Clinical comparison of overlapping deletions of 19p13.3.

PubMed

Risheg, Hiba; Pasion, Romela; Sacharow, Stephanie; Proud, Virginia; Immken, LaDonna; Schwartz, Stuart; Tepperberg, Jim H; Papenhausen, Peter; Tan, Tiong Y; Andrieux, Joris; Plessis, Ghislaine; Amor, David J; Keitges, Elisabeth A

2013-05-01

We present three patients with overlapping interstitial deletions of 19p13.3 identified by high resolution SNP microarray analysis. All three had a similar phenotype characterized by intellectual disability or developmental delay, structural heart abnormalities, large head relative to height and weight or macrocephaly, and minor facial anomalies. Deletion sizes ranged from 792 Kb to 1.0 Mb and included a common region arr [hg19] 19p13.3 (3,814,392-4,136,989), containing eight genes: ZFR2, ATCAY, NMRK2, DAPK3, EEF2, PIAS4, ZBTB7A, MAP2K2, and two non-coding RNA's MIR637 and SNORDU37. The patient phenotypes were compared with three previous single patient reports with similar interstitial 19p13.3 deletions and six additional patients from the DECIPHER and ISCA databases to determine if a common haploinsufficient phenotype for the region can be established. Copyright © 2013 Wiley Periodicals, Inc.

Relatively low proportion of dystrophin gene deletions in Israeili Duchenne and Becker muscular dystrophy patients

DOE Office of Scientific and Technical Information (OSTI.GOV)

Shomrat, R.; Gluck, E.; Legum, C.

1994-02-15

Duchenne muscular dystrophy (DMD) and Becker muscular dystrophy (BMD) are allelic disorders caused by mutations in the X-linked dystrophin gene. The most common mutations in western populations are deletions that are spread non-randomly throughout the gene. Molecular analysis of the dystrophin gene structure by hybridization of the full length cDNA to Southern blots and by PCR in 62 unrelated Israeli male DMD/BMD patients showed deletions in 23 (37%). This proportion is significantly lower than that found in European and North American populations (55-65%). Seventy-eight percent of the deletions were confined to exons 44-52, half of these exons 44-45, and themore » remaining 22% to exons 1 and 19. There was no correlation between the size of the deletion and the severity of the disease. All the deletions causing frameshift resulted in the DMD phenotypes. 43 refs., 1 fig., 1 tab.« less

DMD mutation spectrum analysis in 613 Chinese patients with dystrophinopathy.

PubMed

Guo, Ruolan; Zhu, Guosheng; Zhu, Huimin; Ma, Ruiyu; Peng, Ying; Liang, Desheng; Wu, Lingqian

2015-08-01

Dystrophinopathy is a group of inherited diseases caused by mutations in the DMD gene. Within the dystrophinopathy spectrum, Duchenne and Becker muscular dystrophies are common X-linked recessive disorders that mainly feature striated muscle necrosis. We combined multiplex ligation-dependent probe amplification with Sanger sequencing to detect large deletions/duplications and point mutations in the DMD gene in 613 Chinese patients. A total of 571 (93.1%) patients were diagnosed, including 428 (69.8%) with large deletions/duplications and 143 (23.3%) with point mutations. Deletion/duplication breakpoints gathered mostly in introns 44-55. Reading frame rules could explain 88.6% of deletion mutations. We identified seventy novel point mutations that had not been previously reported. Spectrum expansion and genotype-phenotype analysis of DMD mutations on such a large sample size in Han Chinese population would provide new insights into the pathogenic mechanism underlying dystrophinopathies.

Analysis of chromosome 22q11 copy number variations by multiplex ligation-dependent probe amplification for prenatal diagnosis of congenital heart defect.

PubMed

Zhang, Jingjing; Ma, Dingyuan; Wang, Yan; Cao, Li; Wu, Yun; Qiao, Fengchang; Liu, An; Li, Li; Lin, Ying; Liu, Gang; Liu, Cuiyun; Hu, Ping; Xu, Zhengfeng

2015-01-01

Congenital heart defects (CHD) represent one of the most common birth defects. This study aimed to evaluate the value of multiplex ligation-dependent probe amplification (MLPA) as a tool to detect the copy number variations (CNVs) of 22q11 in fetuses with CHD. A large cohort of 225 fetuses with CHD was screened by fetal echocardiography. Once common chromosome abnormalities in 30 fetuses were screened out by conventional G-banding analysis, the CNVs of chromosome 22q11 in the remaining 195 fetuses were determined by MLPA for prenatal genetic counseling. In 195 CHD fetuses with normal karyotype, 11 cases had pathological CNVs, including 22q11.2 deletion (seven cases), the deletion of 22q11 cat eye syndrome (CES) region (one case), 22q11.2 duplication (one case), 22q13.3 deletion (one case) and 17p13.3 deletion (one case). In total, our findings from MLPA screening represented 4.9 % in our cohort. Among these, three cases were inherited CNVs, and eight cases were de novo. These CNVs were further verified by single nucleotide polymorphism (SNP)-array analysis, and their chromosomal location was refined. This study indicated that MLPA could serve as an effective test for routine prenatal diagnosis of 22q11 in fetuses with CHD.

Germline APOBEC3B deletion is associated with breast cancer risk in an Asian multi-ethnic cohort and with immune cell presentation.

PubMed

Wen, Wei Xiong; Soo, Jaslyn Sian-Siu; Kwan, Pui Yoke; Hong, Elaine; Khang, Tsung Fei; Mariapun, Shivaani; Lee, Christine Shu-Mei; Hasan, Siti Norhidayu; Rajadurai, Pathmanathan; Yip, Cheng Har; Mohd Taib, Nur Aishah; Teo, Soo Hwang

2016-05-27

APOBEC3B is a cytosine deaminase implicated in immune response to viral infection, cancer predisposition and carcinogenesis. Germline APOBEC3B deletion is more common in East Asian women and confers a modest risk to breast cancer in both East Asian and Caucasian women. Analysis of tumour samples from women of European descent has shown that germline APOBEC3B deletion is associated with an increased propensity to develop somatic mutations and with an enrichment for immune response-related gene sets. However, this has not been examined in Asian tumour samples, where population differences in genetic and dietary factors may have an impact on the immune system. In this study, we determined the prevalence of germline APOBEC3B deletion and its association with breast cancer risk in a cross-sectional hospital-based Asian multi-ethnic cohort of 1451 cases and 1442 controls from Malaysia. We compared gene expression profiles of breast cancers arising from APOBEC3B deletion carriers and non-carriers using microarray analyses. Finally, we characterised the overall abundance of tumour-infiltrating immune cells in breast cancers from TCGA and METABRIC using ESTIMATE and relative frequency of 22 immune cell subsets in breast cancers from METABRIC using CIBERSORT. The minor allelic frequency of APOBEC3B deletion was estimated to be 0.35, 0.42 and 0.16 in female populations of Chinese, Malay and Indian descent, respectively, and that germline APOBEC3B deletion was associated with breast cancer risk with odds ratios of 1.23 (95 % CI: [1.05, 1.44]) for one-copy deletion and 1.38 (95 % CI: [1.10, 1.74]) for two-copy deletion compared to women with no deletion. Germline APOBEC3B deletion was not associated with any clinicopathologic features or the expression of any APOBEC family members but was associated with immune response-related gene sets (FDR q values < 0.05). Analysis of breast cancers from METABRIC revealed breast cancers from APOBEC3B deletion carriers to have significantly higher abundance of tumour-infiltrating immune cells (P < 0.001). Taken together, our data suggests that tumour-infiltrating immune cells may be an important feature of breast cancers arising in women with APOBEC3B germline deletion, and that this may be of particular interest in Asian women where the germline deletion is more common.

Molecular definition of 22q11 deletions in 151 velo-cardio-facial syndrome patients.

PubMed Central

Carlson, C; Sirotkin, H; Pandita, R; Goldberg, R; McKie, J; Wadey, R; Patanjali, S R; Weissman, S M; Anyane-Yeboa, K; Warburton, D; Scambler, P; Shprintzen, R; Kucherlapati, R; Morrow, B E

1997-01-01

Velo-cardio-facial syndrome (VCFS) is a relatively common developmental disorder characterized by craniofacial anomalies and conotruncal heart defects. Many VCFS patients have hemizygous deletions for a part of 22q11, suggesting that haploinsufficiency in this region is responsible for its etiology. Because most cases of VCFS are sporadic, portions of 22q11 may be prone to rearrangement. To understand the molecular basis for chromosomal deletions, we defined the extent of the deletion, by genotyping 151 VCFS patients and performing haplotype analysis on 105, using 15 consecutive polymorphic markers in 22q11. We found that 83% had a deletion and >90% of these had a similar approximately 3 Mb deletion, suggesting that sequences flanking the common breakpoints are susceptible to rearrangement. We found no correlation between the presence or size of the deletion and the phenotype. To further define the chromosomal breakpoints among the VCFS patients, we developed somatic hybrid cell lines from a set of VCFS patients. An 11-kb resolution physical map of a 1,080-kb region that includes deletion breakpoints was constructed, incorporating genes and expressed sequence tags (ESTs) isolated by the hybridization selection method. The ordered markers were used to examine the two separated copies of chromosome 22 in the somatic hybrid cell lines. In some cases, we were able to map the chromosome breakpoints within a single cosmid. A 480-kb critical region for VCFS has been delineated, including the genes for GSCL, CTP, CLTD, HIRA, and TMVCF, as well as a number of novel ordered ESTs. PMID:9326327

Prenatal diagnosis of two fetuses with deletions of 8p23.1, critical region for congenital diaphragmatic hernia and heart defects.

PubMed

Keitges, Elisabeth A; Pasion, Romela; Burnside, Rachel D; Mason, Carla; Gonzalez-Ruiz, Antonio; Dunn, Teresa; Masiello, Meredith; Gebbia, Joseph A; Fernandez, Carlos O; Risheg, Hiba

2013-07-01

Microdeletions of 8p23.1 are mediated by low copy repeats and can cause congenital diaphragmatic hernia (CDH) and cardiac defects. Within this region, point mutations of the GATA4 gene have been shown to cause cardiac defects. However, the cause of CDH in these deletions has been difficult to determine due to the paucity of mutations that result in CDH, the lack of smaller deletions to refine the region and the reduced penetrance of CDH in these large deletions. Mice deficient for one copy of the Gata4 gene have been described with CDH and heart defects suggesting mutations in Gata4 can cause the phenotype in mice. We report on the SNP microarray analysis on two fetuses with deletions of 8p23.1. The first had CDH and a ventricular septal defect (VSD) on ultrasonography and a family history of a maternal VSD. Microarray analysis detected a 127-kb deletion which included the GATA4 and NEIL2 genes which was inherited from the mother. The second fetus had an incomplete atrioventricular canal defect on ultrasonography. Microarray analysis showed a 315-kb deletion that included seven genes, GATA4, NEIL2, FDFT1, CTSB, DEFB136, DEFB135, and DEFB134. These results suggest that haploinsufficiency of the two genes in common within 8p23.1; GATA4 and NEIL2 can cause CDH and cardiac defects in humans. Copyright © 2013 Wiley Periodicals, Inc.

[Gene Diagnosis and Analysis of Clinical Hematological Phenotype of Thailand Deleted α-Thalassemia 1].

PubMed

Lin, Na; Huang, Hai-Long; Wang, Yan; Zheng, Lin; Fang, Xiang-Qun; Cai, Mei-Ying; Wang, Lin-Shuo; Liu, He-Kun; Xu, Liang-Pu; Lin, Yuan

2016-08-01

To investigate the hematologic characteristics and gene diagnosis of patients with Thailand deleted α-thalassemia 1, so as to provide the information for clinical genetic counseling. The clinical data of 32 patients with Thailand delated α-thalassemia 1 were analyzed retrospectively; the hematologic characteristics and gene diagnosis of Thailand deleted type were investigated by using routine hematologic examination, genetic detection of common thalassemia and Thailand deleted α-thalassemia 1. Among 32 cases, the Thailand deleted α-thalassemia 1 heterozygote was found in 29 cases, the Thailand deleted α-thalassemia 1 and α(3.7) gene deletion double heterozygote were found in 1 case, the Thailand deleted α-thalassemia 1 with β-thalassemia (1 case with codons 41-42 mutation heterozygous, 1 case with CD17 mutation heterozygous) was found in 2 cases by detection. The MCV and MCH levels were decreased in all cases of Thailand deleted thalassemia 1, there were significant differences in RBC, MCV, MCH (P<0.05) between normal control and Thailand deletion α-thalassemia 1 group; there were also significant differences in MCHC (P<0.05) between Southeast asia thalassemia and Thailand deleted α-thalassemia 1 group. There are no significant differences in hematological parameters except MCHC between Southeast asia thalassemia and Thailand deleted α-thalassemia 1 group. moreover the Thailand deleted α-thalassemia 1 in a certain proportion exists in area with high incidence of thalassemia, therefor the clinicians should pay more attention to the screen and diagnosis of Thailand delated α-thalassemia and can exactly diagnose the Thailand delected α-thalassemia 1 on the basis of comprehensive analysis of conventional and Thailand delected α-thalassemia 1 detection results, clinical presentation, hematologic parameters and ultrasonic examination, so as to avoid the birth of child with severe and intermidiate type α-thalassemia caused by Thailand deleted α-thalassemia 1.

Identification of novel deletions of 15q11q13 in Angelman syndrome by array-CGH: molecular characterization and genotype-phenotype correlations.

PubMed

Sahoo, Trilochan; Bacino, Carlos A; German, Jennifer R; Shaw, Chad A; Bird, Lynne M; Kimonis, Virginia; Anselm, Irinia; Waisbren, Susan; Beaudet, Arthur L; Peters, Sarika U

2007-09-01

Angelman syndrome (AS) is a neurodevelopmental disorder characterized by mental retardation, absent speech, ataxia, and a happy disposition. Deletions of the 15q11q13 region are found in approximately 70% of AS patients. The deletions are sub-classified into class I and class II based on their sizes of approximately 6.8 and approximately 6.0, respectively, with two different proximal breakpoints and a common distal breakpoint. Utilizing a chromosome 15-specific comparative genomic hybridization genomic microarray (array-CGH), we have identified, determined the deletion sizes, and mapped the breakpoints in a cohort of 44 cases, to relate those breakpoints to the genomic architecture and derive more precise genotype-phenotype correlations. Interestingly four patients of the 44 studied (9.1%) had novel and unusually large deletions, and are reported here. This is the first report of very large deletions of 15q11q13 resulting in AS; the largest deletion being >10.6 Mb. These novel deletions involve three different distal breakpoints, two of which have been earlier shown to be involved in the generation of isodicentric 15q chromosomes (idic15). Additionally, precise determination of the deletion breakpoints reveals the presence of directly oriented low-copy repeats (LCRs) flanking the recurrent and novel breakpoints. The LCRs are adequate in size, orientation, and homology to enable abnormal recombination events leading to deletions and duplications. This genomic organization provides evidence for a common mechanism for the generation of both common and rare deletion types. Larger deletions result in a loss of several genes outside the common Angelman syndrome-Prader-Willi syndrome (AS-PWS) critical interval, and a more severe phenotype.

Meta-analysis confirms the LCE3C_LCE3B deletion as a risk factor for psoriasis in several ethnic groups and finds interaction with HLA-Cw6

PubMed Central

Riveira-Munoz, Eva; He, Su-Min; Escaramís, Georgia; Stuart, Philip E; Hüffmeier, Ulrike; Lee, Catherine; Kirby, Brian; Oka, Akira; Giardina, Emiliano; Liao, Wilson; Bergboer, Judith; Kainu, Kati; de Cid, Rafael; Munkhbat, Batmunkh; Zeeuwen, Patrick L J M; Armour, John A L; Poon, Annie; Mabuchi, Tomotaka; Ozawa, Akira; Zawirska, Agnieszka; Burden, David A; Barker, Jonathan N; Capon, Francesca; Traupe, Heiko; Sun, Liang-Dan; Cui, Yong; Yin, Xian-Yong; Chen, Gang; Lim, Henry; Nair, Rajan; Voorhess, John; Tejasvi, Trilokraj; Pujol, Ramón; Munkhtuvshin, Namid; Fischer, Judith; Kere, Juha; Schalkwijk, Joost; Bowcock, Anne; Kwok, Pui-Yan; Novelli, Giuseppe; Inoko, Hidetoshi; Ryan, Anthony W; Trembath, Richard C; Reis, André; Zhang, Xue-Jun; Elder, James T; Estivill, Xavier

2012-01-01

A multicenter meta-analysis including data from 9389 psoriasis patients and 9477 control subjects was performed to investigate the contribution of the deletion of genes LCE3C and LCE3B, involved in skin barrier defense, to psoriasis susceptibility in different populations. The study confirms that the deletion of LCE3C and LCE3B is a common genetic factor for susceptibility to psoriasis in European populations [OROverall = 1.21 (1.15–1.27)], and for the first time directly demonstrated the deletion's association with psoriasis in [Chinese OR = 1.27 (1.16–1.34); Mongolian OR = 2.08 (1.44–2.99)] populations. The analysis of the HLA-Cw6 locus showed significant differences in the epistatic interaction with the LCE3C and LCE3B deletion in at least some European populations, indicating epistatic effects between these two major genetic contributors to psoriasis. The study highlights the value of examining genetic risk factors in multiple populations to identify genetic interactions, and indicates the need of further studies to understand the interaction of the skin barrier and the immune system in susceptibility to psoriasis. PMID:21107349

Submicroscopic deletions at 22q11.2: Variability of the clinical picture and delineation of a commonly deleted region

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lindsay, E.A.; Shaffer, L.G.; Greenberg, F.

DiGeorge anomaly (DGA) and velo-cardio-facial syndrome (VCFS) are frequently associated with monosomy of chromosome region 22q11. Most patients have a submicroscopic deletion, recently estimated to be at least 1-2 Mb. It is not clear whether individuals who present with only some of the features of these conditions have the deletion, and if so, whether the size of the deletion varies from those with more classic phenotypes. We have used fluorescence in situ hybridization (FISH) to assess the deletion status of 85 individuals referred to us for molecular analysis, with a wide range of DGA-like or VCFS-like clinical features. The testmore » probe used was the cosmid sc11.1, which detects two loci about 2 Mb apart in 22q11.2. Twenty-four patients carried the deletion. Of the deleted patients, most had classic DGA or VCFS phenotypes, but 6 deleted patients had mild phenotypes, including 2 with minor facial anomalies and velopharyngeal incompetence as the only presenting signs. Despite the great phenotypic variability among the deleted patients, none had a deletion smaller than the 2-Mb region defined by sc11.1. Smaller deletions were not detected in patients with particularly suggestive phenotypes who were not deleted for sc11.1, even when tested with two other probes from the DGA/VCFS region. 24 refs., 2 figs., 2 tabs.« less

Thorough analysis of unorthodox ABO deletions called by the 1000 Genomes project.

PubMed

Möller, M; Hellberg, Å; Olsson, M L

2018-02-01

ABO remains the clinically most important blood group system, but despite earlier extensive research, significant findings are still being made. The vast majority of catalogued ABO null alleles are based on the c.261delG polymorphism. Apart from c.802G>A, other mechanisms for O alleles are rare. While analysing the data set from the 1000 Genomes (1000G) project, we encountered two previously uncharacterized deletions, which needed further exploration. The Erythrogene database, complemented with bioinformatics software, was used to analyse ABO in 2504 individuals from 1000G. DNA samples from selected 1000G donors and African blood donors were examined by allele-specific PCR and Sanger sequencing to characterize predicted deletions. A 5821-bp deletion encompassing exons 5-7 was called in twenty 1000G individuals, predominantly Africans. This allele was confirmed and its exact deletion point defined by bioinformatic analyses and in vitro experiments. A PCR assay was developed, and screening of African samples revealed three donors heterozygous for this deletion, which was thereby phenotypically established as an O allele. Analysis of upstream genetic markers indicated an ancestral origin from ABO*O.01.02. We estimate this deletion as the 3rd most common mechanism behind O alleles. A 24-bp deletion was called in nine individuals and showed greater diversity regarding ethnic distribution and allelic background. It could neither be confirmed by in silico nor in vitro experiments. A previously uncharacterized ABO deletion among Africans was comprehensively mapped and a genotyping strategy devised. The false prediction of another deletion emphasizes the need for cautious interpretation of NGS data and calls for strict validation routines. © 2017 International Society of Blood Transfusion.

Phenotypic and Molecular Convergence of 2q23.1 Deletion Syndrome with Other Neurodevelopmental Syndromes Associated with Autism Spectrum Disorder

PubMed Central

Mullegama, Sureni V.; Alaimo, Joseph T.; Chen, Li; Elsea, Sarah H.

2015-01-01

Roughly 20% of autism spectrum disorders (ASD) are syndromic with a well-established genetic cause. Studying the genes involved can provide insight into the molecular and cellular mechanisms of ASD. 2q23.1 deletion syndrome (causative gene, MBD5) is a recently identified genetic neurodevelopmental disorder associated with ASD. Mutations in MBD5 have been found in ASD cohorts. In this study, we provide a phenotypic update on the prevalent features of 2q23.1 deletion syndrome, which include severe intellectual disability, seizures, significant speech impairment, sleep disturbance, and autistic-like behavioral problems. Next, we examined the phenotypic, molecular, and network/pathway relationships between nine neurodevelopmental disorders associated with ASD: 2q23.1 deletion Rett, Angelman, Pitt-Hopkins, 2q23.1 duplication, 5q14.3 deletion, Kleefstra, Kabuki make-up, and Smith-Magenis syndromes. We show phenotypic overlaps consisting of intellectual disability, speech delay, seizures, sleep disturbance, hypotonia, and autistic-like behaviors. Molecularly, MBD5 possibly regulates the expression of UBE3A, TCF4, MEF2C, EHMT1 and RAI1. Network analysis reveals that there could be indirect protein interactions, further implicating function for these genes in common pathways. Further, we show that when MBD5 and RAI1 are haploinsufficient, they perturb several common pathways that are linked to neuronal and behavioral development. These findings support further investigations into the molecular and pathway relationships among genes linked to neurodevelopmental disorders and ASD, which will hopefully lead to common points of regulation that may be targeted toward therapeutic intervention. PMID:25853262

Proteomic profiling of a mouse model of acute intestinal Apc deletion leads to identification of potential novel biomarkers of human colorectal cancer (CRC).

PubMed

Hammoudi, Abeer; Song, Fei; Reed, Karen R; Jenkins, Rosalind E; Meniel, Valerie S; Watson, Alastair J M; Pritchard, D Mark; Clarke, Alan R; Jenkins, John R

2013-10-25

Colorectal cancer (CRC) is the fourth most common cause of cancer-related death worldwide. Accurate non-invasive screening for CRC would greatly enhance a population's health. Adenomatous polyposis coli (Apc) gene mutations commonly occur in human colorectal adenomas and carcinomas, leading to Wnt signalling pathway activation. Acute conditional transgenic deletion of Apc in murine intestinal epithelium (AhCre(+)Apc(fl)(/)(fl)) causes phenotypic changes similar to those found during colorectal tumourigenesis. This study comprised a proteomic analysis of murine small intestinal epithelial cells following acute Apc deletion to identify proteins that show altered expression during human colorectal carcinogenesis, thus identifying proteins that may prove clinically useful as blood/serum biomarkers of colorectal neoplasia. Eighty-one proteins showed significantly increased expression following iTRAQ analysis, and validation of nine of these by Ingenuity Pathaway Analysis showed they could be detected in blood or serum. Expression was assessed in AhCre(+)Apc(fl)(/)(fl) small intestinal epithelium by immunohistochemistry, western blot and quantitative real-time PCR; increased nucelolin concentrations were also detected in the serum of AhCre(+)Apc(fl)(/)(fl) and Apc(Min)(/)(+) mice by ELISA. Six proteins; heat shock 60kDa protein 1, Nucleolin, Prohibitin, Cytokeratin 18, Ribosomal protein L6 and DEAD (Asp-Glu-Ala-Asp) box polypeptide 5,were selected for further investigation. Increased expression of 4 of these was confirmed in human CRC by qPCR. In conclusion, several novel candidate biomarkers have been identified from analysis of transgenic mice in which the Apc gene was deleted in the intestinal epithelium that also showed increased expression in human CRC. Some of these warrant further investigation as potential serum-based biomarkers of human CRC. Copyright © 2013 Elsevier Inc. All rights reserved.

Mucopolysaccharidosis type IVA: Common double deletion in the N-Acetylgalactosamine-6-sulfatase gene (GALNS)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hori, Toshinori; Tomatsu, Shunji; Fukuda, Seiji

1995-04-10

Mucopolysaccharidosis IVA (MPS IVA) is an autosomal recessive disorder caused by a deficiency in N-acetylgalactosamine-6-sulfatase (GALNS). We found two separate deletions of nearly 8.0 and 6.0 kb in the GALNS gene, including some exons. There are Alu repetitive elements near the breakpoints of the 8.0-kb deletion, and this deletion resulted from an Alu-Alu recombination. The other 6.0-kb deletion involved illegitimate recombinational events between incomplete short direct repeats of 8 bp at deletion breakpoints. The same rearrangement has been observed in a heteroallelic state in four unrelated patients. This is the first documentation of a common double deletion a gene thatmore » is not a member of a gene cluster. 39 refs., 5 figs.« less

Weak D caused by a founder deletion in the RHD gene.

PubMed

Fichou, Yann; Chen, Jian-Min; Le Maréchal, Cédric; Jamet, Déborah; Dupont, Isabelle; Chuteau, Claude; Durousseau, Cécile; Loirat, Marie-Jeanne; Bailly, Pascal; Férec, Claude

2012-11-01

The RhD blood group system exemplifies a genotype-phenotype correlation by virtue of its highly polymorphic and immunogenic nature. Weak D phenotypes are generally thought to result from missense mutations leading to quantitative change of the D antigen in the red blood cell membrane or intracellularly. Different sets of polymerase chain reaction primers were designed to map and clone a deletion involving RHD Exon 10, which was found in approximately 3% of approximately 2000 RHD hemizygous subjects with D phenotype ambiguity. D antigen density was measured by flow cytometry. Transcript analysis was carried out by 3'-rapid amplification of complementary DNA ends. Haplotype analysis was performed by microsatellite genotyping. A 5405-bp deletion that removed nearly two-thirds of Intron 9 and almost all of Exon 10 of the RHD gene was characterized. It is predicted to result in the replacement of the last eight amino acids of the wild-type RhD protein by another four amino acids. The mean RhD antigen density from two deletion carriers was determined to be only 30. A consensus haplotype could be deduced from the deletion carriers based on the microsatellite genotyping data. The currently reported deletion was derived from a common founder. This deletion appears to represent not only the first large deletion associated with weak D but also the weakest of weak D alleles so far reported. This highly unusual genotype-phenotype relationship may be attributable to the additive effect of three distinct mechanisms that affect mRNA formation, mRNA stability, and RhD/ankyrin-R interaction, respectively. © 2012 American Association of Blood Banks.

ABCA7 frameshift deletion associated with Alzheimer disease in African Americans

PubMed Central

Cukier, Holly N.; Kunkle, Brian W.; Vardarajan, Badri N.; Rolati, Sophie; Hamilton-Nelson, Kara L.; Kohli, Martin A.; Whitehead, Patrice L.; Dombroski, Beth A.; Van Booven, Derek; Lang, Rosalyn; Dykxhoorn, Derek M.; Farrer, Lindsay A.; Cuccaro, Michael L.; Vance, Jeffery M.; Gilbert, John R.; Beecham, Gary W.; Martin, Eden R.; Carney, Regina M.; Mayeux, Richard; Schellenberg, Gerard D.; Byrd, Goldie S.; Haines, Jonathan L.

2016-01-01

Objective: To identify a causative variant(s) that may contribute to Alzheimer disease (AD) in African Americans (AA) in the ATP-binding cassette, subfamily A (ABC1), member 7 (ABCA7) gene, a known risk factor for late-onset AD. Methods: Custom capture sequencing was performed on ∼150 kb encompassing ABCA7 in 40 AA cases and 37 AA controls carrying the AA risk allele (rs115550680). Association testing was performed for an ABCA7 deletion identified in large AA data sets (discovery n = 1,068; replication n = 1,749) and whole exome sequencing of Caribbean Hispanic (CH) AD families. Results: A 44-base pair deletion (rs142076058) was identified in all 77 risk genotype carriers, which shows that the deletion is in high linkage disequilibrium with the risk allele. The deletion was assessed in a large data set (531 cases and 527 controls) and, after adjustments for age, sex, and APOE status, was significantly associated with disease (p = 0.0002, odds ratio [OR] = 2.13 [95% confidence interval (CI): 1.42–3.20]). An independent data set replicated the association (447 cases and 880 controls, p = 0.0117, OR = 1.65 [95% CI: 1.12–2.44]), and joint analysis increased the significance (p = 1.414 × 10−5, OR = 1.81 [95% CI: 1.38–2.37]). The deletion is common in AA cases (15.2%) and AA controls (9.74%), but in only 0.12% of our non-Hispanic white cohort. Whole exome sequencing of multiplex, CH families identified the deletion cosegregating with disease in a large sibship. The deleted allele produces a stable, detectable RNA strand and is predicted to result in a frameshift mutation (p.Arg578Alafs) that could interfere with protein function. Conclusions: This common ABCA7 deletion could represent an ethnic-specific pathogenic alteration in AD. PMID:27231719

4p16.3 microdeletions and microduplications detected by chromosomal microarray analysis: New insights into mechanisms and critical regions.

PubMed

Bi, Weimin; Cheung, Sau-Wai; Breman, Amy M; Bacino, Carlos A

2016-10-01

Deletions in the 4p16.3 region cause Wolf-Hirschhorn syndrome, a well known contiguous microdeletion syndrome with the critical region for common phenotype mapped in WHSCR2. Recently, duplications in 4p16.3 were reported in three patients with developmental delay and dysmorphic features. Through chromosomal microarray analysis, we identified 156 patients with a deletion (n = 109) or duplication (n = 47) in 4p16.3 out of approximately 60,000 patients analyzed by Baylor Miraca Genetics Laboratories. Seventy-five of the postnatally detected deletions encompassed the entire critical region, 32 (43%) of which were associated with other chromosome rearrangements, including six patients (8%) that had a duplication adjacent to the terminal deletion. Our data indicate that Wolf-Hirschhorn syndrome deletions with an adjacent duplication occur at a higher frequency than previously appreciated. Pure deletions (n = 14) or duplications (n = 15) without other copy number changes distal to or inside the WHSCR2 were identified for mapping of critical regions. Our data suggest that deletion of the segment from 0.6 to 0.9 Mb from the terminus of 4p causes a seizure phenotype and duplications of a region distal to the previously defined smallest region of overlap for 4p16.3 microduplication syndrome are associated with neurodevelopmental problems. We detected seven Wolf-Hirschhorn syndrome deletions and one 4p16.3 duplication prenatally; all of the seven are either >8 Mb in size and/or associated with large duplications. In conclusion, our study provides deeper insight into the molecular mechanisms, the critical regions and effective prenatal diagnosis for 4p16.3 deletions/ duplications. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

Molecular analyses of 17p11.2 deletions in 62 Smith-Magenis syndrome patients

DOE Office of Scientific and Technical Information (OSTI.GOV)

Juyal, R.C.; Figuera, L.E.; Hauge, X.

1996-05-01

Smith-Magenis syndrome (SMS) is a clinically recognizable, multiple congenital anomalies/mental retardation syndrome caused by an interstitial deletion involving band p11.2 of chromosome 17. Toward the molecular definition of the interval defining this microdeletion syndrome, 62 unrelated SMS patients in conjunction with 70 available unaffected parents were molecularly analyzed with respect to the presence or absence of 14 loci in the proximal region of the short arm of chromosome 17. A multifaceted approach was used to determine deletion status at the various loci that combined (1) FISH analysis, (2) PCR and Southern analysis of somatic cell hybrids retaining the deleted chromosomemore » 17 from selected patients, and (3) genotype determination of patients for whom a parent(s) was available at four microsatellite marker loci and at four loci with associated RFLPs. The relative order of two novel anonymous markers and a new microsatellite marker was determined in 17p11.2. The results confirmed that the proximal deletion breakpoint in the majority of SMS patients is located between markers D17S58 (EW301) and D17S446 (FG1) within the 17p11.1-17p11.2 region. The common distal breakpoint was mapped between markers cCI17-638, which lies distal to D17S71, and cCI17-498, which lies proximal to the Charcot Marie-Tooth disease type 1A locus. The locus D17S258 was found to be deleted in all 62 patients, and probes from this region can be used for diagnosis of the SMS deletion by FISH. Ten patients demonstrated molecularly distinct deletions; of these, two patients had smaller deletions and will enable the definition of the critical interval for SMS. 49 refs.« less

A Comparison of Missing-Data Procedures for Arima Time-Series Analysis

ERIC Educational Resources Information Center

Velicer, Wayne F.; Colby, Suzanne M.

2005-01-01

Missing data are a common practical problem for longitudinal designs. Time-series analysis is a longitudinal method that involves a large number of observations on a single unit. Four different missing-data methods (deletion, mean substitution, mean of adjacent observations, and maximum likelihood estimation) were evaluated. Computer-generated…

Combined pituitary hormone deficiency (CPHD) due to a complete PROP1 deletion.

PubMed

Abrão, M G; Leite, M V; Carvalho, L R; Billerbeck, A E C; Nishi, M Y; Barbosa, A S; Martin, R M; Arnhold, I J P; Mendonca, B B

2006-09-01

PROP1 mutations are the most common cause of genetic combined pituitary hormone deficiency (CPHD). The aim of this study was to investigate the PROP1 gene in two siblings with CPHD. Pituitary function and imaging assessment and molecular analysis of PROP1. Two siblings, born to consanguineous parents, presented with GH deficiency associated with other pituitary hormone deficiencies (TSH, PRL and gonadotrophins). The male sibling also had an evolving cortisol deficiency. Pituitary size was evaluated by magnetic resonance imaging (MRI). PROP1 gene analysis was performed by polymerase chain reaction (PCR), automatic sequencing and Southern blotting. Amplification of sequence tag sites (STS) and the Q8N6H0 gene flanking PROP1 were performed to define the extension of PROP1 deletion. MRI revealed a hypoplastic anterior pituitary in the girl at 14 years and pituitary enlargement in the boy at 18 years. The PROP1 gene failed to amplify in both siblings, whereas other genes were amplified. Southern blotting analysis revealed the PROP1 band in the controls and confirmed complete PROP1 deletion in both siblings. The extension of the deletion was 18.4 kb. The region flanking PROP1 contains several Alu core sequences that might have facilitated stem-loop-mediated excision of PROP1. We report here a complete deletion of PROP1 in two siblings with CPHD phenotype.

A common cognitive, psychiatric, and dysmorphic phenotype in carriers of NRXN1 deletion

PubMed Central

Viñas-Jornet, Marina; Esteba-Castillo, Susanna; Gabau, Elisabeth; Ribas-Vidal, Núria; Baena, Neus; San, Joan; Ruiz, Anna; Coll, Maria Dolors; Novell, Ramon; Guitart, Miriam

2014-01-01

Deletions in the 2p16.3 region that includes the neurexin (NRXN1) gene are associated with intellectual disability and various psychiatric disorders, in particular, autism and schizophrenia. We present three unrelated patients, two adults and one child, in whom we identified an intragenic 2p16.3 deletion within the NRXN1 gene using an oligonucleotide comparative genomic hybridization array. The three patients presented dual diagnosis that consisted of mild intellectual disability and autism and bipolar disorder. Also, they all shared a dysmorphic phenotype characterized by a long face, deep set eyes, and prominent premaxilla. Genetic analysis of family members showed two inherited deletions. A comprehensive neuropsychological examination of the 2p16.3 deletion carriers revealed the same phenotype, characterized by anxiety disorder, borderline intelligence, and dysexecutive syndrome. The cognitive pattern of dysexecutive syndrome with poor working memory and reduced attention switching, mental flexibility, and verbal fluency was the same than those of the adult probands. We suggest that in addition to intellectual disability and psychiatric disease, NRXN1 deletion is a risk factor for a characteristic cognitive and dysmorphic profile. The new cognitive phenotype found in the 2p16.3 deletion carriers suggests that 2p16.3 deletions might have a wide variable expressivity instead of incomplete penetrance. PMID:25614873

PTEN genomic deletion predicts prostate cancer recurrence and is associated with low AR expression and transcriptional activity

PubMed Central

2012-01-01

Background Prostate cancer (PCa), a leading cause of cancer death in North American men, displays a broad range of clinical outcome from relatively indolent to lethal metastatic disease. Several genomic alterations have been identified in PCa which may serve as predictors of progression. PTEN, (10q23.3), is a negative regulator of the phosphatidylinositol 3-kinase (PIK3)/AKT survival pathway and a tumor suppressor frequently deleted in PCa. The androgen receptor (AR) signalling pathway is known to play an important role in PCa and its blockade constitutes a commonly used treatment modality. In this study, we assessed the deletion status of PTEN along with AR expression levels in 43 primary PCa specimens with clinical follow-up. Methods Fluorescence In Situ Hybridization (FISH) was done on formalin fixed paraffin embedded (FFPE) PCa samples to examine the deletion status of PTEN. AR expression levels were determined using immunohistochemistry (IHC). Results Using FISH, we found 18 cases of PTEN deletion. Kaplan-Meier analysis showed an association with disease recurrence (P=0.03). Concurrently, IHC staining for AR found significantly lower levels of AR expression within those tumors deleted for PTEN (P<0.05). To validate these observations we interrogated a copy number alteration and gene expression profiling dataset of 64 PCa samples, 17 of which were PTEN deleted. We confirmed the predictive value of PTEN deletion in disease recurrence (P=0.03). PTEN deletion was also linked to diminished expression of PTEN (P<0.01) and AR (P=0.02). Furthermore, gene set enrichment analysis revealed a diminished expression of genes downstream of AR signalling in PTEN deleted tumors. Conclusions Altogether, our data suggest that PTEN deleted tumors expressing low levels of AR may represent a worse prognostic subset of PCa establishing a challenge for therapeutic management. PMID:23171135

Molecular characterization of a polymorphic 3-Mb deletion at chromosome Yp11.2 containing the AMELY locus in Singapore and Malaysia populations.

PubMed

Yong, Rita Y Y; Gan, Linda S H; Chang, Yuet Meng; Yap, Eric P H

2007-11-01

Amelogenin paralogs on Chromosome X (AMELX) and Y (AMELY) are commonly used sexing markers. Interstitial deletion of Yp involving the AMELY locus has previously been reported. The combined frequency of the AMELY null allele in Singapore and Malaysia populations is 2.7%, 0.6% in Indian and Malay ethnic groups respectively. It is absent among 541 Chinese screened. The null allele in this study belongs to 3 Y haplogroups; J2e1 (85.7%), F* (9.5%) and D* (4.8%). Low and high-resolution STS mapping, followed by sequence analysis of breakpoint junction confirmed a large deletion of 3 to 3.7-Mb located at the Yp11.2 region. Both breakpoints were located in TSPY repeat arrays, suggesting a non-allelic homologous recombination (NAHR) mechanism of deletion. All regional null samples shared identical breakpoint sequences according to their haplogroup affiliation, providing molecular evidence of a common ancestry origin for each haplogroup, and at least 3 independent deletion events recurred in history. The estimated ages based on Y-SNP and STR analysis were approximately 13.5 +/- 3.1 kyears and approximately 0.9 +/- 0.9 kyears for the J2e1 and F* mutations, respectively. A novel polymorphism G > A at Y-GATA-H4 locus in complete linkage disequilibrium with J2e1 null mutations is a more recent event. This work re-emphasizes the need to include other sexing markers for gender determination in certain regional populations. The frequency difference among global populations suggests it constitutes another structural variation locus of human chromosome Y. The breakpoint sequences provide further information to a better understanding of the NAHR mechanism and DNA rearrangements due to higher order genomic architecture.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Merriwether, D.A.; Huston, S.L.; Bunker, C.A.

An intergenic region V Mitochondrial DNA (mtDNA) 9 bp deletion located between the genes for tRNA{sup LYS} and cytochrome oxidase II was discovered in a small percentage of Nigerian and Ivory Coast natives. Previously this deletion has been described as Asian-specific and has been reported throughout the New World, Asia, S.E. Asia, and the Pacific Islands at frequencies ranging from 0% to 100%. In the New World and the Pacific Islands, the deletion is almost always accompanied by an Hae III restriction site gain at nt 16517. All 9 occurrences of the deletion observed in Africa (from four different populations)more » co-occur with the Hae III 16517 site gain, indicating that the African deletion probably shares a common origin with the deletion described as {open_quotes}Asian-specific{close_quotes}. The deletion was found in Benin and Sokoto, Nigeria in 2/54 Edo Bini, 1/2 Edo Ishan, 3/99 Hausa, 0/18 Fulani, and 0/16 other Nigerians. The deletion was also detected in 3/115 Ivory Coast natives from Abidjan. A 9 bp insertion (triplication) was observed in 1/115 Ivory Coast natives. The triplicated individual also possessed the Hae III 16517 site gain. The fragment containing the African deletion was sequenced and found to be identical in sequence to the Asian deletion region. D-loop sequence of nts 15975 to 00048 revealed that 2 of the 3 Ivory Coast deleted individuals and 1 of the 6 Nigerians deleted (Hausa) had a T-C transition at nt position 16189 which is common in New World-deleted individuals. These results raise the possibility that the occurrence of this deletion predates the separation of Asian and African populations from a common ancestral populations, or that the deletion has occurred more than once in human evolution. Either explanation requires that caution be exercised when using the 9 bp deletion as a population marker.« less

Velopharyngeal Anatomy in 22q11.2 Deletion Syndrome: A Three-Dimensional Cephalometric Analysis

PubMed Central

Ruotolo, Rachel A.; Veitia, Nestor A.; Corbin, Aaron; McDonough, Joseph; Solot, Cynthia B.; McDonald-McGinn, Donna; Zackai, Elaine H.; Emanuel, Beverly S.; Cnaan, Avital; LaRossa, Don; Arens, Raanan; Kirschner, Richard E.

2010-01-01

Objective 22q11.2 deletion syndrome is the most common genetic cause of velopharyngeal dysfunction (VPD). Magnetic resonance imaging (MRI) is a promising method for noninvasive, three-dimensional (3D) assessment of velopharyngeal (VP) anatomy. The purpose of this study was to assess VP structure in patients with 22q11.2 deletion syndrome by using 3D MRI analysis. Design This was a retrospective analysis of magnetic resonance images obtained in patients with VPD associated with a 22q11.2 deletion compared with a normal control group. Setting This study was conducted at The Children’s Hospital of Philadelphia, a pediatric tertiary care center. Patients, Participants The study group consisted of 5 children between the ages of 2.9 and 7.9 years, with 22q11.2 deletion syndrome confirmed by fluorescence in situ hybridization analysis. All had VPD confirmed by nasendoscopy or videofluoroscopy. The control population consisted of 123 unaffected patients who underwent MRI for reasons other than VP assessment. Interventions Axial and sagittal T1- and T2-weighted magnetic resonance images with 3-mm slice thickness were obtained from the orbit to the larynx in all patients by using a 1.5T Siemens Visions system. Outcome Measures Linear, angular, and volumetric measurements of VP structures were obtained from the magnetic resonance images with VIDA image- processing software. Results The study group demonstrated greater anterior and posterior cranial base and atlanto-dental angles. They also demonstrated greater pharyngeal cavity volume and width and lesser tonsillar and adenoid volumes. Conclusion Patients with a 22q11.2 deletion demonstrate significant alterations in VP anatomy that may contribute to VPD. PMID:16854203

Recurrent Deletions and Reciprocal Duplications of 10q11.21q11.23 Including CHAT and SLC18A3 are Likely Mediated by Complex Low-Copy Repeats

PubMed Central

Stankiewicz, Paweł; Kulkarni, Shashikant; Dharmadhikari, Avinash V.; Sampath, Srirangan; Bhatt, Samarth S.; Shaikh, Tamim H.; Xia, Zhilian; Pursley, Amber N.; Cooper, M. Lance; Shinawi, Marwan; Paciorkowski, Alex R.; Grange, Dorothy K.; Noetzel, Michael J.; Saunders, Scott; Simons, Paul; Summar, Marshall; Lee, Brendan; Scaglia, Fernando; Fellmann, Florence; Martinet, Danielle; Beckmann, Jacques S.; Asamoah, Alexander; Platky, Kathryn; Sparks, Susan; Martin, Ann S.; Madan-Khetarpal, Suneeta; Hoover, Jacqueline; Medne, Livija; Bonnemann, Carsten G.; Moeschler, John B.; Vallee, Stephanie E.; Parikh, Sumit; Irwin, Polly; Dalzell, Victoria P.; Smith, Wendy E.; Banks, Valerie C.; Flannery, David B.; Lovell, Carolyn M.; Bellus, Gary A.; Golden-Grant, Kathryn; Gorski, Jerome L.; Kussmann, Jennifer L.; McGregor, Tracy L.; Hamid, Rizwan; Pfotenhauer, Jean; Ballif, Blake C.; Shaw, Chad A.; Kang, Sung-Hae L.; Bacino, Carlos A.; Patel, Ankita; Rosenfeld, Jill A.; Cheung, Sau Wai; Shaffer, Lisa G.

2013-01-01

We report 24 unrelated individuals with deletions and 17 additional cases with duplications at 10q11.21q21.1 identified by chromosomal microarray analysis. The rearrangements range in size from 0.3 to 12 Mb. Nineteen of the deletions and eight duplications are flanked by large, directly oriented segmental duplications of >98% sequence identity, suggesting that nonallelic homologous recombination (NAHR) caused these genomic rearrangements. Nine individuals with deletions and five with duplications have additional copy number changes. Detailed clinical evaluation of 20 patients with deletions revealed variable clinical features, with developmental delay (DD) and/or intellectual disability (ID) as the only features common to a majority of individuals. We suggest that some of the other features present in more than one patient with deletion, including hypotonia, sleep apnea, chronic constipation, gastroesophageal and vesicoureteral refluxes, epilepsy, ataxia, dysphagia, nystagmus, and ptosis may result from deletion of the CHAT gene, encoding choline acetyltransferase, and the SLC18A3 gene, mapping in the first intron of CHAT and encoding vesicular acetylcholine transporter. The phenotypic diversity and presence of the deletion in apparently normal carrier parents suggest that subjects carrying 10q11.21q11.23 deletions may exhibit variable phenotypic expressivity and incomplete penetrance influenced by additional genetic and nongenetic modifiers. PMID:21948486

1p36 deletion syndrome associated with Prader-Willi-like phenotype.

PubMed

Tsuyusaki, Yu; Yoshihashi, Hiroshi; Furuya, Noritaka; Adachi, Masanori; Osaka, Hitoshi; Yamamoto, Kayono; Kurosawa, Kenji

2010-08-01

1p36 deletion syndrome is one of the most common subtelomeric deletion syndromes, characterized by moderate to severe mental retardation, characteristic facial appearance, hypotonia, obesity, and seizures. The clinical features often overlap with those of Prader-Willi syndrome (PWS). To elucidate the phenotype-genotype correlation in 1p36 deletion syndrome, two cases involving a PWS-like phenotype were analyzed on molecular cytogenetics. Two patients presenting with the PWS-like phenotype but having negative results for PWS underwent fluorescence in situ hybridization (FISH). The size of the chromosome 1p36 deletions was characterized using probes of BAC clones based on the University of California, Santa Cruz (UCSC) Genome Browser. PWS was excluded on FISH and methylation-specific polymerase chain reaction. Subsequent FISH using the probe D1Z2 showed deletion of the 1p36.3 region, confirming the diagnosis of 1p36 deletion syndrome. Further analysis characterized the 1p36 deletions as being located between 4.17 and 4.36 Mb in patient 1 and between 4.89 and 6.09 Mb in patient 2. Patients with 1p36 deletion syndrome exhibit a PWS-like phenotype and are therefore probably underdiagnosed. The possible involvement of the terminal 4 Mb region of chromosome 1p36 in the PWS-like phenotype is hypothesized. © 2010 Japan Pediatric Society.

State of the art and new developments in molecular diagnostics for hemoglobinopathies in multiethnic societies.

PubMed

Harteveld, C L

2014-02-01

For detecting carriers of thalassemia traits, the basic part of diagnostics consists of measurement of the hematological indices followed by mostly automatic separation and measurement of the Hb fractions, while direct Hb separation either on high pressure liquid chromatography or capillary electrophoresis is sufficient to putatively identify carriers of the common Hb variants like HbS, C, E, D, and O-Arab. A putative positive result is reported together with an advice for parents, partner, or family analysis. For couples, presumed at-risk confirmation at the DNA level is essential. In general, this part of diagnostics is done in specialized centers provided with sufficient experience and the technical tools needed to combine hematological and biochemical interpretation with identification of the mutations at the molecular level. State-of-the-art tools are usually available in centers that also provide prenatal diagnosis and should consist of gap-PCR for the common deletions, direct DNA sequencing for all kind of point-mutations and the capacity to uncover novel or rare mutations or disease mechanisms. New developments are MLPA for large and eventually unknown deletion defects and microarray technology for fine mapping and primer design for breakpoint analysis. Gap-PCR primers designed in the region flanking the deletion breakpoints can subsequently be used to facilitate carrier detection of uncommon deletions in family members or isolated populations in laboratories where no microarray technology or MLPA is available. © 2013 John Wiley & Sons Ltd.

Genetic diagnosis of Duchenne and Becker muscular dystrophy using multiplex ligation-dependent probe amplification in Rwandan patients.

PubMed

Uwineza, Annette; Hitayezu, Janvier; Murorunkwere, Seraphine; Ndinkabandi, Janvier; Kalala Malu, Celestin Kaputu; Caberg, Jean Hubert; Dideberg, Vinciane; Bours, Vincent; Mutesa, Leon

2014-04-01

Duchenne and Becker muscular dystrophies are the most common clinical forms of muscular dystrophies. They are genetically X-linked diseases caused by a mutation in the dystrophin (DMD) gene. A genetic diagnosis was carried out in six Rwandan patients presenting a phenotype of Duchenne and Becker muscular dystrophies and six asymptomatic female carrier relatives using multiplex ligation-dependent probe amplification (MLPA). Our results revealed deletion of the exons 48-51 in one patient, an inherited deletion of the exons 8-21 in two brothers and a de novo deletion of the exons 46-50 in the fourth patient. No copy number variation was found in two patients. Only one female carrier presented exon deletion in the DMD gene. This is the first cohort of genetic analysis in Rwandan patients affected by Duchenne and Becker muscular dystrophies. This report confirmed that MLPA assay can be easily implemented in low-income countries.

Characterization of Deletions of the HBA and HBB Loci by Array Comparative Genomic Hybridization

PubMed Central

Sabath, Daniel E.; Bender, Michael A.; Sankaran, Vijay G.; Vamos, Esther; Kentsis, Alex; Yi, Hye-Son; Greisman, Harvey A.

2017-01-01

Thalassemia is among the most common genetic diseases worldwide. α-Thalassemia is usually caused by deletion of one or more of the duplicated HBA genes on chromosome 16. In contrast, most β-thalassemia results from point mutations that decrease or eliminate expression of the HBB gene on chromosome 11. Deletions within the HBB locus result in thalassemia or hereditary persistence of fetal Hb. Although routine diagnostic testing cannot distinguish thalassemia deletions from point mutations, deletional hereditary persistence of fetal Hb is notable for having an elevated HbF level with a normal mean corpuscular volume. A small number of deletions accounts for most α-thalassemias; in contrast, there are no predominant HBB deletions causing β-thalassemia. To facilitate the identification and characterization of deletions of the HBA and HBB globin loci, we performed array-based comparative genomic hybridization using a custom oligonucleotide microarray. We accurately mapped the breakpoints of known and previously uncharacterized HBB deletions defining previously uncharacterized deletion breakpoints by PCR amplification and sequencing. The array also successfully identified the common HBA deletions --SEA and --FIL. In summary, comparative genomic hybridization can be used to characterize deletions of the HBA and HBB loci, allowing high-resolution characterization of novel deletions that are not readily detected by PCR-based methods. PMID:26612711

TBX6 Null Variants and a Common Hypomorphic Allele in Congenital Scoliosis

PubMed Central

Wu, N.; Ming, X.; Xiao, J.; Wu, Z.; Chen, X.; Shinawi, M.; Shen, Y.; Yu, G.; Liu, J.; Xie, H.; Gucev, Z.S.; Liu, S.; Yang, N.; Al-Kateb, H.; Chen, J.; Zhang, Jian; Hauser, N.; Zhang, T.; Tasic, V.; Liu, P.; Su, X.; Pan, X.; Liu, C.; Wang, L.; Shen, Joseph; Shen, Jianxiong; Chen, Y.; Zhang, T.; Zhang, Jianguo; Choy, K.W.; Wang, Jun; Wang, Q.; Li, S.; Zhou, W.; Guo, J.; Wang, Y.; Zhang, C.; Zhao, H.; An, Y.; Zhao, Y.; Wang, Jiucun; Liu, Z.; Zuo, Y.; Tian, Y.; Weng, X.; Sutton, V.R.; Wang, H.; Ming, Y.; Kulkarni, S.; Zhong, T.P.; Giampietro, P.F.; Dunwoodie, S.L.; Cheung, S.W.; Zhang, X.; Jin, L.; Lupski, J.R.; Qiu, G.; Zhang, F.

2015-01-01

BACKGROUND Congenital scoliosis is a common type of vertebral malformation. Genetic susceptibility has been implicated in congenital scoliosis. METHODS We evaluated 161 Han Chinese persons with sporadic congenital scoliosis, 166 Han Chinese controls, and 2 pedigrees, family members of which had a 16p11.2 deletion, using comparative genomic hybridization, quantitative polymerase-chain-reaction analysis, and DNA sequencing. We carried out tests of replication using an additional series of 76 Han Chinese persons with congenital scoliosis and a multi-center series of 42 persons with 16p11.2 deletions. RESULTS We identified a total of 17 heterozygous TBX6 null mutations in the 161 persons with sporadic congenital scoliosis (11%); we did not observe any null mutations in TBX6 in 166 controls (P<3.8×10−6). These null alleles include copy-number variants (12 instances of a 16p11.2 deletion affecting TBX6) and single-nucleotide variants (1 nonsense and 4 frame-shift mutations). However, the discordant intrafamilial phenotypes of 16p11.2 deletion carriers suggest that heterozygous TBX6 null mutation is insufficient to cause congenital scoliosis. We went on to identify a common TBX6 haplotype as the second risk allele in all 17 carriers of TBX6 null mutations (P<1.1×10−6). Replication studies involving additional persons with congenital scoliosis who carried a deletion affecting TBX6 confirmed this compound inheritance model. In vitro functional assays suggested that the risk haplotype is a hypomorphic allele. Hemivertebrae are characteristic of TBX6-associated congenital scoliosis. CONCLUSIONS Compound inheritance of a rare null mutation and a hypomorphic allele of TBX6 accounted for up to 11% of congenital scoliosis cases in the series that we analyzed. PMID:25564734

Mutational analysis of Greek patients with suspected hereditary neuropathy with liability to pressure palsies (HNPP): a 15-year experience.

PubMed

Karadima, Georgia; Koutsis, Georgios; Raftopoulou, Maria; Karletidi, Karolina-Maria; Zambelis, Thomas; Karandreas, Nikolaos; Panas, Marios

2015-06-01

There has been limited information from population studies regarding the overall frequency of the common 1.5-Mb 17p11.2 deletion and even scarcer data regarding the overall frequency of PMP22 micromutations in patients with a clinical suspicion of hereditary neuropathy with liability to pressure palsies (HNPP). We have analysed 100 consecutive Greek patients referred for HNPP genetic testing over a 15-year period to our Neurogenetics Unit in Athens, a reference centre for all regions of Greece. All patients were screened for the 1.5-Mb deletion and a selected subgroup of deletion-negative patients for PMP22 micromutations. Mutation-positive and mutation-negative patients were compared for various clinical parameters. In total, 54 mutation-positive patients were identified. In index cases, the deletion frequency was 47.8%, and the PMP22 micromutation frequency was 2.2%. Within mutation-positive patients, the common deletion represented 95.7% and PMP22 micromutations 4.3% of cases. Two previously reported PMP22 micromutations (c.364_365delCC and c.79-2A>G) were detected. HNPP index cases had a 2.8-1 male-to-female ratio, similar to mutation-negative patients. A typical phenotype (recurrent or isolated palsies) was present in 82.4% of symptomatic HNPP cases, significantly higher than mutation-negative patients. Sensitivity of proposed electrophysiological diagnostic criteria for HNPP was calculated at 95.7% and specificity at 80.5%. In conclusion, the common HNPP deletion accounts for ∼50% and PMP22 micromutations for ∼2% of cases in a large consecutive cohort of patients with suspected HNPP. The mutational and phenotypic spectrum of HNPP is similar in the Greek population compared with other populations. Proposed electrophysiological diagnostic criteria perform satisfactorily in everyday clinical practice. © 2015 Peripheral Nerve Society.

Coincidence of synteny breakpoints with malignancy-related deletions on human chromosome 3

PubMed Central

Kost-Alimova, Maria; Kiss, Hajnalka; Fedorova, Ludmila; Yang, Ying; Dumanski, Jan P.; Klein, George; Imreh, Stefan

2003-01-01

We have found previously that during tumor growth intact human chromosome 3 transferred into tumor cells regularly looses certain 3p regions, among them the ≈1.4-Mb common eliminated region 1 (CER1) at 3p21.3. Fluorescence in situ hybridization analysis of 12 mouse orthologous loci revealed that CER1 splits into two segments in mouse and therefore contains a murine/human conservation breakpoint region (CBR). Several breaks occurred in tumors within the region surrounding the CBR, and this sequence has features that characterize unstable chromosomal regions: deletions in yeast artificial chromosome clones, late replication, gene and segment duplications, and pseudogene insertions. Sequence analysis of the entire 3p12-22 revealed that other cancer-associated deletions (regions eliminated from monochromosomal hybrids carrying an intact chromosome 3 during tumor growth and homozygous deletions found in human tumors) colocalized nonrandomly with murine/human CBRs and were characterized by an increased number of local gene duplications and murine/human conservation mismatches (single genes that do not match into the conserved chromosomal segment). The CBR within CER1 contains a simple tandem TATAGA repeat capable of forming a 40-bp-long secondary hairpin-like structure. This repeat is nonrandomly localized within the other tumor-associated deletions and in the vicinity of 3p12-22 CBRs. PMID:12738884

Small terminal deletions of the long arm of chromosome 2: Two new cases

DOE Office of Scientific and Technical Information (OSTI.GOV)

Fisher, A.M.; Ellis, K.H.; Browne, C.E.

1994-12-01

We report on 2 girls with small de novo terminal deletions of the long arm of chromosome 2 and breakpoints within q37. Four cases with similar or more extensive deletions have been previously reported in full. Hypotonia and psychomotor retardation were the only manifestations common to all 6 cases. The phenotype associated with small terminal 2q deletions is variable and clearly not always as mild as indicated in previous reports. The abnormality may also be more common than has been assumed. 12 refs., 3 figs., 1 tab.

A 1.5 Mb submicroscopic deletion in 17p11.2-p12 is frequently observed in Italian families with hereditary neuropathy with liability to pressure palsies

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lorenzetti, D.; Roa, B.B.; Abbas, N.E.

1994-09-01

Hereditary neuropathy with liability to pressure palsies (HNPP) is an autosomal dominant disorder characterized by recurrent mononeuropathies that was recently associated with a 1.5 Mb deletion in chromosome 17p11.2-p12. Duplication of the same region is known to be associated with Charcot-Marie-Tooth disease type 1A (CMT1A), a more severe peripheral neuropathy characterized by symmetrically slowed nerve conduction velocity. The CMT1A duplication and HNPP deletion are reciprocal recombination products involving a repeat element (CMT1A-REP) which flanks the 1.5 Mb region involved in the duplication/deletion. Patients from 9 unrelated HNPP Italian families were clinically, electrophysiologically and histologically evaluated. Families were typed with amore » polymorphic (CA){sub n} repeat and with RFLPs corresponding to loci D17S122, D17S125 and D17S61, which all map within the deleted region. Lack of allelic transmission from affected parent to affected offspring was observed in four informative families, suggesting the presence of deletion. Southern blot analysis of EcoRI digested genomic DNA from HNPP patients and control subjects was performed using a probe mapping within the CMT1A-REP elements. A reduced hybridization signal of a 6.0 kb EcoRI fragment, mapping within the distal CMT1A-REP, was observed in all HNPP patients suggesting the loss of one copy of this fragment in the HNPP-deleted chromosome. PFGE analysis of SacII digested genomic DNA from selected HNPP subjects showed the presence of a junction fragment which has previously been found in association with the 1.5 Mb HNPP deletion. Evidence for deletion could be demonstrated in all 9 families suggesting that the 17p11.2-p12 deletion is commonly associated with HNPP.« less

A 1.5-Mb deletion in 17p11.2-p12 is frequently observed in Italian families with hereditary neuropathy with liability to pressure palsies

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lorenzetti, D.; Pandolfo, M.; Pareyson, D.

1995-01-01

Hereditary neuropathy with liability to pressure palsies (HNPP) is an autosomal dominant disorder characterized by recurrent mononeuropathies. A 1.5-Mb deletion in chromosome 17p11.2-p12 has been associated with HNPP. Duplication of the same 1.5-Mb region is known to be associated with Charcot-Marie-Tooth disease type 1 (CMT1A), a more severe peripheral neuropathy characterized by symmetrically slowed nerve conduction velocity (NCV). The CMT1A duplication and HNPP deletion appear to be the reciprocal products of a recombination event involving a repeat element (CMT1A-REP) that flanks the 1.5-Mb region involved in the duplication/deletion. Patients from nine unrelated Italian families who were diagnosed with HNPP onmore » the basis of clinical, electrophysiological, and histological evaluations were analyzed by molecular methods for DNA deletion on chromosome 17p. In all nine families, Southern analysis using a CMT1A-REP probe detected a reduced hybridization signal of a 6.0-kb EcoRI fragment mapping within the distal CMT1A-REP, indicating deletion of one copy of CMT1A-REP in these HNPP patients. Families were also typed with a polymorphic (CA){sub n} repeat and with RFLPs corresponding to loci D17S122, D17S125, and D17S61, which all map within the deleted region. Lack of allelic transmission from affected parent to affected offspring was observed in four informative families, providing an independent indication for deletion. Furthermore, pulsed-field gel electrophoresis analysis of SacII-digested genomic DNA detected junction fragments specific to the 1.5-Mb HNPP deletion in seven of nine Italian families included in this study. These findings suggest that a 1.5-Mb deletion on 17p11.2-p12 is the most common mutation associated with HNPP. 51 refs., 5 figs., 1 tab.« less

Mucopolysaccharidosis IVA: Four new exonic mutations in patients with N-acetylgalactosamine-6-sulfate sulfatase deficiency

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tomatsu, Shunji; Fukuda, Seiji; Yamagishi, Atsushi

1996-05-01

We report four new mutations in Japanese patients with mucopolysaccharidosis IVA (MPSIVA) who were heterozygous for a common double gene deletion. A nonsense mutation of CAG to TAG at codon 148 in exon 4 was identified, resulting in a change of Q to a stop codon and three missense mutations: V (GTC) to A (GCC) at codon 138 in exon 4, P (CCC) to S (TCC) at codon 151 in exon 5, and P (CCC) to L (CTC) at codon 151 in exon 5. Introduction of these mutations into the normal GALNS cDNA and transient expression in cultured fibroblasts resultedmore » in a significant decrease in the enzyme activity. V138A and Q148X mutations result in changes of restriction site, which were analyzed by restriction-enzyme assay. P151S and P151L mutations that did not alter the restriction site were detected by direct sequencing or allele specific oligohybridization. Detection of the double gene deletion was initially done using Southern blots and was confirmed by PCR. Haplotypes were determined using seven polymorphisms to the GALNS locus in families with the double gene deletion. Haplotype analysis showed that the common double gene deletion occurred on a single haplotype, except for some variation in a VNTR-like polymorphism. This finding is consistent with a common founder for all individuals with this mutation. 48 refs., 5 figs., 1 tab.« less

Lynch syndrome-associated extracolonic tumors are rare in two extended families with the same EPCAM deletion.

PubMed

Lynch, Henry T; Riegert-Johnson, Douglas L; Snyder, Carrie; Lynch, Jane F; Hagenkord, Jill; Boland, C Richard; Rhees, Jennifer; Thibodeau, Stephen N; Boardman, Lisa A; Davies, Janine; Kuiper, Roland P; Hoogerbrugge, Nicoline; Ligtenberg, Marjolijn J L

2011-10-01

The Lynch syndrome (LS) is an inherited cancer syndrome showing a preponderance of colorectal cancer (CRC) in context with endometrial cancer and several other extracolonic cancers, which is due to pathogenic mutations in the mismatch repair (MMR) genes, MLH1, MSH2, MSH6, and PMS2. Some families were found to show a LS phenotype without an identified MMR mutation, although there was microsatellite instability and absence of MSH2 expression by immunohistochemistry. Studies of a subset of these families found a deletion at the 3' end of the epithelial cell adhesion molecule (EPCAM) gene, causing transcription read-through resulting in silencing of MSH2 through hypermethylation of its promoter. The tumor spectrum of such families appears to differ from classical LS. Our study of two large families (USA Family R and Dutch Family A) with an EPCAM deletion was carried out using each institution's standard family study protocol. DNA was extracted from peripheral blood and EPCAM deletion analysis was performed. Both families were found to harbor the same deletion at the 3' end of EPCAM. Analysis showed that the deletion originated from a common ancestor. Family R and Family A members showed segregation of CRC with the presence of this EPCAM mutation. Compared with classic LS, there were almost no extracolonic cancers. Members of Family R and Family A, all with the same EPCAM deletion, predominantly presented with CRC but no LS-associated endometrial cancer, confirming findings seen in other, smaller, LS families with EPCAM mutations. In these EPCAM mutation carriers, cancer surveillance should be focused on CRC.

Digital PCR methods improve detection sensitivity and measurement precision of low abundance mtDNA deletions.

PubMed

Belmonte, Frances R; Martin, James L; Frescura, Kristin; Damas, Joana; Pereira, Filipe; Tarnopolsky, Mark A; Kaufman, Brett A

2016-04-28

Mitochondrial DNA (mtDNA) mutations are a common cause of primary mitochondrial disorders, and have also been implicated in a broad collection of conditions, including aging, neurodegeneration, and cancer. Prevalent among these pathogenic variants are mtDNA deletions, which show a strong bias for the loss of sequence in the major arc between, but not including, the heavy and light strand origins of replication. Because individual mtDNA deletions can accumulate focally, occur with multiple mixed breakpoints, and in the presence of normal mtDNA sequences, methods that detect broad-spectrum mutations with enhanced sensitivity and limited costs have both research and clinical applications. In this study, we evaluated semi-quantitative and digital PCR-based methods of mtDNA deletion detection using double-stranded reference templates or biological samples. Our aim was to describe key experimental assay parameters that will enable the analysis of low levels or small differences in mtDNA deletion load during disease progression, with limited false-positive detection. We determined that the digital PCR method significantly improved mtDNA deletion detection sensitivity through absolute quantitation, improved precision and reduced assay standard error.

Digital PCR methods improve detection sensitivity and measurement precision of low abundance mtDNA deletions

PubMed Central

Belmonte, Frances R.; Martin, James L.; Frescura, Kristin; Damas, Joana; Pereira, Filipe; Tarnopolsky, Mark A.; Kaufman, Brett A.

2016-01-01

Mitochondrial DNA (mtDNA) mutations are a common cause of primary mitochondrial disorders, and have also been implicated in a broad collection of conditions, including aging, neurodegeneration, and cancer. Prevalent among these pathogenic variants are mtDNA deletions, which show a strong bias for the loss of sequence in the major arc between, but not including, the heavy and light strand origins of replication. Because individual mtDNA deletions can accumulate focally, occur with multiple mixed breakpoints, and in the presence of normal mtDNA sequences, methods that detect broad-spectrum mutations with enhanced sensitivity and limited costs have both research and clinical applications. In this study, we evaluated semi-quantitative and digital PCR-based methods of mtDNA deletion detection using double-stranded reference templates or biological samples. Our aim was to describe key experimental assay parameters that will enable the analysis of low levels or small differences in mtDNA deletion load during disease progression, with limited false-positive detection. We determined that the digital PCR method significantly improved mtDNA deletion detection sensitivity through absolute quantitation, improved precision and reduced assay standard error. PMID:27122135

Early-onset obesity and paternal 2pter deletion encompassing the ACP1, TMEM18, and MYT1L genes.

PubMed

Doco-Fenzy, Martine; Leroy, Camille; Schneider, Anouck; Petit, Florence; Delrue, Marie-Ange; Andrieux, Joris; Perrin-Sabourin, Laurence; Landais, Emilie; Aboura, Azzedine; Puechberty, Jacques; Girard, Manon; Tournaire, Magali; Sanchez, Elodie; Rooryck, Caroline; Ameil, Agnès; Goossens, Michel; Jonveaux, Philippe; Lefort, Geneviève; Taine, Laurence; Cailley, Dorothée; Gaillard, Dominique; Leheup, Bruno; Sarda, Pierre; Geneviève, David

2014-04-01

Obesity is a common but highly, clinically, and genetically heterogeneous disease. Deletion of the terminal region of the short arm of chromosome 2 is rare and has been reported in about 13 patients in the literature often associated with a Prader-Willi-like phenotype. We report on five unrelated patients with 2p25 deletion of paternal origin presenting with early-onset obesity, hyperphagia, intellectual deficiency, and behavioural difficulties. Among these patients, three had de novo pure 2pter deletions, one presented with a paternal derivative der(2)t(2;15)(p25.3;q26) with deletion in the 2pter region and the last patient presented with an interstitial 2p25 deletion. The size of the deletions was characterized by SNP array or array-CGH and was confirmed by fluorescence in situ hybridization (FISH) studies. Four patients shared a 2p25.3 deletion with a minimal critical region estimated at 1.97 Mb and encompassing seven genes, namely SH3HYL1, ACP1, TMEMI8, SNTG2, TPO, PXDN, and MYT1L genes. The fifth patient had a smaller interstitial deletion encompassing the TPO, PXDN, and MYT1L genes. Paternal origin of the deletion was determined by genotyping using microsatellite markers. Analysis of the genes encompassed in the deleted region led us to speculate that the ACP1, TMEM18, and/or MYT1L genes might be involved in early-onset obesity. In addition, intellectual deficiency and behavioural troubles can be explained by the heterozygous loss of the SNTG2 and MYT1L genes. Finally, we discuss the parent-of-origin of the deletion.

Molecular characterization of deletion breakpoints in adults with 22q11 deletion syndrome

PubMed Central

Stachon, Andrea C.; Squire, Jeremy A.; Moldovan, Laura; Bayani, Jane; Meyn, Stephen; Chow, Eva; Bassett, Anne S.

2011-01-01

22q11 Deletion syndrome (22q11DS) is a common microdeletion syndrome with variable expression, including congenital and later onset conditions such as schizophrenia. Most studies indicate that expression does not appear to be related to length of the deletion but there is limited information on the endpoints of even the common deletion breakpoint regions in adults. We used a real-time quantitative PCR (qPCR) approach to fine map 22q11.2 deletions in 44 adults with 22q11DS, 22 with schizophrenia (SZ; 12 M, 10 F; mean age 35.7 SD 8.0 years) and 22 with no history of psychosis (NP; 8 M, 14 F; mean age 27.1 SD 8.6 years). QPCR data were consistent with clinical FISH results using the TUPLE1 or N25 probes. Two subjects (one SZ, one NP) negative for clinical FISH had atypical 22q11.2 deletions confirmed by FISH using the RP11-138C22 probe. Most (n = 34; 18 SZ, 16 NP) subjects shared a common 3 Mb hemizygous 22q11.2 deletion. However, eight subjects showed breakpoint variability: a more telomeric proximal breakpoint (n = 2), or more centromeric (n = 3) or more telomeric distal breakpoint (n = 3). One NP subject had a proximal nested 1.4 Mb deletion. COMT and TBX1 were deleted in all 44 subjects, and PRODH in 40 subjects (19 SZ, 21 NP). The results delineate proximal and distal breakpoint variants in 22q11DS. Neither deletion extent nor PRODH haploinsufficiency appeared to explain the clinical expression of schizophrenia in the present study. Further studies are needed to elucidate the molecular basis of schizophrenia and clinical heterogeneity in 22q11DS. PMID:17028864

A Deletion of More than 800 kb Is the Most Recurrent Mutation in Chilean Patients with SHOX Gene Defects.

PubMed

Poggi, Helena; Vera, Alejandra; Avalos, Carolina; Lagos, Marcela; Mellado, Cecilia; Aracena, Mariana; Aravena, Teresa; Garcia, Hernan; Godoy, Claudia; Cattani, Andreina; Reyes, Loreto; Lacourt, Patricia; Rumie, Hana; Mericq, Veronica; Arriaza, Marta; Martinez-Aguayo, Alejandro

2015-01-01

Deletions in the SHOX gene are the most frequent genetic cause of Leri-Weill syndrome and Langer mesomelic dysplasia, which are also present in idiopathic short stature. To describe the molecular and clinical findings observed in 23 of 45 non-consanguineous Chilean patients with different phenotypes related to SHOX deficiency. Multiplex ligation-dependent probe amplification was used to detect the deletions; the SHOX coding region and deletion-flanking areas were sequenced to identify point mutations and single-nucleotide polymorphisms (SNPs). The main genetic defects identified in 21 patients consisted of deletions; one of them, a large deletion of >800 kb, was found in 8 patients. Also, a smaller deletion of >350 kb was observed in 4 patients. Although we could not precisely determine the deletion breakpoint, we were able to identify a common haplotype in 7 of the 8 patients with the larger deletion based on 22 informative SNPs. These results suggest that the large deletion-bearing allele has a common ancestor and was either introduced by European immigrants or had originated in our Amerindian population. This study allowed us to identify one recurrent deletion in Chilean patients; also, it contributed to expanding our knowledge about the genetic background of our population. © 2015 S. Karger AG, Basel.

Marker-Assisted Molecular Profiling, Deletion Mutant Analysis, and RNA-Seq Reveal a Disease Resistance Cluster Associated with Uromyces appendiculatus Infection in Common Bean Phaseolus vulgaris L.

PubMed

Todd, Antonette R; Donofrio, Nicole; Sripathi, Venkateswara R; McClean, Phillip E; Lee, Rian K; Pastor-Corrales, Marcial; Kalavacharla, Venu Kal

2017-05-23

Common bean ( Phaseolus vulgaris L.) is an important legume, useful for its high protein and dietary fiber. The fungal pathogen Uromyces appendiculatus (Pers.) Unger can cause major loss in susceptible varieties of the common bean. The Ur-3 locus provides race specific resistance to virulent strains or races of the bean rust pathogen along with Crg , (Complements resistance gene), which is required for Ur-3 -mediated rust resistance. In this study, we inoculated two common bean genotypes (resistant "Sierra" and susceptible crg) with rust race 53 of U. appendiculatus , isolated leaf RNA at specific time points, and sequenced their transcriptomes. First, molecular markers were used to locate and identify a 250 kb deletion on chromosome 10 in mutant crg (which carries a deletion at the Crg locus). Next, we identified differential expression of several disease resistance genes between Mock Inoculated (MI) and Inoculated (I) samples of "Sierra" leaf RNA within the 250 kb delineated region. Both marker assisted molecular profiling and RNA-seq were used to identify possible transcriptomic locations of interest regarding the resistance in the common bean to race 53. Identification of differential expression among samples in disease resistance clusters in the bean genome may elucidate significant genes underlying rust resistance. Along with preserving favorable traits in the crop, the current research may also aid in global sustainability of food stocks necessary for many populations.

Marker-Assisted Molecular Profiling, Deletion Mutant Analysis, and RNA-Seq Reveal a Disease Resistance Cluster Associated with Uromyces appendiculatus Infection in Common Bean Phaseolus vulgaris L.

PubMed Central

Todd, Antonette R.; Donofrio, Nicole; Sripathi, Venkateswara R.; McClean, Phillip E.; Lee, Rian K.; Pastor-Corrales, Marcial; Kalavacharla, Venu (Kal)

2017-01-01

Common bean (Phaseolus vulgaris L.) is an important legume, useful for its high protein and dietary fiber. The fungal pathogen Uromyces appendiculatus (Pers.) Unger can cause major loss in susceptible varieties of the common bean. The Ur-3 locus provides race specific resistance to virulent strains or races of the bean rust pathogen along with Crg, (Complements resistance gene), which is required for Ur-3-mediated rust resistance. In this study, we inoculated two common bean genotypes (resistant “Sierra” and susceptible crg) with rust race 53 of U. appendiculatus, isolated leaf RNA at specific time points, and sequenced their transcriptomes. First, molecular markers were used to locate and identify a 250 kb deletion on chromosome 10 in mutant crg (which carries a deletion at the Crg locus). Next, we identified differential expression of several disease resistance genes between Mock Inoculated (MI) and Inoculated (I) samples of “Sierra” leaf RNA within the 250 kb delineated region. Both marker assisted molecular profiling and RNA-seq were used to identify possible transcriptomic locations of interest regarding the resistance in the common bean to race 53. Identification of differential expression among samples in disease resistance clusters in the bean genome may elucidate significant genes underlying rust resistance. Along with preserving favorable traits in the crop, the current research may also aid in global sustainability of food stocks necessary for many populations. PMID:28545258

Monosomy1p36.3 and trisomy 19p13.3 in a child with periventricular nodular heterotopia.

PubMed

Descartes, Maria; Mikhail, Fady M; Franklin, Judith C; McGrath, Tony M; Bebin, Martina

2011-10-01

Monosomy 1p36 is a clinically recognizable syndrome that is considered to be the most common terminal deletion syndrome. It has characteristic clinical features that include craniofacial dysmorphism, congenital anomalies, hearing deficits, developmental delay, mental retardation, hypotonia, seizures, and brain anomalies. Brain anomalies in patients with 1p36 deletion are frequent but inconsistent. To date, 2 cases with monosomy 1p36 associated with periventricular nodular heterotopia (PNH) have been reported. We report a 2-month-old boy with multiple congenital anomalies; brain magnetic resonance imaging revealed PNH. The first 2 described cases were pure terminal deletions, whereas our patient carried unbalanced translocation due to an adjacent 1 segregation of a balanced maternal translocation, resulting in monosomy 1p36.3 and trisomy 19p13.3 identified by whole-genome array comparative genomic hybridization analysis. Our patient, with a smaller deletion that the 2 previously reported cases, can help narrow the critical region for PNH in association with the 1p36 deletion. Several potential candidate genes are discussed. Copyright © 2011 Elsevier Inc. All rights reserved.

Deletion 22q13.3 syndrome.

PubMed

Phelan, Mary C

2008-05-27

The deletion 22q13.3 syndrome (deletion 22q13 syndrome or Phelan-McDermid syndrome) is a chromosome microdeletion syndrome characterized by neonatal hypotonia, global developmental delay, normal to accelerated growth, absent to severely delayed speech, and minor dysmorphic features. The deletion occurs with equal frequency in males and females and has been reported in mosaic and non-mosaic forms. Due to lack of clinical recognition and often insufficient laboratory testing, the syndrome is under-diagnosed and its true incidence remains unknown. Common physical traits include long eye lashes, large or unusual ears, relatively large hands, dysplastic toenails, full brow, dolicocephaly, full cheeks, bulbous nose, and pointed chin. Behavior is autistic-like with decreased perception of pain and habitual chewing or mouthing. The loss of 22q13.3 can result from simple deletion, translocation, ring chromosome formation and less common structural changes affecting the long arm of chromosome 22, specifically the region containing the SHANK3 gene. The diagnosis of deletion 22q13 syndrome should be considered in all cases of hypotonia of unknown etiology and in individuals with absent speech. Although the deletion can sometimes be detected by high resolution chromosome analysis, fluorescence in situ hybridization (FISH) or array comparative genomic hybridization (CGH) is recommended for confirmation. Differential diagnosis includes syndromes associated with hypotonia, developmental delay, speech delay and/or autistic-like affect (Prader-Willi, Angelman, Williams, Smith-Magenis, Fragile X, Sotos, FG, trichorhinophalangeal and velocardiofacial syndromes, autism spectrum disorders, cerebral palsy). Genetic counseling is recommended and parental laboratory studies should be considered to identify cryptic rearrangements and detect parental mosaicism. Prenatal diagnosis should be offered for future pregnancies in those families with inherited rearrangements. Individuals with deletion 22q13 should have routine examinations by the primary care physician as well as genetic evaluations with referral to specialists if neurological, gastrointestinal, renal, or other systemic problems are suspected. Affected individuals benefit from early intervention programs, intense occupational and communication therapies, adaptive exercise and sport programs, and other therapies to strengthen their muscles and increase their communication skills. No apparent life-threatening organic abnormalities accompany the diagnosis of deletion 22q13.

Developmental delay and connective tissue disorder in four patients sharing a common microdeletion at 6q13-14.

PubMed

Van Esch, Hilde; Rosser, Elisabeth M; Janssens, Sandra; Van Ingelghem, Ingrid; Loeys, Bart; Menten, Bjorn

2010-10-01

Interstitial deletions of the long arm of chromosome 6 are rare, and most reported cases represent large, cytogenetically detectable deletions. The implementation of array comparative genome hybridisation in the diagnostic work-up of patients presenting with congenital disorders, including developmental delay, has enabled identification of many patients with smaller chromosomal imbalances. In this report, the cases are presented of four patients with a de novo interstitial deletion of chromosome 6q13-14, resulting in a common microdeletion of 3.7 Mb. All presented with developmental delay, mild dysmorphism and signs of lax connective tissue. Interestingly, the common deleted region harbours 16 genes, of which COL12A1 is a good candidate for the connective tissue pathology.

Molecular analysis of complex cases of alpha- and beta-thalassemia in Mexican mestizo patients with microcytosis and hypochromia reveals two novel alpha(0) -thalassemia deletions - -(Mex1) and - -(Mex2).

PubMed

de-la-Cruz-Salcedo, E I; Ibarra, B; Rizo-de-la-Torre, L C; Sánchez-López, J Y; González-Mercado, A; Harteveld, C L; Perea-Díaz, F J

2016-10-01

Alpha-thalassemia (α-thal) is a common monogenic disorder worldwide. In mixed ethnic populations, α-thal and beta-thalassemia (β-thal) can be expected, sometimes giving complex phenotypes, which without molecular analysis are not easily explained. We performed the molecular identification of α- and β-thal alleles in 51 Mexican patients with microcytosis, hypochromia, and normal or low levels of HbA2 . Common deletional alleles (-α(3.7) , -α(4.2) , - -(SEA) , - -(MED) , - -(FIL) , - -(THAI) , -α(20.5) ) and α-triplication were studied by gap-PCR and nondeletional alleles (α(IVSI) ((-5nt)) , α2 (NcoI) , α1 (NcoI) ) by ARMS. β-thal alleles Cd39 (C>T), IVS1:1 (G>A), IVS1:110 (G>A), and Spanish δβ-thal were also investigated. DNA sequencing was performed on HBA2, HBA1, and HBB genes. Negative samples were subjected to MLPA. In 35 subjects, we identified the mutations, -α(3.7) , - -(SEA) , - -(FIL) , α(IVSI) ((-5nt)) , and ααα(anti3.7) and two novel deletion alleles - -(Mex1) (6.8-8.9 kb) and - -(Mex2) (77.6-135.7 kb). Four individuals also had a β-thal allele (Cd39/IVS1:110). No α-thal alleles were observed in 16 subjects, but three had a β-thal mutation Cd39, IVS1:110, and Spanish δβ-thal. α-thal is relatively common in Mexican patients, the combination with β-thal is sometimes unexpected, and this underlines the importance of performing molecular analysis for both α- and β-genes defects in patients showing microcytic hypochromic anemia. © 2016 John Wiley & Sons Ltd.

Co-inheritance of α-thalassaemia and β-thalassaemia in a prenatal screening population in mainland China.

PubMed

Li, Jian; Xie, Xing-Mei; Liao, Can; Li, Dong-Zhi

2014-12-01

To determine the prevalence of α-thalassaemia in β-thalassaemia individuals in a Chinese population. The standard diagnostic marker for β-thalassaemia was elevation of the Hb A2 level (>3.5%) with low mean corpuscular volume. The common α-thalassaemia mutations were studied by molecular analysis in all identified β-thalassaemia carriers. A prevalence rate of 3.3% for β-thalassaemia was found in our population; α- and β-thalassaemia interactions were found to co-exist in 17.8% of the β-thalassaemia carriers. The -SEA deletion was the most common α-thalassaemia mutation co-inherited with β-thalassaemia, followed by the -α3.7 deletion, the -α4.2 deletion, Hb Quong Sze, and Hb Constant Spring. Our results suggest that it could be valuable to study co-existing α-globin mutations in subjects with β-thalassaemia trait in a prenatal screening programme, especially in populations with a high prevalence of haemoglobinopathies. © The Author(s) 2014 Reprints and permissions: sagepub.co.uk/journalsPermissions.nav.

A Tunisian patient with Pearson syndrome harboring the 4.977kb common deletion associated to two novel large-scale mitochondrial deletions.

PubMed

Ayed, Imen Ben; Chamkha, Imen; Mkaouar-Rebai, Emna; Kammoun, Thouraya; Mezghani, Najla; Chabchoub, Imen; Aloulou, Hajer; Hachicha, Mongia; Fakhfakh, Faiza

2011-07-29

Pearson syndrome (PS) is a multisystem disease including refractory anemia, vacuolization of marrow precursors and pancreatic fibrosis. The disease starts during infancy and affects various tissues and organs, and most affected children die before the age of 3years. Pearson syndrome is caused by de novo large-scale deletions or, more rarely, duplications in the mitochondrial genome. In the present report, we described a Pearson syndrome patient harboring multiple mitochondrial deletions which is, in our knowledge, the first case described and studied in Tunisia. In fact, we reported the common 4.977kb deletion and two novel heteroplasmic deletions (5.030 and 5.234kb) of the mtDNA. These deletions affect several protein-coding and tRNAs genes and could strongly lead to defects in mitochondrial polypeptides synthesis, and impair oxidative phosphorylation and energy metabolism in the respiratory chain in the studied patient. Copyright © 2011 Elsevier Inc. All rights reserved.

A physical map, including a BAC/PAC clone contig, of the Williams-Beuren syndrome--deletion region at 7q11.23.

PubMed

Peoples, R; Franke, Y; Wang, Y K; Pérez-Jurado, L; Paperna, T; Cisco, M; Francke, U

2000-01-01

Williams-Beuren syndrome (WBS) is a developmental disorder caused by haploinsufficiency for genes in a 2-cM region of chromosome band 7q11.23. With the exception of vascular stenoses due to deletion of the elastin gene, the various features of WBS have not yet been attributed to specific genes. Although >/=16 genes have been identified within the WBS deletion, completion of a physical map of the region has been difficult because of the large duplicated regions flanking the deletion. We present a physical map of the WBS deletion and flanking regions, based on assembly of a bacterial artificial chromosome/P1-derived artificial chromosome contig, analysis of high-throughput genome-sequence data, and long-range restriction mapping of genomic and cloned DNA by pulsed-field gel electrophoresis. Our map encompasses 3 Mb, including 1.6 Mb within the deletion. Two large duplicons, flanking the deletion, of >/=320 kb contain unique sequence elements from the internal border regions of the deletion, such as sequences from GTF2I (telomeric) and FKBP6 (centromeric). A third copy of this duplicon exists in inverted orientation distal to the telomeric flanking one. These duplicons show stronger sequence conservation with regard to each other than to the presumptive ancestral loci within the common deletion region. Sequence elements originating from beyond 7q11.23 are also present in these duplicons. Although the duplicons are not present in mice, the order of the single-copy genes in the conserved syntenic region of mouse chromosome 5 is inverted relative to the human map. A model is presented for a mechanism of WBS-deletion formation, based on the orientation of duplicons' components relative to each other and to the ancestral elements within the deletion region.

High-molecular-weight glutenin subunit-deficient mutants induced by ion beam and the effects of Glu-1 loci deletion on wheat quality properties.

PubMed

Zhang, Lujun; Chen, Qiufang; Su, Mingjie; Yan, Biao; Zhang, Xiangqi; Jiao, Zhen

2016-03-15

High-molecular-weight glutenin subunits (HMW-GSs) play a critical role in determining the viscoelastic properties of wheat. Mutations induced by ion beam radiation have been applied to improve the yield and quality of crop. In this study, HMW-GS-deficient mutant lines were selected and the effects of Glu-1 loci deletion on wheat quality properties were illustrated according to the analysis of dry seeds of common wheat (Triticum aestivum L.) Xiaoyan 81 treated with a nitrogen ion beam. Three HMW-GS-deficient mutant lines were obtained and then detected by sodium dodecyl sulfate polyacrylamide gel electrophoresis. Large-chromosome-fragment deletion resulted in specific deficiencies, and the deleted region sizes were determined using molecular markers. Agronomic characters, quantity and proportion of glutenins and dough microstructure of the deletion lines all proved to be quite different from those of wild-type Xiaoyan 81. Analysis of quality properties suggested that GluA1(-) had superior property parameters, while GluB1(-) and GluD1(-) both showed a significant decrease in quality properties compared with Xiaoyan 81. The effects of the three Glu-1 loci on flour and dough quality-related parameters should be Glu-D1 > Glu-B1 > Glu-A1. Ion beam radiation can be used as a mutagen to create new crop mutants. © 2015 Society of Chemical Industry.

Deletion patterns of the STS gene and flanking sequences in Israeli X-linked ichthyosis patients and carriers: analysis by polymerase chain reaction and fluorescence in situ hybridization techniques.

PubMed

Aviram-Goldring, A; Goldman, B; Netanelov-Shapira, I; Chen-Shtoyerman, R; Zvulunov, A; Tal, O; Ilan, T; Peleg, L

2000-03-01

Deletion of the entire steroid sulfatase (STS) gene is the most common molecular defect in X-linked ichthyosis (XLI) patients. Usually, additional flanking sequences are also missing. The aim of this study was to estimate the extent of deletions in an ethnically heterogeneous population of Israeli XLI patients. Multiplex polymerase chain reaction (PCR) and fluorescence in situ hybridization (FISH) techniques were applied in the analysis of blood samples of 24 patients and amniotic cells of seven affected fetuses from 22 unrelated families. In 19 families, a large deletion of the 2-3 megabase was found. It included the whole STS gene and spanned adjacent areas up- and downstream between the loci DXS 1139 and DXS 1132. Two unrelated families of Iraqi ancestry had a partial deletion of the gene and its centromeric adjacent sequence. In another family, the telomeric end of the extragenic segment was only partially missing. Application of FISH on metaphase blood cells and interphase amniotic cells confirmed the diagnosis of XLI in all patients, except the three with partial intragenic deletion. In those cases, the remaining fraction of the gene was sufficient to provide a false negative result. Diagnosis of carriers and prenatal diagnosis in uncultured cells was applicable only by FISH. Our study revealed a remarkable heterogeneity in the deletion pattern among Israeli patients with XLI. This heterogeneity could not be attributed to specific ethnic groups because of the small size of the study group. More studies involving patients of various ancestries should be carried out. In addition, this study demonstrated the usefulness of the FISH technique in the prenatal diagnosis of fetuses with suspected XLI.

Diagnostic screening identifies a wide range of mutations involving the SHOX gene, including a common 47.5 kb deletion 160 kb downstream with a variable phenotypic effect.

PubMed

Bunyan, David J; Baker, Kevin R; Harvey, John F; Thomas, N Simon

2013-06-01

Léri-Weill dyschondrosteosis (LWD) results from heterozygous mutations of the SHOX gene, with homozygosity or compound heterozygosity resulting in the more severe form, Langer mesomelic dysplasia (LMD). These mutations typically take the form of whole or partial gene deletions, point mutations within the coding sequence, or large (>100 kb) 3' deletions of downstream regulatory elements. We have analyzed the coding sequence of the SHOX gene and its downstream regulatory regions in a cohort of 377 individuals referred with symptoms of LWD, LMD or short stature. A causative mutation was identified in 68% of the probands with LWD or LMD (91/134). In addition, a 47.5 kb deletion was found 160 kb downstream of the SHOX gene in 17 of the 377 patients (12% of the LWD referrals, 4.5% of all referrals). In 14 of these 17 patients, this was the only potentially causative abnormality detected (13 had symptoms consistent with LWD and one had short stature only), but the other three 47.5 kb deletions were found in patients with an additional causative SHOX mutation (with symptoms of LWD rather than LMD). Parental samples were available on 14/17 of these families, and analysis of these showed a more variable phenotype ranging from apparently unaffected to LWD. Breakpoint sequence analysis has shown that the 47.5 kb deletion is identical in all 17 patients, most likely due to an ancient founder mutation rather than recurrence. This deletion was not seen in 471 normal controls (P<0.0001), providing further evidence for a phenotypic effect, albeit one with variable penetration. Copyright © 2013 Wiley Periodicals, Inc.

Lynch Syndrome-Associated Extracolonic Tumors Are Rare in Two Extended Families With the Same EPCAM Deletion

PubMed Central

Lynch, Henry T.; Riegert-Johnson, Douglas L.; Snyder, Carrie; Lynch, Jane F.; Hagenkord, Jill; Boland, C. Richard; Rhees, Jennifer; Thibodeau, Stephen N.; Boardman, Lisa A.; Davies, Janine; Kuiper, Roland P.; Hoogerbrugge, Nicoline; Ligtenberg, Marjolijn J.L.

2013-01-01

OBJECTIVES The Lynch syndrome (LS) is an inherited cancer syndrome showing a preponderance of colorectal cancer (CRC) in context with endometrial cancer and several other extracolonic cancers, which is due to pathogenic mutations in the mismatch repair (MMR) genes, MLH1, MSH2, MSH6, and PMS2. Some families were found to show a LS phenotype without an identified MMR mutation, although there was microsatellite instability and absence of MSH2 expression by immunohistochemistry. Studies of a subset of these families found a deletion at the 3′ end of the epithelial cell adhesion molecule (EPCAM) gene, causing transcription read-through resulting in silencing of MSH2 through hypermethylation of its promoter. The tumor spectrum of such families appears to differ from classical LS. METHODS Our study of two large families (USA Family R and Dutch Family A) with an EPCAM deletion was carried out using each institution’s standard family study protocol. DNA was extracted from peripheral blood and EPCAM deletion analysis was performed. RESULTS Both families were found to harbor the same deletion at the 3′ end of EPCAM. Analysis showed that the deletion originated from a common ancestor. Family R and Family A members showed segregation of CRC with the presence of this EPCAM mutation. Compared with classic LS, there were almost no extracolonic cancers. CONCLUSIONS Members of Family R and Family A, all with the same EPCAM deletion, predominantly presented with CRC but no LS-associated endometrial cancer, confirming findings seen in other, smaller, LS families with EPCAM mutations. In these EPCAM mutation carriers, cancer surveillance should be focused on CRC. PMID:21769135

The prevalence of chromosomal deletions relating to developmental delay and/or intellectual disability in human euploid blastocysts.

PubMed

He, Wenyin; Sun, Xiaofang; Liu, Lian; Li, Man; Jin, Hua; Wang, Wei-Hua

2014-01-01

Chromosomal anomalies in human embryos produced by in vitro fertilization are very common, which include numerical (aneuploidy) and structural (deletion, duplication or others) anomalies. Our previous study indicated that chromosomal deletion(s) is the most common structural anomaly accounting for approximately 8% of euploid blastocysts. It is still unknown if these deletions in human euploid blastocysts have clinical significance. In this study, we analyzed 15 previously diagnosed euploid blastocysts that had chromosomal deletion(s) using Agilent oligonucleotide DNA microarray platform and localized the gene location in each deletion. Then, we used OMIM gene map and phenotype database to investigate if these deletions are related with some important genes that cause genetic diseases, especially developmental delay or intellectual disability. As results, we found that the detectable chromosomal deletion size with Agilent microarray is above 2.38 Mb, while the deletions observed in human blastocysts are between 11.6 to 103 Mb. With OMIM gene map and phenotype database information, we found that deletions can result in loss of 81-464 genes. Out of these genes, 34-149 genes are related with known genetic problems. Furthermore, we found that 5 out of 15 samples lost genes in the deleted region, which were related to developmental delay and/or intellectual disability. In conclusion, our data indicates that all human euploid blastocysts with chromosomal deletion(s) are abnormal and transfer of these embryos may cause birth defects and/or developmental and intellectual disabilities. Therefore, the embryos with chromosomal deletion revealed by DNA microarray should not be transferred to the patients, or further gene map and/or phenotype seeking is necessary before making a final decision.

Combined pituitary hormone deficiency due to gross deletions in the POU1F1 (PIT-1) and PROP1 genes.

PubMed

Bertko, Eleonore; Klammt, Jürgen; Dusatkova, Petra; Bahceci, Mithat; Gonc, Nazli; Ten Have, Louise; Kandemir, Nurgun; Mansmann, Georg; Obermannova, Barbora; Oostdijk, Wilma; Pfäffle, Heike; Rockstroh-Lippold, Denise; Schlicke, Marina; Tuzcu, Alpaslan Kemal; Pfäffle, Roland

2017-08-01

Pituitary development depends on a complex cascade of interacting transcription factors and signaling molecules. Lesions in this cascade lead to isolated or combined pituitary hormone deficiency (CPHD). The aim of this study was to identify copy number variants (CNVs) in genes known to cause CPHD and to determine their structure. We analyzed 70 CPHD patients from 64 families. Deletions were found in three Turkish families and one family from northern Iraq. In one family we identified a 4.96 kb deletion that comprises the first two exons of POU1F1. In three families a homozygous 15.9 kb deletion including complete PROP1 was discovered. Breakpoints map within highly homologous AluY sequences. Haplotype analysis revealed a shared haplotype of 350 kb among PROP1 deletion carriers. For the first time we were able to assign the boundaries of a previously reported PROP1 deletion. This gross deletion shows strong evidence to originate from a common ancestor in patients with Kurdish descent. No CNVs within LHX3, LHX4, HESX1, GH1 and GHRHR were found. Our data prove multiplex ligation-dependent probe amplification to be a valuable tool for the detection of CNVs as cause of pituitary insufficiencies and should be considered as an analytical method particularly in Kurdish patients.

An unusual clinical severity of 16p11.2 deletion syndrome caused by unmasked recessive mutation of CLN3.

PubMed

Pebrel-Richard, Céline; Debost-Legrand, Anne; Eymard-Pierre, Eléonore; Greze, Victoria; Kemeny, Stéphan; Gay-Bellile, Mathilde; Gouas, Laetitia; Tchirkov, Andreï; Vago, Philippe; Goumy, Carole; Francannet, Christine

2014-03-01

With the introduction of array comparative genomic hybridization (aCGH) techniques in the diagnostic setting of patients with developmental delay and congenital malformations, many new microdeletion syndromes have been recognized. One of these recently recognized microdeletion syndromes is the 16p11.2 deletion syndrome, associated with variable clinical outcomes including developmental delay, autism spectrum disorder, epilepsy, and obesity, but also apparently normal phenotype. We report on a 16-year-old patient with developmental delay, exhibiting retinis pigmentosa with progressive visual failure from the age of 9 years, ataxia, and peripheral neuropathy. Chromosomal microarray analysis identified a 1.7-Mb 16p11.2 deletion encompassing the 593-kb common deletion (∼29.5 to ∼30.1 Mb; Hg18) and the 220-kb distal deletion (∼28.74 to ∼28.95 Mb; Hg18) that partially included the CLN3 gene. As the patient's clinical findings were different from usual 16p11.2 microdeletion phenotypes and showed some features reminiscent of juvenile neuronal ceroid-lipofuscinosis (JNCL, Batten disease, OMIM 204200), we suspected and confirmed a mutation of the remaining CLN3 allele. This case further illustrates that unmasking of hemizygous recessive mutations by chromosomal deletion represents one explanation for the phenotypic variability observed in chromosomal deletion disorders.

An unusual clinical severity of 16p11.2 deletion syndrome caused by unmasked recessive mutation of CLN3

PubMed Central

Pebrel-Richard, Céline; Debost-Legrand, Anne; Eymard-Pierre, Eléonore; Greze, Victoria; Kemeny, Stéphan; Gay-Bellile, Mathilde; Gouas, Laetitia; Tchirkov, Andreï; Vago, Philippe; Goumy, Carole; Francannet, Christine

2014-01-01

With the introduction of array comparative genomic hybridization (aCGH) techniques in the diagnostic setting of patients with developmental delay and congenital malformations, many new microdeletion syndromes have been recognized. One of these recently recognized microdeletion syndromes is the 16p11.2 deletion syndrome, associated with variable clinical outcomes including developmental delay, autism spectrum disorder, epilepsy, and obesity, but also apparently normal phenotype. We report on a 16-year-old patient with developmental delay, exhibiting retinis pigmentosa with progressive visual failure from the age of 9 years, ataxia, and peripheral neuropathy. Chromosomal microarray analysis identified a 1.7-Mb 16p11.2 deletion encompassing the 593-kb common deletion (∼29.5 to ∼30.1 Mb; Hg18) and the 220-kb distal deletion (∼28.74 to ∼28.95 Mb; Hg18) that partially included the CLN3 gene. As the patient's clinical findings were different from usual 16p11.2 microdeletion phenotypes and showed some features reminiscent of juvenile neuronal ceroid-lipofuscinosis (JNCL, Batten disease, OMIM 204200), we suspected and confirmed a mutation of the remaining CLN3 allele. This case further illustrates that unmasking of hemizygous recessive mutations by chromosomal deletion represents one explanation for the phenotypic variability observed in chromosomal deletion disorders. PMID:23860047

Combined pituitary hormone deficiency due to gross deletions in the POU1F1 (PIT-1) and PROP1 genes

PubMed Central

Bertko, Eleonore; Klammt, Jürgen; Dusatkova, Petra; Bahceci, Mithat; Gonc, Nazli; ten Have, Louise; Kandemir, Nurgun; Mansmann, Georg; Obermannova, Barbora; Oostdijk, Wilma; Pfäffle, Heike; Rockstroh-Lippold, Denise; Schlicke, Marina; Tuzcu, Alpaslan Kemal; Pfäffle, Roland

2017-01-01

Pituitary development depends on a complex cascade of interacting transcription factors and signaling molecules. Lesions in this cascade lead to isolated or combined pituitary hormone deficiency (CPHD). The aim of this study was to identify copy number variants (CNVs) in genes known to cause CPHD and to determine their structure. We analyzed 70 CPHD patients from 64 families. Deletions were found in three Turkish families and one family from northern Iraq. In one family we identified a 4.96 kb deletion that comprises the first two exons of POU1F1. In three families a homozygous 15.9 kb deletion including complete PROP1 was discovered. Breakpoints map within highly homologous AluY sequences. Haplotype analysis revealed a shared haplotype of 350 kb among PROP1 deletion carriers. For the first time we were able to assign the boundaries of a previously reported PROP1 deletion. This gross deletion shows strong evidence to originate from a common ancestor in patients with Kurdish descent. No CNVs within LHX3, LHX4, HESX1, GH1 and GHRHR were found. Our data prove multiplex ligation-dependent probe amplification to be a valuable tool for the detection of CNVs as cause of pituitary insufficiencies and should be considered as an analytical method particularly in Kurdish patients. PMID:28356564

Pfhrp2-Deleted Plasmodium falciparum Parasites in the Democratic Republic of the Congo: A National Cross-sectional Survey.

PubMed

Parr, Jonathan B; Verity, Robert; Doctor, Stephanie M; Janko, Mark; Carey-Ewend, Kelly; Turman, Breanna J; Keeler, Corinna; Slater, Hannah C; Whitesell, Amy N; Mwandagalirwa, Kashamuka; Ghani, Azra C; Likwela, Joris L; Tshefu, Antoinette K; Emch, Michael; Juliano, Jonathan J; Meshnick, Steven R

2017-07-01

Rapid diagnostic tests (RDTs) account for more than two-thirds of malaria diagnoses in Africa. Deletions of the Plasmodium falciparum hrp2 (pfhrp2) gene cause false-negative RDT results and have never been investigated on a national level. Spread of pfhrp2-deleted P. falciparum mutants, resistant to detection by HRP2-based RDTs, would represent a serious threat to malaria elimination efforts. Using a nationally representative cross-sectional study of 7,137 children under five years of age from the Democratic Republic of Congo (DRC), we tested 783 subjects with RDT-/PCR+ results using PCR assays to detect and confirm deletions of the pfhrp2 gene. Spatial and population genetic analyses were employed to examine the distribution and evolution of these parasites. We identified 149 pfhrp2-deleted parasites, representing 6.4% of all P. falciparum infections country-wide (95% confidence interval 5.1-8.0%). Bayesian spatial analyses identified statistically significant clustering of pfhrp2 deletions near Kinshasa and Kivu. Population genetic analysis revealed significant genetic differentiation between wild-type and pfhrp2-deleted parasite populations (GST = .046, p ≤ .00001). Pfhrp2-deleted P. falciparum is a common cause of RDT-/PCR+ malaria among asymptomatic children in the DRC and appears to be clustered within select communities. Surveillance for these deletions is needed, and alternatives to HRP2-specific RDTs may be necessary. © The Author 2016. Published by Oxford University Press for the Infectious Diseases Society of America. All rights reserved. For permissions, e-mail journals.permissions@oup.com.

Construction of the physical map of the gpa7 locus reveals that a large segment was deleted during rice domestication.

PubMed

Li, Xianran; Tian, Feng; Huang, Haiyan; Tan, Lubin; Zhu, Zuofeng; Hu, Songnian; Sun, Chuanqing

2008-06-01

To facilitate cloning gene(s) underlying gpa7, a deep-coverage BAC library was constructed for an isolate of common wild rice (Oryza rufipogon Griff.) collected from Dongxiang, Jiangxi Province, China (DXCWR). gpa7, a quantitative trait locus corresponding to grain number per panicle, is positioned in the short arm of chromosome 7. The BAC library containing 96,768 clones represents approximate 18 haploid genome equivalents. The contig spanning DXCWR gpa7 was constructed with a series of ordered markers. The putative physical map near the gpa7 locus of another accession of O. rufipogon (Accession: IRGC 105491) was also isolated in silico. Analysis of the physical maps of gpa7 indicated that a segment of about 150 kb was deleted during domestication of common wild rice.

Severe laryngeal stenosis in newly born twins with 22q11.2 deletion syndrome: A case report.

PubMed

Clive, B; Corsten, G; Penney, L S; Van den Hof, M; El-Naggar, W

2016-05-18

Chromosome 22q11.2 deletion syndrome is common and presents with a range of clinical features from cardiac malformations to hypocalcemia. Laryngeal anomalies are not a common feature of this syndrome. We describe newly born twins who presented with unexpected severe birth depression secondary to severe type IV glottic webs requiring extensive resuscitation and emergency tracheostomy. They were diagnosed postnatally to have deletion of 22q11.2. The successful resuscitation of these infants at birth was only possible because they were born in a tertiary care hospital. This report shows the critical nature of prenatal diagnosis of 22q11.2 deletion syndrome.

Random single amino acid deletion sampling unveils structural tolerance and the benefits of helical registry shift on GFP folding and structure.

PubMed

Arpino, James A J; Reddington, Samuel C; Halliwell, Lisa M; Rizkallah, Pierre J; Jones, D Dafydd

2014-06-10

Altering a protein's backbone through amino acid deletion is a common evolutionary mutational mechanism, but is generally ignored during protein engineering primarily because its effect on the folding-structure-function relationship is difficult to predict. Using directed evolution, enhanced green fluorescent protein (EGFP) was observed to tolerate residue deletion across the breadth of the protein, particularly within short and long loops, helical elements, and at the termini of strands. A variant with G4 removed from a helix (EGFP(G4Δ)) conferred significantly higher cellular fluorescence. Folding analysis revealed that EGFP(G4Δ) retained more structure upon unfolding and refolded with almost 100% efficiency but at the expense of thermodynamic stability. The EGFP(G4Δ) structure revealed that G4 deletion caused a beneficial helical registry shift resulting in a new polar interaction network, which potentially stabilizes a cis proline peptide bond and links secondary structure elements. Thus, deletion mutations and registry shifts can enhance proteins through structural rearrangements not possible by substitution mutations alone. Copyright © 2014 The Authors. Published by Elsevier Inc. All rights reserved.

Comparative sequence analysis of a region on human chromosome 13q14, frequently deleted in B-cell chronic lymphocytic leukemia, and its homologous region on mouse chromosome 14.

PubMed

Kapanadze, B; Makeeva, N; Corcoran, M; Jareborg, N; Hammarsund, M; Baranova, A; Zabarovsky, E; Vorontsova, O; Merup, M; Gahrton, G; Jansson, M; Yankovsky, N; Einhorn, S; Oscier, D; Grandér, D; Sangfelt, O

2000-12-15

Previous studies have indicated the presence of a putative tumor suppressor gene on human chromosome 13q14, commonly deleted in patients with B-cell chronic lymphocytic leukemia (B-CLL). We have recently identified a minimally deleted region encompassing parts of two adjacent genes, termed LEU1 and LEU2 (leukemia-associated genes 1 and 2), and several additional transcripts. In addition, 50 kb centromeric to this region we have identified another gene, LEU5/RFP2. To elucidate further the complex genomic organization of this region, we have identified, mapped, and sequenced the homologous region in the mouse. Fluorescence in situ hybridization analysis demonstrated that the region maps to mouse chromosome 14. The overall organization and gene order in this region were found to be highly conserved in the mouse. Sequence comparison between the human deletion hotspot region and its homologous mouse region revealed a high degree of sequence conservation with an overall score of 74%. However, our data also show that in terms of transcribed sequences, only two of those, human LEU2 and LEU5/RFP2, are clearly conserved, strengthening the case for these genes as putative candidate B-CLL tumor suppressor genes.

Accumulation of Mitochondrial DNA Common Deletion Since The Preataxic Stage of Machado-Joseph Disease.

PubMed

Raposo, Mafalda; Ramos, Amanda; Santos, Cristina; Kazachkova, Nadiya; Teixeira, Balbina; Bettencourt, Conceição; Lima, Manuela

2018-04-21

Molecular alterations reflecting pathophysiologic changes thought to occur many years before the clinical onset of Machado-Joseph disease (MJD)/spinocerebellar ataxia type 3 (SCA3), a late-onset polyglutamine disorder, remain unidentified. The absence of molecular biomarkers hampers clinical trials, which lack sensitive measures of disease progression, preventing the identification of events occurring prior to clinical onset. Our aim was to analyse the mtDNA content and the amount of the common deletion (m.8482_13460del4977) in a cohort of 16 preataxic MJD mutation carriers, 85 MJD patients and 101 apparently healthy age-matched controls. Relative expression levels of RPPH1, MT-ND1 and MT-ND4 genes were assessed by quantitative real-time PCR. The mtDNA content was calculated as the difference between the expression levels of a mitochondrial gene (MT-ND1) and a nuclear gene (RPPH1); the amount of mtDNA common deletion was calculated as the difference between expression levels of a deleted (MT-ND4) and an undeleted (MT-ND1) mitochondrial genes. mtDNA content in MJD carriers was similar to that of healthy age-matched controls, whereas the percentage of the common deletion was significantly increased in MJD subjects, and more pronounced in the preclinical stage (p < 0.05). The BCL2/BAX ratio was decreased in preataxic carriers compared to controls, suggesting that the mitochondrial-mediated apoptotic pathway is altered in MJD. Our findings demonstrate for the first time that accumulation of common deletion starts in the preclinical stage. Such early alterations provide support to the current understanding that any therapeutic intervention in MJD should start before the overt clinical phenotype.

Patients with chronic lymphocytic leukemia and complex karyotype show an adverse outcome even in absence of TP53/ATM FISH deletions

PubMed Central

Puiggros, Anna; Collado, Rosa; Calasanz, Maria José; Ortega, Margarita; Ruiz-Xivillé, Neus; Rivas-Delgado, Alfredo; Luño, Elisa; González, Teresa; Navarro, Blanca; García-Malo, MaDolores; Valiente, Alberto; Hernández, José Ángel; Ardanaz, María Teresa; Piñan, María Ángeles; Blanco, María Laura; Hernández-Sánchez, María; Batlle-López, Ana; Salgado, Rocío; Salido, Marta; Ferrer, Ana; Abrisqueta, Pau; Gimeno, Eva; Abella, Eugènia; Ferrá, Christelle; Terol, María José; Ortuño, Francisco; Costa, Dolors; Moreno, Carol; Carbonell, Félix; Bosch, Francesc; Delgado, Julio; Espinet, Blanca

2017-01-01

Genomic complexity identified by chromosome banding analysis (CBA) predicts a worse clinical outcome in CLL patients treated either with standard or new treatments. Herein, we analyzed the clinical impact of complex karyotypes (CK) with or without high-risk FISH deletions (ATM and/or TP53, HR-FISH) in a cohort of 1045 untreated MBL/CLL patients. In all, 99/1045 (9.5%) patients displayed a CK. Despite ATM and TP53 deletions were more common in CK (25% vs 7%; P < 0.001; 40% vs 5%; P < 0.001, respectively), only 44% (40/90) patients with TP53 deletions showed a CK. CK group showed a significant higher two-year cumulative incidence of treatment (48% vs 20%; P < 0.001), as well as a shorter overall survival (OS) (79 mo vs not reached; P < 0.001). When patients were categorized regarding CK and HR-FISH, those with both characteristics showed the worst median OS (52 mo) being clearly distinct from those non-CK and non-HR-FISH (median not reached), but no significant differences were detected between cases with only CK or HR-FISH. Both CK and TP53 deletion remained statistically significant in the multivariate analysis for OS. In conclusion, CK group is globally associated with advanced disease and poor prognostic markers. Further investigation in larger cohorts with CK lacking HR-FISH is needed to elucidate which mechanisms underlie the poor outcome of this subgroup. PMID:28903342

UGT2B17 gene deletion associated with an increase in bone mineral density similar to the effect of hormone replacement in postmenopausal women.

PubMed

Giroux, S; Bussières, J; Bureau, A; Rousseau, F

2012-03-01

UGT2B17 is one of the most important enzymes for androgen metabolism. In addition, the UGT2B17 gene is one of the most commonly deleted regions of the human genome. The deletion was previously found associated with higher femoral bone density in men and women, and we replicated this association in a sample of postmenopausal who never used hormone therapy. Deletion of the UGT2B17 gene was previously shown to be associated with a higher hip bone mineral density (BMD). Using a PCR assay, we tried to replicate the association among a large group of 2,379 women. We examined the effect of the deletion on femoral neck BMD and lumbar spine BMD according to the menopausal status and hormone replacement therapy (HRT). We used a high-throughput PCR assay to identify the gene and the deletion in a population of well-characterized women. Two additional polymorphisms, UGT2B28 deletion and UGT2B15 rs1902023 G > T were also investigated. Only UGT2B17 deletion was associated with LS and FN BMD. Furthermore, the association was seen only among postmenopausal women who had never used hormone replacement as in the first reported association. We confirmed the association between UGT2B17 deletion and a higher LS and FN BMD. In addition, we show that the association is observed among postmenopausal women who never used HRT consistent with the enzymatic function of UGT2B17. The analysis shows that those having one or two UGT2B17 alleles benefit from HRT, which is not the case for null carriers.

Breed relationships facilitate fine-mapping studies: A 7.8-kb deletion cosegregates with Collie eye anomaly across multiple dog breeds

PubMed Central

Parker, Heidi G.; Kukekova, Anna V.; Akey, Dayna T.; Goldstein, Orly; Kirkness, Ewen F.; Baysac, Kathleen C.; Mosher, Dana S.; Aguirre, Gustavo D.; Acland, Gregory M.; Ostrander, Elaine A.

2007-01-01

The features of modern dog breeds that increase the ease of mapping common diseases, such as reduced heterogeneity and extensive linkage disequilibrium, may also increase the difficulty associated with fine mapping and identifying causative mutations. One way to address this problem is by combining data from multiple breeds segregating the same trait after initial linkage has been determined. The multibreed approach increases the number of potentially informative recombination events and reduces the size of the critical haplotype by taking advantage of shortened linkage disequilibrium distances found across breeds. In order to identify breeds that likely share a trait inherited from the same ancestral source, we have used cluster analysis to divide 132 breeds of dog into five primary breed groups. We then use the multibreed approach to fine-map Collie eye anomaly (cea), a complex disorder of ocular development that was initially mapped to a 3.9-cM region on canine chromosome 37. Combined genotypes from affected individuals from four breeds of a single breed group significantly narrowed the candidate gene region to a 103-kb interval spanning only four genes. Sequence analysis revealed that all affected dogs share a homozygous deletion of 7.8 kb in the NHEJ1 gene. This intronic deletion spans a highly conserved binding domain to which several developmentally important proteins bind. This work both establishes that the primary cea mutation arose as a single disease allele in a common ancestor of herding breeds as well as highlights the value of comparative population analysis for refining regions of linkage. PMID:17916641

Novel and differential accumulation of mitochondrial DNA deletions in Swedish and vietnamese patients with colorectal cancer.

PubMed

Dimberg, Jan; Hong, Thai Trinh; Skarstedt, Marita; Löfgren, Sture; Zar, Niklas; Matussek, Andreas

2014-01-01

Mitochondrial DNA (mtDNA) has been proposed to be involved in carcinogenesis and aging. The mtDNA 4977 bp deletion is one of the most frequently observed mtDNA mutations in human tissues and may play a role in colorectal cancer (CRC). In the present study, we aimed to evaluate the frequency of mtDNA 4977 bp deletion in CRC tissues and its association with clinical factors. We determined the presence of the 4977 bp common deletion in cancer and normal paired tissue samples from 105 Swedish and 88 Vietnamese patients with CRC using polymerase chain reaction (PCR) assays. The mtDNA 4977 bp deletion was shown to be significantly more frequent in normal tissues in comparison with paired cancer tissues in both Swedish and Vietnamese patients. The 4977 bp common deletion was significantly more frequent in cancer tissues of the Vietnamese patients compared to the Swedish patients, and in Vietnamese cancer tissues, the 4977 bp deletion was significantly over represented in those with localized disease compared to those with disseminated disease. Moreover, we detected nine novel mtDNA deletions and found a significantly higher rate of these in CRC tissues in Swedish in comparison to Vietnamese patients. The mtDNA 4977 bp deletion seems to have an impact on the clinical outcome of CRC in Vietnamese patients, that the Swedish patients accumulate more of the detected novel deletions in CRC tissue compared to Vietnamese patients probably indicates divergent mechanisms in colorectal carcinogenesis.

A Physical Map, Including a BAC/PAC Clone Contig, of the Williams-Beuren Syndrome–Deletion Region at 7q11.23

PubMed Central

Peoples, Risa; Franke, Yvonne; Wang, Yu-Ker; Pérez-Jurado, Luis; Paperna, Tamar; Cisco, Michael; Francke, Uta

2000-01-01

Summary Williams-Beuren syndrome (WBS) is a developmental disorder caused by haploinsufficiency for genes in a 2-cM region of chromosome band 7q11.23. With the exception of vascular stenoses due to deletion of the elastin gene, the various features of WBS have not yet been attributed to specific genes. Although ⩾16 genes have been identified within the WBS deletion, completion of a physical map of the region has been difficult because of the large duplicated regions flanking the deletion. We present a physical map of the WBS deletion and flanking regions, based on assembly of a bacterial artificial chromosome/P1-derived artificial chromosome contig, analysis of high-throughput genome-sequence data, and long-range restriction mapping of genomic and cloned DNA by pulsed-field gel electrophoresis. Our map encompasses 3 Mb, including 1.6 Mb within the deletion. Two large duplicons, flanking the deletion, of ⩾320 kb contain unique sequence elements from the internal border regions of the deletion, such as sequences from GTF2I (telomeric) and FKBP6 (centromeric). A third copy of this duplicon exists in inverted orientation distal to the telomeric flanking one. These duplicons show stronger sequence conservation with regard to each other than to the presumptive ancestral loci within the common deletion region. Sequence elements originating from beyond 7q11.23 are also present in these duplicons. Although the duplicons are not present in mice, the order of the single-copy genes in the conserved syntenic region of mouse chromosome 5 is inverted relative to the human map. A model is presented for a mechanism of WBS-deletion formation, based on the orientation of duplicons' components relative to each other and to the ancestral elements within the deletion region. PMID:10631136

Identification of deletions in children with congenital hypothyroidism and thyroid dysgenesis with the use of multiplex ligation-dependent probe amplification.

PubMed

Kumorowicz-Czoch, Malgorzata; Madetko-Talowska, Anna; Tylek-Lemanska, Dorota; Pietrzyk, Jacek J; Starzyk, Jerzy

2015-01-01

Thyroid dysgenesis (TD) is the most common cause of congenital hypothyroidism (CH). Important genetic factors possibly contributing to TD etiologies include mutations of thyroid transcription factors and TSHR-encoding genes. Our objective was to determine multiplex ligation-dependent probe amplification (MLPA) utility in detecting the copy number changes in patients with CH and TD. The study included 45 children from southeastern Poland selected via already established neonatal screening for CH. Genomic DNA was extracted from peripheral blood samples and used in MLPA analysis. Genetic variations were analyzed within selected fragments of the PAX8, FOXE1, NKX2-1, thyroid stimulating hormone receptor (TSHR), and TPO genes. Three heterozygous deletion types in probe hybridization regions were identified for the following genes: PAX8 (exon 7), TSHR (exon 2), and FOXE1 (exon 1). Monoallelic deletions were identified in 5/45 TD subjects. MLPA is a useful tool for copy number changes detection and might both improve and expand genetic analysis for CH and TD.

Gene analysis of PROP1 in dwarfism with combined pituitary hormone deficiency.

PubMed

Takamura, N; Fofanova, O V; Kinoshita, E; Yamashita, S

1999-06-01

The prophet of Pit-1 gene (PROP1), a novel pituitary-specific homeodomain factor, has been proved to be one of the causative genes for combined pituitary hormone deficiency (CPHD). Recently, PROP1 mutations have been identified in CPHD families, including our Russian cohort. The 2-bp deletion, 296delGA (A301G302del), is the most common mutational hot spot. Furthermore, in our cohort, PROP1 mutations are more common in comparison with human POU1F1 gene mutations. Here we review the gene analysis of PROP1 in patients with CPHD.

Rapid detection of α-thalassaemia variants using droplet digital PCR.

PubMed

Lee, T-Y; Lai, M-I; Ramachandran, V; Tan, J A M A; Teh, L-K; Othman, R; Hussein, N H; George, E

2016-08-01

Alpha thalassaemia is a highly prevalent disease globally and is a well-known public health problem in Malaysia. The deletional forms of the mutation are the most common forms found in alpha thalassaemia. The three most common deletional alpha thalassaemia found in this region include --(SEA) deletion, -α(3.7) rightward and -α(4.2) leftward deletions. The prevalence rate of triplication alpha cases such as ααα(anti3.7) and ααα(anti4.2) is not known in Malaysia although it plays a role in exacerbating the clinical phenotypes in beta thalassaemia carriers. Recently, there have been more reported cases of rare alpha thalassaemia mutations due to the advancement of molecular techniques involved in thalassaemia detections. Therefore, it is essential to develop a new method which allows the detection of different alpha thalassaemia mutations including the rare ones simultaneously and accurately. The purpose of this study was to design an assay for the detection of triplications, common and rare deletional alpha thalassaemia using droplet digital PCR (ddPCR). This is a quantitative detection method to measure the changes of copy number which can detect deletions, duplications and triplications of the alpha globin gene simultaneously. In conclusion, ddPCR is an alternative method for rapid detection of alpha thalassaemia variants in Malaysia. © 2016 John Wiley & Sons Ltd.

Early onset intellectual disability in chromosome 22q11.2 deletion syndrome.

PubMed

Cascella, Marco; Muzio, Maria Rosaria

2015-01-01

Chromosome 22q11.2 deletion syndrome, or DiGeorge syndrome, or velocardiofacial syndrome, is one of the most common multiple anomaly syndromes in humans. This syndrome is commonly caused by a microdelection from chromosome 22 at band q11.2. Although this genetic disorder may reflect several clinical abnormalities and different degrees of organ commitment, the clinical features that have driven the greatest amount of attention are behavioral and developmental features, because individuals with 22q11.2 deletion syndrome have a 30-fold risk of developing schizophrenia. There are differing opinions about the cognitive development, and commonly a cognitive decline rather than an early onset intellectual disability has been observed. We report a case of 22q11.2 deletion syndrome with both early assessment of mild intellectual disabilities and tetralogy of Fallot as the only physic manifestation. Copyright © 2015 Sociedad Chilena de Pediatría. Publicado por Elsevier España, S.L.U. All rights reserved.

Molecular analysis of beta-globin gene mutations among Thai beta-thalassemia children: results from a single center study

PubMed Central

Boonyawat, Boonchai; Monsereenusorn, Chalinee; Traivaree, Chanchai

2014-01-01

Background Beta-thalassemia is one of the most common genetic disorders in Thailand. Clinical phenotype ranges from silent carrier to clinically manifested conditions including severe beta-thalassemia major and mild beta-thalassemia intermedia. Objective This study aimed to characterize the spectrum of beta-globin gene mutations in pediatric patients who were followed-up in Phramongkutklao Hospital. Patients and methods Eighty unrelated beta-thalassemia patients were enrolled in this study including 57 with beta-thalassemia/hemoglobin E, eight with homozygous beta-thalassemia, and 15 with heterozygous beta-thalassemia. Mutation analysis was performed by multiplex amplification refractory mutation system (M-ARMS), direct DNA sequencing of beta-globin gene, and gap polymerase chain reaction for 3.4 kb deletion detection, respectively. Results A total of 13 different beta-thalassemia mutations were identified among 88 alleles. The most common mutation was codon 41/42 (-TCTT) (37.5%), followed by codon 17 (A>T) (26.1%), IVS-I-5 (G>C) (8%), IVS-II-654 (C>T) (6.8%), IVS-I-1 (G>T) (4.5%), and codon 71/72 (+A) (2.3%), and all these six common mutations (85.2%) were detected by M-ARMS. Six uncommon mutations (10.2%) were identified by DNA sequencing including 4.5% for codon 35 (C>A) and 1.1% initiation codon mutation (ATG>AGG), codon 15 (G>A), codon 19 (A>G), codon 27/28 (+C), and codon 123/124/125 (-ACCCCACC), respectively. The 3.4 kb deletion was detected at 4.5%. The most common genotype of beta-thalassemia major patients was codon 41/42 (-TCTT)/codon 26 (G>A) or betaE accounting for 40%. Conclusion All of the beta-thalassemia alleles have been characterized by a combination of techniques including M-ARMS, DNA sequencing, and gap polymerase chain reaction for 3.4 kb deletion detection. Thirteen mutations account for 100% of the beta-thalassemia genes among the pediatric patients in our study. PMID:25525381

Analysis of APOBEC3A/3B germline deletion polymorphism in breast, cervical and oral cancers from South India and its impact on miRNA regulation.

PubMed

Revathidevi, Sundaramoorthy; Manikandan, Mayakannan; Rao, Arunagiri Kuha Deva Magendhra; Vinothkumar, Vilvanathan; Arunkumar, Ganesan; Rajkumar, Kottayasamy Seenivasagam; Ramani, Rajendran; Rajaraman, Ramamurthy; Ajay, Chandrasekar; Munirajan, Arasambattu Kannan

2016-09-01

Breast cancer and cervical cancer are the leading causes of death in women worldwide as well as in India, whilst oral cancer is the top most common cancer among Asian especially in Indian men in terms of both incidence and mortality rate. Genetic factors determining the predisposition to cancer are being explored to identify the signature genetic variations associated with these cancers. Recently, a germline deletion polymorphism in APOBEC3 gene cluster which completely deletes APOBEC3B coding region has been studied for its association with cancer risk. We screened the germline deletion polymorphism in 409 cancer patients (224 breast cancer, 88 cervical cancer and 97 oral cancer samples), 478 controls and 239 cervical cancer tissue DNAs of South Indian origin. The results suggest that the APOBEC3A/3B deletion polymorphism is not significantly associated with cancer risk in our study population (OR 0.739, 95 % CI, p value 0.91457). Considering the viral restriction property of APOBEC3s, we also screened cervical cancer tissue DNAs for the human papilloma virus infection. We observed a gradual increase in the frequency of HPV16 infection from AA/BB cases (66.86 %) to AA/-- cases (71.43) which signifies the impact of this deletion polymorphism in HPV infection. In addition, we performed in silico analysis to understand the effect of this polymorphism on miRNA regulation of the APOBEC3A/3B fusion transcript. Only 8 APOBEC3B targeting miRNAs were observed to regulate the fusion transcript of which miR-34b-3p and miR-138-5p were found to be frequently downregulated in cancers suggesting miRNA-mediated deregulation of APOBEC3A expression in cancer patients harbouring this particular deletion polymorphism.

Common cytological and cytogenetic features of Epstein-Barr virus (EBV)-positive natural killer (NK) cells and cell lines derived from patients with nasal T/NK-cell lymphomas, chronic active EBV infection and hydroa vacciniforme-like eruptions.

PubMed

Zhang, Yu; Nagata, Hiroshi; Ikeuchi, Tatsuro; Mukai, Hiroyuki; Oyoshi, Michiko K; Demachi, Ayako; Morio, Tomohiro; Wakiguchi, Hiroshi; Kimura, Nobuhiro; Shimizu, Norio; Yamamoto, Kohtaro

2003-06-01

In this study, we describe the cytological and cytogenetic features of six Epstein-Barr virus (EBV)-infected natural killer (NK) cell clones. Three cell clones, SNK-1, -3 and -6, were derived from patients with nasal T/NK-cell lymphomas; two cell clones, SNK-5 and -10, were isolated from patients with chronic active EBV infection (CAEBV); and the other cell clone, SNK-11, was from a patient with hydroa vacciniforme (HV)-like eruptions. An analysis of the number of EBV-terminal repeats showed that the SNK cell clones had monoclonal EBV genomes identical to the original EBV-infected cells of the respective patients, and SNK cells had the type II latency of EBV infection, suggesting that not only the cell clones isolated from nasal T/NK-cell lymphomas but also those isolated from CAEBV and HV-like eruptions had been transformed by EBV to a certain degree. Cytogenetic analysis detected deletions in chromosome 6q in five out of the six SNK cell clones, while 6q was not deleted in four control cell lines of T-cell lineage. This suggested that a 6q deletion is a characteristic feature of EBV-positive NK cells, which proliferated in the diseased individuals. The results showed that EBV-positive NK cells in malignant and non-malignant lymphoproliferative diseases shared common cytological and cytogenetic features.

Deletion detection for diagnosis of Duchenne muscular dystrophy in the Japanese population--comparison between the polymerase chain reaction and the Southern blot analysis.

PubMed

Katayama, S; Takeshita, N; Yano, T; Ubagai, T; Qiu, X J; Katagiri, Y; Kubo, H; Hirakawa, S

1993-06-01

We compared the efficacy of the multiplex PCR with that of the cDNA analysis for detection of deletions of the DMD gene in the Japanese patients. Thirty males with DMD from 27 Japanese families were studied by the multiplex PCR, and 24 of them were also investigated by Southern blot analysis. We used five dystrophin cDNA probes for deletion analysis. A total of 19 regions were amplified by the PCR to detect deletions, 9 regions by the method of Chamberlain et al. and another 10 regions by the method of Beggs et al. Deletions were detected in 14 (52%) out of 27 DMD families by the PCR. Southern blot analysis detected deletions in 14 (64%) out of 22 families. Thirteen (93%) of the 14 DMD families with deletions detected by Southern blotting were also confirmed by the multiplex PCR. Provided care is taken in cases where the deletion is limited to a single exon, the multiplex PCR appears to be an efficient and useful alternative to conventional Southern blot analysis for detecting deletions during the prenatal and postnatal diagnosis of DMD.

SOX2 anophthalmia syndrome: 12 new cases demonstrating broader phenotype and high frequency of large gene deletions.

PubMed

Bakrania, P; Robinson, D O; Bunyan, D J; Salt, A; Martin, A; Crolla, J A; Wyatt, A; Fielder, A; Ainsworth, J; Moore, A; Read, S; Uddin, J; Laws, D; Pascuel-Salcedo, D; Ayuso, C; Allen, L; Collin, J R O; Ragge, N K

2007-11-01

Developmental eye anomalies, which include anophthalmia (absent eye) or microphthalmia (small eye) are an important cause of severe visual impairment in infants and young children. Heterozygous mutations in SOX2, a SOX1B-HMG box transcription factor, have been found in up to 10% of individuals with severe microphthalmia or anophthalmia and such mutations could also be associated with a range of non-ocular abnormalities. We performed mutation analysis on a new cohort of 120 patients with congenital eye abnormalities, mainly anophthalmia, microphthalmia and coloboma. Multiplex ligation-dependent probe amplification (MLPA) and fluorescence in situ hybridisation (FISH) were used to detect whole gene deletion. We identified four novel intragenic SOX2 mutations (one single base deletion, one single base duplication and two point mutations generating premature translational termination codons) and two further cases with the previously reported c.70del20 mutation. Of 52 patients with severe microphthalmia or anophthalmia analysed by MLPA, 5 were found to be deleted for the whole SOX2 gene and 1 had a partial deletion. In two of these, FISH studies identified sub-microscopic deletions involving a minimum of 328 Kb and 550 Kb. The SOX2 phenotypes include a patient with anophthalmia, oesophageal abnormalities and horseshoe kidney, and a patient with a retinal dystrophy implicating SOX2 in retinal development. Our results provide further evidence that SOX2 haploinsufficiency is a common cause of severe developmental ocular malformations and that background genetic variation determines the varying phenotypes. Given the high incidence of whole gene deletion we recommend that all patients with severe microphthalmia or anophthalmia, including unilateral cases be screened by MLPA and FISH for SOX2 deletions.

An atypical case of fragile X syndrome caused by a deletion that includes the FMR1 gene.

PubMed Central

Quan, F; Zonana, J; Gunter, K; Peterson, K L; Magenis, R E; Popovich, B W

1995-01-01

Fragile X syndrome is the most common form of inherited mental retardation and results from the transcriptional inactivation of the FMR1 gene. In the vast majority of cases, this is caused by the expansion of an unstable CGG repeat in the first exon of the FMR1 gene. We describe here a phenotypically atypical case of fragile X syndrome, caused by a deletion that includes the entire FMR1 gene and > or = 9.0 Mb of flanking DNA. The proband, RK, was a 6-year-old mentally retarded male with obesity and anal atresia. A diagnosis of fragile X syndrome was established by the failure of RK's DNA to hybridize to a 558-bp PstI-XhoI fragment (pfxa3) specific for the 5'-end of the FMR1 gene. The analysis of flanking markers in the interval from Xq26.3-q28 indicated a deletion extending from between 160-500 kb distal and 9.0 Mb proximal to the FMR1 gene. High-resolution chromosome banding confirmed a deletion with breakpoints in Xq26.3 and Xq27.3. This deletion was maternally transmitted and arose as a new mutation on the grandpaternal X chromosome. The maternal transmission of the deletion was confirmed by FISH using a 34-kb cosmid (c31.4) containing most of the FMR1 gene. These results indicated that RK carried a deletion of the FMR1 region with the most proximal breakpoint described to date. This patient's unusual clinical presentation may indicate the presence of genes located in the deleted interval proximal to the FMR1 locus that are able to modify the fragile X syndrome phenotype. Images Figure 5 Figure 2 Figure 4 Figure 6 Figure 7 PMID:7726157

Contiguous gene deletion of chromosome 2p16.3-p21 as a cause of Lynch syndrome.

PubMed

Salo-Mullen, Erin E; Lynn, Patricio B; Wang, Lu; Walsh, Michael; Gopalan, Anuradha; Shia, Jinru; Tran, Christina; Man, Fung Ying; McBride, Sean; Schattner, Mark; Zhang, Liying; Weiser, Martin R; Stadler, Zsofia K

2018-01-01

Lynch syndrome is an autosomal dominant condition caused by pathogenic mutations in the DNA mismatch repair (MMR) genes. Although commonly associated with clinical features such as intellectual disability and congenital anomalies, contiguous gene deletions may also result in cancer predisposition syndromes. We report on a 52-year-old male with Lynch syndrome caused by deletion of chromosome 2p16.3-p21. The patient had intellectual disability and presented with a prostatic adenocarcinoma with an incidentally identified synchronous sigmoid adenocarcinoma that exhibited deficient MMR with an absence of MSH2 and MSH6 protein expression. Family history was unrevealing. Physical exam revealed short stature, brachycephaly with a narrow forehead and short philtrum, brachydactyly of the hands, palmar transverse crease, broad and small feet with hyperpigmentation of the soles. The patient underwent total colectomy with ileorectal anastomosis for a pT3N1 sigmoid adenocarcinoma. Germline genetic testing of the MSH2, MSH6, and EPCAM genes revealed full gene deletions. SNP-array based DNA copy number analysis identified a deletion of 4.8 Mb at 2p16.3-p21. In addition to the three Lynch syndrome associated genes, the deleted chromosomal section encompassed genes including NRXN1, CRIPT, CALM2, FBXO11, LHCGR, MCFD2, TTC7A, EPAS1, PRKCE, and 15 others. Contiguous gene deletions have been described in other inherited cancer predisposition syndromes, such as Familial Adenomatous Polyposis. Our report and review of the literature suggests that contiguous gene deletion within the 2p16-p21 chromosomal region is a rare cause of Lynch syndrome, but presents with distinct phenotypic features, highlighting the need for recognition and awareness of this syndromic entity.

[Grave's disease in children with 22q11 deletion. Report of three cases].

PubMed

Gosselin, J; Lebon-Labich, B; Lucron, H; Marçon, F; Leheup, B

2004-12-01

Hypothyroidism is a well recognized complication of 22q11.2 deletion syndrome. Auto-immune hyperthyroidism is less common. We report three patients with a 22q11.2 deletion and Graves' disease diagnosed at age 17, 14 and 11 years, respectively. The clinical and biological presentation was typical for auto-immune hyperthyroidism. Graves' disease should be periodically sought during the follow-up program of patients with 22q11.2 deletion syndrome.

A novel silent deletion, an insertion mutation and a nonsense mutation in the TCOF1 gene found in two Chinese cases of Treacher Collins syndrome.

PubMed

Wang, Yan; Yin, Xiao-Juan; Han, Tao; Peng, Wei; Wu, Hong-Lin; Liu, Xin; Feng, Zhi-Chun

2014-12-01

Treacher Collins syndrome (TCS) is the most common and well-known craniofacial disorder caused by mutations in the genes involved in pre-rRNA transcription, which include the TCOF1 gene. This study explored the role of TCOF1 mutations in Chinese patients with TCS. Mutational analysis of the TCOF1 gene was performed in three patients using polymerase chain reaction and direct sequencing. Among these three patients, two additional TCOF1 variations, a novel 18 bp deletion and a novel 1 bp insertion mutation, were found in patient 1, together with a novel nonsense mutation (p.Ser476X) and a previously reported 4 bp deletion (c.1872_1875delTGAG) in other patients. Pedigree analysis allowed for prediction of the character of the mutation, which was either pathological or not. The 18 bp deletion of six amino acids, Ser-Asp-Ser-Glu-Glu-Glu (798*803), which was located in the CKII phosphorylation site of treacle, seemed relatively benign for TCS. By contrast, another novel mutation of c.1072_1073insC (p.Gln358ProfsX23) was a frameshift mutation and expected to result in a premature stop codon. This study provides insights into the functional domain of treacle and illustrates the importance of clinical and family TCS screening for the interpretation of novel sequence alterations.

Analysis of case-parent trios at a locus with a deletion allele: association of GSTM1 with autism.

PubMed

Buyske, Steven; Williams, Tanishia A; Mars, Audrey E; Stenroos, Edward S; Ming, Sue X; Wang, Rong; Sreenath, Madhura; Factura, Marivic F; Reddy, Chitra; Lambert, George H; Johnson, William G

2006-02-10

Certain loci on the human genome, such as glutathione S-transferase M1 (GSTM1), do not permit heterozygotes to be reliably determined by commonly used methods. Association of such a locus with a disease is therefore generally tested with a case-control design. When subjects have already been ascertained in a case-parent design however, the question arises as to whether the data can still be used to test disease association at such a locus. A likelihood ratio test was constructed that can be used with a case-parents design but has somewhat less power than a Pearson's chi-squared test that uses a case-control design. The test is illustrated on a novel dataset showing a genotype relative risk near 2 for the homozygous GSTM1 deletion genotype and autism. Although the case-control design will remain the mainstay for a locus with a deletion, the likelihood ratio test will be useful for such a locus analyzed as part of a larger case-parent study design. The likelihood ratio test has the advantage that it can incorporate complete and incomplete case-parent trios as well as independent cases and controls. Both analyses support (p = 0.046 for the proposed test, p = 0.028 for the case-control analysis) an association of the homozygous GSTM1 deletion genotype with autism.

Analysis of case-parent trios at a locus with a deletion allele: association of GSTM1 with autism

PubMed Central

Buyske, Steven; Williams, Tanishia A; Mars, Audrey E; Stenroos, Edward S; Ming, Sue X; Wang, Rong; Sreenath, Madhura; Factura, Marivic F; Reddy, Chitra; Lambert, George H; Johnson, William G

2006-01-01

Background Certain loci on the human genome, such as glutathione S-transferase M1 (GSTM1), do not permit heterozygotes to be reliably determined by commonly used methods. Association of such a locus with a disease is therefore generally tested with a case-control design. When subjects have already been ascertained in a case-parent design however, the question arises as to whether the data can still be used to test disease association at such a locus. Results A likelihood ratio test was constructed that can be used with a case-parents design but has somewhat less power than a Pearson's chi-squared test that uses a case-control design. The test is illustrated on a novel dataset showing a genotype relative risk near 2 for the homozygous GSTM1 deletion genotype and autism. Conclusion Although the case-control design will remain the mainstay for a locus with a deletion, the likelihood ratio test will be useful for such a locus analyzed as part of a larger case-parent study design. The likelihood ratio test has the advantage that it can incorporate complete and incomplete case-parent trios as well as independent cases and controls. Both analyses support (p = 0.046 for the proposed test, p = 0.028 for the case-control analysis) an association of the homozygous GSTM1 deletion genotype with autism. PMID:16472391

Microdeletions are a general feature of adult and adolescent acute lymphoblastic leukemia: Unexpected similarities with pediatric disease

PubMed Central

Paulsson, Kajsa; Cazier, Jean-Baptiste; MacDougall, Finlay; Stevens, Jane; Stasevich, Irina; Vrcelj, Nikoletta; Chaplin, Tracy; Lillington, Debra M.; Lister, T. Andrew; Young, Bryan D.

2008-01-01

We present here a genome-wide map of abnormalities found in diagnostic samples from 45 adults and adolescents with acute lymphoblastic leukemia (ALL). A 500K SNP array analysis uncovered frequent genetic abnormalities, with cryptic deletions constituting half of the detected changes, implying that microdeletions are a characteristic feature of this malignancy. Importantly, the pattern of deletions resembled that recently reported in pediatric ALL, suggesting that adult, adolescent, and childhood cases may be more similar on the genetic level than previously thought. Thus, 70% of the cases displayed deletion of one or more of the CDKN2A, PAX5, IKZF1, ETV6, RB1, and EBF1 genes. Furthermore, several genes not previously implicated in the pathogenesis of ALL were identified as possible recurrent targets of deletion. In total, the SNP array analysis identified 367 genetic abnormalities not corresponding to known copy number polymorphisms, with all but two cases (96%) displaying at least one cryptic change. The resolution level of this SNP array study is the highest used to date to investigate a malignant hematologic disorder. Our findings provide insights into the leukemogenic process and may be clinically important in adult and adolescent ALL. Most importantly, we report that microdeletions of key genes appear to be a common, characteristic feature of ALL that is shared among different clinical, morphological, and cytogenetic subgroups. PMID:18458336

Large-scale mapping of cortical alterations in 22q11.2 deletion syndrome: Convergence with idiopathic psychosis and effects of deletion size.

PubMed

Sun, Daqiang; Ching, Christopher R K; Lin, Amy; Forsyth, Jennifer K; Kushan, Leila; Vajdi, Ariana; Jalbrzikowski, Maria; Hansen, Laura; Villalon-Reina, Julio E; Qu, Xiaoping; Jonas, Rachel K; van Amelsvoort, Therese; Bakker, Geor; Kates, Wendy R; Antshel, Kevin M; Fremont, Wanda; Campbell, Linda E; McCabe, Kathryn L; Daly, Eileen; Gudbrandsen, Maria; Murphy, Clodagh M; Murphy, Declan; Craig, Michael; Vorstman, Jacob; Fiksinski, Ania; Koops, Sanne; Ruparel, Kosha; Roalf, David R; Gur, Raquel E; Schmitt, J Eric; Simon, Tony J; Goodrich-Hunsaker, Naomi J; Durdle, Courtney A; Bassett, Anne S; Chow, Eva W C; Butcher, Nancy J; Vila-Rodriguez, Fidel; Doherty, Joanne; Cunningham, Adam; van den Bree, Marianne B M; Linden, David E J; Moss, Hayley; Owen, Michael J; Murphy, Kieran C; McDonald-McGinn, Donna M; Emanuel, Beverly; van Erp, Theo G M; Turner, Jessica A; Thompson, Paul M; Bearden, Carrie E

2018-06-13

The 22q11.2 deletion (22q11DS) is a common chromosomal microdeletion and a potent risk factor for psychotic illness. Prior studies reported widespread cortical changes in 22q11DS, but were generally underpowered to characterize neuroanatomic abnormalities associated with psychosis in 22q11DS, and/or neuroanatomic effects of variability in deletion size. To address these issues, we developed the ENIGMA (Enhancing Neuro Imaging Genetics Through Meta-Analysis) 22q11.2 Working Group, representing the largest analysis of brain structural alterations in 22q11DS to date. The imaging data were collected from 10 centers worldwide, including 474 subjects with 22q11DS (age = 18.2 ± 8.6; 46.9% female) and 315 typically developing, matched controls (age = 18.0 ± 9.2; 45.9% female). Compared to controls, 22q11DS individuals showed thicker cortical gray matter overall (left/right hemispheres: Cohen's d = 0.61/0.65), but focal thickness reduction in temporal and cingulate cortex. Cortical surface area (SA), however, showed pervasive reductions in 22q11DS (left/right hemispheres: d = -1.01/-1.02). 22q11DS cases vs. controls were classified with 93.8% accuracy based on these neuroanatomic patterns. Comparison of 22q11DS-psychosis to idiopathic schizophrenia (ENIGMA-Schizophrenia Working Group) revealed significant convergence of affected brain regions, particularly in fronto-temporal cortex. Finally, cortical SA was significantly greater in 22q11DS cases with smaller 1.5 Mb deletions, relative to those with typical 3 Mb deletions. We found a robust neuroanatomic signature of 22q11DS, and the first evidence that deletion size impacts brain structure. Psychotic illness in this highly penetrant deletion was associated with similar neuroanatomic abnormalities to idiopathic schizophrenia. These consistent cross-site findings highlight the homogeneity of this single genetic etiology, and support the suitability of 22q11DS as a biological model of schizophrenia.

Multi-agent chemotherapy overcomes glucocorticoid resistance conferred by a BIM deletion polymorphism in pediatric acute lymphoblastic leukemia.

PubMed

Soh, Sheila Xinxuan; Lim, Joshua Yew Suang; Huang, John W J; Jiang, Nan; Yeoh, Allen Eng Juh; Ong, S Tiong

2014-01-01

A broad range of anti-cancer agents, including glucocorticoids (GCs) and tyrosine kinase inhibitors (TKIs), kill cells by upregulating the pro-apoptotic BCL2 family member, BIM. A common germline deletion in the BIM gene was recently shown to favor the production of non-apoptotic BIM isoforms, and to predict inferior responses in TKI-treated chronic myeloid leukemia (CML) and EGFR-driven lung cancer patients. Given that both in vitro and in vivo GC resistance are predictive of adverse outcomes in acute lymphoblastic leukemia (ALL), we hypothesized that this polymorphism would mediate GC resistance, and serve as a biomarker of poor response in ALL. Accordingly, we used zinc finger nucleases to generate ALL cell lines with the BIM deletion, and confirmed the ability of the deletion to mediate GC resistance in vitro. In contrast to CML and lung cancer, the BIM deletion did not predict for poorer clinical outcome in a retrospective analysis of 411 pediatric ALL patients who were uniformly treated with GCs and chemotherapy. Underlying the lack of prognostic significance, we found that the chemotherapy agents used in our cohort (vincristine, L-asparaginase, and methotrexate) were each able to induce ALL cell death in a BIM-independent fashion, and resensitize BIM deletion-containing cells to GCs. Together, our work demonstrates how effective therapy can overcome intrinsic resistance in ALL patients, and suggests the potential of using combinations of drugs that work via divergent mechanisms of cell killing to surmount BIM deletion-mediated drug resistance in other cancers.

Difference of clinical phenotypes and immunological features of 22q11.2 deletion syndrome in north-eastern Thai children compare to western countries.

PubMed

Wichajam, Khunton; Kampan, Jureeporn

2014-10-01

22q11.2 deletion syndrome is a common microdeletion syndrome that affected various systems. To determine clinical phenotypes and immunologicalfeatures of 22q11.2 deletion syndrome in north-eastern Thai children compare to western countries. The authors described the clinical and immunological features in 20 north-eastern Thai children with 22q11.2 deletion syndrome that were followed-up at Srinagarind Hospital. Clinical phenotypes were facial dysmorphism (100%), congenital heart disease (80%) and cleft palate (30%). Prevalence of tetralogy of Fallot (TOF) in this syndrome was higher than in western. Serious infections were found including pneumonia, septicemia and brain abscess. Only a patient had panhypogammaglobulinemia and subsequently died. Selective IgA deficiency was not found. There was a twin patient conceivedfrom intracytoplasmic sperm injection (ICSI). TOF is more common in Asian patients than in western which different to selective IgA deficiency. The 22q11.2 deletion syndrome could be consequence from ICSI.

Generation and characterization of koi herpesvirus recombinants lacking viral enzymes of nucleotide metabolism.

PubMed

Fuchs, Walter; Fichtner, Dieter; Bergmann, Sven M; Mettenleiter, Thomas C

2011-06-01

Koi herpesvirus (KHV) causes a fatal disease in koi and common carp, but no reliable and genetically characterized vaccines are available up to now. Therefore, we generated KHV recombinants possessing deletions within the viral ribonucleotide reductase (RNR), thymidine kinase (TK), dUTPase, or TK and dUTPase genes, and their corresponding rescuants. All KHV mutants were replication competent in cultured cells. Whereas plaque sizes and titers of RNR-negative KHV were reduced, replication of the other mutants was not affected. Experimental infection of carp indicated attenuation of TK- or dUTPase-deleted KHV, and PCR analysis of tissue samples permitted differentiation of mutant from wild-type virus.

Autistic disorder in patients with Williams-Beuren syndrome: a reconsideration of the Williams-Beuren syndrome phenotype.

PubMed

Tordjman, Sylvie; Anderson, George M; Botbol, Michel; Toutain, Annick; Sarda, Pierre; Carlier, Michèle; Saugier-Veber, Pascale; Baumann, Clarisse; Cohen, David; Lagneaux, Céline; Tabet, Anne-Claude; Verloes, Alain

2012-01-01

Williams-Beuren syndrome (WBS), a rare developmental disorder caused by deletion of contiguous genes at 7q11.23, has been characterized by strengths in socialization (overfriendliness) and communication (excessive talkativeness). WBS has been often considered as the polar opposite behavioral phenotype to autism. Our objective was to better understand the range of phenotypic expression in WBS and the relationship between WBS and autistic disorder. The study was conducted on 9 French individuals aged from 4 to 37 years old with autistic disorder associated with WBS. Behavioral assessments were performed using Autism Diagnostic Interview-Revised (ADI-R) and Autism Diagnostic Observation Schedule (ADOS) scales. Molecular characterization of the WBS critical region was performed by FISH. FISH analysis indicated that all 9 patients displayed the common WBS deletion. All 9 patients met ADI-R and ADOS diagnostic criteria for autism, displaying stereotypies and severe impairments in social interaction and communication (including the absence of expressive language). Additionally, patients showed improvement in social communication over time. The results indicate that comorbid autism and WBS is more frequent than expected and suggest that the common WBS deletion can result in a continuum of social communication impairment, ranging from excessive talkativeness and overfriendliness to absence of verbal language and poor social relationships. Appreciation of the possible co-occurrence of WBS and autism challenges the common view that WBS represents the opposite behavioral phenotype of autism, and might lead to improved recognition of WBS in individuals diagnosed with autism.

Heterozygous Deletion of FOXA2 Segregates with Disease in a Family with Heterotaxy, Panhypopituitarism, and Biliary Atresia

PubMed Central

Tsai, Ellen A.; Grochowski, Christopher M.; Falsey, Alexandra M.; Rajagopalan, Ramakrishnan; Wendel, Danielle; Devoto, Marcella; Krantz, Ian D.; Loomes, Kathleen M.; Spinner, Nancy B.

2015-01-01

Biliary atresia (BA) is a pediatric cholangiopathy with unknown etiology occurring in isolated and syndromic forms. Laterality defects affecting the cardiovascular and gastrointestinal systems are the most common features present in syndromic BA. Most cases are sporadic, although reports of familial cases have led to the hypothesis of genetic susceptibility in some patients. We identified a child with BA, malrotation, and interrupted inferior vena cava whose father presented with situs inversus, polysplenia, panhypopituitarism, and mildly dysmorphic facial features. Chromosomal microarray analysis demonstrated a 277kb heterozygous deletion on chromosome 20 which included a single gene, FOXA2, in the proband and her father. This deletion was confirmed to be de novo in the father. The proband and her father share a common diagnosis of heterotaxy, but they also each presented with a variety of other issues. Further genetic screening revealed that the proband carried an additional protein-altering polymorphism (rs1904589; p.His165Arg) in the NODAL gene that is not present in the father, and this variant has been shown to decrease expression of the gene. As FOXA2 can be a regulator of NODAL expression, we propose that haploinsufficiency for FOXA2 combined with a decreased expression of NODAL is the likely cause for syndromic BA in this proband. PMID:25765999

The Common Inversion of the Williams–Beuren Syndrome Region at 7q11.23 Does Not Cause Clinical Symptoms

PubMed Central

Tam, Elaine; Young, Edwin J.; Morris, Colleen A.; Marshall, Christian R.; Loo, Wayne; Scherer, Stephen W.; Mervis, Carolyn B.; Osborne, Lucy R.

2010-01-01

Williams–Beuren syndrome (WBS) is caused by a ~1.5 million base pair deletion at 7q11.23. A common inversion of the region, WBSinv-1, exists as a polymorphism but was also found in individuals with WBS-like features but no deletion, suggesting it could cause clinical symptoms. We performed a full clinical, developmental and genetic assessment of two previously reported individuals with clinical symptoms and WBSinv-1 but no 7q11.23 deletion. We also examined expression of genes at 7q11.23 in individuals in the general population who have WBSinv-1. We show that individuals with clinical symptoms and WBSinv-1 do not show significant clinical or psychological overlap with individuals with WBS. In addition, a 1.3 Mb duplication of part of the velocardiofacial syndrome region on chromosome 22q11.2 was found in one participant with WBSinv-1 and clinical symptoms. We also demonstrate that individuals with WBSinv-1 show normal expression of genes from the WBS region. These results suggest that WBSinv-1 does not cause clinical symptoms and we advise caution when diagnosing individuals with atypical presentation of rare syndromes. Whole genome analysis may reveal previously unidentified copy number variants that could contribute to syndromic features. PMID:18553513

The use of field-inversion gel electrophoresis for deletion detection in Duchenne muscular dystrophy.

PubMed Central

Chen, J D; Denton, M J; Morgan, G; Pearn, J H; Mackinlay, A G

1988-01-01

Deletion is a common cause of Duchenne muscular dystrophy (DMD). Field-inversion gel electrophoresis, in conjunction with Southern blot hybridization, was used to detect large SfiI DNA fragments in the DMD locus. Two unrelated boys with DMD were found to have abnormal sized DNA fragments resulting from deletions. Some of the female relatives of these patients were also shown by this method to have deletions in the DMD locus. Images Figure 1 PMID:3358426

Dosage analysis of cancer predisposition genes by multiplex ligation-dependent probe amplification

PubMed Central

Bunyan, D J; Eccles, D M; Sillibourne, J; Wilkins, E; Thomas, N Simon; Shea-Simonds, J; Duncan, P J; Curtis, C E; Robinson, D O; Harvey, J F; Cross, N C P

2004-01-01

Multiplex ligation-dependent probe amplification (MLPA) is a recently described method for detecting gross deletions or duplications of DNA sequences, aberrations which are commonly overlooked by standard diagnostic analysis. To determine the incidence of copy number variants in cancer predisposition genes from families in the Wessex region, we have analysed the hMLH1 and hMSH2 genes in patients with hereditary nonpolyposis colorectal cancer (HNPCC), BRCA1 and BRCA2 in families with hereditary breast/ovarian cancer (BRCA) and APC in patients with familial adenomatous polyposis coli (FAP). Hereditary nonpolyposis colorectal cancer (n=162) and FAP (n=74) probands were fully screened for small mutations, and cases for which no causative abnormality were found (HNPCC, n=122; FAP, n=24) were screened by MLPA. Complete or partial gene deletions were identified in seven cases for hMSH2 (5.7% of mutation-negative HNPCC; 4.3% of all HNPCC), no cases for hMLH1 and six cases for APC (25% of mutation negative FAP; 8% of all FAP). For BRCA1 and BRCA2, a partial mutation screen was performed and 136 mutation-negative cases were selected for MLPA. Five deletions and one duplication were found for BRCA1 (4.4% of mutation-negative BRCA cases) and one deletion for BRCA2 (0.7% of mutation-negative BRCA cases). Cost analysis indicates it is marginally more cost effective to perform MLPA prior to point mutation screening, but the main advantage gained by prescreening is a greatly reduced reporting time for the patients who are positive. These data demonstrate that dosage analysis is an essential component of genetic screening for cancer predisposition genes. PMID:15475941

Cold Urticaria, Immunodeficiency, and Autoimmunity Related to PLCG2 Deletions

PubMed Central

Ombrello, Michael J.; Remmers, Elaine F.; Sun, Guangping; Freeman, Alexandra F.; Datta, Shrimati; Torabi-Parizi, Parizad; Subramanian, Naeha; Bunney, Tom D.; Baxendale, Rhona W.; Martins, Marta S.; Romberg, Neil; Komarow, Hirsh; Aksentijevich, Ivona; Kim, Hun Sik; Ho, Jason; Cruse, Glenn; Jung, Mi-Yeon; Gilfillan, Alasdair M.; Metcalfe, Dean D.; Nelson, Celeste; O'Brien, Michelle; Wisch, Laura; Stone, Kelly; Douek, Daniel C.; Gandhi, Chhavi; Wanderer, Alan A.; Lee, Hane; Nelson, Stanley F.; Shianna, Kevin V.; Cirulli, Elizabeth T.; Goldstein, David B.; Long, Eric O.; Moir, Susan; Meffre, Eric; Holland, Steven M.; Kastner, Daniel L.; Katan, Matilda; Hoffman, Hal M.; Milner, Joshua D.

2012-01-01

Background Mendelian analysis of disorders of immune regulation can provide insight into molecular pathways associated with host defense and immune tolerance. Methods We identified three families with a dominantly inherited complex of cold-induced urticaria, antibody deficiency, and susceptibility to infection and autoimmunity. Immunophenotyping methods included flow cytometry, analysis of serum immunoglobulins and autoantibodies, lymphocyte stimulation, and enzymatic assays. Genetic studies included linkage analysis, targeted Sanger sequencing, and next-generation whole-genome sequencing. Results Cold urticaria occurred in all affected subjects. Other, variable manifestations included atopy, granulomatous rash, autoimmune thyroiditis, the presence of antinuclear antibodies, sinopulmonary infections, and common variable immunodeficiency. Levels of serum IgM and IgA and circulating natural killer cells and class-switched memory B cells were reduced. Linkage analysis showed a 7-Mb candidate interval on chromosome 16q in one family, overlapping by 3.5 Mb a disease-associated haplotype in a smaller family. This interval includes PLCG2, encoding phospholipase Cγ2 (PLCγ2), a signaling molecule expressed in B cells, natural killer cells, and mast cells. Sequencing of complementary DNA revealed heterozygous transcripts lacking exon 19 in two families and lacking exons 20 through 22 in a third family. Genomic sequencing identified three distinct in-frame deletions that cosegregated with disease. These deletions, located within a region encoding an autoinhibitory domain, result in protein products with constitutive phospholipase activity. PLCG2-expressing cells had diminished cellular signaling at 37°C but enhanced signaling at subphysiologic temperatures. Conclusions Genomic deletions in PLCG2 cause gain of PLCγ2 function, leading to signaling abnormalities in multiple leukocyte subsets and a phenotype encompassing both excessive and deficient immune function. (Funded by the National Institutes of Health Intramural Research Programs and others.) PMID:22236196

Molecular Definition of the 22q11 Deletions in Velo-Cardio-Facial Syndrome

PubMed Central

Morrow, Bernice; Goldberg, Rosalie; Carlson, Christine; Gupta, Ruchira Das; Sirotkin, Howard; Collins, John; Dunham, Ian; O'Donnell, Hilary; Scambler, Peter; Shprintzen, Robert; Kucherlapati, Raju

1995-01-01

Velo-cardio-facial syndrome (VCFS) is a common genetic disorder among individuals with cleft palate and is associated with hemizygous deletions in human chromosome 22q11. Toward the molecular definition of the deletions, we constructed a physical map of 22q11 in the form of overlapping YACs. The physical map covers >9 cM of genetic distance, estimated to span 5 Mb of DNA, and contains a total of 64 markers. Eleven highly polymorphic short tandem-repeat polymorphic (STRP) markers were placed on the physical map, and 10 of these were unambiguously ordered. The 11 polymorphic markers were used to type the DNA from a total of 61 VCFS patients and 49 unaffected relatives. Comparison of levels of heterozygosity of these markers in VCFS patients and their unaffected relatives revealed that four of these markers are commonly hemizygous among VCFS patients. To confirm these results and to define further the breakpoints in VCFS patients, 15 VCFS individuals and their unaffected parents were genotyped for the 11 STRP markers. Haplotypes generated from this study revealed that 82% of the patients have deletions that can be defined by the STRP markers. The results revealed that all patients who have a deletion share a common proximal breakpoint, while there are two distinct distal breakpoints. Markers D22S941 and D22S944 appear to be consistently hemizygous in patients with deletions. Both of these markers are located on a single nonchimeric YAC that is 400 kb long. The results also show that the parental origin of the deleted chromosome does not have any effect on the phenotypic manifestation ImagesFigure 2Figure 3 PMID:7762562

Molecular definition of the 22q11 deletions in velo-cardio-facial syndrome

DOE Office of Scientific and Technical Information (OSTI.GOV)

Morrow, B.; Carlson, C.; Gupta, R.D.

Velo-cardio-facial syndrome (VCFS) is a common genetic disorder among individuals with cleft plate and is associated with hemizygous deletions in human chromosome 22q11. Toward the molecular definition of the deletions, we constructed a physical map of 22q11 in the form of overlapping YACs. The physical map covers >9 cM of genetic distance, estimated to span 5 Mb of DNA, and contains a total of 64 markers. Eleven highly polymorphic short tandem-repeat polymorphic (STRP) markers were placed on the physical map, and 10 of these were unambiguously ordered. The 11 polymorphic markers were used to type the DNA from a totalmore » of 61 VCFS patients and 49 unaffected relatives. Comparison of levels of heterozygosity of these markers in VCFS patients and their unaffected relatives revealed that four of these markers are commonly hemizygous among VCFS patients. To confirm these results and to define further the breakpoints in VCFS patients, 15 VCFS individuals and their unaffected parents were genotyped for the 11 STRP markers. Haplotypes generated from this study revealed that 82% of the patients have deletions that can be defined by the STRP markers. The results revealed that all patients who have a deletion share a common proximal breakpoint, while there are two distinct distal breakpoints. Markers D22S941 and D22S944 appear to be consistently hemizygous in patients with deletions. Both of these markers are located on a single nonchimeric YAC that is 400 kb long. The results show that the parental origin of the deleted chromosome does not have any effect on the phenotypic manifestation. 58 refs., 6 figs., 2 tabs.« less

Genetics Home Reference: 17q12 deletion syndrome

MedlinePlus

... spectrum disorder (which affects social interaction and communication), schizophrenia , anxiety, and bipolar disorder . Less commonly, 17q12 deletion ... Encyclopedia: Autism Spectrum Disorder Encyclopedia: Bipolar Disorder Encyclopedia: ... Topic: Developmental Disabilities Health Topic: Diabetes Health ...

APC promoter 1B deletion in seven American families with familial adenomatous polyposis.

PubMed

Snow, A K; Tuohy, T M F; Sargent, N R; Smith, L J; Burt, R W; Neklason, D W

2015-10-01

Familial adenomatous polyposis (FAP) is a colorectal cancer predisposition syndrome caused by mutations in the adenomatous polyposis coli (APC) gene. Clinical genetic testing fails to identify disease causing mutations in up to 20% of clinically apparent FAP cases. Following the inclusion of multiplex ligation-dependent probe amplification (MLPA) probes specific for APC promoter 1B, seven probands were identified with a deletion of promoter 1B. Using haplotype analysis spanning the APC locus, the seven families appear to be identical by descent from a common founder. The clinical phenotype of 19 mutation carriers is classical FAP with colectomy at an average age of 24. The majority of cases had a large number of duodenal and gastric polyps. Measurements of allele-specific expression of APC mRNA using TaqMan assay confirmed that relative expression in the allele containing the promoter 1B deletion was reduced 42-98%, depending on tissue type. This study confirms the importance of APC promoter deletions as a cause of FAP and identifies a founder mutation in FAP patients from the United States. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

A new case of interstitial 6q16.2 deletion in a patient with Prader-Willi-like phenotype and investigation of SIM1 gene deletion in 87 patients with syndromic obesity.

PubMed

Varela, Monica C; Simões-Sato, Alex Y; Kim, Chong A; Bertola, Débora R; De Castro, Claudia I E; Koiffmann, Celia P

2006-01-01

The association of obesity, phenotypic abnormalities and mental retardation characterizes syndromic obesity. Its most common form is the Prader-Willi syndrome (PWS-- neonatal hypotonia, poor sucking, delayed psychomotor development, hyperphagia, severe obesity, short stature, small hands and feet, hypogonadism, mild to moderate mental retardation and behavioral disorders). A PWS-like phenotype has been described in patients with chromosome abnormalities involving the chromosome region 6q16.2 that includes the SIM1 gene. Herein we report cytogenetic and gene studies including a screening for the SIM1 gene deletion, performed on 87 patients with PWS-like phenotype, and describe the fifth case of syndromic obesity with an interstitial deletion of the chromosome segment 6q16-q21 and suggest that mutational analysis and further studies of the parental origin of chromosome alterations of 6q16.2 in patients with and without PWS-like phenotype are needed to evaluate possible imprinting effects of SIM1 gene and establish the contribution that alterations in this gene makes to the etiology of syndromic and non-syndromic obesity.

Genetic Dosage Compensation in a Family with Velo-cardio-facial/DiGeorge/22q11.2 Deletion Syndrome

PubMed Central

Alkalay, Avishai A.; Guo, Tingwei; Montagna, Cristina; Digilio, M. Cristina; Marino, Bruno; Dallapiccola, Bruno; Morrow, Bernice

2014-01-01

Cytogenetic studies of a male child carrying the 22q11.2 deletion common in patients with velo-cardio-facial/DiGeorge syndrome revealed an unexpected rearrangement of the 22q11.2 region in his normal appearing mother. The mother carries a 3 Mb deletion on one copy and a reciprocal, similar sized duplication on the other copy of chromosome 22q11.2 as revealed by fluorescence in situ hybridization and array comparative genome hybridization analysis. The most parsimonious mechanism for the rearrangement is a mitotic non-allelic homologous recombination event in a cell in the early embryo soon after fertilization. The normal phenotype of the mother can be explained by the theory of genetic dosage compensation. This is the second documented case of such an event for this or any genomic disorder. This finding helps to reinforce this phenomenon in a human model, and has significant implications for genetic counseling of future children. PMID:21337693

A 6-amino acid insertion/deletion polymorphism in the mucin domain of TIM-1 confers protections against HIV-1 infection.

PubMed

Biasin, Mara; Sironi, Manuela; Saulle, Irma; Pontremoli, Chiara; Garziano, Micaela; Cagliani, Rachele; Trabattoni, Daria; Lo Caputo, Sergio; Vichi, Francesca; Mazzotta, Francesco; Forni, Diego; Riva, Stefania; Aguilar-Jimenez, Wbeimar; Cedeño, Samandhy; Sanchez, Jorge; Brander, Christian; Zapata, Wildeman; Rugeles, Maria Teresa; Clerici, Mario

2017-01-01

We investigated whether a 6-amino acid insertion/deletion polymorphism in the mucin domain of TIM-1 (T-cell immunoglobulin and mucin domain 1), modulates susceptibility to HIV-1 infection. The polymorphism was genotyped in three case/control cohorts of HIV-1 exposed seronegative individuals (HESN) and HIV-1 infected subjects from Italy, Peru, and Colombia; data from a Thai population were retrieved from the literature. Across all cohorts, homozygosity for the short TIM-1 allele was more common in HESNs than in HIV-1 infected subjects. A meta-analysis of the four association analyses yielded a p value of 0.005. In vitro infection assays of CD4+ T lymphocytes indicated that homozygosity for the short allele is associated with lower rate of HIV-1 replication. These results suggest that the deletion allele protects from HIV-1 infection with a recessive effect. Copyright © 2016 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.

Velo-cardio-facial syndrome: Frequency and textent of 22q11 deletions

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lindsay, E.A.; Goldberg, R.; Jurecic, V.

Velo-cardio-facial (VCFS) or Shprintzen syndrome is associated with deletions in a region of chromosome 22q11.2 also deleted in DiGeorge anomaly and some forms of congenital heart disease. Due to the variability of phenotype, the evaluation of the incidence of deletions has been hampered by uncertainty of diagnosis. In this study, 54 patients were diagnosed with VCFS by a single group of clinicians using homogeneous clinical criteria independent of the deletion status. Cell lines of these patients were established and the deletion status evaluated for three loci within the commonly deleted region at 22q11.2 using fluorescence in situ hybridization (FISH). Inmore » 81% of the patients all three loci were hemizygous. In one patient we observed a smaller interstitial deletion than that defined by the three loci. The phenotype of this patient was not different from that observed in patients with larger deletions. 22 refs., 2 figs., 1 tab.« less

Stabilization of perfect and imperfect tandem repeats by single-strand DNA exonucleases

PubMed Central

Feschenko, Vladimir V.; Rajman, Luis A.; Lovett, Susan T.

2003-01-01

Rearrangements between tandemly repeated DNA sequences are a common source of genetic instability. Such rearrangements underlie several human genetic diseases. In many organisms, the mismatch-repair (MMR) system functions to stabilize repeats when the repeat unit is short or when sequence imperfections are present between the repeats. We show here that the action of single-stranded DNA (ssDNA) exonucleases plays an additional, important role in stabilizing tandem repeats, independent of their role in MMR. For perfect repeats of ≈100 bp in Escherichia coli that are not susceptible to MMR, exonuclease (Exo)-I, ExoX, and RecJ exonuclease redundantly inhibit deletion. Our data suggest that >90% of potential deletion events are avoided by the combined action of these three exonucleases. Imperfect tandem repeats, less prone to rearrangements, are stabilized by both the MMR-pathway and ssDNA-specific exonucleases. For 100-bp repeats containing four mispairs, ExoI alone aborts most deletion events, even in the presence of a functional MMR system. By genetic analysis, we show that the inhibitory effect of ssDNA exonucleases on deletion formation is independent of the MutS and UvrD proteins. Exonuclease degradation of DNA displaced during the deletion process may abort slipped misalignment. Exonuclease action is therefore a significant force in genetic stabilization of many forms of repetitive DNA. PMID:12538867

Genotype-phenotype analysis of recombinant chromosome 4 syndrome: an array-CGH study and literature review

PubMed Central

2013-01-01

Background Recombinant chromosome 4, a rare constitutional rearrangement arising from pericentric inversion, comprises a duplicated segment of 4p13~p15→4pter and a deleted segment of 4q35→4qter. To date, 10 cases of recombinant chromosome 4 have been reported. Result We describe the second case in which array-CGH was used to characterize recombinant chromosome 4 syndrome. The patient was a one-year old boy with consistent clinical features. Conventional cytogenetics and FISH documented a recombinant chromosome 4, derived from a paternal pericentric inversion, leading to partial trisomy 4p and partial monosomy of 4q. Array-CGH, performed to further characterize the rearranged chromosome 4 and delineate the breakpoints, documented a small (4.36 Mb) 4q35.1 terminal deletion and a large (23.81 Mb) 4p15.1 terminal duplication. Genotype-phenotype analysis of 10 previously reported cases and the present case indicated relatively consistent clinical features and breakpoints. This consistency was more evident in our case and another characterized by array-CGH, where both showed the common breakpoints of p15.1 and q35.1. A genotype-phenotype correlation study between rec(4), dup(4p), and del(4q) syndromes revealed that urogenital and cardiac defects are probably due to the deletion of 4q whereas the other clinical features are likely due to 4p duplication. Conclusion Our findings support that the clinical features of patients with rec(4) are relatively consistent and specific to the regions of duplication or deletion. Recombinant chromosome 4 syndrome thus appears to be a discrete entity that can be suspected on the basis of clinical features or specific deleted and duplicated chromosomal regions. PMID:23639048

Genotype-phenotype analysis of recombinant chromosome 4 syndrome: an array-CGH study and literature review.

PubMed

Hemmat, Morteza; Hemmat, Omid; Anguiano, Arturo; Boyar, Fatih Z; El Naggar, Mohammed; Wang, Jia-Chi; Wang, Borris T; Sahoo, Trilochan; Owen, Renius; Haddadin, Mary

2013-05-02

Recombinant chromosome 4, a rare constitutional rearrangement arising from pericentric inversion, comprises a duplicated segment of 4p13~p15→4pter and a deleted segment of 4q35→4qter. To date, 10 cases of recombinant chromosome 4 have been reported. We describe the second case in which array-CGH was used to characterize recombinant chromosome 4 syndrome. The patient was a one-year old boy with consistent clinical features. Conventional cytogenetics and FISH documented a recombinant chromosome 4, derived from a paternal pericentric inversion, leading to partial trisomy 4p and partial monosomy of 4q. Array-CGH, performed to further characterize the rearranged chromosome 4 and delineate the breakpoints, documented a small (4.36 Mb) 4q35.1 terminal deletion and a large (23.81 Mb) 4p15.1 terminal duplication. Genotype-phenotype analysis of 10 previously reported cases and the present case indicated relatively consistent clinical features and breakpoints. This consistency was more evident in our case and another characterized by array-CGH, where both showed the common breakpoints of p15.1 and q35.1. A genotype-phenotype correlation study between rec(4), dup(4p), and del(4q) syndromes revealed that urogenital and cardiac defects are probably due to the deletion of 4q whereas the other clinical features are likely due to 4p duplication. Our findings support that the clinical features of patients with rec(4) are relatively consistent and specific to the regions of duplication or deletion. Recombinant chromosome 4 syndrome thus appears to be a discrete entity that can be suspected on the basis of clinical features or specific deleted and duplicated chromosomal regions.

The impact of trisomy 12, retinoblastoma gene and P53 in prognosis of B-cell chronic lymphocytic leukemia.

PubMed

AbdelSalam, M; El Sissy, A; Samra, M A; Ibrahim, S; El Markaby, D; Gadallah, F

2008-06-01

Routine cytogenetic analysis frequently fails to identify an abnormal clone in B-cell lymphocytic leukaemia (B-CLL) due to poor response to mitogen stimulation. Fluorescence in situ hybridization (FISH) suggest that chromosomal abnormalities occur more frequently, most commonly trisomy 12, retinoblastoma gene deletion (Rb1 gene) and P53 gene deletion. 30 patients with B-CLL were enrolled in the trial from two centers in Cairo, Egypt during the period May 2000 to January 2002. Karyotyping and FISH assessment for possible chromosomal abnormalities (trisomy 12, Rb1 gene and P53 gene) were done at initial diagnosis. Results of cytogenetic abnormalities were correlated with clinical picture and survival. The median age was 57.4 years (range 40-75). Karyotyping technique showed that no metaphase could be detected in 30%, metaphase with normal karyotyping was observed in 63% and cytogenetic abnormalities were detected in two cases (one trisomy 12 and one deletion in chromosome 13). FISH examination of interphase and metaphase nuclei revealed cytogenetic abnormalities in 15 cases (50%), trisomy 12 in 9 (30%), Rb1 gene deletion in 5 (17%) and P53 gene deletion in 3. At diagnosis, patients with trisomy 12 were significantly associated with advanced stage and absolute lymphocyte count of >or=30,000/mm(3). Univariate analysis showed that absolute lymphocyte count >or=30,000/mm(3) (p=0.004) and trisomy 12 (p=0.024) were associated with poor progression free survival. Interphase and metaphase FISH studies improve the cytogenetic diagnosis of chromosomal abnormalities in B-CLL. Lymphocytosis and trisomy 12 may be a good indicator of poor prognosis.

Fluorescence in situ hybridization for the diagnosis of NPHP1 deletion-related nephronophthisis on renal biopsy.

PubMed

Larsen, Christopher P; Bonsib, Stephen M; Beggs, Marjorie L; Wilson, Jon D

2018-06-24

Nephronophthisis is an autosomal recessive tubulointerstitial nephropathy that is a leading genetic etiology of end stage renal disease in children and young adults. Approximately 60% of patients with a known genetic etiology of nephronophthisis are due to homozygous deletion of the NPHP1 gene. We identified a total of 45 renal biopsies from young patients with chronic kidney disease of undetermined etiology and analyzed them for the possibility of nephronophthisis due to NPHP1 deletion using interphase fluorescence in situ hybridization and/or polymerase chain reaction. Homozygous NPHP1 deletion was identified in nine patients (20%). In cases with adequate tissue, both assays were performed and showed 100% agreement. Blinded histopathologic analysis was then performed and identified six lesions that were significantly more common in biopsies from patients with NPHP1 deletion-proven nephronophthisis than chronic kidney injury of other known etiologies. Many of the classically described nephronophthisis biopsy lesions such as tubular basement membrane duplication, presence of cysts, and mononuclear interstitial inflammation were not significantly associated with this disease when compared with biopsies from patients with chronic kidney injury due to other etiologies. There were, however, morphologic lesions that were strongly associated with NPHP1 deletion including tubular abnormalities such as diverticulum, florets, and macula densa-like change as well as interstitial Tamm-Horsfall aggregates, periglomerular fibrosis, and the absence of arteriosclerosis. Awareness of the histopathologic pattern of injury in nephronophthisis combined with testing for NPHP1 deletion enables renal pathologists to provide a definitive pathologic and genetic diagnosis in a subset of patients with this disease. Copyright © 2018. Published by Elsevier Inc.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Quan, F.; Zonana, J.; Gunter, K.

Fragile X syndrome is the most common form of inherited mental retardation and results from the transcriptional inactivation of the FMR1 gene. In the vast majority of cases, this is caused by the expansion of an unstable CGG repeat in the first exon of the FMR1 gene. We describe here a phenotypically atypical case of fragile X syndrome, caused by a deletion that includes the entire FMR1 gene and {ge}9.0 Mb of flanking DNA. The proband, RK, was a 6-year-old mentally retarded male with obesity and anal atresia. A diagnosis of fragile X syndrome was established by the failure ofmore » RK`s DNA to hybridize to a 558-bp PstI-XhoI fragment (pfxa3) specific for the 5{prime}-end of the FMR1 gene. The analysis of flanking markers in the interval from Xq26.3-q28 indicated a deletion extending from between 160-500 kb distal and 9.0 Mb proximal to the FMR1 gene. High-resolution chromosome banding confirmed a deletion with breakpoints in Xq26.3 and Xq27.3. This deletion was maternally transmitted and arose as a new mutation on the grandpaternal X chromosome. The maternal transmission of the deletion was confirmed by FISH using a 34-kb cosmid (c31.4) containing most of the FMR1 gene. These results indicated that RK carried a deletion of the FMR1 region with the most proximal breakpoint described to date. This patient`s unusual clinical presentation may indicate the presence of genes located in the deleted interval proximal to the FMR1 locus that are able to modify the fragile X syndrome phenotype. 36 refs., 7 figs.« less

Gr/gr deletions on Y-chromosome correlate with male infertility: an original study, meta-analyses, and trial sequential analyses

NASA Astrophysics Data System (ADS)

Bansal, Sandeep Kumar; Jaiswal, Deepika; Gupta, Nishi; Singh, Kiran; Dada, Rima; Sankhwar, Satya Narayan; Gupta, Gopal; Rajender, Singh

2016-02-01

We analyzed the AZFc region of the Y-chromosome for complete (b2/b4) and distinct partial deletions (gr/gr, b1/b3, b2/b3) in 822 infertile and 225 proven fertile men. We observed complete AZFc deletions in 0.97% and partial deletions in 6.20% of the cases. Among partial deletions, the frequency of gr/gr deletions was the highest (5.84%). The comparison of partial deletion data between cases and controls suggested a significant association of the gr/gr deletions with infertility (P = 0.0004); however, the other partial deletions did not correlate with infertility. In cohort analysis, men with gr/gr deletions had a relatively poor sperm count (54.20 ± 57.45 million/ml) in comparison to those without deletions (72.49 ± 60.06), though the difference was not statistically significant (p = 0.071). Meta-analysis also suggested that gr/gr deletions are significantly associated with male infertility risk (OR = 1.821, 95% CI = 1.39-2.37, p = 0.000). We also performed trial sequential analyses that strengthened the evidence for an overall significant association of gr/gr deletions with the risk of male infertility. Another meta-analysis suggested a significant association of the gr/gr deletions with low sperm count. In conclusion, the gr/gr deletions show a strong correlation with male infertility risk and low sperm count, particularly in the Caucasian populations.

Usefulness of p16/CDKN2A fluorescence in situ hybridization and BAP1 immunohistochemistry for the diagnosis of biphasic mesothelioma.

PubMed

Wu, Di; Hiroshima, Kenzo; Yusa, Toshikazu; Ozaki, Daisuke; Koh, Eitetsu; Sekine, Yasuo; Matsumoto, Shinji; Nabeshima, Kazuki; Sato, Ayuko; Tsujimura, Tohru; Yamakawa, Hisami; Tada, Yuji; Shimada, Hideaki; Tagawa, Masatoshi

2017-02-01

Malignant mesothelioma is a highly aggressive neoplasm, and the histologic subtype is one of the most reliable prognostic factors. Some biphasic mesotheliomas are difficult to distinguish from epithelioid mesotheliomas with atypical fibrous stroma. The aim of this study was to analyze p16/CDKN2A deletions in mesotheliomas by fluorescence in situ hybridization (FISH) and BAP1 immunohistochemistry to evaluate their potential role in the diagnosis of biphasic mesothelioma. We collected 38 cases of pleural mesotheliomas. The results of this study clearly distinguished 29 cases of biphasic mesothelioma from 9 cases of epithelioid mesothelioma. The proportion of biphasic mesotheliomas with homozygous deletions of p16/CDKN2A in total was 96.6% (28/29). Homozygous deletion of p16/CDKN2A was observed in 18 (94.7%) of 19 biphasic mesotheliomas with 100% concordance of the p16/CDKN2A deletion status between the epithelioid and sarcomatoid components in each case. Homozygous deletion of the p16/CDKN2A was observed in 7 (77.8%) of 9 epithelioid mesotheliomas but not in fibrous stroma. BAP1 loss was observed in 5 (38.5%) of 13 biphasic mesotheliomas and in both epithelioid and sarcomatoid components. BAP1 loss was observed in 5 (62.5%) of 8 epithelioid mesotheliomas but not in fibrous stroma. Homozygous deletion of p16/CDKN2A is common in biphasic mesotheliomas, and the analysis of only one component of mesothelioma is sufficient to show that the tumor is malignant. However, compared with histology alone, FISH analysis of the p16/CDKN2A status and BAP1 immunohistochemistry in the spindled mesothelium provide a more objective means to differentiate between biphasic mesothelioma and epithelioid mesothelioma with atypical stromal cells. Copyright © 2016 Elsevier Inc. All rights reserved.

Clinicopathologic and molecular spectrum of RNASEH1-related mitochondrial disease

PubMed Central

Bugiardini, Enrico; Poole, Olivia V.; Manole, Andreea; Pittman, Alan M.; Horga, Alejandro; Hargreaves, Iain; Woodward, Cathy E.; Sweeney, Mary G.; Holton, Janice L.; Taanman, Jan-Willem; Plant, Gordon T.; Poulton, Joanna; Zeviani, Massimo; Ghezzi, Daniele; Taylor, John; Smith, Conrad; Fratter, Carl; Kanikannan, Meena A.; Paramasivam, Arumugam; Thangaraj, Kumarasamy; Spinazzola, Antonella; Holt, Ian J.; Houlden, Henry; Hanna, Michael G.

2017-01-01

Objective: Pathologic ribonuclease H1 (RNase H1) causes aberrant mitochondrial DNA (mtDNA) segregation and is associated with multiple mtDNA deletions. We aimed to determine the prevalence of RNase H1 gene (RNASEH1) mutations among patients with mitochondrial disease and establish clinically meaningful genotype-phenotype correlations. Methods: RNASEH1 was analyzed in patients with (1) multiple deletions/depletion of muscle mtDNA and (2) mendelian progressive external ophthalmoplegia (PEO) with neuropathologic evidence of mitochondrial dysfunction, but no detectable multiple deletions/depletion of muscle mtDNA. Clinicopathologic and molecular evaluation of the newly identified and previously reported patients harboring RNASEH1 mutations was subsequently undertaken. Results: Pathogenic c.424G>A p.Val142Ile RNASEH1 mutations were detected in 3 pedigrees among the 74 probands screened. Given that all 3 families had Indian ancestry, RNASEH1 genetic analysis was undertaken in 50 additional Indian probands with variable clinical presentations associated with multiple mtDNA deletions, but no further RNASEH1 mutations were confirmed. RNASEH1-related mitochondrial disease was characterized by PEO (100%), cerebellar ataxia (57%), and dysphagia (50%). The ataxia neuropathy spectrum phenotype was observed in 1 patient. Although the c.424G>A p.Val142Ile mutation underpins all reported RNASEH1-related mitochondrial disease, haplotype analysis suggested an independent origin, rather than a founder event, for the variant in our families. Conclusions: In our cohort, RNASEH1 mutations represent the fourth most common cause of adult mendelian PEO associated with multiple mtDNA deletions, following mutations in POLG, RRM2B, and TWNK. RNASEH1 genetic analysis should also be considered in all patients with POLG-negative ataxia neuropathy spectrum. The pathophysiologic mechanisms by which the c.424G>A p.Val142Ile mutation impairs human RNase H1 warrant further investigation. PMID:28508084

Recurrent reciprocal deletions and duplications of 16p13.11: the deletion is a risk factor for MR/MCA while the duplication may be a rare benign variant

PubMed Central

Hannes, F D; Sharp, A J; Mefford, H C; de Ravel, T; Ruivenkamp, C A; Breuning, M H; Fryns, J-P; Devriendt, K; Van Buggenhout, G; Vogels, A; Stewart, H; Hennekam, R C; Cooper, G M; Regan, R; Knight, S J L; Eichler, E E; Vermeesch, J R

2009-01-01

Background: Genomic disorders are often caused by non-allelic homologous recombination between segmental duplications. Chromosome 16 is especially rich in a chromosome-specific low copy repeat, termed LCR16. Methods and Results: A bacterial artificial chromosome (BAC) array comparative genome hybridisation (CGH) screen of 1027 patients with mental retardation and/or multiple congenital anomalies (MR/MCA) was performed. The BAC array CGH screen identified five patients with deletions and five with apparently reciprocal duplications of 16p13 covering 1.65 Mb, including 15 RefSeq genes. In addition, three atypical rearrangements overlapping or flanking this region were found. Fine mapping by high-resolution oligonucleotide arrays suggests that these deletions and duplications result from non-allelic homologous recombination (NAHR) between distinct LCR16 subunits with >99% sequence identity. Deletions and duplications were either de novo or inherited from unaffected parents. To determine whether these imbalances are associated with the MR/MCA phenotype or whether they might be benign variants, a population of 2014 normal controls was screened. The absence of deletions in the control population showed that 16p13.11 deletions are significantly associated with MR/MCA (p = 0.0048). Despite phenotypic variability, common features were identified: three patients with deletions presented with MR, microcephaly and epilepsy (two of these had also short stature), and two other deletion carriers ascertained prenatally presented with cleft lip and midline defects. In contrast to its previous association with autism, the duplication seems to be a common variant in the population (5/1682, 0.29%). Conclusion: These findings indicate that deletions inherited from clinically normal parents are likely to be causal for the patients’ phenotype whereas the role of duplications (de novo or inherited) in the phenotype remains uncertain. This difference in knowledge regarding the clinical relevance of the deletion and the duplication causes a paradigm shift in (cyto)genetic counselling. PMID:18550696

Subtelomeric Deletion of Chromosome 10p15.3: Clinical Findings and Molecular Cytogenetic Characterization

PubMed Central

DeScipio, Cheryl; Conlin, Laura; Rosenfeld, Jill; Tepperberg, James; Pasion, Romela; Patel, Ankita; McDonald, Marie T; Aradhya, Swaroop; Ho, Darlene; Goldstein, Jennifer; McGuire, Marianne; Mulchandani, Surabhi; Medne, Livija; Rupps, Rosemarie; Serrano, Alvaro H.; Thorland, Erik C; Tsai, Anne C-H; Hilhorst-Hofstee, Yvonne; Ruivenkamp, Claudia AL; Van Esch, Hilde; Addor, Marie-Claude; Martinet, Danielle; Mason, Thornton B.A.; Clark, Dinah; Spinner, Nancy B; Krantz, Ian D

2012-01-01

We describe 19 unrelated individuals with submicroscopic deletions involving 10p15.3 characterized by chromosomal microarray (CMA). Interestingly, to our knowledge, only two individuals with isolated, submicroscopic 10p15.3 deletion have been reported to date; however, only limited clinical information is available for these probands and the deleted region has not been molecularly mapped. Comprehensive clinical history was obtained for 12 of the 19 individuals described in this study. Common features among these 12 individuals include: cognitive/behavioral/developmental differences (11/11), speech delay/language disorder (10/10), motor delay (10/10), craniofacial dysmorphism (9/12), hypotonia (7/11,), brain anomalies (4/6) and seizures (3/7). Parental studies were performed for nine of the 19 individuals; the 10p15.3 deletion was de novo in seven of the probands, not maternally inherited in one proband and inherited from an apparently affected mother in one proband. Molecular mapping of the 19 individuals reported in this study has identified two genes, ZMYND11 (OMIM# 608668) and DIP2C (OMIM# 611380) (UCSC Genome Browser), mapping within 10p15.3 which are most commonly deleted. Although no single gene has been identified which is deleted in all 19 individuals studied, the deleted region in all but one individual includes ZMYND11 and the deleted region in all but one other individual includes DIP2C. There is not a clearly identifiable phenotypic difference between these two individuals and the size of the deleted region does not generally predict clinical features. Little is currently known about these genes complicating a direct genotype/phenotype correlation at this time. These data however, suggest that ZMYND11 and/or DIP2C haploinsufficiency contributes to the clinical features associated with 10p15 deletions in probands described in this study. PMID:22847950

Subtelomeric deletion of chromosome 10p15.3: clinical findings and molecular cytogenetic characterization.

PubMed

DeScipio, Cheryl; Conlin, Laura; Rosenfeld, Jill; Tepperberg, James; Pasion, Romela; Patel, Ankita; McDonald, Marie T; Aradhya, Swaroop; Ho, Darlene; Goldstein, Jennifer; McGuire, Marianne; Mulchandani, Surabhi; Medne, Livija; Rupps, Rosemarie; Serrano, Alvaro H; Thorland, Erik C; Tsai, Anne C-H; Hilhorst-Hofstee, Yvonne; Ruivenkamp, Claudia A L; Van Esch, Hilde; Addor, Marie-Claude; Martinet, Danielle; Mason, Thornton B A; Clark, Dinah; Spinner, Nancy B; Krantz, Ian D

2012-09-01

We describe 19 unrelated individuals with submicroscopic deletions involving 10p15.3 characterized by chromosomal microarray (CMA). Interestingly, to our knowledge, only two individuals with isolated, submicroscopic 10p15.3 deletion have been reported to date; however, only limited clinical information is available for these probands and the deleted region has not been molecularly mapped. Comprehensive clinical history was obtained for 12 of the 19 individuals described in this study. Common features among these 12 individuals include: cognitive/behavioral/developmental differences (11/11), speech delay/language disorder (10/10), motor delay (10/10), craniofacial dysmorphism (9/12), hypotonia (7/11), brain anomalies (4/6) and seizures (3/7). Parental studies were performed for nine of the 19 individuals; the 10p15.3 deletion was de novo in seven of the probands, not maternally inherited in one proband and inherited from an apparently affected mother in one proband. Molecular mapping of the 19 individuals reported in this study has identified two genes, ZMYND11 (OMIM 608668) and DIP2C (OMIM 611380; UCSC Genome Browser), mapping within 10p15.3 which are most commonly deleted. Although no single gene has been identified which is deleted in all 19 individuals studied, the deleted region in all but one individual includes ZMYND11 and the deleted region in all but one other individual includes DIP2C. There is not a clearly identifiable phenotypic difference between these two individuals and the size of the deleted region does not generally predict clinical features. Little is currently known about these genes complicating a direct genotype/phenotype correlation at this time. These data however, suggest that ZMYND11 and/or DIP2C haploinsufficiency contributes to the clinical features associated with 10p15 deletions in probands described in this study. Copyright © 2012 Wiley Periodicals, Inc.

[Analysis of hematological phenotype and genotype of 23 patients from Guangdong with co-inherited hemoglobin Hb Westmead and β-thalassemia].

PubMed

Yan, Miansheng; Gan, Xin; Liu, Min; Huang, Bin; Zhong, Liangying

2016-10-01

To analyze the genotype-phenotype correlation among carriers from Guangdong with co-inherited hemoglobin Hb Westmead (HbWS) and β-thalassemia. Twenty three patients (including 9 males and 14 females, aged 1-53 year old) were diagnosed by hematological analysis and genetic testing. Complete blood cell count and hemoglobin electrophoresis analysis were performed on a XE4000i automatic hemocyte analyzer. Hb, HbF and HbA2 were tested by high performance liquid chromatography (HPLC). Gap-PCR was adopted to detect three common thalassemia deletions. Reverse dot-blotting (RDB) assay was applied for detecting three common non-deletional α2 gene mutations and β-thalassemia. Among the 23 patients, 12 showed anemia, among whom 9 had mild anemia and 3 had moderate anemia. The lowest Hb was 68 g/L, and both mean corpuscular volume and mean corpuscular hemoglobin were lower than average, while HbA2 was higher than 3.5%. Genetic analysis confirmed that 5 cases had αWS-α/α-α, β CD654/β N (21.7%), 4 had α WS-α/α-α, β CD41-42/β N (17.4%), 5 had α WS-α/α-α, β CD17/β N (21.7%), 4 had α WS-α/α-α, β CD28/β N (17.4%), 1 had α WS-α/α-α, β CD71-72/β N (4.3%), 1 had αWS-α/α-α, β CD27-28/β N (4.3%), 1 had α WS-α/α-α, β CD41-42/β CD17 (4.3%), 2 had a concomitant β-thalassemia heterozygosity and -α 3.7 deletion. Patients with co-existing Hb WS and other β-thalassemia trait may show variable clinical features. Such compound heterozygotes are usually misdiagnosed during screening by hemoglobin electrophoresis, accurate diagnose should be attained by molecular diagnosis.

Clinical variability of Waardenburg-Shah syndrome in patients with proximal 13q deletion syndrome including the endothelin-B receptor locus.

PubMed

Tüysüz, Beyhan; Collin, Anna; Arapoğlu, Müjde; Suyugül, Nezir

2009-10-01

Waardenburg-Shah syndrome (Waardenburg syndrome type IV-WS4) is an auditory-pigmentary disorder that combines clinical features of pigmentary abnormalities of the skin, hair and irides, sensorineural hearing loss, and Hirschsprung disease (HSCR). Mutations in the endothelin-B receptor (EDNRB) gene on 13q22 have been found to cause this syndrome. Mutations in both alleles cause the full phenotype, while heterozygous mutations cause isolated HSCR or HSCR with minor pigmentary anomalies and/or sensorineural deafness. We investigated the status of the EDNRB gene, by FISH analysis, in three patients with de novo proximal 13q deletions detected at cytogenetic analysis and examined the clinical variability of WS4 among these patients. Chromosome 13q was screened with locus specific FISH probes and breakpoints were determined at 13q22.1q31.3 in Patients 1 and 3, and at 13q21.1q31.3 in Patient 2. An EDNRB specific FISH probe was deleted in all three patients. All patients had common facial features seen in proximal 13q deletion syndrome and mild mental retardation. However, findings related to WS4 were variable; Patient 1 had hypopigmentation of the irides and HSCR, Patient 2 had prominent bicolored irides and mild bilateral hearing loss, and Patient 3 had only mild unilateral hearing loss. These data contribute new insights into the pathogenesis of WS4.

Autistic Disorder in Patients with Williams-Beuren Syndrome: A Reconsideration of the Williams-Beuren Syndrome Phenotype

PubMed Central

Tordjman, Sylvie; Anderson, George M.; Botbol, Michel; Toutain, Annick; Sarda, Pierre; Carlier, Michèle; Saugier-Veber, Pascale; Baumann, Clarisse; Cohen, David; Lagneaux, Céline; Tabet, Anne-Claude; Verloes, Alain

2012-01-01

Background Williams-Beuren syndrome (WBS), a rare developmental disorder caused by deletion of contiguous genes at 7q11.23, has been characterized by strengths in socialization (overfriendliness) and communication (excessive talkativeness). WBS has been often considered as the polar opposite behavioral phenotype to autism. Our objective was to better understand the range of phenotypic expression in WBS and the relationship between WBS and autistic disorder. Methodology The study was conducted on 9 French individuals aged from 4 to 37 years old with autistic disorder associated with WBS. Behavioral assessments were performed using Autism Diagnostic Interview-Revised (ADI-R) and Autism Diagnostic Observation Schedule (ADOS) scales. Molecular characterization of the WBS critical region was performed by FISH. Findings FISH analysis indicated that all 9 patients displayed the common WBS deletion. All 9 patients met ADI-R and ADOS diagnostic criteria for autism, displaying stereotypies and severe impairments in social interaction and communication (including the absence of expressive language). Additionally, patients showed improvement in social communication over time. Conclusions The results indicate that comorbid autism and WBS is more frequent than expected and suggest that the common WBS deletion can result in a continuum of social communication impairment, ranging from excessive talkativeness and overfriendliness to absence of verbal language and poor social relationships. Appreciation of the possible co-occurrence of WBS and autism challenges the common view that WBS represents the opposite behavioral phenotype of autism, and might lead to improved recognition of WBS in individuals diagnosed with autism. PMID:22412832

Cryptic intragenic deletion of the SHOX gene in a family with Léri-Weill dyschondrosteosis detected by Multiplex Ligation-Dependent Probe Amplification (MLPA).

PubMed

Funari, Mariana F A; Jorge, Alexander A L; Pinto, Emilia M; Arnhold, Ivo J P; Mendonca, Berenice B; Nishi, Mirian Y

2008-11-01

LWD is associated to SHOX haploinsufficiency, in most cases, due to gene deletion. Generally FISH and microsatellite analysis are used to identify SHOX deletion. MLPA is a new method of detecting gene copy variation, allowing simultaneous analysis of several regions. Here we describe the presence of a SHOX intragenic deletion in a family with LWD, analyzed through different methodologies. Genomic DNA of 11 subjects from one family were studied by microsatellite analysis, direct sequencing and MLPA. FISH was performed in two affected individuals. Microsatellite analysis showed that all affected members shared the same haplotype suggesting the involvement of SHOX. MLPA detected an intragenic deletion involving exons IV-VIa, which was not detected by FISH and microsatellite analysis. In conclusion, the MLPA technique was proved to be the best solution on detecting this small deletion, it has the advantage of being less laborious also allowing the analysis of several regions simultaneously.

Genomic alterations in Warthin tumors of the parotid gland.

PubMed

Wemmert, Silke; Willnecker, Vivienne; Sauter, Birgit; Schuh, Sebastian; Brunner, Christian; Bohle, Rainer Maria; Urbschat, Steffi; Schick, Bernhard

2014-04-01

Despite the fact that Warthin tumors are the second most common type of benign salivary gland tumors, information regarding genetic alterations is extremely limited, and the tumorigenesis of these tumors has not been elucidated. The present results of the largest series of 30 tumors analyzed by comparative genomic hybridization (CGH) to date confirmed previous genetic findings and identified significant new candidate regions. The most commonly observed alterations were deletions of the short arm of chromosome 8, followed by deletions on 9p. Further representative changes were deletions on 16p and 22q with the minimal overlapping region at 16p12p13.1 and 22q12.1q12.3. Moreover, we indicated two different patterns of chromosomal aberrations. One group harbors deletions on 8p partly apparent with deletions on 9q, 11q 15q, 16p and 22. The second group shows gains on 22, partly apparent with gains on 1p and 20q and deletions on 9p. This leads to the assumption that Warthin tumors, in particular those with a high number of alterations, can be divided into two different genetic groups based on the pattern of numerical chromosomal aberrations. Further studies should address whether these subgroups also reflect a different clinical presentation.

P53 oncosuppressor influences selection of genomic imbalances in response to ionizing radiations in human osteosarcoma cell line SAOS-2.

PubMed

Zuffa, Elisa; Mancini, Manuela; Brusa, Gianluca; Pagnotta, Eleonora; Hattinger, Claudia Maria; Serra, Massimo; Remondini, Daniel; Castellani, Gastone; Corrado, Patrizia; Barbieri, Enza; Santucci, Maria Alessandra

2008-07-01

To investigate the impact of TP53 (tumor protein 53, p53) on genomic stability of osteosarcoma (OS). In first instance, we expressed in OS cell line SAOS-2 (lacking p53) a wild type (wt) p53 construct, whose protein undergoes nuclear import and activation in response to ionizing radiations (IR). Thereafter, we investigated genomic imbalances (amplifications and deletions at genes or DNA regions most frequently altered in human cancers) associated with radio-resistance relative to p53 expression by mean of an array-based comparative genomic hybridization (aCGH) strategy. Finally we investigated a putative marker of radio-induced oxidative stress, a 4,977 bp deletion at mitochondrial (mt) DNA usually referred to as 'common' deletion, by mean of a polimerase chain reaction (PCR) strategy. In radio-resistant subclones generated from wt p53-transfected SAOS-2 cells DNA deletions were remarkably reduced and the accumulation of 'common' deletion at mtDNA (that may let the persistence of oxidative damage by precluding detoxification from reactive oxygen species [ROS]) completely abrogated. The results of our study confirm that wt p53 has a role in protection of OS cell DNA integrity. Multiple mechanisms involved in p53 safeguard of genomic integrity and prevention of deletion outcome are discussed.

Prader-Willi syndrome and atypical submicroscopic 15q11-q13 deletions with or without imprinting defects.

PubMed

Hassan, Maaz; Butler, Merlin G

2016-11-01

We report a 20 year follow up on a Caucasian female, now 26 years of age, with Prader-Willi syndrome (PWS) harboring an atypical 15q11-q13 submicroscopic deletion of 100-200 kb in size first detected in 1996 involving the imprinting center, SNRPN gene and surrounding region. PWS is a rare complex disorder caused by the loss of paternally expressed genes in the 15q11-q13 region. With high resolution chromosomal microarray and methylation - specific MLPA analysis, we updated the genetic findings on our patient and found a 209,819bp deletion including the SNURF-SNRPN gene complex which includes the imprinting center and the SNORD116 region. We compared with four other similarly reported individuals in the literature with atypical submicroscopic deletions within this region but without imprinting center involvement to better characterize the specific genetic lesions causing PWS clinical findings. Clinically, our patient met the diagnostic criteria of PWS including infantile hypotonia, a poor suck with feeding difficulties, global developmental delays and later food foraging, childhood obesity, small hands and skin picking. Small atypical deletions of comparable sizes were seen in the 15q11-q13 region in all five cases and similar behavioral/physical characteristics were found despite an imprinting defect in our patient. These results further support an overlapping critical deletion region involving the non-coding snoRNA SNORD116 in common in the five individuals playing a key role in contributing to the PWS phenotype. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

The Evolution and Functional Impact of Human Deletion Variants Shared with Archaic Hominin Genomes

PubMed Central

Lin, Yen-Lung; Pavlidis, Pavlos; Karakoc, Emre; Ajay, Jerry; Gokcumen, Omer

2015-01-01

Allele sharing between modern and archaic hominin genomes has been variously interpreted to have originated from ancestral genetic structure or through non-African introgression from archaic hominins. However, evolution of polymorphic human deletions that are shared with archaic hominin genomes has yet to be studied. We identified 427 polymorphic human deletions that are shared with archaic hominin genomes, approximately 87% of which originated before the Human–Neandertal divergence (ancient) and only approximately 9% of which have been introgressed from Neandertals (introgressed). Recurrence, incomplete lineage sorting between human and chimp lineages, and hominid-specific insertions constitute the remaining approximately 4% of allele sharing between humans and archaic hominins. We observed that ancient deletions correspond to more than 13% of all common (>5% allele frequency) deletion variation among modern humans. Our analyses indicate that the genomic landscapes of both ancient and introgressed deletion variants were primarily shaped by purifying selection, eliminating large and exonic variants. We found 17 exonic deletions that are shared with archaic hominin genomes, including those leading to three fusion transcripts. The affected genes are involved in metabolism of external and internal compounds, growth and sperm formation, as well as susceptibility to psoriasis and Crohn’s disease. Our analyses suggest that these “exonic” deletion variants have evolved through different adaptive forces, including balancing and population-specific positive selection. Our findings reveal that genomic structural variants that are shared between humans and archaic hominin genomes are common among modern humans and can influence biomedically and evolutionarily important phenotypes. PMID:25556237

Analysis of the complete genome of subgroup A' hepatitis B virus isolates from South Africa.

PubMed

Kramvis, Anna; Weitzmann, Louise; Owiredu, William K B A; Kew, Michael C

2002-04-01

A phylogenetic analysis is presented of six complete and seven pre-S1/S2/S gene sequences of hepatitis B virus (HBV) isolates from South Africa. Five of the full-length sequences and all of the pre-S2/S sequences have been previously reported. Four of the six complete genomes and three of the five incomplete sequences clustered with subgroup A', a unique segment of genotype A of HBV previously identified in 60% of South African isolates using analysis of the pre-S2/S region alone. This separation was also evident when the polymerase open reading frame was analysed, but not on analysis of either the X or pre-core/core genes. Amino acids were identified in the pre-S1 and polymerase regions specific to subgroup A'. In common with genotype D, 10 of 11 genotype A South African isolates had an 11 amino acid deletion in the amino end of the pre-S1 region. This deletion is also found in hepadnaviruses from non-human primates.

Analysis of repeat-mediated deletions in the mitochondrial genome of Saccharomyces cerevisiae.

PubMed

Phadnis, Naina; Sia, Rey A; Sia, Elaine A

2005-12-01

Mitochondrial DNA deletions and point mutations accumulate in an age-dependent manner in mammals. The mitochondrial genome in aging humans often displays a 4977-bp deletion flanked by short direct repeats. Additionally, direct repeats flank two-thirds of the reported mitochondrial DNA deletions. The mechanism by which these deletions arise is unknown, but direct-repeat-mediated deletions involving polymerase slippage, homologous recombination, and nonhomologous end joining have been proposed. We have developed a genetic reporter to measure the rate at which direct-repeat-mediated deletions arise in the mitochondrial genome of Saccharomyces cerevisiae. Here we analyze the effect of repeat size and heterology between repeats on the rate of deletions. We find that the dependence on homology for repeat-mediated deletions is linear down to 33 bp. Heterology between repeats does not affect the deletion rate substantially. Analysis of recombination products suggests that the deletions are produced by at least two different pathways, one that generates only deletions and one that appears to generate both deletions and reciprocal products of recombination. We discuss how this reporter may be used to identify the proteins in yeast that have an impact on the generation of direct-repeat-mediated deletions.

Analysis of Repeat-Mediated Deletions in the Mitochondrial Genome of Saccharomyces cerevisiae

PubMed Central

Phadnis, Naina; Sia, Rey A.; Sia, Elaine A.

2005-01-01

Mitochondrial DNA deletions and point mutations accumulate in an age-dependent manner in mammals. The mitochondrial genome in aging humans often displays a 4977-bp deletion flanked by short direct repeats. Additionally, direct repeats flank two-thirds of the reported mitochondrial DNA deletions. The mechanism by which these deletions arise is unknown, but direct-repeat-mediated deletions involving polymerase slippage, homologous recombination, and nonhomologous end joining have been proposed. We have developed a genetic reporter to measure the rate at which direct-repeat-mediated deletions arise in the mitochondrial genome of Saccharomyces cerevisiae. Here we analyze the effect of repeat size and heterology between repeats on the rate of deletions. We find that the dependence on homology for repeat-mediated deletions is linear down to 33 bp. Heterology between repeats does not affect the deletion rate substantially. Analysis of recombination products suggests that the deletions are produced by at least two different pathways, one that generates only deletions and one that appears to generate both deletions and reciprocal products of recombination. We discuss how this reporter may be used to identify the proteins in yeast that have an impact on the generation of direct-repeat-mediated deletions. PMID:16157666

∆F508 CFTR interactome remodelling promotes rescue of cystic fibrosis.

PubMed

Pankow, Sandra; Bamberger, Casimir; Calzolari, Diego; Martínez-Bartolomé, Salvador; Lavallée-Adam, Mathieu; Balch, William E; Yates, John R

2015-12-24

Deletion of phenylalanine 508 of the cystic fibrosis transmembrane conductance regulator (∆F508 CFTR) is the major cause of cystic fibrosis, one of the most common inherited childhood diseases. The mutated CFTR anion channel is not fully glycosylated and shows minimal activity in bronchial epithelial cells of patients with cystic fibrosis. Low temperature or inhibition of histone deacetylases can partly rescue ∆F508 CFTR cellular processing defects and function. A favourable change of ∆F508 CFTR protein-protein interactions was proposed as a mechanism of rescue; however, CFTR interactome dynamics during temperature shift and inhibition of histone deacetylases are unknown. Here we report the first comprehensive analysis of the CFTR and ∆F508 CFTR interactome and its dynamics during temperature shift and inhibition of histone deacetylases. By using a novel deep proteomic analysis method, we identify 638 individual high-confidence CFTR interactors and discover a ∆F508 deletion-specific interactome, which is extensively remodelled upon rescue. Detailed analysis of the interactome remodelling identifies key novel interactors, whose loss promote ∆F508 CFTR channel function in primary cystic fibrosis epithelia or which are critical for CFTR biogenesis. Our results demonstrate that global remodelling of ∆F508 CFTR interactions is crucial for rescue, and provide comprehensive insight into the molecular disease mechanisms of cystic fibrosis caused by deletion of F508.

A deletion and a duplication in distal 22q11.2 deletion syndrome region. Clinical implications and review

PubMed Central

Fernández, Luis; Nevado, Julián; Santos, Fernando; Heine-Suñer, Damià; Martinez-Glez, Victor; García-Miñaur, Sixto; Palomo, Rebeca; Delicado, Alicia; Pajares, Isidora López; Palomares, María; García-Guereta, Luis; Valverde, Eva; Hawkins, Federico; Lapunzina, Pablo

2009-01-01

Background Individuals affected with DiGeorge and Velocardiofacial syndromes present with both phenotypic diversity and variable expressivity. The most frequent clinical features include conotruncal congenital heart defects, velopharyngeal insufficiency, hypocalcemia and a characteristic craniofacial dysmorphism. The etiology in most patients is a 3 Mb recurrent deletion in region 22q11.2. However, cases of infrequent deletions and duplications with different sizes and locations have also been reported, generally with a milder, slightly different phenotype for duplications but with no clear genotype-phenotype correlation to date. Methods We present a 7 month-old male patient with surgically corrected ASD and multiple VSDs, and dysmorphic facial features not clearly suggestive of 22q11.2 deletion syndrome, and a newborn male infant with cleft lip and palate and upslanting palpebral fissures. Karyotype, FISH, MLPA, microsatellite markers segregation studies and SNP genotyping by array-CGH were performed in both patients and parents. Results Karyotype and FISH with probe N25 were normal for both patients. MLPA analysis detected a partial de novo 1.1 Mb deletion in one patient and a novel partial familial 0.4 Mb duplication in the other. Both of these alterations were located at a distal position within the commonly deleted region in 22q11.2. These rearrangements were confirmed and accurately characterized by microsatellite marker segregation studies and SNP array genotyping. Conclusion The phenotypic diversity found for deletions and duplications supports a lack of genotype-phenotype correlation in the vicinity of the LCRC-LCRD interval of the 22q11.2 chromosomal region, whereas the high presence of duplications in normal individuals supports their role as polymorphisms. We suggest that any hypothetical correlation between the clinical phenotype and the size and location of these alterations may be masked by other genetic and/or epigenetic modifying factors. PMID:19490635

Evaluation of copy-number variants as modifiers of breast and ovarian cancer risk for BRCA1 pathogenic variant carriers

PubMed Central

Walker, Logan C; Marquart, Louise; Pearson, John F; Wiggins, George A R; O'Mara, Tracy A; Parsons, Michael T; Barrowdale, Daniel; McGuffog, Lesley; Dennis, Joe; Benitez, Javier; Slavin, Thomas P; Radice, Paolo; Frost, Debra; Godwin, Andrew K; Meindl, Alfons; Schmutzler, Rita Katharina; Isaacs, Claudine; Peshkin, Beth N; Caldes, Trinidad; Hogervorst, Frans BL; Lazaro, Conxi; Jakubowska, Anna; Montagna, Marco; Chen, Xiaoqing; Offit, Kenneth; Hulick, Peter J; Andrulis, Irene L; Lindblom, Annika; Nussbaum, Robert L; Nathanson, Katherine L; Chenevix-Trench, Georgia; Antoniou, Antonis C; Couch, Fergus J; Spurdle, Amanda B

2017-01-01

Genome-wide studies of patients carrying pathogenic variants (mutations) in BRCA1 or BRCA2 have reported strong associations between single-nucleotide polymorphisms (SNPs) and cancer risk. To conduct the first genome-wide association analysis of copy-number variants (CNVs) with breast or ovarian cancer risk in a cohort of 2500 BRCA1 pathogenic variant carriers, CNV discovery was performed using multiple calling algorithms and Illumina 610k SNP array data from a previously published genome-wide association study. Our analysis, which focused on functionally disruptive genomic deletions overlapping gene regions, identified a number of loci associated with risk of breast or ovarian cancer for BRCA1 pathogenic variant carriers. Despite only including putative deletions called by at least two or more algorithms, detection of selected CNVs by ancillary molecular technologies only confirmed 40% of predicted common (>1% allele frequency) variants. These include four loci that were associated (unadjusted P<0.05) with breast cancer (GTF2H2, ZNF385B, NAALADL2 and PSG5), and two loci associated with ovarian cancer (CYP2A7 and OR2A1). An interesting finding from this study was an association of a validated CNV deletion at the CYP2A7 locus (19q13.2) with decreased ovarian cancer risk (relative risk=0.50, P=0.007). Genomic analysis found this deletion coincides with a region displaying strong regulatory potential in ovarian tissue, but not in breast epithelial cells. This study highlighted the need to verify CNVs in vitro, but also provides evidence that experimentally validated CNVs (with plausible biological consequences) can modify risk of breast or ovarian cancer in BRCA1 pathogenic variant carriers. PMID:28145423

Heterozygous deletion of FOXA2 segregates with disease in a family with heterotaxy, panhypopituitarism, and biliary atresia.

PubMed

Tsai, Ellen A; Grochowski, Christopher M; Falsey, Alexandra M; Rajagopalan, Ramakrishnan; Wendel, Danielle; Devoto, Marcella; Krantz, Ian D; Loomes, Kathleen M; Spinner, Nancy B

2015-06-01

Biliary atresia (BA) is a pediatric cholangiopathy with unknown etiology occurring in isolated and syndromic forms. Laterality defects affecting the cardiovascular and gastrointestinal systems are the most common features present in syndromic BA. Most cases are sporadic, although reports of familial cases have led to the hypothesis of genetic susceptibility in some patients. We identified a child with BA, malrotation, and interrupted inferior vena cava whose father presented with situs inversus, polysplenia, panhypopituitarism, and mildly dysmorphic facial features. Chromosomal microarray analysis demonstrated a 277 kb heterozygous deletion on chromosome 20, which included a single gene, FOXA2, in the proband and her father. This deletion was confirmed to be de novo in the father. The proband and her father share a common diagnosis of heterotaxy, but they also each presented with a variety of other issues. Further genetic screening revealed that the proband carried an additional protein-altering polymorphism (rs1904589; p.His165Arg) in the NODAL gene that is not present in the father, and this variant has been shown to decrease expression of the gene. As FOXA2 can be a regulator of NODAL expression, we propose that haploinsufficiency for FOXA2 combined with a decreased expression of NODAL is the likely cause for syndromic BA in this proband. © 2015 WILEY PERIODICALS, INC.

Molecular Analysis of Pediatric Oligodendrogliomas Highlights Genetic Differences with Adult Counterparts and Other Pediatric Gliomas.

PubMed

Nauen, David; Haley, Lisa; Lin, Ming-Tseh; Perry, Arie; Giannini, Caterina; Burger, Peter C; Rodriguez, Fausto J

2016-03-01

Oligodendroglioma represents a distinctive neoplasm in adults but similar neoplasms occur rarely in children. We studied 20 cases of pediatric oligodendroglioma by SNP array (median age 9 years, range 1-19; 15 grade II and 5 grade III). Cytogenetic abnormalities were present in 8 (53%) grade II and all five anaplastic oligodendrogliomas. Most changes were in the form of deletion and copy neutral loss of heterozygosity (LOH). The most common abnormality was 1p deletion (n = 5). Whole arm 1p19q co-deletion was present in three cases from adolescent patients and 9p loss in 3, including one low-grade oligodendroglioma with CDKN2A homozygous deletion. Common losses were largely limited to the anaplastic subset (n = 5) and included 3q29 (n = 3), 11p (n = 3), 17q (n = 3), 4q (n = 2), 6p (n = 2), 13q (n = 2), 14q (n = 2), 17p (n = 2) and whole Ch 18 loss (n = 2). Gains were non-recurrent except for whole Ch 7 (n = 2) and gain on 12q (n = 2) including the MDM2 locus. Possible germ line LOH (or uniparental disomy) was present in seven cases (35%), with one focal abnormality (22q13.1-13.2) in two. BRAF-KIAA1549 fusions and BRAF p.V600E mutations were absent (n = 13 and 8). In summary, cytogenetic alterations in pediatric oligodendrogliomas are characterized mostly by genomic losses, particularly in anaplastic tumors. © 2015 International Society of Neuropathology.

A French multicenter study of over 700 patients with 22q11 deletions diagnosed using FISH or aCGH.

PubMed

Poirsier, Céline; Besseau-Ayasse, Justine; Schluth-Bolard, Caroline; Toutain, Jérôme; Missirian, Chantal; Le Caignec, Cédric; Bazin, Anne; de Blois, Marie Christine; Kuentz, Paul; Catty, Marie; Choiset, Agnès; Plessis, Ghislaine; Basinko, Audrey; Letard, Pascaline; Flori, Elisabeth; Jimenez, Mélanie; Valduga, Mylène; Landais, Emilie; Lallaoui, Hakima; Cartault, François; Lespinasse, James; Martin-Coignard, Dominique; Callier, Patrick; Pebrel-Richard, Céline; Portnoi, Marie-France; Busa, Tiffany; Receveur, Aline; Amblard, Florence; Yardin, Catherine; Harbuz, Radu; Prieur, Fabienne; Le Meur, Nathalie; Pipiras, Eva; Kleinfinger, Pascale; Vialard, François; Doco-Fenzy, Martine

2016-06-01

Although 22q11.2 deletion syndrome (22q11.2DS) is the most recurrent human microdeletion syndrome associated with a highly variable phenotype, little is known about the condition's true incidence and the phenotype at diagnosis. We performed a multicenter, retrospective analysis of postnatally diagnosed patients recruited by members of the Association des Cytogénéticiens de Langue Française (the French-Speaking Cytogeneticists Association). Clinical and cytogenetic data on 749 cases diagnosed between 1995 and 2013 were collected by 31 French cytogenetics laboratories. The most frequent reasons for referral of postnatally diagnosed cases were a congenital heart defect (CHD, 48.6%), facial dysmorphism (49.7%) and developmental delay (40.7%). Since 2007 (the year in which array comparative genomic hybridization (aCGH) was introduced for the routine screening of patients with intellectual disability), almost all cases have been diagnosed using FISH (96.1%). Only 15 cases (all with an atypical phenotype) were diagnosed with aCGH; the deletion size ranged from 745 to 2904 kb. The deletion was inherited in 15.0% of cases and was of maternal origin in 85.5% of the latter. This is the largest yet documented cohort of patients with 22q11.2DS (the most commonly diagnosed microdeletion) from the same population. French cytogenetics laboratories diagnosed at least 108 affected patients (including fetuses) per year from among a national population of ∼66 million. As observed for prenatal diagnoses, CHDs were the most frequently detected malformation in postnatal diagnoses. The most common CHD in postnatal diagnoses was an isolated septal defect.

Deletions of the long arm of chromosome 5 define subgroups of T-cell acute lymphoblastic leukemia

PubMed Central

La Starza, Roberta; Barba, Gianluca; Demeyer, Sofie; Pierini, Valentina; Di Giacomo, Danika; Gianfelici, Valentina; Schwab, Claire; Matteucci, Caterina; Vicente, Carmen; Cools, Jan; Messina, Monica; Crescenzi, Barbara; Chiaretti, Sabina; Foà, Robin; Basso, Giuseppe; Harrison, Christine J.; Mecucci, Cristina

2016-01-01

Recurrent deletions of the long arm of chromosome 5 were detected in 23/200 cases of T-cell acute lymphoblastic leukemia. Genomic studies identified two types of deletions: interstitial and terminal. Interstitial 5q deletions, found in five cases, were present in both adults and children with a female predominance (chi-square, P=0.012). Interestingly, these cases resembled immature/early T-cell precursor acute lymphoblastic leukemia showing significant down-regulation of five out of the ten top differentially expressed genes in this leukemia group, including TCF7 which maps within the 5q31 common deleted region. Mutations of genes known to be associated with immature/early T-cell precursor acute lymphoblastic leukemia, i.e. WT1, ETV6, JAK1, JAK3, and RUNX1, were present, while CDKN2A/B deletions/mutations were never detected. All patients had relapsed/resistant disease and blasts showed an early differentiation arrest with expression of myeloid markers. Terminal 5q deletions, found in 18 of patients, were more prevalent in adults (chi-square, P=0.010) and defined a subgroup of HOXA-positive T-cell acute lymphoblastic leukemia characterized by 130 up- and 197 down-regulated genes. Down-regulated genes included TRIM41, ZFP62, MAPK9, MGAT1, and CNOT6, all mapping within the 1.4 Mb common deleted region at 5q35.3. Of interest, besides CNOT6 down-regulation, these cases also showed low BTG1 expression and a high incidence of CNOT3 mutations, suggesting that the CCR4-NOT complex plays a crucial role in the pathogenesis of HOXA-positive T-cell acute lymphoblastic leukemia with terminal 5q deletions. In conclusion, interstitial and terminal 5q deletions are recurrent genomic losses identifying distinct subtypes of T-cell acute lymphoblastic leukemia. PMID:27151989

Deletions of the long arm of chromosome 5 define subgroups of T-cell acute lymphoblastic leukemia.

PubMed

La Starza, Roberta; Barba, Gianluca; Demeyer, Sofie; Pierini, Valentina; Di Giacomo, Danika; Gianfelici, Valentina; Schwab, Claire; Matteucci, Caterina; Vicente, Carmen; Cools, Jan; Messina, Monica; Crescenzi, Barbara; Chiaretti, Sabina; Foà, Robin; Basso, Giuseppe; Harrison, Christine J; Mecucci, Cristina

2016-08-01

Recurrent deletions of the long arm of chromosome 5 were detected in 23/200 cases of T-cell acute lymphoblastic leukemia. Genomic studies identified two types of deletions: interstitial and terminal. Interstitial 5q deletions, found in five cases, were present in both adults and children with a female predominance (chi-square, P=0.012). Interestingly, these cases resembled immature/early T-cell precursor acute lymphoblastic leukemia showing significant down-regulation of five out of the ten top differentially expressed genes in this leukemia group, including TCF7 which maps within the 5q31 common deleted region. Mutations of genes known to be associated with immature/early T-cell precursor acute lymphoblastic leukemia, i.e. WT1, ETV6, JAK1, JAK3, and RUNX1, were present, while CDKN2A/B deletions/mutations were never detected. All patients had relapsed/resistant disease and blasts showed an early differentiation arrest with expression of myeloid markers. Terminal 5q deletions, found in 18 of patients, were more prevalent in adults (chi-square, P=0.010) and defined a subgroup of HOXA-positive T-cell acute lymphoblastic leukemia characterized by 130 up- and 197 down-regulated genes. Down-regulated genes included TRIM41, ZFP62, MAPK9, MGAT1, and CNOT6, all mapping within the 1.4 Mb common deleted region at 5q35.3. Of interest, besides CNOT6 down-regulation, these cases also showed low BTG1 expression and a high incidence of CNOT3 mutations, suggesting that the CCR4-NOT complex plays a crucial role in the pathogenesis of HOXA-positive T-cell acute lymphoblastic leukemia with terminal 5q deletions. In conclusion, interstitial and terminal 5q deletions are recurrent genomic losses identifying distinct subtypes of T-cell acute lymphoblastic leukemia. Copyright© Ferrata Storti Foundation.

Zoom‐in comparative genomic hybridisation arrays for the characterisation of variable breakpoint contiguous gene syndromes

PubMed Central

Johnston, Jennifer J; Walker, Robert L; Davis, Sean; Facio, Flavia; Turner, Joyce T; Bick, David P; Daentl, Donna L; Ellison, Jay W; Meltzer, Paul S; Biesecker, Leslie G

2007-01-01

Contiguous gene syndromes cause disorders via haploinsufficiency for adjacent genes. Some contiguous gene syndromes (CGS) have stereotypical breakpoints, but others have variable breakpoints. In CGS that have variable breakpoints, the extent of the deletions may be correlated with severity. The Greig cephalopolysyndactyly contiguous gene syndrome (GCPS‐CGS) is a multiple malformation syndrome caused by haploinsufficiency of GLI3 and adjacent genes. In addition, non‐CGS GCPS can be caused by deletions or duplications in GLI3. Although fluorescence in situ hybridisation (FISH) can identify large deletion mutations in patients with GCPS or GCPS‐CGS, it is not practical for identification of small intragenic deletions or insertions, and it is difficult to accurately characterise the extent of the large deletions using this technique. We have designed a custom comparative genomic hybridisation (CGH) array that allows identification of deletions and duplications at kilobase resolution in the vicinity of GLI3. The array averages one probe every 730 bp for a total of about 14 000 probes over 10 Mb. We have analysed 16 individuals with known or suspected deletions or duplications. In 15 of 16 individuals (14 deletions and 1 duplication), the array confirmed the prior results. In the remaining patient, the normal CGH array result was correct, and the prior assessment was a false positive quantitative polymerase chain reaction result. We conclude that high‐density CGH array analysis is more sensitive than FISH analysis for detecting deletions and provides clinically useful results on the extent of the deletion. We suggest that high‐density CGH array analysis should replace FISH analysis for assessment of deletions and duplications in patients with contiguous gene syndromes caused by variable deletions. PMID:17098889

Studying human disease genes in Caenorhabditis elegans: a molecular genetics laboratory project.

PubMed

Cox-Paulson, Elisabeth A; Grana, Theresa M; Harris, Michelle A; Batzli, Janet M

2012-01-01

Scientists routinely integrate information from various channels to explore topics under study. We designed a 4-wk undergraduate laboratory module that used a multifaceted approach to study a question in molecular genetics. Specifically, students investigated whether Caenorhabditis elegans can be a useful model system for studying genes associated with human disease. In a large-enrollment, sophomore-level laboratory course, groups of three to four students were assigned a gene associated with either breast cancer (brc-1), Wilson disease (cua-1), ovarian dysgenesis (fshr-1), or colon cancer (mlh-1). Students compared observable phenotypes of wild-type C. elegans and C. elegans with a homozygous deletion in the assigned gene. They confirmed the genetic deletion with nested polymerase chain reaction and performed a bioinformatics analysis to predict how the deletion would affect the encoded mRNA and protein. Students also performed RNA interference (RNAi) against their assigned gene and evaluated whether RNAi caused a phenotype similar to that of the genetic deletion. As a capstone activity, students prepared scientific posters in which they presented their data, evaluated whether C. elegans was a useful model system for studying their assigned genes, and proposed future directions. Assessment showed gains in understanding genotype versus phenotype, RNAi, common bioinformatics tools, and the utility of model organisms.

FOXP2 gene deletion and infant feeding difficulties: a case report.

PubMed

Zimmerman, Emily; Maron, Jill L

2016-01-01

Forkhead box protein P2 (FOXP2) is a well-studied gene known to play an essential role in normal speech development. Deletions in the gene have been shown to result in developmental speech disorders and regulatory disruption of downstream gene targets associated with common forms of language impairments. Despite similarities in motor planning and execution between speech development and oral feeding competence, there have been no reports to date linking deletions within the FOXP2 gene to oral feeding impairments in the newborn. The patient was a nondysmorphic, appropriately and symmetrically grown male infant born at 35-wk gestational age. He had a prolonged neonatal intensive care unit stay because of persistent oral feeding incoordination requiring gastrostomy tube placement. Cardiac and neurological imagings were within normal limits. A microarray analysis found an ∼9-kb loss within chromosome band 7q3.1 that contains exon 2 of FOXP2, demonstrating a single copy of this region instead of the normal two copies per diploid gene. This case study expands our current understanding of the role FOXP2 exerts on motor planning and coordination necessary for both oral feeding success and speech-language development. This case report has important consequences for future diagnosis and treatment for infants with FOXP2 deletions, mutations, and varying levels of gene expression.

New developments in Smith-Magenis syndrome (del 17p11.2).

PubMed

Gropman, Andrea L; Elsea, Sarah; Duncan, Wallace C; Smith, Ann C M

2007-04-01

Recent clinical, neuroimaging, sleep, and molecular cytogenetic studies have provided new insights into the mechanisms leading to the Smith-Magenis phenotype and are summarized in this review. Cross sectional studies of patients with Smith-Magenis syndrome have found evidence for central and peripheral nervous system abnormalities, neurobehavioral disturbances, and an inverted pattern of melatonin secretion leading to circadian rhythm disturbance. A common chromosome 17p11.2 deletion interval spanning approximately 3.5 Mb is identified in about 70% of individuals with chromosome deletion. Recently heterozygous point mutations in the RAI1 gene within the Smith-Magenis syndrome critical region have been reported in Smith-Magenis syndrome patients without detectable deletion by fluorescent in-situ hybridization. Patients with intragenic mutations in RAI1 as well as those with deletions share most but not all aspects of the phenotype. Findings from molecular cytogenetic analysis suggest that other genes or genetic background may play a role in altering the functional availability of RAI1 for downstream effects. Further research into additional genes in the Smith-Magenis syndrome critical region will help define the role they play in modifying features or severity of the Smith-Magenis syndrome phenotype. More research is needed to translate advances in clinical research into new treatment options to address the sleep and neurobehavioral problems in this disorder.

Studying Human Disease Genes in Caenorhabditis elegans: A Molecular Genetics Laboratory Project

PubMed Central

Cox-Paulson, Elisabeth A.; Grana, Theresa M.; Harris, Michelle A.; Batzli, Janet M.

2012-01-01

Scientists routinely integrate information from various channels to explore topics under study. We designed a 4-wk undergraduate laboratory module that used a multifaceted approach to study a question in molecular genetics. Specifically, students investigated whether Caenorhabditis elegans can be a useful model system for studying genes associated with human disease. In a large-enrollment, sophomore-level laboratory course, groups of three to four students were assigned a gene associated with either breast cancer (brc-1), Wilson disease (cua-1), ovarian dysgenesis (fshr-1), or colon cancer (mlh-1). Students compared observable phenotypes of wild-type C. elegans and C. elegans with a homozygous deletion in the assigned gene. They confirmed the genetic deletion with nested polymerase chain reaction and performed a bioinformatics analysis to predict how the deletion would affect the encoded mRNA and protein. Students also performed RNA interference (RNAi) against their assigned gene and evaluated whether RNAi caused a phenotype similar to that of the genetic deletion. As a capstone activity, students prepared scientific posters in which they presented their data, evaluated whether C. elegans was a useful model system for studying their assigned genes, and proposed future directions. Assessment showed gains in understanding genotype versus phenotype, RNAi, common bioinformatics tools, and the utility of model organisms. PMID:22665589

Large deletion in PIGL: a common mutational mechanism in CHIME syndrome?

PubMed

Ceroni, José Rm; Yamamoto, Guilherme L; Honjo, Rachel S; Kim, Chong A; Passos-Bueno, Maria R; Bertola, Débora R

2018-01-01

CHIME syndrome is an extremely rare autosomal recessive multisystemic disorder caused by mutations in PIGL. PIGL is an endoplasmic reticulum localized enzyme that catalyzes the second step of glycosylphosphatidylinositol (GPI) biosynthesis, which plays a role in the anchorage of cell-surface proteins including receptors, enzymes, and adhesion molecules. Germline mutations in other members of GPI and Post GPI Attachment to Proteins (PGAP) family genes have been described and constitute a group of diseases within the congenital disorders of glycosylation. Patients in this group often present alkaline phosphatase serum levels abnormalities and neurological symptoms. We report a CHIME syndrome patient who harbors a missense mutation c.500T > C (p.Leu167Pro) and a large deletion involving the 5' untranslated region and part of exon 1 of PIGL. In CHIME syndrome, a recurrent missense mutation c.500T > C (p.Leu167Pro) is found in the majority of patients, associated with a null mutation in the other allele, including an overrepresentation of large deletions. The latter are not detected by the standard analysis in sequencing techniques, including next-generation sequencing. Thus, in individuals with a clinical diagnosis of CHIME syndrome in which only one mutation is found, an active search for a large deletion should be sought.

Large deletion in PIGL: a common mutational mechanism in CHIME syndrome?

PubMed Central

Ceroni, José RM; Yamamoto, Guilherme L; Honjo, Rachel S; Kim, Chong A; Passos-Bueno, Maria R; Bertola, Débora R

2018-01-01

Abstract CHIME syndrome is an extremely rare autosomal recessive multisystemic disorder caused by mutations in PIGL. PIGL is an endoplasmic reticulum localized enzyme that catalyzes the second step of glycosylphosphatidylinositol (GPI) biosynthesis, which plays a role in the anchorage of cell-surface proteins including receptors, enzymes, and adhesion molecules. Germline mutations in other members of GPI and Post GPI Attachment to Proteins (PGAP) family genes have been described and constitute a group of diseases within the congenital disorders of glycosylation. Patients in this group often present alkaline phosphatase serum levels abnormalities and neurological symptoms. We report a CHIME syndrome patient who harbors a missense mutation c.500T > C (p.Leu167Pro) and a large deletion involving the 5’ untranslated region and part of exon 1 of PIGL. In CHIME syndrome, a recurrent missense mutation c.500T > C (p.Leu167Pro) is found in the majority of patients, associated with a null mutation in the other allele, including an overrepresentation of large deletions. The latter are not detected by the standard analysis in sequencing techniques, including next-generation sequencing. Thus, in individuals with a clinical diagnosis of CHIME syndrome in which only one mutation is found, an active search for a large deletion should be sought. PMID:29473937

The Identification of Microdeletion and Reciprocal Microduplication in 22q11.2 Using High-Resolution CMA Technology

PubMed Central

Leite, Ana Julia Cunha; Pinto, Irene Plaza; Cunha, Damiana Mirian da Cruz e; Ribeiro, Cristiano Luiz; da Silva, Claudio Carlos; da Cruz, Aparecido Divino; Minasi, Lysa Bernardes

2016-01-01

The chromosome 22q11.2 region has long been implicated in genomic diseases. Some genomic regions exhibit numerous low copy repeats with high identity in which they provide increased genomic instability and mediate deletions and duplications in many disorders. DiGeorge Syndrome is the most common deletion syndrome and reciprocal duplications could be occurring in half of the frequency of microdeletions. We described five patients with phenotypic variability that carries deletions or reciprocal duplications at 22q11.2 detected by Chromosomal Microarray Analysis. The CytoScan HD technology was used to detect changes in the genome copy number variation of patients who had clinical indication to global developmental delay and a normal karyotype. We observed in our study three microdeletions and two microduplications in 22q11.2 region with variable intervals containing known genes and unstudied transcripts as well as the LCRs that are often flanking and within this genomic rearrangement. The identification of these variants is of particular interest because it may provide insight into genes or genomic regions that are crucial for specific phenotypic manifestations and are useful to assist in the quest for understanding the mechanisms subjacent to genomic deletions and duplications. PMID:27123452

Mutation and deletion analysis of GFRα-1, encoding the co-receptor for the GDNF/RET complex, in human brain tumours

PubMed Central

Gimm, O; Gössling, A; Marsh, D J; Dahia, P L M; Mulligan, L M; Deimling, A von; Eng, C

1999-01-01

Glial cell line-derived neurotrophic factor (GDNF) plays a key role in the control of vertebrate neuron survival and differentiation in both the central and peripheral nervous systems. GDNF preferentially binds to GFRα-1 which then interacts with the receptor tyrosine kinase RET. We investigated a panel of 36 independent cases of mainly advanced sporadic brain tumours for the presence of mutations in GDNF and GFRα-1. No mutations were found in the coding region of GDNF. We identified six previously described GFRα-1 polymorphisms, two of which lead to an amino acid change. In 15 of 36 brain tumours, all polymorphic variants appeared to be homozygous. Of these 15 tumours, one also had a rare, apparently homozygous, sequence variant at codon 361. Because of the rarity of the combination of homozygous sequence variants, analysis for hemizygous deletion was pursued in the 15 samples and loss of heterozygosity was found in 11 tumours. Our data suggest that intragenic point mutations of GDNF or GFRα-1 are not a common aetiologic event in brain tumours. However, either deletion of GFRα-1 and/or nearby genes may contribute to the pathogenesis of these tumours. © 1999 Cancer Research Campaign PMID:10408842

12p13.33 microdeletion including ELKS/ERC1, a new locus associated with childhood apraxia of speech

PubMed Central

Thevenon, Julien; Callier, Patrick; Andrieux, Joris; Delobel, Bruno; David, Albert; Sukno, Sylvie; Minot, Delphine; Mosca Anne, Laure; Marle, Nathalie; Sanlaville, Damien; Bonnet, Marlène; Masurel-Paulet, Alice; Levy, Fabienne; Gaunt, Lorraine; Farrell, Sandra; Le Caignec, Cédric; Toutain, Annick; Carmignac, Virginie; Mugneret, Francine; Clayton-Smith, Jill; Thauvin-Robinet, Christel; Faivre, Laurence

2013-01-01

Speech sound disorders are heterogeneous conditions, and sporadic and familial cases have been described. However, monogenic inheritance explains only a small proportion of such disorders, in particular in cases with childhood apraxia of speech (CAS). Deletions of <5 Mb involving the 12p13.33 locus is one of the least commonly deleted subtelomeric regions. Only four patients have been reported with such a deletion diagnosed with fluorescence in situ hybridisation telomere analysis or array CGH. To further delineate this rare microdeletional syndrome, a French collaboration together with a search in the Decipher database allowed us to gather nine new patients with a 12p13.33 subtelomeric or interstitial rearrangement identified by array CGH. Speech delay was found in all patients, which could be defined as CAS when patients had been evaluated by a speech therapist (5/9 patients). Intellectual deficiency was found in 5/9 patients only, and often associated with psychiatric manifestations of various severity. Two such deletions were inherited from an apparently healthy parent, but reevaluation revealed abnormal speech production at least in childhood, suggesting variable expressivity. The ELKS/ERC1 gene, which encodes for a synaptic factor, is found in the smallest region of overlap. These results reinforce the hypothesis that deletions of the 12p13.33 locus may be responsible for variable phenotypes including CAS associated with neurobehavioural troubles and that the presence of CAS justifies a genetic work-up. PMID:22713806

Genetic studies of Prader-Willi patients provide evidence for conservation of genomic architecture in proximal chromosome 15q.

PubMed

Hou, Aihua; Lin, Shuan-Pei; Ho, Shi Yun; Chen, Chi-Fung Jennifer; Lin, Hsiang-Yu; Chen, Yen-Juin; Huang, Chi-Yu; Chiu, Huei-Ching; Chuang, Chih-Kuang; Chen, Ken-Shiung

2011-03-01

Prader-Willi syndrome (PWS) is a neurogenetic disorder associated with recurrent genomic recombination involving low copy repeats (LCRs) located in the human chromosome 15q11-q13. Previous studies of PWS patients from Asia suggested that there is a higher incidence of deletion and lower incidence of maternal uniparental disomy (mUPD) compared to that of Western populations. In this report, we present genetic etiology of 28 PWS patients from Taiwan. Consistent with the genetic etiology findings from Western populations, the type II deletion appears to be the most common deletion subtype. Furthermore, the ratio of the two most common deletion subtypes and the ratio of the maternal heterodisomy to isodisomy cases observed from this study are in agreement with previous findings from Western populations. In addition, we identified and further mapped the deletion breakpoints in two patients with atypical deletions using array CGH (comparative genomic hybridization). Despite the relatively small numbers of patients in each subgroup, our findings suggest that the genomic architecture responsible for the recurrent recombination in PWS is conserved in Taiwanese of the Han Chinese heritage and Western populations, thereby predisposing chromosome 15q11-q13 to a similar risk of rearrangements. © 2010 The Authors Annals of Human Genetics © 2010 Blackwell Publishing Ltd/University College London.

Molecular Characterisation of α- and β-Thalassaemia among Indigenous Senoi Orang Asli Communities in Peninsular Malaysia.

PubMed

Koh, Danny Xuan Rong; Raja Sabudin, Raja Zahratul Azma; Mohd Yusoff, Malisa; Hussin, Noor Hamidah; Ahmad, Rahimah; Othman, Ainoon; Ismail, Endom

2017-09-01

Thalassaemia is a public health problem in Malaysia, with each ethnic group having their own common mutations. However, there is a lack on data on the prevalence and common mutations among the indigenous people. This cross-sectional study was performed to determine the common mutations of α- and β-thalassaemia among the subethnic groups of Senoi, the largest Orang Asli group in Peninsular Malaysia. Blood samples collected from six Senoi subethnic groups were analysed for full blood count and haemoglobin analysis (HbAn). Samples with abnormal findings were then screened for α- and β-globin gene mutations. Out of the 752 samples collected, 255 showed abnormal HbAn results, and 122 cases showing abnormal red cell indices with normal HbAn findings were subjected to molecular screening. DNA analysis revealed a mixture of α- and β-globin gene mutations with 25 concomitant cases. The types of gene abnormalities detected for α-thalassaemia were termination codon (T>C) Hb CS (α CS α), Cd59 (G>A) haemoglobin Adana (Hb Adana) (α Cd59 α), initiation codon (ATG>A-G) (α IniCd α), two-gene deletion (- SEA ), and single-gene 3.7-kb deletion (-α 3.7 ). For β-thalassaemia, there were Cd26 (G>A) Hb E (β E ), Cd19 (A>G) Haemoglobin Malay (Hb Malay) (β Cd19 ), and IVS 1-5 (G>C) (β IVS 1-5 ). © 2017 John Wiley & Sons Ltd/University College London.

Short stature in a mother and daughter with terminal deletion of Xp22.3

DOE Office of Scientific and Technical Information (OSTI.GOV)

Schwinger, E.; Kirschstein, M.; Konermann, T.

1996-05-03

Short stature in females is often caused by homozygosity for the terminal portion of Xp due to monosomy X or a deletion. We report on a mother and daughter with short stature as sole phenotypic abnormality and deletion of bands Xp22.32-p22.33 demonstrated by classic and molecular cytogenetic analysis. In both individuals, the deleted X chromosome was late replicating. Molecular analysis suggested that the deletion is terminal and the breakpoint was localized between the STS and DXS7470 loci in Xp22.32. Chromosome analysis is often done on females with short stature to exclude Ullrich-Turner syndrome. Small deletions, terminal or interstitial, are easilymore » missed by conventional cytogenetic investigation; thus molecular analyses are useful to detect those cases. 8 refs., 3 figs.« less

Low cost biosensor-based molecular differential diagnosis of α-thalassemia (Southeast Asia deletion).

PubMed

Wangmaung, Nantawan; Promptmas, Chamras; Chomean, Sirinart; Sanchomphu, Chularat; Ittarat, Wanida

2013-06-01

Thalassemias are genetic hematologic diseases which the homozygous form of α-thalassemia can cause either death in utero or shortly after birth. It is necessary to accurately identify high-risk heterozygous couples. We developed a quartz crystal microbalance (QCM) to identify the abnormal gene causing the commonly found α-thalassemia1, [Southeast Asia (SEA) deletion]. This work is an improved method of our previous study by reducing both production cost and analysis time. A silver electrode on the QCM surface was immobilized with a biotinylated probe. The α-globin gene fragment was amplified and hybridized with the probe. Hybridization was indicated by changes of quartz oscillation. Each drying step was improved by using an air pump for 30 min instead of the overnight air dry. The diagnostic potency of the silver QCM was evaluated using 70 suspected samples with microcytic hypochromic erythrocytes. The silver QCM could clearly identify samples with abnormal α-globin genes, either homozygous or heterozygous, from normal samples. Thirteen out of 70 blood samples were identified as carrier of α-thalassemia1 (SEA deletion). Results were consistent with the standard agarose gel electrophoresis. Using silver instead of gold QCM could reduce the production expense 10-fold. An air pump drying the QCM surface could reduce the analysis time from 3 days to 4 h. The silver thalassemic QCM was specific, sensitive, rapid, cheap and field applicable. It could be used as a one-step definite diagnosis of α-thalassemia1 (SEA deletion) with no need for the preliminary screening test.

Velopharyngeal incompetence diagnosed in a series of cardiac patients prompted by the finding of a 22q11.2 deletion

DOE Office of Scientific and Technical Information (OSTI.GOV)

Driscoll, D.A.; Emanuel, B.S.; Goldmuntz, E.

Congenital heart disease is very common and may occur as an isolated malformation or as part of a well-defined syndrome. In some syndromes, specific types are overrepresented as compared to their incidence in the general population. Conotruncal anomalies are one such example where they are seen as part of DiGeorge syndrome (DGS) and Velo-Cardio-Facial syndrome (VCFS). Often, the diagnosis of VCFS is not suspected because mild facial dysmorphia is frequently not appreciated in the newborn period. While overt cleft palate, a characteristic finding in VCFS, would be detected early, a submucousal cleft palate or velopharyngeal incompetence (VPI) may go unrecognizedmore » in the pre-verbal child and may remain undiagnosed in the older patient who is not referred for a palatal evaluation. In patients with either DGS or VCFS, microdeletions of chromosome 22q11.2 have been demonstrated in almost 90% of patients. As part of our ongoing study, twenty patients with a conotruncal cardiac anomaly, without an overt cleft palate, were referred for 22q11.2 deletion analysis. 13/20 patients were found to have a deletion. All 13 deleted patients underwent palatal evaluations by a plastic surgeon and speech pathologist. 7 patients were noted to have VPI. Intervention including speech therapy and/or posterior pharyngeal flap surgery for these previously undiagnosed abnormalities is underway. These results suggest that palatal abnormalities are underdiagnosed in a significant proportion of patients with conotruncal cardiac defects. We therefore propose deletion studies in these patients followed by prompt palatal evaluations when the deletion is present. Early diagnosis of VPI and submucousal cleft palate should lead to early intervention and appropriate management of the speech difficulties encountered by these individuals.« less

Genome-Wide Mutational Signature of the Chemotherapeutic Agent Mitomycin C in Caenorhabditis elegans.

PubMed

Tam, Annie S; Chu, Jeffrey S C; Rose, Ann M

2015-11-12

Cancer therapy largely depends on chemotherapeutic agents that generate DNA lesions. However, our understanding of the nature of the resulting lesions as well as the mutational profiles of these chemotherapeutic agents is limited. Among these lesions, DNA interstrand crosslinks are among the more toxic types of DNA damage. Here, we have characterized the mutational spectrum of the commonly used DNA interstrand crosslinking agent mitomycin C (MMC). Using a combination of genetic mapping, whole genome sequencing, and genomic analysis, we have identified and confirmed several genomic lesions linked to MMC-induced DNA damage in Caenorhabditis elegans. Our data indicate that MMC predominantly causes deletions, with a 5'-CpG-3' sequence context prevalent in the deleted regions of DNA. Furthermore, we identified microhomology flanking the deletion junctions, indicative of DNA repair via nonhomologous end joining. Based on these results, we propose a general repair mechanism that is likely to be involved in the biological response to this highly toxic agent. In conclusion, the systematic study we have described provides insight into potential sequence specificity of MMC with DNA. Copyright © 2016 Tam et al.

Rapid diagnosis of common deletional α-thalassemia in the Chinese population by qPCR based on identical primer homologous fragments.

PubMed

Long, Ju

2016-05-01

In China, -(SEA), -α(3.7) and -α(4.2) are common deletional α-thalassemia alleles. Gap-PCR is the currently used detection method for these alleles, whose disadvantages include time-consuming procedure and increased potential for PCR product contamination. Therefore, this detection method needs to be improved. Based on identical-primer homologous fragments, a qPCR system was developed for deletional α-thalassemia genotyping, which was composed of a group of quantitatively-related primers and their corresponding probes plus two groups of qualitatively-related primers and their corresponding probes. In order to verify the accuracy of the qPCR system, known genotype samples and random samples are employed. The standard curve result demonstrated that designed primers and probes all yielded good amplification efficiency. In the tests of known genotype samples and random samples, sample detection results were consistent with verification results. In detecting αα, -(SEA), -α(3.7) and -α(4.2) alleles, deletional α-thalassemia alleles are accurately detected by this method. In addition, this method is provided with a wider detection range, greater speed and reduced PCR product contamination risk when compared with current common gap-PCR detection reagents. Copyright © 2016 Elsevier B.V. All rights reserved.

Genome-wide copy number variation analysis identified deletions in SFMBT1 associated with fasting plasma glucose in a Han Chinese population.

PubMed

Chung, Ren-Hua; Chiu, Yen-Feng; Hung, Yi-Jen; Lee, Wen-Jane; Wu, Kwan-Dun; Chen, Hui-Ling; Lin, Ming-Wei; Chen, Yii-Der I; Quertermous, Thomas; Hsiung, Chao A

2017-08-08

Fasting glucose and fasting insulin are glycemic traits closely related to diabetes, and understanding the role of genetic factors in these traits can help reveal the etiology of type 2 diabetes. Although single nucleotide polymorphisms (SNPs) in several candidate genes have been found to be associated with fasting glucose and fasting insulin, copy number variations (CNVs), which have been reported to be associated with several complex traits, have not been reported for association with these two traits. We aimed to identify CNVs associated with fasting glucose and fasting insulin. We conducted a genome-wide CNV association analysis for fasting plasma glucose (FPG) and fasting plasma insulin (FPI) using a family-based genome-wide association study sample from a Han Chinese population in Taiwan. A family-based CNV association test was developed in this study to identify common CNVs (i.e., CNVs with frequencies ≥ 5%), and a generalized estimating equation approach was used to test the associations between the traits and counts of global rare CNVs (i.e., CNVs with frequencies <5%). We found a significant genome-wide association for common deletions with a frequency of 5.2% in the Scm-like with four mbt domains 1 (SFMBT1) gene with FPG (association p-value = 2×10 -4 and an adjusted p-value = 0.0478 for multiple testing). No significant association was observed between global rare CNVs and FPG or FPI. The deletions in 20 individuals with DNA samples available were successfully validated using PCR-based amplification. The association of the deletions in SFMBT1 with FPG was further evaluated using an independent population-based replication sample obtained from the Taiwan Biobank. An association p-value of 0.065, which was close to the significance level of 0.05, for FPG was obtained by testing 9 individuals with CNVs in the SFMBT1 gene region and 11,692 individuals with normal copies in the replication cohort. Previous studies have found that SNPs in SFMBT1 are associated with blood pressure and serum urate concentration, suggesting that SFMBT1 may have functional implications in some metabolic-related traits.

Impact of molecular mechanisms, including deletion size, on Prader-Willi syndrome phenotype: study of 75 patients.

PubMed

Varela, M C; Kok, F; Setian, N; Kim, C A; Koiffmann, C P

2005-01-01

Prader-Willi syndrome (PWS) can result from a 15q11-q13 paternal deletion, maternal uniparental disomy (UPD), or imprinting mutations. We describe here the phenotypic variability detected in 51 patients with different types of deletions and 24 patients with UPD. Although no statistically significant differences could be demonstrated between the two main types of PWS deletion patients, it was observed that type I (BP1-BP3) patients acquired speech later than type II (BP2-BP3) patients. Comparing the clinical pictures of our patients with UPD with those with deletions, we found that UPD children presented with lower birth length and started walking earlier and deletion patients presented with a much higher incidence of seizures than UPD patients. In addition, the mean maternal age in the UPD group was higher than in the deletion group. No statistically significant differences could be demonstrated between the deletion and the UPD group with respect to any of the major features of PWS. In conclusion, our study did not detect significant phenotypic differences among type I and type II PWS deletion patients, but it did demonstrate that seizures were six times more common in patients with a deletion than in those with UPD.

Molecular and cytogenetic investigation of Y chromosome deletions over three generations facilitated by intracytoplasmic sperm injection.

PubMed

Minor, Agata; Wong, Edgar Chan; Harmer, Karynn; Ma, Sai

2007-08-01

The azoospermic factor (AZF) region is critical for normal spermatogenesis since microdeletions and partial deletions have been associated with infertility. We investigate the diagnostic ability of karyotyping in detecting clinically relevant Y chromosome deletions. The clinical significance of heterochromatin deletions, microdeletions and partial AZFc deletions is also evaluated. A patient with a Yq deletion, affected by severe oligoasthenoteratozoospermia, underwent intracytoplasmic sperm injection (ICSI) which resulted in the birth of a healthy baby boy. The patient, his father and his son underwent Y chromosome microdeletion and partial AZFc deletion screening. We also studied the aneuploidy rate in the sperm of the patient by fluorescent in situ hybridization. AZF microdeletions were absent in the family. However, microdeletion analysis confirmed that the Yq deletion was limited to the heterochromatin. We found a partial AZFc gr/gr deletion in all three family members. We observed an increased rate of sex chromosome aneuploidy in the infertile patient. Cytogenetic analysis was misleading in identifying the Yq breakpoint. Infertility observed in the patient was associated with the gr/gr partial deletion. However, because of the incomplete penetrance of gr/gr deletions, the consequence of the vertical transmission of the deletion through ICSI remains unknown. Copyright (c) 2007 John Wiley & Sons, Ltd.

Next-Generation Molecular Testing of Newborn Dried Blood Spots for Cystic Fibrosis.

PubMed

Lefterova, Martina I; Shen, Peidong; Odegaard, Justin I; Fung, Eula; Chiang, Tsoyu; Peng, Gang; Davis, Ronald W; Wang, Wenyi; Kharrazi, Martin; Schrijver, Iris; Scharfe, Curt

2016-03-01

Newborn screening for cystic fibrosis enables early detection and management of this debilitating genetic disease. Implementing comprehensive CFTR analysis using Sanger sequencing as a component of confirmatory testing of all screen-positive newborns has remained impractical due to relatively lengthy turnaround times and high cost. Here, we describe CFseq, a highly sensitive, specific, rapid (<3 days), and cost-effective assay for comprehensive CFTR gene analysis from dried blood spots, the common newborn screening specimen. The unique design of CFseq integrates optimized dried blood spot sample processing, a novel multiplex amplification method from as little as 1 ng of genomic DNA, and multiplex next-generation sequencing of 96 samples in a single run to detect all relevant CFTR mutation types. Sequence data analysis utilizes publicly available software supplemented by an expert-curated compendium of >2000 CFTR variants. Validation studies across 190 dried blood spots demonstrated 100% sensitivity and a positive predictive value of 100% for single-nucleotide variants and insertions and deletions and complete concordance across the polymorphic poly-TG and consecutive poly-T tracts. Additionally, we accurately detected both a known exon 2,3 deletion and a previously undetected exon 22,23 deletion. CFseq is thus able to replace all existing CFTR molecular assays with a single robust, definitive assay at significant cost and time savings and could be adapted to high-throughput screening of other inherited conditions. Copyright © 2016 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.

DiGeorge-like syndrome in a child with a 3p12.3 deletion involving MIR4273 gene born to a mother with gestational diabetes mellitus.

PubMed

Cirillo, Emilia; Giardino, Giuliana; Gallo, Vera; Galasso, Giovanni; Romano, Roberta; D'Assante, Roberta; Scalia, Giulia; Del Vecchio, Luigi; Nitsch, Lucio; Genesio, Rita; Pignata, Claudio

2017-04-24

Chromosome 22q11.2 deletion is the most common chromosomal alteration associated with DiGeorge syndrome (DGS), even though this is not the only underlying cause of DGS. In rare patients, mutations in a single gene, TBX1, have been described resulting in a DGS phenotype. Recently, it has been reported that at least part of the TBX1 mutant phenotype is due to excessive bone morphogenetic proteins (BMP) signaling. Evidence suggests that miRNA may modulate the expression of critical T-box transcriptional regulators during midface development and Bmp-signaling. We report on a 7-year-old Caucasian male born to a mother affected with gestational diabetes (GDM) who had a 371Kb-interstitial deletion of 3p12.3 identified by array CGH, involving the ZNF717, MIR1243, and 4273 genes. The child presented with a DiGeorge anomaly (DGA) associated with unilateral renal agenesis and language delay. The immunological evaluation revealed a severe reduction and impairment of T lymphocytes. FISH analysis and TBX1 sequencing were negative. Among the miRNA-4273 predicted target genes, we found BMP3, which is involved in several steps of embryogenesis including kidney and lung organogenesis and in insulin gene expression. Since, DGA is not commonly found in newborns of diabetic mothers, we hypothesize that the pathogenesis of DGA associated with GDM is multifactorial, involving both genetic and/or epigenetic cofactors. © 2017 Wiley Periodicals, Inc.

Headbobber: A Combined Morphogenetic and Cochleosaccular Mouse Model to Study 10qter Deletions in Human Deafness

PubMed Central

Buniello, Annalisa; Hardisty-Hughes, Rachel E.; Pass, Johanna C.; Bober, Eva; Smith, Richard J.; Steel, Karen P.

2013-01-01

The recessive mouse mutant headbobber (hb) displays the characteristic behavioural traits associated with vestibular defects including headbobbing, circling and deafness. This mutation was caused by the insertion of a transgene into distal chromosome 7 affecting expression of native genes. We show that the inner ear of hb/hb mutants lacks semicircular canals and cristae, and the saccule and utricle are fused together in a single utriculosaccular sac. Moreover, we detect severe abnormalities of the cochlear sensory hair cells, the stria vascularis looks severely disorganised, Reissner's membrane is collapsed and no endocochlear potential is detected. Myo7a and Kcnj10 expression analysis show a lack of the melanocyte-like intermediate cells in hb/hb stria vascularis, which can explain the absence of endocochlear potential. We use Trp2 as a marker of melanoblasts migrating from the neural crest at E12.5 and show that they do not interdigitate into the developing strial epithelium, associated with abnormal persistence of the basal lamina in the hb/hb cochlea. We perform array CGH, deep sequencing as well as an extensive expression analysis of candidate genes in the headbobber region of hb/hb and littermate controls, and conclude that the headbobber phenotype is caused by: 1) effect of a 648 kb deletion on distal Chr7, resulting in the loss of three protein coding genes (Gpr26, Cpmx2 and Chst15) with expression in the inner ear but unknown function; and 2) indirect, long range effect of the deletion on the expression of neighboring genes on Chr7, associated with downregulation of Hmx3, Hmx2 and Nkx1.2 homeobox transcription factors. Interestingly, deletions of the orthologous region in humans, affecting the same genes, have been reported in nineteen patients with common features including sensorineural hearing loss and vestibular problems. Therefore, we propose that headbobber is a useful model to gain insight into the mechanisms underlying deafness in human 10qter deletion syndrome. PMID:23457544

Further delineation of the 15q13 microdeletion and duplication syndromes: a clinical spectrum varying from non-pathogenic to a severe outcome.

PubMed

van Bon, B W M; Mefford, H C; Menten, B; Koolen, D A; Sharp, A J; Nillesen, W M; Innis, J W; de Ravel, T J L; Mercer, C L; Fichera, M; Stewart, H; Connell, L E; Ounap, K; Lachlan, K; Castle, B; Van der Aa, N; van Ravenswaaij, C; Nobrega, M A; Serra-Juhé, C; Simonic, I; de Leeuw, N; Pfundt, R; Bongers, E M; Baker, C; Finnemore, P; Huang, S; Maloney, V K; Crolla, J A; van Kalmthout, M; Elia, M; Vandeweyer, G; Fryns, J P; Janssens, S; Foulds, N; Reitano, S; Smith, K; Parkel, S; Loeys, B; Woods, C G; Oostra, A; Speleman, F; Pereira, A C; Kurg, A; Willatt, L; Knight, S J L; Vermeesch, J R; Romano, C; Barber, J C; Mortier, G; Pérez-Jurado, L A; Kooy, F; Brunner, H G; Eichler, E E; Kleefstra, T; de Vries, B B A

2009-08-01

Recurrent 15q13.3 microdeletions were recently identified with identical proximal (BP4) and distal (BP5) breakpoints and associated with mild to moderate mental retardation and epilepsy. To assess further the clinical implications of this novel 15q13.3 microdeletion syndrome, 18 new probands with a deletion were molecularly and clinically characterised. In addition, we evaluated the characteristics of a family with a more proximal deletion between BP3 and BP4. Finally, four patients with a duplication in the BP3-BP4-BP5 region were included in this study to ascertain the clinical significance of duplications in this region. The 15q13.3 microdeletion in our series was associated with a highly variable intra- and inter-familial phenotype. At least 11 of the 18 deletions identified were inherited. Moreover, 7 of 10 siblings from four different families also had this deletion: one had a mild developmental delay, four had only learning problems during childhood, but functioned well in daily life as adults, whereas the other two had no learning problems at all. In contrast to previous findings, seizures were not a common feature in our series (only 2 of 17 living probands). Three patients with deletions had cardiac defects and deletion of the KLF13 gene, located in the critical region, may contribute to these abnormalities. The limited data from the single family with the more proximal BP3-BP4 deletion suggest this deletion may have little clinical significance. Patients with duplications of the BP3-BP4-BP5 region did not share a recognisable phenotype, but psychiatric disease was noted in 2 of 4 patients. Overall, our findings broaden the phenotypic spectrum associated with 15q13.3 deletions and suggest that, in some individuals, deletion of 15q13.3 is not sufficient to cause disease. The existence of microdeletion syndromes, associated with an unpredictable and variable phenotypic outcome, will pose the clinician with diagnostic difficulties and challenge the commonly used paradigm in the diagnostic setting that aberrations inherited from a phenotypically normal parent are usually without clinical consequences.

A Pyrosequencing-Based Assay for the Rapid Detection of the 22q11.2 Deletion in DNA from Buccal and Dried Blood Spot Samples

PubMed Central

Koontz, Deborah; Baecher, Kirsten; Kobrynski, Lisa; Nikolova, Stanimila; Gallagher, Margaret

2015-01-01

The 22q11.2 deletion syndrome is one of the most common deletion syndromes in newborns. Some affected newborns may be diagnosed shortly after birth because of the presence of heart defects, palatal defects, or severe immune deficiencies. However, diagnosis is often delayed in patients presenting with other associated conditions that would benefit from early recognition and treatment, such as speech delays, learning difficulties, and schizophrenia. Fluorescence in situ hybridization (FISH) is the gold standard for deletion detection, but it is costly and time consuming and requires a whole blood specimen. Our goal was to develop a suitable assay for population-based screening of easily collectible specimens, such as buccal swabs and dried blood spots (DBS). We designed a pyrosequencing assay and validated it using DNA from FISH–confirmed 22q11 deletion syndrome patients and normal controls. We tested DBS from nine patients and paired buccal cell and venous blood specimens from 20 patients. Results were 100% concordant with FISH assay results. DNA samples from normal controls (n = 180 cell lines, n = 15 DBS, and n = 88 buccal specimens) were negative for the deletion. Limiting dilution experiments demonstrated that accurate results could be obtained from as little as 1 ng of DNA. This method represents a reliable and low-cost alternative for detection of the common 22q11.2 microdeletions and can be adapted to high-throughput population screening. PMID:24973633

Genetic modifiers of Velo- cardio- facial syndrome/DiGeorge syndrome

PubMed Central

Aggarwal, Vimla S.; Morrow, Bernice E.

2009-01-01

Velo-cardio-facial syndrome/DiGeorge syndrome (VCFS/DGS), the most common micro-deletion disorder in humans, is characterized by craniofacial, parathyroid and thymic defects as well as cardiac outflow tract malformations. Most patients have a similar hemizygous 3 million base pair deletion on 22q11.2. Studies in mouse have shown that Tbx1, a T- box containing transcription factor present on the deleted region, is likely responsible for the etiology of the syndrome. Furthermore, mutations in TBX1 have been found in rare non-deleted patients. Despite having the same sized deletion, most VCFS/DGS patients exhibit significant clinical variability. Stochastic, environmental and genetic factors likely modify the phenotype of patients with the disorder. Here, we review mouse genetics studies which may help identify genetic modifiers for VCFS/DGS. PMID:18636633

Targeted Knockdown of Bone Morphogenetic Protein Signaling within Neural Progenitors Protects the Brain and Improves Motor Function following Postnatal Hypoxia-Ischemia

PubMed Central

Dettman, Robert W.; Birch, Derin; Fernando, Augusta; Kessler, John A.; Dizon, Maria L.V.

2018-01-01

Hypoxic-ischemic injury (HI) to the neonatal human brain results in myelin loss that, in some children, can manifest as cerebral palsy. Previously, we had found that neuronal overexpression of the bone morphogenic protein (BMP) inhibitor noggin during development increased oligodendroglia and improved motor function in an experimental model of HI utilizing unilateral common carotid artery ligation followed by hypoxia. As BMPs are known to negatively regulate oligodendroglial fate specification of neural stem cells and alter differentiation of committed oligodendroglia, BMP signaling is likely an important mechanism leading to myelin loss. Here, we showed that BMP signaling is upregulated within oligodendroglia of the neonatal brain. We tested the hypothesis that inhibition of BMP signaling specifically within neural progenitor cells (NPCs) is sufficient to protect oligodendroglia. We conditionally deleted the BMP receptor 2 subtype (BMPR2) in NG2-expressing cells after HI. We found that BMPR2 deletion globally protects the brain as assessed by MRI and protects motor function as assessed by digital gait analysis, and that conditional deletion of BMPR2 maintains oligodendrocyte marker expression by immunofluorescence and Western blot and prevents loss of oligodendroglia. Finally, BMPR2 deletion after HI results in an increase in noncompacted myelin. Thus, our data indicate that inhibition of BMP signaling specifically in NPCs may be a tractable strategy to protect the newborn brain from HI. PMID:29324456

Dicer-Like Proteins Regulate Sexual Development via the Biogenesis of Perithecium-Specific MicroRNAs in a Plant Pathogenic Fungus Fusarium graminearum

PubMed Central

Zeng, Wenping; Wang, Jie; Wang, Ying; Lin, Jing; Fu, Yanping; Xie, Jiatao; Jiang, Daohong; Chen, Tao; Liu, Huiquan; Cheng, Jiasen

2018-01-01

Ascospores act as the primary inoculum of Fusarium graminearum, which causes the destructive disease Fusarium head blight (FHB), or scab. MicroRNAs (miRNAs) have been reported in the F. graminearum vegetative stage, and Fgdcl2 is involved in microRNA-like RNA (milRNA) biogenesis but has no major impact on vegetative growth, abiotic stress or pathogenesis. In the present study, we found that ascospore discharge was decreased in the Fgdcl1 deletion mutant, and completely blocked in the double-deletion mutant of Fgdcl1 and Fgdcl2. Besides, more immature asci were observed in the double-deletion mutant. Interestingly, the up-regulated differentially expressed genes (DEGs) common to ΔFgdcl1 and ΔFgdcl1/2 were related to ion transmembrane transporter and membrane components. The combination of small RNA and transcriptome sequencing with bioinformatics analysis predicted 143 novel milRNAs in wild-type perithecia, and 138 of these milRNAs partly or absolutely depended on Fgdcl1, while only 5 novel milRNAs were still obtained in the Fgdcl1 and Fgdcl2 double-deletion mutant. Furthermore, 117 potential target genes were predicted. Overall, Fgdcl1 and Fgdcl2 genes were partly functionally redundant in ascospore discharge and perithecium-specific milRNA generation in F. graminearum, and these perithecium-specific milRNAs play potential roles in sexual development. PMID:29755439

Prader-Willi Syndrome due to an Unbalanced de novo Translocation t(15;19)(q12;p13.3).

PubMed

Dang, Vy; Surampalli, Abhilasha; Manzardo, Ann M; Youn, Stephanie; Butler, Merlin G; Gold, June-Anne; Kimonis, Virginia E

2016-01-01

Prader-Willi syndrome (PWS) is a complex, multisystem genetic disorder characterized by endocrine, neurologic, and behavioral abnormalities. We report the first case of an unbalanced de novo reciprocal translocation of chromosomes 15 and 19, 45,XY,-15,der(19)t(15;19)(q12;p13.3), resulting in monosomy for the PWS critical chromosome region. Our patient had several typical features of PWS including infantile hypotonia, a poor suck and feeding difficulties, tantrums, skin picking, compulsions, small hands and feet, and food seeking, but not hypopigmentation, a micropenis, cryptorchidism or obesity as common findings seen in PWS at the time of examination at 6 years of age. He had seizures noted from 1 to 3 years of age and marked cognitive delay. High-resolution SNP microarray analysis identified an atypical PWS type I deletion in chromosome 15 involving the proximal breakpoint BP1. The deletion extended beyond the GABRB3 gene but was proximal to the usual distal breakpoint (BP3) within the 15q11q13 region, and GABRA5, GABRG3, and OCA2 genes were intact. No deletion of band 19p13.3 was detected; therefore, the patient was not at an increased risk of tumors from the Peutz-Jeghers syndrome associated with a deletion of the STK11 gene. © 2016 S. Karger AG, Basel.

Rapid Screening for Deleted Form of β-thalassemia by Real-Time Quantitative PCR.

PubMed

Ke, Liang-Yin; Chang, Jan-Gowth; Chang, Chao-Sung; Hsieh, Li-Ling; Liu, Ta-Chih

2017-01-01

Thalassemia is the most common single gene disease in human beings. The prevalence rate of β-thalassemia in Taiwan is approximately 1-3%. Previously methods to reveal and diagnose severe deleted form of α- or β-thalassemia were insufficient and inappropriate for prenatal diagnosis. A real-time quantitative PCR method was set up for rapid screening of the deleted form of β-thalassemia. Our results show that ΔΔCt between deleted form of β-thalassemia and normal individuals were 1.0674 ± 0.0713. On the contrary, mutation form β-thalassemia showed no difference with normal healthy control. The HBB/CCR5 ratio for deleted form of β-thalassemia patients was 0.48, whether normal individuals and mutation form of β-thalassemia was 1.0. This RQ-PCR technique is an alternative rapid screening assay for deleted form of β-thalassemia. In addition, it could also identify undefined type. Our technique by using RQ-PCR to quantify gene copies is a reliable and time-saving method that can screen deleted form of β-thalassemia. © 2016 Wiley Periodicals, Inc.

Deletion of 8.5 Mb, including the FMR1 gene, in a male with the fragile X syndrome phenotype and overgrowth.

PubMed

Parvari, R; Mumm, S; Galil, A; Manor, E; Bar-David, Y; Carmi, R

1999-04-02

A four-year-old boy with severe psychomotor retardation, facial appearance consistent with the fragile X syndrome, hypotonia, and overgrowth was found to have a deletion including the fragile X gene (FMR1). The breakpoints of the deletion were established between CDR1 and sWXD2905 (approximately 200 kb apart) at Xq27.1 (centromeric) and between DXS8318 (612-1078L) and DXS7847 (576-291L) (approximately 250 kb apart) at Xq28, about 500 kb telomeric to the FMR1 gene. The total length of the deletion is approximately 8.5 Mb. The propositus's mother, who was found to be a carrier of the deletion, showed very mild mental impairment. Except for mental retardation, which is a common finding in all cases reported with similar deletions of chromosome Xq, this patient had generalized overgrowth, exceeding the 97th centile for height and weight. Obesity and increased growth parameters have been reported in other patients with deletions either overlapping or within a distance of 0.5 Mb from the deletion in the present patient. Thus, it is suggested that a deletion of the 8-Mb fragment centromeric to the FMR1 gene might have an effect on growth.

Assessment of copy number variations in 120 patients with Poland syndrome.

PubMed

Vaccari, Carlotta Maria; Tassano, Elisa; Torre, Michele; Gimelli, Stefania; Divizia, Maria Teresa; Romanini, Maria Victoria; Bossi, Simone; Musante, Ilaria; Valle, Maura; Senes, Filippo; Catena, Nunzio; Bedeschi, Maria Francesca; Baban, Anwar; Calevo, Maria Grazia; Acquaviva, Massimo; Lerone, Margherita; Ravazzolo, Roberto; Puliti, Aldamaria

2016-11-25

Poland Syndrome (PS) is a rare congenital disorder presenting with agenesis/hypoplasia of the pectoralis major muscle variably associated with thoracic and/or upper limb anomalies. Most cases are sporadic, but familial recurrence, with different inheritance patterns, has been observed. The genetic etiology of PS remains unknown. Karyotyping and array-comparative genomic hybridization (CGH) analyses can identify genomic imbalances that can clarify the genetic etiology of congenital and neurodevelopmental disorders. We previously reported a chromosome 11 deletion in twin girls with pectoralis muscle hypoplasia and skeletal anomalies, and a chromosome six deletion in a patient presenting a complex phenotype that included pectoralis muscle hypoplasia. However, the contribution of genomic imbalances to PS remains largely unknown. To investigate the prevalence of chromosomal imbalances in PS, standard cytogenetic and array-CGH analyses were performed in 120 PS patients. Following the application of stringent filter criteria, 14 rare copy number variations (CNVs) were identified in 14 PS patients in different regions outside known common copy number variations: seven genomic duplications and seven genomic deletions, enclosing the two previously reported PS associated chromosomal deletions. These CNVs ranged from 0.04 to 4.71 Mb in size. Bioinformatic analysis of array-CGH data indicated gene enrichment in pathways involved in cell-cell adhesion, DNA binding and apoptosis processes. The analysis also provided a number of candidate genes possibly causing the developmental defects observed in PS patients, among others REV3L, a gene coding for an error-prone DNA polymerase previously associated with Möbius Syndrome with variable phenotypes including pectoralis muscle agenesis. A number of rare CNVs were identified in PS patients, and these involve genes that represent candidates for further evaluation. Rare inherited CNVs may contribute to, or represent risk factors of PS in a multifactorial mode of inheritance.

Variation in Fumonisin and Ochratoxin Production Associated with Differences in Biosynthetic Gene Content in Aspergillus niger and A. welwitschiae Isolates from Multiple Crop and Geographic Origins

PubMed Central

Susca, Antonia; Proctor, Robert H.; Morelli, Massimiliano; Haidukowski, Miriam; Gallo, Antonia; Logrieco, Antonio F.; Moretti, Antonio

2016-01-01

The fungi Aspergillus niger and A. welwitschiae are morphologically indistinguishable species used for industrial fermentation and for food and beverage production. The fungi also occur widely on food crops. Concerns about their safety have arisen with the discovery that some isolates of both species produce fumonisin (FB) and ochratoxin A (OTA) mycotoxins. Here, we examined FB and OTA production as well as the presence of genes responsible for synthesis of the mycotoxins in a collection of 92 A. niger/A. welwitschiae isolates from multiple crop and geographic origins. The results indicate that (i) isolates of both species differed in ability to produce the mycotoxins; (ii) FB-nonproducing isolates of A. niger had an intact fumonisin biosynthetic gene (fum) cluster; (iii) FB-nonproducing isolates of A. welwitschiae exhibited multiple patterns of fum gene deletion; and (iv) OTA-nonproducing isolates of both species lacked the ochratoxin A biosynthetic gene (ota) cluster. Analysis of genome sequence data revealed a single pattern of ota gene deletion in the two species. Phylogenetic analysis suggest that the simplest explanation for this is that ota cluster deletion occurred in a common ancestor of A. niger and A. welwitschiae, and subsequently both the intact and deleted cluster were retained as alternate alleles during divergence of the ancestor into descendent species. Finally, comparison of results from this and previous studies indicate that a majority of A. niger isolates and a minority of A. welwitschiae isolates can produce FBs, whereas, a minority of isolates of both species produce OTA. The comparison also suggested that the relative abundance of each species and frequency of FB/OTA-producing isolates can vary with crop and/or geographic origin. PMID:27667988

Identifying candidate genes for 2p15p16.1 microdeletion syndrome using clinical, genomic, and functional analysis

PubMed Central

Bagheri, Hani; Badduke, Chansonette; Qiao, Ying; Colnaghi, Rita; Abramowicz, Iga; Alcantara, Diana; Dunham, Christopher; Wen, Jiadi; Wildin, Robert S.; Nowaczyk, Malgorzata J.M.; Eichmeyer, Jennifer; Lehman, Anna; Maranda, Bruno; Martell, Sally; Shan, Xianghong; Lewis, Suzanne M.E.; O’Driscoll, Mark; Gregory-Evans, Cheryl Y.

2016-01-01

The 2p15p16.1 microdeletion syndrome has a core phenotype consisting of intellectual disability, microcephaly, hypotonia, delayed growth, common craniofacial features, and digital anomalies. So far, more than 20 cases of 2p15p16.1 microdeletion syndrome have been reported in the literature; however, the size of the deletions and their breakpoints vary, making it difficult to identify the candidate genes. Recent reports pointed to 4 genes (XPO1, USP34, BCL11A, and REL) that were included, alone or in combination, in the smallest deletions causing the syndrome. Here, we describe 8 new patients with the 2p15p16.1 deletion and review all published cases to date. We demonstrate functional deficits for the above 4 candidate genes using patients’ lymphoblast cell lines (LCLs) and knockdown of their orthologs in zebrafish. All genes were dosage sensitive on the basis of reduced protein expression in LCLs. In addition, deletion of XPO1, a nuclear exporter, cosegregated with nuclear accumulation of one of its cargo molecules (rpS5) in patients’ LCLs. Other pathways associated with these genes (e.g., NF-κB and Wnt signaling as well as the DNA damage response) were not impaired in patients’ LCLs. Knockdown of xpo1a, rel, bcl11aa, and bcl11ab resulted in abnormal zebrafish embryonic development including microcephaly, dysmorphic body, hindered growth, and small fins as well as structural brain abnormalities. Our multifaceted analysis strongly implicates XPO1, REL, and BCL11A as candidate genes for 2p15p16.1 microdeletion syndrome. PMID:27699255

Variation in Fumonisin and Ochratoxin Production Associated with Differences in Biosynthetic Gene Content in Aspergillus niger and A. welwitschiae Isolates from Multiple Crop and Geographic Origins.

PubMed

Susca, Antonia; Proctor, Robert H; Morelli, Massimiliano; Haidukowski, Miriam; Gallo, Antonia; Logrieco, Antonio F; Moretti, Antonio

2016-01-01

The fungi Aspergillus niger and A. welwitschiae are morphologically indistinguishable species used for industrial fermentation and for food and beverage production. The fungi also occur widely on food crops. Concerns about their safety have arisen with the discovery that some isolates of both species produce fumonisin (FB) and ochratoxin A (OTA) mycotoxins. Here, we examined FB and OTA production as well as the presence of genes responsible for synthesis of the mycotoxins in a collection of 92 A. niger/A. welwitschiae isolates from multiple crop and geographic origins. The results indicate that (i) isolates of both species differed in ability to produce the mycotoxins; (ii) FB-nonproducing isolates of A. niger had an intact fumonisin biosynthetic gene (fum) cluster; (iii) FB-nonproducing isolates of A. welwitschiae exhibited multiple patterns of fum gene deletion; and (iv) OTA-nonproducing isolates of both species lacked the ochratoxin A biosynthetic gene (ota) cluster. Analysis of genome sequence data revealed a single pattern of ota gene deletion in the two species. Phylogenetic analysis suggest that the simplest explanation for this is that ota cluster deletion occurred in a common ancestor of A. niger and A. welwitschiae, and subsequently both the intact and deleted cluster were retained as alternate alleles during divergence of the ancestor into descendent species. Finally, comparison of results from this and previous studies indicate that a majority of A. niger isolates and a minority of A. welwitschiae isolates can produce FBs, whereas, a minority of isolates of both species produce OTA. The comparison also suggested that the relative abundance of each species and frequency of FB/OTA-producing isolates can vary with crop and/or geographic origin.

Disruption of the gene Euchromatin Histone Methyl Transferase1 (Eu-HMTase1) is associated with the 9q34 subtelomeric deletion syndrome

PubMed Central

Kleefstra, T; Smidt, M; Banning, M; Oudakker, A; Van Esch, H; de Brouwer, A P M; Nillesen, W; Sistermans, E; Hamel, B; de Bruijn, D; Fryns, J; Yntema, H; Brunner, H; de Vries, B B A; van Bokhoven, H

2005-01-01

Background: A new syndrome has been recognised following thorough analysis of patients with a terminal submicroscopic subtelomeric deletion of chromosome 9q. These have in common severe mental retardation, hypotonia, brachycephaly, flat face with hypertelorism, synophrys, anteverted nares, thickened lower lip, carp mouth with macroglossia, and conotruncal heart defects. The minimum critical region responsible for this 9q subtelomeric deletion syndrome (9q–) is approximately 1.2 Mb and encompasses at least 14 genes. Objective: To characterise the breakpoints of a de novo balanced translocation t(X;9)(p11.23;q34.3) in a mentally retarded female patient with clinical features similar to the 9q– syndrome. Results: Sequence analysis of the break points showed that the translocation was fully balanced and only one gene on chromosome 9 was disrupted—Euchromatin Histone Methyl Transferase1 (Eu-HMTase1)—encoding a histone H3 lysine 9 methyltransferase (H3-K9 HMTase). This indicates that haploinsufficiency of Eu-HMTase1 is responsible for the 9q submicroscopic subtelomeric deletion syndrome. This observation was further supported by the spatio-temporal expression of the gene. Using tissue in situ hybridisation studies in mouse embryos and adult brain, Eu-HMTase1 was shown to be expressed in the developing nervous system and in specific peripheral tissues. While expression is selectively downregulated in adult brain, substantial expression is retained in the olfactory bulb, anterior/ventral lateral ventricular wall, and hippocampus and weakly in the piriform cortex. Conclusions: The expression pattern of this gene suggests a role in the CNS development and function, which is in line with the severe mental retardation and behaviour problems in patients who lack one copy of the gene. PMID:15805155

2q37 Deletion syndrome confirmed by high-resolution cytogenetic analysis

PubMed Central

Cho, Eun-Kyung; Kim, Jinsup; Yang, Aram; Jin, Dong-Kyu

2017-01-01

Chromosome 2q37 deletion syndrome is a rare chromosomal disorder characterized by mild to moderate developmental delay, brachydactyly of the third to fifth digits or toes, short stature, obesity, hypotonia, a characteristic facial appearance, and autism spectrum disorder. Here, we report on a patient with 2q37 deletion presenting with dilated cardiomyopathy (DCMP). Congenital heart malformations have been noted in up to 20% of patients with 2q37 deletions. However, DCMP has not been reported in 2q37 deletion patients previously. The patient exhibited the characteristic facial appearance (a flat nasal bridge, deep-set eyes, arched eyebrows, and a thin upper lip), developmental delay, mild mental retardation, peripheral nerve palsy, and Albright hereditary osteodystrophy (AHO)-like phenotypes (short stature and brachydactyly). Conventional chromosomal analysis results were normal; however, microarray-based comparative genomic hybridization revealed terminal deletion at 2q37.1q37.3. In addition, the patient was confirmed to have partial growth hormone (GH) deficiency and had shown a significant increase in growth rate after substitutive GH therapy. Chromosome 2q37 deletion syndrome should be considered in the differential diagnosis of patients presenting with AHO features, especially in the presence of facial dysmorphism. When patients are suspected of having a 2q37 deletion, high-resolution cytogenetic analysis is recommended. PMID:28690993

Usefulness of MLPA in the detection of SHOX deletions.

PubMed

Funari, Mariana F A; Jorge, Alexander A L; Souza, Silvia C A L; Billerbeck, Ana E C; Arnhold, Ivo J P; Mendonca, Berenice B; Nishi, Mirian Y

2010-01-01

SHOX haploinsufficiency causes a wide spectrum of short stature phenotypes, such as Leri-Weill dyschondrosteosis (LWD) and disproportionate short stature (DSS). SHOX deletions are responsible for approximately two thirds of isolated haploinsufficiency; therefore, it is important to determine the most appropriate methodology for detection of gene deletion. In this study, three methodologies for the detection of SHOX deletions were compared: the fluorescence in situ hybridization (FISH), microsatellite analysis and multiplex ligation-dependent probe amplification (MLPA). Forty-four patients (8 LWD and 36 DSS) were analyzed. The cosmid LLNOYCO3'M'34F5 was used as a probe for the FISH analysis and microsatellite analysis were performed using three intragenic microsatellite markers. MLPA was performed using commercial kits. Twelve patients (8 LWD and 4 DSS) had deletions in SHOX area detected by MLPA and 2 patients generated discordant results with the other methodologies. In the first case, the deletion was not detected by FISH. In the second case, both FISH and microsatellite analyses were unable to identify the intragenic deletion. In conclusion, MLPA was more sensitive, less expensive and less laborious; therefore, it should be used as the initial molecular method for the detection of SHOX gene deletion. Copyright © 2010 Elsevier Masson SAS. All rights reserved.

Copy number variants in attention-deficit hyperactive disorder: identification of the 15q13 deletion and its functional role.

PubMed

Valbonesi, Stefano; Magri, Chiara; Traversa, Michele; Faraone, Stephen V; Cattaneo, Annamaria; Milanesi, Elena; Valenti, Vera; Gennarelli, Massimo; Scassellati, Catia

2015-04-01

Evidence has supported a role for rare copy number variants in the etiology of attention-deficit hyperactivity disorder (ADHD), in particular, the region 15q13, which is also a hot spot for several neuropsychiatric disorders. This region spans several genes, but their role and the biological implications remain unclear. We carried out, for the first time, an analysis of the 15q13 region in an Italian cohort of 117 ADHD patients and 77 controls using the MLPA method, confirmed by a genome single-nucleotide polymorphism array. In addition, we probed for downstream effects of the 15q13 deletions on gene expression by carrying out a transcriptomic analysis in blood. We found 15q13 deletions in two ADHD patients and identified 129 genes as significantly dysregulated in the blood of the two ADHD patients carrying 15q13 deletions compared with ADHD patients without 15q13 deletions. As expected, genes in the deleted region (KLF13, MTMR10) were downregulated in the two patients with deletions. Moreover, a pathway analysis identified apoptosis, oxidation reduction, and immune response as the mechanisms that were altered most significantly in the ADHD patients with 15q13 deletions. Interestingly, we showed that deletions in KLF13 and CHRNA7 influenced the expression of genes belonging to the same immune/inflammatory and oxidative stress signaling pathways. Our findings are consistent with the presence of 15q13 deletions in Italian ADHD patients. More interestingly, we show that pathways related to immune/inflammatory response and oxidative stress signaling are affected by the deletion of KFL13 and CHRNA7. Because the phenotypic effects of 15q13 are pleiotropic, our findings suggest that there are shared biologic pathways among multiple neuropsychiatric conditions.

Mathematical Learning Disabilities in Children with 22q11.2 Deletion Syndrome: A Review

ERIC Educational Resources Information Center

De Smedt, Bert; Swillen, Ann; Verschaffel, Lieven; Ghesquiere, Pol

2009-01-01

Mathematical learning disabilities (MLD) occur frequently in children with specific genetic disorders, like Turner syndrome, fragile X syndrome and neurofibromatosis. This review focuses on MLD in children with chromosome 22q11.2 deletion syndrome (22q11DS). This syndrome is the most common known microdeletion syndrome with a prevalence of at…

77 FR 14297 - Connect America Fund; a National Broadband Plan for Our Future; Establishing Just and Reasonable...

Federal Register 2010, 2011, 2012, 2013, 2014

2012-03-09

... Reduction Act requirements, and finds good cause to delete certain rules that are now obsolete. DATES... Paperwork Reduction Act (PRA) requirements, and finds good cause to delete certain rules that are now... CAF phase I support,'' but excludes Interstate Common Line Support (ICLS) on the basis that it...

Translational Research for Muscular Dystrophy

DTIC Science & Technology

2012-05-01

common in-frame deletions for which clinical information from human Becker muscular dystrophy patients (deletion of exons 44-45, 49-51, 48-53) is lacking... Dystrophy PRINCIPAL INVESTIGATOR: Gregory A. Cox, Ph.D. CONTRACTING ORGANIZATION: The Jackson Laboratory...REPORT TYPE Annual 3. DATES COVERED 1 MAR 2011 - 30 APR 2012 4. TITLE AND SUBTITLE Translational Research for Muscular Dystrophy 5a. CONTRACT

The frequency of previously undetectable deletions involving 3' Exons of the PMS2 gene.

PubMed

Vaughn, Cecily P; Baker, Christine L; Samowitz, Wade S; Swensen, Jeffrey J

2013-01-01

Lynch syndrome is characterized by mutations in one of four mismatch repair genes, MLH1, MSH2, MSH6, or PMS2. Clinical mutation analysis of these genes includes sequencing of exonic regions and deletion/duplication analysis. However, detection of deletions and duplications in PMS2 has previously been confined to Exons 1-11 due to gene conversion between PMS2 and the pseudogene PMS2CL in the remaining 3' exons (Exons 12-15). We have recently described an MLPA-based method that permits detection of deletions of PMS2 Exons 12-15; however, the frequency of such deletions has not yet been determined. To address this question, we tested for 3' deletions in 58 samples that were reported to be negative for PMS2 mutations using previously available methods. All samples were from individuals whose tumors exhibited loss of PMS2 immunohistochemical staining without concomitant loss of MLH1 immunostaining. We identified seven samples in this cohort with deletions in the 3' region of PMS2, including three previously reported samples with deletions of Exons 13-15 (two samples) and Exons 14-15. Also detected were deletions of Exons 12-15, Exon 13, and Exon 14 (two samples). Breakpoint analysis of the intragenic deletions suggests they occurred through Alu-mediated recombination. Our results indicate that ∼12% of samples suspected of harboring a PMS2 mutation based on immunohistochemical staining, for which mutations have not yet been identified, would benefit from testing using the new methodology. Copyright © 2012 Wiley Periodicals, Inc.

Molecular analysis of PROP1, POU1F1, LHX3, and HESX1 in Turkish patients with combined pituitary hormone deficiency: a multicenter study.

PubMed

Baş, Firdevs; Uyguner, Z Oya; Darendeliler, Feyza; Aycan, Zehra; Çetinkaya, Ergun; Berberoğlu, Merih; Şiklar, Zeynep; Öcal, Gönül; Darcan, Şükran; Gökşen, Damla; Topaloğlu, Ali Kemal; Yüksel, Bilgin; Özbek, Mehmet Nuri; Ercan, Oya; Evliyaoğlu, Olcay; Çetinkaya, Semra; Şen, Yaşar; Atabek, Emre; Toksoy, Güven; Aydin, Banu Küçükemre; Bundak, Rüveyde

2015-06-01

To investigate the specific mutations in PROP1, POU1F1, LHX3, and HESX1 genes in patients with combined pituitary hormone deficiency (CPHD) in Turkey. Seventy-six patients with CPHD were included in this study. Based on clinical, hormonal, and neuro-radiological data, relevant transcription factor genes were evaluated by Sanger sequencing and multiplex ligation-dependent probe amplification. Total frequency of mutations was 30.9 % in patients with CPHD. Frequency was significantly higher in familial patients (p = 0.001). Three different types of mutations in PROP1 gene (complete gene deletion, c.301-302delAG, a novel mutation; IVS1+2T>G) were found in 12 unrelated patients (21.8 %). Mutations in PROP1 gene were markedly higher in familial than in sporadic cases (58.8 vs. 5.3 %, p < 0.001). Homozygous complete gene deletion was the most common mutation in PROP1 gene (8/12) and was identified in six familial patients. Four different homozygous mutations [p.Q4X, novel mutations; exons 1-2 deletion, p.V153F, p.I244S] were detected in POU1F1 gene. Central precocious puberty was firstly observed in a sporadic-male patient with homozygous POU1F1 (p.I244S) mutation. A homozygous mutation in HESX1 gene (p.R160H) was detected in one patient. This study is the first to investigate specific mutations in CPHD patients in Turkey. Complete deletion in PROP1 gene was the most common mutation encountered in patients with CPHD. We believe that the results of this study will contribute to the establishment of genetic screening strategies in Turkey, as well as to the studies on phenotype-genotype correlations and early diagnosis of CPHD patients.

A Deletion in the Canine POMC Gene Is Associated with Weight and Appetite in Obesity-Prone Labrador Retriever Dogs.

PubMed

Raffan, Eleanor; Dennis, Rowena J; O'Donovan, Conor J; Becker, Julia M; Scott, Robert A; Smith, Stephen P; Withers, David J; Wood, Claire J; Conci, Elena; Clements, Dylan N; Summers, Kim M; German, Alexander J; Mellersh, Cathryn S; Arendt, Maja L; Iyemere, Valentine P; Withers, Elaine; Söder, Josefin; Wernersson, Sara; Andersson, Göran; Lindblad-Toh, Kerstin; Yeo, Giles S H; O'Rahilly, Stephen

2016-05-10

Sequencing of candidate genes for obesity in Labrador retriever dogs identified a 14 bp deletion in pro-opiomelanocortin (POMC) with an allele frequency of 12%. The deletion disrupts the β-MSH and β-endorphin coding sequences and is associated with body weight (per allele effect of 0.33 SD), adiposity, and greater food motivation. Among other dog breeds, the deletion was only found in the closely related flat-coat retriever (FCR), where it is similarly associated with body weight and food motivation. The mutation is significantly more common in Labrador retrievers selected to become assistance dogs than pets. In conclusion, the deletion in POMC is a significant modifier of weight and appetite in Labrador retrievers and FCRs and may influence other behavioral traits. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

Osteopoikilosis, short stature and mental retardation as key features of a new microdeletion syndrome on 12q14.

PubMed

Menten, Björn; Buysse, Karen; Zahir, Farah; Hellemans, Jan; Hamilton, Sara J; Costa, Teresa; Fagerstrom, Carrie; Anadiotis, George; Kingsbury, Daniel; McGillivray, Barbara C; Marra, Marco A; Friedman, Jan M; Speleman, Frank; Mortier, Geert

2007-04-01

This report presents the detection of a heterozygous deletion at chromosome 12q14 in three unrelated patients with a similar phenotype consisting of mild mental retardation, failure to thrive in infancy, proportionate short stature and osteopoikilosis as the most characteristic features. In each case, this interstitial deletion was found using molecular karyotyping. The deletion occurred as a de novo event and varied between 3.44 and 6 megabases (Mb) in size with a 3.44 Mb common deleted region. The deleted interval was not flanked by low-copy repeats or segmental duplications. It contains 13 RefSeq genes, including LEMD3, which was previously shown to be the causal gene for osteopoikilosis. The observation of osteopoikilosis lesions should facilitate recognition of this new microdeletion syndrome among children with failure to thrive, short stature and learning disabilities.

A pyrosequencing-based assay for the rapid detection of the 22q11.2 deletion in DNA from buccal and dried blood spot samples.

PubMed

Koontz, Deborah; Baecher, Kirsten; Kobrynski, Lisa; Nikolova, Stanimila; Gallagher, Margaret

2014-09-01

The 22q11.2 deletion syndrome is one of the most common deletion syndromes in newborns. Some affected newborns may be diagnosed shortly after birth because of the presence of heart defects, palatal defects, or severe immune deficiencies. However, diagnosis is often delayed in patients presenting with other associated conditions that would benefit from early recognition and treatment, such as speech delays, learning difficulties, and schizophrenia. Fluorescence in situ hybridization (FISH) is the gold standard for deletion detection, but it is costly and time consuming and requires a whole blood specimen. Our goal was to develop a suitable assay for population-based screening of easily collectible specimens, such as buccal swabs and dried blood spots (DBS). We designed a pyrosequencing assay and validated it using DNA from FISH-confirmed 22q11 deletion syndrome patients and normal controls. We tested DBS from nine patients and paired buccal cell and venous blood specimens from 20 patients. Results were 100% concordant with FISH assay results. DNA samples from normal controls (n = 180 cell lines, n = 15 DBS, and n = 88 buccal specimens) were negative for the deletion. Limiting dilution experiments demonstrated that accurate results could be obtained from as little as 1 ng of DNA. This method represents a reliable and low-cost alternative for detection of the common 22q11.2 microdeletions and can be adapted to high-throughput population screening. Copyright © 2014 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.

Age-related clinical and biological features of PTEN abnormalities in T-cell acute lymphoblastic leukaemia.

PubMed

Tesio, M; Trinquand, A; Ballerini, P; Hypolite, G; Lhermitte, L; Petit, A; Ifrah, N; Baruchel, A; Dombret, H; Macintyre, E; Asnafi, V

2017-12-01

The tumour suppressor gene PTEN is commonly altered in T-cell acute lymphoblastic leukaemia but its prognostic impact is still debated. We screened a cohort of 573 fully characterised adult and paediatric T-cell acute lymphoblastic leukaemia (T-ALL) patients for genomic PTEN abnormalities. PTEN-inactivating mutations and/or deletions were identified in 91 cases (16%), including 18% of paediatric (49/277) and 14% of adult cases (42/296). Thirty-four patients harboured only mutations, 12 cases demonstrated only large deletions and 9 only microdeletions. About 36 patients had combined alterations. Different mechanisms of PTEN inactivation predicted differences in the clinical outcome for both adult and paediatric patients treated according to the GRAALL03/05 and FRALLE2000 protocols. Whereas large deletions predicted lower 5-year overall survival (P=0.0053 in adults, P=0.001 in children) and disease-free survival (P=0.0009 in adults, P=0.0002 in children), mutations were not associated with a worse prognosis. The prognostic impact of PTEN loss is therefore linked to the underlying type of genomic abnormality, both in adult and paediatric T-ALLs, demonstrating that detailed analysis of the type of abnormality type would be useful to refine risk stratification.

Exon dosage analysis of parkin gene in Chinese sporadic Parkinson's disease.

PubMed

Guo, Ji-Feng; Dong, Xiao-Li; Xu, Qian; Li, Nan; Yan, Xin-Xiang; Xia, Kun; Tang, Bei-Sha

2015-09-14

Parkin gene mutations are by far the most common mutations in both familial Parkinson's disease (PD) and sporadic PD. Approximately, 50% of parkin mutations is exon dosage mutations (i.e., deletions and duplications of entire exons). Here, we first established a MLPA assay for quick detection of parkin exon rearrangements. Then, we studied parkin exon dosage mutations in 755 Chinese sporadic PDdisease patients using the established MLPA assay. We found that there were 25 (3.3%) patients with exon dosage alterations including deletions and duplications, 20 (11.4%) patients with exon rearrangements in 178 early-onset patients, and 5 (0.86%) patients with exon rearrangement mutations in 579 later-onset patients. The percentage of individuals with parkin dosage mutations is more than 33% when the age at onset is less than 30 years old, but less than 7% when the age at onset is more than 30. In these mutations, deletion is the main mutational style, especially in exon 2-5. Our results indicated that exon dosage mutations in parkin gene might be the main cause for sporadic PD, especially in EOP. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

Deletion of Asxl1 results in myelodysplasia and severe developmental defects in vivo

PubMed Central

Abdel-Wahab, Omar; Gao, Jie; Adli, Mazhar; Dey, Anwesha; Trimarchi, Thomas; Chung, Young Rock; Kuscu, Cem; Hricik, Todd; Ndiaye-Lobry, Delphine; LaFave, Lindsay M.; Koche, Richard; Shih, Alan H.; Guryanova, Olga A.; Kim, Eunhee; Li, Sheng; Pandey, Suveg; Shin, Joseph Y.; Telis, Leon; Liu, Jinfeng; Bhatt, Parva K.; Monette, Sebastien; Zhao, Xinyang; Mason, Christopher E.; Park, Christopher Y.; Bernstein, Bradley E.

2013-01-01

Somatic Addition of Sex Combs Like 1 (ASXL1) mutations occur in 10–30% of patients with myeloid malignancies, most commonly in myelodysplastic syndromes (MDSs), and are associated with adverse outcome. Germline ASXL1 mutations occur in patients with Bohring-Opitz syndrome. Here, we show that constitutive loss of Asxl1 results in developmental abnormalities, including anophthalmia, microcephaly, cleft palates, and mandibular malformations. In contrast, hematopoietic-specific deletion of Asxl1 results in progressive, multilineage cytopenias and dysplasia in the context of increased numbers of hematopoietic stem/progenitor cells, characteristic features of human MDS. Serial transplantation of Asxl1-null hematopoietic cells results in a lethal myeloid disorder at a shorter latency than primary Asxl1 knockout (KO) mice. Asxl1 deletion reduces hematopoietic stem cell self-renewal, which is restored by concomitant deletion of Tet2, a gene commonly co-mutated with ASXL1 in MDS patients. Moreover, compound Asxl1/Tet2 deletion results in an MDS phenotype with hastened death compared with single-gene KO mice. Asxl1 loss results in a global reduction of H3K27 trimethylation and dysregulated expression of known regulators of hematopoiesis. RNA-Seq/ChIP-Seq analyses of Asxl1 in hematopoietic cells identify a subset of differentially expressed genes as direct targets of Asxl1. These findings underscore the importance of Asxl1 in Polycomb group function, development, and hematopoiesis. PMID:24218140

A common deletion in two gamma ray induced rat pulmonary tumor cell lines.

PubMed

Van Klaveren, P; De Bruijne, J; Van der Winden, H; Kal, H B; Bentvelzen, P

1994-01-01

Subtraction hybridization was performed on normal WAG/Rij rat DNA with DNA from a syngeneic Ir-192 induced pulmonary tumor cell line L37. The residual DNA was amplified by means of sequence-independent PCR. This procedure yielded a sequence, of which multiple copies are present in normal rat DNA. In the tumor line L37 two restriction fragments hybridizing with this repeat sequence are lacking. In another Ir-192 induced pulmonary tumor line, L33, one of these fragments was also lacking. This indicates a common deletion in the two tumor lines.

Gene Expression and Pathway Analysis of Effects of the CMAH Deactivation on Mouse Lung, Kidney and Heart

PubMed Central

Kwon, Deug-Nam; Chang, Byung-Soo; Kim, Jin-Hoi

2014-01-01

Background N-glycolylneuraminic acid (Neu5Gc) is generated by hydroxylation of CMP-Neu5Ac to CMP-Neu5Gc, catalyzed by CMP-Neu5Ac hydroxylase (CMAH). However, humans lack this common mammalian cell surface molecule, Neu5Gc, due to inactivation of the CMAH gene during evolution. CMAH is one of several human-specific genes whose function has been lost by disruption or deletion of the coding frame. It has been suggested that CMAH inactivation has resulted in biochemical or physiological characteristics that have resulted in human-specific diseases. Methodology/Principal Findings To identify differential gene expression profiles associated with the loss of Neu5Gc expression, we performed microarray analysis using Illumina MouseRef-8 v2 Expression BeadChip, using the main tissues (lung, kidney, and heart) from control mice and CMP-Neu5Ac hydroxylase (Cmah) gene knock-out mice, respectively. Out of a total of 25,697 genes, 204, 162, and 147 genes were found to be significantly modulated in the lung, kidney, and heart tissues of the Cmah null mouse, respectively. In this study, we examined the gene expression profiles, using three commercial pathway analysis software packages: Ingenuity Pathways Analysis, Kyoto Encyclopedia of Genes and Genomes analysis, and Pathway Studio. The gene ontology analysis revealed that the top 6 biological processes of these genes included protein metabolism and modification, signal transduction, lipid, fatty acid, and steroid metabolism, nucleoside, nucleotide and nucleic acid metabolism, immunity and defense, and carbohydrate metabolism. Gene interaction network analysis showed a common network that was common to the different tissues of the Cmah null mouse. However, the expression of most sialytransferase mRNAs of Hanganutziu-Deicher antigen, sialy-Tn antigen, Forssman antigen, and Tn antigen was significantly down-regulated in the liver tissue of Cmah null mice. Conclusions/Significance Mice bearing a human-like deletion of the Cmah gene serve as an important model for the study of abnormal pathogenesis and/or metabolism caused by the evolutionary loss of Neu5Gc synthesis in humans. PMID:25229777

Mutation analysis of the MYO7A and CDH23 genes in Japanese patients with Usher syndrome type 1.

PubMed

Nakanishi, Hiroshi; Ohtsubo, Masafumi; Iwasaki, Satoshi; Hotta, Yoshihiro; Takizawa, Yoshinori; Hosono, Katsuhiro; Mizuta, Kunihiro; Mineta, Hiroyuki; Minoshima, Shinsei

2010-12-01

Usher syndrome (USH) is an autosomal recessive disorder characterized by retinitis pigmentosa and hearing loss. USH type 1 (USH1), the second common type of USH, is frequently caused by MYO7A and CDH23 mutations, accounting for 70-80% of the cases among various ethnicities, including Caucasians, Africans and Asians. However, there have been no reports of mutation analysis for any responsible genes for USH1 in Japanese patients. This study describes the first mutation analysis of MYO7A and CDH23 in Japanese USH1 patients. Five mutations (three in MYO7A and two in CDH23) were identified in four of five unrelated patients. Of these mutations, two were novel. One of them, p.Tyr1942SerfsX23 in CDH23, was a large deletion causing the loss of 3 exons. This is the first large deletion to be found in CDH23. The incidence of the MYO7A and CDH23 mutations in the study population was 80%, which is consistent with previous findings. Therefore, mutation screening for these genes is expected to be a highly sensitive method for diagnosing USH1 among the Japanese.

Haploinsufficiency of SOX5 at 12p12.1 is associated with developmental delays with prominent language delay, behavior problems, and mild dysmorphic features.

PubMed

Lamb, Allen N; Rosenfeld, Jill A; Neill, Nicholas J; Talkowski, Michael E; Blumenthal, Ian; Girirajan, Santhosh; Keelean-Fuller, Debra; Fan, Zheng; Pouncey, Jill; Stevens, Cathy; Mackay-Loder, Loren; Terespolsky, Deborah; Bader, Patricia I; Rosenbaum, Kenneth; Vallee, Stephanie E; Moeschler, John B; Ladda, Roger; Sell, Susan; Martin, Judith; Ryan, Shawnia; Jones, Marilyn C; Moran, Rocio; Shealy, Amy; Madan-Khetarpal, Suneeta; McConnell, Juliann; Surti, Urvashi; Delahaye, Andrée; Heron-Longe, Bénédicte; Pipiras, Eva; Benzacken, Brigitte; Passemard, Sandrine; Verloes, Alain; Isidor, Bertrand; Le Caignec, Cedric; Glew, Gwen M; Opheim, Kent E; Descartes, Maria; Eichler, Evan E; Morton, Cynthia C; Gusella, James F; Schultz, Roger A; Ballif, Blake C; Shaffer, Lisa G

2012-04-01

SOX5 encodes a transcription factor involved in the regulation of chondrogenesis and the development of the nervous system. Despite its important developmental roles, SOX5 disruption has yet to be associated with human disease. We report one individual with a reciprocal translocation breakpoint within SOX5, eight individuals with intragenic SOX5 deletions (four are apparently de novo and one inherited from an affected parent), and seven individuals with larger 12p12 deletions encompassing SOX5. Common features in these subjects include prominent speech delay, intellectual disability, behavior abnormalities, and dysmorphic features. The phenotypic impact of the deletions may depend on the location of the deletion and, consequently, which of the three major SOX5 protein isoforms are affected. One intragenic deletion, involving only untranslated exons, was present in a more mildly affected subject, was inherited from a healthy parent and grandparent, and is similar to a deletion found in a control cohort. Therefore, some intragenic SOX5 deletions may have minimal phenotypic effect. Based on the location of the deletions in the subjects compared to the controls, the de novo nature of most of these deletions, and the phenotypic similarities among cases, SOX5 appears to be a dosage-sensitive, developmentally important gene. © 2012 Wiley Periodicals, Inc.

Large Deletions of TSPAN12 Cause Familial Exudative Vitreoretinopathy (FEVR).

PubMed

Seo, Soo Hyun; Kim, Man Jin; Park, Sung Wook; Kim, Jeong Hun; Yu, Young Suk; Song, Ji Yun; Cho, Sung Im; Ahn, Joo Hyun; Oh, Yeon Hee; Lee, Jee-Soo; Lee, Seungjun; Seong, Moon-Woo; Park, Sung Sup; Kim, Ji Yeon

2016-12-01

Familial exudative vitreoretinopathy (FEVR) is a rare, hereditary visual disorder. The gene TSPAN12 is associated with autosomal dominant inheritance of FEVR. The prevalence and impact of large deletions/duplications of TSPAN12 on FEVR patients is unknown. To glean better insight of TSPAN12 on FEVR pathology, herein, we describe three FEVR patients with TSPAN12 deletions. Thirty-three Korean FEVR patients, who previously screened negative for TSPAN12 mutations, mutations in other FEVR-associated genes such as NDP, FZD4, LRP5, and large deletions and duplications of NDP, FZD4, and LRP5, were selected for TSPAN12 large deletion and duplication analyses. Semiquantitative multiplex PCR for TSPAN12 gene dosage analyses were performed, followed by droplet digital PCR (ddPCR) for validation. Among the 33 patients, three patients were confirmed to carry large TSPAN12 deletions. Two of them had whole-gene deletions of TSPAN12, and the other patient possessed a deletion of TSPAN12 in exon 4. FEVR severity detected in these patients was not more severe than in a patient with TSPAN12 point mutation. Regarding previously reported proportions of FEVR-associated genes contributing to the disorder's autosomal dominant inheritance pattern in Korea, we determined that patients with TSPAN12 large deletions were more common than patients with single nucleotide variants in TSPAN12. Evaluating TSPAN12 large deletions and duplications should be considered in FEVR screening and diagnosis as well as in routine genetic workups for FEVR patients.

Genetic Modifiers of the Physical Malformations in Velo-Cardio-Facial Syndrome/DiGeorge Syndrome

ERIC Educational Resources Information Center

Aggarwal, Vimla S.; Morrow, Bernice E.

2008-01-01

Velo-cardio-facial syndrome/DiGeorge syndrome (VCFS/DGS), the most common micro-deletion disorder in humans, is characterized by craniofacial, parathyroid, and thymic defects as well as cardiac outflow tract malformations. Most patients have a similar hemizygous 3 million base pair deletion on 22q11.2. Studies in mouse have shown that "Tbx1", a…

Structural and dynamic changes associated with beneficial engineered single-amino-acid deletion mutations in enhanced green fluorescent protein

DOE Office of Scientific and Technical Information (OSTI.GOV)

Arpino, James A. J.; Rizkallah, Pierre J., E-mail: rizkallahp@cardiff.ac.uk; Jones, D. Dafydd, E-mail: rizkallahp@cardiff.ac.uk

2014-08-01

The beneficial engineered single-amino-acid deletion variants EGFP{sup D190Δ} and EGFP{sup A227Δ} have been studied. Single-amino-acid deletions are a common part of the natural evolutionary landscape but are rarely sampled during protein engineering owing to limited and prejudiced molecular understanding of mutations that shorten the protein backbone. Single-amino-acid deletion variants of enhanced green fluorescent protein (EGFP) have been identified by directed evolution with the beneficial effect of imparting increased cellular fluorescence. Biophysical characterization revealed that increased functional protein production and not changes to the fluorescence parameters was the mechanism that was likely to be responsible. The structure EGFP{sup D190Δ} containing amore » deletion within a loop revealed propagated changes only after the deleted residue. The structure of EGFP{sup A227Δ} revealed that a ‘flipping’ mechanism was used to adjust for residue deletion at the end of a β-strand, with amino acids C-terminal to the deletion site repositioning to take the place of the deleted amino acid. In both variants new networks of short-range and long-range interactions are generated while maintaining the integrity of the hydrophobic core. Both deletion variants also displayed significant local and long-range changes in dynamics, as evident by changes in B factors compared with EGFP. Rather than being detrimental, deletion mutations can introduce beneficial structural effects through altering core protein properties, folding and dynamics, as well as function.« less

Next-Generation Sequencing to Detect Deletion of RB1 and ERBB4 Genes in Chromophobe Renal Cell Carcinoma: A Potential Role in Distinguishing Chromophobe Renal Cell Carcinoma from Renal Oncocytoma.

PubMed

Liu, Qingqing; Cornejo, Kristine M; Cheng, Liang; Hutchinson, Lloyd; Wang, Mingsheng; Zhang, Shaobo; Tomaszewicz, Keith; Cosar, Ediz F; Woda, Bruce A; Jiang, Zhong

2018-04-01

Overlapping morphologic, immunohistochemical, and ultrastructural features make it difficult to diagnose chromophobe renal cell carcinoma (ChRCC) and renal oncocytoma (RO). Because ChRCC is a malignant tumor, whereas RO is a tumor with benign behavior, it is important to distinguish these two entities. We aimed to identify genetic markers that distinguish ChRCC from RO by using next-generation sequencing (NGS). NGS for hotspot mutations or gene copy number changes was performed on 12 renal neoplasms, including seven ChRCC and five RO cases. Matched normal tissues from the same patients were used to exclude germline variants. Rare hotspot mutations were found in cancer-critical genes (TP53 and PIK3CA) in ChRCC but not RO. The NGS gene copy number analysis revealed multiple abnormalities. The two most common deletions were tumor-suppressor genes RB1 and ERBB4 in ChRCC but not RO. Fluorescence in situ hybridization was performed on 65 cases (ChRCC, n = 33; RO, n = 32) to verify hemizygous deletion of RB1 (17/33, 52%) or ERBB4 (11/33, 33%) in ChRCC, but not in RO (0/32, 0%). In total, ChRCCs (23/33, 70%) carry either a hemizygous deletion of RB1 or ERBB4. The combined use of RB1 and ERBB4 fluorescence in situ hybridization to detect deletion of these genes may offer a highly sensitive and specific assay to distinguish ChRCC from RO. Copyright © 2018 American Society for Investigative Pathology. Published by Elsevier Inc. All rights reserved.

Cryptic deletions are a common finding in “balanced” reciprocal and complex chromosome rearrangements: a study of 59 patients

PubMed Central

De Gregori, M; Ciccone, R; Magini, P; Pramparo, T; Gimelli, S; Messa, J; Novara, F; Vetro, A; Rossi, E; Maraschio, P; Bonaglia, M C; Anichini, C; Ferrero, G B; Silengo, M; Fazzi, E; Zatterale, A; Fischetto, R; Previderé, C; Belli, S; Turci, A; Calabrese, G; Bernardi, F; Meneghelli, E; Riegel, M; Rocchi, M; SGuerneri; Lalatta, F; Zelante, L; Romano, C; Fichera, Ma; Mattina, T; Arrigo, G; Zollino, M; Giglio, S; Lonardo, F; Bonfante, A; Ferlini, A; Cifuentes, F; Van Esch, H; Backx, L; Schinzel, A; Vermeesch, J R; Zuffardi, O

2007-01-01

Using array comparative genome hybridisation (CGH) 41 de novo reciprocal translocations and 18 de novo complex chromosome rearrangements (CCRs) were screened. All cases had been interpreted as “balanced” by conventional cytogenetics. In all, 27 cases of reciprocal translocations were detected in patients with an abnormal phenotype, and after array CGH analysis, 11 were found to be unbalanced. Thus 40% (11 of 27) of patients with a “chromosomal phenotype” and an apparently balanced translocation were in fact unbalanced, and 18% (5 of 27) of the reciprocal translocations were instead complex rearrangements with >3 breakpoints. Fourteen fetuses with de novo, apparently balanced translocations, all but two with normal ultrasound findings, were also analysed and all were found to be normal using array CGH. Thirteen CCRs were detected in patients with abnormal phenotypes, two in women who had experienced repeated spontaneous abortions and three in fetuses. Sixteen patients were found to have unbalanced mutations, with up to 4 deletions. These results suggest that genome‐wide array CGH may be advisable in all carriers of “balanced” CCRs. The parental origin of the deletions was investigated in 5 reciprocal translocations and 11 CCRs; all were found to be paternal. Using customised platforms in seven cases of CCRs, the deletion breakpoints were narrowed down to regions of a few hundred base pairs in length. No susceptibility motifs were associated with the imbalances. These results show that the phenotypic abnormalities of apparently balanced de novo CCRs are mainly due to cryptic deletions and that spermatogenesis is more prone to generate multiple chaotic chromosome imbalances and reciprocal translocations than oogenesis. PMID:17766364

Altered auditory processing and effective connectivity in 22q11.2 deletion syndrome.

PubMed

Larsen, Kit Melissa; Mørup, Morten; Birknow, Michelle Rosgaard; Fischer, Elvira; Hulme, Oliver; Vangkilde, Anders; Schmock, Henriette; Baaré, William Frans Christiaan; Didriksen, Michael; Olsen, Line; Werge, Thomas; Siebner, Hartwig R; Garrido, Marta I

2018-01-30

22q11.2 deletion syndrome (22q11.2DS) is one of the most common copy number variants and confers a markedly increased risk for schizophrenia. As such, 22q11.2DS is a homogeneous genetic liability model which enables studies to delineate functional abnormalities that may precede disease onset. Mismatch negativity (MMN), a brain marker of change detection, is reduced in people with schizophrenia compared to healthy controls. Using dynamic causal modelling (DCM), previous studies showed that top-down effective connectivity linking the frontal and temporal cortex is reduced in schizophrenia relative to healthy controls in MMN tasks. In the search for early risk-markers for schizophrenia we investigated the neural basis of change detection in a group with 22q11.2DS. We recorded high-density EEG from 19 young non-psychotic 22q11.2 deletion carriers, as well as from 27 healthy non-carriers with comparable age distribution and sex ratio, while they listened to a sequence of sounds arranged in a roving oddball paradigm. Despite finding no significant reduction in the MMN responses, whole-scalp spatiotemporal analysis of responses to the tones revealed a greater fronto-temporal N1 component in the 22q11.2 deletion carriers. DCM showed reduced intrinsic connection within right primary auditory cortex as well as in the top-down, connection from the right inferior frontal gyrus to right superior temporal gyrus for 22q11.2 deletion carriers although not surviving correction for multiple comparison. We discuss these findings in terms of reduced adaptation and a general increased sensitivity to tones in 22q11.2DS. Copyright © 2018. Published by Elsevier B.V.

Angelman syndrome assessed by neurological and molecular cytogenetic investigations.

PubMed

Hou, J W; Wang, P J; Wang, T R

1997-01-01

Angelman syndrome (AS) is characterized by severe psychomotor retardation, speech impairment, happy disposition with bursts of laughter, ataxia, convulsions, and some distinct physical anomalies. Correct diagnosis of AS is important because of its clinical implications, and once the disease is confirmed, familial genetic counseling becomes crucial. We evaluated 22 patients with a putative diagnosis of AS by both clinical and molecular cytogenetic analysis. A deletion of the region 15q11-13 could be identified cytogenetically in 11 cases by high-resolution technique (group I). Four additional cases were confirmed by fluorescence in situ hybridization (FISH) study with D15S11, SNRPN, D15S10, and GABRB 3 [Prader-Willi syndrome (PWS)/AS region probes] (group II). The common deletion of GABRB 3 was documented in those AS cases (n = 15) by FISH. The other 7 cases exhibited no deletion over 15q11-13 at either the cytogenetic or molecular level (group III). We compared the following associated neurological disorders: convulsions and abnormal EEG, microcephaly, sleep and behavior problems, brain anomalies proved by image studies, sexual precocity with pineal tumor among the three groups, as well as other clinical conditions including congenital heart disease, obesity, scoliosis, and hypopigmentation. In the present study, the differences in neurological and facial characteristics were not distinct among these groups. However, the associated conditions were more frequently observed in the patients with deletion than in those without deletion. The EEG features of AS appear to be less sufficient in helping identify patients at an early age before the clinical features become obvious. Therefore, a region involved in the major As phenotypes may contain only one or more tightly contiguous genes around the GABRB 3 locus, which may explain the clinical heterogeneity in AS.

Development and Characterization of a High Throughput Screen to investigate the delayed Effects of Radiations Commonly Encountered in Space

NASA Astrophysics Data System (ADS)

Morgan, W. F.

Astronauts based on the space station or on long-term space missions will be exposed to high Z radiations in the cosmic environment In order to evaluate the potentially deleterious effects of exposure to radiations commonly encountered in space we have developed and characterized a high throughput assay to detect mutation deletion events and or hyperrecombination in the progeny of exposed cells This assay is based on a plasmid vector containing a green fluorescence protein reporter construct We have shown that after stable transfection of the vector into human or hamster cells this construct can identify mutations specifically base changes and deletions as well as recombination events e g gene conversion or homologous recombination occurring as a result of exposure to ionizing radiation Our focus has been on those events occurring in the progeny of an irradiated cell that are potentially associated with radiation induced genomic instability rather than the more conventional assays that evaluate the direct immediate effects of radiation exposure Considerable time has been spent automating analysis of surviving colonies as a function of time after irradiation in order to determine when delayed instability is induced and the consequences of this delayed instability The assay is now automated permitting the evaluation of potentially rare events associated with low dose low dose rate radiations commonly encountered in space

Testicular expressed genes are missing in familial X-Linked Kallmann syndrome due to two large different deletions in daughter's X chromosomes.

PubMed

Hershkovitz, Eli; Loewenthal, Neta; Peretz, Asaf; Parvari, Ruti

2008-01-01

X-linked Kallmann syndrome (KS) is caused mainly by point mutations, in the KAL1 gene. Large deletions >1 Mb are rare events in the human population and commonly result in contiguous gene syndromes. A search for the mutation causing KS carried out on two pairs of first-degree cousins of 2 sisters. Two different apparently independent deletions were found. The deleted sequences encompass the KAL1 gene and four known additional genes exclusively expressed in testis. Two of these genes belong to the FAM9 gene family, which shares some homology with the SCYP3 gene, previously implicated in azoospermia. One of the events causing the deletion may have been mediated by an L1 transposition, the other by a non-homologous end joining. Such non-homologous recombinations have not yet been reported in the KAL genomic region and thus this area may be more prone to deletions than previously expected. This is the first report on genetic characterization of KS with a deletion of solely testis-expressed genes. The absence of these genes may have unfavorable implications for the patients regarding future fertility. (c) 2008 S. Karger AG, Basel

Sequence family variant loss from the AZFc interval of the human Y chromosome, but not gene copy loss, is strongly associated with male infertility

PubMed Central

Machev, N; Saut, N; Longepied, G; Terriou, P; Navarro, A; Levy, N; Guichaoua, M; Metzler-Guillemai..., C; Collignon, P; Frances, A; Belougne, J; Clemente, E; Chiaroni, J; Chevillard, C; Durand, C; Ducourneau, A; Pech, N; McElreavey, K; Mattei, M; Mitchell, M

2004-01-01

Background: Complete deletion of the complete AZFc interval of the Y chromosome is the most common known genetic cause of human male infertility. Two partial AZFc deletions (gr/gr and b1/b3) that remove some copies of all AZFc genes have recently been identified in infertile and fertile populations, and an association study indicates that the resulting gene dose reduction represents a risk factor for spermatogenic failure. Methods: To determine the incidence of various partial AZFc deletions and their effect on fertility, we combined quantitative and qualitative analyses of the AZFc interval at the DAZ and CDY1 loci in 300 infertile men and 399 control men. Results: We detected 34 partial AZFc deletions (32 gr/gr deletions), arising from at least 19 independent deletion events, and found gr/gr deletion in 6% of infertile and 3.5% of control men (p>0.05). Our data provide evidence for two large AZFc inversion polymorphisms, and for relative hot and cold spots of unequal crossing over within the blocks of homology that mediate gr/gr deletion. Using SFVs (sequence family variants), we discriminate DAZ1/2, DAZ3/4, CDY1a (proximal), and CDY1b (distal) and define four types of DAZ-CDY1 gr/gr deletion. Conclusions: The only deletion type to show an association with infertility was DAZ3/4-CDY1a (p = 0.042), suggesting that most gr/gr deletions are neutral variants. We see a stronger association, however, between loss of the CDY1a SFV and infertility (p = 0.002). Thus, loss of this SFV through deletion or gene conversion could be a major risk factor for male infertility. PMID:15520406

NF1 Microdeletion Syndrome: Refined FISH Characterization of Sporadic and Familial Deletions with Locus-Specific Probes

PubMed Central

Riva, Paola; Corrado, Lucia; Natacci, Federica; Castorina, Pierangela; Wu, Bai-Li; Schneider, Gretchen H.; Clementi, Maurizio; Tenconi, Romano; Korf, Bruce R.; Larizza, Lidia

2000-01-01

Summary Two familial and seven sporadic patients with neurofibromatosis 1—who showed dysmorphism, learning disabilities/mental retardation, and additional signs and carried deletions of the NF1 gene—were investigated by use of a two-step FISH approach to characterize the deletions. With FISH of YAC clones belonging to a 7-Mb 17q11.2 contig, we estimated the extension of all of the deletions and identified the genomic regions harboring the breakpoints. Mosaicism accounted for the mild phenotype in two patients. In subsequent FISH experiments, performed with locus-specific probes generated from the same YACs by means of a novel procedure, we identified the smallest region of overlapping (SRO), mapped the deletion breakpoints, and identified the genes that map to each deletion interval. From centromere to telomere, the ∼0.8-Mb SRO includes sequence-tagged site 64381, the SUPT6H gene (encoding a transcription factor involved in chromatin structure), and NF1. Extending telomerically from the SRO, two additional genes—BLMH, encoding a hydrolase involved in bleomycin resistance, and ACCN1, encoding an amiloride-sensitive cation channel expressed in the CNS—were located in the deleted intervals of seven and three patients, respectively. An apparently common centromeric deletion breakpoint was shared by all of the patients, whereas a different telomeric breakpoint defined a deletion interval of 0.8–3 Mb. There was no apparent correlation between the extent of the deletion and the phenotype. This characterization of gross NF1 deletions provides the premise for addressing correctly any genotype-phenotype correlation in the subset of patients with NF1 deletions. PMID:10631140

Pattern of deletions of the dystrophin gene in Mexican Duchenne/Becker muscular dystrophy patients: the use of new designed primers for the analysis of the major deletion "hot spot" region.

PubMed

Coral-Vazquez, R; Arenas, D; Cisneros, B; Peñaloza, L; Salamanca, F; Kofman, S; Mercado, R; Montañez, C

1997-06-13

We have analyzed 59 unrelated Mexican Duchenne/Becker muscular dystrophy patients (DMD/BMD) using PCR analysis of the 2 prone deletion regions in the DMD gene. Thirty one (52%) of the patients had a deletion of one or several of the exons. Most of the alterations (87%) were clustered in exons 44-52, this being the highest percentage reported until now. In order to improve the molecular diagnosis in the Mexican population, we designed a new multiplex assay to PCR amplify exons 44-52. This assay allowed for the identification of a greater number of deletions in this region compared with the 9 and 5-plex assays previously described and to determine most of the deletion end boundaries. This is a reliable alternative for the initial screening of the DMD patients in the Mexican population.

Elucidation of the mechanism of homozygous deletion of 3p12-13 in the U2020 cell line reveals the unexpected involvement of other chromosomes.

PubMed

Heppell-Parton, A C; Nacheva, E; Carter, N P; Bergh, J; Ogilvie, D; Rabbitts, P H

1999-06-01

Homozygous deletions in tumor cells have been useful in the localization and validation of tumor suppressor genes. We have described a homozygous deletion in a lung cancer cell line (U2020) which is located within the most proximal of the three regions on the short arm of chromosome 3 believed to be lost in lung cancer development. Construction of a YAC contig map indicates that the deletion spans around 8 Mb, but no large deletion was apparent on conventional cytogenetic analysis of the cell line. To investigate this paradox, whole chromosome, arm-specific, and regional paints have been used. This analysis has revealed that genetic loss has occurred by complex rearrangements of chromosomes 3, rather than simple interstitial deletion. These studies emphasize the power of molecular cytogenetics to disclose unsuspected tumor-specific translocations within the extremely complex karyotypes characteristic of solid tumors.

Phylogenetic inference under varying proportions of indel-induced alignment gaps

PubMed Central

Dwivedi, Bhakti; Gadagkar, Sudhindra R

2009-01-01

Background The effect of alignment gaps on phylogenetic accuracy has been the subject of numerous studies. In this study, we investigated the relationship between the total number of gapped sites and phylogenetic accuracy, when the gaps were introduced (by means of computer simulation) to reflect indel (insertion/deletion) events during the evolution of DNA sequences. The resulting (true) alignments were subjected to commonly used gap treatment and phylogenetic inference methods. Results (1) In general, there was a strong – almost deterministic – relationship between the amount of gap in the data and the level of phylogenetic accuracy when the alignments were very "gappy", (2) gaps resulting from deletions (as opposed to insertions) contributed more to the inaccuracy of phylogenetic inference, (3) the probabilistic methods (Bayesian, PhyML & "MLε, " a method implemented in DNAML in PHYLIP) performed better at most levels of gap percentage when compared to parsimony (MP) and distance (NJ) methods, with Bayesian analysis being clearly the best, (4) methods that treat gapped sites as missing data yielded less accurate trees when compared to those that attribute phylogenetic signal to the gapped sites (by coding them as binary character data – presence/absence, or as in the MLε method), and (5) in general, the accuracy of phylogenetic inference depended upon the amount of available data when the gaps resulted from mainly deletion events, and the amount of missing data when insertion events were equally likely to have caused the alignment gaps. Conclusion When gaps in an alignment are a consequence of indel events in the evolution of the sequences, the accuracy of phylogenetic analysis is likely to improve if: (1) alignment gaps are categorized as arising from insertion events or deletion events and then treated separately in the analysis, (2) the evolutionary signal provided by indels is harnessed in the phylogenetic analysis, and (3) methods that utilize the phylogenetic signal in indels are developed for distance methods too. When the true homology is known and the amount of gaps is 20 percent of the alignment length or less, the methods used in this study are likely to yield trees with 90–100 percent accuracy. PMID:19698168

Impact of the Bim Deletion Polymorphism on Survival Among Patients With Completely Resected Non-Small-Cell Lung Carcinoma.

PubMed

Atsumi, Jun; Shimizu, Kimihiro; Ohtaki, Yoichi; Kaira, Kyoichi; Kakegawa, Seiichi; Nagashima, Toshiteru; Enokida, Yasuaki; Nakazawa, Seshiru; Obayashi, Kai; Takase, Yoshiaki; Kawashima, Osamu; Kamiyoshihara, Mitsuhiro; Sugano, Masayuki; Ibe, Takashi; Igai, Hitoshi; Takeyoshi, Izumi

2016-02-01

A deletion polymorphism of the Bim gene has been reported to be a prognostic factor for patients with non-small-cell lung cancer (NSCLC) treated with epidermal growth factor receptor-tyrosine kinase inhibitors in the Asian population. We investigated the impact of the Bim deletion polymorphism on survival among patients with completely resected NSCLC. The Bim polymorphism was detected by polymerase chain reaction analysis. We measured overall survival (OS) and recurrence-free survival rates in 411 patients and postrecurrence survival (PRS) in 94 patients who experienced recurrence and received additional anticancer therapy. The Bim deletion polymorphism was detected in 61 patients (14.8%). OS rates were significantly lower for patients with the Bim deletion polymorphism than for those with the wild-type sequence. On multivariable analysis, the Bim deletion polymorphism was identified as an independent prognostic factor for OS (hazard ratio, 1.98; 95% CI, 1.17 to 3.36; P = .011). Among the 94 patients who experienced recurrence and were treated with anticancer therapy, patients with the Bim deletion polymorphism showed significantly poorer PRS than those with the wild-type sequence (median, 9.8 months v 26.9 months, respectively; P < .001). Multivariable analysis revealed that the Bim deletion polymorphism was an independent predictor of PRS (hazard ratio, 3.36; 95% CI, 1.75 to 6.47; P < .001). This trend remained apparent in subgroup analyses stratified by EGFR status, histology, and therapeutic modality. The Bim deletion polymorphism is a novel indicator of shortened PRS among patients with recurrent NSCLC treated with anticancer therapy in the Asian population.

Diagnosis of a terminal deletion of 4p with duplication of Xp22.31 in a patient with findings of Opitz G/BBB syndrome and Wolf-Hirschhorn syndrome.

PubMed

So, Joyce; Müller, Ines; Kunath, Melanie; Herrmann, Susanne; Ullmann, Reinhard; Schweiger, Susann

2008-01-01

Opitz G/BBB syndrome (OS) is a congenital midline malformation syndrome characterized by hypertelorism, hypospadias, cleft lip/palate, laryngotracheoesophageal abnormalities, imperforate anus, developmental delay and cardiac defects. The X-linked form is caused by mutations in the MID1 gene, while no gene has yet been identified for the autosomal dominant form. Here, we report on a 15-year-old boy who was referred for MID1 mutation analysis with findings typical of OS, including apparent hypertelorism, hypospadias, a history of feeding difficulties, dysphagia secondary to esophageal arteria lusoria, growth retardation and developmental delay. No MID1 mutation was found, but subsequent sub-megabase resolution array CGH unexpectedly documented a 2.34 Mb terminal 4p deletion, suggesting a diagnosis of WHS, and a duplication in Xp22.31. Wolf-Hirschhorn syndrome (WHS) is a contiguous gene deletion syndrome involving terminal chromosome 4p deletions, in particular 4p16.3. WHS is characterized by typical facial appearance ("Greek helmet facies"), mental retardation, congenital hypotonia, and growth retardation. While the severity of developmental delay in this patient supports the diagnosis of WHS rather than OS, this case illustrates the striking similarities of clinical findings in seemingly unrelated syndromes, suggesting common or interacting pathways at the molecular and pathogenetic level. This is the first report of arteria lusoria (esophageal vascular ring) in a patient with WHS. (c) 2007 Wiley-Liss, Inc.

Identification of an essential virulence gene of cyprinid herpesvirus 3.

PubMed

Boutier, Maxime; Gao, Yuan; Vancsok, Catherine; Suárez, Nicolás M; Davison, Andrew J; Vanderplasschen, Alain

2017-09-01

The genus Cyprinivirus consists of a growing list of phylogenetically related viruses, some of which cause severe economic losses to the aquaculture industry. The archetypal member, cyprinid herpesvirus 3 (CyHV-3) causes mass mortalities worldwide in koi and common carp. A CyHV-3 mutant was described previously that is attenuated in vivo by a deletion affecting two genes (ORF56 and ORF57). The relative contributions of ORF56 and ORF57 to the safety and efficacy profile of this vaccine candidate have now been assessed by analysing viruses individually deleted for ORF56 or ORF57. Inoculation of these viruses into carp demonstrated that the absence of ORF56 did not affect virulence, whereas the absence of ORF57 led to an attenuation comparable to, though slightly less than, that of the doubly deleted virus. To demonstrate further the role of ORF57 as a key virulence factor, a mutant retaining the ORF57 region but unable to express the ORF57 protein was produced by inserting multiple in-frame stop codons into the coding region. Analysis of this virus in vivo revealed a safety and efficacy profile comparable to that of the doubly deleted virus. These findings show that ORF57 encodes an essential CyHV-3 virulence factor. They also indicate that ORF57 orthologues in other cypriniviruses may offer promising targets for the rational design of attenuated recombinant vaccines. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.

PRIMED: PRIMEr Database for Deleting and Tagging All Fission and Budding Yeast Genes Developed Using the Open-Source Genome Retrieval Script (GRS)

PubMed Central

Cummings, Michael T.; Joh, Richard I.; Motamedi, Mo

2015-01-01

The fission (Schizosaccharomyces pombe) and budding (Saccharomyces cerevisiae) yeasts have served as excellent models for many seminal discoveries in eukaryotic biology. In these organisms, genes are deleted or tagged easily by transforming cells with PCR-generated DNA inserts, flanked by short (50-100bp) regions of gene homology. These PCR reactions use especially designed long primers, which, in addition to the priming sites, carry homology for gene targeting. Primer design follows a fixed method but is tedious and time-consuming especially when done for a large number of genes. To automate this process, we developed the Python-based Genome Retrieval Script (GRS), an easily customizable open-source script for genome analysis. Using GRS, we created PRIMED, the complete PRIMEr D atabase for deleting and C-terminal tagging genes in the main S. pombe and five of the most commonly used S. cerevisiae strains. Because of the importance of noncoding RNAs (ncRNAs) in many biological processes, we also included the deletion primer set for these features in each genome. PRIMED are accurate and comprehensive and are provided as downloadable Excel files, removing the need for future primer design, especially for large-scale functional analyses. Furthermore, the open-source GRS can be used broadly to retrieve genome information from custom or other annotated genomes, thus providing a suitable platform for building other genomic tools by the yeast or other research communities. PMID:25643023

Genotype-Phenotype Analysis, Neuropsychological Assessment, and Growth Hormone Response in a Patient with 18p Deletion Syndrome.

PubMed

Sun, Huihui; Wan, Naijun; Wang, Xinli; Chang, Liang; Cheng, Dazhi

2018-01-01

18p deletion syndrome is a rare chromosomal disease caused by deletion of the short arm of chromosome 18. By using cytogenetic and SNP array analysis, we identified a girl with 18p deletion syndrome exhibiting craniofacial anomalies, intellectual disability, and short stature. G-banding analysis of metaphase cells revealed an abnormal karyotype 46,XX,del(18)(p10). Further, SNP array detected a 15.3-Mb deletion at 18p11.21p11.32 (chr18:12842-15375878) including 61 OMIM genes. Genotype-phenotype correlation analysis showed that clinical manifestations of the patient were correlated with LAMA1, TWSG1, and GNAL deletions. Her neuropsychological assessment test demonstrated delay in most cognitive functions including impaired mathematics, linguistic skills, visual motor perception, respond speed, and executive function. Meanwhile, her integrated visual and auditory continuous performance test (IVA-CPT) indicated a severe comprehensive attention deficit. At age 7 and 1/12 years, her height was 110.8 cm (-2.5 SD height for age). Growth hormone (GH) treatment was initiated. After 27 months treatment, her height was increased to 129.6 cm (-1.0 SD height for age) at 9 and 4/12 years, indicating an effective response to GH treatment. © 2018 S. Karger AG, Basel.

Whole genome sequencing and integrative genomic analysis approach on two 22q11.2 deletion syndrome family trios for genotype to phenotype correlations

PubMed Central

Chung, Jonathan H.; Cai, Jinlu; Suskin, Barrie G.; Zhang, Zhengdong; Coleman, Karlene

2015-01-01

The 22q11.2 deletion syndrome (22q11DS) affects 1:4000 live births and presents with highly variable phenotype expressivity. In this study, we developed an analytical approach utilizing whole genome sequencing and integrative analysis to discover genetic modifiers. Our pipeline combined available tools in order to prioritize rare, predicted deleterious, coding and non-coding single nucleotide variants (SNVs) and insertion/deletions (INDELs) from whole genome sequencing (WGS). We sequenced two unrelated probands with 22q11DS, with contrasting clinical findings, and their unaffected parents. Proband P1 had cognitive impairment, psychotic episodes, anxiety, and tetralogy of Fallot (TOF); while proband P2 had juvenile rheumatoid arthritis but no other major clinical findings. In P1, we identified common variants in COMT and PRODH on 22q11.2 as well as rare potentially deleterious DNA variants in other behavioral/neurocognitive genes. We also identified a de novo SNV in ADNP2 (NM_014913.3:c.2243G>C), encoding a neuroprotective protein that may be involved in behavioral disorders. In P2, we identified a novel non-synonymous SNV in ZFPM2 (NM_012082.3:c.1576C>T), a known causative gene for TOF, which may act as a protective variant downstream of TBX1, haploinsufficiency of which is responsible for congenital heart disease in individuals with 22q11DS. PMID:25981510

Integrated analysis of chromosome copy number variation and gene expression in cervical carcinoma

PubMed Central

Yan, Deng; Yi, Song; Chiu, Wang Chi; Qin, Liu Gui; Kin, Wong Hoi; Kwok Hung, Chung Tony; Linxiao, Han; Wai, Choy Kwong; Yi, Sui; Tao, Yang; Tao, Tang

2017-01-01

Objective This study was conducted to explore chromosomal copy number variations (CNV) and transcript expression and to examine pathways in cervical pathogenesis using genome-wide high resolution microarrays. Methods Genome-wide chromosomal CNVs were investigated in 6 cervical cancer cell lines by Human Genome CGH Microarray Kit (4x44K). Gene expression profiles in cervical cancer cell lines, primary cervical carcinoma and normal cervical epithelium tissues were also studied using the Whole Human Genome Microarray Kit (4x44K). Results Fifty common chromosomal CNVs were identified in the cervical cancer cell lines. Correlation analysis revealed that gene up-regulation or down-regulation is significantly correlated with genomic amplification (P=0.009) or deletion (P=0.006) events. Expression profiles were identified through cluster analysis. Gene annotation analysis pinpointed cell cycle pathways was significantly (P=1.15E-08) affected in cervical cancer. Common CNVs were associated with cervical cancer. Conclusion Chromosomal CNVs may contribute to their transcript expression in cervical cancer. PMID:29312578

Integrated analysis of chromosome copy number variation and gene expression in cervical carcinoma.

PubMed

Yan, Deng; Yi, Song; Chiu, Wang Chi; Qin, Liu Gui; Kin, Wong Hoi; Kwok Hung, Chung Tony; Linxiao, Han; Wai, Choy Kwong; Yi, Sui; Tao, Yang; Tao, Tang

2017-12-12

This study was conducted to explore chromosomal copy number variations (CNV) and transcript expression and to examine pathways in cervical pathogenesis using genome-wide high resolution microarrays. Genome-wide chromosomal CNVs were investigated in 6 cervical cancer cell lines by Human Genome CGH Microarray Kit (4x44K). Gene expression profiles in cervical cancer cell lines, primary cervical carcinoma and normal cervical epithelium tissues were also studied using the Whole Human Genome Microarray Kit (4x44K). Fifty common chromosomal CNVs were identified in the cervical cancer cell lines. Correlation analysis revealed that gene up-regulation or down-regulation is significantly correlated with genomic amplification ( P =0.009) or deletion ( P =0.006) events. Expression profiles were identified through cluster analysis. Gene annotation analysis pinpointed cell cycle pathways was significantly ( P =1.15E-08) affected in cervical cancer. Common CNVs were associated with cervical cancer. Chromosomal CNVs may contribute to their transcript expression in cervical cancer.

Characterization of a hypoallergenic wheat line lacking ω-5 gliadin.

PubMed

Kohno, Kunie; Takahashi, Hitoshi; Endo, Takashi R; Matsuo, Hiroaki; Shiwaku, Kuninori; Morita, Eishin

2016-10-01

There is no curative treatment for wheat-dependent exercise-induced anaphylaxis (WDEIA). ω-5 Gliadin is one of the dominant allergens affecting WDEIA patients. The use of ω-5 gliadin-free wheat flour in the regular diet is considered one of the prophylactic approaches against the elicitation of allergic symptoms and sensitization to ω-5 gliadin. We sought to find hypoallergenic bread wheat (or common wheat) that lacked the genes encoding ω-5 gliadin and to evaluate its in vitro allergenicity. We also aimed to evaluate the sensitization ability of one of the selected hypoallergenic wheat lines by using a possible animal model of wheat allergy. We screened the deletion lines of bread wheat by western blotting to ascertain common wheat lines lacking the ω-5 gliadin locus. The deletion lines we used have partial deficiency of chromosome 1B (Endo and Gill, 1996). To assess sensitization ability of gluten from the selected deletion line, guinea pigs were fed with either the gluten from the selected deletion line or commercially available gluten, and allergic score was evaluated after challenging the same gluten preparations. We found that a deletion line 1BS-18 had the least deficiency of chromosome 1B among the deletion stocks lacking the ω-5 gliadin locus. The challenge test using the guinea pigs revealed that the symptoms induced by application of the 1BS-18 gluten were much less than that of commercially available gluten. The deletion line 1BS-18, which lacked the ω-5 gliadin locus, is likely to have a low sensitization capacity in the guinea pig. The use of the wheat products of the 1BS-18 line in daily life may provide a feasible solution for the onset of wheat allergy. Copyright © 2016 Japanese Society of Allergology. Production and hosting by Elsevier B.V. All rights reserved.

Targeted deletion and lipidomic analysis identify epithelial cell COX-2 as a major driver of chemically induced skin cancer.

PubMed

Jiao, Jing; Ishikawa, Tomo-O; Dumlao, Darren S; Norris, Paul C; Magyar, Clara E; Mikulec, Carol; Catapang, Art; Dennis, Edward A; Fischer, Susan M; Herschman, Harvey R

2014-11-01

Pharmacologic and global gene deletion studies demonstrate that cyclooxygenase-2 (PTGS2/COX-2) plays a critical role in DMBA/TPA-induced skin tumor induction. Although many cell types in the tumor microenvironment express COX-2, the cell types in which COX-2 expression is required for tumor promotion are not clearly established. Here, cell type-specific Cox-2 gene deletion reveals a vital role for skin epithelial cell COX-2 expression in DMBA/TPA tumor induction. In contrast, myeloid Cox-2 gene deletion has no effect on DMBA/TPA tumorigenesis. The infrequent, small tumors that develop on mice with an epithelial cell-specific Cox-2 gene deletion have decreased proliferation and increased cell differentiation properties. Blood vessel density is reduced in tumors with an epithelial cell-specific Cox-2 gene deletion, compared with littermate control tumors, suggesting a reciprocal relationship in tumor progression between COX-2-expressing tumor epithelial cells and microenvironment endothelial cells. Lipidomics analysis of skin and tumors from DMBA/TPA-treated mice suggests that the prostaglandins PGE2 and PGF2α are likely candidates for the epithelial cell COX-2-dependent eicosanoids that mediate tumor progression. This study both illustrates the value of cell type-specific gene deletions in understanding the cellular roles of signal-generating pathways in complex microenvironments and emphasizes the benefit of a systems-based lipidomic analysis approach to identify candidate lipid mediators of biologic responses. Cox-2 gene deletion demonstrates that intrinsic COX-2 expression in initiated keratinocytes is a principal driver of skin carcinogenesis; lipidomic analysis identifies likely prostanoid effectors. ©2014 American Association for Cancer Research.

Prevalence of phonological disorders and phonological processes in typical and atypical phonological development.

PubMed

Ceron, Marizete Ilha; Gubiani, Marileda Barichello; Oliveira, Camila Rosa de; Gubiani, Marieli Barichello; Keske-Soares, Márcia

2017-05-08

To determine the occurrence of phonological disorders by age, gender and school type, and analyze the phonological processes observed in typical and atypical phonological development across different age groups. The sample consisted of 866 children aged between 3:0 and 8:11 years, recruited from public and private schools in the city of Santa Maria/RS. A phonological evaluation was performed to analyze the operative phonological processes. 15.26% (n = 132) of the sample presented atypical phonological acquisition (phonological disorders). Phonological impairments were more frequent in public school students across all age groups. Phonological alterations were most frequent between ages 4 -to 6, and more prevalent in males than females in all but the youngest age group. The most common phonological processes in typical phonological acquisition were: cluster reduction; nonlateral liquid deletion in coda; nonlateral liquid substitution in onset; semivocalization of lateral liquids in coda; and unstressed syllable deletion. In children with phonological disorders, the most common phonological processes were: lateral and nonlateral liquid substitution in onset position; nonlateral liquid deletion; fronting of fricatives in onset position; unstressed syllable deletion; semivocalization of nonlateral liquid in coda; and nonlateral liquid deletion in coda position. Phonological processes were highly prevalent in the present sample, and occurred more often in boys than in girls. Information regarding the type and frequency of phonological processes in both typical phonological acquisition and phonological disorders may contribute to early diagnosis and increase the efficiency of treatment planning.

A 660-Kb Deletion with Antagonistic Effects on Fertility and Milk Production Segregates at High Frequency in Nordic Red Cattle: Additional Evidence for the Common Occurrence of Balancing Selection in Livestock

PubMed Central

Kadri, Naveen Kumar; Sahana, Goutam; Charlier, Carole; Iso-Touru, Terhi; Guldbrandtsen, Bernt; Karim, Latifa; Nielsen, Ulrik Sander; Panitz, Frank; Aamand, Gert Pedersen; Schulman, Nina; Georges, Michel; Vilkki, Johanna; Lund, Mogens Sandø; Druet, Tom

2014-01-01

In dairy cattle, the widespread use of artificial insemination has resulted in increased selection intensity, which has led to spectacular increase in productivity. However, cow fertility has concomitantly severely declined. It is generally assumed that this reduction is primarily due to the negative energy balance of high-producing cows at the peak of lactation. We herein describe the fine-mapping of a major fertility QTL in Nordic Red cattle, and identify a 660-kb deletion encompassing four genes as the causative variant. We show that the deletion is a recessive embryonically lethal mutation. This probably results from the loss of RNASEH2B, which is known to cause embryonic death in mice. Despite its dramatic effect on fertility, 13%, 23% and 32% of the animals carry the deletion in Danish, Swedish and Finnish Red Cattle, respectively. To explain this, we searched for favorable effects on other traits and found that the deletion has strong positive effects on milk yield. This study demonstrates that embryonic lethal mutations account for a non-negligible fraction of the decline in fertility of domestic cattle, and that associated positive effects on milk yield may account for part of the negative genetic correlation. Our study adds to the evidence that structural variants contribute to animal phenotypic variation, and that balancing selection might be more common in livestock species than previously appreciated. PMID:24391517

Genomic Alterations in Biliary Atresia Suggests Region of Potential Disease Susceptibility in 2q37.3

PubMed Central

Leyva-Vega, Melissa; Gerfen, Jennifer; Thiel, Brian D.; Jurkiewicz, Dorota; Rand, Elizabeth B.; Pawlowska, Joanna; Kaminska, Diana; Russo, Pierre; Gai, Xiaowu; Krantz, Ian D.; Kamath, Binita M.; Hakonarson, Hakon; Haber, Barbara A.; Spinner, Nancy B.

2010-01-01

Biliary atresia (BA) is a progressive, idiopathic obliteration of the extrahepatic biliary system occurring exclusively in the neonatal period. It is the most common disease leading to liver transplantation in children. The etiology of BA is unknown, although infectious, immune and genetic causes have been suggested. While the recurrence of BA in families is not common, there are more than 30 multiplex families reported and an underlying genetic susceptibility has been hypothesized. We screened a cohort of 35 BA patients for genomic alterations that might confer susceptibility to BA. DNA was genotyped on the Illumina Quad550 platform, which analyzes over 550,000 single nucleotide polymorphisms (SNPs) for genomic deletions and duplications. Areas of increased and decreased copy number were compared to those found in control populations. In order to identify regions that could serve as susceptibility factors for BA, we searched for regions that were found in BA patients, but not in controls. We identified two unrelated BA patients with overlapping heterozygous deletions of 2q37.3. Patient 1 had a 1.76 Mb (280 SNP), heterozygous deletion containing thirty genes. Patient 2 had a 5.87 Mb (1,346 SNP) heterozygous deletion containing fifty-five genes. The overlapping 1.76 Mb deletion on chromosome 2q37.3 from 240,936,900 to 242,692,820 constitutes the critical region and the genes within this region could be candidates for susceptibility to BA. PMID:20358598

Pathological mechanisms underlying single large‐scale mitochondrial DNA deletions

PubMed Central

Rocha, Mariana C.; Rosa, Hannah S.; Grady, John P.; Blakely, Emma L.; He, Langping; Romain, Nadine; Haller, Ronald G.; Newman, Jane; McFarland, Robert; Ng, Yi Shiau; Gorman, Grainne S.; Schaefer, Andrew M.; Tuppen, Helen A.; Taylor, Robert W.

2018-01-01

Objective Single, large‐scale deletions in mitochondrial DNA (mtDNA) are a common cause of mitochondrial disease. This study aimed to investigate the relationship between the genetic defect and molecular phenotype to improve understanding of pathogenic mechanisms associated with single, large‐scale mtDNA deletions in skeletal muscle. Methods We investigated 23 muscle biopsies taken from adult patients (6 males/17 females with a mean age of 43 years) with characterized single, large‐scale mtDNA deletions. Mitochondrial respiratory chain deficiency in skeletal muscle biopsies was quantified by immunoreactivity levels for complex I and complex IV proteins. Single muscle fibers with varying degrees of deficiency were selected from 6 patient biopsies for determination of mtDNA deletion level and copy number by quantitative polymerase chain reaction. Results We have defined 3 “classes” of single, large‐scale deletion with distinct patterns of mitochondrial deficiency, determined by the size and location of the deletion. Single fiber analyses showed that fibers with greater respiratory chain deficiency harbored higher levels of mtDNA deletion with an increase in total mtDNA copy number. For the first time, we have demonstrated that threshold levels for complex I and complex IV deficiency differ based on deletion class. Interpretation Combining genetic and immunofluorescent assays, we conclude that thresholds for complex I and complex IV deficiency are modulated by the deletion of complex‐specific protein‐encoding genes. Furthermore, removal of mt‐tRNA genes impacts specific complexes only at high deletion levels, when complex‐specific protein‐encoding genes remain. These novel findings provide valuable insight into the pathogenic mechanisms associated with these mutations. Ann Neurol 2018;83:115–130 PMID:29283441

A heterozygous 21-bp deletion in CAPN3 causes dominantly inherited limb girdle muscular dystrophy.

PubMed

Vissing, John; Barresi, Rita; Witting, Nanna; Van Ghelue, Marijke; Gammelgaard, Lise; Bindoff, Laurence A; Straub, Volker; Lochmüller, Hanns; Hudson, Judith; Wahl, Christoph M; Arnardottir, Snjolaug; Dahlbom, Kathe; Jonsrud, Christoffer; Duno, Morten

2016-08-01

Limb girdle muscular dystrophy type 2A is the most common limb girdle muscular dystrophy form worldwide. Although strict recessive inheritance is assumed, patients carrying a single mutation in the calpain 3 gene (CAPN3) are reported. Such findings are commonly attributed to incomplete mutation screening. In this investigation, we report 37 individuals (age range: 21-85 years, 21 females and 16 males) from 10 families in whom only one mutation in CAPN3 could be identified; a 21-bp, in-frame deletion (c.643_663del21). This mutation co-segregated with evidence of muscle disease and autosomal dominant transmission in several generations. Evidence of muscle disease was indicated by muscle pain, muscle weakness and wasting, significant fat replacement of muscles on imaging, myopathic changes on muscle biopsy and loss of calpain 3 protein on western blotting. Thirty-one of 34 patients had elevated creatine kinase or myoglobin. Muscle weakness was generally milder than observed in limb girdle muscular dystrophy type 2A, but affected the same muscle groups (proximal leg, lumbar paraspinal and medial gastrocnemius muscles). In some cases, the weakness was severely disabling. The 21-bp deletion did not affect mRNA maturation. Calpain 3 expression in muscle, assessed by western blot, was below 15% of normal levels in the nine mutation carriers in whom this could be tested. Haplotype analysis in four families from three different countries suggests that the 21-bp deletion is a founder mutation. This study provides strong evidence that heterozygosity for the c.643_663del21 deletion in CAPN3 results in a dominantly inherited muscle disease. The normal expression of mutated mRNA and the severe loss of calpain 3 on western blotting, suggest a dominant negative effect with a loss-of-function mechanism affecting the calpain 3 homodimer. This renders patients deficient in calpain 3 as in limb girdle muscular dystrophy type 2A, albeit in a milder form in most cases. Based on findings in 10 families, our study indicates that a dominantly inherited pattern of calpainopathy exists, and should be considered in the diagnostic work-up and genetic counselling of patients with calpainopathy and single-allele aberrations in CAPN3. © The Author (2016). Published by Oxford University Press on behalf of the Guarantors of Brain. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Thalassaemia screening among students in a secondary school in Ampang, Malaysia.

PubMed

Jameela, S; Sabirah, S O Sharifah; Babam, J; Phan, C L; Visalachy, P; Chang, K M; Salwana, M A; Zuraidah, A; Subramanian, Y; Rahimah, A

2011-12-01

Thalassaemia is a common disorder in Malaysia. It is estimated that 4.5% of the population are carriers for beta- or alpha- thalassaemias. We set out to screen Form 4 students aged between 15 and 16 years old in a national school, for thalassaemia in March 2008. Written consent was obtained from 310 students. The carrier rate for the common thalassaemia syndromes was 6.8% (2.9% for beta-thalassaemia, 2.6% for HbE and 1.3% for two-gene deletion for alpha-thalassaemia). Carriers for beta-thalassaemia and two-gene deletion for alpha-thalassaemia were more common in the Chinese (4.3% and 1.4% respectively) while heterozygous HbE was more common in the Malays (3.8%). The laboratory cost of screening one student was RM 45 and the total number of man-hours spent in this screening activity was 600. This screening exercise showed that thalassaemia carriers are common among the Chinese and Malays and it is feasible to carry out a screening programme for secondary school students.

Radiation-induced total-deletion mutations in the human hprt gene: a biophysical model based on random walk interphase chromatin geometry

NASA Technical Reports Server (NTRS)

Wu, H.; Sachs, R. K.; Yang, T. C.

1998-01-01

PURPOSE: To develop a biophysical model that explains the sizes of radiation-induced hprt deletions. METHODS: Key assumptions: (1) Deletions are produced by two DSB that are closer than an interaction distance at the time of DSB induction; (2) Interphase chromatin is modelled by a biphasic random walk distribution; and (3) Misrejoining of DSB from two separate tracks dominates at low-LET and misrejoining of DSB from a single track dominates at high-LET. RESULTS: The size spectra for radiation-induced total deletions of the hprt gene are calculated. Comparing with the results of Yamada and coworkers for gamma-irradiated human fibroblasts the study finds that an interaction distance of 0.75 microm will fit both the absolute frequency and the size spectrum of the total deletions. It is also shown that high-LET radiations produce, relatively, more total deletions of sizes below 0.5 Mb. The model predicts an essential gene to be located between 2 and 3 Mb from the hprt locus towards the centromere. Using the same assumptions and parameters as for evaluating mutation frequencies, a frequency of intra-arm chromosome deletions is calculated that is in agreement with experimental data. CONCLUSIONS: Radiation-induced total-deletion mutations of the human hprt gene and intrachange chromosome aberrations share a common mechanism for their induction.

Two patients with chromosome 22q11.2 deletion presenting with childhood obesity and hyperphagia.

PubMed

Bassett, J K; Chandler, K E; Douzgou, S

2016-08-01

Chromosome 22q11.2 deletion syndrome is a clinically heterogeneous condition of intellectual disability, parathyroid and thyroid hypoplasia, palatal abnormalities, cardiac malformations and psychiatric symptoms. Hyperphagia and childhood obesity is widely reported in Prader-Willi Syndrome (PWS) but there is only one previous report of this presentation in chromosome 22q11.2 deletion syndrome. We describe two further cases of chromosome 22q11.2 deletion syndrome in which hyperphagia and childhood obesity were the presenting features. This may be a manifestation of obsessive behaviour secondary to some of the psychiatric features commonly seen in chromosome 22q11.2 deletion syndrome. Serious complications may result from hyperphagia and childhood obesity therefore early recognition and intervention is crucial. Due to the similar clinical presentation of these two patients to patients with PWS, it is suggested that the hyperphagia seen here should be managed in a similar way to how it is managed in PWS. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

Molecular mapping within the mouse albino-deletion complex.

PubMed Central

Johnson, D K; Hand, R E; Rinchik, E M

1989-01-01

Induced germ-line deletion mutations in the mouse provide a malleable experimental system for in-depth molecular and functional analysis of large segments of the mammalian genome. To obtain an initial bank of molecular probes for the region of mouse chromosome 7 associated with the albino-deletion complex, random anonymous DNA clones, derived from a library constructed from flow-sorted chromosomes, were screened on DNAs from Mus musculus-Mus spretus F1 hybrids carrying large, multilocus, lethal albino deletions. Clones falling within a given deletion interval can easily be recognized because hybridization bands that represent restriction fragment length polymorphisms specific for the mutant (deleted) chromosome inherited from the M. musculus parent will be absent. Among 72 informative clones used as probes, one, which defines the locus D7OR1, mapped within two deletions that are 6-11 centimorgans in length. Submapping of this anonymous clone across a panel of 27 smaller deletions localized D7OR1 distal to a chromosomal subregion important for survival of the preimplantation embryo, proximal to globin [beta-chain (Hbb)], and near the shaker-1 (sh-1) locus. The results of these deletion-mapping experiments were also confirmed by standard three-point linkage analysis. This strategy for selection and rapid mapping of anonymous DNA probes to chromosomal segments corresponding to germ-line deletion mutations should contribute to the generation of more detailed physical and functional maps of genomic regions associated with mutant developmental phenotypes. Images PMID:2813427

Refining the 22q11.2 deletion breakpoints in DiGeorge syndrome by aCGH

PubMed Central

Bittel, D.C.; Yu, S.; Newkirk, H.; Kibiryeva, N.; Holt, S.; Butler, M.G.; Cooley, L.D.

2009-01-01

Hemizygous deletions of the chromosome 22q11.2 region result in the 22q11.2 deletion syndrome also referred to as DiGeorge, Velocardiofacial or Shprintzen syndromes. The phenotype is variable but commonly includes conotruncal cardiac defects, palatal abnormalities, learning and behavioral problems, immune deficiency, and facial anomalies. Four distinct highly homologous blocks of low copy number repeat sequences (LCRs) flank the deletion region. Mispairing of LCRs during meiosis with unequal meiotic exchange is assumed to cause the recurrent and consistent deletions. The proximal LCR is reportedly located at 22q11.2 from 17.037 to 17.083 Mb while the distal LCR is located from 19.835 to 19.880 Mb. Although the chromosome breakpoints are thought to localize to the LCRs, the positions of the breakpoints have been investigated in only a few individuals. Therefore, we used high resolution oligonucleotide-based 244K microarray comparative genomic hybridization (aCGH) to resolve the breakpoints in a cohort of 20 subjects with known 22q11.2 deletions. We also investigated copy number variation (CNV) in the rest of the genome. The 22q11.2 breaks occurred on either side of the LCR in our subjects, although more commonly on the distal side of the reported proximal LCR. The proximal breakpoints in our subjects spanned the region from 17.036 to 17.398 Mb. This region includes the genes DGCR6 (DiGeorge syndrome critical region protein 6) and PRODH (proline dehydrogenase 1), along with three open reading frames that may encode proteins of unknown function. The distal breakpoints spanned the region from 19.788 to 20.122 Mb. This region includes the genes GGT2 (gamma-glutamyltransferase-like protein 2), HIC2 (hypermethylated in cancer 2), and multiple transcripts of unknown function. The genes in these two breakpoint regions are variably hemizygous depending on the location of the breakpoints. Our 20 subjects had 254 CNVs throughout the genome, 94 duplications and 160 deletions, ranging in size from 1 kb to 2.4 Mb. The presence or absence of genes at the breakpoints depending on the size of the deletion plus variation in the rest of the genome due to CNVs likely contribute to the variable phenotype associated with the 22q11.2 deletion or DiGeorge syndrome. PMID:19420922

Integrated Genomic and Epigenomic Analysis of Breast Cancer Brain Metastasis

PubMed Central

Salhia, Bodour; Kiefer, Jeff; Ross, Julianna T. D.; Metapally, Raghu; Martinez, Rae Anne; Johnson, Kyle N.; DiPerna, Danielle M.; Paquette, Kimberly M.; Jung, Sungwon; Nasser, Sara; Wallstrom, Garrick; Tembe, Waibhav; Baker, Angela; Carpten, John; Resau, Jim; Ryken, Timothy; Sibenaller, Zita; Petricoin, Emanuel F.; Liotta, Lance A.; Ramanathan, Ramesh K.; Berens, Michael E.; Tran, Nhan L.

2014-01-01

The brain is a common site of metastatic disease in patients with breast cancer, which has few therapeutic options and dismal outcomes. The purpose of our study was to identify common and rare events that underlie breast cancer brain metastasis. We performed deep genomic profiling, which integrated gene copy number, gene expression and DNA methylation datasets on a collection of breast brain metastases. We identified frequent large chromosomal gains in 1q, 5p, 8q, 11q, and 20q and frequent broad-level deletions involving 8p, 17p, 21p and Xq. Frequently amplified and overexpressed genes included ATAD2, BRAF, DERL1, DNMTRB and NEK2A. The ATM, CRYAB and HSPB2 genes were commonly deleted and underexpressed. Knowledge mining revealed enrichment in cell cycle and G2/M transition pathways, which contained AURKA, AURKB and FOXM1. Using the PAM50 breast cancer intrinsic classifier, Luminal B, Her2+/ER negative, and basal-like tumors were identified as the most commonly represented breast cancer subtypes in our brain metastasis cohort. While overall methylation levels were increased in breast cancer brain metastasis, basal-like brain metastases were associated with significantly lower levels of methylation. Integrating DNA methylation data with gene expression revealed defects in cell migration and adhesion due to hypermethylation and downregulation of PENK, EDN3, and ITGAM. Hypomethylation and upregulation of KRT8 likely affects adhesion and permeability. Genomic and epigenomic profiling of breast brain metastasis has provided insight into the somatic events underlying this disease, which have potential in forming the basis of future therapeutic strategies. PMID:24489661

Molecular and clinical characterization of a patient with a chromosome 4p deletion, Wolf-Hirschhorn syndrome, and congenital glaucoma.

PubMed

Finzi, S; Pinto, C F; Wiggs, J L

2001-03-01

Wolf-Hirschhorn syndrome is a developmental disorder associated with hemizygous deletion of the distal short arm of chromosome 4. We have identified a patient affected with Wolf-Hirschhorn syndrome and early onset glaucoma. Five other patients with Wolf-Hirschhorn syndrome and early onset glaucoma or ocular anomalies associated with early onset glaucoma have been previously described, suggesting that the association with Wolf-Hirschhorn syndrome is not coincidental. The infrequent association of early onset glaucoma suggests that the chromosomal region commonly deleted in Wolf-Hirschhorn patients does not contain genes responsible for early onset glaucoma. In this study, we performed a molecular characterization of the deleted chromosome 4 to determine the extent of the deletion in an attempt to begin to identify the chromosomal region responsible for the associated glaucoma. Using microsatellite repeat markers located on 4p, we determined that the deletion spanned a 60-cM region including the minimal Wolf-Hirschhorn region. The proximal breakpoint occurred between markers D4S3045 and D4S2974. These results support the hypothesis that patients with Wolf-Hirschhorn syndrome and early onset glaucoma may have large deletions of 4p that include a gene(s) that may be responsible for a dominant form of congenital glaucoma.

A Partial E3 Deletion in Replication-Defective Adenoviral Vectors Allows for Stable Expression of Potentially Toxic Transgene Products.

PubMed

Haut, Larissa H; Gill, Amanda L; Kurupati, Raj K; Bian, Ang; Li, Yan; Giles-Davis, Wynetta; Xiang, Zhiquan; Zhou, Xiang Yang; Ertl, Hildegund C J

2016-10-01

Adenovirus (Ad) is used extensively for construction of viral vectors, most commonly with deletion in its E1 and/or E3 genomic regions. Previously, our attempts to insert envelope proteins (Env) of HIV-1 into such vectors based on chimpanzee-derived Ad (AdC) viruses were thwarted. Here, we describe that genetic instability of an E1- and E3-deleted AdC vector of serotype C6 expressing Env of HIV-1 can be overcome by reinsertion of E3 sequences with anti-apoptotic activities. This partial E3 deletion presumably delays premature death of HEK-293 packaging cell lines due to Env-induced cell apoptosis. The same partial E3 deletion also allows for the generation of stable glycoprotein 140 (gp140)- and gp160-expressing Ad vectors based on AdC7, a distinct AdC serotype. Env-expressing AdC vectors containing the partial E3 deletion are genetically stable upon serial cell culture passaging, produce yields comparable to those of other AdC vectors, and induce transgene product-specific antibody responses in mice. A partial E3 deletion thereby allows expansion of the repertoire of transgenes that can be expressed by Ad vectors.

Methods for Mediation Analysis with Missing Data

ERIC Educational Resources Information Center

Zhang, Zhiyong; Wang, Lijuan

2013-01-01

Despite wide applications of both mediation models and missing data techniques, formal discussion of mediation analysis with missing data is still rare. We introduce and compare four approaches to dealing with missing data in mediation analysis including list wise deletion, pairwise deletion, multiple imputation (MI), and a two-stage maximum…

Relationship between Reaction Time, Fine Motor Control, and Visual-Spatial Perception on Vigilance and Visual-Motor Tasks in 22q11.2 Deletion Syndrome

ERIC Educational Resources Information Center

Howley, Sarah A.; Prasad, Sarah E.; Pender, Niall P.; Murphy, Kieran C.

2012-01-01

22q11.2 Deletion Syndrome (22q11DS) is a common microdeletion disorder associated with mild to moderate intellectual disability and specific neurocognitive deficits, particularly in visual-motor and attentional abilities. Currently there is evidence that the visual-motor profile of 22q11DS is not entirely mediated by intellectual disability and…

Performance on the Modified Card Sorting Test and Its Relation to Psychopathology in Adolescents and Young Adults with 22Q11.2 Deletion Syndrome

ERIC Educational Resources Information Center

Rockers, K.; Ousley, O.; Sutton, T.; Schoenberg, E.; Coleman, K.; Walker, E.; Cubells, J. F.

2009-01-01

Background: Approximately one-third of individuals with 22q11.2 deletion syndrome (22q11DS), a common genetic disorder highly associated with intellectual disabilities, may develop schizophrenia, likely preceded by a mild to moderate cognitive decline. Methods: We examined adolescents and young adults with 22q11DS for the presence of executive…

Alu elements mediate large SPG11 gene rearrangements: further spatacsin mutations.

PubMed

Conceição Pereira, Maria; Loureiro, José Leal; Pinto-Basto, Jorge; Brandão, Eva; Margarida Lopes, Ana; Neves, Georgina; Dias, Pureza; Geraldes, Ruth; Martins, Isabel Pavão; Cruz, Vitor Tedim; Kamsteeg, Erik-Jan; Brunner, Han G; Coutinho, Paula; Sequeiros, Jorge; Alonso, Isabel

2012-01-01

Hereditary spastic paraplegias compose a group of neurodegenerative disorders with a large clinical and genetic heterogeneity. Among the autosomal recessive forms, spastic paraplegia type 11 is the most common. To better understand the spastic paraplegia type 11 mutation spectrum, we studied a group of 54 patients with hereditary spastic paraplegia. Mutation screening was performed by PCR amplification of SPG11 coding regions and intron boundaries, followed by sequencing. For the detection of large gene rearrangements, we performed multiplex ligation-dependent probe amplification. We report 13 families with spastic paraplegia type 11 carrying either novel or previously identified mutations. We describe a complex entire SPG11 rearrangement and show that large gene rearrangements are frequent among patients with spastic paraplegia type 11. Moreover, we mapped the deletion breakpoints of three different large SPG11 deletions and provide evidence for Alu microhomology-mediated exon deletion. Our analysis shows that the high number of repeated elements in SPG11 together with the presence of recombination hotspots and the high intrinsic instability of the 15q locus all contribute toward making this genomic region more prone to large gene rearrangements. These findings enlarge the amount of data relating repeated elements with neurodegenerative disorders and highlight their importance in human disease and genome evolution.

Genome-wide copy number variation study associates metabotropic glutamate receptor gene networks with attention deficit hyperactivity disorder

PubMed Central

Elia, Josephine; Glessner, Joseph T; Wang, Kai; Takahashi, Nagahide; Shtir, Corina J; Hadley, Dexter; Sleiman, Patrick M A; Zhang, Haitao; Kim, Cecilia E; Robison, Reid; Lyon, Gholson J; Flory, James H; Bradfield, Jonathan P; Imielinski, Marcin; Hou, Cuiping; Frackelton, Edward C; Chiavacci, Rosetta M; Sakurai, Takeshi; Rabin, Cara; Middleton, Frank A; Thomas, Kelly A; Garris, Maria; Mentch, Frank; Freitag, Christine M; Steinhausen, Hans-Christoph; Todorov, Alexandre A; Reif, Andreas; Rothenberger, Aribert; Franke, Barbara; Mick, Eric O; Roeyers, Herbert; Buitelaar, Jan; Lesch, Klaus-Peter; Banaschewski, Tobias; Ebstein, Richard P; Mulas, Fernando; Oades, Robert D; Sergeant, Joseph; Sonuga-Barke, Edmund; Renner, Tobias J; Romanos, Marcel; Romanos, Jasmin; Warnke, Andreas; Walitza, Susanne; Meyer, Jobst; Pálmason, Haukur; Seitz, Christiane; Loo, Sandra K; Smalley, Susan L; Biederman, Joseph; Kent, Lindsey; Asherson, Philip; Anney, Richard J L; Gaynor, J William; Shaw, Philip; Devoto, Marcella; White, Peter S; Grant, Struan F A; Buxbaum, Joseph D; Rapoport, Judith L; Williams, Nigel M; Nelson, Stanley F; Faraone, Stephen V; Hakonarson, Hakon

2014-01-01

Attention deficit hyperactivity disorder (ADHD) is a common, heritable neuropsychiatric disorder of unknown etiology. We performed a whole-genome copy number variation (CNV) study on 1,013 cases with ADHD and 4,105 healthy children of European ancestry using 550,000 SNPs. We evaluated statistically significant findings in multiple independent cohorts, with a total of 2,493 cases with ADHD and 9,222 controls of European ancestry, using matched platforms. CNVs affecting metabotropic glutamate receptor genes were enriched across all cohorts (P = 2.1 × 10−9). We saw GRM5 (encoding glutamate receptor, metabotropic 5) deletions in ten cases and one control (P = 1.36 × 10−6). We saw GRM7 deletions in six cases, and we saw GRM8 deletions in eight cases and no controls. GRM1 was duplicated in eight cases. We experimentally validated the observed variants using quantitative RT-PCR. A gene network analysis showed that genes interacting with the genes in the GRM family are enriched for CNVs in ~10% of the cases (P = 4.38 × 10−10) after correction for occurrence in the controls. We identified rare recurrent CNVs affecting glutamatergic neurotransmission genes that were overrepresented in multiple ADHD cohorts. PMID:22138692

Analysis of FMR1 deletion in a subpopulation of post-mitotic neurons in mouse cortex and hippocampus.

PubMed

Amiri, Anahita; Sanchez-Ortiz, Efrain; Cho, Woosung; Birnbaum, Shari G; Xu, Jing; McKay, Renée M; Parada, Luis F

2014-02-01

Fragile X syndrome (FXS) is the most common form of inherited mental retardation and the leading cause of autism. FXS is caused by mutation in a single gene, FMR1, which encodes an RNA-binding protein FMRP. FMRP is highly expressed in neurons and is hypothesized to have a role in synaptic structure, function, and plasticity by regulating mRNAs that encode pre- and post-synaptic proteins. Fmr1 knockout (KO) mice have been used as a model to study FXS. These mice have been reported to show a great degree of phenotypic variability based on the genetic background, environmental signals, and experimental methods. In this study, we sought to restrict FMRP deletion to two brain regions that have been implicated in FXS and autism. We show that ablating Fmr1 in differentiated neurons of hippocampus and cortex results in dendritic alterations and changes in synaptic marker intensity that are brain region specific. In our conditional mutant mice, FMRP-deleted neurons have activated AKT-mTOR pathway signaling in hippocampus but display no apparent behavioral phenotypes. These results highlight the importance of identifying additional factors that interact with Fmr1 to develop FXS. © 2013 International Society for Autism Research, Wiley Periodicals, Inc.

Genomic diversity and adaptation of Salmonella enterica serovar Typhimurium from analysis of six genomes of different phage types

PubMed Central

2013-01-01

Background Salmonella enterica serovar Typhimurium (or simply Typhimurium) is the most common serovar in both human infections and farm animals in Australia and many other countries. Typhimurium is a broad host range serovar but has also evolved into host-adapted variants (i.e. isolated from a particular host such as pigeons). Six Typhimurium strains of different phage types (defined by patterns of susceptibility to lysis by a set of bacteriophages) were analysed using Illumina high-throughput genome sequencing. Results Variations between strains were mainly due to single nucleotide polymorphisms (SNPs) with an average of 611 SNPs per strain, ranging from 391 SNPs to 922 SNPs. There were seven insertions/deletions (indels) involving whole or partial gene deletions, four inactivation events due to IS200 insertion and 15 pseudogenes due to early termination. Four of these inactivated or deleted genes may be virulence related. Nine prophage or prophage remnants were identified in the six strains. Gifsy-1, Gifsy-2 and the sopE2 and sspH2 phage remnants were present in all six genomes while Fels-1, Fels-2, ST64B, ST104 and CP4-57 were variably present. Four strains carried the 90-kb plasmid pSLT which contains several known virulence genes. However, two strains were found to lack the plasmid. In addition, one strain had a novel plasmid similar to Typhi strain CT18 plasmid pHCM2. Conclusion The genome data suggest that variations between strains were mainly due to accumulation of SNPs, some of which resulted in gene inactivation. Unique genetic elements that were common between host-adapted phage types were not found. This study advanced our understanding on the evolution and adaptation of Typhimurium at genomic level. PMID:24138507

Microarray and FISH-based genotype-phenotype analysis of 22 Japanese patients with Wolf-Hirschhorn syndrome.

PubMed

Shimizu, Kenji; Wakui, Keiko; Kosho, Tomoki; Okamoto, Nobuhiko; Mizuno, Seiji; Itomi, Kazuya; Hattori, Shigeto; Nishio, Kimio; Samura, Osamu; Kobayashi, Yoshiyuki; Kako, Yuko; Arai, Takashi; Tsutomu, Oh-ishi; Kawame, Hiroshi; Narumi, Yoko; Ohashi, Hirofumi; Fukushima, Yoshimitsu

2014-03-01

Wolf-Hirschhorn syndrome (WHS) is a contiguous gene deletion syndrome of the distal 4p chromosome, characterized by craniofacial features, growth impairment, intellectual disability, and seizures. Although genotype-phenotype correlation studies have previously been published, several important issues remain to be elucidated including seizure severity. We present detailed clinical and molecular-cytogenetic findings from a microarray and fluorescence in situ hybridization (FISH)-based genotype-phenotype analysis of 22 Japanese WHS patients, the first large non-Western series. 4p deletions were terminal in 20 patients and interstitial in two, with deletion sizes ranging from 2.06 to 29.42 Mb. The new Wolf-Hirschhorn syndrome critical region (WHSCR2) was deleted in all cases, and duplication of other chromosomal regions occurred in four. Complex mosaicism was identified in two cases: two different 4p terminal deletions; a simple 4p terminal deletion and an unbalanced translocation with the same 4p breakpoint. Seizures began in infancy in 33% (2/6) of cases with small (<6 Mb) deletions and in 86% (12/14) of cases with larger deletions (>6 Mb). Status epilepticus occurred in 17% (1/6) with small deletions and in 87% (13/15) with larger deletions. Renal hypoplasia or dysplasia and structural ocular anomalies were more prevalent in those with larger deletions. A new susceptible region for seizure occurrence is suggested between 0.76 and 1.3 Mb from 4 pter, encompassing CTBP1 and CPLX1, and distal to the previously-supposed candidate gene LETM1. The usefulness of bromide therapy for seizures and additional clinical features including hypercholesterolemia are also described. © 2013 Wiley Periodicals, Inc.

A deletion mutation in GJB6 cooperating with a GJB2 mutation in trans in non-syndromic deafness: A novel founder mutation in Ashkenazi Jews.

PubMed

Lerer, I; Sagi, M; Ben-Neriah, Z; Wang, T; Levi, H; Abeliovich, D

2001-11-01

A deletion of at least 140 kb starting approximately 35kb upstream (telomeric) to the GJB2 (CX26) gene was identified in 7 patients from 4 unrelated Jewish Ashkenazi families with non-syndromic hearing loss. These patients were heterozygous for one of the common mutations 167delT or 35delG in the GJB2 gene in trans to the deletion. The deletion started at 5' side of the GJB6 (CX30) gene including the first exon and it did not affect the integrity of the GJB2 gene. The deletion mutation segregated together with the hearing loss, and was not found in a control group of 100 Ashkenazi individuals. We suggest that the deletion is a recessive mutation causing hearing loss in individuals that are double heterozygous for the deletion and for a mutation in the GJB2 gene. The effect of the deletion mutation could be due to a digenic mode of inheritance of GJB2 and GJB6 genes that encode two different connexins; connexin 26 and connexin 30, or it may abolish control elements that are important in the expression of the GJB2 gene in the cochlea. Regardless which of the options is valid, it is apparent that the deletion mutation provides a new insight into connexin function in the auditory system. The deletion mutation was on the same haplotypic background in all the families, and therefore is a founder mutation that increases the impact of GJB2 in the etiology of prelingual recessive non-syndromic hearing loss in the Ashkenazi population. Copyright 2001 Wiley-Liss, Inc.

Rapid deletion plasmid construction methods for protoplast and Agrobacterium based fungal transformation systems

USDA-ARS?s Scientific Manuscript database

Increasing availability of genomic data and sophistication of analytical methodology in fungi has elevated the need for functional genomics tools in these organisms. Gene deletion is a critical tool for functional analysis. The targeted deletion of genes requires both a suitable method for the trans...

Molecular cytogenetic analysis of Xq critical regions in premature ovarian failure

PubMed Central

2013-01-01

Background One of the frequent reasons for unsuccessful conception is premature ovarian failure/primary ovarian insufficiency (POF/POI) that is defined as the loss of functional follicles below the age of 40 years. Among the genetic causes the most common one involves the X chromosome, as in Turner syndrome, partial X deletion and X-autosome translocations. Here we report a case of a 27-year-old female patient referred to genetic counselling because of premature ovarian failure. The aim of this case study to perform molecular genetic and cytogenetic analyses in order to identify the exact genetic background of the pathogenic phenotype. Results For premature ovarian failure disease diagnostics we performed the Fragile mental retardation 1 gene analysis using Southern blot technique and Repeat Primed PCR in order to identify the relationship between the Fragile mental retardation 1 gene premutation status and the premature ovarion failure disease. At this early onset, the premature ovarian failure affected patient we detected one normal allele of Fragile mental retardation 1 gene and we couldn’t verify the methylated allele, therefore we performed the cytogenetic analyses using G-banding and fluorescent in situ hybridization methods and a high resolution molecular cytogenetic method, the array comparative genomic hybridization technique. For this patient applying the G-banding, we identified a large deletion on the X chromosome at the critical region (ChrX q21.31-q28) which is associated with the premature ovarian failure phenotype. In order to detect the exact breakpoints, we used a special cytogenetic array ISCA plus CGH array and we verified a 67.355 Mb size loss at the critical region which include total 795 genes. Conclusions We conclude for this case study that the karyotyping is definitely helpful in the evaluation of premature ovarian failure patients, to identify the non submicroscopic chromosomal rearrangement, and using the array CGH technique we can contribute to the most efficient detection and mapping of exact deletion breakpoints of the deleted Xq region. PMID:24359613

Molecular markers and Schistosoma-associated bladder carcinoma: A systematic review and meta-analysis.

PubMed

Koonrungsesomboon, Nut; Wadagni, Anita Carolle; Mbanefo, Evaristus Chibunna

2015-08-01

Molecular mechanisms and pathogenesis of schistosomal-associated bladder cancer (SABC), one of the most common malignancies in Africa and parts of the Middle East, is still unclear. Identification of host molecular markers involved in schistosomal related bladder carcinogenesis is of value in prediction of high-risk group, early detection and timely intervention. PubMed, Scopus, Google Scholar, Cochrane Library and African Journals Online databases were systematically searched and reviewed. A total of 63 articles reporting 41 host molecular factors were included in the meta-analysis. Pooled odds ratio demonstrated associations of p53 expression, telomerase activity and sFas with SABC as compared to other schistosomal patients (p53 expression: OR=9.46, 95%CI=1.14-78.55, p=0.04; telomerase by TERT: OR=37.38, 95%CI=4.17-334.85, p=0.001; telomerase by TRAP: OR=10.36, 95%CI=6.08-17.64, p<0.00001; sFas: OR=34.37, 95%CI=3.32-355.51, p=0.003). In comparison to bladder cancers of other etiology, positive associations were found between SABC and p15 deletion, p16 deletion, telomerase activity and sFas (p15 deletion: OR=4.20, 95%CI=2.58-6.82, p<0.00001; p16 deletion: OR=4.93, 95%CI=2.52-9.65, p<0.00001; telomerase by TERT: OR=3.01, 95%CI=1.51-5.97, p=0.002; telomerase by TRAP: OR=2.66, 95%CI=1.18-6.01, p=0.02; sFas: OR=4.50, 95%CI=1.78-11.40, p=0.001). Other identified associations were reported by few numbers of studies to enable reliable interpretation. Variations in gene expression or genomic alterations of some molecular markers in SABC as compared to non-SABC or other schistosomal patients were identified. These suggest minute differences in the pathogenesis and physiological profile of SABC, in relation to non-SABC. Copyright © 2015 Elsevier Ltd. All rights reserved.

Multiplex Ultrasensitive Genotyping of Patients with Non-Small Cell Lung Cancer for Epidermal Growth Factor Receptor (EGFR) Mutations by Means of Picodroplet Digital PCR.

PubMed

Watanabe, Masaru; Kawaguchi, Tomoya; Isa, Shun-Ichi; Ando, Masahiko; Tamiya, Akihiro; Kubo, Akihito; Saka, Hideo; Takeo, Sadanori; Adachi, Hirofumi; Tagawa, Tsutomu; Kawashima, Osamu; Yamashita, Motohiro; Kataoka, Kazuhiko; Ichinose, Yukito; Takeuchi, Yukiyasu; Watanabe, Katsuya; Matsumura, Akihide; Koh, Yasuhiro

2017-07-01

Epidermal growth factor receptor (EGFR) mutations have been used as the strongest predictor of effectiveness of treatment with EGFR tyrosine kinase inhibitors (TKIs). Three most common EGFR mutations (L858R, exon 19 deletion, and T790M) are known to be major selection markers for EGFR-TKIs therapy. Here, we developed a multiplex picodroplet digital PCR (ddPCR) assay to detect 3 common EGFR mutations in 1 reaction. Serial-dilution experiments with genomic DNA harboring EGFR mutations revealed linear performance, with analytical sensitivity ~0.01% for each mutation. All 33 EGFR-activating mutations detected in formalin-fixed paraffin-embedded (FFPE) tissue samples by the conventional method were also detected by this multiplex assay. Owing to the higher sensitivity, an additional mutation (T790M; including an ultra-low-level mutation, <0.1%) was detected in the same reaction. Regression analysis of the duplex assay and multiplex assay showed a correlation coefficient (R 2 ) of 0.9986 for L858R, 0.9844 for an exon 19 deletion, and 0.9959 for T790M. Using ddPCR, we designed a multiplex ultrasensitive genotyping platform for 3 common EGFR mutations. Results of this proof-of-principle study on clinical samples indicate clinical utility of multiplex ddPCR for screening for multiple EGFR mutations concurrently with an ultra-rare pretreatment mutation (T790M). Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.

[Chromosome study on chronic lymphocytic leukemia using CpG-oligodeoxynucleotide as immunostimulant agent].

PubMed

Wu, Yafang; Xue, Yongquan; Chen, Suning; Yao, Li; Jiang, Hui; Zhang, Jun; Shen, Juan; Pan, Jinlan; Wang, Yong; Bai, Shuxiao

2010-02-01

To investigate whether CpG-oligodeoxynucleotide (CpG-ODN) can improve the detection rate of the karyotypic abnormalities in chronic lymphocytic leukemia (CLL). The bone marrow (BM) or peripheral blood (PB) cells from 57 cases of CLL were collected and cultured with CpG-ODN DSP30+interleukin-2 (IL-2), phytohemagglutinin (PHA), pokeweed (PWM) or IL-2, respectively. Five days later cells were harvested for chromosome preparation. Karyotypic analysis was done using R banding technique. Panel fluorescence in situ hybridization (FISH) was carried out on 19 cases of CLL with normal karyotypes using the following probes: Cen12, D13S25, Rb1, ATM, p53, MYB and IgH. Genomic DNA from 21 cases of them was extracted from BM or PB leukocytes. The immunoglobulin variable heavy chain (IgVH) was amplified by polymerase chain reaction (PCR) and sequenced. CD38 and ZAP70 expressions in the leukemic cells were determined by flow cytometry (FCM). The detection rate of karyotypic abnormalities in the CpG-ODN+IL-2 group (43.85%) was obviously higher than that in the PHA (15.09%), PWM (17.31%) and IL-2 (3.13%) groups (P<0.01). Fifty-two types of karyotypic abnormalities were found. Among them, trisomy12 (+12) or +12 with other abnormalities were the most common, while translocations were the most frequent structural abnormalities including 3 unbalanced and 11 balanced translocations, among them 7 had rearrangements involving 14q32. Thirteen cases showed one or more abnormalities on FISH including trisomy 12 and p53 deletion each in one case, IgH rearrangement and partial deletion each in one case, 13q14.3 deletion in 11 cases of which 5 cases also had Rb1 deletion, 1 case had Rb1 partial deletion. No case with ATM or MYB deletions was found. PCR detected IgVH mutations in 10/21 cases. FCM showed 10/45 cases were CD38 positive, but 35 /45 were CD38 negative, 11/27 cases expressed ZAP70, but 16/27 did not. Among the 26 cases examined for CD38 and ZAP70 expressions simultaneously, 5 cases were CD38+ZAP70+, 13 were CD38-ZAP70-, 6 were CD38-ZAP70+, and 2 were CD38+ZAP70-, respectively. Statistic analysis showed a correlation between complex karyotype and IgVH without mutation, but no association between karyotype and CD38 or ZAP70 expression was observed. CpG-ODN immunostimulation can obviously raise the detection rate of abnormal karyotypes, especially translocations in CLL. FISH is an important complement to conventional karyotypic analysis. The combination of both methods can provide more comprehensive genetic information for CLL.

The Role of the Y-Chromosome in the Establishment of Murine Hybrid Dysgenesis and in the Analysis of the Nucleotide Sequence Organization, Genetic Transmission and Evolution of Repeated Sequences.

NASA Astrophysics Data System (ADS)

Nallaseth, Ferez Soli

The Y-chromosome presents a unique cytogenetic framework for the evolution of nucleotide sequences. Alignment of nine Y-chromosomal fragments in their increasing Y-specific/non Y-specific (male/female) sequence divergence ratios was directly and inversely related to their interspersion on these two respective genomic fractions. Sequence analysis confirmed a direct relationship between divergence ratios and the Alu, LINE-1, Satellite and their derivative oligonucleotide contents. Thus their relocation on the Y-chromosome is followed by sequence divergence rather than the well documented concerted evolution of these non-coding progenitor repeated sequences. Five of the nine Y-chromosomal fragments are non-pseudoautosomal and transcribed into heterogeneous PolyA^+ RNA and thus can be retrotransposed. Evolutionary and computer analysis identified homologous oligonucleotide tracts in several human loci suggesting common and random mechanistic origins. Dysgenic genomes represent the accelerated evolution driving sequence divergence (McClintock, 1984). Sex reversal and sterility characterizing dysgenesis occurs in C57BL/6JY ^{rm Pos} but not in 129/SvY^{rm Pos} derivative strains. High frequency, random, multi-locus deletion products of the feral Y^{ rm Pos}-chromosome are generated in the germlines of F1(C57BL/6J X 129/SvY^{ rm Pos})(male) and C57BL/6JY ^{rm Pos}(male) but not in 129/SvY^{rm Pos}(male). Equal, 10^{-1}, 10^ {-2}, and 0 copies (relative to males) of Y^{rm Pos}-specific deletion products respectively characterize C57BL/6JY ^{rm Pos} (HC), (LC), (T) and (F) females. The testes determining loci of inactive Y^{rm Pos}-chromosomes in C57BL/6JY^{rm Pos} HC females are the preferentially deleted/rearranged Y ^{rm Pos}-sequences. Disruption of regulation of plasma testosterone and hepatic MUP-A mRNA levels, TRD of a 4.7 Kbp EcoR1 fragment suggest disruption of autosomal/X-chromosomal sequences. These data and the highly repeated progenitor (Alu, GATA, LINE-1) sequence content of deletion products confirmed the previously unidentified loss of genetic control of mammalian chromosome biology and hybrid dysgenesis.

Clinical spectrum and molecular diagnosis of Angelman and Prader-Willi syndrome patients with an imprinting mutation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Saitoh, S.; Cassidy, S.B.; Conroy, J.M.

Recent studies have identified a new class of Prader-Willi syndrome (PWS) and Angelman syndrome (AS) patients who have biparental inheritance, but neither the typical deletion nor uniparental disomy (UPD) or translocation. However, these patients have uniparental DNA methylation throughout 15q11-q13, and thus appear to have a mutation in the imprinting process for this region. Here we describe detailed clinical findings of five AS imprinting mutation patients (three families) and two PWS imprinting mutation patients (one new family). All these patients have essentially the classical clinical phenotype for the respective syndrome, except that the incidence of microcephaly is lower in imprintingmore » mutation AS patients than in deletion AS patients. Furthermore, imprinting mutation AS and PWS patients do not typically have hypopigmentation, which is commonly found in patients with the usual large deletion. Molecular diagnosis of these cases is initially achieved by DNA methylation analyses of the DN34/ZNF127, PW71 (D15S63), and SNRPN loci. The latter two probes have clear advantages in the simple molecular diagnostic analysis of PWS and AS patients with an imprinting mutation, as has been found for typical deletion or UPD PWS and AS cases. With the recent finding of inherited microdeletions in PWS and AS imprinting mutation families, our studies define a new class of these two syndromes. The clinical and molecular identification of these PWS and AS patients has important genetic counseling consequences. 49 refs., 4 figs., 3 tabs.« less

Homozygous deletion in TUSC3 causing syndromic intellectual disability: a new patient.

PubMed

Loddo, Sara; Parisi, Valentina; Doccini, Viola; Filippi, Tiziana; Bernardini, Laura; Brovedani, Paola; Ricci, Federica; Novelli, Antonio; Battaglia, Agatino

2013-08-01

Defects in the TUSC3 gene have been identified in individuals with nonsyndromic autosomal recessive intellectual disability (ARID), due to either point mutations or intragenic deletions. We report on a boy with a homozygous microdeletion 8p22, sizing 203 kb, encompassing the first exon of the TUSC3 gene, detected by SNP-array analysis (Human Gene Chip 6.0; Affymetrix). Both nonconsanguineous parents come from a small Sicilian village and were heterozygous carriers of the microdeletion. The propositus had a few dysmorphic features and a moderate cognitive impairment. Verbal communication was impaired, with an inappropriate phonetic inventory, important phono-articolatory distortions, and bucco-phonatory dyspraxia. Comprehension was possible for simple sentences. Behavior was characterized by motor instability, high tendency to irritability and distraibility, anxiety traits, and an oppositional-defiant disorder. His parents were of normal intelligence. TUSC3 is thought to encode a subunit of the endoplasmic reticulum-bound oligosaccharyltranferase complex that catalyzes a pivotal step in the protein N-glycosylation process. TUSC3 has been recently reported as a member of the plasma membrane Mg(2+) transport system, with a possible involvement in learning abilities, working memory and short- and long-term memory. This is the third family in which a deletion has been described. Although the pathogenic mechanism has not been clarified yet, our report argues for a more prominent role of TUSC3 in the etiology of intellectual disability and that deletions encompassing this gene could be more common than expected. Copyright © 2013 Wiley Periodicals, Inc.

Gene-nutrient interaction markedly influences yeast chronological lifespan.

PubMed

Smith, Daniel L; Maharrey, Crystal H; Carey, Christopher R; White, Richard A; Hartman, John L

2016-12-15

Research into the genetic mechanisms of aging has expanded rapidly over the past two decades. This has in part been the result of the use of model organisms (particularly yeast, worms and flies) and high-throughput technologies, combined with a growing interest in aging research. Despite this progress, widespread consensus regarding the pathways that are fundamental to the modulation of cellular aging and lifespan for all organisms has been limited due to discrepancies between different studies. We have compared results from published genome-wide, chronological lifespan (CLS) screens of individual gene deletion strains in Saccharomyces cerevisiae in order to identify gene deletion strains with consistent influences on longevity as possible indicators of fundamental aging processes from this single-celled, eukaryotic model organism. Three previous reports have described genetic modifiers of chronological aging in the budding yeast (S. cerevisiae) using the yeast gene deletion strain collection. We performed a comparison among the data sets using correlation and decile distribution analysis to describe concordance between screens and identify strains that consistently increased or decreased CLS. We used gene enrichment analysis in an effort to understand the biology underlying genes identified in multiple studies. We attempted to replicate the different experimental conditions employed by the screens to identify potential sources of variability in CLS worth further investigating. Among 3209 strains present in all three screens, nine deletions strains were in common in the longest-lived decile (2.80%) and thirteen were in common in the shortest-lived decile (4.05%) of all three screens. Similarly, pairwise overlap between screens was low. When the same comparison was extended to three deciles to include more mutants studied in common between the three screens, enrichment of cellular processes based on gene ontology analysis in the long-lived strains remained very limited. To test the hypothesis that different parental strain auxotrophic requirements or media formulations employed by the respective genome-wide screens might contribute to the lack of concordance, different CLS assay conditions were assessed in combination with strains having different ploidy and auxotrophic requirements (all relevant to differences in the way the three genome-wide CLS screens were performed). This limited but systematic analysis of CLS with respect to auxotrophy, ploidy, and media revealed several instances of gene-nutrient interaction. There is surprisingly little overlap between the results of three independently performed genome-wide screens of CLS in S. cerevisiae. However, differences in strain genetic background (ploidy and specific auxotrophic requirements) were present, as well as different media and experimental conditions (e.g., aeration and pooled vs. individual culturing), which, along with stochastic effects such as genetic drift or selection of secondary mutations that suppress the loss of function from gene deletion, could in theory account for some of the lack of consensus between results. Considering the lack of overlap in CLS phenotypes among the set of genes reported by all three screens, and the results of a CLS experiment that systematically tested (incorporating extensive controls) for interactions between variables existing between the screens, we propose that discrepancies can be reconciled through deeper understanding of the influence of cell intrinsic factors such as auxotrophic requirements ploidy status, extrinsic factors such as media composition and aeration, as well as interactions that may occur between them, for example as a result of different pooling vs. individually aging cultures. Such factors may have a more significant impact on CLS outcomes than previously realized. Future studies that systematically account for these contextual factors, and can thus clarify the interactions between genetic and nutrient factors that alter CLS phenotypes, should aid more complete understanding of the underlying biology so that genetic principles of CLS in yeast can be extrapolated to differential cellular aging observed in animal models. Copyright © 2016 Elsevier Inc. All rights reserved.

Gene-Nutrient Interaction Markedly Influences Yeast Chronological Lifespan

PubMed Central

Smith, Daniel L.; Maharrey, Crystal H.; Carey, Christopher R.; White, Richard A.; Hartman, John L.

2016-01-01

Purpose Research into the genetic mechanisms of aging has expanded rapidly over the past two decades. This has in part been the result of the use of model organisms (particularly yeast, worms and flies) and high-throughput technologies, combined with a growing interest in aging research. Despite this progress, widespread consensus regarding the pathways that are fundamental to the modulation of cellular aging and lifespan for all organisms has been limited due to discrepancies between different studies. We have compared results from published genome-wide, chronological lifespan (CLS) screens of individual gene deletion strains in S. cerevisiae in order to identify gene deletion strains with consistent influences on longevity as possible indicators of fundamental aging processes from this single-celled, eukaryotic model organism. Methods Three previous reports have described genetic modifiers of chronological aging in the budding yeast (S. cerevisiae) using the yeast gene deletion strain collection. We performed a comparison among the data sets using correlation and decile distribution analysis to describe concordance between screens and identify strains that consistently increased or decreased CLS. We used gene enrichment analysis in an effort to understand the biology underlying genes identified in multiple studies. We attempted to replicate the different experimental conditions employed by the screens to identify potential sources of variability in CLS worth further investigating. Results Among 3209 strains present in all three screens, nine (2.80%) deletions strains were in common in the longest-lived decile and thirteen (4.05%) were in common in the shortest-lived decile for all three screens. Similarly, pairwise overlap between screens was low. When the same comparison was extended to three deciles to include more mutants studied in common between the three screens, enrichment of cellular processes based on gene ontology analysis in the long-lived strains remained very limited. To test the hypothesis that different parental strain auxotrophic requirements or media formulations employed by the respective genome-wide screens might contribute to the lack of concordance, different CLS assay conditions were assessed in combination with strains having different ploidy and auxotrophic requirements (all relevant to differences in the way the three genome-wide CLS screens were performed). This limited but systematic analysis of CLS with respect to auxotrophy, ploidy, and media revealed several instances of gene × nutrient interaction. Conclusions There is surprisingly little overlap between the results of three independently performed genome-wide screens of CLS in S. cerevisiae. However, differences in strain genetic background (ploidy and specific auxotrophic requirements) were present, as well as different media and experimental conditions (e.g., aeration and pooled vs. individual culturing), which, along with stochastic effects such as genetic drift or selection of secondary mutations that suppress the loss of function from gene deletion, could in theory account for some of the lack of consensus between results. Considering the lack of overlap in CLS phenotypes among the set of genes reported by all three screens, and the results of a CLS experiment that systematically tested (incorporating extensive controls) for interactions between variables existing between the screens, we propose that discrepancies can be reconciled through deeper understanding of the influence of cell intrinsic factors such as auxotrophic requirements ploidy status, extrinsic factors such as media composition and aeration, as well as interactions that may occur between them, for example as a result of different pooling vs. individually aging cultures. Such factors may have a more significant impact on CLS outcomes than previously realized. Future studies that systematically account for these contextual factors, and can thus clarify the interactions between genetic and nutrient factors that alter CLS phenotypes, should aid more complete understanding of the underlying biology so that genetic principles of CLS in yeast can be extrapolated to differential cellular aging observed in animal models. PMID:27125759

Chronic lymphocytic leukemia-associated chromosomal abnormalities and miRNA deregulation.

PubMed

Kiefer, Yvonne; Schulte, Christoph; Tiemann, Markus; Bullerdiek, Joern

2012-01-01

Chronic lymphocytic leukemia is the most common leukemia in adults. By cytogenetic investigations major subgroups of the disease can be identified that reflect different routes of tumor development. Of these chromosomal deviations, trisomy 12 and deletions of parts of either the long arm of chromosome 13, the long arm of chromosome 11, or the short arm of chromosome 17 are most commonly detected. In some of these aberrations the molecular target has been identified as eg, ataxia telangiectasia mutated (ATM) in case of deletions of chromosomal region 11q22~23 and the genes encoding microRNAs miR-15a/16-1 as likely targets of deletions of chromosomal band 13q14.3. Of note, these aberrations do not characterize independent subgroups but often coexist within the metaphases of one tumor. Generally, complex aberrations are associated with a worse prognosis than simple karyotypic alterations. Due to smaller sizes of the missing segment the detection of recurrent deletions is not always possible by means of classical cytogenetics but requires more advanced techniques as in particular fluorescence in situ hybridization (FISH). Nevertheless, at this time it is not recommended to replace classical cytogenetics by FISH because this would miss additional information given by complex or secondary karyotypic alterations. However, the results of cytogenetic analyses allow the stratification of prognostic and predictive groups of the disease. Of these, the group characterized by deletions involving TP53 is clinically most relevant. In the future refined methods as eg, array-based comparative genomic hybridization will supplement the existing techniques to characterize CLL.

Molecular diagnosis of α-thalassemia in a multiethnic population.

PubMed

Gilad, Oded; Shemer, Orna Steinberg; Dgany, Orly; Krasnov, Tanya; Nevo, Michal; Noy-Lotan, Sharon; Rabinowicz, Ron; Amitai, Nofar; Ben-Dor, Shifra; Yaniv, Isaac; Yacobovich, Joanne; Tamary, Hannah

2017-06-01

α-Thalassemia, one of the most common genetic diseases, is caused by deletions or point mutations affecting one to four α-globin genes. Molecular diagnosis is important to prevent the most severe forms of the disease. However, the diagnosis of α-thalassemia is complex due to a high variability of the genetic defects involved, with over 250 described mutations. We summarize herein the findings of genetic analyses of DNA samples referred to our laboratory for the molecular diagnosis of α-thalassemia, along with a detailed clinical description. We utilized a diagnostic algorithm including Gap-PCR, to detect known deletions, followed by sequencing of the α-globin gene, to identify known and novel point mutations, and multiplex ligation-dependent probe amplification (MLPA) for the diagnosis of rare or novel deletions. α-Thalassemia was diagnosed in 662 of 975 samples referred to our laboratory. Most commonly found were deletions (75.3%, including two novel deletions previously described by us); point mutations comprised 25.4% of the cases, including five novel mutations. Our population included mostly Jews (of Ashkenazi and Sephardic origin) and Muslim Arabs, who presented with a higher rate of point mutations and hemoglobin H disease. Overall, we detected 53 different genotype combinations causing a spectrum of clinical phenotypes, from asymptomatic to severe anemia. Our work constitutes the largest group of patients with α-thalassemia originating in the Mediterranean whose clinical characteristics and molecular basis have been determined. We suggest a diagnostic algorithm that leads to an accurate molecular diagnosis in multiethnic populations. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Large mitochondrial DNA deletion in an infant with addison disease.

PubMed

Duran, Gloria P; Martinez-Aguayo, A; Poggi, H; Lagos, M; Gutierrez, D; Harris, P R

2012-01-01

Mitochondrial diseases are a group of disorders caused by mutations in nuclear DNA or mitochondrial DNA, usually involving multiple organ systems. Primary adrenal insufficiency due to mitochondrial disease is extremely infrequent and has been reported in association with mitochondrial DNA deletion syndromes such as Kearns-Sayre syndrome. To report a 3-year-old boy with Addison disease, congenital glaucoma, chronic pancreatitis, and mitochondrial myopathy due to large mitochondrial DNA deletion. Molecular analysis of mitochondrial DNA samples obtained from peripheral blood, oral mucosa, and muscle tissue. A novel large mitochondrial DNA deletion of 7,372bp was identified involving almost all genes on the big arch of mtDNA. This case reaffirms the association of adrenal insufficiency and mitochondrial DNA deletions and presents new evidence that glaucoma is another manifestation of mitochondrial diseases. Due to the genetic and clinical heterogeneity of mitochondrial disorders, molecular analysis is crucial to confirm diagnosis and to allow accurate genetic counseling.

Total alpha-globin gene cluster deletion has high frequency in Filipinos

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hunt, J.A.; Haruyama, A.Z.; Chu, B.M.

1994-09-01

Most {alpha}-thalassemias [Thal] are due to large deletions. In Southeast Asians, the (--{sup SEA}) double {alpha}-globin gene deletion is common, 3 (--{sup Tot}) total {alpha}-globin cluster deletions are known: Filipino (--{sup Fil}), Thai (--{sup Thai}), and Chinese (--{sup Chin}). In a Hawaii Thal project, provisional diagnosis of {alpha}-Thal-1 heterozygotes was based on microcytosis, normal isoelectric focusing, and no iron deficiency. One in 10 unselected Filipinos was an {alpha}-Thal-1 heterozygote, 2/3 of these had a (--{sup Tot}) deletion: a {var_sigma}-cDNA probe consistently showed fainter intensity of the constant 5.5 kb {var_sigma}{sub 2} BamHI band, with no heterzygosity for {var_sigma}-globin region polymorphisms;more » {alpha}-cDNA or {var_sigma}-cDNA probes showed no BamHI or BglII bands diagnostic of the (--{sup SEA}) deletion; bands for the (-{alpha}) {alpha}-Thal-2 single {alpha}-globin deletions were only seen in Hb H cases. A reliable monoclonal anti-{var_sigma}-peptide antibody test for the (--{sup SEA}) deletion was always negative in (--{sup Tot}) samples. Southern digests with the Lo probe, a gift from D. Higgs of Oxford Univ., confirmed that 49 of 50 (--{sup Tot}) chromosomes in Filipinos were (--{sup Fil}). Of 20 {alpha}-Thal-1 hydrops born to Filipinos, 11 were (--{sup Fil}/--{sup SEA}) compound heterozygotes; 9 were (--{sup SEA}/--{sup SEA}) homozygotes, but none was a (--{sup Fil}/--{sup Fil}).« less

An atypical deletion of the Williams–Beuren syndrome interval implicates genes associated with defective visuospatial processing and autism

PubMed Central

Edelmann, Lisa; Prosnitz, Aaron; Pardo, Sherly; Bhatt, Jahnavi; Cohen, Ninette; Lauriat, Tara; Ouchanov, Leonid; González, Patricia J; Manghi, Elina R; Bondy, Pamela; Esquivel, Marcela; Monge, Silvia; Delgado, Marietha F; Splendore, Alessandra; Francke, Uta; Burton, Barbara K; McInnes, L Alison

2007-01-01

Background During a genetic study of autism, a female child who met diagnostic criteria for autism spectrum disorder, but also exhibited the cognitive–behavioural profile (CBP) associated with Williams–Beuren syndrome (WBS) was examined. The WBS CBP includes impaired visuospatial ability, an overly friendly personality, excessive non‐social anxiety and language delay. Methods Using array‐based comparative genomic hybridisation (aCGH), a deletion corresponding to BAC RP11‐89A20 in the distal end of the WBS deletion interval was detected. Hemizygosity was confirmed using fluorescence in situ hybridisation and fine mapping was performed by measuring the copy number of genomic DNA using quantitative polymerase chain reaction. Results The proximal breakpoint was mapped to intron 1 of GTF2IRD1 and the distal breakpoint lies 2.4–3.1 Mb towards the telomere. The subject was completely hemizygous for GTF2I, commonly deleted in carriers of the classic ∼1.5 Mb WBS deletion, and GTF2IRD2, deleted in carriers of the rare ∼1.84 Mb WBS deletion. Conclusion Hemizygosity of the GTF2 family of transcription factors is sufficient to produce many aspects of the WBS CBP, and particularly implicate the GTF2 transcription factors in the visuospatial construction deficit. Symptoms of autism in this case may be due to deletion of additional genes outside the typical WBS interval or remote effects on gene expression at other loci. PMID:16971481

Analysis of Pax6 contiguous gene deletions in the mouse, Mus musculus, identifies regions distinct from Pax6 responsible for extreme small-eye and belly-spotting phenotypes.

PubMed

Favor, Jack; Bradley, Alan; Conte, Nathalie; Janik, Dirk; Pretsch, Walter; Reitmeir, Peter; Rosemann, Michael; Schmahl, Wolfgang; Wienberg, Johannes; Zaus, Irmgard

2009-08-01

In the mouse Pax6 function is critical in a dose-dependent manner for proper eye development. Pax6 contiguous gene deletions were shown to be homozygous lethal at an early embryonic stage. Heterozygotes express belly spotting and extreme microphthalmia. The eye phenotype is more severe than in heterozygous Pax6 intragenic null mutants, raising the possibility that deletions are functionally different from intragenic null mutations or that a region distinct from Pax6 included in the deletions affects eye phenotype. We recovered and identified the exact regions deleted in three new Pax6 deletions. All are homozygous lethal at an early embryonic stage. None express belly spotting. One expresses extreme microphthalmia and two express the milder eye phenotype similar to Pax6 intragenic null mutants. Analysis of Pax6 expression levels and the major isoforms excluded the hypothesis that the deletions expressing extreme microphthalmia are directly due to the action of Pax6 and functionally different from intragenic null mutations. A region distinct from Pax6 containing eight genes was identified for belly spotting. A second region containing one gene (Rcn1) was identified for the extreme microphthalmia phenotype. Rcn1 is a Ca(+2)-binding protein, resident in the endoplasmic reticulum, participates in the secretory pathway and expressed in the eye. Our results suggest that deletion of Rcn1 directly or indirectly contributes to the eye phenotype in Pax6 contiguous gene deletions.

Nearest Neighbor Classification of Stationary Time Series: An Application to Anesthesia Level Classification by EEG Analysis.

DTIC Science & Technology

1980-12-05

classification procedures that are common in speech processing. The anesthesia level classification by EEG time series population screening problem example is in...formance. The use of the KL number type metric in NN rule classification, in a delete-one subj ect ’s EE-at-a-time KL-NN and KL- kNN classification of the...17 individual labeled EEG sample population using KL-NN and KL- kNN rules. The results obtained are shown in Table 1. The entries in the table indicate

Recurrent DGCR8, DROSHA, and SIX homeodomain mutations in favorable histology Wilms tumors | Office of Cancer Genomics

Cancer.gov

We report the most common single-nucleotide substitution/deletion mutations in favorable histology Wilms tumors (FHWTs) to occur within SIX1/2 (7% of 534 tumors) and microRNA processing genes (miRNAPGs) DGCR8 and DROSHA (15% of 534 tumors). Comprehensive analysis of 77 FHWTs indicates that tumors with SIX1/2 and/or miRNAPG mutations show a pre-induction metanephric mesenchyme gene expression pattern and are significantly associated with both perilobar nephrogenic rests and 11p15 imprinting aberrations.

Hypertensive Cerebral Hemorrhage in a Patient with Turner Syndrome Caused by Deletion in the Short Arm of the X Chromosome.

PubMed

Hori, Yusuke S; Ohkura, Takahiro; Ebisudani, Yuki; Umakoshi, Michiari; Ishi, Masato; Oda, Kazunori; Aoi, Mizuho; Inoue, Takushi; Furujo, Mahoko; Tanaka, Hiroyuki; Fukuhara, Toru

2018-01-01

Turner syndrome is a chromosomal disorder usually caused by complete deletion of an X chromosome, with deletion in the short arm of the X chromosome being a rare cause of the condition. Patients with Turner syndrome commonly develop hypertension, and associated vascular complications such as aortic dissection or cerebral hemorrhage have been reported. Cerebral hemorrhage in Turner syndrome is a rare complication, and only a few reports have been published. In these reports, all patients have XO karyotypes or a mosaic type as the cause of Turner syndrome, while no other Turner syndrome types have been documented. In this report, we present for the first time a patient with Turner syndrome caused by deletion in the short arm of the X chromosome who experienced hypertensive hemorrhage as a late complication. © 2017 S. Karger AG, Basel.

Disruption of the psbA gene by the copy correction mechanism reveals that the expression of plastid-encoded genes is regulated by photosynthesis activity.

PubMed

Khan, Muhammad Sarwar; Hameed, Waqar; Nozoe, Mikio; Shiina, Takashi

2007-05-01

The functional analysis of genes encoded by the chloroplast genome of tobacco by reverse genetics is routine. Nevertheless, for a small number of genes their deletion generates heteroplasmic genotypes, complicating their analysis. There is thus the need for additional strategies to develop deletion mutants for these genes. We have developed a homologous copy correction-based strategy for deleting/mutating genes encoded on the chloroplast genome. This system was used to produce psbA knockouts. The resulting plants are homoplasmic and lack photosystem II (PSII) activity. Further, the deletion mutants exhibit a distinct phenotype; young leaves are green, whereas older leaves are bleached, irrespective of light conditions. This suggests that senescence is promoted by the absence of psbA. Analysis of the transcript levels indicates that NEP (nuclear-encoded plastid RNA polymerase)-dependent plastid genes are up regulated in the psbA deletion mutants, whereas the bleached leaves retain plastid-encoded plastid RNA polymerase activity. Hence, the expression of NEP-dependent plastid genes may be regulated by photosynthesis, either directly or indirectly.

Novel mutations responsible for α-thalassemia in Iranian families.

PubMed

Bayat, Nooshin; Farashi, Samaneh; Hafezi-Nejad, Nima; Faramarzi, Negin; Ashki, Mehri; Vakili, Shadi; Imanian, Hashem; Khosravi, Mohsen; Azar-Keivan, Azita; Najmabadi, Hossein

2013-01-01

α-Thalassemia (α-thal) is usually caused by deletions on the α-globin gene cluster and the role of point mutations is less well investigated. In the present study, a total of 1048 individuals with hypochromic microcytic anemia, who did not present the most common α-thal deletions, were referred for α-globin gene DNA sequencing. The nucleotide changes were studied and a total of five new mutations was identified, of which three were located on the α2 gene [codon7 (Lys→Stop), codon 34 (Leu→Pro) and codon 83 (Leu→Arg)] and two on the α1 gene [IVS-I-116 (A>G) and codon 44 (+C)]. These novel mutations not only explain new findings by molecular analysis of the α-globin gene but also have clinical importance due to their changes in α-globin production in means of decreased hemoglobin (Hb) related values. Moreover, considerations of its role in combination with other mutations, and the possibility of causing Hb H (β4) are yet to be studied.

Targeted Deletion and Lipidomic Analysis Identify Epithelial Cell COX-2 as a Major Driver of Chemically-induced Skin Cancer

PubMed Central

Jiao, Jing; Ishikawa, Tomo-o; Dumlao, Darren S.; Norris, Paul C.; Magyar, Clara E.; Mikulec, Carol; Catapang, Art; Dennis, Edward A.; Fischer, Susan M.; Herschman, Harvey R.

2014-01-01

Pharmacologic and global gene deletion studies demonstrate that cyclooxygenase-2 (PTGS2/COX2) plays a critical role in DMBA/TPA-induced skin tumor induction. While many cell types in the tumor microenvironment express COX-2, the cell types in which COX-2 expression is required for tumor promotion are not clearly established. Here, cell-type specific Cox-2 gene deletion reveals a vital role for skin epithelial cell COX-2 expression in DMBA/TPA tumor induction. In contrast, myeloid Cox-2 gene deletion has no effect on DMBA/TPA tumorigenesis. The infrequent, small tumors that develop on mice with an epithelial cell-specific Cox-2 gene deletion have decreased proliferation and increased cell differentiation properties. Blood vessel density is reduced in tumors with an epithelial cell-specific Cox-2 gene deletion, compared to littermate control tumors, suggesting a reciprocal relationship in tumor progression between COX-2 expressing tumor epithelial cells and microenvironment endothelial cells. Lipidomics analysis of skin and tumors from DMBA/TPA-treated mice suggests that the prostaglandins PGE2 and PGF2α are likely candidates for the epithelial cell COX-2-dependent eicosanoids that mediate tumor progression. This study both illustrates the value of cell-type specific gene deletions in understanding the cellular roles of signal-generating pathways in complex microenvironments and emphasizes the benefit of a systems-based lipidomic analysis approach to identify candidate lipid mediators of biological responses. PMID:25063587

Association between F508 deletion in CFTR and chronic pancreatitis risk.

PubMed

Zhao, Dong; Xu, Yanzhen; Li, Jiatong; Fu, Shien; Xiao, Feifan; Song, Xiaowei; Xie, Zhibin; Jiang, Min; He, Yan; Liu, Chengwu; Wen, Qiongxian; Yang, Xiaoli

2017-09-01

The cystic fibrosis transmembrane conductance regulator (CFTR) has been reported to influence individual susceptibility to chronic pancreatitis (CP), but the results of previous studies are controversial. We performed a study to demonstrate the relationship between CFTR and CP. We searched PubMed, Scopus, and Embase for studies of patients with CP. Seven studies from 1995 to 2016 were identified, and included 64,832 patients. Pooled prevalence and 95% confidence intervals (CIs) were calculated. F508 deletion in CFTR was significantly positively associated with CP risk in the overall analysis (odds ratio [OR]=3.20, 95% CI: 2.30-4.44, I 2 =31.7%). In subgroup analysis stratified by ethnicity, F508 deletion was significantly associated with CP risk in Indian populations, using a fixed effects model (ORs=5.45, 95% CI: 2.52-11.79, I 2 =0.0%), and in non-Indian populations, using a random effects model (ORs=3.59, 95% CI: 1.73-7.48, I 2 =60.9%). At the same time, we found that Indians with F508 deletion had much higher CP prevalence than non-Indians. Interestingly, F508 deletion was also associated with CP and idiopathic CP risk in subgroup analysis stratified by aeitiology, using the fixed effects model. Based on current evidence, F508 deletion is a risk factor for CP, and Indians with F508 deletion have much higher CP morbidity. Copyright © 2017 Editrice Gastroenterologica Italiana S.r.l. Published by Elsevier Ltd. All rights reserved.

A Comprehensive Molecular Investigation of α-Thalassemia in an Iranian Cohort from Different Provinces of North Iran.

PubMed

Eftekhari, Hajar; Tamaddoni, Ahmad; Mahmoudi Nesheli, Hassan; Vakili, Mohsen; Sedaghat, Sadegh; Banihashemi, Ali; Azizi, Mandana; Youssefi Kamangar, Reza; Akhavan-Niaki, Haleh

2017-01-01

α-Thalassemia (α-thal) is the most common monogenic disease that is caused by the absence or reduced expression of α-globin genes. The aim of this study was to investigate common α-globin mutations and their associated haplotypes in four northern provinces of Iran (Gilan, Mazandaran, Golestan, Khorasan). One thousand, one hundred and ninety-one persons were tested for α-thal mutations by gap-polymerase chain reaction (PCR), reverse dot-blot hybridization, restriction fragment length polymorphism (RFLP) analysis and sequencing. Of the nine different mutations found, the most frequent were -α 3.7 (rightward deletion) (45.6%), polyadenylation site (α p ° lyA2 α) (α2) (AATAAA>AATGAA; HBA2: c.*92 A>G) (15.27%), - - MED (Mediterranean deletion) (6.86%), -α 4.2 (leftward deletion), (6.17%), α CS α [Hb Constant Spring (Hb CS) (HBA2: c.427 T>C)] (4.62%), -α -5 nt (HBA2: c.95+2_95+6delTGAGG) (3.70%). All chromosomes bearing an α-globin point mutation [α p ° lyA2 α, -α -5 nt α, α CS α, α p ° lyA1 α (AATAAA> AATAAG; HBA2: c.*94 A>G)] showed only one haplotype that was present in most normal chromosomes, while the -α 3.7 deletion was associated with three distinct haplotypes. Our results indicate that α-thal mutations are heterogeneous and -α 3.7 and α p ° lyA2 α are the most prevalent mutations in this region. The presence of -α 3.7 with three different haplotypes suggests an older history for this mutation. The high prevalence of α p ° lyA2 α in Mazandaran Province, Iran compared to other parts of the country and the world, suggests a founder effect. Altogether, we here provide further data confirming the heterogeneity of the northern population of Iran. These data may contribute to the establishment of a national mutation database, more accurate genetic counseling and prenatal diagnosis (PND).

ACE Gene in Egyptian Ischemic Stroke Patients.

PubMed

Mostafa, Magdy A; El-Nabiel, Lobna M; Fahmy, Nagia Aly; Aref, Hany; Shreef, Edrees; Abd El-Tawab, Fathy; Abdulghany, Osama M

2016-09-01

Angiotensin-1-converting enzyme (ACE) is a crucial player in vascular homeostasis and in the pathogenesis of atherosclerosis and hypertension. The present study was conducted to determine whether there is an association between the ACE insertion/deletion (I/D) polymorphism and ischemic stroke in Egyptian population. Also, we analyzed the ACE gene I/D polymorphism as a risk factor for small-vessel (SV) versus large-vessel (LV) disease. Sixty patients with ischemic stroke were included: 30 with SV disease and 30 with LV disease. In addition, a control group of 30 apparent healthy subjects were studied. Clinical assessment, computed tomography, magnetic resonance imaging brain, and genetic study using the polymerase chain reaction of ACE gene were done for all subjects. We found that the distribution of ACE gene polymorphism frequency was significantly different between the 3 groups. The DD genotype was far more common in stroke patients compared to controls. It was also significantly more common in each of the patient groups compared to controls but rather similar in the 2 patient groups with SV and LV diseases. We found that the ACE gene deletion/deletion genotype is common in Egyptian patients with non-cardioembolic ischemic stroke but does not appear to be specific neither to SV nor to LV disease. Copyright © 2016 National Stroke Association. Published by Elsevier Inc. All rights reserved.

The effect of icotinib combined with chemotherapy in untreated non-small-cell lung cancer that harbored EGFR-sensitive mutations in a real-life setting: a retrospective analysis.

PubMed

Wang, Lulu; Li, Yan; Li, Luchun; Wu, Zhijuan; Yang, Dan; Ma, Huiwen; Wang, Donglin

2018-01-01

This study was conducted to compare the efficacy of a combination of icotinib and chemotherapy with icotinib or chemotherapy alone in untreated non-small cell lung cancer (NSCLC) patients harboring epidermal growth factor receptor (EGFR)-sensitive mutations and to analyze the curative effect of different treatments on different genetic mutations (EGFR 19 exon deletion and L858R mutation) in a real-life setting. One hundred ninety-one patients were studied in this retrospective analysis from January 2013 to December 2015. The baseline characteristics, curative effects and adverse events of patients were analyzed. The primary endpoint was progression free survival (PFS). Longer PFS and overall survival (OS), and better objective response rate (ORR) were observed in the combination group compared to icotinib or chemotherapy along. For patients with an EGFR 19 exon deletion, the PFS, OS, and ORR in the combination group were superior to those in the icotinib or chemotherapy group. For the patients with the EGFR L858R mutation, better PFS and ORR were observed in the combination group, but OS was not obviously prolonged. Grade 3 or 4 adverse events were most commonly reported with combination therapy or chemotherapy alone. No possible drug-related interstitial lung disease or of drug related deaths occurred. The combination of icotinib and chemotherapy in patients with untreated NSCLC harboring sensitive EGFR mutations resulted in improved PFS and OS, especially in those who harbored the EGFR exon 19 deletion.

The effect of icotinib combined with chemotherapy in untreated non-small-cell lung cancer that harbored EGFR-sensitive mutations in a real-life setting: a retrospective analysis

PubMed Central

Wang, Lulu; Li, Yan; Li, Luchun; Wu, Zhijuan; Yang, Dan; Ma, Huiwen; Wang, Donglin

2018-01-01

Purpose This study was conducted to compare the efficacy of a combination of icotinib and chemotherapy with icotinib or chemotherapy alone in untreated non-small cell lung cancer (NSCLC) patients harboring epidermal growth factor receptor (EGFR)-sensitive mutations and to analyze the curative effect of different treatments on different genetic mutations (EGFR 19 exon deletion and L858R mutation) in a real-life setting. Patients and methods One hundred ninety-one patients were studied in this retrospective analysis from January 2013 to December 2015. The baseline characteristics, curative effects and adverse events of patients were analyzed. The primary endpoint was progression free survival (PFS). Results Longer PFS and overall survival (OS), and better objective response rate (ORR) were observed in the combination group compared to icotinib or chemotherapy along. For patients with an EGFR 19 exon deletion, the PFS, OS, and ORR in the combination group were superior to those in the icotinib or chemotherapy group. For the patients with the EGFR L858R mutation, better PFS and ORR were observed in the combination group, but OS was not obviously prolonged. Grade 3 or 4 adverse events were most commonly reported with combination therapy or chemotherapy alone. No possible drug-related interstitial lung disease or of drug related deaths occurred. Conclusion The combination of icotinib and chemotherapy in patients with untreated NSCLC harboring sensitive EGFR mutations resulted in improved PFS and OS, especially in those who harbored the EGFR exon 19 deletion. PMID:29731642

Submicroscopic deletions at the WAGR locus, revealed by nonradioactive in situ hybridization.

PubMed

Fantes, J A; Bickmore, W A; Fletcher, J M; Ballesta, F; Hanson, I M; van Heyningen, V

1992-12-01

Fluorescence in situ hybridization (FISH) with biotin-labeled probes mapping to 11p13 has been used for the molecular analysis of deletions of the WAGR (Wilms tumor, aniridia, genitourinary abnormalities, and mental retardation) locus. We have detected a submicroscopic 11p13 deletion in a child with inherited aniridia who subsequently presented with Wilms tumor in a horseshoe kidney, only revealed at surgery. The mother, who has aniridia, was also found to carry a deletion including both the aniridia candidate gene (AN2) and the Wilms tumor predisposition gene (WT1). This is therefore a rare case of an inherited WAGR deletion. Wilms tumor has so far only been associated with sporadic de novo aniridia cases. We have shown that a cosmid probe for a candidate aniridia gene, homologous to the mouse Pax-6 gene, is deleted in cell lines from aniridia patients with previously characterized deletions at 11p13, while another cosmid marker mapping between two aniridia-associated translocation breakpoints (and hence a second candidate marker) is present on both chromosomes. These results support the Pax-6 homologue as a strong candidate for the AN2 gene. FISH with cosmid probes has proved to be a fast and reliable technique for the molecular analysis of deletions. It can be used with limited amounts of material and has strong potential for clinical applications.

Isolation of anonymous DNA sequences from within a submicroscopic X chromosomal deletion in a patient with choroideremia, deafness, and mental retardation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nussbaum, R.L.; Lesko, J.G.; Lewis, R.A.

1987-09-01

Choroideremia, an X-chromosome linked retinal dystrophy of unknown pathogenesis, causes progressive nightblindness and eventual central blindness in affected males by the third to fourth decade of life. Choroideremia has been mapped to Xq13-21 by tight linkage to restriction fragment length polymorphism loci. The authors have recently identified two families in which choroideremia is inherited with mental retardation and deafness. In family XL-62, an interstitial deletion Xq21 is visible by cytogenetic analysis and two linked anonymous DNA markers, DXYS1 and DXS72, are deleted. In the second family, XL-45, an interstitial deletion was suspected on phenotypic grounds but could not be confirmedmore » by high-resolution cytogenetic analysis. They used phenol-enhanced reassociation of 48,XXXX DNA in competition with excess XL-45 DNA to generate a library of cloned DNA enriched for sequences that might be deleted in XL-45. Two of the first 83 sequences characterized from the library were found to be deleted in probands from family XL-45 as well as from family XL-62. Isolation of these sequences proves that XL-45 does contain a submicroscopic deletion and provides a starting point for identifying overlapping genomic sequences that span the XL-45 deletion. Each overlapping sequence will be studied to identify exons from the choroideremia locus.« less

Cytogenetic and molecular analysis in Angelman syndrome.

PubMed

Zackowski, J L; Nicholls, R D; Gray, B A; Bent-Williams, A; Gottlieb, W; Harris, P J; Waters, M F; Driscoll, D J; Zori, R T; Williams, C A

1993-04-01

We report on cytogenetic and molecular analyses of 29 Angelman syndrome (AS) individuals ascertained in 1990 through the first National Angelman Syndrome Conference. High resolution GTG- and GBG-banded chromosomes were studied. Standard molecular analysis with six 15q11q13 DNA sequences was used to analyze copy number and parental origin of 15q11q13. Concordance between molecular and cytogenetic data was excellent. The combined data showed that 23 of the 27 probands (85%) on whom we had definitive results have deletions of the chromosome 15q11q13 region. Two classes of deletion were detected molecularly: most patients were deleted for the 5 more proximal probes, but in 2 cases the deletion extended distally to include in sixth probe. In the 13 cases where the parental origin of the deleted chromosome 15 could be established, it was maternal. There were no cases of uniparental disomy. Cytological observations of the relative sizes of the heterochromatic regions of the short arm of chromosome 15 suggested that chromosomes with large heterochromatic blocks may be more prone to de novo deletion.

Deletion Diagnostics for the Generalised Linear Mixed Model with independent random effects

PubMed Central

Ganguli, B.; Roy, S. Sen; Naskar, M.; Malloy, E. J.; Eisen, E. A.

2015-01-01

The Generalised Linear Mixed Model (GLMM) is widely used for modelling environmental data. However, such data are prone to influential observations which can distort the estimated exposure-response curve particularly in regions of high exposure. Deletion diagnostics for iterative estimation schemes commonly derive the deleted estimates based on a single iteration of the full system holding certain pivotal quantities such as the information matrix to be constant. In this paper, we present an approximate formula for the deleted estimates and Cook’s distance for the GLMM which does not assume that the estimates of variance parameters are unaffected by deletion. The procedure allows the user to calculate standardised DFBETAs for mean as well as variance parameters. In certain cases, such as when using the GLMM as a device for smoothing, such residuals for the variance parameters are interesting in their own right. In general, the procedure leads to deleted estimates of mean parameters which are corrected for the effect of deletion on variance components as estimation of the two sets of parameters is interdependent. The probabilistic behaviour of these residuals is investigated and a simulation based procedure suggested for their standardisation. The method is used to identify influential individuals in an occupational cohort exposed to silica. The results show that failure to conduct post model fitting diagnostics for variance components can lead to erroneous conclusions about the fitted curve and unstable confidence intervals. PMID:26626135

Deletion of chromosome 21 in a girl with congenital hypothyroidism and mild mental retardation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ahlbom, B.E.; Anneren, G.; Sidenvall, R.

1996-08-23

We report on a girl with a large interstitial deletion of the long arm of chromosome 21 and with mild mental retardation, congenital hypothyroidism, and hyperopia. The deletion [del(21)(q11.1-q22.1)] extends molecularly from marker D21S215 to D21S213. The distal breakpoint is not clearly defined but is situated between markers D21S213 and IFNAR. This patient has the largest deletion of chromosome 21 known without having severe mental retardation or malformations. The deletion does not involve the {open_quotes}Down syndrome chromosome{close_quotes} region, the region of chromosome 21 which in trisomy causes most of the manifestations of Down syndrome. Apparently, the proximal part of themore » long arm of chromosome 21 does not include genes that are responsible for severe clinical effects in the event of either deletion or duplication, since several reported patients with either trisomy or deletion of this region have mild phenotypic abnormalities. Congenital hypothyroidism is much more common in Down syndrome than in the average population. Thus, the congenital hypothyroidism of the present patient might indicate that there is one or several genes on the proximal part of chromosome 21, which might be of importance for the thyroid function. 24 refs., 4 figs., 2 tabs.« less

Genomic Signature of Multidrug-Resistant Salmonella enterica Serovar Typhi Isolates Related to a Massive Outbreak in Zambia between 2010 and 2012

PubMed Central

Leekitcharoenphon, Pimlapas; Lukjancenko, Oksana; Lukwesa-Musyani, Chileshe; Tambatamba, Bushimbwa; Mwaba, John; Kalonda, Annie; Nakazwe, Ruth; Kwenda, Geoffrey; Jensen, Jacob Dyring; Svendsen, Christina A.; Dittmann, Karen K.; Kaas, Rolf S.; Cavaco, Lina M.; Aarestrup, Frank M.; Hasman, Henrik; Mwansa, James C. L.

2014-01-01

Retrospectively, we investigated the epidemiology of a massive Salmonella enterica serovar Typhi outbreak in Zambia during 2010 to 2012. Ninety-four isolates were susceptibility tested by MIC determinations. Whole-genome sequence typing (WGST) of 33 isolates and bioinformatic analysis identified the multilocus sequence type (MLST), haplotype, plasmid replicon, antimicrobial resistance genes, and genetic relatedness by single nucleotide polymorphism (SNP) analysis and genomic deletions. The outbreak affected 2,040 patients, with a fatality rate of 0.5%. Most (83.0%) isolates were multidrug resistant (MDR). The isolates belonged to MLST ST1 and a new variant of the haplotype, H58B. Most isolates contained a chromosomally translocated region containing seven antimicrobial resistance genes, catA1, blaTEM-1, dfrA7, sul1, sul2, strA, and strB, and fragments of the incompatibility group Q1 (IncQ1) plasmid replicon, the class 1 integron, and the mer operon. The genomic analysis revealed 415 SNP differences overall and 35 deletions among 33 of the isolates subjected to whole-genome sequencing. In comparison with other genomes of H58, the Zambian isolates separated from genomes from Central Africa and India by 34 and 52 SNPs, respectively. The phylogenetic analysis indicates that 32 of the 33 isolates sequenced belonged to a tight clonal group distinct from other H58 genomes included in the study. The small numbers of SNPs identified within this group are consistent with the short-term transmission that can be expected over a period of 2 years. The phylogenetic analysis and deletions suggest that a single MDR clone was responsible for the outbreak, during which occasional other S. Typhi lineages, including sensitive ones, continued to cocirculate. The common view is that the emerging global S. Typhi haplotype, H58B, containing the MDR IncHI1 plasmid is responsible for the majority of typhoid infections in Asia and sub-Saharan Africa; we found that a new variant of the haplotype harboring a chromosomally translocated region containing the MDR islands of IncHI1 plasmid has emerged in Zambia. This could change the perception of the term “classical MDR typhoid” currently being solely associated with the IncHI1 plasmid. It might be more common than presently thought that S. Typhi haplotype H58B harbors the IncHI1 plasmid or a chromosomally translocated MDR region or both. PMID:25392358

Copy number variations in Saudi family with intellectual disability and epilepsy.

PubMed

Naseer, Muhammad I; Chaudhary, Adeel G; Rasool, Mahmood; Kalamegam, Gauthaman; Ashgan, Fai T; Assidi, Mourad; Ahmed, Farid; Ansari, Shakeel A; Zaidi, Syed Kashif; Jan, Mohammed M; Al-Qahtani, Mohammad H

2016-10-17

Epilepsy is genetically complex but common brain disorder of the world affecting millions of people with almost of all age groups. Novel Copy number variations (CNVs) are considered as important reason for the numerous neurodevelopmental disorders along with intellectual disability and epilepsy. DNA array based studies contribute to explain a more severe clinical presentation of the disease but interoperation of many detected CNVs are still challenging. In order to study novel CNVs with epilepsy related genes in Saudi family with six affected and two normal individuals with several forms of epileptic seizures, intellectual disability (ID), and minor dysmorphism, we performed the high density whole genome Agilent sure print G3 Hmn CGH 2x 400 K array-CGH chips analysis. Our results showed de novo deletions, duplications and deletion plus duplication on differential chromosomal regions in the affected individuals that were not shown in the normal fathe and normal kids by using Agilent CytoGenomics 3.0.6.6 softwear. Copy number gain were observed in the chromosome 1, 16 and 22 with LCE3C, HPR, GSTT2, GSTTP2, DDT and DDTL genes respectively whereas the deletions observed in the chromosomal regions 8p23-p21 (4303127-4337759) and the potential gene in this region is CSMD1 (OMIM: 612279). Moreover, the array CGH results deletions and duplication were also validated by using primer design of deleted regions utilizing the flanked SNPs using simple PCR and also by using quantitative real time PCR. We found some of the de novo deletions and duplication in our study in Saudi family with intellectual disability and epilepsy. Our results suggest that array-CGH should be used as a first line of genetic test for epilepsy except there is a strong indication for a monogenic syndrome. The advanced high through put array-CGH technique used in this study aim to collect the data base and to identify new mechanisms describing epileptic disorder, may help to improve the clinical management of individual cases in decreasing the burden of epilepsy in Saudi Arabia.

Frequency of heterozygous TET2 deletions in myeloproliferative neoplasms

PubMed Central

Tripodi, Joseph; Hoffman, Ronald; Najfeld, Vesna; Weinberg, Rona

2010-01-01

The Philadelphia chromosome (Ph)-negative myeloproliferative neoplasms (MPNs), including polycythemia vera, essential thrombocythemia, and primary myelofibrosis, are a group of clonal hematopoietic stem cell disorders with overlapping clinical and cytogenetic features and a variable tendency to evolve into acute leukemia. These diseases not only share overlapping chromosomal abnormalities but also a number of acquired somatic mutations. Recently, mutations in a putative tumor suppressor gene, ten-eleven translocation 2 (TET2) on chromosome 4q24 have been identified in 12% of patients with MPN. Additionally 4q24 chromosomal rearrangements in MPN, including TET2 deletions, have also been observed using conventional cytogenetics. The goal of this study was to investigate the frequency of genomic TET2 rearrangements in MPN using fluorescence in situ hybridization as a more sensitive method for screening and identifying genomic deletions. Among 146 MPN patients, we identified two patients (1.4%) who showed a common 4q24 deletion, including TET2. Our observations also indicated that the frequency of TET2 deletion is increased in patients with an abnormal karyotype (5%). PMID:21188113

Fluorescence in situ hybridization evaluation of chromosome deletion patterns in prostate cancer.

PubMed

Huang, S F; Xiao, S; Renshaw, A A; Loughlin, K R; Hudson, T J; Fletcher, J A

1996-11-01

Various nonrandom chromosomal aberrations have been identified in prostate carcinoma. These aberrations include deletions of several chromosome regions, particularly the chromosome 8 short arm. Large-scale numerical aberrations, reflected in aberrant DNA ploidy, are also found in a minority of cases. However, it is unclear whether prostate carcinomas contain aberrations of certain chromosome regions that are deleted frequently in other common types of cancer. In this study, we performed dual-color fluorescence in situ hybridization on intact nuclei from touch preparations of 16 prostate cancers. Chromosome copy number was determined using pericentromeric probes, whereas potential chromosome arm deletions were evaluated using yeast artificial chromosome (YAC) and P1 probes. Two YAC probes targeted chromosome 8 short arm regions known to be deleted frequently in prostate cancer. Other YACs and P1s were for chromosome regions, including 1p22, 3p14, 6q21, 9p21, and 22q12, that are deletion targets in a variety of cancers although not extensively studied in prostate cancer. Hybridization efficiencies and signal intensities were excellent for both repeat sequence (alpha-satellite) and single, copy (YAC and P1) fluorescence in situ hybridization probes. Of 16 prostate cancers, 11 had clonal aberrations of 1 or more of the 13 chromosome regions evaluated, and 10 cases (62.5%) had 8p deletions, including 4 cases with 8p deletion in virtually all cells and aneuploidy in only a subset of those deleted cells. Deletions at 3p14, 6q21, and 22q12 were identified in 2, 1, and 1 case, respectively, and each of those cases had a similarly sized cell population with 8p deletion. These studies confirm 8p deletion in the majority of prostate carcinomas. 8p deletions appear to be early events in prostate tumorigenesis, often antedating aneuploidy. Fluorescence in situ hybridization strategies incorporating pericentromeric and single-copy regional chromosome probes offer a powerful and efficient means for determining frequency and progression of oncogenetic events in prostate cancer.

Deletion mapping of chromosome 13q in head and neck squamous cell carcinoma in Indian patients: correlation with prognosis of the tumour

PubMed Central

Sabbir, Golam Md; Roy, Anup; Mandal, Syamsundar; Dam, Aniruddha; Roychoudhury, Susanta; Panda, Chinmay Kumar

2006-01-01

Deletions in chromosome (chr.) 13q occur frequently in head and neck squamous cell carcinoma (HNSCC). Previous studies failed to identify common deleted regions in chr.13q, though several candidate tumour suppressor genes (TSGs) loci, e.g. BRCA2, RB1 and BRCAX have been localized in this chromosome, as well as no prognostic significance of the deletion has been reported. Thus, in the present study, deletion mapping of chr. 13q has been done in 55 primary HNSCC samples of Indian patients using 11 highly polymorphic microsatellite markers of which three were intragenic to BRCA2 gene, one intragenic to RB1 gene and another from BRCAX locus. The deletion in chr.13q was significantly associated with progression of HNSCC. High frequencies (27–39%) of loss of heterozygosity were found in 13q13.1 (BRCA2), 13q14.2 (RB1), 13q21.2–22.1 (BRCAX) and 13q31.1 regions. Deletions in the BRCA2 and RB1 regions were significantly correlated. The four highly deleted regions were associated with clinical stage and histological grades of the tumour as well as poor patient outcome. Deletion in the 13q31.1 region was only found to be associated with HPV infection. High frequencies (11–23%) of microsatellite size alteration (MA) were seen to overlap with the highly deleted regions. Forty per cent of the samples showed rare biallelic alteration whereas loss of normal copy of chromosome 13q was seen in five tumours. Thus, it seems that the putative TSGs located in the BRCAX and 13q31.1 regions as well as the BRCA2 and RB1 genes may have some cumulative effect in progression and poor prognosis of HNSCC. Significant association between deletion in BRCA2 and RB1 gene loci may indicate functional relationship between the genes in this tumour progression. PMID:16623759

Microdeletion syndromes, balanced translocations, and gene mapping.

PubMed Central

Schinzel, A

1988-01-01

High resolution prometaphase chromosome banding has allowed the detection of discrete chromosome aberrations which escaped earlier metaphase examinations. Consistent tiny deletions have been detected in some well established malformation syndromes: an interstitial deletion in 15q11/12 in the majority of patients with the Prader-Willi syndrome and in a minority of patients with the Angelman (happy puppet) syndrome; a terminal deletion of 17p13.3 in most patients examined with the Miller-Dieker syndrome; an interstitial deletion of 8q23.3/24.1 in a large majority of patients with the Giedion-Langer syndrome; an interstitial deletion of 11p13 in virtually all patients with the WAGR (Wilms' tumour-aniridia-gonadoblastoma-retardation) syndrome; and an interstitial deletion in 22q11 in about one third of patients with the DiGeorge sequence. In addition, a combination of chromosome prometaphase banding and DNA marker studies has allowed the localisation of the genes for retinoblastoma and for Wilms' tumour and the clarification of both the autosomal recessive nature of the mutation and the possible somatic mutations by which the normal allele can be lost in retina and kidney cells. After a number of X linked genes had been mapped, discrete deletions in the X chromosome were detected by prometaphase banding with specific attention paid to the sites of the gene(s) in males who had from one to up to four different X linked disorders plus mental retardation. Furthermore, the detection of balanced translocations in probands with disorders caused by autosomal dominant or X linked genes has allowed a better insight into the localisation of these genes. In some females with X linked disorders, balanced X; autosomal translocations have allowed the localisation of X linked genes at the breakpoint on the X chromosome. Balanced autosome; autosome translocations segregating with autosomal dominant conditions have provided some clues to the gene location of these conditions. In two conditions, Greig cephalopolysyndactyly and dominant aniridia, two translocation families with one common breakpoint have allowed quite a confident location of the genes at the common breakpoint at 7p13 and 11p13, respectively. PMID:3050093

A systematic review and meta-analysis of individual patient data on the impact of the BIM deletion polymorphism on treatment outcomes in epidermal growth factor receptor mutant lung cancer.

PubMed

Soh, Sheila X; Siddiqui, Fahad J; Allen, John C; Kim, Go Woon; Lee, Jae Cheol; Yatabe, Yasushi; Soda, Manabu; Mano, Hiroyuki; Soo, Ross A; Chin, Tan-Min; Ebi, Hiromichi; Yano, Seiji; Matsuo, Keitaro; Niu, Xiaomin; Lu, Shun; Isobe, Kazutoshi; Lee, Jih-Hsiang; Yang, James C; Zhao, Mingchuan; Zhou, Caicun; Lee, June-Koo; Lee, Se-Hoon; Lee, Ji Yun; Ahn, Myung-Ju; Tan, Tira J; Tan, Daniel S; Tan, Eng-Huat; Ong, S Tiong; Lim, Wan-Teck

2017-06-20

A germline deletion in the BIM (BCL2L11) gene has been shown to impair the apoptotic response to tyrosine kinase inhibitors (TKIs) in vitro but its association with poor outcomes in TKI-treated non-small cell lung cancer (NSCLC) patients remains unclear. We conducted a systematic review and meta-analysis on both aggregate and individual patient data to address this issue. In an aggregate data meta-analysis (n = 1429), the BIM deletion was associated with inferior PFS (HR = 1.51, 95%CI = 1.06-2.13, P = 0.02). Using individual patient data (n = 1200), we found a significant interaction between the deletion and ethnicity. Amongst non-Koreans, the deletion was an independent predictor of shorter PFS (Chinese: HR = 1.607, 95%CI = 1.251-2.065, P = 0.0002; Japanese: HR = 2.636, 95%CI = 1.603-4.335, P = 0.0001), and OS (HR = 1.457, 95% CI = 1.063-1.997, P = 0.019). In Kaplan-Meier analyses, the BIM deletion was associated with shorter survival in non-Koreans (PFS: 8.0 months v 11.1 months, P < 0.0005; OS: 25.7 v 30.0 months, P = 0.042). In Koreans, the BIM deletion was not predictive of PFS or OS. 10 published and 3 unpublished studies that reported survival outcomes in NSCLC patients stratified according to BIM deletion were identified from PubMed and Embase. Summary risk estimates were calculated from aggregate patient data using a random-effects model. For individual patient data, Kaplan-Meier analyses were supported by multivariate Cox regression to estimate hazard ratios (HRs) for PFS and OS. In selected populations, the BIM deletion is a significant predictor of shorter PFS and OS on EGFR-TKIs. Further studies to determine its effect on response to other BIM-dependent therapeutic agents are needed, so that alternative treatment strategies may be devised.

Strong correlation of elastin deletions, detected by FISH, with Williams syndrome: Evaluation of 235 patients

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lowery, M.C.; Brothman, L.J.; Leonard, C.O.

1995-07-01

Williams syndrome (WS) is generally characterized by mental deficiency, gregarious personality, dysmorphic facies, supravalvular aortic stenosis, and idiopathic infantile hypercalcemia. Patients with WS show allelic loss of elastin (ELN), exhibiting a submicroscopic deletion, at 7q11.23, detectable by FISH. Hemizygosity is likely the cause of vascular abnormalities in WS patients. A series of 235 patients was studied, and molecular cytogenetic deletions were seen in 96% of patients with classic WS. Patients included 195 solicited through the Williams Syndrome Association (WSA), plus 40 clinical cytogenetics cases referred by primary-care physicians. Photographs and medical records of most WSA subjects were reviewed, and patientsmore » were identified as {open_quotes}classic{open_quotes} (n = 114) or{open_quotes}uncertain{close_quotes} (n = 39). An additional 42 WSA patients were evaluated without clinical information. FISH was performed with biotinylated ELN cosmids on metaphase cells from immortalized lymphoblastoid lines from WSA patients and after high-resolution banding analysis on clinical referral patients. An alpha-satellite probe for chromosome 7 was included in hybridizations, as an internal control. Ninety-six percent of the patients with classic WS showed a deletion in one ELN allele; four of these did not show a deletion. Of the uncertain WS patients, only 3 of 39 showed a deletion. Of the 42 who were not classified phenotypically, because of lack of clinical information, 25 patients (60%) showed a deletion. Thirty-eight percent (15/40) of clinical cytogenetics cases showed an ELN deletion and no cytogenetic deletion by banded analysis. These results support the usefulness of FISH for the detection of elastin deletions as an initial diagnostic assay for WS. 14 refs., 2 figs., 4 tabs.« less

Two novel partial deletions of LDL-receptor gene in Italian patients with familial hypercholesterolemia (FH Siracusa and FH Reggio Emilia).

PubMed

Garuti, R; Lelli, N; Barozzini, M; Tiozzo, R; Ghisellini, M; Simone, M L; Li Volti, S; Garozzo, R; Mollica, F; Vergoni, W; Bertolini, S; Calandra, S

1996-03-01

In the present study we report two novel partial deletions of the LDL-R gene. The first (FH Siracusa), found in an FH-heterozygote, consists of a 20 kb deletion spanning from the 5' flanking region to the intron 2 of the LDL-receptor gene. The elimination of the promoter and the first two exons prevents the transcription of the deleted allele, as shown by Northern blot analysis of LDL-R mRNA isolated from the proband's fibroblasts. The second deletion (FH Reggio Emilia), which eliminates 11 nucleotides of exon 10, was also found in an FH heterozygote. The characterization of this deletion was made possible by a combination of techniques such as single strand conformation polymorphism (SSCP) analysis, direct sequence of exon 10 and cloning of the normal and deleted exon 10 from the proband's DNA. The 11 nt deletion occurs in a region of exon 10 which contains three triplets (CTG) and two four-nucleotides (CTGG) direct repeats. This structural feature might render this region more susceptible to a slipped mispairing during DNA duplication. Since this deletion causes a shift of the BamHI site at the 5' end of exon 10, a method has been devised for its rapid screening which is based on the PCR amplification of exon 10 followed by BamHI digestion. FH Reggio Emilia deletion produces a shift in the reading frame downstream from Lys458, leading to a sequence of 51 novel amino acids before the occurrence of a premature stop codon (truncated receptor). However, since RT-PCR failed to demonstrate the presence of the mutant LDL-R mRNA in proband fibroblasts, it is likely that the amount of truncated receptor produced in these cells is negligible.

Molecular and clinical characterization of two patients with Prader-Willi syndrome and atypical deletions of proximal chromosome 15q.

PubMed

Calounova, Gabriela; Hedvicakova, Petra; Silhanova, Eva; Kreckova, Gabriela; Sedlacek, Zdenek

2008-08-01

Prader-Willi syndrome (PWS) is caused by the disturbed expression of genes from the imprinted region of 15q11-q13, but the specific contributions of individual genes remain unknown. Most paternal PWS deletions are bracketed by recurrent breakpoints BP1 or BP2 and BP3. Atypical deletions are very rare. In the present work, we describe the molecular analysis of two patients with atypical deletions using microsatellite analysis, methylation-specific MLPA, and microarray CGH. A deletion of about 2 Mb in Patient 1 started at BP2 and ended in the middle of the typically deleted region within the UBE3A gene. The deletion in Patient 2 started 1.3 Mb distal from BP2 within the C15ORF2 gene, extended over 9.5 Mb, and ended within the AVEN gene in proximal 15q14. In Patient 1 both deletion breakpoints involved repetitive regions, which precluded cloning of the junction and pointed to non-allelic homologous recombination as a possible mechanism of this rearrangement. The breakpoints in Patient 2 were sequenced, and their structure suggested non-homologous end joining as the most likely cause of this deletion. The phenotype of both patients did not depart significantly from the typical clinical picture of PWS, although some symptoms in Patient 2 were also reminiscent of the phenotype of individuals with the recently described 15q13.3 microdeletion syndrome. Our findings support previous observations of relatively mild phenotypic effects resulting from deletions that extend distally from the PWS region and observations of the modest effects of different types of genetic defects on the spectrum and severity of symptoms in PWS. Copyright 2008 Wiley-Liss, Inc.

Deletion of ETS-1, a gene in the Jacobsen syndrome critical region, causes ventricular septal defects and abnormal ventricular morphology in mice

PubMed Central

Ye, Maoqing; Coldren, Chris; Liang, Xingqun; Mattina, Teresa; Goldmuntz, Elizabeth; Benson, D. Woodrow; Ivy, Dunbar; Perryman, M.B.; Garrett-Sinha, Lee Ann; Grossfeld, Paul

2010-01-01

Congenital heart defects comprise the most common form of major birth defects, affecting 0.7% of all newborn infants. Jacobsen syndrome (11q-) is a rare chromosomal disorder caused by deletions in distal 11q. We have previously determined that a wide spectrum of the most common congenital heart defects occur in 11q-, including an unprecedented high frequency of hypoplastic left heart syndrome (HLHS). We identified an ∼7 Mb ‘cardiac critical region’ in distal 11q that contains a putative causative gene(s) for congenital heart disease. In this study, we utilized chromosomal microarray mapping to characterize three patients with 11q- and congenital heart defects that carry interstitial deletions overlapping the 7 Mb cardiac critical region. We propose that this 1.2 Mb region of overlap harbors a gene(s) that causes at least a subset of the congenital heart defects that occur in 11q-. We demonstrate that one gene in this region, ETS-1 (a member of the ETS family of transcription factors), is expressed in the endocardium and neural crest during early mouse heart development. Gene-targeted deletion of ETS-1 in mice in a C57/B6 background causes, with high penetrance, large membranous ventricular septal defects and a bifid cardiac apex, and less frequently a non-apex-forming left ventricle (one of the hallmarks of HLHS). Our results implicate an important role for the ETS-1 transcription factor in mammalian heart development and should provide important insights into some of the most common forms of congenital heart disease. PMID:19942620

GtfA and GtfB Are Both Required for Protein O-Glycosylation in Lactobacillus plantarum

PubMed Central

Lee, I-Chiao; van Swam, Iris I.; Tomita, Satoru; Morsomme, Pierre; Rolain, Thomas; Hols, Pascal; Bron, Peter A.

2014-01-01

Acm2, the major autolysin of Lactobacillus plantarum WCFS1, was recently found to be O-glycosylated with N-acetylhexosamine, likely N-acetylglucosamine (GlcNAc). In this study, we set out to identify the glycosylation machinery by employing a comparative genomics approach to identify Gtf1 homologues, which are involved in fimbria-associated protein 1 (Fap1) glycosylation in Streptococcus parasanguinis. This in silico approach resulted in the identification of 6 candidate L. plantarum WCFS1 genes with significant homology to Gtf1, namely, tagE1 to tagE6. These candidate genes were targeted by systematic gene deletion, followed by assessment of the consequences on glycosylation of Acm2. We observed a changed mobility of Acm2 on SDS-PAGE in the tagE5E6 deletion strain, while deletion of other tagE genes resulted in Acm2 mobility comparable to that of the wild type. Subsequent mass spectrometry analysis of excised and in-gel-digested Acm2 confirmed the loss of glycosylation on Acm2 in the tagE5E6 deletion mutant, whereas a lectin blot using GlcNAc-specific succinylated wheat germ agglutinin (sWGA) revealed that besides Acm2, tagE5E6 deletion also abolished all but one other sWGA-reactive, protease-sensitive signal. Only complementation of both tagE5 and tagE6 restored those sWGA lectin signals, establishing that TagE5 and TagE6 are both required for the glycosylation of Acm2 as well as the vast majority of other sWGA-reactive proteins. Finally, sWGA lectin blotting experiments using a panel of 8 other L. plantarum strains revealed that protein glycosylation is a common feature in L. plantarum strains. With the establishment of these enzymes as protein glycosyltransferases, we propose to rename TagE5 and TagE6 as GtfA and GtfB, respectively. PMID:24532775

Common regions of deletion in chromosome regions 3p12 and 3p14.2 in primary clear cell renal carcinomas.

PubMed

Lubinski, J; Hadaczek, P; Podolski, J; Toloczko, A; Sikorski, A; McCue, P; Druck, T; Huebner, K

1994-07-15

Nearly all clear cell renal cell carcinomas (RCCs) exhibit loss of alleles on the short arm of chromosome 3. Loss and mutation at the von Hippel-Lindau (VHL) gene at 3p25 probably occurs in most RCCs and, since the VHL gene was recently cloned, data on VHL involvement in RCCs is accumulating. However, the region 3p14-p12, a region that contains the familial RCC-associated t(3;8)(p14.2;q24) chromosome translocation and the small cell lung carcinoma-associated homozygous deletion at 3p13-12, has also been reported to exhibit allele loss in a large fraction of RCCs. In order to focus future studies on potential suppressor genes in the 3p14-p12 region, we have studied allele loss in 30 RCCs with 9 polymorphic simple sequence repeat markers spanning 3p21.1-p12. Partial losses in the 3p21-p12 region were observed, allowing determination of common regions of loss of heterozygosity overlap in 15 RCCs. Results suggested that most RCCs exhibit loss in a region which brackets the t(3;8) familial chromosome translocation at 3p14.2, and some show additional deletions within the U2020 small cell lung carcinoma deletion at 3p12.

Do the exome: A case of Williams-Beuren syndrome with severe epilepsy due to a truncating de novo variant in GABRA1.

PubMed

Popp, Bernt; Trollmann, Regina; Büttner, Christian; Caliebe, Almuth; Thiel, Christian T; Hüffmeier, Ulrike; Reis, André; Zweier, Christiane

2016-10-01

Williams-Beuren syndrome (WBS) is a relatively common, clinically recognizable microdeletion syndrome. In most cases the typical heterozygous deletion of 1.5 Mb on chromosome 7q11.23 spanning about 26 genes can be identified. Also some larger or smaller atypical deletions have been reported and associated with additional or atypical phenotypic aspects. We report on an individual with typical WBS due to the common deletion and with refractory infantile spasms. Using trio-exome sequencing, we identified a de novo truncating variant c.1200del, p (Lys401Serfs*25) in GABRA1 as the likely cause of the early onset epilepsy. This unique case not only allows to further define the phenotypic spectrum of infantile epileptic encephalopathy associated with rare de novo GABRA1 variants but exemplifies the need for a sensitive review of unclear associations in clinically defined syndromes and for extended diagnostic work-up in individuals with unusual presentations of a genetically confirmed diagnosis. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

Peripheral neuropathy predicts nuclear gene defect in patients with mitochondrial ophthalmoplegia.

PubMed

Horga, Alejandro; Pitceathly, Robert D S; Blake, Julian C; Woodward, Catherine E; Zapater, Pedro; Fratter, Carl; Mudanohwo, Ese E; Plant, Gordon T; Houlden, Henry; Sweeney, Mary G; Hanna, Michael G; Reilly, Mary M

2014-12-01

Progressive external ophthalmoplegia is a common clinical feature in mitochondrial disease caused by nuclear DNA defects and single, large-scale mitochondrial DNA deletions and is less frequently associated with point mutations of mitochondrial DNA. Peripheral neuropathy is also a frequent manifestation of mitochondrial disease, although its prevalence and characteristics varies considerably among the different syndromes and genetic aetiologies. Based on clinical observations, we systematically investigated whether the presence of peripheral neuropathy could predict the underlying genetic defect in patients with progressive external ophthalmoplegia. We analysed detailed demographic, clinical and neurophysiological data from 116 patients with genetically-defined mitochondrial disease and progressive external ophthalmoplegia. Seventy-eight patients (67%) had a single mitochondrial DNA deletion, 12 (10%) had a point mutation of mitochondrial DNA and 26 (22%) had mutations in either POLG, C10orf2 or RRM2B, or had multiple mitochondrial DNA deletions in muscle without an identified nuclear gene defect. Seventy-seven patients had neurophysiological studies; of these, 16 patients (21%) had a large-fibre peripheral neuropathy. The prevalence of peripheral neuropathy was significantly lower in patients with a single mitochondrial DNA deletion (2%) as compared to those with a point mutation of mitochondrial DNA or with a nuclear DNA defect (44% and 52%, respectively; P<0.001). Univariate analyses revealed significant differences in the distribution of other clinical features between genotypes, including age at disease onset, gender, family history, progressive external ophthalmoplegia at clinical presentation, hearing loss, pigmentary retinopathy and extrapyramidal features. However, binomial logistic regression analysis identified peripheral neuropathy as the only independent predictor associated with a nuclear DNA defect (P=0.002; odds ratio 8.43, 95% confidence interval 2.24-31.76). Multinomial logistic regression analysis identified peripheral neuropathy, family history and hearing loss as significant predictors of the genotype, and the same three variables showed the highest performance in genotype classification in a decision tree analysis. Of these variables, peripheral neuropathy had the highest specificity (91%), negative predictive value (83%) and positive likelihood ratio (5.87) for the diagnosis of a nuclear DNA defect. These results indicate that peripheral neuropathy is a rare finding in patients with single mitochondrial DNA deletions but that it is highly predictive of an underlying nuclear DNA defect. This observation may facilitate the development of diagnostic algorithms. We suggest that nuclear gene testing may enable a more rapid diagnosis and avoid muscle biopsy in patients with progressive external ophthalmoplegia and peripheral neuropathy. © The Author (2014). Published by Oxford University Press on behalf of the Guarantors of Brain.

Peripheral neuropathy predicts nuclear gene defect in patients with mitochondrial ophthalmoplegia

PubMed Central

Pitceathly, Robert D. S.; Blake, Julian C.; Woodward, Catherine E.; Zapater, Pedro; Fratter, Carl; Mudanohwo, Ese E.; Plant, Gordon T.; Houlden, Henry; Sweeney, Mary G.; Hanna, Michael G.; Reilly, Mary M.

2014-01-01

Progressive external ophthalmoplegia is a common clinical feature in mitochondrial disease caused by nuclear DNA defects and single, large-scale mitochondrial DNA deletions and is less frequently associated with point mutations of mitochondrial DNA. Peripheral neuropathy is also a frequent manifestation of mitochondrial disease, although its prevalence and characteristics varies considerably among the different syndromes and genetic aetiologies. Based on clinical observations, we systematically investigated whether the presence of peripheral neuropathy could predict the underlying genetic defect in patients with progressive external ophthalmoplegia. We analysed detailed demographic, clinical and neurophysiological data from 116 patients with genetically-defined mitochondrial disease and progressive external ophthalmoplegia. Seventy-eight patients (67%) had a single mitochondrial DNA deletion, 12 (10%) had a point mutation of mitochondrial DNA and 26 (22%) had mutations in either POLG, C10orf2 or RRM2B, or had multiple mitochondrial DNA deletions in muscle without an identified nuclear gene defect. Seventy-seven patients had neurophysiological studies; of these, 16 patients (21%) had a large-fibre peripheral neuropathy. The prevalence of peripheral neuropathy was significantly lower in patients with a single mitochondrial DNA deletion (2%) as compared to those with a point mutation of mitochondrial DNA or with a nuclear DNA defect (44% and 52%, respectively; P < 0.001). Univariate analyses revealed significant differences in the distribution of other clinical features between genotypes, including age at disease onset, gender, family history, progressive external ophthalmoplegia at clinical presentation, hearing loss, pigmentary retinopathy and extrapyramidal features. However, binomial logistic regression analysis identified peripheral neuropathy as the only independent predictor associated with a nuclear DNA defect (P = 0.002; odds ratio 8.43, 95% confidence interval 2.24–31.76). Multinomial logistic regression analysis identified peripheral neuropathy, family history and hearing loss as significant predictors of the genotype, and the same three variables showed the highest performance in genotype classification in a decision tree analysis. Of these variables, peripheral neuropathy had the highest specificity (91%), negative predictive value (83%) and positive likelihood ratio (5.87) for the diagnosis of a nuclear DNA defect. These results indicate that peripheral neuropathy is a rare finding in patients with single mitochondrial DNA deletions but that it is highly predictive of an underlying nuclear DNA defect. This observation may facilitate the development of diagnostic algorithms. We suggest that nuclear gene testing may enable a more rapid diagnosis and avoid muscle biopsy in patients with progressive external ophthalmoplegia and peripheral neuropathy. PMID:25281868

Rearrangement and allelic imbalance on chromosome 5 leads to homozygous deletions in the CDKN2A/2B tumor suppressor gene region in rat endometrial cancer.

PubMed

Adamovic, Tatjana; Hamta, Ahmad; Roshani, Leyla; Lü, Xuchun; Röhme, Dan; Helou, Khalil; Klinga-Levan, Karin; Levan, Göran

2008-07-01

The inbred BDII rat is a valuable experimental model for the genetic analysis of hormone-dependent endometrial adenocarcinoma (EAC). One common aberration detected previously by comparative genomic hybridization in rat EAC is loss affecting mostly the middle part of rat chromosome 5 (RNO5). First, we applied an RNO5-specific painting probe and four region-specific gene probes onto tumor cell metaphases from 21 EACs, and found that rearrangements involving RNO5 were common. The copy numbers of loci situated on RNO5 were found to be reduced, particularly for the CDKN2A/2B locus. Second, polymerase chain reaction analysis was performed with 22 genes and markers and homozygous deletions of the CDKN2A exon 1beta and CDKN2B genes were detected in 13 EACs (62%) and of CDKN2A exon 1alpha in 12 EACs (57%) Third, the occurrence of allelic imbalance in RNO5 was analyzed using 39 microsatellite markers covering the entire chromosome and frequent loss of heterozygosity was detected. Even more intriguing was the repeated finding of allele switching in a narrow region of 7 Mb across the CDKN2A/2B locus. We conclude that genetic events affecting the middle part of RNO5 (including bands 5q31 approximately q33 and the CDKN2A locus) contribute to the development of EAC in rat, with the CDKN2A locus having a primary role.

Case report: cytogenetic and molecular analysis of proximal interstitial deletion of 4p, review of the literature and comparison with wolf-hirschhorn syndrome.

PubMed

Bailey, Nathanael G; South, Sarah T; Hummel, Marybeth; Wenger, Sharon L

2010-01-01

We report on a two-year-old female with a de novo proximal interstitial deletion of the short arm of chromosome 4 and a tetralogy of Fallot malformation. The patient had a karyotype of 46,XX,del(4)(p14p15.33) that was further characterized by array comparative genomic hybridization (aCGH). Phenotypic abnormalities for our patient are compared with those of previously reported patients with similar proximal 4p deletions as well as more distal deletions. The functions of genes that are deleted within this segment are reviewed.

Copy Number Variation in Obsessive-Compulsive Disorder and Tourette Syndrome: A Cross-Disorder Study

PubMed Central

McGrath, Lauren M.; Yu, Dongmei; Marshall, Christian; Davis, Lea K.; Thiruvahindrapuram, Bhooma; Li, Bingbin; Cappi, Carolina; Gerber, Gloria; Wolf, Aaron; Schroeder, Frederick A.; Osiecki, Lisa; O’Dushlaine, Colm; Kirby, Andrew; Illmann, Cornelia; Haddad, Stephen; Gallagher, Patience; Fagerness, Jesen A.; Barr, Cathy L.; Bellodi, Laura; Benarroch, Fortu; Bienvenu, O. Joseph; Black, Donald W.; Bloch, Michael H.; Bruun, Ruth D.; Budman, Cathy L.; Camarena, Beatriz; Cath, Danielle C.; Cavallini, Maria C.; Chouinard, Sylvain; Coric, Vladimir; Cullen, Bernadette; Delorme, Richard; Denys, Damiaan; Derks, Eske M.; Dion, Yves; Rosário, Maria C.; Eapen, Valsama; Evans, Patrick; Falkai, Peter; Fernandez, Thomas; Garrido, Helena; Geller, Daniel; Grabe, Hans J.; Grados, Marco A.; Greenberg, Benjamin D.; Gross-Tsur, Varda; Grünblatt, Edna; Heiman, Gary A.; Hemmings, Sian M.J.; Herrera, Luis D.; Hounie, Ana G.; Jankovic, Joseph; Kennedy, James L; King, Robert A.; Kurlan, Roger; Lanzagorta, Nuria; Leboyer, Marion; Leckman, James F.; Lennertz, Leonhard; Lochner, Christine; Lowe, Thomas L.; Lyon, Gholson J.; Macciardi, Fabio; Maier, Wolfgang; McCracken, James T.; McMahon, William; Murphy, Dennis L.; Naarden, Allan L; Neale, Benjamin M; Nurmi, Erika; Pakstis, Andrew J.; Pato, Michele T.; Pato, Carlos N.; Piacentini, John; Pittenger, Christopher; Pollak, Yehuda; Reus, Victor I.; Richter, Margaret A.; Riddle, Mark; Robertson, Mary M.; Rosenberg, David; Rouleau, Guy A.; Ruhrmann, Stephan; Sampaio, Aline S.; Samuels, Jack; Sandor, Paul; Sheppard, Brooke; Singer, Harvey S.; Smit, Jan H.; Stein, Dan J.; Tischfield, Jay A.; Vallada, Homero; Veenstra-VanderWeele, Jeremy; Walitza, Susanne; Wang, Ying; Wendland, Jens R.; Shugart, Yin Yao; Miguel, Euripedes C.; Nicolini, Humberto; Oostra, Ben A.; Moessner, Rainald; Wagner, Michael; Ruiz-Linares, Andres; Heutink, Peter; Nestadt, Gerald; Freimer, Nelson; Petryshen, Tracey; Posthuma, Danielle; Jenike, Michael A.; Cox, Nancy J.; Hanna, Gregory L.; Brentani, Helena; Scherer, Stephen W.; Arnold, Paul D.; Stewart, S. Evelyn; Mathews, Carol A.; Knowles, James A.; Cook, Edwin H.; Pauls, David L.; Wang, Kai; Scharf, Jeremiah M.

2014-01-01

Objective Obsessive-compulsive disorder (OCD) and Tourette syndrome (TS) are heritable, neurodevelopmental disorders with a partially shared genetic etiology. This study represents the first genome-wide investigation of large (>500kb), rare (<1%) copy number variants (CNVs) in OCD and the largest genome-wide CNV analysis in TS to date. Method The primary analyses utilized a cross-disorder design for 2,699 patients (1,613 ascertained for OCD, 1,086 ascertained for TS) and 1,789 controls. Parental data facilitated a de novo analysis in 348 OCD trios. Results Although no global CNV burden was detected in the cross-disorder analysis or in secondary, disease-specific analyses, there was a 3.3-fold increased burden of large deletions previously associated with other neurodevelopmental disorders (p=.09). Half of these neurodevelopmental deletions were located in a single locus, 16p13.11 (5 patient deletions: 0 control deletions, p=0.08 in current study, p=0.025 compared to published controls). Three 16p13.11 deletions were confirmed de novo, providing further support to the etiological significance of this region. The overall OCD de novo rate was 1.4%, which is intermediate between published rates in controls (0.7%) and in autism or schizophrenia (2–4%). Conclusion Several converging lines of evidence implicate 16p13.11 deletions in OCD, with weaker evidence for a role in TS. The trend toward increased overall neurodevelopmental CNV burden in TS and OCD suggests that deletions previously associated with other neurodevelopmental disorders may also contribute to these phenotypes. PMID:25062598

A large germline deletion in the Chek2 kinase gene is associated with an increased risk of prostate cancer

PubMed Central

Cybulski, C; Wokołorczyk, D; Huzarski, T; Byrski, T; Gronwald, J; Górski, B; Dębniak, T; Masojć, B; Jakubowska, A; Gliniewicz, B; Sikorski, A; Stawicka, M; Godlewski, D; Kwias, Z; Antczak, A; Krajka, K; Lauer, W; Sosnowski, M; Sikorska‐Radek, P; Bar, K; Klijer, R; Zdrojowy, R; Małkiewicz, B; Borkowski, A; Borkowski, T; Szwiec, M; Narod, S A; Lubiński, J

2006-01-01

Background Germline mutations in the Chek2 kinase gene (CHEK2) have been associated with a range of cancer types. Recently, a large deletion of exons 9 and 10 of CHEK2 was identified in several unrelated patients with breast cancer of Czech or Slovak origin. The geographical and ethnic extent of this founder allele has not yet been determined. Participants and methods We assayed for the presence of this deletion, and of three other CHEK2 founder mutations, in 1864 patients with prostate cancer and 5496 controls from Poland. Results The deletion was detected in 24 of 5496 (0.4%) controls from the general population, and is the most common CHEK2 truncating founder allele in Polish patients. The deletion was identified in 15 of 1864 (0.8%) men with unselected prostate cancer (OR 1.9; 95% CI 0.97 to 3.5; p = 0.09) and in 4 of 249 men with familial prostate cancer (OR 3.7; 95% CI 1.3 to 10.8; p = 0.03). These ORs were similar to those associated with the other truncating mutations (IVS2+1G→A, 1100delC). Conclusion A large deletion of exons 9 and 10 of CHEK2 confers an increased risk of prostate cancer in Polish men. The del5395 founder deletion might be present in other Slavic populations, including Ukraine, Belarus, Russia, Baltic and Balkan countries. It will be of interest to see to what extent this deletion is responsible for the burden of prostate cancer in other populations. PMID:17085682

Genes commonly deleted in childhood B-cell precursor acute lymphoblastic leukemia: association with cytogenetics and clinical features

PubMed Central

Schwab, Claire J.; Chilton, Lucy; Morrison, Heather; Jones, Lisa; Al-Shehhi, Halima; Erhorn, Amy; Russell, Lisa J.; Moorman, Anthony V.; Harrison, Christine J.

2013-01-01

In childhood B-cell precursor acute lymphoblastic leukemia, cytogenetics is important in diagnosis and as an indicator of response to therapy, thus playing a key role in risk stratification of patients for treatment. Little is known of the relationship between different cytogenetic subtypes in B-cell precursor acute lymphoblastic leukemia and the recently reported copy number abnormalities affecting significant leukemia associated genes. In a consecutive series of 1427 childhood B-cell precursor acute lymphoblastic leukemia patients, we have determined the incidence and type of copy number abnormalities using multiplex ligation-dependent probe amplification. We have shown strong links between certain deletions and cytogenetic subtypes, including the novel association between RB1 deletions and intrachromosomal amplification of chromosome 21. In this study, we characterized the different copy number abnormalities and show heterogeneity of PAX5 and IKZF1 deletions and the recurrent nature of RB1 deletions. Whole gene losses are often indicative of larger deletions, visible by conventional cytogenetics. An increased number of copy number abnormalities is associated with NCI high risk, specifically deletions of IKZF1 and CDKN2A/B, which occur more frequently among these patients. IKZF1 deletions and rearrangements of CRLF2 among patients with undefined karyotypes may point to the poor risk BCR-ABL1-like group. In conclusion, this study has demonstrated in a large representative cohort of children with B-cell precursor acute lymphoblastic leukemia that the pattern of copy number abnormalities is highly variable according to the primary genetic abnormality. PMID:23508010

Subtelomeric deletions of chromosome 6p: molecular and cytogenetic characterization of three new cases with phenotypic overlap with Ritscher-Schinzel (3C) syndrome.

PubMed

Descipio, Cheryl; Schneider, Lori; Young, Terri L; Wasserman, Nora; Yaeger, Dinah; Lu, Fengmin; Wheeler, Patricia G; Williams, Marc S; Bason, Lynn; Jukofsky, Lori; Menon, Ammini; Geschwindt, Ryan; Chudley, Albert E; Saraiva, Jorge; Schinzel, Albert A G L; Guichet, Agnes; Dobyns, William E; Toutain, Annick; Spinner, Nancy B; Krantz, Ian D

2005-04-01

We have identified six children in three families with subtelomeric deletions of 6p25 and a recognizable phenotype consisting of ptosis, posterior embryotoxon, optic nerve abnormalities, mild glaucoma, Dandy-Walker malformation, hydrocephalus, atrial septal defect, patent ductus arteriosus, and mild mental retardation. There is considerable clinical overlap between these children and individuals with the Ritscher-Schinzel (or cranio-cerebello-cardiac (3C)) syndrome (OMIM #220210). Clinical features of 3C syndrome include craniofacial anomalies (macrocephaly, prominent forehead and occiput, foramina parietalia, hypertelorism, down-slanting palpebral fissures, ocular colobomas, depressed nasal bridge, narrow or cleft palate, and low-set ears), cerebellar malformations (variable manifestations of a Dandy-Walker malformation with moderate mental retardation), and cardiac defects (primarily septal defects). Since the original report, over 25 patients with 3C syndrome have been reported. Recessive inheritance has been postulated based on recurrence in siblings born to unaffected parents and parental consanguinity in two familial cases. Molecular and cytogenetic mapping of the 6p deletions in these three families with subtelomeric deletions of chromosome 6p have defined a 1.3 Mb minimally deleted critical region. To determine if 6p deletions are common in 3C syndrome, we analyzed seven unrelated individuals with 3C syndrome for deletions of this region. Three forkhead genes (FOXF1 and FOXQ1 from within the critical region, and FOXC1 proximal to this region) were evaluated as potential candidate disease genes for this disorder. No deletions or disease-causing mutations were identified.

Chemical-genetic profile analysis in yeast suggests that a previously uncharacterized open reading frame, YBR261C, affects protein synthesis

PubMed Central

Alamgir, Md; Eroukova, Veronika; Jessulat, Matthew; Xu, Jianhua; Golshani, Ashkan

2008-01-01

Background Functional genomics has received considerable attention in the post-genomic era, as it aims to identify function(s) for different genes. One way to study gene function is to investigate the alterations in the responses of deletion mutants to different stimuli. Here we investigate the genetic profile of yeast non-essential gene deletion array (yGDA, ~4700 strains) for increased sensitivity to paromomycin, which targets the process of protein synthesis. Results As expected, our analysis indicated that the majority of deletion strains (134) with increased sensitivity to paromomycin, are involved in protein biosynthesis. The remaining strains can be divided into smaller functional categories: metabolism (45), cellular component biogenesis and organization (28), DNA maintenance (21), transport (20), others (38) and unknown (39). These may represent minor cellular target sites (side-effects) for paromomycin. They may also represent novel links to protein synthesis. One of these strains carries a deletion for a previously uncharacterized ORF, YBR261C, that we term TAE1 for Translation Associated Element 1. Our focused follow-up experiments indicated that deletion of TAE1 alters the ribosomal profile of the mutant cells. Also, gene deletion strain for TAE1 has defects in both translation efficiency and fidelity. Miniaturized synthetic genetic array analysis further indicates that TAE1 genetically interacts with 16 ribosomal protein genes. Phenotypic suppression analysis using TAE1 overexpression also links TAE1 to protein synthesis. Conclusion We show that a previously uncharacterized ORF, YBR261C, affects the process of protein synthesis and reaffirm that large-scale genetic profile analysis can be a useful tool to study novel gene function(s). PMID:19055778

Chemical-genetic profile analysis in yeast suggests that a previously uncharacterized open reading frame, YBR261C, affects protein synthesis.

PubMed

Alamgir, Md; Eroukova, Veronika; Jessulat, Matthew; Xu, Jianhua; Golshani, Ashkan

2008-12-03

Functional genomics has received considerable attention in the post-genomic era, as it aims to identify function(s) for different genes. One way to study gene function is to investigate the alterations in the responses of deletion mutants to different stimuli. Here we investigate the genetic profile of yeast non-essential gene deletion array (yGDA, approximately 4700 strains) for increased sensitivity to paromomycin, which targets the process of protein synthesis. As expected, our analysis indicated that the majority of deletion strains (134) with increased sensitivity to paromomycin, are involved in protein biosynthesis. The remaining strains can be divided into smaller functional categories: metabolism (45), cellular component biogenesis and organization (28), DNA maintenance (21), transport (20), others (38) and unknown (39). These may represent minor cellular target sites (side-effects) for paromomycin. They may also represent novel links to protein synthesis. One of these strains carries a deletion for a previously uncharacterized ORF, YBR261C, that we term TAE1 for Translation Associated Element 1. Our focused follow-up experiments indicated that deletion of TAE1 alters the ribosomal profile of the mutant cells. Also, gene deletion strain for TAE1 has defects in both translation efficiency and fidelity. Miniaturized synthetic genetic array analysis further indicates that TAE1 genetically interacts with 16 ribosomal protein genes. Phenotypic suppression analysis using TAE1 overexpression also links TAE1 to protein synthesis. We show that a previously uncharacterized ORF, YBR261C, affects the process of protein synthesis and reaffirm that large-scale genetic profile analysis can be a useful tool to study novel gene function(s).

Molecular Inversion Probe Analysis of Gene Copy Alterations Reveals Distinct Categories of Colorectal Carcinoma

PubMed Central

Ji, Hanlee; Kumm, Jochen; Zhang, Michael; Farnam, Kyle; Salari, Keyan; Faham, Malek; Ford, James M.; Davis, Ronald W.

2006-01-01

Genomic instability is a major feature of neoplastic development in colorectal carcinoma and other cancers. Specific genomic instability events, such as deletions in chromosomes and other alterations in gene copy number, have potential utility as biologically relevant prognostic biomarkers. For example, genomic deletions on chromosome arm 18q are an indicator of colorectal carcinoma behavior and potentially useful as a prognostic indicator. Adapting a novel genomic technology called molecular inversion probes which can determine gene copy alterations, such as genomic deletions, we designed a set of probes to interrogate several hundred individual exons of >200 cancer genes with an overall distribution covering all chromosome arms. In addition, >100 probes were designed in close proximity of microsatellite markers on chromosome arm 18q. We analyzed a set of colorectal carcinoma cell lines and primary colorectal tumor samples for gene copy alterations and deletion mutations in exons. Based on clustering analysis, we distinguished the different categories of genomic instability among the colorectal cancer cell lines. Our analysis of primary tumors uncovered several distinct categories of colorectal carcinoma, each with specific patterns of 18q deletions and deletion mutations in specific genes. This finding has potential clinical ramifications given the application of 18q loss of heterozygosity events as a potential indicator for adjuvant treatment in stage II colorectal carcinoma. PMID:16912164

Reduced expression of APC-1B but not APC-1A by the deletion of promoter 1B is responsible for familial adenomatous polyposis.

PubMed

Yamaguchi, Kiyoshi; Nagayama, Satoshi; Shimizu, Eigo; Komura, Mitsuhiro; Yamaguchi, Rui; Shibuya, Tetsuo; Arai, Masami; Hatakeyama, Seira; Ikenoue, Tsuneo; Ueno, Masashi; Miyano, Satoru; Imoto, Seiya; Furukawa, Yoichi

2016-05-24

Germline mutations in the tumor suppressor gene APC are associated with familial adenomatous polyposis (FAP). Here we applied whole-genome sequencing (WGS) to the DNA of a sporadic FAP patient in which we did not find any pathological APC mutations by direct sequencing. WGS identified a promoter deletion of approximately 10 kb encompassing promoter 1B and exon1B of APC. Additional allele-specific expression analysis by deep cDNA sequencing revealed that the deletion reduced the expression of the mutated APC allele to as low as 11.2% in the total APC transcripts, suggesting that the residual mutant transcripts were driven by other promoter(s). Furthermore, cap analysis of gene expression (CAGE) demonstrated that the deleted promoter 1B region is responsible for the great majority of APC transcription in many tissues except the brain. The deletion decreased the transcripts of APC-1B to 39-45% in the patient compared to the healthy controls, but it did not decrease those of APC-1A. Different deletions including promoter 1B have been reported in FAP patients. Taken together, our results strengthen the evidence that analysis of structural variations in promoter 1B should be considered for the FAP patients whose pathological mutations are not identified by conventional direct sequencing.

A resource for functional profiling of noncoding RNA in the yeast Saccharomyces cerevisiae.

PubMed

Parker, Steven; Fraczek, Marcin G; Wu, Jian; Shamsah, Sara; Manousaki, Alkisti; Dungrattanalert, Kobchai; de Almeida, Rogerio Alves; Estrada-Rivadeneyra, Diego; Omara, Walid; Delneri, Daniela; O'Keefe, Raymond T

2017-08-01

Eukaryotic genomes are extensively transcribed, generating many different RNAs with no known function. We have constructed 1502 molecular barcoded ncRNA gene deletion strains encompassing 443 ncRNAs in the yeast Saccharomyces cerevisiae as tools for ncRNA functional analysis. This resource includes deletions of small nuclear RNAs (snRNAs), transfer RNAs (tRNAs), small nucleolar RNAs (snoRNAs), and other annotated ncRNAs as well as the more recently identified stable unannotated transcripts (SUTs) and cryptic unstable transcripts (CUTs) whose functions are largely unknown. Specifically, deletions have been constructed for ncRNAs found in the intergenic regions, not overlapping genes or their promoters (i.e., at least 200 bp minimum distance from the closest gene start codon). The deletion strains carry molecular barcodes designed to be complementary with the protein gene deletion collection enabling parallel analysis experiments. These strains will be useful for the numerous genomic and molecular techniques that utilize deletion strains, including genome-wide phenotypic screens under different growth conditions, pooled chemogenomic screens with drugs or chemicals, synthetic genetic array analysis to uncover novel genetic interactions, and synthetic dosage lethality screens to analyze gene dosage. Overall, we created a valuable resource for the RNA community and for future ncRNA research. © 2017 Parker et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

UCP2 and 3 deletion screening and distribution in 15 pig breeds.

PubMed

Li, Yanhua; Li, Hanjie; Zhao, Xingbo; Li, Ning; Wu, Changxin

2007-02-01

The uncoupling protein family is a mitochondrial anion carrier family. It plays an important role in the biological traits of animal body weight, basal metabolic rate and energy conversion. Using PCR and PCR-SSCP, we scanned the porcine uncoupling protein 2 gene (UCP2) and uncoupling protein 3 gene (UCP3) and found seven deletion sites, three in UCP2 and four in UCP3. The deletions in 15 pig breeds showed that deletion influenced weight. The genotype compounding of seven deletion sites in 15 pig breeds had significant effects on performance traits of the pig, such as body weight. We predicted the potential protein factor binding sites using the transcription factor analysis tool TFSearch version 1.3 online. Two deletions (1830 nt and 3219 nt) in UCP3 were found to change the transcriptional factor sites. The 16 bp deletion in 1830 nt added a SP1 site and a 6 bp deletion in 3219 nt removed two MZF1 sites. Seven deletion polymorphisms were covered in introns of linkage genes of UCP2 and UCP3, showing that UCPs have conservation and genetic reliability.

Ugene, a newly identified protein that is commonly over-expressed in cancer, and that binds uracil DNA-glycosylase

PubMed Central

Guo, Chunguang; Zhang, Xiaodong; Fink, Stephen P; Platzer, Petra; Wilson, Keith; Willson, James K. V.; Wang, Zhenghe; Markowitz, Sanford D

2008-01-01

Expression microarrays identified a novel transcript, designated as Ugene, whose expression is absent in normal colon and colon adenomas, but that is commonly induced in malignant colon cancers. These findings were validated by real-time PCR and Northern blot analysis in an independent panel of colon cancer cases. In addition, Ugene expression was found to be elevated in many other common cancer types, including, breast, lung, uterus, and ovary. Immunofluorescence of V5-tagged Ugene revealed it to have a nuclear localization. In a pull-down assay, uracil DNA-glycosylase 2 (UNG2), an important enzyme in the base excision repair pathway, was identified as a partner protein that binds to Ugene. Co-immunoprecipitation and Western blot analysis confirmed the binding between the endogenous Ugene and UNG2 proteins. Using deletion constructs, we find that Ugene binds to the first 25 amino acids of the UNG2 NH2-terminus. We suggest Ugene induction in cancer may contribute to the cancer phenotype by interacting with the base excision repair pathway. PMID:18676834

MAOA/B deletion syndrome in male siblings with severe developmental delay and sudden loss of muscle tonus.

PubMed

Saito, Mari; Yamagata, Takanori; Matsumoto, Ayumi; Shiba, Yusuke; Nagashima, Masako; Taniguchi, Shuhei; Jimbo, Eriko; Momoi, Mariko Y

2014-01-01

Deletion of the monoamine oxidase (MAO)-A and MAO-B was detected in two male siblings and in their mother. The approximately 800-kb deletion, extending from about 43.0MB to 43.8MB, was detected by array comparative genomic hybridization analysis. The MAOA and MAOB genes were included in the deletion, but the adjacent Norrie disease gene, NDP, was not deleted. The boys had short stature, hypotonia, severe developmental delays, episodes of sudden loss of muscle tone, exiting behavior, lip-smacking and autistic features. The serotonin levels in their cerebrospinal fluid were extremely elevated. Another set of siblings with this deletion was reported previously. We propose recognition of MAOA/B deletion syndrome as a distinct disorder. Copyright © 2013 The Japanese Society of Child Neurology. Published by Elsevier B.V. All rights reserved.

Deletions spanning the neurofibromatosis I gene: Identification and phenotype of five patients

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kayes, L.M.; Burke, W.; Bennett, R.

Neurofibromatosis type 1 (NF1) is an autosomal dominant disorder characterized by marked variation in clinical severity. To investigate the contribution to variability by genes either contiguous to or contained within the NF1 gene, the authors screened six NF1 patients with mild facial dysmorphology, mental retardation, and/or learning disabilities, for DNA rearrangement of the NF1 region. Five of the six patients had NF1 gene deletions on the basis of quantitative densitometry, locus hemizygosity, and analysis of somatic cell hybrid lines. Analysis of hybrid lines carrying each of the patient's chromosomes 17, with 15 regional DNA markers, demonstrated that each of themore » five patients carried a deletion >700 kb in size. Minimally, each of the deletions involved the entire 350-kb NF1 gene; the three genes - EVI2A, EVI2B, and OMG-that are contained within an NF1 intron; and considerable flanking DNA. For four of the patients, the deletions mapped to the same interval; the deletion in the fifth patient was larger, extending farther in both directions. The remaining NF1 allele presumably produced functional neurofibromin; no gene rearrangements were detected, and RNA-PCR demonstrated that it was transcribed. These data provide compelling evidence that the NF1 disorder results from haploid insufficiency of neurofibromin. Of the three documented de novo deletion cases, two involved the paternal NF1 allele and one the maternal allele. The parental origin of the single remaining expresses NF1 allele had no dramatic effect on patient phenotype. The deletion patients exhibited a variable number of physical anomalies that were not correlated with the extent of their deletion. All five patients with deletions were remarkable for exhibiting a large number of neurfibromas for their age, suggesting that deletion of an unknown gene in the NF1 region may affect tumor initiation or development. 69 refs., 5 figs., 1 tab.« less

Potential Diagnostic and Prognostic Value of Lymphocytic Mitochondrial DNA Deletion in Relation to Folic Acid Status in HCV-Related Hepatocellular Carcinoma

PubMed Central

Zekri, Abdel Rahman N; Salama, Hosny; Medhat, Eman; Hamdy, Sherif; Hassan, Zeinab K; Bakr, Yasser Mabrouk; Youssef, Amira Salah El - Din; Saleh, Doaa; Saeed, Ramy; Omran, Dalia

2017-01-01

Objective: We assessed the possibility of using mitochondrial (mt) DNA deletion as a molecular biomarker for disease progression in HCV-related hepatocellular carcinoma (HCC) and to identify its association with folic acid status. Methods: Serum folic acid and lymphocytic mtDNA deletions were assessed in 90 patients; 50 with HCC, 20 with liver cirrhosis (LC), and 20 with chronic hepatitis C (CHC) compared to 10 healthy control subjects. The diagnostic accuracy of mtDNA deletions frequency was evaluated using receiver-operating characteristic (ROC) curve analysis Survival analysis was performed using the Kaplan-Meier method. Differences in the survival rates were compared using log-rank test. Result: Our data revealed a significant elevation of mtDNA deletions frequency in the HCC group compared to the other groups (P-value <0.01). Also, our data showed a significant correlation between folate deficiency and high frequency of mtDNA deletions in patients with HCV-related HCC when compared to the other groups (r= -0.094 and P-value <0.05). Moreover, the size of the hepatic focal lesion in the HCC patients was positively correlated with mtDNA deletions (r= 0.09 and P-value <0.01). The median survival time for the HCC patients with high frequency of mtDNA deletions (∆Ct ≥3.9; 5.7+ 0.6 months) was significantly shorter than those with low mtDNA deletions frequency (∆Ct < 3.9; 11.9+ 0.04 months, P-value <0.01). Conclusion: Our data provided an evidence that lymphocytic mtDNA deletion could be used as non-invasive biomarker for disease progression and patients’ survival in HCV-related HCC. Also, our findings implied a causal relationship between the folate deficiency and the high mtDNA deletions frequency among Egyptian patients with HCV related HCC. PMID:28952275

Design and Validation of a New MLPA-Based Assay for the Detection of RS1 Gene Deletions and Application in a Large Family with X-Linked Juvenile Retinoschisis.

PubMed

Nicoletti, Annalisa; Ziccardi, Lucia; Maltese, Paolo Enrico; Benedetti, Sabrina; Palumbo, Orazio; Rendina, Michelina; D'Agruma, Leonardo; Falsini, Benedetto; Wang, Xinjing; Bertelli, Matteo

2017-02-01

X-linked juvenile retinoschisis (XLRS) is a severe ocular disorder that can evolve to blindness. More than 200 different disease-causing mutations have been reported in the RS1 gene and approximately 10% of these are deletions. Since transmission is X-linked, males are always affected and females are usually carriers. The identification of female carriers is always important and poses a technical challenge. Therefore, we sought to develop a multiplex ligation dependent probe amplification (MLPA)-based method to identify deletions or duplications in this gene. We then used our assay to study a large XLRS family. We designed six probes specific for each RS1 exon and then optimized and validated our method using control samples with known gene deletions. In the XLRS family, RS1 gene copy number variation was assessed by "home-made" MLPA analysis and by single nucleotide polymorphism (SNP) array analysis using the CytoScan HD Array. Direct sequencing was used for deletion breakpoint mapping. Our assay detected all deletions in control samples. All affected males of the family were positive for a deletion of exon 2 of the RS1 gene (RS1:NM_000330:c.53-?_78+?del). Carrier females were also identified. Our method is easily replicated, reliable, and inexpensive and allows female carriers to be detected. This is the first report of deep characterization of a whole exon deletion in the RS1 gene.

Haptoglobin genotyping of Vietnamese: global distribution of HP del, complete deletion allele of the HP gene.

PubMed

Soejima, Mikiko; Agusa, Tetsuro; Iwata, Hisato; Fujihara, Junko; Kunito, Takashi; Takeshita, Haruo; Lan, Vi Thi Mai; Minh, Tu Binh; Takahashi, Shin; Trang, Pham Thi Kim; Viet, Pham Hung; Tanabe, Shinsuke; Koda, Yoshiro

2015-01-01

The haptoglobin (HP) gene deletion allele (HP(del)) is responsible for anhaptoglobinemia and a genetic risk factor for anaphylaxis reaction after transfusion due to production of the anti-HP antibody. The distribution of this allele has been explored by several groups including ours. Here, we studied the frequency of HP(del) in addition to the distribution of common HP genotypes in 293 Vietnamese. The HP(del) was encountered with the frequency of 0.020. The present result suggested that this deletion allele is restricted to East and Southeast Asians. Thus, this allele seems to be a potential ancestry informative marker for these populations. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

Increased CNV-Region deletions in mild cognitive impairment (MCI) and Alzheimer's disease (AD) subjects in the ADNI sample

PubMed Central

Guffanti, Guia; Torri, Federica; Rasmussen, Jerod; Clark, Andrew P.; Lakatos, Anita; Turner, Jessica A.; Fallon, James H.; Saykin, Andrew J.; Weiner, Michael; Vawter, Marquis P.; Knowles, James A.; Potkin, Steven G.; Macciardi, Fabio

2014-01-01

We investigated the genome-wide distribution of CNVs in the Alzheimer's disease (AD) Neuroimaging Initiative (ADNI) sample (146 with AD, 313 with Mild Cognitive Impairment (MCI), and 181 controls). Comparison of single CNVs between cases (MCI and AD) and controls shows overrepresentation of large heterozygous deletions in cases (p-value < 0.0001). The analysis of CNV-Regions identifies 44 copy number variable loci of heterozygous deletions, with more CNV-Regions among affected than controls (p = 0.005). Seven of the 44 CNV-Regions are nominally significant for association with cognitive impairment. We validated and confirmed our main findings with genome re-sequencing of selected patients and controls. The functional pathway analysis of the genes putatively affected by deletions of CNV-Regions reveals enrichment of genes implicated in axonal guidance, cell–cell adhesion, neuronal morphogenesis and differentiation. Our findings support the role of CNVs in AD, and suggest an association between large deletions and the development of cognitive impairment PMID:23583670

Deletion of the SHOX gene in patients with short stature of unknown cause.

PubMed

Morizio, E; Stuppia, L; Gatta, V; Fantasia, D; Guanciali Franchi, P; Rinaldi, M M; Scarano, G; Concolino, D; Giannotti, A; Verrotti, A; Chiarelli, F; Calabrese, G; Palka, G

2003-06-15

A fluorescence in situ hybridization (FISH) study was performed in 56 patients with short stature of unknown cause in order to establish the role of deletion of the SHOX gene in this population. FISH analysis was carried out on metaphase spreads and interphase lymphocytes from blood smears using a probe specific for the SHOX gene. Deletion of SHOX was found in four patients (7.1%). No skeletal abnormalities were detected in these patients either at the physical examination or at X-rays of the upper and lower limbs. Present results indicate that SHOX plays an important role also in short stature of unknown cause, and FISH analysis appears as an easy, appropriate, and inexpensive method for the detection of SHOX deletion. Copyright 2003 Wiley-Liss, Inc.

SNP-array lesions in core binding factor acute myeloid leukemia

PubMed Central

Duployez, Nicolas; Boudry-Labis, Elise; Roumier, Christophe; Boissel, Nicolas; Petit, Arnaud; Geffroy, Sandrine; Helevaut, Nathalie; Celli-Lebras, Karine; Terré, Christine; Fenneteau, Odile; Cuccuini, Wendy; Luquet, Isabelle; Lapillonne, Hélène; Lacombe, Catherine; Cornillet, Pascale; Ifrah, Norbert; Dombret, Hervé; Leverger, Guy; Jourdan, Eric; Preudhomme, Claude

2018-01-01

Acute myeloid leukemia (AML) with t(8;21) and inv(16), together referred as core binding factor (CBF)-AML, are recognized as unique entities. Both rearrangements share a common pathophysiology, the disruption of the CBF, and a relatively good prognosis. Experiments have demonstrated that CBF rearrangements were insufficient to induce leukemia, implying the existence of cooperating events. To explore these aberrations, we performed single nucleotide polymorphism (SNP)-array in a well-annotated cohort of 198 patients with CBF-AML. Excluding breakpoint-associated lesions, the most frequent events included loss of a sex chromosome (53%), deletions at 9q21 (12%) and 7q36 (9%) in patients with t(8;21) compared with trisomy 22 (13%), trisomy 8 (10%) and 7q36 deletions (12%) in patients with inv(16). SNP-array revealed novel recurrent genetic alterations likely to be involved in CBF-AML leukemogenesis. ZBTB7A mutations (20% of t(8;21)-AML) were shown to be a target of copy-neutral losses of heterozygosity (CN-LOH) at chromosome 19p. FOXP1 focal deletions were identified in 5% of inv(16)-AML while sequence analysis revealed that 2% carried FOXP1 truncating mutations. Finally, CCDC26 disruption was found in both subtypes (4.5% of the whole cohort) and possibly highlighted a new lesion associated with aberrant tyrosine kinase signaling in this particular subtype of leukemia. PMID:29464086

Hhex Regulates Hematopoietic Stem Cell Self-Renewal and Stress Hematopoiesis via Repression of Cdkn2a.

PubMed

Jackson, Jacob T; Shields, Benjamin J; Shi, Wei; Di Rago, Ladina; Metcalf, Donald; Nicola, Nicos A; McCormack, Matthew P

2017-08-01

The hematopoietically expressed homeobox transcription factor (Hhex) is important for the maturation of definitive hematopoietic progenitors and B-cells during development. We have recently shown that in adult hematopoiesis, Hhex is dispensable for maintenance of hematopoietic stem cells (HSCs) and myeloid lineages but essential for the commitment of common lymphoid progenitors (CLPs) to lymphoid lineages. Here, we show that during serial bone marrow transplantation, Hhex-deleted HSCs are progressively lost, revealing an intrinsic defect in HSC self-renewal. Moreover, Hhex-deleted mice show markedly impaired hematopoietic recovery following myeloablation, due to a failure of progenitor expansion. In vitro, Hhex-null blast colonies were incapable of replating, implying a specific requirement for Hhex in immature progenitors. Transcriptome analysis of Hhex-null Lin - Sca + Kit + cells showed that Hhex deletion leads to derepression of polycomb repressive complex 2 (PRC2) and PRC1 target genes, including the Cdkn2a locus encoding the tumor suppressors p16 Ink 4 a and p19 Arf . Indeed, loss of Cdkn2a restored the capacity of Hhex-null blast colonies to generate myeloid progenitors in vitro, as well as hematopoietic reconstitution following myeloablation in vivo. Thus, HSCs require Hhex to promote PRC2-mediated Cdkn2a repression to enable continued self-renewal and response to hematopoietic stress. Stem Cells 2017;35:1948-1957. © 2017 AlphaMed Press.

Targeted disruption of the 3p12 gene, Dutt1/Robo1, predisposes mice to lung adenocarcinomas and lymphomas with methylation of the gene promoter.

PubMed

Xian, Jian; Aitchison, Alan; Bobrow, Linda; Corbett, Gerard; Pannell, Richard; Rabbitts, Terence; Rabbitts, Pamela

2004-09-15

The DUTT1 gene is located on human chromosome 3, band p12, within a region of nested homozygous deletions in breast and lung tumors. It is therefore a candidate tumor suppressor gene in humans and is the homologue (ROBO1) of the Drosophila axonal guidance receptor gene, Roundabout. We have shown previously that mice with a targeted homozygous deletion within the Dutt1/Robo1 gene generally die at birth due to incomplete lung development: survivors die within the first year of life with epithelial bronchial hyperplasia as a common feature. Because Dutt1/Robo1 heterozygous mice develop normally, we have determined their tumor susceptibility. Mice with a targeted deletion within one Dutt1/Robo1 allele spontaneously develop lymphomas and carcinomas in their second year of life with a 3-fold increase in incidence compared with controls: invasive lung adenocarcinomas are by far the predominant carcinoma. In addition to the mutant allele, loss of heterozygosity analysis indicates that these tumors retain the structurally normal allele but with substantial methylation of the gene's promoter. Substantial reduction of Dutt1/Robo1 protein expression in tumors is observed by Western blotting and immunohistochemistry. This suggests that Dutt1/Robo1 is a classic tumor suppressor gene requiring inactivation of both alleles to elicit tumorigenesis in these mice.

SNP-array lesions in core binding factor acute myeloid leukemia.

PubMed

Duployez, Nicolas; Boudry-Labis, Elise; Roumier, Christophe; Boissel, Nicolas; Petit, Arnaud; Geffroy, Sandrine; Helevaut, Nathalie; Celli-Lebras, Karine; Terré, Christine; Fenneteau, Odile; Cuccuini, Wendy; Luquet, Isabelle; Lapillonne, Hélène; Lacombe, Catherine; Cornillet, Pascale; Ifrah, Norbert; Dombret, Hervé; Leverger, Guy; Jourdan, Eric; Preudhomme, Claude

2018-01-19

Acute myeloid leukemia (AML) with t(8;21) and inv(16), together referred as core binding factor (CBF)-AML, are recognized as unique entities. Both rearrangements share a common pathophysiology, the disruption of the CBF, and a relatively good prognosis. Experiments have demonstrated that CBF rearrangements were insufficient to induce leukemia, implying the existence of cooperating events. To explore these aberrations, we performed single nucleotide polymorphism (SNP)-array in a well-annotated cohort of 198 patients with CBF-AML. Excluding breakpoint-associated lesions, the most frequent events included loss of a sex chromosome (53%), deletions at 9q21 (12%) and 7q36 (9%) in patients with t(8;21) compared with trisomy 22 (13%), trisomy 8 (10%) and 7q36 deletions (12%) in patients with inv(16). SNP-array revealed novel recurrent genetic alterations likely to be involved in CBF-AML leukemogenesis. ZBTB7A mutations (20% of t(8;21)-AML) were shown to be a target of copy-neutral losses of heterozygosity (CN-LOH) at chromosome 19p. FOXP1 focal deletions were identified in 5% of inv(16)-AML while sequence analysis revealed that 2% carried FOXP1 truncating mutations. Finally, CCDC26 disruption was found in both subtypes (4.5% of the whole cohort) and possibly highlighted a new lesion associated with aberrant tyrosine kinase signaling in this particular subtype of leukemia.

Genes necessary for expression of a virulence determinant and for transmission of Plasmodium falciparum are located on a 0.3-megabase region of chromosome 9.

PubMed Central

Day, K P; Karamalis, F; Thompson, J; Barnes, D A; Peterson, C; Brown, H; Brown, G V; Kemp, D J

1993-01-01

Virulence of the human malaria parasite Plasmodium falciparum is believed to relate to adhesion of parasitized erythrocytes to postcapillary venular endothelium (asexual cytoadherence). Transmission of malaria to the mosquito vector involves a switch from asexual to sexual development (gametocytogenesis). Continuous in vitro culture of P. falciparum frequently results in irreversible loss of asexual cytoadherence and gametocytogenesis. Field isolates and cloned lines differing in expression of these phenotypes were karyotyped by pulse-field gel electrophoresis. This analysis showed that expression of both phenotypes mapped to a 0.3-Mb subtelomeric deletion of chromosome 9. This deletion frequently occurs during adaptation of parasite isolates to in vitro culture. Parasites with this deletion did not express the variant surface agglutination phenotype and the putative asexual cytoadherence ligand designated P. falciparum erythrocyte membrane protein 1, which has recently been shown to undergo antigenic variation. The syntenic relationship between asexual cytoadherence and gametocytogenesis suggests that expression of these phenotypes is genetically linked. One explanation for this linkage is that both developmental pathways share a common cytoadherence mechanism. This proposed biological and genetic linkage between a virulence factor (asexual cytoadherence) and transmissibility (gametocytogenesis) would help explain why a high degree of virulence has evolved and been maintained in falciparum malaria. Images Fig. 1 Fig. 2 Fig. 3 PMID:8367496

Beckwith-Wiedemann-like macroglossia and 18q23 haploinsufficiency.

PubMed

Lirussi, Frédéric; Jonard, Laurence; Gaston, Véronique; Sanlaville, Damien; Kooy, R Frank; Winnepenninckx, Birgitta; Maher, Eamonn R; Fitzpatrick, David R; Gicquel, Christine; Portnoï, Marie-France; Couderc, Rémy; Vazquez, Marie-Paule; Bahuau, Michel

2007-12-01

Beckwith-Wiedemann syndrome (BWS) is an overgrowth condition with tumor proclivity linked to a genetic imbalance of a complex imprinted region in 11p15.5. A female child with features fitting in with the BWS diagnostic framework and an apparent loss of imprinting (LOI) of the IGF2 gene in 11p15.5 was also reported to have a de novo chromosome 18q segmental deletion (Patient 1), thus pointing at the location of a possible trans-activating regulator element for maintenance of IGF2 imprinting and providing one of the few examples of locus heterogeneity of BWS. A second child with de novo 18q23 deletion and features of macroglossia, naevus flammeus, bilateral inguinal hernia and transient neonatal hypoglycemia, thus also fitting in with the BWS diagnostic framework, is here fully reported (Patient 2). In this child, an analysis of the BWS1 locus precluded any paternal isodisomy and showed a normal imprinting pattern (mono-allelic expression of IGF2 and normal H19 and CDKN1OT1/LIT1 methylation index). In Patients 1 and 2, deletions were shown to overlap, defining a minimal region of haplo-insufficiency of 3.8-5.6 Mb in 18q23. We conclude that this region provides a candidate location for an original macroglossia condition with strong overlap with BWS, but without obvious upstream functional relationship with the BWS1 locus in 11p15.5. Because this minimal region of haplo-insufficiency falls into a common region of deletion in 18q- syndrome, we inferred that this macroglossia condition would follow a recessive pattern of inheritance. (c) 2007 Wiley-Liss, Inc.

Zinc Finger Transcription Factors Displaced SREBP Proteins as the Major Sterol Regulators during Saccharomycotina Evolution

PubMed Central

Maguire, Sarah L.; Wang, Can; Holland, Linda M.; Brunel, François; Neuvéglise, Cécile; Nicaud, Jean-Marc; Zavrel, Martin; White, Theodore C.; Wolfe, Kenneth H.; Butler, Geraldine

2014-01-01

In most eukaryotes, including the majority of fungi, expression of sterol biosynthesis genes is regulated by Sterol-Regulatory Element Binding Proteins (SREBPs), which are basic helix-loop-helix transcription activators. However, in yeasts such as Saccharomyces cerevisiae and Candida albicans sterol synthesis is instead regulated by Upc2, an unrelated transcription factor with a Gal4-type zinc finger. The SREBPs in S. cerevisiae (Hms1) and C. albicans (Cph2) have lost a domain, are not major regulators of sterol synthesis, and instead regulate filamentous growth. We report here that rewiring of the sterol regulon, with Upc2 taking over from SREBP, likely occurred in the common ancestor of all Saccharomycotina. Yarrowia lipolytica, a deep-branching species, is the only genome known to contain intact and full-length orthologs of both SREBP (Sre1) and Upc2. Deleting YlUPC2, but not YlSRE1, confers susceptibility to azole drugs. Sterol levels are significantly reduced in the YlUPC2 deletion. RNA-seq analysis shows that hypoxic regulation of sterol synthesis genes in Y. lipolytica is predominantly mediated by Upc2. However, YlSre1 still retains a role in hypoxic regulation; growth of Y. lipolytica in hypoxic conditions is reduced in a Ylupc2 deletion and is abolished in a Ylsre1/Ylupc2 double deletion, and YlSre1 regulates sterol gene expression during hypoxia adaptation. We show that YlSRE1, and to a lesser extent YlUPC2, are required for switching from yeast to filamentous growth in hypoxia. Sre1 appears to have an ancestral role in the regulation of filamentation, which became decoupled from its role in sterol gene regulation by the arrival of Upc2 in the Saccharomycotina. PMID:24453983

Circadian abnormalities in mouse models of Smith-Magenis syndrome: evidence for involvement of RAI1.

PubMed

Lacaria, Melanie; Gu, Wenli; Lupski, James R

2013-07-01

Smith-Magenis syndrome (SMS; OMIM 182290) is a genomic disorder characterized by multiple congenital anomalies, intellectual disability, behavioral abnormalities, and disordered sleep resulting from an ~3.7 Mb deletion copy number variant (CNV) on chromosome 17p11.2 or from point mutations in the gene RAI1. The reciprocal duplication of this region results in another genomic disorder, Potocki-Lupski syndrome (PTLS; OMIM 610883), characterized by autism, intellectual disability, and congenital anomalies. We previously used chromosome-engineering and gene targeting to generate mouse models for PTLS (Dp(11)17/+), and SMS due to either deletion CNV or gene knock-out (Df(11)17-2/+ and Rai1(+/-) , respectively) and we observed phenotypes in these mouse models consistent with their associated human syndromes. To investigate the contribution of individual genes to the circadian phenotypes observed in SMS, we now report the analysis of free-running period lengths in Rai1(+/-) and Df(11)17-2/+ mice, as well as in mice deficient for another known circadian gene mapping within the commonly deleted/duplicated region, Dexras1, and we compare these results to those previously observed in Dp(11)17/+ mice. Reduced free-running period lengths were seen in Df(11)17-2/+, Rai1(+/-) , and Dexras1(-/-) , but not Dexras1(+/-) mice, suggesting that Rai1 may be the primary gene underlying the circadian defects in SMS. However, we cannot rule out the possibility that cis effects between multiple haploinsufficient genes in the SMS critical interval (e.g., RAI1 and DEXRAS1) either exacerbate the circadian phenotypes observed in SMS patients with deletions or increase their penetrance in certain environments. This study also confirms a previous report of abnormal circadian function in Dexras1(-/-) mice. Copyright © 2013 Wiley Periodicals, Inc.

Analytic Validation of a Clinical-Grade PTEN Immunohistochemistry Assay in Prostate Cancer by Comparison to PTEN FISH

PubMed Central

Lotan, Tamara L.; Wei, Wei; Ludkovski, Olga; Morais, Carlos L.; Guedes, Liana B.; Jamaspishvili, Tamara; Lopez, Karen; Hawley, Sarah T.; Feng, Ziding; Fazli, Ladan; Hurtado-Coll, Antonio; McKenney, Jesse K.; Simko, Jeffrey; Carroll, Peter R.; Gleave, Martin; Lin, Daniel W.; Nelson, Peter S.; Thompson, Ian M.; True, Lawrence D.; Brooks, James D.; Lance, Raymond; Troyer, Dean; Squire, Jeremy A.

2016-01-01

PTEN loss is a promising prognostic and predictive biomarker in prostate cancer. Because it occurs most commonly via PTEN gene deletion, we developed a clinical-grade, automated and inexpensive immunohistochemical assay to detect PTEN loss. We studied the sensitivity and specificity of PTEN immunohistochemistry relative to 4-color fluorescence in situ hybridization (FISH) for detection of PTEN gene deletion in a multi-institutional cohort of 731 primary prostate tumors. Intact PTEN immunostaining was 91% specific for absence of PTEN gene deletion, (549/602 tumors with 2 copies of the PTEN gene by FISH showed intact expression of PTEN by immunohistochemistry) and 97% sensitive for presence of homozygous PTEN gene deletion (absent PTEN protein expression by immunohistochemistry in 65/67 tumors with homozygous deletion). PTEN immunohistochemistry was 65% sensitive for presence of hemizygous PTEN gene deletion, with protein loss in 40/62 hemizygous tumors. We reviewed the 53 cases where immunohistochemistry showed PTEN protein loss and FISH showed 2 intact copies of the PTEN gene. On re-review, there was ambiguous immunohistochemistry loss in 6% (3/53) and failure to analyze the same tumor area by both methods in 34% (18/53). Of the remaining discordant cases, 41% (13/32) revealed hemizygous (n=8) or homozygous (n=5) PTEN gene deletion that was focal in most cases (11/13). The remaining 19 cases had 2 copies of the PTEN gene by FISH, representing truly discordant cases. Our automated PTEN immunohistochemistry assay is a sensitive method for detection of homozygous PTEN gene deletions. Immunohistochemistry screening is particularly useful to identify cases with heterogeneous PTEN gene deletion in a subset of tumor glands. Mutations, small insertions or deletions and/or epigenetic or microRNA-mediated mechanisms may lead to PTEN protein loss in tumors with normal or hemizygous PTEN gene copy number. PMID:27174589

Identification of the first de novo PAR1 deletion downstream of SHOX in an individual diagnosed with Léri-Weill dyschondrosteosis (LWD).

PubMed

Barroso, Eva; Benito-Sanz, Sara; Belinchón, Alberta; Yuste-Checa, Patricia; Gracia, Ricardo; Aragones, Angel; Campos-Barros, Angel; Heath, Karen E

2010-01-01

Léri-Weill dyschondrosteosis (LWD, MIM 127300), is a dominantly inherited skeletal dysplasia with disproportionate short stature, mesomelic limb shortening, and the characteristic Madelung deformity. Two regions of the pseudoautosomal region 1 (PAR1) have been shown to be involved in LWD, SHOX (short-stature homeobox-containing gene) and the downstream enhancer region. We report our genetic findings of a young girl clinically diagnosed with LWD. We analyzed the proband and her family using MLPA and microsatellite analysis. We identified a deletion, 726-866 kb in size, of the downstream SHOX enhancer region in the proband. Neither parent carried the deletion. Microsatellite analysis showed that the deleted allele was of paternal origin. The mutation is more likely to have arisen from a de novo event but paternal gonadal mosaicism cannot be excluded. In conclusion, we report the clinical and molecular details of the first case of a de novo deletion of the downstream PAR1 region in an LWD individual. De novo deletions of SHOX and the downstream enhancer region must be therefore considered in cases of isolated LWD. Copyright 2010 Elsevier Masson SAS. All rights reserved.

Identification of single gene deletions at 15q13.3: further evidence that CHRNA7 causes the 15q13.3 microdeletion syndrome phenotype.

PubMed

Hoppman-Chaney, N; Wain, K; Seger, P R; Superneau, D W; Hodge, J C

2013-04-01

The 15q13.3 microdeletion syndrome (OMIM #612001) is characterized by a wide range of phenotypic features, including intellectual disability, seizures, autism, and psychiatric conditions. This deletion is inherited in approximately 75% of cases and has been found in mildly affected and normal parents, consistent with variable expressivity and incomplete penetrance. The common deletion is approximately 2 Mb and contains several genes; however, the gene(s) responsible for the resulting clinical features have not been clearly defined. Recently, four probands were reported with small deletions including only the CHRNA7 gene. These patients showed a wide range of phenotypic features similar to those associated with the larger 15q13.3 microdeletion. To further correlate genotype and phenotype, we queried our database of >15,000 patients tested in the Mayo Clinic Cytogenetics Laboratory from 2008 to 2011 and identified 19 individuals (10 probands and 9 family members) with isolated heterozygous CHRNA7 gene deletions. All but two infants displayed multiple features consistent with 15q13.3 microdeletion syndrome. We also identified the first de novo deletion confined to CHRNA7 as well as the second known case with homozygous deletion of CHRNA7 only. These results provide further evidence implicating CHRNA7 as the gene responsible for the clinical findings associated with 15q13.3 microdeletion. © 2012 John Wiley & Sons A/S. Published by Blackwell Publishing Ltd.

A new deletion refines the boundaries of the murine Prader–Willi syndrome imprinting center

PubMed Central

DuBose, Amanda J.; Smith, Emily Y.; Yang, Thomas P.; Johnstone, Karen A.; Resnick, James L.

2011-01-01

The human chromosomal 15q11–15q13 region is subject to both maternal and paternal genomic imprinting. Absence of paternal gene expression from this region results in Prader–Willi syndrome (PWS), while absence of maternal gene expression leads to Angelman syndrome. Transcription of paternally expressed genes in the region depends upon an imprinting center termed the PWS-IC. Imprinting defects in PWS can be caused by microdeletions and the smallest commonly deleted region indicates that the PWS-IC lies within a region of 4.3 kb. The function and location of the PWS-IC is evolutionarily conserved, but delineation of the PWS-IC in mouse has proven difficult. The first targeted mutation of the PWS-IC, a deletion of 35 kb spanning Snrpn exon 1, exhibited a complete PWS-IC deletion phenotype. Pups inheriting this mutation paternally showed a complete loss of paternal gene expression and died neonatally. A reported deletion of 4.8 kb showed only a reduction in paternal gene expression and incomplete penetrance of neonatal lethality, suggesting that some PWS-IC function had been retained. Here, we report that a 6 kb deletion spanning Snrpn exon 1 exhibits a complete PWS-IC deletion phenotype. Pups inheriting this mutation paternally lack detectable expression of all PWS genes and paternal silencing of Ube3a, exhibit maternal DNA methylation imprints at Ndn and Mkrn3 and suffer failure to thrive leading to a fully penetrant neonatal lethality. PMID:21659337

A new deletion refines the boundaries of the murine Prader-Willi syndrome imprinting center.

PubMed

Dubose, Amanda J; Smith, Emily Y; Yang, Thomas P; Johnstone, Karen A; Resnick, James L

2011-09-01

The human chromosomal 15q11-15q13 region is subject to both maternal and paternal genomic imprinting. Absence of paternal gene expression from this region results in Prader-Willi syndrome (PWS), while absence of maternal gene expression leads to Angelman syndrome. Transcription of paternally expressed genes in the region depends upon an imprinting center termed the PWS-IC. Imprinting defects in PWS can be caused by microdeletions and the smallest commonly deleted region indicates that the PWS-IC lies within a region of 4.3 kb. The function and location of the PWS-IC is evolutionarily conserved, but delineation of the PWS-IC in mouse has proven difficult. The first targeted mutation of the PWS-IC, a deletion of 35 kb spanning Snrpn exon 1, exhibited a complete PWS-IC deletion phenotype. Pups inheriting this mutation paternally showed a complete loss of paternal gene expression and died neonatally. A reported deletion of 4.8 kb showed only a reduction in paternal gene expression and incomplete penetrance of neonatal lethality, suggesting that some PWS-IC function had been retained. Here, we report that a 6 kb deletion spanning Snrpn exon 1 exhibits a complete PWS-IC deletion phenotype. Pups inheriting this mutation paternally lack detectable expression of all PWS genes and paternal silencing of Ube3a, exhibit maternal DNA methylation imprints at Ndn and Mkrn3 and suffer failure to thrive leading to a fully penetrant neonatal lethality.

A preliminary analysis of quantifying computer security vulnerability data in "the wild"

NASA Astrophysics Data System (ADS)

Farris, Katheryn A.; McNamara, Sean R.; Goldstein, Adam; Cybenko, George

2016-05-01

A system of computers, networks and software has some level of vulnerability exposure that puts it at risk to criminal hackers. Presently, most vulnerability research uses data from software vendors, and the National Vulnerability Database (NVD). We propose an alternative path forward through grounding our analysis in data from the operational information security community, i.e. vulnerability data from "the wild". In this paper, we propose a vulnerability data parsing algorithm and an in-depth univariate and multivariate analysis of the vulnerability arrival and deletion process (also referred to as the vulnerability birth-death process). We find that vulnerability arrivals are best characterized by the log-normal distribution and vulnerability deletions are best characterized by the exponential distribution. These distributions can serve as prior probabilities for future Bayesian analysis. We also find that over 22% of the deleted vulnerability data have a rate of zero, and that the arrival vulnerability data is always greater than zero. Finally, we quantify and visualize the dependencies between vulnerability arrivals and deletions through a bivariate scatterplot and statistical observations.

Molecular analysis and comparison of radiation-induced large deletions of the HPRT locus in primary human skin fibroblasts

NASA Technical Reports Server (NTRS)

Yamada, Y.; Park, M. S.; Okinaka, R. T.; Chen, D. J.

1996-01-01

Genetic alterations in gamma-ray- and alpha-particle-induced HPRT mutants were examined by multiplex polymerase chain reaction (PCR) analysis. A total of 39-63% of gamma-ray-induced and 31-57% of alpha-particle-induced mutants had partial or total deletions of the HPRT gene. The proportion of these deletion events was dependent on radiation dose, and at the resolution limits employed there were no significant differences between the spectra induced by equitoxic doses of alpha particles (0.2-0.4 Gy) and gamma rays (3 Gy). The molecular nature of the deletions was analyzed by the use of sequence tagged site (STS) primers and PCR amplification as a "probe" for specific regions of the human X chromosome within the Xq26 region. These STSs were closely linked and spanned regions approximately 1.7 Mbp from the telomeric side and 1.7 Mbp from the centromeric side of the HPRT gene. These markers include: DXS53, 299R, DXS79, yH3L, 3/19, PR1, PR25, H2, yH3R, 1/44, 1/67, 1/1, DXS86, D8C6, DXS10 and DXS144. STS analyses indicated that the maximum size of total deletions in radiation-induced HPRT mutants can be greater than 2.7 Mbp and deletion size appears to be dependent on radiation dose. There were no apparent differences in the sizes of the deletions induced by alpha particles or gamma rays. On the other hand, deletions containing portions of the HPRT gene were observed to be 800 kbp or less, and the pattern of the partial deletion induced by alpha particles appeared to be different from that induced by gamma rays.

Analysis of a new homozygous deletion in the tumor suppressor region at 3p12.3 reveals two novel intronic noncoding RNA genes.

PubMed

Angeloni, Debora; ter Elst, Arja; Wei, Ming Hui; van der Veen, Anneke Y; Braga, Eleonora A; Klimov, Eugene A; Timmer, Tineke; Korobeinikova, Luba; Lerman, Michael I; Buys, Charles H C M

2006-07-01

Homozygous deletions or loss of heterozygosity (LOH) at human chromosome band 3p12 are consistent features of lung and other malignancies, suggesting the presence of a tumor suppressor gene(s) (TSG) at this location. Only one gene has been cloned thus far from the overlapping region deleted in lung and breast cancer cell lines U2020, NCI H2198, and HCC38. It is DUTT1 (Deleted in U Twenty Twenty), also known as ROBO1, FLJ21882, and SAX3, according to HUGO. DUTT1, the human ortholog of the fly gene ROBO, has homology with NCAM proteins. Extensive analyses of DUTT1 in lung cancer have not revealed any mutations, suggesting that another gene(s) at this location could be of importance in lung cancer initiation and progression. Here, we report the discovery of a new, small, homozygous deletion in the small cell lung cancer (SCLC) cell line GLC20, nested in the overlapping, critical region. The deletion was delineated using several polymorphic markers and three overlapping P1 phage clones. Fiber-FISH experiments revealed the deletion was approximately 130 kb. Comparative genomic sequence analysis uncovered short sequence elements highly conserved among mammalian genomes and the chicken genome. The discovery of two EST clusters within the deleted region led to the isolation of two noncoding RNA (ncRNA) genes. These were subsequently found differentially expressed in various tumors when compared to their normal tissues. The ncRNA and other highly conserved sequence elements in the deleted region may represent miRNA targets of importance in cancer initiation or progression. Published 2006 Wiley-Liss, Inc.

An interstitial 15q11-q14 deletion: expanded Prader-Willi syndrome phenotype.

PubMed

Butler, Merlin G; Bittel, Douglas C; Kibiryeva, Nataliya; Cooley, Linda D; Yu, Shihui

2010-02-01

We present an infant girl with a de novo interstitial deletion of the chromosome 15q11-q14 region, larger than the typical deletion seen in Prader-Willi syndrome (PWS). She presented with features seen in PWS including hypotonia, a poor suck, feeding problems, and mild micrognathia. She also presented with features not typically seen in PWS such as preauricular ear tags, a high-arched palate, edematous feet, coarctation of the aorta, a PDA, and a bicuspid aortic valve. G-banded chromosome analysis showed a large de novo deletion of the proximal long arm of chromosome 15 confirmed using FISH probes (D15511 and GABRB3). Methylation testing was abnormal and consistent with the diagnosis of PWS. Because of the large appearing deletion by karyotype analysis, an array comparative genomic hybridization (aCGH) was performed. A 12.3 Mb deletion was found which involved the 15q11-q14 region containing approximately 60 protein coding genes. This rare deletion was approximately twice the size of the typical deletion seen in PWS and involved the proximal breakpoint BP1 and the distal breakpoint was located in the 15q14 band between previously recognized breakpoints BP5 and BP6. The deletion extended slightly distal to the AVEN gene including the neighboring CHRM5 gene. There is no evidence that the genes in the 15q14 band are imprinted; therefore, their potential contribution in this patient's expanded PWS phenotype must be a consequence of dosage sensitivity of the genes or due to altered expression of intact neighboring genes from a position effect. Copyright 2010 Wiley-Liss, Inc.

Abnormal brain magnetic resonance imaging in two patients with Smith-Magenis syndrome.

PubMed

Maya, Idit; Vinkler, Chana; Konen, Osnat; Kornreich, Liora; Steinberg, Tamar; Yeshaya, Josepha; Latarowski, Victoria; Shohat, Mordechai; Lev, Dorit; Baris, Hagit N

2014-08-01

Smith-Magenis syndrome (SMS) is a clinically recognizable contiguous gene syndrome ascribed to an interstitial deletion in chromosome 17p11.2. Seventy percent of SMS patients have a common deletion interval spanning 3.5 megabases (Mb). Clinical features of SMS include characteristic mild dysmorphic features, ocular anomalies, short stature, brachydactyly, and hypotonia. SMS patients have a unique neurobehavioral phenotype that includes intellectual disability, self-injurious behavior and severe sleep disturbance. Little has been reported in the medical literature about anatomical brain anomalies in patients with SMS. Here we describe two patients with SMS caused by the common deletion in 17p11.2 diagnosed using chromosomal microarray (CMA). Both patients had a typical clinical presentation and abnormal brain magnetic resonance imaging (MRI) findings. One patient had subependymal periventricular gray matter heterotopia, and the second had a thin corpus callosum, a thin brain stem and hypoplasia of the cerebellar vermis. This report discusses the possible abnormal MRI images in SMS and reviews the literature on brain malformations in SMS. Finally, although structural brain malformations in SMS patients are not a common feature, we suggest baseline routine brain imaging in patients with SMS in particular, and in patients with chromosomal microdeletion/microduplication syndromes in general. Structural brain malformations in these patients may affect the decision-making process regarding their management. © 2014 Wiley Periodicals, Inc.

Molecular detection of a 4p deletion using PCR-based polymorphisms: a technique for the rapid detection of the Wolf-Hirschhorn syndrome.

PubMed

Altherr, M R; Gusella, J F; Wasmuth, J J; Kummer, M A; McKercher, S W; Johnson, V P

1992-11-01

Wolf-Hirschhorn syndrome (WHS) results from a deletion of part of chromosome 4p. The region of 4p consistently deleted in WHS is near the tip of 4p. Two loci in this region D4S95 and D4S125 are associated with highly informative VNTR polymorphisms and were recently converted to allow PCR-based screening. PCR analysis was used successfully to identify a small de novo deletion of 4p in a patient suspected of having WHS. This procedure allows a rapid and accurate confirmation of 4p deletions in cases where cytogenetics alone cannot provide a clear answer.

The relationship between BIM deletion polymorphism and clinical significance of epidermal growth factor receptor-mutated non-small cell lung cancer patients with epidermal growth factor receptor-tyrosine kinase inhibitor therapy: a meta-analysis.

PubMed

Zou, Qian; Zhan, Ping; Lv, Tangfeng; Song, Yong

2015-12-01

BIM deletion polymorphism is a germline that might lead to little or no BH3 expression, which affects epidermal growth factor receptor-tyrosine kinase inhibitor (EGFR-TKI) related apoptosis. Recent studies show that BIM deletion polymorphism might be a critical factor leading to the resistance of EGFR-TKIs in EGFR mutation-positive non-small cell lung cancer (NSCLC) patients. Thus, a meta-analysis was conducted by combing seven original eligible studies including 778 NSCLC patients to investigate a steady and reliable conclusion. Our study indicated that BIM deletion polymorphism was significantly associated with the poor objective response rate (ORR) of EGFR-TKIs in EGFR-mutated NSCLC patients [odds ratios (OR) =0.55, 95% confidence interval (CI), 0.33-0.92]. And disease control rate (DCR) in EGFR-mutate NSCLC patients treated with EGFR-TKIs was significantly decreased in patients with BIM deletion polymorphism (OR=0.55, 95% CI, 0.27-1.12). Moreover, the progression-free survival (PFS) of patients with BIM deletion polymorphism is shorter. These findings suggested that BIM deletion polymorphism might be a genetic cause of intrinsic resistance to TKI therapy and it could be emerged as an independent predictor to identify patients who would benefit from TKI targeted therapy in EGFR-mutated NSCLC.

Masking as an effective quality control method for next-generation sequencing data analysis.

PubMed

Yun, Sajung; Yun, Sijung

2014-12-13

Next generation sequencing produces base calls with low quality scores that can affect the accuracy of identifying simple nucleotide variation calls, including single nucleotide polymorphisms and small insertions and deletions. Here we compare the effectiveness of two data preprocessing methods, masking and trimming, and the accuracy of simple nucleotide variation calls on whole-genome sequence data from Caenorhabditis elegans. Masking substitutes low quality base calls with 'N's (undetermined bases), whereas trimming removes low quality bases that results in a shorter read lengths. We demonstrate that masking is more effective than trimming in reducing the false-positive rate in single nucleotide polymorphism (SNP) calling. However, both of the preprocessing methods did not affect the false-negative rate in SNP calling with statistical significance compared to the data analysis without preprocessing. False-positive rate and false-negative rate for small insertions and deletions did not show differences between masking and trimming. We recommend masking over trimming as a more effective preprocessing method for next generation sequencing data analysis since masking reduces the false-positive rate in SNP calling without sacrificing the false-negative rate although trimming is more commonly used currently in the field. The perl script for masking is available at http://code.google.com/p/subn/. The sequencing data used in the study were deposited in the Sequence Read Archive (SRX450968 and SRX451773).

DRD2 Promoter Region Variation Predicts Antipsychotic-Induced Weight Gain in First Episode Schizophrenia

PubMed Central

Lencz, Todd; Robinson, Delbert G.; Napolitano, Barbara; Sevy, Serge; Kane, John M.; Goldman, David; Malhotra, Anil K.

2010-01-01

Many antipsychotic medications carry a substantial liability for weight gain, and one mechanism common to all antipsychotics is binding to the dopamine D2 receptor. We therefore examined the relationship between −141C Ins/Del (rs1799732), a functional promoter region polymorphism in DRD2, and antipsychotic-induced weight gain in 58 first episode schizophrenia patients enrolled in a randomized trial of risperidone (RIS) vs. olanzapine (OLZ). Carriers of the deletion allele (n=29) were compared to Ins/Ins homozygotes (non-carriers, n=29) in a mixed model encompassing 10 weight measurements over 16 weeks. Deletion allele carriers demonstrated significantly more weight gain after 6 weeks of treatment regardless of assigned medication. While deletion carriers were prescribed higher doses of OLZ (but not RIS), dose did not appear to account for the genotype effects on weight gain. Given previous evidence that deletion carriers demonstrate reduced symptom response to medication, additional study of appropriate treatment options for these patients appears warranted. PMID:20664489

Comparison of the efficacy of icotinib in patients with non-small-cell lung cancer according to the type of epidermal growth factor receptor mutation.

PubMed

Xue, Zhang Xiao; Wen, Wang Xiu; Zhuang, Yu; Hua, Zang Jian; Xia, Yang Ni

2016-09-01

Icotinib hydrochloride is a novel epidermal growth factor receptor (EGFR) tyrosine kinase inhibitor (TKI) with preclinical and clinical activity in non-small-cell lung cancer (NSCLC). Exon 19 deletion and L858R point mutation are the most commonly encountered EGFR mutations in NSCLC, and they predict improved clinical outcomes following treatment with icotinib. The objective of this study was to evaluate the differential clinical efficacy of icotinib in patients with exon 19 deletion or L858R point mutation of the EGFR gene. A total of 104 patients with advanced NSCLC, who harbored exon 19 deletion or L858R point mutation of EGFR and were treated with icotinib, were enrolled in this study. The tumor response and progression-free survival were evaluated. There were no significant differences between patients with EGFR exon 19 deletion and those with L858R point mutation who received treatment with icotinib.

A CRISPR-Cas9 Generated MDCK Cell Line Expressing Human MDR1 Without Endogenous Canine MDR1 (cABCB1): An Improved Tool for Drug Efflux Studies.

PubMed

Karlgren, Maria; Simoff, Ivailo; Backlund, Maria; Wegler, Christine; Keiser, Markus; Handin, Niklas; Müller, Janett; Lundquist, Patrik; Jareborg, Anne-Christine; Oswald, Stefan; Artursson, Per

2017-09-01

Madin-Darby canine kidney (MDCK) II cells stably transfected with transport proteins are commonly used models for drug transport studies. However, endogenous expression of especially canine MDR1 (cMDR1) confounds the interpretation of such studies. Here we have established an MDCK cell line stably overexpressing the human MDR1 transporter (hMDR1; P-glycoprotein), and used CRISPR-Cas9 gene editing to knockout the endogenous cMDR1. Genomic screening revealed the generation of a clonal cell line homozygous for a 4-nucleotide deletion in the canine ABCB1 gene leading to a frameshift and a premature stop codon. Knockout of cMDR1 expression was verified by quantitative protein analysis and functional studies showing retained activity of the human MDR1 transporter. Application of this cell line allowed unbiased reclassification of drugs previously defined as both substrates and non-substrates in different studies using commonly used MDCK-MDR1 clones. Our new MDCK-hMDR1 cell line, together with a previously developed control cell line, both with identical deletions in the canine ABCB1 gene and lack of cMDR1 expression represent excellent in vitro tools for use in drug discovery. Copyright © 2017 American Pharmacists Association®. Published by Elsevier Inc. All rights reserved.

Inducing rye 1R chromosome structural changes in common wheat cv. Chinese spring by the gametocidal chromosome 2C of Aegilops cylindrica.

PubMed

Shi, Fang; Liu, Kun-Fan; Endo, Takashi R; Wang, Dao-Wen

2005-05-01

To generate 1 R deletion and translocation lines, we introduced a 2C chromosome,which was derived from Aegilops cylindrica and was known to have a gametocidal function when added monosomically into common wheat cv. Chinese Spring (CS) and its derivative, into a wheat-rye 1R chromosome disomic addition line (CS-1R"). When the individuals with chromosome constitution 21" + 1R" + 2C' (2n = 45) were selfed, the 1R chromosome structural changes were found to be induced with high frequency (24.1%) among the progenies. By using C-banding and GISH analysis, we analyzed 1R structural changes in 46 F3 individuals, which came from 23 F2 plants. The rearranged 1R chromosomes could be characterized in about 85% of the F3 individuals. This included telosome 1RL (39.1%), iso-chromosome 1 RL (2.2%), whole arm translocation involving 1RL (32.6%), telosome 1RS (4.3%), iso-chromosome 1RS (4.3%), and 1R deletion mutant with break point in the long arm (2.2%). The mutant 1R lines obtained in this study will potentially be useful in mapping the chromosome locations of agronomically important genes located in 1R. This study also demonstrated that molecular markers might be used to identify wheat chromosome arm involved in translocation with 1R.

The histone chaperone ASF1 is essential for sexual development in the filamentous fungus Sordaria macrospora.

PubMed

Gesing, Stefan; Schindler, Daniel; Fränzel, Benjamin; Wolters, Dirk; Nowrousian, Minou

2012-05-01

Ascomycetes develop four major types of fruiting bodies that share a common ancestor, and a set of common core genes most likely controls this process. One way to identify such genes is to search for conserved expression patterns. We analysed microarray data of Fusarium graminearum and Sordaria macrospora, identifying 78 genes with similar expression patterns during fruiting body development. One of these genes was asf1 (anti-silencing function 1), encoding a predicted histone chaperone. asf1 expression is also upregulated during development in the distantly related ascomycete Pyronema confluens. To test whether asf1 plays a role in fungal development, we generated an S. macrospora asf1 deletion mutant. The mutant is sterile and can be complemented to fertility by transformation with the wild-type asf1 and its P. confluens homologue. An ASF1-EGFP fusion protein localizes to the nucleus. By tandem-affinity purification/mass spectrometry as well as yeast two-hybrid analysis, we identified histones H3 and H4 as ASF1 interaction partners. Several developmental genes are dependent on asf1 for correct transcriptional expression. Deletion of the histone chaperone genes rtt106 and cac2 did not cause any developmental phenotypes. These data indicate that asf1 of S. macrospora encodes a conserved histone chaperone that is required for fruiting body development. © 2012 Blackwell Publishing Ltd.

XPD localizes in mitochondria and protects the mitochondrial genome from oxidative DNA damage.

PubMed

Liu, Jing; Fang, Hongbo; Chi, Zhenfen; Wu, Zan; Wei, Di; Mo, Dongliang; Niu, Kaifeng; Balajee, Adayabalam S; Hei, Tom K; Nie, Linghu; Zhao, Yongliang

2015-06-23

Xeroderma pigmentosum group D (XPD/ERCC2) encodes an ATP-dependent helicase that plays essential roles in both transcription and nucleotide excision repair of nuclear DNA, however, whether or not XPD exerts similar functions in mitochondria remains elusive. In this study, we provide the first evidence that XPD is localized in the inner membrane of mitochondria, and cells under oxidative stress showed an enhanced recruitment of XPD into mitochondrial compartment. Furthermore, mitochondrial reactive oxygen species production and levels of oxidative stress-induced mitochondrial DNA (mtDNA) common deletion were significantly elevated, whereas capacity for oxidative damage repair of mtDNA was markedly reduced in both XPD-suppressed human osteosarcoma (U2OS) cells and XPD-deficient human fibroblasts. Immunoprecipitation-mass spectrometry analysis was used to identify interacting factor(s) with XPD and TUFM, a mitochondrial Tu translation elongation factor was detected to be physically interacted with XPD. Similar to the findings in XPD-deficient cells, mitochondrial common deletion and oxidative damage repair capacity in U2OS cells were found to be significantly altered after TUFM knock-down. Our findings clearly demonstrate that XPD plays crucial role(s) in protecting mitochondrial genome stability by facilitating an efficient repair of oxidative DNA damage in mitochondria. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

Exploratory cohort study and meta-analysis of BIM deletion polymorphism in patients with epidermal growth factor receptor-mutant non-small-cell lung cancer treated with epidermal growth factor receptor tyrosine kinase inhibitors

PubMed Central

Sun, Si; Yu, Hui; Wang, Huijie; Zhao, Xinmin; Zhao, Xintai; Wu, Xianghua; Qiao, Jie; Chang, Jianhua; Wang, Jialei

2017-01-01

Background Non-small-cell lung cancer (NSCLC) patients with epidermal growth factor receptor (EGFR) mutations might develop primary and secondary resistance to tyrosine kinase inhibitors (TKIs). The proapoptotic protein Bcl-2-like 11 (BIM) is a key modulator of apoptosis triggered by EGFR-TKIs. The recent studies have indicated that some patients with positive EGFR mutations were refractory to EGFR-TKIs if they harbored a BIM deletion polymorphism. The purpose of this study was to investigate whether BIM polymorphism predicts treatment efficacy of EGFR-TKIs in Chinese NSCLC patients. Patients and methods A cohort of advanced NSCLC patients with EGFR mutations and treated with EGFR-TKIs (gefitinib or erlotinib) were recruited. We drew peripheral blood to determinate BIM deletion status and then compared patients’ clinical outcomes according to the BIM deletion status. Additionally, we electronically searched eligible cohort studies and conducted a meta-analysis to pool event risk. Results The exploratory cohort study included 140 patients. Patients with and without the BIM deletion polymorphism had similar objective response rates (ORRs, 48.5 vs 63.0%, P=0.16), disease control rate (DCR, 93.9 vs 97.0%, P=0.60) and adverse reactions. Similar progression-free survival (PFS) and overall survival (OS) were noted in overall population (P=0.27 for PFS and P=0.61 for OS) and prespecified patient subgroups. The meta-analysis included 10 eligible cohort studies involving 1,317 NSCLC patients. It showed the positive BIM deletion was associated with shorter PFS (hazard ratio =1.45; P=0.02). Nonsignificant differences existed for ORR, DCR and OS. Conclusion The expanded meta-analysis results demonstrated the positive BIM deletion predicts shorter PFS in NSCLC patients after treatment with EGFR-TKIs while other clinical measures do not. A large multicenter well-designed cohort study involving other concurrent genetic alterations is warranted. PMID:28435285

Exploratory cohort study and meta-analysis of BIM deletion polymorphism in patients with epidermal growth factor receptor-mutant non-small-cell lung cancer treated with epidermal growth factor receptor tyrosine kinase inhibitors.

PubMed

Sun, Si; Yu, Hui; Wang, Huijie; Zhao, Xinmin; Zhao, Xintai; Wu, Xianghua; Qiao, Jie; Chang, Jianhua; Wang, Jialei

2017-01-01

Non-small-cell lung cancer (NSCLC) patients with epidermal growth factor receptor ( EGFR ) mutations might develop primary and secondary resistance to tyrosine kinase inhibitors (TKIs). The proapoptotic protein Bcl-2-like 11 (BIM) is a key modulator of apoptosis triggered by EGFR-TKIs. The recent studies have indicated that some patients with positive EGFR mutations were refractory to EGFR-TKIs if they harbored a BIM deletion polymorphism. The purpose of this study was to investigate whether BIM polymorphism predicts treatment efficacy of EGFR-TKIs in Chinese NSCLC patients. A cohort of advanced NSCLC patients with EGFR mutations and treated with EGFR-TKIs (gefitinib or erlotinib) were recruited. We drew peripheral blood to determinate BIM deletion status and then compared patients' clinical outcomes according to the BIM deletion status. Additionally, we electronically searched eligible cohort studies and conducted a meta-analysis to pool event risk. The exploratory cohort study included 140 patients. Patients with and without the BIM deletion polymorphism had similar objective response rates (ORRs, 48.5 vs 63.0%, P =0.16), disease control rate (DCR, 93.9 vs 97.0%, P =0.60) and adverse reactions. Similar progression-free survival (PFS) and overall survival (OS) were noted in overall population ( P =0.27 for PFS and P =0.61 for OS) and prespecified patient subgroups. The meta-analysis included 10 eligible cohort studies involving 1,317 NSCLC patients. It showed the positive BIM deletion was associated with shorter PFS (hazard ratio =1.45; P =0.02). Nonsignificant differences existed for ORR, DCR and OS. The expanded meta-analysis results demonstrated the positive BIM deletion predicts shorter PFS in NSCLC patients after treatment with EGFR-TKIs while other clinical measures do not. A large multicenter well-designed cohort study involving other concurrent genetic alterations is warranted.

De Novo STX16 Deletions: An Infrequent Cause of Pseudohypoparathyroidism Type Ib that Should Be Excluded in Sporadic Cases

PubMed Central

Turan, Serap; Ignatius, Jaakko; Moilanen, Jukka S.; Kuismin, Outi; Stewart, Helen; Mann, Nicholas P.; Linglart, Agnès; Bastepe, Murat

2012-01-01

Context: Maternally inherited 3-kb STX16 deletions cause autosomal dominant pseudohypoparathyroidism type Ib (PHP-Ib) characterized by PTH resistance with loss of methylation restricted to the GNAS exon A/B. Objective: The objective of the study was to search for the 3-kb STX16 deletion and to establish haplotypes for the GNAS region for two PHP-Ib patients and their families. Setting: The study was conducted at a research laboratory and tertiary care hospitals. Patients: The index cases presented at the ages 8 and 9.5 yr, respectively, with hypocalcemia, hyperphosphatemia, and elevated PTH. Interventions: There were no interventions. Results: DNA analyses of the index cases revealed an isolated loss of the GNAS exon A/B methylation and the 3-kb STX16 deletion. In the first family, the patient's healthy mother and sister showed no genetic or epigenetic abnormality, yet microsatellite analysis of the GNAS region indicated that both siblings share the same maternal allele, with the exception of an allelic loss for marker 261P9-CA1 (located within STX16), leading to the conclusion that a de novo mutation had occurred on the maternal allele. In the second family, three siblings of the index case are also affected, and an analysis of their DNA revealed the 3-kb STX16 deletion, which was also found in the healthy mother and a maternal uncle. Analysis of the siblings of the deceased maternal grandfather and some of their descendants excluded the 3-kb STX16 deletion, but haplotype analysis of the GNAS region suggested that he had acquired the mutation de novo. Conclusions: De novo 3-kb STX16 deletions, reported only once previously, are infrequent but should be excluded in all cases of PHP-Ib, even when the family history is negative for an inherited form of this disorder. PMID:23087324

Relationship of sleep abnormalities to patient genotypes in Prader-Willi syndrome

DOE Office of Scientific and Technical Information (OSTI.GOV)

Vgontzas, A.N.; Kales, A.; Bixler, E.O.

To assess whether sleep abnormalities are related to the genetic abnormalities in Prader-Willi Syndrome (PWS), we performed polysomnographic studies (nighttime and daytime) and determined the chromosome 15 genotypes in eight patients with PWS. Four patients demonstrated sleep onset REM periods (SOREM), and five met the objective polysomnographic criteria for severe or moderate excessive daytime sleepiness (EDS). Three of the four patients with SOREM displayed a paternally derived deletion of chromosome 15q11-q13, whereas the fourth exhibited maternal uniparental heterodisomy in this chromosomal region (UPD). Two of the four patients that did not display SOREM carried paternally derived deletions; the remaining twomore » demonstrated UPD. Four of the five patients with EDS displayed paternal deletions, and the fifth exhibited UPD. One of three patients without evidence of EDS demonstrated paternal deletion; the remaining two showed UPD. Although neither EDS nor SOREM was not consistently associated with a specific genetic abnormality, these phenotypes may be more common in patients with paternal deletions than in those with UPD. Sleep abnormalities in PWS cannot be explained by a single genetic model. 32 refs., 1 tab.« less

Recurrance of sporadic neurofibromatosis type 1 due to germline mosaicism in the unaffected father

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lazaro, C.; Gaona, A.; Lynch, M.

Neurofibromatosis type 1 (NF1) or von Recklinghausen disease is one of the most common autosomal dominant disorders in man. In this report we describe a kindred with two affected offspring, in which neither of the parents fulfills the diagnostic criteria of NF1. DNA from peripheral blood was obtained from the family members and from the father`s spermatozoa. Several microsatellite markers, located in intronic regions of the NF1 gene, NF1 cDNA probes, and individual NF1 exons, were analyzed. NF1 microsatellite analysis in the family showed that there was no inheritance of paternal alleles for marker IVS38GT53.0 in the two affected siblings,more » while they inherited alleles from both parents for other intragenic markers. Hybridization of DNA from the family members with intragenic probes detected abnormal fragments in the lymphocytes from the NF1 individuals and in 10% of father`s spermatozoa, but not in lymphocytes from the parents. The restriction map was consistent with an interstitial deletion of 12 kb. So, we have detected hemizygosity for a microsatellite marker within the NF1 gene, and demonstrated that severe NF1 in a family with recurrence of the diseas, is due to the inheritance of a 12-kb deletion from the clinically unaffected father, who is mosaic for the deletion in his germline cells. This is the first time that germline mosaicism has been demonstrated in NF1. The analysis of the specific NF1 mutation in the sperm of the parent in de novo cases might help in the detection of mosaicism, facilitating genetic counseling.« less

Multiple endocrine neoplasia type 1: analysis of germline MEN1 mutations in the Italian multicenter MEN1 patient database.

PubMed

Marini, Francesca; Giusti, Francesca; Fossi, Caterina; Cioppi, Federica; Cianferotti, Luisella; Masi, Laura; Boaretto, Francesca; Zovato, Stefania; Cetani, Filomena; Colao, Annamaria; Davì, Maria Vittoria; Faggiano, Antongiulio; Fanciulli, Giuseppe; Ferolla, Piero; Ferone, Diego; Loli, Paola; Mantero, Franco; Marcocci, Claudio; Opocher, Giuseppe; Beck-Peccoz, Paolo; Persani, Luca; Scillitani, Alfredo; Guizzardi, Fabiana; Spada, Anna; Tomassetti, Paola; Tonelli, Francesco; Brandi, Maria Luisa

2018-03-01

Multiple endocrine neoplasia type 1 (MEN1) is caused by germline inactivating mutations of the MEN1 gene. Currently, no direct genotype-phenotype correlation is identified. We aim to analyze MEN1 mutation site and features, and possible correlations between the mutation type and/or the affected menin functional domain and clinical presentation in patients from the Italian multicenter MEN1 database, one of the largest worldwide MEN1 mutation series published to date. The study included the analysis of MEN1 mutation profile in 410 MEN1 patients [370 familial cases from 123 different pedigrees (48 still asymptomatic at the time of this study) and 40 single cases]. We identified 99 different mutations: 41 frameshift [small intra-exon deletions (28) or insertions (13)], 13 nonsense, 26 missense and 11 splicing site mutations, 4 in-frame small deletions, and 4 intragenic large deletions spanning more than one exon. One family had two different inactivating MEN1 mutations on the same allele. Gastro-entero-pancreatic tumors resulted more frequent in patients with a nonsense mutation, and thoracic neuroendocrine tumors in individuals bearing a splicing-site mutation. Our data regarding mutation type frequency and distribution are in accordance with previously published data: MEN1 mutations are scattered through the entire coding region, and truncating mutations are the most common in MEN1 syndrome. A specific direct correlation between MEN1 genotype and clinical phenotype was not found in all our families, and wide intra-familial clinical variability and variable disease penetrance were both confirmed, suggesting a role for modifying, still undetermined, factors, explaining the variable MEN1 tumorigenesis.

Detection of SEA-type α-thalassemia in embryo biopsies by digital PCR.

PubMed

Lee, Ta-Hsien; Hsu, Ya-Chiung; Chang, Chia Lin

2017-08-01

Accurate and efficient pre-implantation genetic diagnosis (PGD) based on the analysis of single or oligo-cells is needed for timely identification of embryos that are affected by deleterious genetic traits in in vitro fertilization (IVF) clinics. Polymerase chain reaction (PCR) is the backbone of modern genetic diagnoses, and a spectrum of PCR-based techniques have been used to detect various thalassemia mutations in prenatal diagnosis (PND) and PGD. Among thalassemias, SEA-type α-thalassemia is the most common variety found in Asia, and can lead to Bart's hydrops fetalis and serious maternal complications. To formulate an efficient digital PCR for clinical diagnosis of SEA-type α-thalassemia in cultured embryos, we conducted a pilot study to detect the α-globin and SEA-type deletion alleles in blastomere biopsies with a highly sensitive microfluidics-based digital PCR method. Genomic DNA from embryo biopsy samples were extracted, and crude DNA extracts were first amplified by a conventional PCR procedure followed by a nested PCR reaction with primers and probes that are designed for digital PCR amplification. Analysis of microfluidics-based PCR reactions showed that robust signals for normal α-globin and SEA-type deletion alleles, together with an internal control gene, can be routinely generated using crude embryo biopsies after a 10 6 -fold dilution of primary PCR products. The SEA-type deletion in cultured embryos can be sensitively diagnosed with the digital PCR procedure in clinics. The adoption of this robust PGD method could prevent the implantation of IVF embryos that are destined to develop Bart's hydrops fetalis in a timely manner. The results also help inform future development of a standard digital PCR procedure for cost-effective PGD of α-thalassemia in a standard IVF clinic. Copyright © 2017. Published by Elsevier B.V.

Transferring Desirable Genes from Agropyron cristatum 7P Chromosome into Common Wheat.

PubMed

Lu, Mingjie; Lu, Yuqing; Li, Huanhuan; Pan, Cuili; Guo, Yong; Zhang, Jinpeng; Yang, Xinming; Li, Xiuquan; Liu, Weihua; Li, Lihui

2016-01-01

Wheat-Agropyron cristatum 7P disomic addition line Ⅱ-5-1, derived from the distant hybridization between A. cristatum (2n = 4x = 28, PPPP) and the common wheat cv. Fukuhokomugi (Fukuho), displays numerous desirable agronomic traits, including enhanced thousand-grain weight, smaller flag leaf, and enhanced tolerance to drought. In order to transfer these traits into common wheat, Ⅱ-5-1 was induced by 60Co-γ ray, leading to the creation of 18 translocation lines and three deletion lines. Genomic in situ hybridization (GISH) and fluorescence in situ hybridization (FISH) indicated that multiple wheat chromosomes were involved in the translocation events, including chromosome 2A, 3A, 5A, 7A, 3B, 5B, 7B, 3D and 7D. A. cristatum 7P chromosome was divided into 15 chromosomal bins with fifty-five sequence-tagged site (STS) markers specific to A. cristatum 7P chromosome. Seven and eight chromosomal bins were located on 7PS and 7PL, respectively. The above-mentioned translocation and deletion lines each contained different, yet overlapping 7P chromosomal fragments, covering the entire A. cristatum 7P chromosome. Three translocation lines (7PT-13, 7PT-14 and 7PT-17) and three deletion lines (del-1, del-2 and del-3), which contained the common chromosomal bins 7PS1-3, displayed higher thousand-grain weigh than Fukuho, suggesting that potential genes conferring high thousand-grain weigh might be located on these chromosomal bins. Therefore, wheat-A. cristatum 7P translocation lines with elite traits will be useful as novel germplasms for wheat genetic improvement.

mtDNA control-region sequence variation suggests multiple independent origins of an "Asian-specific" 9-bp deletion in sub-Saharan Africans.

PubMed Central

Soodyall, H.; Vigilant, L.; Hill, A. V.; Stoneking, M.; Jenkins, T.

1996-01-01

The intergenic COII/tRNA(Lys) 9-bp deletion in human mtDNA, which is found at varying frequencies in Asia, Southeast Asia, Polynesia, and the New World, was also found in 81 of 919 sub-Saharan Africans. Using mtDNA control-region sequence data from a subset of 41 individuals with the deletion, we identified 22 unique mtDNA types associated with the deletion in Africa. A comparison of the unique mtDNA types from sub-Saharan Africans and Asians with the 9-bp deletion revealed that sub-Saharan Africans and Asians have sequence profiles that differ in the locations and frequencies of variant sites. Both phylogenetic and mismatch-distribution analysis suggest that 9-bp deletion arose independently in sub-Saharan Africa and Asia and that the deletion has arisen more than once in Africa. Within Africa, the deletion was not found among Khoisan peoples and was rare to absent in western and southwestern African populations, but it did occur in Pygmy and Negroid populations from central Africa and in Malawi and southern African Bantu-speakers. The distribution of the 9-bp deletion in Africa suggests that the deletion could have arisen in central Africa and was then introduced to southern Africa via the recent "Bantu expansion." PMID:8644719

The fate of deleted DNA produced during programmed genomic deletion events in Tetrahymena thermophila.

PubMed Central

Saveliev, S V; Cox, M M

1994-01-01

Thousands of DNA deletion events occur during macronuclear development in the ciliate Tetrahymena thermophila. In two deleted genomic regions, designated M and R, the eliminated sequences form circles that can be detected by PCR. However, the circles are not normal products of the reaction pathway. The circular forms occur at very low levels in conjugating cells, but are stable. Sequencing analysis showed that many of the circles (as many as 50% of those examined) reflected a precise deletion in the M and R regions. The remaining circles were either smaller or larger and contained varying lengths of sequences derived from the chromosomal DNA surrounding the eliminated region. The chromosomal junctions left behind after deletion were more precise, although deletions in either the M or R regions can generate any of several alternative junctions (1). Some new chromosomal junctions were detected in the present study. The results suggest that the deleted segment is released as a linear DNA species that is degraded rapidly. The species is only rarely converted to the stable circles we detect. The deletion mechanism is different from those proposed for deletion events in hypotrichous ciliates (2-4), and does not reflect a conservative site-specific recombination process such as that promoted by the bacteriophage lambda integrase (5). Images PMID:7838724

A systematic review and meta-analysis of individual patient data on the impact of the BIM deletion polymorphism on treatment outcomes in epidermal growth factor receptor mutant lung cancer

PubMed Central

Allen, John C.; Kim, Go Woon; Lee, Jae Cheol; Yatabe, Yasushi; Soda, Manabu; Mano, Hiroyuki; Soo, Ross A.; Chin, Tan-Min; Ebi, Hiromichi; Yano, Seiji; Matsuo, Keitaro; Niu, Xiaomin; Lu, Shun; Isobe, Kazutoshi; Lee, Jih-Hsiang; Yang, James C.; Zhao, Mingchuan; Zhou, Caicun; Lee, June-Koo; Lee, Se-Hoon; Lee, Ji Yun; Ahn, Myung-Ju; Tan, Tira J.; Tan, Daniel S.; Tan, Eng-Huat; Ong, S. Tiong; Lim, Wan-Teck

2017-01-01

Background A germline deletion in the BIM (BCL2L11) gene has been shown to impair the apoptotic response to tyrosine kinase inhibitors (TKIs) in vitro but its association with poor outcomes in TKI-treated non-small cell lung cancer (NSCLC) patients remains unclear. We conducted a systematic review and meta-analysis on both aggregate and individual patient data to address this issue. Results In an aggregate data meta-analysis (n = 1429), the BIM deletion was associated with inferior PFS (HR = 1.51, 95%CI = 1.06–2.13, P = 0.02). Using individual patient data (n = 1200), we found a significant interaction between the deletion and ethnicity. Amongst non-Koreans, the deletion was an independent predictor of shorter PFS (Chinese: HR = 1.607, 95%CI = 1.251–2.065, P = 0.0002; Japanese: HR = 2.636, 95%CI = 1.603–4.335, P = 0.0001), and OS (HR = 1.457, 95% CI = 1.063–1.997, P = 0.019). In Kaplan-Meier analyses, the BIM deletion was associated with shorter survival in non-Koreans (PFS: 8.0 months v 11.1 months, P < 0.0005; OS: 25.7 v 30.0 months, P = 0.042). In Koreans, the BIM deletion was not predictive of PFS or OS. Materials and Methods 10 published and 3 unpublished studies that reported survival outcomes in NSCLC patients stratified according to BIM deletion were identified from PubMed and Embase. Summary risk estimates were calculated from aggregate patient data using a random-effects model. For individual patient data, Kaplan-Meier analyses were supported by multivariate Cox regression to estimate hazard ratios (HRs) for PFS and OS. Conclusions In selected populations, the BIM deletion is a significant predictor of shorter PFS and OS on EGFR-TKIs. Further studies to determine its effect on response to other BIM-dependent therapeutic agents are needed, so that alternative treatment strategies may be devised. PMID:28467813

Xp22.3 genomic deletions involving the CDKL5 gene in girls with early onset epileptic encephalopathy.

PubMed

Mei, Davide; Marini, Carla; Novara, Francesca; Bernardina, Bernardo D; Granata, Tiziana; Fontana, Elena; Parrini, Elena; Ferrari, Anna R; Murgia, Alessandra; Zuffardi, Orsetta; Guerrini, Renzo

2010-04-01

Mutations of the X-linked gene cyclin-dependent kinase-like 5 (CDKL5) cause an X-linked encephalopathy with early onset intractable epilepsy, including infantile spasms and other seizure types, and a Rett syndrome (RTT)-like phenotype. Very limited information is available on the frequency and phenotypic spectrum associated with CDKL5 deletions/duplications. We investigated the role of CDKL5 deletions/duplications in causing early onset intractable epilepsy of unknown etiology in girls. We studied 49 girls with early onset intractable epilepsy, with or without infantile spasms, and developmental impairment, for whom no etiologic factors were obvious after clinical examination, brain magnetic resonance imaging (MRI) and expanded screening for inborn errors of metabolism. We performed CDKL5 gene mutation analysis in all and multiplex ligation dependent probe amplification assay (MLPA) in those who were mutation negative. Custom Array-comparative genomic hybridization (CGH), breakpoint polymerase chain reaction (PCR) analysis, and X-inactivation studies were performed in patients in whom MLPA uncovered a genomic alteration. We found CDKL5 mutations in 8.2% (4 of 49) of patients and genomic deletions in 8.2% (4 of 49). Overall, abnormalities of the CDKL5 gene accounted for 16.3% (8 of 49) of patients. CDKL5 gene deletions are an under-ascertained cause of early onset intractable epilepsy in girls. Genetic testing of CDKL5, including both mutation and deletion/duplication analysis, should be considered in this clinical subgroup.

Absence of Genomic Ikaros/IKZF1 Deletions in Pediatric B-Precursor Acute Lymphoblastic Leukemia

PubMed Central

Qazi, Sanjive; Ma, Hong; Uckun, Fatih M

2013-01-01

Here we report the results of gene expression analyses using multiple probesets aimed at determining the incidence of Ikaros/IKZF1 deletions in pediatric B-precursor acute lymphoblastic leukemia (BPL). Primary leukemia cells from 122 Philadelphia chromosome (Ph)+ BPL patients and 237 Ph− BPL patients as well as normal hematopoietic cells from 74 normal non-leukemic bone marrow specimens were organized according to expression levels of IKZF1 transcripts utilizing two-way hierarchical clustering technique to identify specimens with low IKZF1 expression for the 10 probesets interrogating Exons 1 through 4 and Exon 8. Our analysis demonstrated no changes in expression that would be expected from homozygous or heterozygous deletions of IKZF1 in primary leukemic cells. Similar results were obtained in gene expression analysis of primary leukemic cells from 20 Ph+ positive and 155 Ph− BPL patients in a validation dataset. Taken together, our gene expression analyses in 534 pediatric BPL cases, including 142 cases with Ph+ BPL, contradict previous reports that were based on SNP array data and suggested that Ph+ pediatric BPL is characterized by a high frequency of homozygous or heterozygous IKZF1 deletions. Further, exon-specific genomic PCR analysis of primary leukemia cells from 21 high-risk pediatric BPL patients and 11 standard-risk pediatric BPL patients, and 8 patients with infant BPL did not show any evidence for homozygous IKZF1 locus deletions. Nor was there any evidence for homozygous or heterozygous intragenic IKZF1 deletions. PMID:24478816

Identifying Likely Transmission Pathways within a 10-Year Community Outbreak of Tuberculosis by High-Depth Whole Genome Sequencing

PubMed Central

Sadsad, Rosemarie; Martinez, Elena; Jelfs, Peter; Hill-Cawthorne, Grant A.; Gilbert, Gwendolyn L.; Marais, Ben J.; Sintchenko, Vitali

2016-01-01

Background Improved tuberculosis control and the need to contain the spread of drug-resistant strains provide a strong rationale for exploring tuberculosis transmission dynamics at the population level. Whole-genome sequencing provides optimal strain resolution, facilitating detailed mapping of potential transmission pathways. Methods We sequenced 22 isolates from a Mycobacterium tuberculosis cluster in New South Wales, Australia, identified during routine 24-locus mycobacterial interspersed repetitive unit typing. Following high-depth paired-end sequencing using the Illumina HiSeq 2000 platform, two independent pipelines were employed for analysis, both employing read mapping onto reference genomes as well as de novo assembly, to control biases in variant detection. In addition to single-nucleotide polymorphisms, the analyses also sought to identify insertions, deletions and structural variants. Results Isolates were highly similar, with a distance of 13 variants between the most distant members of the cluster. The most sensitive analysis classified the 22 isolates into 18 groups. Four of the isolates did not appear to share a recent common ancestor with the largest clade; another four isolates had an uncertain ancestral relationship with the largest clade. Conclusion Whole genome sequencing, with analysis of single-nucleotide polymorphisms, insertions, deletions, structural variants and subpopulations, enabled the highest possible level of discrimination between cluster members, clarifying likely transmission pathways and exposing the complexity of strain origin. The analysis provides a basis for targeted public health intervention and enhanced classification of future isolates linked to the cluster. PMID:26938641

Juvenile Moyamoya and Craniosynostosis in a Child with Deletion 1p32p31: Expanding the Clinical Spectrum of 1p32p31 Deletion Syndrome and a Review of the Literature

PubMed Central

Prontera, Paolo; Rogaia, Daniela; Mencarelli, Amedea; Ottaviani, Valentina; Guercini, Giorgio; Bersano, Anna; Stangoni, Gabriela

2017-01-01

Moyamoya angiopathy (MA) is a rare cerebrovascular disorder characterised by the progressive occlusion of the internal carotid artery. Its aetiology is uncertain, but a genetic background seems likely, given the high MA familial rate. To investigate the aetiology of craniosynostosis and juvenile moyamoya in a 14-year-old male patient, we performed an array-comparative genomic hybridisation revealing a de novo interstitial deletion of 8.5 Mb in chromosome region 1p32p31. The deletion involved 34 protein coding genes, including NF1A, whose haploinsufficiency is indicated as being mainly responsible for the 1p32-p31 chromosome deletion syndrome phenotype (OMIM 613735). Our patient also has a deleted FOXD3 of the FOX gene family of transcription factors, which plays an important role in neural crest cell growth and differentiation. As the murine FOXD3−/− model shows craniofacial anomalies and abnormal common carotid artery morphology, it can be hypothesised that FOXD3 is involved in the pathogenesis of the craniofacial and vascular defects observed in our patient. In support of our assumption, we found in the literature another patient with a syndromic form of MA who had a deletion involving another FOX gene (FOXC1). In addition to describing the clinical history of our patient, we have reviewed all of the available literature concerning other patients with a 1p32p31 deletion, including cases from the Decipher database, and we have also reviewed the genetic disorders associated with MA, which is a useful guide for the diagnosis of syndromic form of MA. PMID:28926972

Disparities in visuo-spatial constructive abilities in Williams syndrome patients with typical deletion on chromosome 7q11.23.

PubMed

Muramatsu, Yukako; Tokita, Yoshihito; Mizuno, Seiji; Nakamura, Miho

2017-02-01

Williams syndrome (WS) is known for its uneven cognitive abilities, especially the difficulty in visuo-spatial cognition, though there are some inter-individual phenotypic differences. It has been proposed that the difficulty in visuo-spatial cognition of WS patients can be attributed to a haploinsufficiency of some genes located on the deleted region in 7q11.23, based on an examination of atypical deletions identified in WS patients with atypical cognitive deficits. According to this hypothesis, the inter-individual differences in visuo-spatial cognitive ability arise from variations in deletion. We investigated whether there were inter-individual differences in the visuo-spatial constructive abilities of five unrelated WS patients with the typical deletion on chromosome 7q11.23 that includes the candidate genes contributing visuo-spatial difficulty in WS patients. We used tests with three-dimensional factors such as Benton's three-dimensional block construction test, which are considered to be more sensitive than those with only two-dimensional factors. There were diverse inter-individual differences in the visuo-spatial constructive abilities among the present participants who shared the same typical genomic deletion of WS. One of the participants showed almost equivalent performances to typically developing adults in those tests. In the present study, we found a wide range of cognitive abilities in visuo-spatial construction even among the patients with a common deletion pattern of WS. The findings suggest that attributing differences in the phenotypes entirely to genetic factors such as an atypical deletion may not be always correct. Copyright © 2016 The Japanese Society of Child Neurology. Published by Elsevier B.V. All rights reserved.

Spectrum of phenotypic anomalies in four families with deletion of the SHOX enhancer region.

PubMed

Gatta, Valentina; Palka, Chiara; Chiavaroli, Valentina; Franchi, Sara; Cannataro, Giovanni; Savastano, Massimo; Cotroneo, Antonio Raffaele; Chiarelli, Francesco; Mohn, Angelika; Stuppia, Liborio

2014-07-23

SHOX alterations have been reported in 67% of patients affected by Léri-Weill dyschondrosteosis (LWD), with a larger prevalence of gene deletions than point mutations. It has been recently demonstrated that these deletions can involve the SHOX enhancer region, rather that the coding region, with variable phenotype of the affected patients.Here, we report a SHOX gene analysis carried out by MLPA in 14 LWD patients from 4 families with variable phenotype. All patients presented a SHOX enhancer deletion. In particular, a patient with a severe bilateral Madelung deformity without short stature showed a homozygous alteration identical to the recently described 47.5 kb PAR1 deletion. Moreover, we identified, for the first time, in three related patients with a severe bilateral Madelung deformity, a smaller deletion than the 47.5 kb PAR1 deletion encompassing the same enhancer region (ECR1/CNE7). Data reported in this study provide new information about the spectrum of phenotypic alterations showed by LWD patients with different deletions of the SHOX enhancer region.

Spectrum of phenotypic anomalies in four families with deletion of the SHOX enhancer region

PubMed Central

2014-01-01

Background SHOX alterations have been reported in 67% of patients affected by Léri-Weill dyschondrosteosis (LWD), with a larger prevalence of gene deletions than point mutations. It has been recently demonstrated that these deletions can involve the SHOX enhancer region, rather that the coding region, with variable phenotype of the affected patients. Here, we report a SHOX gene analysis carried out by MLPA in 14 LWD patients from 4 families with variable phenotype. Case presentation All patients presented a SHOX enhancer deletion. In particular, a patient with a severe bilateral Madelung deformity without short stature showed a homozygous alteration identical to the recently described 47.5 kb PAR1 deletion. Moreover, we identified, for the first time, in three related patients with a severe bilateral Madelung deformity, a smaller deletion than the 47.5 kb PAR1 deletion encompassing the same enhancer region (ECR1/CNE7). Conclusions Data reported in this study provide new information about the spectrum of phenotypic alterations showed by LWD patients with different deletions of the SHOX enhancer region. PMID:25056248

Quantitative PCR analysis reveals a high incidence of large intragenic deletions in the FANCA gene in Spanish Fanconi anemia patients.

PubMed

Callén, E; Tischkowitz, M D; Creus, A; Marcos, R; Bueren, J A; Casado, J A; Mathew, C G; Surrallés, J

2004-01-01

Fanconi anaemia is an autosomal recessive disease characterized by chromosome fragility, multiple congenital abnormalities, progressive bone marrow failure and a high predisposition to develop malignancies. Most of the Fanconi anaemia patients belong to complementation group FA-A due to mutations in the FANCA gene. This gene contains 43 exons along a 4.3-kb coding sequence with a very heterogeneous mutational spectrum that makes the mutation screening of FANCA a difficult task. In addition, as the FANCA gene is rich in Alu sequences, it was reported that Alu-mediated recombination led to large intragenic deletions that cannot be detected in heterozygous state by conventional PCR, SSCP analysis, or DNA sequencing. To overcome this problem, a method based on quantitative fluorescent multiplex PCR was proposed to detect intragenic deletions in FANCA involving the most frequently deleted exons (exons 5, 11, 17, 21 and 31). Here we apply the proposed method to detect intragenic deletions in 25 Spanish FA-A patients previously assigned to complementation group FA-A by FANCA cDNA retroviral transduction. A total of eight heterozygous deletions involving from one to more than 26 exons were detected. Thus, one third of the patients carried a large intragenic deletion that would have not been detected by conventional methods. These results are in agreement with previously published data and indicate that large intragenic deletions are one of the most frequent mutations leading to Fanconi anaemia. Consequently, this technology should be applied in future studies on FANCA to improve the mutation detection rate. Copyright 2003 S. Karger AG, Basel

A large homozygous deletion in the SAMHD1 gene causes atypical Aicardi–Goutiéres syndrome associated with mtDNA deletions

PubMed Central

Leshinsky-Silver, Esther; Malinger, Gustavo; Ben-Sira, Liat; Kidron, Dvora; Cohen, Sarit; Inbar, Shani; Bezaleli, Tali; Levine, Arie; Vinkler, Chana; Lev, Dorit; Lerman-Sagie, Tally

2011-01-01

Aicardi–Goutiéres syndrome (AGS) is a genetic neurodegenerative disorder with clinical symptoms mimicking a congenital viral infection. Five causative genes have been described: three prime repair exonuclease1 (TREX1), ribonucleases H2A, B and C, and most recently SAM domain and HD domain 1 (SAMHD1). We performed a detailed clinical and molecular characterization of a family with autosomal recessive neurodegenerative disorder showing white matter destruction and calcifications, presenting in utero and associated with multiple mtDNA deletions. A muscle biopsy was normal and did not show any evidence of respiratory chain dysfunction. Southern blot analysis of tissue from a living child and affected fetuses demonstrated multiple mtDNA deletions. Molecular analysis of genes involved in mtDNA synthesis and maintenance (POLGα, POLGβ, Twinkle, ANT1, TK2, SUCLA1 and DGOUK) revealed normal sequences. Sequencing of TREX1 and ribonucleases H2A, B and C failed to reveal any mutations. Whole-genome homozygosity mapping revealed a candidate region containing the SAMHD1 gene. Sequencing of the gene in the affected child and two affected fetuses revealed a large deletion (9 kb), spanning the promoter, exon1 and intron 1. The parents were found to be heterozygous for this deletion. The identification of a homozygous large deletion in the SAMHD1 gene causing atypical AGS with multiple mtDNA deletions may add information regarding the involvement of mitochondria in self-activation of innate immunity by cell intrinsic components. PMID:21102625

Design and Validation of a New MLPA-Based Assay for the Detection of RS1 Gene Deletions and Application in a Large Family with X-Linked Juvenile Retinoschisis

PubMed Central

Nicoletti, Annalisa; Ziccardi, Lucia; Benedetti, Sabrina; Palumbo, Orazio; Rendina, Michelina; D'Agruma, Leonardo; Falsini, Benedetto; Wang, Xinjing; Bertelli, Matteo

2017-01-01

Aims: X-linked juvenile retinoschisis (XLRS) is a severe ocular disorder that can evolve to blindness. More than 200 different disease-causing mutations have been reported in the RS1 gene and approximately 10% of these are deletions. Since transmission is X-linked, males are always affected and females are usually carriers. The identification of female carriers is always important and poses a technical challenge. Therefore, we sought to develop a multiplex ligation dependent probe amplification (MLPA)-based method to identify deletions or duplications in this gene. We then used our assay to study a large XLRS family. Methods: We designed six probes specific for each RS1 exon and then optimized and validated our method using control samples with known gene deletions. In the XLRS family, RS1 gene copy number variation was assessed by “home-made” MLPA analysis and by single nucleotide polymorphism (SNP) array analysis using the CytoScan HD Array. Direct sequencing was used for deletion breakpoint mapping. Results: Our assay detected all deletions in control samples. All affected males of the family were positive for a deletion of exon 2 of the RS1 gene (RS1:NM_000330:c.53-?_78+?del). Carrier females were also identified. Conclusion: Our method is easily replicated, reliable, and inexpensive and allows female carriers to be detected. This is the first report of deep characterization of a whole exon deletion in the RS1 gene. PMID:27997221

Genetic testing for oculocutaneous albinism type 1 and 2 and Hermansky-Pudlak syndrome type 1 and 3 mutations in Puerto Rico.

PubMed

Santiago Borrero, Pedro J; Rodríguez-Pérez, Yolanda; Renta, Jessicca Y; Izquierdo, Natalio J; Del Fierro, Laura; Muñoz, Daniel; Molina, Norma López; Ramírez, Sonia; Pagán-Mercado, Glorivee; Ortíz, Idith; Rivera-Caragol, Enid; Spritz, Richard A; Cadilla, Carmen L

2006-01-01

Hermansky-Pudlak syndrome (HPS) (MIM #203300) is a heterogeneous group of autosomal recessive disorders characterized by oculocutaneous albinism (OCA), bleeding tendency, and lysosomal dysfunction. HPS is very common in Puerto Rico (PR), particularly in the northwest part of the island, with a frequency of approximately 1:1,800. Two HPS genes and mutations have been identified in PR, a 16-base pair (bp) duplication in HPS1 and a 3,904-bp deletion in HPS3. In Puerto Ricans with more typical OCA, the most common mutation of the tyrosinase (TYR) (human tyrosinase (OCA1) gene) gene was G47D. We describe screening 229 Puerto Rican OCA patients for these mutations, and for mutations in the OCA2 gene. We found the HPS1 mutation in 42.8% of cases, the HPS3 deletion in 17%, the TYR G47D mutation in 3.0%, and a 2.4-kb deletion of the OCA2 gene in 1.3%. Among Puerto Rican newborns, the frequency of the HPS1 mutation is highest in northwest PR (1:21; 4.8%) and lower in central PR (1:64; 1.6%). The HPS3 gene deletion is most frequent in central PR (1:32; 3.1%). Our findings provide insights into the genetics of albinism and HPS in PR, and provide the basis for genetic screening for these disorders in this minority population.

Genetic Testing for Oculocutaneous Albinism Type 1 and 2 and Hermansky–Pudlak Syndrome Type 1 and 3 Mutations in Puerto Rico

PubMed Central

Santiago Borrero, Pedro J.; Rodríguez-Pérez, Yolanda; Renta, Jessicca Y.; Izquierdo, Natalio J.; del Fierro, Laura; Muñoz, Daniel; Molina, Norma López; Ramírez, Sonia; Pagán-Mercado, Glorivee; Ortíz, Idith; Rivera-Caragol, Enid; Spritz, Richard A.; Cadilla, Carmen L.

2013-01-01

Hermansky–Pudlak syndrome (HPS) (MIM #203300) is a heterogeneous group of autosomal recessive disorders characterized by oculocutaneous albinism (OCA), bleeding tendency, and lysosomal dysfunction. HPS is very common in Puerto Rico (PR), particularly in the northwest part of the island, with a frequency of ~1:1,800. Two HPS genes and mutations have been identified in PR, a 16-base pair (bp) duplication in HPS1 and a 3,904-bp deletion in HPS3. In Puerto Ricans with more typical OCA, the most common mutation of the tyrosinase (TYR) (human tyrosinase (OCA1) gene) gene was G47D. We describe screening 229 Puerto Rican OCA patients for these mutations, and for mutations in the OCA2 gene. We found the HPS1 mutation in 42.8% of cases, the HPS3 deletion in 17%, the TYR G47D mutation in 3.0%, and a 2.4-kb deletion of the OCA2 gene in 1.3%. Among Puerto Rican newborns, the frequency of the HPS1 mutation is highest in northwest PR (1:21; 4.8%) and lower in central PR (1:64; 1.6%). The HPS3 gene deletion is most frequent in central PR (1:32; 3.1%). Our findings provide insights into the genetics of albinism and HPS in PR, and provide the basis for genetic screening for these disorders in this minority population. PMID:16417222

Identification of a novel AluSx-mediated deletion of exon 3 in the SBDS gene in a patient with Shwachman-Diamond syndrome.

PubMed

Costa, Elísio; Duque, Frederico; Oliveira, Jorge; Garcia, Paula; Gonçalves, Isabel; Diogo, Luísa; Santos, Rosário

2007-01-01

Shwachman-Diamond syndrome (SDS) is caused by mutations in the SBDS gene, most of which are the result of gene conversion events involving its highly homologous pseudogene SBDSP. Here we describe the molecular characterization of the first documented gross deletion in the SBDS gene, in a 4-year-old Portuguese girl with SDS. The clinical diagnosis was based on the presence of hematological symptoms (severe anemia and cyclic neutropenia), pancreatic exocrine insufficiency and skeletal abnormalities. Routine molecular screening revealed heterozygosity for the common splicing mutation c.258+2T>C, and a further step-wise approach led to the detection of a large deletion encompassing exon 3, the endpoints of which were subsequently delineated at the gDNA level. This novel mutation (c.258+374_459+250del), predictably giving rise to an internally deleted polypeptide (p.Ile87_Gln153del), appears to have arisen from an excision event mediated by AluSx elements which are present in introns 2 and 3. Our case illustrates the importance of including gross deletion screening in the SDS diagnostic setting, especially in cases where only one deleterious mutation is detected by routine screening methods. In particular, deletional rearrangements involving exon 3 should be considered, since Alu sequences are known to be an important cause of recurrent mutations.

VHL deletion impairs mammary alveologenesis but is not sufficient for mammary tumorigenesis.

PubMed

Seagroves, Tiffany N; Peacock, Danielle L; Liao, Debbie; Schwab, Luciana P; Krueger, Robin; Handorf, Charles R; Haase, Volker H; Johnson, Randall S

2010-05-01

Overexpression of hypoxia inducible factor-1 (HIF-1)alpha, which is common in most solid tumors, correlates with poor prognosis and high metastatic risk in breast cancer patients. Because HIF-1alpha protein stability is tightly controlled by the tumor suppressor von Hippel-Lindau (VHL), deletion of VHL results in constitutive HIF-1alpha expression. To determine whether VHL plays a role in normal mammary gland development, and if HIF-1alpha overexpression is sufficient to initiate breast cancer, Vhl was conditionally deleted in the mammary epithelium using the Cre/loxP system. During first pregnancy, loss of Vhl resulted in decreased mammary epithelial cell proliferation and impaired alveolar differentiation; despite these phenotypes, lactation was sufficient to support pup growth. In contrast, in multiparous dams, Vhl(-/-) mammary glands exhibited a progressive loss of alveolar epithelium, culminating in lactation failure. Deletion of Vhl in the epithelium also impacted the mammary stroma, as there was increased microvessel density accompanied by hemorrhage and increased immune cell infiltration. However, deletion of Vhl was not sufficient to induce mammary tumorigenesis in dams bred continuously for up to 24 months of age. Moreover, co-deletion of Hif1a could not rescue the Vhl(-/-)-dependent phenotype as dams were unable to successfully lactate during the first lactation. These results suggest that additional VHL-regulated genes besides HIF1A function to maintain the proliferative and regenerative potential of the breast epithelium.

Interrelationship between TP53 gene deletion, protein expression and chromosome 17 aneusomy in gastric adenocarcinoma

PubMed Central

2009-01-01

Background This study evaluates the existence of numerical alterations of chromosome 17 and TP53 gene deletion in gastric adenocarcinoma. The p53 protein expression was also evaluated, as well as, possible associations with clinicopathological characteristics. Methods Dual-color fluorescence in situ hybridization and immunostaining were performed in twenty gastric cancer samples of individuals from Northern Brazil. Results Deletion of TP53 was found in all samples. TP53 was inactivated mainly by single allelic deletion, varying to 7–39% of cells/case. Aneusomy of chromosome 17 was observed in 85% of cases. Chromosome 17 monosomy and gain were both observed in about half of cases. Cells with gain of chromosome 17 frequently presented TP53 deletion. The frequency of cells with two chr17 and one TP53 signals observed was higher in diffuse than in intestinal-type GC. Immunoreactivity of p53 was found only in intestinal-type samples. The frequency of cells with two chr17 and two TP53 signals found was higher in samples with positive p53 expression than in negative cases in intestinal-type GC. Conclusion We suggest that TP53 deletion and chromosome 17 aneusomy is a common event in GC and other TP53 alterations, as mutation, may be implicated in the distinct carcinogenesis process of diffuse and intestinal types. PMID:19619279

The short arm deletion syndrome of chromosome 4 (4p- syndrome).

PubMed

Zellweger, H; Bardach, J; Bordwell, J; Williams, K

1975-01-01

Partial deletion of the short arm of chromosome 4 (4p-) represents another (rare) cause of cleft lip and cleft palate. Further characteristic manifestations of the syndrome (also called Wolf or Wolf-Hirschhorn syndrome) are growth failure, microcephaly, prominent glabella, hypertelorism, beaked nose, poorly differentiated and low set ears, cardiac and renal malformation and hypospadias. Life expectancy is often shortened. The 4p- syndrome has many features in common with another deletion syndrome, the cri-du-chat syndrome, and also with the Smith-Lemli-Opitz syndrome. The latter is a hereditary condition with normal karyotype. The cri-du-chat syndrome is characterized by a peculiar high-pitched, mewing cry and can be differentiated from the Wolf syndrome by the different staining characteristics (banding) of chromosomes 4 and 5.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chitayat, D.; Thomas, M.; Silver, M.M.

Homozygosity for the South-Asian {alpha}-thalassemia (--{sup SEA}/) deletion is a serious hematological condition that results, in most cases, in intrauterine or postnatal death due to anemia and severe hypoxia of prenatal onset. A relationship between congenital abnormalities and intrauterine hypoxia has been postulated. However, since homozygosity for the (--{sup SEA}/) deletion is most common in underdeveloped countries where detailed autopsies are lacking, the incidence of congenital abnormalities among these babies has not been well delineated. We report on three newborn infants, homozygous for the (--{sup SEA}/) deletion, who were born with limb defects. We postulate that this combination is themore » result of prenatal hypoxia which may affect other fetal body organs. This should be taken into consideration when prenatal treatment of affected fetuses, with intrauterine blood transfusion, is suggested. 47 refs., 3 figs.« less

A patient with congenital hyperlactataemia and Leigh syndrome: an uncommon mitochondrial variant.

PubMed

Ching, C K; Mak, Chloe M; Au, K M; Chan, K Y; Yuen, Y P; Yau, Eric K C; Ma, Louis C K; Chow, H L; Chan, Albert Y W

2013-08-01

We report an uncommon mitochondrial variant in a baby girl with congenital hyperlactataemia and Leigh syndrome. The patient presented with a single episode of generalised clonic convulsion at day 19, and was found to have isolated and persistent hyperlactataemia ranging from 3.34 to 9.26 mmol/L. She had elevated serum lactate-to-pyruvate ratios of up to 35 and high plasma alanine concentration, indicative of a respiratory chain defect. At the age of 8 months, she developed evolving neurological and imaging features compatible with Leigh syndrome. Genetic testing for common mitochondrial DNA mutations, large mitochondrial DNA deletions, and selected nuclear genes was negative. Further analysis of lymphocyte mitochondrial DNA by sequencing revealed an uncommon heteroplasmic variant, NC_012920.1(MT-ND5):m.13094T>C (p.Val253Ala), which was previously shown to reduce complex I activity. In patients in whom there was a high suspicion of mitochondrial disorder, entire mitochondrial DNA analysis may be warranted if initial screening of common mitochondrial DNA mutations is negative.

Screening for duplications, deletions and a common intronic mutation detects 35% of second mutations in patients with USH2A monoallelic mutations on Sanger sequencing.

PubMed

Steele-Stallard, Heather B; Le Quesne Stabej, Polona; Lenassi, Eva; Luxon, Linda M; Claustres, Mireille; Roux, Anne-Francoise; Webster, Andrew R; Bitner-Glindzicz, Maria

2013-08-08

Usher Syndrome is the leading cause of inherited deaf-blindness. It is divided into three subtypes, of which the most common is Usher type 2, and the USH2A gene accounts for 75-80% of cases. Despite recent sequencing strategies, in our cohort a significant proportion of individuals with Usher type 2 have just one heterozygous disease-causing mutation in USH2A, or no convincing disease-causing mutations across nine Usher genes. The purpose of this study was to improve the molecular diagnosis in these families by screening USH2A for duplications, heterozygous deletions and a common pathogenic deep intronic variant USH2A: c.7595-2144A>G. Forty-nine Usher type 2 or atypical Usher families who had missing mutations (mono-allelic USH2A or no mutations following Sanger sequencing of nine Usher genes) were screened for duplications/deletions using the USH2A SALSA MLPA reagent kit (MRC-Holland). Identification of USH2A: c.7595-2144A>G was achieved by Sanger sequencing. Mutations were confirmed by a combination of reverse transcription PCR using RNA extracted from nasal epithelial cells or fibroblasts, and by array comparative genomic hybridisation with sequencing across the genomic breakpoints. Eight mutations were identified in 23 Usher type 2 families (35%) with one previously identified heterozygous disease-causing mutation in USH2A. These consisted of five heterozygous deletions, one duplication, and two heterozygous instances of the pathogenic variant USH2A: c.7595-2144A>G. No variants were found in the 15 Usher type 2 families with no previously identified disease-causing mutations. In 11 atypical families, none of whom had any previously identified convincing disease-causing mutations, the mutation USH2A: c.7595-2144A>G was identified in a heterozygous state in one family. All five deletions and the heterozygous duplication we report here are novel. This is the first time that a duplication in USH2A has been reported as a cause of Usher syndrome. We found that 8 of 23 (35%) of 'missing' mutations in Usher type 2 probands with only a single heterozygous USH2A mutation detected with Sanger sequencing could be attributed to deletions, duplications or a pathogenic deep intronic variant. Future mutation detection strategies and genetic counselling will need to take into account the prevalence of these types of mutations in order to provide a more comprehensive diagnostic service.

Quantitative proteomics and network analysis of SSA1 and SSB1 deletion mutants reveals robustness of chaperone HSP70 network in Saccharomyces cerevisiae

PubMed Central

Jarnuczak, Andrew F.; Eyers, Claire E.; Schwartz, Jean‐Marc; Grant, Christopher M.

2015-01-01

Molecular chaperones play an important role in protein homeostasis and the cellular response to stress. In particular, the HSP70 chaperones in yeast mediate a large volume of protein folding through transient associations with their substrates. This chaperone interaction network can be disturbed by various perturbations, such as environmental stress or a gene deletion. Here, we consider deletions of two major chaperone proteins, SSA1 and SSB1, from the chaperone network in Sacchromyces cerevisiae. We employ a SILAC‐based approach to examine changes in global and local protein abundance and rationalise our results via network analysis and graph theoretical approaches. Although the deletions result in an overall increase in intracellular protein content, correlated with an increase in cell size, this is not matched by substantial changes in individual protein concentrations. Despite the phenotypic robustness to deletion of these major hub proteins, it cannot be simply explained by the presence of paralogues. Instead, network analysis and a theoretical consideration of folding workload suggest that the robustness to perturbation is a product of the overall network structure. This highlights how quantitative proteomics and systems modelling can be used to rationalise emergent network properties, and how the HSP70 system can accommodate the loss of major hubs. PMID:25689132

Novel large deletion in AVPR2 gene causing copy number variation in a patient with X-linked nephrogenic diabetes insipidus.

PubMed

Cho, Sun Young; Law, Chun Yiu; Ng, Kwok Leung; Lam, Ching Wan

2016-04-01

The diagnosis of cranial and nephrogenic diabetes insipidus (DI) can be clinically challenging. The application of molecular genetic analysis can help in resolving diagnostic difficulties. A 3 month-old boy presented with recurrent polyuria was admitted to Intensive Care Unit and was treated as DI. The patient also had a strong family history of polyuria affecting his maternal uncles. Molecular genetic analysis using Single Nucleotide Polymorphism (SNP) array detected a large deletion located at Xq28 region and the breakpoint was identified using PCR and Sanger sequencing. An 11,535 bp novel deletion affecting the entire APVR2 gene and the last intron and exon of the ARHGAP4 gene was confirmed. This large deletion is likely due to the 7-bp microhomology sequence at the junctions of both 5' and 3' breakpoints. No disease-causing mutation was identified for AQP2. We report a novel deletion in a Chinese patient with congenital nephrogenic DI. We suggested that patients with suspected congenital DI should undergo genetic analysis of AVPR2 and AQP2 genes. A definitive diagnosis can benefit patient by treatment of hydrochlorothiazide and amiloride and avoiding unnecessary investigations. Copyright © 2016 Elsevier B.V. All rights reserved.

Copy-Number Variation of the Glucose Transporter Gene SLC2A3 and Congenital Heart Defects in the 22q11.2 Deletion Syndrome.

PubMed

Mlynarski, Elisabeth E; Sheridan, Molly B; Xie, Michael; Guo, Tingwei; Racedo, Silvia E; McDonald-McGinn, Donna M; Gai, Xiaowu; Chow, Eva W C; Vorstman, Jacob; Swillen, Ann; Devriendt, Koen; Breckpot, Jeroen; Digilio, Maria Cristina; Marino, Bruno; Dallapiccola, Bruno; Philip, Nicole; Simon, Tony J; Roberts, Amy E; Piotrowicz, Małgorzata; Bearden, Carrie E; Eliez, Stephan; Gothelf, Doron; Coleman, Karlene; Kates, Wendy R; Devoto, Marcella; Zackai, Elaine; Heine-Suñer, Damian; Shaikh, Tamim H; Bassett, Anne S; Goldmuntz, Elizabeth; Morrow, Bernice E; Emanuel, Beverly S

2015-05-07

The 22q11.2 deletion syndrome (22q11DS; velocardiofacial/DiGeorge syndrome; VCFS/DGS) is the most common microdeletion syndrome and the phenotypic presentation is highly variable. Approximately 65% of individuals with 22q11DS have a congenital heart defect (CHD), mostly of the conotruncal type, and/or an aortic arch defect. The etiology of this phenotypic variability is not currently known. We hypothesized that copy-number variants (CNVs) outside the 22q11.2 deleted region might increase the risk of being born with a CHD in this sensitized population. Genotyping with Affymetrix SNP Array 6.0 was performed on two groups of subjects with 22q11DS separated by time of ascertainment and processing. CNV analysis was completed on a total of 949 subjects (cohort 1, n = 562; cohort 2, n = 387), 603 with CHDs (cohort 1, n = 363; cohort 2, n = 240) and 346 with normal cardiac anatomy (cohort 1, n = 199; cohort 2, n = 147). Our analysis revealed that a duplication of SLC2A3 was the most frequent CNV identified in the first cohort. It was present in 18 subjects with CHDs and 1 subject without (p = 3.12 × 10(-3), two-tailed Fisher's exact test). In the second cohort, the SLC2A3 duplication was also significantly enriched in subjects with CHDs (p = 3.30 × 10(-2), two-tailed Fisher's exact test). The SLC2A3 duplication was the most frequent CNV detected and the only significant finding in our combined analysis (p = 2.68 × 10(-4), two-tailed Fisher's exact test), indicating that the SLC2A3 duplication might serve as a genetic modifier of CHDs and/or aortic arch anomalies in individuals with 22q11DS. Copyright © 2015 The American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.

Different approaches in the molecular analysis of the SHOX gene dysfunctions.

PubMed

Stuppia, L; Gatta, V; Antonucci, I; Giuliani, R; Palka, G

2010-06-01

Deficit of the short stature homeobox containing gene (SHOX) accounts for 2.15% of cases of idiopathic short stature (ISS) and 50-100% of cases of Leri-Weill dyschondrosteosis (LWD). It has been demonstrated that patients with SHOX deficit show a good response to treatment with GH. Thus, the early identification of SHOX alterations is a crucial point in order to choose the best treatment for ISS and LWD patients. In this study, we analyze the most commonly used molecular techniques for the detection of SHOX gene alterations. multiple ligation-dependent probe amplification analysis appears to represent the gold standard for the detection of deletion involving the SHOX gene or the enhancer region, being able to show both alterations in a single assay.

Inflammatory peeling skin syndrome caused by homozygous genomic deletion in the PSORS1 region encompassing the CDSN gene.

PubMed

Ishida-Yamamoto, Akemi; Furio, Laetitia; Igawa, Satomi; Honma, Masaru; Tron, Elodie; Malan, Valerie; Murakami, Masamoto; Hovnanian, Alain

2014-01-01

Peeling skin syndrome (PSS) type B is a rare recessive genodermatosis characterized by lifelong widespread, reddish peeling of the skin with pruritus. The disease is caused by small-scale mutations in the Corneodesmosin gene (CDSN) leading to premature termination codons. We report for the first time a Japanese case resulting from complete deletion of CDSN. Corneodesmosin was undetectable in the epidermis, and CDSN was unamplifiable by PCR. QMPSF analysis demonstrated deletion of CDSN exons inherited from each parent. Deletion mapping using microsatellite haplotyping, CGH array and PCR analysis established that the genomic deletion spanned 49-72 kb between HCG22 and TCF19, removing CDSN as well as five other genes within the psoriasis susceptibility region 1 (PSORS1) on 6p21.33. This observation widens the spectrum of molecular defects underlying PSS type B and shows that loss of these five genes from the PSORS1 region does not result in an additional cutaneous phenotype. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Abnormal protein in the cerebrospinal fluid of patients with a submicroscopic X-chromosomal deletion associated with Norrie disease: preliminary report.

PubMed

Joy, J E; Poglod, R; Murphy, D L; Sims, K B; de la Chapelle, A; Sankila, E M; Norio, R; Merril, C R

1991-01-01

Norrie disease is an X-linked recessive disorder characterized by congenital blindness and, in many cases, mental retardation. Some Norrie disease cases have been shown to be associated with a submicroscopic deletion in chromosomal region Xp11.3. Cerebrospinal fluid (CSF) was collected from four male patients with an X-chromosomal deletion associated with Norrie disease. CSF proteins were resolved using two-dimensional gel electrophoresis and then analyzed by computer using the Elsie V program. Our analysis revealed a protein that appears to be altered in patients with Norrie disease deletion.

Somatically Acquired Isodicentric Y and Mosaic Loss of Chromosome Y in a Boy with Hypospadias.

PubMed

Miyado, Mami; Muroya, Koji; Katsumi, Momori; Saito, Kazuki; Kon, Masafumi; Fukami, Maki

2018-04-07

Isodicentric Y chromosome [idic(Y)] represents a relatively common subtype of Y chromosomal rearrangements in the germline; however, limited evidence supports the postzygotic occurrence of idic(Y). Here, we report a boy with hypospadias and somatically acquired idic(Y). The 3.5-year-old boy has been identified in our previous study for patients with hypospadias. In the present study, cytogenetic analysis including FISH revealed a 45,X[5]/46,X,idic(Y)[7]/46,XY[8] karyotype. MLPA showed a mosaic deletion involving PPP1R12BP1 and RBMY2DP. The idic(Y) was likely to have been formed through aberrant recombination between P1 palindromes and subsequently underwent mosaic loss. The patient's phenotype was attributable to deletion of some Y chromosomal genes and/or mosaic loss of chromosome Y (mLOY). The results suggest that idic(Y) can originate in postzygotic cells via palindrome-mediated crossovers. Moreover, our data indicate that somatically acquired idic(Y) can trigger mLOY, which usually appears as an aging-related phenomenon in elderly men. © 2018 S. Karger AG, Basel.

Williams Syndrome and 15q Duplication: Coincidence versus Association.

PubMed

Khokhar, Aditi; Agarwal, Swashti; Perez-Colon, Sheila

2017-01-01

Williams syndrome is a multisystem disorder caused by contiguous gene deletion in 7q11.23, commonly associated with distinctive facial features, supravalvular aortic stenosis, short stature, idiopathic hypercalcemia, developmental delay, joint laxity, and a friendly personality. The clinical features of 15q11q13 duplication syndrome include autism, mental retardation, ataxia, seizures, developmental delay, and behavioral problems. We report a rare case of a girl with genetically confirmed Williams syndrome and coexisting 15q duplication syndrome. The patient underwent treatment for central precocious puberty and later presented with primary amenorrhea. The karyotype revealed 47,XX,+mar. FISH analysis for the marker chromosome showed partial trisomy/tetrasomy for proximal chromosome 15q (15p13q13). FISH using an ELN -specific probe demonstrated a deletion in the Williams syndrome critical region in 7q11.23. To our knowledge, a coexistence of Williams syndrome and 15q duplication syndrome has not been reported in the literature. Our patient had early pubertal development, which has been described in some patients with Williams syndrome. However, years later after discontinuing gonadotropin-releasing hormone analogue treatment, she developed primary amenorrhea.

Myocardial-specific R-spondin3 drives proliferation of the coronary stems primarily through the Leucine Rich Repeat G Protein coupled receptor LGR4.

PubMed

Da Silva, Fabio; Massa, Filippo; Motamedi, Fariba Jian; Vidal, Valerie; Rocha, Ana Sofia; Gregoire, Elodie P; Cai, Chen-Leng; Wagner, Kay Dietrich; Schedl, Andreas

2018-05-31

Coronary artery anomalies are common congenital disorders with serious consequences in adult life. Coronary circulation begins when the coronary stems form connections between the aorta and the developing vascular plexus. We recently identified the WNT signaling modulator R-spondin 3 (Rspo3), as a crucial regulator of coronary stem proliferation. Using expression analysis and tissue-specific deletion we now demonstrate that Rspo3 is primarily produced by cardiomyocytes. Moreover, we have employed CRISPR/Cas9 technology to generate novel Lgr4-null alleles that showed a significant decrease in coronary stem proliferation and thus phenocopied the coronary artery defects seen in Rspo3 mutants. Interestingly, Lgr4 mutants displayed slightly hypomorphic right ventricles, an observation also made after myocardial specific deletion of Rspo3. These results shed new light on the role of Rspo3 in heart development and demonstrate that LGR4 is the principal R-spondin 3 receptor in the heart. Copyright © 2018 Elsevier Inc. All rights reserved.

Functional Profiling Using the Saccharomyces Genome Deletion Project Collections.

PubMed

Nislow, Corey; Wong, Lai Hong; Lee, Amy Huei-Yi; Giaever, Guri

2016-09-01

The ability to measure and quantify the fitness of an entire organism requires considerably more complex approaches than simply using traditional "omic" methods that examine, for example, the abundance of RNA transcripts, proteins, or metabolites. The yeast deletion collections represent the only systematic, comprehensive set of null alleles for any organism in which such fitness measurements can be assayed. Generated by the Saccharomyces Genome Deletion Project, these collections allow the systematic and parallel analysis of gene functions using any measurable phenotype. The unique 20-bp molecular barcodes engineered into the genome of each deletion strain facilitate the massively parallel analysis of individual fitness. Here, we present functional genomic protocols for use with the yeast deletion collections. We describe how to maintain, propagate, and store the deletion collections and how to perform growth fitness assays on single and parallel screening platforms. Phenotypic fitness analyses of the yeast mutants, described in brief here, provide important insights into biological functions, mechanisms of drug action, and response to environmental stresses. It is important to bear in mind that the specific assays described in this protocol represent some of the many ways in which these collections can be assayed, and in this description particular attention is paid to maximizing throughput using growth as the phenotypic measure. © 2016 Cold Spring Harbor Laboratory Press.

Genomic interval engineering of mice identified a novel modulator of triglyceride production

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhu, Y.; Jong, M.C.; Frazer, K.A.

1999-10-01

To accelerate the biological annotation of novel genes discovered in sequenced of mammalian genomes, we are creating large deletions in the mouse genome targeted to include clusters of such genes. Here we describe the targeted deletion of a 450 kb region on mouse chromosome 11 which, based on computational analysis of the deleted murine sequences and human 5q orthologous sequences, codes for nine putative genes. Mice homozygous for the deletion had a variety of abnormalities including severe hypertriglyceridemia, hepatic and cardiac enlargement, growth retardation and premature mortality. Analysis of triglyceride metabolism in these animals demonstrated a several-fold increase in hepaticmore » very-low density lipoprotein (VLDL) triglyceride secretion, the most prevalent mechanism responsible for hypertriglyceridemia in humans. A series of mouse BAC and human YAC transgenes covering different intervals of the 450 kb deleted region were assessed for their ability to complement the deletion induced abnormalities. These studies revealed that OCTN2, a gene recently shown to play a role in carnitine transport, was able to correct the triglyceride abnormalities. The discovery of this previously unappreciated relationship between OCTN2, carnitine and hepatic triglyceride production is of particular importance due to the clinical consequence of hypertriglyceridemia and the paucity of genes known to modulate triglyceride secretion.« less

Schizophrenia and chromosomal deletions

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lindsay, E.A.; Baldini, A.; Morris, M. A.

Recent genetic linkage analysis studies have suggested the presence of a schizophrenia locus on the chromosomal region 22q11-q13. Schizophrenia has also been frequently observed in patients affected with velo-cardio-facial syndrome (VCFS), a disorder frequently associated with deletions within 22q11.1. It has been hypothesized that psychosis in VCFS may be due to deletion of the catechol-o-methyl transferase gene. Prompted by these observations, we screened for 22q11 deletions in a population of 100 schizophrenics selected from the Maryland Epidemiological Sample. Our results show that there are schizophrenic patients carrying a deletion of 22q11.1 and a mild VCFS phenotype that might remain unrecognized.more » These findings should encourage a search for a schizophrenia-susceptibility gene within the deleted region and alert those in clinical practice to the possible presence of a mild VCFS phenotype associated with schizophrenia. 9 refs.« less

The Canine POMC Gene, Obesity in Labrador Retrievers and Susceptibility to Diabetes Mellitus.

PubMed

Davison, L J; Holder, A; Catchpole, B; O'Callaghan, C A

2017-03-01

Diabetes mellitus (DM) in dogs is a common endocrinopathy with a complex genetic architecture. Disease susceptibility in several breeds is associated with polymorphisms in immune response genes, but in the Labrador retriever breed, no genetic associations with DM have been identified. A deletion in the pro-opiomelanocortin (POMC) gene in Labrador retrievers is associated with increased appetite and risk of obesity. To characterize the POMC deletion in Labrador retrievers, to develop a simple genetic test for this mutation, and to test the hypothesis that the POMC gene deletion is associated with an increased risk of DM in this breed. Sixty-one non-diabetic Labrador retrievers aged >6 years and 57 Labrador retrievers with DM. Case-control genotyping study to compare the frequency of the POMC deletion in dogs with and without DM. After polymerase chain reaction (PCR) and sequencing to characterize the mutation, a PCR-based test was developed and validated using 2 different restriction fragment length polymorphism assays. A 14-base-pair deletion was confirmed and localized to exon 3 of the canine POMC gene. A PCR-based test for the deletion was successfully developed. There was no association between the presence of the POMC deletion mutation and DM in this population of Labrador retriever dogs (P = .31). This study adds to the existing scientific literature indicating that there is little evidence for a direct link between obesity and DM in dogs. Copyright © 2016 The Authors. Journal of Veterinary Internal Medicine published by Wiley Periodicals, Inc. on behalf of the American College of Veterinary Internal Medicine.

DeF-GPU: Efficient and effective deletions finding in hepatitis B viral genomic DNA using a GPU architecture.

PubMed

Cheng, Chun-Pei; Lan, Kuo-Lun; Liu, Wen-Chun; Chang, Ting-Tsung; Tseng, Vincent S

2016-12-01

Hepatitis B viral (HBV) infection is strongly associated with an increased risk of liver diseases like cirrhosis or hepatocellular carcinoma (HCC). Many lines of evidence suggest that deletions occurring in HBV genomic DNA are highly associated with the activity of HBV via the interplay between aberrant viral proteins release and human immune system. Deletions finding on the HBV whole genome sequences is thus a very important issue though there exist underlying the challenges in mining such big and complex biological data. Although some next generation sequencing (NGS) tools are recently designed for identifying structural variations such as insertions or deletions, their validity is generally committed to human sequences study. This design may not be suitable for viruses due to different species. We propose a graphics processing unit (GPU)-based data mining method called DeF-GPU to efficiently and precisely identify HBV deletions from large NGS data, which generally contain millions of reads. To fit the single instruction multiple data instructions, sequencing reads are referred to as multiple data and the deletion finding procedure is referred to as a single instruction. We use Compute Unified Device Architecture (CUDA) to parallelize the procedures, and further validate DeF-GPU on 5 synthetic and 1 real datasets. Our results suggest that DeF-GPU outperforms the existing commonly-used method Pindel and is able to exactly identify the deletions of our ground truth in few seconds. The source code and other related materials are available at https://sourceforge.net/projects/defgpu/. Copyright © 2016 Elsevier Inc. All rights reserved.

Genotyping of alpha-thalassemia deletions using multiplex polymerase chain reactions and gold nanoparticle-filled capillary electrophoresis.

PubMed

Chen, Yen-Ling; Shih, Chi-Jen; Ferrance, Jerome; Chang, Ya-Sian; Chang, Jan-Gowth; Wu, Shou-Mei

2009-02-13

A gold nanoparticle-filled capillary electrophoresis method combined with three multiplex polymerase chain reactions (PCRs) was established for simultaneous diagnosis of five common alpha-thalassemia deletions, including the -alpha(3.7) deletion, -alpha(4.2) deletion, Southeast Asian (--(SEA)), Filipino (--(FIL)) and Thai (--(THAI)) deletions. Gold nanoparticles (GNPs) were used as a pseudostationary phase to improve the resolution between DNA fragments in a low-viscosity polymer. To achieve the best CE separation, several parameters were evaluated for optimizing the separation conditions, including the capillary coating, the concentrations of polymer sieving matrix, the sizes and concentrations of GNPs, the buffer concentrations, and the pH. The final CE method for separating a 200-base pair (bp) DNA ladder and alpha-thalassemia deletions used a DB-17 capillary, 0.6% poly(ethylene oxide) (PEO) prepared in a mixture of GNP(32nm) solution and glycine buffer (25mM, pH 9.0) (80:20, v/v) as the sieving matrix with 1microM YO-PRO-1 for fluorescence detection; the applied voltage was -10kV (detector at anode side) and the separation temperature was 25 degrees C. Under these optimal conditions, 15 DNA fragments with sizes ranging from 0.2kb to 3.0kb were resolved within 11.5min. The RSDs of migration times were less than 2.81%. A total of 21 patients with alpha-thalassemia deletions were analyzed using this method, and all results showed good agreement with those obtained by gel electrophoresis.

Small fibre neuropathy in mitochondrial diseases explored with sudoscan.

PubMed

Luigetti, Marco; Primiano, Guido; Cuccagna, Cristina; Bernardo, Daniela; Sauchelli, Donato; Vollono, Catello; Servidei, Serenella

2018-06-01

Polyneuropathy in mitochondrial diseases (MDs) is relatively common and widely investigated, but few data are instead reported about small fibres involvement. In order to investigate the involvement of small fibres in MDs we performed extensive neurophysiological test (nerve conduction studies; sympathetic skin response; sudoscan) in 27 patients with genetic diagnosis of MD (7 m.3243A > G; 4 m.8344A > G; 9 single mtDNA deletion; 7 multiple mtDNA deletions). NCS showed a polyneuropathy in 11/27 cases (41%). The incidence was very high in POLG1 (100%), m.8344A > G (75%) and m.3243A > G (43%), while only 11% of patients with single deletion had evidence of large fibres involvement. Sympathetic skin response was abnormal only in three patients (one progressive external ophthalmoplegia with single mtDNA deletion; one patient with m.3243A > G mutation; one patient with POLG1 mutation). Sudoscan revealed the presence of an autonomic small fibres dysfunction in 9/27 cases (33%), most of them (7/9) carrying a single mtDNA deletion. Sudoscan data were also confirmed in a sub-group of patients by laser evoked potentials study. Considering only patients with single mtDNA deletion 7/9 (78%) showed abnormal results at sudoscan. Small fibre neuropathy is another feature to investigate in mitochondrial diseases and seems specifically associated with the presence of single mtDNA deletion. The correct identification through specific neurophysiological tests of small fibres involvement in MDs represents another tile in this challenging diagnosis. Copyright © 2018 International Federation of Clinical Neurophysiology. Published by Elsevier B.V. All rights reserved.

Tumor suppressors BTG1 and IKZF1 cooperate during mouse leukemia development and increase relapse risk in B-cell precursor acute lymphoblastic leukemia patients.

PubMed

Scheijen, Blanca; Boer, Judith M; Marke, René; Tijchon, Esther; van Ingen Schenau, Dorette; Waanders, Esmé; van Emst, Liesbeth; van der Meer, Laurens T; Pieters, Rob; Escherich, Gabriele; Horstmann, Martin A; Sonneveld, Edwin; Venn, Nicola; Sutton, Rosemary; Dalla-Pozza, Luciano; Kuiper, Roland P; Hoogerbrugge, Peter M; den Boer, Monique L; van Leeuwen, Frank N

2017-03-01

Deletions and mutations affecting lymphoid transcription factor IKZF1 (IKAROS) are associated with an increased relapse risk and poor outcome in B-cell precursor acute lymphoblastic leukemia. However, additional genetic events may either enhance or negate the effects of IKZF1 deletions on prognosis. In a large discovery cohort of 533 childhood B-cell precursor acute lymphoblastic leukemia patients, we observed that single-copy losses of BTG1 were significantly enriched in IKZF1 -deleted B-cell precursor acute lymphoblastic leukemia ( P =0.007). While BTG1 deletions alone had no impact on prognosis, the combined presence of BTG1 and IKZF1 deletions was associated with a significantly lower 5-year event-free survival ( P =0.0003) and a higher 5-year cumulative incidence of relapse ( P =0.005), when compared with IKZF1 -deleted cases without BTG1 aberrations. In contrast, other copy number losses commonly observed in B-cell precursor acute lymphoblastic leukemia, such as CDKN2A/B, PAX5, EBF1 or RB1 , did not affect the outcome of IKZF1 -deleted acute lymphoblastic leukemia patients. To establish whether the combined loss of IKZF1 and BTG1 function cooperate in leukemogenesis, Btg1 -deficient mice were crossed onto an Ikzf1 heterozygous background. We observed that loss of Btg1 increased the tumor incidence of Ikzf1 +/- mice in a dose-dependent manner. Moreover, murine B cells deficient for Btg1 and Ikzf1 +/- displayed increased resistance to glucocorticoids, but not to other chemotherapeutic drugs. Together, our results identify BTG1 as a tumor suppressor in leukemia that, when deleted, strongly enhances the risk of relapse in IKZF1 -deleted B-cell precursor acute lymphoblastic leukemia, and augments the glucocorticoid resistance phenotype mediated by the loss of IKZF1 function. Copyright© Ferrata Storti Foundation.

Enhancement of astaxanthin production in Xanthophyllomyces dendrorhous by efficient method for the complete deletion of genes.

PubMed

Yamamoto, Keisuke; Hara, Kiyotaka Y; Morita, Toshihiko; Nishimura, Akira; Sasaki, Daisuke; Ishii, Jun; Ogino, Chiaki; Kizaki, Noriyuki; Kondo, Akihiko

2016-09-13

Red yeast, Xanthophyllomyces dendrorhous is the only yeast known to produce astaxanthin, an anti-oxidant isoprenoid (carotenoid) widely used in the aquaculture, food, pharmaceutical and cosmetic industries. The potential of this microorganism as a platform cell factory for isoprenoid production has been recognized because of high flux through its native terpene pathway. Recently, we developed a multiple gene expression system in X. dendrorhous and enhanced the mevalonate synthetic pathway to increase astaxanthin production. In contrast, the mevalonate synthetic pathway is suppressed by ergosterol through feedback inhibition. Therefore, releasing the mevalonate synthetic pathway from this inhibition through the deletion of genes involved in ergosterol synthesis is a promising strategy to improve isoprenoid production. An efficient method for deleting diploid genes in X. dendrorhous, however, has not yet been developed. Xanthophyllomyces dendrorhous was cultivated under gradually increasing concentrations of antibiotics following the introduction of antibiotic resistant genes to be replaced with target genes. Using this method, double CYP61 genes encoding C-22 sterol desaturases relating to ergosterol biosynthesis were deleted sequentially. This double CYP61 deleted strain showed decreased ergosterol biosynthesis compared with the parental strain and single CYP61 disrupted strain. Additionally, this double deletion of CYP61 genes showed increased astaxanthin production compared with the parental strain and the single CYP61 knockout strain. Finally, astaxanthin production was enhanced by 1.4-fold compared with the parental strain, although astaxanthin production was not affected in the single CYP61 knockout strain. In this study, we developed a system to completely delete target diploid genes in X. dendrorhous. Using this method, we deleted diploid CYP61 genes involved in the synthesis of ergosterol that inhibits the pathway for mevalonate, which is a common substrate for isoprenoid biosynthesis. The resulting decrease in ergosterol biosynthesis increased astaxanthin production. The efficient method for deleting diploid genes developed in this study has the potential to improve industrial production of various isoprenoids in X. dendrorhous.

A foetus with 18p11.32-q21.2 duplication and Xp22.33-p11.1 deletion derived from a maternal reciprocal translocation t(X;18)(q13;q21.3).

PubMed

Chen, Jun-Kun; Liu, Ping; Hu, Li-Qin; Xie, Qing; Huang, Quan-Fei; Liu, Hai-Liang

2018-01-01

Non-invasive prenatal testing (NIPT) evaluates circulating cell-free DNA (cfDNA) and has been widely applied, with highly accurate results for detecting foetal trisomies 21, 18 and 13. Recently, increasing attention has been paid to the clinical application of the non-invasive detection of foetal sub-chromosomal duplications and deletions beyond common aneuploidies. A 32-year-old healthy pregnant woman was referred to the Medical Genetic Centre of Ganzhou Maternal and Child Health Care Hospital. As routine practice, ultrasound examination at a gestational age of 16 weeks showed that the foetus is normal. To avoid invasive prenatal diagnosis procedures, an NIPT was offered to further screen for common foetal chromosomal abnormalities. The result showed that there was an approximately 50.94 Mb duplication in p11.32-q21.2 of chromosome 18 and an approximately 58.46 Mb deletion in p22.33-p11.1 of chromosome X. In addition, the chromosome karyotypes of the parents and foetus were also analysed. Chromosome karyotype analysis results showed that foetal karyotype was 46,X,der(18), the maternal karyotype was 46,XX,t(X;18)(q13;q21.3), and the paternal karyotype revealed no obvious abnormality. In this case, we successfully detected a healthy pregnant woman with balanced translocation X;18(q13;q21.3) and described the foetal karyotype as 46,X,der(18)t(X;18)(q11;q21.1)mat. Our report illustrated these cases which present complex X;autosome balance translocation and X;autosome unbalance translocation which may contribute to severe clinical phenotypes. In addition, our report also proved that the interruption of genes in the Xq critical region is not only reason of primary infertility. Finally, we prompted that NIPT might play a role in the first trimester screening of sub-chromosomal rearrangement.

A Duchenne Muscular Dystrophy Gene Hot Spot Mutation in Dystrophin-Deficient Cavalier King Charles Spaniels Is Amenable to Exon 51 Skipping

PubMed Central

Walmsley, Gemma L.; Arechavala-Gomeza, Virginia; Fernandez-Fuente, Marta; Burke, Margaret M.; Nagel, Nicole; Holder, Angela; Stanley, Rachael; Chandler, Kate; Marks, Stanley L.; Muntoni, Francesco; Shelton, G. Diane; Piercy, Richard J.

2010-01-01

Background Duchenne muscular dystrophy (DMD), which afflicts 1 in 3500 boys, is one of the most common genetic disorders of children. This fatal degenerative condition is caused by an absence or deficiency of dystrophin in striated muscle. Most affected patients have inherited or spontaneous deletions in the dystrophin gene that disrupt the reading frame resulting in unstable truncated products. For these patients, restoration of the reading frame via antisense oligonucleotide-mediated exon skipping is a promising therapeutic approach. The major DMD deletion “hot spot” is found between exons 45 and 53, and skipping exon 51 in particular is predicted to ameliorate the dystrophic phenotype in the greatest number of patients. Currently the mdx mouse is the most widely used animal model of DMD, although its mild phenotype limits its suitability in clinical trials. The Golden Retriever muscular dystrophy (GRMD) model has a severe phenotype, but due to its large size, is expensive to use. Both these models have mutations in regions of the dystrophin gene distant from the commonly mutated DMD “hot spot”. Methodology/Principal Findings Here we describe the severe phenotype, histopathological findings, and molecular analysis of Cavalier King Charles Spaniels with dystrophin-deficient muscular dystrophy (CKCS-MD). The dogs harbour a missense mutation in the 5′ donor splice site of exon 50 that results in deletion of exon 50 in mRNA transcripts and a predicted premature truncation of the translated protein. Antisense oligonucleotide-mediated skipping of exon 51 in cultured myoblasts from an affected dog restored the reading frame and protein expression. Conclusions/Significance Given the small size of the breed, the amiable temperament and the nature of the mutation, we propose that CKCS-MD is a valuable new model for clinical trials of antisense oligonucleotide-induced exon skipping and other therapeutic approaches for DMD. PMID:20072625

Identification of a novel 15.5 kb SHOX deletion associated with marked intrafamilial phenotypic variability and analysis of its molecular origin.

PubMed

Alexandrou, Angelos; Papaevripidou, Ioannis; Tsangaras, Kyriakos; Alexandrou, Ioanna; Tryfonidis, Marios; Christophidou-Anastasiadou, Violetta; Zamba-Papanicolaou, Eleni; Koumbaris, George; Neocleous, Vassos; Phylactou, Leonidas A; Skordis, Nicos; Tanteles, George A; Sismani, Carolina

2016-12-01

Haploinsufficiency of the short stature homeobox contaning SHOX gene has been shown to result in a spectrum of phenotypes ranging from Leri-Weill dyschondrosteosis (LWD) at the more severe end to SHOX-related short stature at the milder end of the spectrum. Most alterations are whole gene deletions, point mutations within the coding region, or microdeletions in its flanking sequences. Here, we present the clinical and molecular data as well as the potential molecular mechanism underlying a novel microdeletion, causing a variable SHOX-related haploinsufficiency disorder in a three-generation family. The phenotype resembles that of LWD in females, in males, however, the phenotypic expression is milder. The 15523-bp SHOX intragenic deletion, encompassing exons 3-6, was initially detected by array-CGH, followed by MLPA analysis. Sequencing of the breakpoints indicated an Alu recombination-mediated deletion (ARMD) as the potential causative mechanism.

Novel 5.712 kb mitochondrial DNA deletion in a patient with Pearson syndrome: a case report.

PubMed

Park, Joonhong; Ryu, Hyejin; Jang, Woori; Chae, Hyojin; Kim, Myungshin; Kim, Yonggoo; Kim, Jiyeon; Lee, Jae Wook; Chung, Nack-Gyun; Cho, Bin; Suh, Byung Kyu

2015-05-01

Pearson marrow‑pancreas syndrome (PS) is a progressive multi‑organ disorder caused by deletions and duplications of mitochondrial DNA (mtDNA). PS is often fatal in infancy, and the majority of patients with PS succumb to the disease before reaching three‑years‑of‑age, due to septicemia, metabolic acidosis or hepatocellular insufficiency. The present report describes the case of a four‑month‑old infant with severe normocytic normochromic anemia, vacuolization of hematopoietic precursors and metabolic acidosis. After extensive clinical investigation, the patient was diagnosed with PS, which was confirmed by molecular analysis of mtDNA. The molecular analysis detected a novel large‑scale (5.712 kb) deletion spanning nucleotides 8,011 to 13,722 of mtDNA, which lacked direct repeats at the deletion boundaries. The present report is, to the best of our knowledge, the first case reported in South Korea.

Targeted exome sequencing and chromosomal microarray for the molecular diagnosis of nevoid basal cell carcinoma syndrome.

PubMed

Matsudate, Yoshihiro; Naruto, Takuya; Hayashi, Yumiko; Minami, Mitsuyoshi; Tohyama, Mikiko; Yokota, Kenji; Yamada, Daisuke; Imoto, Issei; Kubo, Yoshiaki

2017-06-01

Nevoid basal cell carcinoma syndrome (NBCCS) is an autosomal dominant disorder mainly caused by heterozygous mutations of PTCH1. In addition to characteristic clinical features, detection of a mutation in causative genes is reliable for the diagnosis of NBCCS; however, no mutations have been identified in some patients using conventional methods. To improve the method for the molecular diagnosis of NBCCS. We performed targeted exome sequencing (TES) analysis using a multi-gene panel, including PTCH1, PTCH2, SUFU, and other sonic hedgehog signaling pathway-related genes, based on next-generation sequencing (NGS) technology in 8 cases in whom possible causative mutations were not detected by previously performed conventional analysis and 2 recent cases of NBCCS. Subsequent analysis of gross deletion within or around PTCH1 detected by TES was performed using chromosomal microarray (CMA). Through TES analysis, specific single nucleotide variants or small indels of PTCH1 causing inferred amino acid changes were identified in 2 novel cases and 2 undiagnosed cases, whereas gross deletions within or around PTCH1, which are validated by CMA, were found in 3 undiagnosed cases. However, no mutations were detected even by TES in 3 cases. Among 3 cases with gross deletions of PTCH1, deletions containing the entire PTCH1 and additional neighboring genes were detected in 2 cases, one of which exhibited atypical clinical features, such as severe mental retardation, likely associated with genes located within the 4.3Mb deleted region, especially. TES-based simultaneous evaluation of sequences and copy number status in all targeted coding exons by NGS is likely to be more useful for the molecular diagnosis of NBCCS than conventional methods. CMA is recommended as a subsequent analysis for validation and detailed mapping of deleted regions, which may explain the atypical clinical features of NBCCS cases. Copyright © 2017 Japanese Society for Investigative Dermatology. Published by Elsevier B.V. All rights reserved.

MTAP deletion confers enhanced dependency on the PRMT5 arginine methyltransferase in cancer cells | Office of Cancer Genomics

Cancer.gov

The discovery of cancer dependencies has the potential to inform therapeutic strategies and to identify putative drug targets. Integrating data from comprehensive genomic profiling of cancer cell lines and from functional characterization of cancer cell dependencies, we discovered that loss of the enzyme methylthioadenosine phosphorylase (MTAP) confers a selective dependence on protein arginine methyltransferase 5 (PRMT5) and its binding partner WDR77. MTAP is frequently lost due to its proximity to the commonly deleted tumor suppressor gene, CDKN2A.

Seventeen {alpha}-hydroxylase deficiency with one base pair deletion of the cytochrome P450c17 (CYP17) gene

DOE Office of Scientific and Technical Information (OSTI.GOV)

Oshiro, Chikara; Takasu, Nobuyuki; Wakugami, Tamio

1995-08-01

Mutation of the cytochrome P450c17 (CYP17) gene causes 17{alpha}-hydroxylase deficiency (170HD). Recently, several researchers have elucidated the molecular basis of 170HD by gene analysis. We experienced a case of 170HD and intended to reveal the abnormality of the CYP17 gene in this Japanese female with 170HD. Leukocytes were obtained from the patient, her mother and sister, and normal control subjects. We amplified the CYP17 gene using polymerase chain reaction and performed the sequence analysis using the dideoxy terminator method and restriction enzyme analysis. We found that the patient had one base-pair deletion at the position of amino acid 438. Anmore » indentical result was obtained with restriction enzyme analysis. This G deletion altered the reading frame and resulted in a premature stop codon at position 443; the ligand of heme iron (Cys: cystine 442) was absent. This small mutation may account for the patient`s clinical manifestations of 170HD. This is the first case of 170HD with only one base pair deletion of the CYP17 gene. 18 refs., 3 figs.« less

PAR1 deletions downstream of SHOX are the most frequent defect in a Spanish cohort of Léri-Weill dyschondrosteosis (LWD) probands.

PubMed

Benito-Sanz, Sara; del Blanco, Darya Gorbenko; Aza-Carmona, Miriam; Magano, Luis F; Lapunzina, Pablo; Argente, Jesús; Campos-Barros, Angel; Heath, Karen E

2006-10-01

Léri-Weill dyschondrosteosis (LWD) is a skeletal dysplasia characterized by disproportionate short stature and Madelung deformity. Mutations or deletions of the SHOX gene have been previously identified as the main cause of LWD. We recently identified the existence of a second class of pseudoautosomal region 1 (PAR1) deletions which do not include SHOX, implicated in the etiopathogenesis of LWD. The deletions map at least 30-250 kb downstream of SHOX, are variable in size and clearly cosegregate with the LWD phenotype. In order to determine the frequency of this new type of deletions in the Spanish population we analyzed the distribution of PAR1 defects, including the screening of SHOX deletions, mutations, and PAR1 deletions downstream of SHOX, in a total of 26 LWD probands by a combination of MLPA, microsatellite analysis, SNP genotyping, dHPLC, and DNA sequencing. A molecular defect was identified in 16/26 LWD patients (61.5%): 10 PAR1 deletions downstream of SHOX, four SHOX encompassing deletions, and two SHOX mutations. No apparent phenotypic differences were observed between patients with SHOX defects and those with PAR1 deletions downstream of SHOX. In the examined cohort of Spanish LWD probands, PAR1 deletions downstream of SHOX represent the highest proportion of identified mutations (38%) compared to SHOX deletions (15%) and mutations (8%). As a consequence of our findings, the screening of this region should be included in the routine genetic testing of LWD. Also, LWD patients who tested negative for SHOX defects should be re-evaluated for PAR1 deletions downstream of SHOX.

Familial Xp22.33-Xp22.12 deletion delineated by chromosomal microarray analysis causes proportionate short stature.

PubMed

Cho, Sung Yoon; Ki, Chang-Seok; Jang, Ja-Hyun; Sohn, Young Bae; Park, Sung Won; Kim, Se Hwa; Kim, Su Jin; Jin, Dong-Kyu

2012-06-01

Patients with Xp deletions have short stature and may have some somatic traits typical of Turner syndrome (TS), whereas gonadal function is generally preserved. In most studies of these patients, microsatellites have been used to determine the break point of the Xp deletion. In the present study, we describe the clinical, cytogenetic, and chromosomal microarray (CMA) analysis of a family with an Xp22.33-Xp22.12 deletion. Two female siblings, aged 8 years 9 months and 11 years 10 months, presented with short stature. The older sibling's height (index case) was 137.9 cm (-1.81 SDS) and the younger sibling's height was 118.6 cm (-2.13 SDS). The mother and both daughters had only a short stature; a skeletal survey showed normal findings except for mildly shortened 4th and 5th metacarpal bones. No features of TS were present. The deletion appeared terminal with a breakpoint within Xp22.2 located about 19.9 Mb from the Xp telomere. The deletion contained 102 protein-coding genes. A probe of the end breakage point was located at the 19,908,986th base of the X chromosome, and a probe of the marginal normal region near the breakage point was located at the 19,910,848th base of the X chromosome. Therefore, the breakage point was concluded to be located between these two probes. In summary, we report a familial case of an Xp deletion. The findings of our study may be helpful in further analyzing the phenotypes associated with Xp deletions. Copyright © 2012 Wiley Periodicals, Inc.

Neuronal activity in the isolated mouse spinal cord during spontaneous deletions in fictive locomotion: insights into locomotor central pattern generator organization

PubMed Central

Zhong, Guisheng; Shevtsova, Natalia A; Rybak, Ilya A; Harris-Warrick, Ronald M

2012-01-01

We explored the organization of the spinal central pattern generator (CPG) for locomotion by analysing the activity of spinal interneurons and motoneurons during spontaneous deletions occurring during fictive locomotion in the isolated neonatal mouse spinal cord, following earlier work on locomotor deletions in the cat. In the isolated mouse spinal cord, most spontaneous deletions were non-resetting, with rhythmic activity resuming after an integer number of cycles. Flexor and extensor deletions showed marked asymmetry: flexor deletions were accompanied by sustained ipsilateral extensor activity, whereas rhythmic flexor bursting was not perturbed during extensor deletions. Rhythmic activity on one side of the cord was not perturbed during non-resetting spontaneous deletions on the other side, and these deletions could occur with no input from the other side of the cord. These results suggest that the locomotor CPG has a two-level organization with rhythm-generating (RG) and pattern-forming (PF) networks, in which only the flexor RG network is intrinsically rhythmic. To further explore the neuronal organization of the CPG, we monitored activity of motoneurons and selected identified interneurons during spontaneous non-resetting deletions. Motoneurons lost rhythmic synaptic drive during ipsilateral deletions. Flexor-related commissural interneurons continued to fire rhythmically during non-resetting ipsilateral flexor deletions. Deletion analysis revealed two classes of rhythmic V2a interneurons. Type I V2a interneurons retained rhythmic synaptic drive and firing during ipsilateral motor deletions, while type II V2a interneurons lost rhythmic synaptic input and fell silent during deletions. This suggests that the type I neurons are components of the RG, whereas the type II neurons are components of the PF network. We propose a computational model of the spinal locomotor CPG that reproduces our experimental results. The results may provide novel insights into the organization of spinal locomotor networks. PMID:22869012

Single strand conformation polymorphism based SNP and Indel markers for genetic mapping and synteny analysis of common bean (Phaseolus vulgaris L.)

PubMed Central

2009-01-01

Background Expressed sequence tags (ESTs) are an important source of gene-based markers such as those based on insertion-deletions (Indels) or single-nucleotide polymorphisms (SNPs). Several gel based methods have been reported for the detection of sequence variants, however they have not been widely exploited in common bean, an important legume crop of the developing world. The objectives of this project were to develop and map EST based markers using analysis of single strand conformation polymorphisms (SSCPs), to create a transcript map for common bean and to compare synteny of the common bean map with sequenced chromosomes of other legumes. Results A set of 418 EST based amplicons were evaluated for parental polymorphisms using the SSCP technique and 26% of these presented a clear conformational or size polymorphism between Andean and Mesoamerican genotypes. The amplicon based markers were then used for genetic mapping with segregation analysis performed in the DOR364 × G19833 recombinant inbred line (RIL) population. A total of 118 new marker loci were placed into an integrated molecular map for common bean consisting of 288 markers. Of these, 218 were used for synteny analysis and 186 presented homology with segments of the soybean genome with an e-value lower than 7 × 10-12. The synteny analysis with soybean showed a mosaic pattern of syntenic blocks with most segments of any one common bean linkage group associated with two soybean chromosomes. The analysis with Medicago truncatula and Lotus japonicus presented fewer syntenic regions consistent with the more distant phylogenetic relationship between the galegoid and phaseoloid legumes. Conclusion The SSCP technique is a useful and inexpensive alternative to other SNP or Indel detection techniques for saturating the common bean genetic map with functional markers that may be useful in marker assisted selection. In addition, the genetic markers based on ESTs allowed the construction of a transcript map and given their high conservation between species allowed synteny comparisons to be made to sequenced genomes. This synteny analysis may support positional cloning of target genes in common bean through the use of genomic information from these other legumes. PMID:20030833

Analysis of Glu-1 deletion lines reveals the importance of high molecular weight glutenin subunits 7+9 Glu-B1 in wheat flour tortilla making

USDA-ARS?s Scientific Manuscript database

High molecular weight glutenin subunits (HMW-GS) play a significant role in the functional properties of wheat flour. Wheat lines in which one or more of the HMW-GS alleles were absent from Glu-A1, Glu-B1 or Glu-D1 loci (deletion lines) were compared with non-deletion lines for dough and tortilla ma...

Role of the XIAP-Cooper Axis in Prostate Cancer

DTIC Science & Technology

2011-04-01

growing yeast transformed with a plasmid encoding human XIAP in Cu-free selective medium. Supplemental Cu was added to the medium 1-2 hours before...human XIAP into yeast deletion strains. We selected 16 deletion strains from the same background as our wild-type control (BY4741) for analysis. These...transformed with the XIAP expression plasmid. This objective is complete. Assess yeast deletion mutants for delivery of copper to XIAP. After

Williams-Beuren syndrome: phenotypic variability and deletions of chromosomes 7, 11, and 22 in a series of 52 patients.

PubMed Central

Joyce, C A; Zorich, B; Pike, S J; Barber, J C; Dennis, N R

1996-01-01

Fluorescence in situ hybridisation (FISH) and conventional chromosome analysis were performed on a series of 52 patients with classical Williams-Beuren syndrome (WBS), suspected WBS, or supravalvular aortic stenosis (SVAS). In the classical WBS group, 22/23 (96%) had a submicroscopic deletion of the elastin locus on chromosome 7, but the remaining patient had a unique interstitial deletion of chromosome 11 (del(11)(q13.5q14.2)). In the suspected WBS group 2/22 (9%) patients had elastin deletions but a third patient had a complex karyotype including a ring chromosome 22 with a deletion of the long arm (r(22)(p11-->q13)). In the SVAS group, 1/7 (14%) had an elastin gene deletion, despite having normal development and minimal signs of WBS. Overall, some patients with submicroscopic elastin deletions have fewer features of Williams-Beuren syndrome than those with other cytogenetic abnormalities. These results, therefore, emphasise the importance of a combined conventional and molecular cytogenetic approach to diagnosis and suggest that the degree to which submicroscopic deletions of chromosome 7 extend beyond the elastin locus may explain some of the phenotypic variability found in Williams-Beuren syndrome. Images PMID:9004128

Conversion of Deletions during Recombination in Pneumococcal Transformation

PubMed Central

Lefevre, J. C.; Mostachfi, P.; Gasc, A. M.; Guillot, E.; Pasta, F.; Sicard, M.

1989-01-01

Genetic analysis of 16 deletions obtained in the amiA locus of pneumococcus is described. When present on donor DNA, all deletions increased drastically the frequency of wild-type recombinants in two-point crosses. This effect was maximal for deletions longer than 200 bases. It was reduced for heterologies shorter than 76 bases and did not exist for very short deletions. In three-point crosses in which the deletion was localized between two point mutations, we demonstrated that this excess of wild-type recombinants was the result of a genetic conversion. This conversion extended over several scores of bases outside the deletion. Conversion takes place during the heteroduplex stage of recombination. Therefore, in pneumococcal transformation, long heterologies participated in this heteroduplex configuration. As this conversion did not require an active DNA polymerase A gene it is proposed that the mechanism of conversion is not a DNA repair synthesis but involves breakage and ligation between DNA molecules. Conversion of deletions did not require the Hex system of correction of mismatched bases. It differs also from localized conversion. It appears that it is a process that evolved to correct errors of replication which lead to long heterologies and which are not eliminated by other systems. PMID:2599365

Isolation of expressed sequences from the region commonly deleted in Velo-cardio-facial syndrome

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sirotkin, H.; Morrow, B.; DasGupta, R.

Velo-cardio-facial syndrome (VCFS) is a relatively common autosomal dominant genetic disorder characterized by cleft palate, cardiac abnormalities, learning disabilities and a characteristic facial dysmorphology. Most VCFS patients have interstitial deletions of 22q11 of 1-2 mb. In an effort to isolate the gene(s) responsible for VCFS we have utilized a hybrid selection protocol to recover expressed sequences from three non-overlapping YACs comprising almost 1 mb of the commonly deleted region. Total yeast genomic DNA or isolated YAC DNA was immobilized on Hybond-N filters, blocked with yeast and human ribosomal and human repetitive sequences and hybridized with a mixture of random primedmore » short fragment cDNA libraries. Six human short fragment libraries derived from total fetus, fetal brain, adult brain, testes, thymus and spleen have been used for the selections. Short fragment cDNAs retained on the filter were passed through a second round of selection and cloned into lambda gt10. cDNAs shown to originate from the YACs and from chromosome 22 are being used to isolate full length cDNAs. Three genes known to be present on these YACs, catechol-O-methyltransferase, tuple 1 and clathrin heavy chain have been recovered. Additionally, a gene related to the murine p120 gene and a number of novel short cDNAs have been isolated. The role of these genes in VCFS is being investigated.« less

Factor IX[sub Madrid 2]: A deletion/insertion in Facotr IX gene which abolishes the sequence of the donor junction at the exon IV-intron d splice site

DOE Office of Scientific and Technical Information (OSTI.GOV)

Solera, J.; Magallon, M.; Martin-Villar, J.

1992-02-01

DNA from a patient with severe hemophilia B was evaluated by RFLP analysis, producing results which suggested the existence of a partial deletion within the factor IX gene. The deletion was further localized and characterized by PCR amplification and sequencing. The altered allele has a 4,442-bp deletion which removes both the donor splice site located at the 5[prime] end of intron d and the two last coding nucleotides located at the 3[prime] end of exon IV in the normal factor IX gene; this fragment has been inserted in inverted orientation. Two homologous sequences have been discovered at the ends ofmore » the deleted DNA fragment.« less

CRISPR-based screening of genomic island excision events in bacteria.

PubMed

Selle, Kurt; Klaenhammer, Todd R; Barrangou, Rodolphe

2015-06-30

Genomic analysis of Streptococcus thermophilus revealed that mobile genetic elements (MGEs) likely contributed to gene acquisition and loss during evolutionary adaptation to milk. Clustered regularly interspaced short palindromic repeats-CRISPR-associated genes (CRISPR-Cas), the adaptive immune system in bacteria, limits genetic diversity by targeting MGEs including bacteriophages, transposons, and plasmids. CRISPR-Cas systems are widespread in streptococci, suggesting that the interplay between CRISPR-Cas systems and MGEs is one of the driving forces governing genome homeostasis in this genus. To investigate the genetic outcomes resulting from CRISPR-Cas targeting of integrated MGEs, in silico prediction revealed four genomic islands without essential genes in lengths from 8 to 102 kbp, totaling 7% of the genome. In this study, the endogenous CRISPR3 type II system was programmed to target the four islands independently through plasmid-based expression of engineered CRISPR arrays. Targeting lacZ within the largest 102-kbp genomic island was lethal to wild-type cells and resulted in a reduction of up to 2.5-log in the surviving population. Genotyping of Lac(-) survivors revealed variable deletion events between the flanking insertion-sequence elements, all resulting in elimination of the Lac-encoding island. Chimeric insertion sequence footprints were observed at the deletion junctions after targeting all of the four genomic islands, suggesting a common mechanism of deletion via recombination between flanking insertion sequences. These results established that self-targeting CRISPR-Cas systems may direct significant evolution of bacterial genomes on a population level, influencing genome homeostasis and remodeling.

Rare copy number variants and congenital heart defects in the 22q11.2 deletion syndrome.

PubMed

Mlynarski, Elisabeth E; Xie, Michael; Taylor, Deanne; Sheridan, Molly B; Guo, Tingwei; Racedo, Silvia E; McDonald-McGinn, Donna M; Chow, Eva W C; Vorstman, Jacob; Swillen, Ann; Devriendt, Koen; Breckpot, Jeroen; Digilio, Maria Cristina; Marino, Bruno; Dallapiccola, Bruno; Philip, Nicole; Simon, Tony J; Roberts, Amy E; Piotrowicz, Małgorzata; Bearden, Carrie E; Eliez, Stephan; Gothelf, Doron; Coleman, Karlene; Kates, Wendy R; Devoto, Marcella; Zackai, Elaine; Heine-Suñer, Damian; Goldmuntz, Elizabeth; Bassett, Anne S; Morrow, Bernice E; Emanuel, Beverly S

2016-03-01

The 22q11.2 deletion syndrome (22q11DS; velocardiofacial/DiGeorge syndrome; VCFS/DGS; MIM #192430; 188400) is the most common microdeletion syndrome. The phenotypic presentation of 22q11DS is highly variable; approximately 60-75 % of 22q11DS patients have been reported to have a congenital heart defect (CHD), mostly of the conotruncal type, and/or aortic arch defect. The etiology of the cardiac phenotypic variability is not currently known for the majority of patients. We hypothesized that rare copy number variants (CNVs) outside the 22q11.2 deleted region may modify the risk of being born with a CHD in this sensitized population. Rare CNV analysis was performed using Affymetrix SNP Array 6.0 data from 946 22q11DS subjects with CHDs (n = 607) or with normal cardiac anatomy (n = 339). Although there was no significant difference in the overall burden of rare CNVs, an overabundance of CNVs affecting cardiac-related genes was detected in 22q11DS individuals with CHDs. When the rare CNVs were examined with regard to gene interactions, specific cardiac networks, such as Wnt signaling, appear to be overrepresented in 22q11DS CHD cases but not 22q11DS controls with a normal heart. Collectively, these data suggest that CNVs outside the 22q11.2 region may contain genes that modify risk for CHDs in some 22q11DS patients.

Human retinoblastoma susceptibility gene: genomic organization and analysis of heterozygous intragenic deletion mutants.

PubMed Central

Bookstein, R; Lee, E Y; To, H; Young, L J; Sery, T W; Hayes, R C; Friedmann, T; Lee, W H

1988-01-01

A gene in chromosome region 13q14 has been identified as the human retinoblastoma susceptibility (RB) gene on the basis of altered gene expression found in virtually all retinoblastomas. In order to further characterize the RB gene and its structural alterations, we examined genomic clones of the RB gene isolated from both a normal human genomic library and a library made from DNA of the retinoblastoma cell line Y79. First, a restriction and exon map of the RB gene was constructed by aligning overlapping genomic clones, yielding three contiguous regions ("contigs") of 150 kilobases total length separated by two gaps. At least 20 exons were identified in genomic clones, and these were provisionally numbered. Second, two overlapping genomic clones that demonstrated a DNA deletion of exons 2 through 6 from one RB allele were isolated from the Y79 library. To confirm and extend this result, a unique sequence probe from intron 1 was used to detect similar and possibly identical heterozygous deletions in genomic DNA from three retinoblastoma cell lines, thereby explaining the origins of their shortened RB mRNA transcripts. The same probe detected genomic rearrangements in fibroblasts from two hereditary retinoblastoma patients, indicating that intron 1 includes a frequent site for mutations conferring predisposition to retinoblastoma. Third, this probe also detected a polymorphic site for BamHI with allele frequencies near 0.5/0.5. Identification of commonly mutated regions will contribute significantly to genetic diagnosis in retinoblastoma patients and families. Images PMID:2895471

Transferring Desirable Genes from Agropyron cristatum 7P Chromosome into Common Wheat

PubMed Central

Li, Huanhuan; Pan, Cuili; Guo, Yong; Zhang, Jinpeng; Yang, Xinming; Li, Xiuquan; Liu, Weihua; Li, Lihui

2016-01-01

Wheat-Agropyron cristatum 7P disomic addition line Ⅱ-5-1, derived from the distant hybridization between A. cristatum (2n = 4x = 28, PPPP) and the common wheat cv. Fukuhokomugi (Fukuho), displays numerous desirable agronomic traits, including enhanced thousand-grain weight, smaller flag leaf, and enhanced tolerance to drought. In order to transfer these traits into common wheat, Ⅱ-5-1 was induced by 60Co-γ ray, leading to the creation of 18 translocation lines and three deletion lines. Genomic in situ hybridization (GISH) and fluorescence in situ hybridization (FISH) indicated that multiple wheat chromosomes were involved in the translocation events, including chromosome 2A, 3A, 5A, 7A, 3B, 5B, 7B, 3D and 7D. A. cristatum 7P chromosome was divided into 15 chromosomal bins with fifty-five sequence-tagged site (STS) markers specific to A. cristatum 7P chromosome. Seven and eight chromosomal bins were located on 7PS and 7PL, respectively. The above-mentioned translocation and deletion lines each contained different, yet overlapping 7P chromosomal fragments, covering the entire A. cristatum 7P chromosome. Three translocation lines (7PT-13, 7PT-14 and 7PT-17) and three deletion lines (del-1, del-2 and del-3), which contained the common chromosomal bins 7PS1-3, displayed higher thousand-grain weigh than Fukuho, suggesting that potential genes conferring high thousand-grain weigh might be located on these chromosomal bins. Therefore, wheat-A. cristatum 7P translocation lines with elite traits will be useful as novel germplasms for wheat genetic improvement. PMID:27459347

Kabuki syndrome is not caused by a microdeletion in the DiGeorge/velocardiofacial chromosomal region within 22q11.2

DOE Office of Scientific and Technical Information (OSTI.GOV)

Li, M.; Zackai, E.H.; Kaplan, P.

1996-10-16

Kabuki syndrome (KS) or Niikawa-Kuroki syndrome is a sporadic disorder characterized by postnatal growth retardation, developmental delay, mild to moderate retardation, and a characteristic facial appearance. Cardiovascular defects, clefts of the lip, palate, or both, and musculoskeletal abnormalities occur in about 50% of patients with KS. The cause of this multiple congenital anomaly syndrome is unknown, and investigators have speculated that KS is a contiguous gene-deletion syndrome. Based on the presence of congenital heart defects in patients with KS, it was suggested that this disorder might share a common cause with the 22q11 deletion syndromes. A preliminary study of 2more » patients with KS failed to detect a deletion within 22q11. We report the results of fluorescence in situ hybridization with cosmid probes for loci D22S75 (N25) and D22S259 (1132) within the DiGeorge chromosomal region (DGCR) on metaphase spreads from an additional 5 patients, 2 non-Japanese and 3 Japanese, with KS. None of the 5 had deletions at either locus. It is unlikely that KS is caused by a deletion within 22q11. 16 refs.« less

[An updated review of 1p36 deletion (monosomy) syndrome].

PubMed

Bello, Sabina; Rodríguez-Moreno, Antonio

The Monosomy 1p36 deletion syndrome is part of the group of diseases known as Rare Diseases. The objective of the present work is to review the characteristics of Monosomy 1p36 deletion syndrome. The monosomy 1p36 deletion syndrome phenotype includes: dysmorphic craniofacial features; large anterior fontanelle, unibrow, deep-set eyes, epicanthus, wide nasal root/bridge, mandible hypoplasia, abnormal location of the pinna, philtrum and pointed chin; neurological alterations: seizures and hydrocephalus (in some cases). Cerebral malformations: ventricular hypertrophy, increased subarachnoid space, morphological alterations of corpus callosum, cortical atrophy, delays in myelinisation, periventricular leukomalacia and periventricular heterotopia. These alterations produce intellectual disability and delays in motor growth, communication skills, language, social and adaptive behaviour. It is Hearing and vision impairments are also observed in subjects with this syndrome, as well as alterations of cardiac, endocrine and urinary systems and alterations at skin and skeletal level. Approximately 100 cases have been documented since 1981. This rare disease is the most common subtelomeric-micro-deletion syndrome. In situ hybridization with fluorescence (FISH) and array-comparative genomic hybridization (CGH-array) are at present the two best diagnostic techniques. There is currently no effective medical treatment for this disease. Copyright © 2016 Sociedad Chilena de Pediatría. Publicado por Elsevier España, S.L.U. All rights reserved.

Molecular Analysis-Based Genetic Characterization of a Cohort of Patients with Duchenne and Becker Muscular Dystrophy in Eastern China.

PubMed

Zhao, Hui-Hui; Sun, Xue-Ping; Shi, Ming-Chao; Yi, Yong-Xiang; Cheng, Hong; Wang, Xing-Xia; Xu, Qing-Cheng; Ma, Hong-Ming; Wu, Hao-Quan; Jin, Qing-Wen; Niu, Qi

2018-04-05

Duchenne muscular dystrophy (DMD) and Becker muscular dystrophy (BMD) are common X-linked recessive neuromuscular disorders caused by mutations in dystrophin gene. Multiplex polymerase chain reaction (multiplex PCR) and multiplex ligation-dependent probe amplification (MLPA) are the most common methods for detecting dystrophin gene mutations. This study aimed to contrast the two methods and discern the genetic characterization of patients with DMD/BMD in Eastern China. We collected 121 probands, 64 mothers of probands, and 15 fetuses in our study. The dystrophin gene was detected by multiplex PCR primarily in 28 probands, and MLPA was used in multiplex PCR-negative cases subsequently. The dystrophin gene of the remaining 93 probands and 62 female potential carriers was tested by MLPA directly. In fetuses, multiplex PCR and MLPA were performed on 4 fetuses and 10 fetuses, respectively. In addition, sequencing was also performed in 4 probands with negative MLPA. We found that 61.98% of the subjects had genetic mutations including deletions (50.41%) and duplications (11.57%). There were 43.75% of mothers as carriers of the mutation. In 15 fetuses, 2 out of 7 male fetuses were found to be unhealthy and 2 out of 8 female fetuses were found to be carriers. Exons 3-26 and 45-52 have the maximum frequency in mutation regions. In the frequency of exons individually, exon 47 and exon 50 were the most common in deleted regions and exons 5, 6, and 7 were found most frequently in duplicated regions. MLPA has better productivity and sensitivity than multiplex PCR. Prenatal diagnosis should be applied in DMD high-risk fetuses to reduce the disease incidence. Furthermore, it is the responsibility of physicians to inform female carriers the importance of prenatal diagnosis.

The human chromosomal fragile sites more often involved in constitutional deletions and duplications - A genetic and statistical assessment

NASA Astrophysics Data System (ADS)

Gomes, Dora Prata; Sequeira, Inês J.; Figueiredo, Carlos; Rueff, José; Brás, Aldina

2016-12-01

Human chromosomal fragile sites (CFSs) are heritable loci or regions of the human chromosomes prone to exhibit gaps, breaks and rearrangements. Determining the frequency of deletions and duplications in CFSs may contribute to explain the occurrence of human disease due to those rearrangements. In this study we analyzed the frequency of deletions and duplications in each human CFS. Statistical methods, namely data display, descriptive statistics and linear regression analysis were applied to analyze this dataset. We found that FRA15C, FRA16A and FRAXB are the most frequently involved CFSs in deletions and duplications occurring in the human genome.

Neonatal hypocalcemia, neonatal seizures, and intellectual disability in 22q11.2 deletion syndrome

PubMed Central

Cheung, Evelyn Ning Man; George, Susan R.; Andrade, Danielle M.; Chow, Eva W. C.; Silversides, Candice K.; Bassett, Anne S.

2015-01-01

Purpose Hypocalcemia is a common endocrinological condition in 22q11.2 deletion syndrome. Neonatal hypocalcemia may affect neurodevelopment. We hypothesized that neonatal hypocalcemia would be associated with rare, more severe forms of intellectual disability in 22q11.2 deletion syndrome. Methods We used a logistic regression model to investigate potential predictors of intellectual disability severity, including neonatal hypocalcemia, neonatal seizures, and complex congenital heart disease, e.g., interrupted aortic arch, in 149 adults with 22q11.2 deletion syndrome. Ten subjects had moderate-to-severe intellectual disability. Results The model was highly significant (P < 0.0001), showing neonatal seizures (P = 0.0018) and neonatal hypocalcemia (P = 0.047) to be significant predictors of a more severe level of intellectual disability. Neonatal seizures were significantly associated with neonatal hypocalcemia in the entire sample (P < 0.0001), regardless of intellectual level. There was no evidence for the association of moderate- to-severe intellectual disability with other factors such as major structural brain malformations in this sample. Conclusion The results suggest that neonatal seizures may increase the risk for more severe intellectual deficits in 22q11.2 deletion syndrome, likely mediated by neonatal hypocalcemia. Neonatal hypocalcemia often remains unrecognized until the postseizure period, when damage to neurons may already have occurred. These findings support the importance of early recognition and treatment of neonatal hypocalcemia and potentially neonatal screening for 22q11.2 deletions. PMID:23765047

Mitochondrial pathology in inclusion body myositis.

PubMed

Lindgren, Ulrika; Roos, Sara; Hedberg Oldfors, Carola; Moslemi, Ali-Reza; Lindberg, Christopher; Oldfors, Anders

2015-04-01

Inclusion body myositis (IBM) is usually associated with a large number of cytochrome c oxidase (COX)-deficient muscle fibers and acquired mitochondrial DNA (mtDNA) deletions. We studied the number of COX-deficient fibers and the amount of mtDNA deletions, and if variants in nuclear genes involved in mtDNA maintenance may contribute to the occurrence of mtDNA deletions in IBM muscle. Twenty-six IBM patients were included. COX-deficient fibers were assayed by morphometry and mtDNA deletions by qPCR. POLG was analyzed in all patients by Sanger sequencing and C10orf2 (Twinkle), DNA2, MGME1, OPA1, POLG2, RRM2B, SLC25A4 and TYMP in six patients by next generation sequencing. Patients with many COX-deficient muscle fibers had a significantly higher proportion of mtDNA deletions than patients with few COX-deficient fibers. We found previously unreported variants in POLG and C10orf2 and IBM patients had a significantly higher frequency of an RRM2B variant than controls. POLG variants appeared more common in IBM patients with many COX-deficient fibers, but the difference was not statistically significant. We conclude that COX-deficient fibers in inclusion body myositis are associated with multiple mtDNA deletions. In IBM patients we found novel and also previously reported variants in genes of importance for mtDNA maintenance that warrants further studies. Copyright © 2014 Elsevier B.V. All rights reserved.

Phenotypic expression of partial AZFc deletions is independent of the variations in DAZL and BOULE in a Han population.

PubMed

Chen, Pu; Ma, Mingyi; Li, Lei; Zhang, Sizhong; Su, Dan; Ma, Yongxin; Liu, Yunqiang; Tao, Dachang; Lin, Li; Yang, Yuan

2010-01-01

DAZ on the Y chromosome and 2 autosomal ancestral genes DAZL and BOULE are suggested to represent functional conservation in spermatogenesis. The partial AZFc deletion, a common mutation of the Y chromosome, always involves 2 DAZ copies and represents a different spermatogenic phenotype in the populations studied. To investigate whether the variations in DAZL and BOULE influence partial AZFc deletion phenotype, the genotyping of 15 loci variations, including 4 known mutations and 11 single-nucleotide polymorphisms (SNPs), was carried out in 157 azoo-/oligzoospermic men and 57 normozoospermic men, both groups with partial AZFc deletions. The frequencies of the alleles, genotypes, and haplotypes of the variations were compared between the 2 groups. As a result, for 9 exonic variations in DAZL and BOULE, only T12A was observed in both groups with similar frequency, and I71V was identified in an azoospermic man with b2/b3 deletion, whereas the rest were absent in the population. The distribution of DAZL haplotypes from 4 variations, including T12A, and of BOULE haplotypes from 2 SNPs was similar between men with normozoospermia and spermatogenic failure. Our findings indicate that the contribution of DAZL and BOULE variations to spermatogenic impairment in men with the DAZ defect is greatly limited, suggesting that expression of spermatogenic phenotypes of partial AZFc deletions is independent of the variations in DAZL and BOULE in the Han population.

A large deletion of PROP1 gene in patients with combined pituitary hormone deficiency from two unrelated Chinese pedigrees.

PubMed

Zhang, Huiwen; Wang, Yi; Han, Lianshu; Gu, Xuefan; Shi, Dingping

2010-01-01

Familial combined pituitary hormone deficiency (CPHD) appears to have a genetic cause, PROP1 gene mutations being the most common one. We investigated whether PROP1 plays a role in two Chinese familial cases of CPHD. PROP1 gene and adjacent sequences from genomic samples from two unrelated families were amplified to investigate molecular variations and define the extension of a potential deletion. A quantitative real-time polymerase chain reaction was conducted to analyze the copy number of PROP1 gene in the probands' mothers. The relationship of the two distantly located families was further analyzed using microsatellite markers. A segment of about 53.2 kilobases (kb) comprehending PROP1 and another gene encoding a hypothetical protein Q6ZTH3 was deleted in both pedigrees. The mother of one of the probands was hemizygous for this large deletion, which confirmed the assumption that the affected children inherited the deletion allele from their consanguineous parents. The difference of three microsatellites surrounding the absent segment indicated that the two pedigrees were genetically unrelated. We report the largest genomic deletion including PROP1 gene associated with CPHD. Q6ZTH3 is unlikely to exert an indispensable function during embryogenesis or organogenesis. The 7.7-kb segment upstream of the transcription of PROP1 probably harbors a fragile site that favors the occurrence of breakpoints. Copyright (c) 2010 S. Karger AG, Basel.

Reduction of Aspergillus niger Virulence in Apple Fruits by Deletion of the Catalase Gene cpeB.

PubMed

Zhang, Meng-Ke; Tang, Jun; Huang, Zhong-Qin; Hu, Kang-Di; Li, Yan-Hong; Han, Zhuo; Chen, Xiao-Yan; Hu, Lan-Ying; Yao, Gai-Fang; Zhang, Hua

2018-05-30

Aspergillus niger, a common saprophytic fungus, causes rot in many fruits. We studied the role of a putative catalase-peroxidase-encoding gene, cpeB, in oxidative stress and virulence in fruit. The cpeB gene was deleted in A. niger by homologous recombination, and the Δ cpeB mutant showed decreased CAT activity compared with that of the wild type. The cpeB gene deletion caused increased sensitivity to H 2 O 2 stress, and spore germination was significantly reduced; in addition, the reactive-oxygen-species (ROS) metabolites superoxide anions (·O 2 - ), hydrogen peroxide (H 2 O 2 ), and malondialdehyde (MDA) accumulated in the Δ cpeB mutant during H 2 O 2 stress. Furthermore, ROS metabolism in A. niger infected apples was determined, and our results showed that the Δ cpeB mutant induced an attenuated response in apple fruit during the fruit-pathogen interaction; the cpeB gene deletion significantly reduced the development of lesions, suggesting that the cpeB gene in A. niger is essential for full virulence in apples.

Careful with That Axe, Gene, Genome Perturbation after a PEG-Mediated Protoplast Transformation in Fusarium verticillioides.

PubMed

Scala, Valeria; Grottoli, Alessandro; Aiese Cigliano, Riccardo; Anzar, Irantzu; Beccaccioli, Marzia; Fanelli, Corrado; Dall'Asta, Chiara; Battilani, Paola; Reverberi, Massimo; Sanseverino, Walter

2017-05-31

Fusarium verticillioides causes ear rot disease in maize and its contamination with fumonisins, mycotoxins harmful for humans and livestock. Lipids, and their oxidized forms, may drive the fate of this disease. In a previous study, we have explored the role of oxylipins in this interaction by deleting by standard transformation procedures a linoleate diol synthase-coding gene, lds1 , in F. verticillioides . A profound phenotypic diversity in the mutants generated has prompted us to investigate more deeply the whole genome of two lds1 -deleted strains. Bioinformatics analyses pinpoint significant differences in the genome sequences emerged between the wild type and the lds1 -mutants further than those trivially attributable to the deletion of the lds1 locus, such as single nucleotide polymorphisms, small deletion/insertion polymorphisms and structural variations. Results suggest that the effect of a (theoretically) punctual transformation event might have enhanced the natural mechanisms of genomic variability and that transformation practices, commonly used in the reverse genetics of fungi, may potentially be responsible for unexpected, stochastic and henceforth off-target rearrangements throughout the genome.

Careful with That Axe, Gene, Genome Perturbation after a PEG-Mediated Protoplast Transformation in Fusarium verticillioides

PubMed Central

Scala, Valeria; Grottoli, Alessandro; Aiese Cigliano, Riccardo; Anzar, Irantzu; Beccaccioli, Marzia; Fanelli, Corrado; Dall’Asta, Chiara; Battilani, Paola; Reverberi, Massimo; Sanseverino, Walter

2017-01-01

Fusarium verticillioides causes ear rot disease in maize and its contamination with fumonisins, mycotoxins harmful for humans and livestock. Lipids, and their oxidized forms, may drive the fate of this disease. In a previous study, we have explored the role of oxylipins in this interaction by deleting by standard transformation procedures a linoleate diol synthase-coding gene, lds1, in F. verticillioides. A profound phenotypic diversity in the mutants generated has prompted us to investigate more deeply the whole genome of two lds1-deleted strains. Bioinformatics analyses pinpoint significant differences in the genome sequences emerged between the wild type and the lds1-mutants further than those trivially attributable to the deletion of the lds1 locus, such as single nucleotide polymorphisms, small deletion/insertion polymorphisms and structural variations. Results suggest that the effect of a (theoretically) punctual transformation event might have enhanced the natural mechanisms of genomic variability and that transformation practices, commonly used in the reverse genetics of fungi, may potentially be responsible for unexpected, stochastic and henceforth off-target rearrangements throughout the genome. PMID:28561789

Nested Inversion Polymorphisms Predispose Chromosome 22q11.2 to Meiotic Rearrangements.

PubMed

Demaerel, Wolfram; Hestand, Matthew S; Vergaelen, Elfi; Swillen, Ann; López-Sánchez, Marcos; Pérez-Jurado, Luis A; McDonald-McGinn, Donna M; Zackai, Elaine; Emanuel, Beverly S; Morrow, Bernice E; Breckpot, Jeroen; Devriendt, Koenraad; Vermeesch, Joris R

2017-10-05

Inversion polymorphisms between low-copy repeats (LCRs) might predispose chromosomes to meiotic non-allelic homologous recombination (NAHR) events and thus lead to genomic disorders. However, for the 22q11.2 deletion syndrome (22q11.2DS), the most common genomic disorder, no such inversions have been uncovered as of yet. Using fiber-FISH, we demonstrate that parents transmitting the de novo 3 Mb LCR22A-D 22q11.2 deletion, the reciprocal duplication, and the smaller 1.5 Mb LCR22A-B 22q11.2 deletion carry inversions of LCR22B-D or LCR22C-D. Hence, the inversions predispose chromosome 22q11.2 to meiotic rearrangements and increase the individual risk for transmitting rearrangements. Interestingly, the inversions are nested or flanking rather than coinciding with the deletion or duplication sizes. This finding raises the possibility that inversions are a prerequisite not only for 22q11.2 rearrangements but also for all NAHR-mediated genomic disorders. Copyright © 2017. Published by Elsevier Inc.

A familial {open_quotes}balanced{close_quotes} 3;9 translocation with cryptic 8q insertion leading to deletion and duplication of 9p23 loci in siblings

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wagstaff, J.; Hemann, M.

1994-09-01

Families in which a balanced translocation has been transmitted from a normal parent to a child with a phenotypic abnormality have been a longstanding puzzle for human geneticists. A child with phenotypic features of the 9p- syndrome, including metopic craniosynostosis, small ears, abdominal wall defect, and mental retardation, was found to have a cytogenetically balanced 3;9 translocation, with breakpoints at 3p11 and 9p23, inherited from his normal father. He also exhibited marked hypopigmentation of hair and skin. Analysis with a cDNA probe from the TYRP1 (tyrosinase-related protein 1) gene in 9p23 showed heterozygous deletion in the child but in neithermore » parent. This submicroscopic deletion also included loci D9S157, D9S274, D9S268, and D9S267. FISH analysis of the proband`s father indicated the 9p23 loci deleted in his son were present on neither the der(3) nor the der(9) translocation product, but had been inserted into the long arm of chromosome 8. Therefore, the apparent deletion of these loci in the proband was the result of meiotic segregation of the father`s 3;9 translocation chromosomes together with his normal chromosome 8. Neither the deletion from the translocation chromosomes nor the insertion into 8q was detectable by standard chromosome banding techniques. The proband`s sister exhibited speech delay, mild facial dysmorphism, and renal malformation, and her karyotype was 46,XX. Molecular analysis of this sister showed 3 copies of 9p23 sequences, indicating that she had inherited normal chromosomes 3 and 9 from her father as well as the chromosome 8 with the insertion from 9p23. This analysis illustrates a new mechanism to explain cases of phenotypic discordance in familial balanced translocations: submicroscopic deletion of material from the translocation breakpoint and insertion into a third chromosome in the balanced parent, with meiotic segregation leading to loss of the inserted material in the child.« less

Array-based comparative genomic hybridization in 190 Korean patients with developmental delay and/or intellectual disability: a single tertiary care university center study.

PubMed

Lee, Cha Gon; Park, Sang-Jin; Yun, Jun-No; Ko, Jung Min; Kim, Hyon-Ju; Yim, Shin-Young; Sohn, Young Bae

2013-11-01

This study analyzed and evaluated the demographic, clinical, and cytogenetic data [G-banded karyotyping and array-based comparative genomic hybridization (array CGH)] of patients with unexplained developmental delay or intellectual disability at a single Korean institution. We collected clinical and cytogenetic data based on retrospective charts at Ajou University Medical Center, Suwon, Korea from April 2008 to March 2012. A total of 190 patients were identified. Mean age was 5.1±1.87 years. Array CGH yielded abnormal results in 26 of 190 patients (13.7%). Copy number losses were about two-fold more frequent than gains. A total of 61.5% of all patients had copy number losses. The most common deletion disorders included 22q11.2 deletion syndrome, 15q11.2q12 deletion and 18q deletion syndrome. Copy number gains were identified in 34.6% of patients, and common diseases among these included Potocki-Lupski syndrome, 15q11-13 duplication syndrome and duplication 22q. Abnormal karyotype with normal array CGH results was exhibited in 2.6% of patients; theses included balanced translocation (n=2), inversion (n=2) and low-level mosaicism (n=1). Facial abnormalities (p<0.001) and failure to thrive were (p<0.001) also more frequent in the group of patients with abnormal CGH findings. Array CGH is a useful diagnostic tool in clinical settings in patients with developmental delay or intellectual disability combined with facial abnormalities or failure to thrive.

Alpha-thalassemia (3.7 kb deletion) in a population from the Brazilian Amazon region: Santarém, Pará State.

PubMed

Souza, A E S; Cardoso, G L; Takanashi, S Y L; Guerreiro, J F

2009-04-28

The ethnic composition of the Brazilian population favors high frequencies of the -alpha3.7 deletion, responsible for alpha-thalassemia, because this mutation is very common in African populations. In spite of its importance, this hemoglobinopathy has been poorly investigated in Brazil, especially at the molecular level. We investigated the prevalence of the -alpha3.7 mutation in 220 individuals attended at the Municipal Hospital of Santarém, in the state of Pará. These patients were distributed into three different groups: i) 103 individuals with anemia who had microcytosis and hypochromia, ii) 11 individuals without anemia who had microcytosis and hypochromia, and iii) 106 individuals with no hematological alterations. We examined the usefulness of investigating alpha-thalassemia carrier status for microcytosis. Among the 103 patients with anemia, 20 (19.4%) were heterozygotes (-alpha3.7/alphaalpha) and one (1.0%) was a homozygote (-alpha3.7/-alpha3.7). Among the 11 patients without anemia, one heterozygote (-alpha3.7/alphaalpha) was identified; in the third group, composed of normal individuals (106 samples), deletion -alpha3.7 was found in seven samples (6.6%), all of which were heterozygotes (-alpha/alphaalpha).These frequencies are within the expected range, given available data on the distribution of this hemoglobin disorder in human populations and the ethnic composition of the population of Santarém. We found that alpha-thalassemia is a common cause of microcytosis, given that a high proportion (19.2%) of the microcytic population carried alpha-globin gene deletions.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Saito, Kayoko; Ikeya, Kiyoko; Kondo, Eri

Mosaicism is a mixed state, with two cell populations of different genetic origins caused by a cell mutation occurring after fertilization. In the present case, DNA analysis of lymphocytes led to a DMD diagnosis before death. Postmortem immunocytochemical and DNA analysis showed somatic mosaicism. At age 18 years, blood lymphocyte DNA analysis showed a DMD gene deletion, upstream from exon 7 to the 5{prime} end containing both muscle and brain promoters. As the patient`s mother and elder sister had no deletions, he was considered to have a new mutation. Immunocytochemical studies of postmortem tissues showed that dystrophin was absent frommore » the tongue, deltoid, intercostal, psoas and rectus femoris muscles, but there was a mix of dystrophin-positive and negative fibers in the rectus abdominis, cardiac, temporalis and sternocleidomastoid muscles. All diaphragm cells were dystrophin positive. Polymerase chain reaction (PCR) amplification from all tissues except the temporalis and sternocleidomastoid muscles, diaphragm and kidney, in which no deletion was found, showed the deletion from at least exon 6 to the 5{prime} end containing both muscle and brain promoters. In this case, a genomic deletion of the DMD gene contributed to the formation of tissues derived from both ectoderm and endoderm, and cells of mesodermal origin showed genotypic and phenotypic heterogeneity. Our results indicate a mutation of the present case may have occurred just before the period of germ layer formation. 34 refs., 7 figs.« less

Quantitative proteomics and network analysis of SSA1 and SSB1 deletion mutants reveals robustness of chaperone HSP70 network in Saccharomyces cerevisiae.

PubMed

Jarnuczak, Andrew F; Eyers, Claire E; Schwartz, Jean-Marc; Grant, Christopher M; Hubbard, Simon J

2015-09-01

Molecular chaperones play an important role in protein homeostasis and the cellular response to stress. In particular, the HSP70 chaperones in yeast mediate a large volume of protein folding through transient associations with their substrates. This chaperone interaction network can be disturbed by various perturbations, such as environmental stress or a gene deletion. Here, we consider deletions of two major chaperone proteins, SSA1 and SSB1, from the chaperone network in Sacchromyces cerevisiae. We employ a SILAC-based approach to examine changes in global and local protein abundance and rationalise our results via network analysis and graph theoretical approaches. Although the deletions result in an overall increase in intracellular protein content, correlated with an increase in cell size, this is not matched by substantial changes in individual protein concentrations. Despite the phenotypic robustness to deletion of these major hub proteins, it cannot be simply explained by the presence of paralogues. Instead, network analysis and a theoretical consideration of folding workload suggest that the robustness to perturbation is a product of the overall network structure. This highlights how quantitative proteomics and systems modelling can be used to rationalise emergent network properties, and how the HSP70 system can accommodate the loss of major hubs. © 2015 The Authors. PROTEOMICS published by Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

A modified multiplex ligation-dependent probe amplification method for the detection of 22q11.2 copy number variations in patients with congenital heart disease.

PubMed

Zhang, Xiaoqing; Xu, Yuejuan; Liu, Deyuan; Geng, Juan; Chen, Sun; Jiang, Zhengwen; Fu, Qihua; Sun, Kun

2015-05-08

Copy number variations (CNVs) of chromosomal region 22q11.2 are associated with a subset of patients with congenital heart disease (CHD). Accurate and efficient detection of CNV is important for genetic analysis of CHD. The aim of the study was to introduce a novel approach named CNVplex®, a high-throughput analysis technique designed for efficient detection of chromosomal CNVs, and to explore the prevalence of sub-chromosomal imbalances in 22q11.2 loci in patients with CHD from a single institute. We developed a novel technique, CNVplex®, for high-throughput detection of sub-chromosomal copy number aberrations. Modified from the multiplex ligation-dependent probe amplification (MLPA) method, it introduced a lengthening ligation system and four universal primer sets, which simplified the synthesis of probes and significantly improved the flexibility of the experiment. We used 110 samples, which were extensively characterized with chromosomal microarray analysis and MLPA, to validate the performance of the newly developed method. Furthermore, CNVplex® was used to screen for sub-chromosomal imbalances in 22q11.2 loci in 818 CHD patients consecutively enrolled from Shanghai Children's Medical Center. In the methodology development phase, CNVplex® detected all copy number aberrations that were previously identified with both chromosomal microarray analysis and MLPA, demonstrating 100% sensitivity and specificity. In the validation phase, 22q11.2 deletion and 22q11.2 duplication were detected in 39 and 1 of 818 patients with CHD by CNVplex®, respectively. Our data demonstrated that the frequency of 22q11.2 deletion varied among sub-groups of CHD patients. Notably, 22q11.2 deletion was more commonly observed in cases with conotruncal defect (CTD) than in cases with non-CTD (P<0.001). With higher resolution and more probes against selected chromosomal loci, CNVplex® also identified several individuals with small CNVs and alterations in other chromosomes. CNVplex® is sensitive and specific in its detection of CNVs, and it is an alternative to MLPA for batch screening of pathogenetic CNVs in known genomic loci.

Analysis of copy number variations in Holstein-Friesian cow genomes based on whole-genome sequence data.

PubMed

Mielczarek, M; Frąszczak, M; Giannico, R; Minozzi, G; Williams, John L; Wojdak-Maksymiec, K; Szyda, J

2017-07-01

Thirty-two whole genome DNA sequences of cows were analyzed to evaluate inter-individual variability in the distribution and length of copy number variations (CNV) and to functionally annotate CNV breakpoints. The total number of deletions per individual varied between 9,731 and 15,051, whereas the number of duplications was between 1,694 and 5,187. Most of the deletions (81%) and duplications (86%) were unique to a single cow. No relation between the pattern of variant sharing and a family relationship or disease status was found. The animal-averaged length of deletions was from 5,234 to 9,145 bp and the average length of duplications was between 7,254 and 8,843 bp. Highly significant inter-individual variation in length and number of CNV was detected for both deletions and duplications. The majority of deletion and duplication breakpoints were located in intergenic regions and introns, whereas fewer were identified in noncoding transcripts and splice regions. Only 1.35 and 0.79% of the deletion and duplication breakpoints were observed within coding regions. A gene with the highest number of deletion breakpoints codes for protein kinase cGMP-dependent type I, whereas the T-cell receptor α constant gene had the most duplication breakpoints. The functional annotation of genes with the largest incidence of deletion/duplication breakpoints identified 87/112 Kyoto Encyclopedia of Genes and Genomes pathways, but none of the pathways were significantly enriched or depleted with breakpoints. The analysis of Gene Ontology (GO) terms revealed that a cluster with the highest enrichment score among genes with many deletion breakpoints was represented by GO terms related to ion transport, whereas the GO term cluster mostly enriched among the genes with many duplication breakpoints was related to binding of macromolecules. Furthermore, when considering the number of deletion breakpoints per gene functional category, no significant differences were observed between the "housekeeping" and "strong selection" categories, but genes representing the "low selection pressure" group showed a significantly higher number of breakpoints. Copyright © 2017 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

The preS deletion of hepatitis B virus (HBV) is associated with liver fibrosis progression in patients with chronic HBV infection.

PubMed

Li, Fan; Li, Xiaodong; Yan, Tao; Liu, Yan; Cheng, Yongqian; Xu, Zhihui; Shao, Qing; Liao, Hao; Huang, Pengyu; Li, Jin; Chen, Guo-Feng; Xu, Dongping

2018-03-01

Limited data are available regarding the association of hepatitis B virus (HBV) mutations with liver fibrosis in HBV infection. The study aimed to clarify whether HBV preS deletion mutation is associated with liver fibrosis progression. A total of 469 patients were enrolled, including 324 with chronic hepatitis B (CHB), 28 with HBV-related compensated liver cirrhosis (LC), and 117 with HBV-related decompensated LC. All CHB and compensated LC patients received liver biopsy. Fibrosis grade was assessed using METAVIR score. HBV preS deletion was determined by direct sequencing and verified by clonal sequencing. Overall preS deletion was detected in 12.6% (59/469) patients, specifically, in 7.51% (13/173), 10.60% (16/151), and 20.69% (30/145) of patients with no-to-mild liver fibrosis (F0-1), moderate-to-severe liver fibrosis (F2-3), and cirrhosis (F4), respectively (p < 0.01). Patients with preS-deleted HBV had lower serum HBV DNA and albumin levels compared to patients with wild-type HBV. The median length of preS deletion was 39-base pairs (bp) (3-204 bp) and the deletion most frequently emerged in preS2 initial region. Multivariate analysis identified the preS2 deletion rather than preS1 deletion to be an independent risk factor of significant fibrosis, i.e., METAVIR F ≥ 2 (p = 0.007). In addition, preS-deleted viral sequences were detected in the pool of intrahepatic HBV covalently closed circular DNA. HBV preS deletion is positively associated with liver fibrosis progression in chronic HBV-infected patients. HBV preS2 deletion may serve as a warning indicator for liver fibrosis progression.

Detection limit of intragenic deletions with targeted array comparative genomic hybridization

PubMed Central

2013-01-01

Background Pathogenic mutations range from single nucleotide changes to deletions or duplications that encompass a single exon to several genes. The use of gene-centric high-density array comparative genomic hybridization (aCGH) has revolutionized the detection of intragenic copy number variations. We implemented an exon-centric design of high-resolution aCGH to detect single- and multi-exon deletions and duplications in a large set of genes using the OGT 60 K and 180 K arrays. Here we describe the molecular characterization and breakpoint mapping of deletions at the smaller end of the detectable range in several genes using aCGH. Results The method initially implemented to detect single to multiple exon deletions, was able to detect deletions much smaller than anticipated. The selected deletions we describe vary in size, ranging from over 2 kb to as small as 12 base pairs. The smallest of these deletions are only detectable after careful manual review during data analysis. Suspected deletions smaller than the detection size for which the method was optimized, were rigorously followed up and confirmed with PCR-based investigations to uncover the true detection size limit of intragenic deletions with this technology. False-positive deletion calls often demonstrated single nucleotide changes or an insertion causing lower hybridization of probes demonstrating the sensitivity of aCGH. Conclusions With optimizing aCGH design and careful review process, aCGH can uncover intragenic deletions as small as dozen bases. These data provide insight that will help optimize probe coverage in array design and illustrate the true assay sensitivity. Mapping of the breakpoints confirms smaller deletions and contributes to the understanding of the mechanism behind these events. Our knowledge of the mutation spectra of several genes can be expected to change as previously unrecognized intragenic deletions are uncovered. PMID:24304607

PAX ECONOPACK Economic Analysis Package. User’s Manual.

DTIC Science & Technology

1986-01-01

35807-4301 ______________ I I CONTROLLING OFFICE NAME AND ADDRESS 12. REPORT DATE Commander US Army Corns of Fneineers January 1936 ATTN: TOAP-ZCP-"B...20 Mass. Ave. , NW 3 NUMBER OF PAGES ..ILI;I DC 20314-10G-0 253 14. MONITRING AGENCY NAME & ADDRESSIl dlierent [min Controlling Office) IS. SECURITY...PROMPT. EXANPLE: C>QED (1) QED EDITOR = CONTROL A - FOR CHARACTER DELETION = CONTROL W - FOR WORD DELETION = CONTROL Q - FOR L[NE DELETION = CONTROL R

Chronic lymphocytic leukaemia with 17p deletion: a retrospective analysis of prognostic factors and therapy results.

PubMed

Delgado, Julio; Espinet, Blanca; Oliveira, Ana C; Abrisqueta, Pau; de la Serna, Javier; Collado, Rosa; Loscertales, Javier; Lopez, Montserrat; Hernandez-Rivas, Jose A; Ferra, Christelle; Ramirez, Angel; Roncero, Josep M; Lopez, Cristina; Aventin, Anna; Puiggros, Anna; Abella, Eugenia; Carbonell, Felix; Costa, Dolors; Carrio, Anna; Gonzalez, Marcos

2012-04-01

Patients with chronic lymphocytic leukaemia (CLL) whose tumour cells harbour a 17p deletion (17p-) are universally considered to have a poor prognosis. The deletion can be detected at diagnosis or during the evolution of the disease, particularly in patients who have received chemotherapy. We sought to evaluate the natural history of patients with 17p- CLL, identify predictive factors within this prognostic subgroup, and evaluate the results of different therapeutic approaches. Data from 294 patients with 17p- CLL followed up at 20 different institutions was retrospectively collected and analysed. Median age was 68 (range 27-98) years at the time of fluorescence in situ hybridization analysis. After 17p- documentation, 52% received treatment, achieving an overall response rate of 50%. Median overall survival was 41 months, and was significantly shorter in patients with elevated beta(2)-microglobulin concentration (P < 0·001), B symptoms (P = 0·016), higher percentage of cells with deletion (P < 0·001), and acquired deletions (P = 0·012). These findings suggest that patients with 17p- CLL have a variable prognosis that can be refined using simple clinical and laboratory features, including 17p- clone size, beta2-microglobulin concentration, presence of B symptoms and type of deletion (de novo versus acquired). © 2012 Blackwell Publishing Ltd.

Patients with Exon 19 Deletion Were Associated with Longer Progression-Free Survival Compared to Those with L858R Mutation after First-Line EGFR-TKIs for Advanced Non-Small Cell Lung Cancer: A Meta-Analysis

PubMed Central

Fang, Wenfeng; Yan, Yue; Hu, Zhihuang; Hong, Shaodong; Wu, Xuan; Qin, Tao; Liang, Wenhua; Zhang, Li

2014-01-01

Backgrounds It has been extensively proved that the efficacy of epidermal growth factor receptor-tyrosine kinase inhibitors (EGFR-TKIs) is superior to that of cytotoxic chemotherapy in advanced non-small cell lung cancer (NSCLC) patients harboring sensitive EGFR mutations. However, the question of whether the efficacy of EGFR-TKIs differs between exon 19 deletion and exon 21 L858R mutation has not been yet statistically answered. Methods Subgroup data on hazard ratio (HR) for progression-free survival (PFS) of correlative studies were extracted and synthesized based on random-effect model. Comparison of outcomes between specific mutations was estimated through indirect and direct methods, respectively. Results A total of 13 studies of advanced NSCLC patients with either 19 or 21 exon alteration receiving first-line EGFR-TKIs were included. Based on the data from six clinical trials for indirect meta-analysis, the pooled HRTKI/chemotherapy for PFS were 0.28 (95% CI 0.20–0.38, P<0.001) in patients with 19 exon deletion and 0.47 (95% CI 0.35–0.64, P<0.001) in those with exon 21 L858R mutation. Indirect comparison revealed that the patients with exon 19 deletion had longer PFS than those with exon 21 L858R mutation (HR19 exon deletion/exon 21 L858R mutation  = 0.59, 95% CI 0.38–0.92; P = 0.019). Additionally, direct meta-analysis showed similar result (HR19 exon deletion/exon 21 L858R mutation  = 0.75, 95% CI 0.65 to 0.85; P<0.001) by incorporating another seven studies. Conclusions For advanced NSCLC patients, exon 19 deletion might be associated with longer PFS compared to L858 mutation at exon 21 after first-line EGFR-TKIs. PMID:25222496

Complex mosaic CDKL5 deletion with two distinct mutant alleles in a 4-year-old girl.

PubMed

Boutry-Kryza, Nadia; Ville, Dorothée; Labalme, Audrey; Calender, Alain; Dupont, Jean-Michel; Touraine, Renaud; Edery, Patrick; des Portes, Vincent; Sanlaville, Damien; Lesca, Gaetan

2014-08-01

Mutations of the CDKL5 gene cause early epileptic encephalopathy. Patients manifest refractory epilepsy, beginning before the age of 3 months, which is associated with severe psychomotor delay and features that overlap with Rett syndrome. We report here a patient with mosaicism for CDKL5 exonic deletion, with the presence of two mutant alleles. The affected 4-year-old girl presented with infantile spasms, beginning at the age of 9 months, but subsequent progression of the disease was consistent with the classical CDKL5-related phenotype. A deletion of exons 17 and 18 was suspected on the basis of Multiplex Ligation Probe Amplification analysis, but unexpected results for cDNA analysis, which showed the presence of an abnormal transcript with the deletion of exon 18 only, led us to suspect that two distinct events might have occurred. We used custom array-CGH to determine the size and breakpoints of these deletions. Exon 18 was deleted from one of the abnormal alleles, and exon 17 was deleted from the other. A Fork Stalling and Template Switching (FoSTeS) mechanism was proposed to explain the two events, given the presence of regions of microhomology at the breakpoints. We propose here an original involvement of the FoSTeS mechanism to explain the co-occurrence of these two events in the CDKL5 gene in a single patient. This patient highlights the difficulties involved in the detection of such abnormalities, particularly when they occur in a mosaic state and involve two distinct mutational events in a single gene. © 2014 Wiley Periodicals, Inc.

Confirmation and refinement of the heterozygous deletion of the small leucine-rich proteoglycans associated with posterior amorphous corneal dystrophy.

PubMed

Cervantes, Aleck E; Gee, Katherine M; Whiting, Martha F; Frausto, Ricardo F; Aldave, Anthony J

2018-04-19

To present the clinical and cytogenetic features of a previously unreported family with posterior amorphous corneal dystrophy (PACD) associated with a heterozygous deletion of the small leucine-rich proteoglycan (SRLP) genes on chromosome 12. Clinical characterization was performed using slit lamp biomicroscopic and optical coherence tomography (OCT) imaging. Genomic DNA was collected from affected and unaffected family members, and a cytogenomic array was used to identify copy number variations (CNV) present in the PACD locus. Three members of a Guatemalan family presented with clinical characteristics consistent with PACD: bilateral posterior stromal lamellar opacification, decreased corneal curvature, and iridocorneal adhesions. OCT imaging demonstrated decreased corneal thickness and hyperreflectivity of the posterior third of the corneal stroma. CNV analysis confirmed the presumed clinical diagnosis of PACD by revealing a 0.304 Mb heterozygous deletion in the PACD locus on chromosome 12 that included the four SLRP genes (KERA, LUM, DCN, and EPYC) deleted in each of the PACD families in which CNV analysis has been reported. This is the first report of the OCT appearance of PACD and the second confirmation of a heterozygous deletion of chromosome 12q21.33 as the cause of PACD, highlighting the utility of array-based cytogenomics to confirm the suspected clinical diagnosis of PACD. As the smallest previously reported pathogenic deletion was 0.701 Mb, the 0.304-Mb deletion we report is the smallest identified to date and reduces the size of the PACD locus to 0.275 Mb.

Prognostic significance of KIT exon 11 deletion mutation in intermediate-risk gastrointestinal stromal tumor.

PubMed

Quek, Richard; Farid, Mohamad; Kanjanapan, Yada; Lim, Cindy; Tan, Iain Beehuat; Kesavan, Sittampalam; Lim, Tony Kiat Hon; Oon, Lynette Lin-Ean; Goh, Brian Kp; Chan, Weng Hoong; Teo, Melissa; Chung, Alexander Yf; Ong, Hock Soo; Wong, Wai Keong; Tan, Patrick; Yip, Desmond

2017-06-01

Benefit of adjuvant imatinib therapy following curative resection in patients with intermediate-risk gastrointestinal stromal tumor (GIST) is unclear. GIST-specific exon mutations, in particular exon 11 deletions, have been shown to be prognostic. We hypothesize that specific KIT mutations may improve risk stratification in patients with intermediate-risk GIST, identifying a subgroup of patients who may benefit from adjuvant therapy. In total, 142 GIST patients with complete clinicopathologic and mutational data from two sites were included. Risk classification was based on the modified National Institute of Health (NIH) criteria. In this cohort, 74% (n = 105) of patients harbored a KIT mutation; 61% (n = 86) were found in exon 11 of which nearly 70% were KIT exon 11 deletions (n = 60). A total of 18% (n = 25) of cases were classified as having intermediate-risk disease. Univariate analysis confirmed tumor size, mitotic index, nongastric origin, presence of tumor rupture and modified NIH criteria were adversely prognostic for relapse-free survival (RFS). Among KIT/PDGFRA mutants, KIT exon 11 deletions had a significantly worse prognosis (hazard ratio 2.31; 95% confidence interval, 1.30-4.10; P = 0.003). Multivariate analysis confirmed KIT exon 11 deletion (P = 0.003) and clinical risk classification (P < 0.001) as independent adverse prognostic factors for RFS. Intermediate-risk patients harboring KIT exon 11 deletions had RFS outcomes similar to high-risk patients. The presence of KIT exon 11 deletion mutation in patients with intermediate-risk GIST is associated with an inferior clinical outcome with RFS similar to high-risk patients. © 2016 John Wiley & Sons Australia, Ltd.

Enhanced hexose fermentation by Saccharomyces cerevisiae through integration of stoichiometric modeling and genetic screening.

PubMed

Quarterman, Josh; Kim, Soo Rin; Kim, Pan-Jun; Jin, Yong-Su

2015-01-20

In order to determine beneficial gene deletions for ethanol production by the yeast Saccharomyces cerevisiae, we performed an in silico gene deletion experiment based on a genome-scale metabolic model. Genes coding for two oxidative phosphorylation reactions (cytochrome c oxidase and ubiquinol cytochrome c reductase) were identified by the model-based simulation as potential deletion targets for enhancing ethanol production and maintaining acceptable overall growth rate in oxygen-limited conditions. Since the two target enzymes are composed of multiple subunits, we conducted a genetic screening study to evaluate the in silico results and compare the effect of deleting various portions of the respiratory enzyme complexes. Over two-thirds of the knockout mutants identified by the in silico study did exhibit experimental behavior in qualitative agreement with model predictions, but the exceptions illustrate the limitation of using a purely stoichiometric model-based approach. Furthermore, there was a substantial quantitative variation in phenotype among the various respiration-deficient mutants that were screened in this study, and three genes encoding respiratory enzyme subunits were identified as the best knockout targets for improving hexose fermentation in microaerobic conditions. Specifically, deletion of either COX9 or QCR9 resulted in higher ethanol production rates than the parental strain by 37% and 27%, respectively, with slight growth disadvantages. Also, deletion of QCR6 led to improved ethanol production rate by 24% with no growth disadvantage. The beneficial effects of these gene deletions were consistently demonstrated in different strain backgrounds and with four common hexoses. The combination of stoichiometric modeling and genetic screening using a systematic knockout collection was useful for narrowing a large set of gene targets and identifying targets of interest. Copyright © 2014 Elsevier B.V. All rights reserved.

Genetic subtype differences in neural circuitry of food motivation in Prader-Willi syndrome.

PubMed

Holsen, L M; Zarcone, J R; Chambers, R; Butler, M G; Bittel, D C; Brooks, W M; Thompson, T I; Savage, C R

2009-02-01

Differences in behavioral phenotypes between the two most common subtypes of Prader-Willi syndrome (PWS) (chromosome 15q deletions and maternal uniparental disomy 15 (UPD) indicate that distinct neural networks may be affected. Though both subtypes display hyperphagia, the deletion subgroup shows reduced behavioral inhibition around food, whereas those with UPD are generally more able to maintain cognitive control over food intake impulses. To examine the neural basis of phenotypic differences to better understand relationships between genetic subtypes and behavioral outcomes. We predicted greater food motivation circuitry activity in the deletion subtype and greater activity in higher order cognitive regions in the UPD group, especially after eating. Nine individuals with PWS due to UPD and nine individuals with PWS due to (type 2) deletion, matched for age, gender and body mass index, underwent functional magnetic resonance imaging (fMRI) while viewing food images during two food motivation states: one before (pre-meal) and one after (post-meal) eating a standardized 500 kcal meal. Both PWS subgroups showed greater activity in response to food pre- and post-meal compared with the healthy-weight group. Compared with UPD, the deletion subtype showed increased food motivation network activation both pre- and post-meal, especially in the medial prefrontal cortex (mPFC) and amygdala. In contrast, the UPD group showed greater activation than the deletion subtype post-meal in the dorsolateral prefrontal cortex (DLPFC) and parahippocampal gyrus (PHG). These preliminary findings are the first functional neuroimaging findings to support divergent neural mechanisms associated with behavioral phenotypes in genetic subtypes of PWS. Results are discussed within the framework of genetic mechanisms such as haploinsufficiency and gene dosage effects and their differential influence on deletion and UPD subtypes, respectively.

The mouse lymphoma assay detects recombination, deletion, and aneuploidy.

PubMed

Wang, Jianyong; Sawyer, Jeffrey R; Chen, Ling; Chen, Tao; Honma, Masamitsu; Mei, Nan; Moore, Martha M

2009-05-01

The mouse lymphoma assay (MLA) uses the thymidine kinase (Tk) gene of the L5178Y/Tk(+/-)-3.7.2C mouse lymphoma cell line as a reporter gene to evaluate the mutagenicity of chemical and physical agents. The MLA is recommended by both the United States Food and Drug Administration and the United States Environmental Protection Agency as the preferred in vitro mammalian cell mutation assay for genetic toxicology screening because it detects a wide range of genetic alterations, including both point mutations and chromosomal mutations. However, the specific types of chromosomal mutations that can be detected by the MLA need further clarification. For this purpose, three chemicals, including two clastogens and an aneugen (3'-azido-3'-deoxythymidine, mitomycin C, and taxol), were used to induce Tk mutants. Loss of heterozygosity (LOH) analysis was used to select mutants that could be informative as to whether they resulted from deletion, mitotic recombination, or aneuploidy. A combination of additional methods, G-banding analysis, chromosome painting, and a real-time PCR method to detect the copy number (CN) of the Tk gene was then used to provide a detailed analysis. LOH involving at least 25% of chromosome 11, a normal karyotype, and a Tk CN of 2 would indicate that the mutant resulted from recombination, whereas LOH combined with a karyotypically visible deletion of chromosome 11 and a Tk CN of 1 would indicate a deletion. Aneuploidy was confirmed using G-banding combined with chromosome painting analysis for mutants showing LOH at every microsatellite marker on chromosome 11. From this analysis, it is clear that mouse lymphoma Tk mutants can result from recombination, deletion, and aneuploidy.

Prognostic Implications of Monosomies in Patients With Multiple Myeloma.

PubMed

Shin, Sang-Yong; Eom, Hyeon-Seok; Sohn, Ji Yeon; Lee, Hyewon; Park, Boram; Joo, Jungnam; Jang, Ja-Hyun; Lee, Mi-Na; Kim, Jung Kwon; Kong, Sun-Young

2017-03-01

Cytogenetic analysis aides in risk stratification for patients with multiple myeloma (MM). Although several cytogenetic aberrations have been reported to be prognostic, less is known about the association between the presence of monosomies and prognosis. The present study evaluated the prevalence and prognostic implications of monosomies in patients with MM. Karyotypes were determined using conventional cytogenetics and fluorescence in situ hybridization (FISH). The prognostic effect of monosomies was evaluated by comparison with the clinical factors in MM patients with normal karyotypes. Karyotypes were successfully determined in 167 of the 170 patients with MM. Of these 167 patients, 52 (31.1%) had abnormal karyotypes. Univariable analyses showed that a normal karyotype, hypodiploidy, monosomies of chromosomes 13 and 16, deletion or monosomy of 13q14, and loss of X detected by metaphase analysis were each associated with reduced progression-free survival (P < .05 for each). Univariable analyses showed that a normal karyotype, hypodiploidy, monosomies of chromosomes 13 and 16, deletion or monosomy of 13q14 detected by metaphase analysis and FISH-determined RB1 (13q)/TP53 (17p) deletion were each associated with reduced overall survival (P < .05 for each). Multivariable analysis showed that hypodiploidy detected by metaphase analysis was independently prognostic of shorter progression-free survival (P < .05 for each) and that hypodiploidy, monosomy 16, and loss of Y chromosome and FISH-determined TP53 (17p) deletion were associated with reduced overall survival (P < .05 for each). In addition to known cytogenetic abnormalities, such as monosomy 13, hypodiploidy, and TP53 (17p) deletion, monosomy 16 and loss of the Y chromosome have adverse prognostic implications in patients with MM. Copyright © 2016 Elsevier Inc. All rights reserved.

[Phenotype-genotype correlation analysis of 12 cases with Angelman/Prader-Willi syndrome].

PubMed

Chen, Chen; Peng, Ying; Xia, Yan; Li, Haoxian; Zhu, Huimin; Pan, Qian; Yin, Fei; Wu, Lingqian

2014-12-01

To investigate the genotype-phenotype correlation in patients with Angelman syndrome/Prader-Willi syndrome (AS/PWS) and assess the application value of high-resolution single nucleotide polymorphism microarrays (SNP array) for such diseases. Twelve AS/PWS patients were diagnosed through SNP array, fluorescence in situ hybridization (FISH) and karyotype analysis. Clinical characteristics were analyzed. Deletions ranging from 4.8 Mb to 7.0 Mb on chromosome 15q11.2-13 were detected in 11 patients. Uniparental disomy (UPD) was detected in only 1 patient. Patients with deletions could be divided into 2 groups, including 7 cases with class I and 4 with class II. The two groups however had no significant phenotypic difference. The UPD patient had relatively better development and language ability. Deletions of 6 patients were confirmed by FISH to be of de novo in origin. The risk to their sibs was determined to be less than 1%. The phenotypic differences between AS/PWS patients with class I and class II deletion need to be further studied. SNP array is useful in detecting and distinguishing of patients with deletion or UPD. This method may be applied for studying the genotype-phenotype association and the mechanism underlying AS/PWS.

A novel deletion of SNURF/SNRPN exon 1 in a patient with Prader-Willi-like phenotype.

PubMed

Cao, Yang; AlHumaidi, Susan S; Faqeih, Eissa A; Pitel, Beth A; Lundquist, Patrick; Aypar, Umut

2017-08-01

Here we report the smallest deletion involving SNURF/SNRPN that causes major symptoms of Prader-Willi syndrome (PWS), including hypotonia, dysmorphic features, intellectual disability, and obesity. A female patient with the aforementioned and additional features was referred to the Mayo Clinic Cytogenetics laboratory for genetic testing. Chromosomal microarray analysis and subsequent Sanger sequencing identified a de novo 6.4 kb deletion at 15q11.2, containing exon 1 of the SNURF gene and exon 1 of the shortest isoform of the SNRPN gene. SNURF/SNRPN exon 1, which is methylated on the silent maternal allele, is associated with acetylated histones on the expressed paternal allele. This region also overlaps with the PWS-imprinting center (IC). Subsequent molecular methylation analysis was performed using methylation-specific MLPA (MS-MLPA), which characterized that the deletion of SNURF/SNRPN exon 1 was paternal in origin, consistent with the PWS-like phenotype. Since SNURF/SNRPN gene and the PWS-IC are known to regulate snoRNAs, it is likely that the PWS-like phenotype observed in patients with paternal SNURF/SNRPN deletion is due to the disrupted expression of SNORD116 snoRNAs. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Koivisto, U.M.; Viikari, J.S.; Kontula, K.

Two deletions of the low-density lipoprotein (LDL) receptor gene were previously shown to account for about two thirds of all mutations causing familial hypercholesterolemia (FH) in Finland. We screened the DNA samples from a cohort representing the remaining 30% of Finnish heterozygous FH patients by amplifying all the 18 exons of the receptor gene by PCR and searching for DNA variations with the SSCP technique. Ten novel mutations were identified, comprising two nonsense and seven missense mutations as well as one frameshift mutation caused by a 13-bp deletion. A single nucleotide change, substituting adenine for guanidine at position 2533 andmore » resulting in an amino acid change of glycine to aspartic acid at codon 823, was found in DNA samples from 14 unrelated FH probands. This mutation (FH-Turku) affects the sequence encoding the putative basolateral sorting signal of the LDL receptor protein; however, the exact functional consequences of this mutation are yet to be examined. The FH-Turku gene and another point mutation (Leu380{r_arrow}His or FH-Pori) together account for {approximately}8% of the FH-causing genes in Finland and are particularly common among FH patients from the southwestern part of the country (combined, 30%). Primer-introduced restriction analysis was applied for convenient assay of the FH-Turku and FH-Pori point mutations. In conclusion, this paper demonstrates the unique genetic background of FH in Finland and describes a commonly occurring FH gene with a missense mutation closest to the C terminus thus far reported. 32 refs., 5 figs., 2 tabs.« less

A functional polymorphism of the NFKB1 gene increases the risk for alcoholic liver cirrhosis in patients with alcohol dependence.

PubMed

Marcos, Miguel; Pastor, Isabel; González-Sarmiento, Rogelio; Laso, Francisco Javier

2009-11-01

The genetic basis for the predisposition to alcoholic liver cirrhosis (ALC) remains unknown. Increasing evidence supports a role for the nuclear factor (NF)-kappaB, the NF-kappaB inhibitor alpha (NFKBIA), and the peroxisome proliferator-activated receptor (PPAR)-gamma in the pathogenesis of alcoholic liver disease, raising the possibility that common polymorphisms in genes encoding these molecules may confer susceptibility to ALC. The objective of this study was to analyze the relationship between common polymorphisms in NFKB1, NFKBIA, and PPARG2 genes and the presence of ALC. A total of 258 male alcoholics (161 without liver disease and 97 with ALC) and 101 healthy controls were genotyped for the -94ins/delATTG NFKB1, 3'-UTR+126G>A NFKBIA, and 34C>G PPARG2 polymorphisms. The association of these genetic variants with ALC was tested in alcoholic patients with alcohol abuse and alcohol dependence. A logistic regression analysis was further performed to analyze the model of inheritance. We found an association between the presence of the deletion allele in NFKB1 polymorphism and ALC in patients with alcohol dependence. We found no association between NFKBIA and PPARG2 polymorphisms and the presence of ALC. The deletion allele of the -94ins/del NFKB1 polymorphism could be associated with a higher risk of developing ALC through an increase in inflammation, as supported by previous data.

Genetic landscape of extreme responders with anaplastic oligodendroglioma.

PubMed

Holdhoff, Matthias; Cairncross, Gregory J; Kollmeyer, Thomas M; Zhang, Ming; Zhang, Peixin; Mehta, Minesh P; Werner-Wasik, Maria; Souhami, Luis; Bahary, Jean-Paul; Kwok, Young; Hartford, Alan C; Chakravarti, Arnab; Yegnasubramanian, Srinivasan; Vogelstein, Bert; Papadopoulos, Nickolas; Kinzler, Kenneth; Jenkins, Robert B; Bettegowda, Chetan

2017-05-30

The NRG Oncology RTOG 9402 trial showed significant survival benefit in patients with 1p/19q co-deleted anaplastic oligodendrogliomas (AO) who received both radiation (RT) and chemotherapy (PCV regimen) versus RT alone. Substantial separation of the survival curves was only seen after 7.3 years. We aimed to determine whether there are specific genetic alterations that distinguish co-deleted AO patients who benefit from the addition of PCV from those who do not. We performed whole exome sequencing on matched tumor and normal DNA from all available short-term (STS) and long-term survivors (LTS) who received RT+PCV. hTERT status and rs55705857 genotypes (G-allele) were analyzed in both cohorts. Six STS (survival of <7.3y) and 7 LTS (survival of ≥7.3y and no progression) had sufficient material for analysis. There was no significant difference between the groups regarding age, performance status and extent of resection. On average, STS had 7 and LTS 4 mutations. Most common mutations in STS vs. LTS were: IDH1 (67 vs. 86%), CIC (50 vs. 71%) and FUBP1 (17 vs. 71%). The hTERT promoter was mutated in 83% STS and 86% LTS. Genotyping of rs55705857 showed a higher prevalence of G allele carriers in LTS than STS (43 vs. 17%). These findings confirm that IDH, CIC, FUBP1 mutations and rs55705857 genotype are common in AO. No distinct genetic signature was identified to differentiate STS and LTS.

Homozygous hereditary C3 deficiency due to a partial gene deletion.

PubMed Central

Botto, M; Fong, K Y; So, A K; Barlow, R; Routier, R; Morley, B J; Walport, M J

1992-01-01

The molecular mechanism of C3 deficiency in an Afrikaans patient with recurrent pyogenic infections was studied. Restriction enzyme analysis showed a gene deletion of 800 base pairs (bp) mapping to the alpha chain of C3. Amplification of genomic DNA, using the PCR, demonstrated that the deletion included exons 22 and 23 of the C3 gene. Truncated mRNA was shown in an Epstein-Barr virus-transformed B-cell line by PCR amplification of first-strand cDNA. A consequence of this deletion was that the RNA transcribed 3' to the deletion was out of frame, resulting in formation of a stop codon 19 bp downstream from the deletion. The molecular basis of the deletion was compatible with homologous recombination between two Alu sequences located in introns 21 and 23. An unrelated nonconsanguineous relative and two of a sample of 174 Afrikaans-speaking individuals were heterozygous carriers of the same gene deletion. The wide prevalence of this null allele in this population is probably due to the effects of a small founder population. The presence of this deletion in the C3 gene is not compatible with production of any functional C3, supporting the idea that study of such patients offers a valid model for understanding physiological activities of C3 in vivo in humans. Images PMID:1350678

Epidermal growth factor receptor mutations in adenocarcinoma in situ and minimally invasive adenocarcinoma detected using mutation-specific monoclonal antibodies.

PubMed

Nakamura, Haruhiko; Koizumi, Hirotaka; Kimura, Hiroyuki; Marushima, Hideki; Saji, Hisashi; Takagi, Masayuki

2016-09-01

Epidermal growth factor receptor (EGFR) mutation rates in adenocarcinoma in situ (AIS) and minimally invasive adenocarcinoma (MIA) were studied using both DNA analysis and mutation-specific immunohistochemistry. The peptide nucleic acid-locked nucleic acid polymerase chain reaction clamp method was used to detect mutations in exons 18, 19, 20, and 21 of the EGFR gene in DNA samples extracted from paraffin-embedded tissue sections. Simultaneously, immunohistochemical analysis with two EGFR mutation-specific monoclonal antibodies was used to identify proteins resulting from an in-frame deletion in exon 19 (E746_A750del) and a point mutation replacing leucine with arginine at codon 858 of exon 21 (L858R). Forty-three tumors (22 AIS and 21 MIA) were examined. The EGFR mutation rate in AIS detected by DNA analysis was 27.3% (L858R, 5/22; exon 19 deletion,1/22), whereas that detected in MIA was 42.9% (L858R,4/21; exon 19 deletion,5/21). Mutations detected by immunohistochemical analysis included 22.7% (L858R, 4/22; exon 19 deletion, 1/22) in AIS and 42.9% (L858R, 4/21; exon 19 deletion, 5/21) in MIA. Although some results were contradictory, concordant results were obtained using both assays in 38 of 43 cases (88.4%). DNA and immunohistochemical analyses revealed similar EGFR mutation rates in both MIA and AIS, suggesting that mutation-specific monoclonal antibodies are useful to confirm DNA assay results. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

DNA Sequences Proximal to Human Mitochondrial DNA Deletion Breakpoints Prevalent in Human Disease Form G-quadruplexes, a Class of DNA Structures Inefficiently Unwound by the Mitochondrial Replicative Twinkle Helicase*

PubMed Central

Bharti, Sanjay Kumar; Sommers, Joshua A.; Zhou, Jun; Kaplan, Daniel L.; Spelbrink, Johannes N.; Mergny, Jean-Louis; Brosh, Robert M.

2014-01-01

Mitochondrial DNA deletions are prominent in human genetic disorders, cancer, and aging. It is thought that stalling of the mitochondrial replication machinery during DNA synthesis is a prominent source of mitochondrial genome instability; however, the precise molecular determinants of defective mitochondrial replication are not well understood. In this work, we performed a computational analysis of the human mitochondrial genome using the “Pattern Finder” G-quadruplex (G4) predictor algorithm to assess whether G4-forming sequences reside in close proximity (within 20 base pairs) to known mitochondrial DNA deletion breakpoints. We then used this information to map G4P sequences with deletions characteristic of representative mitochondrial genetic disorders and also those identified in various cancers and aging. Circular dichroism and UV spectral analysis demonstrated that mitochondrial G-rich sequences near deletion breakpoints prevalent in human disease form G-quadruplex DNA structures. A biochemical analysis of purified recombinant human Twinkle protein (gene product of c10orf2) showed that the mitochondrial replicative helicase inefficiently unwinds well characterized intermolecular and intramolecular G-quadruplex DNA substrates, as well as a unimolecular G4 substrate derived from a mitochondrial sequence that nests a deletion breakpoint described in human renal cell carcinoma. Although G4 has been implicated in the initiation of mitochondrial DNA replication, our current findings suggest that mitochondrial G-quadruplexes are also likely to be a source of instability for the mitochondrial genome by perturbing the normal progression of the mitochondrial replication machinery, including DNA unwinding by Twinkle helicase. PMID:25193669

Partial AZFc duplications not deletions are associated with male infertility in the Yi population of Yunnan Province, China.

PubMed

Ye, Jun-jie; Ma, Li; Yang, Li-juan; Wang, Jin-huan; Wang, Yue-li; Guo, Hai; Gong, Ning; Nie, Wen-hui; Zhao, Shu-hua

2013-09-01

There are many reports on associations between spermatogenesis and partial azoospermia factor c (AZFc) deletions as well as duplications; however, results are conflicting, possibly due to differences in methodology and ethnic background. The purpose of this study is to investigate the association of AZFc polymorphisms and male infertility in the Yi ethnic population, residents within Yunnan Province, China. A total of 224 infertile patients and 153 fertile subjects were selected in the Yi ethnic population. The study was performed by sequence-tagged site plus/minus (STS+/-) analysis followed by gene dosage and gene copy definition analysis. Y haplotypes of 215 cases and 115 controls were defined by 12 binary markers using single nucleotide polymorphism on Y chromosome (Y-SNP) multiplex assays based on single base primer extension technology. The distribution of Y haplotypes was not significantly different between the case and control groups. The frequencies of both gr/gr (7.6% vs. 8.5%) and b2/b3 (6.3% vs. 8.5%) deletions do not show significant differences. Similarly, single nucleotide variant (SNV) analysis shows no significant difference of gene copy definition between the cases and controls. However, the frequency of partial duplications in the infertile group (4.0%) is significantly higher than that in the control group (0.7%). Further, we found a case with sY1206 deletion which had two CDY1 copies but removed half of DAZ genes. Our results show that male infertility is associated with partial AZFc duplications, but neither gr/gr nor b2/b3 deletions, suggesting that partial AZFc duplications rather than deletions are risk factors for male infertility in Chinese-Yi population.

Genetic Relatedness of Clostridium difficile Isolates from Various Origins Determined by Triple-Locus Sequence Analysis Based on Toxin Regulatory Genes tcdC, tcdR, and cdtR▿

PubMed Central

Bouvet, Philippe J. M.; Popoff, Michel R.

2008-01-01

A triple-locus nucleotide sequence analysis based on toxin regulatory genes tcdC, tcdR and cdtR was initiated to assess the sequence variability of these genes among Clostridium difficile isolates and to study the genetic relatedness between isolates. A preliminary investigation of the variability of the tcdC gene was done with 57 clinical and veterinary isolates. Twenty-three isolates representing nine main clusters were selected for tcdC, tcdR, and cdtR analysis. The numbers of alleles found for tcdC, tcdR and cdtR were nine, six, and five, respectively. All strains possessed the cdtR gene except toxin A-negative toxin B-positive variants. All but one binary toxin CDT-positive isolate harbored a deletion (>1 bp) in the tcdC gene. The combined analyses of the three genes allowed us to distinguish five lineages correlated with the different types of deletion in tcdC, i.e., 18 bp (associated or not with a deletion at position 117), 36 bp, 39 bp, and 54 bp, and with the wild-type tcdC (no deletion). The tcdR and tcdC genes, though located within the same pathogenicity locus, were found to have evolved separately. Coevolution of the three genes was noted only with strains harboring a 39-bp or a 54-bp deletion in tcdC that formed two homogeneous, separate divergent clusters. Our study supported the existence of the known clones (PCR ribotype 027 isolates and toxin A-negative toxin B-positive C. difficile variants) and evidence for clonality of isolates with a 39-bp deletion (toxinotype V, PCR ribotype 078) that are frequently isolated worldwide from human infections and from food animals. PMID:18832125

HbA2 levels in β-thalassaemia carriers with the Filipino β0-deletion: are the levels higher than what is found with non-deletional forms of β0-thalassaemia?

PubMed

George, E; Teh, Lai Kuan; Tan, Jama; Lai, Mei I; Wong, Lily

2013-01-01

Classical carriers of β-thalassaemia are identified by a raised HbA2 level. Earlier studies indicated that the Filipino β-deletion has high raised HbA2 levels. The introduction of automated high performance liquid chromatography (HPLC) for thalassaemia screening is an important advance in technology for haematology laboratories. The BioRad Variant II Hb analyser is a common instrument used to quantify HbA2 levels in thalassaemia screening. This study aimed to determine HbA2 levels in carriers of Filipino β-mutation using the BioRad Variant II Hb analyser. The Filipino β-deletion was identified using gap-polymerase chain reaction (PCR) in the parents of transfusion dependent β-thalassaemia patients who were homozygous for the Filipino β-deletion in the indigenous population of Sabah, Malaysia. Hb subtypes were quantified on the BioRad Variant II Hb analyser. Concurrent α-thalassaemia was identified by multiplex gap-PCR for deletions and amplification refractory mutation system (ARMS)-PCR for non-deletional mutations. The mean HbA2 level for Filipino β-thalassaemia trait was 5.9 ± 0.47 and with coinheritance of α-thalassaemia was 6.3 ± 0.44 (-α heterozygous) and 6.7 ± 0.36 (-α homozygous). The HbA2 levels were all >4% in keeping with the findings of classical β-thalassaemia trait and significantly higher than levels seen in non-deletional forms of β-thalassaemia. The HbA2 level measured on the BioRad Variant II Hb analyser was lower than the level in the first description of the Filipino β-thalassaemia. β-thalassaemia trait with coinheritance of α-thalassaemia (-α) is associated with significantly higher HbA2 level.

A familial {open_quotes}balanced{close_quotes} 3;9 translocation with cryptic 8q insertion leading to deletion and duplication of 9p23 loci in siblings

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wagstaff, J.; Hemann, M.

1995-01-01

A child with phenotypic features of the 9p{sup {minus}} syndrome, including metopic craniosynostosis, small ears, abdominal wall defect, and mental retardation, as well as hypopigmentation, was found to have a cytogenetically balanced 3;9 translocation, with breakpoints at 3p11 and 9p23, inherited from his phenotypically normal father. Molecular analysis showed heterozygous deletion of the TYRP (tyrosinase-related protein) locus, as well as loci D9S157, D9S274, D9S268, and D9S267, in the child but in neither parent. FISH analysis of the proband`s father indicated that loci deleted in his son, including TYRP, were present on neither the der(3) nor the der(9) translocation products butmore » had been inserted into the long arm of chromosome 8. Therefore, the apparent deletion of these loci in the proband was the result of meiotic segregation of the father`s 3;9 translocation chromosomes together with his normal chromosome 8 (not bearing the insertion from 9p23). Neither the deletion of these 9p23 loci from the translocation chromosomes nor their insertion into 8q was detectable by standard chromosome banding techniques. The proband`s sister exhibited speech delay, mild facial dysmorphism, and renal malformation, and her karyotype was 46,XX. Molecular analysis showed that she had inherited normal chromosomes 3 and 9, as well as the chromosome 8 with the insertion of 9p23 material, from her father. This analysis illustrates a new mechanism to explain cases in which an apparently balanced translocation has been transmitted from a normal parent to a child with a phenotypic abnormality: submicroscopic deletion of material from the translocation breakpoint and insertion into a third chromosome in the balanced parent, with meiotic segregation leading to loss of the inserted material in the child. 36 refs., 9 figs., 1 tab.« less

Functional correction of dystrophin actin binding domain mutations by genome editing

PubMed Central

Kyrychenko, Viktoriia; Kyrychenko, Sergii; Tiburcy, Malte; Shelton, John M.; Long, Chengzu; Schneider, Jay W.; Zimmermann, Wolfram-Hubertus; Bassel-Duby, Rhonda

2017-01-01

Dystrophin maintains the integrity of striated muscles by linking the actin cytoskeleton with the cell membrane. Duchenne muscular dystrophy (DMD) is caused by mutations in the dystrophin gene (DMD) that result in progressive, debilitating muscle weakness, cardiomyopathy, and a shortened lifespan. Mutations of dystrophin that disrupt the amino-terminal actin-binding domain 1 (ABD-1), encoded by exons 2–8, represent the second-most common cause of DMD. In the present study, we compared three different strategies for CRISPR/Cas9 genome editing to correct mutations in the ABD-1 region of the DMD gene by deleting exons 3–9, 6–9, or 7–11 in human induced pluripotent stem cells (iPSCs) and by assessing the function of iPSC-derived cardiomyocytes. All three exon deletion strategies enabled the expression of truncated dystrophin protein and restoration of cardiomyocyte contractility and calcium transients to varying degrees. We show that deletion of exons 3–9 by genomic editing provides an especially effective means of correcting disease-causing ABD-1 mutations. These findings represent an important step toward eventual correction of common DMD mutations and provide a means of rapidly assessing the expression and function of internally truncated forms of dystrophin-lacking portions of ABD-1. PMID:28931764

Retrospective assessment of the most common mitochondrial DNA mutations in a large Hungarian cohort of suspect mitochondrial cases.

PubMed

Remenyi, Viktoria; Inczedy-Farkas, Gabriella; Komlosi, Katalin; Horvath, Rita; Maasz, Anita; Janicsek, Ingrid; Pentelenyi, Klara; Gal, Aniko; Karcagi, Veronika; Melegh, Bela; Molnar, Maria Judit

2015-08-01

Prevalence estimations for mitochondrial disorders still vary widely and only few epidemiologic studies have been carried out so far. With the present work we aim to give a comprehensive overview about frequencies of the most common mitochondrial mutations in Hungarian patients. A total of 1328 patients were tested between 1999 and 2012. Among them, 882 were screened for the m.3243A > G, m.8344A > G, m.8993T > C/G mutations and deletions, 446 for LHON primary mutations. The mutation frequency in our cohort was 2.61% for the m.3243A > G, 1.47% for the m.8344A > G, 17.94% for Leber's Hereditary Optic Neuropathy (m.3460G > A, m.11778G > A, m.14484T > C) and 0.45% for the m.8993T > C/G substitutions. Single mtDNA deletions were detected in 14.97%, while multiple deletions in 6.01% of the cases. The mutation frequency in Hungarian patients suggestive of mitochondrial disease was similar to other Caucasian populations. Further retrospective studies of different populations are needed in order to accurately assess the importance of mitochondrial diseases and manage these patients.

In vivo DNA deletion assay to detect environmental and genetic predisposition to cancer.

PubMed

Reliene, Ramune; Bishop, Alexander J R; Aubrecht, Jiri; Schiestl, Robert H

2004-01-01

Large-scale genomic rearrangements such as DNA deletions play a role in the etiology of cancer. The frequency of DNA deletions can be elevated by exposure to carcinogens or by mutations in genes involved in the maintenance of genomic integrity. The in vivo DNA deletion assay allows a visual detection of deletion events within the pink-eyed unstable (pun) locus in developing mouse embryos. A deletion of one copy of a duplicated 70-kb DNA fragment within the pun locus restores the pink-eyed dilute (p) gene, which encodes a protein responsible for the assembly of a black color melanin complex. Deletion events occurring in premelanocytes cause visible black patches (fur-spots) on the light gray fur of offspring and black pigmented cells (eye-spots) on the unpigmented retinal pigment epithelium (RPE). In the fur-spot assay, 10-d-old pups are observed for black spots on the fur. In the eye-spot assay, mice are sacrificed at d 20, eyes are removed, and the wholemount RPE slides are prepared for eye-spot analysis. The frequency, size, and position relative to the optic nerve of the eye-spots are determined. This assay can be used to study the effect of environmental chemicals and physical agents as well as the genetic control of DNA deletions in vivo.

Mutation analysis of the MECP2 gene in patients of Slavic origin with Rett syndrome: novel mutations and polymorphisms.

PubMed

Zahorakova, Daniela; Rosipal, Robert; Hadac, Jan; Zumrova, Alena; Bzduch, Vladimir; Misovicova, Nadezda; Baxova, Alice; Zeman, Jiri; Martasek, Pavel

2007-01-01

Rett syndrome (RTT), an X-linked dominant neurodevelopmental disorder in females, is caused mainly by de novo mutations in the methyl-CpG-binding protein 2 gene (MECP2). Here we report mutation analysis of the MECP2 gene in 87 patients with RTT from the Czech and Slovak Republics, and Ukraine. The patients, all girls, with classical RTT were investigated for mutations using bi-directional DNA sequencing and conformation sensitive gel electrophoresis analysis of the coding sequence and exon/intron boundaries of the MECP2 gene. Restriction fragment length polymorphism analysis was performed to confirm the mutations that cause the creation or abolition of the restriction site. Mutation-negative cases were subsequently examined by multiple ligation-dependent probe amplification (MLPA) to identify large deletions. Mutation screening revealed 31 different mutations in 68 patients and 12 non-pathogenic polymorphisms. Six mutations have not been previously published: two point mutations (323T>A, 904C>T), three deletions (189_190delGA, 816_832del17, 1069delAGC) and one deletion/inversion (1063_1236del174;1189_1231inv43). MLPA analysis revealed large deletions in two patients. The detection rate was 78.16%. Our results confirm the high frequency of MECP2 mutations in females with RTT and provide data concerning the mutation heterogeneity in the Slavic population.

Common Variable Immunodeficiency Caused by FANC Mutations.

PubMed

Sekinaka, Yujin; Mitsuiki, Noriko; Imai, Kohsuke; Yabe, Miharu; Yabe, Hiromasa; Mitsui-Sekinaka, Kanako; Honma, Kenichi; Takagi, Masatoshi; Arai, Ayako; Yoshida, Kenichi; Okuno, Yusuke; Shiraishi, Yuichi; Chiba, Kenichi; Tanaka, Hiroko; Miyano, Satoru; Muramatsu, Hideki; Kojima, Seiji; Hira, Asuka; Takata, Minoru; Ohara, Osamu; Ogawa, Seishi; Morio, Tomohiro; Nonoyama, Shigeaki

2017-07-01

Common variable immunodeficiency (CVID) is the most common adult-onset primary antibody deficiency disease due to various causative genes. Several genes, which are known to be the cause of different diseases, have recently been reported as the cause of CVID in patients by performing whole exome sequencing (WES) analysis. Here, we found FANC gene mutations as a cause of adult-onset CVID in two patients. B cells were absent and CD4 + T cells were skewed toward CD45RO + memory T cells. T-cell receptor excision circles (TRECs) and signal joint kappa-deleting recombination excision circles (sjKRECs) were undetectable in both patients. Both patients had no anemia, neutropenia, or thrombocytopenia. Using WES, we identified compound heterozygous mutations of FANCE in one patient and homozygous mutation of FANCA in another patient. The impaired function of FANC protein complex was confirmed by a monoubiquitination assay and by chromosome fragility test. We then performed several immunological evaluations including quantitative lymphocyte analysis and TRECs/sjKRECs analysis for 32 individuals with Fanconi anemia (FA). In total, 22 FA patients (68.8%) were found to have immunological abnormalities, suggesting that such immunological findings may be common in FA patients. These data indicate that FANC mutations are involved in impaired lymphogenesis probably by the accumulation of DNA replication stress, leading to CVID. It is important to diagnose FA because it drastically changes clinical management. We propose that FANC mutations can cause isolated immunodeficiency in addition to bone marrow failure and malignancy.

A comprehensive analysis of replicative lifespan in 4,698 single-gene deletion strains uncovers conserved mechanisms of aging

PubMed Central

McCormick, Mark A.; Delaney, Joe R.; Tsuchiya, Mitsuhiro; Tsuchiyama, Scott; Shemorry, Anna; Sim, Sylvia; Chou, Annie Chia-Zong; Ahmed, Umema; Carr, Daniel; Murakami, Christopher J.; Schleit, Jennifer; Sutphin, George L.; Wasko, Brian M.; Bennett, Christopher F.; Wang, Adrienne M.; Olsen, Brady; Beyer, Richard P.; Bammler, Theodor K.; Prunkard, Donna; Johnson, Simon C.; Pennypacker, Juniper K.; An, Elroy; Anies, Arieanna; Castanza, Anthony S.; Choi, Eunice; Dang, Nick; Enerio, Shiena; Fletcher, Marissa; Fox, Lindsay; Goswami, Sarani; Higgins, Sean A.; Holmberg, Molly A.; Hu, Di; Hui, Jessica; Jelic, Monika; Jeong, Ki-Soo; Johnston, Elijah; Kerr, Emily O.; Kim, Jin; Kim, Diana; Kirkland, Katie; Klum, Shannon; Kotireddy, Soumya; Liao, Eric; Lim, Michael; Lin, Michael S.; Lo, Winston C.; Lockshon, Dan; Miller, Hillary A.; Moller, Richard M.; Muller, Brian; Oakes, Jonathan; Pak, Diana N.; Peng, Zhao Jun; Pham, Kim M.; Pollard, Tom G.; Pradeep, Prarthana; Pruett, Dillon; Rai, Dilreet; Robison, Brett; Rodriguez, Ariana A.; Ros, Bopharoth; Sage, Michael; Singh, Manpreet K.; Smith, Erica D.; Snead, Katie; Solanky, Amrita; Spector, Benjamin L.; Steffen, Kristan K.; Tchao, Bie Nga; Ting, Marc K.; Wende, Helen Vander; Wang, Dennis; Welton, K. Linnea; Westman, Eric A.; Brem, Rachel B.; Liu, Xin-guang; Suh, Yousin; Zhou, Zhongjun; Kaeberlein, Matt; Kennedy, Brian K.

2015-01-01

SUMMARY Many genes that affect replicative lifespan (RLS) in the budding yeast Saccharomyces cerevisiae also affect aging in other organisms such as C. elegans and M. musculus. We performed a systematic analysis of yeast RLS in a set of 4,698 viable single-gene deletion strains. Multiple functional gene clusters were identified, and full genome-to-genome comparison demonstrated a significant conservation in longevity pathways between yeast and C. elegans. Among the mechanisms of aging identified, deletion of tRNA exporter LOS1 robustly extended lifespan. Dietary restriction (DR) and inhibition of mechanistic Target of Rapamycin (mTOR) exclude Los1 from the nucleus in a Rad53-dependent manner. Moreover, lifespan extension from deletion of LOS1 is non-additive with DR or mTOR inhibition, and results in Gcn4 transcription factor activation. Thus, the DNA damage response and mTOR converge on Los1-mediated nuclear tRNA export to regulate Gcn4 activity and aging. PMID:26456335

Novel germline SDHD deletion associated with an unusual sympathetic head and neck paraganglioma.

PubMed

Cadiñanos, Juan; Llorente, José L; de la Rosa, Jorge; Villameytide, José A; Illán, Rafael; Durán, Noelia S; Murias, Eduardo; Cabanillas, Rubén

2011-08-01

Paragangliomas (PGLs) are rare tumors arising either from sympathetic or parasympathetic-associated chromaffin tissue. PGLs can occur either sporadically or as part of a hereditary syndrome. Sympathetic head and neck PGLs are extremely rare tumors and only a few cases have been reported to date. We report the pedigree of a patient with a head and neck PGL arising from the right sympathetic trunk. SDHD mutation analysis was performed using standard sequencing, multiplex ligation-dependent probe amplification, chromosome 11-specific comparative genome hybridization, and long-range/short-range polymerase chain reaction (PCR) approaches. A previously unreported chromosome 11q deletion encompassing 5 annotated genes (SDHD, DLAT, PIH1D2, C11Orf57, and TIMM8B) was detected in the proband. PGL families considered "mutation-negative" may be attributable to large gene deletions not detectable by standard sequencing methods. Therefore, deletion analysis should be offered to families or individuals at risk for hereditary PGLs. Copyright © 2010 Wiley Periodicals, Inc.

Novel SNP array analysis and exome sequencing detect a homozygous exon 7 deletion of MEGF10 causing early onset myopathy, areflexia, respiratory distress and dysphagia (EMARDD)

PubMed Central

Pierson, Tyler Mark; Markello, Thomas; Accardi, John; Wolfe, Lynne; Adams, David; Sincan, Murat; Tarazi, Noor M.; Fajardo, Karin Fuentes; Cherukuri, Praveen F.; Bajraktari, Ilda; Meilleur, Katy G.; Donkervoort, Sandra; Jain, Mina; Hu, Ying; Lehky, Tanya J.; Cruz, Pedro; Mullikin, James C.; Bonnemann, Carsten; Gahl, William A.; Boerkoel, Cornelius F.; Tifft, Cynthia J.

2013-01-01

Early-onset myopathy, areflexia, respiratory distress and dysphagia (EMARDD) is a myopathic disorder associated with mutations in MEGF10. By novel analysis of SNP array hybridization and exome sequence coverage, we diagnosed a 10-year old girl with EMARDD following identification of a novel homozygous deletion of exon 7 in MEGF10. In contrast to previously reported EMARDD patients, her weakness was more prominent proximally than distally, and involved her legs more than her arms. MRI of her pelvis and thighs showed muscle atrophy and fatty replacement. Ultrasound of several muscle groups revealed dense homogenous increases in echogenicity. Cloning and sequencing of the deletion breakpoint identified features suggesting the mutation arose by fork stalling and template switching. These findings constitute the first genomic deletion causing EMARDD, expand the clinical phenotype, and provide new insight into the pattern and histology of its muscular pathology. PMID:23453856

Association Between Early-Onset Parkinson Disease and 22q11.2 Deletion Syndrome

PubMed Central

Butcher, Nancy J.; Kiehl, Tim-Rasmus; Hazrati, Lili-Naz; Chow, Eva W. C.; Rogaeva, Ekaterina; Lang, Anthony E.; Bassett, Anne S.

2015-01-01

IMPORTANCE Clinical case reports of parkinsonism co-occurring with hemizygous 22q11.2 deletions and the associated multisystem syndrome, 22q11.2 deletion syndrome (22q11.2DS), suggest that 22q11.2 deletions may lead to increased risk of early-onset Parkinson disease (PD). The frequency of PD and its neuropathological presentation remain unknown in this common genetic condition. OBJECTIVE To evaluate a possible association between 22q11.2 deletions and PD. DESIGN, SETTING, AND PARTICIPANTS An observational study of the occurrence of PD in the world’s largest cohort of well-characterized adults with a molecularly confirmed diagnosis of 22q11.2DS (n = 159 [6 with postmortem tissue]; age range, 18.1–68.6 years) was conducted in Toronto, Ontario, Canada. Rare postmortem brain tissue from individuals with 22q11.2DS and a clinical history of PD was investigated for neurodegenerative changes and compared with that from individuals with no history of a movement disorder. MAIN OUTCOMES AND MEASURES A clinical diagnosis of PD made by a neurologist and neuropathological features of PD. RESULTS Adults with 22q11.2DS had a significantly elevated occurrence of PD compared with standard population estimates (standardized morbidity ratio = 69.7; 95% CI, 19.0–178.5). All cases showed early onset and typical PD symptom pattern, treatment response, and course. All were negative for family history of PD and known pathogenic PD-related mutations. The common use of antipsychotics in patients with 22q11.2DS to manage associated psychiatric symptoms delayed diagnosis of PD by up to 10 years. Postmortem brain tissue revealed classic loss of midbrain dopaminergic neurons in all 3 postmortem 22q11.2DS-PD cases. Typical α-synuclein–positive Lewy bodies were present in the expected distribution in 2 cases but absent in another. CONCLUSIONS AND RELEVANCE These findings suggest that 22q11.2 deletions represent a novel genetic risk factor for early-onset PD with variable neuropathological presentation reminiscent of LRRK2-associated PD neuropathology. Individuals with early-onset PD and classic features of 22q11.2DS should be considered for genetic testing, and those with a known 22q11.2 deletion should be monitored for the development of parkinsonian symptoms. Molecular studies of the implicated genes, including DGCR8, may help shed light on the underlying pathophysiology of PD in 22q11.2DS and idiopathic PD. PMID:24018986

Periventricular heterotopia in a boy with interstitial deletion of chromosome 4p.

PubMed

Gawlik-Kuklinska, Katarzyna; Wierzba, Jolanta; Wozniak, Agnieszka; Iliszko, Mariola; Debiec-Rychter, Maria; Dubaniewicz-Wybieralska, Miroslawa; Limon, Janusz

2008-01-01

We report on a 4-year-old boy with a proximal interstitial deletion in the short arm of chromosome 4p with the karyotype 46,XY,del(4)(p14p15.32),inv(9)(p13q13). For a precise delineation of the deleted region, an array-based comparative genomic hybridization (a-CGH) analysis was performed. The proband's phenotype and cytogenetic findings are compared with previously reported cases with proximal 4p deletion syndrome. The syndrome is associated with normal growth, varying degrees of mental retardation, characteristic facial appearance and minor dysmorphic features. Additionally, our patient developed a seizure disorder due to abnormal neuronal migration, i.e., periventricular heterotopia.

Product analysis illuminates the final steps of IES deletion in Tetrahymena thermophila

PubMed Central

Saveliev, Sergei V.; Cox, Michael M.

2001-01-01

DNA sequences (IES elements) eliminated from the developing macronucleus in the ciliate Tetrahymena thermophila are released as linear fragments, which have now been detected and isolated. A PCR-mediated examination of fragment end structures reveals three types of strand scission events, reflecting three steps in the deletion process. New evidence is provided for two steps proposed previously: an initiating double-stranded cleavage, and strand transfer to create a branched deletion intermediate. The fragment ends provide evidence for a previously uncharacterized third step: the branched DNA strand is cleaved at one of several defined sites located within 15–16 nucleotides of the IES boundary, liberating the deleted DNA in a linear form. PMID:11406601

Product analysis illuminates the final steps of IES deletion in Tetrahymena thermophila.

PubMed

Saveliev, S V; Cox, M M

2001-06-15

DNA sequences (IES elements) eliminated from the developing macronucleus in the ciliate Tetrahymena thermophila are released as linear fragments, which have now been detected and isolated. A PCR-mediated examination of fragment end structures reveals three types of strand scission events, reflecting three steps in the deletion process. New evidence is provided for two steps proposed previously: an initiating double-stranded cleavage, and strand transfer to create a branched deletion intermediate. The fragment ends provide evidence for a previously uncharacterized third step: the branched DNA strand is cleaved at one of several defined sites located within 15-16 nucleotides of the IES boundary, liberating the deleted DNA in a linear form.

Interrupted Aortic Arch Type B in A Patient with Cat Eye Syndrome

PubMed Central

Belangero, Sintia Iole Nogueira; Bellucco, Fernanda Teixeira da Silva; Cernach, Mirlene C. S. P.; Hacker, April M.; Emanuel, Beverly S.; Melaragno, Maria Isabel

2010-01-01

We report a patient with cat eye syndrome and interrupted aortic arch type B, a typical finding in the 22q11.2 deletion syndrome. Chromosomal analysis and fluorescent in situ hybridization (FISH) showed a supernumerary bisatellited isodicentric marker chromosome derived from chromosome 22. The segment from 22pter to 22q11.2 in the supernumerary chromosome found in our patient does not overlap with the region deleted in patients with the 22q11.2 deletion syndrome. However, the finding of an interrupted aortic arch type B is unusual in CES, although it is a frequent heart defect in the 22q11 deletion syndrome. PMID:19629279

Infantile ictal apneas in a child with williams-beuren syndrome.

PubMed

Myers, Kenneth A; McLeod, D Ross; Bello-Espinosa, Luis

2013-02-01

Williams-Beuren syndrome is a genetic disorder rarely associated with seizures. The few described cases of Williams-Beuren syndrome and epilepsy have primarily involved infantile spasms and deletions extending beyond the common deletion region for this disorder. We present the case of a 5-week-old child with ictal apneas and typical Williams-Beuren syndrome deletion. Diagnosis was challenging, because the child had cardiac, respiratory, and gastrointestinal abnormalities typically associated with Williams-Beuren syndrome, which are also associated with cyanotic episodes. The results of interictal electroencephalography were normal, illustrating that prolonged electroencephalography is often essential in evaluation of suspected ictal apneas. Seizure freedom was achieved with carbamazepine. Sudden death is seen in Williams-Beuren syndrome, and this case raises the question whether some of these cases may be related to ictal apneas and could potentially be preventable with appropriate pharmaceutical intervention. Copyright © 2013 Elsevier Inc. All rights reserved.

Deletion and aberrant CpG island methylation of Caspase 8 gene in medulloblastoma.

PubMed

Gonzalez-Gomez, Pilar; Bello, M Josefa; Inda, M Mar; Alonso, M Eva; Arjona, Dolores; Amiñoso, Cinthia; Lopez-Marin, Isabel; de Campos, Jose M; Sarasa, Jose L; Castresana, Javier S; Rey, Juan A

2004-09-01

Aberrant methylation of promoter CpG islands in human genes is an alternative genetic inactivation mechanism that contributes to the development of human tumors. Nevertheless, few studies have analyzed methylation in medulloblastomas. We determined the frequency of aberrant CpG island methylation for Caspase 8 (CASP8) in a group of 24 medulloblastomas arising in 8 adult and 16 pediatric patients. Complete methylation of CASP8 was found in 15 tumors (62%) and one case displayed hemimethylation. Three samples amplified neither of the two primer sets for methylated or unmethylated alleles, suggesting that genomic deletion occurred in the 5' flanking region of CASP8. Our findings suggest that methylation commonly contributes to CASP8 silencing in medulloblastomas and that homozygous deletion or severe sequence changes involving the promoter region may be another mechanism leading to CASP8 inactivation in this neoplasm.

Comparative analysis of the Hrp pathogenicity island of Rubus- and Spiraeoideae-infecting Erwinia amylovora strains identifies the IT region as a remnant of an integrative conjugative element.

PubMed

Mann, Rachel A; Blom, Jochen; Bühlmann, Andreas; Plummer, Kim M; Beer, Steven V; Luck, Joanne E; Goesmann, Alexander; Frey, Jürg E; Rodoni, Brendan C; Duffy, Brion; Smits, Theo H M

2012-08-01

The Hrp pathogenicity island (hrpPAI) of Erwinia amylovora not only encodes a type III secretion system (T3SS) and other genes required for pathogenesis on host plants, but also includes the so-called island transfer (IT) region, a region that originates from an integrative conjugative element (ICE). Comparative genomic analysis of the IT regions of two Spiraeoideae- and three Rubus-infecting strains revealed that the regions in Spiraeoideae-infecting strains were syntenic and highly conserved in length and genetic information, but that the IT regions of the Rubus-infecting strains varied in gene content and length, showing a mosaic structure. None of the ICEs in E. amylovora strains were complete, as conserved ICE genes and the left border were missing, probably due to reductive genome evolution. Comparison of the hrpPAI region of E. amylovora strains to syntenic regions from other Erwinia spp. indicates that the hrpPAI and the IT regions are the result of several insertion and deletion events that have occurred within the ICE. It also suggests that the T3SS was present in a common ancestor of the pathoadapted Erwinia spp. and that insertion and deletion events in the IT region occurred during speciation. Copyright © 2012 Elsevier B.V. All rights reserved.

Development and validation of a SYBR Green I-based real-time polymerase chain reaction method for detection of haptoglobin gene deletion in clinical materials.

PubMed

Soejima, Mikiko; Tsuchiya, Yuji; Egashira, Kouichi; Kawano, Hiroyuki; Sagawa, Kimitaka; Koda, Yoshiro

2010-06-01

Anhaptoglobinemic patients run the risk of severe anaphylactic transfusion reaction because they produce serum haptoglobin (Hp) antibodies. Being homozygous for the Hp gene deletion (HP(del)) is the only known cause of congenital anhaptoglobinemia, and clinical diagnosis of HP(del) before transfusion is important to prevent anaphylactic shock. We recently developed a 5'-nuclease (TaqMan) real-time polymerase chain reaction (PCR) method. A SYBR Green I-based duplex real-time PCR assay using two forward primers and a common reverse primer followed by melting curve analysis was developed to determine HP(del) zygosity in a single tube. In addition, to obviate initial DNA extraction, we examined serially diluted blood samples as PCR templates. Allelic discrimination of HP(del) yielded optimal results at blood sample dilutions of 1:64 to 1:1024. The results from 2231 blood samples were fully concordant with those obtained by the TaqMan-based real-time PCR method. The detection rate of the HP(del) allele by the SYBR Green I-based method is comparable with that using the TaqMan-based method. This method is readily applicable due to its low initial cost and analyzability using economical real-time PCR machines and is suitable for high-throughput analysis as an alternative method for allelic discrimination of HP(del).

Genetic features of Mycobacterium tuberculosis modern Beijing sublineage

PubMed Central

Liu, Qingyun; Luo, Tao; Dong, Xinran; Sun, Gang; Liu, Zhu; Gan, Mingyun; Wu, Jie; Shen, Xin; Gao, Qian

2016-01-01

Mycobacterium tuberculosis (MTB) Beijing strains have caused a great concern because of their rapid emergence and increasing prevalence in worldwide regions. Great efforts have been made to investigate the pathogenic characteristics of Beijing strains such as hypervirulence, drug resistance and favoring transmission. Phylogenetically, MTB Beijing family was divided into modern and ancient sublineages. Modern Beijing strains displayed enhanced virulence and higher prevalence when compared with ancient Beijing strains, but the genetic basis for this difference remains unclear. In this study, by analyzing previously published sequencing data of 1082 MTB Beijing isolates, we determined the genetic changes that were commonly present in modern Beijing strains but absent in ancient Beijing strains. These changes include 44 single-nucleotide polymorphisms (SNPs) and two short genomic deletions. Through bioinformatics analysis, we demonstrated that these genetic changes had high probability of functional effects. For example, 4 genes were frameshifted due to premature stop mutation or genomic deletions, 19 nonsynonymous SNPs located in conservative codons, and there is a significant enrichment in regulatory network for all nonsynonymous mutations. Besides, three SNPs located in promoter regions were verified to alter downstream gene expressions. Our study precisely defined the genetic features of modern Beijing strains and provided interesting clues for future researches to elucidate the mechanisms that underlie this sublineage's successful expansion. These findings from the analysis of the modern Beijing sublineage could provide us a model to understand the dynamics of pathogenicity of MTB. PMID:26905026

Clinical analysis of PMS2: mutation detection and avoidance of pseudogenes.

PubMed

Vaughn, Cecily P; Robles, Jorge; Swensen, Jeffrey J; Miller, Christine E; Lyon, Elaine; Mao, Rong; Bayrak-Toydemir, Pinar; Samowitz, Wade S

2010-05-01

Germline mutation detection in PMS2, one of four mismatch repair genes associated with Lynch syndrome, is greatly complicated by the presence of numerous pseudogenes. We used a modification of a long-range PCR method to evaluate PMS2 in 145 clinical samples. This modification avoids potential interference from the pseudogene PMS2CL by utilizing a long-range product spanning exons 11-15, with the forward primer anchored in exon 10, an exon not shared by PMS2CL. Large deletions were identified by MLPA. Pathogenic PMS2 mutations were identified in 22 of 59 patients whose tumors showed isolated loss of PMS2 by immunohistochemistry (IHC), the IHC profile most commonly associated with a germline PMS2 mutation. Three additional patients with pathogenic mutations were identified from 53 samples without IHC data. Thirty-seven percent of the identified mutations were large deletions encompassing one or more exons. In 27 patients whose tumors showed absence of either another protein or combination of proteins, no pathogenic mutations were identified. We conclude that modified long-range PCR can be used to preferentially amplify the PMS2 gene and avoid pseudogene interference, thus providing a clinically useful germline analysis of PMS2. Our data also support the use of IHC screening to direct germline testing of PMS2. (c) 2010 Wiley-Liss, Inc.

Clinical significance of BIM deletion polymorphism in non-small-cell lung cancer with epidermal growth factor receptor mutation.

PubMed

Isobe, Kazutoshi; Hata, Yoshinobu; Tochigi, Naobumi; Kaburaki, Kyohei; Kobayashi, Hiroshi; Makino, Takashi; Otsuka, Hajime; Sato, Fumitomo; Ishida, Fumiaki; Kikuchi, Naoshi; Hirota, Nao; Sato, Keita; Sano, Go; Sugino, Keishi; Sakamoto, Susumu; Takai, Yujiro; Shibuya, Kazutoshi; Iyoda, Akira; Homma, Sakae

2014-04-01

Germline alterations in the proapoptotic protein Bcl-2-like 11 (BIM) can have a crucial role in tumor response to treatment. To determine the clinical utility of detecting BIM deletion polymorphism in non-small-cell lung cancer positive for epidermal growth factor receptor (EGFR) mutation, we examined outcomes of patients with and without BIM alterations. We studied 70 patients with EGFR mutation-positive non-small-cell lung cancer who were treated with an EGFR tyrosine kinase inhibitor between January 2008 and January 2013. BIM deletion was analyzed by polymerase chain reaction in 58 samples of peripheral blood and 24 formalin-fixed paraffin-embedded slides of surgical specimens (20 of lung tissue and four of brain tissue); both blood and tissue specimens were available for 12 patients. We retrospectively analyzed clinical characteristics, response rate, toxicity, and outcomes among patients with and without BIM deletion. BIM deletion was present in 13 of 70 patients (18.6%). There were no significant differences between patients with and without BIM deletion in clinical characteristics, rate of response to EGFR tyrosine kinase inhibitor, or incidence of adverse events. Patients with BIM deletion had significantly shorter progression-free survival (PFS) than those without BIM deletion (median, 227 versus 533 days; p < 0.001). Multivariate Cox regression analysis showed that BIM deletion was an independent indicator of shorter PFS (hazard ratio, 3.99; 95% confidence interval, 1.864-8.547; p < 0.001). Polymerase chain reaction successfully detected BIM deletion in samples of peripheral blood and formalin-fixed paraffin-embedded slides of surgical specimens. BIM deletion was the most important independent prognostic factor in shorter PFS.

Case-Deletion Diagnostics for Maximum Likelihood Multipoint Quantitative Trait Locus Linkage Analysis

PubMed Central

Mendoza, Maria C.B.; Burns, Trudy L.; Jones, Michael P.

2009-01-01

Objectives Case-deletion diagnostic methods are tools that allow identification of influential observations that may affect parameter estimates and model fitting conclusions. The goal of this paper was to develop two case-deletion diagnostics, the exact case deletion (ECD) and the empirical influence function (EIF), for detecting outliers that can affect results of sib-pair maximum likelihood quantitative trait locus (QTL) linkage analysis. Methods Subroutines to compute the ECD and EIF were incorporated into the maximum likelihood QTL variance estimation components of the linkage analysis program MAPMAKER/SIBS. Performance of the diagnostics was compared in simulation studies that evaluated the proportion of outliers correctly identified (sensitivity), and the proportion of non-outliers correctly identified (specificity). Results Simulations involving nuclear family data sets with one outlier showed EIF sensitivities approximated ECD sensitivities well for outlier-affected parameters. Sensitivities were high, indicating the outlier was identified a high proportion of the time. Simulations also showed the enormous computational time advantage of the EIF. Diagnostics applied to body mass index in nuclear families detected observations influential on the lod score and model parameter estimates. Conclusions The EIF is a practical diagnostic tool that has the advantages of high sensitivity and quick computation. PMID:19172086

Genomic imbalances in esophageal carcinoma cell lines involve Wnt pathway genes.

PubMed

Brown, Jacqueline; Bothma, Hannelie; Veale, Robin; Willem, Pascale

2011-06-28

To identify molecular markers shared across South African esophageal squamous cell carcinoma (ESCC) cell lines using cytogenetics, fluorescence in situ hybridization (FISH) and single nucleotide polymorphism (SNP) array copy number analysis. We used conventional cytogenetics, FISH, and multicolor FISH to characterize the chromosomal rearrangements of five ESCC cell lines established in South Africa. The whole genome copy number profile was established from 250K SNP arrays, and data was analyzed with the CNAT 4.0 and GISTIC software. We detected common translocation breakpoints involving chromosomes 1p11-12 and 3p11.2, the latter correlated with the deletion, or interruption of the EPHA3 gene. The most significant amplifications involved the following chromosomal regions and genes: 11q13.3 (CCND1, FGF3, FGF4, FGF19, MYEOV), 8q24.21(C-MYC, FAM84B), 11q22.1-q22.3 (BIRC2, BIRC3), 5p15.2 (CTNND2), 3q11.2-q12.2 (MINA) and 18p11.32 (TYMS, YES1). The significant deletions included 1p31.2-p31.1 (CTH, GADD45α, DIRAS3), 2q22.1 (LRP1B), 3p12.1-p14.2 (FHIT), 4q22.1-q32.1 (CASP6, SMAD1), 8p23.2-q11.1 (BNIP3L) and 18q21.1-q21.2 (SMAD4, DCC). The 3p11.2 translocation breakpoint was shared across four cell lines, supporting a role for genes involved at this site, in particular, the EPHA3 gene which has previously been reported to be deleted in ESCC. The finding that a significant number of genes that were amplified (FGF3, FGF4, FGF19, CCND1 and C-MYC) or deleted (SFRP2 gene) are involved in the Wnt and fibroblast growth factor signaling pathways, suggests that these pathways may be activated in these cell lines.

Genomic imbalances in esophageal carcinoma cell lines involve Wnt pathway genes

PubMed Central

Brown, Jacqueline; Bothma, Hannelie; Veale, Robin; Willem, Pascale

2011-01-01

AIM: To identify molecular markers shared across South African esophageal squamous cell carcinoma (ESCC) cell lines using cytogenetics, fluorescence in situ hybridization (FISH) and single nucleotide polymorphism (SNP) array copy number analysis. METHODS: We used conventional cytogenetics, FISH, and multicolor FISH to characterize the chromosomal rearrangements of five ESCC cell lines established in South Africa. The whole genome copy number profile was established from 250K SNP arrays, and data was analyzed with the CNAT 4.0 and GISTIC software. RESULTS: We detected common translocation breakpoints involving chromosomes 1p11-12 and 3p11.2, the latter correlated with the deletion, or interruption of the EPHA3 gene. The most significant amplifications involved the following chromosomal regions and genes: 11q13.3 (CCND1, FGF3, FGF4, FGF19, MYEOV), 8q24.21(C-MYC, FAM84B), 11q22.1-q22.3 (BIRC2, BIRC3), 5p15.2 (CTNND2), 3q11.2-q12.2 (MINA) and 18p11.32 (TYMS, YES1). The significant deletions included 1p31.2-p31.1 (CTH, GADD45α, DIRAS3), 2q22.1 (LRP1B), 3p12.1-p14.2 (FHIT), 4q22.1-q32.1 (CASP6, SMAD1), 8p23.2-q11.1 (BNIP3L) and 18q21.1-q21.2 (SMAD4, DCC). The 3p11.2 translocation breakpoint was shared across four cell lines, supporting a role for genes involved at this site, in particular, the EPHA3 gene which has previously been reported to be deleted in ESCC. CONCLUSION: The finding that a significant number of genes that were amplified (FGF3, FGF4, FGF19, CCND1 and C-MYC) or deleted (SFRP2 gene) are involved in the Wnt and fibroblast growth factor signaling pathways, suggests that these pathways may be activated in these cell lines. PMID:21734802

Paternal isodisomy for chromosome 2 as the cause of Crigler-Najjar type I syndrome.

PubMed

Petit, François M; Gajdos, Vincent; Parisot, Frédéric; Capel, Liliane; Aboura, Azzedine; Lachaux, Alain; Tachdjian, Gérard; Poüs, Christian; Labrune, Philippe

2005-03-01

Crigler-Najjar syndrome type I (CN-I) is a rare and severe autosomal recessive metabolic disease due to a total deficiency of bilirubin uridine diphosphate glucuronosyltransferase located on chromosome 2. We report on a child with CN-I due to a phenylalanine residue deletion inherited only from the father carrying this deletion at the heterozygous state. Cytogenetic analyses showed no deletion of the chromosomal 2q37 region. Microsatellite analysis of the child and his parents was consistent with paternal isodisomy for chromosome 2 in the child. This report demonstrates that uniparental disomy may be at the origin of very rare diseases transmitted as autosomal recessive traits and emphasizes the need for parental DNA analysis in such cases.

A 5-year-old white girl with Prader-Willi syndrome and a submicroscopic deletion of chromosome 15q11q13.

PubMed

Butler, M G; Christian, S L; Kubota, T; Ledbetter, D H

1996-10-16

We report on a 5-year-old white girl with Prader-Willi syndrome (PWS) and a submicroscopic deletion of 15q11q13 of approximately 100-200 kb in size. High resolution chromosome analysis was normal but fluorescence in situ hybridization (FISH), Southern hybridization, and microsatellite data from the 15q11q13 region demonstrated that the deletion was paternal in origin and included the SNRPN, PAR-5, and PAR-7 genes from the proximal to distal boundaries of the deletion segment. SNRPN and PW71B methylation studies showed an abnormal pattern consistent with the diagnosis of PWS and supported the presence of a paternal deletion of 15q11q13 or an imprinting mutation. Biparental (normal) inheritance of PW71B (D15S63 locus) and a deletion of the SNRPN gene were observed by microsatellite, quantitative Southern hybridization, and/or FISH analyses. Our patient met the diagnostic criteria for PWS, but has no reported behavior problems, hyperphagia, or hypopigmentation. Our patient further supports SNRPN and possibly other genomic sequences which are deleted as the cause of the phenotype recognized in PWS patients.

Quantitative phenotyping via deep barcode sequencing.

PubMed

Smith, Andrew M; Heisler, Lawrence E; Mellor, Joseph; Kaper, Fiona; Thompson, Michael J; Chee, Mark; Roth, Frederick P; Giaever, Guri; Nislow, Corey

2009-10-01

Next-generation DNA sequencing technologies have revolutionized diverse genomics applications, including de novo genome sequencing, SNP detection, chromatin immunoprecipitation, and transcriptome analysis. Here we apply deep sequencing to genome-scale fitness profiling to evaluate yeast strain collections in parallel. This method, Barcode analysis by Sequencing, or "Bar-seq," outperforms the current benchmark barcode microarray assay in terms of both dynamic range and throughput. When applied to a complex chemogenomic assay, Bar-seq quantitatively identifies drug targets, with performance superior to the benchmark microarray assay. We also show that Bar-seq is well-suited for a multiplex format. We completely re-sequenced and re-annotated the yeast deletion collection using deep sequencing, found that approximately 20% of the barcodes and common priming sequences varied from expectation, and used this revised list of barcode sequences to improve data quality. Together, this new assay and analysis routine provide a deep-sequencing-based toolkit for identifying gene-environment interactions on a genome-wide scale.

Analysis of BIM (BCL-2 like 11 gene) deletion polymorphism in Chinese non-small cell lung cancer patients

PubMed Central

Zhong, Jia; Li, Zheng-Xiang; Zhao, Jun; Duan, Jian-Chun; Bai, Hua; An, Tong-Tong; Yang, Xiao-Dan; Wang, Jie

2014-01-01

Background Drug resistance significantly weakens the efficacy of cancer treatment, and the BIM (also known as the BCL2L11 gene) deletion polymorphism has been identified as a potential biomarker for drug resistance. In this retrospective study, we included a total of 290 patients with advanced non-small cell lung cancer (NSCLC) who received treatment with epidermal growth factor receptor-tyrosine kinase inhibitors (EGFR-TKIs) and chemotherapy. Methods The BIM deletion polymorphism of each patient was detected by polymerase chain reaction. EGFR mutations were detected by denaturing high-performance liquid chromatography methods and the amplification refractory mutation system. Results The BIM deletion polymorphism was detected in 45/290 (15.5%) Chinese NSCLC patients. No associations were observed between the BIM deletion and clinic-pathologic characteristics of patients. The BIM deletion polymorphism was predictive of shorter progression-free survival in Chinese patients with EGFR-mutant adenocarcinoma and who were treated with EGFR-TKIs (7.30 vs. 9.53 months, P = 0.034). Additionally, we found that the BIM deletion polymorphism was an effective predictor of short progression-free survival in individuals with EGFR-mutant NSCLC and treated with chemotherapy containing pemetrexed (3.32 vs. 5.30, P = 0.012) or second-/beyond-line chemotherapy containing taxanes (1.53 vs. 2.61 months, P = 0.025). The BIM deletion was not correlated with overall survival. Conclusion The BIM deletion polymorphism occurs in 15.5% of Chinese NSCLC patients, and is a biomarker for resistance to TKIs and chemotherapy. However, BIM deletion was not a decisive factor in overall survival. PMID:26767045

Analysis of BIM (BCL-2 like 11 gene) deletion polymorphism in Chinese non-small cell lung cancer patients.

PubMed

Zhong, Jia; Li, Zheng-Xiang; Zhao, Jun; Duan, Jian-Chun; Bai, Hua; An, Tong-Tong; Yang, Xiao-Dan; Wang, Jie

2014-11-01

Drug resistance significantly weakens the efficacy of cancer treatment, and the BIM (also known as the BCL2L11 gene) deletion polymorphism has been identified as a potential biomarker for drug resistance. In this retrospective study, we included a total of 290 patients with advanced non-small cell lung cancer (NSCLC) who received treatment with epidermal growth factor receptor-tyrosine kinase inhibitors (EGFR-TKIs) and chemotherapy. The BIM deletion polymorphism of each patient was detected by polymerase chain reaction. EGFR mutations were detected by denaturing high-performance liquid chromatography methods and the amplification refractory mutation system. The BIM deletion polymorphism was detected in 45/290 (15.5%) Chinese NSCLC patients. No associations were observed between the BIM deletion and clinic-pathologic characteristics of patients. The BIM deletion polymorphism was predictive of shorter progression-free survival in Chinese patients with EGFR-mutant adenocarcinoma and who were treated with EGFR-TKIs (7.30 vs. 9.53 months, P = 0.034). Additionally, we found that the BIM deletion polymorphism was an effective predictor of short progression-free survival in individuals with EGFR-mutant NSCLC and treated with chemotherapy containing pemetrexed (3.32 vs. 5.30, P = 0.012) or second-/beyond-line chemotherapy containing taxanes (1.53 vs. 2.61 months, P = 0.025). The BIM deletion was not correlated with overall survival. The BIM deletion polymorphism occurs in 15.5% of Chinese NSCLC patients, and is a biomarker for resistance to TKIs and chemotherapy. However, BIM deletion was not a decisive factor in overall survival.

A 3.0-kb deletion including an erythroid cell-specific regulatory element in intron 1 of the ABO blood group gene in an individual with the Bm phenotype.

PubMed

Sano, R; Kuboya, E; Nakajima, T; Takahashi, Y; Takahashi, K; Kubo, R; Kominato, Y; Takeshita, H; Yamao, H; Kishida, T; Isa, K; Ogasawara, K; Uchikawa, M

2015-04-01

We developed a sequence-specific primer PCR (SSP-PCR) for detection of a 5.8-kb deletion (B(m) 5.8) involving an erythroid cell-specific regulatory element in intron 1 of the ABO blood group gene. Using this SSP-PCR, we performed genetic analysis of 382 individuals with Bm or ABm. The 5.8-kb deletion was found in 380 individuals, and disruption of the GATA motif in the regulatory element was found in one individual. Furthermore, a novel 3.0-kb deletion involving the element (B(m) 3.0) was demonstrated in the remaining individual. Comparisons of single-nucleotide polymorphisms and microsatellites in intron 1 between B(m) 5.8 and B(m) 3.0 suggested that these deletions occurred independently. © 2014 International Society of Blood Transfusion.

Association between BIM deletion polymorphism and clinical outcome of EGFR-mutated NSCLC patient with EGFR-TKI therapy: A meta-analysis.

PubMed

Ma, Ji-Yong; Yan, Hai-Jun; Gu, Wei

2015-01-01

BIM deletion polymorphism was deemed to be associated with downregulation of BIM, resulting in a decreased apoptosis induced by epidermal growth factor receptor-tyrosine kinase inhibitors (EGFR-TKIs) in EGFR mutation-positive non-small cell lung cancer (NSCLC). However, accumulating evidences concerning the association between BIM deletion polymorphism and efficacy of EGFR-TKI and survival in EGFR-mutation-driven NSCLC patient reported contradictory results. A meta-analysis was conducted by combing six original eligible studies including 871 NSCLC patients. Our study showed that BIM deletion polymorphism was significantly associated with poor response to EGFR-TKI therapy in mutant EGFRNSCLC patients (P(h) = 0.309, P(z) = 0.001, OR = 0.39, 95% confidence interval (CI) = 0.23-0.67). Disease control rate (DCR) in mutant EGFRNSCLC patient with treatment of EGFR-TKI was significantly decreased in patients with BIM deletion polymorphism comparing to patients harbored BIM wild variant (P(h) = 0.583, P(Z) = 0.007, OR = 0.46, 95%CI = 0.25-0.85). EGFR mutation-derived NSCLC patient carrying BIM deletion polymorphism had a shorter progression-free survival (PFS; P(h) < 0.001, P(z) < 0.001, hazard ratio (HR) = 1.37, 95%CI = 1.09-1.71) and overall survival (OS; P(h) = 0.90, P(z) = 0.003, HR = 1.25, 95%CI = 1.08-1.45), than those harbored BIM wild variant. These results suggested that BIM deletion polymorphism might be a cause that contributes to primary EGFR-TKI resistance, and it could be used as a genetic predictor for EGFR-TKI outcome and an independent prognostic factor of EGFR mutation-driven NSCLC patient.

Genomic Variability of Mycobacterium tuberculosis Strains of the Euro-American Lineage Based on Large Sequence Deletions and 15-Locus MIRU-VNTR Polymorphism

PubMed Central

Rindi, Laura; Medici, Chiara; Bimbi, Nicola; Buzzigoli, Andrea; Lari, Nicoletta; Garzelli, Carlo

2014-01-01

A sample of 260 Mycobacterium tuberculosis strains assigned to the Euro-American family was studied to identify phylogenetically informative genomic regions of difference (RD). Mutually exclusive deletions of regions RD115, RD122, RD174, RD182, RD183, RD193, RD219, RD726 and RD761 were found in 202 strains; the RDRio deletion was detected exclusively among the RD174-deleted strains. Although certain deletions were found more frequently in certain spoligotype families (i.e., deletion RD115 in T and LAM, RD174 in LAM, RD182 in Haarlem, RD219 in T and RD726 in the “Cameroon” family), the RD-defined sublineages did not specifically match with spoligotype-defined families, thus arguing against the use of spoligotyping for establishing exact phylogenetic relationships between strains. Notably, when tested for katG463/gyrA95 polymorphism, all the RD-defined sublineages belonged to Principal Genotypic Group (PGG) 2, except sublineage RD219 exclusively belonging to PGG3; the 58 Euro-American strains with no deletion were of either PGG2 or 3. A representative sample of 197 isolates was then analyzed by standard 15-locus MIRU-VNTR typing, a suitable approach to independently assess genetic relationships among the strains. Analysis of the MIRU-VNTR typing results by using a minimum spanning tree (MST) and a classical dendrogram showed groupings that were largely concordant with those obtained by RD-based analysis. Isolates of a given RD profile show, in addition to closely related MIRU-VNTR profiles, related spoligotype profiles that can serve as a basis for better spoligotype-based classification. PMID:25197794

Selfish Little Circles: Transmission Bias and Evolution of Large Deletion-Bearing Mitochondrial DNA in Caenorhabditis briggsae Nematodes

PubMed Central

Clark, Katie A.; Howe, Dana K.; Gafner, Kristin; Kusuma, Danika; Ping, Sita; Estes, Suzanne; Denver, Dee R.

2012-01-01

Selfish DNA poses a significant challenge to genome stability and organismal fitness in diverse eukaryotic lineages. Although selfish mitochondrial DNA (mtDNA) has known associations with cytoplasmic male sterility in numerous gynodioecious plant species and is manifested as petite mutants in experimental yeast lab populations, examples of selfish mtDNA in animals are less common. We analyzed the inheritance and evolution of mitochondrial DNA bearing large heteroplasmic deletions including nad5 gene sequences (nad5Δ mtDNA), in the nematode Caenorhabditis briggsae. The deletion is widespread in C. briggsae natural populations and is associated with deleterious organismal effects. We studied the inheritance patterns of nad5Δ mtDNA using eight sets of C. briggsae mutation-accumulation (MA) lines, each initiated from a different natural strain progenitor and bottlenecked as single hermaphrodites across generations. We observed a consistent and strong drive toward higher levels of deletion-bearing molecules in the heteroplasmic pool of mtDNA after ten generations of bottlenecking. Our results demonstrate a uniform transmission bias whereby nad5Δ mtDNA accumulates to higher levels relative to intact mtDNA in multiple genetically diverse natural strains of C. briggsae. We calculated an average 1% per-generation transmission bias for deletion-bearing mtDNA relative to intact genomes. Our study, coupled with known deleterious phenotypes associated with high deletion levels, shows that nad5Δ mtDNA are selfish genetic elements that have evolved in natural populations of C. briggsae, offering a powerful new system to study selfish mtDNA dynamics in metazoans. PMID:22859984

Biasing genome-editing events toward precise length deletions with an RNA-guided TevCas9 dual nuclease.

PubMed

Wolfs, Jason M; Hamilton, Thomas A; Lant, Jeremy T; Laforet, Marcon; Zhang, Jenny; Salemi, Louisa M; Gloor, Gregory B; Schild-Poulter, Caroline; Edgell, David R

2016-12-27

The CRISPR/Cas9 nuclease is commonly used to make gene knockouts. The blunt DNA ends generated by cleavage can be efficiently ligated by the classical nonhomologous end-joining repair pathway (c-NHEJ), regenerating the target site. This repair creates a cycle of cleavage, ligation, and target site regeneration that persists until sufficient modification of the DNA break by alternative NHEJ prevents further Cas9 cutting, generating a heterogeneous population of insertions and deletions typical of gene knockouts. Here, we develop a strategy to escape this cycle and bias events toward defined length deletions by creating an RNA-guided dual active site nuclease that generates two noncompatible DNA breaks at a target site, effectively deleting the majority of the target site such that it cannot be regenerated. The TevCas9 nuclease, a fusion of the I-TevI nuclease domain to Cas9, functions robustly in HEK293 cells and generates 33- to 36-bp deletions at frequencies up to 40%. Deep sequencing revealed minimal processing of TevCas9 products, consistent with protection of the DNA ends from exonucleolytic degradation and repair by the c-NHEJ pathway. Directed evolution experiments identified I-TevI variants with broadened targeting range, making TevCas9 an easy-to-use reagent. Our results highlight how the sequence-tolerant cleavage properties of the I-TevI homing endonuclease can be harnessed to enhance Cas9 applications, circumventing the cleavage and ligation cycle and biasing genome-editing events toward defined length deletions.

Transfusion-dependent thalassemia in Northern Sarawak: a molecular study to identify different genotypes in the multi-ethnic groups and the importance of genomic sequencing in unstudied populations.

PubMed

Tan, Jin-Ai M A; Chin, Saw-Sian; Ong, Gek-Bee; Mohamed Unni, Mohamed N; Soosay, Ashley E R; Gudum, Henry R; Kho, Siew-Leng; Chua, Kek-Heng; Chen, Jang J; George, Elizabeth

2015-01-01

Although thalassemia is a genetic hemoglobinopathy in Malaysia, there is limited data on thalassemia mutations in the indigenous groups. This study aims to identify the types of globin gene mutations in transfusion-dependent patients in Northern Sarawak. Blood was collected from 32 patients from the Malay, Chinese, Kedayan, Bisayah, Kadazandusun, Tagal, and Bugis populations. The α- and β-globin gene mutations were characterized using DNA amplification and genomic sequencing. Ten β- and 2 previously reported α-globin defects were identified. The Filipino β-deletion represented the majority of the β-thalassemia alleles in the indigenous patients. Homozygosity for the deletion was observed in all Bisayah, Kadazandusun and Tagal patients. The β-globin gene mutations in the Chinese patients were similar to the Chinese in West Malaysia. Hb Adana (HBA2:c.179G>A) and the -α(3.7)/αα deletion were detected in 5 patients. A novel 24-bp deletion in the α2-globin gene (HBA2:c.95 + 5_95 + 28delGGCTCCCTCCCCTGCTCCGACCCG) was identified by sequencing. Co-inheritance of α-thalassemia with β-thalassemia did not ameliorate the severity of thalassemia major in the patients. The Filipino β-deletion was the most common gene defect observed. Homozygosity for the Filipino β-deletion appears to be unique to the Malays in Sarawak. Genomic sequencing is an essential tool to detect rare genetic variants in the study of new populations. © 2014 S. Karger AG, Basel.

Prader-Willi-like phenotype: investigation of 1p36 deletion in 41 patients with delayed psychomotor development, hypotonia, obesity and/or hyperphagia, learning disabilities and behavioral problems.

PubMed

D'Angelo, Carla S; Da Paz, José A; Kim, Chong A; Bertola, Débora R; Castro, Claudia I E; Varela, Monica C; Koiffmann, Célia P

2006-01-01

Monosomy 1p36 is one of the most commonly observed mental retardation (MR) syndromes that results in a clinically recognizable phenotype including delayed psychomotor development and/or MR, hypotonia, epilepsy, hearing loss, growth delay, microcephaly, deep-set eyes, flat nasal bridge and pointed chin. Besides, a Prader-Willi syndrome (PWS)-like phenotype has been described in patients with 1p36 monosomy. Forty-one patients presenting hypotonia, developmental delay, obesity and/or hyperphagia and behavioral problems who tested negative for PWS were investigated by FISH and/or microsatellite markers. Twenty-six were analyzed with a 1p-specific subtelomeric probe, and one terminal deletion was identified. Thirty patients (15 of which also studied by FISH) were investigated by microsatellite markers, and no interstitial 1p36 deletion was found. Our patient presenting the 1p36 deletion did not have the striking features of this monosomy, but her clinical and behavioral features were quite similar to those observed in patients with PWS, except for the presence of normal sucking at birth. The extent of the deletion could be limited to the most terminal 2.5 Mb of 1p36, within the chromosomal region 1p36.33-1p36.32, that is smaller than usually seen in monosomy 1p36 patients. Therefore, chromosome 1p36.33 deletion should be investigated in patients with hypotonia, developmental delay, obesity and/or hyperphagia and behavioral problems who test negative for PWS.