The Evolution of Human Genetic Studies of Cleft Lip and Cleft Palate

PubMed Central

Marazita, Mary L.

2013-01-01

Orofacial clefts (OFCs)—primarily cleft lip and cleft palate—are among the most common birth defects in all populations worldwide, and have notable population, ethnicity, and gender differences in birth prevalence. Interest in these birth defects goes back centuries, as does formal scientific interest; scientists often used OFCs as examples or evidence during paradigm shifts in human genetics, and have also used virtually every new method of human genetic analysis to deepen our understanding of OFC. This review traces the evolution of human genetic investigations of OFC, highlights the specific insights gained about OFC through the years, and culminates in a review of recent key OFC genetic findings resulting from the powerful tools of the genomics era. Notably, OFC represents a major success for genome-wide approaches, and the field is poised for further breakthroughs in the near future. PMID:22703175

Conduct disorder

MedlinePlus

Disruptive behavior - child; Impulse control problem - child ... Conduct disorder has been linked to: Child abuse Drug or alcohol use in the parents Family conflicts Genetic defects Poverty The diagnosis is more common among boys. It is ...

Genetic and flow anomalies in congenital heart disease.

PubMed

Rugonyi, Sandra

2016-01-01

Congenital heart defects are the most common malformations in humans, affecting approximately 1% of newborn babies. While genetic causes of congenital heart disease have been studied, only less than 20% of human cases are clearly linked to genetic anomalies. The cause for the majority of the cases remains unknown. Heart formation is a finely orchestrated developmental process and slight disruptions of it can lead to severe malformations. Dysregulation of developmental processes leading to heart malformations are caused by genetic anomalies but also environmental factors including blood flow. Intra-cardiac blood flow dynamics plays a significant role regulating heart development and perturbations of blood flow lead to congenital heart defects in animal models. Defects that result from hemodynamic alterations, however, recapitulate those observed in human babies, even those due to genetic anomalies and toxic teratogen exposure. Because important cardiac developmental events, such as valve formation and septation, occur under blood flow conditions while the heart is pumping, blood flow regulation of cardiac formation might be a critical factor determining cardiac phenotype. The contribution of flow to cardiac phenotype, however, is frequently ignored. More research is needed to determine how blood flow influences cardiac development and the extent to which flow may determine cardiac phenotype.

Pancreas and gallbladder agenesis in a newborn with semilobar holoprosencephaly, a case report.

PubMed

Hilbrands, Robert; Keymolen, Kathelijn; Michotte, Alex; Marichal, Miriam; Cools, Filip; Goossens, Anieta; Veld, Peter In't; De Schepper, Jean; Hattersley, Andrew; Heimberg, Harry

2017-05-19

Pancreatic agenesis is an extremely rare cause of neonatal diabetes mellitus and has enabled the discovery of several key transcription factors essential for normal pancreas and beta cell development. We report a case of a Caucasian female with complete pancreatic agenesis occurring together with semilobar holoprosencephaly (HPE), a more common brain developmental disorder. Clinical findings were later confirmed by autopsy, which also identified agenesis of the gallbladder. Although the sequences of a selected set of genes related to pancreas agenesis or HPE were wild-type, the patient's phenotype suggests a genetic defect that emerges early in embryonic development of brain, gallbladder and pancreas. Developmental defects of the pancreas and brain can occur together. Identifying the genetic defect may identify a novel key regulator in beta cell development.

The essential and downstream common proteins of amyotrophic lateral sclerosis: A protein-protein interaction network analysis.

PubMed

Mao, Yimin; Kuo, Su-Wei; Chen, Le; Heckman, C J; Jiang, M C

2017-01-01

Amyotrophic Lateral Sclerosis (ALS) is a devastative neurodegenerative disease characterized by selective loss of motoneurons. While several breakthroughs have been made in identifying ALS genetic defects, the detailed molecular mechanisms are still unclear. These genetic defects involve in numerous biological processes, which converge to a common destiny: motoneuron degeneration. In addition, the common comorbid Frontotemporal Dementia (FTD) further complicates the investigation of ALS etiology. In this study, we aimed to explore the protein-protein interaction network built on known ALS-causative genes to identify essential proteins and common downstream proteins between classical ALS and ALS+FTD (classical ALS + ALS/FTD) groups. The results suggest that classical ALS and ALS+FTD share similar essential protein set (VCP, FUS, TDP-43 and hnRNPA1) but have distinctive functional enrichment profiles. Thus, disruptions to these essential proteins might cause motoneuron susceptible to cellular stresses and eventually vulnerable to proteinopathies. Moreover, we identified a common downstream protein, ubiquitin-C, extensively interconnected with ALS-causative proteins (22 out of 24) which was not linked to ALS previously. Our in silico approach provides the computational background for identifying ALS therapeutic targets, and points out the potential downstream common ground of ALS-causative mutations.

Genetic and Cellular Mechanisms Regulating Anterior Foregut and Esophageal Development

PubMed Central

Jacobs, Ian J.; Ku, Wei-Yao; Que, Jianwen

2012-01-01

Separation of the single anterior foregut tube into the esophagus and trachea involves cell proliferation and differentiation, as well as dynamic changes in cell-cell adhesion and migration. These biological processes are regulated and coordinated at multiple levels through the interplay of the epithelium and mesenchyme. Genetic studies and in vitro modeling have shed light on relevant regulatory networks that include a number of transcription factors and signaling pathways. These signaling molecules exhibit unique expression patterns and play specific functions in their respective territories before the separation process occurs. Disruption of regulatory networks inevitably leads to defective separation and malformation of the trachea and esophagus and results in the formation of a relatively common birth defect, esophageal atresia with or without tracheoesophageal fistula (EA/TEF). Significantly, some of the signaling pathways and transcription factors involved in anterior foregut separation continue to play important roles in the morphogenesis of the individual organs. In this review, we will focus on new findings related to these different developmental processes and discuss them in the context of developmental disorders (or birth defects) commonly seen in clinics. PMID:22750256

Genetics of SCID

PubMed Central

2010-01-01

Human SCID (Severe Combined Immunodeficiency) is a prenatal disorder of T lymphocyte development, that depends on the expression of numerous genes. The knowledge of the genetic basis of SCID is essential for diagnosis (e.g., clinical phenotype, lymphocyte profile) and treatment (e.g., use and type of pre-hematopoietic stem cell transplant conditioning). Over the last years novel genetic defects causing SCID have been discovered, and the molecular and immunological mechanisms of SCID have been better characterized. Distinct forms of SCID show both common and peculiar (e.g., absence or presence of nonimmunological features) aspects, and they are currently classified into six groups according to prevalent pathophysiological mechanisms: impaired cytokine-mediated signaling; pre-T cell receptor defects; increased lymphocyte apoptosis; defects in thymus embryogenesis; impaired calcium flux; other mechanisms. This review is the updated, extended and largely modified translation of the article "Cossu F: Le basi genetiche delle SCID", originally published in Italian language in the journal "Prospettive in Pediatria" 2009, 156:228-238. PMID:21078154

Xeroderma pigmentosum: biochemical and genetic characteristics

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cleaver, J.E.; Bootsma, D.

1975-01-01

Biochemical and genetic studies on xeroderma pigmentosum are reviewed under the following headings: clinical features of xeroderma pigmentosum; karyotype; cell killing and host cell reactivation after irradiation or exposure to chemical carcinogens; SV40 transformation of xeroderma pigmentosum cells; biochemical defects in the common and de Sanctis-Cacchione forms of xeroderma pigmentosum; cell hybridization and complementation groups; biochemical defects in the xeroderma pigmentosum variant and the role of caffeine in DNA repair; DNA repair in xeroderma pigmentosum heterozygotes; response of xeroderma pigmentosum cells to various mutagens and chemical carcinogens; other high and low repair diseases; and possible significance of DNA repair inmore » theories of aging and carcinogenesis. (HLW)« less

Targeted disruption of sp7 and myostatin with CRISPR-Cas9 results in severe bone defects and more muscular cells in common carp

PubMed Central

Zhong, Zhaomin; Niu, Pengfei; Wang, Mingyong; Huang, Guodong; Xu, Shuhao; Sun, Yi; Xu, Xiaona; Hou, Yi; Sun, Xiaowen; Yan, Yilin; Wang, Han

2016-01-01

The common carp (Cyprinus carpio) as one of the most important aquaculture fishes produces over 3 million metric tones annually, approximately 10% the annual production of the all farmed freshwater fish worldwide. However, the tetraploidy genome and long generation-time of the common carp have made its breeding and genetic studies extremely difficult. Here, TALEN and CRISPR-Cas9, two versatile genome-editing tools, are employed to target common carp bone-related genes sp7, runx2, bmp2a, spp1, opg, and muscle suppressor gene mstn. TALEN were shown to induce mutations in the target coding sites of sp7, runx2, spp1 and mstn. With CRISPR-Cas9, the two common carp sp7 genes, sp7a and sp7b, were mutated individually, all resulting in severe bone defects; while mstnba mutated fish have grown significantly more muscle cells. We also employed CRISPR-Cas9 to generate double mutant fish of sp7a;mstnba with high efficiencies in a single step. These results demonstrate that both TALEN and CRISPR-Cas9 are highly efficient tools for modifying the common carp genome, and open avenues for facilitating common carp genetic studies and breeding. PMID:26976234

Dissection of the complex genetic basis of craniofacial anomalies using haploid genetics and interspecies hybrids in Nasonia wasps

PubMed Central

Werren, John H.; Cohen, Lorna B.; Gadau, Juergen; Ponce, Rita; Baudry, Emmanuelle; Lynch, Jeremy A.

2016-01-01

The animal head is a complex structure where numerous sensory, structural and alimentary structures are concentrated and integrated, and its ontogeny requires precise and delicate interactions among genes, cells, and tissues. Thus, it is perhaps unsurprising that craniofacial abnormalities are among the most common birth defects in people, or that these defects have a complex genetic basis involving interactions among multiple loci. Developmental processes that depend on such epistatic interactions become exponentially more difficult to study in diploid organisms as the number of genes involved increases. Here, we present hybrid haploid males of the wasp species pair Nasonia vitripennis and Nasonia giraulti, which have distinct male head morphologies, as a genetic model of craniofacial development that possesses the genetic advantages of haploidy, along with many powerful genomic tools. Viable, fertile hybrids can be made between the species, and quantitative trail loci related to shape differences have been identified. In addition, a subset of hybrid males show head abnormalities, including clefting at the midline and asymmetries. Crucially, epistatic interactions among multiple loci underlie several developmental differences and defects observed in the F2 hybrid males. Furthermore, we demonstrate an introgression of a chromosomal region from N. giraulti into N. vitripennis that shows an abnormality in relative eye size, which maps to a region containing a major QTL for this trait. Therefore, the genetic sources of head morphology can, in principle, be identified by positional cloning. Thus, Nasonia is well positioned to be a uniquely powerful model invertebrate system with which to probe both development and complex genetics of craniofacial patterning and defects. PMID:26721604

Genome-wide linkage analysis of congenital heart defects using MOD score analysis identifies two novel loci

PubMed Central

2013-01-01

Background Congenital heart defects (CHD) is the most common cause of death from a congenital structure abnormality in newborns and is often associated with fetal loss. There are many types of CHD. Human genetic studies have identified genes that are responsible for the inheritance of a particular type of CHD and for some types of CHD previously thought to be sporadic. However, occasionally different members of the same family might have anatomically distinct defects — for instance, one member with atrial septal defect, one with tetralogy of Fallot, and one with ventricular septal defect. Our objective is to identify susceptibility loci for CHD in families affected by distinct defects. The occurrence of these apparently discordant clinical phenotypes within one family might hint at a genetic framework common to most types of CHD. Results We performed a genome-wide linkage analysis using MOD score analysis in families with diverse CHD. Significant linkage was obtained in two regions, at chromosome 15 (15q26.3, Pempirical = 0.0004) and at chromosome 18 (18q21.2, Pempirical = 0.0005). Conclusions In these two novel regions four candidate genes are located: SELS, SNRPA1, and PCSK6 on 15q26.3, and TCF4 on 18q21.2. The new loci reported here have not previously been described in connection with CHD. Although further studies in other cohorts are needed to confirm these findings, the results presented here together with recent insight into how the heart normally develops will improve the understanding of CHD. PMID:23705960

Mitochondrial Translation and Beyond: Processes Implicated in Combined Oxidative Phosphorylation Deficiencies

PubMed Central

Smits, Paulien; Smeitink, Jan; van den Heuvel, Lambert

2010-01-01

Mitochondrial disorders are a heterogeneous group of often multisystemic and early fatal diseases, which are amongst the most common inherited human diseases. These disorders are caused by defects in the oxidative phosphorylation (OXPHOS) system, which comprises five multisubunit enzyme complexes encoded by both the nuclear and the mitochondrial genomes. Due to the multitude of proteins and intricacy of the processes required for a properly functioning OXPHOS system, identifying the genetic defect that underlies an OXPHOS deficiency is not an easy task, especially in the case of combined OXPHOS defects. In the present communication we give an extensive overview of the proteins and processes (in)directly involved in mitochondrial translation and the biogenesis of the OXPHOS system and their roles in combined OXPHOS deficiencies. This knowledge is important for further research into the genetic causes, with the ultimate goal to effectively prevent and cure these complex and often devastating disorders. PMID:20396601

The natural history and the national pre-marital screening program in Saudi Arabia.

PubMed

El-Hazmi, Mohsen A F

2004-11-01

The genetic disorders are chronic in nature and, therefore, require continuous support and health care. Consequently, the genetic diseases cause formidable economic and psychosocial burdens on the family with negative reflection on the community at large. The genetic diseases are a heterogeneous group that result in varieties of chronic health ailment as a result of defects in the genetic material. The congenital malformations and some genetic defects may result from exposure to radiation, pharmaceutical drugs, the exposure of the mother during pregnancy to certain infectious diseases, such as rubella, toxoplasma or viruses. It may also result as a side effect of chronic diseases, including diabetes, hypertension or varieties of environmental factors, or both. The other group of genetic diseases are transmitted from parents to the offspring through a specific pattern of inheritance exemplified by recessive genetic disorders. This group includes the sickle cell gene, the thalassemias, the hemophilias, inborn errors of metabolism and red cell enzymopathies. The main etiological factors of genetic diseases and congenital malformations are 1) Genetic defects which are transmitted to offspring through carriers of affected parents. 2) Mutations in the genetic materials due to spontaneous mutations, exposure of the mother during pregnancy to infectious diseases, such as rubella and toxoplasma, receiving certain teratogenic drugs during pregnancy, exposure of the mother to ionizing radiation during pregnancy such as x-ray and chronic diseases of the mother, such as diabetes mellitus. 3) Others such as difficult labor or injury to the baby, during or after labor. This paper reviews the natural history of common blood genetic disorders and the means of prevention and control, focusing on pre-marital screening as a means of prevention.

Madras motor neuron disease (MMND) is distinct from the riboflavin transporter genetic defects that cause Brown–Vialetto–Van Laere syndrome

PubMed Central

Nalini, Atchayaram; Pandraud, Amelie; Mok, Kin; Houlden, Henry

2013-01-01

Introduction Madras motor neuron disease (MMND), MMND variant (MMNDV) and Familial MMND (FMMND) have a unique geographic distribution predominantly reported from Southern India. The characteristic features are onset in young, weakness and wasting of limbs, multiple lower cranial nerve palsies and sensorineural hearing loss. There is a considerable overlap in the phenotype of MMND with Brown–Vialetto–Van Laere syndrome (BVVL) Boltshauser syndrome, Nathalie syndrome and Fazio–Londe syndrome. Recently a number of BVVL cases and families have been described with mutations in two riboflavin transporter genes SLC52A2 and SLC52A3 (solute carrier family 52, riboflavin transporter, member 2 and 3 respectively). Methods and results We describe six families and four sporadic MMND cases that have been clinically characterized in detail with history, examination, imaging and electrophysiological investigations. We sequenced the SLC52A1, SLC52A2 and SLC52A3 in affected probands and sporadic individuals from the MMND series as well as the C9ORF72 expansion. No genetic defects were identified and the C9ORF72 repeats were all less than 10. Conclusions These data suggest that MMND is a distinct clinical subgroup of childhood onset MND patients where the known genetic defects are so far negative. The clinico-genetic features of MMND in comparison with the BVVL group of childhood motor neuron diseases suggest that these diseases are likely to share a common defective biological pathway that may be a combination of genetic and environmental factors. PMID:24139842

Madras motor neuron disease (MMND) is distinct from the riboflavin transporter genetic defects that cause Brown-Vialetto-Van Laere syndrome.

PubMed

Nalini, Atchayaram; Pandraud, Amelie; Mok, Kin; Houlden, Henry

2013-11-15

Madras motor neuron disease (MMND), MMND variant (MMNDV) and Familial MMND (FMMND) have a unique geographic distribution predominantly reported from Southern India. The characteristic features are onset in young, weakness and wasting of limbs, multiple lower cranial nerve palsies and sensorineural hearing loss. There is a considerable overlap in the phenotype of MMND with Brown-Vialetto-Van Laere syndrome (BVVL) Boltshauser syndrome, Nathalie syndrome and Fazio-Londe syndrome. Recently a number of BVVL cases and families have been described with mutations in two riboflavin transporter genes SLC52A2 and SLC52A3 (solute carrier family 52, riboflavin transporter, member 2 and 3 respectively). We describe six families and four sporadic MMND cases that have been clinically characterized in detail with history, examination, imaging and electrophysiological investigations. We sequenced the SLC52A1, SLC52A2 and SLC52A3 in affected probands and sporadic individuals from the MMND series as well as the C9ORF72 expansion. No genetic defects were identified and the C9ORF72 repeats were all less than 10. These data suggest that MMND is a distinct clinical subgroup of childhood onset MND patients where the known genetic defects are so far negative. The clinico-genetic features of MMND in comparison with the BVVL group of childhood motor neuron diseases suggest that these diseases are likely to share a common defective biological pathway that may be a combination of genetic and environmental factors. © 2013 Published by Elsevier B.V.

Spatial-time-state fusion algorithm for defect detection through eddy current pulsed thermography

NASA Astrophysics Data System (ADS)

Xiao, Xiang; Gao, Bin; Woo, Wai Lok; Tian, Gui Yun; Xiao, Xiao Ting

2018-05-01

Eddy Current Pulsed Thermography (ECPT) has received extensive attention due to its high sensitive of detectability on surface and subsurface cracks. However, it remains as a difficult challenge in unsupervised detection as to identify defects without knowing any prior knowledge. This paper presents a spatial-time-state features fusion algorithm to obtain fully profile of the defects by directional scanning. The proposed method is intended to conduct features extraction by using independent component analysis (ICA) and automatic features selection embedding genetic algorithm. Finally, the optimal feature of each step is fused to obtain defects reconstruction by applying common orthogonal basis extraction (COBE) method. Experiments have been conducted to validate the study and verify the efficacy of the proposed method on blind defect detection.

Global Mapping of the Yeast Genetic Interaction Network

NASA Astrophysics Data System (ADS)

Tong, Amy Hin Yan; Lesage, Guillaume; Bader, Gary D.; Ding, Huiming; Xu, Hong; Xin, Xiaofeng; Young, James; Berriz, Gabriel F.; Brost, Renee L.; Chang, Michael; Chen, YiQun; Cheng, Xin; Chua, Gordon; Friesen, Helena; Goldberg, Debra S.; Haynes, Jennifer; Humphries, Christine; He, Grace; Hussein, Shamiza; Ke, Lizhu; Krogan, Nevan; Li, Zhijian; Levinson, Joshua N.; Lu, Hong; Ménard, Patrice; Munyana, Christella; Parsons, Ainslie B.; Ryan, Owen; Tonikian, Raffi; Roberts, Tania; Sdicu, Anne-Marie; Shapiro, Jesse; Sheikh, Bilal; Suter, Bernhard; Wong, Sharyl L.; Zhang, Lan V.; Zhu, Hongwei; Burd, Christopher G.; Munro, Sean; Sander, Chris; Rine, Jasper; Greenblatt, Jack; Peter, Matthias; Bretscher, Anthony; Bell, Graham; Roth, Frederick P.; Brown, Grant W.; Andrews, Brenda; Bussey, Howard; Boone, Charles

2004-02-01

A genetic interaction network containing ~1000 genes and ~4000 interactions was mapped by crossing mutations in 132 different query genes into a set of ~4700 viable gene yeast deletion mutants and scoring the double mutant progeny for fitness defects. Network connectivity was predictive of function because interactions often occurred among functionally related genes, and similar patterns of interactions tended to identify components of the same pathway. The genetic network exhibited dense local neighborhoods; therefore, the position of a gene on a partially mapped network is predictive of other genetic interactions. Because digenic interactions are common in yeast, similar networks may underlie the complex genetics associated with inherited phenotypes in other organisms.

Genetic Landscape of Congenital Myasthenic Syndromes From Turkey: Novel Mutations and Clinical Insights.

PubMed

Yiş, Uluç; Becker, Kerstin; Kurul, Semra Hız; Uyanik, Gökhan; Bayram, Erhan; Haliloğlu, Göknur; Polat, Ayşe İpek; Ayanoğlu, Müge; Okur, Derya; Tosun, Ayşe Fahriye; Serdaroğlu, Gül; Yilmaz, Sanem; Topaloğlu, Haluk; Anlar, Banu; Cirak, Sebahattin; Engel, Andrew G

2017-07-01

Congenital myasthenic syndromes are clinically and genetically heterogeneous disorders of neuromuscular transmission. Most are treatable, but certain subtypes worsen with cholinesterase inhibitors. This underlines the importance of genetic diagnosis. Here, the authors report on cases with genetically proven congenital myasthenic syndromes from Turkey. The authors retrospectively reviewed their experience of all patients with congenital myasthenic syndromes, referred over a 5-year period (2011-2016) to the Child Neurology Department of Dokuz Eylül University, Izmir, Turkey. In addition, PubMed was searched for published cases of genetically proven congenital myasthenic syndromes originating from Turkey. In total, the authors identified 43 (8 new patients, 35 recently published patients) cases. Defects in the acetylcholine receptor (n = 15; 35%) were the most common type, followed by synaptic basal-lamina associated (n = 14; 33%) and presynaptic syndromes (n = 10; 23%). The authors had only 3 cases (7%) who had defects in endplate development. One patient had mutation GFPT1 gene (n = 1; 2%). Knowledge on congenital myasthenic syndromes and related genes in Turkey will lead to prompt diagnosis and treatment of these rare neuromuscular disorders.

Comprehensive 5-Year Study of Cytogenetic Aberrations in 668 Infertile Men

PubMed Central

Yatsenko, Alexander N.; Yatsenko, Svetlana A.; Weedin, John W.; Lawrence, Amy E.; Patel, Ankita; Peacock, Sandra; Matzuk, Martin M.; Lamb, Dolores J.; Cheung, Sau Wai; Lipshultz, Larry I.

2010-01-01

Purpose The causes of male infertility are heterogeneous but more than 50% of cases have a genetic basis. Specific genetic defects have been identified in less than 20% of infertile males and, thus, most causes remain to be elucidated. The most common cytogenetic defects associated with nonobstructive azoospermia are numerical and structural chromosome abnormalities, including Klinefelter syndrome (47,XXY) and Y chromosome microdeletions. To refine the incidence and nature of chromosomal aberrations in males with infertility we reviewed cytogenetic results in 668 infertile men with oligozoospermia and azoospermia. Materials and Methods High resolution Giemsa banding chromosome analysis and/or fluorescence in situ hybridization were done in 668 infertile males referred for routine cytogenetic analysis between January 2004 and March 2009. Results The overall incidence of chromosomal abnormalities was about 8.2%. Of the 55 patients with abnormal cytogenetic findings sex chromosome aneuploidies were observed in 29 (53%), including Klinefelter syndrome in 27 (49%). Structural chromosome abnormalities involving autosomes (29%) and sex chromosomes (18%) were detected in 26 infertile men. Abnormal cytogenetic findings were observed in 35 of 264 patients (13.3%) with azoospermia and 19 of 365 (5.2%) with oligozoospermia. Conclusions Structural chromosomal defects and low level sex chromosome mosaicism are common in oligozoospermia cases. Extensive cytogenetic assessment and fluorescence in situ hybridization may improve the detection rate in males with oligozoospermia. These findings highlight the need for efficient genetic testing in infertile men so that couples may make informed decisions on assisted reproductive technologies to achieve parenthood. PMID:20172548

A novel ciliopathic skull defect arising from excess neural crest.

PubMed

Tabler, Jacqueline M; Rice, Christopher P; Liu, Karen J; Wallingford, John B

2016-09-01

The skull is essential for protecting the brain from damage, and birth defects involving disorganization of skull bones are common. However, the developmental trajectories and molecular etiologies by which many craniofacial phenotypes arise remain poorly understood. Here, we report a novel skull defect in ciliopathic Fuz mutant mice in which only a single bone pair encases the forebrain, instead of the usual paired frontal and parietal bones. Through genetic lineage analysis, we show that this defect stems from a massive expansion of the neural crest-derived frontal bone. This expansion occurs at the expense of the mesodermally-derived parietal bones, which are either severely reduced or absent. A similar, though less severe, phenotype was observed in Gli3 mutant mice, consistent with a role for Gli3 in cilia-mediated signaling. Excess crest has also been shown to drive defective palate morphogenesis in ciliopathic mice, and that defect is ameliorated by reduction of Fgf8 gene dosage. Strikingly, skull defects in Fuz mutant mice are also rescued by loss of one allele of fgf8, suggesting a potential route to therapy. In sum, this work is significant for revealing a novel skull defect with a previously un-described developmental etiology and for suggesting a common developmental origin for skull and palate defects in ciliopathies. Copyright © 2016 Elsevier Inc. All rights reserved.

Extensive investigation of the IGF2/H19 imprinting control region reveals novel OCT4/SOX2 binding site defects associated with specific methylation patterns in Beckwith-Wiedemann syndrome.

PubMed

Abi Habib, Walid; Azzi, Salah; Brioude, Frédéric; Steunou, Virginie; Thibaud, Nathalie; Das Neves, Cristina; Le Jule, Marilyne; Chantot-Bastaraud, Sandra; Keren, Boris; Lyonnet, Stanislas; Michot, Caroline; Rossi, Massimiliano; Pasquier, Laurent; Gicquel, Christine; Rossignol, Sylvie; Le Bouc, Yves; Netchine, Irène

2014-11-01

Isolated gain of methylation (GOM) at the IGF2/H19 imprinting control region 1 (ICR1) accounts for about 10% of patients with BWS. A subset of these patients have genetic defects within ICR1, but the frequency of these defects has not yet been established in a large cohort of BWS patients with isolated ICR1 GOM. Here, we carried out a genetic analysis in a large cohort of 57 BWS patients with isolated ICR1 GOM and analyzed the methylation status of the entire domain. We found a new point mutation in two unrelated families and a 21 bp deletion in another unrelated child, both of which were maternally inherited and affected the OCT4/SOX2 binding site in the A2 repeat of ICR1. Based on data from this and previous studies, we estimate that cis genetic defects account for about 20% of BWS patients with isolated ICR1 GOM. Methylation analysis at eight loci of the IGF2/H19 domain revealed that sites surrounding OCT4/SOX2 binding site mutations were fully methylated and methylation indexes declined as a function of distance from these sites. This was not the case in BWS patients without genetic defects identified. Thus, GOM does not spread uniformly across the IGF2/H19 domain, suggesting that OCT4/SOX2 protects against methylation at local sites. These findings add new insights to the mechanism of the regulation of the ICR1 domain. Our data show that mutations and deletions within ICR1 are relatively common. Systematic identification is therefore necessary to establish appropriate genetic counseling for BWS patients with isolated ICR1 GOM. © The Author 2014. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Osteogenesis Imperfecta due to Mutations in Non-Collagenous Genes-Lessons in the Biology of Bone Formation

PubMed Central

Marini, Joan C.; Reich, Adi; Smith, Simone M.

2014-01-01

Purpose of Review Osteogenesis imperfecta (OI), or “brittle bone disease”, has mainly been considered a bone disorder caused by collagen mutations. Within the last decade, however, a surge of genetic discoveries has created a new paradigm for OI as a collagen-related disorder, where autosomal dominant type I collagen defects cause most cases, while rare, mostly recessive forms are due to defects in genes whose protein products interact with collagen protein. This review is both timely and relevant in outlining the genesis, development and future of this paradigm shift in the understanding of OI. Recent Findings BRIL and PEDF defects cause types V and VI OI via defective bone mineralization, while defects in CRTAP, P3H1 and CyPB cause types VII-IX via defective collagen post-translational modification. Hsp47 and FKBP65 defects cause types X and XI OI via aberrant collagen crosslinking, folding and chaperoning, while defects in SP7, WNT1, TRIC-B and OASIS disrupt osteoblast development. Finally, absence of the type I collagen C-propeptidase BMP1 causes type XII OI due to altered collagen maturation/processing. Summary Identification of these multiple causative defects has provided crucial information for accurate genetic counseling, inspired a recently proposed functional grouping of OI types by shared mechanism to simplify current nosology, and should prod investigations into common pathways in OI. Such investigations could yield critical information on cellular and bone tissue mechanisms and translate to new mechanistic insight into clinical therapies for patients. PMID:25007323

Whole-genome sequencing in a pair of monozygotic twins with discordant cleft lip and palate subtypes.

PubMed

Takahashi, Masahiro; Hosomichi, Kazuyoshi; Yamaguchi, Tetsutaro; Nagahama, Ryo; Yoshida, Hiroshi; Maki, Koutaro; Marazita, Mary L; Weinberg, Seth M; Tajima, Atsushi

2018-06-06

Orofacial clefts (OFCs) are common and aetiologically complex birth defects. This study explored potential genetic differences in a pair of Japanese monozygotic (MZ) twins with different forms of OFC using whole-genome sequencing. One co-twin (MZ-1) presented with non-syndromic bilateral cleft lip and palate; the other co-twin (MZ-2) had non-syndromic bilateral cleft lip and unilateral left-sided cleft alveolus. Neither parent had an OFC. Craniofacial morphologic features and potential genetic differences were compared using standard cephalometry and whole-genome sequencing, respectively. Morphologically, MZ-1 had a smaller vertical mandibular height, compared to MZ-2. However, no discordant genetic differences were detected. Moreover, both twins and their parents harboured rare candidate gene variants (GRHL3; TPM1) considered to be associated with OFCs. The observed differences between MZ-1 and MZ-2 in craniofacial morphology assessed by cephalograms might be directly attributable to the effects of the OFC on growth and/or differences in surgical history, given the lack of any differences in genetic background. However, comparisons of discordant MZ twins should continue to identify novel candidates that might control OFC or that might partly explain the missing heritability for this common birth defect, in addition to understanding craniofacial growth and development. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

Chemical and HTS Profiling of 63 Cleft Palate Teratogens from ToxCast (FutureTox III)

EPA Science Inventory

Cleft palate is a common human birth defect that has been linked to both genetic and environmental factors. To characterize the potential molecular targets and biological processes across mechanistically diverse teratogens that cause cleft palate, we mined the ToxCast high-throug...

Epidemiology of Down Syndrome

ERIC Educational Resources Information Center

Sherman, Stephanie L.; Allen, Emily G.; Bean, Lora H.; Freeman, Sallie B.

2007-01-01

Down syndrome (DS) is the most commonly identified genetic form of mental retardation and the leading cause of specific birth defects and medical conditions. Traditional epidemiological studies to determine the prevalence, cause, and clinical significance of the syndrome have been conducted over the last 100 years. DS has been estimated to occur…

Conserved genetic pathways associated with microphthalmia, anophthalmia, and coloboma

PubMed Central

Reis, Linda M.; Semina, Elena V.

2016-01-01

The human eye is a complex organ whose development requires extraordinary coordination of developmental processes. The conservation of ocular developmental steps in vertebrates suggests possible common genetic mechanisms. Genetic diseases involving the eye represent a leading cause of blindness in children and adults. During the last decades, there has been an exponential increase in genetic studies of ocular disorders. In this review, we summarize current success in identification of genes responsible for microphthalmia, anophthalmia and coloboma (MAC) phenotypes, which are associated with early defects in embryonic eye development. Studies in animal models for the orthologous genes identified overlapping phenotypes for most factors confirming the conservation of their function in vertebrate development. These animal models allow for further investigation of the mechanisms of MAC, integration of various identified genes into common developmental pathways and, finally, provide an avenue for the development and testing of therapeutic interventions. PMID:26046913

Conserved genetic pathways associated with microphthalmia, anophthalmia, and coloboma.

PubMed

Reis, Linda M; Semina, Elena V

2015-06-01

The human eye is a complex organ whose development requires extraordinary coordination of developmental processes. The conservation of ocular developmental steps in vertebrates suggests possible common genetic mechanisms. Genetic diseases involving the eye represent a leading cause of blindness in children and adults. During the last decades, there has been an exponential increase in genetic studies of ocular disorders. In this review, we summarize current success in identification of genes responsible for microphthalmia, anophthalmia, and coloboma (MAC) phenotypes, which are associated with early defects in embryonic eye development. Studies in animal models for the orthologous genes identified overlapping phenotypes for most factors, confirming the conservation of their function in vertebrate development. These animal models allow for further investigation of the mechanisms of MAC, integration of various identified genes into common developmental pathways and finally, provide an avenue for the development and testing of therapeutic interventions. © 2015 Wiley Periodicals, Inc.

Adults with genetic syndromes and cardiovascular abnormalities: Clinical history and management

PubMed Central

Lin, Angela E.; Basson, Craig T.; Goldmuntz, Elizabeth; Magoulas, Pilar L.; McDermott, Deborah A.; McDonald-McGinn, Donna M.; McPherson, Elspeth; Morris, Colleen A.; Noonan, Jacqueline; Nowak, Catherine; Pierpont, Mary Ella; Pyeritz, Reed E.; Rope, Alan F.; Zackai, Elaine; Pober, Barbara R.

2009-01-01

Cardiovascular abnormalities, especially structural congenital heart defects (CHDs), commonly occur in malformation syndromes and genetic disorders. Individuals with syndromes comprise a significant proportion of those affected with selected CHDs such as complete atrioventricular canal, interrupted arch type B, supravalvar aortic stenosis and pulmonary stenosis. As these individuals age, they contribute to the growing population of adults with special health care needs. Although most will require longterm cardiology followup, primary care providers, geneticists and other specialists should be aware of (1) the type and frequency of cardiovascular abnormalities, (2) the range of clinical outcomes, and (3) guidelines for prospective management and treatment of potential complications. This article reviews fundamental genetic, cardiac, medical and reproductive issues associated with common genetic syndromes which are frequently associated with a cardiovascular abnormality. New data are also provided about the cardiac status of adults with a 22q11.2 deletion and with Down syndrome. PMID:18580689

Genetic Drivers of Kidney Defects in the DiGeorge Syndrome.

PubMed

Lopez-Rivera, Esther; Liu, Yangfan P; Verbitsky, Miguel; Anderson, Blair R; Capone, Valentina P; Otto, Edgar A; Yan, Zhonghai; Mitrotti, Adele; Martino, Jeremiah; Steers, Nicholas J; Fasel, David A; Vukojevic, Katarina; Deng, Rong; Racedo, Silvia E; Liu, Qingxue; Werth, Max; Westland, Rik; Vivante, Asaf; Makar, Gabriel S; Bodria, Monica; Sampson, Matthew G; Gillies, Christopher E; Vega-Warner, Virginia; Maiorana, Mariarosa; Petrey, Donald S; Honig, Barry; Lozanovski, Vladimir J; Salomon, Rémi; Heidet, Laurence; Carpentier, Wassila; Gaillard, Dominique; Carrea, Alba; Gesualdo, Loreto; Cusi, Daniele; Izzi, Claudia; Scolari, Francesco; van Wijk, Joanna A E; Arapovic, Adela; Saraga-Babic, Mirna; Saraga, Marijan; Kunac, Nenad; Samii, Ali; McDonald-McGinn, Donna M; Crowley, Terrence B; Zackai, Elaine H; Drozdz, Dorota; Miklaszewska, Monika; Tkaczyk, Marcin; Sikora, Przemyslaw; Szczepanska, Maria; Mizerska-Wasiak, Malgorzata; Krzemien, Grazyna; Szmigielska, Agnieszka; Zaniew, Marcin; Darlow, John M; Puri, Prem; Barton, David; Casolari, Emilio; Furth, Susan L; Warady, Bradley A; Gucev, Zoran; Hakonarson, Hakon; Flogelova, Hana; Tasic, Velibor; Latos-Bielenska, Anna; Materna-Kiryluk, Anna; Allegri, Landino; Wong, Craig S; Drummond, Iain A; D'Agati, Vivette; Imamoto, Akira; Barasch, Jonathan M; Hildebrandt, Friedhelm; Kiryluk, Krzysztof; Lifton, Richard P; Morrow, Bernice E; Jeanpierre, Cecile; Papaioannou, Virginia E; Ghiggeri, Gian Marco; Gharavi, Ali G; Katsanis, Nicholas; Sanna-Cherchi, Simone

2017-02-23

The DiGeorge syndrome, the most common of the microdeletion syndromes, affects multiple organs, including the heart, the nervous system, and the kidney. It is caused by deletions on chromosome 22q11.2; the genetic driver of the kidney defects is unknown. We conducted a genomewide search for structural variants in two cohorts: 2080 patients with congenital kidney and urinary tract anomalies and 22,094 controls. We performed exome and targeted resequencing in samples obtained from 586 additional patients with congenital kidney anomalies. We also carried out functional studies using zebrafish and mice. We identified heterozygous deletions of 22q11.2 in 1.1% of the patients with congenital kidney anomalies and in 0.01% of population controls (odds ratio, 81.5; P=4.5×10 -14 ). We localized the main drivers of renal disease in the DiGeorge syndrome to a 370-kb region containing nine genes. In zebrafish embryos, an induced loss of function in snap29, aifm3, and crkl resulted in renal defects; the loss of crkl alone was sufficient to induce defects. Five of 586 patients with congenital urinary anomalies had newly identified, heterozygous protein-altering variants, including a premature termination codon, in CRKL. The inactivation of Crkl in the mouse model induced developmental defects similar to those observed in patients with congenital urinary anomalies. We identified a recurrent 370-kb deletion at the 22q11.2 locus as a driver of kidney defects in the DiGeorge syndrome and in sporadic congenital kidney and urinary tract anomalies. Of the nine genes at this locus, SNAP29, AIFM3, and CRKL appear to be critical to the phenotype, with haploinsufficiency of CRKL emerging as the main genetic driver. (Funded by the National Institutes of Health and others.).

(Epi)genotype-Phenotype Analysis in 69 Japanese Patients With Pseudohypoparathyroidism Type I

PubMed Central

Sano, Shinichiro; Nakamura, Akie; Matsubara, Keiko; Nagasaki, Keisuke; Fukami, Maki; Kagami, Masayo

2018-01-01

Context: Pseudohypoparathyroidism type I (PHP-I) is divided into PHP-Ia with Albright hereditary osteodystrophy and PHP-Ib, which usually shows no Albright hereditary osteodystrophy features. Although PHP-Ia and PHP-Ib are typically caused by genetic defects involving α subunit of the stimulatory G protein (Gsα)–coding GNAS exons and methylation defects of the GNAS differentially methylated regions (DMRs) on the maternal allele, respectively, detailed phenotypic characteristics still remains to be examined. Objective: To clarify phenotypic characteristics according to underlying (epi)genetic causes. Patients and Methods: We performed (epi)genotype-phenotype analysis in 69 Japanese patients with PHP-I; that is, 28 patients with genetic defects involving Gsα-coding GNAS exons (group 1) consisting of 12 patients with missense variants (subgroup A) and 16 patients with null variants (subgroup B), as well as 41 patients with methylation defects (group 2) consisting of 21 patients with broad methylation defects of the GNAS-DMRs (subgroup C) and 20 patients with an isolated A/B-DMR methylation defect accompanied by the common STX16 microdeletion (subgroup D). Results: Although (epi)genotype-phenotype findings were grossly similar to those reported previously, several important findings were identified, including younger age at hypocalcemic symptoms and higher frequencies of hyperphosphatemia in subgroup C than in subgroup D, development of brachydactyly in four patients of subgroup C, predominant manifestation of subcutaneous ossification in subgroup B, higher frequency of thyrotropin resistance in group 1 than in group 2, and relatively low thyrotropin values in four patients with low T4 values and relatively low luteinizing hormone/follicle-stimulating hormone values in five adult females with ovarian dysfunction. Conclusion: The results imply the presence of clinical findings characteristic of each underlying cause and provide useful information on the imprinting status of Gsα. PMID:29379892

Assessment of the role of copy-number variants in 150 patients with congenital heart defects.

PubMed

Derwińska, Katarzyna; Bartnik, Magdalena; Wiśniowiecka-Kowalnik, Barbara; Jagła, Mateusz; Rudziński, Andrzej; Pietrzyk, Jacek J; Kawalec, Wanda; Ziółkowska, Lidia; Kutkowska-Kaźmierczak, Anna; Gambin, Tomasz; Sykulski, Maciej; Shaw, Chad A; Gambin, Anna; Mazurczak, Tadeusz; Obersztyn, Ewa; Bocian, Ewa; Stankiewicz, Paweł

2012-01-01

Congenital heart defects are the most common group of major birth anomalies and one of the leading causes of infant deaths. Mendelian and chromosomal syndromes account for about 20% of congenital heart defects and in some cases are associated with other malformations, intellectual disability, and/or dysmorphic features. The remarkable conservation of genetic pathways regulating heart development in animals suggests that genetic factors can be responsible for a significantly higher percentage of cases. Assessment of the role of CNVs in the etiology of congenital heart defects using microarray studies. Genome-wide array comparative genomic hybridization, targeting genes known to play an important role in heart development or responsible for abnormal cardiac phenotype was used in the study on 150 patients. In addition, we have used multiplex ligation-dependent probe amplification specific for chromosome 22q11.2 region. We have identified 21 copy-number variants, including 13 known causative recurrent rearrangements (12 deletions 22q11.2 and one deletion 7q11.23), three potentially pathogenic duplications (5q14.2, 15q13.3, and 22q11.2), and five variants likely benign for cardiac anomalies. We suggest that abnormal copy-number of the ARRDC3 and KLF13 genes can be responsible for heart defects. Our study demonstrates that array comparative genomic hybridization enables detection of clinically significant chromosomal imbalances in patients with congenital heart defects.

Epilepsy Genetics—Past, Present, and Future

PubMed Central

Poduri, Annapurna; Lowenstein, Daniel

2014-01-01

Human epilepsy is a common and heterogeneous condition in which genetics play an important etiological role. We begin by reviewing the past history of epilepsy genetics, a field that has traditionally included studies of pedigrees with epilepsy caused by defects in ion channels and neurotransmitters. We highlight important recent discoveries that have expanded the field beyond the realm of channels and neurotransmitters and that have challenged the notion that single genes produce single disorders. Finally, we project toward an exciting future for epilepsy genetics as large-scale collaborative phenotyping studies come face to face with new technologies in genomic medicine. PMID:21277190

A cAMP-Regulated Chloride Channel in Lymphocytes that is Affected in Cystic Fibrosis

NASA Astrophysics Data System (ADS)

Chen, Jennifer H.; Schulman, Howard; Gardner, Phyllis

1989-02-01

A defect in regulation of a chloride channel appears to be the molecular basis for cystic fibrosis (CF), a common lethal genetic disease. It is shown here that a chloride channel with kinetic and regulatory properties similar to those described for secretory epithelial cells is present in both T and B lymphocyte cell lines. The regulation of the channels by adenosine 3',5'-monophosphate (cAMP)--dependent protein kinase in transformed B cells from CF patients is defective. Thus, lymphocytes may be an accessible source of CF tissue for study of this defect, for cloning of the chloride channel complex, and for diagnosis of the disease.

Inherited trombophilic states and pulmonary embolism

PubMed Central

Konecny, Filip

2009-01-01

Pulmonary embolism (PE) and deep vein thrombosis (DVT) are associated with considerable morbidity and mortality, mostly, in case of PE for its lack of sensitivity of its early detection. For as much as twenty-five percent of PE patients the primary clinical appearance is unexpected death. While PE is one of the most avertable causes of hospital associated deaths, its diagnostics can be extremely difficult. Newly increased interest in an inherited thrombophilic states has been provoked by the discovery of several common inherited abnormalities, i.e. the prothrombin (PT) gene G20210A, Factor V Leiden (FVL) mutation (Arg506Gln), hyperhomocystenemia and homocysteiuria, Wein-Penzing defect, Sticky Platelet Syndrome (SPS), Quebec platelet disorder (QPD) and Sickle Cell Disease (SCD). PE incidence rates increase exponentially with age for both men and women, as they might harbor more than one thrombophilic state. Although the impact of genetic factors on PE is to some extent documented with lacking taxonomy, its genetic testing as its prevention strategy fall short. In this review thrombophilic states are divided into inherited or acquired, and only the inherited and newly documented are more closely followed. Factors are further grouped based on its thrombophilic taxonomy into; inherited defects of coagulation, inherited defects of fibrinolysis, inherited defects of enzymatic pathway in relation to development of VTE and PE and inherited defects of platelets in relation to PE. It was beyond the scope of this review to follow all inherited and newly recognized factors and its association to VTE and PE; however the overall taxonomy makes this review clinically valuable i.e. in relation to genetic testing as PE prevention. PMID:21772860

Inherited trombophilic states and pulmonary embolism.

PubMed

Konecny, Filip

2009-01-01

Pulmonary embolism (PE) and deep vein thrombosis (DVT) are associated with considerable morbidity and mortality, mostly, in case of PE for its lack of sensitivity of its early detection. For as much as twenty-five percent of PE patients the primary clinical appearance is unexpected death. While PE is one of the most avertable causes of hospital associated deaths, its diagnostics can be extremely difficult. Newly increased interest in an inherited thrombophilic states has been provoked by the discovery of several common inherited abnormalities, i.e. the prothrombin (PT) gene G20210A, Factor V Leiden (FVL) mutation (Arg506Gln), hyperhomocystenemia and homocysteiuria, Wein-Penzing defect, Sticky Platelet Syndrome (SPS), Quebec platelet disorder (QPD) and Sickle Cell Disease (SCD). PE incidence rates increase exponentially with age for both men and women, as they might harbor more than one thrombophilic state. Although the impact of genetic factors on PE is to some extent documented with lacking taxonomy, its genetic testing as its prevention strategy fall short.In this review thrombophilic states are divided into inherited or acquired, and only the inherited and newly documented are more closely followed. Factors are further grouped based on its thrombophilic taxonomy into; inherited defects of coagulation, inherited defects of fibrinolysis, inherited defects of enzymatic pathway in relation to development of VTE and PE and inherited defects of platelets in relation to PE. It was beyond the scope of this review to follow all inherited and newly recognized factors and its association to VTE and PE; however the overall taxonomy makes this review clinically valuable i.e. in relation to genetic testing as PE prevention.

Defects in middle ear cavitation cause conductive hearing loss in the Tcof1 mutant mouse.

PubMed

Richter, Carol A; Amin, Susan; Linden, Jennifer; Dixon, Jill; Dixon, Michael J; Tucker, Abigail S

2010-04-15

Conductive hearing loss (CHL) is one of the most common forms of human deafness. Despite this observation, a surprising gap in our understanding of the mechanisms underlying CHL remains, particularly with respect to the molecular mechanisms underlying middle ear development and disease. Treacher Collins syndrome (TCS) is an autosomal dominant disorder of facial development that results from mutations in the gene TCOF1. CHL is a common feature of TCS but the causes of the hearing defect have not been studied. In this study, we have utilized Tcof1 mutant mice to dissect the developmental mechanisms underlying CHL. Our results demonstrate that effective cavitation of the middle ear is intimately linked to growth of the auditory bulla, the neural crest cell-derived structure that encapsulates all middle ear components, and that defects in these processes have a profoundly detrimental effect on hearing. This research provides important insights into a poorly characterized cause of human deafness, and provides the first mouse model for the study of middle ear cavity defects, while also being of direct relevance to a human genetic disorder.

Patent ductus arteriosus in mice with smooth muscle-specific Jag1 deletion

PubMed Central

Feng, Xuesong; Krebs, Luke T.; Gridley, Thomas

2010-01-01

The ductus arteriosus is an arterial vessel that shunts blood flow away from the lungs during fetal life, but normally occludes after birth to establish the adult circulation pattern. Failure of the ductus arteriosus to close after birth is termed patent ductus arteriosus and is one of the most common congenital heart defects. Mice with smooth muscle cell-specific deletion of Jag1, which encodes a Notch ligand, die postnatally from patent ductus arteriosus. These mice exhibit defects in contractile smooth muscle cell differentiation in the vascular wall of the ductus arteriosus and adjacent descending aorta. These defects arise through an inability to propagate the JAG1-Notch signal via lateral induction throughout the width of the vascular wall. Both heterotypic endothelial smooth muscle cell interactions and homotypic vascular smooth muscle cell interactions are required for normal patterning and differentiation of the ductus arteriosus and adjacent descending aorta. This new model for a common congenital heart defect provides novel insights into the genetic programs that underlie ductus arteriosus development and closure. PMID:21068062

The cell biology of polycystic kidney disease

PubMed Central

Chapin, Hannah C.

2010-01-01

Polycystic kidney disease is a common genetic disorder in which fluid-filled cysts displace normal renal tubules. Here we focus on autosomal dominant polycystic kidney disease, which is attributable to mutations in the PKD1 and PKD2 genes and which is characterized by perturbations of renal epithelial cell growth control, fluid transport, and morphogenesis. The mechanisms that connect the underlying genetic defects to disease pathogenesis are poorly understood, but their exploration is shedding new light on interesting cell biological processes and suggesting novel therapeutic targets. PMID:21079243

A Deletion of More than 800 kb Is the Most Recurrent Mutation in Chilean Patients with SHOX Gene Defects.

PubMed

Poggi, Helena; Vera, Alejandra; Avalos, Carolina; Lagos, Marcela; Mellado, Cecilia; Aracena, Mariana; Aravena, Teresa; Garcia, Hernan; Godoy, Claudia; Cattani, Andreina; Reyes, Loreto; Lacourt, Patricia; Rumie, Hana; Mericq, Veronica; Arriaza, Marta; Martinez-Aguayo, Alejandro

2015-01-01

Deletions in the SHOX gene are the most frequent genetic cause of Leri-Weill syndrome and Langer mesomelic dysplasia, which are also present in idiopathic short stature. To describe the molecular and clinical findings observed in 23 of 45 non-consanguineous Chilean patients with different phenotypes related to SHOX deficiency. Multiplex ligation-dependent probe amplification was used to detect the deletions; the SHOX coding region and deletion-flanking areas were sequenced to identify point mutations and single-nucleotide polymorphisms (SNPs). The main genetic defects identified in 21 patients consisted of deletions; one of them, a large deletion of >800 kb, was found in 8 patients. Also, a smaller deletion of >350 kb was observed in 4 patients. Although we could not precisely determine the deletion breakpoint, we were able to identify a common haplotype in 7 of the 8 patients with the larger deletion based on 22 informative SNPs. These results suggest that the large deletion-bearing allele has a common ancestor and was either introduced by European immigrants or had originated in our Amerindian population. This study allowed us to identify one recurrent deletion in Chilean patients; also, it contributed to expanding our knowledge about the genetic background of our population. © 2015 S. Karger AG, Basel.

Genetics, gene expression and bioinformatics of the pituitary gland.

PubMed

Davis, Shannon W; Potok, Mary Anne; Brinkmeier, Michelle L; Carninci, Piero; Lyons, Robert H; MacDonald, James W; Fleming, Michelle T; Mortensen, Amanda H; Egashira, Noboru; Ghosh, Debashis; Steel, Karen P; Osamura, Robert Y; Hayashizaki, Yoshihide; Camper, Sally A

2009-04-01

Genetic cases of congenital pituitary hormone deficiency are common and many are caused by transcription factor defects. Mouse models with orthologous mutations are invaluable for uncovering the molecular mechanisms that lead to problems in organ development and typical patient characteristics. We are using mutant mice defective in the transcription factors PROP1 and POU1F1 for gene expression profiling to identify target genes for these critical transcription factors and candidates for cases of pituitary hormone deficiency of unknown aetiology. These studies reveal critical roles for Wnt signalling pathways, including the TCF/LEF transcription factors and interacting proteins of the groucho family, bone morphogenetic protein antagonists and targets of notch signalling. Current studies are investigating the roles of novel homeobox genes and pathways that regulate the transition from proliferation to differentiation, cell adhesion and cell migration. Pituitary adenomas are a common human health problem, yet most cases are sporadic, necessitating alternative approaches to traditional Mendelian genetic studies. Mouse models of adenoma formation offer the opportunity for gene expression profiling during progressive stages of hyperplasia, adenoma and tumorigenesis. This approach holds promise for the identification of relevant pathways and candidate genes as risk factors for adenoma formation, understanding mechanisms of progression, and identifying drug targets and clinically relevant biomarkers. Copyright 2009 S. Karger AG, Basel.

Genetics, Gene Expression and Bioinformatics of the Pituitary Gland

PubMed Central

Davis, Shannon W; Potok, Mary Anne; Brinkmeier, Michelle L; Carninci, Piero; Lyons, Robert H; MacDonald, James W.; Fleming, Michelle T; Mortensen, Amanda H; Egashira, Noboru; Ghosh, Debashis; Steel, Karen P.; Osamura, Robert Y; Hayashizaki, Yoshihide; Camper, Sally A

2011-01-01

Genetic cases of congenital pituitary hormone deficiency are common and many are caused by transcription factor defects. Mouse models with orthologous mutations are invaluable for uncovering the molecular mechanisms that lead to problems in organ development and typical patient characteristics. We are using mutant mice defective in the transcription factors PROP1 and POU1F1 for gene expression profiling to identify target genes for these critical transcription factors and candidates for cases of pituitary hormone deficiency of unknown etiology. These studies reveal critical roles for Wnt signalling pathways including the TCF/LEF transcription factors and interacting proteins of the groucho family, bone morphogenetic proteins antagonists, and targets of notch signalling. Current studies are investigating roles of novel homeobox genes and pathways that regulate the transition from proliferation to differentiation, cell adhesion and cell migration. Pituitary adenomas are a common human health problem, yet most cases are sporadic, necessitating alternative approaches to traditional Mendelian genetic studies. Mouse models of adenoma formation offer the opportunity for gene expression profiling during progressive stages of hyperplasia, adenoma and tumorigenesis. This approach holds promise for identification of relevant pathways and candidate genes as risk factors for adenoma formation, understanding mechanisms of progression, and identifying drug targets and clinically relevant biomarkers. PMID:19407506

Bright Promise for Your Child with Cleft Lip and Cleft Palate. Revised Edition.

ERIC Educational Resources Information Center

McDonald, Eugene T.; Berlin, Asa J.

Intended for parents of children with cleft lip and cleft palate, the booklet provides an overview of the condition. Addressed are the following topics (sample subtopics in parentheses): prenatal development and birth defects (facial development); possible causes of cleft lip/cleft palate (common misconceptions, genetic factors, environmental…

Down Syndrome - Genetics and Cardiogenetics.

PubMed

Plaiasu, Vasilica

2017-09-01

During the last years, Down syndrome has been the focus of special attention. Down syndrome is a genetic disorder characterized by distinct physical features and some degree of cognitive disability. Patients with Down syndrome also present many other congenital anomalies. The mapping for phenotypes to specific regions of chromosome 21 permits to identify which genes (or small regions) contribute to the phenotypic features of Down syndrome and thus, to understand its pathogenesis. Mainly there are three cytogenetic forms of Down syndrome: free trisomy 21, mosaic trisomy 21 and robertsonian translocation trisomy 21. Prenatal and postnatal testing has become commonly used to diagnose different cases presenting the same pathology. Early clinical diagnosis is extremely important for patient prognosis. Lately, advances in Down syndrome research have been registered, but little is known about cardiovascular phenotype in Down syndrome. About half of patients with Down syndrome have congenital heart disease, and atrioventricular septal defects are the most common defects found. Basic research on Down syndrome is now rapidly accelerating, using new genomic technologies. There were many studies performed to identify a correlation between genotype and phenotype in Down syndrome.

Bone tissue ultrastructural defects in a mouse model for osteogenesis imperfecta: a Raman spectroscopy study

NASA Astrophysics Data System (ADS)

Chen, Tsoching; Kozloff, Kenneth M.; Goldstein, Steven A.; Morris, Michael D.

2004-07-01

Osteogenesis imperfecta (OI) is genetic defect in which the genes that code for the α1(I) or α2(I) chains of type I collagen are defective. The defects often result in substitution of a bulky amino acid for glycine, causing formation of collagen that can not form the normal triple helix. Depending on the details of the defects, the outcomes range from controllable to lethal. This study focuses on OI type IV, a more common and moderately severe form of the disease. People with the disease have a substantial increase in the risk and rate of fracture. We examine the spectroscopic consequences of these defects, using a mouse model (BRTL) that mimics OI type IV. We compare Raman images from tibial cortical tissue of wild-type mice and BRTL mice with single copy of mutation and show that both mineral to matrix ratios and collagen inter-fibril cross-links are different in wild-type and mutant mice.

The rare association of tetralogy of Fallot with hypertrophic cardiomyopathy. Report of 2 neonatal patients.

PubMed Central

Lewin, M B; Towbin, J A; Thapar, M K; Dreyer, W J; Feltes, T F

1997-01-01

Although tetralogy of Fallot is commonly associated with other congenital heart defects, it is rarely found in conjunction with hypertrophic cardiomyopathy. We describe the cases of 2 neonates with this rare condition, both of whom required surgical intervention during infancy. Because hypertrophic cardiomyopathy is frequently familial, and tetralogy of Fallot is commonly found in patients diagnosed with chromosomal anomalies, we speculate about a possible genetic cause for this association. PMID:9339511

Monogenic syndromes of abnormal glucose homeostasis: clinical review and relevance to the understanding of the pathology of insulin resistance and ß cell failure

PubMed Central

Porter, J; Barrett, T

2005-01-01

Type 2 diabetes mellitus is caused by a combination of insulin resistance and ß cell failure. The polygenic nature of type 2 diabetes has made it difficult to study. Although many candidate genes for this condition have been suggested, in most cases association studies have been equivocal. Monogenic forms of diabetes have now been studied extensively, and the genetic basis of many of these syndromes has been elucidated, leading to greater understanding of the functions of the genes involved. Common variations in the genes causing monogenic disorders have been associated with susceptibility to type 2 diabetes in several populations and explain some of the linkage seen in genome-wide scans. Monogenic disorders are also helpful in understanding both normal and disordered glucose and insulin metabolism. Three main areas of defect contribute to diabetes: defects in insulin signalling leading to insulin resistance; defects of insulin secretion leading to hypoinsulinaemia; and apoptosis leading to decreased ß cell mass. These three pathological pathways are reviewed, focusing on rare genetic syndromes which have diabetes as a prominent feature. Apoptosis seems to be a final common pathway in both type 1 and type 2 diabetes. Study of rare forms of diabetes may help ion determining new therapeutic targets to preserve or increase ß cell mass and function. PMID:15772126

Maternal and infant genetic variants, maternal periconceptional use of selective serotonin reuptake inhibitors, and risk of congenital heart defects in offspring: population based study.

PubMed

Nembhard, Wendy N; Tang, Xinyu; Hu, Zhuopei; MacLeod, Stewart; Stowe, Zachary; Webber, Daniel

2017-03-06

Objective  To evaluate whether the association between maternal periconceptional use of selective serotonin reuptake inhibitors (SSRIs) and increased risk of congenital heart defects in offspring is modified by maternal or infant genetic variants in folate, homocysteine, or transsulfuration pathways. Design  Population based study. DNA from mothers, fathers, and infants was genotyped with an Illumina GoldenGate custom single nucleotide polymorphism panel. A hybrid design based on a log linear model was used to calculate relative risks and Bayesian false discovery probabilities (BFDP) to identify polymorphisms associated with congenital heart defects modified by SSRI use. Data sources  Data from the US National Birth Defects Prevention Study on 1180 liveborn infants with congenital heart defects and 1644 controls, born 1997-2008. Main outcome measures  Cases included infants with selected congenital heart defects and control infants had no major defects. SSRI use was obtained from telephone interviews with mothers. Results  For women who reported taking SSRIs periconceptionally, maternal SHMT1 (rs9909104) GG and AGgenotypes were associated with a 5.9 and 2.4 increased risk of select congenital heart defects in offspring, respectively, versus the AA genotype (BFDP=0.69). Compared with the AA genotype, BHMT (rs492842 and rs542852) GG and AG genotypes were associated with twice the riskof congenital heart defects (BFDP=0.74 and 0.79, respectively). MGST1 (rs2075237) CC and ACgenotypes were associated with an increased risk compared with the GG genotype (8.0 and 2.8, respectively; BFDP=0.79). Single nucleotide polymorphism in infant genes in the folate (MTHFS rs12438477), homocysteine (TRDMT1 rs6602178 and GNMT rs11752813) and transsulfuration (GSTP1 rs7941395 and MGST1 rs7294985) pathways were also associated with an increased risk of congenital heart defects. Conclusions  Common maternal or infant genetic variants in folate, homocysteine, or transsulfuration pathways are associated with an increased risk of certain congenital heart defects among children of women taking SSRIs during cardiogenesis. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.

Genetic testing in congenital heart disease: A clinical approach

PubMed Central

Chaix, Marie A; Andelfinger, Gregor; Khairy, Paul

2016-01-01

Congenital heart disease (CHD) is the most common type of birth defect. Traditionally, a polygenic model defined by the interaction of multiple genes and environmental factors was hypothesized to account for different forms of CHD. It is now understood that the contribution of genetics to CHD extends beyond a single unified paradigm. For example, monogenic models and chromosomal abnormalities have been associated with various syndromic and non-syndromic forms of CHD. In such instances, genetic investigation and testing may potentially play an important role in clinical care. A family tree with a detailed phenotypic description serves as the initial screening tool to identify potentially inherited defects and to guide further genetic investigation. The selection of a genetic test is contingent upon the particular diagnostic hypothesis generated by clinical examination. Genetic investigation in CHD may carry the potential to improve prognosis by yielding valuable information with regards to personalized medical care, confidence in the clinical diagnosis, and/or targeted patient follow-up. Moreover, genetic assessment may serve as a tool to predict recurrence risk, define the pattern of inheritance within a family, and evaluate the need for further family screening. In some circumstances, prenatal or preimplantation genetic screening could identify fetuses or embryos at high risk for CHD. Although genetics may appear to constitute a highly specialized sector of cardiology, basic knowledge regarding inheritance patterns, recurrence risks, and available screening and diagnostic tools, including their strengths and limitations, could assist the treating physician in providing sound counsel. PMID:26981213

Osteosarcoma Genetics and Epigenetics: Emerging Biology and Candidate Therapies

PubMed Central

Morrow, James J.; Khanna, Chand

2016-01-01

Osteosarcoma is the most common primary malignancy of bone, typically presenting in the first or second decade of life. Unfortunately, clinical outcomes for osteosarcoma patients have not substantially improved in over 30 years. This stagnation in therapeutic advances is perhaps explained by the genetic, epigenetic, and biological complexities of this rare tumor. In this review we provide a general background on the biology of osteosarcoma and the clinical status quo. We go on to enumerate the genetic and epigenetic defects identified in osteosarcoma. Finally, we discuss ongoing large-scale studies in the field and potential new therapies that are currently under investigation. PMID:26349415

Synaptic proteins and receptors defects in autism spectrum disorders

PubMed Central

Chen, Jianling; Yu, Shunying; Fu, Yingmei; Li, Xiaohong

2014-01-01

Recent studies have found that hundreds of genetic variants, including common and rare variants, rare and de novo mutations, and common polymorphisms contribute to the occurrence of autism spectrum disorders (ASDs). The mutations in a number of genes such as neurexin, neuroligin, postsynaptic density protein 95, SH3, and multiple ankyrin repeat domains 3 (SHANK3), synapsin, gephyrin, cadherin, and protocadherin, thousand-and-one-amino acid 2 kinase, and contactin, have been shown to play important roles in the development and function of synapses. In addition, synaptic receptors, such as gamma-aminobutyric acid receptors and glutamate receptors, have also been associated with ASDs. This review will primarily focus on the defects of synaptic proteins and receptors associated with ASDs and their roles in the pathogenesis of ASDs via synaptic pathways. PMID:25309321

Identifying Genetic Sources of Phenotypic Heterogeneity in Orofacial Clefts by Targeted Sequencing.

PubMed

Carlson, Jenna C; Taub, Margaret A; Feingold, Eleanor; Beaty, Terri H; Murray, Jeffrey C; Marazita, Mary L; Leslie, Elizabeth J

2017-07-17

Orofacial clefts (OFCs), including nonsyndromic cleft lip with or without cleft palate (NSCL/P), are common birth defects. NSCL/P is highly heterogeneous with multiple phenotypic presentations. Two common subtypes of NSCL/P are cleft lip (CL) and cleft lip with cleft palate (CLP) which have different population prevalence. Similarly, NSCL/P can be divided into bilateral and unilateral clefts, with unilateral being the most common. Individuals with unilateral NSCL/P are more likely to be affected on the left side of the upper lip, but right side affection also occurs. Moreover, NSCL/P is twice as common in males as in females. The goal of this study is to discover genetic variants that have different effects in case subgroups. We conducted both common variant and rare variant analyses in 1034 individuals of Asian ancestry with NSCL/P, examining four sources of heterogeneity within CL/P: cleft type, sex, laterality, and side. We identified several regions associated with subtype differentiation: cleft type differences in 8q24 (p = 1.00 × 10 -4 ), laterality differences in IRF6, a gene previously implicated with wound healing (p = 2.166 × 10 -4 ), sex differences and side of unilateral CL differences in FGFR2 (p = 3.00 × 10 -4 ; p = 6.00 × 10 -4 ), and sex differences in VAX1 (p < 1.00 × 10 -4 ) among others. Many of the regions associated with phenotypic modification were either adjacent to or overlapping functional elements based on ENCODE chromatin marks and published craniofacial enhancers. We have identified multiple common and rare variants as potential phenotypic modifiers of NSCL/P, and suggest plausible elements responsible for phenotypic heterogeneity, further elucidating the complex genetic architecture of OFCs. Birth Defects Research 109:1030-1038, 2017. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

Congenital diaphragmatic hernias: from genes to mechanisms to therapies

PubMed Central

McCulley, David J.; Shen, Yufeng; Wynn, Julia; Shang, Linshan; Bogenschutz, Eric; Sun, Xin

2017-01-01

ABSTRACT Congenital diaphragmatic hernias (CDHs) and structural anomalies of the diaphragm are a common class of congenital birth defects that are associated with significant morbidity and mortality due to associated pulmonary hypoplasia, pulmonary hypertension and heart failure. In ∼30% of CDH patients, genomic analyses have identified a range of genetic defects, including chromosomal anomalies, copy number variants and sequence variants. The affected genes identified in CDH patients include transcription factors, such as GATA4, ZFPM2, NR2F2 and WT1, and signaling pathway components, including members of the retinoic acid pathway. Mutations in these genes affect diaphragm development and can have pleiotropic effects on pulmonary and cardiac development. New therapies, including fetal endoscopic tracheal occlusion and prenatal transplacental fetal treatments, aim to normalize lung development and pulmonary vascular tone to prevent and treat lung hypoplasia and pulmonary hypertension, respectively. Studies of the association between particular genetic mutations and clinical outcomes should allow us to better understand the origin of this birth defect and to improve our ability to predict and identify patients most likely to benefit from specialized treatment strategies. PMID:28768736

Forward Genetic Dissection of Biofilm Development by Fusobacterium nucleatum: Novel Functions of Cell Division Proteins FtsX and EnvC.

PubMed

Wu, Chenggang; Al Mamun, Abu Amar Mohamed; Luong, Truc Thanh; Hu, Bo; Gu, Jianhua; Lee, Ju Huck; D'Amore, Melissa; Das, Asis; Ton-That, Hung

2018-04-24

Fusobacterium nucleatum is a key member of the human oral biofilm. It is also implicated in preterm birth and colorectal cancer. To facilitate basic studies of fusobacterial virulence, we describe here a versatile transposon mutagenesis procedure and a pilot screen for mutants defective in biofilm formation. Out of 10 independent biofilm-defective mutants isolated, the affected genes included the homologs of the Escherichia coli cell division proteins FtsX and EnvC, the electron transport protein RnfA, and four proteins with unknown functions. Next, a facile new gene deletion method demonstrated that nonpolar, in-frame deletion of ftsX or envC produces viable bacteria that are highly filamentous due to defective cell division. Transmission electron and cryo-electron microscopy revealed that the Δ ftsX and Δ envC mutant cells remain joined with apparent constriction, and scanning electron microscopy (EM) uncovered a smooth cell surface without the microfolds present in wild-type cells. FtsX and EnvC proteins interact with each other as well as a common set of interacting partners, many with unknown function. Last, biofilm development is altered when cell division is blocked by MinC overproduction; however, unlike the phenotypes of Δ ftsX and Δ envC mutants, a weakly adherent biofilm is formed, and the wild-type rugged cell surface is maintained. Therefore, FtsX and EnvC may perform novel functions in Fusobacterium cell biology. This is the first report of an unbiased approach to uncover genetic determinants of fusobacterial biofilm development. It points to an intriguing link among cytokinesis, cell surface dynamics, and biofilm formation, whose molecular underpinnings remain to be elucidated. IMPORTANCE Little is known about the virulence mechanisms and associated factors in F. nucleatum , due mainly to the lack of convenient genetic tools for this organism. We employed two efficient genetic strategies to identify F. nucleatum biofilm-defective mutants, revealing FtsX and EnvC among seven biofilm-associated factors. Electron microscopy established cell division defects of the Δ ftsX and Δ envC mutants, accompanied with a smooth cell surface, unlike the microfold, rugged appearance of wild-type bacteria. Proteomic studies demonstrated that FtsX and EnvC interact with each other as well as a set of common and unique interacting proteins, many with unknown functions. Importantly, blocking cell division by MinC overproduction led to formation of a weakly adherent biofilm, without alteration of the wild-type cell surface. Thus, this work links cell division and surface dynamics to biofilm development and lays a foundation for future genetic and biochemical investigations of basic cellular processes in this clinically significant pathogen. Copyright © 2018 Wu et al.

Receptor tyrosine kinase alterations in AML - biology and therapy.

PubMed

Stirewalt, Derek L; Meshinchi, Soheil

2010-01-01

Acute myeloid leukemia (AML) is the most common form of leukemia in adults, and despite some recent progress in understanding the biology of the disease, AML remains the leading cause of leukemia-related deaths in adults and children. AML is a complex and heterogeneous disease, often involving multiple genetic defects that promote leukemic transformation and drug resistance. The cooperativity model suggests that an initial genetic event leads to maturational arrest in a myeloid progenitor cell, and subsequent genetic events induce proliferation and block apoptosis. Together, these genetic abnormalities lead to clonal expansion and frank leukemia. The purpose of this chapter is to review the biology of receptor tyrosine kinases (RTKs) in AML, exploring how RTKs are being used as novel prognostic factors and potential therapeutic targets.

Genes for normal sleep and sleep disorders.

PubMed

Tafti, Mehdi; Maret, Stéphanie; Dauvilliers, Yves

2005-01-01

Sleep and wakefulness are complex behaviors that are influenced by many genetic and environmental factors, which are beginning to be discovered. The contribution of genetic components to sleep disorders is also increasingly recognized as important. Point mutations in the prion protein, period 2, and the prepro-hypocretin/orexin gene have been found as the cause of a few sleep disorders but the possibility that other gene defects may contribute to the pathophysiology of major sleep disorders is worth in-depth investigations. However, single gene disorders are rare and most common disorders are complex in terms of their genetic susceptibility, environmental effects, gene-gene, and gene-environment interactions. We review here the current progress in the genetics of normal and pathological sleep.

National Newborn Screening and Genetics Resource Center

MedlinePlus

... GENERAL INFORMATION Conditions Screened by US Programs General Resources Genetics Birth Defects Hearing Screening FOR PROFESSIONALS ACT Sheets(ACMG) General Resources Newborn Screening Genetics Birth Defects FOR FAMILIES FAQs ...

[Progress in studies on the genetic risk factors for nonsyndromic cleft lip or palate in China].

PubMed

Huang, Y Q

2017-04-09

Cleft lip and palate is the most common congenital defects of oral and maxillofacial region in human beings. The etiology of this malformation is complex, with both genetic and environmental causal factors are involved. To provide a better understanding in the genetic etiology of cleft lip or palate, the author summarized recent years studies based on Chinese population. Those researches included validation of some candidate genes for cleft lip or palate, using genome wide association analysis which included six independent cohorts from China to elucidate the genetic architecture of non-syndromic cleft lip with or without cleft palate in Chinese population and finally found a new susceptibility locus. This locus was on the 16p13.3 (rs8049367) between CREBBP and ADCY9. It has been mentioned common methods of genetic analysis involved in the researches on cleft lip or palate in this paper. Furthermore, we try to discuss new methods to illustrate the etiology of cleft lip and palate that could provide more inspiration on future researches.

Molecular genetic studies in a case series of isolated hypoaldosteronism due to biosynthesis defects or aldosterone resistance.

PubMed

Turan, Ihsan; Kotan, Leman Damla; Tastan, Mehmet; Gurbuz, Fatih; Topaloglu, Ali Kemal; Yuksel, Bilgin

2018-06-01

Hypoaldosteronism is associated with either insufficient aldosterone production or aldosterone resistance (pseudohypoaldosteronism). Patients with aldosterone defects typically present with similar symptoms and findings, which include failure to thrive, vomiting, hyponatremia, hyperkalemia and metabolic acidosis. Accurate diagnosis of these clinical conditions therefore can be challenging. Molecular genetic analyses can help to greatly clarify this complexity. The aim of this study was to obtain an overview of the clinical and genetic characteristics of patients with aldosterone defects due to biosynthesis defects or aldosterone resistance. We investigated the clinical and molecular genetic features of 8 consecutive patients with a clinical picture of aldosterone defects seen in our clinics during the period of May 2015 through October 2017. We screened CYP11B2 for aldosterone synthesis defects and NR3C2 and the three EnaC subunits (SCNN1A, SCNN1B and SCNN1G) for aldosterone resistance. We found 4 novel and 2 previously reported mutations in the genes CYP11B2, NR3C2, SCNN1A and SCNN1G in 9 affected individuals from 7 unrelated families. Molecular genetic investigations can help confidently diagnose these conditions and clarify the pathogenicity of aldosterone defects. This study may expand the clinical and genetic correlations of defects in aldosterone synthesis or resistance. © 2018 John Wiley & Sons Ltd.

Inflammatory Bowel Disease in Primary Immunodeficiencies.

PubMed

Kelsen, Judith R; Sullivan, Kathleen E

2017-08-01

Inflammatory bowel disease is most often a polygenic disorder with contributions from the intestinal microbiome, defects in barrier function, and dysregulated host responses to microbial stimulation. There is, however, increasing recognition of single gene defects that underlie a subset of patients with inflammatory bowel disease, particularly those with early-onset disease, and this review focuses on the primary immunodeficiencies associated with early-onset inflammatory bowel disease. The advent of next-generation sequencing has led to an improved recognition of single gene defects underlying some cases of inflammatory bowel disease. Among single gene defects, immune response genes are the most frequent category identified. This is also true of common genetic variants associated with inflammatory bowel disease, supporting a pivotal role for host responses in the pathogenesis. This review focuses on practical aspects related to diagnosis and management of children with inflammatory bowel disease who have underlying primary immunodeficiencies.

Proposed Strategy for Selection Against Recessive Genetic Defects Through a Combination of Inbreeding and DNA Markers

USDA-ARS?s Scientific Manuscript database

Recessive genetic defects are currently on the minds of many cattle breeders. The relatively rapid development of diagnostic DNA tests for recessive defects appears to be a major recent technological advancement. However, the attitude of breeders and breed associations toward recessive defects seems...

Genetic Drivers of Kidney Defects in the DiGeorge Syndrome

PubMed Central

Lopez-Rivera, E.; Liu, Y.P.; Verbitsky, M.; Anderson, B.R.; Capone, V.P.; Otto, E.A.; Yan, Z.; Mitrotti, A.; Martino, J.; Steers, N.J.; Fasel, D.A.; Vukojevic, K.; Deng, R.; Racedo, S.E.; Liu, Q.; Werth, M.; Westland, R.; Vivante, A.; Makar, G.S.; Bodria, M.; Sampson, M.G.; Gillies, C.E.; Vega-Warner, V.; Maiorana, M.; Petrey, D.S.; Honig, B.; Lozanovski, V.J.; Salomon, R.; Heidet, L.; Carpentier, W.; Gaillard, D.; Carrea, A.; Gesualdo, L.; Cusi, D.; Izzi, C.; Scolari, F.; van Wijk, J.A.E.; Arapovic, A.; Saraga-Babic, M.; Saraga, M.; Kunac, N.; Samii, A.; McDonald-McGinn, D.M.; Crowley, T.B.; Zackai, E.H.; Drozdz, D.; Miklaszewska, M.; Tkaczyk, M.; Sikora, P.; Szczepanska, M.; Mizerska-Wasiak, M.; Krzemien, G.; Szmigielska, A.; Zaniew, M.; Darlow, J.M.; Puri, P.; Barton, D.; Casolari, E.; Furth, S.L.; Warady, B.A.; Gucev, Z.; Hakonarson, H.; Flogelova, H.; Tasic, V.; Latos-Bielenska, A.; Materna-Kiryluk, A.; Allegri, L.; Wong, C.S.; Drummond, I.A.; D’Agati, V.; Imamoto, A.; Barasch, J.M.; Hildebrandt, F.; Kiryluk, K.; Lifton, R.P.; Morrow, B.E.; Jeanpierre, C.; Papaioannou, V.E.; Ghiggeri, G.M.; Gharavi, A.G.; Katsanis, N.; Sanna-Cherchi, S.

2017-01-01

BACKGROUND The DiGeorge syndrome, the most common of the microdeletion syndromes, affects multiple organs, including the heart, the nervous system, and the kidney. It is caused by deletions on chromosome 22q11.2; the genetic driver of the kidney defects is unknown. METHODS We conducted a genomewide search for structural variants in two cohorts: 2080 patients with congenital kidney and urinary tract anomalies and 22,094 controls. We performed exome and targeted resequencing in samples obtained from 586 additional patients with congenital kidney anomalies. We also carried out functional studies using zebrafish and mice. RESULTS We identified heterozygous deletions of 22q11.2 in 1.1% of the patients with congenital kidney anomalies and in 0.01% of population controls (odds ratio, 81.5; P=4.5×10−14). We localized the main drivers of renal disease in the DiGeorge syndrome to a 370-kb region containing nine genes. In zebrafish embryos, an induced loss of function in snap29, aifm3, and crkl resulted in renal defects; the loss of crkl alone was sufficient to induce defects. Five of 586 patients with congenital urinary anomalies had newly identified, heterozygous protein-altering variants, including a premature termination codon, in CRKL. The inactivation of Crkl in the mouse model induced developmental defects similar to those observed in patients with congenital urinary anomalies. CONCLUSIONS We identified a recurrent 370-kb deletion at the 22q11.2 locus as a driver of kidney defects in the DiGeorge syndrome and in sporadic congenital kidney and urinary tract anomalies. Of the nine genes at this locus, SNAP29, AIFM3, and CRKL appear to be critical to the phenotype, with haploinsufficiency of CRKL emerging as the main genetic driver. (Funded by the National Institutes of Health and others.) PMID:28121514

Modeling Axonal Defects in Hereditary Spastic Paraplegia with Human Pluripotent Stem Cells

PubMed Central

Denton, Kyle R.; Xu, Chongchong; Shah, Harsh; Li, Xue-Jun

2016-01-01

BACKGROUND Cortical motor neurons, also known as upper motor neurons, are large projection neurons whose axons convey signals to lower motor neurons to control the muscle movements. Degeneration of cortical motor neuron axons is implicated in several debilitating disorders, including hereditary spastic paraplegia (HSP) and amyotrophic lateral sclerosis (ALS). Since the discovery of the first HSP gene, SPAST that encodes spastin, over 70 distinct genetic loci associated with HSP have been identified. How the mutations of these functionally diverse genes result in axonal degeneration and why certain axons are affected in HSP remains largely unknown. The development of induced pluripotent stem cell (iPSC) technology has provided researchers an excellent resource to generate patient-specific human neurons to model human neuropathologic processes including axonal defects. METHODS In this article, we will frst review the pathology and pathways affected in the common forms of HSP subtypes by searching the PubMed database. We will then summurize the findings and insights gained from studies using iPSC-based models, and discuss the challenges and future directions. RESULTS HSPs, a heterogeneous group of genetic neurodegenerative disorders, are characterized by lower extremity weakness and spasticity that result from retrograde axonal degeneration of cortical motor neurons. Recently, iPSCs have been generated from several common forms of HSP including SPG4, SPG3A, and SPG11 patients. Neurons derived from HSP iPSCs exhibit disease-relevant axonal defects, such as impaired neurite outgrowth, increased axonal swellings, and reduced axonal transport. CONCLUSION These patient-derived neurons offer unique tools to study the pathogenic mechanisms and explore the treatments for rescuing axonal defects in HSP, as well as other diseases involving axonopathy. PMID:27956894

Genetics of hereditary disorders of magnesium homeostasis.

PubMed

Schlingmann, Karl P; Konrad, Martin; Seyberth, Hannsjörg W

2004-01-01

Magnesium plays an essential role in many biochemical and physiological processes. Homeostasis of magnesium is tightly regulated and depends on the balance between intestinal absorption and renal excretion. During the last decades, various hereditary disorders of magnesium handling have been clinically characterized and genetic studies in affected individuals have led to the identification of some molecular components of cellular magnesium transport. In addition to these hereditary forms of magnesium deficiency, recent studies have revealed a high prevalence of latent hypomagnesemia in the general population. This finding is of special interest in view of the association between hypomagnesemia and common chronic diseases such as diabetes, coronary heart disease, hypertension, and asthma. However, valuable methods for the diagnosis of body and tissue magnesium deficiency are still lacking. This review focuses on clinical and genetic aspects of hereditary disorders of magnesium homeostasis. We will review primary defects of epithelial magnesium transport, disorders associated with defects in Ca(2+)/ Mg(2+) sensing, as well as diseases characterized by renal salt wasting and hypokalemic alkalosis, with special emphasis on disturbed magnesium homeostasis.

Genetic Modifiers of the Physical Malformations in Velo-Cardio-Facial Syndrome/DiGeorge Syndrome

ERIC Educational Resources Information Center

Aggarwal, Vimla S.; Morrow, Bernice E.

2008-01-01

Velo-cardio-facial syndrome/DiGeorge syndrome (VCFS/DGS), the most common micro-deletion disorder in humans, is characterized by craniofacial, parathyroid, and thymic defects as well as cardiac outflow tract malformations. Most patients have a similar hemizygous 3 million base pair deletion on 22q11.2. Studies in mouse have shown that "Tbx1", a…

DEHP (DI-N-ETHYLHEXYL PHTHALATE), WHEN ADMINISTERED DURING SEXUAL DIFFERENTIATION, INDUCES DOSE DEPENDENT DECREASES IN FETAL TESTIS INSL3 GENE EXPRESSION AND STERIOD HORMONE SYNTHESIS

EPA Science Inventory

Cryptorchidism is a fairly common human malformation, being displayed in 1-3 males per 100 at birth. Since only a small percentage of these lesions can be linked to known genetic defects, developmental exposure to man-made chemicals has been implicated in the increase in thisrepr...

Genetic Counseling for Congenital Heart Defects

MedlinePlus

... Artery Disease Venous Thromboembolism Aortic Aneurysm More Genetic Counseling for Congenital Heart Defects Updated:Jan 19,2018 ... with congenital heart disease considers having children. Genetic counseling can help answer these questions and address your ...

Common and Specific Protein Accumulation Patterns in Different Albino/Pale-Green Mutants Reveals Regulon Organization at the Proteome Level1[W

PubMed Central

Motohashi, Reiko; Rödiger, Anja; Agne, Birgit; Baerenfaller, Katja; Baginsky, Sacha

2012-01-01

Research interest in proteomics is increasingly shifting toward the reverse genetic characterization of gene function at the proteome level. In plants, several distinct gene defects perturb photosynthetic capacity, resulting in the loss of chlorophyll and an albino or pale-green phenotype. Because photosynthesis is interconnected with the entire plant metabolism and its regulation, all albino plants share common characteristics that are determined by the switch from autotrophic to heterotrophic growth. Reverse genetic characterizations of such plants often cannot distinguish between specific consequences of a gene defect from generic effects in response to perturbations in photosynthetic capacity. Here, we set out to define common and specific features of protein accumulation in three different albino/pale-green plant lines. Using quantitative proteomics, we report a common molecular phenotype that connects the loss of photosynthetic capacity with other chloroplast and cellular functions, such as protein folding and stability, plastid protein import, and the expression of stress-related genes. Surprisingly, we do not find significant differences in the expression of key transcriptional regulators, suggesting that substantial regulation occurs at the posttranscriptional level. We examine the influence of different normalization schemes on the quantitative proteomics data and report all identified proteins along with their fold changes and P values in albino plants in comparison with the wild type. Our analysis provides initial guidance for the distinction between general and specific adaptations of the proteome in photosynthesis-impaired plants. PMID:23027667

Engineered chromosome-based genetic mapping establishes a 3.7 Mb critical genomic region for Down syndrome-associated heart defects in mice.

PubMed

Liu, Chunhong; Morishima, Masae; Jiang, Xiaoling; Yu, Tao; Meng, Kai; Ray, Debjit; Pao, Annie; Ye, Ping; Parmacek, Michael S; Yu, Y Eugene

2014-06-01

Trisomy 21 (Down syndrome, DS) is the most common human genetic anomaly associated with heart defects. Based on evolutionary conservation, DS-associated heart defects have been modeled in mice. By generating and analyzing mouse mutants carrying different genomic rearrangements in human chromosome 21 (Hsa21) syntenic regions, we found the triplication of the Tiam1-Kcnj6 region on mouse chromosome 16 (Mmu16) resulted in DS-related cardiovascular abnormalities. In this study, we developed two tandem duplications spanning the Tiam1-Kcnj6 genomic region on Mmu16 using recombinase-mediated genome engineering, Dp(16)3Yey and Dp(16)4Yey, spanning the 2.1 Mb Tiam1-Il10rb and 3.7 Mb Ifnar1-Kcnj6 regions, respectively. We found that Dp(16)4Yey/+, but not Dp(16)3Yey/+, led to heart defects, suggesting the triplication of the Ifnar1-Kcnj6 region is sufficient to cause DS-associated heart defects. Our transcriptional analysis of Dp(16)4Yey/+ embryos showed that the Hsa21 gene orthologs located within the duplicated interval were expressed at the elevated levels, reflecting the consequences of the gene dosage alterations. Therefore, we have identified a 3.7 Mb genomic region, the smallest critical genomic region, for DS-associated heart defects, and our results should set the stage for the final step to establish the identities of the causal gene(s), whose elevated expression(s) directly underlie this major DS phenotype.

Phenotype-genotype correlations in Leigh syndrome: new insights from a multicentre study of 96 patients.

PubMed

Sofou, Kalliopi; de Coo, Irenaeus F M; Ostergaard, Elsebet; Isohanni, Pirjo; Naess, Karin; De Meirleir, Linda; Tzoulis, Charalampos; Uusimaa, Johanna; Lönnqvist, Tuula; Bindoff, Laurence Albert; Tulinius, Már; Darin, Niklas

2018-01-01

Leigh syndrome is a phenotypically and genetically heterogeneous mitochondrial disorder. While some genetic defects are associated with well-described phenotypes, phenotype-genotype correlations in Leigh syndrome are not fully explored. We aimed to identify phenotype-genotype correlations in Leigh syndrome in a large cohort of systematically evaluated patients. We studied 96 patients with genetically confirmed Leigh syndrome diagnosed and followed in eight European centres specialising in mitochondrial diseases. We found that ataxia, ophthalmoplegia and cardiomyopathy were more prevalent among patients with mitochondrial DNA defects. Patients with mutations in MT-ND and NDUF genes with complex I deficiency shared common phenotypic features, such as early development of central nervous system disease, followed by high occurrence of cardiac and ocular manifestations. The cerebral cortex was affected in patients with NDUF mutations significantly more often than the rest of the cohort. Patients with the m.8993T>G mutation in MT-ATP6 gene had more severe clinical and radiological manifestations and poorer disease outcome compared with patients with the m.8993T>C mutation. Our study provides new insights into phenotype-genotype correlations in Leigh syndrome and particularly in patients with complex I deficiency and with defects in the mitochondrial ATP synthase. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2018. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

Advantages and pitfalls of an extended gene panel for investigating complex neurometabolic phenotypes.

PubMed

Reid, Emma S; Papandreou, Apostolos; Drury, Suzanne; Boustred, Christopher; Yue, Wyatt W; Wedatilake, Yehani; Beesley, Clare; Jacques, Thomas S; Anderson, Glenn; Abulhoul, Lara; Broomfield, Alex; Cleary, Maureen; Grunewald, Stephanie; Varadkar, Sophia M; Lench, Nick; Rahman, Shamima; Gissen, Paul; Clayton, Peter T; Mills, Philippa B

2016-11-01

Neurometabolic disorders are markedly heterogeneous, both clinically and genetically, and are characterized by variable neurological dysfunction accompanied by suggestive neuroimaging or biochemical abnormalities. Despite early specialist input, delays in diagnosis and appropriate treatment initiation are common. Next-generation sequencing approaches still have limitations but are already enabling earlier and more efficient diagnoses in these patients. We designed a gene panel targeting 614 genes causing inborn errors of metabolism and tested its diagnostic efficacy in a paediatric cohort of 30 undiagnosed patients presenting with variable neurometabolic phenotypes. Genetic defects that could, at least partially, explain observed phenotypes were identified in 53% of cases. Where biochemical abnormalities pointing towards a particular gene defect were present, our panel identified diagnoses in 89% of patients. Phenotypes attributable to defects in more than one gene were seen in 13% of cases. The ability of in silico tools, including structure-guided prediction programmes to characterize novel missense variants were also interrogated. Our study expands the genetic, clinical and biochemical phenotypes of well-characterized (POMGNT1, TPP1) and recently identified disorders (PGAP2, ACSF3, SERAC1, AFG3L2, DPYS). Overall, our panel was accurate and efficient, demonstrating good potential for applying similar approaches to clinically and biochemically diverse neurometabolic disease cohorts. © The Author (2016). Published by Oxford University Press on behalf of the Guarantors of Brain.

Shared molecular networks in orofacial and neural tube development.

PubMed

Kousa, Youssef A; Mansour, Tamer A; Seada, Haitham; Matoo, Samaneh; Schutte, Brian C

2017-01-30

Single genetic variants can affect multiple tissues during development. Thus it is possible that disruption of shared gene regulatory networks might underlie syndromic presentations. In this study, we explore this idea through examination of two critical developmental programs that control orofacial and neural tube development and identify shared regulatory factors and networks. Identification of these networks has the potential to yield additional candidate genes for poorly understood developmental disorders and assist in modeling and perhaps managing risk factors to prevent morbidly and mortality. We reviewed the literature to identify genes common between orofacial and neural tube defects and development. We then conducted a bioinformatic analysis to identify shared molecular targets and pathways in the development of these tissues. Finally, we examine publicly available RNA-Seq data to identify which of these genes are expressed in both tissues during development. We identify common regulatory factors in orofacial and neural tube development. Pathway enrichment analysis shows that folate, cancer and hedgehog signaling pathways are shared in neural tube and orofacial development. Developing neural tissues differentially express mouse exencephaly and cleft palate genes, whereas developing orofacial tissues were enriched for both clefting and neural tube defect genes. These data suggest that key developmental factors and pathways are shared between orofacial and neural tube defects. We conclude that it might be most beneficial to focus on common regulatory factors and pathways to better understand pathology and develop preventative measures for these birth defects. Birth Defects Research 109:169-179, 2017. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

Osteogenesis imperfecta due to mutations in non-collagenous genes: lessons in the biology of bone formation.

PubMed

Marini, Joan C; Reich, Adi; Smith, Simone M

2014-08-01

Osteogenesis imperfecta or 'brittle bone disease' has mainly been considered a bone disorder caused by collagen mutations. Within the last decade, however, a surge of genetic discoveries has created a new paradigm for osteogenesis imperfecta as a collagen-related disorder, where most cases are due to autosomal dominant type I collagen defects, while rare, mostly recessive, forms are due to defects in genes whose protein products interact with collagen protein. This review is both timely and relevant in outlining the genesis, development, and future of this paradigm shift in the understanding of osteogenesis imperfecta. Bone-restricted interferon-induced transmembrane (IFITM)-like protein (BRIL) and pigment epithelium-derived factor (PEDF) defects cause types V and VI osteogenesis imperfecta via defective bone mineralization, while defects in cartilage-associated protein (CRTAP), prolyl 3-hydroxylase 1 (P3H1), and cyclophilin B (CYPB) cause types VII-IX osteogenesis imperfecta via defective collagen post-translational modification. Heat shock protein 47 (HSP47) and FK506-binding protein-65 (FKBP65) defects cause types X and XI osteogenesis imperfecta via aberrant collagen crosslinking, folding, and chaperoning, while defects in SP7 transcription factor, wingless-type MMTV integration site family member 1 (WNT1), trimeric intracellular cation channel type b (TRIC-B), and old astrocyte specifically induced substance (OASIS) disrupt osteoblast development. Finally, absence of the type I collagen C-propeptidase bone morphogenetic protein 1 (BMP1) causes type XII osteogenesis imperfecta due to altered collagen maturation/processing. Identification of these multiple causative defects has provided crucial information for accurate genetic counseling, inspired a recently proposed functional grouping of osteogenesis imperfecta types by shared mechanism to simplify current nosology, and has prodded investigations into common pathways in osteogenesis imperfecta. Such investigations could yield critical information on cellular and bone tissue mechanisms and translate to new mechanistic insight into clinical therapies for patients.

Cystic fibrosis.

PubMed

O'Sullivan, Brian P; Freedman, Steven D

2009-05-30

Cystic fibrosis is the most common lethal genetic disease in white populations. The outlook for patients with the disease has improved steadily over many years, largely as a result of earlier diagnosis, more aggressive therapy, and provision of care in specialised centres. Researchers now have a more complete understanding of the molecular-biological defect that underlies cystic fibrosis, which is leading to new approaches to treatment. One of these treatments, hypertonic saline, is already in use, whereas others are in advanced stages of development. We review clinical care for cystic fibrosis and discuss recent advances in the understanding of its pathogenesis, implementation of screening of neonates, and development of therapies aimed at treating the basic defect.

Facts about Down Syndrome for Women over 35.

ERIC Educational Resources Information Center

National Inst. of Child Health and Human Development (NIH), Bethesda, MD.

This booklet presents facts about Down Syndrome for women over 35 years of age. Down Syndrome is one of the most common causes of severe mental retardation. The chances of bearing a child with a genetic defect such as Down Syndrome increase sharply with maternal age (1 in 900 for women aged 30 to 1 in 12 for women aged 48). Answers are provided to…

The Molecular Basis of Hereditary Enamel Defects in Humans

PubMed Central

Carrion, I.A.; Morris, C.

2015-01-01

The formation of human enamel is highly regulated at the molecular level and involves thousands of genes. Requisites for development of this highly mineralized tissue include cell differentiation; production of a unique extracellular matrix; processing of the extracellular matrix; altering of cell function during different stages of enamel formation; cell movement and attachment; regulation of ion and protein movement; and regulation of hydration, pH, and other conditions of the microenvironment, to name just a few. Not surprising, there is a plethora of hereditary conditions with an enamel phenotype. The objective of this review was to identify the hereditary conditions listed on Online Mendelian Inheritance in Man (OMIM) that have an associated enamel phenotype and whether a causative gene has been identified. The OMIM database was searched with the terms amelogenesis, enamel, dental, and tooth, and all results were screened by 2 individuals to determine if an enamel phenotype was identified. Gene and gene product function was reviewed on OMIM and from publications identified in PubMed. The search strategy revealed 91 conditions listed in OMIM as having an enamel phenotype, and of those, 71 have a known molecular etiology or linked genetic loci. The purported protein function of those conditions with a known genetic basis included enzymes, regulatory proteins, extracellular matrix proteins, transcription factors, and transmembrane proteins. The most common enamel phenotype was a deficient amount of enamel, or enamel hypoplasia, with hypomineralization defects being reported less frequently. Knowing these molecular defects allows an initial cataloging of molecular pathways that lead to hereditary enamel defects in humans. This knowledge provides insight into the diverse molecular pathways involved in enamel formation and can be useful when searching for the genetic etiology of hereditary conditions that involve enamel. PMID:25389004

Rare copy number variants in a population-based investigation of hypoplastic right heart syndrome.

PubMed

Dimopoulos, Aggeliki; Sicko, Robert J; Kay, Denise M; Rigler, Shannon L; Druschel, Charlotte M; Caggana, Michele; Browne, Marilyn L; Fan, Ruzong; Romitti, Paul A; Brody, Lawrence C; Mills, James L

2017-01-20

Hypoplastic right heart syndrome (HRHS) is a rare congenital defect characterized by underdevelopment of the right heart structures commonly accompanied by an atrial septal defect. Familial HRHS reports suggest genetic factor involvement. We examined the role of copy number variants (CNVs) in HRHS. We genotyped 32 HRHS cases identified from all New York State live births (1998-2005) using Illumina HumanOmni2.5 microarrays. CNVs were called with PennCNV and prioritized if they were ≥20 Kb, contained ≥10 SNPs and had minimal overlap with CNVs from in-house controls, the Database of Genomic Variants, HapMap3, and Childrens Hospital of Philadelphia database. We identified 28 CNVs in 17 cases; several encompassed genes important for right heart development. One case had a 2p16-2p23 duplication spanning LBH, a limb and heart development transcription factor. Lbh mis-expression results in right ventricular hypoplasia and pulmonary valve defects. This duplication also encompassed SOS1, a factor associated with pulmonary valve stenosis in Noonan syndrome. Sos1 -/- mice display thin and poorly trabeculated ventricles. In another case, we identified a 1.5 Mb deletion associated with Williams-Beuren syndrome, a disorder that includes valvular malformations. A third case had a 24 Kb deletion upstream of the TGFβ ligand ITGB8. Embryos genetically null for Itgb8, and its intracellular interactant Band 4.1B, display lethal cardiac phenotypes. To our knowledge, this is the first study of CNVs in HRHS. We identified several rare CNVs that overlap genes related to right ventricular wall and valve development, suggesting that genetics plays a role in HRHS and providing clues for further investigation. Birth Defects Research 109:16-26, 2017. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

The molecular basis of hereditary enamel defects in humans.

PubMed

Wright, J T; Carrion, I A; Morris, C

2015-01-01

The formation of human enamel is highly regulated at the molecular level and involves thousands of genes. Requisites for development of this highly mineralized tissue include cell differentiation; production of a unique extracellular matrix; processing of the extracellular matrix; altering of cell function during different stages of enamel formation; cell movement and attachment; regulation of ion and protein movement; and regulation of hydration, pH, and other conditions of the microenvironment, to name just a few. Not surprising, there is a plethora of hereditary conditions with an enamel phenotype. The objective of this review was to identify the hereditary conditions listed on Online Mendelian Inheritance in Man (OMIM) that have an associated enamel phenotype and whether a causative gene has been identified. The OMIM database was searched with the terms amelogenesis, enamel, dental, and tooth, and all results were screened by 2 individuals to determine if an enamel phenotype was identified. Gene and gene product function was reviewed on OMIM and from publications identified in PubMed. The search strategy revealed 91 conditions listed in OMIM as having an enamel phenotype, and of those, 71 have a known molecular etiology or linked genetic loci. The purported protein function of those conditions with a known genetic basis included enzymes, regulatory proteins, extracellular matrix proteins, transcription factors, and transmembrane proteins. The most common enamel phenotype was a deficient amount of enamel, or enamel hypoplasia, with hypomineralization defects being reported less frequently. Knowing these molecular defects allows an initial cataloging of molecular pathways that lead to hereditary enamel defects in humans. This knowledge provides insight into the diverse molecular pathways involved in enamel formation and can be useful when searching for the genetic etiology of hereditary conditions that involve enamel. © International & American Associations for Dental Research 2014.

Impact of noncardiac congenital and genetic abnormalities on outcomes in hypoplastic left heart syndrome.

PubMed

Patel, Angira; Hickey, Edward; Mavroudis, Constantine; Jacobs, Jeffrey P; Jacobs, Marshall L; Backer, Carl L; Gevitz, Melanie; Mavroudis, Constantine D

2010-06-01

Hypoplastic left heart syndrome may coexist with noncardiac congenital defects or genetic syndromes. We explored the impact of such lesions on outcomes after staged univentricular palliation. Society of Thoracic Surgeons database 2002 to 2006: Children diagnosed with hypoplastic left heart syndrome who underwent stage 1 Norwood (n = 1,236), stage 2 superior cavopulmonary anastamosis (n = 702) or stage 3 Fontan (n = 553) procedures were studied. In-hospital mortality, postoperative complications, and length of stay were compared at each stage between those with and without noncardiac-genetic defects. Congenital Heart Surgeons' Society database 1994 to 2001: All 703 infants enrolled in the Congenital Heart Surgeons' Society critical left ventricular outflow tract obstruction study who underwent primary stage 1 palliation were reviewed. The impact of noncardiac defects-syndromes on survival was explored using multivariable parametric models with bootstrap bagging. Society of Thoracic Surgeons database: Stage 1 in-hospital mortality (26% vs 20%, p = 0.04) and mean postoperative length of stay (42 versus 31 days, p < 0.0001) were greater, and postoperative complications significantly more prevalent in infants with noncardiac-genetic defects. Congenital Heart Surgeons' Society database: Noncardiac-genetic defects were present in 55 (8%). Early hazard for death after Norwood was significantly worse in infants with noncardiac defects-syndromes (p = 0.008). Chromosomal defects (n = 14) were highly unfavorable: the early risk of death was doubled (10-year survival 25 +/- 9% vs 54 +/- 2%, p = 0.005). Turner syndrome accounted for the majority of chromosomal defects in this population (11 of 14, 79%). Mode of death was rarely attributable to the noncardiac-genetic defect. Survival in hypoplastic left heart syndrome is strongly influenced by the presence of noncardiac abnormalities. Strategies to improve mortality in infants with noncardiac abnormalities should be explored. Presence of chromosomal defects, especially Turner syndrome, should enter decision-management options for parents and physicians. 2010 The Society of Thoracic Surgeons. Published by Elsevier Inc. All rights reserved.

Genome-wide mapping in a house mouse hybrid zone reveals hybrid sterility loci and Dobzhansky-Muller interactions.

PubMed

Turner, Leslie M; Harr, Bettina

2014-12-09

Mapping hybrid defects in contact zones between incipient species can identify genomic regions contributing to reproductive isolation and reveal genetic mechanisms of speciation. The house mouse features a rare combination of sophisticated genetic tools and natural hybrid zones between subspecies. Male hybrids often show reduced fertility, a common reproductive barrier between incipient species. Laboratory crosses have identified sterility loci, but each encompasses hundreds of genes. We map genetic determinants of testis weight and testis gene expression using offspring of mice captured in a hybrid zone between M. musculus musculus and M. m. domesticus. Many generations of admixture enables high-resolution mapping of loci contributing to these sterility-related phenotypes. We identify complex interactions among sterility loci, suggesting multiple, non-independent genetic incompatibilities contribute to barriers to gene flow in the hybrid zone.

Genetic modifiers of Velo- cardio- facial syndrome/DiGeorge syndrome

PubMed Central

Aggarwal, Vimla S.; Morrow, Bernice E.

2009-01-01

Velo-cardio-facial syndrome/DiGeorge syndrome (VCFS/DGS), the most common micro-deletion disorder in humans, is characterized by craniofacial, parathyroid and thymic defects as well as cardiac outflow tract malformations. Most patients have a similar hemizygous 3 million base pair deletion on 22q11.2. Studies in mouse have shown that Tbx1, a T- box containing transcription factor present on the deleted region, is likely responsible for the etiology of the syndrome. Furthermore, mutations in TBX1 have been found in rare non-deleted patients. Despite having the same sized deletion, most VCFS/DGS patients exhibit significant clinical variability. Stochastic, environmental and genetic factors likely modify the phenotype of patients with the disorder. Here, we review mouse genetics studies which may help identify genetic modifiers for VCFS/DGS. PMID:18636633

[Folic acid: Primary prevention of neural tube defects. Literature Review].

PubMed

Llamas Centeno, M J; Miguélez Lago, C

2016-03-01

Neural tube defects (NTD) are the most common congenital malformations of the nervous system, they have a multifactorial etiology, are caused by exposure to chemical, physical or biological toxic agents, factors deficiency, diabetes, obesity, hyperthermia, genetic alterations and unknown causes. Some of these factors are associated with malnutrition by interfering with the folic acid metabolic pathway, the vitamin responsible for neural tube closure. Its deficit produce anomalies that can cause abortions, stillbirths or newborn serious injuries that cause disability, impaired quality of life and require expensive treatments to try to alleviate in some way the alterations produced in the embryo. Folic acid deficiency is considered the ultimate cause of the production of neural tube defects, it is clear the reduction in the incidence of Espina Bifida after administration of folic acid before conception, this leads us to want to further study the action of folic acid and its application in the primary prevention of neural tube defects. More than 40 countries have made the fortification of flour with folate, achieving encouraging data of decrease in the prevalence of neural tube defects. This paper attempts to make a literature review, which clarify the current situation and future of the prevention of neural tube defects.

Genetic, Hormonal, and Physiological Analysis of Late Maturity α-Amylase in Wheat1[W][OA

PubMed Central

Barrero, Jose M.; Mrva, Kolumbina; Talbot, Mark J.; White, Rosemary G.; Taylor, Jennifer; Gubler, Frank; Mares, Daryl J.

2013-01-01

Late maturity α-amylase (LMA) is a genetic defect that is commonly found in bread wheat (Triticum aestivum) cultivars and can result in commercially unacceptably high levels of α-amylase in harvest-ripe grain in the absence of rain or preharvest sprouting. This defect represents a serious problem for wheat farmers, and apart from the circumstantial evidence that gibberellins are somehow involved in the expression of LMA, the mechanisms or genes underlying LMA are unknown. In this work, we use a doubled haploid population segregating for constitutive LMA to physiologically analyze the appearance of LMA during grain development and to profile the transcriptomic and hormonal changes associated with this phenomenon. Our results show that LMA is a consequence of a very narrow and transitory peak of expression of genes encoding high-isoelectric point α-amylase during grain development and that the LMA phenotype seems to be a partial or incomplete gibberellin response emerging from a strongly altered hormonal environment. PMID:23321420

Theoretical aspects of autism: causes--a review.

PubMed

Ratajczak, Helen V

2011-01-01

Autism, a member of the pervasive developmental disorders (PDDs), has been increasing dramatically since its description by Leo Kanner in 1943. First estimated to occur in 4 to 5 per 10,000 children, the incidence of autism is now 1 per 110 in the United States, and 1 per 64 in the United Kingdom, with similar incidences throughout the world. Searching information from 1943 to the present in PubMed and Ovid Medline databases, this review summarizes results that correlate the timing of changes in incidence with environmental changes. Autism could result from more than one cause, with different manifestations in different individuals that share common symptoms. Documented causes of autism include genetic mutations and/or deletions, viral infections, and encephalitis following vaccination. Therefore, autism is the result of genetic defects and/or inflammation of the brain. The inflammation could be caused by a defective placenta, immature blood-brain barrier, the immune response of the mother to infection while pregnant, a premature birth, encephalitis in the child after birth, or a toxic environment.

UDP-glucose Dehydrogenase Polymorphisms from Patients with Congenital Heart Valve Defects Disrupt Enzyme Stability and Quaternary Assembly*

PubMed Central

Hyde, Annastasia S.; Farmer, Erin L.; Easley, Katherine E.; van Lammeren, Kristy; Christoffels, Vincent M.; Barycki, Joseph J.; Bakkers, Jeroen; Simpson, Melanie A.

2012-01-01

Cardiac valve defects are a common congenital heart malformation and a significant clinical problem. Defining molecular factors in cardiac valve development has facilitated identification of underlying causes of valve malformation. Gene disruption in zebrafish revealed a critical role for UDP-glucose dehydrogenase (UGDH) in valve development, so this gene was screened for polymorphisms in a patient population suffering from cardiac valve defects. Two genetic substitutions were identified and predicted to encode missense mutations of arginine 141 to cysteine and glutamate 416 to aspartate, respectively. Using a zebrafish model of defective heart valve formation caused by morpholino oligonucleotide knockdown of UGDH, transcripts encoding the UGDH R141C or E416D mutant enzymes were unable to restore cardiac valve formation and could only partially rescue cardiac edema. Characterization of the mutant recombinant enzymes purified from Escherichia coli revealed modest alterations in the enzymatic activity of the mutants and a significant reduction in the half-life of enzyme activity at 37 °C. This reduction in activity could be propagated to the wild-type enzyme in a 1:1 mixed reaction. Furthermore, the quaternary structure of both mutants, normally hexameric, was destabilized to favor the dimeric species, and the intrinsic thermal stability of the R141C mutant was highly compromised. The results are consistent with the reduced function of both missense mutations significantly reducing the ability of UGDH to provide precursors for cardiac cushion formation, which is essential to subsequent valve formation. The identification of these polymorphisms in patient populations will help identify families genetically at risk for valve defects. PMID:22815472

Genetic and Molecular Analysis of the X Chromosomal Region 14b17-14c4 in Drosophila Melanogaster: Loss of Function in Nona, a Nuclear Protein Common to Many Cell Types, Results in Specific Physiological and Behavioral Defects

PubMed Central

Stanewsky, R.; Rendahl, K. G.; Dill, M.; Saumweber, H.

1993-01-01

We have performed a genetic analysis of the 14C region of the X chromosome of Drosophila melanogaster to isolate loss of function alleles of no-on-transient A (nonA; 14C1-2; 1-52.3). NONA is a nuclear protein common to many cell types, which is present in many puffs on polytene chromosomes. Sequence data suggest that the protein contains a pair of RNA binding motifs (RRM) found in many single-strand nucleic acid binding proteins. Hypomorphic alleles of this gene, which lead to aberrant visual and courtship song behavior, still contain normally distributed nonA RNA and NONA protein in embryos, and in all available alleles NONA protein is present in puffs of third instar larval polytene chromosomes. We find that complete loss of this general nuclear protein is semilethal in hemizygous males and homozygous cell lethal in the female germline. Surviving males show more extreme defects in nervous system function than have been described for the hypomorphic alleles. Five other essential genes that reside within this region have been partially characterized. PMID:8244005

Birth defects and genetic disorders among Arab Americans--Michigan, 1992-2003.

PubMed

Yanni, Emad A; Copeland, Glenn; Olney, Richard S

2010-06-01

Birth defects and genetic disorders are leading causes of infant morbidity and mortality in many countries. Population-based data on birth defects among Arab-American children have not been documented previously. Michigan has the second largest Arab-American community in the United States after California. Using data from the Michigan Birth Defects Registry (MBDR), which includes information on parents' country of birth and ancestry, birth prevalences were estimated in offspring of Michigan women of Arab ancestry for 21 major categories of birth defects and 12 congenital endocrine, metabolic, and hereditary disorders. Compared with other non-Hispanic white children in Michigan, Arab-American children had similar or lower birth prevalences of the selected types of structural birth defects, with higher rates of certain hereditary blood disorders and three categories of metabolic disorders. These estimates are important for planning preconception and antenatal health care, genetic counseling, and clinical care for Arab Americans.

Mitochondrial enteropathy: the primary pathology may not be within the gastrointestinal tract

PubMed Central

Chinnery, P; Jones, S; Sviland, L; Andrews, R; Parsons, T; Turnbull, D; Bindoff, L

2001-01-01

BACKGROUND—Mitochondrial DNA (mtDNA) defects are an important cause of disease. Although gastrointestinal symptoms are common in these patients, their pathogenesis remains uncertain.
AIM—To investigate the role of the mtDNA defect in the production of gastrointestinal dysfunction.
PATIENT—A 20 year old woman who presented at 15 years of age with recurrent vomiting and pseudo-obstruction, who did not respond to conservative management and ultimately had subtotal gastrectomy and Roux-en-y reconstruction. She subsequently presented with status epilepticus and was found to have a mitochondrial respiratory chain disorder due to a pathogenic mtDNA point mutation (A3243G).
METHODS—Resected bowel was studied using light and electron microscopy and mtDNA analysed from both mucosal and muscular layers using polymerase chain reaction generated RFLP analysis. 
RESULTS— Histological and electron microscopic studies revealed no morphological abnormalities in the resected stomach, and molecular genetic analysis failed to identify the genetic defect in either the mucosal or muscle layers.
CONCLUSION—This study suggests that in some individuals with gastrointestinal symptoms associated with established mitochondrial DNA disease, the primary pathology of the mitochondrial enteropathy lies outside the gastrointestinal tract.


Keywords: mitochondrial encephalomyopathy; cyclical vomiting; pseudo-obstruction PMID:11115833

Thiamine deficiency in childhood with attention to genetic causes: Survival and outcome predictors.

PubMed

Ortigoza-Escobar, Juan Darío; Alfadhel, Majid; Molero-Luis, Marta; Darin, Niklas; Spiegel, Ronen; de Coo, Irenaeus F; Gerards, Mike; Taylor, Robert W; Artuch, Rafael; Nashabat, Marwan; Rodríguez-Pombo, Pilar; Tabarki, Brahim; Pérez-Dueñas, Belén

2017-09-01

Primary and secondary conditions leading to thiamine deficiency have overlapping features in children, presenting with acute episodes of encephalopathy, bilateral symmetric brain lesions, and high excretion of organic acids that are specific of thiamine-dependent mitochondrial enzymes, mainly lactate, alpha-ketoglutarate, and branched chain keto-acids. Undiagnosed and untreated thiamine deficiencies are often fatal or lead to severe sequelae. Herein, we describe the clinical and genetic characterization of 79 patients with inherited thiamine defects causing encephalopathy in childhood, identifying outcome predictors in patients with pathogenic SLC19A3 variants, the most common genetic etiology. We propose diagnostic criteria that will aid clinicians to establish a faster and accurate diagnosis so that early vitamin supplementation is considered. Ann Neurol 2017;82:317-330. © 2017 American Neurological Association.

Environmental Assessment for Slope Stabilization Projects at Fort MacArthur, San Pedro, California

DTIC Science & Technology

2012-01-01

located within close proximity of the edge of the bluff. However, this loss of land would not create a significant impact to land use and the benefit ...brittlebush, and Common deerweed ( Lotus scoparius). Implementation of the Proposed Action would have no impact on federal or state-listed threatened and...cancer, birth defects, genetic damage, and other adverse health effects. The source and effects of hazardous air pollutants are generally local

Cri du Chat Syndrome and Primary Ciliary Dyskinesia: A Common Genetic Cause on Chromosome 5p

PubMed Central

Shapiro, Adam J.; Weck, Karen E.; Chao, Kay C.; Rosenfeld, Margaret; Nygren, Anders O. H.; Knowles, Michael R.; Leigh, Margaret W.; Zariwala, Maimoona A.

2014-01-01

Cri du chat syndrome (CdCS) and primary ciliary dyskinesia (PCD) are rare diseases that present with frequent respiratory symptoms. PCD can be caused by hemizygous DNAH5 mutation in combination with a 5p segmental deletion attributable to CdCS on the opposite chromosome. Chronic oto-sino-pulmonary symptoms or organ laterality defects in CdCS should prompt an evaluation for PCD. PMID:25066065

Familiar Papillary Thyroid Carcinoma in a Large Brazilian Family Is Not Associated with Succinate Dehydrogenase Defects.

PubMed

Accordi, Elen Dias; Xekouki, Paraskevi; Azevedo, Bruna; de Alexandre, Rodrigo Bertollo; Frasson, Carla; Gantzel, Siliane Marie; Papadakis, Georgios Z; Angelousi, Anna; Stratakis, Constantine A; Sotomaior, Vanessa Santos; Faucz, Fabio R

2016-07-01

Thyroid cancer is the most common endocrine gland malignancy. Advances in understanding the genetic basis for thyroid cancer revealed the potential involvement of several genes in the formation of thyroid tumors. Mutations in the gene coding for succinate dehydrogenase subtype B (SDHB) have been implicated in papillary thyroid cancer (PTC). Succinate dehydrogenase (SDH) is a heterotetrameric protein composed of four subunits, SDHA, SDHB, SDHC, and SDHD, and participates in both the electron transport chain and the tricarboxylic acid cycle. The aim of the study was to evaluate the association between variants in the SDHA, SDHB, SDHC, and SDHD genes and familiar PTC in a large Brazilian family. Four patients with PTC, 1 patient with PTC and gastrointestinal stromal tumor (GIST), 1 patient with GIST, and their relatives - several of them with different thyroid problems - from a large Brazilian family were screened for genetic variations of SDHx genes with the use of polymerase chain reaction-single-stranded conformational polymorphism and direct sequencing. Only one rare variation in SDHA was found in some of the family members, but not segregating with the disease. No other genetic variants of these genes were detected in the family members that presented with PTC and/or GIST. Familiar PTC and a GIST were not associated with SDHx mutations; additional genetic defects, yet unknown, may be responsible for the development of tumor.

Genome-wide mapping in a house mouse hybrid zone reveals hybrid sterility loci and Dobzhansky-Muller interactions

PubMed Central

Turner, Leslie M; Harr, Bettina

2014-01-01

Mapping hybrid defects in contact zones between incipient species can identify genomic regions contributing to reproductive isolation and reveal genetic mechanisms of speciation. The house mouse features a rare combination of sophisticated genetic tools and natural hybrid zones between subspecies. Male hybrids often show reduced fertility, a common reproductive barrier between incipient species. Laboratory crosses have identified sterility loci, but each encompasses hundreds of genes. We map genetic determinants of testis weight and testis gene expression using offspring of mice captured in a hybrid zone between M. musculus musculus and M. m. domesticus. Many generations of admixture enables high-resolution mapping of loci contributing to these sterility-related phenotypes. We identify complex interactions among sterility loci, suggesting multiple, non-independent genetic incompatibilities contribute to barriers to gene flow in the hybrid zone. DOI: http://dx.doi.org/10.7554/eLife.02504.001 PMID:25487987

Cysteamine re-establishes the clearance of Pseudomonas aeruginosa by macrophages bearing the cystic fibrosis-relevant F508del-CFTR mutation.

PubMed

Ferrari, Eleonora; Monzani, Romina; Villella, Valeria R; Esposito, Speranza; Saluzzo, Francesca; Rossin, Federica; D'Eletto, Manuela; Tosco, Antonella; De Gregorio, Fabiola; Izzo, Valentina; Maiuri, Maria C; Kroemer, Guido; Raia, Valeria; Maiuri, Luigi

2017-01-12

Cystic fibrosis (CF), the most common lethal monogenic disease in Caucasians, is characterized by recurrent bacterial infections and colonization, mainly by Pseudomonas aeruginosa, resulting in unresolved airway inflammation. CF is caused by mutations in the gene coding for the cystic fibrosis transmembrane conductance regulator (CFTR) protein, which functions as a chloride channel in epithelial cells, macrophages, and other cell types. Impaired bacterial handling by macrophages is a feature of CF airways, although it is still debated how defective CFTR impairs bacterial killing. Recent evidence indicates that a defective autophagy in CF macrophages leads to alterations of bacterial clearance upon infection. Here we use bone marrow-derived macrophages from transgenic mice to provide the genetic proof that defective CFTR compromises both uptake and clearance of internalized Pseudomonas aeruginosa. We demonstrate that the proteostasis regulator cysteamine, which rescues the function of the most common F508del-CFTR mutant and hence reduces lung inflammation in CF patients, can also repair the defects of CF macrophages, thus restoring both bacterial internalization and clearance through a process that involves upregulation of the pro-autophagic protein Beclin 1 and re-establishment of the autophagic pathway. Altogether these results indicate that cysteamine restores the function of several distinct cell types, including that of macrophages, which might contribute to its beneficial effects on CF.

Cysteamine re-establishes the clearance of Pseudomonas aeruginosa by macrophages bearing the cystic fibrosis-relevant F508del-CFTR mutation

PubMed Central

Ferrari, Eleonora; Monzani, Romina; Villella, Valeria R; Esposito, Speranza; Saluzzo, Francesca; Rossin, Federica; D'Eletto, Manuela; Tosco, Antonella; De Gregorio, Fabiola; Izzo, Valentina; Maiuri, Maria C; Kroemer, Guido; Raia, Valeria; Maiuri, Luigi

2017-01-01

Cystic fibrosis (CF), the most common lethal monogenic disease in Caucasians, is characterized by recurrent bacterial infections and colonization, mainly by Pseudomonas aeruginosa, resulting in unresolved airway inflammation. CF is caused by mutations in the gene coding for the cystic fibrosis transmembrane conductance regulator (CFTR) protein, which functions as a chloride channel in epithelial cells, macrophages, and other cell types. Impaired bacterial handling by macrophages is a feature of CF airways, although it is still debated how defective CFTR impairs bacterial killing. Recent evidence indicates that a defective autophagy in CF macrophages leads to alterations of bacterial clearance upon infection. Here we use bone marrow-derived macrophages from transgenic mice to provide the genetic proof that defective CFTR compromises both uptake and clearance of internalized Pseudomonas aeruginosa. We demonstrate that the proteostasis regulator cysteamine, which rescues the function of the most common F508del-CFTR mutant and hence reduces lung inflammation in CF patients, can also repair the defects of CF macrophages, thus restoring both bacterial internalization and clearance through a process that involves upregulation of the pro-autophagic protein Beclin 1 and re-establishment of the autophagic pathway. Altogether these results indicate that cysteamine restores the function of several distinct cell types, including that of macrophages, which might contribute to its beneficial effects on CF. PMID:28079883

Peripheral neuropathy predicts nuclear gene defect in patients with mitochondrial ophthalmoplegia.

PubMed

Horga, Alejandro; Pitceathly, Robert D S; Blake, Julian C; Woodward, Catherine E; Zapater, Pedro; Fratter, Carl; Mudanohwo, Ese E; Plant, Gordon T; Houlden, Henry; Sweeney, Mary G; Hanna, Michael G; Reilly, Mary M

2014-12-01

Progressive external ophthalmoplegia is a common clinical feature in mitochondrial disease caused by nuclear DNA defects and single, large-scale mitochondrial DNA deletions and is less frequently associated with point mutations of mitochondrial DNA. Peripheral neuropathy is also a frequent manifestation of mitochondrial disease, although its prevalence and characteristics varies considerably among the different syndromes and genetic aetiologies. Based on clinical observations, we systematically investigated whether the presence of peripheral neuropathy could predict the underlying genetic defect in patients with progressive external ophthalmoplegia. We analysed detailed demographic, clinical and neurophysiological data from 116 patients with genetically-defined mitochondrial disease and progressive external ophthalmoplegia. Seventy-eight patients (67%) had a single mitochondrial DNA deletion, 12 (10%) had a point mutation of mitochondrial DNA and 26 (22%) had mutations in either POLG, C10orf2 or RRM2B, or had multiple mitochondrial DNA deletions in muscle without an identified nuclear gene defect. Seventy-seven patients had neurophysiological studies; of these, 16 patients (21%) had a large-fibre peripheral neuropathy. The prevalence of peripheral neuropathy was significantly lower in patients with a single mitochondrial DNA deletion (2%) as compared to those with a point mutation of mitochondrial DNA or with a nuclear DNA defect (44% and 52%, respectively; P<0.001). Univariate analyses revealed significant differences in the distribution of other clinical features between genotypes, including age at disease onset, gender, family history, progressive external ophthalmoplegia at clinical presentation, hearing loss, pigmentary retinopathy and extrapyramidal features. However, binomial logistic regression analysis identified peripheral neuropathy as the only independent predictor associated with a nuclear DNA defect (P=0.002; odds ratio 8.43, 95% confidence interval 2.24-31.76). Multinomial logistic regression analysis identified peripheral neuropathy, family history and hearing loss as significant predictors of the genotype, and the same three variables showed the highest performance in genotype classification in a decision tree analysis. Of these variables, peripheral neuropathy had the highest specificity (91%), negative predictive value (83%) and positive likelihood ratio (5.87) for the diagnosis of a nuclear DNA defect. These results indicate that peripheral neuropathy is a rare finding in patients with single mitochondrial DNA deletions but that it is highly predictive of an underlying nuclear DNA defect. This observation may facilitate the development of diagnostic algorithms. We suggest that nuclear gene testing may enable a more rapid diagnosis and avoid muscle biopsy in patients with progressive external ophthalmoplegia and peripheral neuropathy. © The Author (2014). Published by Oxford University Press on behalf of the Guarantors of Brain.

Peripheral neuropathy predicts nuclear gene defect in patients with mitochondrial ophthalmoplegia

PubMed Central

Pitceathly, Robert D. S.; Blake, Julian C.; Woodward, Catherine E.; Zapater, Pedro; Fratter, Carl; Mudanohwo, Ese E.; Plant, Gordon T.; Houlden, Henry; Sweeney, Mary G.; Hanna, Michael G.; Reilly, Mary M.

2014-01-01

Progressive external ophthalmoplegia is a common clinical feature in mitochondrial disease caused by nuclear DNA defects and single, large-scale mitochondrial DNA deletions and is less frequently associated with point mutations of mitochondrial DNA. Peripheral neuropathy is also a frequent manifestation of mitochondrial disease, although its prevalence and characteristics varies considerably among the different syndromes and genetic aetiologies. Based on clinical observations, we systematically investigated whether the presence of peripheral neuropathy could predict the underlying genetic defect in patients with progressive external ophthalmoplegia. We analysed detailed demographic, clinical and neurophysiological data from 116 patients with genetically-defined mitochondrial disease and progressive external ophthalmoplegia. Seventy-eight patients (67%) had a single mitochondrial DNA deletion, 12 (10%) had a point mutation of mitochondrial DNA and 26 (22%) had mutations in either POLG, C10orf2 or RRM2B, or had multiple mitochondrial DNA deletions in muscle without an identified nuclear gene defect. Seventy-seven patients had neurophysiological studies; of these, 16 patients (21%) had a large-fibre peripheral neuropathy. The prevalence of peripheral neuropathy was significantly lower in patients with a single mitochondrial DNA deletion (2%) as compared to those with a point mutation of mitochondrial DNA or with a nuclear DNA defect (44% and 52%, respectively; P < 0.001). Univariate analyses revealed significant differences in the distribution of other clinical features between genotypes, including age at disease onset, gender, family history, progressive external ophthalmoplegia at clinical presentation, hearing loss, pigmentary retinopathy and extrapyramidal features. However, binomial logistic regression analysis identified peripheral neuropathy as the only independent predictor associated with a nuclear DNA defect (P = 0.002; odds ratio 8.43, 95% confidence interval 2.24–31.76). Multinomial logistic regression analysis identified peripheral neuropathy, family history and hearing loss as significant predictors of the genotype, and the same three variables showed the highest performance in genotype classification in a decision tree analysis. Of these variables, peripheral neuropathy had the highest specificity (91%), negative predictive value (83%) and positive likelihood ratio (5.87) for the diagnosis of a nuclear DNA defect. These results indicate that peripheral neuropathy is a rare finding in patients with single mitochondrial DNA deletions but that it is highly predictive of an underlying nuclear DNA defect. This observation may facilitate the development of diagnostic algorithms. We suggest that nuclear gene testing may enable a more rapid diagnosis and avoid muscle biopsy in patients with progressive external ophthalmoplegia and peripheral neuropathy. PMID:25281868

[Introduction to Genetic/Rare Disease and the Application of Genetic Counseling].

PubMed

Chu, Shao-Yin; Weng, Chun-Ying

2017-10-01

Genetic disease or hereditary disease is a group of disorders that is caused by mutations in an individual's genome. The mutated genome or gene may be transmitted through the germ line during reproduction, causing certain recurrence risk in offspring and other family members. The heritability of these disorders is thus an important issue to deal with clinically. In Taiwan, a rare disease is defined as a disease that is prevalent in fewer than 1 in 10,000 individuals. As up to 80% of rare disease cases in Taiwan are genetic disease disorders, genetic disease may not rare. The pathophysiology of genetic/ rare disease is very complicated. Individual disorders may have their own unique mechanisms (such as Fragile X syndrome), with most of these mechanisms still unclear or unknown. The symptoms and signs of genetic/rare disease thus present the greatest variabilities and cause difficulties in making diagnoses. Most related patients may present multiple congenital anomalies, metabolic disorders, growth and developmental delays, defects in cognition, neuromuscular abnormalities, and defects in vision, hearing or other organ functions. Symptomatic and supportive treatment still comprise a major component of treatment of genetic/rare disease (with the exception of special formulae for several inborn errors of metabolic disease and enzyme replacement therapy in some lysosomal storage disease). Poor self-care ability is common and the burden on caregivers is huge. Most rare disease patients are treated using a comprehensive rehabilitation program that begins during very early childhood, receive individual educational programs, and are continuously monitored with regard to their growth, developmental, and nutritional status. Inter-professional patient care, genetic counseling, and the creation of family support networks play an important role in family management. Public awareness and the creation of appropriate social systems and resources allocation are mandatory for proper care. The incidence of each genetic/rare disease is rare, but collectively they are important public health issue and a challenge to medical care.

The role of functionally defective rare germline variants of sialic acid acetylesterase in autoimmune Addison's disease

PubMed Central

Gan, Earn H; MacArthur, Katie; Mitchell, Anna L; Pearce, Simon H S

2012-01-01

Background Autoimmune Addison's disease (AAD) is a rare condition with a complex genetic basis. A panel of rare and functionally defective genetic variants in the sialic acid acetylesterase (SIAE) gene has recently been implicated in several common autoimmune conditions. We performed a case–control study to determine whether these rare variants are associated with a rarer condition, AAD. Method We analysed nine SIAE gene variants (W48X, M89V, C196F, C226G, R230W, T312M, Y349C, F404S and R479C) in a United Kingdom cohort of 378 AAD subjects and 387 healthy controls. All samples were genotyped using Sequenom iPlex chemistry to characterise primer extension products. Results A heterozygous rare allele at codon 312 (312*M) was found in one AAD patient (0.13%) but was not detected in the healthy controls. The commoner, functionally recessive variant at codon 89 (89*V) was found to be homozygous in two AAD patients but was only found in the heterozygous state in controls. Taking into account all nine alleles examined, 4/378 (1.06%) AAD patients and 1/387 (0.25%) healthy controls carried the defective SIAE alleles, with a calculated odds ratio of 4.13 (95% CI 0.44–97.45, two-tailed P value 0.212, NS). Conclusion We demonstrated the presence of 89*V homozygotes and the 312*M rare allele in the AAD cohort, but overall, our analysis does not support a role for rare variants in SIAE in the pathogenesis of AAD. However, the relatively small collection of AAD patients limits the power to exclude a small effect. PMID:23011869

Color vision abnormalities in type II diabetes: Sankara Nethralaya Diabetic Retinopathy Epidemiology and Molecular Genetics Study II report no 2

PubMed Central

Gella, Laxmi; Raman, Rajiv; Kulothungan, Vaitheeswaran; Pal, Swakshyar Saumya; Ganesan, Suganeswari; Srinivasan, Sangeetha; Sharma, Tarun

2017-01-01

Purpose: The purpose of this study is to assess color vision abnormalities in a cohort of subjects with type II diabetes and elucidate associated risk factors. Methods: Subjects were recruited from follow-up cohort of Sankara Nethralaya Diabetic Retinopathy Epidemiology and Molecular Genetics Study I. Six hundred and seventy-three eyes of 343 subjects were included from this population-based study. All subjects underwent detailed ophthalmic evaluation, including the Farnsworth-Munsell 100 hue test. Results: The prevalence of impaired color vision (ICV) was 43% (CI: 39.2–46.7). Risk factors for ICV were higher heart rate (odds ratio [OR]: 1.043, [1.023–1.064]) and a higher intraocular pressure (IOP) (OR: 1.086, [1.012–1.165]). Subjects with clinically significant macular edema (CSME) had three times higher chance of having ICV. C1, C2, and C3 are the commonly found Early Treatment Diabetic Retinopathy Study (ETDRS) patterns. The moment of inertia method showed that the angle did not reveal any specific pattern of color vision defect. Although the major and minor radii were high in those with ICV, we did not observe polarity. Confusion index was high in subjects with ICV, indicating a severe color vision defect. Conclusions: The prevalence of ICV was 43% among subjects with type II diabetes. The most commonly observed patterns were increasing severities of the blue–yellow defect on ETDRS patterns, but no specific pattern was observed at the moment of inertia analysis. The presence of CSME, a higher heart rate, and IOP was significant risk factors for ICV. This functional impairment in color vision could significantly contribute to morbidity among subjects with diabetes. PMID:29044066

Color vision abnormalities in type II diabetes: Sankara Nethralaya Diabetic Retinopathy Epidemiology and Molecular Genetics Study II report no 2.

PubMed

Gella, Laxmi; Raman, Rajiv; Kulothungan, Vaitheeswaran; Pal, Swakshyar Saumya; Ganesan, Suganeswari; Srinivasan, Sangeetha; Sharma, Tarun

2017-10-01

The purpose of this study is to assess color vision abnormalities in a cohort of subjects with type II diabetes and elucidate associated risk factors. Subjects were recruited from follow-up cohort of Sankara Nethralaya Diabetic Retinopathy Epidemiology and Molecular Genetics Study I. Six hundred and seventy-three eyes of 343 subjects were included from this population-based study. All subjects underwent detailed ophthalmic evaluation, including the Farnsworth-Munsell 100 hue test. The prevalence of impaired color vision (ICV) was 43% (CI: 39.2-46.7). Risk factors for ICV were higher heart rate (odds ratio [OR]: 1.043, [1.023-1.064]) and a higher intraocular pressure (IOP) (OR: 1.086, [1.012-1.165]). Subjects with clinically significant macular edema (CSME) had three times higher chance of having ICV. C1, C2, and C3 are the commonly found Early Treatment Diabetic Retinopathy Study (ETDRS) patterns. The moment of inertia method showed that the angle did not reveal any specific pattern of color vision defect. Although the major and minor radii were high in those with ICV, we did not observe polarity. Confusion index was high in subjects with ICV, indicating a severe color vision defect. The prevalence of ICV was 43% among subjects with type II diabetes. The most commonly observed patterns were increasing severities of the blue-yellow defect on ETDRS patterns, but no specific pattern was observed at the moment of inertia analysis. The presence of CSME, a higher heart rate, and IOP was significant risk factors for ICV. This functional impairment in color vision could significantly contribute to morbidity among subjects with diabetes.

Copy number variation as a genetic basis for heterotaxy and heterotaxy-spectrum congenital heart defects.

PubMed

Cowan, Jason R; Tariq, Muhammad; Shaw, Chad; Rao, Mitchell; Belmont, John W; Lalani, Seema R; Smolarek, Teresa A; Ware, Stephanie M

2016-12-19

Genomic disorders and rare copy number abnormalities are identified in 15-25% of patients with syndromic conditions, but their prevalence in individuals with isolated birth defects is less clear. A spectrum of congenital heart defects (CHDs) is seen in heterotaxy, a highly heritable and genetically heterogeneous multiple congenital anomaly syndrome resulting from failure to properly establish left-right (L-R) organ asymmetry during early embryonic development. To identify novel genetic causes of heterotaxy, we analysed copy number variants (CNVs) in 225 patients with heterotaxy and heterotaxy-spectrum CHDs using array-based genotyping methods. Clinically relevant CNVs were identified in approximately 20% of patients and encompassed both known and putative heterotaxy genes. Patients were carefully phenotyped, revealing a significant association of abdominal situs inversus with pathogenic or likely pathogenic CNVs, while d-transposition of the great arteries was more frequently associated with common CNVs. Identified cytogenetic abnormalities ranged from large unbalanced translocations to smaller, kilobase-scale CNVs, including a rare, single exon deletion in ZIC3, a gene known to cause X-linked heterotaxy. Morpholino loss-of-function experiments in Xenopus support a role for one of these novel candidates, the platelet isoform of phosphofructokinase-1 (PFKP) in heterotaxy. Collectively, our results confirm a high CNV yield for array-based testing in patients with heterotaxy, and support use of CNV analysis for identification of novel biological processes relevant to human laterality.This article is part of the themed issue 'Provocative questions in left-right asymmetry'. © 2016 The Author(s).

A single codon insertion in PICALM is associated with development of familial subvalvular aortic stenosis in Newfoundland dogs.

PubMed

Stern, Joshua A; White, Stephen N; Lehmkuhl, Linda B; Reina-Doreste, Yamir; Ferguson, Jordan L; Nascone-Yoder, Nanette M; Meurs, Kathryn M

2014-09-01

Familial subvalvular aortic stenosis (SAS) is one of the most common congenital heart defects in dogs and is an inherited defect of Newfoundlands, golden retrievers and human children. Although SAS is known to be inherited, specific genes involved in Newfoundlands with SAS have not been defined. We hypothesized that SAS in Newfoundlands is inherited in an autosomal dominant pattern and caused by a single genetic variant. We studied 93 prospectively recruited Newfoundland dogs, and 180 control dogs of 30 breeds. By providing cardiac screening evaluations for Newfoundlands we conducted a pedigree evaluation, genome-wide association study and RNA sequence analysis to identify a proposed pattern of inheritance and genetic loci associated with the development of SAS. We identified a three-nucleotide exonic insertion in phosphatidylinositol-binding clathrin assembly protein (PICALM) that is associated with the development of SAS in Newfoundlands. Pedigree evaluation best supported an autosomal dominant pattern of inheritance and provided evidence that equivocally affected individuals may pass on SAS in their progeny. Immunohistochemistry demonstrated the presence of PICALM in the canine myocardium and area of the subvalvular ridge. Additionally, small molecule inhibition of clathrin-mediated endocytosis resulted in developmental abnormalities within the outflow tract (OFT) of Xenopus laevis embryos. The ability to test for presence of this PICALM insertion may impact dog-breeding decisions and facilitate reduction of SAS disease prevalence in Newfoundland dogs. Understanding the role of PICALM in OFT development may aid in future molecular and genetic investigations into other congenital heart defects of various species.

Genetic Factors That Might Lead to Different Responses in Individuals Exposed to Perchlorate

PubMed Central

Scinicariello, Franco; Murray, H. Edward; Smith, Lester; Wilbur, Sharon; Fowler, Bruce A.

2005-01-01

Perchlorate has been detected in groundwater in many parts of the United States, and recent detection in vegetable and dairy food products indicates that contamination by perchlorate is more widespread than previously thought. Perchlorate is a competitive inhibitor of the sodium iodide symporter, the thyroid cell–surface protein responsible for transporting iodide from the plasma into the thyroid. An estimated 4.3% of the U.S. population is subclinically hypothyroid, and 6.9% of pregnant women may have low iodine intake. Congenital hypothyroidism affects 1 in 3,000 to 1 in 4,000 infants, and 15% of these cases have been attributed to genetic defects. Our objective in this review is to identify genetic biomarkers that would help define subpopulations sensitive to environmental perchlorate exposure. We review the literature to identify genetic defects involved in the iodination process of the thyroid hormone synthesis, particularly defects in iodide transport from circulation into the thyroid cell, defects in iodide transport from the thyroid cell to the follicular lumen (Pendred syndrome), and defects of iodide organification. Furthermore, we summarize relevant studies of perchlorate in humans. Because of perchlorate inhibition of iodide uptake, it is biologically plausible that chronic ingestion of perchlorate through contaminated sources may cause some degree of iodine discharge in populations that are genetically susceptible to defects in the iodination process of the thyroid hormone synthesis, thus deteriorating their conditions. We conclude that future studies linking human disease and environmental perchlorate exposure should consider the genetic makeup of the participants, actual perchlorate exposure levels, and individual iodine intake/excretion levels. PMID:16263499

Prevalence of an unusual hypoplastic defect of the permanent maxillary lateral incisor in great apes.

PubMed

Hannibal, Darcy L

2017-02-01

In this article, I describe a previously unreported maxillary lateral incisor defect (MLID) of the enamel in great apes and evaluate potential general causes (genetic, systemic stress, or localized disturbance), as well as examine differences in prevalence among the represented taxa. This defect occurred only on the labial surface of the maxillary lateral incisor and extended from the cervical-mesial quarter of the crown to the mesial edge of the cementoenamel junction (CEJ). The study sample consisted of 136 great ape specimens, including 41 gorillas, 25 chimpanzees, and 70 orangutans from the Smithsonian's National Museum of Natural History great ape collection. I used logistic regression to assess the prevalence of this defect in the sample and a binomial probability test for bilaterality. This defect of the maxillary lateral incisor is the second most common defect I observed in the study sample (30.1% of individuals affected), and was more likely to occur in individuals with linear enamel hypoplasia (LEH) and pit defects than those without these defects. Among specimens with both maxillary lateral incisors present, the defect was mostly bilateral. Pan and Pongo were significantly more likely to exhibit the defect than Gorilla. Between Pongo species, Pongo pygmaeus was significantly more likely to exhibit the defect than Pongo abelii. Between subspecies of Gorilla, although Gorilla gorilla gorilla exhibited the defect and Gorilla gorilla beringei did not, the difference was not significant. No sex differences were evident in this sample. The prevalence of this defect indicates it is not hereditary. The bilateral trend indicates a systemic cause, although the high inter-tooth specificity suggests a local disturbance and a combination of both is possible. © 2016 Wiley Periodicals, Inc.

The Complex Genetic Basis of Congenital Heart Defects

PubMed Central

Akhirome, Ehiole; Walton, Nephi A.; Nogee, Julie M.; Jay, Patrick Y.

2017-01-01

Twenty years ago, chromosomal abnormalities were the only identifiable genetic causes of a small fraction of congenital heart defects (CHD). Today, a de novo or inherited genetic abnormality can be identified as pathogenic in one-third of cases. We refer to them here as monogenic causes, insofar as the genetic abnormality has a readily detectable, large effect. What explains the other two-thirds? This review considers a complex genetic basis. That is, a combination of genetic mutations or variants that individually may have little or no detectable effect contribute to the pathogenesis of a heart defect. Genes in the embryo that act directly in cardiac developmental pathways have received the most attention, but genes in the mother that establish the gestational milieu via pathways related to metabolism and aging also have an effect. A growing body of evidence highlights the pathogenic significance of genetic interactions in the embryo and maternal effects that have a genetic basis. The investigation of CHD as guided by a complex genetic model could help estimate risk more precisely and logically lead to a means of prevention. PMID:28381817

Genetics of recessive cognitive disorders.

PubMed

Musante, Luciana; Ropers, H Hilger

2014-01-01

Most severe forms of intellectual disability (ID) have specific genetic causes. Numerous X chromosome gene defects and disease-causing copy-number variants have been linked to ID and related disorders, and recent studies have revealed that sporadic cases are often due to dominant de novo mutations with low recurrence risk. For autosomal recessive ID (ARID) the recurrence risk is high and, in populations with frequent parental consanguinity, ARID is the most common form of ID. Even so, its elucidation has lagged behind. Here we review recent progress in this field, show that ARID is not rare even in outbred Western populations, and discuss the prospects for improving its diagnosis and prevention. Copyright © 2013 Elsevier Ltd. All rights reserved.

[Neonatal diabetes mellitus].

PubMed

Gurgel, Lucimary C; Moisés, Regina S

2008-03-01

Neonatal diabetes is a rare condition characterized by hyperglycemia, requiring insulin treatment, diagnosed within the first months of life. The disorder may be either transient, resolving in infancy or early childhood with possible relapse later, or permanent in which case lifelong treatment is necessary. Both conditions are genetically heterogeneous; however, the majority of the cases of transient neonatal diabetes are due to abnormalities of an imprinted region of chromosome 6q24. For permanent neonatal diabetes, the most common causes are heterozygous activating mutations of KCNJ11, the gene encoding the Kir6.2 sub-unit of the ATP-sensitive potassium channel. In this article we discuss the clinical features of neonatal diabetes, the underlying genetic defects and the therapeutic implications.

Cri du chat syndrome and primary ciliary dyskinesia: a common genetic cause on chromosome 5p.

PubMed

Shapiro, Adam J; Weck, Karen E; Chao, Kay C; Rosenfeld, Margaret; Nygren, Anders O H; Knowles, Michael R; Leigh, Margaret W; Zariwala, Maimoona A

2014-10-01

Cri du chat syndrome (CdCS) and primary ciliary dyskinesia (PCD) are rare diseases that present with frequent respiratory symptoms. PCD can be caused by hemizygous DNAH5 mutation in combination with a 5p segmental deletion attributable to CdCS on the opposite chromosome. Chronic oto-sino-pulmonary symptoms or organ laterality defects in CdCS should prompt an evaluation for PCD. Copyright © 2014 Elsevier Inc. All rights reserved.

Lynch syndrome in the 21st century: clinical perspectives.

PubMed

Tiwari, A K; Roy, H K; Lynch, H T

2016-03-01

Lynch syndrome (LS) is the most common of all inherited cancer syndromes, associated with substantially elevated risks for colonic and extracolonic malignancies, earlier onset and high rates of multiple primary cancers. At the genetic level, it is caused by a defective mismatch repair (MMR) system due to presence of germline defects in at least one of the MMR genes- MLH1, MSH2, MSH6, PMS2 or EPCAM. An impaired MMR function during replication introduces infidelity in DNA sequence and leads to ubiquitous mutations at simple repetitive sequences (microsatellites), causing microsatellite instability (MSI). Although previously, clinicopathological criteria such as Amsterdam I/II and Revised Bethesda Guidelines were commonly used to identify suspected LS mutation carriers, there has been a recent push towards universally testing, especially in case of colorectal cancers (CRCs), through immunohistochemistry for expression of MMR proteins or through molecular tests (polymerase chain reaction, PCR) for MSI, in order to identify LS mutation carriers and subject them to genetic testing to ascertain the specific gene implicated. In this review, we have discussed the latest diagnostic strategies and the current screening and treatment guidelines for colonic and extracolonic cancers in clinically affected and at-risk individuals for LS. © The Author 2015. Published by Oxford University Press on behalf of the Association of Physicians. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Noonan syndrome and related disorders: alterations in growth and puberty.

PubMed

Noonan, Jacqueline A

2006-12-01

Noonan syndrome is a relatively common multiple malformation syndrome with characteristic facies, short stature and congenital heart disease, most commonly pulmonary stenosis (Noonan, Clin Pediatr, 33:548-555, 1994). Recently, a mutation in the PTPN11 gene (Tartaglia, Mehler, Goldberg, Zampino, Brunner, Kremer et al., Nat Genet, 29:465-468, 2001) was found to be present in about 50% of individuals with Noonan syndrome. The phenotype noted in Noonan syndrome is also found in a number of other syndromes which include LEOPARD (Gorlin, Anderson, Blaw, Am J Dis Child, 17:652-662, 1969), Cardio-facio-cutaneous syndrome (Reynolds, Neri, Hermann, Blumberg, Coldwell, Miles et al., Am J Med Genet, 28:413-427, 1986) and Costello syndrome (Hennekam, Am J Med Genet, 117C(1):42-48, 2003). All three of these syndromes share similar cardiac defects and all have postnatal short stature. Very recently, HRAS mutations (Aoki, Niihori, Kawame, Kurosawa, Ohashi, Tanaka et al., Nat Genet, 37:1038-1040, 2005) have been found in the Costello syndrome and germline mutations in KRAS and BRAF genes (Rodriguez-Viciana, Tetsu, Tidyman, Estep, Conger, Santa Cruz et al., Nat Genet, 2006; Niihori, Aoki, Narumi, Neri, Cave, Verloes et al., Nat Genet, 38:294-296, 2006) in the Cardio-facio-cutaneous syndrome. Phenotypic overlap between these genetic disorders can now be explained since each is caused by germline mutations that are major components of the RAS-MAPK pathway. This pathway plays an important role in growth factor and cytokine signaling as well as cancer pathogenesis.

Fetal programming of appetite and obesity.

PubMed

Breier, B H; Vickers, M H; Ikenasio, B A; Chan, K Y; Wong, W P

2001-12-20

Obesity and related metabolic disorders are prevalent health issues in modern society and are commonly attributed to lifestyle and dietary factors. However, the mechanisms by which environmental factors modulate the physiological systems that control weight regulation and the aetiology of metabolic disorders, which manifest in adult life, may have their roots before birth. The 'fetal origins' or 'fetal programming' paradigm is based on the observation that environmental changes can reset the developmental path during intrauterine development leading to obesity and cardiovascular and metabolic disorders later in life. The pathogenesis is not based on genetic defects but on altered genetic expression as a consequence of an adaptation to environmental changes during fetal development. While many endocrine systems can be affected by fetal programming recent experimental studies suggest that leptin and insulin resistance are critical endocrine defects in the pathogenesis of programming-induced obesity and metabolic disorders. However, it remains to be determined whether postnatal obesity is a consequence of programming of appetite regulation and whether hyperphagia is the main underlying cause of the increased adiposity and the development of metabolic disorders.

Inborn Errors in Immunity

PubMed Central

Lionakis, M.S.; Hajishengallis, G.

2015-01-01

In recent years, the study of genetic defects arising from inborn errors in immunity has resulted in the discovery of new genes involved in the function of the immune system and in the elucidation of the roles of known genes whose importance was previously unappreciated. With the recent explosion in the field of genomics and the increasing number of genetic defects identified, the study of naturally occurring mutations has become a powerful tool for gaining mechanistic insight into the functions of the human immune system. In this concise perspective, we discuss emerging evidence that inborn errors in immunity constitute real-life models that are indispensable both for the in-depth understanding of human biology and for obtaining critical insights into common diseases, such as those affecting oral health. In the field of oral mucosal immunity, through the study of patients with select gene disruptions, the interleukin-17 (IL-17) pathway has emerged as a critical element in oral immune surveillance and susceptibility to inflammatory disease, with disruptions in the IL-17 axis now strongly linked to mucosal fungal susceptibility, whereas overactivation of the same pathways is linked to inflammatory periodontitis. PMID:25900229

Shared molecular and cellular mechanisms of premature ageing and ageing-associated diseases.

PubMed

Kubben, Nard; Misteli, Tom

2017-10-01

Ageing is the predominant risk factor for many common diseases. Human premature ageing diseases are powerful model systems to identify and characterize cellular mechanisms that underpin physiological ageing. Their study also leads to a better understanding of the causes, drivers and potential therapeutic strategies of common diseases associated with ageing, including neurological disorders, diabetes, cardiovascular diseases and cancer. Using the rare premature ageing disorder Hutchinson-Gilford progeria syndrome as a paradigm, we discuss here the shared mechanisms between premature ageing and ageing-associated diseases, including defects in genetic, epigenetic and metabolic pathways; mitochondrial and protein homeostasis; cell cycle; and stem cell-regenerative capacity.

Genetic causes of male infertility.

PubMed

Stouffs, Katrien; Seneca, Sara; Lissens, Willy

2014-05-01

Male infertility, affecting around half of the couples with a problem to get pregnant, is a very heterogeneous condition. Part of patients are having a defect in spermatogenesis of which the underlying causes (including genetic ones) remain largely unknown. The only genetic tests routinely used in the diagnosis of male infertility are the analyses for the presence of Yq microdeletions and/or chromosomal abnormalities. Various other single gene or polygenic defects have been proposed to be involved in male fertility. Yet, their causative effect often remains to be proven. The recent evolution in the development of whole genome-based techniques may help in clarifying the role of genes and other genetic factors involved in spermatogenesis and spermatogenesis defects. Copyright © 2014 Elsevier Masson SAS. All rights reserved.

Copy Number Variants and Exome Sequencing Analysis in Six Pairs of Chinese Monozygotic Twins Discordant for Congenital Heart Disease.

PubMed

Xu, Yuejuan; Li, Tingting; Pu, Tian; Cao, Ruixue; Long, Fei; Chen, Sun; Sun, Kun; Xu, Rang

2017-12-01

Congenital heart disease (CHD) is one of the most common birth defects. More than 200 susceptibility loci have been identified for CHDs, yet a large part of the genetic risk factors remain unexplained. Monozygotic (MZ) twins are thought to be completely genetically identical; however, discordant phenotypes have been found in MZ twins. Recent studies have demonstrated genetic differences between MZ twins. We aimed to test whether copy number variants (CNVs) and/or genetic mutation differences play a role in the etiology of CHDs by using single nucleotide polymorphism (SNP) genotyping arrays and whole exome sequencing of twin pairs discordant for CHDs. Our goal was to identify mutations present only in the affected twins, which could identify novel candidates for CHD susceptibility loci. We present a comprehensive analysis for the CNVs and genetic mutation results of the selected individuals but detected no consistent differences within the twin pairs. Our study confirms that chromosomal structure or genetic mutation differences do not seem to play a role in the MZ twins discordant for CHD.

Diagnostic dilemma: osteopetrosis with superimposed rickets causing neonatal hypocalcemia.

PubMed

Olgaç, Asburçe; Tümer, Leyla; Boyunağa, Öznur; Kızılkaya, Metehan; Hasanoğlu, Alev

2015-04-01

Osteopetrosis is a rare genetic condition of reduced osteoclastic bone resorption which causes defective bone remodeling and skeletal sclerosis during growth, having effects on many organs and tissues. Mutation of T-cell immune regulator 1 (TCRG1) gene is the most common genetic defect leading to osteopetrosis, with poor prognosis. The autosomal recessive form presents in the infantile period (also known as malignant infantile osteopetrosis--MIOP), and is characterized by fractures, short stature, hepatosplenomegaly, compressive neuropathies, hypocalcemia and pancytopenia. Being a rare disease with non-specific clinical manifestations, the diagnosis is difficult and usually delayed. Rickets is a characteristic feature of MIOP which results from the defect in osteoclasts to provide a normal Ca/P balance resulting in the poor mineralization of the osteoid. Various treatment options have been suggested for osteopetrosis, but hematopoietic stem cell transplantation still remains the only curative treatment option presently. The authors report the case of a 46-day-old girl with late-onset neonatal hypocalcemia and rickets that was later diagnosed as osteopetrosis. This case report emphasizes that infantile osteopetrosis is an important cause of neonatal hypocalcemia. As irreversible complications develop within the first months of life, immediate diagnosis and early intervention are crucial and may be life-saving. © The Author [2015]. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

The genetics of hair-cell function in zebrafish.

PubMed

Nicolson, Teresa

2017-09-01

Our ears are remarkable sensory organs, providing the important senses of balance and hearing. The complex structure of the inner ear, or 'labyrinth', along with the assorted neuroepithelia, have evolved to detect head movements and sounds with impressive sensitivity. The rub is that the inner ear is highly vulnerable to genetic lesions and environmental insults. According to National Institute of Health estimates, hearing loss is one of the most commonly inherited or acquired sensorineural diseases. To understand the causes of deafness and balance disorders, it is imperative to understand the underlying biology of the inner ear, especially the inner workings of the sensory receptors. These receptors, which are termed hair cells, are particularly susceptible to genetic mutations - more than two dozen genes are associated with defects in this cell type in humans. Over the past decade, a substantial amount of progress has been made in working out the molecular basis of hair-cell function using vertebrate animal models. Given the transparency of the inner ear and the genetic tools that are available, zebrafish have become an increasingly popular animal model for the study of deafness and vestibular dysfunction. Mutagenesis screens for larval defects in hearing and balance have been fruitful in finding key components, many of which have been implicated in human deafness. This review will focus on the genes that are required for hair-cell function in zebrafish, with a particular emphasis on mechanotransduction. In addition, the generation of new tools available for the characterization of zebrafish hair-cell mutants will be discussed.

Clarinet (CLA-1), a novel active zone protein required for synaptic vesicle clustering and release

PubMed Central

Nelson, Jessica; Richmond, Janet E; Colón-Ramos, Daniel A; Shen, Kang

2017-01-01

Active zone proteins cluster synaptic vesicles at presynaptic terminals and coordinate their release. In forward genetic screens, we isolated a novel Caenorhabditis elegans active zone gene, clarinet (cla-1). cla-1 mutants exhibit defects in synaptic vesicle clustering, active zone structure and synapse number. As a result, they have reduced spontaneous vesicle release and increased synaptic depression. cla-1 mutants show defects in vesicle distribution near the presynaptic dense projection, with fewer undocked vesicles contacting the dense projection and more docked vesicles at the plasma membrane. cla-1 encodes three isoforms containing common C-terminal PDZ and C2 domains with homology to vertebrate active zone proteins Piccolo and RIM. The C-termini of all isoforms localize to the active zone. Specific loss of the ~9000 amino acid long isoform results in vesicle clustering defects and increased synaptic depression. Our data indicate that specific isoforms of clarinet serve distinct functions, regulating synapse development, vesicle clustering and release. PMID:29160205

ZIC2 in Holoprosencephaly.

PubMed

Barratt, Kristen S; Arkell, Ruth M

2018-01-01

The ZIC2 transcription factor is one of the most commonly mutated genes in Holoprosencephaly (HPE) probands. HPE is a severe congenital defect of forebrain development which occurs when the cerebral hemispheres fail to separate during the early stages of organogenesis and is typically associated with mispatterning of the embryonic midline. Recent study of genotype-phenotype correlations in HPE cases has defined distinctive features of ZIC2-associated HPE presentation and genetics, revealing that ZIC2 mutation does not produce the craniofacial abnormalities generally thought to characterise HPE but leads to a range of non-forebrain phenotypes. Furthermore, the studies confirm the extent of ZIC2 allelic heterogeneity and that pathogenic variants of ZIC2 are associated with both classic and middle interhemispheric variant (MIHV) HPE which arise from defective ventral and dorsal forebrain patterning, respectively. An allelic series of mouse mutants has helped to delineate the cellular and molecular mechanisms by which one gene leads to defects in these related but distinct embryological processes.

Recurrent candidiasis and early-onset gastric cancer in a patient with a genetically defined partial MYD88 defect.

PubMed

Vogelaar, Ingrid P; Ligtenberg, Marjolijn J L; van der Post, Rachel S; de Voer, Richarda M; Kets, C Marleen; Jansen, Trees J G; Jacobs, Liesbeth; Schreibelt, Gerty; de Vries, I Jolanda M; Netea, Mihai G; Hoogerbrugge, Nicoline

2016-04-01

Gastric cancer is caused by both genetic and environmental factors. A woman who suffered from recurrent candidiasis throughout her life developed diffuse-type gastric cancer at the age of 23 years. Using whole-exome sequencing we identified a germline homozygous missense variant in MYD88. Immunological assays on peripheral blood mononuclear cells revealed an impaired immune response upon stimulation with Candida albicans, characterized by a defective production of the cytokine interleukin-17. Our data suggest that a genetic defect in MYD88 results in an impaired immune response and may increase gastric cancer risk.

Axenfeld-Rieger syndrome.

PubMed

Seifi, M; Walter, M A

2018-06-01

Axenfeld-Rieger syndrome (ARS) is a clinically and genetically heterogeneous group of developmental disorders affecting primarily the anterior segment of the eye, often leading to secondary glaucoma. Patients with ARS may also present with systemic changes, including dental defects, mild craniofacial dysmorphism, and umbilical anomalies. ARS is inherited in an autosomal-dominant fashion; the underlying defect in 40% of patients is mutations in PITX2 or FOXC1. Here, an overview of the clinical spectrum of ARS is provided. As well, the known underlying genetic defects, clinical diagnostic possibilities, genetic counseling and treatments of ARS are discussed in detail. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Color vision tests comparison: Farnsworth D-15 versus Lanthony D-15

NASA Astrophysics Data System (ADS)

Szmigiel, Marta; Geniusz, Malwina; Geniusz, Maciej K.

2017-09-01

Disorder of color vision in humans is the inability to perceive differences between some or all of the colors that are normally perceived by others. Color blindness is usually a birth defect, a genetically determined. For this reason it is much more common in men than women. This paper presents the results of the test FarnsworthD-15 and Lanthony D-15 on a group of volunteers, both adults and children. The study was conducted to compare the results of both tests.

The genetic control of phenformin 4-hydroxylation.

PubMed Central

Shah, R R; Evans, D A; Oates, N S; Idle, J R; Smith, R L

1985-01-01

Previously published results of phenformin 4-hydroxylation in 195 unrelated white British volunteers and 87 family members of 27 randomly selected probands have been subjected to genetic analysis. The results clearly show that about 9% of this population has a genetically determined defect in carrying out this oxidation reaction. The character for the defect is inherited in a Mendelian autosomal recessive fashion. The polymorphism shows a substantial degree of dominance. PMID:4078865

MEF2C loss-of-function mutation contributes to congenital heart defects.

PubMed

Qiao, Xiao-Hui; Wang, Fei; Zhang, Xian-Ling; Huang, Ri-Tai; Xue, Song; Wang, Juan; Qiu, Xing-Biao; Liu, Xing-Yuan; Yang, Yi-Qing

2017-01-01

Congenital heart disease (CHD) is the most common type of developmental abnormality in humans, and is a leading cause for substantially increased morbidity and mortality in affected individuals. Increasing studies demonstrates a pivotal role of genetic defects in the pathogenesis of CHD, and presently mutations in more than 60 genes have been associated with CHD. Nevertheless, CHD is of pronounced genetic heterogeneity, and the genetic basis underpinning CHD in a large proportion of patients remains unclear. In the present study, the whole coding exons and splicing donors/acceptors of the MEF2C gene, which codes for a transcription factor essential for normal cardiovascular development, were sequenced in 200 unrelated patients affected with CHD, and a novel heterozygous missense mutation, p.L38P, was identified in an index patient with patent ductus arteriosus (PDA) and ventricular septal defect (VSD). Genetic scan of the mutation carrier's family members available showed that the mutation was present in all affected family members but absent in unaffected family members. Analysis of the proband's pedigree revealed that the mutation co-segregated with PDA, which was transmitted as an autosomal dominant trait with complete penetrance. The mutation changed the amino acid that was completely conserved evolutionarily, and did not exist in 300 unrelated, ethnically-matched healthy individuals used as controls. Functional deciphers by using a dual-luciferase reporter assay system unveiled that the mutant MEF2C protein had a significantly reduced transcriptional activity. Furthermore, the mutation significantly diminished the synergistic activation between MEF2C and GATA4, another cardiac core transcription factor that has been causally linked to CHD. In conclusion, this is the first report on the association of a MEF2C loss-of-function mutation with an increased vulnerability to CHD in humans, which provides novel insight into the molecular mechanisms underlying CHD, implying potential implications for early diagnosis and timely prophylaxis of CHD.

MEF2C loss-of-function mutation contributes to congenital heart defects

PubMed Central

Qiao, Xiao-Hui; Wang, Fei; Zhang, Xian-Ling; Huang, Ri-Tai; Xue, Song; Wang, Juan; Qiu, Xing-Biao; Liu, Xing-Yuan; Yang, Yi-Qing

2017-01-01

Congenital heart disease (CHD) is the most common type of developmental abnormality in humans, and is a leading cause for substantially increased morbidity and mortality in affected individuals. Increasing studies demonstrates a pivotal role of genetic defects in the pathogenesis of CHD, and presently mutations in more than 60 genes have been associated with CHD. Nevertheless, CHD is of pronounced genetic heterogeneity, and the genetic basis underpinning CHD in a large proportion of patients remains unclear. In the present study, the whole coding exons and splicing donors/acceptors of the MEF2C gene, which codes for a transcription factor essential for normal cardiovascular development, were sequenced in 200 unrelated patients affected with CHD, and a novel heterozygous missense mutation, p.L38P, was identified in an index patient with patent ductus arteriosus (PDA) and ventricular septal defect (VSD). Genetic scan of the mutation carrier's family members available showed that the mutation was present in all affected family members but absent in unaffected family members. Analysis of the proband's pedigree revealed that the mutation co-segregated with PDA, which was transmitted as an autosomal dominant trait with complete penetrance. The mutation changed the amino acid that was completely conserved evolutionarily, and did not exist in 300 unrelated, ethnically-matched healthy individuals used as controls. Functional deciphers by using a dual-luciferase reporter assay system unveiled that the mutant MEF2C protein had a significantly reduced transcriptional activity. Furthermore, the mutation significantly diminished the synergistic activation between MEF2C and GATA4, another cardiac core transcription factor that has been causally linked to CHD. In conclusion, this is the first report on the association of a MEF2C loss-of-function mutation with an increased vulnerability to CHD in humans, which provides novel insight into the molecular mechanisms underlying CHD, implying potential implications for early diagnosis and timely prophylaxis of CHD. PMID:29104469

Rare Copy Number Variants in a Population Based Investigation of Hypoplastic Right Heart Syndrome

PubMed Central

Dimopoulos, Aggeliki; Sicko, Robert J.; Kay, Denise M.; Rigler, Shannon L.; Druschel, Charlotte M.; Caggana, Michele; Browne, Marilyn L.; Fan, Ruzong; Romitti, Paul A.; Brody, Lawrence C.; Mills, James L.

2016-01-01

Background Hypoplastic right heart syndrome (HRHS) is a rare congenital defect characterized by underdevelopment of the right heart structures commonly accompanied by an atrial septal defect. Familial HRHS reports suggest genetic factor involvement. We examined the role of copy number variants (CNVs) in HRHS. Methods We genotyped 32 HRHS cases identified from all New York State live births (1998–2005) using Illumina HumanOmni2.5 microarrays. CNVs were called with PennCNV and prioritized if they were ≥20Kb, contained ≥10 SNPs and had minimal overlap with CNVs from in-house controls, the Database of Genomic Variants, HapMap3 and CHOP database. Results We identified 28 CNVs in 17 cases; several encompassed genes important for right heart development. One case had a 2p16–2p23 duplication spanning LBH, a limb and heart development transcription factor. Lbh mis-expression results in right ventricular hypoplasia and pulmonary valve defects. This duplication also encompassed SOS1, a factor associated with pulmonary valve stenosis in Noonan syndrome. Sos1−/− mice display thin and poorly trabeculated ventricles. In another case, we identified a 1.5Mb deletion associated with Williams Beuren syndrome, a disorder that includes valvular malformations. A third case had a 24Kb deletion upstream of the TGFβ ligand ITGB8. Embryos genetically null for Itgb8, and its intracellular interactant Band 4.1B, display lethal cardiac phenotypes. Conclusions To our knowledge, this is the first study of CNVs in HRHS. We identified several rare CNVs that overlap genes related to right ventricular wall and valve development, suggesting that genetics plays a role in HRHS and providing clues for further investigation. PMID:28009100

Genetic screening of non-classic CAH females with hyperandrogenemia identifies a novel CYP11B1 gene mutation.

PubMed

Shammas, Christos; Byrou, Stefania; Phelan, Marie M; Toumba, Meropi; Stylianou, Charilaos; Skordis, Nicos; Neocleous, Vassos; Phylactou, Leonidas A

2016-04-01

Congenital adrenal hyperplasia (CAH) is an endocrine autosomal recessive disorder with various symptoms of diverse severity. Mild hyperandrogenemia is the most commonclinical feature in non-classic CAH patients and 95% of the cases are identified by mutations in the CYP21A2 gene. In the present study, the second most common cause for non-classic CAH (NC-CAH), 11β-hydroxylase deficiency due to mutations in the CYP11B1 gene, is investigated. Screening of the CYP21A2 and CYP11B1 genes by direct sequencing was carried out for the detection of possible genetic defects in patients with suspected CAH. It wasobserved that CYP11B1 variants co-exist only in rare cases along with mutations in CYP21A2 in patients clinically diagnosed with CAH. A total of 23 NC-CAH female patients out of 75 were identified with only one mutation in the CYP21A2 gene. The novel CYP11B1 gene mutation, p.Val484Asp, was identified in a patient with CAH in the heterozygous state. The structural characterization of the novel p.Val484Asp was found to likely cause distortion of the surrounding beta sheet and indirect destabilization of the cavity that occurs on the opposite face of the structural elements, leading to partial impairment of the enzymatic activity. CYP21A2 gene mutations are the most frequent genetic defects in cases of NC-CAH even when these patients are in the heterozygous state. These mutations have a diverse phenotype giving rise to a variable extent of cortisol synthesis impairment; it is also clear that CYP11B1 mutants are a rare type of defects causing CAH.

Imprinting defects at human 14q32 locus alters gene expression and is associated with the pathobiology of osteosarcoma

PubMed Central

Shu, Jingmin; Li, Lihua; Sarver, Anne E.; Pope, Emily A.; Varshney, Jyotika; Thayanithy, Venugopal; Spector, Logan; Largaespada, David A.; Steer, Clifford J.; Subramanian, Subbaya

2016-01-01

Osteosarcoma is the most common primary bone malignancy affecting children and adolescents. Although several genetic predisposing conditions have been associated with osteosarcoma, our understanding of its pathobiology is rather limited. Here we show that, first, an imprinting defect at human 14q32-locus is highly prevalent (87%) and specifically associated with osteosarcoma patients < 30 years of age. Second, the average demethylation at differentially methylated regions (DMRs) in the 14q32-locus varied significantly compared to genome-wide demethylation. Third, the 14q32-locus was enriched in both H3K4-me3 and H3K27-me3 histone modifications that affected expression of all imprinted genes and miRNAs in this region. Fourth, imprinting defects at 14q32 - DMRs are present in triad DNA samples from affected children and their biological parents. Finally, imprinting defects at 14q32-DMRs were also observed at higher frequencies in an Rb1/Trp53 mutation-induced osteosarcoma mouse model. Further analysis of normal and tumor tissues from a Sleeping Beauty mouse model of spontaneous osteosarcoma supported the notion that these imprinting defects may be a key factor in osteosarcoma pathobiology. In conclusion, we demonstrate that imprinting defects at the 14q32 locus significantly alter gene expression, may contribute to the pathogenesis of osteosarcoma, and could be predictive of survival outcomes. PMID:26802029

Androgen insensitivity syndrome

MedlinePlus

... the person has some or all of the physical traits of a woman, but the genetic makeup of a man. Causes AIS is caused by genetic defects on the X chromosome. These defects make the body unable to respond to the hormones that produce a male appearance. The syndrome is divided into two main categories: ...

Slit–Robo signalling in heart development

PubMed Central

Zhao, Juanjuan; Mommersteeg, Mathilda T M

2018-01-01

Abstract The Slit ligands and their Robo receptors are well-known for their roles during axon guidance in the central nervous system but are still relatively unknown in the cardiac field. However, data from different animal models suggest a broad involvement of the pathway in many aspects of heart development, from cardiac cell migration and alignment, lumen formation, chamber formation, to the formation of the ventricular septum, semilunar and atrioventricular valves, caval veins, and pericardium. Absence of one or more of the genes in the pathway results in defects ranging from bicuspid aortic valves to ventricular septal defects and abnormal venous connections to the heart. Congenital heart defects are the most common congenital malformations found in life new-born babies and progress in methods for large scale human genetic testing has significantly enhanced the identification of new causative genes involved in human congenital heart disease. Recently, loss of function variants in ROBO1 have also been linked to ventricular septal defects and tetralogy of Fallot in patients. Here, we will give an overview of the role of the Slit–Robo signalling pathway in Drosophila, zebrafish, and mouse heart development. The extent of these data warrant further attention on the SLIT–ROBO signalling pathway as a candidate for an array of human congenital heart defects. PMID:29538649

Limb-body wall defect: experience of a reference service of fetal medicine from Southern Brazil.

PubMed

Gazolla, Ana C; da Cunha, André C; Telles, Jorge A B; Betat, Rosilene da S; Romano, Mayara A; Marshall, Isabel; Gobatto, Amanda M; de H Bicca, Anna M; Arcolini, Camila P; Dal Pai, Thaís K V; Vieira, Luciane R; Targa, Luciano V; Betineli, Ildo; Zen, Paulo R G; Rosa, Rafael F M

2014-10-01

Limb-body wall defect is a rare condition characterized by a combination of large and complex defects of the ventral thorax and abdominal wall with craniofacial and limb anomalies. The aim of this study was to describe the experience of our fetal medicine service, a reference from Southern Brazil, with prenatally diagnosed patients with a limb-body wall defect in a 3 years period. Only patients who fulfilled the criteria suggested by Hunter et al. (2011) were included in the study. Clinical data and results of radiological and cytogenetic evaluation were collected from their medical records. Our sample was composed of 8 patients. Many of their mothers were younger than 25 years (50%) and in their first pregnancy (62.5%). It is noteworthy that one patient was referred due to suspected anencephaly and another due to a twin pregnancy with an embryonic sac. Craniofacial defects were verified in three patients (37.5%), thoracic/abdominal abnormalities in 6 (75%) and limb defects in eight (100%). Congenital heart defects were observed in five patients (62.5%). One of them presented a previously undescribed complex heart defect. The results disclosed that complementary exams, such as MRI and echocardiography, are important to better define the observed defects. Some of them, such as congenital heart defects, may be more common than previously reported. This definition is essential for the proper management of the pregnancy and genetic counseling of the family. The birth of these children must be planned with caution and for the prognosis a long survival possibility, despite unlikely and rare, must be considered. © 2014 Wiley Periodicals, Inc.

Genetic susceptibility to Candida infections

PubMed Central

Smeekens, Sanne P; van de Veerdonk, Frank L; Kullberg, Bart Jan; Netea, Mihai G

2013-01-01

Candida spp. are medically important fungi causing severe mucosal and life-threatening invasive infections, especially in immunocompromised hosts. However, not all individuals at risk develop Candida infections, and it is believed that genetic variation plays an important role in host susceptibility. On the one hand, severe fungal infections are associated with monogenic primary immunodeficiencies such as defects in STAT1, STAT3 or CARD9, recently discovered as novel clinical entities. On the other hand, more common polymorphisms in genes of the immune system have also been associated with fungal infections such as recurrent vulvovaginal candidiasis and candidemia. The discovery of the genetic susceptibility to Candida infections can lead to a better understanding of the pathogenesis of the disease, as well as to the design of novel immunotherapeutic strategies. This review is part of the review series on host-pathogen interactions. See more reviews from this series. PMID:23629947

Maturity-Onset Diabetes of the Young: What Do Clinicians Need to Know?

PubMed Central

2015-01-01

Maturity-onset diabetes of the young (MODY) is a monogenic form of diabetes that is characterized by an early onset, autosomal dominant mode of inheritance and a primary defect in pancreatic β-cell function. MODY represents less than 2% of all diabetes cases and is commonly misdiagnosed as type 1 or type 2 diabetes mellitus. At least 13 MODY subtypes with distinct genetic etiologies have been identified to date. A correct genetic diagnosis is important as it often leads to personalized treatment for those with diabetes and enables predictive genetic testing for their asymptomatic relatives. Next-generation sequencing may provide an efficient method for screening mutations in this form of diabetes as well as identifying new MODY genes. In this review, I discuss a current update on MODY in the literatures and cover the studies that have been performed in Korea. PMID:26706916

Noonan syndrome and related disorders: Alterations in growth and puberty

PubMed Central

2006-01-01

Noonan syndrome is a relatively common multiple malformation syndrome with characteristic facies, short stature and congenital heart disease, most commonly pulmonary stenosis (Noonan, Clin Pediatr, 33:548–555, 1994). Recently, a mutation in the PTPN11 gene (Tartaglia, Mehler, Goldberg, Zampino, Brunner, Kremer et al., Nat Genet, 29:465–468, 2001) was found to be present in about 50% of individuals with Noonan syndrome. The phenotype noted in Noonan syndrome is also found in a number of other syndromes which include LEOPARD (Gorlin, Anderson, Blaw, Am J Dis Child, 17:652–662, 1969), Cardio-facio-cutaneous syndrome (Reynolds, Neri, Hermann, Blumberg, Coldwell, Miles et al., Am J Med Genet, 28:413–427, 1986) and Costello syndrome (Hennekam, Am J Med Genet, 117C(1):42–48, 2003). All three of these syndromes share similar cardiac defects and all have postnatal short stature. Very recently, HRAS mutations (Aoki, Niihori, Kawame, Kurosawa, Ohashi, Tanaka et al., Nat Genet, 37:1038–1040, 2005) have been found in the Costello syndrome and germline mutations in KRAS and BRAF genes (Rodriguez-Viciana, Tetsu, Tidyman, Estep, Conger, Santa Cruz et al., Nat Genet,2006; Niihori, Aoki, Narumi, Neri, Cave, Verloes et al., Nat Genet, 38:294–296, 2006) in the Cardio-facio-cutaneous syndrome. Phenotypic overlap between these genetic disorders can now be explained since each is caused by germline mutations that are major components of the RAS-MAPK pathway. This pathway plays an important role in growth factor and cytokine signaling as well as cancer pathogenesis. PMID:17177115

Genetics Home Reference: congenital bile acid synthesis defect type 1

MedlinePlus

... type 1 Congenital bile acid synthesis defect type 1 Printable PDF Open All Close All Enable Javascript to view the expand/collapse boxes. Description Congenital bile acid synthesis defect type 1 ...

Genetic parameters of egg defects and egg quality in layer chickens.

PubMed

Wolc, A; Arango, J; Settar, P; O'Sullivan, N P; Olori, V E; White, I M S; Hill, W G; Dekkers, J C M

2012-06-01

Genetic parameters were estimated for egg defects, egg production, and egg quality traits. Eggs from 11,738 purebred brown-egg laying hens were classified as salable or as having one of the following defects: bloody, broken, calcium deposit, dirty, double yolk, misshapen, pee-wee, shell-less, and soft shelled. Egg quality included albumen height, egg weight, yolk weight, and puncture score. Body weight, age at sexual maturity, and egg production were also recorded. Heritability estimates of liability to defects using a threshold animal model were less than 0.1 for bloody and dirty; between 0.1 and 0.2 for pee-wee, broken, misshapen, soft shelled, and shell-less; and above 0.2 for calcium deposit and double yolk. Quality and production traits were more heritable, with estimates ranging from 0.29 (puncture score) to 0.74 (egg weight). High-producing hens had a lower frequency of egg defects. High egg weight and BW were associated with an increased frequency of double yolks, and to a lesser extent, with more shell quality defects. Estimates of genetic correlations among defect traits that were related to shell quality were positive and moderate to strong (0.24-0.73), suggesting that these could be grouped into one category or selection could be based on the trait with the highest heritability or that is easiest to measure. Selection against defective eggs would be more efficient by including egg defect traits in the selection criterion, along with egg production rate of salable eggs and egg quality traits.

Communities and community genetics in Ethiopia.

PubMed

Tadesse, Luche; Tafesse, Fikru; Hamamy, Hanan

2014-01-01

The rates of congenital and genetic disorders in low and middle income countries are similar or might be higher than in high income countries due to a multitude of risk factors and the dearth of community genetic services. To direct effective preventive, diagnostic and counseling services, collecting data on the incidence and prevalence of various congenital and genetic disorders and their risk factors is a pre-requisite for establishing genetic services at the community level and mainly at the primary health care setting. This brief review is meant to assess the available epidemiological data in Ethiopia pertaining to congenital and genetic disorders on which the future community genetic services could be built. Existing epidemiological data on congenital and genetic disorders in Ethiopia is limited, and the few studies conducted revealed that folate and iodine deficiencies are prevalent among women in the reproductive age. Pregnant women's infection with syphilis and rubella is prevailing. Based on available data, cleft lip and palate, congenital heart diseases, club-foot, and gastro-intestinal malformations are the most common birth defects in Ethiopia. Community based studies to accurately demonstrate the incidence and prevalence levels of these disorders are almost unavailable. To plan for organization and implementation of community genetic services at the primary health care level in Ethiopia, conducting standardized epidemiological studies is currently highly recommended.

Communities and community genetics in Ethiopia

PubMed Central

Tadesse, Luche; Tafesse, Fikru; Hamamy, Hanan

2014-01-01

The rates of congenital and genetic disorders in low and middle income countries are similar or might be higher than in high income countries due to a multitude of risk factors and the dearth of community genetic services. To direct effective preventive, diagnostic and counseling services, collecting data on the incidence and prevalence of various congenital and genetic disorders and their risk factors is a pre-requisite for establishing genetic services at the community level and mainly at the primary health care setting. This brief review is meant to assess the available epidemiological data in Ethiopia pertaining to congenital and genetic disorders on which the future community genetic services could be built. Existing epidemiological data on congenital and genetic disorders in Ethiopia is limited, and the few studies conducted revealed that folate and iodine deficiencies are prevalent among women in the reproductive age. Pregnant women's infection with syphilis and rubella is prevailing. Based on available data, cleft lip and palate, congenital heart diseases, club-foot, and gastro-intestinalmalformations are the most common birth defects in Ethiopia. Community based studies to accurately demonstrate the incidence and prevalence levels of these disorders are almost unavailable. To plan for organization and implementation of community genetic services at the primary health care level in Ethiopia, conducting standardized epidemiological studies is currently highly recommended. PMID:25404975

Spectrum of prenatally detected central nervous system malformations: Neural tube defects continue to be the leading foetal malformation.

PubMed

Siddesh, Anjurani; Gupta, Geetika; Sharan, Ram; Agarwal, Meenal; Phadke, Shubha R

2017-04-01

Prenatal diagnosis of malformations is an important method of prevention and control of congenital anomalies with poor prognosis. Central nervous system (CNS) malformations amongst these are the most common. The information about the prevalence and spectrum of prenatally detected malformations is crucial for genetic counselling and policymaking for population-based preventive programmes. The objective of this study was to study the spectrum of prenatally detected CNS malformations and their association with chromosomal abnormalities and autopsy findings. This retrospective study was conducted in a tertiary care hospital in north India from January 2007 to December 2013. The details of cases with prenatally detected CNS malformations were collected and were related with the foetal chromosomal analysis and autopsy findings. Amongst 6044 prenatal ultrasonographic examinations performed; 768 (12.7%) had structural malformations and 243 (31.6%) had CNS malformations. Neural tube defects (NTDs) accounted for 52.3 per cent of CNS malformations and 16.5 per cent of all malformations. The other major groups of prenatally detected CNS malformations were ventriculomegaly and midline anomalies. Chromosomal abnormalities were detected in 8.2 per cent of the 73 cases studied. Foetal autopsy findings were available for 48 foetuses. Foetal autopsy identified additional findings in eight foetuses and the aetiological diagnosis changed in two of them (4.2%). Amongst prenatally detected malformations, CNS malformations were common. NTD, which largely is a preventable anomaly, continued to be the most common group. Moreover, 60 per cent of malformations were diagnosed after 20 weeks, posing legal issues. Chromosomal analysis and foetal autopsy are essential for genetic counselling based on aetiological diagnosis.

Unique among ciliopathies: primary ciliary dyskinesia, a motile cilia disorder.

PubMed

Praveen, Kavita; Davis, Erica E; Katsanis, Nicholas

2015-01-01

Primary ciliary dyskinesia (PCD) is a ciliopathy, but represents the sole entity from this class of disorders that results from the dysfunction of motile cilia. Characterized by respiratory problems appearing in childhood, infertility, and situs defects in ~50% of individuals, PCD has an estimated prevalence of approximately 1 in 10,000 live births. The diagnosis of PCD can be prolonged due to a lack of disease awareness, coupled with the fact that symptoms can be confused with other more common genetic disorders, such as cystic fibrosis, or environmental insults that result in frequent respiratory infections. A primarily autosomal recessive disorder, PCD is genetically heterogeneous with >30 causal genes identified, posing significant challenges to genetic diagnosis. Here, we provide an overview of PCD as a disorder underscored by impaired ciliary motility; we discuss the recent advances towards uncovering the genetic basis of PCD; we discuss the molecular knowledge gained from PCD gene discovery, which has improved our understanding of motile ciliary assembly; and we speculate on how accelerated diagnosis, together with detailed phenotypic data, will shape the genetic and functional architecture of this disorder.

Identification of Autophagosome-associated Proteins and Regulators by Quantitative Proteomic Analysis and Genetic Screens*

PubMed Central

Dengjel, Jörn; Høyer-Hansen, Maria; Nielsen, Maria O.; Eisenberg, Tobias; Harder, Lea M.; Schandorff, Søren; Farkas, Thomas; Kirkegaard, Thomas; Becker, Andrea C.; Schroeder, Sabrina; Vanselow, Katja; Lundberg, Emma; Nielsen, Mogens M.; Kristensen, Anders R.; Akimov, Vyacheslav; Bunkenborg, Jakob; Madeo, Frank; Jäättelä, Marja; Andersen, Jens S.

2012-01-01

Autophagy is one of the major intracellular catabolic pathways, but little is known about the composition of autophagosomes. To study the associated proteins, we isolated autophagosomes from human breast cancer cells using two different biochemical methods and three stimulus types: amino acid deprivation or rapamycin or concanamycin A treatment. The autophagosome-associated proteins were dependent on stimulus, but a core set of proteins was stimulus-independent. Remarkably, proteasomal proteins were abundant among the stimulus-independent common autophagosome-associated proteins, and the activation of autophagy significantly decreased the cellular proteasome level and activity supporting interplay between the two degradation pathways. A screen of yeast strains defective in the orthologs of the human genes encoding for a common set of autophagosome-associated proteins revealed several regulators of autophagy, including subunits of the retromer complex. The combined spatiotemporal proteomic and genetic data sets presented here provide a basis for further characterization of autophagosome biogenesis and cargo selection. PMID:22311637

Modeling Anterior Development in Mice: Diet as Modulator of Risk for Neural Tube Defects

PubMed Central

Kappen, Claudia

2014-01-01

Head morphogenesis is a complex process that is controlled by multiple signaling centers. The most common defects of cranial development are craniofacial defects, such as cleft lip and cleft palate, and neural tube defects, such as anencephaly and encephalocoele in humans. More than 400 genes that contribute to proper neural tube closure have been identified in experimental animals, but only very few causative gene mutations have been identified in humans, supporting the notion that environmental influences are critical. The intrauterine environment is influenced by maternal nutrition, and hence, maternal diet can modulate the risk for cranial and neural tube defects. This article reviews recent progress toward a better understanding of nutrients during pregnancy, with particular focus on mouse models for defective neural tube closure. At least four major patterns of nutrient responses are apparent, suggesting that multiple pathways are involved in the response, and likely in the underlying pathogenesis of the defects. Folic acid has been the most widely studied nutrient, and the diverse responses of the mouse models to folic acid supplementation indicate that folic acid is not universally beneficial, but that the effect is dependent on genetic configuration. If this is the case for other nutrients as well, efforts to prevent neural tube defects with nutritional supplementation may need to become more specifically targeted than previously appreciated. Mouse models are indispensable for a better understanding of nutrient–gene interactions in normal pregnancies, as well as in those affected by metabolic diseases, such as diabetes and obesity. PMID:24124024

Rapid screening for nuclear genes mutations in isolated respiratory chain complex I defects.

PubMed

Pagniez-Mammeri, Hélène; Lombes, Anne; Brivet, Michèle; Ogier-de Baulny, Hélène; Landrieu, Pierre; Legrand, Alain; Slama, Abdelhamid

2009-04-01

Complex I or reduced nicotinamide adenine dinucleotide (NADH): ubiquinone oxydoreductase deficiency is the most common cause of respiratory chain defects. Molecular bases of complex I deficiencies are rarely identified because of the dual genetic origin of this multi-enzymatic complex (nuclear DNA and mitochondrial DNA) and the lack of phenotype-genotype correlation. We used a rapid method to screen patients with isolated complex I deficiencies for nuclear genes mutations by Surveyor nuclease digestion of cDNAs. Eight complex I nuclear genes, among the most frequently mutated (NDUFS1, NDUFS2, NDUFS3, NDUFS4, NDUFS7, NDUFS8, NDUFV1 and NDUFV2), were studied in 22 cDNA fragments spanning their coding sequences in 8 patients with a biochemically proved complex I deficiency. Single nucleotide polymorphisms and missense mutations were detected in 18.7% of the cDNA fragments by Surveyor nuclease treatment. Molecular defects were detected in 3 patients. Surveyor nuclease screening is a reliable method for genotyping nuclear complex I deficiencies, easy to interpret, and limits the number of sequence reactions. Its use will enhance the possibility of prenatal diagnosis and help us for a better understanding of complex I molecular defects.

The Yersiniabactin-Associated ATP Binding Cassette Proteins YbtP and YbtQ Enhance Escherichia coli Fitness during High-Titer Cystitis

PubMed Central

Koh, Eun-Ik; Hung, Chia S.

2016-01-01

The Yersinia high-pathogenicity island (HPI) is common to multiple virulence strategies used by Escherichia coli strains associated with urinary tract infection (UTI). Among the genes in this island are ybtP and ybtQ, encoding distinctive ATP binding cassette (ABC) proteins associated with iron(III)-yersiniabactin import in Yersinia pestis. In this study, we compared the impact of ybtPQ on a model E. coli cystitis strain during in vitro culture and experimental murine infections. A ybtPQ-null mutant exhibited no growth defect under standard culture conditions, consistent with nonessentiality in this background. A growth defect phenotype was observed and genetically complemented in vitro during iron(III)-yersiniabactin-dependent growth. Following inoculation into the bladders of C3H/HEN and C3H/HeOuJ mice, this strain exhibited a profound, 106-fold competitive infection defect in the subgroup of mice that progressed to high-titer bladder infections. These results identify a virulence role for YbtPQ in the highly inflammatory microenvironment characteristic of high-titer cystitis. The profound competitive defect may relate to the apparent selection of Yersinia HPI-positive E. coli in uncomplicated clinical UTIs. PMID:26883590

Effects of strain and age on hepatic gene expression profiles in murine models of HFE-associated hereditary hemochromatosis.

PubMed

Lee, Seung-Min; Loguinov, Alexandre; Fleming, Robert E; Vulpe, Christopher D

2015-01-01

Hereditary hemochromatosis is an iron overload disorder most commonly caused by a defect in the HFE gene. While the genetic defect is highly prevalent, the majority of individuals do not develop clinically significant iron overload, suggesting the importance of genetic modifiers. Murine hfe knockout models have demonstrated that strain background has a strong effect on the severity of iron loading. We noted that hepatic iron loading in hfe-/- mice occurs primarily over the first postnatal weeks (loading phase) followed by a timeframe of relatively static iron concentrations (plateau phase). We thus evaluated the effects of background strain and of age on hepatic gene expression in Hfe knockout mice (hfe-/-). Hepatic gene expression profiles were examined using cDNA microarrays in 4- and 8-week-old hfe-/- and wild-type mice on two different genetic backgrounds, C57BL/6J (C57) and AKR/J (AKR). Genes differentially regulated in all hfe-/- mice groups, compared with wild-type mice, including those involved in cell survival, stress and damage responses and lipid metabolism. AKR strain-specific changes in lipid metabolism genes and C57 strain-specific changes in cell adhesion and extracellular matrix protein genes were detected in hfe-/- mice. Mouse strain and age are each significantly associated with hepatic gene expression profiles in hfe-/- mice. These affects may underlie or reflect differences in iron loading in these mice.

SCRIB and PUF60 Are Primary Drivers of the Multisystemic Phenotypes of the 8q24.3 Copy-Number Variant

PubMed Central

Dauber, Andrew; Golzio, Christelle; Guenot, Cécile; Jodelka, Francine M.; Kibaek, Maria; Kjaergaard, Susanne; Leheup, Bruno; Martinet, Danielle; Nowaczyk, Malgorzata J.M.; Rosenfeld, Jill A.; Zeesman, Susan; Zunich, Janice; Beckmann, Jacques S.; Hirschhorn, Joel N.; Hastings, Michelle L.; Jacquemont, Sebastien; Katsanis, Nicholas

2013-01-01

Copy-number variants (CNVs) represent a significant interpretative challenge, given that each CNV typically affects the dosage of multiple genes. Here we report on five individuals with coloboma, microcephaly, developmental delay, short stature, and craniofacial, cardiac, and renal defects who harbor overlapping microdeletions on 8q24.3. Fine mapping localized a commonly deleted 78 kb region that contains three genes: SCRIB, NRBP2, and PUF60. In vivo dissection of the CNV showed discrete contributions of the planar cell polarity effector SCRIB and the splicing factor PUF60 to the syndromic phenotype, and the combinatorial suppression of both genes exacerbated some, but not all, phenotypic components. Consistent with these findings, we identified an individual with microcephaly, short stature, intellectual disability, and heart defects with a de novo c.505C>T variant leading to a p.His169Tyr change in PUF60. Functional testing of this allele in vivo and in vitro showed that the mutation perturbs the relative dosage of two PUF60 isoforms and, subsequently, the splicing efficiency of downstream PUF60 targets. These data inform the functions of two genes not associated previously with human genetic disease and demonstrate how CNVs can exhibit complex genetic architecture, with the phenotype being the amalgam of both discrete dosage dysfunction of single transcripts and also of binary genetic interactions. PMID:24140112

Genetic abnormalities in bicuspid aortic valve root phenotype: preliminary results.

PubMed

Girdauskas, Evaldas; Geist, Lisa; Disha, Kushtrim; Kazakbaev, Iliaz; Groß, Tatiana; Schulz, Solveig; Ungelenk, Martin; Kuntze, Thomas; Reichenspurner, Hermann; Kurth, Ingo

2017-07-01

Genetic defects associated with bicuspid aortopathy have been infrequently analysed. Our goal was to examine the prevalence of rare genetic variants in patients with a bicuspid aortic valve (BAV) with a root phenotype using next-generation sequencing technology. We investigated a total of 124 patients with BAV with a root dilatation phenotype who underwent aortic valve ± proximal aortic surgery at a single institution (BAV database, n  = 812) during a 20-year period (1995-2015). Cross-sectional follow-up revealed 63 (51%) patients who were still alive and willing to participate. Systematic follow-up visits were scheduled from March to December 2015 and included aortic imaging as well as peripheral blood sampling for genetic testing. Next-generation sequencing libraries were prepared using a custom-made HaloPlex HS gene panel and included 20 candidate genes known to be associated with aortopathy and BAV. The primary end-point was the prevalence of genetic defects in our study cohort. A total of 63 patients (mean age 46 ± 10 years, 92% men) with BAV root phenotype and mean post-aortic valve replacement follow-up of 10.3 ± 4.9 years were included. Our genetic analysis yielded a wide spectrum of rare, potentially or likely pathogenic variants in 19 (30%) patients, with NOTCH1 variants being the most common ( n  = 6). Moreover, deleterious variants were revealed in AXIN1 ( n  = 3), NOS3 ( n  = 3), ELN ( n  = 2), FBN1 ( n  = 2) , FN1 ( n  = 2) and rarely in other candidate genes. Our preliminary study demonstrates a high prevalence and a wide spectrum of rare genetic variants in patients with the BAV root phenotype, indicative of the potentially congenital origin of associated aortopathy in this specific BAV cohort. © The Author 2017. Published by Oxford University Press on behalf of the European Association for Cardio-Thoracic Surgery. All rights reserved.

Facts about Birth Defects

MedlinePlus

... Defects Language: English (US) Español (Spanish) Recommend on Facebook Tweet Share Compartir On This Page Birth Defects are Common Identifying Birth Defects Causes Prevention References Birth defects are common, costly, and critical conditions that affect 1 in every 33 babies born in the ...

MECHANISMS IN ENDOCRINOLOGY: Novel genetic causes of short stature.

PubMed

Wit, Jan M; Oostdijk, Wilma; Losekoot, Monique; van Duyvenvoorde, Hermine A; Ruivenkamp, Claudia A L; Kant, Sarina G

2016-04-01

The fast technological development, particularly single nucleotide polymorphism array, array-comparative genomic hybridization, and whole exome sequencing, has led to the discovery of many novel genetic causes of growth failure. In this review we discuss a selection of these, according to a diagnostic classification centred on the epiphyseal growth plate. We successively discuss disorders in hormone signalling, paracrine factors, matrix molecules, intracellular pathways, and fundamental cellular processes, followed by chromosomal aberrations including copy number variants (CNVs) and imprinting disorders associated with short stature. Many novel causes of GH deficiency (GHD) as part of combined pituitary hormone deficiency have been uncovered. The most frequent genetic causes of isolated GHD are GH1 and GHRHR defects, but several novel causes have recently been found, such as GHSR, RNPC3, and IFT172 mutations. Besides well-defined causes of GH insensitivity (GHR, STAT5B, IGFALS, IGF1 defects), disorders of NFκB signalling, STAT3 and IGF2 have recently been discovered. Heterozygous IGF1R defects are a relatively frequent cause of prenatal and postnatal growth retardation. TRHA mutations cause a syndromic form of short stature with elevated T3/T4 ratio. Disorders of signalling of various paracrine factors (FGFs, BMPs, WNTs, PTHrP/IHH, and CNP/NPR2) or genetic defects affecting cartilage extracellular matrix usually cause disproportionate short stature. Heterozygous NPR2 or SHOX defects may be found in ∼3% of short children, and also rasopathies (e.g., Noonan syndrome) can be found in children without clear syndromic appearance. Numerous other syndromes associated with short stature are caused by genetic defects in fundamental cellular processes, chromosomal abnormalities, CNVs, and imprinting disorders. © 2016 European Society of Endocrinology.

Lrp4 and Wise interplay controls the formation and patterning of mammary and other skin appendage placodes by modulating Wnt signaling.

PubMed

Ahn, Youngwook; Sims, Carrie; Logue, Jennifer M; Weatherbee, Scott D; Krumlauf, Robb

2013-02-01

The future site of skin appendage development is marked by a placode during embryogenesis. Although Wnt/β-catenin signaling is known to be essential for skin appendage development, it is unclear which cellular processes are controlled by the signaling and how the precise level of the signaling activity is achieved during placode formation. We have investigated roles for Lrp4 and its potential ligand Wise (Sostdc1) in mammary and other skin appendage placodes. Lrp4 mutant mice displayed a delay in placode initiation and changes in distribution and number of mammary precursor cells leading to abnormal morphology, number and position of mammary placodes. These Lrp4 mammary defects, as well as limb defects, were associated with elevated Wnt/β-catenin signaling and were rescued by reducing the dose of the Wnt co-receptor genes Lrp5 and Lrp6, or by inactivating the gene encoding β-catenin. Wise-null mice phenocopied a subset of the Lrp4 mammary defects and Wise overexpression reduced the number of mammary precursor cells. Genetic epistasis analyses suggest that Wise requires Lrp4 to exert its function and that, together, they have a role in limiting mammary fate, but Lrp4 has an early Wise-independent role in facilitating placode formation. Lrp4 and Wise mutants also share defects in vibrissa and hair follicle development, suggesting that the roles played by Lrp4 and Wise are common to skin appendages. Our study presents genetic evidence for interplay between Lrp4 and Wise in inhibiting Wnt/β-catenin signaling and provides an insight into how modulation of Wnt/β-catenin signaling controls cellular processes important for skin placode formation.

Analysis of the Ush2a gene in medaka fish (Oryzias latipes).

PubMed

Aller, Elena; Sánchez-Sánchez, Ana V; Chicote, Javier U; García-García, Gema; Udaondo, Patricia; Cavallé, Laura; Piquer-Gil, Marina; García-España, Antonio; Díaz-Llopis, Manuel; Millán, José M; Mullor, José L

2013-01-01

Patients suffering from Usher syndrome (USH) exhibit sensorineural hearing loss, retinitis pigmentosa (RP) and, in some cases, vestibular dysfunction. USH is the most common genetic disorder affecting hearing and vision and is included in a group of hereditary pathologies associated with defects in ciliary function known as ciliopathies. This syndrome is clinically classified into three types: USH1, USH2 and USH3. USH2 accounts for well over one-half of all Usher cases and mutations in the USH2A gene are responsible for the majority of USH2 cases, but also for atypical Usher syndrome and recessive non-syndromic RP. Because medaka fish (Oryzias latypes) is an attractive model organism for genetic-based studies in biomedical research, we investigated the expression and function of the USH2A ortholog in this teleost species. Ol-Ush2a encodes a protein of 5.445 aa codons, containing the same motif arrangement as the human USH2A. Ol-Ush2a is expressed during early stages of medaka fish development and persists into adulthood. Temporal Ol-Ush2a expression analysis using whole mount in situ hybridization (WMISH) on embryos at different embryonic stages showed restricted expression to otoliths and retina, suggesting that Ol-Ush2a might play a conserved role in the development and/or maintenance of retinal photoreceptors and cochlear hair cells. Knockdown of Ol-Ush2a in medaka fish caused embryonic developmental defects (small eyes and heads, otolith malformations and shortened bodies with curved tails) resulting in late embryo lethality. These embryonic defects, observed in our study and in other ciliary disorders, are associated with defective cell movement specifically implicated in left-right (LR) axis determination and planar cell polarity (PCP).

Animal Models of Fibrotic Lung Disease

PubMed Central

Lawson, William E.; Oury, Tim D.; Sisson, Thomas H.; Raghavendran, Krishnan; Hogaboam, Cory M.

2013-01-01

Interstitial lung fibrosis can develop as a consequence of occupational or medical exposure, as a result of genetic defects, and after trauma or acute lung injury leading to fibroproliferative acute respiratory distress syndrome, or it can develop in an idiopathic manner. The pathogenesis of each form of lung fibrosis remains poorly understood. They each result in a progressive loss of lung function with increasing dyspnea, and most forms ultimately result in mortality. To better understand the pathogenesis of lung fibrotic disorders, multiple animal models have been developed. This review summarizes the common and emerging models of lung fibrosis to highlight their usefulness in understanding the cell–cell and soluble mediator interactions that drive fibrotic responses. Recent advances have allowed for the development of models to study targeted injuries of Type II alveolar epithelial cells, fibroblastic autonomous effects, and targeted genetic defects. Repetitive dosing in some models has more closely mimicked the pathology of human fibrotic lung disease. We also have a much better understanding of the fact that the aged lung has increased susceptibility to fibrosis. Each of the models reviewed in this report offers a powerful tool for studying some aspect of fibrotic lung disease. PMID:23526222

Targeting neuronal MAPK14/p38α activity to modulate autophagy in the Alzheimer disease brain.

PubMed

Alam, John; Scheper, Wiep

2016-12-01

Dysregulated autophagic-lysosomal degradation of proteins has been linked to the most common genetic defect in familial Alzheimer disease, and has been correlated with disease progression in both human disease and in animal models. Recently, it was demonstrated that the expression of MAPK14/p38α protein is upregulated in the brain of APP-PS1 transgenic Alzheimer mouse and further that genetic deficiency of Mapk14 in the APP-PS1 mouse stimulates macroautophagy/autophagy, which then leads to reduced amyloid pathology via increasing autophagic-lysosomal degradation of BACE1. The findings resolve at least in the context of the APP-PS1 mouse, prior conflicting in vitro observations that have implicated MAPK14 in autophagic processes, and indicate that inhibition of MAPK14 enzyme activity has potential as a therapeutic approach to mitigate a critical physiological defect within neurons of the Alzheimer disease brain. Moreover, the findings suggest that biomarkers of BACE1 activity could be utilized to evaluate the effects of MAPK14 inhibition and other autophagy-inducing therapeutic approaches in human clinical studies, thereby potentially facilitating the clinical development of such agents.

Targeting neuronal MAPK14/p38α activity to modulate autophagy in the Alzheimer disease brain

PubMed Central

Alam, John; Scheper, Wiep

2016-01-01

ABSTRACT Dysregulated autophagic-lysosomal degradation of proteins has been linked to the most common genetic defect in familial Alzheimer disease, and has been correlated with disease progression in both human disease and in animal models. Recently, it was demonstrated that the expression of MAPK14/p38α protein is upregulated in the brain of APP-PS1 transgenic Alzheimer mouse and further that genetic deficiency of Mapk14 in the APP-PS1 mouse stimulates macroautophagy/autophagy, which then leads to reduced amyloid pathology via increasing autophagic-lysosomal degradation of BACE1. The findings resolve at least in the context of the APP-PS1 mouse, prior conflicting in vitro observations that have implicated MAPK14 in autophagic processes, and indicate that inhibition of MAPK14 enzyme activity has potential as a therapeutic approach to mitigate a critical physiological defect within neurons of the Alzheimer disease brain. Moreover, the findings suggest that biomarkers of BACE1 activity could be utilized to evaluate the effects of MAPK14 inhibition and other autophagy-inducing therapeutic approaches in human clinical studies, thereby potentially facilitating the clinical development of such agents. PMID:27715387

Fostering International Collaboration in Birth Defects Research and Prevention: A Perspective From the International Clearinghouse for Birth Defects Surveillance and Research

PubMed Central

Botto, Lorenzo D.; Robert-Gnansia, Elisabeth; Siffel, Csaba; Harris, John; Borman, Barry; Mastroiacovo, Pierpaolo

2006-01-01

The International Clearing-house for Birth Defects Surveillance and Research, formerly known as International Clearinghouse of Birth Defects Monitoring Systems, consists of 40 registries worldwide that collaborate in monitoring 40 types of birth defects. Clearinghouse activities include the sharing and joint monitoring of birth defect data, epidemiologic and public health research, and capacity building, with the goal of reducing disease and promoting healthy birth outcomes through primary prevention. We discuss 3 of these activities: the collaborative assessment of the potential teratogenicity of first-trimester use of medications (the MADRE project), an example of the intersection of surveillance and research; the international databases of people with orofacial clefts, an example of the evolution from surveillance to outcome research; and the study of genetic polymorphisms, an example of collaboration in public health genetics. PMID:16571708

[Insulin resistance--a physiopathological condition with numerous sequelae: non-insulin-dependent diabetes mellitus (NIDDM), android obesity, essential hypertension, dyslipidemia and atherosclerosis].

PubMed

Pedersen, O

1992-05-11

Recent research has demonstrated that reduced insulin-stimulated glucose metabolism in skeletal muscle (insulin resistance) and hyperinsulinism are common features in widespread diseases such as essential hypertension, android obesity, non-insulin dependent diabetes mellitus, dyslipidemia (in the form of raised serum triglyceride and reduced serum high-density lipoprotein (HDL) cholesterol) and arteriosclerosis. Simultaneously, investigations in a comprehensive group of healthy middle-aged men have revealed insulin resistance in one fourth. On the basis of these observations, a working hypothesis is suggested which postulates that genetic abnormalities in one or more of the candidate genes in the modes of action of insulin occur in a great proportion of the population. These may result in insulin resistance (primary genetic insulin resistance). Primary insulin resistance may be potentiated by a series of circumstances such as ageing, high-fat diet, lack of physical activity, hormonal and metabolic abnormalities or drugs (secondary insulin resistance). As a consequence of the reduced effect of insulin on muscle tissue, compensatory hyperinsulinism develops. Depending on the remaining vulnerability of the individual the hyperinsulinism is presumed to result in development of one or more phenotypes. For example if the beta-cells of the pancreas are unable to secrete sufficient insulin to compensate the insulin resistance on account of genetic defects, glucose intolerance will develop. In a similar manner, hyperinsulinism in insulin-resistant individuals who are predisposed to essential hypertension is presumed to reveal genetic defects in the blood pressure regulating mechanisms and thus contribute to development of the disease.(ABSTRACT TRUNCATED AT 250 WORDS)

Epidemiologic and Genetic Aspects of Spina Bifida and Other Neural Tube Defects

ERIC Educational Resources Information Center

Au, Kit Sing; Ashley-Koch, Allison; Northrup, Hope

2010-01-01

The worldwide incidence of neural tube defects (NTDs) ranges from 1.0 to 10.0 per 1,000 births with almost equal frequencies between two major categories: anencephaly and spina bifida (SB). Epidemiological studies have provided valuable insight for (a) researchers to identify nongenetic and genetic factors contributing to etiology, (b) public…

Genetics of human neural tube defects

PubMed Central

Greene, Nicholas D.E.; Stanier, Philip; Copp, Andrew J.

2009-01-01

Neural tube defects (NTDs) are common, severe congenital malformations whose causation involves multiple genes and environmental factors. Although more than 200 genes are known to cause NTDs in mice, there has been rather limited progress in delineating the molecular basis underlying most human NTDs. Numerous genetic studies have been carried out to investigate candidate genes in cohorts of patients, with particular reference to those that participate in folate one-carbon metabolism. Although the homocysteine remethylation gene MTHFR has emerged as a risk factor in some human populations, few other consistent findings have resulted from this approach. Similarly, attention focused on the human homologues of mouse NTD genes has contributed only limited positive findings to date, although an emerging association between genes of the non-canonical Wnt (planar cell polarity) pathway and NTDs provides candidates for future studies. Priorities for the next phase of this research include: (i) larger studies that are sufficiently powered to detect significant associations with relatively minor risk factors; (ii) analysis of multiple candidate genes in groups of well-genotyped individuals to detect possible gene–gene interactions; (iii) use of high throughput genomic technology to evaluate the role of copy number variants and to detect ‘private’ and regulatory mutations, neither of which have been studied to date; (iv) detailed analysis of patient samples stratified by phenotype to enable, for example, hypothesis-driven testing of candidates genes in groups of NTDs with specific defects of folate metabolism, or in groups of fetuses with well-defined phenotypes such as craniorachischisis. PMID:19808787

Integration of DNA sample collection into a multi-site birth defects case-control study.

PubMed

Rasmussen, Sonja A; Lammer, Edward J; Shaw, Gary M; Finnell, Richard H; McGehee, Robert E; Gallagher, Margaret; Romitti, Paul A; Murray, Jeffrey C

2002-10-01

Advances in quantitative analysis and molecular genotyping have provided unprecedented opportunities to add biological sampling and genetic information to epidemiologic studies. The purpose of this article is to describe the incorporation of DNA sample collection into the National Birth Defects Prevention Study (NBDPS), an ongoing case-control study in an eight-state consortium with a primary goal to identify risk factors for birth defects. Babies with birth defects are identified through birth defects surveillance systems in the eight participating centers. Cases are infants with one or more of over 30 major birth defects. Controls are infants without defects from the same geographic area. Epidemiologic information is collected through an hour-long interview with mothers of both cases and controls. We added the collection of buccal cytobrush DNA samples for case-infants, control-infants, and their parents to this study. We describe here the methods by which the samples have been collected and processed, establishment of a centralized resource for DNA banking, and quality control, database management, access, informed consent, and confidentiality issues. Biological sampling and genetic analyses are important components to epidemiologic studies of birth defects aimed at identifying risk factors. The DNA specimens collected in this study can be used for detection of mutations, study of polymorphic variants that confer differential susceptibility to teratogens, and examination of interactions among genetic risk factors. Information on the methods used and issues faced by the NBDPS may be of value to others considering the addition of DNA sampling to epidemiologic studies.

Molecular Analysis of Congenital Hypothyroidism in Saudi Arabia: SLC26A7 Mutation Is a Novel Defect in Thyroid Dyshormonogenesis.

PubMed

Zou, Minjing; Alzahrani, Ali S; Al-Odaib, Ali; Alqahtani, Mohammad A; Babiker, Omer; Al-Rijjal, Roua A; BinEssa, Huda A; Kattan, Walaa E; Al-Enezi, Anwar F; Al Qarni, Ali; Al-Faham, Manar S A; Baitei, Essa Y; Alsagheir, Afaf; Meyer, Brian F; Shi, Yufei

2018-05-01

Congenital hypothyroidism (CH) is the most common neonatal endocrine disorder, affecting one in 3000 to 4000 newborns. Since the introduction of a newborn screening program in 1988, more than 300 cases have been identified. The underlying genetic defects have not been systematically studied. To identify the mutation spectrum of CH-causing genes. Fifty-five patients from 47 families were studied by next-generation exome sequencing. Mutations were identified in 52.7% of patients (29 of 55) in the following 11 genes: TG, TPO, DUOX2, SLC26A4, SLC26A7, TSHB, TSHR, NKX2-1, PAX8, CDCA8, and HOXB3. Among 30 patients with thyroid dyshormonogenesis, biallelic TG mutations were found in 12 patients (40%), followed by biallelic mutations in TPO (6.7%), SLC26A7 (6.7%), and DUOX2 (3.3%). Monoallelic SLC26A4 mutations were found in two patients, one of them coexisting with two tandem biallelic deletions in SLC26A7. In 25 patients with thyroid dysgenesis, biallelic mutations in TSHR were found in six patients (24%). Biallelic mutations in TSHB, PAX 8, NKX2-1, or HOXB3 were found once in four different patients. A monoallelic CDCA8 mutation was found in one patient. Most mutations were novel, including three TG, two TSHR, and one each in DUOX2, TPO, SLC26A7, TSHB, NKX2-1, PAX8, CDCA8, and HOXB3. SLC26A7 and HOXB3 were novel genes associated with thyroid dyshormonogenesis and dysgenesis, respectively. TG and TSHR mutations are the most common genetic defects in Saudi patients with CH. The prevalence of other disease-causing mutations is low, reflecting the consanguineous nature of the population. SLC26A7 mutations appear to be associated with thyroid dyshormonogenesis.

The impact of RABL2B gene (rs144944885) on human male infertility in patients with oligoasthenoteratozoospermia and immotile short tail sperm defects.

PubMed

Hosseini, Seyedeh Hanieh; Sadighi Gilani, Mohammad Ali; Meybodi, Anahita Mohseni; Sabbaghian, Marjan

2017-04-01

Male infertility is a multifactorial disorder with impressively genetic basis; besides, sperm abnormalities are the cause of numerous cases of male infertility. In this study, we evaluated the genetic variants in exons 4 and 5 and their intron-exon boundaries in RABL2B gene in infertile men with oligoasthenoteratozoospermia (OAT) and immotile short tail sperm (ISTS) defects to define if there is any association between these variants and human male infertility. To this purpose, DNA was extracted from peripheral blood and after PCR reaction and sequencing, the results of sequenced segments were analyzed. In the present study, 30 infertile men with ISTS defect and 30 oligoasthenoteratozoospermic infertile men were recruited. All men were of Iranian origin and it took 3 years to collect patient's samples with ISTS defect. As a result, the 50776482 delC intronic variant (rs144944885) was identified in five patients with oligoasthenoteratozoospermia defect and one patient with ISTS defect in heterozygote form. This variant was not identified in controls. The allelic frequency of the 50776482 delC variant was significantly statistically higher in oligoasthenoteratozoospermic infertile men (p < 0.05). Bioinformatics studies suggested that the 50776482 delC allele would modify the splicing of RABL2B pre-mRNA. In addition, we identified a new genetic variant in RABL2B gene. According to the present study, 50776482 delC allele in the RABL2B gene could be a risk factor in Iranian infertile men with oligoasthenoteratozoospermia defect, but more genetic studies are required to understand the accurate role of this variant in pathogenesis of human male infertility.

Analysis of chromosome 22q11 copy number variations by multiplex ligation-dependent probe amplification for prenatal diagnosis of congenital heart defect.

PubMed

Zhang, Jingjing; Ma, Dingyuan; Wang, Yan; Cao, Li; Wu, Yun; Qiao, Fengchang; Liu, An; Li, Li; Lin, Ying; Liu, Gang; Liu, Cuiyun; Hu, Ping; Xu, Zhengfeng

2015-01-01

Congenital heart defects (CHD) represent one of the most common birth defects. This study aimed to evaluate the value of multiplex ligation-dependent probe amplification (MLPA) as a tool to detect the copy number variations (CNVs) of 22q11 in fetuses with CHD. A large cohort of 225 fetuses with CHD was screened by fetal echocardiography. Once common chromosome abnormalities in 30 fetuses were screened out by conventional G-banding analysis, the CNVs of chromosome 22q11 in the remaining 195 fetuses were determined by MLPA for prenatal genetic counseling. In 195 CHD fetuses with normal karyotype, 11 cases had pathological CNVs, including 22q11.2 deletion (seven cases), the deletion of 22q11 cat eye syndrome (CES) region (one case), 22q11.2 duplication (one case), 22q13.3 deletion (one case) and 17p13.3 deletion (one case). In total, our findings from MLPA screening represented 4.9 % in our cohort. Among these, three cases were inherited CNVs, and eight cases were de novo. These CNVs were further verified by single nucleotide polymorphism (SNP)-array analysis, and their chromosomal location was refined. This study indicated that MLPA could serve as an effective test for routine prenatal diagnosis of 22q11 in fetuses with CHD.

Genetic Counseling: MedlinePlus Health Topic

MedlinePlus

... Craniosynostosis as a clinical and diagnostic problem: molecular pathology and... Article: GENETICS IN ENDOCRINOLOGY: Genetic counseling for congenital ... March of Dimes Birth Defects Foundation Also in Spanish ...

Environmental enrichment decreases GABAergic inhibition and improves cognitive abilities, synaptic plasticity, and visual functions in a mouse model of Down syndrome

PubMed Central

Begenisic, Tatjana; Spolidoro, Maria; Braschi, Chiara; Baroncelli, Laura; Milanese, Marco; Pietra, Gianluca; Fabbri, Maria E.; Bonanno, Giambattista; Cioni, Giovanni; Maffei, Lamberto; Sale, Alessandro

2011-01-01

Down syndrome (DS) is the most common genetic disorder associated with mental retardation. It has been repeatedly shown that Ts65Dn mice, the prime animal model for DS, have severe cognitive and neural plasticity defects due to excessive inhibition. We report that increasing sensory-motor stimulation in adulthood through environmental enrichment (EE) reduces brain inhibition levels and promotes recovery of spatial memory abilities, hippocampal synaptic plasticity, and visual functions in adult Ts65Dn mice. PMID:22207837

Genetic and cellular mechanisms of the formation of Esophageal Atresia and Tracheoesophageal Fistula

PubMed Central

Jacobs, Ian J.; Que, Jianwen

2015-01-01

Foregut separation involves dynamic changes in the activities of signaling pathways and transcription factors. Recent mouse genetic studies demonstrate that some of these pathways interact with each other to form a complex network, leading to a unique dorsal-ventral patterning in the early foregut. In this review we will discuss how this unique dorsal-ventral patterning is set prior to the foregut separation and how disruption of this patterning affects the separation process. We will further discuss the roles of downstream targets of these pathways in regulating separation at cellular and molecular levels. Understanding the mechanism of normal separation process will provide us insights into the pathobiology of a relatively common birth defect Esophageal Atresia (EA) with/without Tracheo-esophageal Fistula (TEF). PMID:23679023

Germline epimutation in humans.

PubMed

Cropley, Jennifer E; Martin, David I K; Suter, Catherine M

2008-12-01

Epigenetic modifications provide all multicellular organisms with a system of gene regulation that allows clonally heritable yet reversible alterations in gene transcription. Errors in this complex system can give rise to abnormal gene silencing, termed 'epimutation'; importantly, this can occur in the absence of any underlying genetic defect. Epimutations are commonly somatic events, and are particularly prevalent in tumors, but we and others have shown that epimutation can also arise in the germline, giving rise to soma-wide transcriptional silencing of a gene. A germline epimutation can mimic the effect of an inactivating mutation, and in doing so, can phenocopy a genetic disease. In this article, we will review the recent findings with germline epimutation at the tumor suppressor gene MLH1, discuss the possible etiology of this phenomenon, and the implications of germline epimutation in humans.

Xeroderma pigmentosum at a tertiary care center in Saudi Arabia.

PubMed

Alwatban, Lenah; Binamer, Yousef

2017-01-01

Xeroderma pigmentosum (XP) is a rare autosomal recessive disorder caused by defective DNA repair that results in extreme sensitivity to ultraviolet (UV) rays. Depending on the type of XP, the disease may affect the skin, eyes and nervous system. Describe the dermatologic manifestations in patients suffering from XP. Retrospective, descriptive review of medical records. Dermatology clinic at tertiary care center in Riyadh. This study included Saudi patients with clinically confirmed XP. Demographic and clinical data including pathology and associated conditions and outcomes. Of 21 patients with XP, the most common manifestation was lentigines, affecting 18 patients (86%). The most common skin cancer was basal cell carcinoma followed by squamous cell carcinoma (SCC) affecting 15 (71.4%) and 9 (42.8%), respectively. Other skin findings included neurofibroma, trichilemmoma and seborrheic keratosis. Ocular involvement included photophobia, which was the most common finding followed by dryness and ocular malignancies. Two patients showed neurological involvement, which correlated with the type of mutation. Considering that XP is a rare genetic disease, this description of our patient population will aid in early recognition and diagnosis. Retrospective and small number of patients. Genetic analyses were done for only 5 of the 21 patients.

Monogenic diseases associated with intestinal inflammation: implications for the understanding of inflammatory bowel disease.

PubMed

Uhlig, Holm H

2013-12-01

Inflammatory bowel disease (IBD), encompassing Crohn's disease and ulcerative colitis, has multifactorial aetiology with complex interactions between genetic and environmental factors. Over 150 genetic loci are associated with IBD. The genetic contribution of the majority of those loci towards explained heritability is low. Recent studies have reported an increasing spectrum of human monogenic diseases that can present with IBD-like intestinal inflammation. A substantial proportion of patients with those genetic defects present with very early onset of intestinal inflammation. The 40 monogenic defects with IBD-like pathology selected in this review can be grouped into defects in intestinal epithelial barrier and stress response, immunodeficiencies affecting granulocyte and phagocyte activity, hyper- and autoinflammatory disorders as well as defects with disturbed T and B lymphocyte selection and activation. In addition, there are defects in immune regulation affecting regulatory T cell activity and interleukin (IL)-10 signalling. Related to the variable penetrance of the IBD-like phenotype, there is a likely role for modifier genes and gene-environment interactions. Treatment options in this heterogeneous group of disorders range from anti-inflammatory and immunosuppressive therapy to blockade of tumour necrosis factor α and IL-1β, surgery, haematopoietic stem cell transplantation or gene therapy. Understanding of prototypic monogenic 'orphan' diseases cannot only provide treatment options for the affected patients but also inform on immunological mechanisms and complement the functional understanding of the pathogenesis of IBD.

Factors affecting maternal participation in the genetic component of the National Birth Defects Prevention Study-United States, 1997-2007.

PubMed

Glidewell, Jill; Reefhuis, Jennita; Rasmussen, Sonja A; Woomert, Alison; Hobbs, Charlotte; Romitti, Paul A; Crider, Krista S

2014-04-01

As epidemiological studies expand to examine gene-environment interaction effects, it is important to identify factors associated with participation in genetic studies. The National Birth Defects Prevention Study is a multisite case-control study designed to investigate environmental and genetic risk factors for major birth defects. The National Birth Defects Prevention Study includes maternal telephone interviews and mailed buccal cell self-collection kits. Because subjects can participate in the interview, independent of buccal cell collection, detailed analysis of factors associated with participation in buccal cell collection was possible. Multivariable logistic regression models were used to identify the factors associated with participation in the genetic component of the study. Buccal cell participation rates varied by race/ethnicity (non-Hispanic whites, 66.9%; Hispanics, 60.4%; and non-Hispanic blacks, 47.3%) and study site (50.2-74.2%). Additional monetary incentive following return of buccal cell kit and shorter interval between infant's estimated date of delivery and interview were associated with increased participation across all racial/ethnic groups. Higher education and delivering an infant with a birth defect were associated with increased participation among non-Hispanic whites and Hispanics. Factors associated with participation varied by race/ethnicity. Improved understanding of factors associated with participation may facilitate strategies to increase participation, thereby improving generalizability of study findings.

Genetics Home Reference: X-linked immunodeficiency with magnesium defect, Epstein-Barr virus infection, and neoplasia

MedlinePlus

... Share: Email Facebook Twitter Home Health Conditions XMEN X-linked immunodeficiency with magnesium defect, Epstein-Barr virus ... Javascript to view the expand/collapse boxes. Description X-linked immunodeficiency with magnesium defect, Epstein-Barr virus ...

History, heresy and radiology in scientific discovery.

PubMed

McCredie, J

2009-10-01

Nowadays, most drugs reach the market after research has established their pharmacology, safety and efficacy. That was not always the case 50 years ago. Thalidomide was used before its target cell or mode of action were known. Commencing with the thalidomide catastrophe--an epidemic of gross birth defects (1958-1962)--thalidomide's origins are revisited to show how this drug came to be made and sold in the 1950s. Thalidomide intersected with Australian radiology in the 1970s. The site and mode of action of the drug was deduced from X-rays of thalidomide-induced bone defects, which have classical radiological signs of sensory neuropathic osteoarthropathy. The longitudinal reduction deformities follow the distribution of segmental sensory innervation of the limb skeleton, indicating neural crest as the target organ. Injury to one level of neural crest halts normal neurotrophism and deletes the dependent segment--a previously unrecognised embryonic mechanism that explains most non-genetic birth defects. The final common pathway is neural crest injury and failure of normal neurotrophism to result in longitudinal reduction deformities, for example, phocomelia.

Evolving Mechanistic Views and Emerging Therapeutic Strategies for Cystic Fibrosis–Related Diabetes

PubMed Central

2017-01-01

Diabetes is a common and important complication of cystic fibrosis, an autosomal recessive genetic disease due to mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene. Cystic fibrosis–related diabetes (CFRD) is associated with profound detrimental effects on the disease course and mortality and is expected to increase in prevalence as the survival of patients with cystic fibrosis continues to improve. Despite progress in the functional characterization of CFTR molecular defects, the mechanistic basis of CFRD is not well understood, in part because of the relative inaccessibility of the pancreatic tissue and the limited availability of representative animal models. This review presents a concise overview of the current understanding of CFRD pathogenesis and provides a cutting-edge update on novel findings from human and animal studies. Potential contributions from paracrine mechanisms and β-cell compensatory mechanisms are highlighted, as well as functional β-cell and α-cell defects, incretin defects, exocrine pancreatic insufficiency, and loss of islet cell mass. State-of-the-art and emerging treatment options are explored, including advances in insulin administration, CFTR modulators, cell replacement, gene replacement, and gene editing therapies. PMID:29264462

[22q11.2DS Syndrome as a Genetic Subtype of Schizophrenia].

PubMed

Huertas-Rodríguez, Cindy Katherin; Payán-Gómez, César; Forero-Castro, Ruth Maribel

2015-01-01

The 22q11.2 deletion syndrome (22q11.2DS) is associated with the microdeletion of this chromosomal region, and represents the second most common genetic syndrome after Down's syndrome. In patients with schizophrenia, 22q11.2DS has a prevalence of 2%, and in selected groups can be increased to between 32-53%. To describe the generalities of 22q11.2DS syndrome as a genetic subtype of schizophrenia, its clinical characteristics, molecular genetic aspects, and frequency in different populations. A review was performed from 1967 to 2013 in scientific databases, compiling articles about 22q11.2DS syndrome and its association with schizophrenia. The 22q11.2 DS syndrome has a variable phenotype associated with other genetic syndromes, birth defects in many tissues and organs, and a high rate of psychiatric disorders, particularly schizophrenia. Likewise, it has been identified in clinical populations with schizophrenia selected by the presence of common syndromic characteristics. FISH, qPCR and MLPA techniques, and recently, aCGH and NGS technologies, are being used to diagnose this microdeletion. It is important in clinical practice to remember that people suffering the 22q11.2DS have a high genetic risk for developing schizophrenia, and it is considered that the simultaneous presence of this disease and 22q11.2DS represents a genetic subtype of schizophrenia. There are clear phenotypic criteria, molecular and cytogenetic methods to diagnose this group of patients, and to optimize a multidisciplinary approach in their monitoring. Copyright © 2014 Asociación Colombiana de Psiquiatría. Publicado por Elsevier España. All rights reserved.

The Child with Recurrent Mycobacterial Disease.

PubMed

Reed, Brian; Dolen, William K

2018-06-23

Many genetic conditions predispose affected individuals to opportunistic infections. A number of immunodeficiency diseases, including genetic defects termed Mendelian susceptibility to mycobacterial disease (MSMD), permit infection from many different strains of mycobacteria that would otherwise not cause disease. These include tuberculous and nontuberculous mycobacteria, and bacille Calmette-Guérin vaccine (BCG). Patients may present with infections from other organisms that depend on macrophage function for containment. Defects in multiple genes in the IL-12 and NFKB signaling pathways can cause the MSMD phenotype, some of which include IL12RB1, IL12B, IKBKG, ISG15, IFNGR1, IFNGR2, CYBB, TYK2, IRF8, and STAT1. Multiple autosomal recessive and dominant, and 2 X-linked recessive gene defects resulting in the MSMD phenotype have been reported, and others await discovery. This review presents the known gene defects and describes clinical findings that result from the mutations. If MSMD is suspected, a careful clinical history and examination and basic immunodeficiency screening tests will narrow the differential diagnosis. A specific diagnosis requires more sophisticated laboratory investigation. Genetic testing permits a definitive diagnosis, permitting genetic counseling. Mild cases respond well to appropriate antibiotic therapy, whereas severe disease may require hematopoietic stem cell transplantation.

Mining the human genome after Association for Molecular Pathology v. Myriad Genetics

PubMed Central

Evans, Barbara J

2014-01-01

The Supreme Court's recent decision in Association for Molecular Pathology v. Myriad Genetics portrays the human genome as a product of nature. This frames medical genetics as an extractive industry that mines a natural resource to produce valuable goods and services. Natural resource law offers insights into problems medical geneticists can expect after this decision and suggests possible solutions. Increased competition among clinical laboratories offers various benefits but threatens to increase fragmentation of genetic data resources, potentially causing waste in the form of lost opportunities to discover the clinical significance of particular gene variants. The solution lies in addressing legal barriers to appropriate data sharing. Sustainable discovery in the field of medical genetics can best be achieved through voluntary data sharing rather than command-and-control tactics, but voluntary mechanisms must be conceived broadly to include market-based approaches as well as donative and publicly funded data commons. The recently revised Health Insurance Portability and Accountability Act Privacy Rule offers an improved—but still imperfect—framework for market-oriented data sharing. This article explores strategies for addressing the Privacy Rule's remaining defects. America is close to having a legal framework that can reward innovators, protect privacy, and promote needed data sharing to advance medical genetics. Genet Med 16 7, 504–509. PMID:24357850

Engineering human cell spheroids to model embryonic tissue fusion in vitro.

EPA Science Inventory

Epithelial-mesenchymal interactions drive embryonic fusion events during development and upon perturbation can result in birth defects. Cleft palate and neural tube defects can result from genetic defects or environmental exposures during development, yet very little is known abo...

Whole-exome sequencing gives additional benefits compared to candidate gene sequencing in the molecular diagnosis of children with growth hormone or IGF-1 insensitivity.

PubMed

Shapiro, Lucy; Chatterjee, Sumana; Ramadan, Dina G; Davies, Kate M; Savage, Martin O; Metherell, Louise A; Storr, Helen L

2017-12-01

GH insensitivity (GHI) is characterised by short stature, IGF-1 deficiency and normal/elevated serum GH. IGF-1 insensitivity results in pre- and post-natal growth failure with normal/high IGF-1 levels. The prevalence of genetic defects is unknown. To identify the underlying genetic diagnoses in a paediatric cohort with GH or IGF-1 insensitivity using candidate gene (CGS) and whole-exome sequencing (WES) and assess factors associated with the discovery of a genetic defect. We undertook a prospective study of 132 patients with short stature and suspected GH or IGF-1 insensitivity referred to our centre for genetic analysis. 107 (96 GHI, 88 probands; 11 IGF-1 insensitivity, 9 probands) underwent CGS. WES was performed in those with no defined genetic aetiology following CGS. A genetic diagnosis was discovered 38/107 (36%) patients (32% probands) by CGS. WES revealed 11 patients with genetic variants in genes known to cause short stature. A further 2 patients had hypomethylation in the H19/IGF2 region or mUPD7 consistent with Silver-Russell Syndrome (total with genetic diagnosis 51/107, 48% or 41/97, 42% probands). WES also identified homozygous putative variants in FANCA and PHKB in 2 patients. Low height SDS and consanguinity were highly predictive for identifying a genetic defect. Comprehensive genetic testing confirms the genetic heterogeneity of GH/IGF-1 insensitivity and successfully identified the genetic aetiology in a significant proportion of cases. WES is rapid and may isolate genetic variants that have been missed by traditional clinically driven genetic testing. This emphasises the benefits of specialist diagnostic centres. © 2017 European Society of Endocrinology.

Drosophila Models of Parkinson's Disease: Discovering Relevant Pathways and Novel Therapeutic Strategies

PubMed Central

Muñoz-Soriano, Verónica; Paricio, Nuria

2011-01-01

Parkinson's disease (PD) is the second most common neurodegenerative disorder and is mainly characterized by the selective and progressive loss of dopaminergic neurons, accompanied by locomotor defects. Although most PD cases are sporadic, several genes are associated with rare familial forms of the disease. Analyses of their function have provided important insights into the disease process, demonstrating that three types of cellular defects are mainly involved in the formation and/or progression of PD: abnormal protein aggregation, oxidative damage, and mitochondrial dysfunction. These studies have been mainly performed in PD models created in mice, fruit flies, and worms. Among them, Drosophila has emerged as a very valuable model organism in the study of either toxin-induced or genetically linked PD. Indeed, many of the existing fly PD models exhibit key features of the disease and have been instrumental to discover pathways relevant for PD pathogenesis, which could facilitate the development of therapeutic strategies. PMID:21512585

Insulin restores neuronal nitric oxide synthase expression and function that is lost in diabetic gastropathy

PubMed Central

Watkins, Crystal C.; Sawa, Akira; Jaffrey, Samie; Blackshaw, Seth; Barrow, Roxanne K.; Snyder, Solomon H.; Ferris, Christopher D.

2000-01-01

Gastrointestinal dysfunction is common in diabetic patients. In genetic (nonobese diabetic) and toxin-elicited (streptozotocin) models of diabetes in mice, we demonstrate defects in gastric emptying and nonadrenergic, noncholinergic relaxation of pyloric muscle, which resemble defects in mice harboring a deletion of the neuronal nitric oxide synthase gene (nNOS). The diabetic mice manifest pronounced reduction in pyloric nNOS protein and mRNA. The decline of nNOS in diabetic mice does not result from loss of myenteric neurons. nNOS expression and pyloric function are restored to normal levels by insulin treatment. Thus diabetic gastropathy in mice reflects an insulin-sensitive reversible loss of nNOS. In diabetic animals, delayed gastric emptying can be reversed with a phosphodiesterase inhibitor, sildenafil. These findings have implications for novel therapeutic approaches and may clarify the etiology of diabetic gastropathy. PMID:10930440

What to consider when pseudohypoparathyroidism is ruled out: iPPSD and differential diagnosis.

PubMed

Pereda, Arrate; Garin, Intza; Perez de Nanclares, Guiomar

2018-03-02

Pseudohypoparathyroidism (PHP) is a rare disease whose phenotypic features are rather difficult to identify in some cases. Thus, although these patients may present with the Albright's hereditary osteodystrophy (AHO) phenotype, which is characterized by small stature, obesity with a rounded face, subcutaneous ossifications, mental retardation and brachydactyly, its manifestations are somewhat variable. Indeed, some of them present with a complete phenotype, whereas others show only subtle manifestations. In addition, the features of the AHO phenotype are not specific to it and a similar phenotype is also commonly observed in other syndromes. Brachydactyly type E (BDE) is the most specific and objective feature of the AHO phenotype, and several genes have been associated with syndromic BDE in the past few years. Moreover, these syndromes have a skeletal and endocrinological phenotype that overlaps with AHO/PHP. In light of the above, we have developed an algorithm to aid in genetic testing of patients with clinical features of AHO but with no causative molecular defect at the GNAS locus. Starting with the feature of brachydactyly, this algorithm allows the differential diagnosis to be broadened and, with the addition of other clinical features, can guide genetic testing. We reviewed our series of patients (n = 23) with a clinical diagnosis of AHO and with brachydactyly type E or similar pattern, who were negative for GNAS anomalies, and classify them according to the diagnosis algorithm to finally propose and analyse the most probable gene(s) in each case. A review of the clinical data for our series of patients, and subsequent analysis of the candidate gene(s), allowed detection of the underlying molecular defect in 12 out of 23 patients: five patients harboured a mutation in PRKAR1A, one in PDE4D, four in TRPS1 and two in PTHLH. This study confirmed that the screening of other genes implicated in syndromes with BDE and AHO or a similar phenotype is very helpful for establishing a correct genetic diagnosis for those patients who have been misdiagnosed with "AHO-like phenotype" with an unknown genetic cause, and also for better describing the characteristic and differential features of these less common syndromes.

Optimization of self-interstitial clusters in 3C-SiC with genetic algorithm

NASA Astrophysics Data System (ADS)

Ko, Hyunseok; Kaczmarowski, Amy; Szlufarska, Izabela; Morgan, Dane

2017-08-01

Under irradiation, SiC develops damage commonly referred to as black spot defects, which are speculated to be self-interstitial atom clusters. To understand the evolution of these defect clusters and their impacts (e.g., through radiation induced swelling) on the performance of SiC in nuclear applications, it is important to identify the cluster composition, structure, and shape. In this work the genetic algorithm code StructOpt was utilized to identify groundstate cluster structures in 3C-SiC. The genetic algorithm was used to explore clusters of up to ∼30 interstitials of C-only, Si-only, and Si-C mixtures embedded in the SiC lattice. We performed the structure search using Hamiltonians from both density functional theory and empirical potentials. The thermodynamic stability of clusters was investigated in terms of their composition (with a focus on Si-only, C-only, and stoichiometric) and shape (spherical vs. planar), as a function of the cluster size (n). Our results suggest that large Si-only clusters are likely unstable, and clusters are predominantly C-only for n ≤ 10 and stoichiometric for n > 10. The results imply that there is an evolution of the shape of the most stable clusters, where small clusters are stable in more spherical geometries while larger clusters are stable in more planar configurations. We also provide an estimated energy vs. size relationship, E(n), for use in future analysis.

Plastid signalling under multiple conditions is accompanied by a common defect in RNA editing in plastids.

PubMed

Kakizaki, Tomohiro; Yazu, Fumiko; Nakayama, Katsuhiro; Ito-Inaba, Yasuko; Inaba, Takehito

2012-01-01

Retrograde signalling from the plastid to the nucleus, also known as plastid signalling, plays a key role in coordinating nuclear gene expression with the functional state of plastids. Inhibitors that cause plastid dysfunction have been suggested to generate specific plastid signals related to their modes of action. However, the molecules involved in plastid signalling remain to be identified. Genetic studies indicate that the plastid-localized pentatricopeptide repeat protein GUN1 mediates signalling under several plastid signalling-related conditions. To elucidate further the nature of plastid signals, investigations were carried out to determine whether different plastid signal-inducing treatments had similar effects on plastids and on nuclear gene expression. It is demonstrated that norflurazon and lincomycin treatments and the plastid protein import2-2 (ppi2-2) mutation, which causes a defect in plastid protein import, all resulted in similar changes at the gene expression level. Furthermore, it was observed that these three treatments resulted in defective RNA editing in plastids. This defect in RNA editing was not a secondary effect of down-regulation of pentatricopeptide repeat protein gene expression in the nucleus. The results indicate that these three treatments, which are known to induce plastid signals, affect RNA editing in plastids, suggesting an unprecedented link between plastid signalling and RNA editing.

Persistent Short-Term Memory Defects Following Sleep Deprivation in a Drosophila Model of Parkinson Disease

PubMed Central

Seugnet, Laurent; Galvin, James E.; Suzuki, Yasuko; Gottschalk, Laura; Shaw, Paul J.

2009-01-01

Study Objectives: Parkinson disease (PD) is the second most common neurodegenerative disorder in the United States. It is associated with motor deficits, sleep disturbances, and cognitive impairment. The pathology associated with PD and the effects of sleep deprivation impinge, in part, upon common molecular pathways suggesting that sleep loss may be particularly deleterious to the degenerating brain. Thus we investigated the long-term consequences of sleep deprivation on short-term memory using a Drosophila model of Parkinson disease. Participants: Transgenic strains of Drosophila melanogaster. Design: Using the GAL4-UAS system, human α-synuclein was expressed throughout the nervous system of adult flies. α-Synuclein expressing flies (αS flies) and the corresponding genetic background controls were sleep deprived for 12 h at age 16 days and allowed to recover undisturbed for at least 3 days. Short-term memory was evaluated using aversive phototaxis suppression. Dopaminergic systems were assessed using mRNA profiling and immunohistochemistry. Measurments and Results: When sleep deprived at an intermediate stage of the pathology, αS flies showed persistent short-term memory deficits that lasted ≥ 3 days. Cognitive deficits were not observed in younger αS flies nor in genetic background controls. Long-term impairments were not associated with accelerated loss of dopaminergic neurons. However mRNA expression of the dopamine receptors dDA1 and DAMB were significantly increased in sleep deprived αS flies. Blocking D1-like receptors during sleep deprivation prevented persistent short-term memory deficits. Importantly, feeding flies the polyphenolic compound curcumin blocked long-term learning deficits. Conclusions: These data emphasize the importance of sleep in a degenerating/reorganizing brain and shows that pathological processes induced by sleep deprivation can be dissected at the molecular and cellular level using Drosophila genetics. Citation: Seugnet L; Galvin JE; Suzuki Y; Gottschalk L; Shaw PJ. Persistent short-term memory defects following sleep deprivation in a drosophila model of parkinson disease. SLEEP 2009;32(8):984-992. PMID:19725249

Identifcation of a Novel Mutation p.I240T in the FRMD7 gene in a Family with Congenital Nystagmus

NASA Astrophysics Data System (ADS)

Zhu, Yihua; Zhuang, Jianfu; Ge, Xianglian; Zhang, Xiao; Wang, Zheng; Sun, Ji; Yang, Juhua; Gu, Feng

2013-10-01

Congenital Nystagmus (CN) is a genetically heterogeneous ocular disease, which causes a significant proportion of childhood visual impairment. To identify the underlying genetic defect of a CN family, twenty-two members were recruited. Genotype analysis showed that affected individuals shared a common haplotype with markers flanking FRMD7 locus. Sequencing FRMD7 revealed a T > C transition in exon 8, causing a conservative substitution of Isoleucine to Tyrosine at codon 240. By protein structural modeling, we found the mutation may disrupt the hydrophobic core and destabilize the protein structure. We reviewed the literature and found that exons 2, 8, and 9 (11.4% of the sequence of FRMD7 mRNA) represent the majority (55.3%) of the reported FRMD7 mutations. In summary, we identified a novel mutation in FRMD7, showed its molecular consequence, and revealed the mutation-rich exons of the FRMD7 gene. Collectively, this provides molecular insights for future CN clinical genetic diagnosis and treatment.

Advances in the Study of Heart Development and Disease Using Zebrafish

PubMed Central

Brown, Daniel R.; Samsa, Leigh Ann; Qian, Li; Liu, Jiandong

2016-01-01

Animal models of cardiovascular disease are key players in the translational medicine pipeline used to define the conserved genetic and molecular basis of disease. Congenital heart diseases (CHDs) are the most common type of human birth defect and feature structural abnormalities that arise during cardiac development and maturation. The zebrafish, Danio rerio, is a valuable vertebrate model organism, offering advantages over traditional mammalian models. These advantages include the rapid, stereotyped and external development of transparent embryos produced in large numbers from inexpensively housed adults, vast capacity for genetic manipulation, and amenability to high-throughput screening. With the help of modern genetics and a sequenced genome, zebrafish have led to insights in cardiovascular diseases ranging from CHDs to arrhythmia and cardiomyopathy. Here, we discuss the utility of zebrafish as a model system and summarize zebrafish cardiac morphogenesis with emphasis on parallels to human heart diseases. Additionally, we discuss the specific tools and experimental platforms utilized in the zebrafish model including forward screens, functional characterization of candidate genes, and high throughput applications. PMID:27335817

Identifcation of a novel mutation p.I240T in the FRMD7 gene in a family with congenital nystagmus.

PubMed

Zhu, Yihua; Zhuang, Jianfu; Ge, Xianglian; Zhang, Xiao; Wang, Zheng; Sun, Ji; Yang, Juhua; Gu, Feng

2013-10-30

Congenital Nystagmus (CN) is a genetically heterogeneous ocular disease, which causes a significant proportion of childhood visual impairment. To identify the underlying genetic defect of a CN family, twenty-two members were recruited. Genotype analysis showed that affected individuals shared a common haplotype with markers flanking FRMD7 locus. Sequencing FRMD7 revealed a T > C transition in exon 8, causing a conservative substitution of Isoleucine to Tyrosine at codon 240. By protein structural modeling, we found the mutation may disrupt the hydrophobic core and destabilize the protein structure. We reviewed the literature and found that exons 2, 8, and 9 (11.4% of the sequence of FRMD7 mRNA) represent the majority (55.3%) of the reported FRMD7 mutations. In summary, we identified a novel mutation in FRMD7, showed its molecular consequence, and revealed the mutation-rich exons of the FRMD7 gene. Collectively, this provides molecular insights for future CN clinical genetic diagnosis and treatment.

Identifcation of a Novel Mutation p.I240T in the FRMD7 gene in a Family with Congenital Nystagmus

PubMed Central

Zhu, Yihua; Zhuang, Jianfu; Ge, Xianglian; Zhang, Xiao; Wang, Zheng; Sun, Ji; Yang, Juhua; Gu, Feng

2013-01-01

Congenital Nystagmus (CN) is a genetically heterogeneous ocular disease, which causes a significant proportion of childhood visual impairment. To identify the underlying genetic defect of a CN family, twenty-two members were recruited. Genotype analysis showed that affected individuals shared a common haplotype with markers flanking FRMD7 locus. Sequencing FRMD7 revealed a T > C transition in exon 8, causing a conservative substitution of Isoleucine to Tyrosine at codon 240. By protein structural modeling, we found the mutation may disrupt the hydrophobic core and destabilize the protein structure. We reviewed the literature and found that exons 2, 8, and 9 (11.4% of the sequence of FRMD7 mRNA) represent the majority (55.3%) of the reported FRMD7 mutations. In summary, we identified a novel mutation in FRMD7, showed its molecular consequence, and revealed the mutation-rich exons of the FRMD7 gene. Collectively, this provides molecular insights for future CN clinical genetic diagnosis and treatment. PMID:24169426

Xeroderma Pigmentosum with Severe Neurological Manifestations/De Sanctis–Cacchione Syndrome and a Novel XPC Mutation

PubMed Central

Hernandez-Quiceno, Sara

2017-01-01

Several genetic disorders caused by defective nucleotide excision repair that affect the skin and the nervous system have been described, including Xeroderma Pigmentosum (XP), De Sanctis–Cacchione syndrome (DSC), Cockayne syndrome, and Trichothiodystrophy. Cutaneous photosensitivity with an increased risk of skin malignancy is a common feature of these disorders, but clinical manifestations commonly overlap these syndromes. Several genes have been found to be altered in these pathologies, but we lack more genotype-phenotype correlations in order to make an accurate diagnosis. Very few cases of DSC syndrome have been reported in the literature. We present a case of a 12-year-old Colombian male, with multiple skin lesions in sun-exposed areas from the age of 3 months and a history of 15 skin cancers. He also displayed severe neurologic abnormalities (intellectual disability, ataxia, altered speech, and hyperreflexia), short stature, and microcephaly, which are features associated with DSC. Genetic testing revealed a novel germline mutation in the XP-C gene (c.547A>T). This is the first case of an XP-C mutation causing De Sanctis–Cacchione syndrome. Multigene panel testing is becoming more widely available and accessible in the clinical setting and will help rapidly unveil the molecular etiology of these rare genetic disorders. PMID:28255305

Pinna abnormalities and low-set ears

MedlinePlus

... Pinna abnormalities; Genetic defect - pinna; Congenital defect - pinna Images Ear abnormalities Pinna of the newborn ear References Haddad J, Keesecker S. Congenital malformations. In: Kliegman RM, Stanton BF, ...

Cardiac Defects and Results of Cardiac Surgery in 22q11.2 Deletion Syndrome

ERIC Educational Resources Information Center

Carotti, Adriano; Digilio, Maria Cristina; Piacentini, Gerardo; Saffirio, Claudia; Di Donato, Roberto M.; Marino, Bruno

2008-01-01

Specific types and subtypes of cardiac defects have been described in children with 22q11.2 deletion syndrome as well as in other genetic syndromes. The conotruncal heart defects occurring in patients with 22q11.2 deletion syndrome include tetralogy of Fallot, pulmonary atresia with ventricular septal defect, truncus arteriosus, interrupted aortic…

Endocrine and molecular investigations in a cohort of 25 adolescent males with prominent/persistent pubertal gynecomastia.

PubMed

Paris, F; Gaspari, L; Mbou, F; Philibert, P; Audran, F; Morel, Y; Biason-Lauber, A; Sultan, C

2016-03-01

Pubertal gynecomastia is a common condition observed in up to 65% of adolescent males. It is usually idiopathic and tends to regress within 1-2 years. In this descriptive cross-sectional study, we investigated 25 adolescent males with prominent (>B3) and/or persistent (>2 years) pubertal gynecomastia (P/PPG) to determine whether a hormonal/genetic defect might underline this condition. Endocrine investigation revealed the absence of hormonal disturbance for 18 boys (72%). Three patients presented Klinefelter syndrome and three a partial androgen insensitivity syndrome (PAIS) as a result of p.Ala646Asp and p.Ala45Gly mutations of the androgen receptor gene. The last patient showed a 17α-hydroxylase/17,20-lyase deficiency as a result of a compound heterozygous mutation of the CYP17A1 gene leading to p.Pro35Thr(P35T) and p.Arg239Stop(R239X) in the P450c17 protein. Enzymatic activity was analyzed: the mutant protein bearing the premature stop codon R239X showed a complete loss of 17α-hydroxylase and 17,20-lyase activity. The mutant P35T seemed to retain 15-20% of 17α-hydroxylase and about 8-10% of 17,20-lyase activity. This work demonstrates that P/PPG had an endocrine/genetic cause in 28% of our cases. PAIS may be expressed only by isolated gynecomastia as well as by 17α-hydroxylase/17,20-lyase deficiency. Isolated P/PPG is not always a 'physiological' condition and should thus be investigated through adequate endocrine and genetic investigations, even though larger studies are needed to better determine the real prevalence of genetic defects in such patients. © 2016 American Society of Andrology and European Academy of Andrology.

Congenital diaphragmatic hernia (CDH) etiology as revealed by pathway genetics.

PubMed

Kantarci, Sibel; Donahoe, Patricia K

2007-05-15

Congenital diaphragmatic hernia (CDH) is a common birth defect with high mortality and morbidity. Two hundred seventy CDH patients were ascertained, carefully phenotyped, and classified as isolated (diaphragm defects alone) or complex (with additional anomalies) cases. We established different strategies to reveal CDH-critical chromosome loci and genes in humans. Candidate genes for sequencing analyses were selected from CDH animal models, genetic intervals of recurrent chromosomal aberration in humans, such as 15q26.1-q26.2 or 1q41-q42.12, as well as genes in the retinoic acid and related pathways and those known to be involved in embryonic lung development. For instance, FOG2, GATA4, and COUP-TFII are all needed for both normal diaphragm and lung development and are likely all in the same genetic and molecular pathway. Linkage analysis was applied first in a large inbred family and then in four multiplex families with Donnai-Barrow syndrome (DBS) associated with CDH. 10K SNP chip and microsatellite markers revealed a DBS locus on chromosome 2q23.3-q31.1. We applied array-based comparative genomic hybridization (aCGH) techniques to over 30, mostly complex, CDH patients and found a de novo microdeletion in a patient with Fryns syndrome related to CDH. Fluorescence in situ hybridization (FISH) and multiplex ligation-dependent probe amplification (MLPA) techniques allowed us to further define the deletion interval. Our aim is to identify genetic intervals and, in those, to prioritize genes that might reveal molecular pathways, mutations in any step of which, might contribute to the same phenotype. More important, the elucidation of pathways may ultimately provide clues to treatment strategies. (c) 2007 Wiley-Liss, Inc.

The multiple genetic causes of central hypothyroidism.

PubMed

Persani, Luca; Bonomi, Marco

2017-03-01

An insufficient stimulation by thyrotropin (TSH) of an otherwise normal thyroid gland represents the cause of Central Hypothyrodism (CeH). CeH is about 1000-folds rarer than Primary Hypothyroidism and often represents a real challenge for the clinicians, mainly because they cannot rely on adequately sensitive parameters for diagnosis or management, as it occurs with circulating TSH in PH. Therefore, CeH diagnosis can be frequently missed or delayed in patients with a previously unknown pituitary involvement. A series of genetic defects have been described to account for isolated CeH or combined pituitary hormone defects (CPHDs) with variable clinical characteristics and degrees of severity. The recently identified candidate gene IGSF1 appears frequently involved. This review provides an updated illustration of the different genetic defects accounting for CeH. Copyright © 2017 Elsevier Ltd. All rights reserved.

Mandibulofacial dysostosis (Treacher-Collins syndrome) in the fetus: novel association with Pectus carinatum in a molecularly confirmed case and review of the fetal phenotype.

PubMed

Konstantinidou, Anastasia E; Tasoulas, Jason; Kallipolitis, Georgios; Gasparatos, Spyros; Velissariou, Voula; Paraskevakou, Helen

2013-12-01

Treacher Collins syndrome is the most common mandibulofacial dysostosis of autosomal dominant or, rarely, recessive inheritance. Affected fetuses may be identified by prenatal ultrasound or diagnosed at autopsy in case of perinatal death or pregnancy termination. We describe the ultrasonographic, autopsy, and molecular findings in a 25-week-gestation affected fetus, and review the clinical, prenatal, and postmortem findings in 15 previously reported fetal and perinatal cases. A nearly complete spectrum of the typical facial characteristics can be present by the early second trimester of gestation, including subtle defects such as lower eyelid colobomas. Mandibular hypoplasia and bilateral auricle defects were constant findings in the affected fetal population. Downslanting palpebral fissures were the second more common feature, followed by midface hypoplasia, polyhydramnios, and ocular defects. Association with Pierre Robin sequence was common (38%) in the reviewed series. Previously unreported pectus carinatum was noted in our case bearing a heterozygous TCOF1 mutation. Other unique reported findings include salivary gland hyperplasia, single umbilical artery, and tracheo-esophageal fistula, all in molecularly unconfirmed cases. Treacher Collins syndrome can be prenatally detected by ultrasound and should be included in the wide range of genetic syndromes that can be diagnosed at perinatal autopsy. Affected fetuses tend to have a more severe phenotype than living patients. The reported association of Treacher Collins syndrome type 1 with pectus carinatum expands the phenotype, provides information on genotype-phenotype correlation, and suggests possible pathogenetic interactions between neural crest cell disorders and the formation of the sternum that merit investigation. Copyright © 2013 Wiley Periodicals, Inc.

Mitochondrial Hepatopathies: Advances in Genetics and Pathogenesis

PubMed Central

Lee, Way S.; Sokol, Ronald J.

2013-01-01

Hepatic involvement is a common feature in childhood mitochondrial hepatopathies, particularly in the neonatal period. Respiratory chain disorders may present as neonatal acute liver failure, hepatic steatohepatitis, cholestasis, or cirrhosis with chronic liver failure of insidious onset. In recent years, specific molecular defects (mutations in nuclear genes such as SCO1, BCS1L, POLG, DGUOK, and MPV17 and the deletion or rearrangement of mitochondrial DNA) have been identified, with the promise of genetic and prenatal diagnosis. The current treatment of mitochondrial hepatopathies is largely ineffective, and the prognosis is generally poor. The role of liver transplantation in patients with liver failure remains poorly defined because of the systemic nature of the disease, which does not respond to transplantation. Prospective, longitudinal, multicentered studies will be needed to address the gaps in our knowledge in these rare liver diseases. PMID:17538929

Widening the Heterogeneity of Leigh Syndrome: Clinical, Biochemical, and Neuroradiologic Features in a Patient Harboring a NDUFA10 Mutation.

PubMed

Minoia, Francesca; Bertamino, Marta; Picco, Paolo; Severino, Mariasavina; Rossi, Andrea; Fiorillo, Chiara; Minetti, Carlo; Nesti, Claudia; Santorelli, Filippo Maria; Di Rocco, Maja

2017-01-01

Leigh syndrome (LS) is an early-onset progressive neurodegenerative disorder, characterized by a wide clinical and genetic heterogeneity, and is the most frequent disorder of mitochondrial energy production in children. Beside its great variability in clinical, biochemical, and genetic features, LS is pathologically uniformly characterized by multifocal bilateral and symmetric spongiform degeneration of the basal ganglia, brainstem, thalamus, cerebellum, spinal cord, and optic nerves. Isolated complex I deficiency is the most common defect identified in Leigh syndrome. In 2011, the first child with a mutation of NDUFA10 gene, coding for an accessory subunits of complex I, was described. Here, we present an additional description of a child with Leigh syndrome harboring a homozygous mutation in NDUFA10, providing insights in clinical, biochemical, and neuroradiologic features for future earlier recognition.

Molecular and phenotypic aspects of CHD7 mutation in CHARGE syndrome

PubMed Central

Zentner, Gabriel E.; Layman, Wanda S.; Martin, Donna M.; Scacheri, Peter C.

2010-01-01

CHARGE syndrome (Coloboma of the eye, Heart defects, Atresia of the choanae, Retardation of growth and/or development, Genital and/or urinary abnormalities, and Ear abnormalities (including deafness) is a genetic disorder characterized by a specific and a recognizable pattern of anomalies. De novo mutations in the gene encoding chromodomain helicase DNA binding protein 7 (CHD7) are the major cause of CHARGE syndrome. Here, we review the clinical features of 379 CHARGE patients who tested positive or negative for mutations in CHD7. We found that CHARGE individuals with CHD7 mutations more commonly have ocular colobomas, temporal bone anomalies (semicircular canal hypoplasia/dysplasia), and facial nerve paralysis compared with mutation negative individuals. We also highlight recent genetic and genomic studies that have provided functional insights into CHD7 and the pathogenesis of CHARGE syndrome. PMID:20186815

Mining the human genome after Association for Molecular Pathology v. Myriad Genetics.

PubMed

Evans, Barbara J

2014-07-01

The Supreme Court's recent decision in Association for Molecular Pathology v. Myriad Genetics portrays the human genome as a product of nature. This frames medical genetics as an extractive industry that mines a natural resource to produce valuable goods and services. Natural resource law offers insights into problems medical geneticists can expect after this decision and suggests possible solutions. Increased competition among clinical laboratories offers various benefits but threatens to increase fragmentation of genetic data resources, potentially causing waste in the form of lost opportunities to discover the clinical significance of particular gene variants. The solution lies in addressing legal barriers to appropriate data sharing. Sustainable discovery in the field of medical genetics can best be achieved through voluntary data sharing rather than command-and-control tactics, but voluntary mechanisms must be conceived broadly to include market-based approaches as well as donative and publicly funded data commons. The recently revised Health Insurance Portability and Accountability Act Privacy Rule offers an improved--but still imperfect--framework for market-oriented data sharing. This article explores strategies for addressing the Privacy Rule's remaining defects. America is close to having a legal framework that can reward innovators, protect privacy, and promote needed data sharing to advance medical genetics.

Genetic Testing as a New Standard for Clinical Diagnosis of Color Vision Deficiencies.

PubMed

Davidoff, Candice; Neitz, Maureen; Neitz, Jay

2016-09-01

The genetics underlying inherited color vision deficiencies is well understood: causative mutations change the copy number or sequence of the long (L), middle (M), or short (S) wavelength sensitive cone opsin genes. This study evaluated the potential of opsin gene analyses for use in clinical diagnosis of color vision defects. We tested 1872 human subjects using direct sequencing of opsin genes and a novel genetic assay that characterizes single nucleotide polymorphisms (SNPs) using the MassArray system. Of the subjects, 1074 also were given standard psychophysical color vision tests for a direct comparison with current clinical methods. Protan and deutan deficiencies were classified correctly in all subjects identified by MassArray as having red-green defects. Estimates of defect severity based on SNPs that control photopigment spectral tuning correlated with estimates derived from Nagel anomaloscopy. The MassArray assay provides genetic information that can be useful in the diagnosis of inherited color vision deficiency including presence versus absence, type, and severity, and it provides information to patients about the underlying pathobiology of their disease. The MassArray assay provides a method that directly analyzes the molecular substrates of color vision that could be used in combination with, or as an alternative to current clinical diagnosis of color defects.

Genetic Testing as a New Standard for Clinical Diagnosis of Color Vision Deficiencies

PubMed Central

Davidoff, Candice; Neitz, Maureen; Neitz, Jay

2016-01-01

Purpose The genetics underlying inherited color vision deficiencies is well understood: causative mutations change the copy number or sequence of the long (L), middle (M), or short (S) wavelength sensitive cone opsin genes. This study evaluated the potential of opsin gene analyses for use in clinical diagnosis of color vision defects. Methods We tested 1872 human subjects using direct sequencing of opsin genes and a novel genetic assay that characterizes single nucleotide polymorphisms (SNPs) using the MassArray system. Of the subjects, 1074 also were given standard psychophysical color vision tests for a direct comparison with current clinical methods. Results Protan and deutan deficiencies were classified correctly in all subjects identified by MassArray as having red–green defects. Estimates of defect severity based on SNPs that control photopigment spectral tuning correlated with estimates derived from Nagel anomaloscopy. Conclusions The MassArray assay provides genetic information that can be useful in the diagnosis of inherited color vision deficiency including presence versus absence, type, and severity, and it provides information to patients about the underlying pathobiology of their disease. Translational Relevance The MassArray assay provides a method that directly analyzes the molecular substrates of color vision that could be used in combination with, or as an alternative to current clinical diagnosis of color defects. PMID:27622081

Update on Leukodystrophies: A Historical Perspective and Adapted Definition.

PubMed

Kevelam, Sietske H; Steenweg, Marjan E; Srivastava, Siddharth; Helman, Guy; Naidu, Sakkubai; Schiffmann, Raphael; Blaser, Susan; Vanderver, Adeline; Wolf, Nicole I; van der Knaap, Marjo S

2016-12-01

Leukodystrophies were defined in the 1980s as progressive genetic disorders primarily affecting myelin of the central nervous system. At that time, a limited number of such disorders and no associated gene defects were known. The majority of the leukodystrophy patients remained without a specific diagnosis. In the following two decades, magnetic resonance imaging pattern recognition revolutionized the field, allowing the definition of numerous novel leukodystrophies. Their genetic defects were usually identified through genetic linkage studies. This process required substantial numbers of cases and many rare disorders remained unclarified. As recently as 2010, 50% of the leukodystrophy patients remained unclassified. Since 2011, whole-exome sequencing has resulted in an exponential increase in numbers of known, distinct, genetically determined, ultrarare leukodystrophies. We performed a retrospective study concerning three historical cohorts of unclassified leukodystrophy patients and found that currently at least 80% of the patients can be molecularly classified. Based on the original definition of the leukodystrophies, numerous defects in proteins important in myelin structure, maintenance, and function were expected. By contrast, a high percentage of the newly identified gene defects affect the housekeeping process of mRNA translation, shedding new light on white matter pathobiology and requiring adaptation of the leukodystrophy definition. Georg Thieme Verlag KG Stuttgart · New York.

VX-809 corrects folding defects in cystic fibrosis transmembrane conductance regulator protein through action on membrane-spanning domain 1

PubMed Central

Ren, Hong Yu; Grove, Diane E.; De La Rosa, Oxana; Houck, Scott A.; Sopha, Pattarawut; Van Goor, Fredrick; Hoffman, Beth J.; Cyr, Douglas M.

2013-01-01

Cystic fibrosis (CF) is a fatal genetic disorder associated with defective hydration of lung airways due to the loss of chloride transport through the CF transmembrane conductance regulator protein (CFTR). CFTR contains two membrane-spanning domains (MSDs), two nucleotide-binding domains (NBDs), and a regulatory domain, and its channel assembly requires multiple interdomain contacts. The most common CF-causing mutation, F508del, occurs in NBD1 and results in misfolding and premature degradation of F508del-CFTR. VX-809 is an investigational CFTR corrector that partially restores CFTR function in people who are homozygous for F508del-CFTR. To identify the folding defect(s) in F508del-CFTR that must be repaired to treat CF, we explored the mechanism of VX-809 action. VX-809 stabilized an N-terminal domain in CFTR that contains only MSD1 and efficaciously restored function to CFTR forms that have missense mutations in MSD1. The action of VX-809 on MSD1 appears to suppress folding defects in F508del-CFTR by enhancing interactions among the NBD1, MSD1, and MSD2 domains. The ability of VX-809 to correct F508del-CFTR is enhanced when combined with mutations that improve F508del-NBD1 interaction with MSD2. These data suggest that the use of VX-809 in combination with an additional CFTR corrector that suppresses folding defects downstream of MSD1 may further enhance CFTR function in people with F508del-CFTR. PMID:23924900

VX-809 corrects folding defects in cystic fibrosis transmembrane conductance regulator protein through action on membrane-spanning domain 1.

PubMed

Ren, Hong Yu; Grove, Diane E; De La Rosa, Oxana; Houck, Scott A; Sopha, Pattarawut; Van Goor, Fredrick; Hoffman, Beth J; Cyr, Douglas M

2013-10-01

Cystic fibrosis (CF) is a fatal genetic disorder associated with defective hydration of lung airways due to the loss of chloride transport through the CF transmembrane conductance regulator protein (CFTR). CFTR contains two membrane-spanning domains (MSDs), two nucleotide-binding domains (NBDs), and a regulatory domain, and its channel assembly requires multiple interdomain contacts. The most common CF-causing mutation, F508del, occurs in NBD1 and results in misfolding and premature degradation of F508del-CFTR. VX-809 is an investigational CFTR corrector that partially restores CFTR function in people who are homozygous for F508del-CFTR. To identify the folding defect(s) in F508del-CFTR that must be repaired to treat CF, we explored the mechanism of VX-809 action. VX-809 stabilized an N-terminal domain in CFTR that contains only MSD1 and efficaciously restored function to CFTR forms that have missense mutations in MSD1. The action of VX-809 on MSD1 appears to suppress folding defects in F508del-CFTR by enhancing interactions among the NBD1, MSD1, and MSD2 domains. The ability of VX-809 to correct F508del-CFTR is enhanced when combined with mutations that improve F508del-NBD1 interaction with MSD2. These data suggest that the use of VX-809 in combination with an additional CFTR corrector that suppresses folding defects downstream of MSD1 may further enhance CFTR function in people with F508del-CFTR.

LRRC6 Mutation Causes Primary Ciliary Dyskinesia with Dynein Arm Defects

PubMed Central

Horani, Amjad; Ferkol, Thomas W.; Shoseyov, David; Wasserman, Mollie G.; Oren, Yifat S.; Kerem, Batsheva; Amirav, Israel; Cohen-Cymberknoh, Malena; Dutcher, Susan K.; Brody, Steven L.; Elpeleg, Orly; Kerem, Eitan

2013-01-01

Despite recent progress in defining the ciliome, the genetic basis for many cases of primary ciliary dyskinesia (PCD) remains elusive. We evaluated five children from two unrelated, consanguineous Palestinian families who had PCD with typical clinical features, reduced nasal nitric oxide concentrations, and absent dynein arms. Linkage analyses revealed a single common homozygous region on chromosome 8 and one candidate was conserved in organisms with motile cilia. Sequencing revealed a single novel mutation in LRRC6 (Leucine-rich repeat containing protein 6) that fit the model of autosomal recessive genetic transmission, leading to a change of a highly conserved amino acid from aspartic acid to histidine (Asp146His). LRRC6 was localized to the cytoplasm and was up-regulated during ciliogenesis in human airway epithelial cells in a Foxj1-dependent fashion. Nasal epithelial cells isolated from affected individuals and shRNA-mediated silencing in human airway epithelial cells, showed reduced LRRC6 expression, absent dynein arms, and slowed cilia beat frequency. Dynein arm proteins were either absent or mislocalized to the cytoplasm in airway epithelial cells from a primary ciliary dyskinesia subject. These findings suggest that LRRC6 plays a role in dynein arm assembly or trafficking and when mutated leads to primary ciliary dyskinesia with laterality defects. PMID:23527195

Mesodermal Tbx1 is required for patterning the proximal mandible in mice

PubMed Central

Aggarwal, Vimla S.; Carpenter, Courtney; Freyer, Laina; Liao, Jun; Petti, Marilena; Morrow, Bernice E.

2010-01-01

Defects in the lower jaw, or mandible, occur commonly either as isolated malformations or in association with genetic syndromes. Understanding its formation and genetic pathways required for shaping its structure in mammalian model organisms will shed light into the pathogenesis of malformations in humans. The lower jaw is derived from the mandibular process of the first pharyngeal arch (MdPA1) during embryogenesis. Integral to the development of the mandible, is the signaling interplay between Fgf8 and Bmp4 in the rostral ectoderm and their downstream effector genes in the underlying neural crest derived mesenchyme. The non-neural crest MdPA1 core mesoderm is needed to form muscles of mastication, but its role in patterning the mandible is unknown. Here, we show that mesoderm specific deletion of Tbx1, a T- box transcription factor and gene for velo-cardio-facial/DiGeorge syndrome, results in defects in formation of the proximal mandible by shifting expression of Fgf8, Bmp4 and their downstream effector genes in mouse embryos at E10.5. This occurs without significant changes in cell proliferation or apoptosis at the same stage. Our results elucidate a new function for the non-neural crest core mesoderm and specifically, mesodermal Tbx1, in shaping the lower jaw. PMID:20501333

Separating genetic and hemodynamic defects in neuropilin 1 knockout embryos.

PubMed

Jones, Elizabeth A V; Yuan, Li; Breant, Christine; Watts, Ryan J; Eichmann, Anne

2008-08-01

Targeted inactivation of genes involved in murine cardiovascular development frequently leads to abnormalities in blood flow. As blood fluid dynamics play a crucial role in shaping vessel morphology, the presence of flow defects generally prohibits the precise assignment of the role of the mutated gene product in the vasculature. In this study, we show how to distinguish between genetic defects caused by targeted inactivation of the neuropilin 1 (Nrp1) receptor and hemodynamic defects occurring in homozygous knockout embryos. Our analysis of a Nrp1 null allele bred onto a C57BL/6 background shows that vessel remodeling defects occur concomitantly with the onset of blood flow and cause death of homozygous mutants at E10.5. Using mouse embryo culture, we establish that hemodynamic defects are already present at E8.5 and continuous circulation is never established in homozygous mutants. The geometry of yolk sac blood vessels is altered and remodeling into yolk sac arteries and veins does not occur. To separate flow-induced deficiencies from those caused by the Nrp1 mutation, we arrested blood flow in cultured wild-type and mutant embryos and followed their vascular development. We find that loss of Nrp1 function rather than flow induces the altered geometry of the capillary plexus. Endothelial cell migration, but not replication, is altered in Nrp1 mutants. Gene expression analysis of endothelial cells isolated from freshly dissected wild-type and mutants and after culture in no-flow conditions showed down-regulation of the arterial marker genes connexin 40 and ephrin B2 related to the loss of Nrp1 function. This method allows genetic defects caused by loss-of-function of a gene important for cardiovascular development to be isolated even in the presence of hemodynamic defects.

The gene for achondroplasia maps to the telomeric region of chromosome 4p.

PubMed

Velinov, M; Slaugenhaupt, S A; Stoilov, I; Scott, C I; Gusella, J F; Tsipouras, P

1994-03-01

Achondroplasia is the most common type of genetic dwarfism. It is characterized by disproportionate short stature and other skeletal anomalies resulting from a defect in the maturation of the chondrocytes in the growth plate of the cartilage. We have now mapped the achondroplasia gene near the telomere of the short arm of chromosome 4 (4p16.3), by family linkage studies using 14 pedigrees. A positive lod score of z = 3.35 with no recombinants was obtained with an intragenic marker for IDUA. This localization will facilitate the positional cloning of the disease gene.

Mouse Models for Investigating the Developmental Bases of Human Birth Defects

PubMed Central

MOON, ANNE M.

2006-01-01

Clinicians and basic scientists share an interest in discovering how genetic or environmental factors interact to perturb normal development and cause birth defects and human disease. Given the complexity of such interactions, it is not surprising that 4% of human infants are born with a congenital malformation, and cardiovascular defects occur in nearly 1%. Our research is based on the fundamental hypothesis that an understanding of normal and abnormal development will permit us to generate effective strategies for both prevention and treatment of human birth defects. Animal models are invaluable in these efforts because they allow one to interrogate the genetic, molecular and cellular events that distinguish normal from abnormal development. Several features of the mouse make it a particularly powerful experimental model: it is a mammalian system with similar embryology, anatomy and physiology to humans; genes, proteins and regulatory programs are largely conserved between human and mouse; and finally, gene targeting in murine embryonic stem cells has made the mouse genome amenable to sophisticated genetic manipulation currently unavailable in any other model organism. PMID:16641221

A PATO-compliant zebrafish screening database (MODB): management of morpholino knockdown screen information.

PubMed

Knowlton, Michelle N; Li, Tongbin; Ren, Yongliang; Bill, Brent R; Ellis, Lynda Bm; Ekker, Stephen C

2008-01-07

The zebrafish is a powerful model vertebrate amenable to high throughput in vivo genetic analyses. Examples include reverse genetic screens using morpholino knockdown, expression-based screening using enhancer trapping and forward genetic screening using transposon insertional mutagenesis. We have created a database to facilitate web-based distribution of data from such genetic studies. The MOrpholino DataBase is a MySQL relational database with an online, PHP interface. Multiple quality control levels allow differential access to data in raw and finished formats. MODBv1 includes sequence information relating to almost 800 morpholinos and their targets and phenotypic data regarding the dose effect of each morpholino (mortality, toxicity and defects). To improve the searchability of this database, we have incorporated a fixed-vocabulary defect ontology that allows for the organization of morpholino affects based on anatomical structure affected and defect produced. This also allows comparison between species utilizing Phenotypic Attribute Trait Ontology (PATO) designated terminology. MODB is also cross-linked with ZFIN, allowing full searches between the two databases. MODB offers users the ability to retrieve morpholino data by sequence of morpholino or target, name of target, anatomical structure affected and defect produced. MODB data can be used for functional genomic analysis of morpholino design to maximize efficacy and minimize toxicity. MODB also serves as a template for future sequence-based functional genetic screen databases, and it is currently being used as a model for the creation of a mutagenic insertional transposon database.

Genetics Home Reference: 21-hydroxylase deficiency

MedlinePlus

... Urinary Tract Defects Orphanet: Congenital adrenal hyperplasia Screening, Technology, and Research in Genetics (PDF) Vanderbilt Childrens Hospital: Congenital Adrenal Hyperplasia (PDF) Virginia Department of ...

Genetic Engineering and the Amelioration of Genetic Defect

ERIC Educational Resources Information Center

Lederberg, Joshua

1970-01-01

Discusses the claims for a brave new world of genetic manipulation" and concludes that if we could agree upon applying genetic (or any other effective) remedies to global problems we probably would need no rescourse to them. Suggests that effective methods of preventing genetic disease are prevention of mutations and detection and…

Constitutional Epi/Genetic Conditions: Genetic, Epigenetic, and Environmental Factors

PubMed Central

Schenkel, Laila C.; Rodenhiser, David; Siu, Victoria; McCready, Elizabeth; Ainsworth, Peter; Sadikovic, Bekim

2016-01-01

There are more than 4,000 phenotypes for which the molecular basis is at least partly known. Though defects in primary DNA structure constitute a major cause of these disorders, epigenetic disruption is emerging as an important alternative mechanism in the etiology of a broad range of congenital and developmental conditions. These include epigenetic defects caused by either localized (in cis) genetic alterations or more distant (in trans) genetic events but can also include environmental effects. Emerging evidence suggests interplay between genetic and environmental factors in the epigenetic etiology of several constitutional “epi/genetic” conditions. This review summarizes our broadening understanding of how epigenetics contributes to pediatric disease by exploring different classes of epigenomic disorders. It further challenges the simplistic dogma of “DNA encodes RNA encodes protein” to best understand the spectrum of factors that can influence genetic traits in a pediatric population. PMID:28180025

New Late Gene, dar, Involved in DNA Replication of Bacteriophage T4 I. Isolation, Characterization, and Genetic Location.

PubMed

Wu, J R; Yeh, Y C

1975-05-01

Suppressors of gene 59-defective mutants were isolated by screening spontaneous, temperature-sensitive (ts) revertants of the amber mutant, amC5, in gene 59. Six ts revertants were isolated. No gene 59-defective ts recombinant was obtained by crossing each ts revertant with the wild type, T4D. However, suppressors of gene 59-defective mutants were obtained from two of these ts revertants. These suppressor mutants are referred to as dar (DNA arrested restoration). dar mutants specifically restored the abnormalities, both in DNA synthesis and burst size, caused by gene 59-defective mutants to normal levels. It is unlikely that dar mutants are nonsense suppressors since theý failed to suppress amber mutations in 11 other genes investigated. The genetic expression of dar is controlled by gene 55; therefore, dar is a late gene. The genetic location of dar has been mapped between genes 24 and 25, a region contiguous to late genes. dar appears to be another nonessential gene of T4 since burst sizes of dar were almost identical to those of the wild type. Mutations in dar did not affect genetic recombination and repair of UV-damaged DNA, but caused a sensitivity to hydroxyurea in progeny formation. The effect of the dar mutation on host DNA degradation cannot account for its hydroxyurea sensitivity. dar mutant alleles were recessive to the wild-type allele as judged by restoration of arrested DNA synthesis. The possible mechanisms for the suppression of defects in gene 59 are discussed.

Transcriptomic analysis of genetically defined autism candidate genes reveals common mechanisms of action

PubMed Central

2013-01-01

Background Austism spectrum disorder (ASD) is a heterogeneous behavioral disorder or condition characterized by severe impairment of social engagement and the presence of repetitive activities. The molecular etiology of ASD is still largely unknown despite a strong genetic component. Part of the difficulty in turning genetics into disease mechanisms and potentially new therapeutics is the sheer number and diversity of the genes that have been associated with ASD and ASD symptoms. The goal of this work is to use shRNA-generated models of genetic defects proposed as causative for ASD to identify the common pathways that might explain how they produce a core clinical disability. Methods Transcript levels of Mecp2, Mef2a, Mef2d, Fmr1, Nlgn1, Nlgn3, Pten, and Shank3 were knocked-down in mouse primary neuron cultures using shRNA constructs. Whole genome expression analysis was conducted for each of the knockdown cultures as well as a mock-transduced culture and a culture exposed to a lentivirus expressing an anti-luciferase shRNA. Gene set enrichment and a causal reasoning engine was employed to identify pathway level perturbations generated by the transcript knockdown. Results Quantification of the shRNA targets confirmed the successful knockdown at the transcript and protein levels of at least 75% for each of the genes. After subtracting out potential artifacts caused by viral infection, gene set enrichment and causal reasoning engine analysis showed that a significant number of gene expression changes mapped to pathways associated with neurogenesis, long-term potentiation, and synaptic activity. Conclusions This work demonstrates that despite the complex genetic nature of ASD, there are common molecular mechanisms that connect many of the best established autism candidate genes. By identifying the key regulatory checkpoints in the interlinking transcriptional networks underlying autism, we are better able to discover the ideal points of intervention that provide the broadest efficacy across the diverse population of autism patients. PMID:24238429

Transcriptomic analysis of genetically defined autism candidate genes reveals common mechanisms of action.

PubMed

Lanz, Thomas A; Guilmette, Edward; Gosink, Mark M; Fischer, James E; Fitzgerald, Lawrence W; Stephenson, Diane T; Pletcher, Mathew T

2013-11-15

Austism spectrum disorder (ASD) is a heterogeneous behavioral disorder or condition characterized by severe impairment of social engagement and the presence of repetitive activities. The molecular etiology of ASD is still largely unknown despite a strong genetic component. Part of the difficulty in turning genetics into disease mechanisms and potentially new therapeutics is the sheer number and diversity of the genes that have been associated with ASD and ASD symptoms. The goal of this work is to use shRNA-generated models of genetic defects proposed as causative for ASD to identify the common pathways that might explain how they produce a core clinical disability. Transcript levels of Mecp2, Mef2a, Mef2d, Fmr1, Nlgn1, Nlgn3, Pten, and Shank3 were knocked-down in mouse primary neuron cultures using shRNA constructs. Whole genome expression analysis was conducted for each of the knockdown cultures as well as a mock-transduced culture and a culture exposed to a lentivirus expressing an anti-luciferase shRNA. Gene set enrichment and a causal reasoning engine was employed to identify pathway level perturbations generated by the transcript knockdown. Quantification of the shRNA targets confirmed the successful knockdown at the transcript and protein levels of at least 75% for each of the genes. After subtracting out potential artifacts caused by viral infection, gene set enrichment and causal reasoning engine analysis showed that a significant number of gene expression changes mapped to pathways associated with neurogenesis, long-term potentiation, and synaptic activity. This work demonstrates that despite the complex genetic nature of ASD, there are common molecular mechanisms that connect many of the best established autism candidate genes. By identifying the key regulatory checkpoints in the interlinking transcriptional networks underlying autism, we are better able to discover the ideal points of intervention that provide the broadest efficacy across the diverse population of autism patients.

Genetic syndrome suspicion: examples of clinical approach in the neonatal unit.

PubMed

Giuffrè, M; De Sanctis, L

2010-06-01

Overgrowth syndromes: the practical clinical approach. Excessive growth can be present in a variety of medical conditions as result of abnormal fetal metabolism (i.e., maternal gestational diabetes) or of an overgrowth syndrome. Within this latter group of diseases, a LGA newborn requires a complex differential diagnosis encompassing several syndromes, such as Beckwith-Wiedemman, Sotos, Weaver, Simpson-Golabi-Behmel, Perlman, and Bannayan-Riley-Ruvalcaba. Partial or global overgrowth, other dysmorphisms, abdominal organs anomalies, as well as benign and malignant tumors are the common issues to examine for the diagnosis and the monitoring of all these disorders. The molecular bases of these conditions, even if partially known so far, can help in explaining the clinical features and prognosis. The diagnostic course, the genetic investigations and the follow-up of a LGA patient will be presented during the seminar. A wide clinical spectrum from esophageal atresia to VACTERL association. Oesophageal atresia (OA) occurs approximately in 1 in 3000 live births. It can be clinically divided into isolated and syndromic, when associated with other features. The aetiology is largely unknown and is likely to be multifactorial, however, various clues have been uncovered in animal experiments particularly defects in the expression of the gene Sonic hedgehog (Shh). The vast majority of cases are sporadic and the recurrence risk for siblings is 1%. Survival is directly related to birth weight and to the presence of a major cardiac defect. The VACTERL association refers to anomalies of the bony spinal column (V), atresias in the gastrointestinal tract (A), congenital heart lesions (C), tracheoesophageal defects (TE), renal and distal urinary tract anomalies (R) and limb lesions (L). The overall phenotype of a series of newborn patients we observed may vary widely, reflecting the aetiologic heterogeneity of this group of conditions. Therefore, possible additional defects must be accurately investigated in all newborns with OA.

When intracellular logistics fails--genetic defects in membrane trafficking.

PubMed

Olkkonen, Vesa M; Ikonen, Elina

2006-12-15

The number of human genetic disorders shown to be due to defects in membrane trafficking has greatly increased during the past five years. Defects have been identified in components involved in sorting of cargo into transport carriers, vesicle budding and scission, movement of vesicles along cytoskeletal tracks, as well as in vesicle tethering, docking and fusion at the target membrane. The nervous system is extremely sensitive to such disturbances of the membrane trafficking machinery, and the majority of these disorders display neurological defects--particularly diseases affecting the motility of transport carriers along cytoskeletal tracks. In several disorders, defects in a component that represents a fundamental part of the trafficking machinery fail to cause global transport defects but result in symptoms limited to specific cell types and transport events; this apparently reflects the redundancy of the transport apparatus. In groups of closely related diseases such as Hermansky-Pudlak and Griscelli syndromes, identification of the underlying gene defects has revealed groups of genes in which mutations lead to similar phenotypic consequences. New functionally linked trafficking components and regulatory mechanisms have thus been discovered. Studies of the gene defects in trafficking disorders therefore not only open avenues for new therapeutic approaches but also significantly contribute to our knowledge of the fundamental mechanisms of intracellular membrane transport.

Quo Vadis, Medical Genetics?

NASA Astrophysics Data System (ADS)

Czeizel, Andrew E.

The beginning of human genetics and its medical part: medical genetics was promising in the early decades of this century. Many genetic diseases and defects with Mendelian origin were identified and it helped families with significant genetic burden to limit their child number. Unfortunately this good start was shadowed by two tragic events. On the one hand, in the 1930s and early 1940s the German fascism brought about the dominance of an unscientific eugenics to mask vile political crimes. People with genetic diseases-defects were forced to sterilisation and several of them were killed. On the other hand, in the 1950s lysenkoism inhibitied the evolution of genetics in the Soviet Union and their satelite countries. Lysenko's doctrine declared genetics as a product of imperialism and a guilty science, therefore leading geneticists were ousted form their posts and some of them were executed or put in prison. Past decades genetics has resulted fantastic new results and achieved a leading position within the natural sciences. To my mind, however, the expected wider use of new eugenics indicates a new tragedy and this Cassandra's prediction is the topic of this presentation.

Disruption of Smad4 in neural crest cells leads to mid-gestation death with pharyngeal arch, craniofacial and cardiac defects

PubMed Central

Nie, Xuguang; Deng, Chu-xia; Wang, Qin; Jiao, Kai

2008-01-01

TGFβ/BMP signaling pathways are essential for normal development of neural crest cells (NCCs). Smad4 encodes the only common Smad protein in mammals, which is a critical nuclear mediator of TGFβ/BMP signaling. In this work, we sought to investigate the roles of Smad4 for development of NCCs. To overcome the early embryonic lethality of Smad4 null mice, we specifically disrupted Smad4 in NCCs using a Cre/loxP system. The mutant mice died at mid-gestation with defects in facial primordia, pharyngeal arches, outflow tract and cardiac ventricles. Further examination revealed that mutant embryos displayed severe molecular defects starting from E9.5. Expression of multiple genes, including Msx1, 2, Ap-2α, Pax3, and Sox9, which play critical roles for NCC development, was downregulated by NCC disruption of Smad4. Moreover, increased cell death was observed in pharyngeal arches from E10.5. However, the cell proliferation rate in these areas was not substantially altered. Taken together, these findings provide compelling genetic evidence that Smad4-mediated activities of TGFβ/BMP signals are essential for appropriate NCC development. PMID:18334251

Cornelia de Lange syndrome: Congenital heart disease in 149 patients.

PubMed

Ayerza Casas, Ariadna; Puisac Uriol, Beatriz; Teresa Rodrigo, María Esperanza; Hernández Marcos, María; Ramos Fuentes, Feliciano J; Pie Juste, Juan

2017-10-11

Cornelia de Lange syndrome (CdLS) is produced by mutations in genes that encode regulatory or structural proteins of the cohesin complex. Congenital heart disease (CHD) is not a major criterion of the disease, but it affects many individuals. The objective of this study was to study the incidence and type of CHD in patients with CdLS. Cardiological findings were evaluated in 149 patients with CdLS and their possible relationship with clinical and genetic variables. A percentage of 34.9 had CHD (septal defects 50%, pulmonary stenosis 27%, aortic coarctation 9.6%). The presence of CHD was related with neonatal hospitalisation (P=.04), hearing loss (P=.002), mortality (P=.09) and lower hyperactivity (P=.02), it being more frequent in HDAC8+ patients (60%), followed by NIPBL+ (33%) and SMC1A+ (28.5%). While septal defects predominate in NIPBL+, pulmonary stenosis is more common in HDAC8+. Patients with CdLS have a high incidence of CHD, which varies according to the affected gene, the most frequent findings being septal defects and pulmonary stenosis. Perform a cardiologic study in all these patients is suggested. Copyright © 2017 Elsevier España, S.L.U. All rights reserved.

Relative susceptibilities of male germ cells to genetic defects induced by cancer chemotherapies

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wyrobek, A J; Schmid, T E; Marchetti, F

Some chemotherapy regimens include agents that are mutagenic or clastogenic in model systems. This raises concerns that cancer survivors, who were treated before or during their reproductive years, may be at increased risks for abnormal reproductive outcomes. However, the available data from offspring of cancer survivors are limited, representing diverse cancers, therapies, time-to-pregnancies, and reproductive outcomes. Rodent breeding data after paternal exposures to individual chemotherapeutic agents illustrate the complexity of factors that influence the risk for transmitted genetic damage including agent, dose, endpoint, and the germ-cell susceptibility profiles that vary across agents. Direct measurements of chromosomal abnormalities in sperm ofmore » mice and humans by sperm FISH have corroborated the differences in germ-cell susceptibilities. The available evidence suggests that the risk of producing chromosomally defective sperm is highest during the first few weeks after the end of chemotherapy, and decays with time. Thus, sperm samples provided immediately after the initiation of cancer therapies may contain treatment-induced genetic defects that will jeopardize the genetic health of offspring.« less

Aristaless-like homeobox protein 1 (ALX1) variant associated with craniofacial structure and frontonasal dysplasia in Burmese cats

PubMed Central

Lyons, Leslie A.; Erdman, Carolyn A.; Grahn, Robert A.; Hamilton, Michael J.; Carter, Michael J.; Helps, Christopher R.; Alhaddad, Hasan; Gandolfi, Barbara

2015-01-01

Frontonasal dysplasia (FND) can have severe presentations that are medically and socially debilitating. Several genes are implicated in FND conditions, including Aristaless-Like Homeobox 1 (ALX1), which is associated with FND3. Breeds of cats are selected and bred for extremes in craniofacial morphologies. In particular, a lineage of Burmese cats with severe brachycephyla is extremely popular and is termed Contemporary Burmese. Genetic studies demonstrated that the brachycephyla of the Contemporary Burmese is a simple co-dominant trait, however, the homozygous cats have a severe craniofacial defect that is incompatible with life. The craniofacial defect of the Burmese was genetically analyzed over a 20 year period, using various genetic analysis techniques. Family-based linkage analysis localized the trait to cat chromosome B4. Genome-wide association studies and other genetic analyses of SNP data refined a critical region. Sequence analysis identified a 12 bp in frame deletion in ALX1, c.496delCTCTCAGGACTG, which is 100% concordant with the craniofacial defect and not found in cats not related to the Contemporary Burmese. PMID:26610632

The social and economic origins of genetic determinism: a case history of the American Eugenics Movement, 1900-1940 and its lessons for today.

PubMed

Allen, G E

1997-01-01

Eugenics, the attempt to improve the genetic quality of the human species by 'better breeding', developed as a worldwide movement between 1900 and 1940. It was particularly prominent in the United States, Britain and Germany, and in those countries was based on the then-new science of Mendelian genetics. Eugenicists developed research programs to determine the degree in which traits such as Huntington's chorea, blindness, deafness, mental retardation (feeblemindedness), intelligence, alcoholism, schizophrenia, manic depression, rebelliousness, nomadism, prostitution and feeble inhibition were genetically determined. Eugenicists were also active in the political arena, lobbying in the United States for immigration restriction and compulsory sterilization laws for those deemed genetically unfit; in Britain they lobbied for incarceration of genetically unfit and in Germany for sterilization and eventually euthanasia. In all these countries one of the major arguments was that of efficiency: that it was inefficient to allow genetic defects to be multiplied and then have to try and deal with the consequences of state care for the offspring. National socialists called genetically defective individuals 'useless eaters' and argued for sterilization or euthanasia on economic grounds. Similar arguments appeared in the United States and Britain as well. At the present time (1997) much research and publicity is being given to claims about a genetic basis for all the same behaviors (alcoholism, manic depression, etc.), again in an economic context--care for people with such diseases is costing too much. There is an important lesson to learn from the past: genetic arguments are put forward to mask the true--social and economic--causes of human behavioral defects.

Genetic modification of chondrocytes with insulin-like growth factor-1 enhances cartilage healing in an equine model.

PubMed

Goodrich, L R; Hidaka, C; Robbins, P D; Evans, C H; Nixon, A J

2007-05-01

Gene therapy with insulin-like growth factor-1 (IGF-1) increases matrix production and enhances chondrocyte proliferation and survival in vitro. The purpose of this study was to determine whether arthroscopically-grafted chondrocytes genetically modified by an adenovirus vector encoding equine IGF-1 (AdIGF-1) would have a beneficial effect on cartilage healing in an equine femoropatellar joint model. A total of 16 horses underwent arthroscopic repair of a single 15 mm cartilage defect in each femoropatellar joint. One joint received 2 x 10(7) AdIGF-1 modified chondrocytes and the contralateral joint received 2 x 10(7) naive (unmodified) chondrocytes. Repairs were analysed at four weeks, nine weeks and eight months after surgery. Morphological and histological appearance, IGF-1 and collagen type II gene expression (polymerase chain reaction, in situ hybridisation and immunohistochemistry), collagen type II content (cyanogen bromide and sodium dodecyl sulphate-polyacrylamide gel electrophoresis), proteoglycan content (dimethylmethylene blue assay), and gene expression for collagen type I, matrix metalloproteinase (MMP)-1, MMP-3, MMP-13, aggrecanase-1, tissue inhibitor of matrix metalloproteinase-1 (TIMP-1) and TIMP-3 were evaluated. Genetic modification of chondrocytes significantly increased IGF-1 mRNA and ligand production in repair tissue for up to nine weeks following transplantation. The gross and histological appearance of IGF-1 modified repair tissue was improved over control defects. Gross filling of defects was significantly improved at four weeks, and a more hyaline-like tissue covered the lesions at eight months. Histological outcome at four and nine weeks post-transplantation revealed greater tissue filling of defects transplanted with genetically modified chondrocytes, whereas repair tissue in control defects was thin and irregular and more fibrous. Collagen type II expression in IGF-1 gene-transduced defects was increased 100-fold at four weeks and correlated with increased collagen type II immunoreaction up to eight months. Genetic modification of chondrocytes with AdIGF-1 prior to transplantation improved early (four to nine weeks), and to a lesser degree long-term, cartilage healing in the equine model. The equine model of cartilage healing closely resembles human clinical cartilage repair. The results of this study suggest that cartilage healing can be enhanced through genetic modification of chondrocytes prior to transplantation.

The determination factors of left-right asymmetry disorders- a short review.

PubMed

Catana, Andreea; Apostu, Adina Patricia

2017-01-01

Laterality defects in humans, situs inversus and heterotaxy, are rare disorders, with an incidence of 1:8000 to 1:10 000 in the general population, and a multifactorial etiology. It has been proved that 1.44/10 000 of all cardiac problems are associated with malformations of left-right asymmetry and heterotaxy accounts for 3% of all congenital heart defects. It is considered that defects of situs appear due to genetic and environmental factors. Also, there is evidence that the ciliopathies (defects of structure or function) are involved in development abnormalities. Over 100 genes have been reported to be involved in left-right patterning in model organisms, but only a few are likely to candidate for left-right asymmetry defects in humans. Left-right asymmetry disorders are genetically heterogeneous and have variable manifestations (from asymptomatic to serious clinical problems). The discovery of the right mechanism of left-right development will help explain the clinical complexity and may contribute to a therapy of these disorders.

Unexpected genetic heterogeneity for primary ciliary dyskinesia in the Irish Traveller population.

PubMed

Casey, Jillian P; McGettigan, Paul A; Healy, Fiona; Hogg, Claire; Reynolds, Alison; Kennedy, Breandan N; Ennis, Sean; Slattery, Dubhfeasa; Lynch, Sally A

2015-02-01

We present a study of five children from three unrelated Irish Traveller families presenting with primary ciliary dyskinesia (PCD). As previously characterized disorders in the Irish Traveller population are caused by common homozygous mutations, we hypothesised that all three PCD families shared the same recessive mutation. However, exome sequencing showed that there was no pathogenic homozygous mutation common to all families. This finding was supported by histology, which showed that each family has a different type of ciliary defect; transposition defect (family A), nude epithelium (family B) and absence of inner and outer dynein arms (family C). Therefore, each family was analysed independently using homozygosity mapping and exome sequencing. The affected siblings in family A share a novel 1 bp duplication in RSPH4A (NM_001161664.1:c.166dup; p.Arg56Profs*11), a radial-spoke head protein involved in ciliary movement. In family B, we identified three candidate genes (CCNO, KCNN3 and CDKN1C), with a 5-bp duplication in CCNO (NM_021147.3:c.258_262dup; p.Gln88Argfs*8) being the most likely cause of ciliary aplasia. This is the first study to implicate CCNO, a DNA repair gene reported to be involved in multiciliogenesis, in PCD. In family C, we identified a ∼3.5-kb deletion in DYX1C1, a neuronal migration gene previously associated with PCD. This is the first report of a disorder in the relatively small Irish Traveller population to be caused by >1 disease gene. Our study identified at least three different PCD genes in the Irish Traveller population, highlighting that one cannot always assume genetic homogeneity, even in small consanguineous populations.

Mutations in the Epithelial Cadherin-p120-Catenin Complex Cause Mendelian Non-Syndromic Cleft Lip with or without Cleft Palate.

PubMed

Cox, Liza L; Cox, Timothy C; Moreno Uribe, Lina M; Zhu, Ying; Richter, Chika T; Nidey, Nichole; Standley, Jennifer M; Deng, Mei; Blue, Elizabeth; Chong, Jessica X; Yang, Yueqin; Carstens, Russ P; Anand, Deepti; Lachke, Salil A; Smith, Joshua D; Dorschner, Michael O; Bedell, Bruce; Kirk, Edwin; Hing, Anne V; Venselaar, Hanka; Valencia-Ramirez, Luz C; Bamshad, Michael J; Glass, Ian A; Cooper, Jonathan A; Haan, Eric; Nickerson, Deborah A; van Bokhoven, Hans; Zhou, Huiqing; Krahn, Katy N; Buckley, Michael F; Murray, Jeffrey C; Lidral, Andrew C; Roscioli, Tony

2018-06-07

Non-syndromic cleft lip with or without cleft palate (NS-CL/P) is one of the most common human birth defects and is generally considered a complex trait. Despite numerous loci identified by genome-wide association studies, the effect sizes of common variants are relatively small, with much of the presumed genetic contribution remaining elusive. We report exome-sequencing results in 209 people from 72 multi-affected families with pedigree structures consistent with autosomal-dominant inheritance and variable penetrance. Herein, pathogenic variants are described in four genes encoding components of the p120-catenin complex (CTNND1, PLEKHA7, PLEKHA5) and an epithelial splicing regulator (ESRP2), in addition to the known CL/P-associated gene, CDH1, which encodes E-cadherin. The findings were also validated in a second cohort of 497 people with NS-CL/P, comprising small families and singletons with pathogenic variants in these genes identified in 14% of multi-affected families and 2% of the replication cohort of smaller families. Enriched expression of each gene/protein in human and mouse embryonic oro-palatal epithelia, demonstration of functional impact of CTNND1 and ESRP2 variants, and recapitulation of the CL/P spectrum in Ctnnd1 knockout mice support a causative role in CL/P pathogenesis. These data show that primary defects in regulators of epithelial cell adhesion are the most significant contributors to NS-CL/P identified to date and that inherited and de novo single gene variants explain a substantial proportion of NS-CL/P. Copyright © 2018 American Society of Human Genetics. All rights reserved.

Defects along the T(H)17 differentiation pathway underlie genetically distinct forms of the hyper IgE syndrome.

PubMed

Al Khatib, Shadi; Keles, Sevgi; Garcia-Lloret, Maria; Karakoc-Aydiner, Elif; Reisli, Ismail; Artac, Hasibe; Camcioglu, Yildiz; Cokugras, Haluk; Somer, Ayper; Kutukculer, Necil; Yilmaz, Mustafa; Ikinciogullari, Aydan; Yegin, Olcay; Yüksek, Mutlu; Genel, Ferah; Kucukosmanoglu, Ercan; Baki, Ali; Bahceciler, Nerin N; Rambhatla, Anupama; Nickerson, Derek W; McGhee, Sean; Barlan, Isil B; Chatila, Talal

2009-08-01

The hyper IgE syndrome (HIES) is characterized by abscesses, eczema, recurrent infections, skeletal and connective tissue abnormalities, elevated serum IgE, and diminished inflammatory responses. It exists as autosomal-dominant and autosomal-recessive forms that manifest common and distinguishing clinical features. A majority of those with autosomal-dominant HIES have heterozygous mutations in signal transducer and activator of transcription (STAT)-3 and impaired T(H)17 differentiation. To elucidate mechanisms underlying different forms of HIES. A cohort of 25 Turkish children diagnosed with HIES were examined for STAT3 mutations by DNA sequencing. Activation of STAT3 by IL-6 and IL-21 and STAT1 by IFN-alpha was assessed by intracellular staining with anti-phospho (p)STAT3 and -pSTAT1 antibodies. T(H)17 and T(H)1 cell differentiation was assessed by measuring the production of IL-17 and IFN-gamma, respectively. Six subjects had STAT3 mutations affecting the DNA binding, Src homology 2, and transactivation domains, including 3 novel ones. Mutation-positive but not mutation-negative subjects with HIES exhibited reduced phosphorylation of STAT3 in response to cytokine stimulation, whereas pSTAT1 activation was unaffected. Both patient groups exhibited impaired T(H)17 responses, but whereas STAT3 mutations abrogated early steps in T(H)17 differentiation, the defects in patients with HIES with normal STAT3 affected more distal steps. In this cohort of Turkish children with HIES, a majority had normal STAT3, implicating other targets in disease pathogenesis. Impaired T(H)17 responses were evident irrespective of the STAT3 mutation status, indicating that different genetic forms of HIES share a common functional outcome.

GWAS for serum galactose-deficient IgA1 implicates critical genes of the O-glycosylation pathway

PubMed Central

Kiryluk, Krzysztof; Moldoveanu, Zina; Suzuki, Hitoshi; Reily, Colin; Hou, Ping; Xie, Jingyuan; Mladkova, Nikol; Prakash, Sindhuri; Fischman, Clara; Shapiro, Samantha; Bradbury, Drew; Ionita-Laza, Iuliana; Eitner, Frank; Rauen, Thomas; Maillard, Nicolas; Floege, Jürgen; Chen, Nan; Zhang, Hong; Scolari, Francesco; Wyatt, Robert J.; Julian, Bruce A.; Gharavi, Ali G.; Novak, Jan

2017-01-01

Aberrant O-glycosylation of serum immunoglobulin A1 (IgA1) represents a heritable pathogenic defect in IgA nephropathy, the most common form of glomerulonephritis worldwide, but specific genetic factors involved in its determination are not known. We performed a quantitative GWAS for serum levels of galactose-deficient IgA1 (Gd-IgA1) in 2,633 subjects of European and East Asian ancestry and discovered two genome-wide significant loci, in C1GALT1 (rs13226913, P = 3.2 x 10−11) and C1GALT1C1 (rs5910940, P = 2.7 x 10−8). These genes encode molecular partners essential for enzymatic O-glycosylation of IgA1. We demonstrated that these two loci explain approximately 7% of variability in circulating Gd-IgA1 in Europeans, but only 2% in East Asians. Notably, the Gd-IgA1-increasing allele of rs13226913 is common in Europeans, but rare in East Asians. Moreover, rs13226913 represents a strong cis-eQTL for C1GALT1 that encodes the key enzyme responsible for the transfer of galactose to O-linked glycans on IgA1. By in vitro siRNA knock-down studies, we confirmed that mRNA levels of both C1GALT1 and C1GALT1C1 determine the rate of secretion of Gd-IgA1 in IgA1-producing cells. Our findings provide novel insights into the genetic regulation of O-glycosylation and are relevant not only to IgA nephropathy, but also to other complex traits associated with O-glycosylation defects, including inflammatory bowel disease, hematologic disease, and cancer. PMID:28187132

Genetics Home Reference: Cantú syndrome

MedlinePlus

... syndrome is a rare condition characterized by excess hair growth (hypertrichosis), a distinctive facial appearance, heart defects, and ... problem with potassium channel function leads to excess hair growth, heart defects, and the other features of Cantú ...

Prenatal care in your first trimester

MedlinePlus

... for birth defects and genetic problems, such as Down syndrome or brain and spinal column defects. If your ... if the baby is at risk for having Down syndrome. If a test called a quadruple screen is ...

When Your Baby Has a Birth Defect

MedlinePlus

... as heart defects, cleft lip and palate, or cerebral palsy. Still, you may find yourself being both the ... the NICU Gene Therapy and Children Down Syndrome Cerebral Palsy Spina Bifida Prenatal Genetic Counseling What Is a ...

Genetics Home Reference: abdominal wall defect

MedlinePlus

... are two main types of abdominal wall defects: omphalocele and gastroschisis . Omphalocele is an opening in the center of the ... covering the exposed organs in gastroschisis. Fetuses with omphalocele may grow slowly before birth (intrauterine growth retardation) ...

Wide spectrum of NR5A1-related phenotypes in 46,XY and 46,XX individuals.

PubMed

Domenice, Sorahia; Machado, Aline Zamboni; Ferreira, Frederico Moraes; Ferraz-de-Souza, Bruno; Lerario, Antonio Marcondes; Lin, Lin; Nishi, Mirian Yumie; Gomes, Nathalia Lisboa; da Silva, Thatiana Evelin; Silva, Rosana Barbosa; Correa, Rafaela Vieira; Montenegro, Luciana Ribeiro; Narciso, Amanda; Costa, Elaine Maria Frade; Achermann, John C; Mendonca, Berenice Bilharinho

2016-12-01

Steroidogenic factor 1 (NR5A1, SF-1, Ad4BP) is a transcriptional regulator of genes involved in adrenal and gonadal development and function. Mutations in NR5A1 have been among the most frequently identified genetic causes of gonadal development disorders and are associated with a wide phenotypic spectrum. In 46,XY individuals, NR5A1-related phenotypes may range from disorders of sex development (DSD) to oligo/azoospermia, and in 46,XX individuals, from 46,XX ovotesticular and testicular DSD to primary ovarian insufficiency (POI). The most common 46,XY phenotype is atypical or female external genitalia with clitoromegaly, palpable gonads, and absence of Müllerian derivatives. Notably, an undervirilized external genitalia is frequently seen at birth, while spontaneous virilization may occur later, at puberty. In 46,XX individuals, NR5A1 mutations are a rare genetic cause of POI, manifesting as primary or secondary amenorrhea, infertility, hypoestrogenism, and elevated gonadotropin levels. Mothers and sisters of 46,XY DSD patients carrying heterozygous NR5A1 mutations may develop POI, and therefore require appropriate counseling. Moreover, the recurrent heterozygous p.Arg92Trp NR5A1 mutation is associated with variable degrees of testis development in 46,XX patients. A clear genotype-phenotype correlation is not seen in patients bearing NR5A1 mutations, suggesting that genetic modifiers, such as pathogenic variants in other testis/ovarian-determining genes, may contribute to the phenotypic expression. Here, we review the published literature on NR5A1-related disease, and discuss our findings at a single tertiary center in Brazil, including ten novel NR5A1 mutations identified in 46,XY DSD patients. The ever-expanding phenotypic range associated with NR5A1 variants in XY and XX individuals confirms its pivotal role in reproductive biology, and should alert clinicians to the possibility of NR5A1 defects in a variety of phenotypes presenting with gonadal dysfunction. Birth Defects Research (Part C) 108:309-320, 2016. © 2016 The Authors Birth Defects Research Part C: Embryo Today: Reviews Published by Wiley Periodicals, Inc. © 2016 The Authors Birth Defects Research Part C: Embryo Today: Reviews Published by Wiley Periodicals, Inc.

Hypoxia as a therapy for mitochondrial disease.

PubMed

Jain, Isha H; Zazzeron, Luca; Goli, Rahul; Alexa, Kristen; Schatzman-Bone, Stephanie; Dhillon, Harveen; Goldberger, Olga; Peng, Jun; Shalem, Ophir; Sanjana, Neville E; Zhang, Feng; Goessling, Wolfram; Zapol, Warren M; Mootha, Vamsi K

2016-04-01

Defects in the mitochondrial respiratory chain (RC) underlie a spectrum of human conditions, ranging from devastating inborn errors of metabolism to aging. We performed a genome-wide Cas9-mediated screen to identify factors that are protective during RC inhibition. Our results highlight the hypoxia response, an endogenous program evolved to adapt to limited oxygen availability. Genetic or small-molecule activation of the hypoxia response is protective against mitochondrial toxicity in cultured cells and zebrafish models. Chronic hypoxia leads to a marked improvement in survival, body weight, body temperature, behavior, neuropathology, and disease biomarkers in a genetic mouse model of Leigh syndrome, the most common pediatric manifestation of mitochondrial disease. Further preclinical studies are required to assess whether hypoxic exposure can be developed into a safe and effective treatment for human diseases associated with mitochondrial dysfunction. Copyright © 2016, American Association for the Advancement of Science.

The genetic architecture of microphthalmia, anophthalmia and coloboma.

PubMed

Williamson, Kathleen A; FitzPatrick, David R

2014-08-01

Microphthalmia, anophthalmia and coloboma (MAC) are distinct phenotypes that represent a continuum of structural developmental eye defects. In severe bilateral cases (anophthalmia or severe microphthalmia) the genetic cause is now identifiable in approximately 80 percent of cases, with de novo heterozygous loss-of-function mutations in SOX2 or OTX2 being the most common. The genetic cause of other forms of MAC, in particular isolated coloboma, remains unknown in the majority of cases. This review will focus on MAC phenotypes that are associated with mutation of the genes SOX2, OTX2, PAX6, STRA6, ALDH1A3, RARB, VSX2, RAX, FOXE3, BMP4, BMP7, GDF3, GDF6, ABCB6, ATOH7, C12orf57, TENM3 (ODZ3), and VAX1. Recently reported mutation of the SALL2 and YAP1 genes are discussed in brief. Clinical and genetic features were reviewed in a total of 283 unrelated MAC cases or families that were mutation-positive from these 20 genes. Both the relative frequency of mutations in MAC cohort screens and the level of confidence in the assignment of disease-causing status were evaluated for each gene. Copyright © 2014 Elsevier Masson SAS. All rights reserved.

Imaging of SHOX-associated anomalies.

PubMed

Gahunia, Harpal K; Babyn, Paul S; Kirsch, Susan; Mendoza-Londono, Roberto

2009-09-01

Human growth is a multifactorial trait influenced by environmental, hormonal, and genetic factors. Although it is clear that multiple factors contribute to an individual's final height and limb development, genetic factors play a crucial role. One such gene is the short stature homeobox ( SHOX) containing gene. Knowledge about the SHOX gene has rapidly increased since its discovery in 1997, and we now know that SHOX haploinsufficiency affects the development of the extremities and is an important cause of short stature. Currently, SHOX mutations occur with an estimated incidence of roughly 1 in 1000 newborns, making mutations of this gene one of the most common genetic defects associated with growth failure and skeletal deformities. Heterozygous mutations of SHOX have been implicated in patients with Madelung's deformity, Leri-Weill dyschondrosteosis (77%), Turner's syndrome (66%), and idiopathic short stature (3%), and homozygous mutations of SHOX gene have been identified in patients with Langer's mesomelic dysplasia (100%). Recognition of the early radiographic features encountered in SHOX haploinsufficiency maybe pivotal for the diagnosis. In this article, we summarize the genetic and clinical features of the various SHOX haploinsufficiency-associated disorders. We present the characteristic imaging features of these disorders and the results of growth hormone treatment trials.

Comprehensive genetic testing for primary immunodeficiency disorders in a tertiary hospital: 10-year experience in Auckland, New Zealand.

PubMed

Woon, See-Tarn; Ameratunga, Rohan

2016-01-01

New Zealand is a developed geographically isolated country in the South Pacific with a population of 4.4 million. Genetic diagnosis is the standard of care for most patients with primary immunodeficiency disorders (PIDs). Since 2005, we have offered a comprehensive genetic testing service for PIDs and other immune-related disorders with a published sequence. Here we present results for this program, over the first decade, between 2005 and 2014. We undertook testing in 228 index cases and 32 carriers during this time. The three most common test requests were for X-linked lymphoproliferative (XLP), tumour necrosis factor receptor associated periodic syndrome (TRAPS) and haemophagocytic lymphohistiocytosis (HLH). Of the 32 suspected XLP cases, positive diagnoses were established in only 2 patients. In contrast, genetic defects in 8 of 11 patients with suspected X-linked agammaglobulinemia (XLA) were confirmed. Most XLA patients were initially identified from absence of B cells. Overall, positive diagnoses were made in about 23% of all tests requested. The diagnostic rate was lowest for several conditions with locus heterogeneity. Thorough clinical characterisation of patients can assist in prioritising which genes should be tested. The clinician-driven customised comprehensive genetic service has worked effectively for New Zealand. Next generation sequencing will play an increasing role in disorders with locus heterogeneity.

[Fetal atrioventricular septal defect associated with Patau and Edwards syndromes, as well as trisomy 22].

PubMed

Cesko, I; Hajdú, J; Marton, T; Tóth-Pál, E; Papp, C; Papp, Z

1998-05-03

The atrioventricular septal defect is usually associated with trisomy 21 and it may be observed in the heterotaxia syndromes. Atrioventricular septal defect may be associated with 8p deletion. There are reported cases of familial atrioventricular septal defect. Atrioventicular septal defect is rarely associated with other chromosomal abnormalities. We are reporting three unusual cases of atrioventricular septal defect that were associated with trisomy 13, 18 and 22. This association may be due to effect of genetic loci on the 13, 18 and 22 chromosome which could play the role in the development and fusion of endocardial cushion and atrioventricular septal defect.

Indiana Health Science Teachers: Their Human Genetics/Bioethics Educational Needs.

ERIC Educational Resources Information Center

Hendrix, Jon R.; And Others

1982-01-01

Results from a human genetics/bioethics needs assessment questionnaire (N = 124 out of 300) mailed to Indiana health teachers are reported. Genetic topics and human genetic diseases/defects included in health science instruction are listed in two tables. Responses to 16 science/society statements (and statements themselves) are also reported. (SK)

Identification of De Novo and Rare Inherited Copy Number Variants in Children with Syndromic Congenital Heart Defects.

PubMed

Hussein, Ibtessam R; Bader, Rima S; Chaudhary, Adeel G; Bassiouni, Randa; Alquaiti, Maha; Ashgan, Fai; Schulten, Hans-Juergen; Al Qahtani, Mohammad H

2018-06-01

Congenital heart defects (CHDs) are the most common birth defects in neonatal life. CHDs could be presented as isolated defects or associated with developmental delay (DD) and/or other congenital malformations. A small proportion of cardiac defects are caused by chromosomal abnormalities or single gene defects; however, in a large proportion of cases no genetic diagnosis could be achieved by clinical examination and conventional genetic analysis. The development of genome wide array-Comparative Genomic Hybridization technique (array-CGH) allowed for the detection of cryptic chromosomal imbalances and pathogenic copy number variants (CNVs) not detected by conventional techniques. We investigated 94 patients having CHDs associated with other malformations and/or DD. Clinical examination and Echocardiography was done to all patients to evaluate the type of CHD. To investigate for genome defects we applied high-density array-CGH 2 × 400K (41 patients) and CGH/SNP microarray 2 × 400K (Agilent) for 53 patients. Confirmation of results was done using Fluorescent in situ hybridization (FISH) or qPCR techniques in certain cases. Chromosomal abnormalities such as trisomy 18, 13, 21, microdeletions: del22q11.2, del7q11.23, del18 (p11.32; p11.21), tetrasomy 18p, trisomy 9p, del11q24-q25, add 15p, add(18)(q21.3), and der 9, 15 (q34.2; q11.2) were detected in 21/94 patients (22%) using both conventional cytogenetics methods and array-CGH technique. Cryptic chromosomal anomalies and pathogenic variants were detected in 15/73 (20.5%) cases. CNVs were observed in a large proportion of the studied samples (27/56) (48%). Clustering of variants was observed in chromosome 1p36, 1p21.1, 2q37, 3q29, 5p15, 7p22.3, 8p23, 11p15.5, 14q11.2, 15q11.2, 16p13.3, 16p11.2, 18p11, 21q22, and 22q11.2. CGH/SNP array could detect loss of heterozygosity (LOH) in different chromosomal loci in 10/25 patients. Array-CGH technique allowed for detection of cryptic chromosomal imbalances that could not be detected by conventional cytogenetics methods. CHDs associated with DD/congenital malformations presented with a relatively high rate of cryptic chromosomal abnormalities. Clustering of CNVs in certain genome loci needs further analysis to identify candidate genes that may provide clues for understanding the molecular pathway of cardiac development.

The clinical spectrum of the m.10191T>C mutation in complex I-deficient Leigh syndrome.

PubMed

Nesbitt, Victoria; Morrison, Patrick J; Crushell, Ellen; Donnelly, Deirdre E; Alston, Charlotte L; He, Langping; McFarland, Robert; Taylor, Robert W

2012-06-01

Mitochondrial respiratory chain diseases represent one of the most common inherited neurometabolic disorders of childhood, affecting a minimum of 1 in 7500 live births. The marked clinical, biochemical, and genetic heterogeneity means that accurate genetic counselling relies heavily upon the identification of the underlying causative mutation in the individual and determination of carrier status in the parents. Isolated complex I deficiency is the most common respiratory chain defect observed in children, resulting in organ-specific or multisystem disease, but most often presenting as Leigh syndrome, for which mitochondrial DNA mutations are important causes. Several recurrent, pathogenic point mutations in the MTND3 gene - including m.10191T>C (p.Ser45Pro) - have been previously identified. In this short clinical review we evaluate the case reports of the m.10191T>C mutation causing complex I-deficient Leigh syndrome described in the literature, in addition to two new ones diagnosed in our laboratory. Both of these appear to have arisen de novo without transmission of the mutation from mother to offspring, illustrating the importance not only of fully characterizing the mitochondrial genome as part of the investigation of children with complex I-deficient Leigh syndrome but also of assessing maternal samples to provide crucial genetic advice for families. © The Authors. Developmental Medicine & Child Neurology © 2012 Mac Keith Press.

A comprehensive defect data bank for no. 2 common oak lumber

Treesearch

Edwin L. Lucas; Leathern R.R. Catron; Leathern R.R. Catron

1973-01-01

Computer simulation of rough mill cut-up operations allows lowcost evaluation of furniture rough mill cut-up procedures. The defect data bank serves as input to such simulation programs. The data bank contains a detailed accounting of defect data taken from 637 No. 2 Common oak boards. Included is a description of each defect (location, size, and type), as well as the...

Identification of De Novo Copy Number Variants Associated with Human Disorders of Sexual Development

PubMed Central

Tannour-Louet, Mounia; Han, Shuo; Corbett, Sean T.; Louet, Jean-Francois; Yatsenko, Svetlana; Meyers, Lindsay; Shaw, Chad A.; Kang, Sung-Hae L.; Cheung, Sau Wai; Lamb, Dolores J.

2010-01-01

Disorders of sexual development (DSD), ranging in severity from genital abnormalities to complete sex reversal, are among the most common human birth defects with incidence rates reaching almost 3%. Although causative alterations in key genes controlling gonad development have been identified, the majority of DSD cases remain unexplained. To improve the diagnosis, we screened 116 children born with idiopathic DSD using a clinically validated array-based comparative genomic hybridization platform. 8951 controls without urogenital defects were used to compare with our cohort of affected patients. Clinically relevant imbalances were found in 21.5% of the analyzed patients. Most anomalies (74.2%) evaded detection by the routinely ordered karyotype and were scattered across the genome in gene-enriched subtelomeric loci. Among these defects, confirmed de novo duplication and deletion events were noted on 1p36.33, 9p24.3 and 19q12-q13.11 for ambiguous genitalia, 10p14 and Xq28 for cryptorchidism and 12p13 and 16p11.2 for hypospadias. These variants were significantly associated with genitourinary defects (P = 6.08×10−12). The causality of defects observed in 5p15.3, 9p24.3, 22q12.1 and Xq28 was supported by the presence of overlapping chromosomal rearrangements in several unrelated patients. In addition to known gonad determining genes including SRY and DMRT1, novel candidate genes such as FGFR2, KANK1, ADCY2 and ZEB2 were encompassed. The identification of risk germline rearrangements for urogenital birth defects may impact diagnosis and genetic counseling and contribute to the elucidation of the molecular mechanisms underlying the pathogenesis of human sexual development. PMID:21048976

K-RasV14I recapitulates Noonan syndrome in mice

PubMed Central

Hernández-Porras, Isabel; Fabbiano, Salvatore; Schuhmacher, Alberto J.; Aicher, Alexandra; Cañamero, Marta; Cámara, Juan Antonio; Cussó, Lorena; Desco, Manuel; Heeschen, Christopher; Mulero, Francisca; Bustelo, Xosé R.; Guerra, Carmen; Barbacid, Mariano

2014-01-01

Noonan syndrome (NS) is an autosomal dominant genetic disorder characterized by short stature, craniofacial dysmorphism, and congenital heart defects. NS also is associated with a risk for developing myeloproliferative disorders (MPD), including juvenile myelomonocytic leukemia (JMML). Mutations responsible for NS occur in at least 11 different loci including KRAS. Here we describe a mouse model for NS induced by K-RasV14I, a recurrent KRAS mutation in NS patients. K-RasV14I–mutant mice displayed multiple NS-associated developmental defects such as growth delay, craniofacial dysmorphia, cardiac defects, and hematologic abnormalities including a severe form of MPD that resembles human JMML. Homozygous animals had perinatal lethality whose penetrance varied with genetic background. Exposure of pregnant mothers to a MEK inhibitor rescued perinatal lethality and prevented craniofacial dysmorphia and cardiac defects. However, Mek inhibition was not sufficient to correct these defects when mice were treated after weaning. Interestingly, Mek inhibition did not correct the neoplastic MPD characteristic of these mutant mice, regardless of the timing at which the mice were treated, thus suggesting that MPD is driven by additional signaling pathways. These genetically engineered K-RasV14I–mutant mice offer an experimental tool for studying the molecular mechanisms underlying the clinical manifestations of NS. Perhaps more importantly, they should be useful as a preclinical model to test new therapies aimed at preventing or ameliorating those deficits associated with this syndrome. PMID:25359213

Clinical, immunologic, and genetic spectrum of 696 patients with combined immunodeficiency.

PubMed

Abolhassani, Hassan; Chou, Janet; Bainter, Wayne; Platt, Craig D; Tavassoli, Mahmood; Momen, Tooba; Tavakol, Marzieh; Eslamian, Mohammad Hossein; Gharagozlou, Mohammad; Movahedi, Masoud; Ghadami, Mohsen; Hamidieh, Amir Ali; Azizi, Gholamreza; Yazdani, Reza; Afarideh, Mohsen; Ghajar, Alireza; Havaei, Arash; Chavoshzadeh, Zahra; Mahdaviani, Seyed Alireza; Cheraghi, Taher; Behniafard, Nasrin; Amin, Reza; Aleyasin, Soheila; Faridhosseini, Reza; Jabbari-Azad, Farahzad; Nabavi, Mohammamd; Bemanian, Mohammad Hassan; Arshi, Saba; Molatefi, Rasol; Sherkat, Roya; Mansouri, Mahboubeh; Mesdaghi, Mehrnaz; Babaie, Delara; Mohammadzadeh, Iraj; Ghaffari, Javad; Shafiei, Alireza; Kalantari, Najmeddin; Ahanchian, Hamid; Khoshkhui, Maryam; Soheili, Habib; Dabbaghzadeh, Abbas; Shirkani, Afshin; Nasiri Kalmarzi, Rasoul; Mortazavi, Seyed Hamidreza; Tafaroji, Javad; Khalili, Abbas; Mohammadi, Javad; Negahdari, Babak; Joghataei, Mohammad-Taghi; Al-Ramadi, Basel K; Picard, Capucine; Parvaneh, Nima; Rezaei, Nima; Chatila, Talal A; Massaad, Michel J; Keles, Sevgi; Hammarström, Lennart; Geha, Raif S; Aghamohammadi, Asghar

2018-04-01

Combined immunodeficiencies (CIDs) are diseases of defective adaptive immunity with diverse clinical phenotypes. Although CIDs are more prevalent in the Middle East than Western countries, the resources for genetic diagnosis are limited. This study aims to characterize the categories of patients with CIDs in Iran clinically and genetically. Clinical and laboratory data were obtained from 696 patients with CIDs. Patients were subdivided into those with syndromic (344 patients) and nonsyndromic (352 patients) CIDs. Targeted DNA sequencing was performed on 243 (34.9%) patients. The overall diagnostic yield of the 243 sequenced patients was 77.8% (189 patients). The clinical diagnosis of hyper-IgE syndrome (P < .001), onset of disease at greater than 5 years (P = .02), and absence of multiple affected family members (P = .04) were significantly more frequent in the patients without a genetic diagnosis. An autosomal recessive disease was found in 62.9% of patients, reflecting the high rate of consanguinity in this cohort. Mutations impairing VDJ recombination and DNA repair were the most common underlying causes of CIDs. However, in patients with syndromic CIDs, autosomal recessive mutations in ataxia-telangiectasia mutated (ATM), autosomal dominant mutations in signal transducer and activator of transcription 3 (STAT3), and microdeletions in 22q11.21 were the most commonly affected genomic loci. Patients with syndromic CIDs had a significantly lower 5-year survival rate rather than those with nonsyndromic CIDs. This study provides proof of principle for the application of targeted next-generation sequencing panels in countries with limited diagnostic resources. The effect of genetic diagnosis on clinical care requires continued improvements in therapeutic resources for these patients. Copyright © 2017 American Academy of Allergy, Asthma & Immunology. All rights reserved.

[Genetic obesity: new diagnostic options].

PubMed

de Vries, T I; Alsters, S I M; Kleinendorst, L; van Haaften, G; van der Zwaag, B; Van Haelst, M M

2017-01-01

- Obesity is an important risk factor for morbidity and premature death, as well as a contributing factor to psychosocial problems. The incidence of obesity has increased dramatically over the last few decades.- Obesity is considered to be a multifactorial condition in which both environmental factors and genetic factors play a part.- In approximately 5% of patients with morbid obesity, a monogenic cause can be identified. Mutations in the MC4R gene are the most frequently occurring monogenic cause of obesity.- The department of Genetics at the VU University Medical Center Amsterdam offers morbidly obese patients a diagnostic analysis of 50 obesity-associated genes. - An underlying obesity-associated genetic defect can influence patient response to certain treatments. Therefore, if the gene defect is known, it can be taken into account when considering treatment options.- The understanding of the genetics of obesity will significantly contribute to research into the development of personalized treatment options.

Regional Variations in the Prevalence of Major Congenital Malformations in Quebec: The Importance of Fetal Growth Environment.

PubMed

Zhao, Jin-Ping; Sheehy, Odile; Bérard, Anick

2015-01-01

Congenital anomalies are the consequence of a complex interaction between genetic predisposition and fetal environment. Based on the Congenital Anomalies Surveillance in Canada Report, between 1998 and 2007 the rate of congenital heart defects in Quebec was significantly higher than the Canadian average; no data on the overall prevalence of congenital anomalies for Quebec or data on regional variations in any province are available. To estimate the prevalence of major congenital malformations (MCMs) in all of the 17 administrative regions of Quebec. Using data from the Quebec Pregnancy Cohort, we included infants if they were born between January 1, 1998 and December 31, 2008. MCMs were identified within the infant's first year of life using validated ICD-9 and ICD-10 codes. The rate of MCMs was calculated and stratified on Quebec's administrative regions. Among 152,353 eligible infants, the prevalence of MCMs was 36.6 (all rates were reported as per 1,000 live births). The regions with the highest rate of MCMs were Lanaudière (48.1), Laval (45.8), and Mauricie (45.1). Regions with the lowest rate were Outaouais (13.4), Côte-Nord (19.1), Abitibi-Témiscamingue (27.5), Gaspésie-îles-de-la-Madeleine (27.9), and Saguenay-Lac-Saint-Jean (28.9). Congenital heart defects (10.3) and musculoskeletal anomalies (12.6) were the most common. Laval had the highest rate of heart defects (16.1), and Lanaudière had the highest rate of musculoskeletal anomalies (22.0). The central regions of Quebec had high rate of MCMs, whereas the relatively genetically homogenous peripheral regions of Quebec had lower rate of MCM, suggesting the importance of fetal growth environment in the etiology of MCMs in Quebec.

Lhx6 and Lhx8 promote palate development through negative regulation of a cell cycle inhibitor gene, p57Kip2

PubMed Central

Cesario, Jeffry M.; Landin Malt, Andre; Deacon, Lindsay J.; Sandberg, Magnus; Vogt, Daniel; Tang, Zuojian; Zhao, Yangu; Brown, Stuart; Rubenstein, John L.; Jeong, Juhee

2015-01-01

Cleft palate is a common birth defect in humans. Therefore, understanding the molecular genetics of palate development is important from both scientific and medical perspectives. Lhx6 and Lhx8 encode LIM homeodomain transcription factors, and inactivation of both genes in mice resulted in profound craniofacial defects including cleft secondary palate. The initial outgrowth of the palate was severely impaired in the mutant embryos, due to decreased cell proliferation. Through genome-wide transcriptional profiling, we discovered that p57Kip2 (Cdkn1c), encoding a cell cycle inhibitor, was up-regulated in the prospective palate of Lhx6−/−;Lhx8−/− mutants. p57Kip2 has been linked to Beckwith–Wiedemann syndrome and IMAGe syndrome in humans, which are developmental disorders with increased incidents of palate defects among the patients. To determine the molecular mechanism underlying the regulation of p57Kip2 by the Lhx genes, we combined chromatin immunoprecipitation, in silico search for transcription factor-binding motifs, and in vitro reporter assays with putative cis-regulatory elements. The results of these experiments indicated that LHX6 and LHX8 regulated p57Kip2 via both direct and indirect mechanisms, with the latter mediated by Forkhead box (FOX) family transcription factors. Together, our findings uncovered a novel connection between the initiation of palate development and a cell cycle inhibitor via LHX. We propose a model in which Lhx6 and Lhx8 negatively regulate p57Kip2 expression in the prospective palate area to allow adequate levels of cell proliferation and thereby promote normal palate development. This is the first report elucidating a molecular genetic pathway downstream of Lhx in palate development. PMID:26071365

Complement C4 deficiency--a plausible risk factor for non-tuberculous mycobacteria (NTM) infection in apparently immunocompetent patients.

PubMed

Kotilainen, Hannele; Lokki, Marja-Liisa; Paakkanen, Riitta; Seppänen, Mikko; Tukiainen, Pentti; Meri, Seppo; Poussa, Tuija; Eskola, Jussi; Valtonen, Ville; Järvinen, Asko

2014-01-01

Non-tuberculous mycobacteria (NTM) are ubiquitous in the environment and they infect mainly persons with underlying pulmonary diseases but also previously healthy elderly women. Defects in host resistance that lead to pulmonary infections by NTM are relatively unknown. A few genetic defects have been associated with both pulmonary and disseminated mycobacterial infections. Rare disseminated NTM infections have been associated with genetic defects in T-cell mediated immunity and in cytokine signaling in families. We investigated whether there was an association between NTM infections and deficiencies of complement components C4A or C4B that are encoded by major histocompatibility complex (MHC). 50 adult patients with a positive NTM culture with symptoms and findings of a NTM disease were recruited. Patients' clinical history was collected and symptoms and clinical findings were categorized according to 2007 diagnostic criteria of The American Thoracic Society (ATS). To investigate the deficiencies of complement, C4A and C4B gene copy numbers and phenotype frequencies of the C4 allotypes were analyzed. Unselected, healthy, 149 Finnish adults were used as controls. NTM patients had more often C4 deficiencies (C4A or C4B) than controls (36/50 [72%] vs 83/149 [56%], OR = 2.05, 95%CI = 1.019-4.105, p = 0.042). C4 deficiencies for female NTM patients were more common than for controls (29/36 [81%] vs 55/100 [55%], OR = 3.39, 95% CI = 1.358-8.460, p = 0.007). C4 deficiences seemed not to be related to any specific underlying disease or C4 phenotype. C4 deficiency may be a risk factor for NTM infection in especially elderly female patients.

Asian flushing: genetic and sociocultural factors of alcoholism among East asians.

PubMed

Lee, Haeok; Kim, Sun S; You, Kwang Soo; Park, Wanju; Yang, Jin Hyang; Kim, Minjin; Hayman, Laura L

2014-01-01

Alcohol use can lead to a cascade of problems such as increased chances of risky behavior and negative health consequences, including alcoholic liver disease and upper gastric and liver cancer. Ethanol is metabolized mainly by 2 major enzymes: alcohol dehydrogenase (ADH) and acetaldehyde dehydrogenase (ALDH). Genetic variations of genes encoding the 2 enzymes are very common among East Asians but relatively rare for most other populations. Facial flushing and other physical discomforts after alcohol drinking triggered by accumulation of acetaldehyde through defective genes for ADH and ALDH have been reported. Approximately 40% of East Asians (Chinese, Japanese, and Korean) show facial flushing after drinking alcohol, known as "Asian flush," which is characterized by adverse reactions on alcohol drinking in individuals possessing the fasting metabolizing alleles for ADH, ADH1B*2, and ADH1C*1, and the null allele for ALDH and ALDH2*2. Alcoholism is determined not only by the genetic deficiency but also by behaviors that involve complex interactions between genetic and sociocultural factors. The purpose of this article was to provide nurses with the most current information about genetic and sociocultural influences on alcoholism and alcohol-related health problems specifically for East Asians and implications of this knowledge to nursing practice. The physiological phenomenon of genes and genetics in relation to alcohol metabolism in this special population is emphasized.

Convergent molecular defects underpin diverse neurodegenerative diseases.

PubMed

Tofaris, George K; Buckley, Noel J

2018-02-19

In our ageing population, neurodegenerative disorders carry an enormous personal, societal and economic burden. Although neurodegenerative diseases are often thought of as clinicopathological entities, increasing evidence suggests a considerable overlap in the molecular underpinnings of their pathogenesis. Such overlapping biological processes include the handling of misfolded proteins, defective organelle trafficking, RNA processing, synaptic health and neuroinflammation. Collectively but in different proportions, these biological processes in neurons or non-neuronal cells lead to regionally distinct patterns of neuronal vulnerability and progression of pathology that could explain the disease symptomology. With the advent of patient-derived cellular models and novel genetic manipulation tools, we are now able to interrogate this commonality despite the cellular complexity of the brain in order to develop novel therapeutic strategies to prevent or arrest neurodegeneration. Here, we describe broadly these concepts and their relevance across neurodegenerative diseases. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2018. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

Polycystin-1 Binds Par3/aPKC and Controls Convergent Extension During Renal Tubular Morphogenesis

PubMed Central

Castelli, Maddalena; Boca, Manila; Chiaravalli, Marco; Ramalingam, Harini; Rowe, Isaline; Distefano, Gianfranco; Carroll, Thomas; Boletta, Alessandra

2013-01-01

Several organs, including lungs and kidneys, are formed by epithelial tubes whose proper morphogenesis ensures correct function. This is best exemplified by the kidney, where defective establishment or maintanance of tubular diameter results in polycystic kidney disease, a common genetic disorder. Most polycystic kidney disease cases result from loss-of-function mutations in the PKD1 gene, encoding Polycystin-1 (PC-1), a large receptor of unknown function. Here we demonstrate that PC-1 plays an essential role in establishment of correct tubular diameter during nephron development. PC-1 associates with Par3 favoring the assembly of a pro-polarizing Par3/aPKC complex and it regulates a program of cell polarity important for oriented cell migration and for a convergent extension-like process during tubular morphogenesis. Par3 inactivation in the developing kidney results in defective convergent extension and tubular morphogenesis and in renal cyst formation. Our data define PC-1 as central to cell polarization and to epithelial tube morphogenesis and homeostasis. PMID:24153433

Organoid cystogenesis reveals a critical role of microenvironment in human polycystic kidney disease

NASA Astrophysics Data System (ADS)

Cruz, Nelly M.; Song, Xuewen; Czerniecki, Stefan M.; Gulieva, Ramila E.; Churchill, Angela J.; Kim, Yong Kyun; Winston, Kosuke; Tran, Linh M.; Diaz, Marco A.; Fu, Hongxia; Finn, Laura S.; Pei, York; Himmelfarb, Jonathan; Freedman, Benjamin S.

2017-11-01

Polycystic kidney disease (PKD) is a life-threatening disorder, commonly caused by defects in polycystin-1 (PC1) or polycystin-2 (PC2), in which tubular epithelia form fluid-filled cysts. A major barrier to understanding PKD is the absence of human cellular models that accurately and efficiently recapitulate cystogenesis. Previously, we have generated a genetic model of PKD using human pluripotent stem cells and derived kidney organoids. Here we show that systematic substitution of physical components can dramatically increase or decrease cyst formation, unveiling a critical role for microenvironment in PKD. Removal of adherent cues increases cystogenesis 10-fold, producing cysts phenotypically resembling PKD that expand massively to 1-centimetre diameters. Removal of stroma enables outgrowth of PKD cell lines, which exhibit defects in PC1 expression and collagen compaction. Cyclic adenosine monophosphate (cAMP), when added, induces cysts in both PKD organoids and controls. These biomaterials establish a highly efficient model of PKD cystogenesis that directly implicates the microenvironment at the earliest stages of the disease.

Altered proliferation and networks in neural cells derived from idiopathic autistic individuals.

PubMed

Marchetto, Maria C; Belinson, Haim; Tian, Yuan; Freitas, Beatriz C; Fu, Chen; Vadodaria, Krishna; Beltrao-Braga, Patricia; Trujillo, Cleber A; Mendes, Ana P D; Padmanabhan, Krishnan; Nunez, Yanelli; Ou, Jing; Ghosh, Himanish; Wright, Rebecca; Brennand, Kristen; Pierce, Karen; Eichenfield, Lawrence; Pramparo, Tiziano; Eyler, Lisa; Barnes, Cynthia C; Courchesne, Eric; Geschwind, Daniel H; Gage, Fred H; Wynshaw-Boris, Anthony; Muotri, Alysson R

2017-06-01

Autism spectrum disorders (ASD) are common, complex and heterogeneous neurodevelopmental disorders. Cellular and molecular mechanisms responsible for ASD pathogenesis have been proposed based on genetic studies, brain pathology and imaging, but a major impediment to testing ASD hypotheses is the lack of human cell models. Here, we reprogrammed fibroblasts to generate induced pluripotent stem cells, neural progenitor cells (NPCs) and neurons from ASD individuals with early brain overgrowth and non-ASD controls with normal brain size. ASD-derived NPCs display increased cell proliferation because of dysregulation of a β-catenin/BRN2 transcriptional cascade. ASD-derived neurons display abnormal neurogenesis and reduced synaptogenesis leading to functional defects in neuronal networks. Interestingly, defects in neuronal networks could be rescued by insulin growth factor 1 (IGF-1), a drug that is currently in clinical trials for ASD. This work demonstrates that selection of ASD subjects based on endophenotypes unraveled biologically relevant pathway disruption and revealed a potential cellular mechanism for the therapeutic effect of IGF-1.

Polycystin-1 binds Par3/aPKC and controls convergent extension during renal tubular morphogenesis

NASA Astrophysics Data System (ADS)

Castelli, Maddalena; Boca, Manila; Chiaravalli, Marco; Ramalingam, Harini; Rowe, Isaline; Distefano, Gianfranco; Carroll, Thomas; Boletta, Alessandra

2013-10-01

Several organs, including the lungs and kidneys, are formed by epithelial tubes whose proper morphogenesis ensures correct function. This is best exemplified by the kidney, where defective establishment or maintenance of tubular diameter results in polycystic kidney disease, a common genetic disorder. Most polycystic kidney disease cases result from loss-of-function mutations in the PKD1 gene, encoding Polycystin-1, a large receptor of unknown function. Here we demonstrate that PC-1 has an essential role in the establishment of correct tubular diameter during nephron development. Polycystin-1 associates with Par3 favouring the assembly of a pro-polarizing Par3/aPKC complex and it regulates a programme of cell polarity important for oriented cell migration and for a convergent extension-like process during tubular morphogenesis. Par3 inactivation in the developing kidney results in defective convergent extension and tubular morphogenesis, and in renal cyst formation. Our data define Polycystin-1 as central to cell polarization and to epithelial tube morphogenesis and homeostasis.

Chronic bilateral dislocation of temporomandibular joint.

PubMed

Shakya, S; Ongole, R; Sumanth, K N; Denny, C E

2010-01-01

Dislocation of the condyle of the mandible is a common condition that may occur in an acute or chronic form. It is characterised by inability to close the mouth with or without pain. Dislocation has to be differentiated from subluxation which is a self reducible condition. Dislocation can occur in any direction with anterior dislocation being the commonest one. Various predisposing factors have been associated with dislocation like muscle fatigue and spasm, the defect in the bony surface like shallow articular eminence, and laxity of the capsular ligament. People with defect in collagen synthesis like Ehler Danlos syndrome, Marfan syndrome are said to be genetically predisposed to this condition. Various treatment modalities have been used ranging from conservative techniques to surgical methods. Acute dislocations can be reduced manually or with conservative approach and recurrent and chronic cases can be reduced by surgical intervention. Though the dislocation in our case was 4 months a simple manual reduction proved to be successful. We believe that manual reduction can be attempted as first line of treatment prior to surgical intervention.

Glucose-6-phosphate dehydrogenase deficiency.

PubMed

Cappellini, M D; Fiorelli, G

2008-01-05

Glucose-6-phosphate dehydrogenase (G6PD) deficiency is the most common human enzyme defect, being present in more than 400 million people worldwide. The global distribution of this disorder is remarkably similar to that of malaria, lending support to the so-called malaria protection hypothesis. G6PD deficiency is an X-linked, hereditary genetic defect due to mutations in the G6PD gene, which cause functional variants with many biochemical and clinical phenotypes. About 140 mutations have been described: most are single base changes, leading to aminoacid substitutions. The most frequent clinical manifestations of G6PD deficiency are neonatal jaundice, and acute haemolytic anaemia, which is usually triggered by an exogenous agent. Some G6PD variants cause chronic haemolysis, leading to congenital non-spherocytic haemolytic anaemia. The most effective management of G6PD deficiency is to prevent haemolysis by avoiding oxidative stress. Screening programmes for the disorder are undertaken, depending on the prevalence of G6PD deficiency in a particular community.

Cardiovascular risk in Turner syndrome.

PubMed

Donato, Beatriz; Ferreira, Maria João

2018-06-01

Turner syndrome is a relatively common genetic disorder of female development, characterized by partial or complete absence of an X chromosome, with a variable clinical presentation. Congenital or acquired cardiovascular disease is highly prevalent and a major cause of early death in this syndrome. The most feared complication is aortic dissection, which can occur at a very young age and requires careful assessment of its risk factors. A systematic literature search identified sixty relevant publications. These were reviewed with regard to the increased risk of cardiovascular disease in women with Turner syndrome, especially in pregnancy. The most common congenital cardiovascular defects are presented and illustrated with appropriate iconography. The current recommendations regarding the screening and monitoring of cardiovascular disease in these patients are discussed. Copyright © 2018 Sociedade Portuguesa de Cardiologia. Publicado por Elsevier España, S.L.U. All rights reserved.

CD22ΔE12 as a molecular target for corrective repair using a RNA trans-splicing strategy: Anti-leukemic activity of a rationally designed RNA trans-splicing molecule

PubMed Central

Uckun, Fatih M.; Qazi, Sanjive; Ma, Hong; Reaman, Gregory H.; Mitchell, Lloyd G.

2015-01-01

Our recent studies have demonstrated that the CD22 exon 12 deletion (CD22ΔE12) is a characteristic genetic defect of therapy-refractory clones in pediatric B-precursor acute lymphoblastic leukemia (BPL) and implicated the CD22ΔE12 genetic defect in the aggressive biology of relapsed or therapy-refractory pediatric BPL. The purpose of the present study was to further evaluate the biologic significance of the CD22ΔE12 molecular lesion and determine if it could serve as a molecular target for corrective repair using RNA trans-splicing therapy. We show that both pediatric and adult B-lineage lymphoid malignancies are characterized by a very high incidence of the CD22ΔE12 genetic defect. We provide experimental evidence that the correction of the CD22ΔE12 genetic defect in human CD22ΔE12+ BPL cells using a rationally designed CD22 RNA trans-splicing molecule (RTM) caused a pronounced reduction of their clonogenicity. The RTM-mediated correction replaced the downstream mutation-rich segment of Intron 12 and remaining segments of the mutant CD22 pre-mRNA with wildtype CD22 Exons 10-14, thereby preventing the generation of the cis-spliced aberrant CD22ΔE12 product. The anti-leukemic activity of this RTM against BPL xenograft clones derived from CD22ΔE12+ leukemia patients provides the preclinical proof-of-concept that correcting the CD22ΔE12 defect with rationally designed CD22 RTMs may provide the foundation for therapeutic innovations that are needed for successful treatment of high-risk and relapsed BPL patients. PMID:25567759

Prevalence of Red-Green Color Vision Defects among Muslim Males and Females of Manipur, India

PubMed Central

SHAH, Ahsana; HUSSAIN, Ruqaiya; FAREED, Mohd; AFZAL, Mohammad

2013-01-01

Background: Color blindness is a common X-linked genetic disorder. However, most of color blinds remain undetected due to absence of proper screening. Our study was to determine the prevalence of red-green color vision defects among Manipuri Muslim males and females. The study could help in decreasing birth of children with this disorder as Muslims commonly perform consanguineous marriage among themselves. Methods: Unrelated individuals of both sexes (Male-1352, Female-1302) belonging to six different populations were randomly selected and screened for red-green color vision defects using the Ishihara (pseudo-isochromatic plates) test from the area of Imphal East and Imphal west districts of Manipur, which is a small hilly state, situated in the north eastern extreme corner of India sharing an international boundary with Myanmar (Burma). Results: About 8.73% of males and 1.69% of females were found to be color blind. Among six different populations studied the males of Meitei population shows the highest frequency i.e. 14.93% while Naga population shows the least frequency of 3.75%. Among females, Meitei population again shows the highest frequency of 2.5% and least frequency is shown by Mughal and Naga populations 0.00% as not a single female color blind was found. Conclusion: Present study shows higher prevalence rate of color blindness as compared to other reported rates of India. Deuteranomaly cases occur in higher percentage than other types of color blindness. The higher prevalence rate observed in Muslims may be due to the hidden effect of consanguineous marriages. PMID:23515069

Prevalence of Red-Green Color Vision Defects among Muslim Males and Females of Manipur, India.

PubMed

Shah, Ahsana; Hussain, Ruqaiya; Fareed, Mohd; Afzal, Mohammad

2013-01-01

Color blindness is a common X-linked genetic disorder. However, most of color blinds remain undetected due to absence of proper screening. Our study was to determine the prevalence of red-green color vision defects among Manipuri Muslim males and females. The study could help in decreasing birth of children with this disorder as Muslims commonly perform consanguineous marriage among themselves. Unrelated individuals of both sexes (Male-1352, Female-1302) belonging to six different populations were randomly selected and screened for red-green color vision defects using the Ishihara (pseudo-isochromatic plates) test from the area of Imphal East and Imphal west districts of Manipur, which is a small hilly state, situated in the north eastern extreme corner of India sharing an international boundary with Myanmar (Burma). About 8.73% of males and 1.69% of females were found to be color blind. Among six different populations studied the males of Meitei population shows the highest frequency i.e. 14.93% while Naga population shows the least frequency of 3.75%. Among females, Meitei population again shows the highest frequency of 2.5% and least frequency is shown by Mughal and Naga populations 0.00% as not a single female color blind was found. Present study shows higher prevalence rate of color blindness as compared to other reported rates of India. Deuteranomaly cases occur in higher percentage than other types of color blindness. The higher prevalence rate observed in Muslims may be due to the hidden effect of consanguineous marriages.

Microbial Gutta-Percha Degradation Shares Common Steps with Rubber Degradation by Nocardia nova SH22a

PubMed Central

Luo, Quan; Hiessl, Sebastian; Poehlein, Anja

2013-01-01

Nocardia nova SH22a, a bacterium capable of degrading gutta-percha (GP) and natural rubber (NR), was used to investigate the GP degradation mechanism and the relations between the GP and NR degradation pathways. For this strain, a protocol of electroporation was systematically optimized, and an efficiency of up to 4.3 × 107 CFU per μg of plasmid DNA was achieved. By applying this optimized protocol to N. nova SH22a, a Tn5096-based transposon mutagenesis library of this bacterium was constructed. Among about 12,000 apramycin-resistant transformants, we identified 76 stable mutants defective in GP or NR utilization. Whereas 10 mutants were specifically defective in GP utilization, the growth of the other 66 mutants was affected on both GP and NR. This indicated that the two degradation pathways are quite similar and share many common steps. The larger number of GP-degrading defective mutants could be explained in one of two ways: either (i) the GP pathway is more complex and harbors more specific steps or (ii) the steps for both pathways are almost identical, but in the case of GP degradation there are fewer enzymes involved in each step. The analysis of transposition loci and genetic studies on interesting genes confirmed the crucial role of an α-methylacyl-coenzyme A racemase in the degradation of both GP and NR. We also demonstrated the probable involvement of enzymes participating in oxidoreduction reactions, β-oxidation, and the synthesis of complex cell envelope lipids in the degradation of GP. PMID:23220954

Burden and impact of congenital syndromes and comorbidities among adults with congenital heart disease.

PubMed

Bracher, Isabelle; Padrutt, Maria; Bonassin, Francesca; Santos Lopes, Bruno; Gruner, Christiane; Stämpfli, Simon F; Oxenius, Angela; De Pasquale, Gabriella; Seeliger, Theresa; Lüscher, Thomas F; Attenhofer Jost, Christine; Greutmann, Matthias

2017-08-01

Our aim was to assess the overall burden of congenital syndromes and non-cardiac comorbidities among adults with congenital heart disease and to assess their impact on circumstances of living and outcomes. Within a cohort of 1725 adults with congenital heart defects (65% defects of moderate or great complexity) followed at a single tertiary care center, congenital syndromes and comorbidities were identified by chart review. Their association with arrhythmias, circumstances of living and survival was analyzed. Within the study cohort, 232 patients (13%) had a genetic syndrome, 51% at least one comorbidity and 23% ≥2 comorbidities. Most prevalent comorbidities were systemic arterial hypertension (11%), thyroid dysfunction (9%), psychiatric disorders (9%), neurologic disorders (7%), chronic lung disease (7%), and previous stroke (6%). In contrast to higher congenital heart defect complexity, the presence of comorbidities had no impact on living circumstances but patients with comorbidities were less likely to work full-time. Atrial arrhythmias were more common among patients with moderate/great disease complexity and those with comorbidities but were less common among patients with congenital syndromes (p<0.01 for all comparisons). Patients with ≥2 comorbidities had lower survival estimates compared to those with ≤1 comorbidity (p=0.013). Congenital syndromes and comorbidities are highly prevalent in adults with congenital heart disease followed at specialist centers and add to the overall complexity of care. The presence of these additional factors has an impact on living circumstances, is associated with arrhythmias and needs to be further explored as prognostic markers. Copyright © 2017 Elsevier B.V. All rights reserved.

Blood flow patterns underlie developmental heart defects

PubMed Central

Midgett, Madeline; Thornburg, Kent

2017-01-01

Although cardiac malformations at birth are typically associated with genetic anomalies, blood flow dynamics also play a crucial role in heart formation. However, the relationship between blood flow patterns in the early embryo and later cardiovascular malformation has not been determined. We used the chicken embryo model to quantify the extent to which anomalous blood flow patterns predict cardiac defects that resemble those in humans and found that restricting either the inflow to the heart or the outflow led to reproducible abnormalities with a dose-response type relationship between blood flow stimuli and the expression of cardiac phenotypes. Constricting the outflow tract by 10–35% led predominantly to ventricular septal defects, whereas constricting by 35–60% most often led to double outlet right ventricle. Ligation of the vitelline vein caused mostly pharyngeal arch artery malformations. We show that both cardiac inflow reduction and graded outflow constriction strongly influence the development of specific and persistent abnormal cardiac structure and function. Moreover, the hemodynamic-associated cardiac defects recapitulate those caused by genetic disorders. Thus our data demonstrate the importance of investigating embryonic blood flow conditions to understand the root causes of congenital heart disease as a prerequisite to future prevention and treatment. NEW & NOTEWORTHY Congenital heart defects result from genetic anomalies, teratogen exposure, and altered blood flow during embryonic development. We show here a novel “dose-response” type relationship between the level of blood flow alteration and manifestation of specific cardiac phenotypes. We speculate that abnormal blood flow may frequently underlie congenital heart defects. PMID:28062416

Identification of a novel PHEX mutation in a Chinese family with X-linked hypophosphatemic rickets using exome sequencing.

PubMed

Yuan, Lamei; Wu, Song; Xu, Hongbo; Xiao, Jingjing; Yang, Zhijian; Xia, Hong; Liu, An; Hu, Pengzhi; Lu, Anjie; Chen, Yulan; Xu, Fengping; Deng, Hao

2015-01-01

Familial hypophosphatemic rickets (HR), the most common inherited form of rickets, is a group of inherited renal phosphate wasting disorders characterized by growth retardation, rickets with bone deformities, osteomalacia, poor dental development, and hypophosphatemia. The purpose of this study was to identify the genetic defect responsible for familial HR in a four-generation Chinese Han pedigree by exome sequencing and Sanger sequencing. Clinical features include skeletal deformities, teeth abnormalities, hearing impairments and variable serum phosphate level in patients of this family. A novel deletion mutation, c.1553delT (p.F518Sfs*4), was identified in the X-linked phosphate regulating endopeptidase homolog gene (PHEX). The mutation is predicted to result in prematurely truncated and loss-of-function PHEX protein. Our data suggest that exome sequencing is a powerful tool to discover mutation(s) in HR, a disorder with genetic and clinical heterogeneity. The findings may also provide new insights into the cause and diagnosis of HR, and have implications for genetic counseling and clinical management.

Fruit flies and intellectual disability.

PubMed

Bolduc, François V; Tully, Tim

2009-01-01

Mental retardation--known more commonly nowadays as intellectual disability--is a severe neurological condition affecting up to 3% of the general population. As a result of the analysis of familial cases and recent advances in clinical genetic testing, great strides have been made in our understanding of the genetic etiologies of mental retardation. Nonetheless, no treatment is currently clinically available to patients suffering from intellectual disability. Several animal models have been used in the study of memory and cognition. Established paradigms in Drosophila have recently captured cognitive defects in fly mutants for orthologs of genes involved in human intellectual disability. We review here three protocols designed to understand the molecular genetic basis of learning and memory in Drosophila and the genes identified so far with relation to mental retardation. In addition, we explore the mental retardation genes for which evidence of neuronal dysfunction other than memory has been established in Drosophila. Finally, we summarize the findings in Drosophila for mental retardation genes for which no neuronal information is yet available. All in all, this review illustrates the impressive overlap between genes identified in human mental retardation and genes involved in physiological learning and memory.

Long QT syndrome and sudden unexpected infant death.

PubMed

Van Niekerk, Chantal; Van Deventer, Barbara Ströh; du Toit-Prinsloo, Lorraine

2017-09-01

Long QT syndrome (LQTS) is an inheritable primary electric disease of the heart characterised by abnormally long QT intervals and a propensity to develop atrial and ventricular tachyarrhythmias. It is caused by an inherited channelopathy responsible for sudden cardiac death in individuals with structurally normal hearts. Long QT syndrome can present early in life, and some studies suggest that it may be associated with up to 20% of sudden unexplained infant death (SUID), particularly when associated with external stressors such as asphyxia, which is commonly seen in many infant death scenes. With an understanding of the genetic defects, it has now been possible to retrospectively analyse samples from infants who have presented to forensic pathology services with a history of unexplained sudden death, which may, in turn, enable the implementation of preventative treatment for siblings previously not known to have pathogenic genetic variations. In this viewpoint article, we will discuss SUID, LQTS and postmortem genetic analysis. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2017. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

Epigenetic understanding of gene-environment interactions in psychiatric disorders: a new concept of clinical genetics

PubMed Central

2012-01-01

Epigenetics is a mechanism that regulates gene expression independently of the underlying DNA sequence, relying instead on the chemical modification of DNA and histone proteins. Although environmental and genetic factors were thought to be independently associated with disorders, several recent lines of evidence suggest that epigenetics bridges these two factors. Epigenetic gene regulation is essential for normal development, thus defects in epigenetics cause various rare congenital diseases. Because epigenetics is a reversible system that can be affected by various environmental factors, such as drugs, nutrition, and mental stress, the epigenetic disorders also include common diseases induced by environmental factors. In this review, we discuss the nature of epigenetic disorders, particularly psychiatric disorders, on the basis of recent findings: 1) susceptibility of the conditions to environmental factors, 2) treatment by taking advantage of their reversible nature, and 3) transgenerational inheritance of epigenetic changes, that is, acquired adaptive epigenetic changes that are passed on to offspring. These recently discovered aspects of epigenetics provide a new concept of clinical genetics. PMID:22414323

Association between ulcerative colitis and systemic lupus erythematosus: report of two cases.

PubMed

Koutroubakis, I E; Kritikos, H; Mouzas, I A; Spanoudakis, S M; Kapsoritakis, A N; Petinaki, E; Kouroumalis, E A; Manousos, O N

1998-05-01

Common aetiopathogenic factors may explain the association of ulcerative colitis with autoimmune disorders such as systemic lupus erythematosus. We report two cases of ulcerative colitis associated with idiopathic systemic lupus erythematosus: one patient who developed ulcerative colitis 11 years after having been diagnosed as a case of systemic lupus erythematosus and one case of simultaneous appearance of the two diseases. The lupus clinical manifestations were in neither case correlated with the treatment of ulcerative colitis. The association between ulcerative colitis and systemic lupus erythematosus is rare. Although a chance occurrence cannot be excluded it is possible that both conditions share some genetic or immunological defects.

Genetic changes associated with testicular cancer susceptibility.

PubMed

Pyle, Louise C; Nathanson, Katherine L

2016-10-01

Testicular germ cell tumor (TGCT) is a highly heritable cancer primarily affecting young white men. Genome-wide association studies (GWAS) have been particularly effective in identifying multiple common variants with strong contribution to TGCT risk. These loci identified through association studies have implicated multiple genes as associated with TGCT predisposition, many of which are unique among cancer types, and regulate processes such as pluripotency, sex specification, and microtubule assembly. Together these biologically plausible genes converge on pathways involved in male germ cell development and maturation, and suggest that perturbation of them confers susceptibility to TGCT, as a developmental defect of germ cell differentiation. Copyright © 2016 Elsevier Inc. All rights reserved.

[The role of fetal echocardiography in the prenatal diagnosis of aneuploidy based upon prenatally diagnosed patau syndrome fetuses (case analysis)].

PubMed

Janiak, Katarzyna; Kaczmarek, Piotr; Krasoń, Aneta; Nowicki, Grzegorz; Piotrowicz, Małgorzata; Respondek-Liberska, Maria

2002-07-01

Assessment of usefulness of the fetal echocardiography and genetic sonography in prenatal diagnosis trisomy 13 (retrospective analysis). Between 1994-1999 at the Department for Diagnosis of Congenital Malformation at the Institute of PPMH in 11 fetuses with Patau Syndrome ultrasound and echocardiography examination were performed. In our study the most of cases come from low risk of pregnant women. Fetal heart defect was the most common anomaly diagnosed prenatally in fetuses with Patau Syndrome (7/11), the second one were central nervous system anomalies (6/11) and genitourinary system anomalies (6/11).

[Orofacial closure defects: cleft lip and palate. A literature review].

PubMed

Díaz Casado, G H; Díaz Grávalos, G J

2013-01-01

Orofacial clefts are a common problem that can lead to significant healthcare use and costs, as well as suffering on the part of the affected individuals and families. There are several theories explaining their origin, but some of the findings are inconsistent. The most accepted theories involve a major genetic basis that could be modified by the presence of external agents. Understanding the underlying causes could help to prevent its occurrence, an area in which the family physician can play an important role. Copyright © 2012 Sociedad Española de Médicos de Atención Primaria (SEMERGEN). Publicado por Elsevier España. All rights reserved.

Developmental defects in zebrafish for classification of EGF pathway inhibitors

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pruvot, Benoist; Curé, Yoann; Djiotsa, Joachim

2014-01-15

One of the major challenges when testing drug candidates targeted at a specific pathway in whole animals is the discrimination between specific effects and unwanted, off-target effects. Here we used the zebrafish to define several developmental defects caused by impairment of Egf signaling, a major pathway of interest in tumor biology. We inactivated Egf signaling by genetically blocking Egf expression or using specific inhibitors of the Egf receptor function. We show that the combined occurrence of defects in cartilage formation, disturbance of blood flow in the trunk and a decrease of myelin basic protein expression represent good indicators for impairmentmore » of Egf signaling. Finally, we present a classification of known tyrosine kinase inhibitors according to their specificity for the Egf pathway. In conclusion, we show that developmental indicators can help to discriminate between specific effects on the target pathway from off-target effects in molecularly targeted drug screening experiments in whole animal systems. - Highlights: • We analyze the functions of Egf signaling on zebrafish development. • Genetic blocking of Egf expression causes cartilage, myelin and circulatory defects. • Chemical inhibition of Egf receptor function causes similar defects. • Developmental defects can reveal the specificity of Egf pathway inhibitors.« less

Incontinentia pigmenti

MedlinePlus

IP is caused by an X-linked dominant genetic defect that occurs on a gene known as IKBKG. Because the gene defect occurs on the X chromosome, the condition is most often seen in females. When it occurs in males, it is usually lethal.

Pax2 regulates a fadd-dependent molecular switch that drives tissue fusion during eye development.

PubMed

Viringipurampeer, Ishaq A; Ferreira, Todd; DeMaria, Shannon; Yoon, Jookyung J; Shan, Xianghong; Moosajee, Mariya; Gregory-Evans, Kevin; Ngai, John; Gregory-Evans, Cheryl Y

2012-05-15

Tissue fusion is an essential morphogenetic mechanism in development, playing a fundamental role in developing neural tube, palate and the optic fissure. Disruption of genes associated with the tissue fusion can lead to congenital malformations, such as spina bifida, cleft lip/palate and ocular coloboma. For instance, the Pax2 transcription factor is required for optic fissure closure, although the mechanism of Pax2 action leading to tissue fusion remains elusive. This lack of information defining how transcription factors drive tissue morphogenesis at the cellular level is hampering new treatments options. Through loss- and gain-of-function analysis, we now establish that pax2 in combination with vax2 directly regulate the fas-associated death domain (fadd) gene. In the presence of fadd, cell proliferation is restricted in the developing eye through a caspase-dependent pathway. However, the loss of fadd results in a proliferation defect and concomitant activation of the necroptosis pathway through RIP1/RIP3 activity, leading to an abnormal open fissure. Inhibition of RIP1 with the small molecule drug necrostatin-1 rescues the pax2 eye fusion defect, thereby overcoming the underlying genetic defect. Thus, fadd has an essential physiological function in protecting the developing optic fissure neuroepithelium from RIP3-dependent necroptosis. This study demonstrates the molecular hierarchies that regulate a cellular switch between proliferation and the apoptotic and necroptotic cell death pathways, which in combination drive tissue morphogenesis. Furthermore, our data suggest that future therapeutic strategies may be based on small molecule drugs that can bypass the gene defects causing common congenital tissue fusion defects.

Italian familial defective apolipoprotein B patients share a unique haplotype with other Caucasian patients.

PubMed

Cefalù, A B; Barbagallo, C M; Sesti, E; Caldarella, R; Polizzi, F; Marino, G; Noto, D; Rolleri, M; Travali, S; Scalisi, G; Notarbartolo, A; Corsini, A; Bertolini, S; Averna, M R

2001-09-01

Familial defective apolipoprotein (apo) B-100 together with familial hypercholesterolemia are the two common genetic conditions that cause hypercholesterolemia. Familial defective apolipoprotein B-100 is due to mutations around codon 3500 of the apo B gene. The most-characterized mutation is a G>A transition at nucleotide 10,708 that results in the substitution of arginine by glutamine at codon 3500 (Apo B Arg3500Gln). Two other mutations are caused by a C>T transition, one at nucleotide 10,800 (Apo B Arg3531Cys) and the other at nucleotide 10,707 (apo B Arg3500Trp). In the present study we describe three new Italian cases of familial defective apolipoprotein B-100 (Apo B Arg3500Gln), one from the Liguria region and two from Sicily, and the haplotype of the apo B gene co-segregating with the mutation. By screening two groups of probands, clinically diagnosed as having Familial Hypercholesterolemia (700 from mainland Italy and 305 from Sicily), the prevalence of familial defective apolipoprotein B-100 due to Arg3500Gln was found to be very low (0.28% and 0.65%, respectively). The Arg3531Cys mutation was not detected in any proband. In the three new families with Arg3500Gln mutation in the present study and in one previously described in Italy, the mutation was associated with a unique apo B haplotype, which is consistent with data previously reported for Caucasian patients [XbaI-, MspI+, EcoRI-, presence of the 5' signal peptide insertion (Ins) allele, and the 49-repeat allele of the 3'-VNTR].

Impaired embryonic development in glucose-6-phosphate dehydrogenase-deficient Caenorhabditis elegans due to abnormal redox homeostasis induced activation of calcium-independent phospholipase and alteration of glycerophospholipid metabolism.

PubMed

Chen, Tzu-Ling; Yang, Hung-Chi; Hung, Cheng-Yu; Ou, Meng-Hsin; Pan, Yi-Yun; Cheng, Mei-Ling; Stern, Arnold; Lo, Szecheng J; Chiu, Daniel Tsun-Yee

2017-01-12

Glucose-6-phosphate dehydrogenase (G6PD) deficiency is a commonly pervasive inherited disease in many parts of the world. The complete lack of G6PD activity in a mouse model causes embryonic lethality. The G6PD-deficient Caenorhabditis elegans model also shows embryonic death as indicated by a severe hatching defect. Although increased oxidative stress has been implicated in both cases as the underlying cause, the exact mechanism has not been clearly delineated. In this study with C. elegans, membrane-associated defects, including enhanced permeability, defective polarity and cytokinesis, were found in G6PD-deficient embryos. The membrane-associated abnormalities were accompanied by impaired eggshell structure as evidenced by a transmission electron microscopic study. Such loss of membrane structural integrity was associated with abnormal lipid composition as lipidomic analysis revealed that lysoglycerophospholipids were significantly increased in G6PD-deficient embryos. Abnormal glycerophospholipid metabolism leading to defective embryonic development could be attributed to the increased activity of calcium-independent phospholipase A 2 (iPLA) in G6PD-deficient embryos. This notion is further supported by the fact that the suppression of multiple iPLAs by genetic manipulation partially rescued the embryonic defects in G6PD-deficient embryos. In addition, G6PD deficiency induced disruption of redox balance as manifested by diminished NADPH and elevated lipid peroxidation in embryos. Taken together, disrupted lipid metabolism due to abnormal redox homeostasis is a major factor contributing to abnormal embryonic development in G6PD-deficient C. elegans.

Suppression of AKT phosphorylation restores rapamycin-based synthetic lethality in SMAD4-defective pancreatic cancer cells.

PubMed

Le Gendre, Onica; Sookdeo, Ayisha; Duliepre, Stephie-Anne; Utter, Matthew; Frias, Maria; Foster, David A

2013-05-01

mTOR has been implicated in survival signals for many human cancers. Rapamycin and TGF-β synergistically induce G1 cell-cycle arrest in several cell lines with intact TGF-β signaling pathway, which protects cells from the apoptotic effects of rapamycin during S-phase of the cell cycle. Thus, rapamycin is cytostatic in the presence of serum/TGF-β and cytotoxic in the absence of serum. However, if TGF-β signaling is defective, rapamycin induced apoptosis in both the presence and absence of serum/TGF-β in colon and breast cancer cell lines. Because genetic dysregulation of TGF-β signaling is commonly observed in pancreatic cancers-with defects in the Smad4 gene being most prevalent, we hypothesized that pancreatic cancers would display a synthetic lethality to rapamycin in the presence of serum/TGF-β. We report here that Smad4-deficient pancreatic cancer cells are killed by rapamycin in the absence of serum; however, in the presence of serum, we did not observe the predicted synthetic lethality with rapamycin. Rapamycin also induced elevated phosphorylation of the survival kinase Akt at Ser473. Suppression of rapamycin-induced Akt phosphorylation restored rapamycin sensitivity in Smad4-null, but not Smad4 wild-type pancreatic cancer cells. This study shows that the synthetic lethality to rapamycin in pancreatic cancers with defective TGF-β signaling is masked by rapamycin-induced increases in Akt phosphorylation. The implication is that a combination of approaches that suppress both Akt phosphorylation and mTOR could be effective in targeting pancreatic cancers with defective TGF-β signaling. ©2013 AACR.

Prenatal Ablation of Nicotinic Receptor alpha7 Cell Lineages Produces Lumbosacral Spina Bifida the Severity of Which is Modified by Choline and Nicotine Exposure

PubMed Central

Rogers, Scott W; Tvrdik, Petr; Capecchi, Mario R; Gahring, Lorise C

2012-01-01

Lumbosacral spina bifida is a common debilitating birth defect whose multiple causes are poorly understood. Here, we provide the first genetic delineation of cholinergic nicotinic receptor alpha7 (Chrna7) expression and link the ablation of the Chrna7 cell lineage to this condition in the mouse. Using homologous recombination, an IRES-Cre bi-cistronic cassette was introduced into the 3′ noncoding region of Chrna7 (Chrna7:Cre) for identifying cell lineages expressing this gene. This lineage first appears at embryonic day E9.0 in rhombomeres 3 and 5 of the neural tube and extends to cell subsets in most tissues by E14.5. Ablation of the Chrna7:Cre cell lineage in embryos from crosses with conditionally expressed attenuated diphtheria toxin results in precise developmental defects including omphalocele (89%) and open spina bifida (SB; 80%). We hypothesized that like humans, this defect would be modified by environmental compounds not only folic acid or choline but also nicotine. Prenatal chronic oral nicotine administration substantially worsened the defect to often include the rostral neural tube. In contrast, supplementation of the maternal diet with 2% choline decreased SB prevalence to 38% and dramatically reduced the defect severity. Folic acid supplementation only trended towards a reduced SB frequency. The omphalocele was unaffected by these interventions. These studies identify the Chrna7 cell lineage as participating in posterior neuropore closure and present a novel model of lower SB that can be substantially modified by the prenatal environment. © 2012 Wiley Periodicals, Inc. PMID:22473653

Congenital and Genetic Disease in Domestic Animals

ERIC Educational Resources Information Center

Mulvihill, John J.

1972-01-01

Reviews observations on domestic animals that have led to the identification of environmental teratogens, and have provided insight into the pathogenesis of congenital defects and genetic diseases in man." (Author/AL)

Pharmacological Inhibition of Poly(ADP-Ribose) Polymerases Improves Fitness and Mitochondrial Function in Skeletal Muscle

PubMed Central

Pirinen, Eija; Canto, Carles; Jo, Young-Suk; Morato, Laia; Zhang, Hongbo; Menzies, Keir; Williams, Evan G.; Mouchiroud, Laurent; Moullan, Norman; Hagberg, Carolina; Li, Wei; Timmers, Silvie; Imhof, Ralph; Verbeek, Jef; Pujol, Aurora; van Loon, Barbara; Viscomi, Carlo; Zeviani, Massimo; Schrauwen, Patrick; Sauve, Anthony; Schoonjans, Kristina; Auwerx, Johan

2014-01-01

SUMMARY We previously demonstrated that the deletion of the poly(ADP-ribose)polymerase (Parp)-1 gene in mice enhances oxidative metabolism, thereby protecting against diet-induced obesity. However, the therapeutic use of PARP inhibitors to enhance mitochondrial function remains to be explored. Here, we show tight negative correlation between Parp-1 expression and energy expenditure in heterogeneous mouse populations, indicating that variations in PARP-1 activity have an impact on metabolic homeostasis. Notably, these genetic correlations can be translated into pharmacological applications. Long-term treatment with PARP inhibitors enhances fitness in mice by increasing the abundance of mitochondrial respiratory complexes and boosting mitochondrial respiratory capacity. Furthermore, PARP inhibitors reverse mitochondrial defects in primary myotubes of obese humans and attenuate genetic defects of mitochondrial metabolism in human fibroblasts and C. elegans. Overall, our work validates in worm, mouse and human models that PARP inhibition may be used to treat both genetic and acquired muscle dysfunction linked to defective mitochondrial function. PMID:24814482

Defects in Mitochondrial DNA Replication and Human Disease

PubMed Central

Copeland, William C.

2011-01-01

Mitochondrial DNA (mtDNA) is replicated by the DNA polymerase γ in concert with accessory proteins such as the mitochondrial DNA helicase, single stranded DNA binding protein, topoisomerase, and initiating factors. Nucleotide precursors for mtDNA replication arise from the mitochondrial salvage pathway originating from transport of nucleosides, or alternatively from cytoplasmic reduction of ribonucleotides. Defects in mtDNA replication or nucleotide metabolism can cause mitochondrial genetic diseases due to mtDNA deletions, point mutations, or depletion which ultimately cause loss of oxidative phosphorylation. These genetic diseases include mtDNA depletion syndromes (MDS) such as Alpers or early infantile hepatocerebral syndromes, and mtDNA deletion disorders, such as progressive external ophthalmoplegia (PEO), ataxia-neuropathy, or mitochondrial neurogastrointestinal encephalomyopathy (MNGIE). This review focuses on our current knowledge of genetic defects of mtDNA replication (POLG, POLG2, C10orf2) and nucleotide metabolism (TYMP, TK2, DGOUK, and RRM2B) that cause instability of mtDNA and mitochondrial disease. PMID:22176657

The mitochondrial import gene tomm22 is specifically required for hepatocyte survival and provides a liver regeneration model

PubMed Central

Curado, Silvia; Ober, Elke A.; Walsh, Susan; Cortes-Hernandez, Paulina; Verkade, Heather; Koehler, Carla M.; Stainier, Didier Y. R.

2010-01-01

SUMMARY Understanding liver development should lead to greater insights into liver diseases and improve therapeutic strategies. In a forward genetic screen for genes regulating liver development in zebrafish, we identified a mutant – oliver – that exhibits liver-specific defects. In oliver mutants, the liver is specified, bile ducts form and hepatocytes differentiate. However, the hepatocytes die shortly after their differentiation, and thus the resulting mutant liver consists mainly of biliary tissue. We identified a mutation in the gene encoding translocase of the outer mitochondrial membrane 22 (Tomm22) as responsible for this phenotype. Mutations in tomm genes have been associated with mitochondrial dysfunction, but most studies on the effect of defective mitochondrial protein translocation have been carried out in cultured cells or unicellular organisms. Therefore, the tomm22 mutant represents an important vertebrate genetic model to study mitochondrial biology and hepatic mitochondrial diseases. We further found that the temporary knockdown of Tomm22 levels by morpholino antisense oligonucleotides causes a specific hepatocyte degeneration phenotype that is reversible: new hepatocytes repopulate the liver as Tomm22 recovers to wild-type levels. The specificity and reversibility of hepatocyte ablation after temporary knockdown of Tomm22 provides an additional model to study liver regeneration, under conditions where most hepatocytes have died. We used this regeneration model to analyze the signaling commonalities between hepatocyte development and regeneration. PMID:20483998

Major Contribution of Genomic Copy Number Variation in Syndromic Congenital Heart Disease: The Use of MLPA as the First Genetic Test.

PubMed

Monteiro, Rejane A C; de Freitas, Mariana L; Vianna, Gabrielle S; de Oliveira, Valdirene T; Pietra, Rafaella X; Ferreira, Luana C A; Rocha, Patrícia P O; da S Gonçalves, Michele; da C César, Giovana; de S Lima, Joziele; Medeiros, Paula F V; Mazzeu, Juliana F; Jehee, Fernanda S

2017-08-01

Congenital heart disease (CHD) is the most common congenital disorder among live births. When associated with extracardiac abnormalities, it is characterized as a syndromic heart disease (syndromic CHD) and corresponds to 25% of all liveborn infants with a heart defect. The etiology in about 65% of the cases still remains unknown, and in about 35% of the patients, it is associated with genetic factors. In the present study, MLPA and SNP-array techniques were used to investigate a group of 47 patients with syndromic CHD. In total, 16 defects (34%) were identified, of which 12 (25.5%) were classified as pathogenic or probably pathogenic. The most frequent abnormalities were 22q11.2 deletion (22q11.2 deletion syndrome) and 7q11.23 deletion (Williams-Beuren syndrome). We also show that rarer malformations may be associated with syndromic CHD, such as 14q32.33 deletion as well as 17q25.3, 15q11.2 (BP1-BP2), 22q13.31, and 12p13.31 ( SLC2A3 ) duplications. The present study demonstrates that CNVs are important causal factors and should be studied in patients with syndromic CHD. Furthermore, the use of MLPA as a first screening test was appropriate, as this less expensive technology detected 11 of the 12 pathogenic abnormalities (91.6%).

Neural Tube Defects

PubMed Central

Greene, Nicholas D.E.; Copp, Andrew J.

2015-01-01

Neural tube defects (NTDs), including spina bifida and anencephaly, are severe birth defects of the central nervous system that originate during embryonic development when the neural tube fails to close completely. Human NTDs are multifactorial, with contributions from both genetic and environmental factors. The genetic basis is not yet well understood, but several nongenetic risk factors have been identified as have possibilities for prevention by maternal folic acid supplementation. Mechanisms underlying neural tube closure and NTDs may be informed by experimental models, which have revealed numerous genes whose abnormal function causes NTDs and have provided details of critical cellular and morphological events whose regulation is essential for closure. Such models also provide an opportunity to investigate potential risk factors and to develop novel preventive therapies. PMID:25032496

The Huntington disease locus is most likely within 325 kilobases of the chromosome 4p telomere

DOE Office of Scientific and Technical Information (OSTI.GOV)

Doggett, N.A.; Cheng, J.F.; Smith, C.L.

1989-12-01

The genetic defect responsible for Huntington disease was originally localized near the tip of the short arm of chromosome 4 by genetic linkage to the locus D4S10. Several markers closer to Huntington disease have since been isolated, but these all appear to be proximal to the defect. A physical map that extends from the most distal of these loci, D4S90, to the telomere of chromosome 4 was constructed. This map identifies at least two CpG islands as markers for Huntington disease candidate genes and places the most likely location of the Huntington disease defect remarkably close (within 325 kilobases) tomore » the telomere.« less

Analysis of the concept of informed consent concerning the use of genetic material according to the European Convention on Bioethics and in other solutionsm - Propositions for broad consent for future genetic research from the point of view of the activity of the Biobank.

PubMed

Patryn, Rafał; Sak, Jarosław

2017-09-21

The aim of the article is a critical presentation of the typology of consents included in the European Convention on Bioethics and in other formal solutions concerning the gathering of genetic material in institutions called Biobanks. Existing types of Acts of Consent are inaccurate in their scope and possess insufficient information regarding the gathering of genetic material (application, usage, processing) and their final (future and diverse) use. Lack of precise legal regulations on the broad future use of genetic material may result in various formal problems relating both to research participants as well as those commissioning the research. Ultimately, it may lead to various complications with the appropriate legal interpretation of consent and possible claims on behalf of the donors. The presented proposition of consent with a terminal premise is to be applied eventually to legal and formal aspects of the collecting of genetic material. It is a possible solution which would clarify the issue of informed consent, and may be implemented in the regulations of the Convention as well as constitute a self-contained legislative solution to this matter. For example, Polish law in its current form, without the ratification of the Bioethical Convention, allows the collecting of material for genetic testing for determination of the risk of genetic defects in common genetic material from people who are planning to have a child.

Correlation of rare coding variants in the gene encoding human glucokinase regulatory protein with phenotypic, cellular, and kinetic outcomes.

PubMed

Rees, Matthew G; Ng, David; Ruppert, Sarah; Turner, Clesson; Beer, Nicola L; Swift, Amy J; Morken, Mario A; Below, Jennifer E; Blech, Ilana; Mullikin, James C; McCarthy, Mark I; Biesecker, Leslie G; Gloyn, Anna L; Collins, Francis S

2012-01-01

Defining the genetic contribution of rare variants to common diseases is a major basic and clinical science challenge that could offer new insights into disease etiology and provide potential for directed gene- and pathway-based prevention and treatment. Common and rare nonsynonymous variants in the GCKR gene are associated with alterations in metabolic traits, most notably serum triglyceride levels. GCKR encodes glucokinase regulatory protein (GKRP), a predominantly nuclear protein that inhibits hepatic glucokinase (GCK) and plays a critical role in glucose homeostasis. The mode of action of rare GCKR variants remains unexplored. We identified 19 nonsynonymous GCKR variants among 800 individuals from the ClinSeq medical sequencing project. Excluding the previously described common missense variant p.Pro446Leu, all variants were rare in the cohort. Accordingly, we functionally characterized all variants to evaluate their potential phenotypic effects. Defects were observed for the majority of the rare variants after assessment of cellular localization, ability to interact with GCK, and kinetic activity of the encoded proteins. Comparing the individuals with functional rare variants to those without such variants showed associations with lipid phenotypes. Our findings suggest that, while nonsynonymous GCKR variants, excluding p.Pro446Leu, are rare in individuals of mixed European descent, the majority do affect protein function. In sum, this study utilizes computational, cell biological, and biochemical methods to present a model for interpreting the clinical significance of rare genetic variants in common disease.

Krabbe disease

MedlinePlus

... the amount of protein in cerebrospinal fluid (CSF) Genetic testing MRI of the head Nerve conduction velocity Testing for the GALC gene defect Treatment There is no specific ... Genetics Home Reference -- ghr.nlm.nih.gov/condition/krabbe- ...

The clinical maze of mitochondrial neurology

PubMed Central

DiMauro, Salvatore; Schon, Eric A.; Carelli, Valerio; Hirano, Michio

2014-01-01

Mitochondrial diseases involve the respiratory chain, which is under the dual control of nuclear and mitochondrial DNA (mtDNA). The complexity of mitochondrial genetics provides one explanation for the clinical heterogeneity of mitochondrial diseases, but our understanding of disease pathogenesis remains limited. Classification of Mendelian mitochondrial encephalomyopathies has been laborious, but whole-exome sequencing studies have revealed unexpected molecular aetiologies for both typical and atypical mitochondrial disease phenotypes. Mendelian mitochondrial defects can affect five components of mitochondrial biology: subunits of respiratory chain complexes (direct hits); mitochondrial assembly proteins; mtDNA translation; phospholipid composition of the inner mitochondrial membrane; or mitochondrial dynamics. A sixth category—defects of mtDNA maintenance—combines features of Mendelian and mitochondrial genetics. Genetic defects in mitochondrial dynamics are especially important in neurology as they cause optic atrophy, hereditary spastic paraplegia, and Charcot–Marie–Tooth disease. Therapy is inadequate and mostly palliative, but promising new avenues are being identified. Here, we review current knowledge on the genetics and pathogenesis of the six categories of mitochondrial disorders outlined above, focusing on their salient clinical manifestations and highlighting novel clinical entities. An outline of diagnostic clues for the various forms of mitochondrial disease, as well as potential therapeutic strategies, is also discussed. PMID:23835535

Genetic short stature.

PubMed

Grunauer, Michelle; Jorge, Alexander A L

2018-02-01

Adult height and growth patterns are largely genetically programmed. Studies in twins have indicated that the heritability of height is high (>80%), suggesting that genetic variation is the main determinant of stature. Height exhibits a normal (Gaussian) distribution according to sex, age, and ancestry. Short stature is usually defined as a height which is 2 standard deviations (S.D.) less than the mean height of a specific population. This definition includes 2.3% of the population and usually includes healthy individuals. In this group of short stature non-syndromic conditions, the genetic influence occurs polygenically or oligogenically. As a rule, each common genetic variant accounts for a small effect (1mm) on individual height variation. Recently, several studies demonstrated that some rare variants can cause greater effect on height, without causing a syndromic condition. In more extreme cases, height SDS below 2.5 or 3 (which would comprise approximately 0.6 and 0.1% of the population, respectively) is frequently associated with syndromic conditions and are usually caused by a monogenic defect. More than 1,000 inherited/genetic diseases have growth disorder as an important phenotype. These conditions are usually responsible for syndromic short stature. In the coming years, we expect to discover several genetic causes of short stature, thereby explaining the phenotype of what we currently classify as short stature of unknown cause. These discoveries will have a profound impact on the follow-up and treatment of these children. Copyright © 2017 Elsevier Ltd. All rights reserved.

Feature selection for neural network based defect classification of ceramic components using high frequency ultrasound.

PubMed

Kesharaju, Manasa; Nagarajah, Romesh

2015-09-01

The motivation for this research stems from a need for providing a non-destructive testing method capable of detecting and locating any defects and microstructural variations within armour ceramic components before issuing them to the soldiers who rely on them for their survival. The development of an automated ultrasonic inspection based classification system would make possible the checking of each ceramic component and immediately alert the operator about the presence of defects. Generally, in many classification problems a choice of features or dimensionality reduction is significant and simultaneously very difficult, as a substantial computational effort is required to evaluate possible feature subsets. In this research, a combination of artificial neural networks and genetic algorithms are used to optimize the feature subset used in classification of various defects in reaction-sintered silicon carbide ceramic components. Initially wavelet based feature extraction is implemented from the region of interest. An Artificial Neural Network classifier is employed to evaluate the performance of these features. Genetic Algorithm based feature selection is performed. Principal Component Analysis is a popular technique used for feature selection and is compared with the genetic algorithm based technique in terms of classification accuracy and selection of optimal number of features. The experimental results confirm that features identified by Principal Component Analysis lead to improved performance in terms of classification percentage with 96% than Genetic algorithm with 94%. Copyright © 2015 Elsevier B.V. All rights reserved.

Changes in B cell immunophenotype in common variable immunodeficiency: cause or effect – is bronchiectasis indicative of undiagnosed immunodeficiency?

PubMed Central

Bright, P; Grigoriadou, S; Kamperidis, P; Buckland, M; Hickey, A; Longhurst, H J

2013-01-01

Common variable immunodeficiency (CVID) is the most common severe primary immunodeficiency, but the pathology of this condition is poorly understood. CVID involves a defect in the production of immunoglobulin from B cells, with a subsequent predisposition to infections. Approximately 10–20% of cases are inherited, but even in families with a genetic defect the penetrance is far from complete. A classification system for CVID has been suggested (EUROclass) based on B cell immunophenotyping, but it has not been shown that altered B cell immunophenotype is not a consequence of the complications and treatment of CVID. This study compares the EUROclass B cell immunophenotype of CVID patients (n = 30) with suitable disease controls with bronchiectasis (n = 11), granulomatous disease (Crohn's disease) (n = 9) and neurological patients on immunoglobulin treatment (n = 6). The results of this study correlate with previous literature, that alterations in B cell immunophenotype are associated strongly with CVID. Interestingly, three of the 11 bronchiectasis patients without known immunodeficiency had an altered B cell immunophenotype, suggesting the possibility of undiagnosed immunodeficiency, or that bronchiectasis may cause a secondary alteration in B cell immunophenotype. This study showed a significant difference in B cell immunophenotype between CVID patients compared to disease control groups of granulomatous disease and immunoglobulin treatment. This suggests that granulomatous disease (in Crohn's disease) and immunoglobulin treatment (for chronic neurological conditions) are not causal of an altered B cell immunophenotype in these control populations. PMID:23286946

Genetics Home Reference: primary carnitine deficiency

MedlinePlus

... 1 link) NIH Office of Dietary Supplements: Carnitine Educational Resources (5 links) Disease InfoSearch: Renal carnitine transport defect Orphanet: Systemic primary carnitine deficiency Screening, Technology, and Research in Genetics The Linus Pauling Institute: ...

Genetics Home Reference: Simpson-Golabi-Behmel syndrome

MedlinePlus

... Wilms tumor and a cancerous tumor called a neuroblastoma that arises from developing nerve cells. Related Information ... Heart Defects Health Topic: Craniofacial Abnormalities Health Topic: Neuroblastoma Health Topic: Wilms Tumor Genetic and Rare Diseases ...

21 CFR 1003.2 - Defect in an electronic product.

Code of Federal Regulations, 2014 CFR

2014-04-01

... genetic injury, to any person, or (2) It fails to conform to its design specifications relating to... injury, including genetic injury to any person; or (3) Fails to accomplish the intended purpose. ...

21 CFR 1003.2 - Defect in an electronic product.

Code of Federal Regulations, 2013 CFR

2013-04-01

... genetic injury, to any person, or (2) It fails to conform to its design specifications relating to... injury, including genetic injury to any person; or (3) Fails to accomplish the intended purpose. ...

Genetics Home Reference: MPV17-related hepatocerebral mitochondrial DNA depletion syndrome

MedlinePlus

... Genetic Testing Registry: Navajo neurohepatopathy Other Diagnosis and Management Resources (2 links) GeneReview: MPV17-Related Hepatocerebral Mitochondrial DNA Maintenance Defect The United Mitochondrial Disease Foundation: Treatments and ...

Nutrition Update, 1978.

ERIC Educational Resources Information Center

Weininger, Jean; Briggs, George M.

1978-01-01

Reviews current nutrition research areas with important practical applications. Topics include hypertension, preventable birth defects, phenylketonuria and genetic diseases, new molecular genetics techniques, and saccharin and sweetners. Entries are brief and a 65-reference list is given. (MA)

Genetics Home Reference: spina bifida

MedlinePlus

... PubMed or Free article on PubMed Central Bassuk AG, Kibar Z. Genetic basis of neural tube defects. ... qualified healthcare professional . About Selection Criteria for Links Data Files & API Site Map Subscribe Customer Support USA. ...

Genetics Home Reference: anencephaly

MedlinePlus

... PubMed or Free article on PubMed Central Bassuk AG, Kibar Z. Genetic basis of neural tube defects. ... qualified healthcare professional . About Selection Criteria for Links Data Files & API Site Map Subscribe Customer Support USA. ...

Pharmacogenetic aspects of drug-induced torsade de pointes: potential tool for improving clinical drug development and prescribing.

PubMed

Shah, Rashmi R

2004-01-01

Drug-induced torsade de pointes (TdP) has proved to be a significant iatro-genic cause of morbidity and mortality and a major reason for the withdrawal of a number of drugs from the market in recent times. Enzymes that metabolise many of these drugs and the potassium channels that are responsible for cardiac repolarisation display genetic polymorphisms. Anecdotal reports have suggested that in many cases of drug-induced TdP, there may be a concealed genetic defect of either these enzymes or the potassium channels, giving rise to either high plasma drug concentrations or diminished cardiac repolarisation reserve, respectively. The presence of either of these genetic defects may predispose a patient to TdP, a potentially fatal adverse reaction, even at therapeutic dosages of QT-prolonging drugs and in the absence of other risk factors. Advances in pharmacogenetics of drug metabolising enzymes and pharmacological targets, together with the prospects of rapid and inexpensive genotyping procedures, promise to individualise and improve the benefit/risk ratio of therapy with drugs that have the potential to cause TdP. The qualitative and the quantitative contributions of these genetic defects in clinical cases of TdP are unclear because not all of the patients with TdP are routinely genotyped and some relevant genetic mutations still remain to be discovered. There are regulatory guidelines that recommend strategies aimed at uncovering the risk of TdP associated with new chemical entities during their development. There are also a number of guidelines that recommend integrating pharmacogenetics in this process. This paper proposes a strategy for integrating pharmacogenetics into drug development programmes to optimise association studies correlating genetic traits and endpoints of clinical interest, namely failure of efficacy or development of repolarisation abnormalities. Until pharmacogenetics is carefully integrated into all phases of development of QT-prolonging drugs and large-scale studies are undertaken during their post-marketing use to determine the genetic components involved in induction of TdP, routine genotyping of patients remains unrealistic. Even without this pharmacogenetic data, the clinical risk of TdP can already be greatly minimised. Clinically, a substantial proportion of cases of TdP are due to the use of either high or usual dosages of drugs with potential to cause TdP in the presence of factors that inhibit drug metabolism. Therefore, choosing the lowest effective dose and identifying patients with these non-genetic risk factors are important means of minimising the risk of TdP. In view of the common secondary pharmacology shared by these drugs, a standard set of contraindications and warnings have evolved over the last decade. These include factors responsible for pharmacokinetic or pharmacodynamic drug interactions. Among the latter, the more important ones are bradycardia, electrolyte imbalance, cardiac disease and co-administration of two or more QT-prolonging drugs. In principle, if large scale prospective studies can demonstrate a substantial genetic component, pharmacogenetically driven prescribing ought to reduce the risk further. However, any potential benefits of pharmacogenetics will be squandered without any reduction in the clinical risk of TdP if physicians do not follow prescribing and monitoring recommendations.

Diversity of genetic events associated with MLH1 promoter methylation in Lynch syndrome families with heritable constitutional epimutation.

PubMed

Leclerc, Julie; Flament, Cathy; Lovecchio, Tonio; Delattre, Lucie; Ait Yahya, Emilie; Baert-Desurmont, Stéphanie; Burnichon, Nelly; Bronner, Myriam; Cabaret, Odile; Lejeune, Sophie; Guimbaud, Rosine; Morin, Gilles; Mauillon, Jacques; Jonveaux, Philippe; Laurent-Puig, Pierre; Frébourg, Thierry; Porchet, Nicole; Buisine, Marie-Pierre

2018-04-12

PurposeConstitutional epimutations are an alternative to genetic mutations in the etiology of genetic diseases. Some of these epimutations, termed secondary, correspond to the epigenetic effects of cis-acting genetic defects transmitted to the offspring following a Mendelian inheritance pattern. In Lynch syndrome, a few families with such apparently heritable MLH1 epimutations have been reported so far.MethodsWe designed a long-range polymerase chain reaction next-generation sequencing strategy to screen MLH1 entire gene and applied it to 4 French families with heritable epimutations and 10 additional patients with no proven transmission of their epimutations.ResultsThis strategy successfully detected the insertion of an Alu element in MLH1 coding sequence in one family. Two previously unreported MLH1 variants were also identified in other epimutation carriers: a nucleotide substitution within intron 1 and a single-nucleotide deletion in the 5'-UTR. Detection of a partial MLH1 duplication in another family required multiplex ligation-dependent probe amplification technology. We demonstrated the segregation of these variants with MLH1 methylation and studied the functional consequences of these defects on transcription.ConclusionThis is the largest cohort of patients with MLH1 secondary epimutations associated with a broad spectrum of genetic defects. This study provides further insight into the complexity of molecular mechanisms leading to secondary epimutations.GENETICS in MEDICINE advance online publication, 12 April 2018; doi:10.1038/gim.2018.47.

The Congenital Heart Disease Genetic Network Study: rationale, design, and early results.

PubMed

Gelb, Bruce; Brueckner, Martina; Chung, Wendy; Goldmuntz, Elizabeth; Kaltman, Jonathan; Kaski, Juan Pablo; Kim, Richard; Kline, Jennie; Mercer-Rosa, Laura; Porter, George; Roberts, Amy; Rosenberg, Ellen; Seiden, Howard; Seidman, Christine; Sleeper, Lynn; Tennstedt, Sharon; Kaltman, Jonathan; Schramm, Charlene; Burns, Kristin; Pearson, Gail; Rosenberg, Ellen

2013-02-15

Congenital heart defects (CHD) are the leading cause of infant mortality among birth defects, and later morbidities and premature mortality remain problematic. Although genetic factors contribute significantly to cause CHD, specific genetic lesions are unknown for most patients. The National Heart, Lung, and Blood Institute-funded Pediatric Cardiac Genomics Consortium established the Congenital Heart Disease Genetic Network Study to investigate relationships between genetic factors, clinical features, and outcomes in CHD. The Pediatric Cardiac Genomics Consortium comprises 6 main and 4 satellite sites at which subjects are recruited, and medical data and biospecimens (blood, saliva, cardiovascular tissue) are collected. Core infrastructure includes an administrative/data-coordinating center, biorepository, data hub, and core laboratories (genotyping, whole-exome sequencing, candidate gene evaluation, and variant confirmation). Eligibility includes all forms of CHD. Annual follow-up is obtained for probands <1-year-old. Parents are enrolled whenever available. Enrollment from December 2010 to June 2012 comprised 3772 probands. One or both parents were enrolled for 72% of probands. Proband median age is 5.5 years. The one third enrolled at age <1 year are contacted annually for follow-up information. The distribution of CHD favors more complex lesions. Approximately, 11% of probands have a genetic diagnosis. Adequate DNA is available from 97% and 91% of blood and saliva samples, respectively. Genomic analyses of probands with heterotaxy, atrial septal defects, conotruncal, and left ventricular outflow tract obstructive lesions are underway. The scientific community's use of Pediatric Cardiac Genomics Consortium resources is welcome.

The Congenital Heart Disease Genetic Network Study

PubMed Central

2013-01-01

Congenital heart defects (CHD) are the leading cause of infant mortality among birth defects, and later morbidities and premature mortality remain problematic. Although genetic factors contribute significantly to cause CHD, specific genetic lesions are unknown for most patients. The National Heart, Lung, and Blood Institute-funded Pediatric Cardiac Genomics Consortium established the Congenital Heart Disease Genetic Network Study to investigate relationships between genetic factors, clinical features, and outcomes in CHD. The Pediatric Cardiac Genomics Consortium comprises 6 main and 4 satellite sites at which subjects are recruited, and medical data and biospecimens (blood, saliva, cardiovascular tissue) are collected. Core infrastructure includes an administrative/data-coordinating center, biorepository, data hub, and core laboratories (genotyping, whole-exome sequencing, candidate gene evaluation, and variant confirmation). Eligibility includes all forms of CHD. Annual follow-up is obtained for probands <1-year-old. Parents are enrolled whenever available. Enrollment from December 2010 to June 2012 comprised 3772 probands. One or both parents were enrolled for 72% of probands. Proband median age is 5.5 years. The one third enrolled at age <1 year are contacted annually for follow-up information. The distribution of CHD favors more complex lesions. Approximately, 11% of probands have a genetic diagnosis. Adequate DNA is available from 97% and 91% of blood and saliva samples, respectively. Genomic analyses of probands with heterotaxy, atrial septal defects, conotruncal, and left ventricular outflow tract obstructive lesions are underway. The scientific community’s use of Pediatric Cardiac Genomics Consortium resources is welcome. PMID:23410879

Genetic Screening for OPA1 and OPA3 Mutations in Patients with Suspected Inherited Optic Neuropathies

PubMed Central

Yu-Wai-Man, Patrick; Shankar, Suma P.; Biousse, Valérie; Miller, Neil R.; Bean, Lora J.H.; Coffee, Bradford; Hegde, Madhuri; Newman, Nancy J.

2010-01-01

Purpose Autosomal-dominant optic atrophy (DOA) is one of the most common inherited optic neuropathies, and it is genetically heterogeneous, with mutations in both OPA1 and OPA3 known to cause disease. About 60% of cases harbor OPA1 mutations, whereas OPA3 mutations have only been reported in two pedigrees with DOA and premature cataracts. The aim of this study was to determine the yield of OPA1 and OPA3 screening in a cohort of presumed DOA cases referred to a tertiary diagnostic laboratory. Design Retrospective case series. Participants One hundred and eighty-eight probands with bilateral optic atrophy referred for molecular genetic investigations at a tertiary diagnostic facility: 38 patients with an autosomal-dominant pattern of inheritance and 150 sporadic cases. Methods OPA1 and OPA3 genetic testing was initially performed using PCR-based sequencing methods. The presence of large-scale OPA1 and OPA3 genomic rearrangements was further assessed with a targeted comparative genomic hybridization (CGH) microarray platform. The three primary Leber hereditary optic neuropathy (LHON) mutations, m.3460G>A, m.11778G>A, and m.14484T>C, were also screened in all patients. Main Outcome Measures The proportion of patients with OPA1 and OPA3 pathogenic mutations. The clinical profile observed in molecularly confirmed DOA cases. Results We found 21 different OPA1 mutations in 27 of the 188 (14.4%) probands screened. The mutations included six novel pathogenic variants and the first reported OPA1 initiation codon mutation at c.1A>T. An OPA1 missense mutation, c.239A>G (p.Y80C), was identified in an 11-year-old African-American girl with optic atrophy and peripheral sensori-motor neuropathy in her lower limbs. The OPA1 detection rate was significantly higher among individuals with a positive family history of visual failure (50.0%) compared with sporadic cases (5.3%). The primary LHON screen was negative in our patient cohort, and additional molecular investigations did not reveal any large-scale OPA1 rearrangements or OPA3 genetic defects. The mean baseline visual acuity for our OPA1-positive group was 0.48 logarithm of the minimum angle of resolution (LogMAR) (Mean Snellen equivalent = 20/61, range = 20/20–20/400, 95% confidence interval = 20/52–20/71), and visual deterioration occurred in 54.2% of patients during follow-up. Conclusions OPA1 mutations are the most common genetic defects identified in patients with suspected DOA, whereas OPA3 mutations are very rare in isolated optic atrophy cases. PMID:21036400

A common FGFR3 gene mutation is present in achondroplasia but not in hypochondroplasia.

PubMed

Stoilov, I; Kilpatrick, M W; Tsipouras, P

1995-01-02

Achondroplasia is the most common type of genetic dwarfism. It is characterized by disproportionate short stature and other skeletal anomalies resulting from a defect in the maturation of the chondrocytes in the growth plate of the cartilage. Recent studies mapped the achondroplasia gene on chromosome region 4p16.3 and identified a common mutation in the gene encoding the fibroblast growth factor receptor 3 (FGFR3). In an analysis of 19 achondroplasia families from a variety of ethnic backgrounds we confirmed the presence of the G380R mutation in 21 of 23 achondroplasia chromosomes studied. In contrast, the G380R mutation was not found in any of the 8 hypochondroplasia chromosomes studied. Furthermore, linkage studies in a 3-generation family with hypochondroplasia show discordant segregation with markers in the 4p16.3 region suggesting that at least some cases of hypochondroplasia are caused by mutations in a gene other than FGFR3.

Meta-analysis Reveals Genome-Wide Significance at 15q13 for Nonsyndromic Clefting of Both the Lip and the Palate, and Functional Analyses Implicate GREM1 As a Plausible Causative Gene

PubMed Central

Ludwig, Kerstin U.; Ahmed, Syeda Tasnim; Böhmer, Anne C.; Sangani, Nasim Bahram; Varghese, Sheryil; Klamt, Johanna; Schuenke, Hannah; Gültepe, Pinar; Hofmann, Andrea; Rubini, Michele; Aldhorae, Khalid Ahmed; Steegers-Theunissen, Regine P.; Rojas-Martinez, Augusto; Reiter, Rudolf; Borck, Guntram; Knapp, Michael; Nakatomi, Mitsushiro; Graf, Daniel; Mangold, Elisabeth; Peters, Heiko

2016-01-01

Nonsyndromic orofacial clefts are common birth defects with multifactorial etiology. The most common type is cleft lip, which occurs with or without cleft palate (nsCLP and nsCLO, respectively). Although genetic components play an important role in nsCLP, the genetic factors that predispose to palate involvement are largely unknown. In this study, we carried out a meta-analysis on genetic and clinical data from three large cohorts and identified strong association between a region on chromosome 15q13 and nsCLP (P = 8.13×10−14 for rs1258763; relative risk (RR): 1.46, 95% confidence interval (CI): 1.32–1.61)) but not nsCLO (P = 0.27; RR: 1.09 (0.94–1.27)). The 5 kb region of strongest association maps downstream of Gremlin-1 (GREM1), which encodes a secreted antagonist of the BMP4 pathway. We show during mouse embryogenesis, Grem1 is expressed in the developing lip and soft palate but not in the hard palate. This is consistent with genotype-phenotype correlations between rs1258763 and a specific nsCLP subphenotype, since a more than two-fold increase in risk was observed in patients displaying clefts of both the lip and soft palate but who had an intact hard palate (RR: 3.76, CI: 1.47–9.61, Pdiff<0.05). While we did not find lip or palate defects in Grem1-deficient mice, wild type embryonic palatal shelves developed divergent shapes when cultured in the presence of ectopic Grem1 protein (P = 0.0014). The present study identified a non-coding region at 15q13 as the second, genome-wide significant locus specific for nsCLP, after 13q31. Moreover, our data suggest that the closely located GREM1 gene contributes to a rare clinical nsCLP entity. This entity specifically involves abnormalities of the lip and soft palate, which develop at different time-points and in separate anatomical regions. PMID:26968009

Neuropsychological dysfunction and developmental defects associated with genetic changes in infants with neonatal diabetes mellitus: a prospective cohort study [corrected].

PubMed

Busiah, Kanetee; Drunat, Séverine; Vaivre-Douret, Laurence; Bonnefond, Amélie; Simon, Albane; Flechtner, Isabelle; Gérard, Bénédicte; Pouvreau, Nathalie; Elie, Caroline; Nimri, Revital; De Vries, Liat; Tubiana-Rufi, Nadia; Metz, Chantal; Bertrand, Anne-Marie; Nivot-Adamiak, Sylvie; de Kerdanet, Marc; Stuckens, Chantal; Jennane, Farida; Souchon, Pierre-François; Le Tallec, Claire; Désirée, Christelle; Pereira, Sabrina; Dechaume, Aurélie; Robert, Jean-Jacques; Phillip, Moshe; Scharfmann, Raphaël; Czernichow, Paul; Froguel, Philippe; Vaxillaire, Martine; Polak, Michel; Cavé, Hélène

2013-11-01

Neonatal diabetes mellitus is a rare genetic form of pancreatic β-cell dysfunction. We compared phenotypic features and clinical outcomes according to genetic subtypes in a cohort of patients diagnosed with neonatal diabetes mellitus before age 1 year, without β-cell autoimmunity and with normal pancreas morphology. We prospectively investigated patients from 20 countries referred to the French Neonatal Diabetes Mellitus Study Group from 1995 to 2010. Patients with hyperglycaemia requiring treatment with insulin before age 1 year were eligible, provided that they had normal pancreatic morphology as assessed by ultrasonography and negative tests for β-cell autoimmunity. We assessed changes in the 6q24 locus, KATP-channel subunit genes (ABCC8 and KCNJ11), and preproinsulin gene (INS) and investigated associations between genotype and phenotype, with special attention to extra-pancreatic abnormalities. We tested 174 index patients, of whom 47 (27%) had no detectable genetic defect. Of the remaining 127 index patients, 40 (31%) had 6q24 abnormalities, 43 (34%) had mutations in KCNJ11, 31 (24%) had mutations in ABCC8, and 13 (10%) had mutations in INS. We reported developmental delay with or without epilepsy in 13 index patients (18% of participants with mutations in genes encoding KATP channel subunits). In-depth neuropsychomotor investigations were done at median age 7 years (IQR 1-15) in 27 index patients with mutations in KATP channel subunit genes who did not have developmental delay or epilepsy. Developmental coordination disorder (particularly visual-spatial dyspraxia) or attention deficits were recorded in all index patients who had this testing. Compared with index patients who had mutations in KATP channel subunit genes, those with 6q24 abnormalities had specific features: developmental defects involving the heart, kidneys, or urinary tract (8/36 [22%] vs 2/71 [3%]; p=0·002), intrauterine growth restriction (34/37 [92%] vs 34/70 [48%]; p<0·0001), and early diagnosis (median age 5·0 days, IQR 1·0-14·5 vs 45·5 days, IQR 27·2-95·0; p<0·0001). Remission of neonatal diabetes mellitus occurred in 89 (51%) index patients at a median age of 17 weeks (IQR 9·5-39·0; median follow-up 4·7 years, IQR 1·5-12·8). Recurrence was common, with no difference between the groups who had 6q24 abnormalities versus mutations in KATP channel subunit genes (82% vs 86%; p=0·36). Neonatal diabetes mellitus is often associated with neuropsychological dysfunction and developmental defects that are specific to the underlying genetic abnormality. A multidisciplinary assessment is therefore essential when patients are diagnosed. Features of neuropsychological dysfunction and developmental defects should be tested for in adults with a history of neonatal diabetes mellitus. Agence Nationale de la Recherche-Maladies Rares Research Program Grant, the Transnational European Research Grant on Rare Diseases, the Société Francophone du Diabète-Association Française du Diabète, the Association Française du Diabète, Aide aux Jeunes Diabétiques, a CIFRE grant from the French Government, HRA-Pharma, the French Ministry of Education and Research, and the Société Française de Pédiatrie. Copyright © 2013 Elsevier Ltd. All rights reserved.

Neural Tube Defects

MedlinePlus

Neural tube defects are birth defects of the brain, spine, or spinal cord. They happen in the ... that she is pregnant. The two most common neural tube defects are spina bifida and anencephaly. In ...

Restoration of Motor Defects Caused by Loss of Drosophila TDP-43 by Expression of the Voltage-Gated Calcium Channel, Cacophony, in Central Neurons.

PubMed

Lembke, Kayly M; Scudder, Charles; Morton, David B

2017-09-27

Defects in the RNA-binding protein, TDP-43, are known to cause a variety of neurodegenerative diseases, including amyotrophic lateral sclerosis and frontotemporal lobar dementia. A variety of experimental systems have shown that neurons are sensitive to TDP-43 expression levels, yet the specific functional defects resulting from TDP-43 dysregulation have not been well described. Using the Drosophila TDP-43 ortholog TBPH, we previously showed that TBPH-null animals display locomotion defects as third instar larvae. Furthermore, loss of TBPH caused a reduction in cacophony , a Type II voltage-gated calcium channel, expression and that genetically restoring cacophony in motor neurons in TBPH mutant animals was sufficient to rescue the locomotion defects. In the present study, we examined the relative contributions of neuromuscular junction physiology and the motor program to the locomotion defects and identified subsets of neurons that require cacophony expression to rescue the defects. At the neuromuscular junction, we showed mEPP amplitudes and frequency require TBPH. Cacophony expression in motor neurons rescued mEPP frequency but not mEPP amplitude. We also showed that TBPH mutants displayed reduced motor neuron bursting and coordination during crawling and restoring cacophony selectively in two pairs of cells located in the brain, the AVM001b/2b neurons, also rescued the locomotion and motor defects, but not the defects in neuromuscular junction physiology. These results suggest that the behavioral defects associated with loss of TBPH throughout the nervous system can be associated with defects in a small number of genes in a limited number of central neurons, rather than peripheral defects. SIGNIFICANCE STATEMENT TDP-43 dysfunction is a common feature in neurodegenerative diseases, including amyotrophic lateral sclerosis, frontotemporal lobar dementia, and Alzheimer's disease. Loss- and gain-of-function models have shown that neurons are sensitive to TDP-43 expression levels, but the specific defects caused by TDP-43 loss of function have not been described in detail. A Drosophila loss-of-function model displays pronounced locomotion defects that can be reversed by restoring the expression levels of a voltage-gated calcium channel, cacophony. We show these defects can be rescued by expression of cacophony in motor neurons and by expression in two pairs of neurons in the brain. These data suggest that loss of TDP-43 can disrupt the central circuitry of the CNS, opening up identification of alternative therapeutic targets for TDP-43 proteinopathies. Copyright © 2017 the authors 0270-6474/17/379486-12$15.00/0.

Wide spectrum of NR5A1‐related phenotypes in 46,XY and 46,XX individuals

PubMed Central

Domenice, Sorahia; Machado, Aline Zamboni; Ferreira, Frederico Moraes; Ferraz‐de‐Souza, Bruno; Lerario, Antonio Marcondes; Lin, Lin; Nishi, Mirian Yumie; Gomes, Nathalia Lisboa; da Silva, Thatiana Evelin; Silva, Rosana Barbosa; Correa, Rafaela Vieira; Montenegro, Luciana Ribeiro; Narciso, Amanda; Costa, Elaine Maria Frade; Achermann, John C

2016-01-01

Steroidogenic factor 1 (NR5A1, SF‐1, Ad4BP) is a transcriptional regulator of genes involved in adrenal and gonadal development and function. Mutations in NR5A1 have been among the most frequently identified genetic causes of gonadal development disorders and are associated with a wide phenotypic spectrum. In 46,XY individuals, NR5A1‐related phenotypes may range from disorders of sex development (DSD) to oligo/azoospermia, and in 46,XX individuals, from 46,XX ovotesticular and testicular DSD to primary ovarian insufficiency (POI). The most common 46,XY phenotype is atypical or female external genitalia with clitoromegaly, palpable gonads, and absence of Müllerian derivatives. Notably, an undervirilized external genitalia is frequently seen at birth, while spontaneous virilization may occur later, at puberty. In 46,XX individuals, NR5A1 mutations are a rare genetic cause of POI, manifesting as primary or secondary amenorrhea, infertility, hypoestrogenism, and elevated gonadotropin levels. Mothers and sisters of 46,XY DSD patients carrying heterozygous NR5A1 mutations may develop POI, and therefore require appropriate counseling. Moreover, the recurrent heterozygous p.Arg92Trp NR5A1 mutation is associated with variable degrees of testis development in 46,XX patients. A clear genotype‐phenotype correlation is not seen in patients bearing NR5A1 mutations, suggesting that genetic modifiers, such as pathogenic variants in other testis/ovarian‐determining genes, may contribute to the phenotypic expression. Here, we review the published literature on NR5A1‐related disease, and discuss our findings at a single tertiary center in Brazil, including ten novel NR5A1 mutations identified in 46,XY DSD patients. The ever‐expanding phenotypic range associated with NR5A1 variants in XY and XX individuals confirms its pivotal role in reproductive biology, and should alert clinicians to the possibility of NR5A1 defects in a variety of phenotypes presenting with gonadal dysfunction. Birth Defects Research (Part C) 108:309–320, 2016. © 2016 The Authors Birth Defects Research Part C: Embryo Today: Reviews Published by Wiley Periodicals, Inc. PMID:28033660

Neurocalcin Delta Suppression Protects against Spinal Muscular Atrophy in Humans and across Species by Restoring Impaired Endocytosis.

PubMed

Riessland, Markus; Kaczmarek, Anna; Schneider, Svenja; Swoboda, Kathryn J; Löhr, Heiko; Bradler, Cathleen; Grysko, Vanessa; Dimitriadi, Maria; Hosseinibarkooie, Seyyedmohsen; Torres-Benito, Laura; Peters, Miriam; Upadhyay, Aaradhita; Biglari, Nasim; Kröber, Sandra; Hölker, Irmgard; Garbes, Lutz; Gilissen, Christian; Hoischen, Alexander; Nürnberg, Gudrun; Nürnberg, Peter; Walter, Michael; Rigo, Frank; Bennett, C Frank; Kye, Min Jeong; Hart, Anne C; Hammerschmidt, Matthias; Kloppenburg, Peter; Wirth, Brunhilde

2017-02-02

Homozygous SMN1 loss causes spinal muscular atrophy (SMA), the most common lethal genetic childhood motor neuron disease. SMN1 encodes SMN, a ubiquitous housekeeping protein, which makes the primarily motor neuron-specific phenotype rather unexpected. SMA-affected individuals harbor low SMN expression from one to six SMN2 copies, which is insufficient to functionally compensate for SMN1 loss. However, rarely individuals with homozygous absence of SMN1 and only three to four SMN2 copies are fully asymptomatic, suggesting protection through genetic modifier(s). Previously, we identified plastin 3 (PLS3) overexpression as an SMA protective modifier in humans and showed that SMN deficit impairs endocytosis, which is rescued by elevated PLS3 levels. Here, we identify reduction of the neuronal calcium sensor Neurocalcin delta (NCALD) as a protective SMA modifier in five asymptomatic SMN1-deleted individuals carrying only four SMN2 copies. We demonstrate that NCALD is a Ca 2+ -dependent negative regulator of endocytosis, as NCALD knockdown improves endocytosis in SMA models and ameliorates pharmacologically induced endocytosis defects in zebrafish. Importantly, NCALD knockdown effectively ameliorates SMA-associated pathological defects across species, including worm, zebrafish, and mouse. In conclusion, our study identifies a previously unknown protective SMA modifier in humans, demonstrates modifier impact in three different SMA animal models, and suggests a potential combinatorial therapeutic strategy to efficiently treat SMA. Since both protective modifiers restore endocytosis, our results confirm that endocytosis is a major cellular mechanism perturbed in SMA and emphasize the power of protective modifiers for understanding disease mechanism and developing therapies. Copyright © 2017 American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.

The Ptch1DL mouse: a new model to study lambdoid craniosynostosis and basal cell nevus syndrome associated skeletal defects

PubMed Central

Feng, Weiguo; Choi, Irene; Clouthier, David E.; Niswander, Lee; Williams, Trevor

2013-01-01

Mouse models provide valuable opportunities for probing the underlying pathology of human birth defects. Employing an ENU-based screen for recessive mutations affecting craniofacial anatomy we isolated a mouse strain, Dogface-like (DL), with abnormal skull and snout morphology. Examination of the skull indicated that these mice developed craniosynostosis of the lambdoid suture. Further analysis revealed skeletal defects related to the pathology of basal cell nevus syndrome (BCNS) including defects in development of the limbs, scapula, ribcage, secondary palate, cranial base, and cranial vault. In humans, BCNS is often associated with mutations in the Hedgehog receptor PTCH1 and genetic mapping in DL identified a point mutation at a splice donor site in Ptch1. Using genetic complementation analysis we determined that DL is a hypomorphic allele of Ptch1, leading to increased Hedgehog signaling. Two aberrant transcripts are generated by the mutated Ptch1DL gene, which would be predicted to reduce significantly the levels of functional Patched1 protein. This new Ptch1 allele broadens the mouse genetic reagents available to study the Hedgehog pathway and provides a valuable means to study the underlying skeletal abnormalities in BCNS. In addition, these results strengthen the connection between elevated Hedgehog signaling and craniosynostosis. PMID:23897749

Metabolic cutis laxa syndromes.

PubMed

Mohamed, Miski; Kouwenberg, Dorus; Gardeitchik, Thatjana; Kornak, Uwe; Wevers, Ron A; Morava, Eva

2011-08-01

Cutis laxa is a rare skin disorder characterized by wrinkled, redundant, inelastic and sagging skin due to defective synthesis of elastic fibers and other proteins of the extracellular matrix. Wrinkled, inelastic skin occurs in many cases as an acquired condition. Syndromic forms of cutis laxa, however, are caused by diverse genetic defects, mostly coding for structural extracellular matrix proteins. Surprisingly a number of metabolic disorders have been also found to be associated with inherited cutis laxa. Menkes disease was the first metabolic disease reported with old-looking, wrinkled skin. Cutis laxa has recently been found in patients with abnormal glycosylation. The discovery of the COG7 defect in patients with wrinkled, inelastic skin was the first genetic link with the Congenital Disorders of Glycosylation (CDG). Since then several inborn errors of metabolism with cutis laxa have been described with variable severity. These include P5CS, ATP6V0A2-CDG and PYCR1 defects. In spite of the evolving number of cutis laxa-related diseases a large part of the cases remain genetically unsolved. In metabolic cutis laxa syndromes the clinical and laboratory features might partially overlap, however there are some distinct, discriminative features. In this review on metabolic diseases causing cutis laxa we offer a practical approach for the differential diagnosis of metabolic cutis laxa syndromes.

Analysis of FOXF1 and the FOX gene cluster in patients with VACTERL association

PubMed Central

Agochukwu, Nneamaka B.; Pineda-Alvarez, Daniel E.; Keaton, Amelia A.; Warren-Mora, Nicole; Raam, Manu S.; Kamat, Aparna; Chandrasekharappa, Settara C.; Solomon, Benjamin D.

2011-01-01

VACTERL association, a relatively common condition with an incidence of approximately 1 in 20,000 – 35,000 births, is a non-random association of birth defects that includes vertebral defects (V), anal atresia (A), cardiac defects (C), tracheo-esophageal fistula (TE), renal anomalies (R) and limb malformations (L). Although the etiology is unknown in the majority of patients, there is evidence that it is causally heterogeneous. Several studies have shown evidence for inheritance in VACTERL, implying a role for genetic loci. Recently, patients with component features of VACTERL and a lethal developmental pulmonary disorder, alveolar capillary dysplasia with misalignment of pulmonary veins (ACD/MPV), were found to harbor deletions or mutations affecting FOXF1 and the FOX gene cluster on chromosome 16q24. We investigated this gene through direct sequencing and high-density SNP microarray in 12 patients with VACTERL association but without ACD/MPV. Our mutational analysis of FOXF1 showed normal sequences and no genomic imbalances affecting the FOX gene cluster on chromosome 16q24 in the studied patients. Possible explanations for these results include the etiologic and clinical heterogeneity of VACTERL association, the possibility that mutations affecting this gene may occur only in more severely affected individuals, and insufficient study sample size. PMID:21315191

[Nephroblastoma and xeroderma pigmentosum: A rare association].

PubMed

Lahlimi, F; Harif, M; Elhoudzi, J

2016-01-01

Xeroderma pigmentosum (XP) is a rare, genetically heterogeneous, autosomal recessive disorder, more common in cases of consanguinity. The basic defect underlying the clinical manifestations is a nucleotide excision repair defect leading to the defective repair of DNA damaged by ultraviolet (UV) radiation. XP is characterized by a high incidence of skin cancer on exposed regions. We report the case of a 5-year-old boy, followed for xeroderma pigmentosum since the age of 4 years. His sister also has the same anomaly. He presented an abdominal mass revealed by abdominal pain and vomiting. Radiological examinations revealed a nephroblastoma with lung metastases. He received primary chemotherapy for six cycles (vincristine, and actinomycin-d adriamycin), then surgery with ureteronephrectomy. Pathological examination of the nephrectomy specimen confirmed the diagnosis of Wilms tumor with a diffuse anaplastic component reaching 50%. The patient was treated according to the GFAOP stage III protocol, with high histological risk. The outcome was favorable but complicated by renal failure due to the toxicity of the treatment. He is currently in complete remission at 1 year from the end of treatment. The association of xeroderma pigmentosum and nephroblastoma is a rare combination. This case illustrates the problem of management of both severe and difficult conditions. Copyright © 2015 Elsevier Masson SAS. All rights reserved.

Rapamycin enhances survival in a Drosophila model of mitochondrial disease.

PubMed

Wang, Adrienne; Mouser, Jacob; Pitt, Jason; Promislow, Daniel; Kaeberlein, Matt

2016-12-06

Pediatric mitochondrial disorders are a devastating category of diseases caused by deficiencies in mitochondrial function. Leigh Syndrome (LS) is the most common of these diseases with symptoms typically appearing within the first year of birth and progressing rapidly until death, usually by 6-7 years of age. Our lab has recently shown that genetic inhibition of the mechanistic target of rapamycin (TOR) rescues the short lifespan of yeast mutants with defective mitochondrial function, and that pharmacological inhibition of TOR by administration of rapamycin significantly rescues the shortened lifespan, neurological symptoms, and neurodegeneration in a mouse model of LS. However, the mechanism by which TOR inhibition exerts these effects, and the extent to which these effects can extend to other models of mitochondrial deficiency, are unknown. Here, we probe the effects of TOR inhibition in a Drosophila model of complex I deficiency. Treatment with rapamycin robustly suppresses the lifespan defect in this model of LS, without affecting behavioral phenotypes. Interestingly, this increased lifespan in response to TOR inhibition occurs in an autophagy-independent manner. Further, we identify a fat storage defect in the ND2 mutant flies that is rescued by rapamycin, supporting a model that rapamycin exerts its effects on mitochondrial disease in these animals by altering metabolism.

Familial Hypercholesterolaemia

PubMed Central

Marais, A David

2004-01-01

Familial hypercholesterolaemia (FH), defined as the heritable occurrence of severe hypercholesterolaemia with cholesterol deposits in tendons and premature heart disease, is caused by at least four genes in sterol and lipoprotein pathways and displays varying gene-dose effects. The genes are the low-density lipoprotein (LDL) receptor, apolipoprotein (apo) B, proprotein convertase subtilisin/kexin 9, and the autosomal recessive hypercholesterolaemia (ARH) adaptor protein. All of these disorders have in common defective clearance of LDL within a complex system of lipid and lipoprotein metabolism and regulation. Normal cellular cholesterol and lipoprotein metabolism is reviewed before describing the disorders, their metabolic derangements and their clinical effects. FH is classified as two simplified phenotypes of disease according to the severity of the metabolic derangement. The dominantly inherited heterozygous phenotype comprises defects in the LDL receptor, apoB100, and neural apoptosis regulatory cleavage protein. The homozygous phenotype is co-dominant in defects of the LDL receptor, and occurs also as the ARH of adapter protein mutations. Defective binding of apoB100 does not result in a significant gene dose effect, but enhances the severity of heterozygotes for LDL receptor mutations. The genetic diagnosis of FH has provided greater accuracy in definition and detection of disease and exposes information about migration of populations. All of these disorders pose a high risk of atherosclerosis, especially in the homozygous phenotype. Studies of influences on the phenotype and responses to treatment are also discussed in the context of the metabolic derangements. PMID:18516203

Defective Cell Cycle Checkpoint Functions in Melanoma Are Associated with Altered Patterns of Gene Expression

PubMed Central

Kaufmann, William K.; Nevis, Kathleen R.; Qu, Pingping; Ibrahim, Joseph G.; Zhou, Tong; Zhou, Yingchun; Simpson, Dennis A.; Helms-Deaton, Jennifer; Cordeiro-Stone, Marila; Moore, Dominic T.; Thomas, Nancy E.; Hao, Honglin; Liu, Zhi; Shields, Janiel M.; Scott, Glynis A.; Sharpless, Norman E.

2009-01-01

Defects in DNA damage responses may underlie genetic instability and malignant progression in melanoma. Cultures of normal human melanocytes (NHMs) and melanoma lines were analyzed to determine whether global patterns of gene expression could predict the efficacy of DNA damage cell cycle checkpoints that arrest growth and suppress genetic instability. NHMs displayed effective G1 and G2 checkpoint responses to ionizing radiation-induced DNA damage. A majority of melanoma cell lines (11/16) displayed significant quantitative defects in one or both checkpoints. Melanomas with B-RAF mutations as a class displayed a significant defect in DNA damage G2 checkpoint function. In contrast the epithelial-like subtype of melanomas with wild-type N-RAS and B-RAF alleles displayed an effective G2 checkpoint but a significant defect in G1 checkpoint function. RNA expression profiling revealed that melanoma lines with defects in the DNA damage G1 checkpoint displayed reduced expression of p53 transcriptional targets, such as CDKN1A and DDB2, and enhanced expression of proliferation-associated genes, such as CDC7 and GEMININ. A Bayesian analysis tool was more accurate than significance analysis of microarrays for predicting checkpoint function using a leave-one-out method. The results suggest that defects in DNA damage checkpoints may be recognized in melanomas through analysis of gene expression. PMID:17597816

Hundreds of variants clustered in genomic loci and biological pathways affect human height

PubMed Central

Lango Allen, Hana; Estrada, Karol; Lettre, Guillaume; Berndt, Sonja I.; Weedon, Michael N.; Rivadeneira, Fernando; Willer, Cristen J.; Jackson, Anne U.; Vedantam, Sailaja; Raychaudhuri, Soumya; Ferreira, Teresa; Wood, Andrew R.; Weyant, Robert J.; Segrè, Ayellet V.; Speliotes, Elizabeth K.; Wheeler, Eleanor; Soranzo, Nicole; Park, Ju-Hyun; Yang, Jian; Gudbjartsson, Daniel; Heard-Costa, Nancy L.; Randall, Joshua C.; Qi, Lu; Smith, Albert Vernon; Mägi, Reedik; Pastinen, Tomi; Liang, Liming; Heid, Iris M.; Luan, Jian'an; Thorleifsson, Gudmar; Winkler, Thomas W.; Goddard, Michael E.; Lo, Ken Sin; Palmer, Cameron; Workalemahu, Tsegaselassie; Aulchenko, Yurii S.; Johansson, Åsa; Zillikens, M.Carola; Feitosa, Mary F.; Esko, Tõnu; Johnson, Toby; Ketkar, Shamika; Kraft, Peter; Mangino, Massimo; Prokopenko, Inga; Absher, Devin; Albrecht, Eva; Ernst, Florian; Glazer, Nicole L.; Hayward, Caroline; Hottenga, Jouke-Jan; Jacobs, Kevin B.; Knowles, Joshua W.; Kutalik, Zoltán; Monda, Keri L.; Polasek, Ozren; Preuss, Michael; Rayner, Nigel W.; Robertson, Neil R.; Steinthorsdottir, Valgerdur; Tyrer, Jonathan P.; Voight, Benjamin F.; Wiklund, Fredrik; Xu, Jianfeng; Zhao, Jing Hua; Nyholt, Dale R.; Pellikka, Niina; Perola, Markus; Perry, John R.B.; Surakka, Ida; Tammesoo, Mari-Liis; Altmaier, Elizabeth L.; Amin, Najaf; Aspelund, Thor; Bhangale, Tushar; Boucher, Gabrielle; Chasman, Daniel I.; Chen, Constance; Coin, Lachlan; Cooper, Matthew N.; Dixon, Anna L.; Gibson, Quince; Grundberg, Elin; Hao, Ke; Junttila, M. Juhani; Kaplan, Lee M.; Kettunen, Johannes; König, Inke R.; Kwan, Tony; Lawrence, Robert W.; Levinson, Douglas F.; Lorentzon, Mattias; McKnight, Barbara; Morris, Andrew P.; Müller, Martina; Ngwa, Julius Suh; Purcell, Shaun; Rafelt, Suzanne; Salem, Rany M.; Salvi, Erika; Sanna, Serena; Shi, Jianxin; Sovio, Ulla; Thompson, John R.; Turchin, Michael C.; Vandenput, Liesbeth; Verlaan, Dominique J.; Vitart, Veronique; White, Charles C.; Ziegler, Andreas; Almgren, Peter; Balmforth, Anthony J.; Campbell, Harry; Citterio, Lorena; De Grandi, Alessandro; Dominiczak, Anna; Duan, Jubao; Elliott, Paul; Elosua, Roberto; Eriksson, Johan G.; Freimer, Nelson B.; Geus, Eco J.C.; Glorioso, Nicola; Haiqing, Shen; Hartikainen, Anna-Liisa; Havulinna, Aki S.; Hicks, Andrew A.; Hui, Jennie; Igl, Wilmar; Illig, Thomas; Jula, Antti; Kajantie, Eero; Kilpeläinen, Tuomas O.; Koiranen, Markku; Kolcic, Ivana; Koskinen, Seppo; Kovacs, Peter; Laitinen, Jaana; Liu, Jianjun; Lokki, Marja-Liisa; Marusic, Ana; Maschio, Andrea; Meitinger, Thomas; Mulas, Antonella; Paré, Guillaume; Parker, Alex N.; Peden, John F.; Petersmann, Astrid; Pichler, Irene; Pietiläinen, Kirsi H.; Pouta, Anneli; Ridderstråle, Martin; Rotter, Jerome I.; Sambrook, Jennifer G.; Sanders, Alan R.; Schmidt, Carsten Oliver; Sinisalo, Juha; Smit, Jan H.; Stringham, Heather M.; Walters, G.Bragi; Widen, Elisabeth; Wild, Sarah H.; Willemsen, Gonneke; Zagato, Laura; Zgaga, Lina; Zitting, Paavo; Alavere, Helene; Farrall, Martin; McArdle, Wendy L.; Nelis, Mari; Peters, Marjolein J.; Ripatti, Samuli; van Meurs, Joyce B.J.; Aben, Katja K.; Ardlie, Kristin G; Beckmann, Jacques S.; Beilby, John P.; Bergman, Richard N.; Bergmann, Sven; Collins, Francis S.; Cusi, Daniele; den Heijer, Martin; Eiriksdottir, Gudny; Gejman, Pablo V.; Hall, Alistair S.; Hamsten, Anders; Huikuri, Heikki V.; Iribarren, Carlos; Kähönen, Mika; Kaprio, Jaakko; Kathiresan, Sekar; Kiemeney, Lambertus; Kocher, Thomas; Launer, Lenore J.; Lehtimäki, Terho; Melander, Olle; Mosley, Tom H.; Musk, Arthur W.; Nieminen, Markku S.; O'Donnell, Christopher J.; Ohlsson, Claes; Oostra, Ben; Palmer, Lyle J.; Raitakari, Olli; Ridker, Paul M.; Rioux, John D.; Rissanen, Aila; Rivolta, Carlo; Schunkert, Heribert; Shuldiner, Alan R.; Siscovick, David S.; Stumvoll, Michael; Tönjes, Anke; Tuomilehto, Jaakko; van Ommen, Gert-Jan; Viikari, Jorma; Heath, Andrew C.; Martin, Nicholas G.; Montgomery, Grant W.; Province, Michael A.; Kayser, Manfred; Arnold, Alice M.; Atwood, Larry D.; Boerwinkle, Eric; Chanock, Stephen J.; Deloukas, Panos; Gieger, Christian; Grönberg, Henrik; Hall, Per; Hattersley, Andrew T.; Hengstenberg, Christian; Hoffman, Wolfgang; Lathrop, G.Mark; Salomaa, Veikko; Schreiber, Stefan; Uda, Manuela; Waterworth, Dawn; Wright, Alan F.; Assimes, Themistocles L.; Barroso, Inês; Hofman, Albert; Mohlke, Karen L.; Boomsma, Dorret I.; Caulfield, Mark J.; Cupples, L.Adrienne; Erdmann, Jeanette; Fox, Caroline S.; Gudnason, Vilmundur; Gyllensten, Ulf; Harris, Tamara B.; Hayes, Richard B.; Jarvelin, Marjo-Riitta; Mooser, Vincent; Munroe, Patricia B.; Ouwehand, Willem H.; Penninx, Brenda W.; Pramstaller, Peter P.; Quertermous, Thomas; Rudan, Igor; Samani, Nilesh J.; Spector, Timothy D.; Völzke, Henry; Watkins, Hugh; Wilson, James F.; Groop, Leif C.; Haritunians, Talin; Hu, Frank B.; Kaplan, Robert C.; Metspalu, Andres; North, Kari E.; Schlessinger, David; Wareham, Nicholas J.; Hunter, David J.; O'Connell, Jeffrey R.; Strachan, David P.; Wichmann, H.-Erich; Borecki, Ingrid B.; van Duijn, Cornelia M.; Schadt, Eric E.; Thorsteinsdottir, Unnur; Peltonen, Leena; Uitterlinden, André; Visscher, Peter M.; Chatterjee, Nilanjan; Loos, Ruth J.F.; Boehnke, Michael; McCarthy, Mark I.; Ingelsson, Erik; Lindgren, Cecilia M.; Abecasis, Gonçalo R.; Stefansson, Kari; Frayling, Timothy M.; Hirschhorn, Joel N

2010-01-01

Most common human traits and diseases have a polygenic pattern of inheritance: DNA sequence variants at many genetic loci influence phenotype. Genome-wide association (GWA) studies have identified >600 variants associated with human traits1, but these typically explain small fractions of phenotypic variation, raising questions about the utility of further studies. Here, using 183,727 individuals, we show that hundreds of genetic variants, in at least 180 loci, influence adult height, a highly heritable and classic polygenic trait2,3. The large number of loci reveals patterns with important implications for genetic studies of common human diseases and traits. First, the 180 loci are not random, but instead are enriched for genes that are connected in biological pathways (P=0.016), and that underlie skeletal growth defects (P<0.001). Second, the likely causal gene is often located near the most strongly associated variant: in 13 of 21 loci containing a known skeletal growth gene, that gene was closest to the associated variant. Third, at least 19 loci have multiple independently associated variants, suggesting that allelic heterogeneity is a frequent feature of polygenic traits, that comprehensive explorations of already-discovered loci should discover additional variants, and that an appreciable fraction of associated loci may have been identified. Fourth, associated variants are enriched for likely functional effects on genes, being over-represented amongst variants that alter amino acid structure of proteins and expression levels of nearby genes. Our data explain ∼10% of the phenotypic variation in height, and we estimate that unidentified common variants of similar effect sizes would increase this figure to ∼16% of phenotypic variation (∼20% of heritable variation). Although additional approaches are needed to fully dissect the genetic architecture of polygenic human traits, our findings indicate that GWA studies can identify large numbers of loci that implicate biologically relevant genes and pathways. PMID:20881960

Gene Editing and Gene-Based Therapeutics for Cardiomyopathies.

PubMed

Ohiri, Joyce C; McNally, Elizabeth M

2018-04-01

With an increasing understanding of genetic defects leading to cardiomyopathy, focus is shifting to correcting these underlying genetic defects. One approach involves treating mutant RNA through antisense oligonucleotides; the first drug has received regulatory approval to treat specific mutations associated with Duchenne muscular dystrophy. Gene editing is being evaluated in the preclinical setting. For inherited cardiomyopathies, genetic correction strategies require tight specificity for the mutant allele. Gene-editing methods are being tested to create deletions that may be useful to restore protein expression by through the bypass of mutations that restore protein production. Site-specific gene editing, which is required to correct many point mutations, is a less efficient process than inducing deletions. Copyright © 2017 Elsevier Inc. All rights reserved.

Genetics and the Quality of Life

ERIC Educational Resources Information Center

Wallace, Bruce

1973-01-01

Knowledge about gene defects (such as the Sickle Cell Gene) should be given to those who show positive laboratory tests. Conflict between gene therapy, aimed at removing the defective gene, and ethical problems should be resolved from the perspective of the effect on future generations. (PS)

Primary Ovarian Insufficiency: X chromosome defects and autoimmunity.

PubMed

Persani, Luca; Rossetti, Raffaella; Cacciatore, Chiara; Bonomi, Marco

2009-08-01

Premature ovarian failure (POF) is a primary ovarian defect characterized by absent menarche or premature depletion of ovarian follicles before the age of 40 years. However, in several instances the distinction between definitive or intermittent POF may be difficult on clinical bases, therefore the more appropriate term Primary Ovarian Insufficiency (POI) has been recently proposed and will be used in this review. POI is a heterogeneous disorder affecting approximately 1% of women <40 years. The most severe forms present with absent pubertal development and primary amenorrhea, whereas forms with post-pubertal onset are characterized by disappearance of menstrual cycles (secondary amenorrhea) associated with a defective folliculogenesis. POI is generally characterized by low levels of gonadal hormones (estrogens and inhibins) and high levels of gonadotropins (LH and FSH) (hypergonadotropic amenorrhea). Heterogeneity of POI is reflected by the variety of possible causes, including autoimmunity, toxics, drugs, as well as genetic defects. Several data indicate that POI has a strong genetic component. In this manuscript we discuss the X chromosome abnormalities that are associated with POI.

Atopic Dermatitis in Children: Clinical Features, Pathophysiology and Treatment

PubMed Central

Lyons, Jonathan J.; Milner, Joshua D.; Stone, Kelly D.

2014-01-01

Atopic dermatitis (AD) is a chronic, relapsing, highly pruritic skin condition resulting from disruption of the epithelial barrier and associated immune dysregulation in the skin of genetically predisposed hosts. AD generally develops in early childhood, has a characteristic age-dependent distribution and is commonly associated with elevated IgE, peripheral eosinophilia and other allergic diseases. Staphylococcus aureus colonization is common and may contribute to disease progression and severity. Targeted therapies to restore both impaired skin barrier and control inflammation are required for optimal outcomes for patients with moderate to severe disease. Pruritus is universal among patients with AD and has a dominant impact on diminishing quality of life. Medications such as anti-histamines have demonstrated poor efficacy in controlling AD-associated itch. Education of patients regarding the primary underlying defects and provision of a comprehensive skin care plan is essential for disease maintenance and management of flares. PMID:25459583

Perinatal autopsy findings in three cases of jugular lymphatic obstruction sequence and cardiac polyvalvular dysplasia.

PubMed

Bendon, Robert; Asamoah, Alexander

2008-01-01

Three infants with a prenatal diagnosis of Noonan's syndrome suffered fetal hydrops and immediate neonatal death. The infants all had the external appearance of jugular lymphatic obstruction sequence with wide-spaced nipples, redundant posterior nuchal skin, and edema of the dorsa of the feet and hands. All 3 demonstrated thick, redundant leaflets of all 4 cardiac valves, and 2 had a membranous ventricular septal defect. One female infant had a mutation of the PTPN11 gene. Two males had no common mutation of PTPN11. The males demonstrated other abnormalities in common, including small penis, testicular malformation, rosette-like appearance of the pituicytes, and an eosinophil infiltration of the pancreatic islets with islet cell hypertrophy. Detailed anatomy of cases of lymphatic obstruction sequence fetuses can be correlated with an increasing number of genetic mutations associated with Noonan's syndrome and related syndromes in mice and humans.

Current Concepts in Graves' Disease

PubMed Central

Girgis, Christian M.; Champion, Bernard L.; Wall, Jack R.

2011-01-01

Graves' disease is the most common cause of hyperthyroidism in the developed world. It is caused by an immune defect in genetically susceptible individuals in whom the production of unique antibodies results in thyroid hormone excess and glandular hyperplasia. When unrecognized, Graves' disease impacts negatively on quality of life and poses serious risks of psychosis, tachyarrhythmia and cardiac failure. Beyond the thyroid, Graves' disease has diverse soft-tissue effects that reflect its systemic autoimmune nature. Thyroid eye disease is the most common of these manifestations and is important to recognise given its risk to vision and potential to deteriorate in response to radioactive iodine ablation. In this review we discuss the investigation and management of Graves' disease, the recent controversy regarding the hepatotoxicity of propylthiouracil and the emergence of novel small-molecule thyroid-stimulating hormone (TSH) receptor ligands as potential targets in the treatment of Graves' disease. PMID:23148179

Congenital Heart Disease: Causes, Diagnosis, Symptoms, and Treatments.

PubMed

Sun, RongRong; Liu, Min; Lu, Lei; Zheng, Yi; Zhang, Peiying

2015-07-01

The congenital heart disease includes abnormalities in heart structure that occur before birth. Such defects occur in the fetus while it is developing in the uterus during pregnancy. About 500,000 adults have congenital heart disease in USA (WebMD, Congenital heart defects medications, www.WebMD.com/heart-disease/tc/congenital-heart-defects-medications , 2014). 1 in every 100 children has defects in their heart due to genetic or chromosomal abnormalities, such as Down syndrome. The excessive alcohol consumption during pregnancy and use of medications, maternal viral infection, such as Rubella virus, measles (German), in the first trimester of pregnancy, all these are risk factors for congenital heart disease in children, and the risk increases if parent or sibling has a congenital heart defect. These are heart valves defects, atrial and ventricular septa defects, stenosis, the heart muscle abnormalities, and a hole inside wall of the heart which causes defect in blood circulation, heart failure, and eventual death. There are no particular symptoms of congenital heart disease, but shortness of breath and limited ability to do exercise, fatigue, abnormal sound of heart as heart murmur, which is diagnosed by a physician while listening to the heart beats. The echocardiogram or transesophageal echocardiogram, electrocardiogram, chest X-ray, cardiac catheterization, and MRI methods are used to detect congenital heart disease. Several medications are given depending on the severity of this disease, and catheter method and surgery are required for serious cases to repair heart valves or heart transplantation as in endocarditis. For genetic study, first DNA is extracted from blood followed by DNA sequence analysis and any defect in nucleotide sequence of DNA is determined. For congenital heart disease, genes in chromosome 1 show some defects in nucleotide sequence. In this review the causes, diagnosis, symptoms, and treatments of congenital heart disease are described.

A Simple Genetic Incompatibility Causes Hybrid Male Sterility in Mimulus

PubMed Central

Sweigart, Andrea L.; Fishman, Lila; Willis, John H.

2006-01-01

Much evidence has shown that postzygotic reproductive isolation (hybrid inviability or sterility) evolves by the accumulation of interlocus incompatibilities between diverging populations. Although in theory only a single pair of incompatible loci is needed to isolate species, empirical work in Drosophila has revealed that hybrid fertility problems often are highly polygenic and complex. In this article we investigate the genetic basis of hybrid sterility between two closely related species of monkeyflower, Mimulus guttatus and M. nasutus. In striking contrast to Drosophila systems, we demonstrate that nearly complete hybrid male sterility in Mimulus results from a simple genetic incompatibility between a single pair of heterospecific loci. We have genetically mapped this sterility effect: the M. guttatus allele at the hybrid male sterility 1 (hms1) locus acts dominantly in combination with recessive M. nasutus alleles at the hybrid male sterility 2 (hms2) locus to cause nearly complete hybrid male sterility. In a preliminary screen to find additional small-effect male sterility factors, we identified one additional locus that also contributes to some of the variation in hybrid male fertility. Interestingly, hms1 and hms2 also cause a significant reduction in hybrid female fertility, suggesting that sex-specific hybrid defects might share a common genetic basis. This possibility is supported by our discovery that recombination is reduced dramatically in a cross involving a parent with the hms1–hms2 incompatibility. PMID:16415357

A simple genetic incompatibility causes hybrid male sterility in mimulus.

PubMed

Sweigart, Andrea L; Fishman, Lila; Willis, John H

2006-04-01

Much evidence has shown that postzygotic reproductive isolation (hybrid inviability or sterility) evolves by the accumulation of interlocus incompatibilities between diverging populations. Although in theory only a single pair of incompatible loci is needed to isolate species, empirical work in Drosophila has revealed that hybrid fertility problems often are highly polygenic and complex. In this article we investigate the genetic basis of hybrid sterility between two closely related species of monkeyflower, Mimulus guttatus and M. nasutus. In striking contrast to Drosophila systems, we demonstrate that nearly complete hybrid male sterility in Mimulus results from a simple genetic incompatibility between a single pair of heterospecific loci. We have genetically mapped this sterility effect: the M. guttatus allele at the hybrid male sterility 1 (hms1) locus acts dominantly in combination with recessive M. nasutus alleles at the hybrid male sterility 2 (hms2) locus to cause nearly complete hybrid male sterility. In a preliminary screen to find additional small-effect male sterility factors, we identified one additional locus that also contributes to some of the variation in hybrid male fertility. Interestingly, hms1 and hms2 also cause a significant reduction in hybrid female fertility, suggesting that sex-specific hybrid defects might share a common genetic basis. This possibility is supported by our discovery that recombination is reduced dramatically in a cross involving a parent with the hms1-hms2 incompatibility.

Conserved Genes Act as Modifiers of Invertebrate SMN Loss of Function Defects

PubMed Central

Chang, Howard C.; Sen, Anindya; Kalloo, Geetika; Harris, Jevede; Barsby, Tom; Walsh, Melissa B.; Satterlee, John S.; Li, Chris; Van Vactor, David; Artavanis-Tsakonas, Spyros; Hart, Anne C.

2010-01-01

Spinal Muscular Atrophy (SMA) is caused by diminished function of the Survival of Motor Neuron (SMN) protein, but the molecular pathways critical for SMA pathology remain elusive. We have used genetic approaches in invertebrate models to identify conserved SMN loss of function modifier genes. Drosophila melanogaster and Caenorhabditis elegans each have a single gene encoding a protein orthologous to human SMN; diminished function of these invertebrate genes causes lethality and neuromuscular defects. To find genes that modulate SMN function defects across species, two approaches were used. First, a genome-wide RNAi screen for C. elegans SMN modifier genes was undertaken, yielding four genes. Second, we tested the conservation of modifier gene function across species; genes identified in one invertebrate model were tested for function in the other invertebrate model. Drosophila orthologs of two genes, which were identified originally in C. elegans, modified Drosophila SMN loss of function defects. C. elegans orthologs of twelve genes, which were originally identified in a previous Drosophila screen, modified C. elegans SMN loss of function defects. Bioinformatic analysis of the conserved, cross-species, modifier genes suggests that conserved cellular pathways, specifically endocytosis and mRNA regulation, act as critical genetic modifiers of SMN loss of function defects across species. PMID:21124729

Genetic evidence in the mouse solidifies the calcium hypothesis of myofiber death in muscular dystrophy

PubMed Central

Burr, A R; Molkentin, J D

2015-01-01

Muscular dystrophy (MD) refers to a clinically and genetically heterogeneous group of degenerative muscle disorders characterized by progressive muscle wasting and often premature death. Although the primary defect underlying most forms of MD typically results from a loss of sarcolemmal integrity, the secondary molecular mechanisms leading to muscle degeneration and myofiber necrosis is debated. One hypothesis suggests that elevated or dysregulated cytosolic calcium is the common transducing event, resulting in myofiber necrosis in MD. Previous measurements of resting calcium levels in myofibers from dystrophic animal models or humans produced equivocal results. However, recent studies in genetically altered mouse models have largely solidified the calcium hypothesis of MD, such that models with artificially elevated calcium in skeletal muscle manifest fulminant dystrophic-like disease, whereas models with enhanced calcium clearance or inhibited calcium influx are resistant to myofiber death and MD. Here, we will review the field and the recent cadre of data from genetically altered mouse models, which we propose have collectively mostly proven the hypothesis that calcium is the primary effector of myofiber necrosis in MD. This new consensus on calcium should guide future selection of drugs to be evaluated in clinical trials as well as gene therapy-based approaches. PMID:26088163

GENES AS INSTRUMENTS FOR STUDYING RISK BEHAVIOR EFFECTS: AN APPLICATION TO MATERNAL SMOKING AND OROFACIAL CLEFTS

PubMed Central

Jugessur, Astanand; Murray, Jeffrey C.; Moreno, Lina; Wilcox, Allen; Lie, Rolv T.

2011-01-01

This study uses instrumental variable (IV) models with genetic instruments to assess the effects of maternal smoking on the child’s risk of orofacial clefts (OFC), a common birth defect. The study uses genotypic variants in neurotransmitter and detoxification genes relateded to smoking as instruments for cigarette smoking before and during pregnancy. Conditional maximum likelihood and two-stage IV probit models are used to estimate the IV model. The data are from a population-level sample of affected and unaffected children in Norway. The selected genetic instruments generally fit the IV assumptions but may be considered “weak” in predicting cigarette smoking. We find that smoking before and during pregnancy increases OFC risk substantially under the IV model (by about 4–5 times at the sample average smoking rate). This effect is greater than that found with classical analytic models. This may be because the usual models are not able to consider self-selection into smoking based on unobserved confounders, or it may to some degree reflect limitations of the instruments. Inference based on weak-instrument robust confidence bounds is consistent with standard inference. Genetic instruments may provide a valuable approach to estimate the “causal” effects of risk behaviors with genetic-predisposing factors (such as smoking) on health and socioeconomic outcomes. PMID:22102793

Gene–environment interactions: key to unraveling the mystery of Parkinson’s disease

PubMed Central

Gao, Hui-Ming; Hong, Jau-shyong

2011-01-01

Parkinson’s disease (PD) is the second most common neurodegenerative disease. The gradual, irreversible loss of dopamine neurons in the substantia nigra isthe signature lesion of PD. Clinical symptoms of PD become apparent when 50–60% of nigral dopamine neurons are lost. PD progresses insidiously for 5–7 years (preclinical period) and then continues to worsen even under the symptomatic treatment. To determine what triggers the disease onset and what drives the chronic, self-propelling neurodegenerative process becomes critical and urgent, since lack of such knowledge impedes the discovery of effective treatments to retard PD progression. At present, available therapeutics only temporarily relieve PD symptoms. While the identification of causative gene defects in familial PD uncovers important genetic influences in this disease, the majority of PD cases are sporadic and idiopathic. The current consensus suggests that PD develops from multiple risk factors including aging, genetic predisposition, and environmental exposure. Here, we briefly review research on the genetic and environmental causes of PD. We also summarize very recent genome-wide association studies on risk gene polymorphisms in the emergence of PD. We highlight the new converging evidence on gene-environment interplay in the development of PD with an emphasis on newly developed multiple-hit PD models involving both genetic lesions and environmental triggers. PMID:21439347

[Wilsons disease].

PubMed

Mareček, Z; Brůha, R

2013-07-01

Wilsons disease is an autosomal recessive genetic disorder in which copper accumulates in tissues, especially in the liver and the brain. The genetic defect affects the P type ATPase gene (ATP7B). More than 500 mutations causing Wilsons disease have been described. The most common mutation in Central Europe concerns H1069Q. The symptoms of Wilsons disease include hepatic or neurological conditions. The hepatic condition is manifested as steatosis, acute or chronic hepatitis or cirrhosis. The neurological conditions are most often manifested after the age of 20 as motor disorders (tremor, speech and writing disorders), which may result in severe extrapyramidal syndrome with rigidity, dysarthria and muscle contractions. The dia-gnosis is based on clinical and laboratory assessments (neurological signs, liver lesions, low ceruloplasmin, increased free serum copper, high Cu volumes in urine, KayserFleischer ring). The dia-gnosis is confirmed by a high Cu level in liver tissue or genetic proof. Untreated Wilsons disease causes death of the patient. If treated properly the survival rate approximates to the survival rate of the common population. The treatment concerns either removal of copper from the body using chelating agents excreted into the urine (Penicillamine, Trientine) or limitation of copper absorption from the intestine and reducing the toxicity of copper (zinc, ammonium tetrathiomolybdate). In the Czech Republic, Penicillamine or zinc is used. A liver transplant is indicated in patients with fulminant hepatic failure or decompensated liver cirrhosis. In the family all siblings of the affected individual need to be screened in order to treat any asymptomatic subjects.

Nature and Nurture: the complex genetics of myopia and refractive error

PubMed Central

Wojciechowski, Robert

2010-01-01

The refractive errors, myopia and hyperopia, are optical defects of the visual system that can cause blurred vision. Uncorrected refractive errors are the most common causes of visual impairment worldwide. It is estimated that 2.5 billion people will be affected by myopia alone with in the next decade. Experimental, epidemiological and clinical research has shown that refractive development is influenced by both environmental and genetic factors. Animal models have demonstrated that eye growth and refractive maturation during infancy are tightly regulated by visually-guided mechanisms. Observational data in human populations provide compelling evidence that environmental influences and individual behavioral factors play crucial roles in myopia susceptibility. Nevertheless, the majority of the variance of refractive error within populations is thought to be due to hereditary factors. Genetic linkage studies have mapped two dozen loci, while association studies have implicated more than 25 different genes in refractive variation. Many of these genes are involved in common biological pathways known to mediate extracellular matrix composition and regulate connective tissue remodeling. Other associated genomic regions suggest novel mechanisms in the etiology of human myopia, such as mitochondrial-mediated cell death or photoreceptor-mediated visual signal transmission. Taken together, observational and experimental studies have revealed the complex nature of human refractive variation, which likely involves variants in several genes and functional pathways. Multiway interactions between genes and/or environmental factors may also be important in determining individual risks of myopia, and may help explain the complex pattern of refractive error in human populations. PMID:21155761

Maternal obesity and tobacco use modify the impact of genetic variants on the occurrence of conotruncal heart defects.

PubMed

Tang, Xinyu; Nick, Todd G; Cleves, Mario A; Erickson, Stephen W; Li, Ming; Li, Jingyun; MacLeod, Stewart L; Hobbs, Charlotte A

2014-01-01

Conotruncal heart defects (CTDs) are among the most severe birth defects worldwide. Studies of CTDs indicate both lifestyle behaviors and genetic variation contribute to the risk of CTDs. Based on a hybrid design using data from 616 case-parental and 1645 control-parental triads recruited for the National Birth Defects Prevention Study between 1997 and 2008, we investigated whether the occurrence of CTDs is associated with interactions between 921 maternal and/or fetal single nucleotide polymorphisms (SNPs) and maternal obesity and tobacco use. The maternal genotypes of the variants in the glutamate-cysteine ligase, catalytic subunit (GCLC) gene and the fetal genotypes of the variants in the glutathione S-transferase alpha 3 (GSTA3) gene were associated with an elevated risk of CTDs among obese mothers. The risk of delivering infants with CTDs among obese mothers carrying AC genotype for a variant in the GCLC gene (rs6458939) was 2.00 times the risk among those carrying CC genotype (95% confidence interval: 1.41, 2.38). The maternal genotypes of several variants in the glutathione-S-transferase (GST) family of genes and the fetal genotypes of the variants in the GCLC gene interacted with tobacco exposures to increase the risk of CTDs. Our study suggests that the genetic basis underlying susceptibility of the developing heart to the adverse effects of maternal obesity and tobacco use involve both maternal and embryonic genetic variants. These results may provide insights into the underlying pathophysiology of CTDs, and ultimately lead to novel prevention strategies.

Maternal eNOS deficiency determines a fatty liver phenotype of the offspring in a sex dependent manner

PubMed Central

Hocher, Berthold; Haumann, Hannah; Rahnenführer, Jan; Reichetzeder, Christoph; Kalk, Philipp; Pfab, Thiemo; Tsuprykov, Oleg; Winter, Stefan; Hofmann, Ute; Li, Jian; Püschel, Gerhard P.; Lang, Florian; Schuppan, Detlef; Schwab, Matthias; Schaeffeler, Elke

2016-01-01

ABSTRACT Maternal environmental factors can impact on the phenotype of the offspring via the induction of epigenetic adaptive mechanisms. The advanced fetal programming hypothesis proposes that maternal genetic variants may influence the offspring's phenotype indirectly via epigenetic modification, despite the absence of a primary genetic defect. To test this hypothesis, heterozygous female eNOS knockout mice and wild type mice were bred with male wild type mice. We then assessed the impact of maternal eNOS deficiency on the liver phenotype of wild type offspring. Birth weight of male wild type offspring born to female heterozygous eNOS knockout mice was reduced compared to offspring of wild type mice. Moreover, the offspring displayed a sex specific liver phenotype, with an increased liver weight, due to steatosis. This was accompanied by sex specific differences in expression and DNA methylation of distinct genes. Liver global DNA methylation was significantly enhanced in both male and female offspring. Also, hepatic parameters of carbohydrate metabolism were reduced in male and female offspring. In addition, male mice displayed reductions in various amino acids in the liver. Maternal genetic alterations, such as partial deletion of the eNOS gene, can affect liver metabolism of wild type offspring without transmission of the intrinsic defect. This occurs in a sex specific way, with more detrimental effects in females. This finding demonstrates that a maternal genetic defect can epigenetically alter the phenotype of the offspring, without inheritance of the defect itself. Importantly, these acquired epigenetic phenotypic changes can persist into adulthood. PMID:27175980

Obstructive heart defects associated with candidate genes, maternal obesity, and folic acid supplementation.

PubMed

Tang, Xinyu; Cleves, Mario A; Nick, Todd G; Li, Ming; MacLeod, Stewart L; Erickson, Stephen W; Li, Jingyun; Shaw, Gary M; Mosley, Bridget S; Hobbs, Charlotte A

2015-06-01

Right-sided and left-sided obstructive heart defects (OHDs) are subtypes of congenital heart defects, in which the heart valves, arteries, or veins are abnormally narrow or blocked. Previous studies have suggested that the development of OHDs involved a complex interplay between genetic variants and maternal factors. Using the data from 569 OHD case families and 1,644 control families enrolled in the National Birth Defects Prevention Study (NBDPS) between 1997 and 2008, we conducted an analysis to investigate the genetic effects of 877 single nucleotide polymorphisms (SNPs) in 60 candidate genes for association with the risk of OHDs, and their interactions with maternal use of folic acid supplements, and pre-pregnancy obesity. Applying log-linear models based on the hybrid design, we identified a SNP in methylenetetrahydrofolate reductase (MTHFR) gene (C677T polymorphism) with a main genetic effect on the occurrence of OHDs. In addition, multiple SNPs in betaine-homocysteine methyltransferase (BHMT and BHMT2) were also identified to be associated with the occurrence of OHDs through significant main infant genetic effects and interaction effects with maternal use of folic acid supplements. We also identified multiple SNPs in glutamate-cysteine ligase, catalytic subunit (GCLC) and DNA (cytosine-5-)-methyltransferase 3 beta (DNMT3B) that were associated with elevated risk of OHDs among obese women. Our findings suggested that the risk of OHDs was closely related to a combined effect of variations in genes in the folate, homocysteine, or glutathione/transsulfuration pathways, maternal use of folic acid supplements and pre-pregnancy obesity. © 2015 Wiley Periodicals, Inc.

Type 2 Diabetes Mellitus: New Genetic Insights will Lead to New Therapeutics

PubMed Central

Wolfs, M.G.M; Hofker, M.H; Wijmenga, C; van Haeften, T.W.

2009-01-01

Type 2 diabetes is a disorder of dysregulated glucose homeostasis. Normal glucose homeostasis is a complex process involving several interacting mechanisms, such as insulin secretion, insulin sensitivity, glucose production, and glucose uptake. The dysregulation of one or more of these mechanisms due to environmental and/or genetic factors, can lead to a defective glucose homeostasis. Hyperglycemia is managed by augmenting insulin secretion and/or interaction with hepatic glucose production, as well as by decreasing dietary caloric intake and raising glucose metabolism through exercise. Although these interventions can delay disease progression and correct blood glucose levels, they are not able to cure the disease or stop its progression entirely. Better management of type 2 diabetes is sorely needed. Advances in genotyping techniques and the availability of large patient cohorts have made it possible to identify common genetic variants associated with type 2 diabetes through genome-wide association studies (GWAS). So far, genetic variants on 19 loci have been identified. Most of these loci contain or lie close to genes that were not previously linked to diabetes and they may thus harbor targets for new drugs. It is also hoped that further genetic studies will pave the way for predictive genetic screening. The newly discovered type 2 diabetes genes can be classified based on their presumed molecular function, and we discuss the relation between these gene classes and current treatments. We go on to consider whether the new genes provide opportunities for developing alternative drug therapies. PMID:19794883

Prevalence of inherited disorders among mixed-breed and purebred dogs: 27,254 cases (1995-2010).

PubMed

Bellumori, Thomas P; Famula, Thomas R; Bannasch, Danika L; Belanger, Janelle M; Oberbauer, Anita M

2013-06-01

To determine the proportion of mixed-breed and purebred dogs with common genetic disorders. Case-control study. 27,254 dogs with an inherited disorder. Electronic medical records were reviewed for 24 genetic disorders: hemangiosarcoma, lymphoma, mast cell tumor, osteosarcoma, aortic stenosis, dilated cardiomyopathy, hypertrophic cardiomyopathy, mitral valve dysplasia, patent ductus arteriosus, ventricular septal defect, hyperadrenocorticism, hypoadrenocorticism, hypothyroidism, elbow dysplasia, hip dysplasia, intervertebral disk disease, patellar luxation, ruptured cranial cruciate ligament, atopy or allergic dermatitis, bloat, cataracts, epilepsy, lens luxation, and portosystemic shunt. For each disorder, healthy controls matched for age, body weight, and sex to each affected dog were identified. Genetic disorders differed in expression. No differences in expression of 13 genetic disorders were detected between purebred dogs and mixed-breed dogs (ie, hip dysplasia, hypo- and hyperadrenocorticism, cancers, lens luxation, and patellar luxation). Purebred dogs were more likely to have 10 genetic disorders, including dilated cardiomyopathy, elbow dysplasia, cataracts, and hypothyroidism. Mixed-breed dogs had a greater probability of ruptured cranial cruciate ligament. Prevalence of genetic disorders in both populations was related to the specific disorder. Recently derived breeds or those from similar lineages appeared to be more susceptible to certain disorders that affect all closely related purebred dogs, whereas disorders with equal prevalence in the 2 populations suggested that those disorders represented more ancient mutations that are widely spread through the dog population. Results provided insight on how breeding practices may reduce prevalence of a disorder.

Terminology, concepts, and models in genetic epidemiology.

PubMed

Teare, M Dawn; Koref, Mauro F Santibàñez

2011-01-01

Genetic epidemiology brings together approaches and techniques developed in mathematical genetics and statistics, medical genetics, quantitative genetics, and epidemiology. In the 1980s, the focus was on the mapping and identification of genes where defects had large effects at the individual level. More recently, statistical and experimental advances have made possible to identify and characterise genes associated with small effects at the individual level. In this chapter, we provide a brief outline of the models, concepts, and terminology used in genetic epidemiology.

[The emphases and basic procedures of genetic counseling in psychotherapeutic model].

PubMed

Zhang, Yuan-Zhi; Zhong, Nanbert

2006-11-01

The emphases and basic procedures of genetic counseling are all different with those in old models. In the psychotherapeutic model, genetic counseling will not only focus on counselees' genetic disorders and birth defects, but also their psychological problems. "Client-centered therapy" termed by Carl Rogers plays an important role in genetic counseling process. The basic procedures of psychotherapeutic model of genetic counseling include 7 steps: initial contact, introduction, agendas, inquiry of family history, presenting information, closing the session and follow-up.

Defective mitochondrial rRNA methyltransferase MRM2 causes MELAS-like clinical syndrome

PubMed Central

Garone, Caterina; D’Souza, Aaron R; Dallabona, Cristina; Lodi, Tiziana; Rebelo-Guiomar, Pedro; Rorbach, Joanna; Donati, Maria Alice; Procopio, Elena; Montomoli, Martino; Guerrini, Renzo; Zeviani, Massimo; Calvo, Sarah E; Mootha, Vamsi K; DiMauro, Salvatore; Ferrero, Ileana; Minczuk, Michal

2017-01-01

Abstract Defects in nuclear-encoded proteins of the mitochondrial translation machinery cause early-onset and tissue-specific deficiency of one or more OXPHOS complexes. Here, we report a 7-year-old Italian boy with childhood-onset rapidly progressive encephalomyopathy and stroke-like episodes. Multiple OXPHOS defects and decreased mtDNA copy number (40%) were detected in muscle homogenate. Clinical features combined with low level of plasma citrulline were highly suggestive of mitochondrial encephalopathy, lactic acidosis and stroke-like episodes (MELAS) syndrome, however, the common m.3243 A > G mutation was excluded. Targeted exome sequencing of genes encoding the mitochondrial proteome identified a damaging mutation, c.567 G > A, affecting a highly conserved amino acid residue (p.Gly189Arg) of the MRM2 protein. MRM2 has never before been linked to a human disease and encodes an enzyme responsible for 2’-O-methyl modification at position U1369 in the human mitochondrial 16S rRNA. We generated a knockout yeast model for the orthologous gene that showed a defect in respiration and the reduction of the 2’-O-methyl modification at the equivalent position (U2791) in the yeast mitochondrial 21S rRNA. Complementation with the mrm2 allele carrying the equivalent yeast mutation failed to rescue the respiratory phenotype, which was instead completely rescued by expressing the wild-type allele. Our findings establish that defective MRM2 causes a MELAS-like phenotype, and suggests the genetic screening of the MRM2 gene in patients with a m.3243 A > G negative MELAS-like presentation. PMID:28973171

Defective mitochondrial rRNA methyltransferase MRM2 causes MELAS-like clinical syndrome.

PubMed

Garone, Caterina; D'Souza, Aaron R; Dallabona, Cristina; Lodi, Tiziana; Rebelo-Guiomar, Pedro; Rorbach, Joanna; Donati, Maria Alice; Procopio, Elena; Montomoli, Martino; Guerrini, Renzo; Zeviani, Massimo; Calvo, Sarah E; Mootha, Vamsi K; DiMauro, Salvatore; Ferrero, Ileana; Minczuk, Michal

2017-11-01

Defects in nuclear-encoded proteins of the mitochondrial translation machinery cause early-onset and tissue-specific deficiency of one or more OXPHOS complexes. Here, we report a 7-year-old Italian boy with childhood-onset rapidly progressive encephalomyopathy and stroke-like episodes. Multiple OXPHOS defects and decreased mtDNA copy number (40%) were detected in muscle homogenate. Clinical features combined with low level of plasma citrulline were highly suggestive of mitochondrial encephalopathy, lactic acidosis and stroke-like episodes (MELAS) syndrome, however, the common m.3243 A > G mutation was excluded. Targeted exome sequencing of genes encoding the mitochondrial proteome identified a damaging mutation, c.567 G > A, affecting a highly conserved amino acid residue (p.Gly189Arg) of the MRM2 protein. MRM2 has never before been linked to a human disease and encodes an enzyme responsible for 2'-O-methyl modification at position U1369 in the human mitochondrial 16S rRNA. We generated a knockout yeast model for the orthologous gene that showed a defect in respiration and the reduction of the 2'-O-methyl modification at the equivalent position (U2791) in the yeast mitochondrial 21S rRNA. Complementation with the mrm2 allele carrying the equivalent yeast mutation failed to rescue the respiratory phenotype, which was instead completely rescued by expressing the wild-type allele. Our findings establish that defective MRM2 causes a MELAS-like phenotype, and suggests the genetic screening of the MRM2 gene in patients with a m.3243 A > G negative MELAS-like presentation. © The Author 2017. Published by Oxford University Press.

Genetic and Molecular Characterization of the Caenorhabditis Elegans Spermatogenesis-Defective Gene Spe-17

PubMed Central

L'Hernault, S. W.; Benian, G. M.; Emmons, R. B.

1993-01-01

Two self-sterile mutations that define the spermatogenesis-defective gene spe-17 have been analyzed. These mutations affect unc-22 and fail to complement each other for both Unc-22 and spermatogenesis defects. Both of these mutations are deficiencies (hcDf1 and hDf13) that affect more than one transcription unit. Genomic DNA adjacent to and including the region deleted by the smaller deficiency (hcDf1) has been sequenced and four mRNAs (including unc-22) have been localized to this sequenced region. The three non unc-22 mRNAs are shown to be sex-specific: a 1.2-kb mRNA that can be detected in sperm-free hermaphrodites and 1.2- and 0.56-kb mRNAs found in males. hDf13 deletes at least 55 kb of chromosome IV, including all of unc-22, both male-specific mRNAs and at least part of the female-specific mRNA. hcDf1, which is approximately 15.6 kb, deletes only the 5' end of unc-22 and the gene that encodes the 0.56-kb male-specific mRNA. The common defect that apparently accounts for the defective sperm in hcDf1 and hDf13 homozygotes is deletion of the spe-17 gene, which encodes the 0.56-kb mRNA. Strains carrying two copies of either deletion are self-fertile when they are transgenic for any of four extrachromosomal array that include spe-17. We have sequenced two spe-17 cDNAs, and the deduced 142 amino acid protein sequence is highly charged and rich in serine and threonine, but shows no significant homology to any previously determined protein sequence. PMID:8349108

FANCB is essential in the male germline and regulates H3K9 methylation on the sex chromosomes during meiosis

PubMed Central

Kato, Yasuko; Alavattam, Kris G.; Sin, Ho-Su; Meetei, Amom Ruhikanta; Pang, Qishen; Andreassen, Paul R.; Namekawa, Satoshi H.

2015-01-01

Fanconi anemia (FA) is a recessive X-linked and autosomal genetic disease associated with bone marrow failure and increased cancer, as well as severe germline defects such as hypogonadism and germ cell depletion. Although deficiencies in FA factors are commonly associated with germ cell defects, it remains unknown whether the FA pathway is involved in unique epigenetic events in germ cells. In this study, we generated Fancb mutant mice, the first mouse model of X-linked FA, and identified a novel function of the FA pathway in epigenetic regulation during mammalian gametogenesis. Fancb mutant mice were infertile and exhibited primordial germ cell (PGC) defects during embryogenesis. Further, Fancb mutation resulted in the reduction of undifferentiated spermatogonia in spermatogenesis, suggesting that FANCB regulates the maintenance of undifferentiated spermatogonia. Additionally, based on functional studies, we dissected the pathway in which FANCB functions during meiosis. The localization of FANCB on sex chromosomes is dependent on MDC1, a binding partner of H2AX phosphorylated at serine 139 (γH2AX), which initiates chromosome-wide silencing. Also, FANCB is required for FANCD2 localization during meiosis, suggesting that the role of FANCB in the activation of the FA pathway is common to both meiosis and somatic DNA damage responses. H3K9me2, a silent epigenetic mark, was decreased on sex chromosomes, whereas H3K9me3 was increased on sex chromosomes in Fancb mutant spermatocytes. Taken together, these results indicate that FANCB functions at critical stages of germ cell development and reveal a novel function of the FA pathway in the regulation of H3K9 methylation in the germline. PMID:26123487

Congenital hemangioma in spondylocostal dysostosis: a novel association*

PubMed Central

Salinas-Torres, Victor Michael

2016-01-01

Congenital hemangioma is a benign tumor caused by dysfunction in embryogenesis and vasculogenesis, which progresses during fetal life to manifest as fully developed at birth. Although hemangiomas are the most common tumor of infancy, rapidly involuting congenital hemangioma has not been described in spondylocostal dysostosis. I report the novel association of congenital hemangioma and spondylocostal dysostosis in a Mexican newborn female patient with neural tube defects. Given the embryological relationship between skin and nervous system, I surmise that this association is not coincidental. I also propose that these morphologic alterations be incorporated to the spondylocostal dysostosis phenotype and specifically looked for in other affected children, in order to provide appropriate medical management and genetic counseling. PMID:28300884

Plant meiosis: the means to 1N.

PubMed

Bhatt, A M; Canales, C; Dickinson, H G

2001-03-01

Meiosis is pivotal in the life history of plants. In addition to providing an opportunity for genetic reassortment, it marks the transition from diploid sporophyte to haploid gametophyte. Recent molecular data suggest that, like animals, plants possess a common set of genes (also conserved in eukaryotic microorganisms) responsible for meiotic recombination and chromosome segregation. However, unlike animals, plant meiocytes do not differentiate from a pool of primordial germ cells, but rather arise de novo from a germline formed from sub-epidermal cells in the anthers and ovules. Mutants defective in the specification of these reproductive cell lines and disrupted in different aspects of the meiotic process are beginning to reveal many features unique to plant meiosis.

Congenital hemangioma in spondylocostal dysostosis: a novel association.

PubMed

Salinas-Torres, Victor Michael

2016-01-01

Congenital hemangioma is a benign tumor caused by dysfunction in embryogenesis and vasculogenesis, which progresses during fetal life to manifest as fully developed at birth. Although hemangiomas are the most common tumor of infancy, rapidly involuting congenital hemangioma has not been described in spondylocostal dysostosis. I report the novel association of congenital hemangioma and spondylocostal dysostosis in a Mexican newborn female patient with neural tube defects. Given the embryological relationship between skin and nervous system, I surmise that this association is not coincidental. I also propose that these morphologic alterations be incorporated to the spondylocostal dysostosis phenotype and specifically looked for in other affected children, in order to provide appropriate medical management and genetic counseling.

Advances in the diagnosis and treatment of cystic fibrosis.

PubMed

Martiniano, Stacey L; Hoppe, Jordana E; Sagel, Scott D; Zemanick, Edith T

2014-08-01

CF is a genetic, life-shortening, multisystem disease that is most commonly diagnosed through newborn screen performed in all 50 states in the United States. In the past, therapies for CF lung disease have primarily targeted the downstream effects of a dysfunctional CFTR protein. Newer CFTR modulator therapies, targeting the basic defect in CF, are available for a limited group of people with CF, and offer the hope of improved treatment options for many more people with CF in the near future. Best practice is directed by consensus clinical care guidelines from the CFF and is provided with a multidisciplinary approach by the team at the CF care center and the primary care office.

Osteochondrosis dissecans of the elbow.

PubMed

Van Sonhoven, F; Geusens, E; Nijs, S

2009-01-01

This case shows a typical presentation of an osteochondrosis dissecans lesion on the capitellum, with associated intra-articular loose bodie(s), diagnosed on plain film. Osteochondrosis dissecans (OCD) is a rather common entity. Mostly the knee joint is involved. Only 5% of OCD lesions occur in the elbow joint. Possible causes of osteochondrosis dissecans include (repetitive) trauma (e.g. in throwing sports or gymnastics), ischemia, ossification defects, and genetic factors. Conventional radiography mostly has a low sensitivity to detect OCD lesions, and is often normal in early stages. CT is more sensitive to detect intra-articular loose bodies. MRI detects very early stages of OCD and radiographically occult lesions that may not be evident on CT.

Personalised Medicine: Genome Maintenance Lessons Learned from Studies in Yeast as a Model Organism.

PubMed

Abugable, Arwa A; Awwad, Dahlia A; Fleifel, Dalia; Ali, Mohamed M; El-Khamisy, Sherif; Elserafy, Menattallah

2017-01-01

Yeast research has been tremendously contributing to the understanding of a variety of molecular pathways due to the ease of its genetic manipulation, fast doubling time as well as being cost-effective. The understanding of these pathways did not only help scientists learn more about the cellular functions but also assisted in deciphering the genetic and cellular defects behind multiple diseases. Hence, yeast research not only opened the doors for transforming basic research into applied research, but also paved the roads for improving diagnosis and innovating personalized therapy of different diseases. In this chapter, we discuss how yeast research has contributed to understanding major genome maintenance pathways such as the S-phase checkpoint activation pathways, repair via homologous recombination and non-homologous end joining as well as topoisomerases-induced protein linked DNA breaks repair. Defects in these pathways lead to neurodegenerative diseases and cancer. Thus, the understanding of the exact genetic defects underlying these diseases allowed the development of personalized medicine, improving the diagnosis and treatment and overcoming the detriments of current conventional therapies such as the side effects, toxicity as well as drug resistance.

A practical guide to the management of anophthalmia and microphthalmia.

PubMed

Ragge, N K; Subak-Sharpe, I D; Collin, J R O

2007-10-01

Congenital anophthalmia and microphthalmia are rare developmental defects of the globe. They often arise in conjunction with other ocular defects such as coloboma and orbital cyst. They may also be part of more generalised syndromes, such as CHARGE syndrome. Anophthalmia, microphthalmia, and coloboma are likely to be caused by disturbances of the morphogenetic pathway that controls eye development, either as a result of primary genetic defect, or external gestational factors, including infection or drugs that can influence the smooth processes of morphogenesis. The ophthalmologist is often the primary carer for children with anophthalmia and microphthalmia, and as such can coordinate the multidisciplinary input needed to offer optimal care for these individuals, including vision and family support services. They are able to assess the vision and maximise the visual potential of the child and they can also ensure that the cosmetic and social impact of anophthalmia or microphthalmia is minimised by starting socket expansion or referring to a specialist oculoplastics and prosthetics unit. A coordinated approach with paediatrics is necessary to manage any associated conditions. Genetic diagnosis and investigations can greatly assist in providing a diagnosis and informed genetic counselling.

An siRNA-based functional genomics screen for the identification of regulators of ciliogenesis and ciliopathy genes

PubMed Central

Racher, Hilary; Phelps, Ian G.; Toedt, Grischa; Kennedy, Julie; Wunderlich, Kirsten A.; Sorusch, Nasrin; Abdelhamed, Zakia A.; Natarajan, Subaashini; Herridge, Warren; van Reeuwijk, Jeroen; Horn, Nicola; Boldt, Karsten; Parry, David A.; Letteboer, Stef J.F.; Roosing, Susanne; Adams, Matthew; Bell, Sandra M.; Bond, Jacquelyn; Higgins, Julie; Morrison, Ewan E.; Tomlinson, Darren C.; Slaats, Gisela G.; van Dam, Teunis J. P.; Huang, Lijia; Kessler, Kristin; Giessl, Andreas; Logan, Clare V.; Boyle, Evan A.; Shendure, Jay; Anazi, Shamsa; Aldahmesh, Mohammed; Al Hazzaa, Selwa; Hegele, Robert A.; Ober, Carole; Frosk, Patrick; Mhanni, Aizeddin A.; Chodirker, Bernard N.; Chudley, Albert E.; Lamont, Ryan; Bernier, Francois P.; Beaulieu, Chandree L.; Gordon, Paul; Pon, Richard T.; Donahue, Clem; Barkovich, A. James; Wolf, Louis; Toomes, Carmel; Thiel, Christian T.; Boycott, Kym M.; McKibbin, Martin; Inglehearn, Chris F.; Stewart, Fiona; Omran, Heymut; Huynen, Martijn A.; Sergouniotis, Panagiotis I.; Alkuraya, Fowzan S.; Parboosingh, Jillian S.; Innes, A Micheil; Willoughby, Colin E.; Giles, Rachel H.; Webster, Andrew R.; Ueffing, Marius; Blacque, Oliver; Gleeson, Joseph G.; Wolfrum, Uwe; Beales, Philip L.; Gibson, Toby

2015-01-01

Defects in primary cilium biogenesis underlie the ciliopathies, a growing group of genetic disorders. We describe a whole genome siRNA-based reverse genetics screen for defects in biogenesis and/or maintenance of the primary cilium, obtaining a global resource. We identify 112 candidate ciliogenesis and ciliopathy genes, including 44 components of the ubiquitin-proteasome system, 12 G-protein-coupled receptors, and three pre-mRNA processing factors (PRPF6, PRPF8 and PRPF31) mutated in autosomal dominant retinitis pigmentosa. The PRPFs localise to the connecting cilium, and PRPF8- and PRPF31-mutated cells have ciliary defects. Combining the screen with exome sequencing data identified recessive mutations in PIBF1/CEP90 and C21orf2/LRRC76 as causes of the ciliopathies Joubert and Jeune syndromes. Biochemical approaches place C21orf2 within key ciliopathy-associated protein modules, offering an explanation for the skeletal and retinal involvement observed in individuals with C21orf2-variants. Our global, unbiased approaches provide insights into ciliogenesis complexity and identify roles for unanticipated pathways in human genetic disease. PMID:26167768

Genetic aspects of hypothalamic and pituitary gland development.

PubMed

McCabe, Mark J; Dattani, Mehul T

2014-01-01

Hypothalamo-pituitary development during embryogenesis is a highly complex process involving the interaction of a network of spatiotemporally regulated signaling molecules and transcription factors. Mutations in any of the genes encoding these components can lead to congenital hypopituitarism, which is often associated with a wide spectrum of defects affecting craniofacial/midline development. In turn, these defects can be incompatible with life, or lead to disorders encompassing holoprosencephaly (HPE) and cleft palate, and septo-optic dysplasia (SOD). In recent years, there has been increasing evidence of an overlapping genotype between this spectrum of disorders and Kallmann syndrome (KS), defined as the association of hypogonadotropic hypogonadism (HH) and anosmia. This is consistent with the known phenotypic overlap between these disorders and opens a new avenue of identifying novel genetic causes of the hypopituitarism spectrum. This chapter reviews the genetic and molecular events leading to the successful development of the hypothalamo-pituitary axis during embryogenesis, and focuses on genes in which variations/mutations occur, leading to congenital hypopituitarism and associated defects. © 2014 Elsevier B.V. All rights reserved.

Mammalian Cardiovascular Patterning as Determined by Hemodynamic Forces and Blood Vessel Genetics

NASA Astrophysics Data System (ADS)

Anderson, Gregory Arthur

Cardiovascular development is a process that involves the timing of multiple molecular events, and numerous subtle three-dimensional conformational changes. Traditional developmental biology techniques have provided large quantities of information as to how these complex organ systems develop. However, the major drawback of the majority of current developmental biological imaging is that they are two-dimensional in nature. It is now well recognized that circulation of blood is required for normal patterning and remodeling of blood vessels. Normal blood vessel formation is dependent upon a complex network of signaling pathways, and genetic mutations in these pathways leads to impaired vascular development, heart failure, and lethality. As such, it is not surprising that mutant mice with aberrant cardiovascular patterning are so common, since normal development requires proper coordination between three systems: the heart, the blood, and the vasculature. This thesis describes the implementation of a three-dimensional imaging technique, optical projection tomography (OPT), in conjunction with a computer-based registration algorithm to statistically analyze developmental differences in groups of wild-type mouse embryos. Embryos that differ by only a few hours' gestational time are shown to have developmental differences in blood vessel formation and heart development progression that can be discerned. This thesis describes how we analyzed mouse models of cardiovascular perturbation by OPT to detect morphological differences in embryonic development in both qualitative and quantitative ways. Both a blood vessel specific mutation and a cardiac specific mutation were analyzed, providing evidence that developmental defects of these types can be quantified. Finally, we describe the implementation of OPT imaging to identify statistically significant phenotypes from three different mouse models of cardiovascular perturbation across a range of developmental time points. Image registration methods, combined with intensity- and deformation-based analyses are described and utilized to fully characterize myosin light chain 2a (Mlc2a), delta-like ligand 4 (Dll4), and Endoglin (Eng) mutant mouse embryos. We show that Eng mutant embryos are statistically similar to the Mlc2a phenotype, confirming that these mouse mutants suffer from a primary cardiac developmental defect. Thus, a loss of hemodynamic force caused by defective pumping of the heart is the primary developmental defect affecting these mice.

Impact of the F508del mutation on ovine CFTR, a Cl− channel with enhanced conductance and ATP-dependent gating

PubMed Central

Cai, Zhiwei; Palmai-Pallag, Timea; Khuituan, Pissared; Mutolo, Michael J; Boinot, Clément; Liu, Beihui; Scott-Ward, Toby S; Callebaut, Isabelle; Harris, Ann; Sheppard, David N

2015-01-01

Cross-species comparative studies are a powerful approach to understanding the epithelial Cl− channel cystic fibrosis transmembrane conductance regulator (CFTR), which is defective in the genetic disease cystic fibrosis (CF). Here, we investigate the single-channel behaviour of ovine CFTR and the impact of the most common CF mutation, F508del-CFTR, using excised inside-out membrane patches from transiently transfected CHO cells. Like human CFTR, ovine CFTR formed a weakly inwardly rectifying Cl− channel regulated by PKA-dependent phosphorylation, inhibited by the open-channel blocker glibenclamide. However, for three reasons, ovine CFTR was noticeably more active than human CFTR. First, single-channel conductance was increased. Second, open probability was augmented because the frequency and duration of channel openings were increased. Third, with enhanced affinity and efficacy, ATP more strongly stimulated ovine CFTR channel gating. Consistent with these data, the CFTR modulator phloxine B failed to potentiate ovine CFTR Cl− currents. Similar to its impact on human CFTR, the F508del mutation caused a temperature-sensitive folding defect, which disrupted ovine CFTR protein processing and reduced membrane stability. However, the F508del mutation had reduced impact on ovine CFTR channel gating in contrast to its marked effects on human CFTR. We conclude that ovine CFTR forms a regulated Cl− channel with enhanced conductance and ATP-dependent channel gating. This phylogenetic analysis of CFTR structure and function demonstrates that subtle changes in structure have pronounced effects on channel function and the consequences of the CF mutation F508del. Key points Malfunction of the cystic fibrosis transmembrane conductance regulator (CFTR), a gated pathway for chloride movement, causes the common life-shortening genetic disease cystic fibrosis (CF). Towards the development of a sheep model of CF, we have investigated the function of sheep CFTR. We found that sheep CFTR was noticeably more active than human CFTR, while the most common CF mutation, F508del, had reduced impact on sheep CFTR function. Our results demonstrate that subtle changes in protein structure have marked effects on CFTR function and the consequences of the CF mutation F508del. PMID:25763566

Selected environmental risk factors and congenital heart defects.

PubMed

Kuciene, Renata; Dulskiene, Virginija

2008-01-01

The aim of the article is to review the published scientific literature and epidemiological studies about the effect of selected environmental risk factors on congenital heart defects in infants. According to recent reports, the prevalence of congenital heart defects is around 1% of live births. Congenital heart malformations are the leading cause of infant mortality. Unfortunately, the majority of the causes of heart defects remain unknown. These malformations are caused by interaction of genetic and environmental factors. The article reviews selected environmental risk factors: maternal illnesses and conditions associated with metabolic disorder (maternal diabetes, obesity, phenylketonuria), maternal lifestyle factors (alcohol use, smoking), which may increase the risk of congenital heart defects.

Pseudotumor of the distal common bile duct at endoscopic retrograde cholangiopancreatography

PubMed Central

Tan, Justin H.; Coakley, Fergus V; Wang, Zhen J.; Poder, Liina; Webb, Emily; Yeh, Benjamin M.

2010-01-01

Background Prior studies have described a pseudocalculus appearance in the distal common bile duct as a normal variant at cholangiography. The objective of this study is to describe the occurrence of pseudotumor in the distal common bile duct at endoscopic retrograde cholangiopancreatography (ERCP). Methods Nine patients who underwent ERCP between May 2004 and July 2008 were identified as having a transient eccentric mural-based filling defect in the distal common bile duct. A single reader systematically reviewed all studies and recorded the imaging findings. Results The mean diameter of the filling defect was 9 mm (range, 5 to 11). Eight patients had resolution of the filling defect during the same ERCP or on a subsequent ERCP, and in 2 of these patients the inferior border of the filling defect was not well visualized. The other patient underwent surgical resection of a presumed tumor with no evidence of malignancy on surgical pathology. Conclusion An eccentric mural-based filling defect in the distal common bile duct can be artifactual in nature and may reflect transient contraction of the sphincter of Oddi. Recognition of this pseudotumor may help avoid unnecessary surgery. PMID:21724120

Conditional Creation and Rescue of Nipbl-Deficiency in Mice Reveals Multiple Determinants of Risk for Congenital Heart Defects

PubMed Central

Jacobs, Russell E.; Lopez-Burks, Martha E.; Choi, Hojae; Wikenheiser, Jamie; Hallgrimsson, Benedikt; Jamniczky, Heather A.; Fraser, Scott E.; Lander, Arthur D.; Calof, Anne L.

2016-01-01

Elucidating the causes of congenital heart defects is made difficult by the complex morphogenesis of the mammalian heart, which takes place early in development, involves contributions from multiple germ layers, and is controlled by many genes. Here, we use a conditional/invertible genetic strategy to identify the cell lineage(s) responsible for the development of heart defects in a Nipbl-deficient mouse model of Cornelia de Lange Syndrome, in which global yet subtle transcriptional dysregulation leads to development of atrial septal defects (ASDs) at high frequency. Using an approach that allows for recombinase-mediated creation or rescue of Nipbl deficiency in different lineages, we uncover complex interactions between the cardiac mesoderm, endoderm, and the rest of the embryo, whereby the risk conferred by genetic abnormality in any one lineage is modified, in a surprisingly non-additive way, by the status of others. We argue that these results are best understood in the context of a model in which the risk of heart defects is associated with the adequacy of early progenitor cell populations relative to the sizes of the structures they must eventually form. PMID:27606604

Caenorhabditis elegans flamingo cadherin fmi-1 regulates GABAergic neuronal development.

PubMed

Najarro, Elvis Huarcaya; Wong, Lianna; Zhen, Mei; Carpio, Edgar Pinedo; Goncharov, Alexandr; Garriga, Gian; Lundquist, Erik A; Jin, Yishi; Ackley, Brian D

2012-03-21

In a genetic screen for regulators of synaptic morphology, we identified the single Caenorhabditis elegans flamingo-like cadherin fmi-1. The fmi-1 mutants exhibit defective axon pathfinding, reduced synapse number, aberrant synapse size and morphology, as well as an abnormal accumulation of synaptic vesicles at nonsynaptic regions. Although FMI-1 is primarily expressed in the nervous system, it is not expressed in the ventral D-type (VD) GABAergic motorneurons, which are defective in fmi-1 mutants. The axon and synaptic defects of VD neurons could be rescued when fmi-1 was expressed exclusively in non-VD neighboring neurons, suggesting a cell nonautonomous action of FMI-1. FMI-1 protein that lacked its intracellular domain still retained its ability to rescue the vesicle accumulation defects of GABAergic motorneurons, indicating that the extracellular domain was sufficient for this function of FMI-1 in GABAergic neuromuscular junction development. Mutations in cdh-4, a Fat-like cadherin, cause similar defects in GABAergic motorneurons. The cdh-4 is expressed by the VD neurons and seems to function in the same genetic pathway as fmi-1 to regulate GABAergic neuron development. Thus, fmi-1 and cdh-4 cadherins might act together to regulate synapse development and axon pathfinding.

Fetal anterior abdominal wall defects: prenatal imaging by magnetic resonance imaging.

PubMed

Victoria, Teresa; Andronikou, Savvas; Bowen, Diana; Laje, Pablo; Weiss, Dana A; Johnson, Ann M; Peranteau, William H; Canning, Douglas A; Adzick, N Scott

2018-04-01

Abdominal wall defects range from the mild umbilical cord hernia to the highly complex limb-body wall syndrome. The most common defects are gastroschisis and omphalocele, and the rarer ones include the exstrophy complex, pentalogy of Cantrell and limb-body wall syndrome. Although all have a common feature of viscera herniation through a defect in the anterior body wall, their imaging features and, more important, postnatal management, differ widely. Correct diagnosis of each entity is imperative in order to achieve appropriate and accurate prenatal counseling and postnatal management. In this paper, we discuss fetal abdominal wall defects and present diagnostic pearls to aid with diagnosis.

Hypermobility, the Ehlers-Danlos syndromes and chronic pain.

PubMed

Syx, Delfien; De Wandele, Inge; Rombaut, Lies; Malfait, Fransiska

2017-01-01

Chronic widespread pain is a common complaint among individuals affected by generalised joint hypermobility. In the absence of other conditions that cause chronic pain, these individuals are usually diagnosed with joint hypermobility syndrome (JHS). JHS is a multifactorial trait with a strong genetic basis, but no specific genetic markers. Clinical overlap of JHS is seen with heritable connective tissue disorders, particularly with the Ehlers-Danlos syndrome, hypermobile type (hEDS). The Ehlers-Danlos syndromes (EDS) comprise a heterogeneous group of rare monogenic conditions that are characterised by joint hypermobility, skin and vascular fragility and generalised connective tissue friability, and are caused by genetic defects in an array of extracellular matrix genes. The genetic basis of hEDS remains however unknown, in contrast to other well-described EDS subtypes. In view of the considerable clinical overlap with JHS, many consider it and hEDS to be a single clinical entity. Clinical experience and a limited number of clinical studies show that chronic pain also is common in EDS patients, especially in hEDS. The specific underlying causes and mechanisms of pain in JHS and EDS remain poorly understood. Factors likely contributing to the generation and chronicity of pain include nociceptive pain, directly based on structural changes in affected joints, muscle and connective tissue; neuropathic pain; impaired proprioception and muscle weakness; and central sensitisation. These mechanisms are not mutually exclusive, and likely more than one mechanism may be present. Furthermore, anxiety, depression, and other variables may influence the phenotype. Chronic pain in JHS and EDS patients often is inadequately controlled by traditional analgesics and physical therapy. In view of the high prevalence of these underrecognised conditions, future studies addressing the nature and mediators of chronic pain are needed in order to potentially identify novel targets for therapeutic intervention and optimise treatment.

[Molecular updates on Usher syndrome].

PubMed

Roux, A-F

2005-01-01

Usher syndrome (USH) is an autosomal recessive disorder characterized by the association of sensorineural hearing loss and retinitis pigmentosa (RP). Usher syndrome is both clinically and genetically heterogeneous. Three clinical subtypes are defined with respect to vestibular dysfunction and the degree of hearing loss. Type I (USH1) patients have profound hearing loss and vestibular dysfunction from birth. Type II (USH2) is the most frequent and patients tend to have less severe hearing impairment and normal vestibular response. Type III (USH3) is characterized by a progressive loss of hearing and is found more frequently among Finnish patients. Recently, major breakthroughs have been made in the molecular genetics of Usher syndrome as a number of chromosomal loci and causative genes have been identified in each clinical subtype. Twelve loci are known and the corresponding genes have been cloned for six of them. Although their functions are not always clearly established, a common role is emerging for the proteins identified within each subtype. As a result, each subtype could emanate from defects affecting distinct cellular mechanisms.

Genetic linkage of autosomal dominant juvenile glaucoma to 1q21-q31 in three affected pedigrees

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wiggs, J.L.; Paglinauan, C.; Fine, A.

1994-05-15

Glaucoma is a common disorder that results in irreversible damage to the optic nerve, causing absolute blindness. In most cases, the optic nerve is damaged by an elevation of the intraocular pressure that is the result of an abnormality in the normal drainage function of the trabecular meshwork. A family history of glaucoma is an important risk factor for the disease, suggesting that genetic defects predisposing to this condition are likely. Three pedigrees segregating an autosomal dominant juvenile glaucoma demonstrated significant linkage to a group of closely spaced markers on chromosome 1. These results confirm the initial mapping of thismore » disease and suggest that this region on chromosome 1 contains an important locus for juvenile glaucoma. The authors describe recombination events that improve the localization of the responsible gene, reducing the size of the candidate region from 30 to 12 cM. 27 refs., 2 figs., 1 tab.« less

Novel disease susceptibility factors for fungal necrotrophic pathogens in Arabidopsis.

PubMed

Dobón, Albor; Canet, Juan Vicente; García-Andrade, Javier; Angulo, Carlos; Neumetzler, Lutz; Persson, Staffan; Vera, Pablo

2015-04-01

Host cells use an intricate signaling system to respond to invasions by pathogenic microorganisms. Although several signaling components of disease resistance against necrotrophic fungal pathogens have been identified, our understanding for how molecular components and host processes contribute to plant disease susceptibility is rather sparse. Here, we identified four transcription factors (TFs) from Arabidopsis that limit pathogen spread. Arabidopsis mutants defective in any of these TFs displayed increased disease susceptibility to Botrytis cinerea and Plectosphaerella cucumerina, and a general activation of non-immune host processes that contribute to plant disease susceptibility. Transcriptome analyses revealed that the mutants share a common transcriptional signature of 77 up-regulated genes. We characterized several of the up-regulated genes that encode peptides with a secretion signal, which we named PROVIR (for provirulence) factors. Forward and reverse genetic analyses revealed that many of the PROVIRs are important for disease susceptibility of the host to fungal necrotrophs. The TFs and PROVIRs identified in our work thus represent novel genetic determinants for plant disease susceptibility to necrotrophic fungal pathogens.

Prevention of type 2 diabetes mellitus in women with previous gestational diabetes mellitus

PubMed Central

Moon, Joon Ho; Kwak, Soo Heon; Jang, Hak C.

2017-01-01

Gestational diabetes mellitus (GDM), defined as any degree of glucose intolerance with onset or first recognition during pregnancy, is characterized by underlying maternal defects in the β-cell response to insulin during pregnancy. Women with a previous history of GDM have a greater than 7-fold higher risk of developing postpartum diabetes compared with women without GDM. Various risk factors for postpartum diabetes have been identified, including maternal age, glucose levels in pregnancy, family history of diabetes, pre-pregnancy and postpartum body mass index, dietary patterns, physical activity, and breastfeeding. Genetic studies revealed that GDM shares common genetic variants with type 2 diabetes. A number of lifestyle interventional trials that aimed to ameliorate modifiable risk factors, including diet, exercise, and breastfeeding, succeeded in reducing the incidence of postpartum diabetes, weight retention, and other obesity-related morbidities. The present review summarizes the findings of previous studies on the incidence and risk factors of postpartum diabetes and discusses recent lifestyle interventional trials that attempted to prevent postpartum diabetes. PMID:28049284

Exploring molecular genetics of bladder cancer: lessons learned from mouse models

PubMed Central

Ahmad, Imran; Sansom, Owen J.; Leung, Hing Y.

2012-01-01

Urothelial cell carcinoma (UCC) of the bladder is one of the most common malignancies worldwide, causing considerable morbidity and mortality. It is unusual among the epithelial carcinomas because tumorigenesis can occur by two distinct pathways: low-grade, recurring papillary tumours usually contain oncogenic mutations in FGFR3 or HRAS, whereas high-grade, muscle-invasive tumours with metastatic potential generally have defects in the pathways controlled by the tumour suppressors p53 and retinoblastoma (RB). Over the past 20 years, a plethora of genetically engineered mouse (GEM) models of UCC have been developed, containing deletions or mutations of key tumour suppressor genes or oncogenes. In this review, we provide an up-to-date summary of these GEM models, analyse their flaws and weaknesses, discuss how they have advanced our understanding of UCC at the molecular level, and comment on their translational potential. We also highlight recent studies supporting a role for dysregulated Wnt signalling in UCC and the development of mouse models that recapitulate this dysregulation. PMID:22422829

Prevention of type 2 diabetes mellitus in women with previous gestational diabetes mellitus.

PubMed

Moon, Joon Ho; Kwak, Soo Heon; Jang, Hak C

2017-01-01

Gestational diabetes mellitus (GDM), defined as any degree of glucose intolerance with onset or first recognition during pregnancy, is characterized by underlying maternal defects in the β-cell response to insulin during pregnancy. Women with a previous history of GDM have a greater than 7-fold higher risk of developing postpartum diabetes compared with women without GDM. Various risk factors for postpartum diabetes have been identified, including maternal age, glucose levels in pregnancy, family history of diabetes, pre-pregnancy and postpartum body mass index, dietary patterns, physical activity, and breastfeeding. Genetic studies revealed that GDM shares common genetic variants with type 2 diabetes. A number of lifestyle interventional trials that aimed to ameliorate modifiable risk factors, including diet, exercise, and breastfeeding, succeeded in reducing the incidence of postpartum diabetes, weight retention, and other obesity-related morbidities. The present review summarizes the findings of previous studies on the incidence and risk factors of postpartum diabetes and discusses recent lifestyle interventional trials that attempted to prevent postpartum diabetes.

Identification of Mutations Causing Aberrant Termination and Deficient Splice Donor Site on the HBA1 Gene.

PubMed

Farashi, Samaneh; Vakili, Shadi; Garous, Negin F; Ashki, Mehri; Forouzesh Pour, Fatemeh; Zeinali, Fatemeh; Rad, Fariba; Imanian, Hashem; Azarkeivan, Azita; Najmabadi, Hossein

2016-01-01

α-Thalassemia (α-thal) is a common genetic disorder in Iran and many parts of the world. Genetic defects on the α-globin gene cluster can result in α-thal that may develop a clinical phenotype varying from almost asymptomatic to a lethal hemolytic anemia. In the present study, four Iranian individuals with hypochromic microcytic anemia, who revealed none of the known mutations responsible for α-thal, were subjected for further investigations. The thalassemic phenotype of these patients resulted from abnormal RNA splicing sites owing to a missense at the splice donor site, a truncated protein or hemoglobin (Hb) variants as a result of two different substitutions on the α1-globin gene. The clinical presentation of mild anemia in these individuals showed the contribution of these novel mutations in α-thal in spite of the dominantly expressed α2-globin gene. This study describes hematological manifestations of subjects carrying some novel mutations comparable to the reported phenotype of α(+)-thal trait.

77 FR 24960 - Agency Forms Undergoing Paperwork Reduction Act Review

Federal Register 2010, 2011, 2012, 2013, 2014

2012-04-26

... DEPARTMENT OF HEALTH AND HUMAN SERVICES Centers for Disease Control and Prevention [30Day-12-0010... Description CDC has been monitoring the occurrence of serious birth defects and genetic diseases in Atlanta... early warning system for new teratogens. In 1997, the Birth Defects Risk Factor Surveillance (BDRFS...

Can Computational Models Be Used to Assess the Developmental Toxicity of Environmental Exposures?

EPA Science Inventory

Environmental causes of birth defects include maternal exposure to drugs, chemicals, or physical agents. Environmental factors account for an estimated 3–7% of birth defects although a broader contribution is likely based on the mother’s general health status and genetic blueprin...

Primary Ciliary Dyskinesia.

PubMed

Knowles, Michael R; Zariwala, Maimoona; Leigh, Margaret

2016-09-01

Primary ciliary dyskinesia (PCD) is a recessive genetically heterogeneous disorder of motile cilia with chronic otosinopulmonary disease and organ laterality defects in ∼50% of cases. The prevalence of PCD is difficult to determine. Recent diagnostic advances through measurement of nasal nitric oxide and genetic testing has allowed rigorous diagnoses and determination of a robust clinical phenotype, which includes neonatal respiratory distress, daily nasal congestion, and wet cough starting early in life, along with organ laterality defects. There is early onset of lung disease in PCD with abnormal airflow mechanics and radiographic abnormalities detected in infancy and early childhood. Copyright © 2016 Elsevier Inc. All rights reserved.

Congenital Heart Defects in Adults : A Field Guide for Cardiologists

PubMed Central

Romfh, Anitra; Pluchinotta, Francesca Romana; Porayette, Prashob; Valente, Anne Marie; Sanders, Stephen P.

2013-01-01

Advances in cardiology and cardiac surgery allow a large proportion of patients with congenital heart defects to survive into adulthood. These patients frequently develop complications characteristic of the defect or its treatment. Consequently, adult cardiologists participating in the care of these patients need a working knowledge of the more common defects. Occasionally, patients with congenital heart defects such as atrial septal defect, Ebstein anomaly or physiologically corrected transposition of the great arteries present for the first time in adulthood. More often patients previously treated in pediatric cardiology centers have transitioned to adult congenital heart disease centers for ongoing care. Some of the more important defects in this category are tetralogy of Fallot, transposition of the great arteries, functionally single ventricle defects, and coarctation. Through this field guide, we provide an overview of the anatomy of selected defects commonly seen in an adult congenital practice using pathology specimens and clinical imaging studies. In addition, we describe the physiology, clinical presentation to the adult cardiologist, possible complications, treatment options, and outcomes. PMID:24294540

Legal implications of genetics and crime research.

PubMed

Denno, D W

1996-01-01

Two controversial topics dominate discussions of the legal implications of genetics and crime research; (1) the viability and politics of such research, which has sparked fervent debate in the USA; and (2) the current status of new or atypical criminal law defences, which would include a genetic-defect defence to criminal behaviour. This chapter begins by examining the scientifically discredited XYY chromosome syndrome defence, the major genetic-defect defence that defendants have attempted, albeit unsuccessfully. It then focuses on attorneys' efforts to test for evidence of genetic abnormality in the recent and highly publicized case involving convicted murderer Stephen Mobley, whose family history reveals four generations of violent, aggressive and behaviourally disordered men and women. Mobley is currently appealing his death sentence before the Georgia Supreme Court on the basis that the trial court denied his request both to have genetic testing performed and to have such testing allowed as evidence into court. This chapter concludes by emphasizing that the question is not whether genetic evidence will ever be admitted into court, but when and under what kinds of circumstances. No doubt, genetic evidence, and comparable kinds of biological evidence, will have a major impact on juries when such evidence is more fully accepted by the legal and scientific communities.

Cartilage constructs engineered from chondrocytes overexpressing IGF-I improve the repair of osteochondral defects in a rabbit model.

PubMed

Madry, H; Kaul, G; Zurakowski, D; Vunjak-Novakovic, G; Cucchiarini, M

2013-04-16

Tissue engineering combined with gene therapy is a promising approach for promoting articular cartilage repair. Here, we tested the hypothesis that engineered cartilage with chondrocytes overexpressing a human insulin-like growth factor I (IGF-I) gene can enhance the repair of osteochondral defects, in a manner dependent on the duration of cultivation. Genetically modified chondrocytes were cultured on biodegradable polyglycolic acid scaffolds in dynamic flow rotating bioreactors for either 10 or 28 d. The resulting cartilaginous constructs were implanted into osteochondral defects in rabbit knee joints. After 28 weeks of in vivo implantation, immunoreactivity to ß-gal was detectable in the repair tissue of defects that received lacZ constructs. Engineered cartilaginous constructs based on IGF-I-overexpressing chondrocytes markedly improved osteochondral repair compared with control (lacZ) constructs. Moreover, IGF-I constructs cultivated for 28 d in vitro significantly promoted osteochondral repair vis-à-vis similar constructs cultivated for 10 d, leading to significantly decreased osteoarthritic changes in the cartilage adjacent to the defects. Hence, the combination of spatially defined overexpression of human IGF-I within a tissue-engineered construct and prolonged bioreactor cultivation resulted in most enhanced articular cartilage repair and reduction of osteoarthritic changes in the cartilage adjacent to the defect. Such genetically enhanced tissue engineering provides a versatile tool to evaluate potential therapeutic genes in vivo and to improve our comprehension of the development of the repair tissue within articular cartilage defects. Insights gained with additional exploration using this model may lead to more effective treatment options for acute cartilage defects.

CARTILAGE CONSTRUCTS ENGINEERED FROM CHONDROCYTES OVEREXPRESSING IGF-I IMPROVE THE REPAIR OF OSTEOCHONDRAL DEFECTS IN A RABBIT MODEL

PubMed Central

Madry, Henning; Kaul, Gunter; Zurakowski, David; Vunjak-Novakovic, Gordana; Cucchiarini, Magali

2015-01-01

Tissue engineering combined with gene therapy is a promising approach for promoting articular cartilage repair. Here, we tested the hypothesis that engineered cartilage with chondrocytes over expressing a human insulin-like growth factor I (IGF-I) gene can enhance the repair of osteochondral defects, in a manner dependent on the duration of cultivation. Genetically modified chondrocytes were cultured on biodegradable polyglycolic acid scaffolds in dynamic flow rotating bioreactors for either 10 or 28 d. The resulting cartilaginous constructs were implanted into osteochondral defects in rabbit knee joints. After 28 weeks of in vivo implantation, immunoreactivity to ß-gal was detectable in the repair tissue of defects that received lacZ constructs. Engineered cartilaginous constructs based on IGF-I-over expressing chondrocytes markedly improved osteochondral repair compared with control (lacZ) constructs. Moreover, IGF-I constructs cultivated for 28 d in vitro significantly promoted osteochondral repair vis-à-vis similar constructs cultivated for 10 d, leading to significantly decreased osteoarthritic changes in the cartilage adjacent to the defects. Hence, the combination of spatially defined overexpression of human IGF-I within a tissue-engineered construct and prolonged bioreactor cultivation resulted in most enhanced articular cartilage repair and reduction of osteoarthritic changes in the cartilage adjacent to the defect. Such genetically enhanced tissue engineering provides a versatile tool to evaluate potential therapeutic genes in vivo and to improve our comprehension of the development of the repair tissue within articular cartilage defects. Insights gained with additional exploration using this model may lead to more effective treatment options for acute cartilage defects. PMID:23588785

Novel (ovario) leukodystrophy related to AARS2 mutations

PubMed Central

Dallabona, Cristina; Diodato, Daria; Kevelam, Sietske H.; Haack, Tobias B.; Wong, Lee-Jun; Salomons, Gajja S.; Baruffini, Enrico; Melchionda, Laura; Mariotti, Caterina; Strom, Tim M.; Meitinger, Thomas; Prokisch, Holger; Chapman, Kim; Colley, Alison; Rocha, Helena; Őunap, Katrin; Schiffmann, Raphael; Salsano, Ettore; Savoiardo, Mario; Hamilton, Eline M.; Abbink, Truus E. M.; Wolf, Nicole I.; Ferrero, Ileana; Lamperti, Costanza; Zeviani, Massimo; Vanderver, Adeline

2014-01-01

Objectives: The study was focused on leukoencephalopathies of unknown cause in order to define a novel, homogeneous phenotype suggestive of a common genetic defect, based on clinical and MRI findings, and to identify the causal genetic defect shared by patients with this phenotype. Methods: Independent next-generation exome-sequencing studies were performed in 2 unrelated patients with a leukoencephalopathy. MRI findings in these patients were compared with available MRIs in a database of unclassified leukoencephalopathies; 11 patients with similar MRI abnormalities were selected. Clinical and MRI findings were investigated. Results: Next-generation sequencing revealed compound heterozygous mutations in AARS2 encoding mitochondrial alanyl-tRNA synthetase in both patients. Functional studies in yeast confirmed the pathogenicity of the mutations in one patient. Sanger sequencing revealed AARS2 mutations in 4 of the 11 selected patients. The 6 patients with AARS2 mutations had childhood- to adulthood-onset signs of neurologic deterioration consisting of ataxia, spasticity, and cognitive decline with features of frontal lobe dysfunction. MRIs showed a leukoencephalopathy with striking involvement of left-right connections, descending tracts, and cerebellar atrophy. All female patients had ovarian failure. None of the patients had signs of a cardiomyopathy. Conclusions: Mutations in AARS2 have been found in a severe form of infantile cardiomyopathy in 2 families. We present 6 patients with a new phenotype caused by AARS2 mutations, characterized by leukoencephalopathy and, in female patients, ovarian failure, indicating that the phenotypic spectrum associated with AARS2 variants is much wider than previously reported. PMID:24808023

HLB1 Is a Tetratricopeptide Repeat Domain-Containing Protein That Operates at the Intersection of the Exocytic and Endocytic Pathways at the TGN/EE in Arabidopsis

DOE PAGES

Sparks, J. Alan; Kwon, Taegun; Renna, Luciana; ...

2016-03-03

The endomembrane system plays essential roles in plant development, but the proteome responsible for its function and organization remains largely uncharacterized in plants. For this study, we identified and characterized the HYPERSENSITIVE TO LATRUNCULIN B1 (HLB1) protein isolated through a forward-genetic screen in Arabidopsis thaliana for mutants with heightened sensitivity to actin-disrupting drugs. HLB1 is a plant-specific tetratricopeptide repeat domain-containing protein of unknown function encoded by a single Arabidopsis gene. HLB1 associated with the trans-Golgi network (TGN)/early endosome (EE) and tracked along filamentous actin, indicating that it could link post-Golgi traffic with the actin cytoskeleton in plants. HLB1 was foundmore » to interact with the ADP-ribosylation-factor guanine nucleotide exchange factor, MIN7/BEN1 (HOPM INTERACTOR7/BREFELDIN A-VISUALIZED ENDOCYTIC TRAFFICKING DEFECTIVE1) by coimmunoprecipitation. The min7/ben1 mutant phenocopied the mild root developmental defects and latrunculin B hypersensitivity of hlb1, and analyses of a hlb1/ min7/ben1 double mutant showed that hlb1 and min7/ben1 operate in common genetic pathways. Based on these data, we propose that HLB1 together with MIN7/BEN1 form a complex with actin to modulate the function of the TGN/EE at the intersection of the exocytic and endocytic pathways in plants.« less

Charcot–Marie–Tooth disease and intracellular traffic

PubMed Central

Bucci, Cecilia; Bakke, Oddmund; Progida, Cinzia

2012-01-01

Mutations of genes whose primary function is the regulation of membrane traffic are increasingly being identified as the underlying causes of various important human disorders. Intriguingly, mutations in ubiquitously expressed membrane traffic genes often lead to cell type- or organ-specific disorders. This is particularly true for neuronal diseases, identifying the nervous system as the most sensitive tissue to alterations of membrane traffic. Charcot–Marie–Tooth (CMT) disease is one of the most common inherited peripheral neuropathies. It is also known as hereditary motor and sensory neuropathy (HMSN), which comprises a group of disorders specifically affecting peripheral nerves. This peripheral neuropathy, highly heterogeneous both clinically and genetically, is characterized by a slowly progressive degeneration of the muscle of the foot, lower leg, hand and forearm, accompanied by sensory loss in the toes, fingers and limbs. More than 30 genes have been identified as targets of mutations that cause CMT neuropathy. A number of these genes encode proteins directly or indirectly involved in the regulation of intracellular traffic. Indeed, the list of genes linked to CMT disease includes genes important for vesicle formation, phosphoinositide metabolism, lysosomal degradation, mitochondrial fission and fusion, and also genes encoding endosomal and cytoskeletal proteins. This review focuses on the link between intracellular transport and CMT disease, highlighting the molecular mechanisms that underlie the different forms of this peripheral neuropathy and discussing the pathophysiological impact of membrane transport genetic defects as well as possible future ways to counteract these defects. PMID:22465036

The EARP Complex and Its Interactor EIPR-1 Are Required for Cargo Sorting to Dense-Core Vesicles

PubMed Central

Topalidou, Irini; Cattin-Ortolá, Jérôme; MacCoss, Michael J.

2016-01-01

The dense-core vesicle is a secretory organelle that mediates the regulated release of peptide hormones, growth factors, and biogenic amines. Dense-core vesicles originate from the trans-Golgi of neurons and neuroendocrine cells, but it is unclear how this specialized organelle is formed and acquires its specific cargos. To identify proteins that act in dense-core vesicle biogenesis, we performed a forward genetic screen in Caenorhabditis elegans for mutants defective in dense-core vesicle function. We previously reported the identification of two conserved proteins that interact with the small GTPase RAB-2 to control normal dense-core vesicle cargo-sorting. Here we identify several additional conserved factors important for dense-core vesicle cargo sorting: the WD40 domain protein EIPR-1 and the endosome-associated recycling protein (EARP) complex. By assaying behavior and the trafficking of dense-core vesicle cargos, we show that mutants that lack EIPR-1 or EARP have defects in dense-core vesicle cargo-sorting similar to those of mutants in the RAB-2 pathway. Genetic epistasis data indicate that RAB-2, EIPR-1 and EARP function in a common pathway. In addition, using a proteomic approach in rat insulinoma cells, we show that EIPR-1 physically interacts with the EARP complex. Our data suggest that EIPR-1 is a new interactor of the EARP complex and that dense-core vesicle cargo sorting depends on the EARP-dependent trafficking of cargo through an endosomal sorting compartment. PMID:27191843

NOX1 loss-of-function genetic variants in patients with inflammatory bowel disease

PubMed Central

Schwerd, T.; Bryant, R. V.; Pandey, S.; Capitani, M.; Meran, L.; Cazier, J.-B.; Jung, J.; Mondal, K.; Parkes, M.; Mathew, CG; Fiedler, K.; McCarthy, D. J.; Sullivan, PB; Rodrigues, A.; Travis, SPL; Moore, C.; Sambrook, J.; Ouwehand, W. H.; Roberts, D. J.; Danesh, J.; Russell, R. K.; Wilson, D. C.; Kelsen, J. R.; Cornall, R.; Denson, L. A.; Kugathasan, S.; Knaus, U. G.; Goncalves Serra, E.; Anderson, C. A.; Duerr, R. H.; McGovern, D. P. B.; Cho, J.; Powrie, F.; Li, V. S. W.; Muise, A. M.; Uhlig, H. H.

2017-01-01

Genetic defects that affect intestinal epithelial barrier function can present with very early onset inflammatory bowel disease (VEOIBD). Using whole genome sequencing, a novel hemizygous defect in NOX1 encoding NAPDH oxidase 1 was identified in a patient with ulcerative colitis-like VEOIBD. Exome screening of 1,878 paediatric patients identified further seven male IBD patients with rare NOX1 mutations. Loss-of-function was validated in p.N122H and p.T497A, and to a lesser degree in p.Y470H, p.R287Q, p.I67M, p.Q293R as well as the previously described p.P330S and the common NOX1 SNP p.D360N (rs34688635) variant. The missense mutation p.N122H abrogated reactive oxygen species (ROS) production in cell lines, ex-vivo colonic explants and patient-derived colonic organoid cultures. Within colonic crypts, NOX1 constitutively generates a high level of ROS in the crypt lumen. Analysis of 9,513 controls and 11,140 IBD patients of non-Jewish European ancestry did not reveal an association between p.D360N and IBD. Our data suggest that loss-of-function variants in NOX1 do not cause a Mendelian disorder of high penetrance but are a context specific modifier. Our results implicate that variants in NOX1 change brush border ROS within colonic crypts at the interface between the epithelium and luminal microbes. PMID:29091079

Diprosopus (partially duplicated head) associated with anencephaly: a case report.

PubMed

al Muti Zaitoun, A; Chang, J; Booker, M

1999-01-01

Craniofacial duplication (diprosopus) is a rare form of conjoined twin. A 16 year old mother with a twin pregnancy delivered one normally formed baby boy and one diprosopus male. The malformed baby was 33 weeks of gestation with a single trunk, normal limbs and various degrees of facial duplication. Of the following structures there were two of each: noses, eyes, ears (and one dimple), mouths, tongues and, with bilateral central cleft lips and cleft palates. This was associated with holoprosencephaly and craniorachischisis. Internal organs showed no duplication. There were multiple congenital anomalies including diaphragmatic hernia, small lungs, two lobes of the right lung, ventricular septal defect, small adrenal gland and small left kidney with short ureter. The body also had a short neck, small chest cavities and kyphosis. X-ray revealed duplication of the vertebral column. The case presented here represents a type II of diprosopia of Rating (1933) and is the least common type reported. We also reviewed 22 recently reported cases of diprosopus. In addition to facial duplication, anencephaly, neural tube defect and cardiac malformations represent the more common congenital abnormalities associated with diprosopus. The pathogenesis of diprosopus is not well understood. Factors that play a role in diprosopus are probably similar to those factors (genetic, environmental and abnormal placental circulation) which affect monozoygotic twins as observed in this case report. Early ultrasonography diagnosis of diprosopus permits one to consider a vaginal therapeutic abortion.

Pathology of Podocytopathies Causing Nephrotic Syndrome in Children.

PubMed

Ranganathan, Sarangarajan

2016-01-01

Nephrotic syndrome (NS) in children includes a diverse group of diseases that range from genetic diseases without any immunological defects to causes that are primarily due to immunological effects. Recent advances in molecular and genomic studies have resulted in a plethora of genetic defects that have been localized to the podocyte, the basic structure that is instrumental in normal filtration process. Although the disease can manifest from birth and into adulthood, the primary focus of this review would be to describe the novel genes and pathology of primary podocyte defects that cause NS in children. This review will restrict itself to the pathology of congenital NS, minimal change disease (MCD), and its variants and focal segmental glomerulosclerosis (FSGS). The two major types of congenital NS are Finnish type characterized by dilated sausage shaped tubules morphologically and diffuse mesangial sclerosis characterized by glomerulosclerosis. MCD has usually normal appearing biopsy features on light microscopy and needs electron microscopy for diagnosis, whereas FSGS in contrast has classic segmental sclerosing lesions identified in different portions of the glomeruli and tubular atrophy. This review summarizes the pathological characteristics of these conditions and also delves into the various genetic defects that have been described as the cause of these primary podocytopathies. Other secondary causes of NS in children, such as membranoproliferative and membranous glomerulonephritis, will not be covered in this review.

Genetic etiology of oral cancer.

PubMed

Ali, Johar; Sabiha, Bibi; Jan, Hanif Ullah; Haider, Syed Adnan; Khan, Abid Ali; Ali, Saima S

2017-07-01

Head and neck squamous cell carcinoma (HNSCC) is the sixth most common cancer worldwide. It accounts for 2.5% of all new cancer cases and 1.9% of all cancer deaths annually. More than 90% of oral cancers (occurring in the mouth, lip, and tongue) are oral squamous cell carcinoma. The incidence rate of oral cancer varies widely throughout the world, with an evident prevalence in South Asian countries. This high incidence occurs in correlation with oral cancer-associated behaviors such as alcohol, tobacco use. Researchers have reported that these behaviors lead to genetic variations in tumor suppressor genes (APC, p53), proto-oncogenes (Myc), oncogene (Ras) and genes controlling normal cellular processes (EIF3E, GSTM1). Processes such as segregation of chromosomes, genomic copy number, loss of heterozygosity, telomere stabilities, regulations of cell-cycle checkpoints, DNA damage repairs and defects in notch signaling pathways are involved in causing oral cancer. In order to develop preventive and therapeutic options, it is necessary to comprehend the basic molecular mechanisms forcing oral tumorigenesis. This review examines, in detail, the mechanisms of genetic alteration which are considered to be responsible for the initiation of oral cancer. Copyright © 2017 Elsevier Ltd. All rights reserved.

Fruit flies and intellectual disability

PubMed Central

Bolduc, François V.; Tully, Tim

2011-01-01

Mental retardation—known more commonly nowadays as intellectual disability—is a severe neurological condition affecting up to 3% of the general population. As a result of the analysis of familial cases and recent advances in clinical genetic testing, great strides have been made in our understanding of the genetic etiologies of mental retardation. Nonetheless, no treatment is currently clinically available to patients suffering from intellectual disability. Several animal models have been used in the study of memory and cognition. Established paradigms in Drosophila have recently captured cognitive defects in fly mutants for orthologs of genes involved in human intellectual disability. We review here three protocols designed to understand the molecular genetic basis of learning and memory in Drosophila and the genes identified so far with relation to mental retardation. In addition, we explore the mental retardation genes for which evidence of neuronal dysfunction other than memory has been established in Drosophila. Finally, we summarize the findings in Drosophila for mental retardation genes for which no neuronal information is yet available. All in all, this review illustrates the impressive overlap between genes identified in human mental retardation and genes involved in physiological learning and memory. PMID:19182539

Chaperoning G Protein-Coupled Receptors: From Cell Biology to Therapeutics

PubMed Central

Conn, P. Michael

2014-01-01

G protein-coupled receptors (GPCRs) are membrane proteins that traverse the plasma membrane seven times (hence, are also called 7TM receptors). The polytopic structure of GPCRs makes the folding of GPCRs difficult and complex. Indeed, many wild-type GPCRs are not folded optimally, and defects in folding are the most common cause of genetic diseases due to GPCR mutations. Both general and receptor-specific molecular chaperones aid the folding of GPCRs. Chemical chaperones have been shown to be able to correct the misfolding in mutant GPCRs, proving to be important tools for studying the structure-function relationship of GPCRs. However, their potential therapeutic value is very limited. Pharmacological chaperones (pharmacoperones) are potentially important novel therapeutics for treating genetic diseases caused by mutations in GPCR genes that resulted in misfolded mutant proteins. Pharmacoperones also increase cell surface expression of wild-type GPCRs; therefore, they could be used to treat diseases that do not harbor mutations in GPCRs. Recent studies have shown that indeed pharmacoperones work in both experimental animals and patients. High-throughput assays have been developed to identify new pharmacoperones that could be used as therapeutics for a number of endocrine and other genetic diseases. PMID:24661201

Molecular genetics of Alzheimer disease.

PubMed

St George-Hyslop, P H

1999-01-01

Epidemiological and individual case studies indicate that genetic factors play a significant role in the genesis of Alzheimer Disease (AD). To date, molecular genetic studies in families multiply affected with AD have identified three genes (Presenilin 1-PS1, Presenilin 2-PS2, and beta-amyloid precursor protein--betaAPP) associated with highly penetrant early onset AD, and one gene (Apolipoprotein E) associated with late onset AD. A fifth potential AD susceptibility locus has been mapped to a broad region of chromosome 12, but the responsible gene defect has not yet been identified. Case-control studies comparing the frequency of alleles in numerous other candidate genes have identified a number of additional potential AD genes. However, methodological difficulties and conflicting results in follow-up studies, make it unclear whether allelic variations in these genes are truly pathogenic. Nevertheless, analysis of the biochemical effects of mutations in PS1, PS2, betaAPP at least, suggest a common biochemical effect-namely disturbances in the processing of betaAPP protein. In addition to utility in defining potential therapeutic targets, in some circumstances these genes can also potentially be used as adjunctives in clinical presymptomatic, symptomatic or pharmacogenomic diagnosis.

Mutations in HYAL2, Encoding Hyaluronidase 2, Cause a Syndrome of Orofacial Clefting and Cor Triatriatum Sinister in Humans and Mice

PubMed Central

Hasan, S. Naimul; Mark, Brian; Harlalka, Gaurav V.; Patton, Michael A.; Ishida, Miho; Sharma, Sanjay; Faqeih, Eissa; Blakley, Brian; Jackson, Mike; Lees, Melissa; Dolinsky, Vernon; Cross, Leroy; Stanier, Philip; Salter, Claire; Baple, Emma L.; Crosby, Andrew H.

2017-01-01

Orofacial clefting is amongst the most common of birth defects, with both genetic and environmental components. Although numerous studies have been undertaken to investigate the complexities of the genetic etiology of this heterogeneous condition, this factor remains incompletely understood. Here, we describe mutations in the HYAL2 gene as a cause of syndromic orofacial clefting. HYAL2, encoding hyaluronidase 2, degrades extracellular hyaluronan, a critical component of the developing heart and palatal shelf matrix. Transfection assays demonstrated that the gene mutations destabilize the molecule, dramatically reducing HYAL2 protein levels. Consistent with the clinical presentation in affected individuals, investigations of Hyal2-/- mice revealed craniofacial abnormalities, including submucosal cleft palate. In addition, cor triatriatum sinister and hearing loss, identified in a proportion of Hyal2-/- mice, were also found as incompletely penetrant features in affected humans. Taken together our findings identify a new genetic cause of orofacial clefting in humans and mice, and define the first molecular cause of human cor triatriatum sinister, illustrating the fundamental importance of HYAL2 and hyaluronan turnover for normal human and mouse development. PMID:28081210

The SCHEIE Visual Field Grading System

PubMed Central

Sankar, Prithvi S.; O’Keefe, Laura; Choi, Daniel; Salowe, Rebecca; Miller-Ellis, Eydie; Lehman, Amanda; Addis, Victoria; Ramakrishnan, Meera; Natesh, Vikas; Whitehead, Gideon; Khachatryan, Naira; O’Brien, Joan

2017-01-01

Objective No method of grading visual field (VF) defects has been widely accepted throughout the glaucoma community. The SCHEIE (Systematic Classification of Humphrey visual fields-Easy Interpretation and Evaluation) grading system for glaucomatous visual fields was created to convey qualitative and quantitative information regarding visual field defects in an objective, reproducible, and easily applicable manner for research purposes. Methods The SCHEIE grading system is composed of a qualitative and quantitative score. The qualitative score consists of designation in one or more of the following categories: normal, central scotoma, paracentral scotoma, paracentral crescent, temporal quadrant, nasal quadrant, peripheral arcuate defect, expansive arcuate, or altitudinal defect. The quantitative component incorporates the Humphrey visual field index (VFI), location of visual defects for superior and inferior hemifields, and blind spot involvement. Accuracy and speed at grading using the qualitative and quantitative components was calculated for non-physician graders. Results Graders had a median accuracy of 96.67% for their qualitative scores and a median accuracy of 98.75% for their quantitative scores. Graders took a mean of 56 seconds per visual field to assign a qualitative score and 20 seconds per visual field to assign a quantitative score. Conclusion The SCHEIE grading system is a reproducible tool that combines qualitative and quantitative measurements to grade glaucomatous visual field defects. The system aims to standardize clinical staging and to make specific visual field defects more easily identifiable. Specific patterns of visual field loss may also be associated with genetic variants in future genetic analysis. PMID:28932621

Heterozygous Deletion of FOXA2 Segregates with Disease in a Family with Heterotaxy, Panhypopituitarism, and Biliary Atresia

PubMed Central

Tsai, Ellen A.; Grochowski, Christopher M.; Falsey, Alexandra M.; Rajagopalan, Ramakrishnan; Wendel, Danielle; Devoto, Marcella; Krantz, Ian D.; Loomes, Kathleen M.; Spinner, Nancy B.

2015-01-01

Biliary atresia (BA) is a pediatric cholangiopathy with unknown etiology occurring in isolated and syndromic forms. Laterality defects affecting the cardiovascular and gastrointestinal systems are the most common features present in syndromic BA. Most cases are sporadic, although reports of familial cases have led to the hypothesis of genetic susceptibility in some patients. We identified a child with BA, malrotation, and interrupted inferior vena cava whose father presented with situs inversus, polysplenia, panhypopituitarism, and mildly dysmorphic facial features. Chromosomal microarray analysis demonstrated a 277kb heterozygous deletion on chromosome 20 which included a single gene, FOXA2, in the proband and her father. This deletion was confirmed to be de novo in the father. The proband and her father share a common diagnosis of heterotaxy, but they also each presented with a variety of other issues. Further genetic screening revealed that the proband carried an additional protein-altering polymorphism (rs1904589; p.His165Arg) in the NODAL gene that is not present in the father, and this variant has been shown to decrease expression of the gene. As FOXA2 can be a regulator of NODAL expression, we propose that haploinsufficiency for FOXA2 combined with a decreased expression of NODAL is the likely cause for syndromic BA in this proband. PMID:25765999

Testicular Cancer and Cryptorchidism

PubMed Central

Ferguson, Lydia; Agoulnik, Alexander I.

2013-01-01

The failure of testicular descent or cryptorchidism is the most common defect in newborn boys. The descent of the testes during development is controlled by insulin-like 3 peptide and steroid hormones produced in testicular Leydig cells, as well as by various genetic and developmental factors. While in some cases the association with genetic abnormalities and environmental causes has been shown, the etiology of cryptorchidism remains uncertain. Cryptorchidism is an established risk factor for infertility and testicular germ cell tumors (TGCT). Experimental animal models suggest a causative role for an abnormal testicular position on the disruption of spermatogenesis however the link between cryptorchidism and TGCT is less clear. The most common type of TGCT in cryptorchid testes is seminoma, believed to be derived from pluripotent prenatal germ cells. Recent studies have shown that seminoma cells and their precursor carcinoma in situ cells express a number of spermatogonial stem cell (SSC) markers suggesting that TGCTs might originate from adult stem cells. We review here the data on changes in the SSC somatic cell niche observed in cryptorchid testes of mouse models and in human patients. We propose that the misregulation of growth factors’ expression may alter the balance between SSC self-renewal and differentiation and shift stem cells toward neoplastic transformation. PMID:23519268

Otitis Media in a New Mouse Model for CHARGE Syndrome with a Deletion in the Chd7 Gene

PubMed Central

Tian, Cong; Yu, Heping; Yang, Bin; Han, Fengchan; Zheng, Ye; Bartels, Cynthia F.; Schelling, Deborah; Arnold, James E.; Scacheri, Peter C.; Zheng, Qing Yin

2012-01-01

Otitis media is a middle ear disease common in children under three years old. Otitis media can occur in normal individuals with no other symptoms or syndromes, but it is often seen in individuals clinically diagnosed with genetic diseases such as CHARGE syndrome, a complex genetic disease caused by mutation in the Chd7 gene and characterized by multiple birth defects. Although otitis media is common in human CHARGE syndrome patients, it has not been reported in mouse models of CHARGE syndrome. In this study, we report a mouse model with a spontaneous deletion mutation in the Chd7 gene and with chronic otitis media of early onset age accompanied by hearing loss. These mice also exhibit morphological alteration in the Eustachian tubes, dysregulation of epithelial proliferation, and decreased density of middle ear cilia. Gene expression profiling revealed up-regulation of Muc5ac, Muc5b and Tgf-β1 transcripts, the products of which are involved in mucin production and TGF pathway regulation. This is the first mouse model of CHARGE syndrome reported to show otitis media with effusion and it will be valuable for studying the etiology of otitis media and other symptoms in CHARGE syndrome. PMID:22539951

Impaired ERAD and ER stress are early and specific events in polyglutamine toxicity

PubMed Central

Duennwald, Martin L.; Lindquist, Susan

2008-01-01

Protein misfolding, whether caused by aging, environmental factors, or genetic mutations, is a common basis for neurodegenerative diseases. The misfolding of proteins with abnormally long polyglutamine (polyQ) expansions causes several neurodegenerative disorders, such as Huntington’s disease (HD). Although many cellular pathways have been documented to be impaired in HD, the primary triggers of polyQ toxicity remain elusive. We report that yeast cells and neuron-like PC12 cells expressing polyQ-expanded huntingtin (htt) fragments display a surprisingly specific, immediate, and drastic defect in endoplasmic reticulum (ER)-associated degradation (ERAD). We further decipher the mechanistic basis for this defect in ERAD: the entrapment of the essential ERAD proteins Npl4, Ufd1, and p97 by polyQ-expanded htt fragments. In both yeast and mammalian neuron-like cells, overexpression of Npl4 and Ufd1 ameliorates polyQ toxicity. Our results establish that impaired ER protein homeostasis is a broad and highly conserved contributor to polyQ toxicity in yeast, in PC12 cells, and, importantly, in striatal cells expressing full-length polyQ-expanded huntingtin. PMID:19015277

Fanconi Anemia: A DNA repair disorder characterized by accelerated decline of the hematopoietic stem cell compartment and other features of aging.

PubMed

Brosh, Robert M; Bellani, Marina; Liu, Yie; Seidman, Michael M

2017-01-01

Fanconi Anemia (FA) is a rare autosomal genetic disorder characterized by progressive bone marrow failure (BMF), endocrine dysfunction, cancer, and other clinical features commonly associated with normal aging. The anemia stems directly from an accelerated decline of the hematopoietic stem cell compartment. Although FA is a complex heterogeneous disease linked to mutations in 19 currently identified genes, there has been much progress in understanding the molecular pathology involved. FA is broadly considered a DNA repair disorder and the FA gene products, together with other DNA repair factors, have been implicated in interstrand cross-link (ICL) repair. However, in addition to the defective DNA damage response, altered epigenetic regulation, and telomere defects, FA is also marked by elevated levels of inflammatory mediators in circulation, a hallmark of faster decline in not only other hereditary aging disorders but also normal aging. In this review, we offer a perspective of FA as a monogenic accelerated aging disorder, citing the latest evidence for its multi-factorial deficiencies underlying its unique clinical and cellular features. Published by Elsevier B.V.

Innate Immune Response and Off-Target Mis-splicing Are Common Morpholino-Induced Side Effects in Xenopus.

PubMed

Gentsch, George E; Spruce, Thomas; Monteiro, Rita S; Owens, Nick D L; Martin, Stephen R; Smith, James C

2018-03-12

Antisense morpholino oligomers (MOs) have been indispensable tools for developmental biologists to transiently knock down (KD) genes rather than to knock them out (KO). Here we report on the implications of genetic KO versus MO-mediated KD of the mesoderm-specifying Brachyury paralogs in the frog Xenopus tropicalis. While both KO and KD embryos fail to activate the same core gene regulatory network, resulting in virtually identical morphological defects, embryos injected with control or target MOs also show a systemic GC content-dependent immune response and many off-target splicing defects. Optimization of MO dosage and increasing incubation temperatures can mitigate, but not eliminate, these MO side effects, which are consistent with the high affinity measured between MO and off-target sequence in vitro. We conclude that while MOs can be useful to profile loss-of-function phenotypes at a molecular level, careful attention must be paid to their immunogenic and off-target side effects. Copyright © 2018 The Francis Crick Institute. Published by Elsevier Inc. All rights reserved.

Mutations in ABCA12 Underlie the Severe Congenital Skin Disease Harlequin Ichthyosis

PubMed Central

Kelsell, David P.; Norgett, Elizabeth E.; Unsworth, Harriet; Teh, Muy-Teck; Cullup, Thomas; Mein, Charles A.; Dopping-Hepenstal, Patricia J.; Dale, Beverly A.; Tadini, Gianluca; Fleckman, Philip; Stephens, Karen G.; Sybert, Virginia P.; Mallory, Susan B.; North, Bernard V.; Witt, David R.; Sprecher, Eli; E. M. Taylor, Aileen; Ilchyshyn, Andrew; Kennedy, Cameron T.; Goodyear, Helen; Moss, Celia; Paige, David; Harper, John I.; Young, Bryan D.; Leigh, Irene M.; Eady, Robin A. J.; O’Toole, Edel A.

2005-01-01

Harlequin ichthyosis (HI) is the most severe and frequently lethal form of recessive congenital ichthyosis. Although defects in lipid transport, protein phosphatase activity, and differentiation have been described, the genetic basis underlying the clinical and cellular phenotypes of HI has yet to be determined. By use of single-nucleotide–polymorphism chip technology and homozygosity mapping, a common region of homozygosity was observed in five patients with HI in the chromosomal region 2q35. Sequencing of the ABCA12 gene, which maps within the minimal region defined by homozygosity mapping, revealed disease-associated mutations, including large intragenic deletions and frameshift deletions in 11 of the 12 screened individuals with HI. Since HI epidermis displays abnormal lamellar granule formation, ABCA12 may play a critical role in the formation of lamellar granules and the discharge of lipids into the intercellular spaces, which would explain the epidermal barrier defect seen in this disorder. This finding paves the way for early prenatal diagnosis. In addition, functional studies of ABCA12 will lead to a better understanding of epidermal differentiation and barrier formation. PMID:15756637

A class of dynamin-like GTPases involved in the generation of the tubular ER network

PubMed Central

Hu, Junjie; Shibata, Yoko; Zhu, Peng-Peng; Voss, Christiane; Rismanchi, Neggy; Prinz, William A.; Rapoport, Tom A.; Blackstone, Craig

2009-01-01

The endoplasmic reticulum (ER) consists of tubules that are shaped by the reticulons and DP1/Yop1p, but how the tubules form an interconnected network is unknown. Here, we show that mammalian atlastins, which are dynamin-like, integral membrane GTPases, interact with the tubule-shaping proteins. The atlastins localize to the tubular ER and are required for proper network formation in vivo and in vitro. Depletion of the atlastins or overexpression of dominant-negative forms inhibits tubule interconnections. The Sey1p GTPase in S. cerevisiae is likely a functional ortholog of the atlastins; it shares the same signature motifs and membrane topology and interacts genetically and physically with the tubule-shaping proteins. Cells simultaneously lacking Sey1p and a tubule-shaping protein have ER morphology defects. These results indicate that formation of the tubular ER network depends on conserved dynamin-like GTPases. Since atlastin-1 mutations cause a common form of hereditary spastic paraplegia, we suggest ER shaping defects as a novel neuropathogenic mechanism. PMID:19665976

Usher syndrome protein network functions in the retina and their relation to other retinal ciliopathies.

PubMed

Sorusch, Nasrin; Wunderlich, Kirsten; Bauss, Katharina; Nagel-Wolfrum, Kerstin; Wolfrum, Uwe

2014-01-01

The human Usher syndrome (USH) is the most frequent cause of combined hereditary deaf-blindness. USH is genetically and clinically heterogeneous: 15 chromosomal loci assigned to 3 clinical types, USH1-3. All USH1 and 2 proteins are organized into protein networks by the scaffold proteins harmonin (USH1C), whirlin (USH2D) and SANS (USH1G). This has contributed essentially to our current understanding of the USH protein function in the eye and the ear and explains why defects in proteins of different families cause very similar phenotypes. Ongoing in depth analyses of USH protein networks in the eye indicated cytoskeletal functions as well as roles in molecular transport processes and ciliary cargo delivery in photoreceptor cells. The analysis of USH protein networks revealed molecular links of USH to other ciliopathies, including non-syndromic inner ear defects and isolated retinal dystrophies but also to kidney diseases and syndromes like the Bardet-Biedl syndrome. These findings provide emerging evidence that USH is a ciliopathy molecularly related to other ciliopathies, which opens an avenue for common therapy strategies to treat these diseases.

Histological variations in juvenile polyp phenotype correlate with genetic defect underlying juvenile polyposis

PubMed Central

van Hattem, W. Arnout; Langeveld, Danielle; de Leng, Wendy W. J.; Morsink, Folkert H.; van Diest, Paul J.; Iacobuzio-Donahue, Christine A.; Giardiello, Francis M.; Offerhaus, G. Johan A.; Brosens, Lodewijk A. A.

2011-01-01

Background Juvenile polyps are distinct hamartomatous malformations of the gastrointestinal tract that may occur in the heritable juvenile polyposis syndrome (JPS) or sporadically. Histologically, juvenile polyps are characterised by a marked increase of the stromal cell compartment but, an epithelial phenotype has also been reported. JPS has an increased risk of colorectal cancer but sporadic juvenile polyps do not. In 50–60% of JPS patients a germline mutation of the TGF-β/BMP pathway genes SMAD4 or BMPR1A is found. This study compares the histological phenotype of juvenile polyps with a SMAD4 or BMPR1A germline mutation and sporadic juvenile polyps. Methods H&E slides of 65 JPS polyps and 25 sporadic juvenile polyps were reviewed for histological features and dysplasia. Systematic random crypt and stroma counts were obtained by count stereology and a crypt-stroma ratio was determined. All polyps were subsequently categorised as type A (crypt-stroma ratio <1.00) or type B (crypt-stroma ratio ≥1.00), the latter referring to the epithelial phenotype. Cell cycle activity was assessed using immunohistochemistry of the proliferation marker Ki67, and mutation analysis was conducted for KRAS and APC to determine the involvement of the adenoma-carcinoma sequence. Results Juvenile polyps with a SMAD4 germline mutation were predominantly type B, whereas, type A was more common among juvenile polyps with a BMPR1A germline mutation, but this distinction could not be ascribed to differences in cell cycle activity. Dysplasia was equally common in JPS polyps with either a SMAD4 or BMPR1A germline mutation, where the involvement of the adenoma-carcinoma sequence does not seem to play a distinct role. Conclusion juvenile polyps in the setting of JPS exhibit distinct phenotypes correlating with the underlying genetic defect. PMID:21412070

[Congenital talipes equinovarus--family occurrence].

PubMed

Kołecka, Ewa; Niedzielski, Kryspin Ryszard; Cukras, Zbigniew; Piotrowicz, Małgorzata

2011-01-01

Although congenital talipes equinovarus (CTEV) is one of the most frequently occurring congenital defects of locomotor organs, its ethiopathogenesis is still not fully known. Amongst the others, the inheritance patterns of that defect are not fully known, and that restricts genetic therapeutics and development of new treatment technologies. The aim of this study was analysis of family lineages of 205 children with CTEV (298 feet) treated at our centre in the years 1998-2008. The family occurrence of CTEV was found in 16 cases (8% of analysed group). 6 lineages, in which CTEV occurred in successive generations, were analysed in detail. Particularly interesting is the lineage of the family 1, in which the defect occurred in three successive generations. In case of that family, an autosomal dominant inheritance pattern is possible. Previously that pattern of CTEV inheritance was described only for isolated populations of Polynesians. In own material the family occurrence of CTEV was found to be less frequent than in bibliographic references. The defect occurred twice as often in boys, while the severe form was more frequently observed in girls, and that is consisted with data in the available bibliography. The analysis of presented lineages of families with CTEV did not allow unambiguous defining of the inheritance pattern for that defect. To confirm the autosomal dominant pattern of CTEV inheritance in the family in which the defect occurred in three successive generations, genetic tests would be necessary.

Genetics Home Reference: congenital hemidysplasia with ichthyosiform erythroderma and limb defects

MedlinePlus

... lesions. Arch Dermatol. 2006 Mar;142(3):348-51. Citation on PubMed Herman GE. Disorders of cholesterol ... Genet A. 2003 Oct 15;122A(3):246-51. Citation on PubMed Kaminska-Winciorek G, Brzezinska-Wcisło ...

Considering genetic characteristics in German Holstein breeding programs.

PubMed

Segelke, D; Täubert, H; Reinhardt, F; Thaller, G

2016-01-01

Recently, several research groups have demonstrated that several haplotypes may cause embryonic loss in the homozygous state. Up to now, carriers of genetic disorders were often excluded from mating, resulting in a decrease of genetic gain and a reduced number of sires available for the breeding program. Ongoing research is very likely to identify additional genetic defects causing embryonic loss and calf mortality by genotyping a large proportion of the female cattle population and sequencing key ancestors. Hence, a clear demand is present to develop a method combining selection against recessive defects (e.g., Holstein haplotypes HH1-HH5) with selection for economically beneficial traits (e.g., polled) for mating decisions. Our proposed method is a genetic index that accounts for the allele frequencies in the population and the economic value of the genetic characteristic without excluding carriers from breeding schemes. Fertility phenotypes from routine genetic evaluations were used to determine the economic value per embryo lost. Previous research has shown that embryo loss caused by HH1 and HH2 occurs later than the loss for HH3, HH4, and HH5. Therefore, an economic value of € 97 was used against HH1 and HH2 and € 70 against HH3, HH4, and HH5. For polled, € 7 per polled calf was considered. Minor allele frequencies of the defects ranged between 0.8 and 3.3%. The polled allele has a frequency of 4.1% in the German Holstein population. A genomic breeding program was simulated to study the effect of changing the selection criteria from assortative mating based on breeding values to selecting the females using the genetic index. Selection for a genetic index on the female path is a useful method to control the allele frequencies by reducing undesirable alleles and simultaneously increasing economical beneficial characteristics maintaining most of the genetic gain in production and functional traits. Additionally, we applied the genetic index to real data and found a decrease of the genetic trend for the birth years 1990 to 2006. Since 2010 the genetic index has increased due to a strong increase in the polled frequency. However, further investigation is needed to better understand the biology to determine the correct time of embryo loss and the economic value of fertility disorders. Copyright © 2016 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

Fault Detection of Roller-Bearings Using Signal Processing and Optimization Algorithms

PubMed Central

Kwak, Dae-Ho; Lee, Dong-Han; Ahn, Jong-Hyo; Koh, Bong-Hwan

2014-01-01

This study presents a fault detection of roller bearings through signal processing and optimization techniques. After the occurrence of scratch-type defects on the inner race of bearings, variations of kurtosis values are investigated in terms of two different data processing techniques: minimum entropy deconvolution (MED), and the Teager-Kaiser Energy Operator (TKEO). MED and the TKEO are employed to qualitatively enhance the discrimination of defect-induced repeating peaks on bearing vibration data with measurement noise. Given the perspective of the execution sequence of MED and the TKEO, the study found that the kurtosis sensitivity towards a defect on bearings could be highly improved. Also, the vibration signal from both healthy and damaged bearings is decomposed into multiple intrinsic mode functions (IMFs), through empirical mode decomposition (EMD). The weight vectors of IMFs become design variables for a genetic algorithm (GA). The weights of each IMF can be optimized through the genetic algorithm, to enhance the sensitivity of kurtosis on damaged bearing signals. Experimental results show that the EMD-GA approach successfully improved the resolution of detectability between a roller bearing with defect, and an intact system. PMID:24368701

Natural killer cell biology illuminated by primary immunodeficiency syndromes in humans.

PubMed

Voss, Matthias; Bryceson, Yenan T

2017-04-01

Natural killer (NK) cells are innate immune cytotoxic effector cells well known for their role in antiviral immunity and tumor immunosurveillance. In parts, this knowledge stems from rare inherited immunodeficiency disorders in humans that abrogate NK cell function leading to immune impairments, most notably associated with a high susceptibility to viral infections. Phenotypically, these disorders range from deficiencies selectively affecting NK cells to complex general immune defects that affect NK cells but also other immune cell subsets. Moreover, deficiencies may be associated with reduced NK cell numbers or rather impair specific NK cell effector functions. In recent years, genetic defects underlying the various NK cell deficiencies have been uncovered and have triggered investigative efforts to decipher the molecular mechanisms underlying these disorders. Here we review the associations between inherited human diseases and NK cell development as well as function, with a particular focus on defects in NK cell exocytosis and cytotoxicity. Furthermore we outline how reports of diverse genetic defects have shaped our understanding of NK cell biology. Copyright © 2015. Published by Elsevier Inc.

Inositol- and folate-resistant neural tube defects in mice lacking the epithelial-specific factor Grhl-3.

PubMed

Ting, Stephen B; Wilanowski, Tomasz; Auden, Alana; Hall, Mark; Voss, Anne K; Thomas, Tim; Parekh, Vishwas; Cunningham, John M; Jane, Stephen M

2003-12-01

The neural tube defects (NTDs) spina bifida and anencephaly are widely prevalent severe birth defects. The mouse mutant curly tail (ct/ct) has served as a model of NTDs for 50 years, even though the responsible genetic defect remained unrecognized. Here we show by gene targeting, mapping and genetic complementation studies that a mouse homolog of the Drosophila grainyhead (grh) gene, grainyhead-like-3 (Grhl3), is a compelling candidate for the gene underlying the curly tail phenotype. The NTDs in Grhl3-null mice are more severe than those in the curly tail strain, as the Grhl3 alleles in ct/ct mice are hypomorphic. Spina bifida in ct/ct mice is folate resistant, but its incidence can be markedly reduced by maternal inositol supplementation periconceptually. The NTDs in Grhl3-/- embryos are also folate resistant, but unlike those in ct/ct mice, they are resistant to inositol. These findings suggest that residual Grhl3 expression in ct/ct mice may be required for inositol rescue of folate-resistant NTDs.

Fishing for Fetal Alcohol Spectrum Disorders: Zebrafish as a Model for Ethanol Teratogenesis.

PubMed

Lovely, Charles Ben; Fernandes, Yohaan; Eberhart, Johann K

2016-10-01

Fetal Alcohol Spectrum Disorders (FASD) describes a wide array of ethanol-induced developmental defects, including craniofacial dysmorphology and cognitive impairments. It affects ∼1 in 100 children born in the United States each year. Due to the pleiotropic effects of ethanol, animal models have proven critical in characterizing the mechanisms of ethanol teratogenesis. In this review, we focus on the utility of zebrafish in characterizing ethanol-induced developmental defects. A growing number of laboratories have focused on using zebrafish to examine ethanol-induced defects in craniofacial, cardiac, ocular, and neural development, as well as cognitive and behavioral impairments. Growing evidence supports that genetic predisposition plays a role in these ethanol-induced defects, yet little is understood about these gene-ethanol interactions. With a high degree of genetic amenability, zebrafish is at the forefront of identifying and characterizing the gene-ethanol interactions that underlie FASD. Because of the conservation of gene function between zebrafish and humans, these studies will directly translate to studies of candidate genes in human populations and allow for better diagnosis and treatment of FASD.

The impact of the metabotropic glutamate receptor and other gene family interaction networks on autism

PubMed Central

Hadley, Dexter; Wu, Zhi-liang; Kao, Charlly; Kini, Akshata; Mohamed-Hadley, Alisha; Thomas, Kelly; Vazquez, Lyam; Qiu, Haijun; Mentch, Frank; Pellegrino, Renata; Kim, Cecilia; Connolly, John; Pinto, Dalila; Merikangas, Alison; Klei, Lambertus; Vorstman, Jacob A.S.; Thompson, Ann; Regan, Regina; Pagnamenta, Alistair T.; Oliveira, Bárbara; Magalhaes, Tiago R.; Gilbert, John; Duketis, Eftichia; De Jonge, Maretha V.; Cuccaro, Michael; Correia, Catarina T.; Conroy, Judith; Conceição, Inês C.; Chiocchetti, Andreas G.; Casey, Jillian P.; Bolshakova, Nadia; Bacchelli, Elena; Anney, Richard; Zwaigenbaum, Lonnie; Wittemeyer, Kerstin; Wallace, Simon; Engeland, Herman van; Soorya, Latha; Rogé, Bernadette; Roberts, Wendy; Poustka, Fritz; Mouga, Susana; Minshew, Nancy; McGrew, Susan G.; Lord, Catherine; Leboyer, Marion; Le Couteur, Ann S.; Kolevzon, Alexander; Jacob, Suma; Guter, Stephen; Green, Jonathan; Green, Andrew; Gillberg, Christopher; Fernandez, Bridget A.; Duque, Frederico; Delorme, Richard; Dawson, Geraldine; Café, Cátia; Brennan, Sean; Bourgeron, Thomas; Bolton, Patrick F.; Bölte, Sven; Bernier, Raphael; Baird, Gillian; Bailey, Anthony J.; Anagnostou, Evdokia; Almeida, Joana; Wijsman, Ellen M.; Vieland, Veronica J.; Vicente, Astrid M.; Schellenberg, Gerard D.; Pericak-Vance, Margaret; Paterson, Andrew D.; Parr, Jeremy R.; Oliveira, Guiomar; Almeida, Joana; Café, Cátia; Mouga, Susana; Correia, Catarina; Nurnberger, John I.; Monaco, Anthony P.; Maestrini, Elena; Klauck, Sabine M.; Hakonarson, Hakon; Haines, Jonathan L.; Geschwind, Daniel H.; Freitag, Christine M.; Folstein, Susan E.; Ennis, Sean; Coon, Hilary; Battaglia, Agatino; Szatmari, Peter; Sutcliffe, James S.; Hallmayer, Joachim; Gill, Michael; Cook, Edwin H.; Buxbaum, Joseph D.; Devlin, Bernie; Gallagher, Louise; Betancur, Catalina; Scherer, Stephen W.; Glessner, Joseph; Hakonarson, Hakon

2014-01-01

Although multiple reports show that defective genetic networks underlie the aetiology of autism, few have translated into pharmacotherapeutic opportunities. Since drugs compete with endogenous small molecules for protein binding, many successful drugs target large gene families with multiple drug binding sites. Here we search for defective gene family interaction networks (GFINs) in 6,742 patients with the ASDs relative to 12,544 neurologically normal controls, to find potentially druggable genetic targets. We find significant enrichment of structural defects (P≤2.40E−09, 1.8-fold enrichment) in the metabotropic glutamate receptor (GRM) GFIN, previously observed to impact attention deficit hyperactivity disorder (ADHD) and schizophrenia. Also, the MXD-MYC-MAX network of genes, previously implicated in cancer, is significantly enriched (P≤3.83E−23, 2.5-fold enrichment), as is the calmodulin 1 (CALM1) gene interaction network (P≤4.16E−04, 14.4-fold enrichment), which regulates voltage-independent calcium-activated action potentials at the neuronal synapse. We find that multiple defective gene family interactions underlie autism, presenting new translational opportunities to explore for therapeutic interventions. PMID:24927284

Heterogeneous Diagnoses Underlying Radial Ray Anomalies.

PubMed

Sevilla-Montoya, Rosalba; Aguinaga, Mónica; Martínez, Alejandro; Razo, Guadalupe; Molina, Bertha; Frías, Sara; Grether, Patricia

2017-03-01

To review perinatal Radial Ray Anomaly (RRA) cases born at the National Institute of Perinatology, Mexico, and to reveal the heterogeneous diagnoses of these patients. All patients with RRA over a 18 mo period were included; 4/15 were detected prenatally and 11/15 postnatally. Karyotype was performed for all patients with bilateral RRA; and chromosomal breakage analysis, when the karyotype was normal. Fifteen RRA patients were identified: one with trisomy 18, three with an isolated defect, six with monogenic disease, four with a genetic association and one with diabetic embryopathy. Five were stillborn and two died during the early neonatal period; all of whom presented with multiple defects. Three of the live born patients and one stillborn with multiple defects had Fanconi anemia. RRAs carry a high perinatal mortality rate (47%) when they occur in association with other defects. The assessment of these patients needs to involve the combined use of ultrasound, clinical, genetic, cytogenetic and molecular testing. The present results indicate that the chromosome breakage test should always be performed to rule out Fanconi anemia in this group.

Gene Therapy for Bone Defects in Oral and Maxillofacial Surgery: A Systematic Review and Meta-Analysis of Animal Studies.

PubMed

Fliefel, Riham; Kühnisch, Jan; Ehrenfeld, Michael; Otto, Sven

2017-02-15

Craniofacial bone defects are challenging problems for maxillofacial surgeons over the years. With the development of cell and molecular biology, gene therapy is a breaking new technology with the aim of regenerating tissues by acting as a delivery system for therapeutic genes in the craniofacial region rather than treating genetic disorders. A systematic review was conducted summarizing the articles reporting gene therapy in maxillofacial surgery to answer the question: Was gene therapy successfully applied to regenerate bone in the maxillofacial region? Electronic searching of online databases was performed in addition to hand searching of the references of included articles. No language or time restrictions were enforced. Meta-analysis was done to assess significant bone formation after delivery of gene material in the surgically induced maxillofacial defects. The search identified 2081 articles, of which 57 were included with 1726 animals. Bone morphogenetic proteins were commonly used proteins for gene therapy. Viral vectors were the universally used vectors. Sprague-Dawley rats were the frequently used animal model in experimental studies. The quality of the articles ranged from excellent to average. Meta-analysis results performed on 21 articles showed that defects favored bone formation by gene therapy. Funnel plot showed symmetry with the absence of publication bias. Gene therapy is on the top list of innovative strategies that developed in the last 10 years with the hope of developing a simple chair-side protocol in the near future, combining improvement of gene delivery as well as knowledge of the molecular basis of oral and maxillofacial structures.

Role of BMP receptor traffic in synaptic growth defects in an ALS model.

PubMed

Deshpande, Mugdha; Feiger, Zachary; Shilton, Amanda K; Luo, Christina C; Silverman, Ethan; Rodal, Avital A

2016-10-01

TAR DNA-binding protein 43 (TDP-43) is genetically and functionally linked to amyotrophic lateral sclerosis (ALS) and regulates transcription, splicing, and transport of thousands of RNA targets that function in diverse cellular pathways. In ALS, pathologically altered TDP-43 is believed to lead to disease by toxic gain-of-function effects on RNA metabolism, as well as by sequestering endogenous TDP-43 and causing its loss of function. However, it is unclear which of the numerous cellular processes disrupted downstream of TDP-43 dysfunction lead to neurodegeneration. Here we found that both loss and gain of function of TDP-43 in Drosophila cause a reduction of synaptic growth-promoting bone morphogenic protein (BMP) signaling at the neuromuscular junction (NMJ). Further, we observed a shift of BMP receptors from early to recycling endosomes and increased mobility of BMP receptor-containing compartments at the NMJ. Inhibition of the recycling endosome GTPase Rab11 partially rescued TDP-43-induced defects in BMP receptor dynamics and distribution and suppressed BMP signaling, synaptic growth, and larval crawling defects. Our results indicate that defects in receptor traffic lead to neuronal dysfunction downstream of TDP-43 misregulation and that rerouting receptor traffic may be a viable strategy for rescuing neurological impairment. © 2016 Deshpande, Feiger, et al. This article is distributed by The American Society for Cell Biology under license from the author(s). Two months after publication it is available to the public under an Attribution–Noncommercial–Share Alike 3.0 Unported Creative Commons License (http://creativecommons.org/licenses/by-nc-sa/3.0).

Determination of volatile marker compounds of common coffee roast defects.

PubMed

Yang, Ni; Liu, Chujiao; Liu, Xingkun; Degn, Tina Kreuzfeldt; Munchow, Morten; Fisk, Ian

2016-11-15

Coffee beans from the same origin were roasted using six time-temperature profiles, in order to identify volatile aroma compounds associated with five common roast coffee defects (light, scorched, dark, baked and underdeveloped). Thirty-seven volatile aroma compounds were selected on the basis that they had previously been identified as potent odorants of coffee and were also identified in all coffee brew preparations; the relative abundance of these aroma compounds was then evaluated using gas chromatography mass spectrometry (GC-MS) with headspace solid phase micro extraction. Some of the 37 key aroma compounds were significantly changed in each coffee roast defect and changes in one marker compound was chosen for each defect type, that is, indole for light defect, 4-ethyl-2-methoxyphenol for scorched defect, phenol for dark defect, maltol for baked defect and 2,5-dimethylfuran for underdeveloped defect. The association of specific changes in aroma profiles for different roast defects has not been shown previously and could be incorporated into screening tools to enable the coffee industry quickly identify if roast defects occur during production. Copyright © 2016 The Authors. Published by Elsevier Ltd.. All rights reserved.

Unilateral terminal aphalangia in father and daughter--exogenous or genetic cause?

PubMed

Neumann, L; Pelz, J; Kunze, J

1998-07-24

Published cases of familial unilateral terminal transverse defects are scarce. We report on a morphologically similar defect of the hand in a father and his daughter. The hand anomaly is similar in both, but on the opposite side. Thalidomide was taken in the sensitive period of the pregnancy by the father's mother. To our knowledge this is the second description of unilateral terminal aphalangia in successive generations. In order to evaluate the possible genetic basis we analyze epidemiological studies in respect to the recurrence risk of cases with isolated limb reduction defects. We compare reports of familial occurrence concerning the degree of relationship as well as the pattern of malformation. The latter seems to be an important aspect from an evolutionary and a developmental viewpoint. For our observation an autosomal dominant transmission is the most likely although multifactorial determination cannot be excluded.

Spondylocostal dysostosis associated with right-sided polythelia, right-sided rib deformity and meningocoele: Case report with review of literature.

PubMed

Rai, Narendra; Thakur, Neha; Khan, Naheed Zin; Dwivedi, Akhilesh Dutt

2015-01-01

Spondylocostal dysostosis (SCD) is a rare anomaly of axial skeleton due to flawed embryological development. A newborn baby boy with right-sided polythelia, meningocoele, fan-like configuration of third and fourth rib, fused fifth and sixth rib and third thoracic hemivertebra was delivered to a second gravid mother by elective caesarean section. Baby was active, cried immediately after birth, had normal muscle tone and reflexes. He passed urine and meconium within 24 h of birth. Based on clinical examination and radiological picture, a diagnosis of SCD with meningocele with right-sided polythelia was made. Our case is the first SCD with polythelia and meningocele in newborn. SCD with right-sided polythelia and rib deformity with neural tube defect (NTD) may be due to a genetic defect with the culprit genes missing. Further genetic and embryological studies might find a link between right-sided rib defects, polythelia and NTD.

Birth defects: Risk factors and consequences

PubMed Central

Oliveira, Camila Ive Ferreira; Fett-Conte, Agnes Cristina

2013-01-01

Birth defects (BDs) or congenital anomalies include all structural and functional alterations in embryonic or fetal development resulting from genetic, environmental or unknown causes, which result in physical and/or mental impairment. BDs occur in about 3% of newborn babies and in most cases of pregnancy loss. BDs are a very complex and heterogeneous group of single or multiple changes that, in most cases, are of unknown etiology. Among the risk factors are advanced maternal and paternal ages, parental consanguinity, teratogenic agents such as infectious agents and drugs, and poor nutrition, in particular folic acid deficiency. One of the consequences of these defects is the high death rate within the first year of life. Information on BDs is becoming increasingly more important throughout the world so that preventive measures can be taken. Knowledge of BDs enables the development of therapeutic and preventive strategies besides adequate genetic counseling. PMID:27625844

Defective minor spliceosome mRNA processing results in isolated familial growth hormone deficiency

PubMed Central

Argente, Jesús; Flores, Raquel; Gutiérrez-Arumí, Armand; Verma, Bhupendra; Martos-Moreno, Gabriel Á; Cuscó, Ivon; Oghabian, Ali; Chowen, Julie A; Frilander, Mikko J; Pérez-Jurado, Luis A

2014-01-01

The molecular basis of a significant number of cases of isolated growth hormone deficiency remains unknown. We describe three sisters affected with severe isolated growth hormone deficiency and pituitary hypoplasia caused by biallelic mutations in the RNPC3 gene, which codes for a minor spliceosome protein required for U11/U12 small nuclear ribonucleoprotein (snRNP) formation and splicing of U12-type introns. We found anomalies in U11/U12 di-snRNP formation and in splicing of multiple U12-type introns in patient cells. Defective transcripts include preprohormone convertases SPCS2 and SPCS3 and actin-related ARPC5L genes, which are candidates for the somatotroph-restricted dysfunction. The reported novel mechanism for familial growth hormone deficiency demonstrates that general mRNA processing defects of the minor spliceosome can lead to very narrow tissue-specific consequences. Subject Categories Genetics, Gene Therapy ' Genetic Disease; Metabolism PMID:24480542

Copy-Number Variation of the Glucose Transporter Gene SLC2A3 and Congenital Heart Defects in the 22q11.2 Deletion Syndrome.

PubMed

Mlynarski, Elisabeth E; Sheridan, Molly B; Xie, Michael; Guo, Tingwei; Racedo, Silvia E; McDonald-McGinn, Donna M; Gai, Xiaowu; Chow, Eva W C; Vorstman, Jacob; Swillen, Ann; Devriendt, Koen; Breckpot, Jeroen; Digilio, Maria Cristina; Marino, Bruno; Dallapiccola, Bruno; Philip, Nicole; Simon, Tony J; Roberts, Amy E; Piotrowicz, Małgorzata; Bearden, Carrie E; Eliez, Stephan; Gothelf, Doron; Coleman, Karlene; Kates, Wendy R; Devoto, Marcella; Zackai, Elaine; Heine-Suñer, Damian; Shaikh, Tamim H; Bassett, Anne S; Goldmuntz, Elizabeth; Morrow, Bernice E; Emanuel, Beverly S

2015-05-07

The 22q11.2 deletion syndrome (22q11DS; velocardiofacial/DiGeorge syndrome; VCFS/DGS) is the most common microdeletion syndrome and the phenotypic presentation is highly variable. Approximately 65% of individuals with 22q11DS have a congenital heart defect (CHD), mostly of the conotruncal type, and/or an aortic arch defect. The etiology of this phenotypic variability is not currently known. We hypothesized that copy-number variants (CNVs) outside the 22q11.2 deleted region might increase the risk of being born with a CHD in this sensitized population. Genotyping with Affymetrix SNP Array 6.0 was performed on two groups of subjects with 22q11DS separated by time of ascertainment and processing. CNV analysis was completed on a total of 949 subjects (cohort 1, n = 562; cohort 2, n = 387), 603 with CHDs (cohort 1, n = 363; cohort 2, n = 240) and 346 with normal cardiac anatomy (cohort 1, n = 199; cohort 2, n = 147). Our analysis revealed that a duplication of SLC2A3 was the most frequent CNV identified in the first cohort. It was present in 18 subjects with CHDs and 1 subject without (p = 3.12 × 10(-3), two-tailed Fisher's exact test). In the second cohort, the SLC2A3 duplication was also significantly enriched in subjects with CHDs (p = 3.30 × 10(-2), two-tailed Fisher's exact test). The SLC2A3 duplication was the most frequent CNV detected and the only significant finding in our combined analysis (p = 2.68 × 10(-4), two-tailed Fisher's exact test), indicating that the SLC2A3 duplication might serve as a genetic modifier of CHDs and/or aortic arch anomalies in individuals with 22q11DS. Copyright © 2015 The American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.

Ndufs4 related Leigh syndrome: A case report and review of the literature.

PubMed

Ortigoza-Escobar, Juan Darío; Oyarzabal, Alfonso; Montero, Raquel; Artuch, Rafael; Jou, Cristina; Jiménez, Cecilia; Gort, Laura; Briones, Paz; Muchart, Jordi; López-Gallardo, Ester; Emperador, Sonia; Pesini, Eduardo Ruiz; Montoya, Julio; Pérez, Belén; Rodríguez-Pombo, Pilar; Pérez-Dueñas, Belén

2016-05-01

The genetic causes of Leigh syndrome are heterogeneous, with a poor correlation between the phenotype and genotype. Here, we present a patient with an NDUFS4 mutation to expand the clinical and biochemical spectrum of the disease. A combined defect in the CoQ, PDH and RCC activities in our patient was due to an inappropriate assembly of the RCC complex I (CI), which was confirmed using Blue-Native polyacrylamide gel electrophoresis (BN-PAGE) analysis. Targeted exome sequencing analysis allowed for the genetic diagnosis of this patient. We reviewed 198 patients with 24 different genetic defects causing RCC I deficiency and compared them to 22 NDUFS4 patients. We concluded that NDUFS4-related Leigh syndrome is invariably linked to an early onset severe phenotype that results in early death. Some data, including the clinical phenotype, neuroimaging and biochemical findings, can guide the genetic study in patients with RCC I deficiency. Copyright © 2016 Elsevier B.V. and Mitochondria Research Society. All rights reserved.

The Role of Cerl2 in the Establishment of Left-Right Asymmetries during Axis Formation and Heart Development

PubMed Central

2017-01-01

The formation of the asymmetric left-right (LR) body axis is one of the fundamental aspects of vertebrate embryonic development, and one still raising passionate discussions among scientists. Although the conserved role of nodal is unquestionable in this process, several of the details around this signaling cascade are still unanswered. To further understand this mechanism, we have been studying Cerberus-like 2 (Cerl2), an inhibitor of Nodal, and its role in the generation of asymmetries in the early vertebrate embryo. The absence of Cerl2 results in a wide spectrum of malformations commonly known as heterotaxia, which comprises defects in either global organ position (e.g., situs inversus totalis), reversed orientation of at least one organ (e.g., situs ambiguus), and mirror images of usually asymmetric paired organs (e.g., left or right isomerisms of the lungs). Moreover, these laterality defects are frequently associated with congenital heart diseases (e.g., transposition of the great arteries, or atrioventricular septal defects). Here, reviewing the knowledge on the establishment of LR asymmetry in mouse embryos, the emerging conclusion is that as necessary as is the activation of the Nodal signaling cascade, the tight control that Cerl2-mediates on Nodal signaling is equally important, and that generates a further regionalized LR genetic program in the proper time and space. PMID:29367552

Holoprosencephaly: signalling interactions between the brain and the face, the environment and the genes, and the phenotypic variability in animal models and humans

PubMed Central

Graf, Daniel; Marcucio, Ralph

2014-01-01

Holoprosencephaly (HPE) is the most common developmental defect of the forebrain characterized by inadequate or absent midline division of the forebrain into cerebral hemispheres, with concomitant midline facial defects in the majority of cases. Understanding the pathogenesis of HPE requires knowledge of the relationship between the developing brain and the facial structures during embryogenesis. A number of signalling pathways control and coordinate the development of the brain and face, including Sonic hedgehog (SHH), Bone Morphogenetic Protein (BMP), Fibroblast Growth Factor (FGF), and Nodal signalling. Mutations in these pathways have been identified in animal models of HPE and human patients. Due to incomplete penetrance and variable expressivity of HPE, patients carrying defined mutations may not manifest the disease at all, or have a spectrum of defects. It is currently unknown what drives manifestation of HPE in genetically at risk individuals, but it has been speculated that other gene mutations and environmental factors may combine as cumulative insults. HPE can be diagnosed in utero by a high-resolution prenatal ultrasound or a fetal magnetic resonance imaging, sometimes in combination with molecular testing from chorionic villi or amniotic fluid sampling. Currently, there are no effective preventive methods for HPE. Better understanding of the mechanisms of gene-environment interactions in HPE would provide avenues for such interventions. PMID:25339593

Defects in Mitochondrial Fatty Acid Synthesis Result in Failure of Multiple Aspects of Mitochondrial Biogenesis in Saccharomyces cerevisiae

PubMed Central

Kursu, V. A. Samuli; Pietikäinen, Laura P.; Fontanesi, Flavia; Aaltonen, Mari J.; Suomi, Fumi; Nair, Remya Raghavan; Schonauer, Melissa S.; Dieckmann, Carol L.; Barrientos, Antoni; Hiltunen, J. Kalervo; Kastaniotis, Alexander J.

2014-01-01

Summary Mitochondrial fatty acid synthesis (mtFAS) shares acetyl-CoA with the Krebs cycle as a common substrate and is required for the production of octanoic acid (C8) precursors of lipoic acid (LA) in mitochondria. MtFAS is a conserved pathway essential for respiration. In a genetic screen in Saccharomyces cerevisiae designed to further elucidate the physiological role of mtFAS, we isolated mutants with defects in mitochondrial post-translational gene expression processes, indicating a novel link to mitochondrial gene expression and respiratory chain biogenesis. In our ensuing analysis, we show that mtFAS, but not lipoylation per se, is required for respiratory competence. We demonstrate that mtFAS is required for mRNA splicing, mitochondrial translation and respiratory complex assembly, and provide evidence that not LA per se, but fatty acids longer than C8 play a role in these processes. We also show that mtFAS- and LA-deficient strains suffer from a mild heme deficiency that may contribute to the respiratory complex assembly defect. Based on our data and previously published information, we propose a model implicating mtFAS as a sensor for mitochondrial acetyl-CoA availability and a coordinator of nuclear and mitochondrial gene expression by adapting the mitochondrial compartment to changes in the metabolic status of the cell. PMID:24102902

Defects in mitochondrial fatty acid synthesis result in failure of multiple aspects of mitochondrial biogenesis in Saccharomyces cerevisiae.

PubMed

Kursu, V A Samuli; Pietikäinen, Laura P; Fontanesi, Flavia; Aaltonen, Mari J; Suomi, Fumi; Raghavan Nair, Remya; Schonauer, Melissa S; Dieckmann, Carol L; Barrientos, Antoni; Hiltunen, J Kalervo; Kastaniotis, Alexander J

2013-11-01

Mitochondrial fatty acid synthesis (mtFAS) shares acetyl-CoA with the Krebs cycle as a common substrate and is required for the production of octanoic acid (C8) precursors of lipoic acid (LA) in mitochondria. MtFAS is a conserved pathway essential for respiration. In a genetic screen in Saccharomyces cerevisiae designed to further elucidate the physiological role of mtFAS, we isolated mutants with defects in mitochondrial post-translational gene expression processes, indicating a novel link to mitochondrial gene expression and respiratory chain biogenesis. In our ensuing analysis, we show that mtFAS, but not lipoylation per se, is required for respiratory competence. We demonstrate that mtFAS is required for mRNA splicing, mitochondrial translation and respiratory complex assembly, and provide evidence that not LA per se, but fatty acids longer than C8 play a role in these processes. We also show that mtFAS- and LA-deficient strains suffer from a mild haem deficiency that may contribute to the respiratory complex assembly defect. Based on our data and previously published information, we propose a model implicating mtFAS as a sensor for mitochondrial acetyl-CoA availability and a co-ordinator of nuclear and mitochondrial gene expression by adapting the mitochondrial compartment to changes in the metabolic status of the cell. © 2013 John Wiley & Sons Ltd.

West Virginia yellow-poplar lumber defect database

Treesearch

Lawrence E. Osborn; Charles J. Gatchell; Curt C. Hassler; Curt C. Hassler

1992-01-01

Describes the data collection methods and the format of the new West Virginia yellow-poplar lumber defect database that was developed for use with computer simulation programs. The database contains descriptions of 627 boards, totaling approximately 3,800 board. feet, collected in West Virginia in grades FAS, FASlF, No. 1 Common, No. 2A Common, and No. 2B Common. The...

Suppression of α-synuclein toxicity and vesicle trafficking defects by phosphorylation at S129 in yeast depends on genetic context

PubMed Central

Sancenon, Vicente; Lee, Sue-Ann; Patrick, Christina; Griffith, Janice; Paulino, Amy; Outeiro, Tiago F.; Reggiori, Fulvio; Masliah, Eliezer; Muchowski, Paul J.

2012-01-01

The aggregation of α-synuclein (αSyn) is a neuropathologic hallmark of Parkinson's disease and other synucleinopathies. In Lewy bodies, αSyn is extensively phosphorylated, predominantly at serine 129 (S129). Recent studies in yeast have shown that, at toxic levels, αSyn disrupts Rab homeostasis, causing an initial endoplasmic reticulum-to-Golgi block that precedes a generalized trafficking collapse. However, whether αSyn phosphorylation modulates trafficking defects has not been evaluated. Here, we show that constitutive expression of αSyn in yeast impairs late-exocytic, early-endocytic and/or recycling trafficking. Although members of the casein kinase I (CKI) family phosphorylate αSyn at S129, they attenuate αSyn toxicity and trafficking defects by an S129 phosphorylation-independent mechanism. Surprisingly, phosphorylation of S129 modulates αSyn toxicity and trafficking defects in a manner strictly determined by genetic background. Abnormal endosome morphology, increased levels of the endosome marker Rab5 and co-localization of mammalian CKI with αSyn aggregates are observed in brain sections from αSyn-overexpressing mice and human synucleinopathies. Our results contribute to evidence that suggests αSyn-induced defects in endocytosis, exocytosis and/or recycling of vesicles involved in these cellular processes might contribute to the pathogenesis of synucleinopathies. PMID:22357655

Molecular dynamics of shock loading of metals with defects

DOE Office of Scientific and Technical Information (OSTI.GOV)

Belak, J.F.

1997-12-31

The finite rise time of shock waves in metals is commonly attributed to dissipative or viscous behavior of the metal. This viscous or plastic behavior is commonly attributed to the motion of defects such as dislocations. Despite this intuitive understanding, the experimental observation of defect motion or nucleation during shock loading has not been possible due to the short time scales involved. Molecular dynamics modeling with realistic interatomic potentials can provide some insight into defect motion during shock loading. However, until quite recently, the length scale required to accurately represent a metal with defects has been beyond the scope ofmore » even the most powerful supercomputers. Here, the author presents simulations of the shock response of single defects and indicate how simulation might provide some insight into the shock loading of metals.« less

Fragile X syndrome neurobiology translates into rational therapy.

PubMed

Braat, Sien; Kooy, R Frank

2014-04-01

Causal genetic defects have been identified for various neurodevelopmental disorders. A key example in this respect is fragile X syndrome, one of the most frequent genetic causes of intellectual disability and autism. Since the discovery of the causal gene, insights into the underlying pathophysiological mechanisms have increased exponentially. Over the past years, defects were discovered in pathways that are potentially amendable by pharmacological treatment. These findings have inspired the initiation of clinical trials in patients. The targeted pathways converge in part with those of related neurodevelopmental disorders raising hopes that the treatments developed for this specific disorder might be more broadly applicable. Copyright © 2014 Elsevier Ltd. All rights reserved.

Hypogonadism: Its Prevalence and Diagnosis.

PubMed

Ross, Anna; Bhasin, Shalender

2016-05-01

Hypogonadism is a clinical syndrome, which results from the failure of the testes to produce physiologic levels of testosterone and a normal number of spermatozoa due to defects at one or more levels of the hypothalamic-pituitary-gonadal axis. Primary hypogonadism results from malfunction at the level of the testes due to a genetic cause, injury, inflammation, or infection. Hypothalamic and/or pituitary failure leads to secondary hypogonadism, most often as a result of genetic defects, neoplasm, or infiltrative disorders. The signs and symptoms of hypogonadism depend on the age of onset, severity of androgen deficiency, and underlying cause of androgen deficiency. Copyright © 2016 Elsevier Inc. All rights reserved.

The App-Runx1 Region Is Critical for Birth Defects and Electrocardiographic Dysfunctions Observed in a Down Syndrome Mouse Model

PubMed Central

Raveau, Matthieu; Lignon, Jacques M.; Nalesso, Valérie; Duchon, Arnaud; Groner, Yoram; Sharp, Andrew J.; Dembele, Doulaye; Brault, Véronique; Hérault, Yann

2012-01-01

Down syndrome (DS) leads to complex phenotypes and is the main genetic cause of birth defects and heart diseases. The Ts65Dn DS mouse model is trisomic for the distal part of mouse chromosome 16 and displays similar features with post-natal lethality and cardiovascular defects. In order to better understand these defects, we defined electrocardiogram (ECG) with a precordial set-up, and we found conduction defects and modifications in wave shape, amplitudes, and durations in Ts65Dn mice. By using a genetic approach consisting of crossing Ts65Dn mice with Ms5Yah mice monosomic for the App-Runx1 genetic interval, we showed that the Ts65Dn viability and ECG were improved by this reduction of gene copy number. Whole-genome expression studies confirmed gene dosage effect in Ts65Dn, Ms5Yah, and Ts65Dn/Ms5Yah hearts and showed an overall perturbation of pathways connected to post-natal lethality (Coq7, Dyrk1a, F5, Gabpa, Hmgn1, Pde10a, Morc3, Slc5a3, and Vwf) and heart function (Tfb1m, Adam19, Slc8a1/Ncx1, and Rcan1). In addition cardiac connexins (Cx40, Cx43) and sodium channel sub-units (Scn5a, Scn1b, Scn10a) were found down-regulated in Ts65Dn atria with additional down-regulation of Cx40 in Ts65Dn ventricles and were likely contributing to conduction defects. All these data pinpoint new cardiac phenotypes in the Ts65Dn, mimicking aspects of human DS features and pathways altered in the mouse model. In addition they highlight the role of the App-Runx1 interval, including Sod1 and Tiam1, in the induction of post-natal lethality and of the cardiac conduction defects in Ts65Dn. These results might lead to new therapeutic strategies to improve the care of DS people. PMID:22693452

Immediate reconstruction of palato-maxillary defect following tumor ablation using temporalis myofascial flap

PubMed Central

Yadav, Sunil; Dhupar, Anita; Dhupar, Vikas; Akkara, Francis; Mittal, Hitesh C.

2014-01-01

The resection of oral cavity tumor and malignancies often causes functional disabilities like deglutition and articulation. Maxillectomy is a very common surgical procedure carried out for the management of benign and malignant tumors of maxilla. Irrespective of the procedure, there is a common end result that is the defect. Several soft tissue flaps can be used for reconstruction of maxillectomy defect. Keeping the parameters of reconstruction in mind it is ideal to reconstruct the maxillary defect with either the free flaps or the regional flaps. Of all regional flaps, the temporalis myofascial flap (TMF) provides a high degree of reliability, vascularity, adequate bulk, and proximity to the defect in the oral and maxillofacial region. PMID:25937744

Genetics of Hearing Loss – Syndromic

PubMed Central

Koffler, Tal; Ushakov, Kathy; Avraham, Karen B.

2015-01-01

Synopsis Hearing loss (HL) is one of the most common birth defects in developed countries and is a diverse pathology with different classifications. One of these is based on the association with other clinical features, defined as syndromic hearing loss (SHL). Determining the etiology of the HL in these patients is extremely beneficial as it enables a personalized approach to caring for the individual. Early screening can further aid in optimal rehabilitation for a child’s development and growth. Pathogenic variants in forty-five genes, encoding proteins functioning as ion channels, transcription factors, molecular motors and more, are known to lead to eleven forms of SHL. The development of high-throughput sequencing technology is facilitating rapid and low-cost diagnostics for patients with SHL. PMID:26443487

Glucose-6-phosphate dehydrogenase deficiency: correlation between the genotype, biochemistry and phenotype.

PubMed

Chan, Daisy K L

2008-12-01

Glucose-6-phosphate dehydrogenase (G6PD) deficiency is a common genetic enzyme defect present in many people from African, Middle Eastern, Mediterranean and Asian countries. Individuals with the enzyme deficiency may remain asymptomatic, develop an acute haemolytic crises to infections or Fava beans, neonatal jaundice or chronic non-spherocytic haemolytic anaemia. Electrophoretic mobility may be fast, slow or normal. Over 160 mutations have been described, mostly due to single amino acid substitution. Although correlation of the genotype and biochemistry with the clinical phenotype of G6PD deficient individuals remains somewhat variable, there is better correlation among individuals presenting with chronic non-spherocytic haemolytic anaemia, which is related to the NADP structure of the enzyme.

Spectrum of mutations in a cohort of UK patients with ADA deficient SCID: Segregation of genotypes with specific ethnicities.

PubMed

Adams, Stuart P; Wilson, Melanie; Harb, Elissar; Fairbanks, Lynette; Xu-Bayford, Jinhua; Brown, Lucie; Kearney, Laura; Madkaikar, Manisha; Bobby Gaspar, H

2015-12-01

Severe combined immunodeficiency (SCID) arises from a number of different genetic defects, one of the most common being mutations in the gene encoding adenosine deaminase (ADA). In the UK, ADA deficient SCID compromises approximately 20% of all known cases of SCID. We carried out a retrospective analysis of the ADA gene in 46 known ADA deficient SCID patients on whom DNA had been stored. Here, we report a high frequency of two previously reported mutations and provide a link between the mutations and patient ethnicity within our patient cohort. We also report on 9 novel mutations that have been previously unreported. Copyright © 2015 Elsevier Inc. All rights reserved.

A novel mutation in SLITRK6 causes deafness and myopia in a Moroccan family.

PubMed

Salime, Sara; Riahi, Zied; Elrharchi, Soukaina; Elkhattabi, Lamiae; Charoute, Hicham; Nahili, Halima; Rouba, Hassan; Kabine, Mostafa; Bonnet, Crystel; Petit, Christine; Barakat, Abdelhamid

2018-06-15

Deafness and myopia syndrome is characterized by moderate-profound, bilateral, congenital or prelingual deafness and high myopia. Autosomal recessive non-syndromic hearing loss is one of the most prevalent human genetic sensorineural defects. Myopia is by far the most common human eye disorder that is known to have a clear heritable component. The analysis of the two exons of SLITRK6 gene in a Moroccan family allowed us to identify a novel single deleterious mutation c.696delG, p.Trp232Cysfs*10 at homozygous state in the exon 2 of the SLITRK6, a gene reported to cause deafness and myopia in various populations. Copyright © 2018 Elsevier B.V. All rights reserved.

[Leigh syndrome caused by the mitochondrial DNA G14459A mutation in a Mexican family].

PubMed

Gutiérrez, A; Saldaña-Martínez, A; García-Ramírez, R; Rayo-Mares, D; Carreras, M; López-Pérez, M J; Ruiz-Pesini, E; Montoya, J; Montiel-Sosa, J F

Leigh syndrome is a neurodegenerative and progressive disease that appears usually in childhood due to defects in nuclear or mitochondrial genome. The mutation G14459A in mitochondrial DNA has been associated previously to Leber hereditary optic neuropathy and recently to Leigh syndrome. A 10 months-old Mexican girl diagnosed of Leigh syndrome. Molecular-genetic studies detected the mutation G14459A in a percentage close to homoplasmy and in low heteroplasmy in her mother. The rest of the maternally related family members analyzed were negative. The G14459A mutation, although not very frequently associated to Leigh syndrome, should be analyzed in patients that do not present the most common point mutations.

Molecular diagnosis of α-thalassemia in a multiethnic population.

PubMed

Gilad, Oded; Shemer, Orna Steinberg; Dgany, Orly; Krasnov, Tanya; Nevo, Michal; Noy-Lotan, Sharon; Rabinowicz, Ron; Amitai, Nofar; Ben-Dor, Shifra; Yaniv, Isaac; Yacobovich, Joanne; Tamary, Hannah

2017-06-01

α-Thalassemia, one of the most common genetic diseases, is caused by deletions or point mutations affecting one to four α-globin genes. Molecular diagnosis is important to prevent the most severe forms of the disease. However, the diagnosis of α-thalassemia is complex due to a high variability of the genetic defects involved, with over 250 described mutations. We summarize herein the findings of genetic analyses of DNA samples referred to our laboratory for the molecular diagnosis of α-thalassemia, along with a detailed clinical description. We utilized a diagnostic algorithm including Gap-PCR, to detect known deletions, followed by sequencing of the α-globin gene, to identify known and novel point mutations, and multiplex ligation-dependent probe amplification (MLPA) for the diagnosis of rare or novel deletions. α-Thalassemia was diagnosed in 662 of 975 samples referred to our laboratory. Most commonly found were deletions (75.3%, including two novel deletions previously described by us); point mutations comprised 25.4% of the cases, including five novel mutations. Our population included mostly Jews (of Ashkenazi and Sephardic origin) and Muslim Arabs, who presented with a higher rate of point mutations and hemoglobin H disease. Overall, we detected 53 different genotype combinations causing a spectrum of clinical phenotypes, from asymptomatic to severe anemia. Our work constitutes the largest group of patients with α-thalassemia originating in the Mediterranean whose clinical characteristics and molecular basis have been determined. We suggest a diagnostic algorithm that leads to an accurate molecular diagnosis in multiethnic populations. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Alström Syndrome: Genetics and Clinical Overview

PubMed Central

Marshall, Jan D; Maffei, Pietro; Collin, Gayle B; Naggert, Jürgen K

2011-01-01

Alström syndrome is a rare autosomal recessive genetic disorder characterized by cone-rod dystrophy, hearing loss, childhood truncal obesity, insulin resistance and hyperinsulinemia, type 2 diabetes, hypertriglyceridemia, short stature in adulthood, cardiomyopathy, and progressive pulmonary, hepatic, and renal dysfunction. Symptoms first appear in infancy and progressive development of multi-organ pathology leads to a reduced life expectancy. Variability in age of onset and severity of clinical symptoms, even within families, is likely due to genetic background. Alström syndrome is caused by mutations in ALMS1, a large gene comprised of 23 exons and coding for a protein of 4,169 amino acids. In general, ALMS1 gene defects include insertions, deletions, and nonsense mutations leading to protein truncations and found primarily in exons 8, 10 and 16. Multiple alternate splice forms exist. ALMS1 protein is found in centrosomes, basal bodies, and cytosol of all tissues affected by the disease. The identification of ALMS1 as a ciliary protein explains the range of observed phenotypes and their similarity to those of other ciliopathies such as Bardet-Biedl syndrome. Studies involving murine and cellular models of Alström syndrome have provided insight into the pathogenic mechanisms underlying obesity and type 2 diabetes, and other clinical problems. Ultimately, research into the pathogenesis of Alström syndrome should lead to better management and treatments for individuals, and have potentially important ramifications for other rare ciliopathies, as well as more common causes of obesity and diabetes, and other conditions common in the general population. PMID:22043170

Whole exome sequencing as a diagnostic tool for patients with ciliopathy-like phenotypes.

PubMed

Castro-Sánchez, Sheila; Álvarez-Satta, María; Tohamy, Mohamed A; Beltran, Sergi; Derdak, Sophia; Valverde, Diana

2017-01-01

Ciliopathies are a group of rare disorders characterized by a high genetic and phenotypic variability, which complicates their molecular diagnosis. Hence the need to use the latest powerful approaches to faster identify the genetic defect in these patients. We applied whole exome sequencing to six consanguineous families clinically diagnosed with ciliopathy-like disease, and for which mutations in predominant Bardet-Biedl syndrome (BBS) genes had previously been excluded. Our strategy, based on first applying several filters to ciliary variants and using many of the bioinformatics tools available, allowed us to identify causal mutations in BBS2, ALMS1 and CRB1 genes in four families, thus confirming the molecular diagnosis of ciliopathy. In the remaining two families, after first rejecting the presence of pathogenic variants in common cilia-related genes, we adopted a new filtering strategy combined with prioritisation tools to rank the final candidate genes for each case. Thus, we propose CORO2B, LMO7 and ZNF17 as novel candidate ciliary genes, but further functional studies will be needed to confirm their role. Our data show the usefulness of this strategy to diagnose patients with unclear phenotypes, and therefore the success of applying such technologies to achieve a rapid and reliable molecular diagnosis, improving genetic counselling for these patients. In addition, the described pipeline also highlights the common pitfalls associated to the large volume of data we have to face and the difficulty of assigning a functional role to these changes, hence the importance of designing the most appropriate strategy according to each case.

Neural circuit architecture defects in a Drosophila model of Fragile X syndrome are alleviated by minocycline treatment and genetic removal of matrix metalloproteinase

PubMed Central

Siller, Saul S.; Broadie, Kendal

2011-01-01

SUMMARY Fragile X syndrome (FXS), caused by loss of the fragile X mental retardation 1 (FMR1) product (FMRP), is the most common cause of inherited intellectual disability and autism spectrum disorders. FXS patients suffer multiple behavioral symptoms, including hyperactivity, disrupted circadian cycles, and learning and memory deficits. Recently, a study in the mouse FXS model showed that the tetracycline derivative minocycline effectively remediates the disease state via a proposed matrix metalloproteinase (MMP) inhibition mechanism. Here, we use the well-characterized Drosophila FXS model to assess the effects of minocycline treatment on multiple neural circuit morphological defects and to investigate the MMP hypothesis. We first treat Drosophila Fmr1 (dfmr1) null animals with minocycline to assay the effects on mutant synaptic architecture in three disparate locations: the neuromuscular junction (NMJ), clock neurons in the circadian activity circuit and Kenyon cells in the mushroom body learning and memory center. We find that minocycline effectively restores normal synaptic structure in all three circuits, promising therapeutic potential for FXS treatment. We next tested the MMP hypothesis by assaying the effects of overexpressing the sole Drosophila tissue inhibitor of MMP (TIMP) in dfmr1 null mutants. We find that TIMP overexpression effectively prevents defects in the NMJ synaptic architecture in dfmr1 mutants. Moreover, co-removal of dfmr1 similarly rescues TIMP overexpression phenotypes, including cellular tracheal defects and lethality. To further test the MMP hypothesis, we generated dfmr1;mmp1 double null mutants. Null mmp1 mutants are 100% lethal and display cellular tracheal defects, but co-removal of dfmr1 allows adult viability and prevents tracheal defects. Conversely, co-removal of mmp1 ameliorates the NMJ synaptic architecture defects in dfmr1 null mutants, despite the lack of detectable difference in MMP1 expression or gelatinase activity between the single dfmr1 mutants and controls. These results support minocycline as a promising potential FXS treatment and suggest that it might act via MMP inhibition. We conclude that FMRP and TIMP pathways interact in a reciprocal, bidirectional manner. PMID:21669931

Stable Defects in Semiconductor Nanowires.

PubMed

Sanchez, A M; Gott, J A; Fonseka, H A; Zhang, Y; Liu, H; Beanland, R

2018-05-09

Semiconductor nanowires are commonly described as being defect-free due to their ability to expel mobile defects with long-range strain fields. Here, we describe previously undiscovered topologically protected line defects with null Burgers vector that, unlike dislocations, are stable in nanoscale crystals. We analyze the defects present in semiconductor nanowires in regions of imperfect crystal growth, i.e., at the nanowire tip formed during consumption of the droplet in self-catalyzed vapor-liquid-solid growth and subsequent vapor-solid shell growth. We use a form of the Burgers circuit method that can be applied to multiply twinned material without difficulty. Our observations show that the nanowire microstructure is very different from bulk material, with line defects either (a) trapped by locks or other defects, (b) arranged as dipoles or groups with a zero total Burgers vector, or (c) have a zero Burgers vector. We find two new line defects with a null Burgers vector, formed from the combination of partial dislocations in twinned material. The most common defect is the three-monolayer high twin facet with a zero Burgers vector. Studies of individual nanowires using cathodoluminescence show that optical emission is quenched in defective regions, showing that they act as strong nonradiative recombination centers.

Feature selection from hyperspectral imaging for guava fruit defects detection

NASA Astrophysics Data System (ADS)

Mat Jafri, Mohd. Zubir; Tan, Sou Ching

2017-06-01

Development of technology makes hyperspectral imaging commonly used for defect detection. In this research, a hyperspectral imaging system was setup in lab to target for guava fruits defect detection. Guava fruit was selected as the object as to our knowledge, there is fewer attempts were made for guava defect detection based on hyperspectral imaging. The common fluorescent light source was used to represent the uncontrolled lighting condition in lab and analysis was carried out in a specific wavelength range due to inefficiency of this particular light source. Based on the data, the reflectance intensity of this specific setup could be categorized in two groups. Sequential feature selection with linear discriminant (LD) and quadratic discriminant (QD) function were used to select features that could potentially be used in defects detection. Besides the ordinary training method, training dataset in discriminant was separated in two to cater for the uncontrolled lighting condition. These two parts were separated based on the brighter and dimmer area. Four evaluation matrixes were evaluated which are LD with common training method, QD with common training method, LD with two part training method and QD with two part training method. These evaluation matrixes were evaluated using F1-score with total 48 defected areas. Experiment shown that F1-score of linear discriminant with the compensated method hitting 0.8 score, which is the highest score among all.

Anatomy of the ventricular septal defect in outflow tract defects: similarities and differences.

PubMed

Mostefa-Kara, Meriem; Bonnet, Damien; Belli, Emre; Fadel, Elie; Houyel, Lucile

2015-03-01

The study objective was to analyze the anatomy of the ventricular septal defect found in various phenotypes of outflow tract defects. We reviewed 277 heart specimens with isolated outlet ventricular septal defect without subpulmonary stenosis (isolated outlet ventricular septal defect, 19); tetralogy of Fallot (71); tetralogy of Fallot with pulmonary atresia (51); common arterial trunk (54); double outlet right ventricle (65) with subaortic, doubly committed, or subpulmonary ventricular septal defect; and interrupted aortic arch type B (17). Special attention was paid to the rims of the ventricular septal defect viewed from the right ventricular side and the relationships between the tricuspid and aortic valves. The ventricular septal defect was always located in the outlet of the right ventricle, between the 2 limbs of the septal band. There was a fibrous continuity between the tricuspid and aortic valves in 74% of specimens with isolated outlet ventricular septal defect, 66% of specimens with tetralogy of Fallot, 39% of specimens with tetralogy of Fallot with pulmonary atresia, 4.6% of specimens with double outlet right ventricle, 1.8% of specimens with common arterial trunk, and zero of specimens with interrupted aortic arch type B (P < .005). When present, this continuity always involved the anterior tricuspid leaflet. The ventricular septal defect in outflow tract defects is always an outlet ventricular septal defect, cradled between the 2 limbs of the septal band. However, there are some differences regarding the posteroinferior and superior rims of the ventricular septal defect. These differences suggest an anatomic continuum from the isolated outlet ventricular septal defect to the interrupted aortic arch type B rather than distinct physiologic phenotypes, related to various degrees of abnormal rotation of the outflow tract during heart development: minimal in isolated outlet ventricular septal defect; incomplete in tetralogy of Fallot, tetralogy of Fallot with pulmonary atresia, and double outlet right ventricle; absent in common arterial trunk; and excessive in interrupted aortic arch type B. Copyright © 2015 The American Association for Thoracic Surgery. Published by Elsevier Inc. All rights reserved.

Growth, nutritional, and gastrointestinal aspects of ankyloblepharon-ectodermal defect-cleft lip and/or palate (AEC) syndrome

USDA-ARS?s Scientific Manuscript database

Ankyloblepharon-ectodermal defect-cleft lip and/or palate (AEC), is a rare genetic disorder due to mutations in the TP63 gene. In the present study, we characterized the pattern of growth and body composition, and the nutritional and gastrointestinal aspects of children and adults (n = 18) affected ...

Defect in IgV gene somatic hypermutation in common variable immuno-deficiency syndrome.

PubMed

Levy, Y; Gupta, N; Le Deist, F; Garcia, C; Fischer, A; Weill, J C; Reynaud, C A

1998-10-27

Common Variable Immuno-Deficiency (CVID) is the most common symptomatic primary antibody-deficiency syndrome, but the basic immunologic defects underlying this syndrome are not well defined. We report here that among eight patients studied (six CVID and two hypogammaglobulinemic patients with recurrent infections), there is in two CVID patients a dramatic reduction in Ig V gene somatic hypermutation with 40-75% of IgG transcripts totally devoid of mutations in the circulating memory B cell compartment. Functional assays of the T cell compartment point to an intrinsic B cell defect in the process of antibody affinity maturation in these two cases.

Late-onset cone photoreceptor degeneration induced by R172W mutation in Rds and partial rescue by gene supplementation.

PubMed

Conley, Shannon; Nour, May; Fliesler, Steven J; Naash, Muna I

2007-12-01

R172W is a common mutation in the human retinal degeneration slow (RDS) gene, associated with a late-onset dominant macular dystrophy. In this study, the authors characterized a mouse model that closely mimics the human phenotype and tested the feasibility of gene supplementation as a disease treatment strategy. Transgenic mouse lines carrying the R172W mutation were generated. The retinal phenotype associated with this mutation in a low-expresser line (L-R172W) was examined, both structurally (histology with correlative immunohistochemistry) and functionally (electroretinography). By examining animals over time and with various rds genetic backgrounds, the authors evaluated the dominance of the defect. To assess the efficacy of gene transfer therapy as a treatment for this defect, a previously characterized transgenic line expressing the normal mouse peripherin/Rds (NMP) was crossed with a higher-expresser Rds line harboring the R172W mutation (H-R172W). Functional, structural, and biochemical analyses were used to assess rescue of the retinal disease phenotype. In the wild-type (WT) background, L-R172W mice exhibited late-onset (12-month) dominant cone degeneration without any apparent effect on rods. The degeneration was slightly accelerated (9 months) in the rds(+/-) background. L-R172W retinas did not form outer segments in the absence of endogenous Rds. With use of the H-R172W line on an rds(+/-) background for proof-of-principle genetic supplementation studies, the NMP transgene product rescued rod and cone functional defects and supported outer segment integrity up to 3 months of age, but the rescue effect did not persist in older (11-month) animals. The R172W mutation leads to dominant cone degeneration in the mouse model, regardless of the expression level of the transgene. In contrast, effects of the mutation on rods are dose dependent, underscoring the usefulness of the L-R172W line as a faithful model of the human phenotype. This model may prove helpful in future studies on the mechanisms of cone degeneration and for elucidating the different roles of Rds in rods and cones. This study provides evidence that Rds genetic supplementation can be used to partially rescue visual function. Although this strategy is capable of rescuing haploinsufficiency, it does not rescue the long-term degeneration associated with a gain-of-function mutation.

Box 6: Nanoscale Defects

NASA Astrophysics Data System (ADS)

Alves, Eduardo; Breese, Mark

Defects affect virtually all properties of crystalline materials, and their role is magnified in nanoscale structures. In this box we describe the different type of defects with particular emphasis on point and linear defects. Above zero Kelvin all real materials have a defect population within their structure, which affects either their crystalline, electronic or optical properties. It is common to attribute a negative connotation to the presence of defects. However, a perfect silicon crystal or any other defect-free semiconductor would have a limited functionality and might even be useless.

A review of genome-wide approaches to study the genetic basis for spermatogenic defects.

PubMed

Aston, Kenneth I; Conrad, Donald F

2013-01-01

Rapidly advancing tools for genetic analysis on a genome-wide scale have been instrumental in identifying the genetic bases for many complex diseases. About half of male infertility cases are of unknown etiology in spite of tremendous efforts to characterize the genetic basis for the disorder. Advancing our understanding of the genetic basis for male infertility will require the application of established and emerging genomic tools. This chapter introduces many of the tools available for genetic studies on a genome-wide scale along with principles of study design and data analysis.

The Implications of Parental Consanguinity on the Care of Neonates.

PubMed

Ng, Diana

2016-08-01

Approximately 6% of births worldwide, 7.9 million children, are born with a serious genetic congenital abnormality each year. A factor thought to increase the prevalence of birth defects is parental consanguinity, which is a social custom practiced in at least 20% of the world's population. The purpose of this article is to explore the relationship between consanguinity and congenital defects. This article also aims to enhance neonatal healthcare practitioners' comprehension of its implications for practice and research. A review of literature was compiled from a search of the online databases Cumulative Index of Nursing and Allied Health (CINAHL), PubMed, EBSCO MegaFILE, and Google Scholar. Literature pertinent to this topic primarily consists of research studies that examine the inbreeding depression phenomenon through comparison of the prevalence of birth defects among the offspring of consanguineous and nonconsanguineous couples. Current studies indicate that the progeny of consanguineous couples are at an increased risk of congenital defects compared with those of nonconsanguineous couples. Consanguinity is one risk factor among many that can lead to a major birth defect. Relationships between consanguineous populations and neonatal healthcare practitioners such as registered nurses, advanced practice nurses, and physicians could significantly alter neonatal health outcomes. Specific recommendations such as genetic counseling and therapeutic communication are discussed. Further studies need to investigate the connection between consanguinity and birth defects while controlling for nongenetic variables. Moreover, a focus on consanguineous communities in the United States would prove beneficial.

Generalized functional linear models for gene-based case-control association studies.

PubMed

Fan, Ruzong; Wang, Yifan; Mills, James L; Carter, Tonia C; Lobach, Iryna; Wilson, Alexander F; Bailey-Wilson, Joan E; Weeks, Daniel E; Xiong, Momiao

2014-11-01

By using functional data analysis techniques, we developed generalized functional linear models for testing association between a dichotomous trait and multiple genetic variants in a genetic region while adjusting for covariates. Both fixed and mixed effect models are developed and compared. Extensive simulations show that Rao's efficient score tests of the fixed effect models are very conservative since they generate lower type I errors than nominal levels, and global tests of the mixed effect models generate accurate type I errors. Furthermore, we found that the Rao's efficient score test statistics of the fixed effect models have higher power than the sequence kernel association test (SKAT) and its optimal unified version (SKAT-O) in most cases when the causal variants are both rare and common. When the causal variants are all rare (i.e., minor allele frequencies less than 0.03), the Rao's efficient score test statistics and the global tests have similar or slightly lower power than SKAT and SKAT-O. In practice, it is not known whether rare variants or common variants in a gene region are disease related. All we can assume is that a combination of rare and common variants influences disease susceptibility. Thus, the improved performance of our models when the causal variants are both rare and common shows that the proposed models can be very useful in dissecting complex traits. We compare the performance of our methods with SKAT and SKAT-O on real neural tube defects and Hirschsprung's disease datasets. The Rao's efficient score test statistics and the global tests are more sensitive than SKAT and SKAT-O in the real data analysis. Our methods can be used in either gene-disease genome-wide/exome-wide association studies or candidate gene analyses. © 2014 WILEY PERIODICALS, INC.

Generalized Functional Linear Models for Gene-based Case-Control Association Studies

PubMed Central

Mills, James L.; Carter, Tonia C.; Lobach, Iryna; Wilson, Alexander F.; Bailey-Wilson, Joan E.; Weeks, Daniel E.; Xiong, Momiao

2014-01-01

By using functional data analysis techniques, we developed generalized functional linear models for testing association between a dichotomous trait and multiple genetic variants in a genetic region while adjusting for covariates. Both fixed and mixed effect models are developed and compared. Extensive simulations show that Rao's efficient score tests of the fixed effect models are very conservative since they generate lower type I errors than nominal levels, and global tests of the mixed effect models generate accurate type I errors. Furthermore, we found that the Rao's efficient score test statistics of the fixed effect models have higher power than the sequence kernel association test (SKAT) and its optimal unified version (SKAT-O) in most cases when the causal variants are both rare and common. When the causal variants are all rare (i.e., minor allele frequencies less than 0.03), the Rao's efficient score test statistics and the global tests have similar or slightly lower power than SKAT and SKAT-O. In practice, it is not known whether rare variants or common variants in a gene are disease-related. All we can assume is that a combination of rare and common variants influences disease susceptibility. Thus, the improved performance of our models when the causal variants are both rare and common shows that the proposed models can be very useful in dissecting complex traits. We compare the performance of our methods with SKAT and SKAT-O on real neural tube defects and Hirschsprung's disease data sets. The Rao's efficient score test statistics and the global tests are more sensitive than SKAT and SKAT-O in the real data analysis. Our methods can be used in either gene-disease genome-wide/exome-wide association studies or candidate gene analyses. PMID:25203683

A Guide to Selected National Genetic Voluntary Organizations.

ERIC Educational Resources Information Center

National Center for Education in Maternal and Child Health, Washington, DC.

The directory lists mutual support groups concerned with the medical and psychosocial impacts of genetic disorders and birth defects on affected individuals and families. Each organization included is dedicated to the ongoing emotional, practical, and financial needs of these populations. Entries are categorized by disorder, including: general,…

A Guide to Selected National Genetic Voluntary Organizations.

ERIC Educational Resources Information Center

National Center for Education in Maternal and Child Health, Washington, DC.

The directory lists approximately 120 mutual support groups concerned with the medical and psychological impacts of genetic disorders and birth defects on individuals and their families. The groups are dedicated to serving the ongoing emotional, practical, and financial needs of these populations. The entries are arranged alphabetically and…

Half a Tithe for Ethics.

ERIC Educational Resources Information Center

Larson, Edward J.

1993-01-01

Two ethical concerns about the Human Genome Project, which aims to sequence all the DNA of a human cell, are discussed: (1) use of germ-line gene therapy to treat perceived hereditary defects or enhance supposed genetic attributes, and (2) personal privacy and potential discrimination arising from possession of individual genetic information. (MSE)

Ellis-van Creveld syndrome: prenatal diagnosis, molecular analysis and genetic counseling.

PubMed

Chen, Chih-Ping; Su, Yi-Ning; Hsu, Chin-Yuan; Chern, Schu-Rern; Tsai, Fuu-Jen; Wu, Pei-Chen; Chen, Po-Tsang; Wang, Wayseen

2010-12-01

To present the perinatal findings and molecular genetic analysis of two siblings with Ellis-van Creveld (EvC) syndrome. A 33-year-old woman, gravida 3, para 1, was referred for genetic counseling at 18 gestational weeks because of recurrent fetal skeletal dysplasia. Two years previously, she had delivered a 1,316-g dead male baby at 28 gestational weeks with a karyotype of 46,XY, postaxial polydactyly of the hands, thoracic narrowness, endocardial cushion defects, transposition of the great arteries, shortening of the long bones, malposition of the toes, and hypoplastic nails. During this pregnancy, prenatal ultrasound at 18 gestational weeks revealed shortening of the long bones (equivalent to 15 weeks), postaxial polydactyly of both hands, thoracic narrowness, and endocardial cushion defects. The pregnancy was subsequently terminated, and a 236-g female fetus was delivered with a karyotype of 46,XX, postaxial polydactyly of the hands, thoracic dysplasia, endocardial cushion defects, shortening of the long bones, and malposition of the toes and hypoplastic nails. The phenotype of each of the two siblings was consistent with EVC syndrome. Molecular analysis of the EVC and EVC2 genes revealed heterozygous mutations in the EVC2 gene. A heterozygous deletion mutation of a 26-bp deletion of c.871-2_894del26 encompassing the junction between intron 7 and exon 8 of the EVC2 gene was found in the mother and two siblings, and a heterozygous nonsense mutation of c.1195C >T, p.R399X in exon 10 of the EVC2 gene was found in the father and two siblings. Prenatal sonographic identification of endocardial cushion defects in association with shortening of the long bones should alert clinicians to the possibility of EvC syndrome and prompt a careful search of hexadactyly of the hands. Molecular analysis of the EVC and EVC2 genes is helpful in genetic counseling in cases with prenatally detected postaxial polydactyly, thoracic narrowness, short limbs and endocardial cushion defects. Copyright © 2010 Taiwan Association of Obstetric & Gynecology. Published by Elsevier B.V. All rights reserved.

An optimization method for defects reduction in fiber laser keyhole welding

NASA Astrophysics Data System (ADS)

Ai, Yuewei; Jiang, Ping; Shao, Xinyu; Wang, Chunming; Li, Peigen; Mi, Gaoyang; Liu, Yang; Liu, Wei

2016-01-01

Laser welding has been widely used in automotive, power, chemical, nuclear and aerospace industries. The quality of welded joints is closely related to the existing defects which are primarily determined by the welding process parameters. This paper proposes a defects optimization method that takes the formation mechanism of welding defects and weld geometric features into consideration. The analysis of welding defects formation mechanism aims to investigate the relationship between welding defects and process parameters, and weld features are considered to identify the optimal process parameters for the desired welded joints with minimum defects. The improved back-propagation neural network possessing good modeling for nonlinear problems is adopted to establish the mathematical model and the obtained model is solved by genetic algorithm. The proposed method is validated by macroweld profile, microstructure and microhardness in the confirmation tests. The results show that the proposed method is effective at reducing welding defects and obtaining high-quality joints for fiber laser keyhole welding in practical production.

Salient Features of Endonuclease Platforms for Therapeutic Genome Editing.

PubMed

Certo, Michael T; Morgan, Richard A

2016-03-01

Emerging gene-editing technologies are nearing a revolutionary phase in genetic medicine: precisely modifying or repairing causal genetic defects. This may include any number of DNA sequence manipulations, such as knocking out a deleterious gene, introducing a particular mutation, or directly repairing a defective sequence by site-specific recombination. All of these edits can currently be achieved via programmable rare-cutting endonucleases to create targeted DNA breaks that can engage and exploit endogenous DNA repair pathways to impart site-specific genetic changes. Over the past decade, several distinct technologies for introducing site-specific DNA breaks have been developed, yet the different biological origins of these gene-editing technologies bring along inherent differences in parameters that impact clinical implementation. This review aims to provide an accessible overview of the various endonuclease-based gene-editing platforms, highlighting the strengths and weakness of each with respect to therapeutic applications.

Salient Features of Endonuclease Platforms for Therapeutic Genome Editing

PubMed Central

Certo, Michael T; Morgan, Richard A

2016-01-01

Emerging gene-editing technologies are nearing a revolutionary phase in genetic medicine: precisely modifying or repairing causal genetic defects. This may include any number of DNA sequence manipulations, such as knocking out a deleterious gene, introducing a particular mutation, or directly repairing a defective sequence by site-specific recombination. All of these edits can currently be achieved via programmable rare-cutting endonucleases to create targeted DNA breaks that can engage and exploit endogenous DNA repair pathways to impart site-specific genetic changes. Over the past decade, several distinct technologies for introducing site-specific DNA breaks have been developed, yet the different biological origins of these gene-editing technologies bring along inherent differences in parameters that impact clinical implementation. This review aims to provide an accessible overview of the various endonuclease-based gene-editing platforms, highlighting the strengths and weakness of each with respect to therapeutic applications. PMID:26796671

Diagnosis and management of primary ciliary dyskinesia.

PubMed

Lucas, Jane S; Burgess, Andrea; Mitchison, Hannah M; Moya, Eduardo; Williamson, Michael; Hogg, Claire

2014-09-01

Primary ciliary dyskinesia (PCD) is an inherited autosomal-recessive disorder of motile cilia characterised by chronic lung disease, rhinosinusitis, hearing impairment and subfertility. Nasal symptoms and respiratory distress usually start soon after birth, and by adulthood bronchiectasis is invariable. Organ laterality defects, usually situs inversus, occur in ∼50% of cases. The estimated prevalence of PCD is up to ∼1 per 10,000 births, but it is more common in populations where consanguinity is common. This review examines who to refer for diagnostic testing. It describes the limitations surrounding diagnosis using currently available techniques and considers whether recent advances to genotype patients with PCD will lead to genetic testing and screening to aid diagnosis in the near future. It discusses the challenges of monitoring and treating respiratory and ENT disease in children with PCD. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.

A patient with congenital hyperlactataemia and Leigh syndrome: an uncommon mitochondrial variant.

PubMed

Ching, C K; Mak, Chloe M; Au, K M; Chan, K Y; Yuen, Y P; Yau, Eric K C; Ma, Louis C K; Chow, H L; Chan, Albert Y W

2013-08-01

We report an uncommon mitochondrial variant in a baby girl with congenital hyperlactataemia and Leigh syndrome. The patient presented with a single episode of generalised clonic convulsion at day 19, and was found to have isolated and persistent hyperlactataemia ranging from 3.34 to 9.26 mmol/L. She had elevated serum lactate-to-pyruvate ratios of up to 35 and high plasma alanine concentration, indicative of a respiratory chain defect. At the age of 8 months, she developed evolving neurological and imaging features compatible with Leigh syndrome. Genetic testing for common mitochondrial DNA mutations, large mitochondrial DNA deletions, and selected nuclear genes was negative. Further analysis of lymphocyte mitochondrial DNA by sequencing revealed an uncommon heteroplasmic variant, NC_012920.1(MT-ND5):m.13094T>C (p.Val253Ala), which was previously shown to reduce complex I activity. In patients in whom there was a high suspicion of mitochondrial disorder, entire mitochondrial DNA analysis may be warranted if initial screening of common mitochondrial DNA mutations is negative.

Myasthenia and related disorders of the neuromuscular junction.

PubMed

Spillane, Jennifer; Beeson, David J; Kullmann, Dimitri M

2010-08-01

Our understanding of transmission at the neuromuscular junction has increased greatly in recent years. We now recognise a wide variety of autoimmune and genetic diseases that affect this specialised synapse, causing muscle weakness and fatigue. These disorders greatly affect quality of life and rarely can be fatal. Myasthenia gravis is the most common disorder and is most commonly caused by autoantibodies targeting postsynaptic acetylcholine receptors. Antibodies to muscle-specific kinase (MuSK) are detected in a variable proportion of the remainder. Treatment is symptomatic and immunomodulatory. Lambert-Eaton myasthenic syndrome is caused by antibodies to presynaptic calcium channels, and approximately 50% of cases are paraneoplastic, most often related to small cell carcinoma of the lung. Botulism is an acquired disorder caused by neurotoxins produced by Clostridium botulinum, impairing acetylcholine release into the synaptic cleft. In addition, several rare congenital myasthenic syndromes have been identified, caused by inherited defects in presynaptic, synaptic basal lamina and postsynaptic proteins necessary for neuromuscular transmission. This review focuses on recent advances in the diagnosis and treatment of these disorders.

Common genetic variants in fatty acid-binding protein-4 (FABP4) and clinical diabetes risk in the Women's Health Initiative Observational Study.

PubMed

Chan, Kei-Hang K; Song, Yiqing; Hsu, Yi-Hsiang; You, Nai-Chieh Y; F Tinker, Lesley; Liu, Simin

2010-09-01

Adipocypte fatty acid-binding protein-4 (FABP4/adipocyte P2) may play a central role in energy metabolism and inflammation. In animal models, defects of the aP2 gene (aP2(-/-)) partially protected against the development of obesity-related insulin resistance, dyslipidemia, and atherosclerosis. However, it is unclear whether common genetic variation in FABP4 gene contributes to risk of type 2 diabetes (T2D) or diabetes-related metabolic traits in humans. We comprehensively assess the genetic associations of variants in the FABP4 gene with T2D risk and diabetes-associated biomarkers in a prospective study of 1,529 cases and 2,147 controls among postmenopausal women aged 50-79 years who enrolled in the Women's Health Initiative Observational Study (WHI-OS). We selected and genotyped a total of 11 haplotype-tagging single-nucleotide polymorphisms (tSNPs) spanning 41.3 kb across FABP4 in all samples. None of the SNPs and their derived haplotypes showed significant association with T2D risk. There were no significant associations between SNPs and plasma levels of inflammatory and endothelial biomarkers, including C-reactive protein, tumor necrosis factor (TNF), interleukin-6 (IL-6), E-selectin, and intercellular adhesion molecule (ICAM-1). Among African-American women, several SNPs were significantly associated with lower levels of vascular cell adhesion molecule-1 (VCAM-1), especially among those with incident T2D. On average, plasma levels of VCAM-1 were significantly lower among carriers of each minor allele at rs1486004(C/T; -1.08 ng/ml, P = 0.01), rs7017115(A/G; -1.07 ng/ml, P = 0.02), and rs2290201(C/T; -1.12 ng/ml, P = 0.002) as compared with the homozygotes of the common allele, respectively. After adjusting for multiple testing, carriers of the rs2290201 minor allele remained significantly associated with decreasing levels of plasma VCAM-1 in these women (P = 0.02). In conclusion, our finding from a multiethnic cohort of postmenopausal women did not support the notion that common genetic variants in the FABP4 gene may trigger increased risk of T2D. The observed significant association between reduced VCAM-1 levels and FABP4 genotypes in African-American women warrant further confirmation.

Common Genetic Variants in Fatty Acid–Binding Protein-4 (FABP4) and Clinical Diabetes Risk in the Women's Health Initiative Observational study

PubMed Central

Chan, Kei-Hang K.; Song, Yiqing; Hsu, Yi-Hsiang; You, Nai-chieh Y.; Tinker, Lesley F.; Liu, Simin

2011-01-01

Adipocypte fatty acid–binding protein-4 (FABP4/adipocyte P2) may play a central role in energy metabolism and inflammation. In animal models, defects of the aP2 gene (aP2–/–) partially protected against the development of obesity-related insulin resistance, dyslipidemia, and atherosclerosis. However, it is unclear whether common genetic variation in FABP4 gene contributes to risk of type 2 diabetes (T2D) or diabetes-related metabolic traits in humans. We comprehensively assess the genetic associations of variants in the FABP4 gene with T2D risk and diabetes-associated biomarkers in a prospective study of 1,529 cases and 2,147 controls among postmenopausal women aged 50–79 years who enrolled in the Women's Health Initiative Observational Study (WHI-OS). We selected and genotyped a total of 11 haplotype-tagging single-nucleotide polymorphisms (tSNPs) spanning 41.3 kb across FABP4 in all samples. None of the SNPs and their derived haplotypes showed significant association with T2D risk. There were no significant associations between SNPs and plasma levels of inflammatory and endothelial biomarkers, including C-reactive protein, tumor necrosis factor (TNF), interleukin-6 (IL-6), E-selectin, and intercellular adhesion molecule (ICAM-1). Among African-American women, several SNPs were significantly associated with lower levels of vascular cell adhesion molecule-1 (VCAM-1), especially among those with incident T2D. On average, plasma levels of VCAM-1 were significantly lower among carriers of each minor allele at rs1486004(C/T; −1.08 ng/ml, P = 0.01), rs7017115(A/G; −1.07 ng/ml, P = 0.02), and rs2290201(C/T; −1.12 ng/ml, P = 0.002) as compared with the homozygotes of the common allele, respectively. After adjusting for multiple testing, carriers of the rs2290201 minor allele remained significantly associated with decreasing levels of plasma VCAM-1 in these women (P = 0.02). In conclusion, our finding from a multiethnic cohort of postmenopausal women did not support the notion that common genetic variants in the FABP4 gene may trigger increased risk of T2D. The observed significant association between reduced VCAM-1 levels and FABP4 genotypes in African-American women warrant further confirmation. PMID:20111020

Anophthalmos, microphthalmos, and Coloboma in the United kingdom: clinical features, results of investigations, and early management.

PubMed

Shah, Shaheen P; Taylor, Amy E; Sowden, Jane C; Ragge, Nicky; Russell-Eggitt, Isabelle; Rahi, Jugnoo S; Gilbert, Clare E

2012-02-01

To describe the clinical features of children with anophthalmos, microphthalmos, and typical coloboma (AMC). Descriptive, observational, cross-sectional study of the United Kingdom. A total of 135 children with AMC newly diagnosed over an 18-month period beginning in October 2006. Cases were identified using active surveillance through an established ophthalmic surveillance system. Eligible cases were followed up 6 months after first notification. Phenotypic characteristics, both ocular and systemic, clinical investigations, causes, and interventions. A total of 210 eyes (of 135 children) were affected by AMC, of which 153 had isolated coloboma or coloboma with microphthalmos. The most common colobomatous anomaly was a chorioretinal defect present in 109 eyes (71.2%). Some 44% of children were bilaterally visually impaired. Systemic abnormalities were present in 59.7% of children, with craniofacial anomalies being the most common. Children with bilateral disease had a 2.7 times higher odds (95% confidence interval, 1.3-5.5, P = 0.006) of having systemic involvement than unilaterally affected children. Neurologic imaging was the most frequent investigation (58.5%) performed. Less than one third (30.3%) of the children with microphthalmos had ocular axial lengths measured. Eight children had confirmed genetic mutations. Approximately half (49.2%) of the children required ocular intervention. Colobomatous defects were the most common phenotype within this spectrum of anomalies in the United Kingdom. The high frequency of posterior segment colobomatous involvement means that a dilated fundal examination should be made in all cases. The significant visual and systemic morbidity in affected children underlines the importance of a multidisciplinary approach to management. Copyright © 2012 American Academy of Ophthalmology. Published by Elsevier Inc. All rights reserved.

Extracorporeal membrane oxygenation in children with heart disease and down syndrome: a multicenter analysis.

PubMed

Gupta, Punkaj; Gossett, Jeffrey M; Rycus, Peter T; Prodhan, Parthak

2014-12-01

The data on the outcomes of children with heart disease and Down syndrome receiving extracorporeal membrane oxygenation (ECMO) for cardiac or respiratory failure are limited. This study aimed to evaluate morbidity and mortality associated with ECMO in children with Down syndrome and heart disease. Children younger than 18 years undergoing heart surgery and ECMO reported in the Extracorporeal Life Support Organization (ELSO) registry (1998-2011) were included in the study. The registry was queried for the following five heart defects: common atrioventricular (AV) canal, tetralogy of Fallot, truncus arteriosus, transposition of great vessels, and interrupted aortic arch. Data collection included patient characteristics, ECMO characteristics, and outcomes. The outcomes evaluated included mortality, ECMO duration, and length of hospital stay for patients with Down syndrome and those with no Down syndrome. The study enrolled 2,815 patients qualified for inclusion. Of these patients, 121 had Down syndrome, whereas 2,694 had no genetic syndrome and were included in the control group. The median age of the patients was 45 days (interquartile range [IQR] 9-192 days), and the median weight was 3.8 kg (IQR 3.0-6.1 kg). The most common cardiac defects in Down syndrome group were common AV canal (63 %) and tetralogy of Fallot (40 %). The Down syndrome group included older patients with greater body weight than the control group. The mortality rate was lower in the Down syndrome group than in the control group (44 vs. 56 %; p = 0.01). The duration of ECMO and length of hospital stay were similar in the two groups. The findings showed that ECMO can be used for children with heart disease and Down syndrome with good results. The outcomes were comparable between the children with Down syndrome and the children without Down syndrome.

A common variant in combination with a nonsense mutation in a member of the thioredoxin family causes primary ciliary dyskinesia

PubMed Central

Duriez, Bénédicte; Duquesnoy, Philippe; Escudier, Estelle; Bridoux, Anne-Marie; Escalier, Denise; Rayet, Isabelle; Marcos, Elisabeth; Vojtek, Anne-Marie; Bercher, Jean-François; Amselem, Serge

2007-01-01

Thioredoxins belong to a large family of enzymatic proteins that function as general protein disulfide reductases, therefore participating in several cellular processes via redox-mediated reactions. So far, none of the 18 members of this family has been involved in human pathology. Here we identified TXNDC3, which encodes a thioredoxin–nucleoside diphosphate kinase, as a gene implicated in primary ciliary dyskinesia (PCD), a genetic condition characterized by chronic respiratory tract infections, left–right asymmetry randomization, and male infertility. We show that the disease, which segregates as a recessive trait, results from the unusual combination of the following two transallelic defects: a nonsense mutation and a common intronic variant found in 1% of control chromosomes. This variant affects the ratio of two physiological TXNDC3 transcripts: the full-length isoform and a novel isoform, TXNDC3d7, carrying an in-frame deletion of exon 7. In vivo and in vitro expression data unveiled the physiological importance of TXNDC3d7 (whose expression was reduced in the patient) and the corresponding protein that was shown to bind microtubules. PCD is known to result from defects of the axoneme, an organelle common to respiratory cilia, embryonic nodal cilia, and sperm flagella, containing dynein arms, with, to date, the implication of genes encoding dynein proteins. Our findings, which identify a another class of molecules involved in PCD, disclose the key role of TXNDC3 in ciliary function; they also point to an unusual mechanism underlying a Mendelian disorder, which is an SNP-induced modification of the ratio of two physiological isoforms generated by alternative splicing. PMID:17360648

Advances in Evaluation of Chronic Diarrhea in Infants.

PubMed

Thiagarajah, Jay R; Kamin, Daniel S; Acra, Sari; Goldsmith, Jeffrey D; Roland, Joseph T; Lencer, Wayne I; Muise, Aleixo M; Goldenring, James R; Avitzur, Yaron; Martín, Martín G

2018-06-01

Diarrhea is common in infants (children less than 2 years of age), usually acute, and, if chronic, commonly caused by allergies and occasionally by infectious agents. Congenital diarrheas and enteropathies (CODEs) are rare causes of devastating chronic diarrhea in infants. Evaluation of CODEs is a lengthy process and infrequently leads to a clear diagnosis. However, genomic analyses and the development of model systems have increased our understanding of CODE pathogenesis. With these advances, a new diagnostic approach is needed. We propose a revised approach to determine causes of diarrhea in infants, including CODEs, based on stool analysis, histologic features, responses to dietary modifications, and genetic tests. After exclusion of common causes of diarrhea in infants, the evaluation proceeds through analyses of stool characteristics (watery, fatty, or bloody) and histologic features, such as the villus to crypt ratio in intestinal biopsies. Infants with CODEs resulting from defects in digestion, absorption, transport of nutrients and electrolytes, or enteroendocrine cell development or function have normal villi to crypt ratios; defects in enterocyte structure or immune-mediated conditions result in an abnormal villus to crypt ratios and morphology. Whole-exome and genome sequencing in the early stages of evaluation can reduce the time required for a definitive diagnosis of CODEs, or lead to identification of new variants associated with these enteropathies. The functional effects of gene mutations can be analyzed in model systems such as enteroids or induced pluripotent stem cells and are facilitated by recent advances in gene editing procedures. Characterization and investigation of new CODE disorders will improve management of patients and advance our understanding of epithelial cells and other cells in the intestinal mucosa. Copyright © 2018 AGA Institute. Published by Elsevier Inc. All rights reserved.

pySAPC, a python package for sparse affinity propagation clustering: Application to odontogenesis whole genome time series gene-expression data.

PubMed

Cao, Huojun; Amendt, Brad A

2016-11-01

Developmental dental anomalies are common forms of congenital defects. The molecular mechanisms of dental anomalies are poorly understood. Systematic approaches such as clustering genes based on similar expression patterns could identify novel genes involved in dental anomalies and provide a framework for understanding molecular regulatory mechanisms of these genes during tooth development (odontogenesis). A python package (pySAPC) of sparse affinity propagation clustering algorithm for large datasets was developed. Whole genome pair-wise similarity was calculated based on expression pattern similarity based on 45 microarrays of several stages during odontogenesis. pySAPC identified 743 gene clusters based on expression pattern similarity during mouse tooth development. Three clusters are significantly enriched for genes associated with dental anomalies (with FDR <0.1). The three clusters of genes have distinct expression patterns during odontogenesis. Clustering genes based on similar expression profiles recovered several known regulatory relationships for genes involved in odontogenesis, as well as many novel genes that may be involved with the same genetic pathways as genes that have already been shown to contribute to dental defects. By using sparse similarity matrix, pySAPC use much less memory and CPU time compared with the original affinity propagation program that uses a full similarity matrix. This python package will be useful for many applications where dataset(s) are too large to use full similarity matrix. This article is part of a Special Issue entitled "System Genetics" Guest Editor: Dr. Yudong Cai and Dr. Tao Huang. Copyright © 2016. Published by Elsevier B.V.

Y choromosomal microdeletion screening in the workup of male infertility and its current status in India.

PubMed

Suganthi, Ramaswamy; Vijesh, Vijayabhavanath Vijayakumaran; Vandana, Nambiar; Fathima Ali Benazir, Jahangir

2014-01-01

Spermatogenesis is an essential stage in human male gamete development, which is regulated by many Y chromosome specific genes. Most of these genes are centred in a specific region located on the long arm of the human Y chromosome known as the azoospermia factor region (AZF). Deletion events are common in Y chromosome because of its peculiar structural organization. Astonishingly, among the several known genetic causes of male infertility, Y chromosomal microdeletions emerged as the most frequent structural chromosome anomaly associated with the quantitative reduction of sperm. The development of assisted reproductive techniques (ART) like intra-cytoplasmic sperm injection (ICSI) and testicular sperm extraction (TESE) helps to bypass the natural barriers of fertilization, but it increases the concern about the transmission of genetic defects. Experimental evidence suggested that the men with Y chromosomal microdeletions vertically transmitted their deletion as well as related fertility disorders to their offspring via these ART techniques. In India, infertility is on alarming rise. ART centres have opened up in virtually every state but still most of the infertility centres in India do not choose to perform Y chromosomal microdeletion diagnosis because of some advanced theoretical reasons. Moreover, there is no consensus among the clinicians about the diagnosis and management of Y chromosomal microdeletion defects. The current review discusses thoroughly the role of Y chromosome microdeletion screening in the workup of male infertility, its significance as a diagnostic test, novel approaches for screening Y deletions and finally a systematic review on the current status of Y chromosome microdeletion deletion screening in India.

Transfusion-dependent thalassemia in Northern Sarawak: a molecular study to identify different genotypes in the multi-ethnic groups and the importance of genomic sequencing in unstudied populations.

PubMed

Tan, Jin-Ai M A; Chin, Saw-Sian; Ong, Gek-Bee; Mohamed Unni, Mohamed N; Soosay, Ashley E R; Gudum, Henry R; Kho, Siew-Leng; Chua, Kek-Heng; Chen, Jang J; George, Elizabeth

2015-01-01

Although thalassemia is a genetic hemoglobinopathy in Malaysia, there is limited data on thalassemia mutations in the indigenous groups. This study aims to identify the types of globin gene mutations in transfusion-dependent patients in Northern Sarawak. Blood was collected from 32 patients from the Malay, Chinese, Kedayan, Bisayah, Kadazandusun, Tagal, and Bugis populations. The α- and β-globin gene mutations were characterized using DNA amplification and genomic sequencing. Ten β- and 2 previously reported α-globin defects were identified. The Filipino β-deletion represented the majority of the β-thalassemia alleles in the indigenous patients. Homozygosity for the deletion was observed in all Bisayah, Kadazandusun and Tagal patients. The β-globin gene mutations in the Chinese patients were similar to the Chinese in West Malaysia. Hb Adana (HBA2:c.179G>A) and the -α(3.7)/αα deletion were detected in 5 patients. A novel 24-bp deletion in the α2-globin gene (HBA2:c.95 + 5_95 + 28delGGCTCCCTCCCCTGCTCCGACCCG) was identified by sequencing. Co-inheritance of α-thalassemia with β-thalassemia did not ameliorate the severity of thalassemia major in the patients. The Filipino β-deletion was the most common gene defect observed. Homozygosity for the Filipino β-deletion appears to be unique to the Malays in Sarawak. Genomic sequencing is an essential tool to detect rare genetic variants in the study of new populations. © 2014 S. Karger AG, Basel.

Prader-Willi syndrome and atypical submicroscopic 15q11-q13 deletions with or without imprinting defects.

PubMed

Hassan, Maaz; Butler, Merlin G

2016-11-01

We report a 20 year follow up on a Caucasian female, now 26 years of age, with Prader-Willi syndrome (PWS) harboring an atypical 15q11-q13 submicroscopic deletion of 100-200 kb in size first detected in 1996 involving the imprinting center, SNRPN gene and surrounding region. PWS is a rare complex disorder caused by the loss of paternally expressed genes in the 15q11-q13 region. With high resolution chromosomal microarray and methylation - specific MLPA analysis, we updated the genetic findings on our patient and found a 209,819bp deletion including the SNURF-SNRPN gene complex which includes the imprinting center and the SNORD116 region. We compared with four other similarly reported individuals in the literature with atypical submicroscopic deletions within this region but without imprinting center involvement to better characterize the specific genetic lesions causing PWS clinical findings. Clinically, our patient met the diagnostic criteria of PWS including infantile hypotonia, a poor suck with feeding difficulties, global developmental delays and later food foraging, childhood obesity, small hands and skin picking. Small atypical deletions of comparable sizes were seen in the 15q11-q13 region in all five cases and similar behavioral/physical characteristics were found despite an imprinting defect in our patient. These results further support an overlapping critical deletion region involving the non-coding snoRNA SNORD116 in common in the five individuals playing a key role in contributing to the PWS phenotype. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

Etiology and clinical presentation of birth defects: population based study

PubMed Central

Carey, John C; Byrne, Janice L B; Krikov, Sergey; Botto, Lorenzo D

2017-01-01

Objective To assess causation and clinical presentation of major birth defects. Design Population based case cohort. Setting Cases of birth defects in children born 2005-09 to resident women, ascertained through Utah’s population based surveillance system. All records underwent clinical re-review. Participants 5504 cases among 270 878 births (prevalence 2.03%), excluding mild isolated conditions (such as muscular ventricular septal defects, distal hypospadias). Main outcome measures The primary outcomes were the proportion of birth defects with a known etiology (chromosomal, genetic, human teratogen, twinning) or unknown etiology, by morphology (isolated, multiple, minors only), and by pathogenesis (sequence, developmental field defect, or known pattern of birth defects). Results Definite cause was assigned in 20.2% (n=1114) of cases: chromosomal or genetic conditions accounted for 94.4% (n=1052), teratogens for 4.1% (n=46, mostly poorly controlled pregestational diabetes), and twinning for 1.4% (n=16, conjoined or acardiac). The 79.8% (n=4390) remaining were classified as unknown etiology; of these 88.2% (n=3874) were isolated birth defects. Family history (similarly affected first degree relative) was documented in 4.8% (n=266). In this cohort, 92.1% (5067/5504) were live born infants (isolated and non-isolated birth defects): 75.3% (4147/5504) were classified as having an isolated birth defect (unknown or known etiology). Conclusions These findings underscore the gaps in our knowledge regarding the causes of birth defects. For the causes that are known, such as smoking or diabetes, assigning causation in individual cases remains challenging. Nevertheless, the ongoing impact of these exposures on fetal development highlights the urgency and benefits of population based preventive interventions. For the causes that are still unknown, better strategies are needed. These can include greater integration of the key elements of etiology, morphology, and pathogenesis into epidemiologic studies; greater collaboration between researchers (such as developmental biologists), clinicians (such as medical geneticists), and epidemiologists; and better ways to objectively measure fetal exposures (beyond maternal self reports) and closer (prenatally) to the critical period of organogenesis. PMID:28559234

The genetics of normal and defective color vision

PubMed Central

Neitz, Jay; Neitz, Maureen

2011-01-01

The contributions of genetics research to the science of normal and defective color vision over the previous few decades are reviewed emphasizing the developments in the 25 years since the last anniversary issue of Vision Research. Understanding of the biology underlying color vision has been vaulted forward through the application of the tools of molecular genetics. For all their complexity, the biological processes responsible for color vision are more accessible than for many other neural systems. This is partly because of the wealth of genetic variations that affect color perception, both within and across species, and because components of the color vision system lend themselves to genetic manipulation. Mutations and rearrangements in the genes encoding the long, middle, and short wavelength sensitive cone pigments are responsible for color vision deficiencies and mutations have been identified that affect the number of cone types, the absorption spectrum of the pigments, the functionality and viability of the cones, and the topography of the cone mosaic. The addition of an opsin gene, as occurred in the evolution of primate color vision, and has been done in experimental animals can produce expanded color vision capacities and this has provided insight into the underlying neural circuitry. PMID:21167193

Peptidic tools applied to redirect alternative splicing events.

PubMed

Nancy, Martínez-Montiel; Nora, Rosas-Murrieta; Rebeca, Martínez-Contreras

2015-05-01

Peptides are versatile and attractive biomolecules that can be applied to modulate genetic mechanisms like alternative splicing. In this process, a single transcript yields different mature RNAs leading to the production of protein isoforms with diverse or even antagonistic functions. During splicing events, errors can be caused either by mutations present in the genome or by defects or imbalances in regulatory protein factors. In any case, defects in alternative splicing have been related to several genetic diseases including muscular dystrophy, Alzheimer's disease and cancer from almost every origin. One of the most effective approaches to redirect alternative splicing events has been to attach cell-penetrating peptides to oligonucleotides that can modulate a single splicing event and restore correct gene expression. Here, we summarize how natural existing and bioengineered peptides have been applied over the last few years to regulate alternative splicing and genetic expression. Under different genetic and cellular backgrounds, peptides have been shown to function as potent vehicles for splice correction, and their therapeutic benefits have reached clinical trials and patenting stages, emphasizing the use of regulatory peptides as an exciting therapeutic tool for the treatment of different genetic diseases. Copyright © 2015 Elsevier Inc. All rights reserved.

Drosophila Syd-1, Liprin-α, and Protein Phosphatase 2A B′ Subunit Wrd Function in a Linear Pathway to Prevent Ectopic Accumulation of Synaptic Materials in Distal Axons

PubMed Central

Li, Long; Tian, Xiaolin; Zhu, Mingwei; Bulgari, Dinara; Böhme, Mathias A.; Goettfert, Fabian; Wichmann, Carolin; Sigrist, Stephan J.; Levitan, Edwin S.

2014-01-01

During synaptic development, presynaptic differentiation occurs as an intrinsic property of axons to form specialized areas of plasma membrane [active zones (AZs)] that regulate exocytosis and endocytosis of synaptic vesicles. Genetic and biochemical studies in vertebrate and invertebrate model systems have identified a number of proteins involved in AZ assembly. However, elucidating the molecular events of AZ assembly in a spatiotemporal manner remains a challenge. Syd-1 (synapse defective-1) and Liprin-α have been identified as two master organizers of AZ assembly. Genetic and imaging analyses in invertebrates show that Syd-1 works upstream of Liprin-α in synaptic assembly through undefined mechanisms. To understand molecular pathways downstream of Liprin-α, we performed a proteomic screen of Liprin-α-interacting proteins in Drosophila brains. We identify Drosophila protein phosphatase 2A (PP2A) regulatory subunit B′ [Wrd (Well Rounded)] as a Liprin-α-interacting protein, and we demonstrate that it mediates the interaction of Liprin-α with PP2A holoenzyme and the Liprin-α-dependent synaptic localization of PP2A. Interestingly, loss of function in syd-1, liprin-α, or wrd shares a common defect in which a portion of synaptic vesicles, dense-core vesicles, and presynaptic cytomatrix proteins ectopically accumulate at the distal, but not proximal, region of motoneuron axons. Strong genetic data show that a linear syd-1/liprin-α/wrd pathway in the motoneuron antagonizes glycogen synthase kinase-3β kinase activity to prevent the ectopic accumulation of synaptic materials. Furthermore, we provide data suggesting that the syd-1/liprin-α/wrd pathway stabilizes AZ specification at the nerve terminal and that such a novel function is independent of the roles of syd-1/liprin-α in regulating the morphology of the T-bar structural protein BRP (Bruchpilot). PMID:24948803

Drosophila Syd-1, liprin-α, and protein phosphatase 2A B' subunit Wrd function in a linear pathway to prevent ectopic accumulation of synaptic materials in distal axons.

PubMed

Li, Long; Tian, Xiaolin; Zhu, Mingwei; Bulgari, Dinara; Böhme, Mathias A; Goettfert, Fabian; Wichmann, Carolin; Sigrist, Stephan J; Levitan, Edwin S; Wu, Chunlai

2014-06-18

During synaptic development, presynaptic differentiation occurs as an intrinsic property of axons to form specialized areas of plasma membrane [active zones (AZs)] that regulate exocytosis and endocytosis of synaptic vesicles. Genetic and biochemical studies in vertebrate and invertebrate model systems have identified a number of proteins involved in AZ assembly. However, elucidating the molecular events of AZ assembly in a spatiotemporal manner remains a challenge. Syd-1 (synapse defective-1) and Liprin-α have been identified as two master organizers of AZ assembly. Genetic and imaging analyses in invertebrates show that Syd-1 works upstream of Liprin-α in synaptic assembly through undefined mechanisms. To understand molecular pathways downstream of Liprin-α, we performed a proteomic screen of Liprin-α-interacting proteins in Drosophila brains. We identify Drosophila protein phosphatase 2A (PP2A) regulatory subunit B' [Wrd (Well Rounded)] as a Liprin-α-interacting protein, and we demonstrate that it mediates the interaction of Liprin-α with PP2A holoenzyme and the Liprin-α-dependent synaptic localization of PP2A. Interestingly, loss of function in syd-1, liprin-α, or wrd shares a common defect in which a portion of synaptic vesicles, dense-core vesicles, and presynaptic cytomatrix proteins ectopically accumulate at the distal, but not proximal, region of motoneuron axons. Strong genetic data show that a linear syd-1/liprin-α/wrd pathway in the motoneuron antagonizes glycogen synthase kinase-3β kinase activity to prevent the ectopic accumulation of synaptic materials. Furthermore, we provide data suggesting that the syd-1/liprin-α/wrd pathway stabilizes AZ specification at the nerve terminal and that such a novel function is independent of the roles of syd-1/liprin-α in regulating the morphology of the T-bar structural protein BRP (Bruchpilot). Copyright © 2014 the authors 0270-6474/14/348474-14$15.00/0.

Kidney diseases caused by glomerular basement membrane type IV collagen defects in dogs.

PubMed

Lees, George E

2013-01-01

To review the pathogenesis, as well as the clinical and pathologic features of canine glomerular diseases caused by genetic type IV collagen defects. Original studies and review articles from human and veterinary medical fields. Presence in glomerular basement membranes (GBM) of a network composed of α3.α4.α5 heterotrimers of type IV collagen is required to maintain structure and function of glomerular capillary walls. Hereditary nephropathy (HN) is the most commonly used name for kidney diseases that occur in dogs due to genetic type IV collagen abnormalities. To date, 4 different collagen IV gene mutations have been identified in dogs with HN; 2 are COL4A5 mutations that cause X-linked HN (XL-HN), and 2 are COL4A4 mutations that cause autosomal recessive HN (AR-HN). Affected males with XL-HN and affected males and females with AR-HN develop juvenile-onset kidney disease manifested by proteinuria typically starting at 3-6 months of age and followed by progressive kidney disease leading to terminal failure usually at 6-24 months of age. Carrier female dogs with XL-HN also develop proteinuria starting at 3-6 months of age, but progressive disease causing kidney failure is uncommon until they are >5 years old. The distinctive pathologic lesions of HN are extensive multilaminar splitting and thickening of the GBM, as demonstrated by electron microscopy, and abnormal type IV collagen α-chain content of basement membranes, as demonstrated by immunolabeling. Identification of the underlying gene mutations has permitted genetic testing and selective breeding practices that currently are minimizing HN in breeds known to be at risk. Canine HN is a rare disease that should be considered whenever a dog exhibits a juvenile-onset kidney disease characterized partly by proteinuria, but highly specialized methods are required to pursue a definitive diagnosis. © Veterinary Emergency and Critical Care Society 2013.

Transport of 5-aminolevulinic acid by the dipeptide permease in Salmonella typhimurium.

PubMed

Elliott, T

1993-01-01

In a previous search for mutants of Salmonella typhimurium that are defective in heme synthesis, one class that is apparently defective in 5-aminolevulinic acid (ALA) uptake (alu) was found. Here, I describe the characterization of these mutations. The mutations all map to a single locus near 77.5 min on the genetic map, which is transcribed counterclockwise. Nutritional tests, genetic and physical mapping, and partial DNA sequence analysis revealed that alu mutants are defective in a periplasmic binding protein-dependent permease that also transports dipeptides, encoded by the dpp operon. The uptake of labeled ALA is defective in dpp mutants and is markedly increased in a strain that has elevated transcription of the dpp locus. Unlabeled L-leucyl-glycine competes with labeled ALA for uptake. In a strain carrying both a dpp-lac operon fusion and a functional copy of the dpp locus, the expression of beta-galactosidase is not induced by ALA, nor, in a hemL mutant, does expression of dpp change substantially during starvation for ALA. The dipeptide permease displays a relaxed substrate specificity that allows transport of the important nonpeptide nutrient ALA, whose structure is closely related to that of glycyl-glycine.

Genetic epidemiology of single gene defects in Chile.

PubMed Central

Cruz-Coke, R; Moreno, R S

1994-01-01

We have studied the correlation between the ethnic structure and the prevalence of single gene defects in Chile. At present the Chilean population is approximately 64% white and 35% Amerindian with traces of other admixture. Fewer than 4% of the Chilean population are foreign born. Investigations indicate that all severe diseases and many others without impaired reproduction have mutation rates within the range of the white population. Classical ethnic diseases are very rare. Autosomal recessive disorders have a wide range of variability: cystic fibrosis has a low incidence and PKU has a similar incidence to English rates. Only 30% of the inborn errors of metabolism have been described in Chilean medical publications. In addition, no Chilean haemoglobin or haptoglobin variants have been described. Some rare inherited diseases in Chilean human isolates have been described, including achromatopsia, chondrocalcinosis, and Creutzfeldt-Jakob disease. The prevalence of intrahepatic cholestasis of pregnancy and supernumerary nipples is the highest in the world and they are associated with aboriginal origin. Single gene defects in Chile are probably shaped by factors related to its ethnic population structure. These local rare single gene defects may be good markers of population admixture for genetic epidemiological studies. PMID:7815439

Interactome of Obesity: Obesidome : Genetic Obesity, Stress Induced Obesity, Pathogenic Obesity Interaction.

PubMed

Geronikolou, Styliani A; Pavlopoulou, Athanasia; Cokkinos, Dennis; Chrousos, George

2017-01-01

Obesity is a chronic disease of increasing prevalence reaching epidemic proportions. Genetic defects as well as epigenetic effects contribute to the obesity phenotype. Investigating gene (e.g. MC4R defects)-environment (behavior, infectious agents, stress) interactions is a relative new field of great research interest. In this study, we have made an effort to create an interactome (henceforth referred to as "obesidome"), where extrinsic stressors response, intrinsic predisposition, immunity response to inflammation and autonomous nervous system implications are integrated. These pathways are presented in one interactome network for the first time. In our study, obesity-related genes/gene products were found to form a complex interactions network.