnel patterns, previously applied for bacterial identification with over 98% accuracy, but they are characterized by both intensity and phase distributions. Our results using digital holography provide new optical discriminators of bacterial species revealed in one single step in form of new optical signatures of bacterial colonies: digital holograms, reconstructed amplitude and phase patterns, as well as diffraction patterns from all observation space, which exhibit species-dependent features. To the best of our knowledge, this is the first report on bacterial colony analysis via digital holography and our study represents an innovative approach to the subject.

Novel Perspectives on the Characterization of Species-Dependent Optical Signatures of Bacterial Colonies by Digital Holography

PubMed Central

Buzalewicz, Igor; Kujawińska, Małgorzata; Krauze, Wojciech; Podbielska, Halina

2016-01-01

The use of light diffraction for the microbiological diagnosis of bacterial colonies was a significant breakthrough with widespread implications for the food industry and clinical practice. We previously confirmed that optical sensors for bacterial colony light diffraction can be used for bacterial identification. This paper is focused on the novel perspectives of this method based on digital in-line holography (DIH), which is able to reconstruct the amplitude and phase properties of examined objects, as well as the amplitude and phase patterns of the optical field scattered/diffracted by the bacterial colony in any chosen observation plane behind the object from single digital hologram. Analysis of the amplitude and phase patterns inside a colony revealed its unique optical properties, which are associated with the internal structure and geometry of the bacterial colony. Moreover, on a computational level, it is possible to select the desired scattered/diffracted pattern within the entire observation volume that exhibits the largest amount of unique, differentiating bacterial features. These properties distinguish this method from the already proposed sensing techniques based on light diffraction/scattering of bacterial colonies. The reconstructed diffraction patterns have a similar spatial distribution as the recorded Fresnel patterns, previously applied for bacterial identification with over 98% accuracy, but they are characterized by both intensity and phase distributions. Our results using digital holography provide new optical discriminators of bacterial species revealed in one single step in form of new optical signatures of bacterial colonies: digital holograms, reconstructed amplitude and phase patterns, as well as diffraction patterns from all observation space, which exhibit species-dependent features. To the best of our knowledge, this is the first report on bacterial colony analysis via digital holography and our study represents an innovative approach to the subject. PMID:26943121

Identifying bacterial predictors of honey bee health.

PubMed

Budge, Giles E; Adams, Ian; Thwaites, Richard; Pietravalle, Stéphane; Drew, Georgia C; Hurst, Gregory D D; Tomkies, Victoria; Boonham, Neil; Brown, Mike

2016-11-01

Non-targeted approaches are useful tools to identify new or emerging issues in bee health. Here, we utilise next generation sequencing to highlight bacteria associated with healthy and unhealthy honey bee colonies, and then use targeted methods to screen a wider pool of colonies with known health status. Our results provide the first evidence that bacteria from the genus Arsenophonus are associated with poor health in honey bee colonies. We also discovered Lactobacillus and Leuconostoc spp. were associated with healthier honey bee colonies. Our results highlight the importance of understanding how the wider microbial population relates to honey bee colony health. Crown Copyright © 2016. Published by Elsevier Inc. All rights reserved.

Detection and Length Estimation of Linear Scratch on Solid Surfaces Using an Angle Constrained Ant Colony Technique

NASA Astrophysics Data System (ADS)

Pal, Siddharth; Basak, Aniruddha; Das, Swagatam

In many manufacturing areas the detection of surface defects is one of the most important processes in quality control. Currently in order to detect small scratches on solid surfaces most of the industries working on material manufacturing rely on visual inspection primarily. In this article we propose a hybrid computational intelligence technique to automatically detect a linear scratch from a solid surface and estimate its length (in pixel unit) simultaneously. The approach is based on a swarm intelligence algorithm called Ant Colony Optimization (ACO) and image preprocessing with Wiener and Sobel filters as well as the Canny edge detector. The ACO algorithm is mostly used to compensate for the broken parts of the scratch. Our experimental results confirm that the proposed technique can be used for detecting scratches from noisy and degraded images, even when it is very difficult for conventional image processing to distinguish the scratch area from its background.

Annealing Ant Colony Optimization with Mutation Operator for Solving TSP

PubMed Central

2016-01-01

Ant Colony Optimization (ACO) has been successfully applied to solve a wide range of combinatorial optimization problems such as minimum spanning tree, traveling salesman problem, and quadratic assignment problem. Basic ACO has drawbacks of trapping into local minimum and low convergence rate. Simulated annealing (SA) and mutation operator have the jumping ability and global convergence; and local search has the ability to speed up the convergence. Therefore, this paper proposed a hybrid ACO algorithm integrating the advantages of ACO, SA, mutation operator, and local search procedure to solve the traveling salesman problem. The core of algorithm is based on the ACO. SA and mutation operator were used to increase the ants population diversity from time to time and the local search was used to exploit the current search area efficiently. The comparative experiments, using 24 TSP instances from TSPLIB, show that the proposed algorithm outperformed some well-known algorithms in the literature in terms of solution quality. PMID:27999590

Estimating rates of local extinction and colonization in colonial species and an extension to the metapopulation and community levels

USGS Publications Warehouse

Barbraud, C.; Nichols, J.D.; Hines, J.E.; Hafner, H.

2003-01-01

Coloniality has mainly been studied from an evolutionary perspective, but relatively few studies have developed methods for modelling colony dynamics. Changes in number of colonies over time provide a useful tool for predicting and evaluating the responses of colonial species to management and to environmental disturbance. Probabilistic Markov process models have been recently used to estimate colony site dynamics using presence-absence data when all colonies are detected in sampling efforts. Here, we define and develop two general approaches for the modelling and analysis of colony dynamics for sampling situations in which all colonies are, and are not, detected. For both approaches, we develop a general probabilistic model for the data and then constrain model parameters based on various hypotheses about colony dynamics. We use Akaike's Information Criterion (AIC) to assess the adequacy of the constrained models. The models are parameterised with conditional probabilities of local colony site extinction and colonization. Presence-absence data arising from Pollock's robust capture-recapture design provide the basis for obtaining unbiased estimates of extinction, colonization, and detection probabilities when not all colonies are detected. This second approach should be particularly useful in situations where detection probabilities are heterogeneous among colony sites. The general methodology is illustrated using presence-absence data on two species of herons (Purple Heron, Ardea purpurea and Grey Heron, Ardea cinerea). Estimates of the extinction and colonization rates showed interspecific differences and strong temporal and spatial variations. We were also able to test specific predictions about colony dynamics based on ideas about habitat change and metapopulation dynamics. We recommend estimators based on probabilistic modelling for future work on colony dynamics. We also believe that this methodological framework has wide application to problems in animal ecology concerning metapopulation and community dynamics.

Identification of rRNA gene loci in the wild mouse (Mus musculus molossinus) captured at Hachioji, Tokyo.

PubMed

Ito, Tsuyoshi; Osawa, Susumu; Shibata, Hideshi; Kanda, Naotoshi

2007-12-01

Mus musculus (M. m.) molossinus has been considered an independent subspecies of Mus musculus. To elucidate the evolutional origin of this subspecies, we carried out double-color FISH using 18s-28s ribosomal DNA and mouse chromosome paint probes. Among eleven rDNA loci detected, five loci on chromosomes 12, 15, 16, 18 and 19 were common to both Mus musculus (M. m.) musculus and M. m. molossinus and the other six loci, on chromosomes 1, 5, 10, 11, 13 and 17, were characteristic in M. m. molossinus. As M. m. molossinus is thought to originate from a hybrid between ancestral colonies of M. m. musculus and Mus musculus castaneus, we supposed that these six rDNA loci might have evolved after geographical isolation of the ancestral hybrid animals from M. m. musculus and M. m. castaneus.

Basal and induced granulopoiesis in outbred, F1 hybrid and inbred mice: can inbreeding depression influence the experimental practice?

PubMed

Hofer, Michal; Pospísil, Milan; Dusek, Ladislav; Holá, Jirina; Hoferová, Zuzana; Weiterová, Lenka

2010-08-01

In this study we examined differences in selected indices of granulopoiesis in outbred, F(1) hybrid and inbred mouse strains. Specifically, serum granulocyte colony-stimulating factor (G-CSF) levels, numbers of marrow granulocyte-macrophage progenitor cells and morphologically recognizable proliferative marrow granulocytic precursor cells were evaluated. These parameters were determined in untreated controls, and in mice exposed either to a non-specific stimulus (injection of saline) or to a granulopoiesis-enhancing stimulus (administration of a cyclooxygenase-2 inhibitor, meloxicam). Lower levels of G-CSF were detectable in the outbred ICR mice, which also demonstrated an enhanced response to both types of the stimuli. Considering the fact that outbred mice are closer to natural mammalian populations, including human ones, the possibility of using outbred mice, instead of the often used inbred strains, for experiments evaluating the effects of pharmacological interventions on hematopoiesis should be investigated.

Inhibition of human megakaryocytopoiesis in vitro by platelet factor 4 (PF4) and a synthetic COOH-terminal PF4 peptide.

PubMed Central

Gewirtz, A M; Calabretta, B; Rucinski, B; Niewiarowski, S; Xu, W Y

1989-01-01

We report that highly purified human platelet factor 4 (PF4) inhibits human megakaryocytopoiesis in vitro. At greater than or equal to 25 micrograms/ml, PF4 inhibited megakaryocyte colony formation approximately 80% in unstimulated cultures, and approximately 58% in cultures containing recombinant human IL 3 and granulocyte-macrophage colony-stimulating factor. Because PF4 (25 micrograms/ml) had no effect on either myeloid or erythroid colony formation lineage specificity of this effect was suggested. A synthetic COOH-terminal PF4 peptide of 24, but not 13 residues, also inhibited megakaryocyte colony formation, whereas a synthetic 18-residue beta-thromboglobulin (beta-TG) peptide and native beta-TG had no such effect when assayed at similar concentrations. The mechanism of PF4-mediated inhibition was investigated. First, we enumerated total cell number, and examined cell maturation in control colonies (n = 200) and colonies (n = 100) that arose in PF4-containing cultures. Total cells per colony did not differ dramatically in the two groups (6.1 +/- 3.0 vs. 4.2 +/- 1.6, respectively), but the numbers of mature large cells per colony was significantly decreased in the presence of PF4 when compared with controls (1.6 +/- 1.5 vs. 3.9 +/- 2.3; P less than 0.001). Second, by using the human leukemia cell line HEL as a model for primitive megakaryocytic cells, we studied the effect of PF4 on cell doubling time, on the expression of both growth-regulated (H3, p53, c-myc,and c-myb), and non-growth-regulated (beta 2-microglobulin) genes. At high concentrations of native PF4 (50 micrograms/ml), no effect on cell doubling time, or H3 or p53 expression was discerned. In contrast, c-myc and c-myb were both upregulated. These results suggested the PF4 inhibited colony formation by impeding cell maturation, as opposed to cell proliferation, perhaps by inducing expression of c-myc and c-myb. The ability of PF4 to inhibit a normal cell maturation function was then tested. Megakaryocytes were incubated in synthetic PF4, or beta-TG peptides for 18 h and effect on Factor V steady-state mRNA levels was determined in 600 individual cells by in situ hybridization. beta-TG peptide had no effect on FV mRNA levels, whereas a approximately 60% decrease in expression of Factor V mRNA was found in megakaryocytes exposed to greater than or equal 100 ng/ml synthetic COOH-terminal PF4 peptide. Accordingly, PF4 modulates megakaryocyte maturation in vitro, and may function as a negative autocrine regulator of human megakaryocytopoiesis. Images PMID:2523411

A simple agar plate preparation for effective transfer of Ureaplasma colonies onto nitrocellulose membranes for colony immunoblotting.

PubMed

Zimmerman, Carl-Ulrich R; Stiedl, Thomas; Spergser, Joachim; Rosengarten, Renate

2014-09-01

A simple method for preparing agar plates is presented, which allows an efficient transfer of Ureaplasma colonies to nitrocellulose membranes for subsequent immunological detection. This simple and reproducible procedure was used to demonstrate antigenic variation in the phase-variable mba-locus of Ureaplasma parvum serovar 3. Copyright © 2014 Elsevier B.V. All rights reserved.

Single-step colony assay for screening antibody libraries.

PubMed

Kato, Mieko; Hanyu, Yoshiro

2017-08-10

We describe a method, single-step colony assay, for simple and rapid screening of single-chain Fv fragment (scFv) libraries. Colonies of Escherichia coli expressing the scFv library are formed on a hydrophilic filter that is positioned in contact with a membrane coated with an antigen. scFv expression is triggered upon treatment of colonies with an induction reagent, following which scFvs are secreted from the cells and diffused to the antigen-coated membrane. scFvs that exhibit binding affinity for the antigen are captured by the membrane-immobilized antigen. Lastly, detection of scFv binding of the antigen on the membrane allows identification of the clones on the filter that express antigen-specific scFvs. We tested this methodology by using an anti-rabbit IgG scFv, scFv(A10B), and a rat immune scFv library. Experiments conducted using scFv(A10B) revealed that this method improves scFv expression during the colony assay. By using our method to screen an immune library of 3×10 3 scFv clones, we established several clones exhibiting affinity for the antigen. Moreover, we tested 7 other antigens, including peptides, and successfully identified positive clones. We believe that this simple procedure and controlled scFv expression of the single-step colony assay could make the antibody screening both rapid and reliable and lead to successful isolation of positive clones from antibody libraries. Copyright © 2017 Elsevier B.V. All rights reserved.

Transplantation of storm-generated coral fragments to enhance Caribbean coral reefs: A successful method but not a solution

USGS Publications Warehouse

Garrison, Virginia H.; Ward, Greg A.

2012-01-01

In response to dramatic losses of reef-building corals and ongoing lack of recovery, a small-scale coral transplant project was initiated in the Caribbean (U.S. Virgin Islands) in 1999 and was followed for 12 years. The primary objectives were to (1) identify a source of coral colonies for transplantation that would not result in damage to reefs, (2) test the feasibility of transplanting storm-generated coral fragments, and (3) develop a simple, inexpensive method for transplanting fragments that could be conducted by the local community.  The ultimate goal was to enhance abundance of threatened reef-building species on local reefs.  Storm-produced coral fragments of two threatened reef-building species [Acropora palmata and A. cervicornis (Acroporidae)] and another fast-growing species [Porites porites (Poritidae)] were collected from environments hostile to coral fragment survival and transplanted to degraded reefs.  Inert nylon cable ties were used to attach transplanted coral fragments to dead coral substrate.  Survival of 75 reference colonies and 60 transplants was assessed over 12 years. Only 9% of colonies were alive after 12 years: no A. cervicornis; 3% of A. palmata transplants and 18% of reference colonies; and 13% of P. porites transplants and 7% of reference colonies. Mortality rates for all species were high and were similar for transplant and reference colonies. Physical dislodgement resulted in the loss of 56% of colonies, whereas 35% died in place.  Only A. palmata showed a difference between transplant and reference colony survival and that was in the first year only.  Location was a factor in survival only for A. palmata reference colonies and after year 10.  Even though the tested methods and concepts were proven effective in the field over the 12-year study, they do not present a solution. No coral conservation strategy will be effective until underlying intrinsic and/or extrinsic factors driving high mortality rates are understood and mitigated or eliminated. Rev. Biol. Trop. 60 (Suppl. 1): 59-70. Epub 2012 March 01.

Passive scalar transport to and from the surface of a Pocillopora coral colony

NASA Astrophysics Data System (ADS)

Hossain, Md Monir; Staples, Anne

2016-11-01

Three-dimensional simulations of flow through a single Pocillopora coral colony were performed to examine the interaction between the flow conditions and scalar transport near a coral colony. With corals currently undergoing a third global bleaching event, a fuller understanding of the transport of nutrients, weak temperature gradients, and other passive scalars to and from the coral polyp tissue is more important than ever. The complex geometry of a coral colony poses a significant challenge for numerical simulation. To simplify grid generation and minimize computational cost, the immersed boundary method was implemented. Large eddy simulation was chosen as the framework to capture the turbulent flow field in the range of realistic Reynolds numbers of 5,000 to 30,000 and turbulent Schmidt numbers of up to 1,000. Both uniform and oscillatory flows through the colony were investigated. Significant differences were found between the cases when the scalar originated at the edge of the flow domain and was transported into the colony, versus when the scalar originated on the surface of the colony and was transported away from the coral. The domain-to-colony transport rates were found to be orders of magnitude higher than the colony-to-domain rates.

Noise-free accurate count of microbial colonies by time-lapse shadow image analysis.

PubMed

Ogawa, Hiroyuki; Nasu, Senshi; Takeshige, Motomu; Funabashi, Hisakage; Saito, Mikako; Matsuoka, Hideaki

2012-12-01

Microbial colonies in food matrices could be counted accurately by a novel noise-free method based on time-lapse shadow image analysis. An agar plate containing many clusters of microbial colonies and/or meat fragments was trans-illuminated to project their 2-dimensional (2D) shadow images on a color CCD camera. The 2D shadow images of every cluster distributed within a 3-mm thick agar layer were captured in focus simultaneously by means of a multiple focusing system, and were then converted to 3-dimensional (3D) shadow images. By time-lapse analysis of the 3D shadow images, it was determined whether each cluster comprised single or multiple colonies or a meat fragment. The analytical precision was high enough to be able to distinguish a microbial colony from a meat fragment, to recognize an oval image as two colonies contacting each other, and to detect microbial colonies hidden under a food fragment. The detection of hidden colonies is its outstanding performance in comparison with other systems. The present system attained accuracy for counting fewer than 5 colonies and is therefore of practical importance. Copyright © 2012 Elsevier B.V. All rights reserved.

Cloning of genes required for hypersensitivity and pathogenicity in Pseudomonas syringae pv. aptata.

PubMed

Minardi, P

1995-01-01

A genomic library of Pseudomonas syringae pv. aptata strain NCPPB 2664, which causes bacterial blight of sugar beet, lettuce and other plants, was constructed in the cosmid vector pCPP31. The 13.4 kb EcoRI fragment of the cosmid pHIR11, containing the hrp (hypersensitive response and pathogenicity) gene cluster of the closely related bacterium Pseudomonas syringae pv. syringae strain 61, was used as a probe to identify a homologous hrp gene cluster in P. syringae pv. aptata. Thirty of 2500 cosmid clones, screened by colony hybridization, gave a strong hybridization signal with the probe, but none of these conferred to the non-pathogenic bacterium, Pseudomonas fluorescens, the ability to elicit the hypersensitive response (HR) in tobacco. Southern blot analysis of EcoRI-digested genomic DNA of P. syringae pv. aptata showed hybridizing bands of 12 kb and 4.4 kb. Only a 12 kb fragment hybridized in digests of the cosmids. Cosmid clone pCPP1069 was mutagenized with Tn10-minitet and marker-exchanged into the genome of P. syringae pv. aptata. Three resulting prototrophic mutant strains failed to elicit the HR in tobacco and to cause disease in lettuce. The DNA flanking the Tn10-minitet insertions from mutated derivatives of pCPP1069 hybridized with the 10.6 kb Bg/II fragment of pHIR11. These results indicate that P. syringae pv. aptata harbours hrp genes that are similar to, but arranged differently from, homologous hrp genes of P. syringae pv. syringae.

Deltamethrin flea-control preserves genetic variability of black-tailed prairie dogs during a plague outbreak

USGS Publications Warehouse

Jones, P.H.; Biggins, D.E.; Eads, D.A.; Eads, S.L.; Britten, H.B.

2012-01-01

Genetic variability and structure of nine black-tailed prairie dog (BTPD, Cynomys ludovicianus) colonies were estimated with 15 unlinked microsatellite markers. A plague epizootic occurred between the first and second years of sampling and our study colonies were nearly extirpated with the exception of three colonies in which prairie dog burrows were previously dusted with an insecticide, deltamethrin, used to control fleas (vectors of the causative agent of plague, Yersinia pestis). This situation provided context to compare genetic variability and structure among dusted and non-dusted colonies pre-epizootic, and among the three dusted colonies pre- and post-epizootic. We found no statistical difference in population genetic structures between dusted and non-dusted colonies pre-epizootic. On dusted colonies, gene flow and recent migration rates increased from the first (pre-epizootic) year to the second (post-epizootic) year which suggested dusted colonies were acting as refugia for prairie dogs from surrounding colonies impacted by plague. Indeed, in the dusted colonies, estimated densities of adult prairie dogs (including dispersers), but not juveniles (non-dispersers), increased from the first year to the second year. In addition to preserving BTPDs and many species that depend on them, protecting colonies with deltamethrin or a plague vaccine could be an effective method to preserve genetic variability of prairie dogs. ?? 2011 Springer Science+Business Media B.V.

Differentiation of Mouse Ovarian Stem Cells Toward Oocyte-Like Structure by Coculture with Granulosa Cells.

PubMed

Parvari, Soraya; Yazdekhasti, Hossein; Rajabi, Zahra; Gerayeli Malek, Valliollah; Rastegar, Tayebeh; Abbasi, Mehdi

2016-11-01

An increasing body of evidence has confirmed existence and function of ovarian stem cells (OSCs). In this study, a novel approach on differentiation of OSCs into oocyte-like cells (OLCs) has been addressed. Recently, different methods have been recruited to isolate and describe aspects of OSCs, but newer and more convenient strategies in isolation are still growing. Herein, a morphology-based method was used to isolate OSCs. Cell suspension of mouse neonatal ovaries was cultured and formed colonies were harvested mechanically and cultivated on mouse embryonic fibroblasts. For differentiation induction, colonies transferred on inactive granulosa cells. Results showed that cells in colonies were positive for alkaline phosphatase activity and reverse transcription-polymerase chain reaction (RT-PCR) confirmed the pluripotency characteristics of cells. Immunofluorescence revealed a positive signal for OCT4, DAZL, MVH, and SSEA1 in colonies as well. Results of RT-PCR and immunofluorescence confirmed that some OLCs were generated within the germ stem cell (GSCs) colonies. The applicability of morphological selection for isolation of GSCs was verified. This method is easier and more economic than other techniques. Our results demonstrate that granulosa cells were effective in inducing the differentiation of OSCs into OLCs through direct cell-to-cell contacts.

Impedimetric quantification of the formation process and the chemosensitivity of cancer cell colonies suspended in 3D environment.

PubMed

Lei, Kin Fong; Wu, Zong-Ming; Huang, Chia-Hao

2015-12-15

In cancer research, colony formation assay is a gold standard for the investigation of the development of early tumors and the effects of cytotoxic agents on tumors in vitro. Quantification of cancer cell colonies suspended in hydrogel is currently achieved by manual counting under microscope. It is challenging to microscopically quantify the colony number and size without subjective bias. In this work, impedimetric quantification of cancer cell colonies suspended in hydrogel was successfully developed and provides a quantitative and objective method to describe the colony formation process and the development of colony size during the culture course. A biosensor embedded with a pair of parallel plate electrodes was fabricated for the impedimetric quantification. Cancer cell (cell line: Huh-7) were encapsulated in methyl cellulose hydrogel and cultured to gradually form cancer cell colonies suspended in 3D environment. At pre-set schedule during the culture course, small volume (50 μL) of colonies/MC hydrogel was collected, mixed with measurement hydrogel, and loaded to the biosensor for measurement. Hence, the colony formation process could be quantitatively represented by a colony index and a colony size index calculated from electrical impedance. Based on these developments, chemosensitivity of cancer cell colonies under different concentrations of anti-cancer drug, i.e., doxorubicin, was quantitatively investigated to study the efficacy of anti-cancer drug. Also, dose-response curve was constructed to calculate the IC50 value, which is an important indicator for chemosensitivity assay. These results showed the impedimetric quantification is a promising technique for the colony formation assay. Copyright © 2015 Elsevier B.V. All rights reserved.

New hybrid conjugate gradient methods with the generalized Wolfe line search.

PubMed

Xu, Xiao; Kong, Fan-Yu

2016-01-01

The conjugate gradient method was an efficient technique for solving the unconstrained optimization problem. In this paper, we made a linear combination with parameters β k of the DY method and the HS method, and putted forward the hybrid method of DY and HS. We also proposed the hybrid of FR and PRP by the same mean. Additionally, to present the two hybrid methods, we promoted the Wolfe line search respectively to compute the step size α k of the two hybrid methods. With the new Wolfe line search, the two hybrid methods had descent property and global convergence property of the two hybrid methods that can also be proved.

Isolation of Escherichia coli mutants defective in enzymes of membrane lipid synthesis.

PubMed Central

Raetz, C R

1975-01-01

A new method has been developed which permits the rapid screening of E. coli colonies for mutants with defective enzymes of phospholipid metabolism. In this procedure, a disc of filter paper is pressed down on an agar plate containing several hundred colonies of mutagen-treated cells, after which the paper is lifted off. In the process the colonies are transferred to the paper, giving rise to a replica print of the master plate. The few cells from each colony left on the master keep growing in the original pattern. The pattern of colonies is also retained on the filter paper, even after the cells are rendered permeable with lysozyme and EDTA. Colonies treated in this manner remain absorbed to the paper, where they can convert sn-(U-14-C)glycero-3-P to phosphatidyl(U-14-C)glycerophosphate, dependent on added CDP-diglyceride. Unrelated reactions of sn-(U-14-C)glycero-3-P that may obscure the synthesis of phosphatidyl-glycerophosphate are inhibited by the addition of reagents poisoning energy generation. The radioactive phospholipid that forms around each colony on the paper is precipitated in situ with trichloroacetic acid, and unreacted sn-(U-14-C)glycero-3-P is washed away. After autoradiography, the colonies on the filter paper are stained with Coomassie blue. When the autoradiogram is superimposed on the strained paper, mutants are identified as blue colonies lacking a black halo. With this method, 20,000 colonies were screened in several days. Four mutants were identified with low levels of CDP-diglyceride:snglycero-3-P phosphatidyl transferase (EC 2.7.8.5, GLYCEROL-PHOSPHATE PHOSPHATIDYLTRANSFERASE, PHOSPHATIDYLGLYCEROPHOSPHATE SYNTHETASE) IN EXTRACTS. With a similar assay, 10,000 additional colonies were screened for mutants with altered CDP-diglyceride:L-serine O-phosphatidyltransferase (EC 2.7.8.8, phosphatidylserine synthetase), and four strains were found in which the enzyme is thermolabile. The screening technique described here is termed replica printing and should be applicable not only to studies of phospholipid metabolism but also to nucleic acid and protein synthesis. Images PMID:49056

Incorporating precision, accuracy and alternative sampling designs into a continental monitoring program for colonial waterbirds

USGS Publications Warehouse

Steinkamp, Melanie J.; Peterjohn, B.G.; Keisman, J.L.

2003-01-01

A comprehensive monitoring program for colonial waterbirds in North America has never existed. At smaller geographic scales, many states and provinces conduct surveys of colonial waterbird populations. Periodic regional surveys are conducted at varying times during the breeding season using a variety of survey methods, which complicates attempts to estimate population trends for most species. The US Geological Survey Patuxent Wildlife Research Center has recently started to coordinate colonial waterbird monitoring efforts throughout North America. A centralized database has been developed with an Internet-based data entry and retrieval page. The extent of existing colonial waterbird surveys has been defined, allowing gaps in coverage to be identified and basic inventories completed where desirable. To enable analyses of comparable data at regional or larger geographic scales, sampling populations through statistically sound sampling designs should supersede obtaining counts at every colony. Standardized breeding season survey techniques have been agreed upon and documented in a monitoring manual. Each survey in the manual has associated with it recommendations for bias estimation, and includes specific instructions on measuring detectability. The methods proposed in the manual are for developing reliable, comparable indices of population size to establish trend information at multiple spatial and temporal scales, but they will not result in robust estimates of total population numbers.

Lack of evidence for an association between Iridovirus and colony collapse disorder.

PubMed

Tokarz, Rafal; Firth, Cadhla; Street, Craig; Cox-Foster, Diana L; Lipkin, W Ian

2011-01-01

Colony collapse disorder (CCD) is characterized by the unexplained losses of large numbers of adult worker bees (Apis mellifera) from apparently healthy colonies. Although infections, toxins, and other stressors have been associated with the onset of CCD, the pathogenesis of this disorder remains obscure. Recently, a proteomics study implicated a double-stranded DNA virus, invertebrate iridescent virus (Family Iridoviridae) along with a microsporidium (Nosema sp.) as the cause of CCD. We tested the validity of this relationship using two independent methods: (i) we surveyed healthy and CCD colonies from the United States and Israel for the presence of members of the Iridovirus genus and (ii) we reanalyzed metagenomics data previously generated from RNA pools of CCD colonies for the presence of Iridovirus-like sequences. Neither analysis revealed any evidence to suggest the presence of an Iridovirus in healthy or CCD colonies.

Lack of Evidence for an Association between Iridovirus and Colony Collapse Disorder

PubMed Central

Street, Craig; Cox-Foster, Diana L.; Lipkin, W. Ian

2011-01-01

Colony collapse disorder (CCD) is characterized by the unexplained losses of large numbers of adult worker bees (Apis mellifera) from apparently healthy colonies. Although infections, toxins, and other stressors have been associated with the onset of CCD, the pathogenesis of this disorder remains obscure. Recently, a proteomics study implicated a double-stranded DNA virus, invertebrate iridescent virus (Family Iridoviridae) along with a microsporidium (Nosema sp.) as the cause of CCD. We tested the validity of this relationship using two independent methods: (i) we surveyed healthy and CCD colonies from the United States and Israel for the presence of members of the Iridovirus genus and (ii) we reanalyzed metagenomics data previously generated from RNA pools of CCD colonies for the presence of Iridovirus-like sequences. Neither analysis revealed any evidence to suggest the presence of an Iridovirus in healthy or CCD colonies. PMID:21738798

Influence of Honey Bee Genotype and Wintering Method on Wintering Performance of Varroa destructor (Parasitiformes: Varroidae)-Infected Honey Bee (Hymenoptera: Apidae) Colonies in a Northern Climate.

PubMed

Bahreini, Rassol; Currie, Robert W

2015-08-01

The objective of this study was to assess the effectiveness of a cooperative breeding program designed to enhance winter survival of honey bees (Apis mellifera L.) when exposed to high levels of varroa (Varroa destructor Anderson and Trueman) in outdoor-wintered and indoor-wintered colonies. Half of the colonies from selected and unselected stocks were randomly assigned to be treated with late autumn oxalic acid treatment or to be left untreated. Colonies were then randomly assigned to be wintered either indoors (n = 37) or outdoors (n = 40). Late autumn treatment with oxalic acid did not improve wintering performance. However, genotype of bees affected colony survival and the proportion of commercially viable colonies in spring, as indicated by greater rates of colony survival and commercially viable colonies for selected stock (43% survived and 33% were viable) in comparison to unselected stock (19% survived and 9% were viable) across all treatment groups. Indoor wintering improved spring bee population score, proportion of colonies surviving, and proportion of commercially viable colonies relative to outdoor wintering (73% of selected stock and 41% of unselected stock survived during indoor wintering). Selected stock showed better "tolerance" to varroa as the selected stock also maintained higher bee populations relative to unselected stock. However, there was no evidence of "resistance" in selected colonies (reduced mite densities). Collectively, this experiment showed that breeding can improve tolerance to varroa and this can help minimize colony loss through winter and improve colony wintering performance. Overall, colony wintering success of both genotypes of bees was better when colonies were wintered indoors than when colonies were wintered outdoors. © The Authors 2015. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Generating size-controlled embryoid bodies using laser direct-write.

PubMed

Dias, A D; Unser, A M; Xie, Y; Chrisey, D B; Corr, D T

2014-06-01

Embryonic stem cells (ESCs) have the potential to self-renew and differentiate into any specialized cell type. One common method to differentiate ESCs in vitro is through embryoid bodies (EBs), three-dimensional cellular aggregates that spontaneously self-assemble and generally express markers for the three germ layers, endoderm, ectoderm, and mesoderm. It has been previously shown that both EB size and 2D colony size each influence differentiation. We hypothesized that we could control the size of the EB formed by mouse ESCs (mESCs) by using a cell printing method, laser direct-write (LDW), to control both the size of the initial printed colony and the local cell density in printed colonies. After printing mESCs at various printed colony sizes and printing densities, two-way ANOVAs indicated that the EB diameter was influenced by printing density after three days (p = 0.0002), while there was no effect of the printed colony diameter on the EB diameter at the same timepoint (p = 0.74). There was no significant interaction between these two factors. Tukey's honestly significant difference test showed that high-density colonies formed significantly larger EBs, suggesting that printed mESCs quickly aggregate with nearby cells. Thus, EBs can be engineered to a desired size by controlling printing density, which will influence the design of future differentiation studies. Herein, we highlight the capacity of LDW to control the local cell density and colony size independently, at prescribed spatial locations, potentially leading to better stem cell maintenance and directed differentiation.

Hepatocyte growth factor induces proliferation and differentiation of multipotent and erythroid hemopoietic progenitors.

PubMed

Galimi, F; Bagnara, G P; Bonsi, L; Cottone, E; Follenzi, A; Simeone, A; Comoglio, P M

1994-12-01

Hepatocyte growth factor (HGF) is a mesenchymal derived growth factor known to induce proliferation and "scattering" of epithelial and endothelial cells. Its receptor is the tyrosine kinase encoded by the c-MET protooncogene. Here we show that highly purified recombinant HGF stimulates hemopoietic progenitors to form colonies in vitro. In the presence of erythropoietin, picomolar concentrations of HGF induced the formation of erythroid burst-forming unit colonies from CD34-positive cells purified from human bone marrow, peripheral blood, or umbilical cord blood. The growth stimulatory activity was restricted to the erythroid lineage. HGF also stimulated the formation of multipotent CFU-GEMM colonies. This effect is synergized by stem cell factor, the ligand of the tyrosine kinase receptor encoded by the c-KIT protooncogene, which is active on early hemopoietic progenitors. By flow cytometry analysis, the receptor for HGF was found to be expressed on the cell surface in a fraction of CD34+ progenitors. Moreover, in situ hybridization experiments showed that HGF receptor mRNA is highly expressed in embryonic erythroid cells (megaloblasts). HGF mRNA was also found to be produced in the embryonal liver. These data show that HGF plays a direct role in the control of proliferation and differentiation of erythroid progenitors, and they suggest that it may be one of the long-sought mediators of paracrine interactions between stromal and hemopoietic cells within the hemopoietic microenvironment.

Wading birds as biological indicators 1975 colony survey

USGS Publications Warehouse

Custer, T.W.; Osborn, R.G.

1977-01-01

The suitability of wading birds (herons and their allies) as biological indicators in the coastal environment were studied in 1975 by 8 teams of investigators which located and censused 198 colonies along the Atlantic coast from Maine to Florida [USA]. Over 1/4 million breeding birds [Ardea herodias, Butorides virescens, Florida caerulea, Bubulcus ibis, Dichromanassa rufescens, Casmerodius albus, Egretta thula, Hydranassa tricolor, Nycticorax nycticorax, Nyctanassa violacea, Mycteria americana, Plegadis falcinellus, Eudocimus albus and Ajaia ajaja] were censused. The number of species in colonies ranged from 1-11. The number of 1- and 2-spp. colonies increased from Florida to Maine. Colony size decreased from Florida to Maine. Wading bird colony sites are generally active each year and the number of colonies may have recently increased in some areas of the coast. Species composition and total population of colonies fluctuate from year to year. The breeding population of wading birds was correlated with the area of coastal wetlands by state. Five teams of investigators studied the reproductive biology of 9 spp. in 13 colonies. Mean clutch size, the percentage of nests in which 1 or more eggs hatched and the overall percentage of eggs that hatched differed among colonies for some species, but no latitudinal gradient was found in any of these characteristics for any species. The use of wading birds to their full potential as biological indicators requires further exploration: survey and reproductive success methods need to be tested, the survey of colonies repeated, available historical information assembled and habitat requirements measured.

Monitoring Colony-level Effects of Sublethal Pesticide Exposure on Honey Bees

PubMed Central

Meikle, William G.; Weiss, Milagra

2017-01-01

The effects of sublethal pesticide exposure to honey bee colonies may be significant but difficult to detect in the field using standard visual assessment methods. Here we describe methods to measure the quantities of adult bees, brood, and food resources by weighing hives and hive parts, by photographing frames, and by installing hives on scales and with internal sensors. Data from these periodic evaluations are then combined with running average and daily detrended data on hive weight and internal hive temperature. The resulting datasets have been used to detect colony-level effects of imidacloprid applied in a sugar syrup as low as 5 parts per billion. The methods are objective, require little training, and provide permanent records in the form of sensor output and photographs. PMID:29286367

Characterization of western X-disease mycoplasma-like organisms

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kirkpatrick, B.C.

1986-01-01

The causal agent of western X-disease, an important disease of cherry (Prunus avium) and peach (Prunus persica) in the western United States, was shown to be a non-culturable, mycoplasma-like organism (WX-MLO). Procedures were developed to purify WX-MLOs from celery and leafhoppers infected with a greenhouse-maintained isolate of the peach yellow leaf roll (ghPYLR) strain of western X-disease. WX-MLOs, purified from ghPYLR-infected leafhoppers, elicited the production of specific antisera (WX antisera) when injected into rabbits. When used in an enzyme-linked immunosorbent assay (ELISA), WX antisera quantitatively detected WX-MLOs in celery, periwinkle, and leafhoppers experimentally infected with either ghPYLR or the Greenmore » Valley (GVX) strain of western X-disease. Recombinant clones were screened by colony, dot and southern hybridizations using /sup 32/P-nick translated DNA extracted from healthy and ghPYLR-infected celery and leafhoppers. Twenty-four clones were identified which hybridized with DNA from diseased but not healthy hosts. DNA hybridization assays, using radiolabeled, cloned WX-MLO DNA, readily detected WX-MLOs in celery, periwinkle, and leafhoppers infected with either GVX or ghPYLR and in cherry and peach with symptoms of GVX.« less

Tumor cell expression of CD163 is associated to postoperative radiotherapy and poor prognosis in patients with breast cancer treated with breast-conserving surgery.

PubMed

Garvin, Stina; Oda, Husam; Arnesson, Lars-Gunnar; Lindström, Annelie; Shabo, Ivan

2018-07-01

Cancer cell fusion with macrophages results in highly tumorigenic hybrids that acquire genetic and phenotypic characteristics from both maternal cells. Macrophage traits, exemplified by CD163 expression, in tumor cells are associated with advanced stages and poor prognosis in breast cancer (BC). In vitro data suggest that cancer cells expressing CD163 acquire radioresistance. Tissue microarray was constructed from primary BC obtained from 83 patients treated with breast-conserving surgery, 50% having received postoperative radiotherapy (RT) and none of the patients had lymph node or distant metastasis. Immunostaining of CD163 in cancer cells and macrophage infiltration (MI) in tumor stroma were evaluated. Macrophage:MCF-7 hybrids were generated by spontaneous in vitro cell fusion. After irradiation (0, 2.5 and 5 Gy γ-radiation), both hybrids and their maternal MCF-7 cells were examined by clonogenic survival. CD163-expression by cancer cells was significantly associated with MI and clinicopathological data. Patients with CD163-positive tumors had significantly shorter disease-free survival (DFS) after RT. In vitro generated macrophage:MCF-7 hybrids developed radioresistance and exhibited better survival and colony forming ability after radiation compared to maternal MCF-7 cancer cells. Our results suggest that macrophage phenotype in tumor cells results in radioresistance in breast cancer and shorter DFS after radiotherapy.

Proteomic profiling of healthy and diseased hybrid soft corals Sinularia maxima × S. polydactyla.

PubMed

Gochfeld, Deborah J; Ankisetty, Sridevi; Slattery, Marc

2015-10-16

Emerging diseases of marine invertebrates have been implicated as one of the major causes of the continuing decline in coral reefs worldwide. To date, most of the focus on marine diseases has been aimed at hard (scleractinian) corals, which are the main reef builders worldwide. However, soft (alcyonacean) corals are also essential components of tropical reefs, representing food, habitat and the 'glue' that consolidates reefs, and they are subject to the same stressors as hard corals. Sinularia maxima and S. polydactyla are the dominant soft corals on the shallow reefs of Guam, where they hybridize. In addition to both parent species, the hybrid soft coral population in Guam is particularly affected by Sinularia tissue loss disease. Using label-free shotgun proteomics, we identified differences in protein expression between healthy and diseased colonies of the hybrid S. maxima × S. polydactyla. This study provided qualitative and quantitative data on specific proteins that were differentially expressed under the stress of disease. In particular, metabolic proteins were down-regulated, whereas proteins related to stress and to symbiont photosynthesis were up-regulated in the diseased soft corals. These results indicate that soft corals are responding to pathogenesis at the level of the proteome, and that this label-free approach can be used to identify and quantify protein biomarkers of sub-lethal stress in studies of marine disease.

Development of a real-time PCR for detection of Mycoplasma bovis in bovine milk and lung samples.

PubMed

Cai, Hugh Y; Bell-Rogers, Patricia; Parker, Lois; Prescott, John F

2005-11-01

A real-time polymerase chain reaction (PCR) assay using hybridization probes on a LightCycler platform was developed for detection of Mycoplasma bovis from individual bovine mastitis milk and pneumonic lung tissues. The detection limit was 550 colony forming units (cfu)/ml of milk and 650 cfu/25 mg of lung tissue. A panel of bovine Mycoplasma and of other bovine-origin bacteria were tested; only M. bovis strains were positive, with a melting peak of 66.6 degrees C. Mycoplasma agalactiae PG2 was also positive and could be distinguished because it had a melting peak of 63.1 degrees C. In validation testing of clinical samples, the relative sensitivity and specificity were 100% and 99.3% for individual milks and 96.6% and 100% for the lung tissue. Using M. bovis real-time PCR, the M. bovis culture-positive milk samples were estimated to contain between 5 x 10(4) and 7.7 x 10(8) cfu/ml and the M. bovis culture-positive lungs between 1 x 10(3) and 1 x 10(9) cfu/25 mg. Isolation, confirmed with the real-time PCR and colony fluorescent antibody test, showed that at the herd level, the proportion of samples positive for M. bovis isolation in mastitis milk samples submitted to the Mastitis Laboratory, Animal Health Laboratory, University of Guelph, Ontario, Canada, was 2.4% (5/201). We conclude that this probe-based real-time PCR assay is a sensitive, specific, and rapid method to identify M. bovis infection in bovine milk and pneumonic lungs.

Video bioinformatics analysis of human embryonic stem cell colony growth.

PubMed

Lin, Sabrina; Fonteno, Shawn; Satish, Shruthi; Bhanu, Bir; Talbot, Prue

2010-05-20

Because video data are complex and are comprised of many images, mining information from video material is difficult to do without the aid of computer software. Video bioinformatics is a powerful quantitative approach for extracting spatio-temporal data from video images using computer software to perform dating mining and analysis. In this article, we introduce a video bioinformatics method for quantifying the growth of human embryonic stem cells (hESC) by analyzing time-lapse videos collected in a Nikon BioStation CT incubator equipped with a camera for video imaging. In our experiments, hESC colonies that were attached to Matrigel were filmed for 48 hours in the BioStation CT. To determine the rate of growth of these colonies, recipes were developed using CL-Quant software which enables users to extract various types of data from video images. To accurately evaluate colony growth, three recipes were created. The first segmented the image into the colony and background, the second enhanced the image to define colonies throughout the video sequence accurately, and the third measured the number of pixels in the colony over time. The three recipes were run in sequence on video data collected in a BioStation CT to analyze the rate of growth of individual hESC colonies over 48 hours. To verify the truthfulness of the CL-Quant recipes, the same data were analyzed manually using Adobe Photoshop software. When the data obtained using the CL-Quant recipes and Photoshop were compared, results were virtually identical, indicating the CL-Quant recipes were truthful. The method described here could be applied to any video data to measure growth rates of hESC or other cells that grow in colonies. In addition, other video bioinformatics recipes can be developed in the future for other cell processes such as migration, apoptosis, and cell adhesion.

Development of a user-friendly delivery method for the fungus Metarhizium anisopliac to control the ectoparasitic mite Varroa destructor in honey bee, Apis mellifera, colonies

USDA-ARS?s Scientific Manuscript database

A user-friendly method to deliver Metarhizium spores to honey bee colonies for control of Varroa mites was developed and tested. Patty blend formulations protected the fungal spores at brood nest temperatures and served as an improved delivery system of the fungus to bee hives. Field trials conducte...

On the problem of solving the optimization for continuous space based on information distribution function of ant colony algorithm

NASA Astrophysics Data System (ADS)

Min, Huang; Na, Cai

2017-06-01

These years, ant colony algorithm has been widely used in solving the domain of discrete space optimization, while the research on solving the continuous space optimization was relatively little. Based on the original optimization for continuous space, the article proposes the improved ant colony algorithm which is used to Solve the optimization for continuous space, so as to overcome the ant colony algorithm’s disadvantages of searching for a long time in continuous space. The article improves the solving way for the total amount of information of each interval and the due number of ants. The article also introduces a function of changes with the increase of the number of iterations in order to enhance the convergence rate of the improved ant colony algorithm. The simulation results show that compared with the result in literature[5], the suggested improved ant colony algorithm that based on the information distribution function has a better convergence performance. Thus, the article provides a new feasible and effective method for ant colony algorithm to solve this kind of problem.

HiveScience: A Citizen Science Project for Beekeepers##

EPA Science Inventory

Over the past decade, beekeepers have been experiencing unacceptably high colony losses while the demand for insect-pollinated crops has tripled during the same time period. Underscoring the need to develop reliable methods for predicting colony health, the United States Departme...

Reduction of feral cat (Felis catus Linnaeus 1758) colony size following hysterectomy of adult female cats.

PubMed

Mendes-de-Almeida, Flavya; Remy, Gabriella L; Gershony, Liza C; Rodrigues, Daniela P; Chame, Marcia; Labarthe, Norma V

2011-06-01

The size of urban cat colonies is limited only by the availability of food and shelter; therefore, their population growth challenges all known population control programs. To test a new population control method, a free-roaming feral cat colony at the Zoological Park in the city of Rio de Janeiro was studied, beginning in 2001. The novel method consisted of performing a hysterectomy on all captured female cats over 6 months of age. To estimate the size of the colony and compare population from year to year, a method of capture-mark-release-recapture was used. The aim was to capture as many individuals as possible, including cats of all ages and gender to estimate numbers of cats in all population categories. Results indicated that the feral cat population remained constant from 2001 to 2004. From 2004 to 2008, the hysterectomy program and population estimates were performed every other year (2006 and 2008). The population was estimated to be 40 cats in 2004, 26 in 2006, and 17 cats in 2008. Although pathogens tend to infect more individuals as the population grows older and maintains natural behavior, these results show that free-roaming feral cat colonies could have their population controlled by a biannual program that focuses on hysterectomy of sexually active female cats. Copyright © 2011 ISFM and AAFP. Published by Elsevier Ltd. All rights reserved.

Comparative analysis of quantitative methodologies for Vibrionaceae biofilms.

PubMed

Chavez-Dozal, Alba A; Nourabadi, Neda; Erken, Martina; McDougald, Diane; Nishiguchi, Michele K

2016-11-01

Multiple symbiotic and free-living Vibrio spp. grow as a form of microbial community known as a biofilm. In the laboratory, methods to quantify Vibrio biofilm mass include crystal violet staining, direct colony-forming unit (CFU) counting, dry biofilm cell mass measurement, and observation of development of wrinkled colonies. Another approach for bacterial biofilms also involves the use of tetrazolium (XTT) assays (used widely in studies of fungi) that are an appropriate measure of metabolic activity and vitality of cells within the biofilm matrix. This study systematically tested five techniques, among which the XTT assay and wrinkled colony measurement provided the most reproducible, accurate, and efficient methods for the quantitative estimation of Vibrionaceae biofilms.

Reproduction of black-crowned night-herons related to predation and contaminants in Oregon and Washington, USA

USGS Publications Warehouse

Blus, L.J.; Rattner, B.A.; Melancon, M.J.; Henny, C.J.

1997-01-01

We studied reproductive characteristics of Black-crowned Night-Herons (Nycticorax nycticorax) at four colonies in south central Washington and one colony in north central Oregon in 1991. Nest success, adjusted using the Mayfield method, was significantly different between colonies and ranged from 12-84% to hatching and 12-73% to 14 days post-hatching. The mean number of young surviving to 14 days of age in each colony ranged from 0.47-1.94 per nesting female (includes recycling efforts that involve laying more than one clutch). They were marked intercolony differences in clutch size and incidence of recycling. Predation (primarily avian) was a major factor that adversely affected nest success in three colonies and was relatively unimportant in two colonies. Residues of DDE, total polychlorinated biphenyls, 2,3,7,8-tetrachlorodibenzo-p-dioxin, and other compounds in eggs were generally low and apparently had little influence on reproductive success at any of the colonies. Mean eggshell thinning ranged from 7-1 1 % in comparison to a pre-1947 norm for eggs measured in museum collections. Cytochrome P450 enzyme (EROD, PROD, and BROD) induction in livers of pipped embryos by colony ranged from low to average in comparison with other colonies throughout the U.S. Average EROD and BROD activities were highest at Sand Dune Island and were lowest at Potholes Reservoir which was designated the reference colony. In relation to our study of three of the five colonies in the early 1980s, residues of DDE and several related compounds appeared to decline, nest predation rates increased, and nest success decreased at all three colonies.

A Bio-Economic Case Study of Canadian Honey Bee (Hymenoptera: Apidae) Colonies: Marker-Assisted Selection (MAS) in Queen Breeding Affects Beekeeper Profits

PubMed Central

Baylis, Kathy; Hoover, Shelley E.; Currie, Rob W.; Melathopoulos, Andony P.; Pernal, Stephen F.; Foster, Leonard J.; Guarna, M. Marta

2017-01-01

Abstract Over the past decade in North America and Europe, winter losses of honey bee (Hymenoptera: Apidae) colonies have increased dramatically. Scientific consensus attributes these losses to multifactorial causes including altered parasite and pathogen profiles, lack of proper nutrition due to agricultural monocultures, exposure to pesticides, management, and weather. One method to reduce colony loss and increase productivity is through selective breeding of queens to produce disease-, pathogen-, and mite-resistant stock. Historically, the only method for identifying desirable traits in honey bees to improve breeding was through observation of bee behavior. A team of Canadian scientists have recently identified markers in bee antennae that correspond to behavioral traits in bees and can be tested for in a laboratory. These scientists have demonstrated that this marker-assisted selection (MAS) can be used to produce hygienic, pathogen-resistant honey bee colonies. Based on this research, we present a beekeeping case study where a beekeeper’s profit function is used to evaluate the economic impact of adopting colonies selected for hygienic behavior using MAS into an apiary. Our results show a net profit gain from an MAS colony of between 2% and 5% when Varroa mites are effectively treated. In the case of ineffective treatment, MAS generates a net profit benefit of between 9% and 96% depending on the Varroa load. When a Varroa mite population has developed some treatment resistance, we show that MAS colonies generate a net profit gain of between 8% and 112% depending on the Varroa load and degree of treatment resistance. PMID:28334400

Lunar horticulture.

NASA Technical Reports Server (NTRS)

Walkinshaw, C. H.

1971-01-01

Discussion of the role that lunar horticulture may fulfill in helping establish the life support system of an earth-independent lunar colony. Such a system is expected to be a hybrid between systems which depend on lunar horticulture and those which depend upon the chemical reclamation of metabolic waste and its resynthesis into nutrients and water. The feasibility of this approach has been established at several laboratories. Plants grow well under reduced pressures and with oxygen concentrations of less than 1% of the total pressure. The carbon dioxide collected from the lunar base personnel should provide sufficient gas pressure (approx. 100 mm Hg) for growing the plants.

Colony fingerprint for discrimination of microbial species based on lensless imaging of microcolonies

PubMed Central

Maeda, Yoshiaki; Dobashi, Hironori; Sugiyama, Yui; Saeki, Tatsuya; Lim, Tae-kyu; Harada, Manabu; Matsunaga, Tadashi; Yoshino, Tomoko

2017-01-01

Detection and identification of microbial species are crucial in a wide range of industries, including production of beverages, foods, cosmetics, and pharmaceuticals. Traditionally, colony formation and its morphological analysis (e.g., size, shape, and color) with a naked eye have been employed for this purpose. However, such a conventional method is time consuming, labor intensive, and not very reproducible. To overcome these problems, we propose a novel method that detects microcolonies (diameter 10–500 μm) using a lensless imaging system. When comparing colony images of five microorganisms from different genera (Escherichia coli, Salmonella enterica, Pseudomonas aeruginosa, Staphylococcus aureus, and Candida albicans), the images showed obvious different features. Being closely related species, St. aureus and St. epidermidis resembled each other, but the imaging analysis could extract substantial information (colony fingerprints) including the morphological and physiological features, and linear discriminant analysis of the colony fingerprints distinguished these two species with 100% of accuracy. Because this system may offer many advantages such as high-throughput testing, lower costs, more compact equipment, and ease of automation, it holds promise for microbial detection and identification in various academic and industrial areas. PMID:28369067

Dual ant colony operational modal analysis parameter estimation method

NASA Astrophysics Data System (ADS)

Sitarz, Piotr; Powałka, Bartosz

2018-01-01

Operational Modal Analysis (OMA) is a common technique used to examine the dynamic properties of a system. Contrary to experimental modal analysis, the input signal is generated in object ambient environment. Operational modal analysis mainly aims at determining the number of pole pairs and at estimating modal parameters. Many methods are used for parameter identification. Some methods operate in time while others in frequency domain. The former use correlation functions, the latter - spectral density functions. However, while some methods require the user to select poles from a stabilisation diagram, others try to automate the selection process. Dual ant colony operational modal analysis parameter estimation method (DAC-OMA) presents a new approach to the problem, avoiding issues involved in the stabilisation diagram. The presented algorithm is fully automated. It uses deterministic methods to define the interval of estimated parameters, thus reducing the problem to optimisation task which is conducted with dedicated software based on ant colony optimisation algorithm. The combination of deterministic methods restricting parameter intervals and artificial intelligence yields very good results, also for closely spaced modes and significantly varied mode shapes within one measurement point.

Comparison of Quantitative Antifungal Testing Methods for Textile Fabrics.

PubMed

Imoto, Yasuo; Seino, Satoshi; Nakagawa, Takashi; Yamamoto, Takao A

2017-01-01

　Quantitative antifungal testing methods for textile fabrics under growth-supportive conditions were studied. Fungal growth activities on unfinished textile fabrics and textile fabrics modified with Ag nanoparticles were investigated using the colony counting method and the luminescence method. Morphological changes of the fungi during incubation were investigated by microscopic observation. Comparison of the results indicated that the fungal growth activity values obtained with the colony counting method depended on the morphological state of the fungi on textile fabrics, whereas those obtained with the luminescence method did not. Our findings indicated that unique characteristics of each testing method must be taken into account for the proper evaluation of antifungal activity.

Sensitivity analysis for simulating pesticide impacts on honey bee colonies

EPA Science Inventory

Background/Question/Methods Regulatory agencies assess risks to honey bees from pesticides through a tiered process that includes predictive modeling with empirical toxicity and chemical data of pesticides as a line of evidence. We evaluate the Varroapop colony model, proposed by...

High order neural correlates of social behavior in the honeybee brain.

PubMed

Duer, Aron; Paffhausen, Benjamin H; Menzel, Randolf

2015-10-30

Honeybees are well established models of neural correlates of sensory function, learning and memory formation. Here we report a novel approach allowing to record high-order mushroom body-extrinsic interneurons in the brain of worker bees within a functional colony. New method The use of two 100 cm long twisted copper electrodes allowed recording of up to four units of mushroom body-extrinsic neurons simultaneously for up to 24h in animals moving freely between members of the colony. Every worker, including the recorded bee, hatched in the experimental environment. The group consisted of 200 animals in average. Animals explored different regions of the comb and interacted with other colony members. The activities of the units were not selective for locations on the comb, body directions with respect to gravity and olfactory signals on the comb, or different social interactions. However, combinations of these parameters defined neural activity in a unit-specific way. In addition, units recorded from the same animal co-varied according to unknown factors. Comparison with existing method(s): All electrophysiological studies with honey bees were performed so far on constrained animals outside their natural behavioral contexts. Yet no neuronal correlates were measured in a social context. Free mobility of recoded insects over a range of a quarter square meter allows addressing questions concerning neural correlates of social communication, planning of tasks within the colony and attention-like processes. The method makes it possible to study neural correlates of social behavior in a near-natural setting within the honeybee colony. Copyright © 2015 Elsevier B.V. All rights reserved.

[Study on the effect of phloretin on inhibiting malignant pheotype of BEL-7402 cells].

PubMed

Luo, Hui; Wang, Ya-Jun; Chen, Jie; Liu, Jiang-Qin

2008-07-01

To investigate the effect of phloretin on inhibiting BEL-7402 cells' growth, invasive, migration and adhesion ability and the rate of colony formation. BEL-7402 cells' growth, invasive, migration and adhesion ability and the rate of colony formation were examined with MIT method and Costar Transwell. Phloretin inhibited the growth, invasive, migration and adhesion ability of BEL-7402 cells and reduced the rate of colony formation in dose-dependent. Phloretin can inhibit BEL-7402 cells' malignant pheotype.

A variant reference data set for the Africanized honeybee, Apis mellifera

PubMed Central

Kadri, Samir M.; Harpur, Brock A.; Orsi, Ricardo O.; Zayed, Amro

2016-01-01

The Africanized honeybee (AHB) is a population of Apis mellifera found in the Americas. AHBs originated in 1956 in Rio Clara, Brazil where imported African A. m. scutellata escaped and hybridized with local populations of European A. mellifera. Africanized populations can now be found from Northern Argentina to the Southern United States. AHBs—often referred to as ‘Killer Bees’— are a major concern to the beekeeping industry as well as a model for the evolutionary genetics of colony defence. We performed high coverage pooled-resequencing of 360 diploid workers from 30 Brazilian AHB colonies using Illumina Hi-Seq (150 bp PE). This yielded a high density SNP data set with an average read depth at each site of 20.25 reads. With 3,606,720 SNPs and 155,336 SNPs within 11,365 genes, this data set is the largest genomic resource available for AHBs and will enable high-resolution studies of the population dynamics, evolution, and genetics of this successful biological invader, in addition to facilitating the development of SNP-based tools for identifying AHBs. PMID:27824336

A variant reference data set for the Africanized honeybee, Apis mellifera.

PubMed

Kadri, Samir M; Harpur, Brock A; Orsi, Ricardo O; Zayed, Amro

2016-11-08

The Africanized honeybee (AHB) is a population of Apis mellifera found in the Americas. AHBs originated in 1956 in Rio Clara, Brazil where imported African A. m. scutellata escaped and hybridized with local populations of European A. mellifera. Africanized populations can now be found from Northern Argentina to the Southern United States. AHBs-often referred to as 'Killer Bees'- are a major concern to the beekeeping industry as well as a model for the evolutionary genetics of colony defence. We performed high coverage pooled-resequencing of 360 diploid workers from 30 Brazilian AHB colonies using Illumina Hi-Seq (150 bp PE). This yielded a high density SNP data set with an average read depth at each site of 20.25 reads. With 3,606,720 SNPs and 155,336 SNPs within 11,365 genes, this data set is the largest genomic resource available for AHBs and will enable high-resolution studies of the population dynamics, evolution, and genetics of this successful biological invader, in addition to facilitating the development of SNP-based tools for identifying AHBs.

Diagnosis of murine mycoplasmal infections by enzyme-linked immunosorbent assay (ELISA).

PubMed

Davis, J; Cassell, G H; Gambill, G; Cox, N; Watson, H; Davidson, M

1987-06-01

ELISA is the currently accepted method for screening rodent colonies for Mycoplasma pulmonis infection. While this assay has greatly improved mycoplasmal detection, it suffers from major defects. Cross-reactions with M. arthritidis are the major technical problem, and prevent definitive diagnosis. Current methods for obtaining a definitive diagnosis are accurate in about 80% of cases, and include ELISA testing for both organisms, immunoblot analysis, and blocking of the murine reaction with heterologous serum. Another technical difficulty is the inherent variability in the assay, which can be overcome by rigid quality control measures and careful attention to detail. The difficulties that arise from the natural history of mycoplasmal infection in barrier-maintained colonies, i.e., low incidence of infected animals and delayed antibody response in animals infected with low numbers of organisms, seriously limit the usefulness of the ELISA. While the assay can be extremely useful in screening breeding colonies and in eliminating mycoplasmas from such colonies, it cannot easily be used to screen potential sources of weanling animals for experimental use.

[Comparison of different methods for the identification of Candida species isolated from clinical specimens].

PubMed

Cetinkaya, Zafer; Altindiş, Mustafa; Aktepe, Orhan Cem; Karabiçak, Nilgün

2003-10-01

The aim of this study was to compare the different methods for the identification of Candida strains isolated from clinical specimens. The methods of germ tube examination, chlamydospore examination formed on the rice Tween-80 (RT-80) agar and evaluation of colony morphologies on the two chromogenic agars (CHROMagar Candida, Albicans ID), were compared with a reference API 20C AUX (bioMerieux, France) automated system based on the carbohydrate assimilation, for the identification of a total 255 Candida isolates. Of them, 173 (67.8%) were identified as C. albicans, 37 (14.5%) were C. glabrata, 23 (9%) were C. krusei, 9 (3.5%) were C. tropicalis, 9 (3.5%) were C. kefyr, 2 (0.8%) were C. guillermondii and 2 (0.8%) were C. parapsilosis, by API 20C AUX system. In the view of these results, 146 (84.4%) of C. albicans strains were identified by germ tube examination, 161 (93.1%) of C. albicans strains and 208 (81.5%) of total strains were identified by chlamydospore examination. 169 (97.7%) of C. albicans strains and 231 (90.6%) of total strains were identified by CHROMagar Candida method, and 168 (97.1%) of C. albicans strains were identified by Albicans ID method, correctly. In the CHROMagar Candida medium, 169 C. albicans isolates have produced bright green colored colonies, whereas 33 (89.2%) isolates which produced dark pink/purple colored colonies were identified as C. glabrata, 7 (77.8%) isolates which produced metalical blue colored colonies were identified as C. tropicalis and 22 (95.6%) isolates which produced pale pink colored colonies were identified as C. krusei. In the Albicans ID medium, four of the 172 isolates which were evaluated as C. albicans initially by producing blue colored colonies, have been identified as C. tropicalis by API 20C AUX system. The sensitivities and specificities of germ tube examination, RT-80, CHROMagar Candida and Albicans ID methods were found as follows, respectively; 84.4% and 100%, 93.1% and 100%, 97.7% and 100%, 99.4% and 95.3 percent. In conclusion, CHROMagar Candida medium seems the most favorable rapid and practical method with high sensitivity and specificity for the identification of Candida species, but its cost-effectiveness should be kept in view.

Simulation-Based Evaluation of Hybridization Network Reconstruction Methods in the Presence of Incomplete Lineage Sorting

PubMed Central

Kamneva, Olga K; Rosenberg, Noah A

2017-01-01

Hybridization events generate reticulate species relationships, giving rise to species networks rather than species trees. We report a comparative study of consensus, maximum parsimony, and maximum likelihood methods of species network reconstruction using gene trees simulated assuming a known species history. We evaluate the role of the divergence time between species involved in a hybridization event, the relative contributions of the hybridizing species, and the error in gene tree estimation. When gene tree discordance is mostly due to hybridization and not due to incomplete lineage sorting (ILS), most of the methods can detect even highly skewed hybridization events between highly divergent species. For recent divergences between hybridizing species, when the influence of ILS is sufficiently high, likelihood methods outperform parsimony and consensus methods, which erroneously identify extra hybridizations. The more sophisticated likelihood methods, however, are affected by gene tree errors to a greater extent than are consensus and parsimony. PMID:28469378

Warehouse stocking optimization based on dynamic ant colony genetic algorithm

NASA Astrophysics Data System (ADS)

Xiao, Xiaoxu

2018-04-01

In view of the various orders of FAW (First Automotive Works) International Logistics Co., Ltd., the SLP method is used to optimize the layout of the warehousing units in the enterprise, thus the warehouse logistics is optimized and the external processing speed of the order is improved. In addition, the relevant intelligent algorithms for optimizing the stocking route problem are analyzed. The ant colony algorithm and genetic algorithm which have good applicability are emphatically studied. The parameters of ant colony algorithm are optimized by genetic algorithm, which improves the performance of ant colony algorithm. A typical path optimization problem model is taken as an example to prove the effectiveness of parameter optimization.

Genetic Interaction Mapping in Schizosaccharomyces pombe Using the Pombe Epistasis Mapper (PEM) System and a ROTOR HDA Colony Replicating Robot in a 1536 Array Format.

PubMed

Roguev, Assen; Xu, Jiewei; Krogan, Nevan

2018-02-01

This protocol describes an optimized high-throughput procedure for generating double deletion mutants in Schizosaccharomyces pombe using the colony replicating robot ROTOR HDA and the PEM (pombe epistasis mapper) system. The method is based on generating high-density colony arrays (1536 colonies per agar plate) and passaging them through a series of antidiploid and mating-type selection (ADS-MTS) and double-mutant selection (DMS) steps. Detailed program parameters for each individual replication step are provided. Using this procedure, batches of 25 or more screens can be routinely performed. © 2018 Cold Spring Harbor Laboratory Press.

Effects of Wintering Environment and Parasite–Pathogen Interactions on Honey Bee Colony Loss in North Temperate Regions

PubMed Central

Currie, Robert W.

2016-01-01

Extreme winter losses of honey bee colonies are a major threat to beekeeping but the combinations of factors underlying colony loss remain debatable. We monitored colonies in two environments (colonies wintered indoors or outdoors) and characterized the effects of two parasitic mites, seven viruses, and Nosema on honey bee colony mortality and population loss over winter. Samples were collected from two locations within hives in fall, mid-winter and spring of 2009/2010. Although fall parasite and pathogen loads were similar in outdoor and indoor-wintered colonies, the outdoor-wintered colonies had greater relative reductions in bee population score over winter. Seasonal patterns in deformed wing virus (DWV), black queen cell virus (BQCV), and Nosema level also differed with the wintering environment. DWV and Nosema levels decreased over winter for indoor-wintered colonies but BQCV did not. Both BQCV and Nosema concentration increased over winter in outdoor-wintered colonies. The mean abundance of Varroa decreased and concentration of Sacbrood virus (SBV), Kashmir bee virus (KBV), and Chronic bee paralysis virus (CBPV) increased over winter but seasonal patterns were not affected by wintering method. For most viruses, either entrance or brood area samples were reasonable predictors of colony virus load but there were significant season*sample location interactions for Nosema and BQCV, indicating that care must be taken when selecting samples from a single location. For Nosema spp., the fall entrance samples were better predictors of future infestation levels than were fall brood area samples. For indoor-wintered colonies, Israeli acute paralysis virus IAPV concentration was negatively correlated with spring population size. For outdoor-wintered hives, spring Varroa abundance and DWV concentration were positively correlated with bee loss and negatively correlated with spring population size. Multivariate analyses for fall collected samples indicated higher DWV was associated with colony death as did high SBV for spring-collected samples. PMID:27448049

Research on cutting path optimization of sheet metal parts based on ant colony algorithm

NASA Astrophysics Data System (ADS)

Wu, Z. Y.; Ling, H.; Li, L.; Wu, L. H.; Liu, N. B.

2017-09-01

In view of the disadvantages of the current cutting path optimization methods of sheet metal parts, a new method based on ant colony algorithm was proposed in this paper. The cutting path optimization problem of sheet metal parts was taken as the research object. The essence and optimization goal of the optimization problem were presented. The traditional serial cutting constraint rule was improved. The cutting constraint rule with cross cutting was proposed. The contour lines of parts were discretized and the mathematical model of cutting path optimization was established. Thus the problem was converted into the selection problem of contour lines of parts. Ant colony algorithm was used to solve the problem. The principle and steps of the algorithm were analyzed.

Field evaluation of the bait toxicant chlorfluazuron in eliminating Coptotermes acinaciformis (Froggatt) (Isoptera: Rhinotermitidae).

PubMed

Peters, Brenton C; Fitzgerald, Christopher J

2003-12-01

Two aspects of the Exterra Termite Interception and Baiting System (Ensystex, Fayetteville, NC) were evaluated in a field experiment using 13 termite mounds near Townsville, Australia. First, a cellulose-acetate powder containing either 0.05% wt:wt or 0.25% wt:wt chlorfluazuron (Requiem, Ensystex, Fayetteville, NC) was tested for its efficacy in eliminating colonies of the xylophagous mound-building subterranean termite Coptotermes acinaciformis (Froggatt). The moist bait matrix was replenished during the first inspection of 10 mounds (five mounds by two treatments) used in the experiment. Second, a single application of the moist bait matrix was used on three additional mounds to test termite responses and the effectiveness of 0.25% wt:wt chlorfluazuron. Although there was no evidence of repellence, there was little removal of replenished bait. Five colonies were eliminated by 0.05% wt:wt chlorfluazuron and five colonies by 0.25% wt:wt chlorfluazuron: another colony was moribund, and elimination appeared imminent. Colony decline was first suspected some 12 wk after bait application, and colony elimination was confirmed, by destructive sampling, about 5 wk later. Colony elimination may have occurred within 12 wk. One colony was an anomaly and did not succumb to the effects of the toxicant. Another colony was not eliminated because of invasion of the baiting system by ants. Ants, principally Iridomyrmex purpureus (F. Smith) group and Papyrius nitidus (Mayr) group, occurred commonly in the stations during the experiment. Microcerotermes sp. was found in five of the C. acinaciformis mounds, after colony elimination. Inspections of small sections of mounds and wooden dowels inserted into mounds were reliable methods for monitoring colony health.

Development and applications of various optimization algorithms for diesel engine combustion and emissions optimization

NASA Astrophysics Data System (ADS)

Ogren, Ryan M.

For this work, Hybrid PSO-GA and Artificial Bee Colony Optimization (ABC) algorithms are applied to the optimization of experimental diesel engine performance, to meet Environmental Protection Agency, off-road, diesel engine standards. This work is the first to apply ABC optimization to experimental engine testing. All trials were conducted at partial load on a four-cylinder, turbocharged, John Deere engine using neat-Biodiesel for PSO-GA and regular pump diesel for ABC. Key variables were altered throughout the experiments, including, fuel pressure, intake gas temperature, exhaust gas recirculation flow, fuel injection quantity for two injections, pilot injection timing and main injection timing. Both forms of optimization proved effective for optimizing engine operation. The PSO-GA hybrid was able to find a superior solution to that of ABC within fewer engine runs. Both solutions call for high exhaust gas recirculation to reduce oxide of nitrogen (NOx) emissions while also moving pilot and main fuel injections to near top dead center for improved tradeoffs between NOx and particulate matter.

Genetic structure of nest aggregations and drone congregations of the southeast Asian stingless bee Trigona collina.

PubMed

Cameron, E C; Franck, P; Oldroyd, B P

2004-08-01

In stingless bees, sex is determined by a single complementary sex-determining locus. This method of sex determination imposes a severe cost of inbreeding because an egg fertilized by sperm carrying the same sex allele as the egg results in a sterile diploid male. To explore how reproductive strategies may be used to avoid inbreeding in stingless bees, we studied the genetic structure of a population of 27 colonies and three drone congregations of Trigona collina in Chanthaburi, Thailand. The colonies were distributed across six nest aggregations, each aggregation located in the base of a different fig tree. Genetic analysis at eight microsatellite loci showed that colonies within aggregations were not related. Samples taken from three drone congregations showed that the males were drawn from a large number of colonies (estimated to be 132 different colonies in our largest swarm). No drone had a genotype indicating that it could have originated from the colony that it was directly outside. Combined, these results suggest that movements of drones and possibly movements of reproductive swarms among colony aggregations provide two mechanisms of inbreeding avoidance. Copyright 2004 Blackwell Publishing Ltd

Changes in coral-associated microbial communities during a bleaching event.

PubMed

Bourne, David; Iida, Yuki; Uthicke, Sven; Smith-Keune, Carolyn

2008-04-01

Environmental stressors such as increased sea surface temperatures are well-known for contributing to coral bleaching; however, the effect of increased temperatures and subsequent bleaching on coral-associated microbial communities is poorly understood. Colonies of the hard coral Acropora millepora were tagged on a reef flat off Magnetic Island (Great Barrier Reef) and surveyed over 2.5 years, which included a severe bleaching event in January/February 2002. Daily average water temperatures exceeded the previous 10-year average by more than 1 degrees C for extended periods with field-based visual surveys recording all tagged colonies displaying signs of bleaching. During the bleaching period, direct counts of coral zooxanthellae densities decreased by approximately 64%, before recovery to pre-bleaching levels after the thermal stress event. A subset of three tagged coral colonies were sampled through the bleaching event and changes in the microbial community elucidated. Denaturing gradient gel electrophoresis (DGGE) analysis demonstrated conserved bacterial banding profiles between the three coral colonies, confirming previous studies highlighting specific microbial associations. As coral colonies bleached, the microbial community shifted and redundancy analysis (RDA) of DGGE banding patterns revealed a correlation of increasing temperature with the appearance of Vibrio-affiliated sequences. Interestingly, this shift to a Vibrio-dominated community commenced prior to visual signs of bleaching. Clone libraries hybridized with Vibrio-specific oligonucleotide probes confirmed an increase in the fraction of Vibrio-affiliated clones during the bleaching period. Post bleaching, the coral microbial associations again shifted, returning to a profile similar to the fingerprints prior to bleaching. This provided further evidence for corals selecting and shaping their microbial partners. For non-bleached samples, a close association with Spongiobacter-related sequences were revealed by both clone libraries and DGGE profiling. Despite Vibrio species being previously implicated in bleaching of specific coral species, it is unsure if the relative increase in retrieved Vibrio sequences is due to bacterial infection or an opportunistic response to compromised health and changing environmental parameters of the coral host. This study provides the first molecular-based study demonstrating changes in coral-associated bacterial assemblages during a bleaching event on a natural reef system.

AutoCellSeg: robust automatic colony forming unit (CFU)/cell analysis using adaptive image segmentation and easy-to-use post-editing techniques.

PubMed

Khan, Arif Ul Maula; Torelli, Angelo; Wolf, Ivo; Gretz, Norbert

2018-05-08

In biological assays, automated cell/colony segmentation and counting is imperative owing to huge image sets. Problems occurring due to drifting image acquisition conditions, background noise and high variation in colony features in experiments demand a user-friendly, adaptive and robust image processing/analysis method. We present AutoCellSeg (based on MATLAB) that implements a supervised automatic and robust image segmentation method. AutoCellSeg utilizes multi-thresholding aided by a feedback-based watershed algorithm taking segmentation plausibility criteria into account. It is usable in different operation modes and intuitively enables the user to select object features interactively for supervised image segmentation method. It allows the user to correct results with a graphical interface. This publicly available tool outperforms tools like OpenCFU and CellProfiler in terms of accuracy and provides many additional useful features for end-users.

Effect of Diuron on aquatic bacteria in laboratory-scale wastewater treatment ponds with special reference to Aeromonas species studied by colony hybridization.

PubMed

Sumpono; Perotti, P; Belan, A; Forestier, C; Lavedrine, B; Bohatier, J

2003-01-01

Six laboratory-scale wastewater treatment ponds were filled with sediment and water obtained from a reference pond (a wastewater treatment plant located in a rural environment at Montel-de-Gelat, Puy-de-Dôme, France). They were kept at 20 degrees C, with alternative light and dark periods (12 h-12 h), and fed with raw effluent supplied weekly. Three of them were treated with Diuron (dissolved in DMSO) at a final concentration 10 mg/l, while the other three received only DMSO. Physico-chemical parameters, total bacteria, cultivable bacteria, and Aeromonas spp. were measured periodically until 41 days after the Diuron contamination. Total bacteria were treated with 4,6-diamidino 2-phenylindole (DAPI) and counted by epifluoroscence microscopy. The cultivable bacteria were quantified on plate count agar medium and Aeromonas spp. using colony hybridization. In the contaminated pilots, biochemical oxygen demand (BOD5), chemical oxygen demand (COD), suspended solids (SS), volatile suspended solids (VSS), ammonium, phosphorus, and bacteria increased, but dissolved oxygen decreased. The abundance of total bacteria, cultivable bacteria (multiplied by 30), and Aeromonas spp. increased for two weeks after Diuron introduction, reverting to initial values three weeks later. The percentage of cultivable bacteria relative to total bacteria was 0.2% in controls and 1.2% in treated pilots, while the percentage of Aeromonas spp. relative to cultivable bacteria decreased from 6-10% to 2%. Our results suggest that Diuron, which acts on the photosystem II of phototrophs, supports the development of cultivable bacteria through new carbon sources derived from the decomposition of photosynthetic micro-organisms, but does not specifically support Aeromonas spp.

Porphyromonas canoris sp. nov., an asaccharolytic, black-pigmented species from the gingival sulcus of dogs.

PubMed

Love, D N; Karjalainen, J; Kanervo, A; Forsblom, B; Sarkiala, E; Bailey, G D; Wigney, D I; Jousimies-Somer, H

1994-04-01

A new species, Porphyromonas canoris, is proposed for black-pigmented asaccharolytic strains isolated from subgingival plaque samples from dogs with naturally occurring periodontal disease. This bacterium is an obligately anaerobic, nonmotile, non-spore-forming, gram-negative, rod-shaped organism. On laked rabbit blood or sheep blood agar plates, colonies are light brown to greenish brown after 2 to 4 days of incubation and dark brown after 14 days of incubation. Colonies on egg yolk agar and on nonhemolyzed sheep blood agar are orange. The cells do not grow in the presence of 20% bile and have a guanine-plus-cytosine content of 49 to 51 mol%. The type strain is VPB 4878 (= NCTC 12835). The average levels of DNA-DNA hybridization between P. canoris strains and other members of the genus Porphyromonas are as follows: Porphyromonas gingivalis ATCC 33277T (T = type strain), 6.5%; Porphyromonas gingivalis cat strain VPB 3492, 5%; Porphyromonas endodontalis ATCC 35406T, 1%; Porphyromonas salivosa NCTC 11362T, 5%; and Porphyromonas circumdentaria NCTC 12469T, 6%. The level of hybridization between P. canoris NCTC 12835T DNA and Porphyromonas asaccharolytica ATCC 25260T DNA is 3%. P. canoris cells produce major amounts of acetic, propionic, isovaleric, and succinic acids and minor amounts of isobutyric and butyric acids as end products of metabolism in cooked meat medium. The major cellular fatty acid is 13-methyltetradecanoic acid (iso-C15:0). Glutamate and malate dehydrogenases are present, as are glucose-6-phosphate dehydrogenase activity (65.7 nmol mg of protein-1 min-1) and 6-phosphogluconate dehydrogenase activity (63.0 nmol mg of protein-1 min-1).(ABSTRACT TRUNCATED AT 250 WORDS)

High expression of long noncoding RNA NORAD indicates a poor prognosis and promotes clinical progression and metastasis in bladder cancer.

PubMed

Li, Qiaqia; Li, Chao; Chen, Jinbo; Liu, Peihua; Cui, Yu; Zhou, Xinyi; Li, Huihuang; Zu, Xiongbing

2018-06-01

To explore the function of NORAD in bladder cancer (BC), and to verify whether NORAD could be used as a biomarker to determine preoperative presence of progression and lymph node metastasis. To our knowledge, it is the first study investigating NORAD and its implications in BC. BC specimens of 90 patients underwent bladder cystectomy or transurethral resection between January 2012 to December 2016 were tested by fluorescence in situ hybridization. The association between NORAD expression and clinicopathological features and prognosis of the patients was analyzed using Kaplan-Meier survival analysis and Cox regression analysis. Quantitative real-time polymerase chain reaction was performed in 4 BC cell lines and 10 fresh tumor sample together with adjacent tissues. MTT, colony formation assay, and Annexin-V apoptosis detection were performed after knockdown of NORAD using shRNA in TSSCUP cells. Western blot was performed to related proteins extracted from these cells. Fluorescence in situ hybridization indicated that high NORAD expression was associated with more advanced histological grade and clinical stage for patients with BC. Higher NORAD expression resulted in lower overall survival, and was an independent prognostic indicator. Real-time polymerase chain reaction showed that the expression of NORAD in BC tissues was higher than those measured in adjacent normal tissues. MTT and colony formation assay demonstrated that knockdown of NORAD results in lower proliferation in TSSCUP cells, whereas PUM2 expression was upregulated and E2F3 downregulated. High NORAD expression could serve as an independent prognostic factor for overall survival of patients with transitional BC. NORAD could be considered as a promising candidate for novel biomarker and therapeutic target for human BC. Copyright © 2018 Elsevier Inc. All rights reserved.

A Bio-Economic Case Study of Canadian Honey Bee (Hymenoptera: Apidae) Colonies: Marker-Assisted Selection (MAS) in Queen Breeding Affects Beekeeper Profits.

PubMed

Bixby, Miriam; Baylis, Kathy; Hoover, Shelley E; Currie, Rob W; Melathopoulos, Andony P; Pernal, Stephen F; Foster, Leonard J; Guarna, M Marta

2017-06-01

Over the past decade in North America and Europe, winter losses of honey bee (Hymenoptera: Apidae) colonies have increased dramatically. Scientific consensus attributes these losses to multifactorial causes including altered parasite and pathogen profiles, lack of proper nutrition due to agricultural monocultures, exposure to pesticides, management, and weather. One method to reduce colony loss and increase productivity is through selective breeding of queens to produce disease-, pathogen-, and mite-resistant stock. Historically, the only method for identifying desirable traits in honey bees to improve breeding was through observation of bee behavior. A team of Canadian scientists have recently identified markers in bee antennae that correspond to behavioral traits in bees and can be tested for in a laboratory. These scientists have demonstrated that this marker-assisted selection (MAS) can be used to produce hygienic, pathogen-resistant honey bee colonies. Based on this research, we present a beekeeping case study where a beekeeper's profit function is used to evaluate the economic impact of adopting colonies selected for hygienic behavior using MAS into an apiary. Our results show a net profit gain from an MAS colony of between 2% and 5% when Varroa mites are effectively treated. In the case of ineffective treatment, MAS generates a net profit benefit of between 9% and 96% depending on the Varroa load. When a Varroa mite population has developed some treatment resistance, we show that MAS colonies generate a net profit gain of between 8% and 112% depending on the Varroa load and degree of treatment resistance. © The Authors 2017. Published by Oxford University Press on behalf of Entomological Society of America.

Rapid detection of malignant bio-species using digital holographic pattern recognition and nano-photonics

NASA Astrophysics Data System (ADS)

Sarkisov, Sergey S.; Kukhtareva, Tatiana; Kukhtarev, Nickolai V.; Curley, Michael J.; Edwards, Vernessa; Creer, Marylyn

2013-03-01

There is a great need for rapid detection of bio-hazardous species particularly in applications to food safety and biodefense. It has been recently demonstrated that the colonies of various bio-species could be rapidly detected using culture-specific and reproducible patterns generated by scattered non-coherent light. However, the method heavily relies on a digital pattern recognition algorithm, which is rather complex, requires substantial computational power and is prone to ambiguities due to shift, scale, or orientation mismatch between the analyzed pattern and the reference from the library. The improvement could be made, if, in addition to the intensity of the scattered optical wave, its phase would be also simultaneously recorded and used for the digital holographic pattern recognition. In this feasibility study the research team recorded digital Gabor-type (in-line) holograms of colonies of micro-organisms, such as Salmonella with a laser diode as a low-coherence light source and a lensless high-resolution (2.0x2.0 micron pixel pitch) digital image sensor. The colonies were grown in conventional Petri dishes using standard methods. The digitally recorded holograms were used for computational reconstruction of the amplitude and phase information of the optical wave diffracted on the colonies. Besides, the pattern recognition of the colony fragments using the cross-correlation between the digital hologram was also implemented. The colonies of mold fungi Altenaria sp, Rhizophus, sp, and Aspergillus sp have been also generating nano-colloidal silver during their growth in specially prepared matrices. The silver-specific plasmonic optical extinction peak at 410-nm was also used for rapid detection and growth monitoring of the fungi colonies.

Multi Dimensional Honey Bee Foraging Algorithm Based on Optimal Energy Consumption

NASA Astrophysics Data System (ADS)

Saritha, R.; Vinod Chandra, S. S.

2017-10-01

In this paper a new nature inspired algorithm is proposed based on natural foraging behavior of multi-dimensional honey bee colonies. This method handles issues that arise when food is shared from multiple sources by multiple swarms at multiple destinations. The self organizing nature of natural honey bee swarms in multiple colonies is based on the principle of energy consumption. Swarms of multiple colonies select a food source to optimally fulfill the requirements of its colonies. This is based on the energy requirement for transporting food between a source and destination. Minimum use of energy leads to maximizing profit in each colony. The mathematical model proposed here is based on this principle. This has been successfully evaluated by applying it on multi-objective transportation problem for optimizing cost and time. The algorithm optimizes the needs at each destination in linear time.

Time-lapse imagery of Adélie penguins reveals differential winter strategies and breeding site occupation

PubMed Central

Southwell, Colin; Emmerson, Louise; Lunn, Daniel

2018-01-01

Polar seabirds adopt different over-wintering strategies to survive and build condition during the critical winter period. Penguin species either reside at the colony during the winter months or migrate long distances. Tracking studies and survey methods have revealed differences in winter migration routes among penguin species and colonies, dependent on both biotic and abiotic factors present. However, scan sampling methods are rarely used to reveal non-breeding behaviors during winter and little is known about presence at the colony site over this period. Here we show that Adélie penguins on the Yalour Islands in the Western Antarctic Peninsula (WAP) are present year-round at the colony and undergo a mid-winter peak in abundance during winter. We found a negative relationship between daylight hours and penguin abundance when either open water or compact ice conditions were present, suggesting that penguins return to the breeding colony when visibility is lowest for at-sea foraging and when either extreme low or high levels of sea ice exist offshore. In contrast, Adélie penguins breeding in East Antarctica were not observed at the colonies during winter, suggesting that Adélie penguins undergo differential winter strategies in the marginal ice zone on the WAP compared to those in East Antarctica. These results demonstrate that cameras can successfully monitor wildlife year-round in areas that are largely inaccessible during winter. PMID:29561876

Evaluation of CP Chromo Select Agar for the enumeration of Clostridium perfringens from water.

PubMed

Manafi, Mammad; Waldherr, Kerstin; Kundi, Michael

2013-10-01

The European Directive on drinking water quality has included mCP agar as the reference method for recovering Clostridium perfringens from drinking waters. In the present study, three media (mCP, TSCF and CP Chromo Select Agar) were evaluated for recovery of C. perfringens in different surface water samples. Out of 139 water samples, using a membrane filtration technique, 131 samples (94.2%) were found to be presumptively positive for C. perfringens in at least one of the culture media. Green colored colonies on CP Chromo Select Agar (CCP agar) were counted as presumptive C. perfringens isolates. Out of 483 green colonies on CCP agar, 96.3% (465 strains, indole negative) were identified as C. perfringens, and 15 strains (3.1%) were indole positive and were identified as Clostridium sordellii, Clostridium bifermentans or Clostridium tetani. Only 3 strains (0.6%) gave false positive results and were identified as Clostridium fallax, Clostridium botulinum, and Clostridium tertium. Variance analysis of the data obtained shows statistically no significant differences in the counts obtained between media employed in this work. The mCP method is very onerous for routine screening and bacterial colonies could not be used for further biochemical testing. The colonies on CCP and TSCF were easy to count and subculture for confirmation tests. TSCF detects sulfite-reducing clostridia, including species other than C. perfringens, and in some cases excessive blackening of the agar frustrated counting of the colonies. If the contamination was too high, TSCF did not consistently produce black colonies and as a consequence, the colonies were white and gave false negative results. On the other hand, the identification of typical and atypical colonies isolated from all media demonstrated that CCP agar was the most useful medium for C. perfringens recovery in water samples. Copyright © 2013 Elsevier B.V. All rights reserved.

Detection of adulterated honey produced by honeybee (Apis mellifera L.) colonies fed with different levels of commercial industrial sugar (C₃ and C₄ plants) syrups by the carbon isotope ratio analysis.

PubMed

Guler, Ahmet; Kocaokutgen, Hasan; Garipoglu, Ali V; Onder, Hasan; Ekinci, Deniz; Biyik, Selim

2014-07-15

In the present study, one hundred pure and adulterated honey samples obtained from feeding honeybee colonies with different levels (5, 20 and 100 L/colony) of various commercial sugar syrups including High Fructose Corn Syrup 85 (HFCS-85), High Fructose Corn Syrup 55 (HFCS-55), Bee Feeding Syrup (BFS), Glucose Monohydrate Sugar (GMS) and Sucrose Sugar (SS) were evaluated in terms of the δ(13)C value of honey and its protein, difference between the δ(13)C value of protein and honey (Δδ(13)C), and C4% sugar ratio. Sugar type, sugar level and the sugar type*sugar level interaction were found to be significant (P<0.001) regarding the evaluated characteristics. Adulterations could not be detected in the 5L/colony syrup level of all sugar types when the δ(13)C value of honey, Δδ(13)C (protein-honey), and C4% sugar ratio were used as criteria according to the AOAC standards. However, it was possible to detect the adulteration by using the same criteria in the honeys taken from the 20 and 100 L/colony of HFCS-85 and the 100L/colony of HFCS-55. Adulteration at low syrup level (20 L/colony) was more easily detected when the fructose content of HFCS syrup increased. As a result, the official methods (AOAC, 978.17, 1995; AOAC, 991.41, 1995; AOAC 998.12, 2005) and Internal Standard Carbon Isotope Ratio Analysis could not efficiently detect the indirect adulteration of honey obtained by feeding the bee colonies with the syrups produced from C3 plants such as sugar beet (Beta vulgaris) and wheat (Triticium vulgare). For this reason, it is strongly needed to develop novel methods and standards that can detect the presence and the level of indirect adulterations. Copyright © 2014 Elsevier Ltd. All rights reserved.

Distribution of Paenibacillus larvae spores inside honey bee colonies and its relevance for diagnosis.

PubMed

Gillard, M; Charriere, J D; Belloy, L

2008-09-01

One of the most important factors affecting the development of honey bee colonies is infectious diseases such as American foulbrood (AFB) caused by the spore forming Gram-positive bacterium Paenibacillus larvae. Colony inspections for AFB clinical symptoms are time consuming. Moreover, diseased cells in the early stages of the infection may easily be overlooked. In this study, we investigated whether it is possible to determine the sanitary status of a colony based on analyses of different materials collected from the hive. We analysed 237 bee samples and 67 honey samples originating from 71 colonies situated in 13 apiaries with clinical AFB occurrences. We tested whether a difference in spore load among bees inside the whole hive exists and which sample material related to its location inside the hive was the most appropriate for an early AFB diagnosis based on the culture method. Results indicated that diagnostics based on analysis of honey samples and bees collected at the hive entrance are of limited value as only 86% and 83%, respectively, of samples from AFB-symptomatic colonies were positive. Analysis of bee samples collected from the brood nest, honey chamber, and edge frame allowed the detection of all colonies showing AFB clinical symptoms. Microbiological analysis showed that more than one quarter of samples collected from colonies without AFB clinical symptoms were positive for P. larvae. Based on these results, we recommend investigating colonies by testing bee samples from the brood nest, edge frame or honey chamber for P. larvae spores.

Pharmacological substances in vitro in limiting growth and development of fungi Colletotrichum genera.

PubMed

Machowicz-Matejko, Eulalia; Zalewska, Ewa D

2015-06-01

The aim of the study was to determine the antimycotic effect of selected substances, povidone iodine at various concentrations and fluconazole, on the growth and development of Colletotrichum spp., which is one of the ocular pathogens. The materials used for the study consisted of 1-spore cultures of 4 fungal species of the genus Colletotrichum: C. dematium, C. gloeosporioides, C. acutatum, and C. coccodes. The method of poisoning culture media and the method of stippling the substance onto fungal colonies were used in the study. Different concentrations of fluconazole (1%) and povidone iodine (1%, 2% and 5%) were evaluated. The growth of the studied fungal species was inhibited in 100% on the medium containing povidone iodine at the concentration of 1%, 2%, and 5%. After 24 h from the application of povidone iodine, a local disappearance of aerial mycelium was observed. In the case of C. coccodes, the colonies were not damaged. After 24 h from the application of fluconazole on C. dematium, C. gloeosporioides and C. acutatum colonies, slight disappearance of aerial mycelium was observed at these points. Despite dispensing the substance during the next few days, the inhibitory effect did not increase. After the application fluconazole on the C. coccodes colonies, the inhibitory effect of the preparation was not observed. The method of stippling of a preparation onto fungal colonies is a quick and reliable method to test many pharmacological substances. One percent, 2%, and 5% povidone iodine in culture medium is fungicidal for Colletotrichum spp. One percent fluconazole in culture medium is fungistatic for Colletotrichum spp. C. coccodes reveals the highest degree of insusceptibility to antimycotic treatment.

Heterospecific pairing and hybridization between Nasutitermes corniger and N. ephratae

NASA Astrophysics Data System (ADS)

Hartke, Tamara R.; Rosengaus, Rebeca B.

2011-09-01

The sympatric neotropical termites Nasutitermes corniger and Nasutitermes ephratae are clearly distinguishable based on morphology, nest architecture, defensive secretion composition, and molecular markers. However, given the extensive ecological, geographical, and behavioral overlap of these closely related species, the potential for interbreeding may exist. To explore this possibility, heterospecific pairs were formed experimentally to examine courtship and colony-establishment behaviors, and reproductive potential. Courtship and nest construction behavior occurred in heterospecific pairs in a similar manner to that of conspecific pairs. Survival of pairs depended upon the species of the female partner. N. ephratae females paired with N. corniger males produced as many offspring as conspecific pairs. N. corniger females mated to N. ephratae males, however, produced significantly fewer offspring at 60 days post-establishment than the reciprocal cross or conspecific N. ephratae or N. corniger pairs. This was also the only pairing in which any aggression was observed. Heterospecific pairs and groups formed in mate choice mesocosms, suggesting that species recognition between these two termites is not an important aspect of mate choice. Overall, species mismatch tolerance and hybrid offspring viability are high. The present data, together with previous evidence from defensive secretions and isozyme analysis, suggest that hybridization may periodically occur in nature, and that reproductive barriers between these two species may be incomplete. Hybridization could provide a rare but important source of genetic diversity and may ensure mating opportunities for the more abundant sex of alates in each species.

An Electrochemical Genosensing Assay Based on Magnetic Beads and Gold Nanoparticle-Loaded Latex Microspheres for Vibrio cholerae Detection.

PubMed

Low, Kim-Fatt; Rijiravanich, Patsamon; Singh, Kirnpal Kaur Banga; Surareungchai, Werasak; Yean, Chan Yean

2015-04-01

An ultrasensitive electrochemical genosensing assay was developed for the sequence-specific detection of Vibrio cholerae DNA using magnetic beads as the biorecognition surface and gold nanoparticle-loaded latex microspheres (latex-AuNPs) as a signal-amplified hybridization tag. This biorecognition surface was prepared by immobilizing specific biotinylated capturing probes onto the streptavidin-coupled magnetic beads. Fabricating a hybridization tag capable of amplifying the electrochemical signal involved loading multiple AuNPs onto polyelectrolyte multilayer film-coated poly(styrene-co-acrylic acid) latex microspheres as carrier particles. The detection targets, single-stranded 224-bp asymmetric PCR amplicons of the V. cholerae lolB gene, were sandwich-hybridized to magnetic bead-functionalized capturing probes and fluorescein-labeled detection probes and tagged with latex-AuNPs. The subsequent electrochemical stripping analysis of chemically dissolved AuNPs loaded onto the latex microspheres allowed for the quantification of the target amplicons. The high-loading capacity of the AuNPs on the latex microspheres for sandwich-type dual-hybridization genosensing provided eminent signal amplification. The genosensing variables were optimized, and the assay specificity was demonstrated. The clinical applicability of the assay was evaluated using spiked stool specimens. The current signal responded linearly to the different V. cholerae concentrations spiked into stool specimens with a detection limit of 2 colony-forming units (CFU)/ml. The proposed latex-AuNP-based magnetogenosensing platform is promising, exhibits an effective amplification performance, and offers new opportunities for the ultrasensitive detection of other microbial pathogens.

Assessing the living and dead proportions of cold-water coral colonies: implications for deep-water Marine Protected Area monitoring in a changing ocean.

PubMed

Vad, Johanne; Orejas, Covadonga; Moreno-Navas, Juan; Findlay, Helen S; Roberts, J Murray

2017-01-01

Coral growth patterns result from an interplay of coral biology and environmental conditions. In this study colony size and proportion of live and dead skeletons in the cold-water coral (CWC) Lophelia pertusa (Linnaeus, 1758) were measured using video footage from Remotely Operated Vehicle (ROV) transects conducted at the inshore Mingulay Reef Complex (MRC) and at the offshore PISCES site (Rockall Bank) in the NE Atlantic. The main goal of this paper was to explore the development of a simple method to quantify coral growth and its potential application as an assessment tool of the health of these remote habitats. Eighteen colonies were selected and whole colony and dead/living layer size were measured. Live to dead layer ratios for each colony were then determined and analysed. The age of each colony was estimated using previously published data. Our paper shows that: (1) two distinct morphotypes can be described: at the MRC, colonies displayed a 'cauliflower-shaped' morphotype whereas at the PISCES site, colonies presented a more flattened 'bush-shaped' morphotype; (2) living layer size was positively correlated with whole colony size; (3) live to dead layer ratio was negatively correlated to whole colony size; (4) live to dead layer ratio never exceeded 0.27. These results suggest that as a colony develops and its growth rate slows down, the proportion of living polyps in the colony decreases. Furthermore, at least 73% of L. pertusa colonies are composed of exposed dead coral skeleton, vulnerable to ocean acidification and the associated shallowing of the aragonite saturation horizon, with significant implications for future deep-sea reef framework integrity. The clear visual contrast between white/pale living and grey/dark dead portions of the colonies also gives a new way by which they can be visually monitored over time. The increased use of marine autonomous survey vehicles offers an important new platform from which such a surveying technique could be applied to monitor deep-water marine protected areas in the future.

Lennie: a smartphone application with novel implications for the management of animal colonies.

PubMed

Allwood, M A; Griffith, D; Allen, C; Reed, J; Mahmoud, Q H; Brunt, K R; Simpson, J A

2015-07-01

Researchers rely on animals for their clinical applicability and ease of monitoring. However, careful management is required to ensure the animal and financial costs are minimized. The incorporation of 'smartphone' technology in research has increased exponentially, with a focus on the development of innovative research-based applications. We have developed a smartphone application designed to address the needs of modern researchers in the management of their colonies. 'Lennie' introduces a new method for the management of small to medium-sized animal colonies. Lennie allows users wireless access to their colonies with the ability to create and edit from virtually anywhere. Lennie also offers the ability to manage colonies based on experiments by assigning animals based on priority. Experimental time-points are also recorded with integrated scheduling options using the calendar function. Lennie represents an alternative to current large-scale software options, as the application design is simple, and requires no training or manuals. As the technological landscape is constantly evolving, we must continue to find ways to improve upon current practices to ensure that research is completed with efficiency and efficacy. With this new method of animal management, researchers are able to spend less time record keeping and can focus their efforts on continued innovation. © The Author(s) 2015.

Ant Colony Optimization Analysis on Overall Stability of High Arch Dam Basis of Field Monitoring

PubMed Central

Liu, Xiaoli; Chen, Hong-Xin; Kim, Jinxie

2014-01-01

A dam ant colony optimization (D-ACO) analysis of the overall stability of high arch dams on complicated foundations is presented in this paper. A modified ant colony optimization (ACO) model is proposed for obtaining dam concrete and rock mechanical parameters. A typical dam parameter feedback problem is proposed for nonlinear back-analysis numerical model based on field monitoring deformation and ACO. The basic principle of the proposed model is the establishment of the objective function of optimizing real concrete and rock mechanical parameter. The feedback analysis is then implemented with a modified ant colony algorithm. The algorithm performance is satisfactory, and the accuracy is verified. The m groups of feedback parameters, used to run a nonlinear FEM code, and the displacement and stress distribution are discussed. A feedback analysis of the deformation of the Lijiaxia arch dam and based on the modified ant colony optimization method is also conducted. By considering various material parameters obtained using different analysis methods, comparative analyses were conducted on dam displacements, stress distribution characteristics, and overall dam stability. The comparison results show that the proposal model can effectively solve for feedback multiple parameters of dam concrete and rock material and basically satisfy assessment requirements for geotechnical structural engineering discipline. PMID:25025089

A simple and inexpensive method for maintaining a defined flora mouse colony.

PubMed

Sedlacek, R S; Mason, K A

1977-10-01

The use of autoclaved cages, feed, bedding, water, and filter caps combined with aseptic techniques of animal husbandry in an existing mouse colony was ineffective in maintaining a defined flora colony. The addition of a laminar air flow bench equipped with a high efficiency particulate air filter provided a sterile environment in which to manipulate mice when the filter caps were removed. The installation of a duct to direct all air entering the room through the bench filter reduced the airborne bacterial counts in the room. This modification combined with the culling or marking of infected cages so that no future breeders would be taken from these cages eliminated a number of bacterial contaminants (Staphylococcus aureus, S epidermidis, and streptococci) from the colony.

Endogenous Sheet-Averaged Tension Within a Large Epithelial Cell Colony.

PubMed

Dumbali, Sandeep P; Mei, Lanju; Qian, Shizhi; Maruthamuthu, Venkat

2017-10-01

Epithelial cells form quasi-two-dimensional sheets that function as contractile media to effect tissue shape changes during development and homeostasis. Endogenously generated intrasheet tension is a driver of such changes, but has predominantly been measured in the presence of directional migration. The nature of epithelial cell-generated forces transmitted over supracellular distances, in the absence of directional migration, is thus largely unclear. In this report, we consider large epithelial cell colonies which are archetypical multicell collectives with extensive cell-cell contacts but with a symmetric (circular) boundary. Using the traction force imbalance method (TFIM) (traction force microscopy combined with physical force balance), we first show that one can determine the colony-level endogenous sheet forces exerted at the midline by one half of the colony on the other half with no prior assumptions on the uniformity of the mechanical properties of the cell sheet. Importantly, we find that this colony-level sheet force exhibits large variations with orientation-the difference between the maximum and minimum sheet force is comparable to the average sheet force itself. Furthermore, the sheet force at the colony midline is largely tensile but the shear component exhibits significantly more variation with orientation. We thus show that even an unperturbed epithelial colony with a symmetric boundary shows significant directional variation in the endogenous sheet tension and shear forces that subsist at the colony level.

Interspecific Transmission of Double-Stranded RNA and Hypovirulence from Sclerotinia sclerotiorum to S. minor.

PubMed

Melzer, M S; Ikeda, S S; Boland, G J

2002-07-01

ABSTRACT Interspecific transmission of a hypovirulence-associated double-stranded RNA (dsRNA) and hypovirulent phenotype was attempted from hypovirulent isolate Ss275 of Sclerotinia sclerotiorum to five virulent isolates of S. minor. dsRNA and the hypovirulent phenotype were successfully transmitted to one of the five isolates, Sm10. Three putative converted isolates of Sm10 were slow growing and developed atypical colony morphologies characteristic of the hypovirulent phenotype. These isolates were assayed for virulence and produced significantly smaller lesions than isolate Sm10 on detached leaves of Romaine lettuce. One of these putative converted isolates, designated Sm10T, was tested to confirm interspecific transmission of dsRNA. In northern hybridizations, dsRNA isolated from Sm10T hybridized with a digoxigenin-labeled cDNA probe prepared from dsRNA isolated from Ss275. Random amplified polymorphic DNA analysis confirmed that isolate Sm10T was derived from Sm10 and not from Ss275 or a hybrid of the two species. The dsRNA and hypovirulent phenotype were subsequently transmitted intraspecifically from Sm10T to Sm8. To our knowledge, this is the first report of interspecific transmission of dsRNA and an associated hypovirulent phenotype between fungal plant pathogens by hyphal anastomosis.

Colony, hanging drop, and methylcellulose three dimensional hypoxic growth optimization of renal cell carcinoma cell lines.

PubMed

Matak, Damian; Brodaczewska, Klaudia K; Lipiec, Monika; Szymanski, Łukasz; Szczylik, Cezary; Czarnecka, Anna M

2017-08-01

Renal cell carcinoma (RCC) is the most lethal of the common urologic malignancies, comprising 3% of all human neoplasms, and the incidence of kidney cancer is rising annually. We need new approaches to target tumor cells that are resistant to current therapies and that give rise to recurrence and treatment failure. In this study, we focused on low oxygen tension and three-dimensional (3D) cell culture incorporation to develop a new RCC growth model. We used the hanging drop and colony formation methods, which are common in 3D culture, as well as a unique methylcellulose (MC) method. For the experiments, we used human primary RCC cell lines, metastatic RCC cell lines, human kidney cancer stem cells, and human healthy epithelial cells. In the hanging drop assay, we verified the potential of various cell lines to create solid aggregates in hypoxic and normoxic conditions. With the semi-soft agar method, we also determined the ability of various cell lines to create colonies under different oxygen conditions. Different cell behavior observed in the MC method versus the hanging drop and colony formation assays suggests that these three assays may be useful to test various cell properties. However, MC seems to be a particularly valuable alternative for 3D cell culture, as its higher efficiency of aggregate formation and serum independency are of interest in different areas of cancer biology.

The ecology of Vibrio vulnificus, Vibrio cholerae, and Vibrio parahaemolyticus in North Carolina estuaries.

PubMed

Blackwell, Karen Dyer; Oliver, James D

2008-04-01

While numerous studies have characterized the distribution and/or ecology of various pathogenic Vibrio spp., here we have simultaneously examined several estuarine sites for Vibrio vulnificus, V. cholerae, and V. parahaemolyticus. For a one year period, waters and sediment were monitored for the presence of these three pathogens at six different sites on the east coast of North Carolina in the United States. All three pathogens, identified using colony hybridization and PCR methods, occurred in these estuarine environments, although V. cholerae occurred only infrequently and at very low levels. Seventeen chemical, physical, and biological parameters were investigated, including salinity, water temperature, turbidity, dissolved oxygen, levels of various inorganic nutrients and dissolved organic carbon, as well as total vibrios, total coliforms, and E. coli. We found each of the Vibrio spp. in water and sediment to correlate to several of these environmental measurements, with water temperature and total Vibrio levels correlating highly (P<0.0001) with occurrence of the three pathogens. Thus, these two parameters may represent simple assays for characterizing the potential public health hazard of estuarine waters.

Stability of Bradyrhizobium japonicum Inoculants after Introduction into Soil

PubMed Central

Brunel, Brigitte; Cleyet-Marel, Jean-Claude; Normand, Philippe; Bardin, Rene

1988-01-01

Bradyrhizobium japonicum USDA 125-Sp, USDA 138, and USDA 138-Sm had been used as inoculants for soybean (Glycine max (L.) Merr.) in soils previously free of B. japonicum. At 8 to 13 years after their release, these strains were reisolated from soil samples. A total of 115 isolates were obtained through nodules, and seven colonies were obtained directly by a serological method. The stability of the inoculants was confirmed by comparing the reisolated cultures with their respective parental strains which had been preserved by being lyophilized or stored on a yeast extract-mannitol agar slant at 4°C. Comparisons were made on morphological and serological characters, carbon compound utilization (8 tested), intrinsic antibiotic resistance (9 tested), and enzymatic activity (19 tested). Mucous and nonmucous isolates of serogroup 125 were analyzed for symbiotic effectiveness and restriction fragment hybridization with a DNA probe. Our data suggest that the B. japonicum inoculants have survived for up to 13 years in the soils without significant mutation except for two reisolates with a slightly increased kanamycin resistance level. Images PMID:16347768

Diffuse colonies of human skin fibroblasts in relation to cellular senescence and proliferation.

PubMed

Zorin, Vadim; Zorina, Alla; Smetanina, Nadezhda; Kopnin, Pavel; Ozerov, Ivan V; Leonov, Sergey; Isaev, Artur; Klokov, Dmitry; Osipov, Andreyan N

2017-05-16

Development of personalized skin treatment in medicine and skin care may benefit from simple and accurate evaluation of the fraction of senescent skin fibroblasts that lost their proliferative capacity. We examined whether enriched analysis of colonies formed by primary human skin fibroblasts, a simple and widely available cellular assay, could reveal correlations with the fraction of senescent cells in heterogenic cell population. We measured fractions of senescence associated β-galactosidase (SA-βgal) positive cells in either mass cultures or colonies of various morphological types (dense, mixed and diffuse) formed by skin fibroblasts from 10 human donors. Although the donors were chosen to be within the same age group (33-54 years), the colony forming efficiency of their fibroblasts (ECO-f) and the percentage of dense, mixed and diffuse colonies varied greatly among the donors. We showed, for the first time, that the SA-βgal positive fraction was the largest in diffuse colonies, confirming that they originated from cells with the least proliferative capacity. The percentage of diffuse colonies was also found to correlate with the SA-βgal positive cells in mass culture. Using Ki67 as a cell proliferation marker, we further demonstrated a strong inverse correlation (r=-0.85, p=0.02) between the percentage of diffuse colonies and the fraction of Ki67+ cells. Moreover, a significant inverse correlation (r=-0.94, p=0.0001) between the percentage of diffuse colonies and ECO-f was found. Our data indicate that quantification of a fraction of diffuse colonies may provide a simple and useful method to evaluate the extent of cellular senescence in human skin fibroblasts.

The Similarity and Appropriate Usage of Three Honey Bee (Hymenoptera: Apidae) Datasets for Longitudinal Studies.

PubMed

Highland, Steven; James, R R

2016-04-01

Honey bee (Apis mellifera L., Hymenoptera: Apidae) colonies have experienced profound fluctuations, especially declines, in the past few decades. Long-term datasets on honey bees are needed to identify the most important environmental and cultural factors associated with these changes. While a few such datasets exist, scientists have been hesitant to use some of these due to perceived shortcomings in the data. We compared data and trends for three datasets. Two come from the US Department of Agriculture's National Agricultural Statistics Service (NASS), Agricultural Statistics Board: one is the annual survey of honey-producing colonies from the Annual Bee and Honey program (ABH), and the other is colony counts from the Census of Agriculture conducted every five years. The third dataset we developed from the number of colonies registered annually by some states. We compared the long-term patterns of change in colony numbers among the datasets on a state-by-state basis. The three datasets often showed similar hive numbers and trends varied by state, with differences between datasets being greatest for those states receiving a large number of migratory colonies. Dataset comparisons provide a method to estimate the number of colonies in a state used for pollination versus honey production. Some states also had separate data for local and migratory colonies, allowing one to determine whether the migratory colonies were typically used for pollination or honey production. The Census of Agriculture should provide the most accurate long-term data on colony numbers, but only every five years. © The Authors 2016. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Phenotypic and genetic analyses of the varroa sensitive hygienic trait in Russian honey bee (hymenoptera: apidae) colonies.

PubMed

Kirrane, Maria J; de Guzman, Lilia I; Holloway, Beth; Frake, Amanda M; Rinderer, Thomas E; Whelan, Pádraig M

2014-01-01

Varroa destructor continues to threaten colonies of European honey bees. General hygiene, and more specific Varroa Sensitive Hygiene (VSH), provide resistance towards the Varroa mite in a number of stocks. In this study, 32 Russian (RHB) and 14 Italian honey bee colonies were assessed for the VSH trait using two different assays. Firstly, colonies were assessed using the standard VSH behavioural assay of the change in infestation of a highly infested donor comb after a one-week exposure. Secondly, the same colonies were assessed using an "actual brood removal assay" that measured the removal of brood in a section created within the donor combs as a potential alternative measure of hygiene towards Varroa-infested brood. All colonies were then analysed for the recently discovered VSH quantitative trait locus (QTL) to determine whether the genetic mechanisms were similar across different stocks. Based on the two assays, RHB colonies were consistently more hygienic toward Varroa-infested brood than Italian honey bee colonies. The actual number of brood cells removed in the defined section was negatively correlated with the Varroa infestations of the colonies (r2 = 0.25). Only two (percentages of brood removed and reproductive foundress Varroa) out of nine phenotypic parameters showed significant associations with genotype distributions. However, the allele associated with each parameter was the opposite of that determined by VSH mapping. In this study, RHB colonies showed high levels of hygienic behaviour towards Varroa -infested brood. The genetic mechanisms are similar to those of the VSH stock, though the opposite allele associates in RHB, indicating a stable recombination event before the selection of the VSH stock. The measurement of brood removal is a simple, reliable alternative method of measuring hygienic behaviour towards Varroa mites, at least in RHB stock.

Phenotypic and Genetic Analyses of the Varroa Sensitive Hygienic Trait in Russian Honey Bee (Hymenoptera: Apidae) Colonies

PubMed Central

Kirrane, Maria J.; de Guzman, Lilia I.; Holloway, Beth; Frake, Amanda M.; Rinderer, Thomas E.; Whelan, Pádraig M.

2015-01-01

Varroa destructor continues to threaten colonies of European honey bees. General hygiene, and more specific Varroa Sensitive Hygiene (VSH), provide resistance towards the Varroa mite in a number of stocks. In this study, 32 Russian (RHB) and 14 Italian honey bee colonies were assessed for the VSH trait using two different assays. Firstly, colonies were assessed using the standard VSH behavioural assay of the change in infestation of a highly infested donor comb after a one-week exposure. Secondly, the same colonies were assessed using an “actual brood removal assay” that measured the removal of brood in a section created within the donor combs as a potential alternative measure of hygiene towards Varroa-infested brood. All colonies were then analysed for the recently discovered VSH quantitative trait locus (QTL) to determine whether the genetic mechanisms were similar across different stocks. Based on the two assays, RHB colonies were consistently more hygienic toward Varroa-infested brood than Italian honey bee colonies. The actual number of brood cells removed in the defined section was negatively correlated with the Varroa infestations of the colonies (r2 = 0.25). Only two (percentages of brood removed and reproductive foundress Varroa) out of nine phenotypic parameters showed significant associations with genotype distributions. However, the allele associated with each parameter was the opposite of that determined by VSH mapping. In this study, RHB colonies showed high levels of hygienic behaviour towards Varroa -infested brood. The genetic mechanisms are similar to those of the VSH stock, though the opposite allele associates in RHB, indicating a stable recombination event before the selection of the VSH stock. The measurement of brood removal is a simple, reliable alternative method of measuring hygienic behaviour towards Varroa mites, at least in RHB stock. PMID:25909856

In-hive Pesticide Exposome: Assessing risks to migratory honey bees from in-hive pesticide contamination in the Eastern United States

NASA Astrophysics Data System (ADS)

Traynor, Kirsten S.; Pettis, Jeffery S.; Tarpy, David R.; Mullin, Christopher A.; Frazier, James L.; Frazier, Maryann; Vanengelsdorp, Dennis

2016-09-01

This study measured part of the in-hive pesticide exposome by analyzing residues from live in-hive bees, stored pollen, and wax in migratory colonies over time and compared exposure to colony health. We summarized the pesticide burden using three different additive methods: (1) the hazard quotient (HQ), an estimate of pesticide exposure risk, (2) the total number of pesticide residues, and (3) the number of relevant residues. Despite being simplistic, these models attempt to summarize potential risk from multiple contaminations in real-world contexts. Colonies performing pollination services were subject to increased pesticide exposure compared to honey-production and holding yards. We found clear links between an increase in the total number of products in wax and colony mortality. In particular, we found that fungicides with particular modes of action increased disproportionally in wax within colonies that died. The occurrence of queen events, a significant risk factor for colony health and productivity, was positively associated with all three proxies of pesticide exposure. While our exposome summation models do not fully capture the complexities of pesticide exposure, they nonetheless help elucidate their risks to colony health. Implementing and improving such models can help identify potential pesticide risks, permitting preventative actions to improve pollinator health.

In-hive Pesticide Exposome: Assessing risks to migratory honey bees from in-hive pesticide contamination in the Eastern United States

PubMed Central

Traynor, Kirsten S.; Pettis, Jeffery S.; Tarpy, David R.; Mullin, Christopher A.; Frazier, James L.; Frazier, Maryann; vanEngelsdorp, Dennis

2016-01-01

This study measured part of the in-hive pesticide exposome by analyzing residues from live in-hive bees, stored pollen, and wax in migratory colonies over time and compared exposure to colony health. We summarized the pesticide burden using three different additive methods: (1) the hazard quotient (HQ), an estimate of pesticide exposure risk, (2) the total number of pesticide residues, and (3) the number of relevant residues. Despite being simplistic, these models attempt to summarize potential risk from multiple contaminations in real-world contexts. Colonies performing pollination services were subject to increased pesticide exposure compared to honey-production and holding yards. We found clear links between an increase in the total number of products in wax and colony mortality. In particular, we found that fungicides with particular modes of action increased disproportionally in wax within colonies that died. The occurrence of queen events, a significant risk factor for colony health and productivity, was positively associated with all three proxies of pesticide exposure. While our exposome summation models do not fully capture the complexities of pesticide exposure, they nonetheless help elucidate their risks to colony health. Implementing and improving such models can help identify potential pesticide risks, permitting preventative actions to improve pollinator health. PMID:27628343

Sugarcane Aphid Population Growth, Plant Injury, and Natural Enemies on Selected Grain Sorghum Hybrids in Texas and Louisiana.

PubMed

Brewer, Michael J; Gordy, John W; Kerns, David L; Woolley, James B; Rooney, William L; Bowling, Robert D

2017-10-01

In response to the 2013 outbreak of sugarcane aphid, Melanaphis sacchari (Zehntner) (Hemiptera: Aphididae), on sorghum, Sorghum bicolor (L.), in North America, experiments were conducted at three southern U.S. grain sorghum production locations (Corpus Christi, TX; Winnsboro, LA; Rosenberg, TX). The objectives were to authenticate yield decline on susceptible hybrids (2014 and 2015) and to measure aphid population growth and natural enemy prevalence on susceptible and resistant hybrids with similar genetic background (2014). Yield decline on susceptible hybrids (Tx 2752/Tx430 and DKS53-67) was more substantial when aphid population growth accelerated quickly and peaked above 300 aphids per leaf (50 to nearly 100% yield decline). Location and year variation in maximum aphid density and cumulative aphid-days was high, with doubling time values on the susceptible hybrids ranging between 3.9 and 7.9 d. On resistant Tx2752/Tx2783, leaf injury and yield decline were not seen or less severe than on its paired susceptible Tx2752/Tx430. Aphids declined on Tx2752/Tx2783 after initial colony establishment (Corpus Christi) or took about 60% longer to double in population size when compared with Tx2572/Tx430 (Winnsboro). The predominant natural enemy taxa were aphelinid mummies (Hymenoptera: Aphelinidae), ladybird beetles (Coleoptera: Coccinellidae), and sryphid flies (Diptera: Syrphidae), and they were more prevalent during flowering than prior to flowering. They were generally responsive to changes in aphid density of both susceptible and resistant hybrids, but variability points to need for further study. In future research, full season observations should continue as well as more detailed study of potential compatibility of sorghum resistance and biological control. © The Author 2017. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Reduction hybrid artifacts of EMG-EOG in electroencephalography evoked by prefrontal transcranial magnetic stimulation

NASA Astrophysics Data System (ADS)

Bai, Yang; Wan, Xiaohong; Zeng, Ke; Ni, Yinmei; Qiu, Lirong; Li, Xiaoli

2016-12-01

Objective. When prefrontal-transcranial magnetic stimulation (p-TMS) performed, it may evoke hybrid artifact mixed with muscle activity and blink activity in EEG recordings. Reducing this kind of hybrid artifact challenges the traditional preprocessing methods. We aim to explore method for the p-TMS evoked hybrid artifact removal. Approach. We propose a novel method used as independent component analysis (ICA) post processing to reduce the p-TMS evoked hybrid artifact. Ensemble empirical mode decomposition (EEMD) was used to decompose signal into multi-components, then the components were separated with artifact reduced by blind source separation (BSS) method. Three standard BSS methods, ICA, independent vector analysis, and canonical correlation analysis (CCA) were tested. Main results. Synthetic results showed that EEMD-CCA outperformed others as ICA post processing step in hybrid artifacts reduction. Its superiority was clearer when signal to noise ratio (SNR) was lower. In application to real experiment, SNR can be significantly increased and the p-TMS evoked potential could be recovered from hybrid artifact contaminated signal. Our proposed method can effectively reduce the p-TMS evoked hybrid artifacts. Significance. Our proposed method may facilitate future prefrontal TMS-EEG researches.

[Analysis of bacterial small-colony variants isolated from clinical specimens].

PubMed

Matsumoto, Takehisa

2014-07-01

There is a slow-growing subpopulation of bacteria with distinctive phenotypic and pathogenic traits called bacterial small-colony variants (SCVs). Phenotypically, SCVs show a slow growth rate, atypical colony morphology, and unusual biochemical characteristics. SCV strains often grow on blood agar or Drigalski agar as non-pigmented or pinpoint pigmented colonies, and key biochemical tests for them are often non-reactive. This review describes analyses of hemin-dependent Escherichia coli SCV and Staphylococcus aureus thymidine-dependent SCVs based on our case reports. Because SCVs exhibit fastidious growth characteristics, clinical microbiologists may easily miss or misidentify them in the clinical laboratory. Therefore, we must elucidate the cause of SCVs, and improve laboratory methods for the identification and assessment of the susceptibility of SCVs in the clinical laboratory.

Iridovirus and microsporidian linked to honey bee colony decline.

PubMed

Bromenshenk, Jerry J; Henderson, Colin B; Wick, Charles H; Stanford, Michael F; Zulich, Alan W; Jabbour, Rabih E; Deshpande, Samir V; McCubbin, Patrick E; Seccomb, Robert A; Welch, Phillip M; Williams, Trevor; Firth, David R; Skowronski, Evan; Lehmann, Margaret M; Bilimoria, Shan L; Gress, Joanna; Wanner, Kevin W; Cramer, Robert A

2010-10-06

In 2010 Colony Collapse Disorder (CCD), again devastated honey bee colonies in the USA, indicating that the problem is neither diminishing nor has it been resolved. Many CCD investigations, using sensitive genome-based methods, have found small RNA bee viruses and the microsporidia, Nosema apis and N. ceranae in healthy and collapsing colonies alike with no single pathogen firmly linked to honey bee losses. We used Mass spectrometry-based proteomics (MSP) to identify and quantify thousands of proteins from healthy and collapsing bee colonies. MSP revealed two unreported RNA viruses in North American honey bees, Varroa destructor-1 virus and Kakugo virus, and identified an invertebrate iridescent virus (IIV) (Iridoviridae) associated with CCD colonies. Prevalence of IIV significantly discriminated among strong, failing, and collapsed colonies. In addition, bees in failing colonies contained not only IIV, but also Nosema. Co-occurrence of these microbes consistently marked CCD in (1) bees from commercial apiaries sampled across the U.S. in 2006-2007, (2) bees sequentially sampled as the disorder progressed in an observation hive colony in 2008, and (3) bees from a recurrence of CCD in Florida in 2009. The pathogen pairing was not observed in samples from colonies with no history of CCD, namely bees from Australia and a large, non-migratory beekeeping business in Montana. Laboratory cage trials with a strain of IIV type 6 and Nosema ceranae confirmed that co-infection with these two pathogens was more lethal to bees than either pathogen alone. These findings implicate co-infection by IIV and Nosema with honey bee colony decline, giving credence to older research pointing to IIV, interacting with Nosema and mites, as probable cause of bee losses in the USA, Europe, and Asia. We next need to characterize the IIV and Nosema that we detected and develop management practices to reduce honey bee losses.

Iridovirus and Microsporidian Linked to Honey Bee Colony Decline

PubMed Central

Bromenshenk, Jerry J.; Henderson, Colin B.; Wick, Charles H.; Stanford, Michael F.; Zulich, Alan W.; Jabbour, Rabih E.; Deshpande, Samir V.; McCubbin, Patrick E.; Seccomb, Robert A.; Welch, Phillip M.; Williams, Trevor; Firth, David R.; Skowronski, Evan; Lehmann, Margaret M.; Bilimoria, Shan L.; Gress, Joanna; Wanner, Kevin W.; Cramer, Robert A.

2010-01-01

Background In 2010 Colony Collapse Disorder (CCD), again devastated honey bee colonies in the USA, indicating that the problem is neither diminishing nor has it been resolved. Many CCD investigations, using sensitive genome-based methods, have found small RNA bee viruses and the microsporidia, Nosema apis and N. ceranae in healthy and collapsing colonies alike with no single pathogen firmly linked to honey bee losses. Methodology/Principal Findings We used Mass spectrometry-based proteomics (MSP) to identify and quantify thousands of proteins from healthy and collapsing bee colonies. MSP revealed two unreported RNA viruses in North American honey bees, Varroa destructor-1 virus and Kakugo virus, and identified an invertebrate iridescent virus (IIV) (Iridoviridae) associated with CCD colonies. Prevalence of IIV significantly discriminated among strong, failing, and collapsed colonies. In addition, bees in failing colonies contained not only IIV, but also Nosema. Co-occurrence of these microbes consistently marked CCD in (1) bees from commercial apiaries sampled across the U.S. in 2006–2007, (2) bees sequentially sampled as the disorder progressed in an observation hive colony in 2008, and (3) bees from a recurrence of CCD in Florida in 2009. The pathogen pairing was not observed in samples from colonies with no history of CCD, namely bees from Australia and a large, non-migratory beekeeping business in Montana. Laboratory cage trials with a strain of IIV type 6 and Nosema ceranae confirmed that co-infection with these two pathogens was more lethal to bees than either pathogen alone. Conclusions/Significance These findings implicate co-infection by IIV and Nosema with honey bee colony decline, giving credence to older research pointing to IIV, interacting with Nosema and mites, as probable cause of bee losses in the USA, Europe, and Asia. We next need to characterize the IIV and Nosema that we detected and develop management practices to reduce honey bee losses. PMID:20949138

A spatial and vertical comparison of coral Sr/Ca variations and growth rates in Montastraea faveolata colonies in Veracruz, Mexico

NASA Astrophysics Data System (ADS)

Cobb, R. M.; DeLong, K. L.; Richey, J. N.; Flannery, J. A.; Kilbourne, K. H.; Smith, J. M.; Quinn, T. M.; Hudson, J. H.

2013-12-01

The massive coral genera Montastraea spp. is ubiquitous in modern and fossil coral reefs in the Gulf of Mexico and Caribbean Sea making this genus a potential archive for paleoclimate reconstructions. Interpretation of modern and fossil coral records requires understanding the origins of variability in coral geochemical variations on scales ranging from intracolony to regional as well as differing water depths. In 1991, the U.S. Geological Survey recovered cores from five Montastraea faveolata colonies offshore of Veracruz, Mexico (19.06°N, 96.93°W) in water depths from 2.7 m to 12.2 m. The average linear extension per year based on x-radiograph analysis is similar (8.1 and 8.6, ×1.9 mm/yr, 1σ; n=31) for colonies at water depths of 2.7 and 4.3 m, respectively, for the interval from 1963 to 1991. Progressively slower extension rates are observed for deeper colonies (7.6 × 1.8, 7.5 × 1.9, and 4.5 × 1.5 mm/yr, 1σ; n=31) for 5.8, 6.1 and 12.2 m, respectively. Correlation coefficients among annual linear extension records vary between 0.00 and 0.40 (n=31) with the lowest correlation between colonies in close proximity (~1 km) and highest between colonies furthest apart (~250 km). We analyzed coral Sr/Ca at approximately 18 samples per year (0.5 mm/sample) along corallite thecal walls parallel to the slab surface for the interval from 1982 to 1991. This geochemical proxy for SST reveals seasonal variations within the coral skeleton that correspond to the high- and low-density bands in the coral slab, which represent one year of growth. Our linear regression of coral Sr/Ca from a single core (5.8 m water depth) to the Optimum Interpolation sea surface temperature (OISST; Reynolds et al., 2002) results in a slope of -0.049 (×0.024 mmol/mol/°C, 1σ; n=100; r2=0.52), which is slightly greater than the slope of other published Montastraea calibrations, but less than those reported for Porites spp. An alternative calibration method is to examine mean coral Sr/Ca with mean SST for various locations from studies using the same analytical methods and reference standards. The mean Sr/Ca calibration for nine coral colonies from Veracruz, Puerto Rico, Florida Keys, and Dry Tortugas with OISST results in a slope similar to that observed for Porites spp. determined with the same method. Slope differences between calibration methods may be due to time averaging along the sample transect. Future work will examine coral Sr/Ca in the other four M. faveolata colonies from Veracruz to assess reproducibility.

Temporal Assessment of Molting in Workers of Formosan Subterranean Termites (Isoptera: Rhinotermitidae).

PubMed

Kakkar, G; Chouvenc, T; Osbrink, W; Su, N-Y

2016-10-01

Molt frequency of workers in laboratory-reared juvenile colonies and foraging population from field colonies of Coptotermes formosanus Shiraki was determined using planar arenas in laboratory. Given that, chitin synthesis inhibitor (CSI)-incorporated baits disrupt the molting process of workers that comprises the major population of a termite colony, temporal assessment of molting frequency in workers can give insights into potential methods of reducing the time to eliminate a CSI-baited colony. In our study the 10-d observation of juvenile colonies of C. formosanus suggested average daily molting incidence of workers in a colony is 1.7 ±  0.3% (mean ± SD). The results from a time lapse study on foraging population of workers showed that on average there is a 44-d intermolt period for second-instar workers molting to third instar and 45 d for third-instar workers molting to fourth instar. At low temperature (21 °C), molting frequency of workers (0.6% per day) was significantly lower than that of workers at 27 °C (2.2% per day). Information from this study suggests that time to molt is an important component of total time for eliminating colonies treated with CSI baits and reduction in time lapse between two consecutive molts may reduce the time required for colony elimination. © The Authors 2016. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Microbiological contamination of cubicle curtains in an out-patient podiatry clinic

PubMed Central

2010-01-01

Background Exposure to potential pathogens on contaminated healthcare garments and curtains can occur through direct or indirect contact. This study aimed to identify the microorganisms present on podiatry clinic curtains and measure the contamination pre and post a standard hospital laundry process. Method Baseline swabs were taken to determine colony counts present on cubical curtains before laundering. Curtains were swabbed again immediately after, one and three weeks post laundering. Total colony counts were calculated and compared to baseline, with identification of micro-organisms. Results Total colony counts increased very slightly by 3% immediately after laundry, which was not statistically significant, and declined significantly (p = 0.0002) by 56% one-week post laundry. Three weeks post laundry colony counts had increased by 16%; although clinically relevant, this was not statistically significant. The two most frequent microorganisms present throughout were Coagulase Negative Staphylococcus and Micrococcus species. Laundering was not completely effective, as both species demonstrated no significant change following laundry. Conclusion This work suggests current laundry procedures may not be 100% effective in killing all microorganisms found on curtains, although a delayed decrease in total colony counts was evident. Cubicle curtains may act as a reservoir for microorganisms creating potential for cross contamination. This highlights the need for additional cleaning methods to decrease the risk of cross infection and the importance of maintaining good hand hygiene. PMID:21087486

Efficient method to create integration-free, virus-free, Myc and Lin28-free human induced pluripotent stem cells from adherent cells.

PubMed

Kamath, Anant; Ternes, Sara; McGowan, Stephen; English, Anthony; Mallampalli, Rama; Moy, Alan B

2017-08-01

Nonviral induced pluripotent stem cell (IPSC) reprogramming is not efficient without the oncogenes, Myc and Lin28 . We describe a robust Myc and Lin28 -free IPSC reprogramming approach using reprogramming molecules. IPSC colony formation was compared in the presence and absence of Myc and Lin28 by the mixture of reprogramming molecules and episomal vectors. While more colonies were observed in cultures transfected with the aforementioned oncogenes, the Myc and Lin28 -free method achieved the same reprogramming efficiency as reports that used these oncogenes. Further, all colonies were fully reprogrammed based on expression of SSEA4, even in the absence of Myc and Lin28 . This approach satisfies an important regulatory pathway for developing IPSC cell therapies with lower clinical risk.

Detection and isolation of nucleic acid sequences using competitive hybridization probes

DOEpatents

Lucas, Joe N.; Straume, Tore; Bogen, Kenneth T.

1997-01-01

A method for detecting a target nucleic acid sequence in a sample is provided using hybridization probes which competitively hybridize to a target nucleic acid. According to the method, a target nucleic acid sequence is hybridized to first and second hybridization probes which are complementary to overlapping portions of the target nucleic acid sequence, the first hybridization probe including a first complexing agent capable of forming a binding pair with a second complexing agent and the second hybridization probe including a detectable marker. The first complexing agent attached to the first hybridization probe is contacted with a second complexing agent, the second complexing agent being attached to a solid support such that when the first and second complexing agents are attached, target nucleic acid sequences hybridized to the first hybridization probe become immobilized on to the solid support. The immobilized target nucleic acids are then separated and detected by detecting the detectable marker attached to the second hybridization probe. A kit for performing the method is also provided.

Detection and isolation of nucleic acid sequences using competitive hybridization probes

DOEpatents

Lucas, J.N.; Straume, T.; Bogen, K.T.

1997-04-01

A method for detecting a target nucleic acid sequence in a sample is provided using hybridization probes which competitively hybridize to a target nucleic acid. According to the method, a target nucleic acid sequence is hybridized to first and second hybridization probes which are complementary to overlapping portions of the target nucleic acid sequence, the first hybridization probe including a first complexing agent capable of forming a binding pair with a second complexing agent and the second hybridization probe including a detectable marker. The first complexing agent attached to the first hybridization probe is contacted with a second complexing agent, the second complexing agent being attached to a solid support such that when the first and second complexing agents are attached, target nucleic acid sequences hybridized to the first hybridization probe become immobilized on to the solid support. The immobilized target nucleic acids are then separated and detected by detecting the detectable marker attached to the second hybridization probe. A kit for performing the method is also provided. 7 figs.

Identification of Malassezia species from pityriasis versicolor lesions with a new multiplex PCR method.

PubMed

Vuran, Emre; Karaarslan, Aydın; Karasartova, Djursun; Turegun, Buse; Sahin, Fikret

2014-02-01

Despite the fact that a range of molecular methods have been developed as tools for the diagnosis of Malassezia species, there are several drawbacks associated with them, such as inefficiency of differentiating all the species, high cost, and questionable reproducibility. In addition, most of the molecular methods require cultivation to enhance sensitivity. Therefore, alternative methods eliminating cultivation and capable of identifying species with high accuracy and reliability are needed. Herein, a multiplex polymerase chain reaction (PCR)-based method was especially developed for the detection of eleven Malassezia species. The multiplex PCR was standardized by incorporating a consensus forward primer, along with Malassezia species-specific reverse primers considering the sizes of the PCR products. In the method, the multiplex-PCR primer content is divided into three parts to circumvent the problem of increased nonspecific background resulting from the use of a large number of primers. DNA extraction protocol described by Harju and colleagues was modified using liquid nitrogen instead of -80 °C to break down the yeast membrane. By a modified extraction procedure followed by multiplex PCR and electrophoresis, the method enables identification and differentiation of Malassezia species from both of the samples obtained directly from skin and yeast colonies grown in culture. Fifty-five patients who were confirmed with pityriasis versicolor were enrolled in the study. Multiplex PCR detected and differentiated all 55 samples obtained directly from the patients' skin. However, 50 out of 55 samples yielded Malassezia colony in the culture. In addition, eight of 50 colonies were misdiagnosed or not completely differentiated by conventional methods based on the sequence analysis of eight colonies. The method is capable of identifying species with high accuracy and reliability. In addition, it is simple, quick, and cost-effective. More importantly, the method works efficiently for the diagnosis of Malassezia species obtained directly from patient samples.

Improved Modeling of Intelligent Tutoring Systems Using Ant Colony Optimization

ERIC Educational Resources Information Center

Rastegarmoghadam, Mahin; Ziarati, Koorush

2017-01-01

Swarm intelligence approaches, such as ant colony optimization (ACO), are used in adaptive e-learning systems and provide an effective method for finding optimal learning paths based on self-organization. The aim of this paper is to develop an improved modeling of adaptive tutoring systems using ACO. In this model, the learning object is…

Use of a Colony of Cooperating Agents and MAPLE To Solve the Traveling Salesman Problem.

ERIC Educational Resources Information Center

Guerrieri, Bruno

This paper reviews an approach for finding optimal solutions to the traveling salesman problem, a well-known problem in combinational optimization, and describes implementing the approach using the MAPLE computer algebra system. The method employed in this approach to the problem is similar to the way ant colonies manage to establish shortest…

Post-Colonial Science Education: The Challenge of Negotiating Researcher Positioning

ERIC Educational Resources Information Center

Burke, Lydia E. Carol-Ann

2014-01-01

In this paper, I describe a methodology that I employed, and resultant methods that I designed, to facilitate a Critical Discourse Analysis exploring perspectives on Western modern science as a school subject discipline in a given Caribbean context. Using specific themes from post-colonial theory, I sought to engage with some of the viewpoints…

Rearing Glypta Fumiferanae [hym.:Ichneumonida] on a multivoltine laboratory colony of the Western Spruce Budworm (Choristoneura Occidentalis) [LEP.:Tortricidae

Treesearch

Nancy Rappaport; Marion Page

1985-01-01

Methods were devloped for rearing Glypta fumiferanae Viereck on a nondiapausing laboratory colony of the western spruce budworm, Choristoneura occidentalis Freeman. Both host and parasite are univoltine and undergo diapause in nature. In this study, the parasite's voltinism was synchronized with that of a nondiapausing...

The Dutch colonial architecture of buildings in Manado’s Old City: A response to the coastal tropical climate

NASA Astrophysics Data System (ADS)

Kumurur, V. A.; Tampi, D. M.

2018-03-01

The late 19th and early 20th centuries was an era when the phenomenon of global warming began, as did the development of cities in Indonesia. In that era, cities in Indonesia functioned as colonial cities. The city of Manado is one of the coastal cities, written in the Dutch Royal Act of 1814 as the territory of Dutch sovereignty, was amended in 1848, 1872 and 1922. Dutch colonial art and architecture in Indonesia are not only influenced by culture but also the climate. For the purpose of physical comfort in the tropical environments, architects began to use local building materials, since the early 19th century, and the building began to be replaced by a customizing architecture. Descriptive analysis was employed as the method in this study. The result found that the Dutch Colonial Architecture emphasized the physical aspects, the royal style adapted to local conditions, and the local building emphasis on function. The tropical climate of Manado City influences the shape of the building with Dutch colonial architectural style in this area. As climate change is shown by rising temperatures, further observations on the design of colonial architecture will be important.

Detection by hyperspectral imaging of shiga toxin-producing Escherichia coli serogroups O26, O45, O103, O111, O121, and O145 on rainbow agar.

PubMed

Windham, William R; Yoon, Seung-Chul; Ladely, Scott R; Haley, Jennifer A; Heitschmidt, Jerry W; Lawrence, Kurt C; Park, Bosoon; Narrang, Neelam; Cray, William C

2013-07-01

The U.S. Department of Agriculture, Food Safety Inspection Service has determined that six non-O157 Shiga toxin-producing Escherichia coli (STEC) serogroups (O26, O45, O103, O111, O121, and O145) are adulterants in raw beef. Isolate and phenotypic discrimination of non-O157 STEC is problematic due to the lack of suitable agar media. The lack of distinct phenotypic color variation among non-O157serogroups cultured on chromogenic agar poses a challenge in selecting colonies for confirmation. In this study, visible and near-infrared hyperspectral imaging and chemometrics were used to detect and classify non-O157 STEC serogroups grown on Rainbow agar O157. The method was first developed by building spectral libraries for each serogroup obtained from ground-truth regions of interest representing the true identity of each pixel and thus each pure culture colony in the hyperspectral agar-plate image. The spectral library for the pure-culture non-O157 STEC consisted of 2,171 colonies, with spectra derived from 124,347 of pixels. The classification models for each serogroup were developed with a k nearest-neighbor classifier. The overall classification training accuracy at the colony level was 99%. The classifier was validated with ground beef enrichments artificially inoculated with 10, 50, and 100 CFU/ml STEC. The validation ground-truth regions of interest of the STEC target colonies consisted of 606 colonies, with 3,030 pixels of spectra. The overall classification accuracy was 98%. The average specificity of the method was 98% due to the low false-positive rate of 1.2%. The sensitivity ranged from 78 to 100% due to the false-negative rates of 22, 7, and 8% for O145, O45, and O26, respectively. This study showed the potential of visible and near-infrared hyperspectral imaging for detecting and classifying colonies of the six non-O157 STEC serogroups. The technique needs to be validated with bacterial cultures directly extracted from meat products and positive identification of colonies by using confirmatory tests such as latex agglutination tests or PCR.

Ultra-Fine Scale Spatially-Integrated Mapping of Habitat and Occupancy Using Structure-From-Motion.

PubMed

McDowall, Philip; Lynch, Heather J

2017-01-01

Organisms respond to and often simultaneously modify their environment. While these interactions are apparent at the landscape extent, the driving mechanisms often occur at very fine spatial scales. Structure-from-Motion (SfM), a computer vision technique, allows the simultaneous mapping of organisms and fine scale habitat, and will greatly improve our understanding of habitat suitability, ecophysiology, and the bi-directional relationship between geomorphology and habitat use. SfM can be used to create high-resolution (centimeter-scale) three-dimensional (3D) habitat models at low cost. These models can capture the abiotic conditions formed by terrain and simultaneously record the position of individual organisms within that terrain. While coloniality is common in seabird species, we have a poor understanding of the extent to which dense breeding aggregations are driven by fine-scale active aggregation or limited suitable habitat. We demonstrate the use of SfM for fine-scale habitat suitability by reconstructing the locations of nests in a gentoo penguin colony and fitting models that explicitly account for conspecific attraction. The resulting digital elevation models (DEMs) are used as covariates in an inhomogeneous hybrid point process model. We find that gentoo penguin nest site selection is a function of the topography of the landscape, but that nests are far more aggregated than would be expected based on terrain alone, suggesting a strong role of behavioral aggregation in driving coloniality in this species. This integrated mapping of organisms and fine scale habitat will greatly improve our understanding of fine-scale habitat suitability, ecophysiology, and the complex bi-directional relationship between geomorphology and habitat use.

Detection of viral agents in fecal specimens of monkeys with diarrhea.

PubMed

Wang, Yuhuan; Tu, Xinming; Humphrey, Charles; McClure, Harold; Jiang, Xi; Qin, Chuan; Glass, Roger I; Jiang, Baoming

2007-04-01

Diarrheal disease is a major cause of morbidity and mortality in humans and animals, including non human primates. While the diagnostics for gastrointestinal bacterial and parasitic pathogens and their etiological role in disease are well established, little is known about the epidemiology, prevalence and role of viral agents in diarrheal illness among monkeys. We collected fecal specimens from monkeys with diarrhea that were housed in two primate colonies, the Institute of Laboratory Animal Sciences, Beijing, China and the Yerkes National Primate Research Center, Georgia, USA. We screened these fecal specimens for rotaviruses and enteric adenoviruses 40/41 by using commercial EIA kits (Rotaclone and Adenoclone), enteroviruses by RT-PCR and Southern blot hybridization, and picobirnaviruses by polyacrylamide gel electrophoresis and silver staining. Some of the specimens were examined by EM for coronaviruses and noroviruses. Of the 92 specimens from China, we found 63 (68%) positive for viruses, including enteroviruses (52%), enteric adenoviruses (21%), rotaviruses (20%), and picobirnaviruses (2%). Coronaviruses were detected in some specimens. Mixed infection of two or more viral agents was seen in 23 (25%) specimens. In the US collection, we detected enteroviruses and enteric adenoviruses in 76% (45/59) and 14% (7/50) of the specimens, respectively. Electron microscopy showed norovirus-like particles in some specimens from both colonies. Our findings indicate endemic infections with enteric viruses in monkeys of both colonies. The availability of new simian rotaviruses, enteric adenoviruses, enteroviruses, and coronaviruses and the discovery of noroviruses and picobirnaviruses may allow us to develop better diagnostics for these agents and determine which of these agents are clearly associated with gastroenteritis in monkeys.

Matrix Extension Study: Validation of the Compact Dry EC Method for Enumeration of Escherichia coli and non-E. coli Coliform Bacteria in Selected Foods.

PubMed

Mizuochi, Shingo; Nelson, Maria; Baylis, Chris; Green, Becky; Jewell, Keith; Monadjemi, Farinaz; Chen, Yi; Salfinger, Yvonne; Fernandez, Maria Cristina

2016-01-01

The Compact Dry "Nissui" EC method, originally certified by the AOAC Research Institute Performance Test Method(SM) program for enumeration of Escherichia coli and non-E. coli coliforms in raw meat products (Performance Tested Method(SM) 110402), has undergone an evaluation to extend the method's claim to cooked chicken, prewashed bagged shredded iceberg lettuce, frozen cod filets, instant nonfat dry milk powder, and pasteurized milk (2% fat). Compact Dry EC is a ready-to-use dry media sheet containing a cold-soluble gelling agent, selective agents, and a chromogenic medium, which are rehydrated by adding 1 mL diluted sample. E. coli form blue/blue-purple colonies, whereas other coliform bacteria form red/pink colonies. Users can obtain an E. coli count (blue/blue-purple colonies only) and a total coliform count (red/pink plus blue/blue-purple colonies) after 24 ± 2 h of incubation at 37 ± 1°C. The matrix extension study was organized by Campden BRI (formerly Campden and Chorleywood Food Research Association Technology, Ltd), Chipping Campden, United Kingdom. Method comparison data for cooked chicken, prewashed bagged shredded iceberg lettuce, frozen cod filets, and instant nonfat dry milk powder were collected in a single-laboratory evaluation by Campden BRI. A multilaboratory study was conducted on pasteurized milk (2% fat), with 13 laboratories participating. The Compact Dry EC method was compared to ISO 16649-2:2001 "Microbiology of food and animal feeding stuffs-Horizontal method for the enumeration of beta-glucuronidase-positive Escherichia coli-Part 2: Colony-count technique at 44 degrees C using 5-bromo-4-chloro-3-indolyl beta-D-glucuronide" and to ISO 4832:2006 "Microbiology of food and animal feeding stuffs-Horizontal method for the enumeration of coliforms-Colony-count technique," the current standards at the time of this study. Each matrix was evaluated separately for E. coli and non-E. coli coliforms at each contamination level (including an uncontaminated level). In the single-laboratory evaluation (cooked chicken, prewashed bagged shredded iceberg lettuce, frozen cod filets, and instant nonfat dry milk powder), colony counts were logarithmically transformed, and then the data were analyzed at each level for sr, RSDr, and mean difference between methods with 95% confidence intervals (CIs). A CI outside a range of -0.5 to 0.5 on the log10 mean difference between methods was used as the criterion to establish a significant statistical difference. In the multilaboratory study on pasteurized milk, after logarithmic transformation, the data were analyzed for sR and RSDR in addition to sr, RSDr, and mean difference with 95% CIs. Regression analysis was performed on all matrixes and reported as r(2). In the single-laboratory evaluation, statistical differences were indicated between the Compact Dry EC and ISO 16649-2 methods for the enumeration of E. coli in two of five contamination levels tested for lettuce, and in the low contamination level for cooked chicken. For the cooked chicken and lettuce at the low level, only a few colonies were recovered for each method, and thus not a true indication of the methods' performance. For the high contamination level of lettuce, counts varied within the sets of five replicates more than 10-fold for each method, which may have contributed to the significant difference. Statistical differences were also indicated between the Compact Dry EC and ISO 4832 methods for the enumeration of coliforms in two of five contamination levels tested for lettuce, two of five contamination levels of milk powder, and in the low contamination level for frozen fish. For the lowest levels of frozen fish and milk powder, only a few colonies were recovered for each method. For the lettuce and the other level of milk powder, counts varied within the sets of five replicates more than 10-fold for each method, which may have contributed to the significant differences indicated in the those contamination levels. In most cases, mean differences between the Compact Dry EC and International Organization of Standardization (ISO) methods were well below 0.5 log10, and the CIs were within the acceptance criterion (-0.5 to 0.5). The sr and RSDr values were similar for both methods, and r(2) values were >0.92 for all comparisons. In the multilaboratory study, no statistical differences were indicated between the methods. The sr, RSDr, sR, and RSDr values were similar for each method and even slightly smaller in most cases for the Compact Dry EC. The r(2) value was 0.97 in comparison to ISO 16649-2, and 0.99 in comparison to ISO 4832. The Compact Dry EC offers comparable results to the ISO standard plating methods in a space saving, easy-to-use format.

Fuzzy Sets in Dynamic Adaptation of Parameters of a Bee Colony Optimization for Controlling the Trajectory of an Autonomous Mobile Robot

PubMed Central

Amador-Angulo, Leticia; Mendoza, Olivia; Castro, Juan R.; Rodríguez-Díaz, Antonio; Melin, Patricia; Castillo, Oscar

2016-01-01

A hybrid approach composed by different types of fuzzy systems, such as the Type-1 Fuzzy Logic System (T1FLS), Interval Type-2 Fuzzy Logic System (IT2FLS) and Generalized Type-2 Fuzzy Logic System (GT2FLS) for the dynamic adaptation of the alpha and beta parameters of a Bee Colony Optimization (BCO) algorithm is presented. The objective of the work is to focus on the BCO technique to find the optimal distribution of the membership functions in the design of fuzzy controllers. We use BCO specifically for tuning membership functions of the fuzzy controller for trajectory stability in an autonomous mobile robot. We add two types of perturbations in the model for the Generalized Type-2 Fuzzy Logic System to better analyze its behavior under uncertainty and this shows better results when compared to the original BCO. We implemented various performance indices; ITAE, IAE, ISE, ITSE, RMSE and MSE to measure the performance of the controller. The experimental results show better performances using GT2FLS then by IT2FLS and T1FLS in the dynamic adaptation the parameters for the BCO algorithm. PMID:27618062

Wnt affects symmetry and morphogenesis during post-embryonic development in colonial chordates.

PubMed

Di Maio, Alessandro; Setar, Leah; Tiozzo, Stefano; De Tomaso, Anthony W

2015-01-01

Wnt signaling is one of the earliest and most highly conserved regulatory pathways for the establishment of the body axes during regeneration and early development. In regeneration, body axes determination occurs independently of tissue rearrangement and early developmental cues. Modulation of the Wnt signaling in either process has shown to result in unusual body axis phenotypes. Botryllus schlosseri is a colonial ascidian that can regenerate its entire body through asexual budding. This processes leads to an adult body via a stereotypical developmental pathway (called blastogenesis), without proceeding through any embryonic developmental stages. In this study, we describe the role of the canonical Wnt pathway during the early stages of asexual development. We characterized expression of three Wnt ligands (Wnt2B, Wnt5A, and Wnt9A) by in situ hybridization and qRT-PCR. Chemical manipulation of the pathway resulted in atypical budding due to the duplication of the A/P axes, supernumerary budding, and loss of the overall cell apical-basal polarity. Our results suggest that Wnt signaling is used for equivalent developmental processes both during embryogenesis and asexual development in an adult organism, suggesting that patterning mechanisms driving morphogenesis are conserved, independent of embryonic, or regenerative development.

Population Census of a Large Common Tern Colony with a Small Unmanned Aircraft

PubMed Central

Chabot, Dominique; Craik, Shawn R.; Bird, David M.

2015-01-01

Small unmanned aircraft systems (UAS) may be useful for conducting high-precision, low-disturbance waterbird surveys, but limited data exist on their effectiveness. We evaluated the capacity of a small UAS to census a large (>6,000 nests) coastal Common tern (Sterna hirundo) colony of which ground surveys are particularly disruptive and time-consuming. We compared aerial photographic tern counts to ground nest counts in 45 plots (5-m radius) throughout the colony at three intervals over a nine-day period in order to identify sources of variation and establish a coefficient to estimate nest numbers from UAS surveys. We also compared a full colony ground count to full counts from two UAS surveys conducted the following day. Finally, we compared colony disturbance levels over the course of UAS flights to matched control periods. Linear regressions between aerial and ground counts in plots had very strong correlations in all three comparison periods (R 2 = 0.972–0.989, P < 0.001) and regression coefficients ranged from 0.928–0.977 terns/nest. Full colony aerial counts were 93.6% and 94.0%, respectively, of the ground count. Varying visibility of terns with ground cover, weather conditions and image quality, and changing nest attendance rates throughout incubation were likely sources of variation in aerial detection rates. Optimally timed UAS surveys of Common tern colonies following our method should yield population estimates in the 93–96% range of ground counts. Although the terns were initially disturbed by the UAS flying overhead, they rapidly habituated to it. Overall, we found no evidence of sustained disturbance to the colony by the UAS. We encourage colonial waterbird researchers and managers to consider taking advantage of this burgeoning technology. PMID:25874997

Dynamics of Weight Change and Temperature of Apis mellifera (Hymenoptera: Apidae) Colonies in a Wintering Building With Controlled Temperature.

PubMed

Stalidzans, E; Zacepins, A; Kviesis, A; Brusbardis, V; Meitalovs, J; Paura, L; Bulipopa, N; Liepniece, M

2017-02-01

Honey bee wintering in a wintering building (indoors) with controlled microclimate is used in some cold regions to minimize colony losses due to the hard weather conditions. The behavior and possible state of bee colonies in a dark room, isolated from natural environment during winter season, was studied by indirect temperature measurements to analyze the expression of their annual rhythm when it is not affected by ambient temperature, rain, snow, wind, and daylight. Thus, the observed behavior in the wintering building is initiated solely by bee colony internal processes. Experiments were carried out to determine the dynamics of temperature above the upper hive body and weight dynamics of indoors and outdoors wintered honey bee colonies and their brood-rearing performance in spring. We found significantly lower honey consumption-related weight loss of indoor wintered colonies compared with outdoor colonies, while no significant difference in the amount of open or sealed brood was found, suggesting that wintering building saves food and physiological resources without an impact on colony activity in spring. Indoor wintered colonies, with or without thermal insulation, did not have significant differences in food consumption and brood rearing in spring. The thermal behavior and weight dynamics of all experimental groups has changed in the middle of February possibly due to increased brood-rearing activity. Temperature measurement above the upper hive body is a convenient remote monitoring method of wintering process. Predictability of food consumption in a wintering building, with constant temperature, enables wintering without oversupply of wintering honey. © The Authors 2017. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Characterization of the Active Microbiotas Associated with Honey Bees Reveals Healthier and Broader Communities when Colonies are Genetically Diverse

PubMed Central

Mattila, Heather R.; Rios, Daniela; Walker-Sperling, Victoria E.; Roeselers, Guus; Newton, Irene L. G.

2012-01-01

Recent losses of honey bee colonies have led to increased interest in the microbial communities that are associated with these important pollinators. A critical function that bacteria perform for their honey bee hosts, but one that is poorly understood, is the transformation of worker-collected pollen into bee bread, a nutritious food product that can be stored for long periods in colonies. We used 16S rRNA pyrosequencing to comprehensively characterize in genetically diverse and genetically uniform colonies the active bacterial communities that are found on honey bees, in their digestive tracts, and in bee bread. This method provided insights that have not been revealed by past studies into the content and benefits of honey bee-associated microbial communities. Colony microbiotas differed substantially between sampling environments and were dominated by several anaerobic bacterial genera never before associated with honey bees, but renowned for their use by humans to ferment food. Colonies with genetically diverse populations of workers, a result of the highly promiscuous mating behavior of queens, benefited from greater microbial diversity, reduced pathogen loads, and increased abundance of putatively helpful bacteria, particularly species from the potentially probiotic genus Bifidobacterium. Across all colonies, Bifidobacterium activity was negatively correlated with the activity of genera that include pathogenic microbes; this relationship suggests a possible target for understanding whether microbes provide protective benefits to honey bees. Within-colony diversity shapes microbiotas associated with honey bees in ways that may have important repercussions for colony function and health. Our findings illuminate the importance of honey bee-bacteria symbioses and examine their intersection with nutrition, pathogen load, and genetic diversity, factors that are considered key to understanding honey bee decline. PMID:22427917

The validity of the red wolf: a response to Roy et al. (1996)

USGS Publications Warehouse

Nowak, R.M.; Federoff, N.E.

1998-01-01

'Red wolf' is a name commonly given to a kind of wild Canis historically found from central Texas to the Atlantic. Since first recorded in colonial times, it variously has been treated as a full species or as a subspecies of the Holarctic gray wolf. Recent genetic research presented by Roy et al. (1996) is one of a series of papers suggesting, through analysis of mitochondrial and nuclear DNA, that the red wolf is not a valid species or subspecies, but instead originated as a hybrid of C. lupus and C. latrans. That there has been hybridization between the red wolf and coyote is not in dispute. The occurrence of hybridization has long has been recognized by all who have looked into the issue and is a major reason that the red wolf is endangered. And, since hybridization did occur, it would not be unexpected to find that genetic material from one species has spread through the other. However, to accept this process of hybridization and consequent decline of the red wolf within the last century, is very different from accepting that the red wolf had a hybrid origin hundreds or thousands of years ago. It requires some effort to comprehend the fundamental difference between the two positions. One argues that the red wolf is an ancient and natural component of its ecosystem but has nearly disappeared, in part because of a hybridization process induced and perhaps controllable by humans. This interpretation demands priority work to save the animal. The other position holds that the red wolf may actually have been a modern creation of a process brought on by human environmental modification, and hence that the animal is nothing more than an artifact that can be discarded. The salvation of the red wolf may hinge upon the effort that is made to grasp this distinction. Hopefully, all parties who have investigated this complex issue will yet reach a consensus, thus allowing the systematic controversy to be put aside in favor of conservation efforts.

Vocal activity as a low cost and scalable index of seabird colony size

USGS Publications Warehouse

Borker, Abraham L.; McKown, Matthew W.; Ackerman, Joshua T.; Eagles-Smith, Collin A.; Tershy, Bernie R.; Croll, Donald A.

2014-01-01

Although wildlife conservation actions have increased globally in number and complexity, the lack of scalable, cost-effective monitoring methods limits adaptive management and the evaluation of conservation efficacy. Automated sensors and computer-aided analyses provide a scalable and increasingly cost-effective tool for conservation monitoring. A key assumption of automated acoustic monitoring of birds is that measures of acoustic activity at colony sites are correlated with the relative abundance of nesting birds. We tested this assumption for nesting Forster's terns (Sterna forsteri) in San Francisco Bay for 2 breeding seasons. Sensors recorded ambient sound at 7 colonies that had 15–111 nests in 2009 and 2010. Colonies were spaced at least 250 m apart and ranged from 36 to 2,571 m2. We used spectrogram cross-correlation to automate the detection of tern calls from recordings. We calculated mean seasonal call rate and compared it with mean active nest count at each colony. Acoustic activity explained 71% of the variation in nest abundance between breeding sites and 88% of the change in colony size between years. These results validate a primary assumption of acoustic indices; that is, for terns, acoustic activity is correlated to relative abundance, a fundamental step toward designing rigorous and scalable acoustic monitoring programs to measure the effectiveness of conservation actions for colonial birds and other acoustically active wildlife.

Identification and Characterization of Anti-Platelet Antibodies in Idiopathic Thrombocytopenic Purpura Patients

PubMed Central

Aghabeigi, N; Lindsey, N; Zamani, A; Shishaeyan, B

2012-01-01

Background: The autoimmune disease known as Idiopathic (immune thrombocytopenic purpura thrombocytopenic purpura (ITP) is clinically defined by a low numbers of platelets in the circulation blood. This study aimed to isolate autoantibodies made against the platelet glycoproteins using platelets from healthy volunteers, to determine their specificity and further elucidate their effects on platelet function. Methods: This study used a phage display system to recognize Fab anti-platelet antibodies. Anti-platelet After isolation, the anti-platelet Fab-expressing phage was characterized by ELISA and Western blotting. The Fab-bearing phage pool obtained from five rounds of panning was analysed in order to determine its anti-platelet reactivity. Of the phage colonies obtained, 100 colonies of different sizes were randomly selected for reaction with whole platelets, using M13 phage as a negative control. Results: Twelve colonies of them had strong reactions against the whole platelet preparation, but only four colonies showed substantial reactivity against the lysed platelet preparation (lysate). Three of the four colonies showed three bands representing proteins with different molecular weights. The fourth colony showed only a single band. The final experiment to characterise the protein isolated from the phage library was a DNA gel agarose test. Conclusion: Each colony showed a DNA band that corresponded with the molecular size marker for 5.4 kbase pairs, and this suggested the presence of heavy and light antibody chains in the phage. PMID:23113135

Antifungal activity of Piper aduncum and Peperomia pellucida leaf ethanol extract against Candida albicans

NASA Astrophysics Data System (ADS)

Hastuti, Utami Sri; Ummah, Yunita Putri Irsadul; Khasanah, Henny Nurul

2017-05-01

This research was done to 1) examine the effect of Piper aduncum leaf ethanol extract at certain concentrations against Candida albicans colony growth inhibition in vitro; 2) examine the effect of Peperomia pellucida leaf ethanol extract at certain concentrations toward Candida albicans colony growth inhibition in vitro; and 3) determine the most effective concentration of P. aduncum and P. pellucida leaves ethanol extract against C. albicans colony growth inhibition in vitro. These plant extracts were prepared by the maceration technique using 95% ethanol, and then sterile filtered and evaporated to obtain the filtrate. The filtrate was diluted with sterile distilled water at certain concentrations, i.e.: 0%, 10%, 20%, 30%, 405, 50%, 60%, 70%, 80%, and 90%. The antifungal effect of each leaf extract concentration was examined by the agar diffusion method on Sabouraud Dextrose Agar medium. The research results are: 1) the P.aduncum leaf ethanol extract at some concentrations has an effect against C. albicans colony growth inhibition in vitro; 2) the P.pellucida leaf ethanol extract at some concentrations has an effect against C. albicans colony growth inhibition in vitro; 3) the P. aduncum leaf ethanol extract at 80% is the most effective for C. albicans colony growth inhibition in vitro; and 4) the P. pellucida leaf ethanol extract at 70% is the most effective for C. albicans colony growth inhibition in vitro.

Probing the fractal pattern and organization of Bacillus thuringiensis bacteria colonies growing under different conditions using quantitative spectral light scattering polarimetry

NASA Astrophysics Data System (ADS)

Banerjee, Paromita; Soni, Jalpa; Purwar, Harsh; Ghosh, Nirmalya; Sengupta, Tapas K.

2013-03-01

Development of methods for quantification of cellular association and patterns in growing bacterial colony is of considerable current interest, not only to help understand multicellular behavior of a bacterial species but also to facilitate detection and identification of a bacterial species in a given space and under a given set of condition(s). We have explored quantitative spectral light scattering polarimetry for probing the morphological and structural changes taking place during colony formations of growing Bacillus thuringiensis bacteria under different conditions (in normal nutrient agar representing favorable growth environment, in the presence of 1% glucose as an additional nutrient, and 3 mM sodium arsenate as toxic material). The method is based on the measurement of spectral 3×3 Mueller matrices (which involves linear polarization measurements alone) and its subsequent analysis via polar decomposition to extract the intrinsic polarization parameters. Moreover, the fractal micro-optical parameter, namely, the Hurst exponent H, is determined via fractal-Born approximation-based inverse analysis of the polarization-preserving component of the light scattering spectra. Interesting differences are noted in the derived values for the H parameter and the intrinsic polarization parameters (linear diattenuation d, linear retardance δ, and linear depolarization Δ coefficients) of the growing bacterial colonies under different conditions. The bacterial colony growing in presence of 1% glucose exhibit the strongest fractality (lowest value of H), whereas that growing in presence of 3 mM sodium arsenate showed the weakest fractality. Moreover, the values for δ and d parameters are found to be considerably higher for the colony growing in presence of glucose, indicating more structured growth pattern. These findings are corroborated further with optical microscopic studies conducted on the same samples.

Power Source Status Estimation and Drive Control Method for Autonomous Decentralized Hybrid Train

NASA Astrophysics Data System (ADS)

Furuya, Takemasa; Ogawa, Kenichi; Yamamoto, Takamitsu; Hasegawa, Hitoshi

A hybrid control system has two main functions: power sharing and equipment protection. In this paper, we discuss the design, construction and testing of a drive control method for an autonomous decentralized hybrid train with 100-kW-class fuel cells (FC) and 36-kWh lithium-ion batteries (Li-Batt). The main objectives of this study are to identify the operation status of the power sources on the basis of the input voltage of the traction inverter and to estimate the maximum traction power control basis of the power-source status. The proposed control method is useful in preventing overload operation of the onboard power sources in an autonomous decentralized hybrid system that has a flexible main circuit configuration and a few control signal lines. Further, with this method, the initial cost of a hybrid system can be reduced and the retrofit design of the hybrid system can be simplified. The effectiveness of the proposed method is experimentally confirmed by using a real-scale hybrid train system.

Performance analysis of AES-Blowfish hybrid algorithm for security of patient medical record data

NASA Astrophysics Data System (ADS)

Mahmud H, Amir; Angga W, Bayu; Tommy; Marwan E, Andi; Siregar, Rosyidah

2018-04-01

A file security is one method to protect data confidentiality, integrity and information security. Cryptography is one of techniques used to secure and guarantee data confidentiality by doing conversion to the plaintext (original message) to cipher text (hidden message) with two important processes, they are encrypt and decrypt. Some researchers proposed a hybrid method to improve data security. In this research we proposed hybrid method of AES-blowfish (BF) to secure the patient’s medical report data into the form PDF file that sources from database. Generation method of private and public key uses two ways of approach, those are RSA method f RSA and ECC. We will analyze impact of these two ways of approach for hybrid method at AES-blowfish based on time and Throughput. Based on testing results, BF method is faster than AES and AES-BF hybrid, however AES-BF hybrid is better for throughput compared with AES and BF is higher.

A New Method of Space Travel Optimized for Space Tourism and Colonization

NASA Astrophysics Data System (ADS)

Turek, Philip A.

2006-01-01

High costs associated with expendable rockets are stifling the development of permanent space colonies. A new method of space travel is presented that enjoys significantly increased performance and reduced cost relative to competing concepts. Based on recycling the kinetic energy of an arriving spacecraft, up to 200 MW of average electrical power is generated and sustained for 2 minutes, and is immediately applied in launching a departing partner spacecraft. The resulting required delta vee for a round trip between low Earth orbit (LEO) and geosynchronous orbit (GEO) drops from 7.6 km/s to 0.54 km/s when 3 recycling stations with an 80 % energy coupling efficiency are used to exchange kinetic energy between 8 partner spacecraft transiting the same route. This method is well suited for round trip high volume space travel such as space tourism traffic to LEO, lunar orbit, and beyond. As the kinetic energy of an arriving spacecraft is the power source for launching departing spacecraft, nascent lunar colonies can electrically launch 26,000 kg payloads long before sustained 100 MW level power supplies become locally available. A pair of recycling stations at an orbiting space colony construction site provides a resource of net impulse, net torque, and electrical power to the colony irrespective of the contents of the arriving payloads. Kinetic energy recycling technology, configuration, operations, and near Earth applications are described.

A hybrid neural learning algorithm using evolutionary learning and derivative free local search method.

PubMed

Ghosh, Ranadhir; Yearwood, John; Ghosh, Moumita; Bagirov, Adil

2006-06-01

In this paper we investigate a hybrid model based on the Discrete Gradient method and an evolutionary strategy for determining the weights in a feed forward artificial neural network. Also we discuss different variants for hybrid models using the Discrete Gradient method and an evolutionary strategy for determining the weights in a feed forward artificial neural network. The Discrete Gradient method has the advantage of being able to jump over many local minima and find very deep local minima. However, earlier research has shown that a good starting point for the discrete gradient method can improve the quality of the solution point. Evolutionary algorithms are best suited for global optimisation problems. Nevertheless they are cursed with longer training times and often unsuitable for real world application. For optimisation problems such as weight optimisation for ANNs in real world applications the dimensions are large and time complexity is critical. Hence the idea of a hybrid model can be a suitable option. In this paper we propose different fusion strategies for hybrid models combining the evolutionary strategy with the discrete gradient method to obtain an optimal solution much quicker. Three different fusion strategies are discussed: a linear hybrid model, an iterative hybrid model and a restricted local search hybrid model. Comparative results on a range of standard datasets are provided for different fusion hybrid models.

Exploring bacterial infections: theoretical and experimental studies of the bacterial population dynamics and antibiotic treatment

NASA Astrophysics Data System (ADS)

Shao, Xinxian

Bacterial infections are very common in human society. Thus extensive research has been conducted to reveal the molecular mechanisms of the pathogenesis and to evaluate the antibiotics' efficacy against bacteria. Little is known, however, about the population dynamics of bacterial populations and their interactions with the host's immune system. In this dissertation, a stochatic model is developed featuring stochastic phenotypic switching of bacterial individuals to explain the single-variant bottleneck discovered in multi strain bacterial infections. I explored early events in a bacterial infection establishment using classical experiments of Moxon and Murphy on neonatal rats. I showed that the minimal model and its simple variants do not work. I proposed modifications to the model that could explain the data quantitatively. The bacterial infections are also commonly established in physical structures, as biofilms or 3-d colonies. In contrast, most research on antibiotic treatment of bacterial infections has been conducted in well-mixed liquid cultures. I explored the efficacy of antibiotics to treat such bacterial colonies, a broadly applicable method is designed and evaluated where discrete bacterial colonies on 2-d surfaces were exposed to antibiotics. I discuss possible explanations and hypotheses for the experimental results. To verify these hypotheses, we investigated the dynamics of bacterial population as 3-d colonies. We showed that a minimal mathematical model of bacterial colony growth in 3-d was able to account for the experimentally observed presence of a diffusion-limited regime. The model further revealed highly loose packing of the cells in 3-d colonies and smaller cell sizes in colonies than plancktonic cells in corresponding liquid culture. Further experimental tests of the model predictions have revealed that the ratio of the cell size in liquid culture to that in colony cultures was consistent with the model prediction, that the dead cells emerged randomly in a colony, and that the cells packed heterogeneously in the outer part of a colony, possibly explaining the loose packing.

Chapter 7: Breeding and Natal Dispersal, Nest Habitat Loss and Implications for Marbled Murrelet Populations

Treesearch

George J. Divoky; Michael Horton

1995-01-01

Evidence of breeding and natal dispersal in alcids is typically provided by the resightings of banded birds, the establishment of new colonies, and/or evidence of immigration to established colonies. The difficulties in banding, observing, and censusing Marbled Murrelets at nesting areas preclude using any of these methods for this species. Based on the limited number...

Statistical methods to quantify the effect of mite parasitism on the probability of death in honey bee colonies

USDA-ARS?s Scientific Manuscript database

Varroa destructor is a mite parasite of European honey bees, Apis mellifera, that weakens the population, can lead to the death of an entire honey bee colony, and is believed to be the parasite with the most economic impact on beekeeping. The purpose of this study was to estimate the probability of ...

Educating "Barbaros": Educational Policies on the Latin American Frontiers between Colonies and Independent Republics (Araucania, Southern Chile/Sonora, Mexico)

ERIC Educational Resources Information Center

Holck, Lasse; Saiz, Monika Contreras

2010-01-01

This article compares the methods and means employed by the state to enforce the education of (semi-)autonomous indigenous groups in southern Chile and northwestern Mexico (Sonora), border regions in the Latin American periphery, covering the transition from colonial times to the consolidation of independent republics until the middle of the…

An antiseptic religion: discovering a hybridity on the flux of hygiene and Christianity.

PubMed

Kim, Shin K

2008-06-01

An antiseptic religion is a form of Protestant Christianity that was shaped in the context of colonization in Korea. This term was coined to explain a religious hybrid that was produced by the intermingling of American Evangelical Protestant Christianity, the concept of hygiene (germ theory) and indigenous Korean religiosity. This research deals with a historical process of making 'a medicalized religion' in Asia from a perspective of postcolonialism. Most of the early American Protestant missionaries in Korea were medical doctors who were influenced by the Germ theory of illness and considered Western medicine as an efficient tool to evangelize the country. As a result of their mission, a religious culture which emphasized washing away sins from the soul as analogous to washing away germs from the body was born. In addition, the Korean people developed a very unique form of public bathing ritual centered in the development of public baths to alleviate anxiety and to destabilize the solid strategies of the Japanese and the Americans, the two major colonial powers in Korea's history in the late 19th century.

Cloning and expression in Escherichia coli of Vibrio parahaemolyticus thermostable direct hemolysin and thermolabile hemolysin genes.

PubMed

Taniguchi, H; Ohta, H; Ogawa, M; Mizuguchi, Y

1985-05-01

Two hemolysin genes of Vibrio parahaemolyticus WP1, a thermostable direct (TSD) hemolysin gene and a thermolabile hemolysin gene, were cloned into the pBR322 vector in Escherichia coli K-12 C600. A large amount of the TSD hemolysin produced in E. coli K-12 accumulated in the periplasmic space. The TSD hemolysin gene was localized on a 0.9-kilobase HindIII-BamHI fragment by identifying qualitatively the production of the TSD hemolysin by a reverse passive hemagglutination assay in the osmotic shock fluid. The thermolabile hemolysin gene was isolated on a 1.3-kilobase HindIII-PstI fragment by selection with the hemolysin on blood agar. Southern blot hybridization and colony hybridization experiments indicated that the TSD hemolysin gene was present in the chromosomal DNA of 15 Kanagawa phenomenon-positive strains but not in 14 negative strains, whereas the thermolabile hemolysin gene was detected in all strains. No homologous DNA sequences to TSD and thermolabile hemolysin genes were detected in the chromosomes of Vibrio cholerae, Vibrio vulnificus, non-O1 V. cholerae, and Vibrio anguillarum.

Quantification of different Eubacterium spp. in human fecal samples with species-specific 16S rRNA-targeted oligonucleotide probes.

PubMed

Schwiertz, A; Le Blay, G; Blaut, M

2000-01-01

Species-specific 16S rRNA-targeted, Cy3 (indocarbocyanine)-labeled oligonucleotide probes were designed and validated to quantify different Eubacterium species in human fecal samples. Probes were directed at Eubacterium barkeri, E. biforme, E. contortum, E. cylindroides (two probes), E. dolichum, E. hadrum, E. lentum, E. limosum, E. moniliforme, and E. ventriosum. The specificity of the probes was tested with the type strains and a range of common intestinal bacteria. With one exception, none of the probes showed cross-hybridization under stringent conditions. The species-specific probes were applied to fecal samples obtained from 12 healthy volunteers. E. biforme, E. cylindroides, E. hadrum, E. lentum, and E. ventriosum could be determined. All other Eubacterium species for which probes had been designed were under the detection limit of 10(7) cells g (dry weight) of feces(-1). The cell counts obtained are essentially in accordance with the literature data, which are based on colony counts. This shows that whole-cell in situ hybridization with species-specific probes is a valuable tool for the enumeration of Eubacterium species in feces.

Quantification of Different Eubacterium spp. in Human Fecal Samples with Species-Specific 16S rRNA-Targeted Oligonucleotide Probes

PubMed Central

Schwiertz, Andreas; Le Blay, Gwenaelle; Blaut, Michael

2000-01-01

Species-specific 16S rRNA-targeted, Cy3 (indocarbocyanine)-labeled oligonucleotide probes were designed and validated to quantify different Eubacterium species in human fecal samples. Probes were directed at Eubacterium barkeri, E. biforme, E. contortum, E. cylindroides (two probes), E. dolichum, E. hadrum, E. lentum, E. limosum, E. moniliforme, and E. ventriosum. The specificity of the probes was tested with the type strains and a range of common intestinal bacteria. With one exception, none of the probes showed cross-hybridization under stringent conditions. The species-specific probes were applied to fecal samples obtained from 12 healthy volunteers. E. biforme, E. cylindroides, E. hadrum, E. lentum, and E. ventriosum could be determined. All other Eubacterium species for which probes had been designed were under the detection limit of 107 cells g (dry weight) of feces−1. The cell counts obtained are essentially in accordance with the literature data, which are based on colony counts. This shows that whole-cell in situ hybridization with species-specific probes is a valuable tool for the enumeration of Eubacterium species in feces. PMID:10618251

Isolation of mini- and microsatellite loci from chromosome 19 library

DOE Office of Scientific and Technical Information (OSTI.GOV)

Prosnyak, M.I.; Belajeva, O.V.; Polukarova, L.G.

Mini- and microsatellite sequences are abundant in the human genome and are very useful as genetic markers. We report the isolation of a panel of clones containing marker sequences from chromosome 19. We screened 10,000 clones from the chromosome 19 cosmid library for the presence of di-(CA)n, tri-(TCC)n, (CAC)n microsatellites and M13-like minisatellite sequences. For this we have used synthetic oligonucleotides and polynucleotides, including micro- (CA, TCC, CAC) and minisatellite (M13 core) sequences. Preliminary results indicated that the chromosome 19 cosmid library contained both human and hamster clones. In order to identify human sequences from this library we have developedmore » the technique of colony and blot hybridization with Alu-PCR, L1-PCR and B1-PCR probes. Dozens of clones have been selected, some of which were analyzed by conventional Southern blot analysis and non-radioactive in situ hybridization of chromosomes. Highly informative markers derived from these clones will be used for physical and genetic mapping of chromosome 19.« less

Sperm-Hybrid Micromotor for Targeted Drug Delivery.

PubMed

Xu, Haifeng; Medina-Sánchez, Mariana; Magdanz, Veronika; Schwarz, Lukas; Hebenstreit, Franziska; Schmidt, Oliver G

2018-01-23

A sperm-driven micromotor is presented as a targeted drug delivery system, which is appealing to potentially treat diseases in the female reproductive tract. This system is demonstrated to be an efficient drug delivery vehicle by first loading a motile sperm cell with an anticancer drug (doxorubicin hydrochloride), guiding it magnetically, to an in vitro cultured tumor spheroid, and finally freeing the sperm cell to deliver the drug locally. The sperm release mechanism is designed to liberate the sperm when the biohybrid micromotor hits the tumor walls, allowing it to swim into the tumor and deliver the drug through the sperm-cancer cell membrane fusion. In our experiments, the sperm cells exhibited a high drug encapsulation capability and drug carrying stability, conveniently minimizing  toxic side effects and unwanted drug accumulation in healthy tissues. Overall, sperm cells are excellent candidates to operate in physiological environments, as they neither express pathogenic proteins nor proliferate to form undesirable colonies, unlike other cells or microorganisms. This sperm-hybrid micromotor is a biocompatible platform with potential application in gynecological healthcare, treating or detecting cancer or other diseases in the female reproductive system.

A Novel Framework for Medical Web Information Foraging Using Hybrid ACO and Tabu Search.

PubMed

Drias, Yassine; Kechid, Samir; Pasi, Gabriella

2016-01-01

We present in this paper a novel approach based on multi-agent technology for Web information foraging. We proposed for this purpose an architecture in which we distinguish two important phases. The first one is a learning process for localizing the most relevant pages that might interest the user. This is performed on a fixed instance of the Web. The second takes into account the openness and dynamicity of the Web. It consists on an incremental learning starting from the result of the first phase and reshaping the outcomes taking into account the changes that undergoes the Web. The system was implemented using a colony of artificial ants hybridized with tabu search in order to achieve more effectiveness and efficiency. To validate our proposal, experiments were conducted on MedlinePlus, a real website dedicated for research in the domain of Health in contrast to other previous works where experiments were performed on web logs datasets. The main results are promising either for those related to strong Web regularities and for the response time, which is very short and hence complies the real time constraint.

Detection with synthetic oligonucleotide probes of nucleotide sequence variations in the genes encoding enterotoxins of Escherichia coli.

PubMed Central

Nishibuchi, M; Murakami, A; Arita, M; Jikuya, H; Takano, J; Honda, T; Miwatani, T

1989-01-01

We examined variations in the genes encoding heat-stable enterotoxin (ST) and heat-labile enterotoxin (LT) in 88 strains of Escherichia coli isolated from individuals with traveler's diarrhea to find suitable sequences for use as oligonucleotide probes. Four oligonucleotide probes of the gene encoding ST of human origin (STIb or STh), one oligonucleotide probe of the gene encoding ST of porcine origin (STIa or STp), and three oligonucleotide probes of the gene encoding LT of human origin (LTIh) were used in DNA colony hybridization tests. In 15 of 22 strains possessing the STh gene and 28 of 42 strains producing LT, the sequences of all regions tested were identical to the published sequences. One region in the STh gene examined with a 18-mer probe was relatively well conserved and was shown to be closely associated with the enterotoxicity of the E. coli strains in suckling mice. This oligonucleotide, however, hybridized with strains of Vibrio cholerae O1, V. parahaemolyticus, and Yersinia enterocolitica that gave negative results in the suckling mouse assay. PMID:2685027

Development and application of a recombination-based library versus library high- throughput yeast two-hybrid (RLL-Y2H) screening system.

PubMed

Yang, Fang; Lei, Yingying; Zhou, Meiling; Yao, Qili; Han, Yichao; Wu, Xiang; Zhong, Wanshun; Zhu, Chenghang; Xu, Weize; Tao, Ran; Chen, Xi; Lin, Da; Rahman, Khaista; Tyagi, Rohit; Habib, Zeshan; Xiao, Shaobo; Wang, Dang; Yu, Yang; Chen, Huanchun; Fu, Zhenfang; Cao, Gang

2018-02-16

Protein-protein interaction (PPI) network maintains proper function of all organisms. Simple high-throughput technologies are desperately needed to delineate the landscape of PPI networks. While recent state-of-the-art yeast two-hybrid (Y2H) systems improved screening efficiency, either individual colony isolation, library preparation arrays, gene barcoding or massive sequencing are still required. Here, we developed a recombination-based 'library vs library' Y2H system (RLL-Y2H), by which multi-library screening can be accomplished in a single pool without any individual treatment. This system is based on the phiC31 integrase-mediated integration between bait and prey plasmids. The integrated fragments were digested by MmeI and subjected to deep sequencing to decode the interaction matrix. We applied this system to decipher the trans-kingdom interactome between Mycobacterium tuberculosis and host cells and further identified Rv2427c interfering with the phagosome-lysosome fusion. This concept can also be applied to other systems to screen protein-RNA and protein-DNA interactions and delineate signaling landscape in cells.

Staggered larval time-to-hatch and insecticide resistance in the major malaria vector Anopheles gambiae S form.

PubMed

Kaiser, Maria L; Koekemoer, Lizette L; Coetzee, Maureen; Hunt, Richard H; Brooke, Basil D

2010-12-14

Anopheles gambiae is a major vector of malaria in the West African region. Resistance to multiple insecticides has been recorded in An. gambiae S form in the Ahafo region of Ghana. A laboratory population (GAH) established using wild material from this locality has enabled a mechanistic characterization of each resistance phenotype as well as an analysis of another adaptive characteristic - staggered larval time-to-hatch. Individual egg batches obtained from wild caught females collected from Ghana and the Republic of the Congo were monitored for staggered larval time-to-hatch. In addition, early and late larval time-to-hatch sub-colonies were selected from GAH. These selected sub-colonies were cross-mated and their hybrid progeny were subsequently intercrossed and back-crossed to the parental strains. The insecticide susceptibilities of the GAH base colony and the time-to-hatch selected sub-colonies were quantified for four insecticide classes using insecticide bioassays. Resistance phenotypes were mechanistically characterized using insecticide-synergist bioassays and diagnostic molecular assays for known reduced target-site sensitivity mutations. Anopheles gambiae GAH showed varying levels of resistance to all insecticide classes. Metabolic detoxification and reduced target-site sensitivity mechanisms were implicated. Most wild-caught families showed staggered larval time-to-hatch. However, some families were either exclusively early hatching or late hatching. Most GAH larvae hatched early but many egg batches contained a proportion of late hatching larvae. Crosses between the time-to-hatch selected sub-colonies yielded ambiguous results that did not fit any hypothetical models based on single-locus Mendelian inheritance. There was significant variation in the expression of insecticide resistance between the time-to-hatch phenotypes. An adaptive response to the presence of multiple insecticide classes necessarily involves the development of multiple resistance mechanisms whose effectiveness may be enhanced by intra-population variation in the expression of resistance phenotypes. The variation in the expression of insecticide resistance in association with selection for larval time-to-hatch may induce this kind of enhanced adaptive plasticity as a consequence of pleiotropy, whereby mosquitoes are able to complete their aquatic life stages in a variable breeding environment using staggered larval time-to-hatch, giving rise to an adult population with enhanced variation in the expression of insecticide resistance.

On Hybrid and mixed finite element methods

NASA Technical Reports Server (NTRS)

Pian, T. H. H.

1981-01-01

Three versions of the assumed stress hybrid model in finite element methods and the corresponding variational principles for the formulation are presented. Examples of rank deficiency for stiffness matrices by the hybrid stress model are given and their corresponding kinematic deformation modes are identified. A discussion of the derivation of general semi-Loof elements for plates and shells by the hybrid stress method is given. It is shown that the equilibrium model by Fraeijs de Veubeke can be derived by the approach of the hybrid stress model as a special case of semi-Loof elements.

Efficient parameter estimation in longitudinal data analysis using a hybrid GEE method.

PubMed

Leung, Denis H Y; Wang, You-Gan; Zhu, Min

2009-07-01

The method of generalized estimating equations (GEEs) provides consistent estimates of the regression parameters in a marginal regression model for longitudinal data, even when the working correlation model is misspecified (Liang and Zeger, 1986). However, the efficiency of a GEE estimate can be seriously affected by the choice of the working correlation model. This study addresses this problem by proposing a hybrid method that combines multiple GEEs based on different working correlation models, using the empirical likelihood method (Qin and Lawless, 1994). Analyses show that this hybrid method is more efficient than a GEE using a misspecified working correlation model. Furthermore, if one of the working correlation structures correctly models the within-subject correlations, then this hybrid method provides the most efficient parameter estimates. In simulations, the hybrid method's finite-sample performance is superior to a GEE under any of the commonly used working correlation models and is almost fully efficient in all scenarios studied. The hybrid method is illustrated using data from a longitudinal study of the respiratory infection rates in 275 Indonesian children.

Chromosome Rearrangements Recovered following Transformation of Neurospora Crassa

PubMed Central

Perkins, D. D.; Kinsey, J. A.; Asch, D. K.; Frederick, G. D.

1993-01-01

New chromosome rearrangements were found in 10% or more of mitotically stable transformants. This was shown for transformations involving a variety of different markers, vectors and recipient strains. Breakpoints were randomly distributed among the seven linkage groups. Controls using untransformed protoplasts of the same strains contained almost no rearrangements. A study of molecularly characterized Am(+) transformants showed that rearrangements are frequent when multiple ectopic integration events have occurred. In contrast, rearrangements are absent or infrequent when only the resident locus is restored to am(+) by a homologous event. Sequences of the transforming vector were genetically linked to breakpoints in 6 of 10 translocations that were examined using Southern hybridization or colony blots. PMID:8349106

Spatio-Temporal Patterns in Colonies of Rod-Shaped Bacteria

NASA Astrophysics Data System (ADS)

Kitsunezaki, S.

In incubation experiments of bacterial colonies of Proteus Mirabilis, macroscopic spatio-temporal patterns, such as turbulent and unidirectional spiral patterns, appear in colonies. Considering only kinetic propeties of rod-shaped bacteria, we propose a phenomenological model for the directional and positional distributions. As the average density increases, homogeneous states bifurcate sub-critically into nonuniform states exhibiting localized collective motion, and spiral patterns appear for sufficiently large density. These patterns result from interactions between the local bacteria densities and the order parameter representing collective motion. Our model can be described by reduced equations using a perturbative method for large density. The unidirectionality of sprial rotation is also discussed.

A hybrid perturbation Galerkin technique with applications to slender body theory

NASA Technical Reports Server (NTRS)

Geer, James F.; Andersen, Carl M.

1989-01-01

A two-step hybrid perturbation-Galerkin method to solve a variety of applied mathematics problems which involve a small parameter is presented. The method consists of: (1) the use of a regular or singular perturbation method to determine the asymptotic expansion of the solution in terms of the small parameter; (2) construction of an approximate solution in the form of a sum of the perturbation coefficient functions multiplied by (unknown) amplitudes (gauge functions); and (3) the use of the classical Bubnov-Galerkin method to determine these amplitudes. This hybrid method has the potential of overcoming some of the drawbacks of the perturbation method and the Bubnov-Galerkin method when they are applied by themselves, while combining some of the good features of both. The proposed method is applied to some singular perturbation problems in slender body theory. The results obtained from the hybrid method are compared with approximate solutions obtained by other methods, and the degree of applicability of the hybrid method to broader problem areas is discussed.

A hybrid perturbation Galerkin technique with applications to slender body theory

NASA Technical Reports Server (NTRS)

Geer, James F.; Andersen, Carl M.

1987-01-01

A two step hybrid perturbation-Galerkin method to solve a variety of applied mathematics problems which involve a small parameter is presented. The method consists of: (1) the use of a regular or singular perturbation method to determine the asymptotic expansion of the solution in terms of the small parameter; (2) construction of an approximate solution in the form of a sum of the perturbation coefficient functions multiplied by (unknown) amplitudes (gauge functions); and (3) the use of the classical Bubnov-Galerkin method to determine these amplitudes. This hybrid method has the potential of overcoming some of the drawbacks of the perturbation method and the Bubnov-Galerkin method when they are applied by themselves, while combining some of the good features of both. The proposed method is applied to some singular perturbation problems in slender body theory. The results obtained from the hybrid method are compared with approximate solutions obtained by other methods, and the degree of applicability of the hybrid method to broader problem areas is discussed.

John Butcher and hybrid methods

NASA Astrophysics Data System (ADS)

Mehdiyeva, Galina; Imanova, Mehriban; Ibrahimov, Vagif

2017-07-01

As is known there are the mainly two classes of the numerical methods for solving ODE, which is commonly called a one and multistep methods. Each of these methods has certain advantages and disadvantages. It is obvious that the method which has better properties of these methods should be constructed at the junction of them. In the middle of the XX century, Butcher and Gear has constructed at the junction of the methods of Runge-Kutta and Adams, which is called hybrid method. Here considers the construction of certain generalizations of hybrid methods, with the high order of accuracy and to explore their application to solving the Ordinary Differential, Volterra Integral and Integro-Differential equations. Also have constructed some specific hybrid methods with the degree p ≤ 10.

Honeybee Colony Vibrational Measurements to Highlight the Brood Cycle

PubMed Central

Bencsik, Martin; Le Conte, Yves; Reyes, Maritza; Pioz, Maryline; Whittaker, David; Crauser, Didier; Simon Delso, Noa; Newton, Michael I.

2015-01-01

Insect pollination is of great importance to crop production worldwide and honey bees are amongst its chief facilitators. Because of the decline of managed colonies, the use of sensor technology is growing in popularity and it is of interest to develop new methods which can more accurately and less invasively assess honey bee colony status. Our approach is to use accelerometers to measure vibrations in order to provide information on colony activity and development. The accelerometers provide amplitude and frequency information which is recorded every three minutes and analysed for night time only. Vibrational data were validated by comparison to visual inspection data, particularly the brood development. We show a strong correlation between vibrational amplitude data and the brood cycle in the vicinity of the sensor. We have further explored the minimum data that is required, when frequency information is also included, to accurately predict the current point in the brood cycle. Such a technique should enable beekeepers to reduce the frequency with which visual inspections are required, reducing the stress this places on the colony and saving the beekeeper time. PMID:26580393

Status of the White-faced Ibis: Breeding colony dynamics of the Great Basin population, 1985-1997

USGS Publications Warehouse

Earnst, S.L.; Neel, L.; Ivey, G.L.; Zimmerman, T.

1998-01-01

The status of the White-faced Ibis (Plegadis chihi) in the Great Basin is of concern because of its small population size and the limited and dynamic nature of its breeding habitat. We analyzed existing annual survey data for the White-faced Ibis breeding in the Great Basin and surrounding area for 1985-1997. Methods varied among colonies and included flight-line counts and fixed-wing aircraft and helicopter surveys. The number of White-faced Ibis breeding pairs in the Great Basin area has nearly tripled since 1985, despite years of severe flooding and drought at major breeding areas. This growth is reflected in both peripheral (i.e., Oregon, California, Idaho) and core (i.e., Nevada and Utah) components of the population. Our data on colony dynamics in Oregon and Nevada illustrate the ability of the highly nomadic White-faced Ibis to compensate for poor conditions at traditional colony sites by moving among colonies and rapidly colonizing newly available wetlands. We suggest that the White-faced Ibis would benefit from a landscape mosaic of well-distributed peripheral wetlands and persistent colony sites. The nomadic nature of the White-faced Ibis and the dynamic nature of their breeding habitat necessitates that wetland management decisions and population monitoring be conducted in a regional context.

Status of the white-faced ibis: Breeding colony dynamics of the Great Basin population, 1985-1997

USGS Publications Warehouse

Earnst, Susan L.; Neel, L.; Ivey, G.L.; Zimmerman, T.

1998-01-01

The status of the White-faced Ibis (Plegadis chihi) in the Great Basin is of concern because of its small population size and the limited and dynamic nature of its breeding habitat. We analyzed existing annual survey data for the White-faced Ibis breeding in the Great Basin and surrounding area for 1985-1997. Methods varied among colonies and included flight-line counts and fixed-wing aircraft and helicopter surveys. The number of White-faced Ibis breeding pairs in the Great Basin area has nearly tripled since 1985, despite years of severe flooding and drought at major breeding areas. This growth is reflected in both peripheral (i.e., Oregon, California, Idaho) and core (i.e., Nevada and Utah) components of the population. Our data on colony dynamics in Oregon and Nevada illustrate the ability of the highly nomadic White-faced Ibis to compensate for poor conditions at traditional colony sites by moving among colonies and rapidly colonizing newly available wetlands. We suggest that the White-faced Ibis would benefit from a landscape mosaic of well-distributed peripheral wetlands and persistent colony sites. The nomadic nature of the White-faced Ibis and the dynamic nature of their breeding habitat necessitates that wetland management decisions and population monitoring be conducted in a regional context.

Idiopathic brood disease syndrome and queen events as precursors of colony mortality in migratory beekeeping operations in the eastern United States.

PubMed

vanEngelsdorp, Dennis; Tarpy, David R; Lengerich, Eugene J; Pettis, Jeffery S

2013-02-01

Using standard epidemiological methods, this study set out to quantify the risk associated with exposure to easily diagnosed factors on colony mortality and morbidity in three migratory beekeeping operations. Fifty-six percent of all colonies monitored during the 10-month period died. The relative risk (RR) that a colony would die over the short term (∼50 days) was appreciably increased in colonies diagnosed with Idiopathic Brood Disease Syndrome (IBDS), a condition where brood of different ages appear molten on the bottom of cells (RR=3.2), or with a "queen event" (e.g., evidence of queen replacement or failure; RR=3.1). We also found that several risk factors-including the incidence of a poor brood pattern, chalkbood (CB), deformed wing virus (DWV), sacbrood virus (SBV), and exceeding the threshold of 5 Varroa mites per 100 bees-were differentially expressed in different beekeeping operations. Further, we found that a diagnosis of several factors were significantly more or less likely to be associated with a simultaneous diagnosis of another risk factor. These finding support the growing consensus that the causes of colony mortality are multiple and interrelated. Copyright © 2012 Elsevier B.V. All rights reserved.

Optimization of Stereo Matching in 3D Reconstruction Based on Binocular Vision

NASA Astrophysics Data System (ADS)

Gai, Qiyang

2018-01-01

Stereo matching is one of the key steps of 3D reconstruction based on binocular vision. In order to improve the convergence speed and accuracy in 3D reconstruction based on binocular vision, this paper adopts the combination method of polar constraint and ant colony algorithm. By using the line constraint to reduce the search range, an ant colony algorithm is used to optimize the stereo matching feature search function in the proposed search range. Through the establishment of the stereo matching optimization process analysis model of ant colony algorithm, the global optimization solution of stereo matching in 3D reconstruction based on binocular vision system is realized. The simulation results show that by the combining the advantage of polar constraint and ant colony algorithm, the stereo matching range of 3D reconstruction based on binocular vision is simplified, and the convergence speed and accuracy of this stereo matching process are improved.

TA-GC cloning: A new simple and versatile technique for the directional cloning of PCR products for recombinant protein expression.

PubMed

Niarchos, Athanasios; Siora, Anastasia; Konstantinou, Evangelia; Kalampoki, Vasiliki; Lagoumintzis, George; Poulas, Konstantinos

2017-01-01

During the last few decades, the recombinant protein expression finds more and more applications. The cloning of protein-coding genes into expression vectors is required to be directional for proper expression, and versatile in order to facilitate gene insertion in multiple different vectors for expression tests. In this study, the TA-GC cloning method is proposed, as a new, simple and efficient method for the directional cloning of protein-coding genes in expression vectors. The presented method features several advantages over existing methods, which tend to be relatively more labour intensive, inflexible or expensive. The proposed method relies on the complementarity between single A- and G-overhangs of the protein-coding gene, obtained after a short incubation with T4 DNA polymerase, and T and C overhangs of the novel vector pET-BccI, created after digestion with the restriction endonuclease BccI. The novel protein-expression vector pET-BccI also facilitates the screening of transformed colonies for recombinant transformants. Evaluation experiments of the proposed TA-GC cloning method showed that 81% of the transformed colonies contained recombinant pET-BccI plasmids, and 98% of the recombinant colonies expressed the desired protein. This demonstrates that TA-GC cloning could be a valuable method for cloning protein-coding genes in expression vectors.

TA-GC cloning: A new simple and versatile technique for the directional cloning of PCR products for recombinant protein expression

PubMed Central

Niarchos, Athanasios; Siora, Anastasia; Konstantinou, Evangelia; Kalampoki, Vasiliki; Poulas, Konstantinos

2017-01-01

During the last few decades, the recombinant protein expression finds more and more applications. The cloning of protein-coding genes into expression vectors is required to be directional for proper expression, and versatile in order to facilitate gene insertion in multiple different vectors for expression tests. In this study, the TA-GC cloning method is proposed, as a new, simple and efficient method for the directional cloning of protein-coding genes in expression vectors. The presented method features several advantages over existing methods, which tend to be relatively more labour intensive, inflexible or expensive. The proposed method relies on the complementarity between single A- and G-overhangs of the protein-coding gene, obtained after a short incubation with T4 DNA polymerase, and T and C overhangs of the novel vector pET-BccI, created after digestion with the restriction endonuclease BccI. The novel protein-expression vector pET-BccI also facilitates the screening of transformed colonies for recombinant transformants. Evaluation experiments of the proposed TA-GC cloning method showed that 81% of the transformed colonies contained recombinant pET-BccI plasmids, and 98% of the recombinant colonies expressed the desired protein. This demonstrates that TA-GC cloning could be a valuable method for cloning protein-coding genes in expression vectors. PMID:29091919

Guided particle swarm optimization method to solve general nonlinear optimization problems

NASA Astrophysics Data System (ADS)

Abdelhalim, Alyaa; Nakata, Kazuhide; El-Alem, Mahmoud; Eltawil, Amr

2018-04-01

The development of hybrid algorithms is becoming an important topic in the global optimization research area. This article proposes a new technique in hybridizing the particle swarm optimization (PSO) algorithm and the Nelder-Mead (NM) simplex search algorithm to solve general nonlinear unconstrained optimization problems. Unlike traditional hybrid methods, the proposed method hybridizes the NM algorithm inside the PSO to improve the velocities and positions of the particles iteratively. The new hybridization considers the PSO algorithm and NM algorithm as one heuristic, not in a sequential or hierarchical manner. The NM algorithm is applied to improve the initial random solution of the PSO algorithm and iteratively in every step to improve the overall performance of the method. The performance of the proposed method was tested over 20 optimization test functions with varying dimensions. Comprehensive comparisons with other methods in the literature indicate that the proposed solution method is promising and competitive.

Investigating a hybrid perturbation-Galerkin technique using computer algebra

NASA Technical Reports Server (NTRS)

Andersen, Carl M.; Geer, James F.

1988-01-01

A two-step hybrid perturbation-Galerkin method is presented for the solution of a variety of differential equations type problems which involve a scalar parameter. The resulting (approximate) solution has the form of a sum where each term consists of the product of two functions. The first function is a function of the independent field variable(s) x, and the second is a function of the parameter lambda. In step one the functions of x are determined by forming a perturbation expansion in lambda. In step two the functions of lambda are determined through the use of the classical Bubnov-Gelerkin method. The resulting hybrid method has the potential of overcoming some of the drawbacks of the perturbation and Bubnov-Galerkin methods applied separately, while combining some of the good features of each. In particular, the results can be useful well beyond the radius of convergence associated with the perturbation expansion. The hybrid method is applied with the aid of computer algebra to a simple two-point boundary value problem where the radius of convergence is finite and to a quantum eigenvalue problem where the radius of convergence is zero. For both problems the hybrid method apparently converges for an infinite range of the parameter lambda. The results obtained from the hybrid method are compared with approximate solutions obtained by other methods, and the applicability of the hybrid method to broader problem areas is discussed.

Hybrid power management system and method

NASA Technical Reports Server (NTRS)

Eichenberg, Dennis J. (Inventor)

2007-01-01

A system and method for hybrid power management. The system includes photovoltaic cells, ultracapacitors, and pulse generators. In one embodiment, the hybrid power management system is used to provide power for a highway safety flasher.

Hybrid Power Management System and Method

NASA Technical Reports Server (NTRS)

Eichenberg, Dennis J. (Inventor)

2008-01-01

A system and method for hybrid power management. The system includes photovoltaic cells, ultracapacitors, and pulse generators. In one embodiment, the hybrid power management system is used to provide power for a highway safety flasher.

Design of fuzzy classifier for diabetes disease using Modified Artificial Bee Colony algorithm.

PubMed

Beloufa, Fayssal; Chikh, M A

2013-10-01

In this study, diagnosis of diabetes disease, which is one of the most important diseases, is conducted with artificial intelligence techniques. We have proposed a novel Artificial Bee Colony (ABC) algorithm in which a mutation operator is added to an Artificial Bee Colony for improving its performance. When the current best solution cannot be updated, a blended crossover operator (BLX-α) of genetic algorithm is applied, in order to enhance the diversity of ABC, without compromising with the solution quality. This modified version of ABC is used as a new tool to create and optimize automatically the membership functions and rules base directly from data. We take the diabetes dataset used in our work from the UCI machine learning repository. The performances of the proposed method are evaluated through classification rate, sensitivity and specificity values using 10-fold cross-validation method. The obtained classification rate of our method is 84.21% and it is very promising when compared with the previous research in the literature for the same problem. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

Machine Learning Approach to Automated Quality Identification of Human Induced Pluripotent Stem Cell Colony Images.

PubMed

Joutsijoki, Henry; Haponen, Markus; Rasku, Jyrki; Aalto-Setälä, Katriina; Juhola, Martti

2016-01-01

The focus of this research is on automated identification of the quality of human induced pluripotent stem cell (iPSC) colony images. iPS cell technology is a contemporary method by which the patient's cells are reprogrammed back to stem cells and are differentiated to any cell type wanted. iPS cell technology will be used in future to patient specific drug screening, disease modeling, and tissue repairing, for instance. However, there are technical challenges before iPS cell technology can be used in practice and one of them is quality control of growing iPSC colonies which is currently done manually but is unfeasible solution in large-scale cultures. The monitoring problem returns to image analysis and classification problem. In this paper, we tackle this problem using machine learning methods such as multiclass Support Vector Machines and several baseline methods together with Scaled Invariant Feature Transformation based features. We perform over 80 test arrangements and do a thorough parameter value search. The best accuracy (62.4%) for classification was obtained by using a k-NN classifier showing improved accuracy compared to earlier studies.

The Effect of Er:YAG Laser on Entroccocus faecalis Bacterium in the Pulpectomy of Anterior Primary Teeth

PubMed Central

Bahrololoomi, Zahra; Poursina, Farkhondeh; Birang, Reza; Foroughi, Elnaz; Yousefshahi, Hazhir

2017-01-01

Introduction: Successful root canal therapy depends on the complete elimination of microorganisms such as Entroccocus faecalis, which is impossible to achieve with the traditional methods. Lasers are recently introduced as a new method to solve the problem. The present study is planned and performed to examining the antibacterial effect of Er: YAG laser. Methods: Sixty extracted anterior primary teeth were prepared and sterilized. E. faecalis bacterium was cultured in canals. Samples were randomly divided into two groups. The first group was disinfected by NaOCl 5/25% and Er: YAG laser and the second group just by NaOCl 5/25%. Samples of canal contents were cultured and colony counts were calculated. The results were analyzed statistically by SPSS software and Mann Whitney test. Results: There was no significant difference between colony counts in both groups (P=0.142). But the number of colonies in the first group was lower than in the second group. Conclusion: Although, Er: YAG laser cannot completely eliminate E. faecalis bacterium, its simultaneous use with NaOCl decreases E. faecalis. PMID:29071021

The Effect of Er:YAG Laser on Entroccocus faecalis Bacterium in the Pulpectomy of Anterior Primary Teeth.

PubMed

Bahrololoomi, Zahra; Poursina, Farkhondeh; Birang, Reza; Foroughi, Elnaz; Yousefshahi, Hazhir

2017-01-01

Introduction: Successful root canal therapy depends on the complete elimination of microorganisms such as Entroccocus faecalis , which is impossible to achieve with the traditional methods. Lasers are recently introduced as a new method to solve the problem. The present study is planned and performed to examining the antibacterial effect of Er: YAG laser. Methods: Sixty extracted anterior primary teeth were prepared and sterilized. E. faecalis bacterium was cultured in canals. Samples were randomly divided into two groups. The first group was disinfected by NaOCl 5/25% and Er: YAG laser and the second group just by NaOCl 5/25%. Samples of canal contents were cultured and colony counts were calculated. The results were analyzed statistically by SPSS software and Mann Whitney test. Results: There was no significant difference between colony counts in both groups ( P =0.142). But the number of colonies in the first group was lower than in the second group. Conclusion: Although, Er: YAG laser cannot completely eliminate E. faecalis bacterium, its simultaneous use with NaOCl decreases E. faecalis .

Personalised Information Services Using a Hybrid Recommendation Method Based on Usage Frequency

ERIC Educational Resources Information Center

Kim, Yong; Chung, Min Gyo

2008-01-01

Purpose: This paper seeks to describe a personal recommendation service (PRS) involving an innovative hybrid recommendation method suitable for deployment in a large-scale multimedia user environment. Design/methodology/approach: The proposed hybrid method partitions content and user into segments and executes association rule mining,…

Fabrication of corneal epithelial cell sheets maintaining colony-forming cells without feeder cells by oxygen-controlled method.

PubMed

Nakajima, Ryota; Takeda, Shizu

2014-01-01

The use of murine 3T3 feeder cells needs to be avoided when fabricating corneal epithelial cell sheets for use in treating ocular surface diseases. However, the expression level of the epithelial stem/progenitor cell marker, p63, is down-regulated in feeder-free culture systems. In this study, in order to fabricate corneal epithelial cell sheets that maintain colony-forming cells without using any feeder cells, we investigated the use of an oxygen-controlled method that was developed previously to fabricate cell sheets efficiently. Rabbit limbal epithelial cells were cultured under hypoxia (1-10% O2) and under normoxia during stratification after reaching confluence. Multilayered corneal epithelial cell sheets were fabricated using an oxygen-controlled method, and immunofluorescence analysis showed that cytokeratin 3 and p63 was expressed in appropriate localization in the cell sheets. The colony-forming efficiency of the cell sheets fabricated by the oxygen-controlled method without feeder cells was significantly higher than that of cell sheets fabricated under 20% O2 without feeder cells. These results indicate that the oxygen-controlled method has the potential to achieve a feeder-free culture system for fabricating corneal epithelial cell sheets for corneal regeneration. Copyright © 2013 Elsevier Ltd. All rights reserved.

Comparison of methods for determining the numbers and species distribution of coliform bacteria in well water samples.

PubMed

Niemi, R M; Heikkilä, M P; Lahti, K; Kalso, S; Niemelä, S I

2001-06-01

Enumeration of coliform bacteria and Escherichia coli is the most widely used method in the estimation of hygienic quality of drinking water. The yield of target bacteria and the species composition of different populations of coliform bacteria may depend on the method.Three methods were compared. Three membrane filtration methods were used for the enumeration of coliform bacteria in shallow well waters. The yield of confirmed coliform bacteria was highest on Differential Coliform agar, followed by LES Endo agar. Differential Coliform agar had the highest proportion of typical colonies, of which 74% were confirmed as belonging to the Enterobacteriaceae. Of the typical colonies on Lactose Tergitol 7 TTC agar, 75% were confirmed as Enterobacteriaceae, whereas 92% of typical colonies on LES Endo agar belonged to the Enterobacteriaceae. LES Endo agar yielded many Serratia strains, Lactose Tergitol 7 TTC agar yielded numerous strains of Rahnella aquatilis and Enterobacter, whereas Differential Coliform agar yielded the widest range of species. The yield of coliform bacteria varied between methods. Each method compared had a characteristic species distribution of target bacteria and a typical level of interference of non-target bacteria. Identification with routine physiological tests to distinct species was hampered by the slight differences between species. High yield and sufficient selectivity are difficult to achieve simultaneously, especially if the target group is diverse. The results showed that several aspects of method performance should be considered, and that the target group must be distinctly defined to enable method comparisons.

Adult Vampire Bats Produce Contact Calls When Isolated: Acoustic Variation by Species, Population, Colony, and Individual

PubMed Central

Carter, Gerald G.; Logsdon, Ryane; Arnold, Bryan D.; Menchaca, Angelica; Medellin, Rodrigo A.

2012-01-01

Background Bat pups produce individually distinct isolation calls to facilitate maternal recognition. Increasing evidence suggests that, in group-living bat species, adults often use similar calls to maintain contact. We investigated if isolated adults from all three species of the highly cooperative vampire bats (Phyllostomidae: Desmodontinae) would produce vocally distinct contact calls when physically isolated. Methods/Principal Findings We assessed variation in contact calls recorded from isolated captive and wild-caught adult common vampire bats (Desmodus rotundus), white-winged vampire bats (Diaemus youngi) and hairy-legged vampire bats (Diphylla ecaudata). We compared species-typical contact call structure, and used information theory and permuted discriminate function analyses to examine call structure variation, and to determine if the individuality of contact calls is encoded by different call features across species and populations. We found that isolated adult vampire bats produce contact calls that vary by species, population, colony, and individual. However, much variation occurred within a single context and individual. We estimated signature information for captive Diaemus (same colony), captive Desmodus (same colony), and wild Desmodus (different colonies) at 3.21, 3.26, and 3.88 bits, respectively. Contact calls from a captive colony of Desmodus were less individually distinct than calls from wild-caught Desmodus from different colonies. Both the degree of individuality and parameters encoding individuality differed between the bats from a single captive colony and the wild-caught individuals from different groups. This result is consistent with, but not sufficient evidence of, vocal convergence in groups. Conclusion Our results show that adult vampire bats of all three species produce highly variable contact calls when isolated. Contact calls contain sufficient information for vocal discrimination, but also possess more intra-individual variation than is required for the sole purpose of identifying individuals. PMID:22719947

Habitat comparisons and productivity in nesting common terns on the mid-Atlantic coast

USGS Publications Warehouse

Erwin, R.M.; Smith, D.C.

1985-01-01

Nesting Common Terns (Sterna hirundo) were studied at a number of barrier beaches and small islands of tidal salt marsh in New Jersey and the Eastern Shore of Maryland-Virginina from 1980 through 1982. Data were collected on clutch sizes, nest spacing, and nesting success. The principal null hypothesis tested was that no difference in reproductive success exists between beach and marsh habitats. Nests were monitored from egg-laying in mid-May until mid-July when young fledged. Clutch sizes varied among colonies and across years but no systematic effect of year, habitat, or colony size on mean clutch size per colony was detected. Analyses of nest productivity (estimated using both the Mayfield method and using a colony average) failed to reveal significant effects of habitat or colony size but showed a stronger year effect. Storm tide flooding and egg chick disappearance (presumably predation by Herring Gulls Larus argentatus and Laughing Gulls L. atricilla nesting nearby) accounted for most nest failures. Losses due to both these mortality factors were unpredictable from year to year. Nest spacing in salt marsh colonies was much closer than it was on barrier beaches. In mixed-species colonies with Black Skimmers (Rynchops niger), distances between tern and skimmer nests were also much smaller in marsh colonies than they were on beaches. The limited amount of wrack (windrows of dead, matted vegetation) preferred by marsh-nesting terns probably explains these spacing differences. Several lines of evidence suggest that terns prefer beaches to marshes for nesting, however, the uncertainty of predation and flooding may often obscure any intrinsic differences in habitat quality. Long-term field studies are essential for testing hypotheses related to differential fitness of individuals among habitats.

Is there a Space for Post-Colonial Theory in the Socio-Psychological Research on Consequences of Colonial Past?

PubMed

Leone, Giovanna

2018-04-26

The focus of my commentary is two-fold. First, I discuss what appeared to me as the central theoretical focus of the article; the possibility to create a space, if at all, for integrating post-colonial theory into the broader research field of social and psychological studies of the consequences of colonial past. Second, I intend to show why, in my opinion, the methodological choices of the authors and the criteria adopted for corpus construction allowed for data that, although too thin to establishing the state of knowledge in the field of study on consequences of colonial past, is nevertheless very informative and thoughts-provoking. My conclusions suggest that this study is an innovative attempt at describing and grasping the results of a search guided by two among the more consolidated electronic datasets currently available for English-speaking scholars. However, this study may not easily understand which can be the space to integrate post-colonial theory in the field of research on consequences of colonial past. To better reach this aim, it is perhaps necessary to build another kind of corpus, open to other languages (starting from French) and focused also on other scientific products, as books or proceedings of congress. In addition, disciplinary boundaries have to be even more explored, starting from interdisciplinary studies on education and historical culture. In spite of these limitations, I am convinced that this innovative study by Tomicic and Berardi tackles issues of relevance to any serious effort towards reflecting on long-term consequences of colonial violence and opens up to valuable new research questions and methods, to be taken into serious account and further explored in future works.

In vivo evaluation of the effect of essential oil-containing oral strips on salivary bacteria using the checkerboard method.

PubMed

da Silva, Carina Maciel; Colombo, Andréa Vieira; do Souto, Renata Martins; Colombo, Ana Paula

2005-01-01

The aim of this study was to evaluate the antimicrobial effect of essential oil-containing oral strips on different species of the oral microbiota. Saliva samples were collected from 20 subjects with good oral health, diluted and plated onto blood agar medium. The subjects were asked to place the strip (Listerine PocketPaks) on the tongue allowing it to dissolve. After 30 minutes, new saliva samples were collected again and the plates with the samples were incubated under anaerobic conditions at 37 degrees C for seven days. Colony counts (CFU/mL) were determined for each sample. The colonies on the plates were washed with 1 mL of TE buffer, and the bacterial suspensions were processed for the identification of 24 species by DNA probes and the Checkerboard DNA-DNA hybridization method. Differences in total counts, prevalence, and levels of the species evaluated before and after placement of the strips were determined by Wilcoxon sign rank and Chi-square tests. A modest increase in the total bacterial number in saliva from 1.4 x 10(8) to 1.7 x 10(8) bacterial cells was observed 30 minutes after the strip placement, although this change was not significant (p = 0.632). Most of the species reduced in frequency and/or levels, including the pathogens A. actinomycetemcomitans, C. rectus, E. corrodens, Fusobacterium spp., P. intermedia, and S. noxia, as well as the beneficial species A. meyeri, A. georgia, A. gerencseriae, A. odontolyticus, and P. acnes after strip placement. In contrast, A. viscosus, P. melaninogenica, P. gingivalis, P. micros, Streptococcus spp., T. forsythensis, and V. parvula presented an increase in prevalence and/or levels. These changes were not statistically significant after adjusting for multiple comparisons (p > 0.0022). The use of the essential oil-containing oral strips resulted in a short-term small increase in the total number of salivary microorganisms. In addition, a not significant decrease of certain periodontopathogens, and an increase in species compatible with oral health were observed.

Population genetics and phylogeography of sea turtles.

PubMed

Bowen, B W; Karl, S A

2007-12-01

The seven species of sea turtles occupy a diversity of niches, and have a history tracing back over 100 million years, yet all share basic life-history features, including exceptional navigation skills and periodic migrations from feeding to breeding habitats. Here, we review the biogeographic, behavioural, and ecological factors that shape the distribution of genetic diversity in sea turtles. Natal homing, wherein turtles return to their region of origin for mating and nesting, has been demonstrated with mtDNA sequences. These maternally inherited markers show strong population structure among nesting colonies while nuclear loci reveal a contrasting pattern of male-mediated gene flow, a phenomenon termed 'complex population structure'. Mixed-stock analyses indicate that multiple nesting colonies can contribute to feeding aggregates, such that exploitation of turtles in these habitats can reduce breeding populations across the region. The mtDNA data also demonstrate migrations across entire ocean basins, some of the longest movements of marine vertebrates. Multiple paternity occurs at reported rates of 0-100%, and can vary by as much as 9-100% within species. Hybridization in almost every combination among members of the Cheloniidae has been documented but the frequency and ultimate ramifications of hybridization are not clear. The global phylogeography of sea turtles reveals a gradient based on habitat preference and thermal regime. The cold-tolerant leatherback turtle (Dermochelys coriacea) shows no evolutionary partitions between Indo-Pacific and Atlantic populations, while the tropical green (Chelonia mydas), hawksbill (Eretmochelys imbricata), and ridleys (Lepidochelys olivacea vs. L. kempi) have ancient separations between oceans. Ridleys and loggerhead (Caretta caretta) also show more recent colonization between ocean basins, probably mediated by warm-water gyres that occasionally traverse the frigid upwelling zone in southern Africa. These rare events may be sufficient to prevent allopatric speciation under contemporary geographic and climatic conditions. Genetic studies have advanced our understanding of marine turtle biology and evolution, but significant gaps persist and provide challenges for the next generation of sea turtle geneticists.

Extension of D-H parameter method to hybrid manipulators used in robot-assisted surgery.

PubMed

Singh, Amanpreet; Singla, Ashish; Soni, Sanjeev

2015-10-01

The main focus of this work is to extend the applicability of D-H parameter method to develop a kinematic model of a hybrid manipulator. A hybrid manipulator is a combination of open- and closed-loop chains and contains planar and spatial links. It has been found in the literature that D-H parameter method leads to ambiguities, when dealing with closed-loop chains. In this work, it has been observed that the D-H parameter method, when applied to a hybrid manipulator, results in an orientational inconsistency, because of which the method cannot be used to develop the kinematic model. In this article, the concept of dummy frames is proposed to resolve the orientational inconsistency and to develop the kinematic model of a hybrid manipulator. Moreover, the prototype of 7-degree-of-freedom hybrid manipulator, known as a surgeon-side manipulator to assist the surgeon during a medical surgery, is also developed to validate the kinematic model derived in this work. © IMechE 2015.

Hybrid ODE/SSA methods and the cell cycle model

NASA Astrophysics Data System (ADS)

Wang, S.; Chen, M.; Cao, Y.

2017-07-01

Stochastic effect in cellular systems has been an important topic in systems biology. Stochastic modeling and simulation methods are important tools to study stochastic effect. Given the low efficiency of stochastic simulation algorithms, the hybrid method, which combines an ordinary differential equation (ODE) system with a stochastic chemically reacting system, shows its unique advantages in the modeling and simulation of biochemical systems. The efficiency of hybrid method is usually limited by reactions in the stochastic subsystem, which are modeled and simulated using Gillespie's framework and frequently interrupt the integration of the ODE subsystem. In this paper we develop an efficient implementation approach for the hybrid method coupled with traditional ODE solvers. We also compare the efficiency of hybrid methods with three widely used ODE solvers RADAU5, DASSL, and DLSODAR. Numerical experiments with three biochemical models are presented. A detailed discussion is presented for the performances of three ODE solvers.

Protection from Oxidative Stress in Immunocytes of the Colonial Ascidian Botryllus schlosseri: Transcript Characterization and Expression Studies.

PubMed

Franchi, Nicola; Ballin, Francesca; Ballarin, Loriano

2017-02-01

Botryllus schlosseri is a cosmopolitan colonial ascidian that undergoes cyclical generation changes, or take-overs, during which adult zooids are resorbed and replaced by their buds. At take-over, adult tissues undergo diffuse apoptosis and effete cells are massively ingested by circulating phagocytes, with a consequent increase in oxygen consumption and in production of reactive oxygen species (ROS). The latter are responsible for the death of phagocytes involved in the clearance of apoptotic cells and corpses by phagocytosis-induced apoptosis. However, the majority of phagocytes and hemocytes do not die, even if they experience oxidative stress. This fact suggests the presence of detoxification mechanisms assuring their protection. To test this assumption, we searched for transcripts of genes involved in detoxification in the transcriptome of B. schlosseri. We identified and characterized transcripts for Cu/Zn superoxide dismutase (SOD), γ-glutamyl-cysteine ligase modulatory subunit (GCLM), glutathione synthase (GS), and two glutathione peroxidases (i.e., GPx3 and GPx5), all involved in protection from ROS. We also carried out a phylogenetic analysis of the putative amino acid sequences, confirming their similarity to their vertebrate counterparts, and studied the location of their mRNAs by in situ hybridization on hemocyte monolayers. We also analyzed gene transcription during the colonial blastogenetic cycle, which is the interval of time between one take-over and the next, by qRT-PCR. In addition, we investigated the effects of cadmium (Cd), an inducer of oxidative stress, on gene transcription. Our results indicated that i) antioxidant gene expression is modulated in the course of the blastogenetic cycle and upon exposure to Cd, and ii) hemocytes synthesize both enzymatic and nonenzymatic antioxidants, in line with the idea that they represent a major detoxification system for ascidians.

Ultra-Fine Scale Spatially-Integrated Mapping of Habitat and Occupancy Using Structure-From-Motion

PubMed Central

McDowall, Philip; Lynch, Heather J.

2017-01-01

Organisms respond to and often simultaneously modify their environment. While these interactions are apparent at the landscape extent, the driving mechanisms often occur at very fine spatial scales. Structure-from-Motion (SfM), a computer vision technique, allows the simultaneous mapping of organisms and fine scale habitat, and will greatly improve our understanding of habitat suitability, ecophysiology, and the bi-directional relationship between geomorphology and habitat use. SfM can be used to create high-resolution (centimeter-scale) three-dimensional (3D) habitat models at low cost. These models can capture the abiotic conditions formed by terrain and simultaneously record the position of individual organisms within that terrain. While coloniality is common in seabird species, we have a poor understanding of the extent to which dense breeding aggregations are driven by fine-scale active aggregation or limited suitable habitat. We demonstrate the use of SfM for fine-scale habitat suitability by reconstructing the locations of nests in a gentoo penguin colony and fitting models that explicitly account for conspecific attraction. The resulting digital elevation models (DEMs) are used as covariates in an inhomogeneous hybrid point process model. We find that gentoo penguin nest site selection is a function of the topography of the landscape, but that nests are far more aggregated than would be expected based on terrain alone, suggesting a strong role of behavioral aggregation in driving coloniality in this species. This integrated mapping of organisms and fine scale habitat will greatly improve our understanding of fine-scale habitat suitability, ecophysiology, and the complex bi-directional relationship between geomorphology and habitat use. PMID:28076351

Existence and stability, and discrete BB and rank conditions, for general mixed-hybrid finite elements in elasticity

NASA Technical Reports Server (NTRS)

Xue, W.-M.; Atluri, S. N.

1985-01-01

In this paper, all possible forms of mixed-hybrid finite element methods that are based on multi-field variational principles are examined as to the conditions for existence, stability, and uniqueness of their solutions. The reasons as to why certain 'simplified hybrid-mixed methods' in general, and the so-called 'simplified hybrid-displacement method' in particular (based on the so-called simplified variational principles), become unstable, are discussed. A comprehensive discussion of the 'discrete' BB-conditions, and the rank conditions, of the matrices arising in mixed-hybrid methods, is given. Some recent studies aimed at the assurance of such rank conditions, and the related problem of the avoidance of spurious kinematic modes, are presented.

Norwegian honey bees surviving Varroa destructor mite infestations by means of natural selection

PubMed Central

Dahle, Bjørn; Neumann, Peter

2017-01-01

Background Managed, feral and wild populations of European honey bee subspecies, Apis mellifera, are currently facing severe colony losses globally. There is consensus that the ectoparasitic mite Varroa destructor, that switched hosts from the Eastern honey bee Apis cerana to the Western honey bee A. mellifera, is a key factor driving these losses. For >20 years, breeding efforts have not produced European honey bee colonies that can survive infestations without the need for mite control. However, at least three populations of European honey bees have developed this ability by means of natural selection and have been surviving for >10 years without mite treatments. Reduced mite reproductive success has been suggested as a key factor explaining this natural survival. Here, we report a managed A. mellifera population in Norway, that has been naturally surviving consistent V. destructor infestations for >17 years. Methods Surviving colonies and local susceptible controls were evaluated for mite infestation levels, mite reproductive success and two potential mechanisms explaining colony survival: grooming of adult worker bees and Varroa Sensitive Hygiene (VSH): adult workers specifically detecting and removing mite-infested brood. Results Mite infestation levels were significantly lower in surviving colonies and mite reproductive success was reduced by 30% when compared to the controls. No significant differences were found between surviving and control colonies for either grooming or VSH. Discussion Our data confirm that reduced mite reproductive success seems to be a key factor for natural survival of infested A. mellifera colonies. However, neither grooming nor VSH seem to explain colony survival. Instead, other behaviors of the adult bees seem to be sufficient to hinder mite reproductive success, because brood for this experiment was taken from susceptible donor colonies only. To mitigate the global impact of V. destructor, we suggest learning more from nature, i.e., identifying the obviously efficient mechanisms favored by natural selection. PMID:29085753

Response Ant Colony Optimization of End Milling Surface Roughness

PubMed Central

Kadirgama, K.; Noor, M. M.; Abd Alla, Ahmed N.

2010-01-01

Metal cutting processes are important due to increased consumer demands for quality metal cutting related products (more precise tolerances and better product surface roughness) that has driven the metal cutting industry to continuously improve quality control of metal cutting processes. This paper presents optimum surface roughness by using milling mould aluminium alloys (AA6061-T6) with Response Ant Colony Optimization (RACO). The approach is based on Response Surface Method (RSM) and Ant Colony Optimization (ACO). The main objectives to find the optimized parameters and the most dominant variables (cutting speed, feedrate, axial depth and radial depth). The first order model indicates that the feedrate is the most significant factor affecting surface roughness. PMID:22294914

Impact of seasonality upon the dynamics of a novel pathogen in a seabird colony

NASA Astrophysics Data System (ADS)

O'Regan, S. M.

2008-11-01

A seasonally perturbed variant of the basic Susceptible-Infected-Recovered (SIR) model in epidemiology is considered in this paper. The effect of seasonality on an IR system of ordinary differential equations describing the dynamics of a novel pathogen, e.g., highly pathogenic avian influenza, in a seabird colony is investigated. The method of Lyapunov functions is used to determine the long-term behaviour of this system. Numerical simulations of the seasonally perturbed IR system indicate that the system exhibits complex dynamics as the amplitude of the seasonal perturbation term is increased. These findings suggest that seasonality may exert a considerable effect on the dynamics of epidemics in a seabird colony.

Fish skin bacteria: Colonial and cellular hydrophobicity.

PubMed

Sar, N; Rosenberg, E

1987-05-01

Bacteria were desorbed from the skin of healthy, fast-swimming fish by several procedures, including brief exposure to sonic oscillation and treatment with nontoxic surface active agents. The surface properties of these bacteria were studied by measuring their adhesion to hexadecane, as well as by a newly developed, simple method for studying the hydrophobicity of bacterial lawns. This method, referred to as the "Direction of Spreading" (DOS) method, consists of recording the direction to which a water drop spreads when introduced at the border between bacterial lawns and other surfaces. Of the 13 fish skin isolates examined, two strains were as hydrophobic as polystyrene by the DOS method. Suspended cells of one of these strains adhered strongly to hexadecane (84%), whereas cells of the other strain adhered poorly (13%). Another strain which was almost as hydrophobic as polystyrene by the DOS method did not adhere to hexadecane at all. Similarly, lawns of three other strains were more hydrophobic than glass by the DOS method, but cell suspensions prepared from these colonies showed little or no adhesion to hexadecane. The high colonial but relatively low cellular hydrophobicity could be due to a hydrophobic slime that is removed during the suspension and washing procedures. The possibility that specific bacteria assist in fish locomotion by changing the surface properties of the fish skin and by producing drag-reducing polymers is discussed.

High prevalence of oral colonization by Candida dubliniensis in HIV-positive patients in Argentina.

PubMed

Binolfi, Andrés; Biasoli, Marisa S; Luque, Alicia G; Tosello, María E; Magaró, Hortensia M

2005-08-01

Candida dubliniensis is a recently described yeast species, closely related to Candida albicans. This work represents the first general survey of the carriage of C. dubliniensis in the oral cavities of HIV-positive patients in Argentina. We studied 133 strains isolated from 162 HIV-positive patients, using the following identification tests: chlamydospore production on corn meal agar with Tween 80; colony color on CHROMagar Candida media; differential growth at 45 degrees C on potato dextrose agar; D-xylose assimilation; chlamydospore formation on sunflower seed agar (SSA); carbohydrate assimilation profiles using the API 20 C Aux commercial kit and PCR using primers that hybridize to the class IV intron of the ACT1 gene. Out of the 133 strains, 21 were identified as C. dubliniensis, representing approximately 13% of the 162 patients in this study. From these data, we conclude that although the PCR assay is the most reliable method, clamydospore formation on SSA is an easier and less expensive test for the screening of C. dubliniensis in the routine laboratory. Our results show that C. dubliniensis has a high prevalence among HIV-positive patients in Argentina.

Morphology and mycelial growth rate of Pleurotus spp. strains from the Mexican mixtec region

PubMed Central

Guadarrama-Mendoza, P.C.; del Toro, G. Valencia; Ramírez-Carrillo, R.; Robles-Martínez, F.; Yáñez-Fernández, J.; Garín-Aguilar, M.E.; Hernández, C.G.; Bravo-Villa, G.

2014-01-01

Two native Pleurotus spp. strains (white LB-050 and pale pink LB-051) were isolated from rotten tree trunks of cazahuate (Ipomoea murucoides) from the Mexican Mixtec Region. Both strains were chemically dedikaryotized to obtain their symmetrical monokaryotic components (neohaplonts). This was achieved employing homogenization time periods from 60 to 65 s, and 3 day incubation at 28 °C in a peptone-glucose solution (PGS). Pairing of compatible neohaplonts resulted in 56 hybrid strains which were classified into the four following hybrid types: (R1-nxB1-n, R1-nxB2-1, R2-nxB1-n and R2-nxB2-1). The mycelial growth of Pleurotus spp. monokaryotic and dikaryotic strains showed differences in texture (cottony or floccose), growth (scarce, regular or abundant), density (high, regular or low), and pigmentation (off-white, white or pale pink). To determine the rate and the amount of mycelium growth in malt extract agar at 28 °C, the diameter of the colony was measured every 24 h until the Petri dish was completely colonized. A linear model had the best fit to the mycelial growth kinetics. A direct relationship between mycelial morphology and growth rate was observed. Cottony mycelium presented significantly higher growth rates (p < 0.01) in comparison with floccose mycelium. Thus, mycelial morphology can be used as criterion to select which pairs must be used for optimizing compatible-mating studies. Hybrids resulting from cottony neohaplonts maintained the characteristically high growth rates of their parental strains with the hybrid R1-nxB1-n being faster than the latter. PMID:25477920

Effect of sample storage time on detection of hybridization signals in Checkerboard DNA-DNA hybridization.

PubMed

do Nascimento, Cássio; Muller, Katia; Sato, Sandra; Albuquerque Junior, Rubens Ferreira

2012-04-01

Long-term sample storage can affect the intensity of the hybridization signals provided by molecular diagnostic methods that use chemiluminescent detection. The aim of this study was to evaluate the effect of different storage times on the hybridization signals of 13 bacterial species detected by the Checkerboard DNA-DNA hybridization method using whole-genomic DNA probes. Ninety-six subgingival biofilm samples were collected from 36 healthy subjects, and the intensity of hybridization signals was evaluated at 4 different time periods: (1) immediately after collecting (n = 24) and (2) after storage at -20 °C for 6 months (n = 24), (3) for 12 months (n = 24), and (4) for 24 months (n = 24). The intensity of hybridization signals obtained from groups 1 and 2 were significantly higher than in the other groups (p < 0.001). No differences were found between groups 1 and 2 (p > 0.05). The Checkerboard DNA-DNA hybridization method was suitable to detect hybridization signals from all groups evaluated, and the intensity of signals decreased significantly after long periods of sample storage.

Photonic integrated circuits based on silica and polymer PLC

NASA Astrophysics Data System (ADS)

Izuhara, T.; Fujita, J.; Gerhardt, R.; Sui, B.; Lin, W.; Grek, B.

2013-03-01

Various methods of hybrid integration of photonic circuits are discussed focusing on merits and challenges. Material platforms discussed in this report are mainly polymer and silica. We categorize the hybridization methods using silica and polymer waveguides into two types, chip-to-chip and on-chip integration. General reviews of these hybridization technologies from the past works are reviewed. An example for each method is discussed in details. We also discuss current status of our silica PLC hybrid integration technology.

Virulence plasmid (pYV)-associated expression of phenotypic virulent determinants in pathogenic Yersinia species: a convenient method for monitoring the presence of pYV under culture conditions and its application for...food

USDA-ARS?s Scientific Manuscript database

In Yersinia pestis, Y. pseudotuberculosis, and Y, enterocolitica, phenotypic expression of virulence plasmid (pYV: 70-kb)-associated genetic determinants may include low calcium response (Lcr, pin point colony, size = 0.36 mm), colony morphology (size = 1.13 mm), crystal violet (CV) binding (dark-v...

Virulence plasmid (pYV)-associated expression of phenotypic virulent determinants in pathogenic Yersinia species: a convenient method for monitoring the presence of pYV under culture conditions and its application for....food

USDA-ARS?s Scientific Manuscript database

In Yersinia pestis, Y. pseudotuberculosis, and Y, enterocolitica, phenotypic expression of several virulence plasmid (pYV: 70-kb)-associated genetic determinants may include low calcium response (Lcr, pin point colony, size = 0.36 mm), colony morphology (size = 1.13 mm), crystal violet (CV) binding...

Computer-based classification of bacteria species by analysis of their colonies Fresnel diffraction patterns

NASA Astrophysics Data System (ADS)

Suchwalko, Agnieszka; Buzalewicz, Igor; Podbielska, Halina

2012-01-01

In the presented paper the optical system with converging spherical wave illumination for classification of bacteria species, is proposed. It allows for compression of the observation space, observation of Fresnel patterns, diffraction pattern scaling and low level of optical aberrations, which are not possessed by other optical configurations. Obtained experimental results have shown that colonies of specific bacteria species generate unique diffraction signatures. Analysis of Fresnel diffraction patterns of bacteria colonies can be fast and reliable method for classification and recognition of bacteria species. To determine the unique features of bacteria colonies diffraction patterns the image processing analysis was proposed. Classification can be performed by analyzing the spatial structure of diffraction patterns, which can be characterized by set of concentric rings. The characteristics of such rings depends on the bacteria species. In the paper, the influence of basic features and ring partitioning number on the bacteria classification, is analyzed. It is demonstrated that Fresnel patterns can be used for classification of following species: Salmonella enteritidis, Staplyococcus aureus, Proteus mirabilis and Citrobacter freundii. Image processing is performed by free ImageJ software, for which a special macro with human interaction, was written. LDA classification, CV method, ANOVA and PCA visualizations preceded by image data extraction were conducted using the free software R.

Interactions between PBEF and oxidative stress proteins-a potential new mechanism underlying PBEF in the pathogenesis of acute lung injury

PubMed Central

Zhang, Li Qin; Adyshev, Djanybek M.; Singleton, Patrick; Li, Hailong; Cepeda, Javier; Huang, Sheng-You; Zou, Xiaoqin; Verin, Alexander D.; Tu, Jiancheng; Garcia, Joe G.N.; Ye, Shui Qing

2008-01-01

Identification of pre-B-cell colony-enhancing factor (PBEF) interacting partners may reveal new molecular mechanisms of PBEF in the pathogenesis of acute lung injury (ALI). The interactions between PBEF and NADH dehydrogenase subunit 1(ND1), ferritin light chain and interferon induced transmembrane 3 (IFITM3) in human pulmonary vascular endothelial cells were identified and validated. ND1, ferritin and IFITM3 are involved in oxidative stress and inflammation. Overexpression of PBEF increased its interactions and intracellular oxidative stress, which can be attenuated by rotenone. The interaction modeling between PBEF and ND1 is consistent with the corresponding experimental finding. These interactions may underlie a novel role of PBEF in the pathogenesis of ALI. Structured summary MINT-6538697: PBEF (uniprotkb:P43490) physically interacts (MI:0218) with NADH1 (uniprotkb:P03886) by two hybrid (MI:0018) MINT-6538811, MINT-6538868: PBEF (uniprotkb:P43490) physically interacts (MI:0218) with interferon-induced transmembra (uniprotkb:Q01628) by anti bait coimmunoprecipitation (MI:0006) MINT-6538787, MINT-6538841: PBEF (uniprotkb:P43490) physically interacts (MI:0218) with NADH1 (uniprotkb:P03886) by anti bait coimmunoprecipitation (MI:0006) MINT-6538755: PBEF (uniprotkb:P43490) physically interacts (MI:0218) with gamma-glutamil-transferase (uniprotkb:P19440) by two hybrid (MI:0018) MINT-6538799, MINT-6538862: PBEF (uniprotkb:P43490) physically interacts (MI:0218) with Ferritin light chain (uniprotkb:P02792) by anti bait coimmunoprecipitation (MI:0006) MINT-6538769: PBEF (uniprotkb:P43490) physically interacts (MI:0218) with E2L6 (uniprotkb:O14933) by two hybrid (MI:0018) MINT-6538741: PBEF (uniprotkb:P43490) physically interacts (MI:0218) with Adenosine A2aR (uniprotkb:P29274) by two hybrid (MI:0018) MINT-6538727: PBEF (uniprotkb:P43490) physically interacts (MI:0218) with interferon-induced transmembra (uniprotkb:Q01628) by two hybrid (MI:0018) MINT-6538712: PBEF (uniprotkb:P43490) physically interacts (MI:0218) with Ferritin light chain (uniprotkb:P02792) by two hybrid (MI:0018) PMID:18486613

Generation of hybrid sinograms for the recovery of kV-CT images with metal artifacts for helical tomotherapy

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jeon, Hosang; Park, Dahl; Kim, Wontaek

Purpose: The overall goal of this study is to restore kilovoltage computed tomography (kV-CT) images which are disfigured by patients’ metal prostheses. By generating a hybrid sinogram that is a combination of kV and megavoltage (MV) projection data, the authors suggest a novel metal artifact-reduction (MAR) method that retains the image quality to match that of kV-CT and simultaneously restores the information of metal prostheses lost due to photon starvation. Methods: CT projection data contain information about attenuation coefficients and the total length of the attenuation. By normalizing raw kV projections with their own total lengths of attenuation, mean attenuationmore » projections were obtained. In the same manner, mean density projections of MV-CT were obtained by the normalization of MV projections resulting from the forward projection of density-calibrated MV-CT images with the geometric parameters of the kV-CT device. To generate the hybrid sinogram, metal-affected signals of the kV sinogram were identified and replaced by the corresponding signals of the MV sinogram following a density calibration step with kV data. Filtered backprojection was implemented to reconstruct the hybrid CT image. To validate the authors’ approach, they simulated four different scenarios for three heads and one pelvis using metallic rod inserts within a cylindrical phantom. Five inserts describing human body elements were also included in the phantom. The authors compared the image qualities among the kV, MV, and hybrid CT images by measuring the contrast-to-noise ratio (CNR), the signal-to-noise ratio (SNR), the densities of all inserts, and the spatial resolution. In addition, the MAR performance was compared among three existing MAR methods and the authors’ hybrid method. Finally, for clinical trials, the authors produced hybrid images of three patients having dental metal prostheses to compare their MAR performances with those of the kV, MV, and three existing MAR methods. Results: The authors compared the image quality and MAR performance of the hybrid method with those of other imaging modalities and the three MAR methods, respectively. The total measured mean of the CNR (SNR) values for the nonmetal inserts was determined to be 14.3 (35.3), 15.3 (37.8), and 25.5 (64.3) for the kV, MV, and hybrid images, respectively, and the spatial resolutions of the hybrid images were similar to those of the kV images. The measured densities of the metal and nonmetal inserts in the hybrid images were in good agreement with their true densities, except in cases of extremely low densities, such as air and lung. Using the hybrid method, major streak artifacts were suitably removed and no secondary artifacts were introduced in the resultant image. In clinical trials, the authors verified that kV and MV projections were successfully combined and turned into the resultant hybrid image with high image contrast, accurate metal information, and few metal artifacts. The hybrid method also outperformed the three existing MAR methods with regard to metal information restoration and secondary artifact prevention. Conclusions: The authors have shown that the hybrid method can restore the overall image quality of kV-CT disfigured by severe metal artifacts and restore the information of metal prostheses lost due to photon starvation. The hybrid images may allow for the improved delineation of structures of interest and accurate dose calculations for radiation treatment planning for patients with metal prostheses.« less

Colony Collapse Disorder: A Descriptive Study

PubMed Central

vanEngelsdorp, Dennis; Evans, Jay D.; Saegerman, Claude; Mullin, Chris; Haubruge, Eric; Nguyen, Bach Kim; Frazier, Maryann; Frazier, Jim; Cox-Foster, Diana; Chen, Yanping; Underwood, Robyn; Tarpy, David R.; Pettis, Jeffery S.

2009-01-01

Background Over the last two winters, there have been large-scale, unexplained losses of managed honey bee (Apis mellifera L.) colonies in the United States. In the absence of a known cause, this syndrome was named Colony Collapse Disorder (CCD) because the main trait was a rapid loss of adult worker bees. We initiated a descriptive epizootiological study in order to better characterize CCD and compare risk factor exposure between populations afflicted by and not afflicted by CCD. Methods and Principal Findings Of 61 quantified variables (including adult bee physiology, pathogen loads, and pesticide levels), no single measure emerged as a most-likely cause of CCD. Bees in CCD colonies had higher pathogen loads and were co-infected with a greater number of pathogens than control populations, suggesting either an increased exposure to pathogens or a reduced resistance of bees toward pathogens. Levels of the synthetic acaricide coumaphos (used by beekeepers to control the parasitic mite Varroa destructor) were higher in control colonies than CCD-affected colonies. Conclusions/Significance This is the first comprehensive survey of CCD-affected bee populations that suggests CCD involves an interaction between pathogens and other stress factors. We present evidence that this condition is contagious or the result of exposure to a common risk factor. Potentially important areas for future hypothesis-driven research, including the possible legacy effect of mite parasitism and the role of honey bee resistance to pesticides, are highlighted. PMID:19649264

Real-time bacterial microcolony counting using on-chip microscopy

NASA Astrophysics Data System (ADS)

Jung, Jae Hee; Lee, Jung Eun

2016-02-01

Observing microbial colonies is the standard method for determining the microbe titer and investigating the behaviors of microbes. Here, we report an automated, real-time bacterial microcolony-counting system implemented on a wide field-of-view (FOV), on-chip microscopy platform, termed ePetri. Using sub-pixel sweeping microscopy (SPSM) with a super-resolution algorithm, this system offers the ability to dynamically track individual bacterial microcolonies over a wide FOV of 5.7 mm × 4.3 mm without requiring a moving stage or lens. As a demonstration, we obtained high-resolution time-series images of S. epidermidis at 20-min intervals. We implemented an image-processing algorithm to analyze the spatiotemporal distribution of microcolonies, the development of which could be observed from a single bacterial cell. Test bacterial colonies with a minimum diameter of 20 μm could be enumerated within 6 h. We showed that our approach not only provides results that are comparable to conventional colony-counting assays but also can be used to monitor the dynamics of colony formation and growth. This microcolony-counting system using on-chip microscopy represents a new platform that substantially reduces the detection time for bacterial colony counting. It uses chip-scale image acquisition and is a simple and compact solution for the automation of colony-counting assays and microbe behavior analysis with applications in antibacterial drug discovery.

Assessing hygienic behavior of Apis mellifera unicolor (Hymenoptera: Apidae), the endemic honey bee from Madagascar.

PubMed

Rasolofoarivao, H; Delatte, H; Raveloson Ravaomanarivo, L H; Reynaud, B; Clémencet, J

2015-06-01

Hygienic behavior (HB) is one of the natural mechanisms of honey bee for limiting the spread of brood diseases and Varroa destructor parasitic mite. Objective of our study was to measure HB of Apis mellifera unicolor colonies (N = 403) from three geographic regions (one infested and two free of V. destructor) in Madagascar. The pin-killing method was used for evaluation of the HB. Responses were measured from 3 h 30 min to 7 h after perforation of the cells. Colonies were very effective in detecting perforated cells. In the first 4 h, on average, they detected at least 50% of the pin-killed brood. Six hours after cell perforation, colonies tested (N = 91) showed a wide range of uncapped (0 to 100%) and cleaned cells (0 to 82%). Global distribution of the rate of cleaned cells at 6 h was multimodal and hygienic responses could be split in three classes. Colonies from the three regions showed a significant difference in HB responses. Three hypotheses (geographic, genetic traits, presence of V. destructor) are further discussed to explain variability of HB responses among the regions. Levels of HB efficiency of A. mellifera unicolor colonies are among the greatest levels reported for A. mellifera subspecies. Presence of highly hygienic colonies is a great opportunity for future breeding program in selection for HB.

Real-time bacterial microcolony counting using on-chip microscopy

PubMed Central

Jung, Jae Hee; Lee, Jung Eun

2016-01-01

Observing microbial colonies is the standard method for determining the microbe titer and investigating the behaviors of microbes. Here, we report an automated, real-time bacterial microcolony-counting system implemented on a wide field-of-view (FOV), on-chip microscopy platform, termed ePetri. Using sub-pixel sweeping microscopy (SPSM) with a super-resolution algorithm, this system offers the ability to dynamically track individual bacterial microcolonies over a wide FOV of 5.7 mm × 4.3 mm without requiring a moving stage or lens. As a demonstration, we obtained high-resolution time-series images of S. epidermidis at 20-min intervals. We implemented an image-processing algorithm to analyze the spatiotemporal distribution of microcolonies, the development of which could be observed from a single bacterial cell. Test bacterial colonies with a minimum diameter of 20 μm could be enumerated within 6 h. We showed that our approach not only provides results that are comparable to conventional colony-counting assays but also can be used to monitor the dynamics of colony formation and growth. This microcolony-counting system using on-chip microscopy represents a new platform that substantially reduces the detection time for bacterial colony counting. It uses chip-scale image acquisition and is a simple and compact solution for the automation of colony-counting assays and microbe behavior analysis with applications in antibacterial drug discovery. PMID:26902822

Firm Efficiency and Returns-to-Scale in the Honey Bee Pollination Services Industry.

PubMed

Jones Ritten, Chian; Peck, Dannele; Ehmke, Mariah; Patalee, M A Buddhika

2018-04-03

While the demand for pollination services have been increasing, continued declines in honey bee, Apis mellifera L. (Hymenoptera: Apidae), colonies have put the cropping sector and the broader health of agro-ecosystems at risk. Economic factors may play a role in dwindling honey bee colony supply in the United States, but have not been extensively studied. Using data envelopment analysis (DEA), we measure technical efficiency, returns to scale, and factors influencing the efficiency of those apiaries in the northern Rocky Mountain region participating in the pollination services market. We find that, although over 25% of apiaries are technically efficient, many experience either increasing or decreasing returns to scale. Smaller apiaries (under 80 colonies) experience increasing returns to scale, but a lack of available financing may hinder them from achieving economically sustainable colony levels. Larger apiaries (over 1,000 colonies) experience decreasing returns to scale. Those beekeepers may have economic incentivizes to decrease colony numbers. Using a double bootstrap method, we find that apiary location and off-farm employment influence apiary technical efficiency. Apiaries in Wyoming are found to be more efficient than those in Utah or Montana. Further, engagement in off-farm employment increases an apiary's technical efficiency. The combined effects of efficiency gains through off-farm employment and diseconomies of scale may explain, in part, the historical decline in honey bee numbers.

Method and apparatus for controlling hybrid powertrain system in response to engine temperature

DOEpatents

Martini, Ryan D; Spohn, Brian L; Lehmen, Allen J; Cerbolles, Teresa L

2014-10-07

A method for controlling a hybrid powertrain system including an internal combustion engine includes controlling operation of the hybrid powertrain system in response to a preferred minimum coolant temperature trajectory for the internal combustion engine.

The political economy of oil and the Niger Delta crisis

NASA Astrophysics Data System (ADS)

Ighodaro, Osaro O.

This study is about the burgeoning crisis in Nigeria's Oil Producing Niger Delta region. Discerning the intersecting contributive factors to the crisis, this dissertation suggests that the Niger Delta crisis is symptomatic of challenges to development in Nigeria. Due to the insidious colonial/neo-colonial practices of subjugation, and exploitation of the host communities, it is suggested that the extractive, super-profit motive of Shell, the concomitant environmental degradation, corruption of a bellicose state, ethnic conflict and suffering of the masses are outcomes of a long historically debilitating relationship with international capital which causes irreparable retardation to the host communities. From cash crop economy to a mono-oil economy resources are removed from the communities and used to enhance the colonial state and their post-colonial harbingers of misery. Hence, the indigenous people claim that the Niger Delta is in a crisis, and they are willing to confront the triple alliance of multinational oil companies like Shell, the Nigerian State and the local elite so long as these allies of subjugation continue to neglect the goose that lays the proverbial golden egg (oil that is). Theoretically, a hybrid Political Economy approach was adopted as the over-aching framework for the study, while Dependency theory, modified by what I have called African Transformative scholarly perspective, served as the conceptual tool. Primary and secondary sources of data, including personal observation, interviews, official government documents and other publications were utilized for this analysis. In view of recommendations, it is suggested that first, the Nigerian state should assume decisive and unflinching leadership in holding oil companies responsible for their activities in the host communities; second, oil companies (like Shell) should see themselves as an integral part of the host communities; invest in their development by providing employment opportunities and adhering to humane environmental practices. Finally, I suggest that the ownership and control of all resources, including oil should be vested in those communities in which they are found. The revenues accruing to the constitutive states of Nigeria will be accordingly taxed with the revenues from the taxes utilized for the general good of the polity especially the less endowed communities.

Assessment of the treatment protocol described in the guidelines for Trichophyton tonsurans infection.

PubMed

Shiraki, Yumi; Hiruma, Masataro; Sugita, Takashi; Ikeda, Shigaku

2008-01-01

Infection with the anthropophilic fungus Trichophyton tonsurans has spread among members of combat sports clubs and has become a serious public health problem in Japan and other countries. Infection usually provokes only a weak inflammatory response, and treatment compliance tends to be poor. To evaluate the hairbrush method and the treatment protocol described in the guidelines for T. tonsurans infection. The study subjects were 69 individuals with positive hairbrush culture from among 327 members of 12 judo clubs participating in the survey. (a) Subjects with no more than 4 colonies by the hairbrush method were treated with miconazole nitrate shampoo. (b) Subjects with 5 or more colonies were treated with (1) itraconazole at a dose of 100 mg/day for 6 weeks or at a dose of 400 mg/day for 1 week, or (2) terbinafine at a dose of 125 mg/day for 6 weeks or at a dose of 500 mg/day for 1 week. Treatment efficacy was monitored by the hairbrush method at 1.5 and 3 months after treatment. Of the 46 subjects with 5 or more colonies isolated by the hairbrush method, 32 (69.6%) took itraconazole or terbinafine in compliance with their treatment schedules and were negative for T. tonsurans after treatment. Of the 23 subjects with 4 or fewer colonies, 15 (65.2%) were negative for T. tonsurans after treatment with miconazole nitrate shampoo. The treatment protocol seems promising, but poor compliance is a problem with the oral treatment regimens. The shampoo therapy is only partially effective, with 35% of subjects remaining positive for T. tonsurans after this therapy. In order to eradicate this disease, we have renewed the guidelines for T. tonsurans infection.

Comparative chronic toxicity of three neonicotinoids on New Zealand packaged honey bees

PubMed Central

Kozii, Ivanna V.; Koziy, Roman V.; Epp, Tasha; Simko, Elemir

2018-01-01

Background Thiamethoxam, clothianidin, and imidacloprid are the most commonly used neonicotinoid insecticides on the Canadian prairies. There is widespread contamination of nectar and pollen with neonicotinoids, at concentrations which are sublethal for honey bees (Apis mellifera Linnaeus). Objective We compared the effects of chronic, sublethal exposure to the three most commonly used neonicotinoids on honey bee colonies established from New Zealand packaged bees using colony weight gain, brood area, and population size as measures of colony performance. Methods From May 7 to July 29, 2016 (12 weeks), sixty-eight colonies received weekly feedings of sugar syrup and pollen patties containing 0 nM, 20 nM (median environmental dose), or 80 nM (high environmental dose) of one of three neonicotinoids (thiamethoxam, clothianidin, and imidacloprid). Colonies were weighed at three-week intervals. Brood area and population size were determined from digital images of colonies at week 12. Statistical analyses were performed by ANOVA and mixed models. Results There was a significant negative effect (-30%, p<0.01) on colony weight gain (honey production) after 9 and 12 weeks of exposure to 80 nM of thiamethoxam, clothianidin, or imidacloprid and on bee cluster size (-21%, p<0.05) after 12 weeks. Analysis of brood area and number of adult bees lacked adequate (>80%) statistical power to detect an effect. Conclusions Chronic exposure of honey bees to high environmental doses of neonicotinoids has negative effects on honey production. Brood area appears to be less sensitive to detect sublethal effects of neonicotinoids. PMID:29293609

Managing honey bees (Hymenoptera: Apidae) for greenhouse tomato pollination.

PubMed

Sabara, Holly A; Winston, Mark L

2003-06-01

Although commercially reared colonies of bumble bees (Bombus sp.) are the primary pollinator world-wide for greenhouse tomatoes (Lycopersicon esculentum Mill.) previous research indicates that honey bees (Apis mellifera L.) might be a feasible alternative or supplement to bumble bee pollination. However, management methods for honey bee greenhouse tomato pollination scarcely have been explored. We 1) tested the effect of initial amounts of brood on colony population size and flight activity in screened greenhouses during the winter, and 2) compared foraging from colonies with brood used within screened and unscreened greenhouses during the summer. Brood rearing was maintained at low levels in both brood and no-brood colonies after 21 d during the winter, and emerging honey bees from both treatments had significantly lower weights than bees from outdoor colonies. Honey bee flight activity throughout the day and over the 21 d in the greenhouse was not influenced by initial brood level. In our summer experiment, brood production in screened greenhouses neared zero after 21 d but higher levels of brood were reared in unscreened greenhouses with access to outside forage. Flower visitation measured throughout the day and over the 21 d the colonies were in the greenhouse was not influenced by screening treatment. An economic analysis indicated that managing honey bees for greenhouse tomato pollination would be financially viable for both beekeepers and growers. We conclude that honey bees can be successfully managed for greenhouse tomato pollination in both screened and unscreened greenhouses if the foraging force is maintained by replacing colonies every 3 wk.

Human factors facilitating the spread of a parasitic honey bee in South Africa.

PubMed

Dietemann, Vincent; Lubbe, Annelize; Crewe, Robin M

2006-02-01

Workers of the honey bee subspecies Apis mellifera capensis (Eschscholtz) produce female offspring by thelytokous parthenogenesis and can parasitize colonies of other subspecies. In 1990, translocation of 400 colonies of A. m. capensis into the distribution area of A. m. scutellata by a commercial beekeeper triggered a dramatic parasitic phenomenon. Parasitized colonies died within a few months of infestation, and this resulted in the loss of tens of thousands of colonies by commercial beekeepers in the A. m. scutellata range in South Africa. To deal with the problem and to identify methods that would limit the impact of the social parasite, we investigated the link between beekeeping management and severity of parasitic infestations in terms of colony mortality and productivity. We demonstrate that colonies from apiaries subjected to migrations are very susceptible to infestation and consequently show dramatic mortality. Their productivity is also inferior to sedentary colonies and those in isolated apiaries in terms of honey yield and brood quantity. Furthermore, by concentrating hives in small areas and often in the vicinity of other beekeepers, cross-infestations can easily occur. This can undermine previously parasite-free beekeeping businesses. As a result of our surveys, we propose beekeeping practices based on locally trapped bees, reduced migration, and better control of parasite spread, thus promoting the conservation of these pollinators. If followed by all the South African beekeepers, these measures should limit the spread of the parasite until it is eliminated within a few years, after which full migratory beekeeping practices could resume.

[Isolation and identification of human periodontal ligament stem cells in vitro].

PubMed

Shen, Tao; Chang, Hui-jun; Jian, Cong-xiang; Yang, Yan-chun; Zhou, Ji-xiang

2011-02-01

To isolate and identify human periodontal ligament stem cells (PDLSC) by improved methods and assess the characteristics of PDLSC ex vivo. The periodontal ligament cells were obtained from the healthy impacted third molars and teeth extracted for orthodontic purposes and used to isolate PDLSC by limiting dilution assay. PDLSC were cultured and expanded in alpha-MEM supplemented with 10% FBS. Colony-forming assay, immunohistochemistry, flow cytometry, osteogenic and adipogenic induction were used to identify PDLSC. The obtained cells had high colony-forming efficiency and were positive staining for vimentin and negative for pancytokeratin. Flow cytometry revealed that the isolated cells were positive for STRO-1 and CD146 antibodies and most were in the G0/G1 phase of cell cycle. Under specific conditions, they could differentiate to the osteoblast and adipocyte lineages in vitro. Limiting dilution assay is an effective method to isolate PDLSC and the single-cell-derived colonies demonstrate the properties of stem cells in vitro.

A novel papillation assay for the identification of genes affecting mutation rate in Pseudomonas putida and other pseudomonads.

PubMed

Tagel, Mari; Tavita, Kairi; Hõrak, Rita; Kivisaar, Maia; Ilves, Heili

2016-08-01

Formation of microcolonies (papillae) permits easy visual screening of mutational events occurring in single colonies of bacteria. In this study, we have established a novel papillation assay employable in a wide range of pseudomonads including Pseudomonas aeruginosa and Pseudomonas putida for monitoring mutation frequency in distinct colonies. With the aid of this assay, we conducted a genome-wide search for the factors affecting mutation frequency in P. putida. Screening ∼27,000 transposon mutants for increased mutation frequency allowed us to identify 34 repeatedly targeted genes. In addition to genes involved in DNA replication and repair, we identified genes participating in metabolism and transport of secondary metabolites, cell motility, and cell wall synthesis. The highest effect on mutant frequency was observed when truA (tRNA pseudouridine synthase), mpl (UDP-N-acetylmuramate-alanine ligase) or gacS (multi-sensor hybrid histidine kinase) were inactivated. Inactivation of truA elevated the mutant frequency only in growing cells, while the deficiency of gacS affected mainly stationary-phase mutagenesis. Thus, our results demonstrate the feasibility of the assay for isolating mutants with elevated mutagenesis in growing as well as stationary-phase bacteria. Copyright © 2016 Elsevier B.V. All rights reserved.

Isolation and characterization of a nonpigmented variant of Porphyromonas endodontalis.

PubMed

Suzuki, K; Ikeda, T; Nakamura, H; Yoshimura, F

1997-06-01

Porphyromonas endodontalis forms dark colonies on media containing blood. We isolated, from an infected root canal, a non-black-pigmented P. endodontalis variant, KSEW01, which forms beige colonies on blood agar media. To characterize this variant, we compared its properties with those of two black-pigmented P. endodontalis strains, ATCC35406 and KSE105. Strain KSEW01 had a gelatinase activity comparable to that of the pigmented strains. Cell lysates of these three strains resolved by SDS-PAGE electrophoresis showed similar protein patterns. Quantitative DNA-DNA hybridization experiments indicated high homology between the nonpigmented strain KSEW01 and the two dark-pigmented strains. From these results, we identified strain KSEW01 as a P. endodontalis nonpigmented variant. DNA restriction endonuclease analysis indicated that the variant was closely related to a pigmented strain, KSE105. In contrast to the pigmented strains, strain KSEW01 did not degrade hemoglobin and formed no vesicles when cultured in the presence of blood. The susceptibilities of these three strains to 22 antibiotics were similar except for vancomycin. The nonpigmented variant was the most resistant to vancomycin (MIC: ATCC35406, 6.25 micrograms/ml; KSE105,12.5 micrograms/ml; KSEW01, 100 micrograms/ml). Overall, a relationship may exist between the presence of black-pigmentation and outer membrane systems of P. endodontalis.

Combining Site Occupancy, Breeding Population Sizes and Reproductive Success to Calculate Time-Averaged Reproductive Output of Different Habitat Types: An Application to Tricolored Blackbirds

PubMed Central

Holyoak, Marcel; Meese, Robert J.; Graves, Emily E.

2014-01-01

In metapopulations in which habitat patches vary in quality and occupancy it can be complicated to calculate the net time-averaged contribution to reproduction of particular populations. Surprisingly, few indices have been proposed for this purpose. We combined occupancy, abundance, frequency of occurrence, and reproductive success to determine the net value of different sites through time and applied this method to a bird of conservation concern. The Tricolored Blackbird (Agelaius tricolor) has experienced large population declines, is the most colonial songbird in North America, is largely confined to California, and breeds itinerantly in multiple habitat types. It has had chronically low reproductive success in recent years. Although young produced per nest have previously been compared across habitats, no study has simultaneously considered site occupancy and reproductive success. Combining occupancy, abundance, frequency of occurrence, reproductive success and nest failure rate we found that that large colonies in grain fields fail frequently because of nest destruction due to harvest prior to fledging. Consequently, net time-averaged reproductive output is low compared to colonies in non-native Himalayan blackberry or thistles, and native stinging nettles. Cattail marshes have intermediate reproductive output, but their reproductive output might be improved by active management. Harvest of grain-field colonies necessitates either promoting delay of harvest or creating alternative, more secure nesting habitats. Stinging nettle and marsh colonies offer the main potential sources for restoration or native habitat creation. From 2005–2011 breeding site occupancy declined 3x faster than new breeding colonies were formed, indicating a rapid decline in occupancy. Total abundance showed a similar decline. Causes of variation in the value for reproduction of nesting substrates and factors behind continuing population declines merit urgent investigation. The method we employ should be useful in other metapopulation studies for calculating time-averaged reproductive output for different sites. PMID:24817307

One-pot in situ redox synthesis of hexacyanoferrate/conductive polymer hybrids as lithium-ion battery cathodes.

PubMed

Wong, Min Hao; Zhang, Zixuan; Yang, Xianfeng; Chen, Xiaojun; Ying, Jackie Y

2015-09-14

An efficient and adaptable method is demonstrated for the synthesis of lithium hexacyanoferrate/conductive polymer hybrids for Li-ion battery cathodes. The hybrids were synthesized via a one-pot method, involving a redox-coupled reaction between pyrrole monomers and the Li3Fe(CN)6 precursor. The hybrids showed much better cyclability relative to reported Prussian Blue (PB) analogs.

Development of a Hybrid RANS/LES Method for Compressible Mixing Layer Simulations

NASA Technical Reports Server (NTRS)

Georgiadis, Nicholas J.; Alexander, J. Iwan D.; Reshotko, Eli

2001-01-01

A hybrid method has been developed for simulations of compressible turbulent mixing layers. Such mixing layers dominate the flows in exhaust systems of modem day aircraft and also those of hypersonic vehicles currently under development. The hybrid method uses a Reynolds-averaged Navier-Stokes (RANS) procedure to calculate wall bounded regions entering a mixing section, and a Large Eddy Simulation (LES) procedure to calculate the mixing dominated regions. A numerical technique was developed to enable the use of the hybrid RANS/LES method on stretched, non-Cartesian grids. The hybrid RANS/LES method is applied to a benchmark compressible mixing layer experiment. Preliminary two-dimensional calculations are used to investigate the effects of axial grid density and boundary conditions. Actual LES calculations, performed in three spatial directions, indicated an initial vortex shedding followed by rapid transition to turbulence, which is in agreement with experimental observations.

Hybrid Chaos Synchronization of Four-Scroll Systems via Active Control

NASA Astrophysics Data System (ADS)

Karthikeyan, Rajagopal; Sundarapandian, Vaidyanathan

2014-03-01

This paper investigates the hybrid chaos synchronization of identical Wang four-scroll systems (Wang, 2009), identical Liu-Chen four-scroll systems (Liu and Chen, 2004) and non-identical Wang and Liu-Chen four-scroll systems. Active control method is the method adopted to achieve the hybrid chaos synchronization of the four-scroll chaotic systems addressed in this paper and our synchronization results are established using Lyapunov stability theory. Since the Lyapunov exponents are not required for these calculations, the active control method is effective and convenient to hybrid synchronize identical and different Wang and Liu-Chen four-scroll chaotic systems. Numerical simulations are also shown to illustrate and validate the hybrid synchronization results derived in this paper.

Transformation From a Conventional Clinical Microbiology Laboratory to Full Automation.

PubMed

Moreno-Camacho, José L; Calva-Espinosa, Diana Y; Leal-Leyva, Yoseli Y; Elizalde-Olivas, Dolores C; Campos-Romero, Abraham; Alcántar-Fernández, Jonathan

2017-12-22

To validate the performance, reproducibility, and reliability of BD automated instruments in order to establish a fully automated clinical microbiology laboratory. We used control strains and clinical samples to assess the accuracy, reproducibility, and reliability of the BD Kiestra WCA, the BD Phoenix, and BD Bruker MALDI-Biotyper instruments and compared them to previously established conventional methods. The following processes were evaluated: sample inoculation and spreading, colony counts, sorting of cultures, antibiotic susceptibility test, and microbial identification. The BD Kiestra recovered single colonies in less time than conventional methods (e.g. E. coli, 7h vs 10h, respectively) and agreement between both methodologies was excellent for colony counts (κ=0.824) and sorting cultures (κ=0.821). Antibiotic susceptibility tests performed with BD Phoenix and disk diffusion demonstrated 96.3% agreement with both methods. Finally, we compared microbial identification in BD Phoenix and Bruker MALDI-Biotyper and observed perfect agreement (κ=1) and identification at a species level for control strains. Together these instruments allow us to process clinical urine samples in 36h (effective time). The BD automated technologies have improved performance compared with conventional methods, and are suitable for its implementation in very busy microbiology laboratories. © American Society for Clinical Pathology 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com

Identification of a novel interspecific hybrid yeast from a metagenomic spontaneously inoculated beer sample using Hi-C.

PubMed

Smukowski Heil, Caiti; Burton, Joshua N; Liachko, Ivan; Friedrich, Anne; Hanson, Noah A; Morris, Cody L; Schacherer, Joseph; Shendure, Jay; Thomas, James H; Dunham, Maitreya J

2018-01-01

Interspecific hybridization is a common mechanism enabling genetic diversification and adaptation; however, the detection of hybrid species has been quite difficult. The identification of microbial hybrids is made even more complicated, as most environmental microbes are resistant to culturing and must be studied in their native mixed communities. We have previously adapted the chromosome conformation capture method Hi-C to the assembly of genomes from mixed populations. Here, we show the method's application in assembling genomes directly from an uncultured, mixed population from a spontaneously inoculated beer sample. Our assembly method has enabled us to de-convolute four bacterial and four yeast genomes from this sample, including a putative yeast hybrid. Downstream isolation and analysis of this hybrid confirmed its genome to consist of Pichia membranifaciens and that of another related, but undescribed, yeast. Our work shows that Hi-C-based metagenomic methods can overcome the limitation of traditional sequencing methods in studying complex mixtures of genomes. Copyright © 2017 John Wiley & Sons, Ltd. Copyright © 2017 John Wiley & Sons, Ltd.

Artificial mismatch hybridization

DOEpatents

Guo, Zhen; Smith, Lloyd M.

1998-01-01

An improved nucleic acid hybridization process is provided which employs a modified oligonucleotide and improves the ability to discriminate a control nucleic acid target from a variant nucleic acid target containing a sequence variation. The modified probe contains at least one artificial mismatch relative to the control nucleic acid target in addition to any mismatch(es) arising from the sequence variation. The invention has direct and advantageous application to numerous existing hybridization methods, including, applications that employ, for example, the Polymerase Chain Reaction, allele-specific nucleic acid sequencing methods, and diagnostic hybridization methods.

A Hybrid Location Method for Missile Security Team Positioning

DTIC Science & Technology

2007-01-01

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission. A Hybrid Location Method for Missile Security...Bell and Weir A Hybrid Location Method for Missile Security Team Positioning Chief Master Sergeant Michael C. Dawson Air Force Logistics Management...problem oj locating security teams over a geographic area to maintain security Jor US Air Force Intercontinental Ballistic Missile Systems. A

When the lowest energy does not induce native structures: parallel minimization of multi-energy values by hybridizing searching intelligences.

PubMed

Lü, Qiang; Xia, Xiao-Yan; Chen, Rong; Miao, Da-Jun; Chen, Sha-Sha; Quan, Li-Jun; Li, Hai-Ou

2012-01-01

Protein structure prediction (PSP), which is usually modeled as a computational optimization problem, remains one of the biggest challenges in computational biology. PSP encounters two difficult obstacles: the inaccurate energy function problem and the searching problem. Even if the lowest energy has been luckily found by the searching procedure, the correct protein structures are not guaranteed to obtain. A general parallel metaheuristic approach is presented to tackle the above two problems. Multi-energy functions are employed to simultaneously guide the parallel searching threads. Searching trajectories are in fact controlled by the parameters of heuristic algorithms. The parallel approach allows the parameters to be perturbed during the searching threads are running in parallel, while each thread is searching the lowest energy value determined by an individual energy function. By hybridizing the intelligences of parallel ant colonies and Monte Carlo Metropolis search, this paper demonstrates an implementation of our parallel approach for PSP. 16 classical instances were tested to show that the parallel approach is competitive for solving PSP problem. This parallel approach combines various sources of both searching intelligences and energy functions, and thus predicts protein conformations with good quality jointly determined by all the parallel searching threads and energy functions. It provides a framework to combine different searching intelligence embedded in heuristic algorithms. It also constructs a container to hybridize different not-so-accurate objective functions which are usually derived from the domain expertise.

When the Lowest Energy Does Not Induce Native Structures: Parallel Minimization of Multi-Energy Values by Hybridizing Searching Intelligences

PubMed Central

Lü, Qiang; Xia, Xiao-Yan; Chen, Rong; Miao, Da-Jun; Chen, Sha-Sha; Quan, Li-Jun; Li, Hai-Ou

2012-01-01

Background Protein structure prediction (PSP), which is usually modeled as a computational optimization problem, remains one of the biggest challenges in computational biology. PSP encounters two difficult obstacles: the inaccurate energy function problem and the searching problem. Even if the lowest energy has been luckily found by the searching procedure, the correct protein structures are not guaranteed to obtain. Results A general parallel metaheuristic approach is presented to tackle the above two problems. Multi-energy functions are employed to simultaneously guide the parallel searching threads. Searching trajectories are in fact controlled by the parameters of heuristic algorithms. The parallel approach allows the parameters to be perturbed during the searching threads are running in parallel, while each thread is searching the lowest energy value determined by an individual energy function. By hybridizing the intelligences of parallel ant colonies and Monte Carlo Metropolis search, this paper demonstrates an implementation of our parallel approach for PSP. 16 classical instances were tested to show that the parallel approach is competitive for solving PSP problem. Conclusions This parallel approach combines various sources of both searching intelligences and energy functions, and thus predicts protein conformations with good quality jointly determined by all the parallel searching threads and energy functions. It provides a framework to combine different searching intelligence embedded in heuristic algorithms. It also constructs a container to hybridize different not-so-accurate objective functions which are usually derived from the domain expertise. PMID:23028708

Molecular ecology of the big brown bat (Eptesicus fuscus): Genetic and natural history variation in a hybrid zone

USGS Publications Warehouse

Neubaum, M.A.; Douglas, M.R.; Douglas, M.E.; O'Shea, T.J.

2007-01-01

Several geographically distinct mitochondrial DNA (mtDNA) lineages of the big brown bat (Eptesicus fuscus) have been documented in North America. Individuals from 2 of these lineages, an eastern and a western form, co-occur within maternity colonies in Colorado. The discovery of 2 divergent mtDNA lineages in sympatry prompted a set of questions regarding possible biological differences between haplotypes. We captured big brown bats at maternity roosts in Colorado and recorded data on body size, pelage color, litter size, roosting and overwintering behaviors, and local distributions. Wing biopsies were collected for genetic analysis. The ND2 region of the mtDNA molecule was used to determine lineage of the bats. In addition, nuclear DNA (nDNA) intron 1 of the ??-globin gene was used to determine if mtDNA lineages are hybridizing. Eastern and western mtDNA lineages differed by 10.3% sequence divergence and examination of genetic data suggests recent population expansion for both lineages. Differences in distribution occur along the Colorado Front Range, with an increasing proportion of western haplotypes farther south. Results from nDNA analyses demonstrated hybridization between the 2 lineages. Additionally, no outstanding distinctiveness was found between the mtDNA lineages in natural history characters examined. We speculate that historical climate changes separated this species into isolated eastern and western populations, and that secondary contact with subsequent interbreeding was facilitated by European settlement. ?? 2007 American Society of Mammalogists.

Evaluation of heterotrophic plate and chromogenic agar colony counting in water quality laboratories.

PubMed

Hallas, Gary; Monis, Paul

2015-01-01

The enumeration of bacteria using plate-based counts is a core technique used by food and water microbiology testing laboratories. However, manual counting of bacterial colonies is both time and labour intensive, can vary between operators and also requires manual entry of results into laboratory information management systems, which can be a source of data entry error. An alternative is to use automated digital colony counters, but there is a lack of peer-reviewed validation data to allow incorporation into standards. We compared the performance of digital counting technology (ProtoCOL3) against manual counting using criteria defined in internationally recognized standard methods. Digital colony counting provided a robust, standardized system suitable for adoption in a commercial testing environment. The digital technology has several advantages:•Improved measurement of uncertainty by using a standard and consistent counting methodology with less operator error.•Efficiency for labour and time (reduced cost).•Elimination of manual entry of data onto LIMS.•Faster result reporting to customers.

Nucleic acid in-situ hybridization detection of infectious agents

NASA Astrophysics Data System (ADS)

Thompson, Curtis T.

2000-04-01

Limitations of traditional culture methods and newer polymerase chain reaction (PCR)-based methods for detection and speciation of infectious agents demonstrate the need for more rapid and better diagnostics. Nucleic acid hybridization is a detection technology that has gained wide acceptance in cancer and prenatal cytogenetics. Using a modification of the nucleic acid hybridization technique known as fluorescence in-situ hybridization, infectious agents can be detected in a variety of specimens with high sensitivity and specificity. The specimens derive from all types of human and animal sources including body fluids, tissue aspirates and biopsy material. Nucleic acid hybridization can be performed in less than one hour. The result can be interpreted either using traditional fluorescence microscopy or automated platforms such as micro arrays. This paper demonstrates proof of concept for nucleic acid hybridization detection of different infectious agents. Interpretation within a cytologic and histologic context is possible with fluorescence microscopic analysis, thereby providing confirmatory evidence of hybridization. With careful probe selection, nucleic acid hybridization promises to be a highly sensitive and specific practical diagnostic alternative to culture, traditional staining methods, immunohistochemistry and complicated nucleic acid amplification tests.

Foraging flights of the white-tailed tropicbird (Phaethon lepturus): Radiotracking and doubly-labelled water

USGS Publications Warehouse

Pennycuick, C.J.; Shaffner, F.C.; Fuller, M.R.; Obrecht, H.H.; Sternberg, L.

1990-01-01

Radiotracking transmitters were fitted to White-tailed Tropicbirds nesting at Culebra, Puerto Rico. Foragers were located by light aircraft out to 89 km SSW of the nesting colony, over a deep-water foraging area south of Vieques Island, Puerto Rico and west of St Croix, U. S. Virgin Islands. Two birds were followed out to 176 km NNW from the colony, over the Puerto Rico Trench, but these did not subsequently return. Foragers carrying radio transmitters performed similarly to those without, in terms of duration of absence from the colony, and mass of food brought for the chick. However, measuremetns of energy consumption by the doubly labelled water method indicated that birds with transmitters consumed significantly more energy than those without.

An artificial bee colony algorithm for locating the critical slip surface in slope stability analysis

NASA Astrophysics Data System (ADS)

Kang, Fei; Li, Junjie; Ma, Zhenyue

2013-02-01

Determination of the critical slip surface with the minimum factor of safety of a slope is a difficult constrained global optimization problem. In this article, an artificial bee colony algorithm with a multi-slice adjustment method is proposed for locating the critical slip surfaces of soil slopes, and the Spencer method is employed to calculate the factor of safety. Six benchmark examples are presented to illustrate the reliability and efficiency of the proposed technique, and it is also compared with some well-known or recent algorithms for the problem. The results show that the new algorithm is promising in terms of accuracy and efficiency.

Conclusions on measurement uncertainty in microbiology.

PubMed

Forster, Lynne I

2009-01-01

Since its first issue in 1999, testing laboratories wishing to comply with all the requirements of ISO/IEC 17025 have been collecting data for estimating uncertainty of measurement for quantitative determinations. In the microbiological field of testing, some debate has arisen as to whether uncertainty needs to be estimated for each method performed in the laboratory for each type of sample matrix tested. Queries also arise concerning the estimation of uncertainty when plate/membrane filter colony counts are below recommended method counting range limits. A selection of water samples (with low to high contamination) was tested in replicate with the associated uncertainty of measurement being estimated from the analytical results obtained. The analyses performed on the water samples included total coliforms, fecal coliforms, fecal streptococci by membrane filtration, and heterotrophic plate counts by the pour plate technique. For those samples where plate/membrane filter colony counts were > or =20, uncertainty estimates at a 95% confidence level were very similar for the methods, being estimated as 0.13, 0.14, 0.14, and 0.12, respectively. For those samples where plate/membrane filter colony counts were <20, estimated uncertainty values for each sample showed close agreement with published confidence limits established using a Poisson distribution approach.

Colony-PCR Is a Rapid Method for DNA Amplification of Hyphomycetes

PubMed Central

Walch, Georg; Knapp, Maria; Rainer, Georg; Peintner, Ursula

2016-01-01

Fungal pure cultures identified with both classical morphological methods and through barcoding sequences are a basic requirement for reliable reference sequences in public databases. Improved techniques for an accelerated DNA barcode reference library construction will result in considerably improved sequence databases covering a wider taxonomic range. Fast, cheap, and reliable methods for obtaining DNA sequences from fungal isolates are, therefore, a valuable tool for the scientific community. Direct colony PCR was already successfully established for yeasts, but has not been evaluated for a wide range of anamorphic soil fungi up to now, and a direct amplification protocol for hyphomycetes without tissue pre-treatment has not been published so far. Here, we present a colony PCR technique directly from fungal hyphae without previous DNA extraction or other prior manipulation. Seven hundred eighty-eight fungal strains from 48 genera were tested with a success rate of 86%. PCR success varied considerably: DNA of fungi belonging to the genera Cladosporium, Geomyces, Fusarium, and Mortierella could be amplified with high success. DNA of soil-borne yeasts was always successfully amplified. Absidia, Mucor, Trichoderma, and Penicillium isolates had noticeably lower PCR success. PMID:29376929

Developmental insights from early mammalian embryos and core signaling pathways that influence human pluripotent cell growth and differentiation.

PubMed

Chen, Kevin G; Mallon, Barbara S; Johnson, Kory R; Hamilton, Rebecca S; McKay, Ronald D G; Robey, Pamela G

2014-05-01

Human pluripotent stem cells (hPSCs) have two potentially attractive applications: cell replacement-based therapies and drug discovery. Both require the efficient generation of large quantities of clinical-grade stem cells that are free from harmful genomic alterations. The currently employed colony-type culture methods often result in low cell yields, unavoidably heterogeneous cell populations, and substantial chromosomal abnormalities. Here, we shed light on the structural relationship between hPSC colonies/embryoid bodies and early-stage embryos in order to optimize current culture methods based on the insights from developmental biology. We further highlight core signaling pathways that underlie multiple epithelial-to-mesenchymal transitions (EMTs), cellular heterogeneity, and chromosomal instability in hPSCs. We also analyze emerging methods such as non-colony type monolayer (NCM) and suspension culture, which provide alternative growth models for hPSC expansion and differentiation. Furthermore, based on the influence of cell-cell interactions and signaling pathways, we propose concepts, strategies, and solutions for production of clinical-grade hPSCs, stem cell precursors, and miniorganoids, which are pivotal steps needed for future clinical applications. Published by Elsevier B.V.

A stereo remote sensing feature selection method based on artificial bee colony algorithm

NASA Astrophysics Data System (ADS)

Yan, Yiming; Liu, Pigang; Zhang, Ye; Su, Nan; Tian, Shu; Gao, Fengjiao; Shen, Yi

2014-05-01

To improve the efficiency of stereo information for remote sensing classification, a stereo remote sensing feature selection method is proposed in this paper presents, which is based on artificial bee colony algorithm. Remote sensing stereo information could be described by digital surface model (DSM) and optical image, which contain information of the three-dimensional structure and optical characteristics, respectively. Firstly, three-dimensional structure characteristic could be analyzed by 3D-Zernike descriptors (3DZD). However, different parameters of 3DZD could descript different complexity of three-dimensional structure, and it needs to be better optimized selected for various objects on the ground. Secondly, features for representing optical characteristic also need to be optimized. If not properly handled, when a stereo feature vector composed of 3DZD and image features, that would be a lot of redundant information, and the redundant information may not improve the classification accuracy, even cause adverse effects. To reduce information redundancy while maintaining or improving the classification accuracy, an optimized frame for this stereo feature selection problem is created, and artificial bee colony algorithm is introduced for solving this optimization problem. Experimental results show that the proposed method can effectively improve the computational efficiency, improve the classification accuracy.

Application of Hybrid Along-Track Interferometry/Displaced Phase Center Antenna Method for Moving Human Target Detection in Forest Environments

DTIC Science & Technology

2016-10-01

ARL-TR-7846 ● OCT 2016 US Army Research Laboratory Application of Hybrid Along-Track Interferometry/ Displaced Phase Center...Research Laboratory Application of Hybrid Along-Track Interferometry/ Displaced Phase Center Antenna Method for Moving Human Target Detection...TYPE Technical Report 3. DATES COVERED (From - To) 2015–2016 4. TITLE AND SUBTITLE Application of Hybrid Along-Track Interferometry/ Displaced

Environmentally friendly ultrosound synthesis and antibacterial activity of cellulose/Ag/AgCl hybrids.

PubMed

Dong, Yan-Yan; Deng, Fu; Zhao, Jin-Jin; He, Jing; Ma, Ming-Guo; Xu, Feng; Sun, Run-Cang

2014-01-01

This study aims to investigate the fabrication and property of cellulose/Ag/AgCl hybrids. In this article, preparation of cellulose/Ag/AgCl hybrids was reported using the cellulose solution, AgNO₃, AlCl₃·6H₂O with ultrasound agitation method. The cellulose solution was synthesized by the dissolution of the microcrystalline cellulose in NaOH/urea aqueous solution. Influences of the experimental parameters of ultrasound treatment time and ultrasonic intermittent on the hybrids were investigated. The phase, microstructure, thermal stability, and morphology of the hybrids were characterized by X-ray powder diffraction (XRD), Fourier transform infrared (FTIR) spectrometry, thermogravimetric analysis (TGA), differential thermal analysis (DTA), and scanning electron microscopy (SEM). Results showed the successful synthesis of cellulose/Ag/AgCl hybrids with good thermal stability. Moreover, the hybrids displayed desirable antimicrobial activities. Compared with other conventional methods, the rapid, green, and environmentally friendly ultrasound agitation method opens a new window to the high value-added applications of biomass. Copyright © 2013 Elsevier Ltd. All rights reserved.

Effect of antibacterial dental adhesive on multispecies biofilms formation.

PubMed

Zhang, K; Wang, S; Zhou, X; Xu, H H K; Weir, M D; Ge, Y; Li, M; Wang, S; Li, Y; Xu, X; Zheng, L; Cheng, L

2015-04-01

Antibacterial adhesives have favorable prospects to inhibit biofilms and secondary caries. The objectives of this study were to investigate the antibacterial effect of dental adhesives containing dimethylaminododecyl methacrylate (DMADDM) on different bacteria in controlled multispecies biofilms and its regulating effect on development of biofilm for the first time. Antibacterial material was synthesized, and Streptococcus mutans, Streptococcus gordonii, and Streptococcus sanguinis were chosen to form multispecies biofilms. Lactic acid assay and pH measurement were conducted to study the acid production of controlled multispecies biofilms. Anthrone method and exopolysaccharide (EPS):bacteria volume ratio measured by confocal laser scanning microscopy were performed to determine the EPS production of biofilms. The colony-forming unit counts, scanning electron microscope imaging, and dead:live volume ratio decided by confocal laser scanning microscopy were used to study the biomass change of controlled multispecies biofilms. The TaqMan real-time polymerase chain reaction and fluorescent in situ hybridization imaging were used to study the proportion change in multispecies biofilms of different groups. The results showed that DMADDM-containing adhesive groups slowed the pH drop and decreased the lactic acid production noticeably, especially lactic acid production in the 5% DMADDM group, which decreased 10- to 30-fold compared with control group (P < 0.05). EPS was reduced significantly in 5% DMADDM group (P < 0.05). The DMADDM groups reduced the colony-forming unit counts significantly (P < 0.05) and had higher dead:live volume ratio in biofilms compared with control group (P < 0.05). The proportion of S. mutans decreased steadily in DMADDM-containing groups and continually increased in control group, and the biofilm had a more healthy development tendency after the regulation of DMADDM. In conclusion, the adhesives containing DMADDM had remarkable antimicrobial properties to serve as "bioactive" adhesive materials and revealed its potential value for antibiofilm and anticaries clinical applications. © International & American Associations for Dental Research 2015.

The Probability of a Gene Tree Topology within a Phylogenetic Network with Applications to Hybridization Detection

PubMed Central

Yu, Yun; Degnan, James H.; Nakhleh, Luay

2012-01-01

Gene tree topologies have proven a powerful data source for various tasks, including species tree inference and species delimitation. Consequently, methods for computing probabilities of gene trees within species trees have been developed and widely used in probabilistic inference frameworks. All these methods assume an underlying multispecies coalescent model. However, when reticulate evolutionary events such as hybridization occur, these methods are inadequate, as they do not account for such events. Methods that account for both hybridization and deep coalescence in computing the probability of a gene tree topology currently exist for very limited cases. However, no such methods exist for general cases, owing primarily to the fact that it is currently unknown how to compute the probability of a gene tree topology within the branches of a phylogenetic network. Here we present a novel method for computing the probability of gene tree topologies on phylogenetic networks and demonstrate its application to the inference of hybridization in the presence of incomplete lineage sorting. We reanalyze a Saccharomyces species data set for which multiple analyses had converged on a species tree candidate. Using our method, though, we show that an evolutionary hypothesis involving hybridization in this group has better support than one of strict divergence. A similar reanalysis on a group of three Drosophila species shows that the data is consistent with hybridization. Further, using extensive simulation studies, we demonstrate the power of gene tree topologies at obtaining accurate estimates of branch lengths and hybridization probabilities of a given phylogenetic network. Finally, we discuss identifiability issues with detecting hybridization, particularly in cases that involve extinction or incomplete sampling of taxa. PMID:22536161

Production of Multiple Growth Factors by a Newly Established Human Thyroid Carcinoma Cell Line

PubMed Central

Yoshida, Yataro; Ohashi, Kensaku; Sano, Emiko; Kobayashi, Hisataka; Endo, Keigo; Naruto, Masanobu; Nakamura, Toru

1992-01-01

A multiple growth factor‐producing tumor cell line (NIM‐1) was newly established from a patient with thyroid cancer and remarkable neutrophilia. NIM‐1 cells also caused severe neutrophilia in nude mice bearing tumors. NIM‐1‐conditioned medium (NIM‐1CM) contained activities that supported not only granulocyte, macrophage and eosinophil colony formation of human bone marrow cells but also the growth of colony‐stimulating factor (CSF)‐dependent cell lines, NFS60‐KX and TF‐1. Northern blot hybridization analysis revealed the constitutive expression of granulocyte‐CSF (G‐CSF), granulocyte/macrophage‐CSF (GM‐CSF) and interleukin(IL)‐6 mRNAs in NIM‐1 cells. Enzyme‐linked immunosorbent assays (ELISA) using NIM‐1CM also confirmed the production of IL‐la and a small amount of IL‐1β besides G‐CSF, GM‐CSF and IL‐6 in NIM‐1 cells. In addition, unexpected production of IL‐11 in NIM‐1 cells was detected by northern blot hybridization analysis and by bioassay using an IL‐11‐dependent cell line. Therefore, NIM‐1 cell line is shown to produce multiple cytokines including potentially megakaryopoietic growth factors such as GM‐CSF, IL‐6 and IL‐11. PMID:1372885

DNA homology and immunological cross-reactivity between Aeromonas hydrophila cytotonic toxin and cholera toxin.

PubMed Central

Schultz, A J; McCardell, B A

1988-01-01

DNA colony hybridization with three 18- to 20-base-long synthetic oligonucleotide probes for cholera toxin (CT) was used to screen 12 clinical isolates of Aeromonas hydrophila. Under stringent hybridizing (overnight at 40 degrees C) and washing (1 h at 50 degrees C) conditions, nine strains reacted with the 32P-labeled CT probes. Concentrated (10x) cell-free supernatants or lysates from eight cultures, heated at 56 degrees C for 20 min, produced cytotonic effects in Y-1 mouse adrenal cells and Chinese hamster ovary (CHO) cells and caused a 1.5- to 22-fold increase in production of cyclic AMP in CHO cells. Preincubation with anti-CT reduced the CHO cell titer of cell lysates by 10-fold. In the GM1 ganglioside enzyme-linked immunosorbent assay, heated supernatants and lysates gave readings equivalent to 3.5 to 100 ng of CT. Three proteins with molecular weights of 89,900, 37,000, and 11,000 reacted with anti-CT on immunoblots of cell lysates from sodium dodecyl sulfate-polyacrylamide gels. These results suggest that there is DNA homology and immunological cross-reactivity between CT and the A. hydrophila cytotonic toxin. Images PMID:2830300

Organization of the capsule biosynthesis gene locus of the oral streptococcus Streptococcus anginosus.

PubMed

Tsunashima, Hiroyuki; Miyake, Katsuhide; Motono, Makoto; Iijima, Shinji

2012-03-01

The capsular polysaccharide (CPS) of the important oral streptococcus Streptococcus anginosus, which causes endocarditis, and the genes for its synthesis have not been clarified. In this study, we investigated the gene locus required for CPS synthesis in S. anginosus. Southern hybridization using the cpsE gene of the well-characterized bacterium S. agalactiae revealed that there is a similar gene in the genome of S. anginosus. By using the colony hybridization technique and inverse PCR, we isolated the CPS synthesis (cps) genes of S. anginosus. This gene cluster consisted of genes containing typical regulatory genes, cpsA-D, and glycosyltransferase genes coding for glucose, rhamnose, N-acetylgalactosamine, and galactofuranose transferases. Furthermore, we confirmed that the cps locus is required for CPS synthesis using a mutant strain with a defective cpsE gene. The cps cluster was found to be located downstream the nrdG gene, which encodes ribonucleoside triphosphate reductase activator, as is the case in other oral streptococci such as S. gordonii and S. sanguinis. However, the location of the gene cluster was different from those of S. pneumonia and S. agalactiae. Copyright © 2011 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

Agar Underlay Method for Recovery of Sublethally Heat-Injured Bacteria

PubMed Central

Kang, D. H.; Siragusa, G. R.

1999-01-01

A method of recovering sublethally heat-injured bacteria was developed. The procedure (termed the agar underlay method) uses a nonselective agar underlaid with a selective medium. In a two-chambered petri dish, the Lutri plate (LP), a nonselective agar is inoculated with a population of sublethally heat-injured bacteria. After a 2-h repair incubation period, selective agar is added to the bottom chamber of the LP and incubated. By diffusing through the nonselective top agar, selective agents from the underlay medium impart selectivity to the system. By the agar underlay method, recovery rates of the heat-injured food-borne pathogens Escherichia coli O157:H7 and Salmonella typhimurium were not different (P > 0.05) from recovery rates determined with nonselective media. Sublethally heat-injured cells (60°C for 1.5 min in buffer or 80°C for 30 s on meat surfaces) grew and produced a typical colony morphology and color reaction when the agar underlay procedure was used with the appropriate respective selective agars. Unlike agar overlay methods for injury repair, the agar underlay procedure allows the typical selective-medium colony morphology to develop and allows colonies to be more easily picked for further characterization. Higher recovery rates of heat-injured fecal enterococci from bovine fecal samples and total coliforms from animal waste lagoons were obtained by the agar underlay method with selective agars than by direct plating on the respective selective media. PMID:10583985

Ascorbic acid augments colony spreading by reducing biofilm formation of methicillin-resistant Staphylococcus aureus.

PubMed

Ali Mirani, Zulfiqar; Khan, Muhammad Naseem; Siddiqui, Anila; Khan, Fouzia; Aziz, Mubashir; Naz, Shagufta; Ahmed, Ayaz; Khan, Seema Ismat

2018-02-01

Staphylococcus aureus is a Gram-positive pathogen, well known for its resistance and versatile lifestyle. Under unfavourable conditions, it adapts biofilm mode of growth. For staphylococcal biofilm formation, production of extracellular polymeric substances (EPS) is a pre-requisite, which is regulated by ica operon-encoded enzymes. This study was designed to know the impact of ascorbic acid on biofilm formation and colony spreading processes of S. aureus and MRSA. The isolates of methicillin-resistant S. aureus (MRSA) used in present study, were recovered from different food samples. Various selective and differential media were used for identification and confirmation of S. aureus . Agar dilution method was used for determination of oxacillin and ascorbic acid resistance level. MRSA isolates were re-confirmed by E-test and by amplification of mecA gene. Tube methods and Congo-Red agar were used to study biofilm formation processes. Gene expression studies were carried on real-time reverse transcriptase-polymerase chain reaction (RT-PCR). The results revealed the presence of mecA gene belonging to SCC mecA type IV along with agr type II in the isolates. In vitro studies showed the sub-inhibitory concentration of oxacillin induced biofilm production. However, addition of sub-inhibitory dose of ascorbic acid was found to inhibit EPS production, biofilm formation and augment colony spreading on soft agar plates. The inhibition of biofilm formation and augmentation of colony spreading observed with ascorbic acid alone or in combination with oxacillin. Moreover, gene expression studies showed that ascorbic acid increases agr expression and decreases icaA gene expression. The present study concluded that ascorbic acid inhibits biofilm formation, promotes colony spreading and increases agr gene expression in MRSA.

Development of a user-friendly delivery method for the fungus Metarhizium anisopliae to control the ectoparasitic mite Varroa destructor in honey bee, Apis mellifera, colonies.

PubMed

Kanga, Lambert H B; Adamczyk, John; Patt, Joseph; Gracia, Carlos; Cascino, John

2010-12-01

A user-friendly method to deliver Metarhizium spores to honey bee colonies for control of Varroa mites was developed and tested. Patty blend formulations protected the fungal spores at brood nest temperatures and served as an improved delivery system of the fungus to bee hives. Field trials conducted in 2006 in Texas using freshly harvested spores indicated that patty blend formulations of 10 g of conidia per hive (applied twice) significantly reduced the numbers of mites per adult bee, mites in sealed brood cells, and residual mites at the end of the 47-day experimental period. Colony development in terms of adult bee populations and brood production also improved. Field trials conducted in 2007 in Florida using less virulent spores produced mixed results. Patty blends of 10 g of conidia per hive (applied twice) were less successful in significantly reducing the number of mites per adult bee. However, hive survivorship and colony strength were improved, and the numbers of residual mites were significantly reduced at the end of the 42-day experimental period. The overall results from 2003 to 2008 field trials indicated that it was critical to have fungal spores with good germination, pathogenicity and virulence. We determined that fungal spores (1 × 10(10) viable spores per gram) with 98% germination and high pathogenicity (95% mite mortality at day 7) provided successful control of mite populations in established honey bee colonies at 10 g of conidia per hive (applied twice). Overall, microbial control of Varroa mite with M. anisopliae is feasible and could be a useful component of an integrated pest management program.

Comparison of Inoculation with the InoqulA and WASP Automated Systems with Manual Inoculation

PubMed Central

Croxatto, Antony; Dijkstra, Klaas; Prod'hom, Guy

2015-01-01

The quality of sample inoculation is critical for achieving an optimal yield of discrete colonies in both monomicrobial and polymicrobial samples to perform identification and antibiotic susceptibility testing. Consequently, we compared the performance between the InoqulA (BD Kiestra), the WASP (Copan), and manual inoculation methods. Defined mono- and polymicrobial samples of 4 bacterial species and cloudy urine specimens were inoculated on chromogenic agar by the InoqulA, the WASP, and manual methods. Images taken with ImagA (BD Kiestra) were analyzed with the VisionLab version 3.43 image analysis software to assess the quality of growth and to prevent subjective interpretation of the data. A 3- to 10-fold higher yield of discrete colonies was observed following automated inoculation with both the InoqulA and WASP systems than that with manual inoculation. The difference in performance between automated and manual inoculation was mainly observed at concentrations of >106 bacteria/ml. Inoculation with the InoqulA system allowed us to obtain significantly more discrete colonies than the WASP system at concentrations of >107 bacteria/ml. However, the level of difference observed was bacterial species dependent. Discrete colonies of bacteria present in 100- to 1,000-fold lower concentrations than the most concentrated populations in defined polymicrobial samples were not reproducibly recovered, even with the automated systems. The analysis of cloudy urine specimens showed that InoqulA inoculation provided a statistically significantly higher number of discrete colonies than that with WASP and manual inoculation. Consequently, the automated InoqulA inoculation greatly decreased the requirement for bacterial subculture and thus resulted in a significant reduction in the time to results, laboratory workload, and laboratory costs. PMID:25972424

Hybrid Learning in Enhancing Communicative Skill in English

ERIC Educational Resources Information Center

Singaravelu, G.

2010-01-01

The present study highlights the effectiveness of Hybrid-Learning in enhancing communicative skill in English among the Trainees of Bachelor of education of School of Distance Education, Bharathiar University,Coimbatore. Hybrid learning refers to mixing of different learning methods or mixing two more methods for teaching learning process. It…

Planting of neonicotinoid-coated corn raises honey bee mortality and sets back colony development.

PubMed

Samson-Robert, Olivier; Labrie, Geneviève; Chagnon, Madeleine; Fournier, Valérie

2017-01-01

Worldwide occurrences of honey bee colony losses have raised concerns about bee health and the sustainability of pollination-dependent crops. While multiple causal factors have been identified, seed coating with insecticides of the neonicotinoid family has been the focus of much discussion and research. Nonetheless, few studies have investigated the impacts of these insecticides under field conditions or in commercial beekeeping operations. Given that corn-seed coating constitutes the largest single use of neonicotinoid, our study compared honey bee mortality from commercial apiaries located in two different agricultural settings, i.e. corn-dominated areas and corn-free environments, during the corn planting season. Data was collected in 2012 and 2013 from 26 bee yards. Dead honey bees from five hives in each apiary were counted and collected, and samples were analyzed using a multi-residue LC-MS/MS method. Long-term effects on colony development were simulated based on a honey bee population dynamic model. Mortality survey showed that colonies located in a corn-dominated area had daily mortality counts 3.51 times those of colonies from corn crop-free sites. Chemical analyses revealed that honey bees were exposed to various agricultural pesticides during the corn planting season, but were primarily subjected to neonicotinoid compounds (54% of analysed samples contained clothianidin, and 31% contained both clothianidin and thiamethoxam). Performance development simulations performed on hive populations' show that increased mortality during the corn planting season sets back colony development and bears contributions to collapse risk but, most of all, reduces the effectiveness and value of colonies for pollination services. Our results also have implications for the numerous large-scale and worldwide-cultivated crops that currently rely on pre-emptive use of neonicotinoid seed treatments.

Emperors in hiding: when ice-breakers and satellites complement each other in Antarctic exploration.

PubMed

Ancel, André; Cristofari, Robin; Fretwell, Peter T; Trathan, Phil N; Wienecke, Barbara; Boureau, Matthieu; Morinay, Jennifer; Blanc, Stéphane; Le Maho, Yvon; Le Bohec, Céline

2014-01-01

Evaluating the demographic trends of marine top predators is critical to understanding the processes involved in the ongoing rapid changes in Antarctic ecosystems. However, the remoteness and logistical complexity of operating in Antarctica, especially during winter, make such an assessment difficult. Satellite imaging is increasingly recognised as a valuable method for remote animal population monitoring, yet its accuracy and reliability are still to be fully evaluated. We report here the first ground visit of an emperor penguin colony first discovered by satellite, but also the discovery of a second one not indicated by satellite survey at that time. Several successive remote surveys in this coastal region of East Antarctica, both before and after sudden local changes, had indeed only identified one colony. These two colonies (with a total of ca. 7,400 breeding pairs) are located near the Mertz Glacier in an area that underwent tremendous habitat change after the glacier tongue broke off in February 2010. Our findings therefore suggest that a satellite survey, although offering a major advance since it allows a global imaging of emperor penguin colonies, may miss certain colony locations when challenged by certain features of polar ecosystems, such as snow cover, evolving ice topology, and rapidly changing habitat. Moreover our survey shows that this large seabird has considerable potential for rapid adaptation to sudden habitat loss, as the colony detected in 2009 may have moved and settled on new breeding grounds. Overall, the ability of emperor penguin colonies to relocate following habitat modification underlines the continued need for a mix of remote sensing and field surveys (aerial photography and ground counts), especially in the less-frequented parts of Antarctica, to gain reliable knowledge about the population demography and dynamics of this flagship species of the Antarctic ecosystem.

Estimating relative decline in populations of subterranean termites (Isoptera: Rhinotermitidae) due to baiting.

PubMed

Evans, T A

2001-12-01

Although mark-recapture protocols produce inaccurate population estimates of termite colonies, they might be employed to estimate a relative change in colony size. This possibility was tested using two Australian, mound-building, wood-eating, subterranean Coptotermes species. Three different toxicants delivered in baits were used to decrease (but not eliminate) colony size, and a single mark-recapture protocol was used to estimate pre- and postbaiting population sizes. For both species, the numbers of termites retrieved from bait stations varied widely, resulting in no significant differences in the numbers of termites sampled between treatments in either the pre- or postbaiting protocols. There were significantly fewer termites sampled in all treatments, controls included, in the postbaiting protocol compared with the pre-, suggesting a seasonal change in forager numbers. The comparison of population estimates shows a large decrease in toxicant treated colonies compared with little change in control colonies, which suggests that estimating the relative decline in population size using mark-recapture protocols might to be possible. However, the change in population estimate was due entirely to the significantly lower recapture rate in the control colonies relative to the toxicant treated colonies, as numbers of unmarked termites did not change between treatments. The population estimates should be treated with caution because low recapture rates produce dubious population estimates and, in some cases, postbaiting mark-recapture population estimates could be much greater than those at prebaiting, despite consumption of bait in sufficient quantities to cause population decline. A possible interaction between fat-stain markers and toxicants should be investigated if mark-recapture population estimates are used. Alternative methods of population change are advised, along with other indirect measures.

Winter honey bee colony losses, Varroa destructor control strategies, and the role of weather conditions: Results from a survey among beekeepers.

PubMed

Beyer, Marco; Junk, Jürgen; Eickermann, Michael; Clermont, Antoine; Kraus, François; Georges, Carlo; Reichart, Andreas; Hoffmann, Lucien

2018-06-01

Sets of treatments that were applied against varroa mites in the Luxembourgish beekeeper community were surveyed annually with a questionnaire between the winters 2010/11 and 2014/15. The average temperature and the precipitation sum of the month, when the respective varroa control method was applied were considered as co-variables when evaluating the efficacy of varroa control regimes. Success or failure of control regimes was evaluated based on the percentage of colonies lost per apiary in the winter following the treatment(s). Neither a positive nor a negative effect of formic acid (concentration 60%, w/v) on the colony losses could be found, irrespective of the weather conditions around the time of application. The higher concentration of 85% formic acid was linked with reduced colony losses when applications were done in August. Colony losses were reduced when Thymovar was applied in July or August, but applications in September were associated with increased losses compared with apiaries not treated with Thymovar during the same period. Apilife application in July as well as Apivar applications between July and September were associated with reduced colony losses. The removal of the drone brood and trickled oxalic acid application had beneficial effects when being done in April and December, respectively. Relatively warm (3.0±1.3°C) and wet (507.0±38.6mm/2months) conditions during the winter months December and January and relatively cool (17.2±1.4°C average monthly temperature) and wet (110.8±55.5mm/month) conditions in July were associated with elevated honey bee colony losses. Copyright © 2018 Elsevier Ltd. All rights reserved.

Emperors in Hiding: When Ice-Breakers and Satellites Complement Each Other in Antarctic Exploration

PubMed Central

Ancel, André; Cristofari, Robin; Fretwell, Peter T.; Trathan, Phil N.; Wienecke, Barbara; Boureau, Matthieu; Morinay, Jennifer; Blanc, Stéphane; Le Maho, Yvon; Le Bohec, Céline

2014-01-01

Evaluating the demographic trends of marine top predators is critical to understanding the processes involved in the ongoing rapid changes in Antarctic ecosystems. However, the remoteness and logistical complexity of operating in Antarctica, especially during winter, make such an assessment difficult. Satellite imaging is increasingly recognised as a valuable method for remote animal population monitoring, yet its accuracy and reliability are still to be fully evaluated. We report here the first ground visit of an emperor penguin colony first discovered by satellite, but also the discovery of a second one not indicated by satellite survey at that time. Several successive remote surveys in this coastal region of East Antarctica, both before and after sudden local changes, had indeed only identified one colony. These two colonies (with a total of ca. 7,400 breeding pairs) are located near the Mertz Glacier in an area that underwent tremendous habitat change after the glacier tongue broke off in February 2010. Our findings therefore suggest that a satellite survey, although offering a major advance since it allows a global imaging of emperor penguin colonies, may miss certain colony locations when challenged by certain features of polar ecosystems, such as snow cover, evolving ice topology, and rapidly changing habitat. Moreover our survey shows that this large seabird has considerable potential for rapid adaptation to sudden habitat loss, as the colony detected in 2009 may have moved and settled on new breeding grounds. Overall, the ability of emperor penguin colonies to relocate following habitat modification underlines the continued need for a mix of remote sensing and field surveys (aerial photography and ground counts), especially in the less-frequented parts of Antarctica, to gain reliable knowledge about the population demography and dynamics of this flagship species of the Antarctic ecosystem. PMID:24963661

Colony impact of pesticide-induced sublethal effects on honeybee workers: A simulation study using BEEHAVE.

PubMed

Thorbek, Pernille; Campbell, Peter J; Thompson, Helen M

2017-03-01

Research on neonicotinoids and honeybees have changed focus from direct mortality to sublethal effects. In the present study, a published honeybee model, BEEHAVE, is used to compare induced colony level impact of pesticides including direct mortality, poor brood care, disorientation, and increased handling time in oilseed rape and sunflower crops. Actual effects on individual bees will depend on exposure concentrations, but in the present study large effects were enforced. In oilseed rape, poor brood care had the largest colony impact, because it created a bottleneck for spring build-up of the workforce, and colony impact for all effect types peaked 1 mo after exposure ceased. In sunflower, the later exposure changed the response so colony impact peaked during exposure, and the bottleneck was honey store build-up. In all scenarios, good forage mitigated effects substantially. It is concluded that field studies should continue at least 1 mo after exposure to ensure detection of ecologically relevant sublethal effects. The results indicated that even if a sublethal effect is difficult to detect in the field, subsequent ecologically relevant colony level impacts would be clear if studies are continued for 1 mo after exposure. Guidance for regulatory studies recommends extended observation periods, and published field studies already use extended observation periods, so it is concluded that current methods are adequate for detecting ecologically relevant sublethal effects. Although published laboratory and semifield studies conducted under controlled exposure conditions suggest that sublethal effects may occur, published field studies with neonicotinoid seed treatments, naturally foraging bees, and extended observation periods do not report colony-level effects, suggesting that in these studies no ecologically relevant sublethal effects occurred. Environ Toxicol Chem 2017;36:831-840. © 2016 SETAC. © 2016 SETAC.

Planting of neonicotinoid-coated corn raises honey bee mortality and sets back colony development

PubMed Central

Samson-Robert, Olivier; Labrie, Geneviève; Chagnon, Madeleine

2017-01-01

Worldwide occurrences of honey bee colony losses have raised concerns about bee health and the sustainability of pollination-dependent crops. While multiple causal factors have been identified, seed coating with insecticides of the neonicotinoid family has been the focus of much discussion and research. Nonetheless, few studies have investigated the impacts of these insecticides under field conditions or in commercial beekeeping operations. Given that corn-seed coating constitutes the largest single use of neonicotinoid, our study compared honey bee mortality from commercial apiaries located in two different agricultural settings, i.e. corn-dominated areas and corn-free environments, during the corn planting season. Data was collected in 2012 and 2013 from 26 bee yards. Dead honey bees from five hives in each apiary were counted and collected, and samples were analyzed using a multi-residue LC-MS/MS method. Long-term effects on colony development were simulated based on a honey bee population dynamic model. Mortality survey showed that colonies located in a corn-dominated area had daily mortality counts 3.51 times those of colonies from corn crop-free sites. Chemical analyses revealed that honey bees were exposed to various agricultural pesticides during the corn planting season, but were primarily subjected to neonicotinoid compounds (54% of analysed samples contained clothianidin, and 31% contained both clothianidin and thiamethoxam). Performance development simulations performed on hive populations’ show that increased mortality during the corn planting season sets back colony development and bears contributions to collapse risk but, most of all, reduces the effectiveness and value of colonies for pollination services. Our results also have implications for the numerous large-scale and worldwide-cultivated crops that currently rely on pre-emptive use of neonicotinoid seed treatments. PMID:28828265

The neglected bee trees: European beech forests as a home for feral honey bee colonies

PubMed Central

2018-01-01

It is a common belief that feral honey bee colonies (Apis mellifera L.) were eradicated in Europe through the loss of habitats, domestication by man and spread of pathogens and parasites. Interestingly, no scientific data are available, neither about the past nor the present status of naturally nesting honeybee colonies. We expected near-natural beech (Fagus sylvatica L.) forests to provide enough suitable nest sites to be a home for feral honey bee colonies in Europe. Here, we made a first assessment of their occurrence and density in two German woodland areas based on two methods, the tracing of nest sites based on forager flight routes (beelining technique), and the direct inspection of potential cavity trees. Further, we established experimental swarms at forest edges and decoded dances for nest sites performed by scout bees in order to study how far swarms from beekeeper-managed hives would potentially move into a forest. We found that feral honey bee colonies regularly inhabit tree cavities in near-natural beech forests at densities of at least 0.11–0.14 colonies/km2. Colonies were not confined to the forest edges; they were also living deep inside the forests. We estimated a median distance of 2,600 m from the bee trees to the next apiaries, while scout bees in experimental swarms communicated nest sites in close distances (median: 470 m). We extrapolate that there are several thousand feral honey bee colonies in German woodlands. These have to be taken in account when assessing the role of forest areas in providing pollination services to the surrounding land, and their occurrence has implications for the species’ perception among researchers, beekeepers and conservationists. This study provides a starting point for investigating the life-histories and the ecological interactions of honey bees in temperate European forest environments. PMID:29637025

The neglected bee trees: European beech forests as a home for feral honey bee colonies.

PubMed

Kohl, Patrick Laurenz; Rutschmann, Benjamin

2018-01-01

It is a common belief that feral honey bee colonies ( Apis mellifera L.) were eradicated in Europe through the loss of habitats, domestication by man and spread of pathogens and parasites. Interestingly, no scientific data are available, neither about the past nor the present status of naturally nesting honeybee colonies. We expected near-natural beech ( Fagus sylvatica L.) forests to provide enough suitable nest sites to be a home for feral honey bee colonies in Europe. Here, we made a first assessment of their occurrence and density in two German woodland areas based on two methods, the tracing of nest sites based on forager flight routes (beelining technique), and the direct inspection of potential cavity trees. Further, we established experimental swarms at forest edges and decoded dances for nest sites performed by scout bees in order to study how far swarms from beekeeper-managed hives would potentially move into a forest. We found that feral honey bee colonies regularly inhabit tree cavities in near-natural beech forests at densities of at least 0.11-0.14 colonies/km 2 . Colonies were not confined to the forest edges; they were also living deep inside the forests. We estimated a median distance of 2,600 m from the bee trees to the next apiaries, while scout bees in experimental swarms communicated nest sites in close distances (median: 470 m). We extrapolate that there are several thousand feral honey bee colonies in German woodlands. These have to be taken in account when assessing the role of forest areas in providing pollination services to the surrounding land, and their occurrence has implications for the species' perception among researchers, beekeepers and conservationists. This study provides a starting point for investigating the life-histories and the ecological interactions of honey bees in temperate European forest environments.

Evaluation of radio-tracking and strip transect methods for determining foraging ranges of Black-Legged Kittiwakes

USGS Publications Warehouse

Ostrand, William D.; Drew, G.S.; Suryan, R.M.; McDonald, L.L.

1998-01-01

We compared strip transect and radio-tracking methods of determining foraging range of Black-legged Kittiwakes (Rissa tridactyla). The mean distance birds were observed from their colony determined by radio-tracking was significantly greater than the mean value calculated from strip transects. We determined that this difference was due to two sources of bias: (1) as distance from the colony increased, the area of available habitat also increased resulting in decreasing bird densities (bird spreading). Consequently, the probability of detecting birds during transect surveys also would decrease as distance from the colony increased, and (2) the maximum distance birds were observed from the colony during radio-tracking exceeded the extent of the strip transect survey. We compared the observed number of birds seen on the strip transect survey to the predictions of a model of the decreasing probability of detection due to bird spreading. Strip transect data were significantly different from modeled data; however, the field data were consistently equal to or below the model predictions, indicating a general conformity to the concept of declining detection at increasing distance. We conclude that radio-tracking data gave a more representative indication of foraging distances than did strip transect sampling. Previous studies of seabirds that have used strip transect sampling without accounting for bird spreading or the effects of study-area limitations probably underestimated foraging range.

Bond additivity corrections for quantum chemistry methods

DOE Office of Scientific and Technical Information (OSTI.GOV)

C. F. Melius; M. D. Allendorf

1999-04-01

In the 1980's, the authors developed a bond-additivity correction procedure for quantum chemical calculations called BAC-MP4, which has proven reliable in calculating the thermochemical properties of molecular species, including radicals as well as stable closed-shell species. New Bond Additivity Correction (BAC) methods have been developed for the G2 method, BAC-G2, as well as for a hybrid DFT/MP2 method, BAC-Hybrid. These BAC methods use a new form of BAC corrections, involving atomic, molecular, and bond-wise additive terms. These terms enable one to treat positive and negative ions as well as neutrals. The BAC-G2 method reduces errors in the G2 method duemore » to nearest-neighbor bonds. The parameters within the BAC-G2 method only depend on atom types. Thus the BAC-G2 method can be used to determine the parameters needed by BAC methods involving lower levels of theory, such as BAC-Hybrid and BAC-MP4. The BAC-Hybrid method should scale well for large molecules. The BAC-Hybrid method uses the differences between the DFT and MP2 as an indicator of the method's accuracy, while the BAC-G2 method uses its internal methods (G1 and G2MP2) to provide an indicator of its accuracy. Indications of the average error as well as worst cases are provided for each of the BAC methods.« less

Presumptive identification of Candida species other than C. albicans, C. krusei, and C. tropicalis with the chromogenic medium CHROMagar Candida

PubMed Central

Hospenthal, Duane R; Beckius, Miriam L; Floyd, Karon L; Horvath, Lynn L; Murray, Clinton K

2006-01-01

Background CHROMagar Candida (CaC) is increasingly being reported as a medium used to differentiate Candida albicans from non-albicans Candida (NAC) species. Rapid identification of NAC can assist the clinician in selecting appropriate antifungal therapy. CaC is a differential chromogenic medium designed to identify C. albicans, C. krusei, and C. tropicalis based on colony color and morphology. Some reports have proposed that CaC can also reliably identify C. dubliniensis and C. glabrata. Methods We evaluated the usefulness of CaC in the identification of C. dubliniensis, C. famata, C. firmetaria, C. glabrata, C. guilliermondii, C. inconspicua, C. kefyr, C. lipolytica, C. lusitaniae, C. norvegensis, C. parapsilosis, and C. rugosa. Results Most NAC produced colonies that were shades of pink, lavender, or ivory. Several isolates of C. firmetaria and all C. inconspicua produced colonies difficult to differentiate from C. krusei. Most C. rugosa isolates produced unique colonies with morphology like C. krusei except in a light blue-green color. C. glabrata isolates produced small dark violet colonies that could be differentiated from the pink and lavender colors produced by other species. All seventeen isolates of C. dubliniensis produced green colonies similar to those produced by C. albicans. Conclusion C. glabrata and C. rugosa appear distinguishable from other species using CaC. Some NAC, including C. firmetaria and C. inconspicua, could be confused with C. krusei using this medium. PMID:16390552

Abundance of diurnal raptors in relation to prairie dog colonies: Implications for bird-aircraft strike hazard

USGS Publications Warehouse

Merriman, J.W.; Boal, C.W.; Bashore, T.L.; Zwank, P.J.; Wester, D.B.

2007-01-01

Some diurnal raptors are frequently observed at prairie dog (Cynomys sp.) colonies. As a result, some military installations have conducted prairie dog control activities to reduce the bird-aircraft strike hazard (BASH) potential of low-flying aircraft. To evaluate the validity of this management strategy, we assessed raptor associations with prairie dog colonies at 2 short-grass prairie study areas: southern Lubbock County, Texas, USA, and Melrose Bombing and Gunnery Range in east-central New Mexico, USA. We quantified diurnal raptors (i.e., Falconiformes) at plots occupied (colony plots) and unoccupied (noncolony plots) by black-tailed prairie dogs (Cynomys ludovicianus) at both sites throughout 2002. We compared the number of individual birds of a given species at colony and noncolony plots within each study area by season. Ferruginous hawks (Buteo regalis) and northern harriers (Circus cyaneus) were more abundant at colony plots, whereas Swainson's hawks (B. swainsoni) and American kestrels (Falco sparverius) were more abundant at noncolony plots. Red-tailed hawk (B. jamaicensis) abundance did not differ between the 2 plot types. Our results suggest prairie dog control as a method of reducing BASH potential may be effective at some sites but may be ineffective or even increase the BASH potential at others. Thus, bird-avoidance models assessing the BASH potential should be conducted on a site-specific basis using information on relative and seasonal abundances of individual raptor species and the relative strike risks they pose to aircraft.

Transgene-free iPSCs generated from small volume peripheral blood nonmobilized CD34+ cells

PubMed Central

Merling, Randall K.; Sweeney, Colin L.; Choi, Uimook; De Ravin, Suk See; Myers, Timothy G.; Otaizo-Carrasquero, Francisco; Pan, Jason; Linton, Gilda; Chen, Lifeng; Koontz, Sherry; Theobald, Narda L.; Malech, Harry L.

2013-01-01

A variety of somatic cells can be reprogrammed to induced pluripotent stem cells (iPSCs), but CD34+ hematopoietic stem cells (HSCs) present in nonmobilized peripheral blood (PB) would be a convenient target. We report a method for deriving iPSC from PB HSCs using immunobead purification and 2- to 4-day culture to enrich CD34+ HSCs to 80% ± 9%, followed by reprogramming with loxP-flanked polycistronic (human Oct4, Klf4, Sox2, and c-Myc) STEMCCA-loxP lentivector, or with Sendai vectors. Colonies arising with STEMCCA-loxP were invariably TRA-1-60+, yielding 5.3 ± 2.8 iPSC colonies per 20 mL PB (n = 17), where most colonies had single-copy STEMCCA-loxP easily excised by transient Cre expression. Colonies arising with Sendai were variably reprogrammed (10%-80% TRA-1-60+), with variable yield (6 to >500 TRA-1-60+ iPSC colonies per 10 mL blood; n = 6). Resultant iPSC clones expressed pluripotent cell markers and generated teratomas. Genomic methylation patterns of STEMCCA-loxP–reprogrammed clones closely matched embryonic stem cells. Furthermore, we showed that iPSCs are derived from the nonmobilized CD34+ HSCs enriched from PB rather than from any lymphocyte or monocyte contaminants because they lack somatic rearrangements typical of T or B lymphocytes and because purified CD14+ monocytes do not yield iPSC colonies under these reprogramming conditions. PMID:23386128

EIT image reconstruction based on a hybrid FE-EFG forward method and the complete-electrode model.

PubMed

Hadinia, M; Jafari, R; Soleimani, M

2016-06-01

This paper presents the application of the hybrid finite element-element free Galerkin (FE-EFG) method for the forward and inverse problems of electrical impedance tomography (EIT). The proposed method is based on the complete electrode model. Finite element (FE) and element-free Galerkin (EFG) methods are accurate numerical techniques. However, the FE technique has meshing task problems and the EFG method is computationally expensive. In this paper, the hybrid FE-EFG method is applied to take both advantages of FE and EFG methods, the complete electrode model of the forward problem is solved, and an iterative regularized Gauss-Newton method is adopted to solve the inverse problem. The proposed method is applied to compute Jacobian in the inverse problem. Utilizing 2D circular homogenous models, the numerical results are validated with analytical and experimental results and the performance of the hybrid FE-EFG method compared with the FE method is illustrated. Results of image reconstruction are presented for a human chest experimental phantom.

Torque Characteristics Analysis of Hybrid Stepping Motor Using 3-D Finite Element Method

NASA Astrophysics Data System (ADS)

Kawase, Yoshihiro; Yamaguchi, Tadashi; Masuda, Tatsuya; Domeki, Hideo; Kobori, Masaru

Hybrid stepping motors are widely used for various electric instruments because of high torque, high accuracy and small step angle. It is necessary for the optimum design of hybrid stepping motors to analyze torque characteristics accurately. In this paper, a hybrid stepping motor is analyzed using the 3-D finite element method taking into account the rotation of the armature. The effects of the interlaminar gap in the core on the torque characteristics are clarified using the gap elements. The validity of our method is clarified by comparison between the calculated results and measured ones.

Trends in the breeding population and driving factors of Adélie penguin in the Ross Sea

NASA Astrophysics Data System (ADS)

He, H.; Li, X.; Cheng, X.

2017-12-01

Ross Sea regions have been characterized by high penguin-chick-rearing habitat suitability in the recent past. Many studies have been done to study the Adélie penguins in the Ross Sea. However, the data they used both had advantages and drawbacks. Besides, little quantitative analysis were carried out to study the impact factors on the penguin population change. In this study, penguin population data from MAPPPD (Mapping application for penguin populations and projected dynamics) and IBA (Important bird areas in Antarctica) were integrated and analyzed to study the distribution and trends in the breeding population of Adélie penguin over time in the Ross Sea. In addition, linear fitting method for spatial data in time series were used to study the driving factors such as 2m-temperature, sea ice cover and chlorophyll-a concentration which can quantify phytoplankton blooms. Results indicated that there were 45 Adélie penguin colonies in the Ross Sea. Cape Adare and Cape Crozier were two biggest colonies on which current Adélie penguin abundance were 428516 and 280787 breeding pairs, respectively. Among these colonies, penguin population on 28 colonies increased, on 5 colonies decreased and on 5 colonies remained no change over time, and there were also 5 new colonies and one colony which were extinct. It was found that Adélie penguin population in most of colonies in the Ross Sea increased, which meant that Adélie penguins in the Ross Sea were "climate change winners". The main reasons for the increase in Adélie penguin population in the Ross Sea might be the rise in 2m-temperature and the increase in sea ice cover and phytoplankton. Higher temperatures have resulted in glacial retreat and snow melting, which leads to an increase in available habitat for penguins. The increased sea ice and phytoplankton might positively affect the abundance of Antarctic krill that was the major prey item for Adélie penguins in Antarctic.

Biomolecular hybrid material and process for preparing same and uses for same

DOEpatents

Kim, Jungbae [Richland, WA

2010-11-23

Disclosed is a composition and method for fabricating novel hybrid materials comprised of, e.g., carbon nanotubes (CNTs) and crosslinked enzyme clusters (CECs). In one method, enzyme-CNT hybrids are prepared by precipitation of enzymes which are subsequently crosslinked, yielding crosslinked enzyme clusters (CECs) on the surface of the CNTs. The CEC-enzyme-CNT hybrids exhibit high activity per unit area or mass as well as improved enzyme stability and longevity over hybrid materials known in the art. The CECs in the disclosed materials permit multilayer biocatalytic coatings to be applied to surfaces providing hybrid materials suitable for use in, e.g., biocatalytic applications and devices as described herein.

An efficient method for hybrid density functional calculation with spin-orbit coupling

NASA Astrophysics Data System (ADS)

Wang, Maoyuan; Liu, Gui-Bin; Guo, Hong; Yao, Yugui

2018-03-01

In first-principles calculations, hybrid functional is often used to improve accuracy from local exchange correlation functionals. A drawback is that evaluating the hybrid functional needs significantly more computing effort. When spin-orbit coupling (SOC) is taken into account, the non-collinear spin structure increases computing effort by at least eight times. As a result, hybrid functional calculations with SOC are intractable in most cases. In this paper, we present an approximate solution to this problem by developing an efficient method based on a mixed linear combination of atomic orbital (LCAO) scheme. We demonstrate the power of this method using several examples and we show that the results compare very well with those of direct hybrid functional calculations with SOC, yet the method only requires a computing effort similar to that without SOC. The presented technique provides a good balance between computing efficiency and accuracy, and it can be extended to magnetic materials.

Structure and weights optimisation of a modified Elman network emotion classifier using hybrid computational intelligence algorithms: a comparative study

NASA Astrophysics Data System (ADS)

Sheikhan, Mansour; Abbasnezhad Arabi, Mahdi; Gharavian, Davood

2015-10-01

Artificial neural networks are efficient models in pattern recognition applications, but their performance is dependent on employing suitable structure and connection weights. This study used a hybrid method for obtaining the optimal weight set and architecture of a recurrent neural emotion classifier based on gravitational search algorithm (GSA) and its binary version (BGSA), respectively. By considering the features of speech signal that were related to prosody, voice quality, and spectrum, a rich feature set was constructed. To select more efficient features, a fast feature selection method was employed. The performance of the proposed hybrid GSA-BGSA method was compared with similar hybrid methods based on particle swarm optimisation (PSO) algorithm and its binary version, PSO and discrete firefly algorithm, and hybrid of error back-propagation and genetic algorithm that were used for optimisation. Experimental tests on Berlin emotional database demonstrated the superior performance of the proposed method using a lighter network structure.

Spatially extended hybrid methods: a review

PubMed Central

2018-01-01

Many biological and physical systems exhibit behaviour at multiple spatial, temporal or population scales. Multiscale processes provide challenges when they are to be simulated using numerical techniques. While coarser methods such as partial differential equations are typically fast to simulate, they lack the individual-level detail that may be required in regions of low concentration or small spatial scale. However, to simulate at such an individual level throughout a domain and in regions where concentrations are high can be computationally expensive. Spatially coupled hybrid methods provide a bridge, allowing for multiple representations of the same species in one spatial domain by partitioning space into distinct modelling subdomains. Over the past 20 years, such hybrid methods have risen to prominence, leading to what is now a very active research area across multiple disciplines including chemistry, physics and mathematics. There are three main motivations for undertaking this review. Firstly, we have collated a large number of spatially extended hybrid methods and presented them in a single coherent document, while comparing and contrasting them, so that anyone who requires a multiscale hybrid method will be able to find the most appropriate one for their need. Secondly, we have provided canonical examples with algorithms and accompanying code, serving to demonstrate how these types of methods work in practice. Finally, we have presented papers that employ these methods on real biological and physical problems, demonstrating their utility. We also consider some open research questions in the area of hybrid method development and the future directions for the field. PMID:29491179

Light-transmittance predictions under multiple-light-scattering conditions. I. Direct problem: hybrid-method approximation.

PubMed

Czerwiński, M; Mroczka, J; Girasole, T; Gouesbet, G; Gréhan, G

2001-03-20

Our aim is to present a method of predicting light transmittances through dense three-dimensional layered media. A hybrid method is introduced as a combination of the four-flux method with coefficients predicted from a Monte Carlo statistical model to take into account the actual three-dimensional geometry of the problem under study. We present the principles of the hybrid method, some exemplifying results of numerical simulations, and their comparison with results obtained from Bouguer-Lambert-Beer law and from Monte Carlo simulations.

Fast Construction of Near Parsimonious Hybridization Networks for Multiple Phylogenetic Trees.

PubMed

Mirzaei, Sajad; Wu, Yufeng

2016-01-01

Hybridization networks represent plausible evolutionary histories of species that are affected by reticulate evolutionary processes. An established computational problem on hybridization networks is constructing the most parsimonious hybridization network such that each of the given phylogenetic trees (called gene trees) is "displayed" in the network. There have been several previous approaches, including an exact method and several heuristics, for this NP-hard problem. However, the exact method is only applicable to a limited range of data, and heuristic methods can be less accurate and also slow sometimes. In this paper, we develop a new algorithm for constructing near parsimonious networks for multiple binary gene trees. This method is more efficient for large numbers of gene trees than previous heuristics. This new method also produces more parsimonious results on many simulated datasets as well as a real biological dataset than a previous method. We also show that our method produces topologically more accurate networks for many datasets.

Experiences from a community based substance use treatment centre in an urban resettlement colony in India.

PubMed

Balhara, Yatan Pal Singh; Ranjan, Rajeev; Dhawan, Anju; Yadav, Deepak

2014-01-01

Background. There are limited community based treatment services for drug dependence in India. Rural areas and urban resettlement colonies are in particular deficient in such services. Aims. The current study aimed at preliminary assessment of substance use disorder management services at a community based substance use treatment clinic in an urban resettlement colony. Methods. The study was carried out at community based substance use treatment centre in a resettlement colony in India. The records of the centre were chart reviewed. Results. A total of 754 patients were registered at the clinic during the study period. Heroin was the primary drug of abuse for 63% of the patients. The mean duration of follow-up for the patients with opioid and alcohol dependence was 13.47 (SD ± 10.37; range 0-39) months. A total of 220 patients of opioid dependence were prescribed substation or abstinence directed therapy. Buprenorphine (87), slow release oral morphine (SROM) (16), and dextropropoxyphene (98) were used for opioid substitution. Conclusion. It is possible to deliver substance use disorder treatment services in community setting. There is a need to develop area specific community based treatment services for substance abuse in socially disadvantaged populations such as urban resettlement colonies.

Experiences from a Community Based Substance Use Treatment Centre in an Urban Resettlement Colony in India

PubMed Central

Balhara, Yatan Pal Singh; Ranjan, Rajeev; Dhawan, Anju; Yadav, Deepak

2014-01-01

Background. There are limited community based treatment services for drug dependence in India. Rural areas and urban resettlement colonies are in particular deficient in such services. Aims. The current study aimed at preliminary assessment of substance use disorder management services at a community based substance use treatment clinic in an urban resettlement colony. Methods. The study was carried out at community based substance use treatment centre in a resettlement colony in India. The records of the centre were chart reviewed. Results. A total of 754 patients were registered at the clinic during the study period. Heroin was the primary drug of abuse for 63% of the patients. The mean duration of follow-up for the patients with opioid and alcohol dependence was 13.47 (SD ± 10.37; range 0–39) months. A total of 220 patients of opioid dependence were prescribed substation or abstinence directed therapy. Buprenorphine (87), slow release oral morphine (SROM) (16), and dextropropoxyphene (98) were used for opioid substitution. Conclusion. It is possible to deliver substance use disorder treatment services in community setting. There is a need to develop area specific community based treatment services for substance abuse in socially disadvantaged populations such as urban resettlement colonies. PMID:25431739

Modeling man: the monkey colony at the Carnegie Institution of Washington's Department of Embryology, 1925-1971.

PubMed

Wilson, Emily K

2012-01-01

Though better recognized for its immediate endeavors in human embryo research, the Carnegie Department of Embryology also employed a breeding colony of rhesus macaques for the purposes of studying human reproduction. This essay follows the course of the first enterprise in maintaining a primate colony for laboratory research and the overlapping scientific, social, and political circumstances that tolerated and cultivated the colony's continued operation from 1925 until 1971. Despite a new-found priority for reproductive sciences in the United States, by the early 1920s an unfertilized human ovum had not yet been seen and even the timing of ovulation remained unresolved. Progress would require an organized research approach that could extend beyond the limitations of working with scant and inherently restrictive human subjects or with common lab mammals like mice. In response, the Department of Embryology, under the Carnegie Institution of Washington (CIW), instituted a novel methodology using a particular primate species as a surrogate in studying normal human reproductive physiology. Over more than 40 years the monkey colony followed an unpremeditated trajectory that would contribute fundamentally to discoveries in human reproduction, early embryo development, reliable birth control methods, and to the establishment of the rhesus macaque as a common model organism.

Performance of the Chromogenic Medium CHROMagar Staph Aureus and the Staphychrom Coagulase Test in the Detection and Identification of Staphylococcus aureus in Clinical Specimens

PubMed Central

Carricajo, Anne; Treny, Axel; Fonsale, Nathalie; Bes, Michele; Reverdy, Marie Elisabeth; Gille, Yves; Aubert, Gerald; Freydiere, Anne Marie

2001-01-01

CHROMagar Staph aureus (CSAM) (CHROMagar Microbiology, Paris, France) is a new chromogenic medium designed to enable detection of colonies of Staphylococcus aureus by their pink color. A total of 775 specimens were cultured in parallel on CHROMagar Staph aureus and conventional media. Among the 267 S. aureus strains recovered on at least one medium, 263 were isolated on CSAM medium (sensitivity, 98.5%), and 245 (sensitivity, 91.8%) were isolated on conventional media. The specificity of presumptive identification of S. aureus on the basis of pink colony color on CSAM medium was 97% (493 of 508). This specificity increased to 100% when coagulase detection with the Staphychrom coagulase test was added and to 98.8% when S. aureus surface components were detected by agglutination in the Pastorex Staph Plus test. Susceptibility testing of 67 S. aureus strains, performed in parallel on pink CSAM colonies and on colonies grown on blood agar, gave similar results. Thus, rapid and accurate recognition and identification of S. aureus isolates were achieved with CSAM as the primary isolation medium, followed by the staphylocoagulase Staphychrom test. Antimicrobial susceptibility testing (disk-diffusion method or ATB STAPH System) can be performed directly on pink CSAM colonies. PMID:11427572

A new collaborative recommendation approach based on users clustering using artificial bee colony algorithm.

PubMed

Ju, Chunhua; Xu, Chonghuan

2013-01-01

Although there are many good collaborative recommendation methods, it is still a challenge to increase the accuracy and diversity of these methods to fulfill users' preferences. In this paper, we propose a novel collaborative filtering recommendation approach based on K-means clustering algorithm. In the process of clustering, we use artificial bee colony (ABC) algorithm to overcome the local optimal problem caused by K-means. After that we adopt the modified cosine similarity to compute the similarity between users in the same clusters. Finally, we generate recommendation results for the corresponding target users. Detailed numerical analysis on a benchmark dataset MovieLens and a real-world dataset indicates that our new collaborative filtering approach based on users clustering algorithm outperforms many other recommendation methods.

A New Collaborative Recommendation Approach Based on Users Clustering Using Artificial Bee Colony Algorithm

PubMed Central

Ju, Chunhua

2013-01-01

Although there are many good collaborative recommendation methods, it is still a challenge to increase the accuracy and diversity of these methods to fulfill users' preferences. In this paper, we propose a novel collaborative filtering recommendation approach based on K-means clustering algorithm. In the process of clustering, we use artificial bee colony (ABC) algorithm to overcome the local optimal problem caused by K-means. After that we adopt the modified cosine similarity to compute the similarity between users in the same clusters. Finally, we generate recommendation results for the corresponding target users. Detailed numerical analysis on a benchmark dataset MovieLens and a real-world dataset indicates that our new collaborative filtering approach based on users clustering algorithm outperforms many other recommendation methods. PMID:24381525

Detection and isolation of nucleic acid sequences using a bifunctional hybridization probe

DOEpatents

Lucas, Joe N.; Straume, Tore; Bogen, Kenneth T.

2000-01-01

A method for detecting and isolating a target sequence in a sample of nucleic acids is provided using a bifunctional hybridization probe capable of hybridizing to the target sequence that includes a detectable marker and a first complexing agent capable of forming a binding pair with a second complexing agent. A kit is also provided for detecting a target sequence in a sample of nucleic acids using a bifunctional hybridization probe according to this method.

Hybrid-DFT  +  V w method for band structure calculation of semiconducting transition metal compounds: the case of cerium dioxide.

PubMed

Ivády, Viktor; Gali, Adam; Abrikosov, Igor A

2017-11-15

Hybrid functionals' non-local exchange-correlation potential contains a derivative discontinuity that improves on standard semi-local density functional theory (DFT) band gaps. Moreover, by careful parameterization, hybrid functionals can provide self-interaction reduced description of selected states. On the other hand, the uniform description of all the electronic states of a given system is a known drawback of these functionals that causes varying accuracy in the description of states with different degrees of localization. This limitation can be remedied by the orbital dependent exact exchange extension of hybrid functionals; the hybrid-DFT  +  V w method (Ivády et al 2014 Phys. Rev. B 90 035146). Based on the analogy of quasi-particle equations and hybrid-DFT single particle equations, here we demonstrate that parameters of hybrid-DFT  +  V w functional can be determined from approximate theoretical quasi-particle spectra without any fitting to experiment. The proposed method is illustrated on the charge self-consistent electronic structure calculation for cerium dioxide where itinerant valence states interact with well-localized 4f atomic like states, making this system challenging for conventional methods, either hybrid-DFT or LDA  +  U, and therefore allowing for a demonstration of the advantages of the proposed scheme.

Design and synthesis of organic-inorganic hybrid capsules for biotechnological applications.

PubMed

Shi, Jiafu; Jiang, Yanjun; Wang, Xiaoli; Wu, Hong; Yang, Dong; Pan, Fusheng; Su, Yanlei; Jiang, Zhongyi

2014-08-07

Organic-inorganic hybrid capsules, which typically possess a hollow lumen and a hybrid wall, have emerged as a novel and promising class of hybrid materials and have attracted enormous attention. In comparison to polymeric capsules or inorganic capsules, the hybrid capsules combine the intrinsic physical/chemical properties of the organic and inorganic moieties, acquire more degrees of freedom to manipulate multiple interactions, create hierarchical structures and integrate multiple functionalities. Thus, the hybrid capsules exhibit superior mechanical strength (vs. polymeric capsules) and diverse functionalities (vs. inorganic capsules), which may give new opportunities to produce high-performance materials. Much effort has been devoted to exploring innovative and effective methods for the synthesis of hybrid capsules that exhibit desirable performance in target applications. This tutorial review firstly presents a brief description of the capsular structure and hybrid materials in nature, then classifies the hybrid capsules into molecule-hybrid capsules and nano-hybrid capsules based upon the size of the organic and inorganic moieties in the capsule wall, followed by a detailed discussion of the design and synthesis of the hybrid capsules. For each kind of hybrid capsule, the state-of-the-art synthesis methods are described in detail and a critical comment is embedded. The applications of these hybrid capsules in biotechnological areas (biocatalysis, drug delivery, etc.) have also been summarized. Hopefully, this review will offer a perspective and guidelines for the future research and development of hybrid capsules.

A modified hybrid uncertain analysis method for dynamic response field of the LSOAAC with random and interval parameters

NASA Astrophysics Data System (ADS)

Zi, Bin; Zhou, Bin

2016-07-01

For the prediction of dynamic response field of the luffing system of an automobile crane (LSOAAC) with random and interval parameters, a hybrid uncertain model is introduced. In the hybrid uncertain model, the parameters with certain probability distribution are modeled as random variables, whereas, the parameters with lower and upper bounds are modeled as interval variables instead of given precise values. Based on the hybrid uncertain model, the hybrid uncertain dynamic response equilibrium equation, in which different random and interval parameters are simultaneously included in input and output terms, is constructed. Then a modified hybrid uncertain analysis method (MHUAM) is proposed. In the MHUAM, based on random interval perturbation method, the first-order Taylor series expansion and the first-order Neumann series, the dynamic response expression of the LSOAAC is developed. Moreover, the mathematical characteristics of extrema of bounds of dynamic response are determined by random interval moment method and monotonic analysis technique. Compared with the hybrid Monte Carlo method (HMCM) and interval perturbation method (IPM), numerical results show the feasibility and efficiency of the MHUAM for solving the hybrid LSOAAC problems. The effects of different uncertain models and parameters on the LSOAAC response field are also investigated deeply, and numerical results indicate that the impact made by the randomness in the thrust of the luffing cylinder F is larger than that made by the gravity of the weight in suspension Q . In addition, the impact made by the uncertainty in the displacement between the lower end of the lifting arm and the luffing cylinder a is larger than that made by the length of the lifting arm L .

Hybrid spread spectrum radio system

DOEpatents

Smith, Stephen F [London, TN; Dress, William B [Camas, WA

2010-02-09

Systems and methods are described for hybrid spread spectrum radio systems. A method, includes receiving a hybrid spread spectrum signal including: fast frequency hopping demodulating and direct sequence demodulating a direct sequence spread spectrum signal, wherein multiple frequency hops occur within a single data-bit time and each bit is represented by chip transmissions at multiple frequencies.

A highly oriented hybrid microarray modified electrode fabricated by a template-free method for ultrasensitive electrochemical DNA recognition

NASA Astrophysics Data System (ADS)

Shi, Lei; Chu, Zhenyu; Dong, Xueliang; Jin, Wanqin; Dempsey, Eithne

2013-10-01

Highly oriented growth of a hybrid microarray was realized by a facile template-free method on gold substrates for the first time. The proposed formation mechanism involves an interfacial structure-directing force arising from self-assembled monolayers (SAMs) between gold substrates and hybrid crystals. Different SAMs and variable surface coverage of the assembled molecules play a critical role in the interfacial directing forces and influence the morphologies of hybrid films. A highly oriented hybrid microarray was formed on the highly aligned and vertical SAMs of 1,4-benzenedithiol molecules with rigid backbones, which afforded an intense structure-directing power for the oriented growth of hybrid crystals. Additionally, the density of the microarray could be adjusted by controlling the surface coverage of assembled molecules. Based on the hybrid microarray modified electrode with a large specific area (ca. 10 times its geometrical area), a label-free electrochemical DNA biosensor was constructed for the detection of an oligonucleotide fragment of the avian flu virus H5N1. The DNA biosensor displayed a significantly low detection limit of 5 pM (S/N = 3), a wide linear response from 10 pM to 10 nM, as well as excellent selectivity, good regeneration and high stability. We expect that the proposed template-free method can provide a new reference for the fabrication of a highly oriented hybrid array and the as-prepared microarray modified electrode will be a promising paradigm in constructing highly sensitive and selective biosensors.Highly oriented growth of a hybrid microarray was realized by a facile template-free method on gold substrates for the first time. The proposed formation mechanism involves an interfacial structure-directing force arising from self-assembled monolayers (SAMs) between gold substrates and hybrid crystals. Different SAMs and variable surface coverage of the assembled molecules play a critical role in the interfacial directing forces and influence the morphologies of hybrid films. A highly oriented hybrid microarray was formed on the highly aligned and vertical SAMs of 1,4-benzenedithiol molecules with rigid backbones, which afforded an intense structure-directing power for the oriented growth of hybrid crystals. Additionally, the density of the microarray could be adjusted by controlling the surface coverage of assembled molecules. Based on the hybrid microarray modified electrode with a large specific area (ca. 10 times its geometrical area), a label-free electrochemical DNA biosensor was constructed for the detection of an oligonucleotide fragment of the avian flu virus H5N1. The DNA biosensor displayed a significantly low detection limit of 5 pM (S/N = 3), a wide linear response from 10 pM to 10 nM, as well as excellent selectivity, good regeneration and high stability. We expect that the proposed template-free method can provide a new reference for the fabrication of a highly oriented hybrid array and the as-prepared microarray modified electrode will be a promising paradigm in constructing highly sensitive and selective biosensors. Electronic supplementary information (ESI) available: Four-probe method for determining the conductivity of the hybrid crystal (Fig. S1); stability comparisons of the hybrid films (Fig. S2); FESEM images of the hybrid microarray (Fig. S3); electrochemical characterizations of the hybrid films (Fig. S4); DFT simulations (Fig. S5); cross-sectional FESEM image of the hybrid microarray (Fig. S6); regeneration and stability tests of the DNA biosensor (Fig. S7). See DOI: 10.1039/c3nr03097k

Effect of Co on Discontinuous Precipitation Transformation with TCP Phase in Ni-based Alloy Containing Re

NASA Astrophysics Data System (ADS)

Shi, Qianying; An, Ning; Huo, Jiajie; Zheng, Yunrong; Feng, Qiang

2017-05-01

The effect of Co on discontinuous precipitation (DP) transformation involving the formation of topologically close-packed (TCP) phase was investigated in three Ni-Cr-Re model alloys containing different levels of Co. One typical TCP phase, σ, was generated within DP cellular colonies along the migrating grain boundaries in experimental alloys during aging treatment. As a result of the increased solubility of Re in the γ matrix and enlarged interlamellar spacing of σ precipitates inside of growing DP colonies, Co addition suppressed the formation of σ phase and associated DP colonies. This study suggests that Co could potentially serve as a microstructural stabilizer in Re-containing Ni-base superalloys, which provides an alternative method for the composition optimization of superalloys.

Hybrid statistics-simulations based method for atom-counting from ADF STEM images.

PubMed

De Wael, Annelies; De Backer, Annick; Jones, Lewys; Nellist, Peter D; Van Aert, Sandra

2017-06-01

A hybrid statistics-simulations based method for atom-counting from annular dark field scanning transmission electron microscopy (ADF STEM) images of monotype crystalline nanostructures is presented. Different atom-counting methods already exist for model-like systems. However, the increasing relevance of radiation damage in the study of nanostructures demands a method that allows atom-counting from low dose images with a low signal-to-noise ratio. Therefore, the hybrid method directly includes prior knowledge from image simulations into the existing statistics-based method for atom-counting, and accounts in this manner for possible discrepancies between actual and simulated experimental conditions. It is shown by means of simulations and experiments that this hybrid method outperforms the statistics-based method, especially for low electron doses and small nanoparticles. The analysis of a simulated low dose image of a small nanoparticle suggests that this method allows for far more reliable quantitative analysis of beam-sensitive materials. Copyright © 2017 Elsevier B.V. All rights reserved.

Use of artificial bee colonies algorithm as numerical approximation of differential equations solution

NASA Astrophysics Data System (ADS)

Fikri, Fariz Fahmi; Nuraini, Nuning

2018-03-01

The differential equation is one of the branches in mathematics which is closely related to human life problems. Some problems that occur in our life can be modeled into differential equations as well as systems of differential equations such as the Lotka-Volterra model and SIR model. Therefore, solving a problem of differential equations is very important. Some differential equations are difficult to solve, so numerical methods are needed to solve that problems. Some numerical methods for solving differential equations that have been widely used are Euler Method, Heun Method, Runge-Kutta and others. However, some of these methods still have some restrictions that cause the method cannot be used to solve more complex problems such as an evaluation interval that we cannot change freely. New methods are needed to improve that problems. One of the method that can be used is the artificial bees colony algorithm. This algorithm is one of metaheuristic algorithm method, which can come out from local search space and do exploration in solution search space so that will get better solution than other method.

A Novel Extraction Approach of Extrinsic and Intrinsic Parameters of InGaAs/GaN pHEMTs

DTIC Science & Technology

2015-07-01

presented, for the first time, artificial bee colony algorithm is applied to the global-optimization based parameter extraction and a novel intrinsic...conservation of the gate charge is well satisfied which further validates this novel extraction method. Index Terms —InGaAs/GaN pHEMTs, artificial bee ...increase the uniqueness of the extraction. Artificial bee colony (ABC) algorithm is adopted as the optimizer due to its excellent ability to escape

Cultural and morphological properties of the vaccine strain Yersinia pestis EV NIIEG bacteria after photodynamic inactivation

NASA Astrophysics Data System (ADS)

Ulianova, Onega V.; Lyapina, Anna M.; Khizhnyakova, Mariya A.; Laskavy, Vladislav N.; Feodorova, Valentina A.; Ulyanov, Sergey S.

2015-03-01

New method of photoinactivation of plague microbes (bacteria Yersinia pestis) has been suggested. Rate of growth of colonies of Y. pestis EV NIIEG at specific regimes of photo processing have been analyzed. Dependence of growth on exposure time and concentrations of photosensitizer (methylene blue) has been studied. Number of colony forming units of Y. pestis EV NIIEG bacteria as a function of intensity of light and concentration of methylene blue has been scrutinized.

A Modified Artificial Bee Colony Algorithm Application for Economic Environmental Dispatch

NASA Astrophysics Data System (ADS)

Tarafdar Hagh, M.; Baghban Orandi, Omid

2018-03-01

In conventional fossil-fuel power systems, the economic environmental dispatch (EED) problem is a major problem that optimally determines the output power of generating units in a way that cost of total production and emission level be minimized simultaneously, and at the same time all the constraints of units and system are satisfied properly. To solve EED problem which is a non-convex optimization problem, a modified artificial bee colony (MABC) algorithm is proposed in this paper. This algorithm by implementing weighted sum method is applied on two test systems, and eventually, obtained results are compared with other reported results. Comparison of results confirms superiority and efficiency of proposed method clearly.

Ancient village fire escape path planning based on improved ant colony algorithm

NASA Astrophysics Data System (ADS)

Xia, Wei; Cao, Kang; Hu, QianChuan

2017-06-01

The roadways are narrow and perplexing in ancient villages, it brings challenges and difficulties for people to choose route to escape when a fire occurs. In this paper, a fire escape path planning method based on ant colony algorithm is presented according to the problem. The factors in the fire environment which influence the escape speed is introduced to improve the heuristic function of the algorithm, optimal transfer strategy, and adjustment pheromone volatile factor to improve pheromone update strategy adaptively, improve its dynamic search ability and search speed. Through simulation, the dynamic adjustment of the optimal escape path is obtained, and the method is proved to be feasible.

Field monitoring of plant-growth-promoting rhizobacteria by colony immunoblotting.

PubMed

Krishnen, Ganisan; Kecskés, Mihály L; Rose, Michael T; Geelan-Small, Peter; Amprayn, Khanok-on; Pereg, Lily; Kennedy, Ivan R

2011-11-01

Inoculant plant-growth-promoting bacteria are emerging as an important component of sustainable agriculture. There is a need to develop inexpensive methods for enumerating these organisms after their application in the field, to better understand their survival and impacts on yields. Immunoblotting is one potential method to measure viable cells, but the high cost of the conventionally used nylon membranes makes this method prohibitive. In this study, less expensive alternative materials such as filter papers, glossy photo papers, and transparencies for the purpose of colony immunoblotting were evaluated and the best substance was chosen for further studies. Whatman filter paper No. 541 combined with a 0.01 mol·L(-1) H(2)SO(4) rinsing step gave similar results to nylon membranes but <20% of the overall cost of the original colony immunoblotting assay. The application of the modified immunoblot method was tested on nonsterile clay soil samples that were spiked with high numbers (>10(7) CFU·g(-1)) of the plant-growth-promoting bacteria Pseudomonas fluorescens , Azospirillum brasilense , or Rhizobium leguminosarum . The modified protocol allowed the identification and recovery of over 50% of the inoculated cells of all three strains, amidst a background of the native soil microflora. Subsequently, the survival of P. fluorescens was successfully monitored for several months after application to field-grown rice at Jerilderie, New South Wales, Australia, thus validating the procedure.

Reinforcement interval type-2 fuzzy controller design by online rule generation and q-value-aided ant colony optimization.

PubMed

Juang, Chia-Feng; Hsu, Chia-Hung

2009-12-01

This paper proposes a new reinforcement-learning method using online rule generation and Q-value-aided ant colony optimization (ORGQACO) for fuzzy controller design. The fuzzy controller is based on an interval type-2 fuzzy system (IT2FS). The antecedent part in the designed IT2FS uses interval type-2 fuzzy sets to improve controller robustness to noise. There are initially no fuzzy rules in the IT2FS. The ORGQACO concurrently designs both the structure and parameters of an IT2FS. We propose an online interval type-2 rule generation method for the evolution of system structure and flexible partitioning of the input space. Consequent part parameters in an IT2FS are designed using Q -values and the reinforcement local-global ant colony optimization algorithm. This algorithm selects the consequent part from a set of candidate actions according to ant pheromone trails and Q-values, both of which are updated using reinforcement signals. The ORGQACO design method is applied to the following three control problems: 1) truck-backing control; 2) magnetic-levitation control; and 3) chaotic-system control. The ORGQACO is compared with other reinforcement-learning methods to verify its efficiency and effectiveness. Comparisons with type-1 fuzzy systems verify the noise robustness property of using an IT2FS.

Rapid diagnosis of sensitivity to ultraviolet light in fibroblasts from dermatologic disorders, with particular reference to xeroderma pigmentosum

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cleaver, J.E.; Thomas, G.H.

1988-04-01

A rapid and simple method for determining the sensitivity of human fibroblasts to ultraviolet light is described. As an alternative to the colony formation assay, this method can be used for the rapid diagnosis of ultraviolet light sensitivity in fibroblasts from photosensitive disorders. The method is based on growth of small numbers of cells in 1-cm wells of culture trays for 4 or more days after irradiation and determination of cell survival by the incorporation of (/sup 3/H)hypoxanthine. D37 values (the dose at which 37% of the control level of incorporation remains) obtained from this procedure showed the same relativemore » sensitivity of normal and xeroderma pigmentosum fibroblasts as was obtained by colony formation. Untransformed and SV40-transformed fibroblasts, which have different growth rates and different responses to high cell densities, gave different D37 values by this assay in culture trays as compared with colony formation. Comparison of relative sensitivities to irradiation should therefore be made only between cell types with similar growth characteristics. The similar sensitivity of normal and xeroderma pigmentosum cells to mitomycin C was also determined by this culture tray method. By increasing cell density at the beginning of the experiments, a greater capacity of group C compared with group D fibroblasts for recovery from potentially lethal damage was also detected.« less

Comparison of the compact dry TC method with the standard method ISO 21149:2006 for determining aerobic colony counts in cosmetic emulsion.

PubMed

De Vaugelade, S; Aime, M; Farcette, N; Maurel, E; Lacour, T; Thomas, C; Bouchonnet, S; Pirnay, S

2017-02-01

Compact Dry TC, a rapid method kit for determining aerobic colony counts, has been developed by Nissui Pharmaceutical Co. for food application. These plates are pre-sterilized and contain culture medium, a cold-soluble gelling agent and a colour redox indicator for rapid enumeration. In this study, the alternative method is compared with the standard method ISO 21149:2006 - Cosmetic - Microbiology - Enumeration and detection of aerobic mesophilic bacteria, for cosmetic emulsions application. An oil-in-water (o/w) cosmetic emulsion was contaminated with a pool of bacterial strains (Escherichia coli ATCC 8739, Staphylococcus aureus ATCC 6538 and Pseudomonas aeruginosa ATCC 9027). One millilitre of samples was spread on agar as described in ISO 21149. The colonies were enumerated after 3 days of incubation. At the same time, 1.2 mL samples were spread on Compact Dry TC kits. The kit was incubated at 35°C ± 1°C for 48 h, and the colonies were enumerated. Accuracy determination was carried out using six replicates at four levels of concentrations (10, 50, 100 and 250 CFU mL -1 ). The repeatability study was carried out using 12 replicates at four levels of concentrations (10, 50, 100 and 250 CFU mL -1 ). Variations relative to the analyst and to the batch of emulsion have been investigated. The linear correlation coefficients of Compact Dry TC Kit enumeration with standard method ISO 21149:2006 was 0.9999. In comparison study, no apparent differences were noted between the Compact Dry TC kit and the reference method ISO 21149, for the detection level of aerobic microorganisms. Relative accuracy, repeatability and intermediate precision studies were acceptable. In the repeatability study, the Shapiro-Wilk test has confirmed the normally distribution of the twelve assays. No significant variations in Compact Dry TC count results were observed with different analysts and different batches of emulsion. The results showed that the two compared methods 'Compact Dry TC' vs. 'conventional pour plate' performed equally well. Demonstration was achieved that the Compact Dry TC method may constitute a useful alternative tool for rapid enumeration of aerobic mesophilic bacteria in cosmetic emulsions. © 2016 Society of Cosmetic Scientists and the Société Française de Cosmétologie.

Simulation of Bacillus subtilis biofilm growth on agar plate by diffusion-reaction based continuum model

NASA Astrophysics Data System (ADS)

Zhang, Xianlong; Wang, Xiaoling; Nie, Kai; Li, Mingpeng; Sun, Qingping

2016-08-01

Various species of bacteria form highly organized spatially-structured aggregates known as biofilms. To understand how microenvironments impact biofilm growth dynamics, we propose a diffusion-reaction continuum model to simulate the formation of Bacillus subtilis biofilm on an agar plate. The extended finite element method combined with level set method are employed to perform the simulation, numerical results show the quantitative relationship between colony morphologies and nutrient depletion over time. Considering that the production of polysaccharide in wild-type cells may enhance biofilm spreading on the agar plate, we inoculate mutant colony incapable of producing polysaccharide to verify our results. Predictions of the glutamate source biofilm’s shape parameters agree with the experimental mutant colony better than that of glycerol source biofilm, suggesting that glutamate is rate limiting nutrient for Bacillus subtilis biofilm growth on agar plate, and the diffusion-limited is a better description to the experiment. In addition, we find that the diffusion time scale is of the same magnitude as growth process, and the common-employed quasi-steady approximation is not applicable here.

Simulation of Bacillus subtilis biofilm growth on agar plate by diffusion-reaction based continuum model.

PubMed

Zhang, Xianlong; Wang, Xiaoling; Nie, Kai; Li, Mingpeng; Sun, Qingping

2016-07-19

Various species of bacteria form highly organized spatially-structured aggregates known as biofilms. To understand how microenvironments impact biofilm growth dynamics, we propose a diffusion-reaction continuum model to simulate the formation of Bacillus subtilis biofilm on an agar plate. The extended finite element method combined with level set method are employed to perform the simulation, numerical results show the quantitative relationship between colony morphologies and nutrient depletion over time. Considering that the production of polysaccharide in wild-type cells may enhance biofilm spreading on the agar plate, we inoculate mutant colony incapable of producing polysaccharide to verify our results. Predictions of the glutamate source biofilm's shape parameters agree with the experimental mutant colony better than that of glycerol source biofilm, suggesting that glutamate is rate limiting nutrient for Bacillus subtilis biofilm growth on agar plate, and the diffusion-limited is a better description to the experiment. In addition, we find that the diffusion time scale is of the same magnitude as growth process, and the common-employed quasi-steady approximation is not applicable here.

Generation of organized germ layers from a single mouse embryonic stem cell.

PubMed

Poh, Yeh-Chuin; Chen, Junwei; Hong, Ying; Yi, Haiying; Zhang, Shuang; Chen, Junjian; Wu, Douglas C; Wang, Lili; Jia, Qiong; Singh, Rishi; Yao, Wenting; Tan, Youhua; Tajik, Arash; Tanaka, Tetsuya S; Wang, Ning

2014-05-30

Mammalian inner cell mass cells undergo lineage-specific differentiation into germ layers of endoderm, mesoderm and ectoderm during gastrulation. It has been a long-standing challenge in developmental biology to replicate these organized germ layer patterns in culture. Here we present a method of generating organized germ layers from a single mouse embryonic stem cell cultured in a soft fibrin matrix. Spatial organization of germ layers is regulated by cortical tension of the colony, matrix dimensionality and softness, and cell-cell adhesion. Remarkably, anchorage of the embryoid colony from the 3D matrix to collagen-1-coated 2D substrates of ~1 kPa results in self-organization of all three germ layers: ectoderm on the outside layer, mesoderm in the middle and endoderm at the centre of the colony, reminiscent of generalized gastrulating chordate embryos. These results suggest that mechanical forces via cell-matrix and cell-cell interactions are crucial in spatial organization of germ layers during mammalian gastrulation. This new in vitro method could be used to gain insights on the mechanisms responsible for the regulation of germ layer formation.

Battery control system for hybrid vehicle and method for controlling a hybrid vehicle battery

DOEpatents

Bockelmann, Thomas R [Battle Creek, MI; Hope, Mark E [Marshall, MI; Zou, Zhanjiang [Battle Creek, MI; Kang, Xiaosong [Battle Creek, MI

2009-02-10

A battery control system for hybrid vehicle includes a hybrid powertrain battery, a vehicle accessory battery, and a prime mover driven generator adapted to charge the vehicle accessory battery. A detecting arrangement is configured to monitor the vehicle accessory battery's state of charge. A controller is configured to activate the prime mover to drive the generator and recharge the vehicle accessory battery in response to the vehicle accessory battery's state of charge falling below a first predetermined level, or transfer electrical power from the hybrid powertrain battery to the vehicle accessory battery in response to the vehicle accessory battery's state of charge falling below a second predetermined level. The invention further includes a method for controlling a hybrid vehicle powertrain system.

A Sub-filter Scale Noise Equation far Hybrid LES Simulations

NASA Technical Reports Server (NTRS)

Goldstein, Marvin E.

2006-01-01

Hybrid LES/subscale modeling approaches have an important advantage over the current noise prediction methods in that they only involve modeling of the relatively universal subscale motion and not the configuration dependent larger scale turbulence . Previous hybrid approaches use approximate statistical techniques or extrapolation methods to obtain the requisite information about the sub-filter scale motion. An alternative approach would be to adopt the modeling techniques used in the current noise prediction methods and determine the unknown stresses from experimental data. The present paper derives an equation for predicting the sub scale sound from information that can be obtained with currently available experimental procedures. The resulting prediction method would then be intermediate between the current noise prediction codes and previously proposed hybrid techniques.

Methods for excluding cliff swallows from nesting on highway structures.

DOT National Transportation Integrated Search

2009-08-01

Cliff swallows (Petrochelidon pyrrhonota) are colonially breeding migratory birds that frequently nest on highway : structures. Protected by the Migratory Bird Treaty Act of 1918, nesting control methods cannot harm swallows or active : nests. This c...

Rapid detection of meticillin-resistant Staphylococcus aureus bacteraemia using combined three-hour short-incubation matrix-assisted laser desorption/ionization time-of-flight MS identification and Alere Culture Colony PBP2a detection test.

PubMed

Delport, Johannes Andries; Mohorovic, Ivor; Burn, Sandi; McCormick, John Kenneth; Schaus, David; Lannigan, Robert; John, Michael

2016-07-01

Meticillin-resistant Staphylococcus aureus (MRSA) bloodstream infection is responsible for significant morbidity, with mortality rates as high as 60 % if not treated appropriately. We describe a rapid method to detect MRSA in blood cultures using a combined three-hour short-incubation BRUKER matrix-assisted laser desorption/ionization time-of-flight MS BioTyper protocol and a qualitative immunochromatographic assay, the Alere Culture Colony Test PBP2a detection test. We compared this combined method with a molecular method detecting the nuc and mecA genes currently performed in our laboratory. One hundred and seventeen S. aureus blood cultures were tested of which 35 were MRSA and 82 were meticillin-sensitive S. aureus (MSSA). The rapid combined test correctly identified 100 % (82/82) of the MSSA and 85.7 % (30/35) of the MRSA after 3 h. There were five false negative results where the isolates were correctly identified as S. aureus, but PBP2a was not detected by the Culture Colony Test. The combined method has a sensitivity of 87.5 %, specificity of 100 %, a positive predictive value of 100 % and a negative predictive value of 94.3 % with the prevalence of MRSA in our S. aureus blood cultures. The combined rapid method offers a significant benefit to early detection of MRSA in positive blood cultures.

Optimization the mechanical properties of coir-luffa cylindrica filled hybrid composites by using Taguchi method

NASA Astrophysics Data System (ADS)

Krishnudu, D. Mohana; Sreeramulu, D.; Reddy, P. Venkateshwar

2018-04-01

In the current study mechanical properties of particles filled hybrid composites have been studied. The mechanical properties of the hybrid composite mainly depend on the proportions of the coir weight, Luffa weight and filler weight. RSM along with Taguchi method have been applied to find the optimized parameters of the hybrid composites. From the current study it was observed that the tensile strength of the composite mainly depends on the coir percent than the other two particles.